Gene Literature Dashboard

Last run: 2026-09-14 07:46:25 — 1628 new papers added, 14687 total in store. Showing last 30 days (216 shown). Use --view YYYY-MM to review older papers.
Also flagged:AIDSCD4deathnucleosidereverse transcriptaseprotease
Journal Article 2026-10-01 No Snippets Lertamornkitti N, Pheerapanyawaranun C, Le ON, Nallusamy RA, Sudjaritruk T, Mohamed TJ, Puthanakit T, Ounchanum P, Kosalaraksa P, Khol V, Kumarasamy N, Qui ND, Van Nguyen L, Yusoff NKN, Kinikar A, Du QT, Fong SM, Muktiarti D, Sohn AH, Chokephaibulkit K, TREAT Asia Pediatric HIV Observational Database of IeDEA Asia-Pacific.
Show Full Abstract

<h4>Background</h4>Transitioning from pediatric to adult HIV care is critical for adolescents and young adults living with HIV (AYLH). This study assessed the timing and factors associated with this transition in Asia.<h4>Setting</h4>Retrospective study of AYLH enrolled in Therapeutics Research, Education, and AIDS Training Asia Pediatric HIV Observational Database clinics between May 1991 and December 2020.<h4>Methods</h4>Eligible AYLH were categorized into <18-year-old transitions, and ≥18-year-old transitions or continued pediatric care.<h4>Results</h4>The analysis included 1803 AYLH from 6 countries. Of these, 92.7% (n = 1672) had perinatally acquired HIV, and 69.9% (n = 1260) were ≥18-year-old transitions or continued pediatric care. Excluding AYLH who remained in pediatric care, median age at transition was 16.1 years (interquartile range [IQR]: 14.9-17.0) for <18-year-old transitions and 20.0 years (IQR: 19.1-21.2) for ≥18-year-old transitions. At age 18, among 1368 AYLH with available viral load data, 72.9% (n = 998) had viral loads <50 copies/mL (78.9% in <18-year-old transitions [n = 310/393] vs 70.6% in ≥18-year-old transitions [n = 688/975]; P = 0.002). The median CD4 count was 635 cells/μL (IQR: 450-842). Factors independently associated with transitions at ≥18-year-old or continued pediatric care included residence in an upper-middle-income country (adjusted odds ratio [aOR] 10.68 [95% confidence interval (CI): 7.76 to 14.68], P < 0.001), living with family (aOR 2.81 [95% CI: 1.99 to 3.97], P < 0.001), and previous antiretroviral therapy class switching (aOR 1.91 [95% CI: 1.34 to 2.72], P < 0.001).<h4>Conclusion</h4>Most AYLH in this cohort transitioned at ≥18 years of age. About one-fourth had unsuppressed viral loads at age 18, irrespective of transition status, underscoring the need for personalized treatment approaches that support antiretroviral therapy adherence from pediatric care, preparing AYLH for transition to adult clinics.

GPR52
Also flagged:GPR30angiogenesisoxygenmyelinmyelinationG15
Journal Article 2026-10-01 ✓ 1 Snippet Hui SW, Gao X, Yu B, Lei QJ, Liu ZY, Wu SL, Cheng YJ, Chen T, Xiao L, Li T, Mei F, Ren H, Wang F.
In-Text Gene Mentions

Gpr52

Show Full Abstract

Myelinogenesis is insufficient in numerous myelin-related diseases in the CNS, leading to functional impairments. Myelinogenesis couples with angiogenesis to ensure adequate need of oxygen and nutrients for oligodendrocyte (OL) differentiation. However, approaches to synchronize myelino-vascular coupling remain unavailable. We hypothesize the identification of shared signaling pathways in vascular cells and oligodendroglia may yield novel strategies to promote myelin repair through strengthening the blood vessel-myelination coupling. Here, single-cell sequencing and in situ hybridization revealed high expression of G-protein-coupled receptor 30 (Gpr30) in both vascular cells and oligodendroglia, with selective enrichment in pericytes and oligodendrocyte precursor cells (OPCs). Cell-specific deletion of GPR30 in pericytes driven by PDGFRβ<sup>CreERT2</sup> resulted in enhanced angiogenesis and myelination in developing brains. GPR30 deletion in OPCs or antagonizing GPR30 by G15 resulted in increased MBP-positive cell density and enhanced nanofiber wrapping capacity in vitro, thereby demonstrating an inhibiting role of GPR30 on OPC differentiation. To elucidate the coordinative role of GPR30 in both cell types, we employed NG2<sup>CreERT</sup> to induce a conditional knockout of GPR30 in both NG2-positive pericytes and OPCs. The conditional deletion of GPR30 enhanced myelination and increased vascular density in developing brains. Further, GPR30 cKO or G15 treatment enhanced myelin repair and functional recovery in the chronic neonatal hypoxia and lysolecithin-induced demyelination model, suggesting that antagonizing GPR30 is a promising strategy to synchronize angiogenesis with myelination to promote myelinogenesis. These findings establish GPR30 antagonism as a promising approach to enhance myelin repair through synchronizing pericyte-mediated angiogenesis and OPC differentiation.

Also flagged:PLHRPembryogenesisneuronal migrationorganizationsynapses
Journal Article 2026-10-01 No Snippets Baltar J, Abati R, Florido L, Holt MG.
Show Full Abstract

Glial cells, including radial glia, oligodendrocyte precursor cells (OPCs), oligodendrocytes, astrocytes, and microglia, are active and dynamic regulators of central nervous system (CNS) development, homeostasis, and disease. Through extensive interactions with neurons, other glial populations, and the vasculature, they form highly specialized communication networks that are essential for normal brain function. While transcriptomic approaches have revealed extensive glial heterogeneity and enabled the prediction of putative signaling networks, a critical challenge remains in validating and translating these findings at the level of distinct protein complexes existing both within and between the various glial cell types. This is largely due to the fact that traditional proteomic technologies lack spatial resolution and/or fail to capture protein interaction networks. Proximity labeling (PL) has emerged as a powerful strategy to overcome these limitations by enabling cell-type-specific mapping of protein networks and subcellular proteomes, with spatial and temporal precision. Emerging studies have applied PL enzymes, such as BioID, TurboID, and HRP, across diverse glial populations, starting to uncover protein networks supporting their interactions with neurons and vascular elements, allowing metabolic support, maintenance of microenvironment homeostasis and cell-cell communication (including synaptic modulation). In this review, we summarize the main PL enzymes, discuss key studies across different glial cell types, and examine the technical challenges and future perspectives of applying PL to investigate glial biology. By complementing transcriptomic data with spatially resolved proteomic insights, PL provides a unique opportunity to deepen our understanding of glial cell biology in health and disease.

SERPINC1
Also flagged:AKT3ACACAMAP3K5FGFR4C3reproduction
Journal Article 2026-10-01 ✓ 1 Snippet Jin L, Dong F, Feng C, Ning J, Zhang X, Liu W, Chen C, Wang D, Bie L, Bai C, Sun H, Sun B.
In-Text Gene Mentions

…FGFR4, C3, andSERPINC1) enriched for meat…

Show Full Abstract

The Min pig, a representative northern Chinese indigenous breed, carries a unique ancestral background shaped by the historical phylogeography of Northeast Asia. This study aimed to dissect the population structure, temporal genetic divergence, and ancestral composition of Min pigs, trace their evolutionary origin, and identify trait-linked functional genes, providing information regarding their evolutionary history and conservation. We analyzed 61 Min pigs sampled across nearly 20 years and 701 reference pigs comprising other Chinese indigenous breeds, Western commercial lines, and Chinese wild boars, using PCA, NJ phylogenetic analysis, Admixture, TreeMix, D-statistic, f4-ratio, and combined selection signature scans (sliding-window F<sub>ST</sub>, XP-EHH, and π-ratio). Clear genetic stratification was observed among Min pig subpopulations, reflecting long-term divergence under natural and artificial selection. PCA and Admixture (K = 2-4) separated East Asian indigenous and Western ancestral components, verifying an admixed Northeast Asian origin with a dominant ancient East Asian component and a Western component. Compared with early-2000s Min pigs, contemporary individuals are genetically closer to Western breeds and exhibit a more scattered structure due to shifted ancestral component proportions, further confirmed by D-statistic and f4-ratio values. We identified 321 differentiated SNP loci based on the Animal QTL database, corresponding to core candidate genes (AKT3, ACACA, MAP3K5, FGFR4, C3, and SERPINC1) enriched for meat quality, growth, reproduction, immunity, energy metabolism, and MAPK/PI3K-Akt/AMPK pathways. This study reveals Min pigs' admixed origin and temporal divergence, clarifying their Northeast Asian evolution and providing molecular markers for genetic monitoring and conservation.

Also flagged:chromosomeGJD2GREM1FMN1PDLIM7immune responses
Journal Article 2026-10-01 No Snippets Hu S, Wei C, Feng D, Gan S.
Show Full Abstract

Wattles are finger-like appendages on the ventral neck of goats, serving as a distinctive morphological marker for breed identification that serves potential implications for production performance. However, their genetic basis remains incompletely characterized. Here, we integrated a genome-wide association study (GWAS) and selection signature analysis to identify candidate genes and genomic regions associated with the wattle trait in goats. Using a linear mixed model, GWAS on 463 goats (23 wattled and 440 non-wattled) identified 385 quantitative trait loci (QTLs) at a 5% false discovery rate, yielding 346 candidate genes. The most significant association signal was observed on chromosome 10 (72.61-73.48 Mb), where the lead SNP (rs636481767) is located within a region containing GJD2, GREM1, and FMN1, showing strong linkage disequilibrium (r<sup>2</sup> > 0.6) with surrounding loci. Subsequent selection signature analysis (23 wattled and 23 non-wattled) identified 83 genomic regions harboring 119 candidate genes. The strongest signals were detected at MFSD14B on chromosome 8 (F<sub>ST</sub> = 0.154, log<sub>2</sub>π-ratio = 2.611) and PDLIM7 on chromosome 7 (F<sub>ST</sub> = 0.144, log<sub>2</sub>π-ratio = 0.806). KEGG pathway enrichment analysis revealed that GWAS-associated genes were involved in glycosylation and immune responses, whereas selection-signature genes were enriched in DNA repair and the Hippo, Notch, and Wnt pathways. Furthermore, cross-species PheWAS revealed that human FMN1 is associated with dermatological, skeletal, and metabolic phenotypes, while porcine FMN1 is associated with backfat thickness and loin muscle depth. Overall, this study provides molecular markers of potential value for goat breeding and pinpoints key candidate genes for future functional validation of wattle development.

Also flagged:Palmitoyl AcyltransferaseZdhhc17Spinal Cord InjuryNuclear Transport FactorsKpna2Ipo9
Journal Article 2026-09-11 No Snippets Chen M, Chen H, Ding S, Liu F, Zheng X, Wang Y, Tian R, Li H, Liu P, Hu L, Liu B, Rong L, Li M.
Show Full Abstract

In adult mammals, poor functional recovery after spinal cord injury (SCI) is largely due to the very limited capacity to reconstruct damaged neural connections together with neuronal loss. Here, we identify the neuroprotective role of Zdhhc17 as a palmitoyl acyltransferase (PAT) following SCI. Neuron‑specific Zdhhc17 overexpression in vitro and in vivo markedly enhances axon regeneration and functional recovery after SCI in a PAT-activity-dependent manner. Interactome and palmitoylation analyses in cortical neurons identify the karyopherins Kpna2 and Ipo9 as previously unrecognized Zdhhc17 substrates. SCI markedly reduces Kpna2 and Ipo9 protein levels, whereas Zdhhc17‑mediated palmitoylation stabilizes them by suppressing their ubiquitin‑dependent degradation. Functionally, neuronal overexpression of Kpna2 or Ipo9 mimics the therapeutic effects of Zdhhc17, and co‑expression of Zdhhc17 with Ipo9, but not Kpna2, further augments SCI repair. Using H<sub>2</sub>O<sub>2</sub>‑induced oxidative stress and glutamate‑induced excitotoxicity models, we further show that Zdhhc17 promotes neuronal survival and activates transcription of intrinsic pro‑regenerative genes after injury. These findings suggest that the Zdhhc17-Kpna2/Ipo9 axis is a novel pharmacological target for SCI treatment.

Also flagged:DEAF1autismNeurodevelopmental disordersautism spectrum disorderintellectual disabilityID
Journal Article 2026-09-11 No Snippets Kim J, Choe MS, Yang WS, Lo C, Liu HW, Kwak TH, Na K, Kiral FR, Xiang Y, Qiu C, Zhong M, Lee M, Tanaka Y, Cakir B, Chung S, Park IH.
Show Full Abstract

Neurodevelopmental disorders (NDDs), including autism spectrum disorder (ASD) and intellectual disability (ID), are genetically heterogeneous. DEAF1 has emerged as a key NDD risk gene, with pathogenic variants linked to DEAF1-associated neurodevelopmental disorder (DAND), but its role in human neurodevelopment remains unclear. Human cortical organoids (hCOs) provide a physiologically relevant model that recapitulates fetal brain development with an authentic human genetic background. Here, we show that a DEAF1 mutation in human embryonic stem cells disrupts chromatin accessibility at neuronal gene loci, leading to significant transcriptional alterations. In hCOs, this mutation results in aberrant progenitor proliferation, disrupted cortical lamination, and impaired neuronal differentiation. Furthermore, we identify WNT signaling, TGFβ superfamily signaling, and cell cycle regulation as commonly dysregulated pathways across multiple ASD-associated genetic perturbations. Pharmacological inhibition of WNT signaling with a Porcupine inhibitor partially rescues phenotypic defects in DEAF1-mutant hCOs. Our findings identify DEAF1 as a critical regulator of neurodevelopment and support pathway-targeted, mutation-independent therapeutic strategies for ASD and related disorders.

SERPINC1
Also flagged:glycosylationAFPhepatocellular carcinomaalpha-fetoproteinN-glycopeptidesglycan
Journal Article 2026-09-10 ✓ 4 Snippets Cao X, Cao Z, Zeng H, Hu Y, Zhang C, Yan G, Zhang L, Shu H, Lu H, Guan M.
In-Text Gene Mentions

…glycosylation of serumantithrombin-IIIas a potential…

…llowing immunoprecipitation ofATIII, comparative analysis confirm…

…downregulation of twoATIIIglycopeptides carrying a…

…glycosylation changes onATIIImay serve as…

Show Full Abstract

Early diagnosis of hepatocellular carcinoma (HCC), particularly in alpha-fetoprotein (AFP)-negative patients, remains a significant challenge. Characterizing N-glycopeptides with site-specific glycan structural information enables a better understanding of the molecular pathogenesis of liver injury and cancer. Here, we performed an unbiased quantitative analysis of N-glycopeptides from serum in patients with hepatitis B virus (HBV)-related liver diseases using a stable isotope labeling-based glycoproteomic approach. Serum samples from patients with liver cirrhosis (LC) and AFP-negative HCC were compared. A total of 264 unique N-glycopeptides were initially identified, with 30 high-confidence intact glycopeptides retained after stringent quality control. Following immunoprecipitation of ATIII, comparative analysis confirmed a significant downregulation of two ATIII glycopeptides carrying a biantennary disialylated (H5N4S2) glycan at asparagine residues N128 and N224 in AFP-negative HCC compared with LC (p < 0.01). A small AFP-positive HCC group was examined as an exploratory reference. Occupancy of four N-glycosylation sites (N128, N167, N187, N224) was verified, and site-specific glycan heterogeneity was delineated. These findings suggest that site-specific glycosylation changes on ATIII may serve as candidate biomarkers to complement current diagnostic strategies for AFP-negative HCC.

Also flagged:proteinase-activated receptor-2leishmaniasiscell differentiationcoagulation factor XF10FX
Journal Article 2026-09-09 No Snippets Kusche Y, Münck N, Nemetschke L, Roebrock K, Fischer-Riepe L, Nattkemper E, Vischedyk K, Steinhoff M, Roth J, Sunderkötter C, Ehrchen J.
Show Full Abstract

Resistance to <i>Leishmania (L.) major</i> depends on the development of a <i>L. major</i>-specific Th1 response, while Th2 differentiation results in susceptibility. We previously showed that the early microenvironment of infected skin delivers important signals for T cell differentiation. We found increased expression levels of coagulation factor X (F10 and FX for protein, respectively) 16 h after infection in the skin of resistant mice compared to susceptible mice. Activated FX is a ligand of proteinase-activated receptor-2 (PAR2), a modulator of inflammatory responses. To assess the role of PAR2, we analysed the course of <i>L. major</i> infection in PAR2-deficient (PAR2<sup><sup>-</sup>/<sup>-</sup></sup>) mice on a resistant C57BL/6 background. PAR2<sup><sup>-</sup>/<sup>-</sup></sup> mice developed significantly larger lesions and harboured more parasites in footpads and draining lymph nodes compared to wild-type mice. In addition, their antigen-specific T cell response was shifted towards Th2. Conversely, early treatment of susceptible BALB/c mice with a PAR2-agonist reduced parasite loads in footpads and spleens and shifted the T cell response towards Th1. This was accompanied by significantly higher expression of the Th1-promoting cytokines IL-6, IL-12, and TNFα in the infected skin. We conclude that PAR2 activation favours Th1-differentiation and resistance in experimental leishmaniasis due to an altered initial microenvironment with increased expression of Th1-promoting cytokines in the infected skin.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disorderpathogenesismitochondrialendoplasmic reticulum
Journal Article 2026-09-09 ✓ 1 Snippet Singh S, Mehta R, Dabhi R, Shah A, Bhatt V, Purushottam M, Sud R, Viswanath B, Vijayvargia R.
In-Text Gene Mentions

…repeats in theHTTgene, resulting in…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a monogenic neurodegenerative disorder caused by expansion of CAG trinucleotide repeats in the HTT gene, resulting in an aggregation-prone mutant huntingtin protein (mHTT) and progressive neuronal dysfunction. HD pathogenesis involves disturbances in protein homeostasis, mitochondrial function, oxidative stress, epigenetic regulation, and inflammatory signalling. We investigated the effects of curcumin, a naturally occurring polyphenol, on these disease-relevant processes in vitro.<h4>Methods and results</h4>Using established HD cellular models, we examined the effects of curcumin on mHTT aggregation, mitochondrial function, oxidative stress, and endoplasmic reticulum stress. Curcumin reduced mHTT aggregation and PERK-eIF2α signalling in HD cells by elevating autophagic clearance. Curcumin treatment increased ATP levels, partially restored Ppargc1α and Nrf1 expression, reduced mitochondrial as well as cytosolic reactive oxygen species and H3K27 trimethylation. In HD patient-derived lymphoblastoid cell lines, curcumin treatment abrogated inflammatory responses.<h4>Conclusions</h4>Curcumin alters multiple disease-relevant cellular processes in HD models, providing mechanistic insight into pathways associated with mHTT toxicity.

PRDX6
Also flagged:detoxificationmetabolismbiosynthesis
Journal Article 2026-09-09 ✓ 1 Snippet Deng S, Wang W, Yu J, Wu Y, Zhang F, Gou X, Zhang Y, Zhao X, Yu J, Huangpeng X, Han L.
In-Text Gene Mentions

…genes (e.g., TAT,PRDX6) emerged as integrative…

Show Full Abstract

Thallium (Tl) is an extremely toxic and strongly bioaccumulative metal increasingly detected in agricultural soils, yet its behavior at the plant-rhizosphere interface remains poorly constrained. Here, we integrated in situ diffusive gradients in thin films (DGT) with multi-omics analyses (transcriptomics, metabolomics, and 16S rRNA sequencing) to elucidate how plant-rhizosphere interactions regulate Tl mobility and detoxification in Brassica rapa. In situ DGT profiling coupled with the European Community Bureau of Reference (BCR) sequential extraction identified the root-soil interface (0-3 cm) as a hotspot of labile Tl dynamics, revealing a dose-dependent shift from rhizosphere-mediated Tl mobilization under moderate exposure to immobilization under high stress. This transition was mirrored by a hormesis-driven plant response, with low Tl levels stimulating growth and uptake (bioconcentration factor, BCF = 4.2), followed by growth inhibition and restricted translocation at higher doses. Multi-omics analyses showed coordinated metabolic and transcriptional reprogramming associated with this shift, including altered central carbon metabolism, glutathione homeostasis, phenylpropanoid biosynthesis, and selective regulation of metal transporters (ZIP downregulation; ABC and MATE upregulation). Key metabolites (L-proline, sinapoyl aldehyde) and genes (e.g., TAT, PRDX6) emerged as integrative regulators linking detoxification, redox balance, and osmoprotection. Concurrently, Tl exposure induced a functional succession of the rhizosphere microbiome toward metal-resistant taxa (e.g., Nitrospira, Microvirga), closely associated with changes in root exudation patterns. Collectively, these findings advance a process-based mechanistic understanding of how rhizosphere biogeochemistry, plant molecular responses and microbial dynamics jointly control Tl mobility and detoxification, informing Tl risk assessment and plant-microbe-assisted management.

PEBP1
Also flagged:bacterial infectionsinflammatory responsessepsis
Journal Article 2026-09-09 ✓ 3 Snippets Li M, Zheng J, Kong C, Geng X, Sun X, Shen N, Wang S, Xia P.
In-Text Gene Mentions

…canonical inflammasome throughPEBP1cleavage.…

…binding protein 1 (PEBP1) to generate an…

PEBP1N terminus appeared…

Show Full Abstract

The non-canonical inflammasome is a protein complex involved in bacterial infections, and its activation leads to excessive inflammatory responses during sepsis. The precise regulation of the non-canonical inflammasome in the body remains unclear. Here, we found that some chemicals that chelate zinc ions positively regulated the activation of the non-canonical inflammasome. These chemicals acted by inhibiting the activity of dipeptidyl peptidase 3 (DPP3). DPP3 cleaved phosphatidylethanolamine binding protein 1 (PEBP1) to generate an N-terminal fragment, which could bind to caspase-4/11 and inhibit the response intensity of the non-canonical inflammasome. PEBP1 N terminus appeared in the serum of mice and patients with sepsis. DPP3-deficient mice exhibited stronger inflammatory cytokine responses and had poor survival in the LPS-induced sepsis model. Promoting the activity of DPP3 effectively constrained the response intensity of sepsis in mice and increased their survival. Our findings provide a perspective for understanding the molecular regulatory process of the non-canonical inflammasome in sepsis.

Also flagged:polyglutamine diseasespathogenesispolyglutamine (PolyQ) diseasesneurodegenerative disordersHuntington's diseasespinocerebellar ataxias
Journal Article 2026-09-09 No Snippets Liu Y, Cui Y, Sun M, Gong L, Liu K, Zhang S, Tan X, Cong S.
Show Full Abstract

MicroRNAs (miRNAs) have emerged as critical regulators in the pathogenesis of polyglutamine (PolyQ) diseases-a group of fatal neurodegenerative disorders caused by CAG repeat expansions, such as Huntington's disease, spinocerebellar ataxias, dentatorubral-pallidoluysian atrophy, and spinal and bulbar muscular atrophy. This review synthesizes recent advances in miRNA dysregulation across all nine PolyQ diseases, focusing on studies published since 2019. We examine how specific miRNAs modulate core pathogenic cascades-including mutant protein aggregation, transcriptional dysregulation, mitochondrial dysfunction, and apoptosis-and then link these molecular events to disease-relevant motor, cognitive, and psychiatric phenotypes. The review highlights therapeutic progress, including the preclinical efficacy of adeno-associated virus (AAV)-delivered artificial miRNAs and emerging exosome-based platforms that target mutant transcripts such as HTT, ATXN1, ATXN3, and ATXN7. AAV5-miHTT has advanced to a first-in-human trial for Huntington's disease (NCT04120493)-a key milestone in clinical translation. Circulating miRNAs in plasma and cerebrospinal fluid show diagnostic potential as minimally invasive, stage-specific biomarkers, but challenges persist in normalization, cross-biofluid concordance, and clinical validation. Despite substantial progress, translational barriers remain-including off-target effects, delivery optimization, immunogenicity, and patient heterogeneity. Overcoming these barriers will require integrative approaches that combine single-cell transcriptomics, engineered delivery systems, machine learning, and longitudinally phenotyped clinical cohorts. This review integrates mechanistic insights, biomarker discovery, and therapeutic development to move miRNA-based strategies toward disease-modifying interventions for PolyQ disorders.

HTT
Also flagged:Huntington's DiseaseHDautosomal dominant neurodegenerative disorderbehavioraljuvenile Huntington's diseasecognitive impairment
Journal Article 2026-09-09 ✓ 1 Snippet Elayan L, Arya K, Jayappa S, Ramani PK, Matapathi UM.
In-Text Gene Mentions

…(71-83) in theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is a rare, autosomal dominant neurodegenerative disorder marked by progressive motor, cognitive, and behavioral symptoms. Although most cases present in adulthood, approximately 1-15% occur before age 20, termed juvenile Huntington's disease (JHD). JHD often follows a more rapid and variable clinical course, with diverse presentations and unique radiological findings. It's rarity and heterogeneous clinical course make diagnostic and management challenges. This case series highlights the clinical and neuroimaging features of three genetically confirmed pediatric patients with JHD from the same family. Ages of symptom onset ranged from 6 to 12 years, with all patients showing expanded CAG repeats (71-83) in the HTT gene. While all presented with cognitive impairment and motor symptoms, their clinical presentations varied. One patient had prominent dystonia and agitation, while another developed significant bradykinesia and altered mental status. Brain MRI findings were consistent across cases, demonstrating severe bilateral caudate and lentiform nuclei atrophy with corresponding T2/FLAIR hyperintensities and T1 hypo intensities. Susceptibility-weighted imaging revealed focal mineral deposition in the globus pallidus in two patients. Notably, mild thoracic spinal cord thinning was observed in one patient, suggesting potential spinal involvement. This case series provides new insight into the phenotypic variability and also demonstrates the less commonly described imaging observations of JHD, including spinal cord changes and SWI abnormalities. It underscores the importance of early imaging, genetic testing, and multidisciplinary care. Support for affected families is critical, as JHD imposes profound emotional and caregiving burdens.

Also flagged:Lactobionic AcidCopperPrimaquinecanceraggregation-related disordersconjugation
Journal Article 2026-09-09 No Snippets Distefano A, Cifalinò L, Sambugaro A, Murador E, Folda A, Grasso G, Nardon C, Rigobello MP, Scalcon V, Oliveri V.
Show Full Abstract

Metal dyshomeostasis and oxidative stress are implicated in the progression of cancer, and neurodegenerative and peripheral aggregation-related disorders. In this study, we investigated primaquine (PQ), a clinically used antimalarial drug, and PQ-lactobionic acid conjugate (LAPQ), a newly synthesized and characterized derivative obtained through conjugation with lactobionic acid, designed to improve physicochemical and biological properties. Both compounds were evaluated for their copper-coordination ability, antioxidant properties, interaction with amyloid-β (Aβ), and capacity to modulate reactive oxygen species (ROS)-induced cellular damage. As a complementary biological line of investigation, their in vitro antiproliferative activity in the presence and absence of copper was also evaluated. The compounds directly interact with Aβ as demonstrated by surface plasmon resonance (SPR) studies. Biological studies revealed marked differences between the two molecules. PQ displayed intrinsic cytotoxicity, whereas LAPQ exhibited enhanced aqueous solubility and substantially reduced antiproliferative activity under the tested conditions, highlighting the impact of sugar conjugation. In cellular oxidative stress models, LAPQ showed a protective effect, preserving cell viability under ROS-generating conditions. In summary, by interacting with Aβ and exhibiting antioxidant activity, two properties relevant to several neurodegenerative and peripheral aggregation-related disorders, our novel compound LAPQ may provide a potential starting point for the development of therapies targeting Aβ-associated disorders.

Also flagged:AntithrombinDeficiencyantithrombin deficiencyD
Journal Article 2026-09-09 No Snippets Zhao Y, Yin J, Song J, Zhao Y, Zhang Y.
Show Full Abstract

A pregnant woman with hereditary antithrombin deficiency was managed with adjusted-dose LMWH throughout pregnancy, monitoring D-dimer and anti-Xa activity, successfully preventing thrombosis and hemorrhage.

Also flagged:cancertumorstumorantibodybreast cancercolorectal carcinoma
Journal Article 2026-09-08 No Snippets Zhang H, Cheng K, Mo J, Chen M, Zhou Z, Wang Z, Yang Z, Chen X, Zhang W.
Show Full Abstract

Across various cancer entities, a wide array of subtypes of B cells that infiltrate tumors can be identified. These subtypes confer these cells with high adaptability in their functions and significant involvement in tumor progression. Tumor-infiltrating B cells act as distinctive microenvironmental mediators that build tertiary lymphoid structures, secrete diverse factors, and generate a wide antibody repertoire, thereby offering a valuable indicator of immunotherapy response. Recent clinical trials have demonstrated that intervening in tumor-infiltrating B cells can be an effective treatment strategy for tumors, including common types such as breast cancer, colorectal carcinoma, and non-small cell lung cancer. These findings suggest that tumor-infiltrating B cells should not be overlooked as therapeutic targets, as they offer significant potential to reduce the incidence of nonresponse, drug resistance, and immune-related adverse effects commonly seen in current treatment techniques. In this review, we explore the historical development of B cells in the context of tumors. We then discuss the various subtypes of tumor-infiltrating B cells, analyzing their diverse roles in tumor development. Additionally, we delve into the signaling pathways of tumor-infiltrating B cells, intercellular crosstalk, and multilevel regulatory mechanisms. Finally, based on immune checkpoints and therapeutic targets on the surface of tumor-infiltrating B cells, we summarize the current understanding which can lead to the development of new intervention methods targeting tumor-infiltrating B cells in the future. This review aims to provide a comprehensive summary of B-cell classification and therapeutic potential, emphasizing their critical role in guiding clinical treatment strategies.

Also flagged:SlapSrcfamily kinaseSrc-family kinasesSrc-like adaptor proteinreceptor tyrosine kinase
Journal Article 2026-09-08 No Snippets Naim D, Houhou Z, Cauchois F, Espie K, Simon V, Boublik Y, Langa Vives F, Homayed Z, Paul C, Maillard M, Hahne M, Pannequin J, Nguyen J, Sirvent A, Roche S.
Show Full Abstract

Src-family kinases (SFKs) regulate proliferation in colonic epithelial cells (CECs), but the mechanisms that restrain their activity remain poorly defined. We identify Src-like adaptor protein (SLAP), a negative regulator of receptor tyrosine kinase signaling, as a key suppressor of SFK activity in the colon. Constitutive and inducible epithelial-specific Slap deletion using a villin-CreERT2 model increases CEC proliferation and accelerates tumorigenesis in the azoxymethane/dextran sodium sulfate model. Slap deficiency also enhances SFK-dependent expansion of normal and tumor-derived colonic organoids. Mechanistically, we identify the receptor tyrosine kinase EPHB2 as a critical upstream activator of SFKs and a direct target of SLAP-mediated regulation. Loss of Slap increased EphB2 protein abundance and tyrosine phosphorylation, and enhanced its association with active SRC. Pharmacological inhibition of EPHB2 suppressed SRC activation and reversed the hyperproliferative phenotype induced by Slap deficiency. Together, these findings uncover a non-genetic mechanism driving SFK activation during colonic transformation and establish SLAP as a tumor suppressor that constrains oncogenic EPHB2-SFK signaling in the colonic epithelium.

Also flagged:TDP-43cytoplasmicRNA-binding proteinTAR DNA-binding protein 43bindingnuclear export
Journal Article 2026-09-08 No Snippets Chin N, Zhang Q, Zou J, Cheng KC, Zheng W, Ye Y.
Show Full Abstract

RNA-binding protein TAR DNA-binding protein 43 (TDP-43) can form liquid-like nuclear assemblies whose phase behavior is thought to influence its aggregation propensity and neurotoxic activity. The mechanisms that govern the liquid-to-solid phase transition of TDP-43 remain poorly defined. Here, we combined chemical and genome-wide genetic screens to identify cellular factors that modulate the phase behavior of an RNA-binding-defective TDP-43 mutant. Our screens uncovered multiple cellular processes, including RNA splicing, protein translation, proteostasis imbalance, and nuclear export as TDP-43 phase regulators. We also developed a semi-permeabilized cell system that partially recapitulates the TDP-43 phase transition in vitro, and showed that nuclear export inhibition reshapes the nuclear environment to favor RNA-dependent liquid-liquid phase separation (LLPS) of TDP-43, which mitigates its aggregation. Nuclear export inhibition in a brain organoid model bearing an ALS-associated mutation reduces pathogenic phospho-TDP-43 accumulation. These findings identify multiple modulators of TDP-43 phase transitions in a sensitized model system and establish a framework for further dissecting the link between nuclear transport and TDP-43 phase dynamics.

HTT
Also flagged:nucleusbinding
Journal Article 2026-09-08 ✓ 1 Snippet Gvozdenov Z, Biswas A, Peng AYT, Barcutean Z, Gestaut D, Frydman J, Struhl K, Freeman BC.
In-Text Gene Mentions

…the Huntingtin proteinHttcorrelated with lowered…

Show Full Abstract

Eukaryotic tailless complex polypeptide 1 ring complex/Chaperonin containing tailless complex polypeptide 1 (TRiC/CCT) chaperonin is typically considered a cytosolic machine mediating polypeptide folding and assembly of protein complexes. Here, we investigated the nuclear role of TRiC/CCT. Use of a TRiC/CCT temperature-sensitive allele revealed increased production of nascent RNA leading to the accumulation of noncoding transcripts. TRiC/CCT was associated with RNA polymerase II (RNAPII) in vitro and in vivo, including when bound to DNA. Heat treatment of the TRiC/CCT ts chaperonin stabilized the RNAPII complex association and binding to the actin and tubulin substrates. Expression of the Huntingtin protein Htt correlated with lowered RNA production and a decreased association between the RNAPII and TRiC/CCT complexes. Together, our presented data support a model where TRiC/CCT regulates the global activity of RNAPII in reaction to the status of proteostasis. Overall, our work reveals an avenue by which TRiC/CCT contributes to homeostasis by regulating the activity of nuclear RNAPII.

Also flagged:deathglucosesolute carrier family 7 member 11SLC7A11disulfidescystine
Journal Article 2026-09-08 No Snippets Wang C, Zhou J, Jin B, Li G, Zhang L, Tian X, Fan Z.
Show Full Abstract

Cell death is essential for maintaining internal stability and metabolic balance in the human body and plays a key role in regulating physiological and pathological processes. Advances in understanding the link between pathological mechanisms and cell death have provided new insights into diagnosis and treatment. A novel, pivotal form of regulated cell death, termed disulfidptosis, has recently been identified. This is characterized by glucose deprivation, elevated expression of solute carrier family 7 member 11 (SLC7A11), accumulation of disulfides such as cystine, disulfide stress, and cell death. These distinctive characteristics indicate that disulfidptosis is mechanistically distinct from other known forms of cell death. Its unique induction mechanism implies its therapeutic potential and warrants further investigation. This cell death process is primarily triggered by intracellular NADPH exhaustion and subsequent actin cytoskeleton collapse, and it exhibits complex crosstalk with ferroptosis, cuproptosis, pyroptosis, necroptosis, apoptosis and autophagy. The core execution relies on the Rac-WRC-Arp2/3 pathway, with emerging involvement of ER stress and p38 MAPK signaling. In this review, we discuss the molecular mechanisms and current status and prospects of targeted therapy for disulfidptosis, as well as its role in cancer and other diseases, including but not limited to neurodegenerative, cardiovascular, autoimmune, and infectious conditions. We hope to provide a comprehensive and systematic framework, including mechanistic analysis, application strategies, clinical translation, and future research directions, to guide in-depth investigation.

Also flagged:Clustered regularly interspaced short palindromic repeatsCRISPRCas9infectious diseases
Journal Article 2026-09-08 No Snippets Zhang Y, Zhang Y, Tang X, Deng X, Zhou Y, Wu Y, Luo J.
Show Full Abstract

Clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 screening has become a central technology in functional genomics, enabling genome-scale interrogation via pooled perturbations. Early CRISPR screens employed survival or simple phenotypic readouts to identify essential genes and drug resistance mechanisms. However, as biological questions have shifted toward understanding regulatory networks, cellular heterogeneity, and context-dependent gene functions, there has been increasing demand for screening strategies capable of capturing complex cellular phenotypes beyond cell fitness. Recent advances in single-cell sequencing, high-content imaging, and spatial transcriptomics have expanded the resolution of CRISPR screening by enabling multidimensional phenotypic characterization following genetic perturbation. By integrating pooled perturbations with diverse readouts, these approaches systematically map targeted gene edits to transcriptional states, cellular phenotypes, and microenvironmental contexts. Meanwhile, innovations in library design, delivery, and computational pipelines have further improved the robustness and interpretability of high-content screening platforms. This review synthesizes the methodological evolution of CRISPR screening, emphasizing advances in perturbation strategies, delivery systems, and multimodal readouts. Representative applications spanning oncology, immunotherapy, developmental biology, neurobiology, and infectious diseases are delineated to demonstrate refined gene network annotations. Additionally, existing technical bottlenecks, such as scalability, cost constraints, and in vivo limitations, are critically assessed. Finally, future directions are proposed to facilitate the development of precise medicine.

bioRxiv 2026-09-08 Preprint (No Snippets API) Keiffer TR, Siddiqa A, Represa-Perez M, Zabir H, Kushwaha A, Sapp M, Zwolinska K.
Show Full Abstract

Nuclear delivery of human papillomavirus (HPV) requires infected cells to undergo mitosis. Incoming HPV DNA is protected by a transport vesicle structure, which becomes unstable post-mitosis. We have previously shown that HPV genome egress takes on average 4 hours post-mitosis completion; thus, we propose that an enzymatic process is involved in degrading this transport vesicle to allow genome egress. Several phospholipase C (PLC) isoforms, including PLCδ3, PLCζ1, and PLCL1, have been previously implicated in HPV infection in large-scale siRNA screens, and the parvovirus VP1 capsid protein has phospholipase enzymatic activity. Therefore, we hypothesized that cellular phospholipases residing in the nucleus mediate egress of the HPV genome from transport vesicles. We utilized siRNA-mediated knockdown and CRISPR/Cas9 knockout techniques to target specific PLC isoforms in both HeLa and HaCaT cell lines. We found that targeting PLC isoforms PLCβ1, β4, δ3, δ4, and γ1 significantly decreased HPV infection in both HeLa and HaCaT cells, as measured using a luciferase-based reporter assay. We also discovered a novel interaction between HPV16 minor protein L2 and PLCs β1, β4, δ1, δ3, and δ4. Furthermore, we observed that knockout of PLCβ4 and δ4 delayed egress of the HPV genome from nuclear membrane-bound vesicles after infection of HeLa cells. We propose that HPV utilizes phospholipase Cs to achieve genome egress from its protective vesicular structure after nuclear delivery. <h4>Importance</h4> The cellular factors involved in the later stages of HPV entry remain to be elucidated. Previous data gleaned from large-scale siRNA screens implicated the involvement of phospholipases in HPV infection. We expanded upon these findings and discovered that the individual phospholipase C (PLC) isoforms β4 and δ4 are important for HPV infectivity. We further linked the loss of infectivity in PLCβ4- and PLCδ4-deficient cells to a defect in HPV genome release from its transport vesicle, which we demonstrated using our differential staining technique. Furthermore, we discovered a novel interaction between the minor protein L2 of HPV16 and PLC isoforms β1, β4, δ1, δ3, and δ4.

bioRxiv 2026-09-08 Preprint (No Snippets API) Sequiera GL, Gjervan SC, McCallum R, Feng J, Ozgoren OK, Bergh S, Bégin J, Levesley J, Findlay Black H, Kay C, Soomarooah T, Arning L, Rajan Babu IS, Başak AN, Klempíř J, Nguyen HP, Petersen Å, Hayden MR, Pouladi MA.
Show Full Abstract

Huntington disease is a fatal neurodegenerative disorder caused by CAG repeat expansion encoding polyglutamine in the HTT gene. Recent studies have shown that loss of CAA/CCA interruptions within polyglutamine-coding CAG tracts and adjacent polyproline-coding region are linked to earlier disease onset. It has been hypothesized that somatic repeat instability, influenced by these interrupted CAG tracts, may mediate this effect. Here we demonstrate that HTT CAA/CCA-loss variant linked to early disease onset exacerbates mutant HTT toxicity in cellular models through mechanisms independent of somatic repeat instability. The CAA/CCA-loss variant exhibits significantly higher toxicity than canonical HTT sequences in both transient expression and stable cell line models. Notably, this enhanced toxicity persists in knockout cells of the mismatch repair gene MSH3 where somatic instability is blunted, with a consistent toxicity hierarchy (CAA/CCA-loss > CCA-loss > CAA-loss > canonical HTT) in both wildtype and MSH3 knockout cells. Furthermore, the CAA/CCA-loss variant generates elevated levels of repeat-associated non-AUG (RAN) translation products. In HEK293-based cellular models, these results suggest that the disease-accelerating effects of HTT CAA/CCA-loss variants involve intrinsic properties of the altered sequence context, highlighting the importance of understanding sequence-specific mechanisms in HD pathogenesis beyond polyglutamine length and somatic instability.

Also flagged:intervertebral disc degenerationintervertebral discdegenerationnucleushistonechromatin
Journal Article 2026-09-07 No Snippets Poramba-Liyanage DW, Tong X, Riemers FM, Meij BP, Dilek Y, Cleypool CGJ, Kamali SA, Le Maitre CL, Camus A, Chan D, van Oudenaarden A, Zeller P, Tryfonidou MA.
Show Full Abstract

Utilizing key developmental cues and refining their orchestrating role in degeneration represents a promising strategy for understanding and treating intervertebral disc (IVD) degeneration, a major cause of chronic lower back pain. Here, we focus on notochordal cells (NCs), which originate from the embryonic notochord and reside in the developing nucleus pulposus. These distinctly vacuolated cells exhibit robust regenerative effects and hold promise for new therapeutic approaches. Dogs, like humans, suffer from the consequences of IVD degeneration. As the IVD matures and degenerates, NCs are replaced by smaller non-vacuolated NP cells (NPCs). The dog was employed as a model to capture, at the single-cell level, the heterogeneity of resident cells by studying the nucleus pulposus tissue at three stages (i.e., juvenile, young adult and degenerate adult). Here, we integrated transcriptomic data with repressive histone H3 lysine 27 trimethylation (H3K27me3) profiles at the single-cell level to assess changes in chromatin states and gene expression across this IVD degeneration-associated cell phenotypic transition. H3K27me3 enrichment on key genes involved in IVD development and homeostasis, such as Brachyury (TBXT), aligns with the observed attenuation during ageing and degeneration seen in both dog and human IVDs. This study further demonstrates that eliminating repressive histone marks, together with CRISPR-mediated gene transactivation, enhances TBXT gene expression in human NPCs derived from degenerated aged discs. Our findings underscore how extensive insights gained through single-cell omics can lead to the identification of crucial cellular cues that may enable degenerate NPCs to regain a healthier phenotype.

bioRxiv 2026-09-07 Preprint (No Snippets API) Chen B, Lu S, Noda T.
Show Full Abstract

Autophagy is induced by nutrient starvation to recycle intracellular constituents; however, its activity must subsequently be attenuated during prolonged nutrient deprivation. The mechanisms underlying this attenuation in mammalian cells remain incompletely understood. Here, using complementary HaloTag-based assays, we show that autophagic activity declines during prolonged starvation in HeLa cells. A genome-wide CRISPR/Cas9 knockout screen designed to identify cells that sustain autophagic activity under these conditions identified protocadherin 17 (PCDH17) as a regulator of autophagy attenuation. PCDH17 depletion maintained autophagic activity during prolonged starvation without detectably altering mTORC1 signaling, ULK1 abundance, or the proximal machinery of autophagosome formation. Instead, PCDH17 depletion increased lysosomal abundance, acidification, and proteolytic activity, whereas PCDH17 overexpression produced reciprocal effects. We further identified a lysosome-associated PCDH17 subpopulation that is supplied predominantly through the biosynthetic ER–Golgi pathway. This pool undergoes proteolytic processing and lysosomal turnover, with starvation preferentially accelerating degradation of the C-terminal fragment while preserving a comparatively stable N-terminal fragment. Together, these findings identify PCDH17 as an unexpected negative regulator of lysosomal function and demonstrate that modulation of lysosomal degradative capacity contributes to autophagy attenuation during prolonged starvation.

SERPINC1
Also flagged:ESRDend-stage renal diseasebindingactivityaggregationcytoskeleton
Journal Article 2026-09-06 ✓ 2 Snippets Liang L, Gu L, Shi L, Luo Q, Kong X, Wang F.
In-Text Gene Mentions

…factor IX (F9),SERPINC1, microfibril-associated glyco…

…patients, C7, F9,SERPINC1, and MFAP4, were…

Show Full Abstract

Arteriovenous fistula (AVF) is the preferred vascular access for patients with end-stage renal disease; however, its failure is primarily due to neointimal hyperplasia. Five patients who underwent initial AVF surgery served as the control group, and another five patients with failed AVF surgery served as the experimental group. Herein, we employed mass spectrometry (MS)-based quantitative proteomics coupled with tandem mass tag labeling to screen differentially expressed proteins (DEPs) in the anastomotic cephalic vein, followed by bioinformatics analyses and verification experiments. A total of 121 DEPs were identified in the failed AVF group. GO analysis was primarily enriched in protein binding, nucleic acid binding, enzyme binding, mRNA binding, cadherin binding, catalytic activity, and cell adhesion molecule binding. KEGG pathways were mainly enriched in cell aggregation and adhesion, actin cytoskeleton, extracellular matrix-receptor interaction, PI3K-Akt signaling pathway, complement and coagulation cascades, and cholesterol metabolism. Protein-protein interaction network consisted of 86 (71.07%) DEPs, including complement VII (C7), factor IX (F9), SERPINC1, microfibril-associated glycoprotein 4 (MFAP4), complement C1s subcomponent, complement C1q subcomponent subunit A, complement C1q subcomponent subunit B, tissue factor, and von Willebrand factor, which interacting with numerous other proteins. In the expanded validation for different patients, C7, F9, SERPINC1, and MFAP4, were verified by immunohistochemical staining and Western blotting, which were consistent with the proteomics results. Collectively, this study identifies a series of potential diagnostic biomarkers, and explores the underlying mechanisms associated with AVF dysfunction.

Also flagged:Bronchopulmonary dysplasialung diseaseprematuritytranslationalmitochondrialextracellular
Journal Article 2026-09-05 No Snippets Zanetto L, Bonadies L, Salvadori S, Valerio E, Priante E, Nardo D, Niklas V, De Luca D, Baraldi E.
Show Full Abstract

Survival of extremely preterm infants has improved owing to advances in perinatal and neonatal care. However, bronchopulmonary dysplasia (BPD) has remained unabated, and research into preventive measures for the broader spectrum of prematurity-associated lung disease (PLD) has met with limited success. We summarize emerging therapeutic strategies with the potential to favorably influence the lifelong trajectory of lung health of preterm infants, especially the most immature. This narrative review examines recent preclinical and clinical studies on therapies for BPD prevention, focusing on mechanism-based interventions, biologic strategies, and innovative translational tools. Preclinical evidence converges on actionable targets in alveolarization, inflammatory pathways, redox and mitochondrial homeostasis, vascular and matrix remodeling. Novel molecules and drug-repurposing strategies are being tested in animal models, while patient-derived platforms may enable personalized therapeutic approaches. Mechanism-based approaches are progressing through Phase 1-2 clinical trials; pending efficacy analyses, insulin-like growth factor-1 replacement may become the first pharmacological therapy specifically approved to reduce or attenuate BPD. In parallel, cell-based therapies and extracellular vesicle strategies offer a complementary paradigm, acting through pleiotropic biological reprogramming of the injured lung. Ethical-regulatory complexity and the challenges of standardizing and scaling cell-based and cell-free therapies may limit clinical translation.<h4>Conclusion</h4>A growing repertoire of therapies for BPD holds promise for modifying early respiratory illness and the long-term burden of PLD. Realizing this potential will benefit from both mechanism-informed combinatorial approaches and pleiotropic strategies, supported by patient-derived translational tools and adequately powered efficacy evaluations. Equally essential are tailored neonatal-first regulatory pathways linking the continuum of BPD to the later respiratory morbidity of PLD, a life-course condition with significant public health relevance beyond the neonatal period.<h4>What is known</h4>• Bronchopulmonary dysplasia (BPD) is the current clinical and regulatory endpoint for neonatal pulmonary therapies. • BPD definitions capture the most severe manifestations of prematurity-associated lung disease (PLD), a broader continuum of respiratory morbidity reaching into adulthood; attenuating BPD may improve the whole spectrum of PLD.<h4>What is new</h4>• Therapies targeting alveolar, inflammatory, oxidative, vascular, and remodeling pathways are in clinical development; pending late-stage trials, IGF-1 replacement may become the first disease-modifying therapy to reduce BPD. • Novel targets, experimental platforms, and repurposed drugs hold promise for precision therapies in preterm infants.

Also flagged:ObesityIronMetabolismSTAT3leptinHepcidin
Journal Article 2026-09-05 No Snippets Aguree S, Meng X.
Show Full Abstract

<h4>Purpose of review</h4>Obesity reshapes systemic iron handling, yet the resulting iron phenotype is frequently misclassified at the bedside and in population studies. This review examines how excess adiposity disturbs iron metabolism and complicates iron-status assessment, with balanced attention to biology and measurement problems across adults and children.<h4>Recent findings</h4>Adipose tissue is an endocrine, inflammatory, and iron-handling organ. In obesity, interleukin-6 drives hepatic hepcidin through JAK/STAT3 signaling, while leptin, adipose hypoxia, and adipose hepcidin expression may contribute additional signals. Hepcidin degrades ferroportin, reducing duodenal iron export and limiting macrophage iron release, producing hypoferremia and iron-restricted erythropoiesis despite normal or elevated ferritin. We and others have shown that women with obesity may have higher hepcidin, ferritin, and inflammatory markers but lower serum iron. Stable-isotope and intervention studies suggest weight loss reduces inflammation and hepcidin and improves iron absorption, whereas the World Health Organization and Biomarkers of Nutrition for Development frameworks recommend interpreting ferritin relative to inflammation. Iron status in obesity spans a continuum from absolute or functional iron deficiency to sufficiency and, in some individuals, hyperferritinemia with possible dysmetabolic iron overload. Reliable assessment requires a multi-marker strategy: ferritin interpreted alongside an inflammation marker such as C-reactive protein and supported by transferrin saturation, soluble transferrin receptor, reticulocyte hemoglobin, or other context-appropriate indices. Management should address reversible inflammation through weight loss and metabolic risk reduction, use oral or intravenous iron according to the likelihood of true deficiency and hepcidin-mediated oral refractoriness, and avoid reflexive phlebotomy for dysmetabolic hyperferritinemia without confirmed overload.

Also flagged:synapseorganizationSynapsesmembranesynaptic adhesion
Journal Article 2026-09-05 No Snippets Thivaios S, Schwenk J, Brechet A, Boudkkazi S, Sethumadhavan N, Henneken P, Miura E, Hayashi A, Kocylowski MK, Haupt A, Kaminski D, Schreiner D, Nowacka A, van den Broucke JB, Kulik A, Schulte U, Sterky FH, Yuzaki M, Scheiffele P, Fakler B.
Show Full Abstract

Synapses, prototypic sites for neuronal communication, are key to brain function. Their organization and properties are instructed by synaptic cell adhesion molecules (sCAMs) that may operate independently or in coordination through yet unknown linker proteins. Here, we used multi-epitope affinity-purifications combined with quantitative mass spectrometry and immuno-EM to comprehensively map synaptic protein networks in the mouse brain. We identify a pre-synaptic core-module assembled from the major sCAMs, Neurexins1-3 and LAR-type receptor protein-tyrosine-phosphatases (PTPRs), and the previously uncharacterized tetraspanins T178A/B. These ternary Neurexin-T178-PTPR complexes form through their trans-membrane domains and assemble during biogenesis in the ER. Loss of T178B leads to module destabilization, accompanied by strong reduction of LAR-PTPRs and re-distribution of synaptic Neurexins. At synapses, the Neurexin-T178-PTPR module recruits stable trans-synaptic protein networks thereby interlinking machineries of the pre-synaptic active zone and establishing stable associations with post-synaptic neurotransmitter receptors. This work uncovers a widely distributed core-module for synaptic adhesion and trans-synaptic signaling in the mammalian brain.

SOX6
Also flagged:WntLgr5BMPchemokinesIL-1βprostaglandin E2
Journal Article 2026-09-05 ✓ 1 Snippet Beccaceci G, Müllerke S, Berger H, Täger C, Möbius R, Fischer AS, Hartl K, Wizenty J, Mollenkopf HJ, Naumann M, Lin M, Sigal M.
In-Text Gene Mentions

…and FB PdgfraSox6), and those…

Show Full Abstract

In the gastrointestinal tract, Wnt and BMP signals control Lgr5⁺ stem cell activity during homeostasis, whereas injury elicits an Lgr5-independent, fetal-like regenerative program driven by YAP. Helicobacter pylori (H. pylori) infection activates YAP, but whether fetal-like reprogramming contributes to gastric pathology, and what drives it, has remained unclear. Here we show that H. pylori-induced gland hyperplasia is accompanied by YAP-dependent fetal-like transcriptional response and loss of epithelial BMP signaling. Epithelial BMP inhibition alone is sufficient to induce this program in vivo, through an epithelial-immune-stromal cascade: BMP-deficient epithelial cells secrete chemokines that recruit IL-1β-producing immune cells, and IL-1β drives enrichment of pro-regenerative fibroblasts producing prostaglandin E2. In gastric epithelial-stromal assembloids, IL-1β elicits stromal prostaglandin E2 production and subsequent epithelial YAP activation. Stromal deletion of the IL-1 receptor abrogates H. pylori-driven reprogramming and pathology. These data define a cascade that converts BMP loss into a fetal-like regenerative state and shapes H. pylori-associated gastric disease.

Also flagged:P2X7 Receptorpurinergic P2X7 receptorP2X7RdeathATP-gated ion channelextracellular
Journal Article 2026-09-05 No Snippets Xiao X, Cao G, Hou S, Yin H.
Show Full Abstract

Rare diseases (RDs) are individually uncommon but collectively affect a large global population, and the vast majority still lack effective disease-modifying therapies. With advances in genomics and data-sharing platforms, research has increasingly shifted from a single-disease perspective to the search for convergent molecular pathways that might be shared across clinically distinct entities. In this context, the purinergic P2X7 receptor (P2X7R) has emerged as a putative "shared molecular platform" due to its central role in inflammation amplification, cell death and immune regulation. P2X7R is an ATP-gated ion channel with unique structural and functional features: under high extracellular ATP, it not only forms a non-selective cation channel but can also dilate into a "large pore" permeable to macromolecules, thereby triggering Ca<sup>2+</sup>overload, NLRP3 inflammasome assembly, reactive oxygen species (ROS) production and apoptotic/necrotic-like cell death. This review briefly outlines the epidemiology of RDs and the structural-functional characteristics of P2X7R, then systematically summarizes current evidence linking P2X7R to multiple rare diseases, including Charcot-Marie-Tooth disease, Guillain-Barré syndrome, amyotrophic lateral sclerosis, Huntington's disease, multiple sclerosis, and selected inflammatory and metabolic RDs (CAPS, familial Mediterranean fever, Systemic sclerosis, Dravet syndrome and Gaucher disease). By comparing P2X7R expression and functional alterations, downstream signaling pathways and pharmacological data from animal models across these conditions, we propose that a P2X7R-dependent network centered on a "Ca<sup>2+</sup>-NLRP3-inflammation/cell death axis" may constitute a common pathogenic backbone for diverse RDs. At the same time, disease-specific spatiotemporal expression patterns of P2X7R in central vs peripheral nervous systems and in immune vs target organ cells confer marked context dependence and "double-edged sword" properties. Finally, we discuss opportunities and challenges for P2X7R-targeted strategies, including the impact of disease stage and sex differences on therapeutic efficacy, and key bottlenecks in translating preclinical findings into clinical benefit. A deeper understanding of both shared and disease-specific roles of P2X7R may provide a conceptual framework and therapeutic entry point for precision stratification and multi-target interventions in rare diseases.

Also flagged:chromatinnucleusorganization
Journal Article 2026-09-04 No Snippets Chen Z, Li X, Dai Y, Shao K, Sun H, Wu N, Yan J, Zhang Y, Yu M.
Show Full Abstract

CCCTC-binding factor (CTCF) is a key architectural protein in the three-dimensional (3D) genome, yet how its loss reshapes chromatin structure and transcription at single-cell resolution remains unclear. Using HiRES, which jointly profiles chromatin contacts and RNA from the same nucleus, we examined genome-wide effects of CTCF depletion. Topologically associating domain (TAD)-like domains (TLDs) across single cells remained largely unchanged in number and size after CTCF loss, but their boundaries became more variably positioned, and pseudobulk analyses revealed reduced interactions within A compartments. We also developed SALTAFinder to identify Spatially Aggregated Long-distance TLD Assemblies (SALTAs), clusters of TLDs occupying shared 3D space within single cells. A subset of SALTAs is enriched for highly expressed genes and super-enhancers and declines upon CTCF depletion. This structural reorganization coincided with a global reduction in per-cell RNA output, as indicated by HiRES and orthogonal measurements. Together, these findings suggest that CTCF contributes to the coordinated regulation of chromatin organization and transcriptional capacity and is associated with stabilization of long-range active chromatin clusters.

Also flagged:breast cancerextracellularmetabolismcomplement activationtumorcancer
Journal Article 2026-09-04 No Snippets Heenkenda MK, Abrahamsson A, Lundberg P, Dabrosin C.
Show Full Abstract

Breast density and estrogen exposure are two major risk factors for breast cancer; however, the underlying biological mechanisms remain incompletely understood. Here, we investigated the extracellular proteomic landscape of normal human breast tissue in situ to define the microenvironment associated with these risk factors. Forty-two postmenopausal women with nondense or dense breasts and 19 premenopausal women underwent microdialysis. We quantified 461 inflammatory proteins in breast tissue and matched subcutaneous fat, enabling discrimination between local and systemic alterations. Breast density was assessed using magnetic resonance imaging. Dense breast tissue exhibited a distinct protein signature characterized by immune-related signaling, altered lipid metabolism, and the extracellular presence of intracellular proteins, consistent with cellular stress and immune modulation, with limited changes in angiogenic and extracellular matrix remodeling proteins. In contrast, estrogen-exposed breasts displayed a proteomic profile dominated by pro-inflammatory cytokines, angiogenic factors, extracellular matrix remodeling proteins, and complement activation, indicative of a dynamic and pro-tumorigenic microenvironment. These findings demonstrate that breast density and estrogen exposure are associated with fundamentally distinct breast microenvironments, both permissive for tumor progression. These breast-specific protein signatures provide mechanistic insight into how these risk factors contribute to cancer development and suggest that effective prevention strategies may require differential targeting.

Also flagged:tumordeathferroptosissecretiontumors
Journal Article 2026-09-04 No Snippets Chung H, Kim SW, Oh JW, Park GM, Cho Y, Choi HS, Kim M, Kim KP, Na YR, Lee HS, Kim HJ, Seok SH.
Show Full Abstract

<b>Background:</b> Radiotherapy eliminates most tumor cells but spares persister tumor cells that evade cell death and drive relapse. Increasing evidence suggests that stromal components of the tumor microenvironment influence treatment responses, yet whether macrophages actively reprogram tumor-intrinsic stress responses to promote radioresistance remains unclear. Here, we investigated the mechanisms by which macrophage-tumor cell interactions regulate ferroptosis and tumor survival after irradiation. <b>Methods:</b> We used macrophage-tumor cell coculture systems, Transwell separation assays, and 3D microfluidic models to examine contact-dependent effects on tumor survival following irradiation. Kinome-wide small interfering RNA screening, RNA sequencing, lipidomic profiling, and quantitative proteomic analysis of secretomes were performed to identify signaling pathways and metabolic changes. Genetic and pharmacological perturbation of Ephrin receptor b4 (Ephb4) signaling were evaluated in vitro and in syngeneic mouse tumor models. Clinical relevance was assessed using transcriptomic analyses and immunohistochemical staining of patient tumor specimens. <b>Results:</b> Macrophage contact reduced lipid peroxidation and cell death in irradiated tumor cells in a contact-dependent manner. Kinome screening identified Ephb4 as a key mediator induced by irradiation in tumor cells. Ephb4 engagement with ephrinb2 on macrophages initiated bidirectional signaling that increased expression of ferroptosis-protective genes (solute carrier family 7 member <i>11</i> [<i>Slc7a11</i>], solute carrier family 3 member 2 [<i>Slc3a2</i>], and glutathione peroxidase 4 [<i>Gpx4</i>]) in tumor cells while activating the toll-like receptor 2- nuclear factor-kappa B pathway and interleukin-6 (IL-6) production in macrophages. Macrophage-derived IL-6 further sustained ferroptosis resistance in tumor cells, and Ephb4-driven secretion of cathepsin S amplified macrophage IL-6 production through a feedforward loop. Genetic or pharmacological inhibition of Ephb4 restored lipid peroxidation and markedly enhanced radiosensitivity in vitro and in vivo. Analysis of patient datasets demonstrated increased EPHB4 expression following radiotherapy and an association between high EPHB4 expression, reduced ferroptosis signatures, and poor treatment response. <b>Conclusions:</b> These findings identify a macrophage-driven ferroptosis evasion program that enables tumor cell survival after irradiation and demonstrate that Ephb4 coordinates bidirectional tumor-macrophage signaling to sustain this resistance. Targeting the Ephb4-ephrinb2 axis represents a potential strategy to enhance ferroptosis and improve radiotherapy efficacy in resistant tumors.

medRxiv 2026-09-04 Preprint (No Snippets API) Fu Y, Morley C, Masters LM, English AC, Zhu Y, Moller AG, Paulin LF, Thompson B, Kalef-Ezra E, Weissenberger G, Shen H, Meredith M, Manini A, Horner D, Reed X, Muzny D, Jaunmuktane Z, Khan ZM, Mehta H, Timp W, Billingsley K, Erwin GS, Proukakis C, Sedlazeck FJ.
Show Full Abstract

Somatic mutations arise throughout life, with functional consequences tied to the cell populations in which they occur. Genome-wide studies measure somatic variations in bulk tissue, whereas single-cell approaches resolve cell identity but provide limited sensitivity for complex alleles. Here we developed SniffCell, which uses DNA methylation carried on native long reads to assign somatic variant-supporting molecules to methylation-resolvable cell types. SniffCell builds cell-type-discriminatory methylation signatures across eight tissues, assigns long reads to cell types, and provides cell-type-specific variant calling. Across peripheral blood mononuclear cells and brain benchmarks, SniffCell recovered sorted cell identities and validated cell-type-specific variant assignments using purified immune-cell, neuronal, and oligodendrocyte fractions. In blood, SniffCell recovered lineage-restricted antigen receptor rearrangements and localized a somatic tandem-repeat expansion to T cells. In the frontal cortex, SniffCell identified recurrent neuron-specific tandem-repeat expansions in genes including FGF14, LRRC7 and SH3RF3 . Across three brain cohorts comprising 172 donors, recurrent neuron-associated expansions were enriched for GAA-rich motifs. In donors with matched blood, and diverged more strongly from the inherited repeat length, whereas oligodendrocyte-associated alleles more often tracked it. SniffCell transforms native bulk long-read genomes into a cell-type-aware resource for somatic variant discovery and reveals recurrent somatic instability in human tissues at cell-type resolution.

Also flagged:autophagydegradationvacuoleconjugation
Journal Article 2026-09-03 No Snippets Dialynaki D, Huang Y, Klionsky DJ.
Show Full Abstract

Mechanisms aimed at recovering from heat-induced damage are closely associated with the organism's ability to survive extreme temperature exposure. In such a scenario, we show that autophagy, as a cytoprotective mechanism, ensures recovery and viability after induced heat stress in <i>Saccharomyces cerevisiae</i>. Our findings indicate that heat shock triggers the targeted degradation of ubiquitinated protein aggregates, mediated by the macroaggrephagy receptor Cue5. Moreover, heat stress induces the turnover of the aggrephagy receptor Cct2 and the polyglutamine repeats of the HTT (huntingtin) protein (polyQ-HTT). Notably, even though Cct2 and polyQ-HTT degradation is vacuole-dependent, it is mediated autonomously of canonical autophagy pathways. Collectively, this study demonstrates a novel role of autophagy in maintaining protein homeostasis after heat stress in yeast and provides insights into the potential medical applications of heat treatment.<b>Abbreviations</b>: Atg1: AuTophaGy related 1; Atg7: AuTophaGy related 7; Atg8: AuTophaGy related 8; Atg13: AuTophaGy related 13; Atg15: AuTophaGy related 15; Cct2: Chaperonin Containing TCP-1 2; CMA: chaperone-mediated autophagy; Cue5: Coupling of Ubiquitin conjugation to ER degradation 5; GFP: green fluorescent protein; HS: heat shock/stress; HTT: huntingtin; Pep4: carboxyPEPtidase Y-deficient 4; polyQ: polyglutamine; RFP: red fluorescent protein.

Also flagged:immune thrombocytopenia
Journal Article 2026-09-03 No Snippets Drivet E, Tsykunova G, Egner IM, Lund KP, Goll GL, Tran HTT, Holme PA, Tvedt THA, Ghanima W, Munthe LA, Kared H.
Show Full Abstract

Not available.

SUDS3
Also flagged:Phosphorylationreplication forkpost-translational modificationsreplication forks
Journal Article 2026-09-03 ✓ 1 Snippet Bobowski BD, Faulkner SC, Pinto HB, Durmaz C, Li Y, Teater MR, Chua GNL, Beckwitt EC, Walker NS, Biaco T, Chan C, O'Donnell ME, Liu S, Melnick AM, Skoultchi AI, David Y.
In-Text Gene Mentions

…known about howlinker histoneshistones regulate the…

Show Full Abstract

DNA replication fidelity depends on the integrity of the replication fork to prevent DNA damage and preserve genome stability. Disruptions to this process can trigger replication stress, leading to the accumulation of single-strand DNA (ssDNA) and double-strand breaks (DSBs), which drive mutagenesis and ultimately contribute to disease. While the roles of core histones and their post-translational modifications in this context have been more well-studied, far less is known about how linker histones regulate the replication stress response. Here, we demonstrate that the S-phase-phosphorylated form of the linker histone H1 (pH1) plays a key role in DNA damage repair at collapsed replication forks, both in vitro and in cells. Using phosphomimic and phosphonull H1 mutants, we show that phosphorylation enhances H1 assembly with ssDNA. Utilizing intein chemistry for the site-specific incorporation of a photocrosslinker to the C-terminus of H1, we map the direct interactors of H1. We identify phosphorylated H1 at replication forks, where it engages replication machinery and DNA damage response factors, including Histone PARylation Factor 1 (HPF1). We further demonstrate that ssDNA induces pH1-HPF1 interactions that promote liquid-like assemblies, correlating with reduced DNA damage and histone PARylation. Consistent with this role, reduction of total H1 increases cellular sensitivity to DNA damage, a phenotype that is partially rescued by reintroduction of H1.4. Together, these findings establish pH1 as a new regulator of DNA damage repair at collapsed replication forks through the controlled sequestration of repair factors.

SOX6
Also flagged:mitochondrialimmune responsesmetabolismangiogenesisthermoregulationbehavioral
Journal Article 2026-09-03 ✓ 1 Snippet Terefe E, Belay G, Tijjani A, Barbosa da Silva MV, Han J, Salim B, Hanotte O.
In-Text Gene Mentions

…, B3GLCT ,SOX6, CWC27 ,…

Show Full Abstract

African zebu cattle (Bos indicus) exhibit remarkable adaptations to extreme thermal conditions, yet the genomic basis of this resilience remains incompletely characterized. Ethiopia provides a unique natural setting in which closely related zebu populations have adapted divergently to dry-hot (DHETZ) and humid-hot (HHETZ) climates. In this study, we reanalyzed publicly available whole-genome sequencing datasets from 46 Ethiopian zebu cattle from five populations and compared them with Asian zebu, Sudanese zebu, African taurine, and European taurine breeds. By integrating genome-wide SNP analysis, population genetic structure assessment, and multiple selection scans (iHS, Hp, XP-EHH, and XP-CLR), we identified distinct and shared selection signatures between DHETZ and HHETZ. We detected 33.7 million and 34.2 million biallelic autosomal SNPs in DHETZ and HHETZ, respectively. Ethiopian zebu clustered closely with Sudanese zebu but showed clear divergence from Asian zebu and taurine breeds. DHETZ and HHETZ exhibited very low genetic differentiation (FST = 0.0063), consistent with their shared ancestry; however, each group displayed unique selection signals. In DHETZ, iHS and Hp detected 298 and 113 candidate regions, respectively, whereas in HHETZ, they detected 244 and 138 regions, respectively. Cross-population XP-EHH and XP-CLR analyses identified 163 and 227 divergent regions between DHETZ and HHETZ, respectively. Integration of the four selection scans identified 19 high-confidence candidate regions in DHETZ and 13 in HHETZ. DHETZ showed strong selection in genes involved in oxidative stress regulation, protein folding, mitochondrial function, and vascular remodeling, including SESN2, DNAJC8, GRPEL2, ABLIM3, and AFAP1L1. In contrast, HHETZ displayed signatures in genes associated with immune responses, energy metabolism, and angiogenesis inhibition, including MYD88, PRKACA, PRKACB, and WIF1. Several genes, including VEGFC, TNIP3, and DMXL2, were under selection in both groups, suggesting conserved mechanisms of thermotolerance and reproductive adaptation. The shared VEGFC signal and the HHETZ-specific WIF1 signal may indicate a distinct vascular regulatory mechanism in the dry-hot and humid-hot environments. Our results reveal a dual pattern of genomic adaptation in Ethiopian zebu cattle and provide candidate loci for future validation and climate-resilient livestock breeding.

Also flagged:metabolismmyelodysplastic neoplasmsofchromosomeribosomal gene expressioncell cycle
Journal Article 2026-09-03 No Snippets Schmitz S, Pearce JE, Martinez-Høyer S, Vroeg In de Wei G, Snoeren IAM, Stalmann USA, Fuchs SNR, Dugourd AJF, Franciosa G, Bindels EM, Walter W, Meyer C, Haferlach T, van der Vorst EPC, Calvete O, Solé F, Saez-Rodriguez J, Linkermann A, Olsen J, Gleitz HFE, Schneider RK.
Show Full Abstract

Deletion of chromosome 5q [del(5q)] is the most common cytogenetic abnormality in myelodysplastic neoplasms (MDS) and results in haploinsufficiency of multiple genes, including CSNK1A1. Recurrent CSNK1A1 mutations, predominantly affecting the E98 hotspot, occur almost exclusively in del(5q) MDS and are associated with adverse outcomes, yet their impact on CK1ɑ function remains unclear. Using integrated transcriptomic, (phospho)proteomic, and kinome activity profiling in hematopoietic stem and progenitor cells (HSPCs), combined with in vivo serial transplantation assays, we show that Csnk1a1 E98V represents a change-of-function rather than a loss-of-function mutation. Unlike Csnk1a1 haploinsufficiency, Csnk1a1 E98V preserves long-term hematopoietic reconstitution and does not enhance clonal expansion in vivo. Instead, the mutation induces suppression of kinase signaling networks, leading to coordinated repression of ribosomal gene expression, protein translation, and cell cycle programs. This signaling rewiring is accompanied by metabolic reprogramming characterized by reduced mitochondrial respiration, increased glycolytic flux, and an inability to adapt to metabolic challenges, creating a stress-tolerant but inflexible cellular state. Notably, Csnk1a1 E98V cells exhibit impaired megakaryopoiesis and increased vulnerability to iron overload, as well as RSL-3-mediated ferroptosis. Analysis of del(5q) MDS patients confirmed that CSNK1A1 mutations are associated with distinct clinical features, including thrombocytopenia, elevated myeloblasts, and reduced bone marrow iron levels. Together, our findings support a two-step model in which del(5q)-associated CSNK1A1 haploinsufficiency drives clonal expansion, followed by acquisition of CSNK1A1 mutations that promote stress tolerance rather than increased proliferation. This adaptive rewiring exposes metabolic and iron-dependent vulnerabilities that may be therapeutically exploited.

Also flagged:Extracellular VesiclesAge-Related DiseasesAgingCellular senescencecell cyclesenescence-associated secretory phenotype
Journal Article 2026-09-03 No Snippets Lv S, Xie J, Huang X, Liu Z, Shi J, Cao Z, Shang Z.
Show Full Abstract

Aging is a complex biological process that leads to a growing burden of age-related diseases (ARD). Cellular senescence, which involves irreversible cell cycle arrest and the release of senescence-associated secretory phenotype (SASP), plays a central role in aging and the development of ARD. Natural extracellular vesicles (NEVs) refer to vesicles that derived from cells, organs and body fluids without artificial interventions. In recent years, NEVs have gained attention as mediators of intercellular communication, and showed multifunctional potential in regulating cellular senescence and ARD. On the one hand, these vesicles are capable of spreading senescence signals by transferring molecules such as miRNAs, proteins, and DNA fragments. On the other hand, NEVs derived from animal cells, body fluids, plant cells, and bacteria have demonstrated potential anti‑aging effects. This review synthesizes research findings from the past two decades, with a particular focus on studies published in the last five years that elucidate the molecular mechanisms by which NEVs regulate cellular senescence. This review aims to summarize various applications (biomarkers, drug delivery vehicles, direct therapeutic agents) of NEVs in major ARD, including neoplasms, cardiovascular diseases, neurodegenerative disorders, bone diseases, and diabetes. Several challenges including standardizing production, targeted delivery, mechanism exploration, and clinical translation are also discussed. Combining bioengineering, multi-omics technologies, and improved model systems could be important to fully utilize the potential of NEVs, and offer precise, safe, and effective strategies for ARD therapy.

Also flagged:Idiopathic Pediatric Uveitisvisionsecretionpediatric uveitisretinal inflammationUveitis
Journal Article 2026-09-02 No Snippets Zhou Q, Huang J, Wang Y, Li X, Liu X, Dai L, Li H, Wang Q, Liu J, Su G, Zhang W, Deng Y, Cao Q, Lai Y, Luo X, Huang C, Chen L, Hou S, Yang P.
Show Full Abstract

Idiopathic pediatric uveitis (IPU) is a leading cause of irreversible vision loss in children; however, the genetic and molecular mechanisms underlying this condition remain unclear. Herein, trio-based whole-exome sequencing was performed in 28 affected families and targeted sequencing was performed in 1953 sporadic cases from a Han Chinese cohort. A rare missense mutation, A773E in intraflagellar transport 122 (IFT122), was identified in one trio and absent from sporadic cases. Functional assays showed that deleterious IFT122-A773E increased inflammatory factor secretion and exacerbated barrier function damage both in vivo and in vitro. Further studies using proteomics demonstrated that IFT122-A773E increased AP-1 transcription factor subunit (FRA1) expression. The IFT122-A773E substitution enhanced the interaction with IFT43 and up-regulated calcium channels, and in turn led to activation of the MEK/ERK signaling axis. Collectively, our findings suggest that IFT122-A773E may increase susceptibility to IPU through activation of the MEK/ERK/FRA1 axis.

Also flagged:KRASlung adenocarcinomasMYCsynthesistranslationaloncogene
Journal Article 2026-09-02 No Snippets Martin TD, Choi MY, McBride JC, Elledge SJ.
Show Full Abstract

Oncogenic KRAS mutations exhibit a striking tissue-restricted tropism, occurring with high frequency in pancreatic, colorectal, and lung adenocarcinomas while remaining rare in other lineages. The molecular basis for why these specific tissues are uniquely permissive to KRAS transformation, and how this context shapes therapeutic vulnerabilities, remains poorly defined. Here, we utilized CRISPR-mediated genome engineering to generate endogenous, conditional KRAS-mutant isogenic cell line models across three primary permissive lineages (lung, colon, and pancreas) and the nonpermissive breast lineage. Integrated genome-wide CRISPR fitness screens and comparative transcriptome analyses revealed that KRAS-driven synthetic lethal (SL) dependencies are profoundly shaped by their tissue of origin. Strikingly, we observed minimal overlap in SL hits across lineages, with only three genes shared among the permissive lines, suggesting that the <i>KRAS</i> oncogene operates through divergent, context-specific genetic networks. Mechanistically, we show that KRAS activation induces a universal MYC-driven metabolic signature, but the specific machinery required to sustain this state is lineage-restricted. We identified a dependency on the diphthamide synthesis pathway to maintain translational fidelity amid a KRAS-induced hypertranslational state. These findings demonstrate that even when driven by the same oncogene, tumors exhibit distinct regulatory landscapes and unique genetic vulnerabilities. Our results provide a framework for developing lineage-aware therapeutic strategies, moving beyond universal KRAS inhibition toward targeted interventions tailored to a tumor's specific tissue context.

Also flagged:nucleus-peripheral nerve injurydiabetic painful neuropathyneuropathyimmune responses
Journal Article 2026-09-02 No Snippets Liao XR, Zheng H, Luo JY, Zheng BX.
Show Full Abstract

Neuropathic pain remains a major unmet clinical challenge, as current therapies provide limited efficacy and poor tolerability. A major obstacle to developing effective analgesics is the pronounced cellular and molecular heterogeneity of the dorsal root ganglion (DRG), which integrates neuronal, glial, immune, and stromal responses to injury. Recent advances in single-cell RNA sequencing (scRNA-seq) and single-nucleus RNA sequencing (snRNA-seq) have enabled cell-type-resolved analyses of these responses and revealed disease-associated cellular states that are obscured by bulk tissue profiling, thereby offering new opportunities to redefine disease mechanisms and therapeutic priorities. This review synthesizes evidence from single-cell studies of peripheral nerve injury, diabetic painful neuropathy, and chemotherapy-induced neuropathy. Although these conditions share common biological processes, including neuronal state remodeling, disrupted glial homeostatic support, context-dependent immune responses, and extracellular matrix reorganization, they do not converge on a single conserved molecular program. Peripheral nerve injury is characterized by neuronal injury and repair states, reactive and metabolic glial remodeling, and neuroimmune recruitment and crosstalk. Diabetic neuropathy is associated with altered sensory coding, impaired satellite glial lipid support, and neurodegenerative remodeling. Chemotherapy-induced neuropathy exhibits substantial agent-specific heterogeneity, including subtype-selective neuronal vulnerability and metalloproteinase-dysregulated satellite glial states following paclitaxel treatment, as well as sex-associated fibrotic remodeling following bortezomib treatment. These cellular states may serve adaptive, maladaptive, or degenerative functions. However, because most available studies rely on single-time-point or repeated cross-sectional sampling, they cannot directly establish temporal progression or causal relationships. We further examine how human DRG atlases bridge experimental models and human disease by determining whether candidate molecular targets and cell states are conserved and by identifying their cellular localization. These datasets also highlight species-specific differences in neuronal organization and non-neuronal transcriptional programs that may limit the direct translation of findings from rodent models. Consequently, the primary translational value of DRG single-cell studies lies in elucidating disease mechanisms and prioritizing candidate therapeutic targets for further investigation. Advancing these discoveries toward clinical application will require complementary evidence from human genetics, human DRG transcriptomic datasets, functional validation studies, and clinical pharmacology. Collectively, these complementary approaches may facilitate the development of mechanism-based and cell-type-informed analgesic strategies.

TNFSF4
Also flagged:VPS45Vacuolar Protein Sorting 45tumourscancerTumourGene Expression
Journal Article 2026-09-02 ✓ 1 Snippet Duan J, Zhao W, Lv N, Xie C, Zhang G, Zhang L, Zhi R.
In-Text Gene Mentions

…ENTPD1, MICB, andTNFSF4( Figure 6A…

Show Full Abstract

<h4>Purpose</h4>A growing body of research indicates that Vacuolar Protein Sorting 45 (VPS45) is essential for the development of tumours and the advancement of cancer. Its biological role and expression profile in HCC are still mostly unknown, nevertheless.<h4>Materials and methods</h4>Using a variety of datasets, including the Tumour Immune Estimation Resource (TIMER) and Gene Expression Profiling Interactive Analysis (GEPIA), among others, we examined the existence and prognostic importance of VPS45. Functional enrichment analysis was employed to elucidate the potential mechanisms through which VPS45 may influence HCC. Additionally, we assessed the relationship between VPS45 expression and immune cell infiltration using single-sample gene set enrichment analysis (ssGSEA) and Estimation of Stromal and Immune cells in Malignant Tumour tissues using Expression data (ESTIMATE). The Tumor Immune Dysfunction and Rejection (TIDE) algorithm was leveraged to assess the sensitivity of predicted gene expression to immunotherapy. Utilizing assays including CCK-8, wound healing, and Transwell migration and invasion methods, we performed in vitro experiments on the MHCC-97H cell line to further investigate the biological significance of VPS45 in the progression of hepatocellular carcinoma (HCC).<h4>Results</h4>According to our research, VPS45 expression is markedly elevated in HCC, and elevated VPS45 levels are associated with a worse prognosis for patients. Functional enrichment analysis showed that elevated VPS45 expression is closely linked to the activation of various oncogenic pathways. VPS45 silencing decreases HCC cell invasion, metastasis, and proliferation, according to in vitro investigations. Interestingly, it was shown that VPS45 levels showed a positive link with immunosuppressive cell populations and related genes, but a negative correlation with a number of anti-tumor immune cell types. Immunotherapy resistance is more common in patients with increased VPS45 expression.<h4>Conclusion</h4>This study clarifies the biological role of VPS45 in hepatocellular carcinoma (HCC) and, through comprehensive database analyses combined with in vitro experiments, supports its potential as a diagnostic and predictive biomarker for HCC. In addition to its value for disease detection and prognosis, VPS45 may help predict patient response to immunotherapy.

Also flagged:Schizophrenianeuro-developmental disorder
Journal Article 2026-09-02 No Snippets Abdalla SA, Saeed A, Ahmed L, Abuswar S, Salih M, Eltigani A, Abdoon IH, Osman B, Ibrahim ME.
Show Full Abstract

<h4>Background</h4>Schizophrenia is considered a neuro-developmental disorder leading to disastrous lifelong disability of the patients and their families. There is a lack of data regarding pharmacogenomics of schizophrenia in Sudan. This study aimed to identify different genes affecting the treatment outcomes in Sudanese patients with schizophrenia.<h4>Methods</h4>A case-control study was conducted on seven families having more than one member diagnosed with schizophrenia. This was a small exploratory family-based sequencing study involving 18 affected individuals and 8 controls from seven families. Ethical clearance and informed consent were obtained. Demographic data were collected using a standardized data collection sheet. DNA was extracted from blood samples collected from patients and control groups. Then, whole-exome and genome sequencing were performed. Sixty-six genes associated with schizophrenia, treatment, and treatment resistance were selected from the variant calling file. Variants showing single-nucleotide polymorphisms (SNPs) were identified. These variants were then classified based on their impact on the protein-coding sequence into high- and moderate-impact. Moreover, indel mutations were also identified.<h4>Results</h4>Twelve variants of seven genes (COMT, FMO1, LPL, CYP2E1, ABCC1, GRM3, CYP2C9) were identified as genes with impact and potential association with schizophrenia (p-value=0.006632). Forty-three genes had a moderate impact, and they showed a potential association with schizophrenia (p-value=0.0004436). Two variants were indel mutations (CYP2D6, DTNBP1) and showed association with schizophrenia (p-value=0.004741). The p-values were generated from different databases.<h4>Conclusion</h4>This exploratory family-based sequencing study identified several potentially relevant pharmacogenomic and schizophrenia-associated variants in Sudanese families, warranting validation in larger and ethnically diverse cohorts.

CACNA1E
Also flagged:methylationreproductionspermatogenesisfertilization
Journal Article 2026-09-01 ✓ 1 Snippet DeCandia AL, Tennenbaum SR, Santymire R, Livieri T, Bortner R, Garelle D, Crosier A, Marinari P, Pukazhenthi BS, Comizzoli P, Maldonado JE, Koepfli KP, vonHoldt BM.
In-Text Gene Mentions

…SLC15A1, PDE10A, PIP5K1B,CACNA1E, and CACNA1A, all…

Show Full Abstract

Many endangered species rely on ex situ management for survival when external threats exist on the landscape. Yet, ex situ settings pose challenges through space limitation, altered environment, and diet. This can lead to environmentally determined inbreeding depression, where ex situ animals exhibit reduced reproductive fitness compared with their in situ counterparts, despite originating from the same genetic stock. We investigated epigenetic differences as a potential mechanism underlying environmentally determined inbreeding depression in black-footed ferrets (Mustela nigripes), a North American endemic species reliant on ex situ conservation. More specifically, we explored how environmental context may influence sperm DNA methylation in samples collected from 12 ex situ and 5 in situ males. Average sperm DNA methylation was significantly higher in ex situ individuals. We additionally identified more than 500 differentially methylated regions between ex situ and in situ sperm samples that were enriched for gene ontology terms pertaining to reproduction and development. Putative genes of interest included NPR2, WEE2, SLC15A1, PDE10A, PIP5K1B, CACNA1E, and CACNA1A, all of which have previously been linked to spermatogenesis, sperm motility, or fertilization in mammals. Results suggest that environmental conditions may alter sperm DNA methylation in black-footed ferrets, with possible links to decreased reproductive success in ex situ settings. These findings provide valuable insights into the molecular mechanisms underlying environmentally determined inbreeding depression in black-footed ferrets and other conservation-reliant species, and can serve as a foundation for future research on improving reproductive health in endangered wildlife.

Also flagged:Colorectal TumorigenesisAutophagycolorectal cancercell cycleinfectioncolonic tumors
Journal Article 2026-09-01 No Snippets Desseux C, Da Silva A, Tassini A, Sauvanet P, Delmas J, Dalmasso G, Nguyen HTT.
Show Full Abstract

<h4>Background</h4>In patients with colorectal cancer (CRC), intestinal dysbiosis has been observed, with abnormal colonization of the colonic mucosa by pathogenic Escherichia coli strains producing a cyclomodulin named cytotoxic necrotizing factor (CNF). Cyclomodulins are bacterial toxins capable of altering the cell cycle of the infected cell. One of the mechanisms involved in host defense against pathogens and in carcinogenesis is autophagy. Here, we aimed at investigating the role of autophagy in colorectal carcinogenesis in the context of CNF-producing E. coli, designated as CyPEC (cytotoxic necrotizing factor-producing E. coli), infection.<h4>Methods</h4>ApcMin/+ mice predisposed to CRC development with autophagy deficiency specifically in intestinal epithelial cells (ApcMin/+/Atg16l1ΔIEC) were infected with the clinical 21F8 strain or the mutant 21F8Δcnf1, which does not produce CNF1.<h4>Results</h4>In ApcMin/+ mice, infection with 21F8 or 21F8Δcnf1 did not have an impact on the number and the size of colonic tumors. However, in ApcMin/+/Atg16l1ΔIEC mice, infection with 21F8 increased number and size of colonic tumors, compared with uninfected or 21F8Δcnf1-infected condition. This increase was CNF1-dependent as it was not observed upon infection with the 21F8Δcnf1 mutant. Mechanistically, the increase in tumorigenesis in ApcMin/+/Atg16l1ΔIEC mice upon 21F8 infection was associated with enhanced proliferation and decreased apoptosis of colonic epithelial cells.<h4>Conclusions</h4>Our results show that autophagy deficiency could be a genetic susceptibility for the development of CRC in patients with abnormal colonization by CyPEC strains.

HTT
Also flagged:Huntington's diseasepathogenesis
Journal Article 2026-09-01 ✓ 3 Snippets Papadopoulou AS, Landles C, Smith EJ, Bondulich MK, Boeddrich A, Canibano-Pico M, Danby ECE, Hoschek F, Iqbal A, Jones ST, Neuendorf N, Nita IM, Osborne GF, Phillips J, Wagner M, Wanker EE, Greene JR, Neueder A, Bates GP.
In-Text Gene Mentions

…were deleted fromHttintron 1 in…

…polyA sites fromHttintron 1 prevented…

…resulted from aHttreadthrough product of…

Show Full Abstract

The mutation that causes Huntington's disease is a CAG repeat expansion in exon 1 of the huntingtin gene (HTT) that leads to an abnormally long polyglutamine tract in the huntingtin protein (HTT). Mutant CAG repeats are unstable and increase in size in specific neurons and brain regions with age, a phenomenon that constitutes the first step in the pathogenesis of the disease. In the presence of an expanded CAG repeat, cryptic polyadenylation (polyA) sites in intron 1 of the HTT pre-mRNA can become activated leading to the polyadenylation of a prematurely terminated transcript, HTT1a. This encodes the HTT1a protein, which is known to be very aggregation-prone and highly pathogenic. Given that the longer the CAG repeat the more HTT1a is generated, could the production of HTT1a be the mechanism through which somatic CAG repeat expansion exerts its pathogenic consequences? Resolving this issue is very important for the design of therapeutic approaches to lower huntingtin levels. We have used a clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 approach to prevent the production of HTT1a in a knock-in mouse model of Huntington's disease. All potential cryptic polyA sites were deleted from Htt intron 1 in HdhQ150 mice and colonies were established that were heterozygous for the intron 1 deletion on a mutant allele (HdhQ150ΔI) and heterozygous for the deletion on a wild-type allele (WTΔI). The CAG repeat sizes in the HdhQ150 and HdhQ150ΔI colonies were well-matched at approximately 195 CAGs. As predicted, the deletion of the cryptic polyA sites from Htt intron 1 prevented the generation of the Htt1a transcript in the HdhQ150ΔI mice. However, very low levels of the HTT1a protein were detected, which resulted from a Htt readthrough product of exon 1 and exon 2, that had retained the deleted intron and terminated at a cryptic polyA site in intron 2. HdhQ150, HdhQ150ΔI, wild-type and WTΔI mice were studied until 17 months of age. Immunohistochemical and homogeneous time-resolved fluorescence analysis showed that HTT aggregation in both HdhQ150 and HdhQ150ΔI brains contained HTT1a, but the dramatic decrease in soluble HTT1a levels in HdhQ150ΔI brains delayed the appearance of aggregated HTT1a by several months. Although this delay in aggregate pathology only partially reversed transcriptional dysregulation, the biomarkers neurofilament light polypeptide (NEFL) and breast regression protein 39 (BRP39) (YKL40) remained at wild-type levels in HdhQ150ΔI mice at 17 months of age. These data demonstrate that the production of HTT1a initiates HTT aggregation and that it is important to target HTT1a in huntingtin-lowering therapeutic strategies.

Also flagged:Cancerprostate cancersadenocarcinomastumorsgene expressioninvasive disease
Journal Article 2026-09-01 No Snippets Storrs E, Mo CK, Chou WH, Bhatt G, Chen S, Wei X, Houston A, Karpova A, Jayasinghe RG, Lal P, Bayguinov P, Herndon JM, Li X, Anjum Simin F, Fang X, Wendl MC, Liu X, Zheng H, Davies SR, Wang JT, Shinkle A, Fulton RS, Ponce J, Heinz M, Head R, Chen, Zhao Y, Fenyo D, Li YE, Ma CX, Aft R, Reimers MA, Kim AH, Puram SV, Fitzpatrick JAJ, Shoghi KI, Figenshau RS, Ademuyiwa FO, Ju T, Colditz GA, Drake BF, Patti GJ, Oh ST, Kim EH, Gillanders WE, Olson JA, Chheda MG, Weimholt C, Veis DJ, Raphael BJ, Fields RC, Pachynski RK, Chen F, Ding L.
Show Full Abstract

Breast and prostate cancers are both hormone-driven adenocarcinomas that undergo analogous invasion programs. Using lightsheet microscopy on intact tumors, we identified transitional junctions between precancerous and invasive regions. We then developed a multimodal serial-section workflow integrating volumetric reconstruction with spatial transcriptomics. Analysis of 319 spatial assays from 51 cases revealed gene expression features and novel structural insights defining the shift from precancer to invasive disease. In breast cancer, loss of MGP and PLAT was associated with invasive transition and promoted tumorigenesis in functional assays. In prostate cancer, GDF15, ALDH1A3, ANPEP, and FASN were upregulated along invasive progression, and their knockdown in PC-3 cells suppressed proliferation and migration. Enrichment of tumor-associated macrophages (SPP1+ and MS4A6A+) along non-triple-negative breast cancer breast cancer transitions highlights immune involvement as a potential driver of invasiveness.<h4>Significance</h4>Our method of defining precise spatial locations of invasive transition allows for the direct interrogation of transition drivers, presenting new therapeutic targets for the two most prevalent cancers and providing a framework for studying spatially defined mechanisms of tumor progression. See related commentary by Jing and Li, p. 1720.

OLFM4
Also flagged:Critical IllnessesBurnhematopoiesisactivationdeathCOVID-19
Journal Article 2026-09-01 ✓ 1 Snippet Sinha S, Mandujano-Tinoco EA, Kutluberk E, Mulder PPG, Collao N, Chockalingam K, Pun A, Dardari R, Verly M, Fraulin FOG, Harrop AR, Rosin NL, Gabriel V, Biernaskie J.
In-Text Gene Mentions

…rophil-specific 5-gene panel (OLFM4, RETN, LCN2, ARG1,…

Show Full Abstract

Severe burns provoke a systemic "genomic storm," yet cell states associated with divergent outcomes remain unclear. We profiled blood cells by single-cell RNA-Sequencing (73 014 cells) from adult patients with burn injuries within postburn day 17 (n = 4) and healthy donors (n = 5), integrated data with bulk signatures of burn size, inhalation injury, and mortality, and evaluated clinical associations in the American Burn Association National Burn Repository. Burn was associated with emergency hematopoiesis marked by expansion of hematopoietic stem/progenitor-like cells, immature neutrophils, and plasmablast/plasma cell states, alongside depletion of naïve CD4+/CD8+ T cells and dendritic cells. Larger burns (>20% TBSA) showed enrichment of humoral transcriptional programs, including plasmablast/plasma cell activation and suppression of cytotoxic CD8+ T-cell states. In multivariable models, inhalation injury was a stronger predictor of death (adjusted odds ratio [OR] 1.9) than burn size (adjusted OR 1.1) and shared greater overlap with the most perturbed single cells in non-survivors; 55% of co-perturbed cells were neutrophils, implicating granulocyte dysregulation as a common lethal axis. We identified a neutrophil-specific 5-gene panel (OLFM4, RETN, LCN2, ARG1, and BTNL3) that discriminated survivors vs non-survivors after burns (area under the curve [AUC] > 0.9) and generalized to trauma (n = 158; AUC 0.81) and intensive care unit COVID-19 (n = 103; AUC 0.75), providing information orthogonal to conventional biomarkers and severity scores. Cytomorphology corroborated transcriptomic immaturity, with ~2-fold higher band neutrophils and larger neutrophil size in a fatal case. Computational drug-reversal analysis highlighted galectin-1 inhibition as a candidate modulator of mortality-associated neutrophil programs. Together, our findings suggest that immature neutrophils represent a shared immune feature across severe burns and other forms of critical illness.

Also flagged:Pancreatic CancerTumorpancreatic ductal adenocarcinomaPDACcancertumors
Journal Article 2026-09-01 No Snippets Viatore M, Polidori R, Putignano AR, Bonometti A, Rahal D, Barbagallo M, Veghini L, Donisi G, Basso G, Giuliano D, Marchini S, Erreni M, Fumagalli MR, Pasqualini F, Grizzi F, Spaggiari P, Uccella S, Bozzarelli S, Zerbi A, Capretti GL, Corbo V, Locati M, Mantovani A, Marchesi F.
Show Full Abstract

Macrophages (Mϕ) constitute a dominant and functionally diverse immune population within the microenvironment of pancreatic ductal adenocarcinoma (PDAC), yet how Mϕ heterogeneity contributes to the tumor remains poorly defined. In an institutional cohort of 145 PDAC specimens, we identified a population of multinucleated giant cells (MGC) of Mϕ origin, an entity previously described in chronic inflammation but rarely in cancer. CD68+ MGCs were present in 28% of tumors, enriched in squamous, nonglandular regions, and more frequent after neoadjuvant chemotherapy. By integrating spatial transcriptomics and quantitative imaging, we defined the features of these cells, which, compared with MGCs in nonneoplastic inflammatory lesions, lacked canonical polarization markers (HLA-DR and CD163) and displayed a distinctive transcriptional program characterized by upregulation of the POLR2K, TUBA8, COX5B, and VDAC1 genes, which encode proteins involved in DNA repair, oxidative stress, and MYC signaling. Spatial analyses revealed activation of hypoxia and extracellular matrix-remodeling pathways in MGC-associated niches, and experimental hypoxia promoted MGC formation in vitro. Consistent with these data, we found that in the The Cancer Genome Atlas (TCGA) Pancreatic Adenocarcinoma (PAAD) dataset a Mϕ MGC gene signature was enriched in the squamous PDAC subtype and correlated with poorer overall survival (P = 0.018). Morphometric and immunofluorescence analyses further showed increased 53BP1+Ki67+ nuclei and nuclear atypia in MGCs, indicating ongoing proliferation despite DNA damage. Together, these data identify MGCs of Mϕ origin as an immune cell state shaped by hypoxia and stress signaling, associated with aggressive tumor phenotypes, and potentially exploitable as an immune classifier in PDAC.

PRDX6
Also flagged:FerroptosisTumordeathmelanomatumorscancer
Journal Article 2026-09-01 ✓ 1 Snippet Ehara D, Yasui K, Yoneda M, Muraoka D, Deng S, Miao P, Jiang C, Sun H, Okamoto S, Amaishi Y, Murota H, Ikeda H.
In-Text Gene Mentions

…PRDX1 , andPRDX6).…

Show Full Abstract

Tumor masses often exhibit heterogeneity, including escape variant clones that lack antigen-presenting machinery and/or tumor antigens, which poses a major challenge to immunotherapy. Ferroptosis, a form of regulated cell death driven by iron-dependent lipid peroxidation, has been shown to effectively induce cell death in various tumor cells. Recent studies have reported that IFNγ suppresses the expression of system Xc-, thereby enhancing the induction of ferroptosis. Based on this, we hypothesized that combining immunotherapy with ferroptosis inducers could enhance antitumor effects against both antigen-positive and antigen-negative tumor cells. We found that combining RSL3, a ferroptosis inducer, with MART-1-specific T-cell receptor-engineered T cells eradicates a heterogeneous tumor model consisting of human melanoma cells and their β2-microglobulin knockout counterparts. In NOD.Cg-PrkdcscidIl2rgtm1Sug/ShiJic mice, this combination therapy demonstrates a significant antitumor effect against tumors with heterogeneity. These findings suggest that integrating ferroptosis inducers with immunotherapy could overcome the limitations imposed by escape-variant tumor clones, offering a promising strategy for cancer treatment.

MLLT10
Also flagged:Type 1 Diabetesdiabetesislet autoimmunityhost cellsmyeloid sarcomaAML
Journal Article 2026-09-01 ✓ 1 Snippet Thelin MA, Cho S, Callebaut A, Nguyen H, Gitelman SE, Kharbanda S, Anderson MS, James EA.
In-Text Gene Mentions

MLLT10

Show Full Abstract

<h4>Objective</h4>Posttransplant type 1 diabetes (T1D) is typically attributed to transferred donor autoimmunity. We investigated a distinct etiology in a patient who developed diabetes following haploidentical hematopoietic cell transplantation, assessing whether autoimmunity originated from donor or residual host cells.<h4>Research design and methods</h4>Leveraging HLA disparity between the haploidentical donor and recipient, we used HLA class II tetramers to enumerate islet-specific CD4+ T cells in peripheral blood restricted by shared versus recipient-only HLA alleles.<h4>Results</h4>Tetramer analysis revealed an expanded population of islet-specific T cells in the recipient. The donor showed no such expansion. Despite 99% donor T-cell chimerism, >80% of the islet-specific T cells were restricted by recipient-unique HLA alleles, suggesting they originated from the residual host fraction.<h4>Conclusions</h4>T1D in this patient was most likely driven by residual recipient-derived T cells. Their survival despite myeloablative conditioning and repeated immunotherapy underscores the remarkable durability of established islet autoimmunity.

SERPINC1
Also flagged:liver diseasecirrhosisSteatotic Liver DiseaseMetabolicNAFLDgene expression
Journal Article 2026-09-01 ✓ 1 Snippet Ma W, Huang J, Cai B, Shao M, Yu X, Kjær MB, Lv M, Zhong X, Xu S, Zhan B, Li Q, Huang Q, Ma M, Cheng L, Luo Y, Grønbæk H, Zhou X, Lin L.
In-Text Gene Mentions

…, SERPINA10 ,SERPINC1, SERPING1 ,…

Show Full Abstract

<h4>Background and aims</h4>Metabolic dysfunction-associated steatotic liver disease (MASLD) is a progressive liver disease that ranges from simple steatosis to inflammation, fibrosis and cirrhosis. To address the unmet need for new MASLD biomarkers, we aimed to identify candidate biomarkers using publicly available RNA sequencing (RNA-seq) and proteomics data.<h4>Methods</h4>An approach involving unsupervised gene clustering was performed using homogeneously processed and integrated RNA-seq data of 625 liver specimens to screen for MASLD biomarkers, in combination with public proteomics data from healthy controls and MASLD patients. Additionally, we validated the results in the MASLD and healthy cohorts using enzyme-linked immunosorbent assay (ELISA) of plasma and immunohistochemical staining (IHC) of liver samples.<h4>Results</h4>We generated a database (https://dreamapp.biomed.au.dk/NAFLD/) for exploring gene expression changes along MASLD progression to facilitate the identification of genes and pathways involved in the disease's progression. Through cross-analysis of the gene and protein clusters, we identified 38 genes as potential biomarkers for MASLD severity. Up-regulation of Quiescin sulfhydryl oxidase 1 (QSOX1) and down-regulation of Interleukin-1 receptor accessory protein (IL1RAP) were associated with increasing MASLD severity in RNA-seq and proteomics data. Particularly, the QSOX1/IL1RAP ratio in plasma demonstrated effectiveness in diagnosing MASLD, with an area under the receiver operating characteristic (AUROC) of up to 0.95 as quantified by proteomics profiling and an AUROC of 0.82 with ELISA.<h4>Conclusions</h4>We discovered a significant association between the levels of QSOX1 and IL1RAP and MASLD severity. Furthermore, the QSOX1/IL1RAP ratio shows promise as a non-invasive biomarker for diagnosing MASLD and assessing its severity.

Also flagged:Heart FailureObesitydiabetesHeart failure with preserved ejectionventricular hypertrophyCardiomyopathy
Journal Article 2026-09-01 No Snippets Mohamed ZI, Shidane AA, Abdiasis AM, Hussein MH, Ibrahim AO, Abdi AA, Hashi KI, Mohamud MA, Mohamed AJ.
Show Full Abstract

<h4>Background</h4>Heart failure with preserved ejection fraction (HFpEF) accounts for over half of all heart failure hospitalizations, with obesity increasingly recognized as a central driver through expansion of epicardial adipose tissue, chronic low-grade inflammation and obesity-related haemodynamic overload culminating in ventricular hypertrophy.<h4>Methods</h4>We synthesized high-impact evidence from pivotal randomized trials and mechanistic studies published between 2015 and 2026, focusing on cardiometabolic outcomes, adipose tissue remodelling and haemodynamic effects of both drug classes.<h4>Results</h4>Tirzepatide produced substantial weight loss (> 20%), significant reductions in epicardial and paracardiac adipose tissue and a 19.5-point improvement in Kansas City Cardiomyopathy Questionnaire scores in the SUMMIT trial. SGLT2i, exemplified by empagliflozin, demonstrated foundational benefit through natriuresis, improved myocardial energetics and reduced heart failure hospitalization independent of diabetes status, with additional renal-protective effects. Because SUMMIT and EMPEROR-Preserved differed in design and populations, direct comparison between agents is not statistically valid; each should be assessed on its own evidence base.<h4>Conclusion</h4>Tirzepatide and SGLT2i act through distinct, physiologically complementary pathways converging on the cardio-renal-metabolic axis. While their combined use is mechanistically promising, it has not yet been tested in a dedicated randomized controlled trial, and prospective studies are needed to establish safety and long-term efficacy in obesity-related HFpEF.

Also flagged:executive functioning impairmentspsychological violenceExecutive dysfunctionEDsensory neurons developmentcell proliferation
Journal Article 2026-09-01 No Snippets Ramos RQ, Silva CMFPD, Evangelista AF, Serpeloni F, Lacerda NR, Avanci JQ, Assis SG.
Show Full Abstract

Although exposure to violence has been linked to executive functioning impairments, the biological mechanisms underlying this association remain unclear. This study examined CpG sites associated with executive functions in 78 young adults and their links to family (psychological and physical) and community violence during childhood. The scales used were Conflict Tactics (family violence); Things I Have Seen and Heard (community violence); Barkley Deficits in Executive Functioning. Mean differences (Mann-Whitney-U/Kruskal-Wallis) and Spearman correlations were assessed. An epigenome-wide association study identified differentially methylated CpGs, and linear regressions examined associations with violence exposures. Girls reported more family and psychological violence. Black participants experienced higher family violence. Executive dysfunction (ED) correlated with psychological family and community violence, and family violence forms were interrelated. Differentially methylated positions highlighted genes tied to key biological processes: MRGPRD (sensory neurons development); DPPA3 (germ-cell development); UNKL (cell differentiation); GPR6 (learning and memory); DUSP5 (cell proliferation and differentiation); and CAPN13 (signal transduction, cytoskeletal remodeling and cell differentiation). Candidate gene analysis found associations between executive dysfunction and methylation levels in these genes. Exploratory pathway analysis suggested enrichment of neurodevelopment and synaptic plasticity, intracellular trafficking and cytoskeletal remodeling, genome stability and cellular stress responses, and neuroimmune and inflammatory signaling. These findings suggest associations between ED, childhood violence exposure, and differential DNA methylation in cognition- and health-related genes, suggesting that epigenetic markers may be associated with pathways linking early adversity to later outcomes, although no causal inference can be drawn.

HFE
Also flagged:mitochondrialphosphorylationosteoclastogenesisBiogenesisPostmenopausal osteoporosisosteoclast differentiation
Journal Article 2026-09-01 ✓ 1 Snippet Yang J, Che J, Yang M, Feng Y, Li Q, Zeng Y.
In-Text Gene Mentions

Hfe

Show Full Abstract

Postmenopausal osteoporosis (PMOP) is linked to iron accumulation. Melatonin has iron-chelating and antioxidant properties, but its mechanism against osteoclastogenesis remains unclear. This study investigated whether melatonin suppresses osteoclast formation by targeting the iron/ROS-CREB-PGC-1β-mediated mitochondrial biogenesis pathway. In vitro, bone marrow-derived macrophages (BMMs) were treated with RANKL and melatonin (10-1000 nM). Melatonin concentration-dependently inhibited osteoclast differentiation, reduced intracellular ferrous and total iron levels, decreased ROS and oxidative stress markers, and suppressed mitochondrial biogenesis. Mechanistically, melatonin indirectly suppressed PGC‑1β expression via inhibition of CREB phosphorylation, without affecting PGC‑1α expression. The CREB activator forskolin reversed melatonin's effects, whereas the CREB inhibitor 666-15 mimicked them. In vivo, ovariectomized (OVX) mice received weekly injections of iron dextran to model moderate iron overload, with or without oral melatonin. Melatonin ameliorated iron‑induced bone loss, improved bone microarchitecture and biomechanical properties, reduced tissue iron stores and bone ROS levels, and suppressed osteoclast mitochondrial biogenesis and the CREB/PGC-1β pathway; these effects were counteracted by forskolin. In conclusion, melatonin prevents osteoclastogenesis and counters bone loss due to iron accumulation in estrogen‑deficient conditions by chelating iron, scavenging ROS, and blocking the iron/ROS‑activated CREB/PGC‑1β axis, thereby suppressing mitochondrial biogenesis. This study offers a mechanistic explanation for using melatonin as a possible treatment for PMOP, particularly when accompanied by iron overload.

SERPINC1
Also flagged:Liver Cirrhosischronic liver diseasecirrhosisCCDCLiver fibrosis
Journal Article 2026-09-01 ✓ 1 Snippet He J, Li B, Yan Y, Wang Y, Zhang M, Sun R, Hou B, Huang S, Zhen L, Wang D, Zhang C.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

<h4>Purpose</h4>Liver fibrosis and cirrhosis represent critical stages in the progression of chronic liver disease, yet their key molecular features remain incompletely understood.<h4>Experimental design</h4>We performed large-scale Olink-based proteomic profiling in over 40,000 participants from the UK Biobank with a median follow-up of 15.6 years to elucidate disease pathophysiology and identify pre-diagnostic biomarkers. Cross-sectional analysis included 66 prevalent cirrhosis cases, and prospective analysis identified 224 incident cirrhosis cases. Machine learning and Mendelian randomization (MR) were applied. An independent cohort was used for validation.<h4>Results</h4>Distinct dysregulated proteins were observed in compensated cirrhosis (CC) and decompensated cirrhosis (DC). In the prospective analysis, 696 proteins were associated with disease onset. A proteomic panel based on these markers achieved an AUC of 0.832 for predicting incident cirrhosis, outperforming established fibrosis scores including FIB-4, APRI, and NFS, and demonstrated robust performance across CC and DC populations. The protein panel showed predictive value (AUC = 0.743) for disease progression in an independent cohort. MR identified 66 proteins with putative causal roles, including 11 potential therapeutic targets.<h4>Conclusions and clinical relevance</h4>These findings provide novel molecular insights into cirrhosis development and support integrated proteomic biomarkers as a discovery and prioritization framework for early risk stratification.

PTGIS
Also flagged:congenital disorder of glycosylationCDGsynthesiswound healingorganizationbiosynthesis
Journal Article 2026-09-01 ✓ 1 Snippet Gallego D, Andreotti G, Monticelli M, Paris D, Martín-Martínez A, Gámez A, Serrano M, Córdoba-Caballero J, Seoane P, Ranea JAG, Pérez B.
In-Text Gene Mentions

…prostacyclin synthase (PTGIS) and pentraxin…

Show Full Abstract

Phosphomannomutase deficiency (PMM2-CDG), the most common congenital disorder of glycosylation (CDG), is characterized by multisystem involvement and a lack of disease-modifying therapies. While previous transcriptomic studies have uncovered disrupted cellular pathways, the functional consequences of these alterations remain poorly understood. To further investigate PMM2-CDG pathophysiology, we integrated proteomic and metabolomic profiling of patient-derived fibroblasts with previously published transcriptomic data. Proteomic analysis was performed using Tandem Mass Tag-based mass spectrometry, while metabolomics was conducted via Nuclear Magnetic Resonance spectroscopy. Multi-omics integration was performed using principal component analysis-based dimensionality reduction, incorporating clinical metadata as supplementary variables. Proteomic analysis identified 43 significantly altered proteins, with enrichment in the retinoic acid synthesis pathway, wound healing, and cytoskeletal organization. Metabolomic profiling revealed altered amino acid levels and elevated concentrations of UDP-GlcNAc, consistent with perturbation of the hexosamine biosynthesis pathway, and increased levels of myo-inositol. Notably, myo-inositol levels showed a strong association with disease severity in the integrated analysis. RT-qPCR confirmed the upregulation of GFPT2. This integrative multi-omics study identifies consistent alterations in the retinoic acid synthesis pathway and hexosamine biosynthesis in PMM2-CDG patient-derived fibroblasts and reveals an association between intracellular myo-inositol levels and disease severity. These findings provide new insights into PMM2-CDG-associated molecular alterations and illustrate the value of multi-omics integration for hypothesis generation in rare diseases.

Also flagged:FerroptosisAlzheimer's Diseaseneurodegenerative disorderpathogenesisADmitochondrial
Journal Article 2026-09-01 No Snippets Salunkhe J, Ugale V.
Show Full Abstract

Alzheimer's disease (AD) is a multifactorial neurodegenerative disorder characterized by progressive cognitive decline, amyloid-β (Aβ) accumulation, oxidative stress, and excitotoxicity. Ferroptosis and N-methyl-D-aspartate (NMDA) receptor activity,may be interconnected in the pathogenesis of Aβ accumulation and associated neurodegeneration in AD. However, the interplay between these pathways remains poorly understood and underexplored for therapeutic intervention against the AD. The review aims to explore the shared molecular triggers of ferroptosis and NMDA receptor overactivation, including the roles of iron, glutamate overload, calcium dysregulation, and reactive oxygen species (ROS) accumulation. We further highlighted the convergent consequences of these processes on mitochondrial dysfunction, lipid peroxidation, and their impact on Aβ pathology. Particular attention is given to P-glycoprotein (P-gp), an efflux transporter involved in the Aβ clearance at the blood-brain barrier, whose expression and function may be modulated by oxidative stress, iron homeostasis, and NMDA receptor signaling. Emerging evidence indicated that ferroptosis and NMDA receptor activity may disrupt P-gp function, thereby impairing Aβ clearance and promoting its accumulation in the AD. Overall, the review elucidates the molecular mechanisms linking ferroptosis and NMDA receptor overactivation and their impact on P-gp-mediated Aβ transport in the AD, providing integrated mechanisms and harnessing their potential for AD therapeutics.

HTT
Also flagged:Neurological DisordersNeurological diseasesAlzheimer's diseaseADParkinson's diseasePD
Journal Article 2026-09-01 ✓ 2 Snippets Okafor NI, Abdelgader A, Abobaker M, Choonara YE.
In-Text Gene Mentions

…within the huntingtin (HTT) gene, leading to…

…of a faultyHTTprotein (mHTT) with…

Show Full Abstract

Neurological disorders (NDs) are characterized by substantial loss of specific neurons, with Alzheimer's and Parkinson's diseases being the most frequent NDs and nearly 99% of all "foreign substances" are prohibited from entering the brain by the blood-brain barrier (BBB) and the blood-cerebrospinal fluid barrier (CFB). These barriers, while crucial for brain protection, pose significant challenges for drug delivery, as they restrict the entry of many therapeutic agents into the brain, and this represents the primary manifestation of the absence of pathogenesis-targeting therapeutics. With significant success across multiple cell transplantation research efforts, stem cell therapy has been utilized for decades to treat neurological disorders. They work by replacing injured or lost cells directly, releasing proliferation and neurotrophic factors through autocrine and paracrine actions, suppressing neurological inflammation, and activation of endogenous brain progenitor cells. Nanocarriers derived from stem cells represent an innovative and promising therapeutic strategy for combating neurological diseases, combining faculties of regeneration of stem cells with the precision of nanotechnology. These nanocarriers possess natural biocompatibility and can efficiently cross the BBB to transport the therapeutic agents directly to affected neural tissues, thereby promoting enhanced treatment efficacy while reducing off-target effects. However, key challenges remain in large-scale production, standardization, and long-term safety. Thus, this review has examined the potential applications of stem cell extracellular vesicle (EV)-nanocarriers, mainly exosomes and recent development in the treatment of neurological diseases.

PRDX6
Also flagged:Mitochondrialagingmetabolismextracellular matrixorganizationresponse to exercise
Journal Article 2026-09-01 ✓ 2 Snippets Ruple BA, Carlini NA, Kofoed JS, Rostamkhani H, Hanson BE, Craig JC, Osburn SC, Manuel AM, Stewart PA, Wanagat J, Broxterman RM, Trinity JD.
In-Text Gene Mentions

PRDX6was similarly correlated…

…proteins, including PRDX3,PRDX6, and components of…

Show Full Abstract

Redox imbalances and mitochondrial dysfunction are key contributors to age-related declines in skeletal muscle and may contribute to impaired exercise responsiveness. Here, we investigated the influence of aging on skeletal muscle redox at rest and in response to acute exercise, examining how mitochondrial quality and quantity relate to skeletal muscle redox status. Skeletal muscle biopsies were obtained from 12 young (22 ± 4 years) and 10 older adults (66 ± 7 years) before and immediately after 60-min of high-intensity knee-extension exercise. We assessed mitochondrial respiration, mitochondrial DNA (mtDNA) copy number and deletion mutation frequency at baseline, while skeletal muscle redox proteomics was performed on pre- and post-exercise biopsies in a subset of participants. Mitochondrial respiration was preserved with age (max respiration, p = 0.123). However, the older adults had a lower mtDNA copy number (p = 0.046) and higher mtDNA deletion frequency (p = 0.001), with widespread remodeling of the skeletal muscle redox proteome, including altered thiol occupancy of proteins involved in metabolism, immune function, and extracellular matrix organization. In response to exercise, young skeletal muscle exhibited predominantly reversible peptide reductions, whereas preferential oxidation of mitochondrial antioxidant proteins, including PRDX3, occurred in older muscle. Both mtDNA deletion frequency and mitochondrial respiration were strongly associated with exercise-induced redox modifications in mitochondrial proteins. These findings suggest that aging alters both the regulation and resolution of exercise-induced redox signaling, with mitochondrial genomic instability and respiration shaping redox responsiveness.

PRDX6
Also flagged:neurodegenerative diseasestauopathiesAlzheimer's diseaseADPick's diseasepaired helical filaments
Journal Article 2026-09-01 ✓ 1 Snippet Copsey A, Oakley SS, Maina MB, Parker R, Marshall KE, Harrington CR, Storey JMD, Wischik CM, Serpell LC.
In-Text Gene Mentions

…as the thiol-peroxidase,PRDX6, alongside an increase…

Show Full Abstract

Tau self-assembly and intracellular deposition are associated with a group of neurodegenerative diseases called tauopathies, which include Alzheimer's disease (AD) and Pick's disease. Here, we measured the proteome response in human neuronal cells (differentiated SH-SY5Y) following the addition of a spontaneously amyloidogenic region of tau known as dGAE (tau297-391), which forms AD-like paired helical filaments in vitro, and proteomic analysis showed increased endogenous tau expression. Further interactome analysis uncovered increased association between tau and proteins associated with nuclear chromatin, the nucleolus, and the spliceosome, as well as the thiol-peroxidase, PRDX6, alongside an increase in reactive oxygen species. The present work highlights a method to identify proteome pathways that may play an important role in the development of tau pathology and reveals an oxidative stress response to dGAE.

NEGR1
Also flagged:tumorCancersubcutaneous tumorcell migrationColorectal Cancertumors
Journal Article 2026-09-01 ✓ 1 Snippet Dong M, Xu W, Zhang J, Jia G.
In-Text Gene Mentions

NEGR1

Show Full Abstract

Colorectal cancer (CRC) prognosis remains challenging due to tumor heterogeneity and immune evasion driven by aberrant inflammatory signaling, and robust multicohort validated prognostic tools with clear therapeutic implications are still lacking. To address this gap, we integrated five independent CRC cohorts (TCGA, GSE17536, GSE17537, GSE29621, and GSE38832; n = 931) and applied single-sample gene set enrichment analysis (ssGSEA) across 15 inflammation-related signaling pathways to construct a prognostic risk score model via multicohort Cox regression and LASSO-Cox regression. The immune landscape was systematically characterized using immune infiltration algorithms, Cancer Immunity Cycle scoring, CellChat analysis, and single-cell RNA sequencing (scRNA-seq) data (GSE166555). The functional role of the candidate gene PCOLCE2 was further validated through in vitro migration and adhesion assays, and confirmed in a syngeneic C57BL/6 mouse subcutaneous tumor model in which MC38-shPCOLCE2 cells were inoculated and treated with anti-PD-1 antibody (200 μg per mouse, every 3 days) alone or in combination to evaluate the synergistic antitumor effect. The resulting 12-gene inflammation-related risk model achieved robust survival stratification across all five independent cohorts, with AUC values of 0.70-0.85 and C-indices consistently outperforming existing prognostic models, demonstrating strong generalizability as a clinical prognostic tool. High-risk patients exhibited significantly worse overall survival (p < 0.001), an immunosuppressive tumor microenvironment, and elevated pro-stromal remodeling signaling, patterns that were corroborated by single-cell resolution analysis. Mechanistically, PCOLCE2 knockdown suppressed CRC cell migration and enhanced matrix adhesion in vitro. Critically, in vivo combination of PCOLCE2 knockdown with PD-1 blockade produced a synergistic antitumor effect superior to either monotherapy (p < 0.01), highlighting PCOLCE2 as a promising therapeutic target to enhance immunotherapy response. Together, these findings present a clinically actionable, multicohort validated inflammation-related prognostic model for CRC risk stratification, and position PCOLCE2 as a driver of invasion and immune evasion whose combination with PD-1 blockade offers a rational therapeutic strategy to improve immunotherapy efficacy in high-risk CRC patients.

NEGR1
Also flagged:cancertumorsynapsecerebral strokesecretioncolorectal cancer
Journal Article 2026-09-01 ✓ 5 Snippets Yongjun L, Zhiwen P, Shangui F, Jinjie Z, Rongbiao Y, Zhongjian C, Wanyuan C, Haixing J, Dening M, Dan L, Cong L, Zhixuan F.
In-Text Gene Mentions

…growth‐promoting factor 2),neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1), neudesin neurotrophic…

…of GDNF, NGF,NEGR1, MANF , and…

…, MDK ,NEGR1, NENF ,…

…GDNF, NGF ,NEGR1, MANF ,…

Show Full Abstract

Studies have demonstrated that the nervous system plays an important role in cancer progression. Nevertheless, the effect of mesenchymal stem cells (MSCs) on cancer has yielded conflicting results. In this study, we discovered that cancer-derived MSCs (CA-MSCs) not only exhibit the properties of neural stem cells (NSCs) but also express a significant amount of neural-related products. These products include neurotrophic factors, neuropeptides, synapse-related products, and axon guidance factors. These identified products exhibit similar or different expression status among human NSCs, cancer and fat-derived MSCs. CA-MSCs expressed more BDNF, GDNF, and NGF than NSCs. Based on these neural-related products expressed by CA-MSCs, expression-prognostic analysis was conducted. It revealed that the expression of MDK and MANF was higher in cancer, and the expression of BDNF, NPTX1, and NGF increased as the tumor stage advanced. For ten neuropeptides, their expression levels were lower in cancer. Thirty synapse-related products displayed their respective expression status between cancer and normal tissues. SYPL1, SYBP2/3, and STX4 had a significant impact on tumor prognosis. Higher levels of syntaxin-4, neugrin, and other axogenesis products were associated with a worse prognosis in cancer. Moreover, immunohistochemistry revealed that NSC-like CA-MSCs were abundant in cancer and exhibited a clear growth-promoting effect on cancer. Briefly, CA-MSCs, which are densely distributed in cancer and have the characteristics of NSCs, express a large number of nerve-related products. These products may have significant effects on tumor progression and prognosis.

Also flagged:immune responsestissue homeostasiscancertumorcancersinnate immunity
Journal Article 2026-09-01 No Snippets Guo L, Li L, Wang F, Liu W, Zhang Y.
Show Full Abstract

The cyclic GMP-AMP synthase (cGAS)-stimulator of interferon genes (STING) signaling pathway, as a key DNA sensor, plays a significant role in the regulation of innate immune responses. This pathway can be activated by sensing abnormal DNA, and is of great significance for resisting the invasion of pathogenic microorganisms and maintaining tissue homeostasis. In addition, the cGAS-STING pathway plays a dual role in cancer, and oncogenic viruses can cause cell carcinogenesis in the body through multiple mechanisms, thereby affecting human health. This manuscript reviews the vital role of cGAS-STING in the immune process, as well as the fact that viruses causing human tumor lesions can activate cGAS-STING, leading to virus inhibition and further preventing the occurrence and development of related cancers, and the paradoxically promoted progression of related cancers by viruses through cGAS-STING. And summarize the agonists and inhibitors that act in different ways based on the activation mechanism of cGAS-STING.

Also flagged:Mitophagymitochondrialmitochondriaautophagyaxoncytosol
Journal Article 2026-09-01 No Snippets Basak B, Riley JF, Nataraj NM, Holzbaur EL.
Show Full Abstract

Regulation of mitochondrial health is critical for maintaining cellular homeostasis in the nervous system. Damaged mitochondria can have detrimental effects on neuronal health and are thought to be key contributors to the progression of neurodegenerative disorders including Parkinson's disease and amyotrophic lateral sclerosis. To mitigate this damage, multiple quality control mechanisms have evolved to eliminate aged or damaged mitochondria. One such quality control process is autophagy, a process that involves turnover of mitochondria at presynaptic sites and the axon terminal under basal conditions. This highly conserved mechanism sequesters mitochondria from the cytosol within autophagosomes followed by degradation upon fusion with a lysosome. Acute mitochondrial damage activates a selective form of autophagy called mitophagy that involves receptor-mediated engulfment and degradation of the damaged organelle. Multiple mechanisms have been shown to drive efficient mitophagy in neurons and glia, including PTEN induced kinase 1 (PINK1)/Parkin-dependent mitophagy and receptor-mediated mitophagy. Genetic, pathological, and experimental evidence all implicate defects in the removal of damaged mitochondria in the onset or progression of neurodegenerative disease. Both the initiation of PINK1/Parkin-dependent mitophagy and deficits in the removal of damaged mitochondria are linked to activation of neuroinflammatory pathways, including NF-κB and cyclic GMP-AMP synthase-stimulator of interferon genes (cGAS-STING) signaling. In this Review, we discuss the molecular pathways governing mitophagy in neurons and glial cells and how deficits in these pathways may lead to neurodegeneration. We also highlight emerging therapeutic strategies aimed at restoring mitophagy to preserve neuronal homeostasis and function.

γδ T cells and cancer.

BTN2A1
Also flagged:viral infectiontumorcanceradaptive immunitytissue homeostasisinfection
Journal Article 2026-09-01 ✓ 2 Snippets Bolini L, Coffelt SB, Silva-Santos B, Wiest DL, Galluzzi L.
In-Text Gene Mentions

…This depends on BTN3A1/BTN2A1dimers that undergo…

…functional BTN3A1 andBTN2A1homologs, but they…

Show Full Abstract

γδ T cells are a subset of lymphoid cells that, unlike their αβ lineage counterparts, express a heterodimeric TCR that mostly operates in an MHC-independent manner. γδ T cells are abundant in barrier tissues, where they continuously monitor epithelial cells for signs of stress or damage. Thus, γδ T cells are among the first responders to pathophysiological conditions, including viral infection and oncogenesis. Human γδ T cells can be classified based on TCR γ and δ chain usage into three main subsets: (a) Vγ9+Vδ2+ cells, accounting for most circulating γδ T cells; (b) Vδ1+ cells, which are common in epithelial linings, and (c) Vδ3+ T cells, which are fairly rare but exhibit unique specificities. Moreover, both human and murine γδ T cells can assume a spectrum of states with divergent phenotypic and functional properties. Accumulating evidence demonstrates that γδ T cells can mediate robust anticancer effects or support tumor progression and resistance to therapy, depending on numerous variables, including functional state and tumor type. Here, we critically discuss the context-dependent interaction between γδ T cells and cancer, focusing on recent developments and the challenges facing current efforts to manipulate this versatile lymphocyte subset for therapeutic purposes.

OLFM4
Also flagged:inflammatory bowel diseasegastrointestinal disordersInflammatory bowel diseasesCDpediatricfunctional gastrointestinal disorders
Journal Article 2026-09-01 ✓ 2 Snippets Zheng HB, Doran BA, Kimler K, Yu A, Tkachev V, Niederlova V, Cribbin K, Fleming R, Bratrude B, Betz K, Cagnin L, McGuckin C, Keskula P, Albanese A, Sacta M, de Sousa Casal J, van Esch R, Kwong AC, Kummerlowe C, Taliaferro F, Fiaschi N, Kou B, Coetzee S, Jalal S, Yabe Y, Dobosz M, Wipperman MF, Hamon SC, Kalliolias GD, Hooper A, Lim WK, Haxhinasto S, Wei Y, Ford M, Ambartsumyan L, Suskind DL, Lee D, Deutsch GH, Deng X, Collen LV, Mitsialis V, Snapper SB, Wahbeh G, Shalek AK, Ordovas-Montanes J, Kean LS.
In-Text Gene Mentions

…high levels ofOLFM4, identifying them…

…by CCL25 andOLFM4expression, we identified…

Show Full Abstract

Crohn's disease is an inflammatory bowel disease (IBD) commonly treated through anti-TNF blockade. However, most patients still relapse and inevitably progress. Comprehensive single-cell RNA-sequencing (scRNA-seq) atlases have largely sampled patients with established treatment-refractory IBD, limiting our understanding of which cell types, subsets, and states at diagnosis anticipate disease severity and response to treatment. Here, through combining clinical, flow cytometry, histology, and scRNA-seq methods, we profile diagnostic human biopsies from the terminal ileum of treatment-naive pediatric patients with Crohn's disease (pediCD; <i>n</i> = 14), matched repeat biopsies (pediCD-treated; <i>n</i> = 8) and from non-inflamed pediatric controls with functional gastrointestinal disorders (FGIDs; <i>n</i> = 13). To resolve and annotate epithelial, stromal, and immune cell states among the 201,883 baseline single-cell transcriptomes, we develop a principled and unbiased tiered clustering approach, ARBOL. Through flow cytometry and scRNA-seq, we observe that treatment-naive pediCD and FGID have similar broad cell type composition. However, through high-resolution scRNA-seq analysis and microscopy, we identify significant differences in cell subsets and states that arise during pediCD relative to FGID. By closely linking our scRNA-seq analysis with clinical meta-data, we resolve a vector of T cell, innate lymphocyte, myeloid, and epithelial cell states in treatment-naive pediCD (pediCD-TIME) samples, which can distinguish patients along the trajectory of disease severity and anti-TNF response. By using ARBOL with integration, we position repeat on-treatment biopsies from our patients between treatment-naive pediCD and on-treatment adult CD. We identify that anti-TNF treatment pushes the pediatric cellular ecosystem toward an adult, more treatment-refractory state. Our study jointly leverages a treatment-naive cohort, high-resolution principled scRNA-seq data analysis, and clinical outcomes to understand which baseline cell states may predict Crohn's disease trajectory.

STAU1
Also flagged:macroautophagyautophagydegradationautophagosomeorganizationcancer
Journal Article 2026-09-01 ✓ 2 Snippets Lin Y, Dai M, Dai E, Kang R, Klionsky DJ, Tang D, Sun Y, Lv N, Jiang J.
In-Text Gene Mentions

…persistent SQSTM1 bodies,STAU1condensates, pathological MAPT…

…is observed inSTAU1(staufen double‐stranded RNA…

Show Full Abstract

Biomolecular phase separation has emerged as a key organizing principle in macroautophagy (hereafter autophagy). In mammalian cells, phase-separated condensates not only serve as substrates for selective degradation, but also act as dynamic platforms for cargo recognition, signaling integration, and autophagosome assembly. The material state of these condensates is an important determinant of autophagic fate. Condensates exist along a continuum ranging from liquid-like droplets to gel-like and solid assemblies, and their progressive maturation can alter accessibility to autophagic machinery. Scaffold proteins and selective autophagy receptors further organize these assemblies into degradation-competent mesoscale reaction fields that couple cargo recognition with phagophore formation. Dysregulation of this phase separation-autophagy axis is increasingly implicated in neurodegeneration, cancer, aging, and stress-associated degenerative disease. Here, we propose a multiscale framework in which molecular accessibility, mesoscale organization, and condensate state transitions collectively shape autophagic outcome, providing a conceptual basis for predictive models and therapeutic strategies aimed at restoring condensate degradability.

MMS22L
Also flagged:replication forkcancercell cyclereplication forksreplication checkpointcheckpoint
Journal Article 2026-09-01 ✓ 1 Snippet Dwivedi HK, Bhattacharya D, Kadupatil S, Nagaraju G.
In-Text Gene Mentions

…facilitated by theMMS22L–TONSL complex, thereby attrib…

Show Full Abstract

RAD51 paralogs (RAD51B, RAD51C, RAD51D, XRCC2, and XRCC3) are evolutionarily conserved essential proteins for cell survival and genome maintenance. RAD51 paralogs were originally identified to play a role in homologous recombination-mediated repair of DNA double-strand breaks (DSBs). However, investigations over the last decade have uncovered new roles of RAD51 paralogs beyond DSB repair in replication stress responses, including replication fork progression, fork stability, and its restart. Recent structural studies have not only uncovered the molecular architecture of previously known RAD51 paralog complexes but also identified novel paralog complex assemblies, providing mechanistic insights into their various genome-maintenance functions. Additionally, a role for RAD51 paralogs in resolving R-loops has been identified, and studies with cancer-associated variants suggest that RAD51 paralogs are potential determinants of cancer susceptibility and therapeutic responses. In the present review, we highlight the recently deciphered structures and novel functions of RAD51 paralog complexes and discuss the clinical and therapeutic implications.

Also flagged:transposonsinfectiongene transferbacterial infectionssynthesischromosomes
Journal Article 2026-09-01 No Snippets Azumah JD, Hoang HTT, Le YH, Calvopina M, Bastidas-Caldes C, Yamamoto M, Yamamoto Y.
Show Full Abstract

Community carriage of extended-spectrum <i>β</i>-lactamase (ESBL)-producing <i>Escherichia coli</i> represents an important reservoir of antimicrobial resistance. However, the genomic diversity and population structure of ESBL-producing <i>E. coli</i> circulating in community settings remain poorly characterized. This study aimed to characterize ESBL-producing <i>E. coli</i> isolated from fecal samples of residents in Ecuador, with an emphasis on the diversity and genomic context of ESBL genes. ESBL-producing <i>E. coli</i> was isolated from fecal samples obtained from 55 residents using MacConkey agar supplemented with cefotaxime. Whole-genome sequencing of the isolates was performed using a hybrid approach combining long- and short-read platforms. Plasmids and <i>β</i>-lactamase genes were identified using DFAST and PlasmidFinder. Bacterial identification and antimicrobial susceptibility testing were conducted by MALDI-TOF MS and the broth microdilution method, respectively. ESBL-producing <i>E. coli</i> were isolated from 35 of 55 fecal samples (63.6%). Complete circular genomes were obtained from 31 isolates. All isolates harbored <i>bla</i> <sub>CTX-M</sub> genes, predominantly belonging to the <i>bla</i> <sub>CTX-M-1</sub> group, whereas 65.7% carried <i>bla</i> <sub>TEM</sub>, mainly <i>bla</i> <sub>TEM-1</sub>, and related variants. Although <i>β</i>-lactamase genes were predominantly plasmid-borne, chromosomal integration was detected in 40% of the isolates. Notably, 87.5% of the isolates harbored IncF plasmids with multiple replicons. Conserved IS<i>26</i>-flanked transposons carrying <i>bla</i> <sub>CTX-M</sub> and <i>bla</i> <sub>TEM</sub> were frequently identified in the plasmids. Phylogenetic analysis revealed substantial genomic diversity across seven phylogroups, together with closely related isolates detected within and between households. These findings provide high-resolution genomic insights into the ESBL determinants circulating in community residents and reveal region-specific patterns of ESBL genomic diversity.

POU3F2
Also flagged:prostate cancerneuroendocrineNE) prostate cancerneurogenesistumortranslational modification
Journal Article 2026-09-01 ✓ 1 Snippet Seilani F, Peng J, Wu M, Esfini Farahani M, Wang X, Akinyemi AO, Liu X.
In-Text Gene Mentions

…is BRN2, aPOU3F2neural lineage transcription…

Show Full Abstract

Lineage plasticity is a major mechanism by which prostate cancer adapts to therapeutic pressure, particularly following sustained inhibition of androgen receptor signaling. A central mediator of this process is BRN2, a POU3F2 neural lineage transcription factor that is normally suppressed in AR-dependent luminal prostate epithelium but becomes aberrantly activated during progression to castration-resistant and neuroendocrine (NE) prostate cancer. This review examines how BRN2 connects developmental neurogenesis to therapy-induced tumor reprogramming. We integrate insights from neurodevelopment and direct lineage reprogramming to describe how BRN2 maintains stem-like and NE transcriptional states. Mechanistically, we discuss how AR suppression, cooperating oncogenic drivers, epigenetic remodeling, and post-translational modification activate BRN2 and reshape transcriptional networks involving SOX2, Wnt signaling, N-Myc, and EZH2. We also evaluate strategies to target BRN2 and its associated dependencies, including direct inhibition of BRN2 DNA binding and pharmacologic disruption of cooperating epigenetic complexes such as BRD4, EZH2, and LSD1, though EZH2 inhibition may paradoxically promote further NE differentiation. We additionally assess BRN2 as a potential circulating biomarker, detectable in extracellular vesicles, though no clinical-grade assay has been validated. This review highlights BRN2 as a key transcriptional regulator of lineage plasticity in prostate cancer, with important implications for overcoming therapy resistance in advanced prostate cancer.

DARS2
Also flagged:protein homeostasismitochondrialorganellemetabolismgene expressionrespiratory‐chain
Journal Article 2026-09-01 ✓ 5 Snippets Isermann L, Trifunovic A.
In-Text Gene Mentions

…drial aspartyl‐tRNA synthetaseDARS2in the heart.…

DARS2deficiency severely disrupts…

…was demonstrated beyondDARS2deficiency.…

…mouse models ofDARS2‐driven mitochondrial encephal…

…support comes fromDARS2deficiency, mtDNA mutator…

Show Full Abstract

Mitochondrial CLPP has emerged as an unusual therapeutic target because both increasing and decreasing its proteolytic activity can be beneficial, depending on the cellular and disease context. Pharmacological CLPP hyperactivation drives broad degradation of mitochondrial proteins and can selectively collapse mitochondrial fitness in susceptible tumor cells, an approach now clinically validated by the approval of dordaviprone for mutant diffuse midline glioma. Conversely, reduced CLPP activity can preserve respiratory-chain components and promote adaptive metabolic and redox remodelling in selected models of mitochondrial disease, neurodegeneration and metabolic dysfunction, with emerging potential in ischaemia-reperfusion injury. These opposing outcomes reflect the broader role of CLPXP in controlling mitochondrial translation, respiratory-chain integrity and metabolism rather than acting simply as a general protein quality-control system. In this review, we discuss the physiological functions and substrate selectivity of CLPXP, the mechanistic basis and clinical development of CLPP inhibitors and activators, and the growing evidence that therapeutic responses depend strongly on tissue identity, metabolic state and the nature of the underlying mitochondrial defect. Together, these findings position CLPP as a context-dependent therapeutic switch whose activity may need to be tuned in opposite directions to either preserve mitochondrial resilience or selectively dismantle mitochondrial fitness.

PEBP1
Also flagged:FerroptosisAcute GlaucomaGlaucomablindnessmetabolismgene silencing
Journal Article 2026-09-01 ✓ 5 Snippets Huang Y, Gong D, Guo J, Huang W, Hu T, Tang S, Li L, Feng B, Dang K, Deng S, Liu Y, Tan C, Yao F, Wang J.
In-Text Gene Mentions

PEBP1Regulates Ferroptosis in…

…We demonstrate thatPebp1is specifically upregulated…

…hanolamine‐binding protein 1 (PEBP1) as a candidate…

…and that AAV‐mediatedPebp1knockdown suppresses ferroptos…

…this study implicatesPebp1in ph‐IOP‐associated RGC…

Show Full Abstract

Glaucoma is the leading cause of irreversible blindness worldwide, primarily driven by the progressive loss of retinal ganglion cells (RGCs) under pathological high intraocular pressure (ph-IOP). Despite the established role of ferroptosis in RGC degeneration, specific molecular targets that can be used for clinical intervention still need to be optimized, and the slow onset of conventional gene therapy vectors is incompatible with the acute clinical course of glaucoma. Here, we integrate single-cell RNA sequencing and spatial transcriptomics to profile the dynamic transcriptomic landscape of the rat retina across acute, subacute, and chronic stages of ph-IOP injury. Through ferroptosis-focused screening of an early-activated RGC gene cluster, we identify the lipid metabolism regulator phosphatidylethanolamine-binding protein 1 (PEBP1) as a candidate mediator of RGC ferroptosis. We demonstrate that Pebp1 is specifically upregulated in injured RGCs with a trajectory mirroring ferroptosis pathway activation, and that AAV-mediated Pebp1 knockdown suppresses ferroptosis through the GPX4/ACSL4 signaling axis, thereby preserving RGC survival, retinal structure, and visual function. To overcome the critical time-window bottleneck-the several weeks delay required for AAV-mediated silencing versus the rapid, irreversible RGC loss in acute glaucoma-we engineer Exosomes-siPebp1, a mesenchymal stem cell-derived exosome system loaded with siPebp1, which enables immediate single-dose intervention post-injury. This system exhibits efficient RGC uptake, prolonged intraocular retention, and robust target gene silencing, and, in a head-to-head comparison, significantly outperforms unloaded exosomes, liposomal formulations, and AAV vectors in RGC protection, without detectable acute systemic or local toxicity. Collectively, this study implicates Pebp1 in ph-IOP-associated RGC ferroptosis and supports exosome-mediated siRNA delivery as a rapid, cell-free intervention strategy for acute glaucomatous injury.

Also flagged:Psychiatric Disordersanxietyinsomniadepression
Journal Article 2026-09-01 No Snippets Xiujia S, Hua LZ, Yuanze G, Jing L, Li L, Chao Z, Ganesan K, Chen J.
Show Full Abstract

Longgu (fossilized bone), a mineral medicine in traditional Chinese medicine, has been used for centuries to treat symptoms resembling modern anxiety and insomnia. This review evaluates the hypothesis that Longgu's therapeutic effects arise from a synergistic network of its constituent metal ions. We synthesized evidence from chemical analyses, pharmacological studies of Ca, Mg, Zn, Fe, Cu, and Mn, and clinical trials of Longgu-containing formulations. The metal ions form an integrated network exhibiting three emergent properties. First, ionostatic balance is achieved through Ca/Mg-mediated regulation of neuronal excitability. Second, cross-pathway synergy occurs where zinc concurrently modulates neurotransmission and promotes neuroplasticity via BDNF. Third, systemic integration involves zinc and manganese co-regulating the gut-brain axis. Clinical studies demonstrate that Longgu-containing formulations improve outcomes in depression, anxiety, and insomnia, particularly for comorbid conditions, and show synergistic effects when combined with conventional antidepressants. This network pharmacology framework repositions Longgu as a model for developing multi-target therapeutics, offering a strategy to overcome limitations of single-target psychiatric drugs.

LRRC7
Also flagged:triple-negative breast cancerchromatinmitochondrial
Journal Article 2026-09-01 ✓ 1 Snippet Fatahian F, Seyed Golestan SMJ, Chinello C, Pagani L, Rezadoost H, Behboudi H, Ghassempour A, Smith A.
In-Text Gene Mentions

… and RNA-associated buffering(LRRC7), and indirect mitochondrial…

Show Full Abstract

Melittin, the cytolytic peptide of honeybee venom, exhibits potent anticancer activity in triple-negative breast cancer (TNBC), yet the molecular programs underlying its cytotoxic effects remain incompletely defined. To address this gap, MDA-MB-231 TNBC cells were exposed to melittin at half-maximal inhibitory concentration(half IC50) and IC50 across early(0.5, 1, and 2 h), mid(3, 4 h), and late (12, 24 h) time windows. Proteomic profiling was performed using label-free data-independent acquisition(DIA) parallel accumulation-serial fragmentation(PASEF). Approximately 5800 proteins were quantified, revealing distinct dose-dependent stress responses. An integrative exploratory framework combining time-resolved log2 fold-change trajectories, area-under-the-curve(AUC) based temporal prioritization, and independent heatmap visualization identified proteins associated with melittin-induced stress remodeling. Half IC50 exposure showed a transient stress-adaptive signature characterized by chromatin remodeling(HMGN2, H2AZ1), structural and RNA-associated buffering(LRRC7), and indirect mitochondrial quality-control signaling(CPAMD8, SPATA4), which progressively weakened over time. In contrast, IC50 treatment induced rapid chromatin remodeling dominated by histone H1 variants(H1.4, H1.2), early RNA instability(LRRC7), and late-stage cytoskeletal disassembly marked by MICAL3 induction, consistent with progression toward apoptosis. These trajectories paralleled dose-dependent apoptotic phenotypes. Overall, data suggest that melittin elicits dose- and time-dependent proteomic stress responses in TNBC cells and identify candidate trajectory-associated proteins and pathways linked to adaptive stress remodeling or progression toward cytotoxic collapse.

Also flagged:Androgenetic alopeciapathogenesismitochondrial
Journal Article 2026-09-01 No Snippets Huang Y, Bian Q, Shen Y, Ding X, Teng Y, Xu D, Yang X, Fan Y.
Show Full Abstract

Androgenetic alopecia (AGA) is the most common form of non-scarring hair loss, driven by genetic factors and increased sensitivity of scalp hair follicles to dihydrotestosterone (DHT), which causes progressive miniaturization of dermal papilla cells and shortens the hair growth phase. The precise molecular pathogenesis of AGA remains incompletely understood. The study aimed to elucidate the regulatory mechanism between secreted frizzled-related protein 2 (SFRP2) and follistatin-like 1 (FSTL1), explore their impact on DHT-induced mitochondrial dysfunction and senescence in dermal papilla cells (DPCs), elucidate the effect of the SFRP2-FSTL1 axis on oxidative stress-related DPCs changes, and identify new therapeutic targets for AGA treatment. In the study, SFRP2 was highly expressed in the DPCs of AGA patients. Knocking down SFRP2 improved hair regeneration and follicle morphology within AGA model mice, promoting proliferation, migration, and invasion of DPCs in vitro. SFRP2 knockdown also alleviated inflammation, senescence, mitochondrial dysfunction, and oxidative stress. SFRP2 was found to bind to FSTL1, thereby promoting FSTL1 protein stability. Knocking down FSTL1 counteracted the negative effects of SFRP2 overexpression in vitro. In conclusion, SFRP2 emerges as a critical regulator in AGA by promoting stability and activity of FSTL1, establishing a novel SFRP2-FSTL1 axis that exacerbates DHT-driven pathogenic changes in DPCs. These findings identify SFRP2 and FSTL1 as key mediators of androgen-induced cellular dysfunction and suggest that disrupting this axis could offer a promising therapeutic strategy for slowing or reversing the progression of AGA.

Also flagged:methylationhypermethylationbrain developmentbiosynthesision channel
Journal Article 2026-09-01 No Snippets Vullioud C, Geweiler D, Melzheimer J, Heinrich S, Fickel J, Wachter B, Weyrich A.
Show Full Abstract

In populations with low genetic diversity, the capacity to adapt to environmental change is limited. While epigenetic mechanisms can generate phenotypic plasticity, their role in mediating adaptive life-history transitions in the wild is largely unknown. Here, we show that in adult Namibian cheetahs (Acinonyx jubatus jubatus), a species with remarkably low genetic diversity, the transition from a floater to a male holding a territory is associated with widespread DNA methylation changes, with a predominance of hypermethylation in territorial males. Using paired blood samples collected from the same individuals before and after becoming territorial, we identified differentially methylated genes which function in pathways related to anatomical and head development, brain development and neurodevelopment, cAMP biosynthesis and ion channel transport, consistent with the observed phenotypic shifts in morphology, spatial movement and aggressive behaviour. These findings suggest that DNA methylation mediates this life-history transition at the molecular level. More broadly, they provide rare evidence that epigenetic regulation is relevant in phenotypic diversity within species with low genetic diversity, potentially supporting adaptive potential at the population level.

Also flagged:Amyloidogenic Neuronal InjuryAPPAlzheimer's diseasedementiaAlzheimerAD
Journal Article 2026-09-01 No Snippets Bhattarai S, Foster EG, Kadry R, Lu Y, Kumar M, Qasim S, Mitra A, Pathak H, Poluektova LY, Gorantla S, Mosley RL, Yeapuri P, Gendelman HE.
Show Full Abstract

<h4>Introduction</h4>A higher incidence of dementia, including Alzheimer's-like pathology, is observed in aged people living with human immunodeficiency virus-1 (HIV-1). However, mechanisms linking HIV-1 to Alzheimer's disease (AD) pathology remain unclear, due to the lack of animal models that allow for concurrent studies of HIV-1 and AD.<h4>Methods</h4>We created a novel amyloid precursor protein (APP) (Swedish mutation) knock-in (KI) AD mouse on an immunocompromised NOG background, NOG/APP<sup>KM670,671NL</sup>/IL-34 (NAIL). Following CD34+ hematopoietic stem cell (HSC) reconstitution, humanized hNAIL mice develop human microglia-like cells in the brain and human immune system in the periphery. This allows, for the first time, studies of progressive brain HIV-1 replication in an AD brain. Four-month-old HSC reconstituted mice were infected with the HIV-1<sub>ADA</sub> strain, and evaluated at 8 weeks post infection to study the role of brain HIV-1 replication on AD-like pathologies.<h4>Results</h4>HIV-1 replication increased amyloid-beta (Aβ) load in the brain and reduced synaptic and neuronal integrity. Cell type-specific spatial transcriptomic analysis demonstrated that Aβ and HIV-1 drive distinct transcriptional patterns, whereas dual pathology amplified AD-like pathology. Neurons showed the highest transcriptional change, with genes linked to neuroinflammation, protein trafficking, and synaptic dysfunction.<h4>Discussion</h4>The hNAIL mice enable interrogation of HIV-AD comorbidities, with a future potential for the development of novel therapeutic interventions.

Also flagged:CaMKIIAgingSarcopeniacalciummitochondrialorganization
Journal Article 2026-09-01 No Snippets Bene MR, Chung T, Luczak ED, Lopez-Cecetaite G, Fountain WA, Rosales-Soto G, Hernández-Ochoa E, Antonescu C, Florea L, Jeong SJ, Elassal E, Le A, Xue QL, Hoke A, Abadir PM, Wang Q.
Show Full Abstract

Sarcopenia, the age-related loss of muscle strength and mass, contributes to adverse health outcomes in older adults. Exercise engages calcium (Ca<sup>2+</sup>)- and redox-dependent signaling pathways that enhance muscle performance and adaptation, whereas aging disrupts Ca<sup>2+</sup> and redox homeostasis. CaMKII is a key transducer of both signals, raising the possibility that sustained CaMKII signaling becomes maladaptive with aging. Here, we show that CaMKII protein abundance is increased in aged mouse skeletal muscle and that sustained CaMKII activation in young muscle is sufficient to impair contractile function before substantial atrophy develops and, with prolonged activation, to promote progressive muscle loss. Sustained CaMKII activation also disrupted mitochondrial organization and shifted the young-muscle transcriptome toward an aged profile characterized by inflammatory and stress-response pathways. Inhibiting canonical NF-κB signaling partially preserved contractile force during prolonged CaMKII activation without preserving muscle mass, and mediation analysis implicated heme/iron-related transcriptional remodeling in the muscle-mass-independent decline in force. Conversely, expression of CN19o, a peptide inhibitor of CaMKII, in aged muscle improved contractile function and shifted the transcriptome away from an aging-associated profile without inducing hypertrophy. Together, these findings identify sustained CaMKII signaling as a contributor to age-associated muscle dysfunction and support a context-dependent shift from adaptive CaMKII signaling in youth to maladaptive signaling in aging, consistent with antagonistic pleiotropy.

Also flagged:intrahepatic cholangiocarcinomatumourantigen presentationcytokinechemokineextracellular
Journal Article 2026-09-01 No Snippets Chen M, Jin S, Zhou Y, Tong J, Zhao Y, Yang Q.
Show Full Abstract

<h4>Background</h4>Intrahepatic cholangiocarcinoma (ICC) is a highly heterogeneous and aggressive malignancy originating from the intrahepatic bile duct epithelial cells. Despite advances in surgery, chemotherapy, targeted therapy, and immune checkpoint inhibitor (ICI)-based regimens, durable disease control remains limited by primary or acquired resistance and marked biological heterogeneity.<h4>Main body</h4>Immunotherapy, primarily based on ICIs, has shown clinical potential for advanced ICC; however, its activity is constrained by a highly immunosuppressive tumour microenvironment (TME), including desmoplastic stromal barriers, myeloid-cell-mediated suppression, impaired antigen presentation, cytokine- and chemokine-driven immune exclusion, and metabolic remodeling. This review summarizes the tumour immune microenvironment (TIME) of ICC, with emphasis on cellular crosstalk among stromal, myeloid, and lymphoid compartments, extracellular matrix remodeling, metabolic constraints, and immune-escape processes. We critically appraised first-line chemoimmunotherapy evidence from advanced biliary tract cancer (BTC) trials and interpreted its relevance to ICC according to clinical evidence, tumour location, molecular subtype, and biomarker context. Biomarkers are discussed according to their current level of clinical validation, and molecular alterations, such as FGFR2 fusions, IDH1 mutations, and BAP1/ARID1A alterations, are considered in relation to immune phenotypes and mechanism-guided combination hypotheses. Finally, we evaluated emerging approaches, including next-generation checkpoint inhibitors, antibody-drug conjugates, bispecific antibodies, CAR-T/CAR-macrophage (CAR-M)/CAR-natural killer (CAR-NK) cell therapies, cancer vaccines, and dendritic cell-based interventions, with particular attention paid to antigen heterogeneity, stromal trafficking barriers, manufacturing complexity, and the limited maturity of ICC-specific clinical evidence.<h4>Conclusions</h4>By integrating the mechanism, clinical evidence, molecular subtype and translational limitations, this review provides a balanced framework for biomarker-guided precision immunotherapy in ICC.<h4>Key points</h4>The clinical evidence and limitations of immunotherapy for intrahepatic cholangiocarcinoma are critically evaluated, with emphasis on ICC-specific interpretation of broader biliary tract cancer trials. The ICC tumour immune microenvironment is integrated into functional immune axes involving stromal, myeloid, lymphoid and metabolic regulation. Molecular subtypes and immune-related biomarkers provide a framework for biomarker-guided precision immunotherapy in ICC. Current ICC immunotherapy trials remain limited by heterogeneous designs, small ICC-specific cohorts and immature clinical evidence. Emerging immunotherapies, including next-generation checkpoint inhibitors, antibody-drug conjugates, cellular therapies and vaccines, require ICC-specific evaluation of biological barriers and clinical feasibility.

Also flagged:congenital diaphragmatic herniagene expressioninfectioncell proliferationcell cycleto hypoxia
Journal Article 2026-09-01 No Snippets Jank M, Aptekmann AO, Tanaka R, Mourin M, De Leon N, Kraljevic M, Patel D, Tse WH, McCallum C, Wagner R, Kahnamoui S, Miyake Y, Zovoilis A, Doi T, Boettcher M, LeDuc R, Keijzer R.
Show Full Abstract

<h4>Rationale</h4>Circular RNAs (circRNAs) are stable, tissue- and developmental-stage-specific regulators of gene expression and candidate disease biomarkers. Their expression profile in abnormal lung development in congenital diaphragmatic hernia (CDH) is unknown.<h4>Objective</h4>To evaluate circRNA expression profile in CDH-associated abnormal lung development.<h4>Methods</h4>We profiled circRNAs in rat CDH and control lungs at embryonic day (E)15 and E21 by microarray. We validated identified circRNAs using back‒splice junction amplicon sequencing, RT-qPCR and in situ hybridisation. We modified a circRNA function prediction tool to predict circRNA::micro(mi)RNA::messenger(m)RNA interactions and compared these with Oxford Nanopore RNA sequencing and existing human CDH datasets.<h4>Measurements and main results</h4>Microarrays revealed a unique circRNA biosignature during CDH lung development. CircAnp32e was expressed in a sex-specific and spatiotemporal expression pattern in the epithelium at E15. The predicted mature sequence of circAnp32e overlapped 90% with its human orthologue. circRNA::miRNA::mRNA interaction networks at E15 and E21 revealed enrichment in inflammation/infection, smooth muscle cell function, cell proliferation/cell cycle regulation and response to hypoxia pathways. Parental genes of differentially expressed circRNAs at E15 enriched pathways linked to cell proliferation/cell cycle/cancer, while at end-gestation, inflammation and cardiovascular processes were also overrepresented. Rat and human CDH lungs showed overlapping pathways with additional enrichment for RNA processing and protein binding/modification in humans. In a human bronchial epithelial (BEAS-2B) nitrofen-injury model, ANP32E and circANP32E were downregulated, and the predicted let-7 target was significantly dysregulated.<h4>Conclusion</h4>A unique circRNA signature during abnormal lung development in CDH may mediate inflammatory responses, smooth muscle cell function and cell proliferation regulation via miRNA sponging. Overlap of downstream pathways in rat and human CDH suggests conserved functions across species. This circRNA biosignature defines strong candidate biomarkers for CDH and a basis for future prospective prenatal investigation.

Also flagged:STX1Bfeverepilepsy syndromesdevelopmental epilepsytransient familial seizure syndrome
Journal Article 2026-08-31 No Snippets Haag C, Gsell F, Vinogradov O, Oquendo MB, Liu Y, Uysal B, Löffler H, Stehle F, Klopfer F, Crönlein J, Böttcher K, Toonen RF, Muhle H, Kohl B, Lerche H, Schwarz N.
Show Full Abstract

<h4>Background</h4>Variants in STX1B/syntaxin-1B are linked to a spectrum of fever-associated epilepsy syndromes. While studies in murine models have provided mechanistic insights, their relevance to human disease in a heterozygous context may be limited.<h4>Methods</h4>We investigated two pathogenic STX1B variants using isolated single neurons and neuronal network cultures derived from patient-specific induced pluripotent stem cells. These carried either a de novo p.G226R variant, associated with severe developmental epilepsy, or an InDel variant (p.K45delinsRCMIE/p.L46M) linked to a transient familial seizure syndrome. Synaptic function and network excitability were assessed using patch-clamp and multi-electrode array recordings, alongside morphological and transcriptomic profiling.<h4>Findings</h4>G226R exhibited both gain- and loss-of-function characteristics, with increased miniature excitatory postsynaptic current frequency in networks but not in autapses, and synaptic failure during sustained high-frequency stimulation. For the InDel variant, the predicted loss-of-function phenotype based on reduced syntaxin-1B levels was not detectable at the single-cell level, likely masked by compensatory synaptic upregulation. At the network level, however, both variants were associated with neuronal hyperexcitability, characterised by more frequent and prolonged bursting activity, with a much stronger phenotype in G226R-containing networks. Transcriptomic profiling revealed a differential dysregulation of synaptic and other neuronal genes.<h4>Interpretation</h4>The divergence between morphological, electrophysiological and transcriptomic findings suggests that compensatory mechanisms may contribute to network hyperexcitability. Initially engaged to maintain homoeostasis, they may ultimately contribute to a pathological network state. The graded severity of network alterations across STX1B variants correlates with the clinical phenotypes.<h4>Funding</h4>BMBF (Treat ION-01GM2210A, SNAREopathies-01EW1809A), 2023 FEBS Summer Fellowship, Fortüne programme (2610-0-0), EKFS college precise.net, Open Access Publishing Fund of University of Tübingen.

Also flagged:-nucleusprotocadherin-γageing
Journal Article 2026-08-31 No Snippets Nelke C, Babilon F, Schroeter CB, Güttsches AK, Quint P, Krause K, Meyer Zu Hörste G, Schoser B, Distler JHW, Meuth SG, Kleefeld F, Ruck T.
Show Full Abstract

<h4>Background</h4>Single-cell and single-nucleus RNA sequencing have transformed our understanding of human skeletal muscle biology, yet reproducibility and cross-study comparison remain limited by the lack of a unified reference framework and consistent cell-type annotation.<h4>Methods</h4>We systematically searched for scRNA-seq and snRNA-seq datasets from adult human skeletal muscle. Seven eligible studies were retrieved and harmonised. We benchmarked multiple integration strategies to construct a joint reference atlas and derived modality-aware marker panels. Selected findings were validated by immunofluorescence in muscle biopsies.<h4>Findings</h4>We generated a harmonised atlas comprising 122,000 cells and 630,000 nuclei from 88 healthy individuals and resolved 17 major skeletal muscle cell populations, spanning mononuclear compartments and multinucleated myofibers. Cross-modality analysis identified tissue- and modality-aware marker panels and nominated both established and previously unrecognised markers. NOVA1 emerged as a selective marker of fibro-adipogenic progenitors and was validated at the transcript and protein levels. Focusing on myonuclei, pseudotime modelling reconstructed differentiation trajectories from quiescent muscle stem cells to mature type I and type II myofibers and revealed lineage-specific programs, including transient activation of protocadherin-γ genes during type I myofiber differentiation. We further provide an interactive web application for marker-based cell-type prediction using the reference atlas.<h4>Interpretation</h4>This integrated reference atlas and accompanying annotation tool establish a standardised framework for human muscle transcriptomics, promoting consistent cell-type assignment and providing a baseline for future studies of muscle development, ageing, and disease.<h4>Funding</h4>Else Kröner-Fresenius-Stiftung and the German Research Foundation.

OLFM4
Also flagged:Cell surfaceaginggene expressionphagocytosisextracellularsurface
Journal Article 2026-08-31 ✓ 1 Snippet Koutsogiannaki S, Alhamdan F, Malm E, Bermudez M, Kim SY, Yuki K.
In-Text Gene Mentions

…DEFA1/3/4, CEACAM8, CD177,OLFM4, CAMP, and MMP8)…

Show Full Abstract

Neutrophils exhibit substantial functional heterogeneity shaped by both developmental stage and cellular maturation, but their mechanisms remain incompletely defined. CD11c (ITGAX) is traditionally considered as a cell surface marker of dendritic cells. We recently reported that it is highly expressed intracellularly in neutrophils and contributes to their maturation; however, its role at the cell surface is unclear. Here, we showed that surface CD11c expression level was heterogeneous across neutrophils, enabling classification into CD11c<sup>hi</sup> and CD11c<sup>-/lo</sup> populations. CD11c<sup>hi</sup> neutrophils display enhanced phagocytic capacity and features of neutrophil aging, including increased CXCR4 and reduced CD62L expression. Bulk RNA sequencing across the three pediatric age groups revealed that differentially expressed genes (DEGs) between CD11c<sup>hi</sup> and CD11c<sup>-/lo</sup> neutrophils were observed most in infants followed by preschool age children. Infant neutrophils exhibited reduced phagocytic capacity and distinct gene expression patterns compared to older children. Functional interrogation of candidate genes (ANXA2, COL6A3, DCN) demonstrated their role in regulating phagocytosis without affecting reactive oxygen species production. Machine learning analysis further identified age-dependent ontology of the DEGs associated with cell surface CD11c expression, including pathways related to adhesion, extracellular matrix interactions, stress responses, and metabolic regulation. Integrative network analysis positioned CD11c linked to cytoskeletal remodeling and phagocytosis. Collectively, these findings support a model in which developmental age establishes the baseline transcriptional landscape of neutrophils, while CD11c serves as a marker of neutrophil aging rather than acting as a primary driver of transcriptional reprogramming.

Also flagged:Memory ImpairmentbehavioralmetabolismDamageNeurodegenerative diseasesAD
Journal Article 2026-08-31 No Snippets Kim HJ, Kim YE, Yu JS, Lee G, Kim SS, Yang HO.
Show Full Abstract

<i>Citrus nippokoreana</i>, a traditional Korean citrus species, is rich in flavonoids and polyphenols with antioxidant properties; however, its neuroprotective potential remains unclear. Neurodegeneration is closely associated with oxidative stress, neuronal apoptosis, and impaired synaptic signaling. In this study, we investigated the effects of <i>C. nippokoreana</i> peel extract (CNE, 30% ethanol) using <i>in vitro</i> and <i>in vivo</i> models. CNE significantly protected HT22 hippocampal neurons against glutamate-induced oxidative stress by reducing intracellular reactive oxygen species (ROS) and apoptosis, while regulating AKT/Nrf2-associated antioxidant pathways and enhancing BDNF/CREB signaling. In a scopolamine-induced mouse model, oral administration of CNE (50 or 100 mg/kg/day) improved cognitive performance in behavioral tests. CNE also restored the expression of BDNF, CREB, and HO-1, and reduced acetylcholinesterase activity in the hippocampus. Histological analysis confirmed reduced neuronal damage. Furthermore, serum metabolomics revealed modulation of tryptophan metabolism, phosphatidylcholine species, and redox-related pathways. To explore constituents potentially contributing to the neuroprotective effects of CNE, major compounds identified by phytochemical profiling were screened in glutamate-induced HT22 cells. Several phytochemicals exhibited protective effects, suggesting that the biological activity of CNE may result from the combined actions of multiple constituents rather than a single compound. These findings suggest that CNE attenuates oxidative stress-induced neuronal damage and improves cognitive function through coordinated regulation of antioxidant defense, neurotrophic signaling, and cholinergic function.

DARS2
Also flagged:Hepatocellular Carcinomacancerchromatintumorcytotoxicitylactylation
Journal Article 2026-08-31 ✓ 1 Snippet Mao S, Fang Y, Gao J, Chen J, Guan Z, Zhao X, Wu J, Wu X, Zhu G, Zhang X, Zhao Q, Yang R, Wang Y, Chu T, Bu Y, Fu J, Li H, Tang Z, Shi Y, Zhou J, Fan J, Jiang J, Liu W.
In-Text Gene Mentions

…, PAIP1 ,DARS2, SLC35F5, and…

Show Full Abstract

<b>Background:</b> Hepatocellular carcinoma (HCC) remains a leading cause of cancer-related mortality, with resistance to immunotherapy posing a major clinical challenge. Natural killer (NK) cells exhibit impaired infiltration and cytotoxicity in HCC; however, the mechanisms underlying NK cell-mediated immune evasion are still poorly understood. This study investigated how NOP2/Sun RNA methyltransferase 2 (NSUN2), a 5-methylcytosine (m<sup>5</sup>C) RNA methyltransferase, induces metabolic reprogramming and immunosuppression to drive HCC progression. <b>Methods:</b> We conducted a genome-wide CRISPR screen in HCC cells cocultured with NK cells. To delineate the downstream mechanisms, we integrated profiling of the m5C epitranscriptome, transcriptome, and chromatin landscape with metabolic characterization. The impact of <i>NSUN2</i> on histone lactylation and programmed cell death 1 ligand 1 (PD-L1) transcription was further investigated. Functional assays in vitro and in vivo using syngeneic murine models and pharmacological inhibition validated these findings. Clinical relevance was assessed using patient tissues, The Cancer Genome Atlas dataset, and immunotherapy cohorts. <b>Results:</b> Genome-wide CRISPR screening in HCC cell-NK cell coculture models identified <i>NSUN2</i> as a key suppressor of NK cell-mediated cytotoxicity. Mechanistically, NSUN2-mediated RNA m<sup>5</sup>C modification enhanced the messenger RNA stability and expression of glycolytic enzymes, including enolase 1 (<i>ENO1</i>), pyruvate kinase M1/2 (<i>PKM</i>), and lactate dehydrogenase A (<i>LDHA</i>), thereby increasing lactate production. Accumulated lactate promoted histone H3 lysine 18 lactylation (H3K18la), which enhanced chromatin accessibility at the <i>CD274</i> (encoding PD-L1) promoter and recruited signal transducer and activator of transcription 3 (STAT3) to drive PD-L1 expression, ultimately inhibiting NK cell-mediated cytotoxicity. Clinically, high NSUN2 expression was associated with elevated PD-L1 levels, poor prognosis, and immunotherapy resistance in patients with HCC. In vivo, <i>NSUN2</i> knockout increased NK cell infiltration and suppressed tumor growth, while the STAT3 inhibitor TTI-101 combined with anti-PD-L1 therapy enhanced NK cell cytotoxicity and inhibited HCC progression. <b>Conclusions:</b> Our data demonstrated that NSUN2 drove immune evasion in HCC by coupling m<sup>5</sup>C-dependent glycolytic reprogramming with H3K18la-mediated epigenetic activation of PD-L1. These findings suggest that NSUN2 could represent a critical nexus between m<sup>5</sup>C RNA methylation and immunosuppression, providing a therapeutic rationale for combination immunotherapy in HCC.

HFE
Also flagged:Congenital Dyserythropoietic Anemia Type 1Congenital dyserythropoietic anemiahereditary disorderserythropoiesisanemiamacrocytic anemia
Journal Article 2026-08-31 ✓ 1 Snippet Zablonski KG, Lachant NA, Perkins A, Archibald WJ.
In-Text Gene Mentions

…6‐phosphate dehydrogenase, andHFEgene testing were…

Show Full Abstract

Congenital dyserythropoietic anemia is a group of hereditary disorders characterized by erythroid hyperplasia and ineffective erythropoiesis, resulting in anemia of varying severity. Congenital dyserythropoietic anemia Type 1 (CDA-1) is classically associated with biallelic mutations in the CDAN1 gene. Here, we report the first case of compound heterozygous CDAN1 mutations p.(D1043V) and p.(S1036F) in clinical practice, presenting in a 24-year-old woman with mild, asymptomatic macrocytic anemia and hyperferritinemia. These variants are currently classified as variants of uncertain significance; however, this report represents the first clinical case of this compound heterozygous CDAN1 variant combination in a patient with a phenotype consistent with CDA-1. As the phenotypic boundaries of CDA-1 continue to expand, clinicians should consider CDA-1 in the differential diagnosis of unexplained macrocytic anemia, even in the absence of severe anemia.

Also flagged:TCF4TMEFF2MRCLEC18AQPRTGMPPB
Journal Article 2026-08-31 No Snippets Tao G, Wang L, Du H, Zeng Z, Lei L.
Show Full Abstract

<h4>Purpose</h4>Low back pain (LBP) is a heterogeneous pain condition with a measurable genetic contribution, but the genes, brain cell types, and spatial tissue contexts through which inherited risk is expressed remain unclear. We aimed to define cell-type-specific and spatially contextualized genetic mechanisms underlying LBP.<h4>Methods</h4>FinnGen R12 LBP GWAS summary statistics (42,521 cases and 353,224 controls) were integrated with brain single-nuclei eQTL data across eight major brain cell classes. We evaluated genome-wide polygenic signal using LDSC, prioritized genes using MAGMA and PoPS, and performed brain cell-type-specific eQTL-anchored Mendelian randomization, primarily based on single-instrument Wald ratio estimates, followed by Bayesian colocalization. Spatial genetic mapping was conducted using gsMap in an E16.5 murine embryonic atlas and two adult human lumbar spinal cord Visium sections. Selected candidates were assessed by RT-qPCR in neuronal-like and astroglial-like inflammatory cell models.<h4>Results</h4>LDSC supported interpretable polygenic signal for LBP. MAGMA and PoPS showed partial gene-level convergence, with TCF4 and TMEFF2 supported by both approaches. Across 1641 tested gene-cell type exposures, significant eQTL-anchored MR associations were concentrated in excitatory neurons, oligodendrocytes, inhibitory neurons, and astrocytes. Integrated eQTL-anchored MR, colocalization, and gene-prioritization evidence highlighted CLEC18A, QPRT, and GMPPB as higher-priority non-MHC candidates with moderate, but not strong, colocalization support. gsMap localized LBP-associated enrichment to neuroaxis-related embryonic regions, including brain, spinal cord, sympathetic nerve, and dorsal root ganglion, and to neuronal-like niches in adult lumbar spinal cord. RT-qPCR showed model-dependent expression changes, with QPRT and LGI4 preferentially responsive in neuronal-like SH-SY5Y cells and GMPPB and DPYSL5 responsive in astroglial-like U251 cells.<h4>Conclusion</h4>These findings support neuronal and glial regulatory programs as plausible contributors to LBP genetic susceptibility and highlight CLEC18A, QPRT, and GMPPB as higher-priority non-MHC candidates with moderate colocalization support. The results provide a spatially contextualized framework for candidate prioritization in LBP, while emphasizing the need for larger cell-type-specific eQTL resources and functional validation before therapeutic or mechanistic conclusions can be drawn.

medRxiv 2026-08-31 Preprint (No Snippets API) Niemiec I, Shabanova A, Ruuska E, Tissarinen M, Liang Z, Anandagoda G, Shah S, Kang Z, Junquera A, Salko M, Haltia U, Virtanen A, Färkkilä A.
Show Full Abstract

High-grade serous ovarian carcinoma (HGSC) responds poorly to immune checkpoint blockade, partly due to a macrophage-dominated immunosuppressive microenvironment. We integrated single-cell spatial proteomics and spatial transcriptomics across 50 HGSC tumors and applied SPACEstat to resolve higher-order immune communities and their transcriptional programs. We identified six immune community types, with macrophage-dominated Myelonets representing the predominant spatial pattern of immune organisation. In chemotherapy-exposed tumors, Myelonets showed coordinated lipid metabolism–immunosuppression and inflammation–MHC-II macrophage transcriptional programs, with SPP1, C1Q, VEGF, MMPs, and CCL18 linked to immunosuppressive states and fibroblasts emerging as key mediators of macrophage communication. Chemotherapy contracted large Myelonets while increasing CD8+ T-cell organization into Lymphonets. Persistent macrophage dominance within Myelonets was associated with adverse outcomes among patients who achieved a complete response to treatment. Together, we identify Myelonets as clinically relevant, multicellular immunoregulatory niches sustained by spatiotemporally coordinated macrophage programs and stromal crosstalk.

bioRxiv 2026-08-31 Preprint (No Snippets API) Körkel-Qu H, Raya E, Guzvic M, Irlbeck C, Mederer T, Spitzl D, Czyz Z, Schunicht L, Seitz S, Roth J, Rack B, Harbeck N, Kurdieh H, Mayr R, Burger M, Robold T, Hofmann H, Weber M, Maak M, Janssen K, Hücker S, Kirsch S, Werner-Klein M, Perry AC, Klein CA.
Show Full Abstract

Disseminated cancer cells (DCC) in non-metastatic carcinoma patient bone marrow (BM) are predictive of metastasis. Those detected by epithelial cytokeratin or EpCAM expression have poorly-characterized transcription profiles due to their extreme rarity: 1∼2 cells per 2x 10 6 BM cells in every third non-metastatic patient. We here characterize the transcriptomes of DCCs. Single-cell RNA-sequencing (scRNA-seq) of 864 EpCAM-positive cells (from 1,151 cancer patients) in BM or lymph nodes (LN) revealed plasma, immune, myeloid, erythroid progenitor cells and two candidate DCC populations, termed M0-DCC and M1-DCC. M0-DCC, mostly from non-metastatic M0-stage patients, displayed the highest known adult stemness scores, and were transcriptomically reminiscent of human cleavage-stage, preimplantation embryos. M1-DCC represented cancer cells undergoing the epithelial-mesenchymal transition (EMT), corresponding to later, implanting and gastrulating embryos. Detection of early-embryo-like DCC categorised patients at highest risk for metastatic progression. Furthermore, high M0-DCC scores predicted the metastatic potential of human cell lines from the Cancer Cell Line Encyclopedia. M0-DCC gene expression profiles can be reversibly induced from M1-DCC-like cells in vitro . The close correspondence between gene expression profiles in immediate early embryonic development and metastatic founder cell candidates provides strong evidence that the onset of cancer and metastasis recruits mechanisms employed in fertilization.

OLFM4
Also flagged:lumenorgan developmentinflammatory bowel diseasecolorectal cancermorphogenesisorganization
Journal Article 2026-08-29 ✓ 2 Snippets McNally DL, Bera K, Petrich NR, Khang A, Coulombe M, Castillo-Azofeifa D, Klein OD, Dempsey PJ, Anseth KS.
In-Text Gene Mentions

…antibodies used were anti‐Olfm4(D6Y5A) rabbit monoclonal…

…among Olfactomedin 4 (Olfm4) expressing intestinal stem…

Show Full Abstract

Fission increases the number of crypts in the intestine during neonatal growth and also restores crypt density after injury by bifurcation of a pre-existing parent crypt into daughter crypts. While fission is typically symmetric in healthy crypts, it is more asymmetric in diseases, and the relationship between parent crypt shape and daughter crypt (a)symmetry is difficult to study as crypt budding and fission are stochastic in organoid models and difficult to control in vivo. Here, a photoresponsive hydrogel is introduced to spatiotemporally control daughter crypt emergence from mature parent crypts in intestinal organoids, enabling longitudinal tracking of crypt bifurcation in vitro. Variation of the photopatterned dimensions tunes parent crypt shape and reveals that both fission efficiency and crypt symmetry depend on parent crypt geometry. Epithelial boundary analysis identified parent crypt curvature as a key factor influencing daughter crypt symmetry. High-curvature or narrow crypts yielded symmetric daughter crypts, whereas wider parent crypts with lower epithelial curvature generated progressively more asymmetric crypts. Mechanistically, non-muscle myosin IIA acts as one key regulator of crypt symmetry. Overall, this work introduces a reproducible and spatiotemporally controllable in vitro model of crypt fission, allowing identification of mechanical determinants of fission that influence intestinal regeneration and development.

HTT
Also flagged:Huntington's diseasebehavioralHD
Journal Article 2026-08-29 ✓ 1 Snippet Kushari S, Saha D, Das BK, Baruah S, Dey KS, Kumar S, Das T, Chakraborty J.
In-Text Gene Mentions

…L-TH with theHTTprotein.…

Show Full Abstract

Huntington's disease (HD) is a neurological condition with limited treatment. Its hallmarks are progressive loss of neurons, chorea, cognitive, motor, and metabolic impairments. The current study uses 3-nitropropionic acid (3-NP) to cause HD-like indications in rats. L-theanine (L-TH), an active component of Camellia sinensis, has already been shown to possess anti-inflammatory and anti-oxidant effects. The impact of the isolated phytoconstituent, L-TH, on 3-NP-induced changes in three distinct brain regions was assessed in the current study. The animals received a 7-day pretreatment consisting of normal saline, extract of C. sinensis (100 and 200 mg/kg b.w., i.p.), L-TH (10 mg/kg b.w., i.p.), and standard Tetrabenazine (TBZ, 25 mg/kg, b.w., i.p.). The administration of 3-NP (10 mg/kg b.w., i.p.) to the treatment groups began on the 8th day of the protocol and continued until the 21st day. The brain homogenates underwent biochemical and neurochemical assessments. In conclusion, L-TH improved behavioral outcomes and attenuated 3-NP-induced neurochemical alterations in brain homogenates. Histopathological analysis revealed lower levels of tissue damage in the L-TH-treated group compared to the 3-NP group. Molecular docking studies further indicated favorable interactions of L-TH with the HTT protein. These findings suggest that L-TH may attenuate 3-NP-induced Huntington's disease-like alterations in rats. However, additional studies using genetic HD models and molecular mechanisms are required to confirm its therapeutic efficacy and underlying mode of action.

Also flagged:HomeostasisSpinocerebellar ataxia type 2SCA2neurodegenerative disorderIRataxia
Journal Article 2026-08-29 No Snippets Aguilera-Rodríguez R, Almaguer-Gotay D, Álvarez-Sosa A, Anidos-Machado M, Silva-Ricardo Y, Cuello-Almarales D, Estupiñán-Rodríguez A, Almaguer-Mederos LE.
Show Full Abstract

Spinocerebellar ataxia type 2 (SCA2) is a neurodegenerative disorder that shows cerebellar glucose hypometabolism, systemic hypermetabolism and weight loss. This study aimed to explore novel molecular mechanisms of disease for SCA2, based on the assessment of blood glucose homeostasis. A case-control and correlational study was conducted in 79 normoglycemic Cuban patients with SCA2 and 83 sex- and age-matched control subjects during a fasting state. A subset of 20 patients with SCA2 and 19 control individuals underwent an oral glucose tolerance test (OGTT). Several indices for assessing blood glucose homeostasis, derived from the fasting state or the OGTT, were included in the study. Fasting glucose levels showed a small increase, whereas the QUICKI index for insulin sensitivity was slightly decreased among patients. Markers of glucose homeostasis derived from the OGTT were no different between patients and controls. Fasting insulin levels, QUICKI, McAuley´s, HOMA2-%S, HOMA2-IR, and HOMA2-%β indices showed weak to moderate correlations with markers of body composition. McAuley´s, TyG, HOMA2-IR, and HOMA2-%β indices correlated with the age at onset, progression rate, or INAS count. Patients with SCA2 with mild-to-moderate ataxia do not have any major alteration in blood glucose homeostasis. Markers of glucose homeostasis associate with body composition and have nominal modifying effects on disease severity and progression rate in patients with SCA2, with McAuley's index showing effects more consistently. Further studies are needed to describe the changes in blood glucose homeostasis in the different stages of disease, and to delve into its pathophysiological relevance.

Also flagged:infectionscancersdenaturationbindingcolorectal cancerhead and neck cancer
Journal Article 2026-08-29 No Snippets Han Z, Erkamp NA, Scrutton R, Licari G, Predeina O, Evers A, Sormanni P, Knowles TPJ.
Show Full Abstract

Excipients are widely used to suppress the self-association of therapeutic proteins, yet their mechanisms of action are not well understood and often assumed to be nonspecific. Here we show that excipient-mediated solubilization of therapeutic antibodies is markedly molecularly specific. Using a high-throughput combinatorial droplet microfluidic platform, we systematically quantify the effects of common pharmaceutical excipients across a diverse panel of monoclonal antibodies (mAbs). Although all studied excipients enhance solubility, their effects can vary significantly between antibodies, spanning dynamic ranges from approximately 7-fold to over 200-fold. Integrating experimental solubilization measurements with sequence- and structure-derived molecular descriptors, we identify interpretable physicochemical determinants underlying excipient responses; for example, the histidine effect is strongly dependent on mAb dipole moment. Our findings reveal trends that highlight the molecular specificity and complexity of antibody-excipient interactions, as well as the limitations of purely generic formulation rules. Overall, this study provides a quantitative framework for analyzing excipient effects across diverse antibodies and supports the development of predictive approaches for rational formulation design. The integration of high-throughput experimentation with molecular feature analysis offers a foundation for improving our understanding and prediction of antibody-specific formulation behavior.

Also flagged:HLA-B27immune-mediated diseasesaxial spondyloarthritisaxSpApsoriatic arthritisinflammatory bowel disease
Journal Article 2026-08-29 No Snippets Zhu X, Liang C, Xu Z, Zhao X, Shi L, He J, Liu K, Zhou P, Xie K, Jin B, Zhu H, Du L, Li L.
Show Full Abstract

<h4>Background</h4>HLA-B27 is strongly associated with a spectrum of immune-mediated diseases, including axial spondyloarthritis (axSpA), psoriatic arthritis (PsA), inflammatory bowel disease (IBD), and acute anterior uveitis (AAU). However, the shared molecular mechanisms and cross-disease diagnostic biomarkers remain poorly defined. This study aimed to identify common gene signatures and potential diagnostic biomarkers across HLA-B27-related diseases using bioinformatics analysis and experimental validation.<h4>Methods</h4>Gene expression datasets for axSpA, PsA, ulcerative colitis (UC), Crohn's disease (CD), and AAU were retrieved from the Gene Expression Omnibus (GEO) database. Disease-specific diagnostic genes were identified via differential expression analysis, least absolute shrinkage and selection operator (LASSO) regression, and receiver operating characteristic (ROC) curve analysis (AUC > 0.9). Shared biomarkers were determined by intersecting differentially expressed genes (DEGs) across all five diseases. Protein-protein interaction (PPI) networks, functional enrichment analyses, and single-sample gene set enrichment analysis (ssGSEA) were performed to explore biological pathways and immune infiltration patterns. Competing endogenous RNA (ceRNA)-transcription factor (TF) regulatory networks were constructed, and potential therapeutic agents were predicted using the Drug-Gene Interaction Database (DGIdb). Finally, the expression of candidate genes was validated by RT-qPCR and Western blot in peripheral blood mononuclear cells (PBMCs) from patients with ankylosing spondylitis (AS) and UC.<h4>Results</h4>A total of 2485, 380, 2682, 2232, and 481 DEGs were identified for axSpA, PsA, UC, CD, and AAU, respectively, with ABCD2 being the only shared biomarker across all five diseases. Disease-specific diagnostic gene panels were established (3 genes for axSpA, 6 for PsA, 15 for UC, 9 for CD, and 4 for AAU). Two major gene clusters were uncovered: an arthritis-related cluster (LAG3, IL15, PRF1, TBX21, IL2RB) and an extra-articular disease-related cluster (IL6, FN1, F2R, HIF1A, ANGPT2). Immune infiltration profiles varied significantly across diseases. Regulatory network analysis revealed complex ceRNA-TF interactions and identified several candidate drugs. In PBMCs, ABCD2 was upregulated in AS and UC, PRF1 in AS, and FN1, IL-6, and F2R in UC.<h4>Conclusion</h4>This study identifies ABCD2 as a potential cross-disease biomarker and two context-dependent key gene clusters for HLA-B27-associated immune-mediated diseases, providing exploratory candidates for future research.

KLHL20
Also flagged:tissue homeostasisextracellularstem cell differentiationAutophagylysosomedegradation
Journal Article 2026-08-28 ✓ 5 Snippets Zhen X, Koh H, Lee DS, Huh JW, Hong SH, Kim TD, Lee JH.
In-Text Gene Mentions

…example, the Cullin 3–KLHL20E3 ligase complex…

…expression of SOX2,KLHL20, GOSR1, EGR2, SP1,…

…Regulation ofKLHL20mRNA stability by…

…next focused onKLHL20, an E3 ubiquitin…

KLHL20expression was significantly…

Show Full Abstract

Autophagy plays a critical role in maintaining cellular homeostasis and regulating stem cell fate. Although microRNAs (miRNAs) are being increasingly recognized for their ability to modulate autophagy and pluripotency in human pluripotent stem cells (hPSCs), the underlying molecular mechanisms remain incompletely understood. This study defines a role for miR-150 deficiency in biasing ectoderm-mesoderm lineage specification in hPSCs and identifies SOX2 as a key downstream node regulated primarily through altered mRNA stability, with additional involvement of an autophagy-associated pathway. miR-150-deficient hPSCs were generated by CRISPR/Cas9-mediated deletion of the miR-150 locus. A range of molecular and cellular techniques were used to investigate how miR-150 regulates SOX2 and KLHL20 expression, modulates the KLHL20-ULK1 interaction, and influences autophagy-mediated SOX2 degradation. Directed differentiation protocols were used to determine the role of miR-150 in germ layer lineage specification. The loss of miR-150 led to increased SOX2 expression by stabilizing its mRNA, resulting in elevated SOX2 protein levels in hPSCs. Concurrently, miR-150 deficiency increased KLHL20 mRNA stability, disrupted ULK1-mediated autophagy, and inhibited SOX2 degradation. Functional assays demonstrated that miR-150 fine-tunes SOX2 expression through dual regulation of mRNA stability and autophagy via the KLHL20-ULK1 axis, maintaining a balanced commitment to the mesodermal and ectodermal lineages. These findings establish miR-150 as a regulator of SOX2 activity and autophagy in hPSCs. By targeting both SOX2 and the KLHL20-ULK1 axis, miR-150 coordinates SOX2 turnover through complementary mechanisms, ensuring precise mesodermal and ectodermal lineage commitment. This multiregulatory strategy provides new insights into how miRNAs integrate intracellular signaling pathways to direct stem cell fate decisions.

TNFSF4
Also flagged:systemic lupus erythematosusSLEbindingautoimmune diseasedegradationliver disease
Journal Article 2026-08-28 ✓ 2 Snippets Chaiprasert A, Han P, Laomettachit T, Ruengjitchatchawalya M.
In-Text Gene Mentions

…PHF1, LYN, WDFY4,TNFSF4, AIF1, TNFSF11, ERCC2,…

…with PHF1, WDFY4,TNFSF4, AIF1, TNFSF11, ERCC2,…

Show Full Abstract

Phycocyanobilin, a bioactive compound derived from Arthrospira platensis C1, was investigated for its potential role in systemic lupus erythematosus (SLE) based on its structural similarity to bilirubin, with a Tanimoto score of 93%. Molecular docking revealed favorable binding affinities between phycocyanobilin and several protein targets, including EGFR, FYN, HLA-B, LCK, LYN, and TP53. Target prediction further identified LYN kinase as a key candidate. Molecular dynamics simulations demonstrated stable binding of the phycocyanobilin-LYN complex, with interaction profiles comparable to those of the native ligand, staurosporine. Binding free energy and residue-level analyses supported strong and stable interactions, highlighting key contributions to complex stability. Overall, these findings provide mechanistic insight into the interaction between phycocyanobilin and LYN, suggesting that this compound may modulate LYN-associated signaling pathways and warrants further investigation in the context of SLE.

HTT
Also flagged:immune responsesglaucomaoptic nerve damageautophagyneurodegenerative diseasesphagocytosis
Journal Article 2026-08-28 ✓ 5 Snippets Li S, Jakobs TC.
In-Text Gene Mentions

HttsiRNA, Wdfy3 siRNA,…

…Among these receptors,Htt(huntingtin), Wdfy3 (WD…

…ForHtt, ALFY, and Optn,…

…most pronounced forHtt, followed by Wdfy3.…

…SPP1-dependent upregulation ofHTT/ALFY-associated receptor acti…

Show Full Abstract

Neurons actively shape immune responses that maintain central nervous system integrity. We identify SPP1 (secreted phosphoprotein 1) as a neuron-derived signal that reprograms microglia into a neuroprotective, homeostatic state after injury and during neurodegeneration. In mouse models of glaucoma and optic nerve damage, neuronal SPP1 enhances microglial autophagy, debris clearance, and anti-inflammatory activity, preserving neuronal survival and visual function. SPP1 is elevated in neurons of human and primate glaucomatous retinas, where SPP1<sup>+</sup> cells show increased resilience. In Alzheimer's disease brain, neuronal SPP1 correlates with neuronal survival, while microglia around Aβ plaques display defective autophagy. In human iPSC co-cultures, SPP1 enhances microglial Aβ clearance and prevents neurodegeneration. Thus, SPP1 defines a protective neuron-microglia axis in glaucoma and possibly other neurodegenerative diseases.

PRDX6
Also flagged:Endothelial dysfunctiontissue remodelingfibroblast activationlung diseaselung diseasespulmonary hypertension
Journal Article 2026-08-28 ✓ 1 Snippet Kontodimas K, Raslan AA, Spira B, Zhu C, Karapurkar J, Kefella Y, Chiu D, Qiu X, Beane JE, Ligresti G, Varelas X.
In-Text Gene Mentions

…including Lrg1 ,Prdx6, Chil1 ,…

Show Full Abstract

Endothelial dysfunction is recognized to contribute to chronic tissue remodeling in the lung, yet endothelial-derived mechanisms driving these processes remain largely undefined. Here, we show that endothelial inactivation of the LATS1 and LATS2 kinases, key suppressors of the transcriptional regulators YAP and TAZ, elicits distinct responses depending on endothelial identity within different pulmonary vascular beds. Our data indicate that LATS1/2 inactivation in general capillary endothelial cells induces a reactive capillary injury-like state, whereas a separate endothelial population located within veins adopts a distinct profibrotic state. We show that expansion of this reactive venous endothelial cell population, which is marked by EBF1 and ACKR1 expression, is associated with fibroblast activation, macrophage accumulation, and epithelial remodeling, collectively generating a microenvironment characteristic of fibrotic lung disease. We further demonstrate that pharmacologic inhibition of YAP/TAZ-TEAD signaling prevents stromal and immune remodeling and fibrotic lesion formation following endothelial LATS1/2 inactivation. These findings identify LATS1/2-mediated restraint of YAP/TAZ as essential for lung endothelial homeostasis and highlight a distinct venous cell response as a direct contributor to fibrotic lung remodeling.

DCC
Also flagged:disseminated cancerbreast-cancercell-cyclerespiratory viral infectionextracellularextracellular-
Journal Article 2026-08-28 ✓ 1 Snippet Atoom AM, Rizaev J, Polatova D, Patel PN, Jamuna KV, Maharana L, Bainsal N, Singhal D.
In-Text Gene Mentions

…or SARS-CoV-2 promotedDCCcell-cycle re-entry and…

Show Full Abstract

Metastatic relapse can arise years after apparently successful treatment because disseminated cancer cells (DCCs) persist in reversible states of cellular, angiogenic, or immune-mediated dormancy. The strongest direct evidence that acute viral inflammation can disturb this equilibrium currently comes from experimental breast-cancer lung-dormancy models in which influenza A virus or SARS-CoV-2 promoted DCC cell-cycle re-entry and metastatic expansion, with interleukin-6 (IL-6) required for the initial awakening phenotype. Human findings reported in the same study are observational and do not establish that respiratory viral infection causes metastatic relapse. This hypothesis-generating Perspective therefore separates direct viral-dormancy evidence from direct inflammation-dormancy evidence, established metastatic-niche biology, mechanistic extrapolation, and unvalidated clinical hypotheses. We critically evaluate IL-6/JAK/STAT3 signaling, the time-dependent balance between antiviral and antitumor immunity, neutrophil extracellular trap-mediated matrix remodeling, epithelial RNA sensing, endothelial and perivascular responses, and selected extracellular-vesicle mechanisms. The evidence does not establish a universal infection-to-niche-to-relapse pathway across cancers or organs. Instead, it supports a context-dependent model in which respiratory infection may transiently perturb the DCC-niche equilibrium in susceptible settings. Priority studies should independently replicate the pulmonary phenotype, define causal timing, distinguish local lung injury from systemic effects, test cross-cancer and cross-organ generalizability, and prospectively evaluate human associations. No post-viral biomarker panel, intensified imaging strategy, or pathway-directed intervention is currently validated for routine clinical use.

TAOK3
Also flagged:membranesmicrotubulesorganizationantigen presentationmitochondrialmembrane
Journal Article 2026-08-28 ✓ 3 Snippets Xiang N, Zhang Z, Wang Y, Wang L, Yang L, Sun X, Liu C.
In-Text Gene Mentions

…rimer: TTCTTGCTCTTCTTCAGAGTCG;Taok35’ primer: TTGCATGAAATTGGACATG…

…of Myc ,Taok3, Plcg2 ,…

…( Myc ,Taok3, Plcg2 ,…

Show Full Abstract

Members of the Wiskott-Aldrich syndrome protein (WASP) family orchestrate cytoskeletal reorganization that modulates B-cell receptor (BCR) signaling and B-cell fate decisions. WHAMM, a WASP-family nucleation-promoting factor member that associates with actin, membranes and microtubules, has not been functionally characterized in B cells. To investigate the role of WHAMM in B-cell development and function, we analyzed a conditional mouse model in which Whamm was deleted in the B-cell lineage. WHAMM-deficient mice exhibited altered splenic B-cell composition, characterized by an accumulation of splenic transitional B cells and a reduction of follicular B cells. Meanwhile, WHAMM deficiency altered the spatial organization and kinetics of proximal BCR signaling, and modified the dynamics of BCR-induced actin remodeling. However, WHAMM-deficient B cells showed largely preserved BCR internalization, antigen presentation, PI3K-AKT-mTOR signaling, ROS production, and mitochondrial membrane potential. Together, this work indicates that WHAMM helps shape splenic B-cell populations and regulates proximal BCR signaling and actin dynamics, while several downstream functional responses remain largely preserved in this study.

Also flagged:PIWIL4gene expressionacute lower respiratory tract infectionPIWIRSV infectionviral infection
Journal Article 2026-08-28 No Snippets Corsello T, Liu T, Kudlicki AS, Zhang Y, Dillman N, Fazal S, Garofalo RP, Casola A.
Show Full Abstract

Respiratory syncytial virus (RSV) causes acute lower respiratory tract infection in young children, the elderly, and immunocompromised hosts, and no RSV vaccine or therapy exists for infants, beyond prophylaxis. PIWI-interacting RNAs (piRNAs), small non-coding RNAs acting through P element-induced wimpy testis (Piwi) proteins, remain largely unexplored. We characterized PIWIL4 expressions and function during RSV infection or poly(I:C) stimulation, a proxy of viral infection. PIWIL4 was expressed in primary and immortalized small airway epithelial cells following RSV infection. While PIWIL4 knockdown did not affect RSV replication, it decreased cytokine and growth factor secretion, altered gene and piRNA expression, and modulated pathways involved in cytokine production, metabolism, and airway remodeling. Limited overlap between piRNA targets and transcriptomic changes suggests PIWIL4 regulates airway epithelial cell responses partly independently of piRNAs. Our study positions PIWIL4 as a key regulator of airway epithelial cell responses to viral infections.

Also flagged:METTL5lung adenocarcinomaN6-methyladenosinem6A) RNA methyltransferasetumorLUAD
Journal Article 2026-08-28 No Snippets Chen X, Xia P, Zhao F.
Show Full Abstract

<h4>Background</h4>METTL5, an N6-methyladenosine (m6A) RNA methyltransferase, has been implicated in tumor progression, but its prognostic value and non-invasive prediction in lung adenocarcinoma (LUAD) remain unclear. This study aimed to develop a pathomics-based machine learning model to predict METTL5 expression from histopathological images and evaluate its prognostic significance in LUAD.<h4>Methods</h4>A total of 327 LUAD patients from The Cancer Genome Atlas (TCGA) with matched hematoxylin and eosin (H&E) slides, transcriptomic, and clinical data were included and randomly divided into training and validation sets (7:3). Quantitative histopathological features were extracted using PyRadiomics. Feature selection was performed via maximum relevance minimum redundancy (mRMR) and recursive feature elimination (RFE), followed by construction of a Gradient Boosting Machine (GBM) model. A pathomics score (PS) was generated to assess prognostic relevance. Survival analyses, gene set variation analysis (GSVA), tumor mutational burden (TMB), immune infiltration analysis, and in vitro functional assays were conducted.<h4>Results</h4>METTL5 overexpression was independently associated with poor overall survival [hazard ratio (HR) =1.637, P=0.007]. The model achieved good predictive performance [area under the curve (AUC) =0.847 in the training set and 0.752 in the validation set]. High PS was significantly associated with worse survival and remained an independent prognostic factor (HR =1.563, P=0.03). Elevated PS correlated with altered metabolic pathways, increased TMB, and immune microenvironment changes. METTL5 knockdown reduced proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT) in A549 cells.<h4>Conclusions</h4>The pathomics-based model accurately predicts METTL5 expression and provides prognostic stratification in LUAD, supporting its potential as a practical imaging-derived biomarker.

Research Square 2026-08-28 Preprint (No Snippets API) Strawbridge R, McQueen D, Kendall K, Anderson J, Casanova F, Fajs N, Gebretsadik E, Hayman M, Ho F, Lyall D, Lyall L, McIntosh A, Niedzwiedz C, Pell J, Welsh P, Tyrrell J.
Show Full Abstract

<title>Abstract</title> <p>Schizophrenia (SCZ) is a highly polygenic disorder and is associated with several comorbidities, including depression, cardiovascular disease, and diabetes; yet the biological pathways underlying this clustering remain poorly understood. This study examined associations between a polygenic risk score for SCZ (PRS-SCZ) and circulating protein levels in 44,661 participants of the UK Biobank. We assessed 1,459 proteins (with ≤ 10% missingness) spanning neurological, inflammatory, cardiometabolic, and oncology panels. After adjustment for technical (population structure, genotyping chip), individual (age, sex, lifestyle), and clinical (comorbidities and medication) variables and multiple testing correction, the standardised PRS-SCZ was significantly negatively associated with C2, RNASET2, BTN2A1, CDSN, HLAE, LTA, MICA-MICB, CNTN3, FCER2, INHBC and CPVL concentrations, and positively with ICAM3, BTN3A2, IL5RA, SLAM7 concentrations. These protein biomarkers may provide insights into the biological pathways underlying schizophrenia and/or its comorbidities.</p>

Research Square 2026-08-28 Preprint (No Snippets API) Nani JV, Jovanovic M, Duque VJ, Tasić T, Šarenac O, Pauža A, Murphy D, Japundžić-Žigon N, Mecawi AdS.
Show Full Abstract

<title>Abstract</title> <p> <bold>Introduction:</bold> Gestational adaptations require central autonomic recalibration via the hypothalamic paraventricular nucleus (PVN), yet how chronic hypertension alters its transcriptomic response during pregnancy remains unknown. We investigated PVN transcriptomic and cardiovascular autonomic profiles in pregnant normotensive (Wistar) and spontaneously hypertensive rats (SHRs) to uncover mechanisms underlying gestational hypothalamic adaptations to hypertension. <bold>Methods</bold> : Radiotelemetry-equipped Wistar rats and SHRs were evaluated for blood pressure, short-term variability, and baroreflex sensitivity alongside PVN bulk RNA-sequencing across virgin and late-pregnant states. <bold>Results</bold> : Both strains exhibited physiological gestational blood pressure drops. However, pregnant SHRs displayed blunted chronotropic reactivity, elevated cardiac sympathetic drive (increased LF HR and LF/HF ratio), and a doubling of spontaneous baroreflex sensitivity. Transcriptomically, pregnant Wistars showed a minimal homeostatic response (33 DEGs: e.g. <italic>Cish, Igfbp3, Irf7</italic> ). In stark contrast, pregnant SHRs underwent massive transcriptomic reprogramming (951 DEGs), marked by loss of astrocytic potassium buffering ( <italic>Kcnj10</italic> , <italic>Kcnb1</italic> ), chaperone depletion ( <italic>Hspa1a</italic> , <italic>Hspa1b</italic> ), excitatory neuropeptide elevation ( <italic>Hcrt</italic> , <italic>Trh</italic> ), and neuroimmune activation ( <italic>Zap70</italic> , <italic>Fcrl2, Itgam, Cmklr1</italic> ). Crucially, intersecting baseline hypertensive DEGs with gestational shifts in SHRs unmasked a significant inverse correlation, where 95.9% of hypertension-altered genes (140/146) underwent active directional reversal during pregnancy ( <italic>Hspa1a, Hspa1b, Ptgds, Per1</italic> ), enriching for translational, ribosomal, and bioenergetic pathways. <bold>Conclusion:</bold> Pre-existing chronic hypertension converts gestational PVN adaptation from a subtle homeostatic adjustment into an extensive genomic requirement (951 vs 33 DEGs). This massive transcriptomic remodeling represents an active counter-regulatory program in SHRs to sustain pregnancy to term, mitigating autonomic risk via heightened baroreflex sensitivity </p>

PRDX6
Also flagged:osteoclast differentiationbone resorptiondegradationphosphorylationbindingmetabolism
Journal Article 2026-08-27 ✓ 2 Snippets Lee H, Lee S, Jang YJ, Lee K, Hwang SY, Oh GT, Park JI, Yi SJ, Kim K.
In-Text Gene Mentions

…(PRDX5), and 1-Cys (PRDX6) groups on the…

…PRDX5 andPRDX6have been implicated…

Show Full Abstract

Osteoclastogenesis is driven by tightly coordinated transcriptional programs downstream of receptor activator of nuclear factor-κB ligand (RANKL) signaling, in which reactive oxygen species (ROS) function as essential secondary messengers. Although extracellular peroxiredoxin 1 (PRDX1) has been implicated in the suppression of osteoclast differentiation, the role of intracellular PRDX1 in regulating osteoclastogenic signaling remains poorly understood. Here, we identify intracellular PRDX1 as a redox-sensitive negative regulator of osteoclastogenesis and bone resorption. PRDX1 deficiency markedly enhanced osteoclast differentiation, bone resorption activity, and osteoporotic phenotypes in vivo. Transcriptomic and mechanistic analyses revealed that PRDX1 attenuates osteoclastogenic gene transcription by blocking the nuclear factor kappa B (NF-κB)/p65 signaling axis. Loss of PRDX1 increased intracellular ROS accumulation, promoted p65 nuclear translocation and promoter occupancy, thereby amplifying osteoclastogenic transcriptional programs. Mechanistically, PRDX1 underwent TNF receptor associated factor 6 (TRAF6)-mediated Lys67-dependent ubiquitylation and lysosomal degradation in response to RANKL signaling. In addition, RANKL-induced Src activation promoted phosphorylation of PRDX1 at Tyr194, which enhanced TRAF6-mediated ubiquitylation without substantially altering overall TRAF6 binding. Together, these findings reveal a PRDX1-ROS feedback loop that modulates NF-κB activity during osteoclastogenesis and identify regulated PRDX1 degradation as a mechanism by which RANKL signaling amplifies osteoclastogenic responses. These findings establish intracellular PRDX1 as an important modulator of skeletal homeostasis, suggesting its potential relevance as a pharmacological target in diseases characterized by excessive bone resorption.

SOX6
Also flagged:discdegenerationnucleus
Journal Article 2026-08-27 ✓ 1 Snippet Tong X, Visscher M, Riemers FM, Versluis D, Geijsen N, Shang P, Tryfonidou MA, Poramba-Liyanage DW.
In-Text Gene Mentions

…TBXT, FOXA2, SOX5,SOX6, and SOX9, coupled…

Show Full Abstract

Intervertebral disc (IVD) degeneration, a leading cause of chronic lower back pain, is associated with loss of vacuolated notochordal cells (NCs) and fibrotic remodeling of the nucleus pulposus. Emerging therapies increasingly focus on NCs, which are rare but therapeutically relevant cells for regenerating degenerated IVDs. In this study, we used CRISPR-based transactivation (CRISPRa) to direct the differentiation of human induced pluripotent stem cells (iPSCs) into the NC lineage. We tested CRISPRa-mediated activation of NOTO, TBXT, FOXA2, SOX5, SOX6, and SOX9, coupled with single-cell sequencing of Aggrecan-2A-mScarlet reporter iPSCs. This approach identified the SOX5/6/9 combination (SOX-trio) as critical for promoting NC lineage commitment. The SOX-trio yielded the largest cell population expressing a range of genes previously associated with NC identity, including SHH, FOXA1, FOXA2, FOXJ1, FN1, ALCAM, KRT8, and KRT18. Our study demonstrates the integration of CRISPRa with single-cell technologies as a powerful platform for investigating and enriching iPSC-derived NCs, supporting future regenerative strategies across various fields.

SERPINC1
Also flagged:coagulation
Journal Article 2026-08-27 ✓ 5 Snippets Xia Y, Zhang G, Zhu H, Hu X, Xia M, Wang X.
In-Text Gene Mentions

…and antithrombin III (ATIII) in an adult…

…Plasma FXII andATIIIactivities were measured…

…Gaussian distribution, whereasATIIIshowed an approximately…

…and 84.1%-104.7% forATIII.…

…and 86.1%-106.7% forATIII.…

Show Full Abstract

<h4>Objective</h4>This study aimed to establish and verify reference intervals (RIs) for coagulation factor XII (FXII) and antithrombin III (ATIII) in an adult population from the Jiangsu region of China and to evaluate the influence of analytical platform on RI interpretation.<h4>Methods</h4>We retrospectively analyzed data from 301 apparently healthy adults attending the Health Examination Center of Nanjing Drum Tower Hospital. Plasma FXII and ATIII activities were measured in parallel using two automated coagulation analyzers, the Sysmex CS-5100 and CS-6500. Statistical analysis followed CLSI EP28-A3 guidelines. Distribution normality was assessed to determine the appropriate method for RI establishment: the non-parametric percentile method for non-normally distributed data and the parametric method for normally distributed data. Analyzer-related agreement was further assessed using Bland-Altman analysis. The derived RIs were verified using an independent sample set of 20 apparently healthy adults.<h4>Results</h4>FXII showed a non-Gaussian distribution, whereas ATIII showed an approximately Gaussian distribution. For the CS-5100 analyzer, the RI was 32.2%-109.1% for FXII and 84.1%-104.7% for ATIII. For the CS-6500 analyzer, the corresponding RIs were 37.1%-111.1% for FXII and 86.1%-106.7% for ATIII. The newly established RIs differed from the manufacturer-provided ranges currently used in routine practice. No clinically meaningful sex-based partitioning was identified. Although analyzer-related differences were statistically significant, Bland-Altman analysis showed modest mean biases between the CS-6500 and CS-5100 platforms, with mean differences of +5.09% for FXII and + 1.17% for ATIII. All verification samples fell within the proposed RIs.<h4>Conclusion</h4>This study established and verified regional RIs for FXII and ATIII in healthy adults from Jiangsu, China. Although analyzer-related differences between the CS-5100 and CS-6500 platforms were modest, the findings highlight the importance of local RI verification when applying manufacturer-derived intervals or changing analytical platforms. These locally derived RIs may improve the interpretation of FXII and ATIII results and reduce unnecessary follow-up testing caused by inappropriate generic intervals.

MLLT10
Also flagged:LeukemiaAMLBacute myeloid leukemiaB-lymphoblastic leukemialymphoma
Journal Article 2026-08-27 ✓ 1 Snippet Zhang H, Miao Q, Wang Y, Li L, Yi M, Jiang X.
In-Text Gene Mentions

…rbored an identical <i>KMT2A::MLLT10</i> fusion, confirming common…

Show Full Abstract

We describe a 1-year-2-month-old boy with <i>KMT2A</i>-rearranged leukemia presenting with concurrent acute myeloid leukemia in bone marrow and B-lymphoblastic leukemia/lymphoma in a right calf mass. Both lesions harbored an identical <i>KMT2A::MLLT10</i> fusion, confirming common clonal origin. This represents the first documented case of spontaneous "spatial lineage divergence" at diagnosis, distinct from therapy-induced lineage switch. The finding highlights the potential need for multi-site biopsy and molecular profiling in extramedullary disease.

SERPINC1
Also flagged:extracellularvesiclesecretionvesiclessynthesisAD
Journal Article 2026-08-27 ✓ 1 Snippet Xu B, Guo Z, Chen J, Xie Y, Wang P, Xiong X, Yu J, Xu Z, Fu Y, Lan Z, Peng G, Zhang J.
In-Text Gene Mentions

…Hub list, includingSERPINC1, NCAM1, GC, CLU,…

Show Full Abstract

<h4>Background</h4>Dysregulation of multivesicular bodies (MVBs) in Alzheimer's disease (AD) contributes to aberrant tau secretion via extracellular vesicles (EVs). This may potentially explain our previous paradoxical observation of elevated free-form p-tau217 alongside reduced p-tau217<sup>+</sup> EVs in plasma. This study aimed to investigate the mechanisms underlying the reduction of p-tau217<sup>+</sup> EVs to uncover AD therapeutic targets.<h4>Methods</h4>By integrating hippocampal spatial transcriptomics of human brain with EV proteomics of cerebrospinal fluid, we identified key regulators of p-tau217<sup>+</sup> EV release. Subsequently, we investigated the mechanisms underlying the synthesis and secretion of p-tau217<sup>+</sup> EVs. The regulatory roles of these candidate proteins were systematically evaluated through shRNA knockdown and interference with a synthetic peptide in both Aβ<sub>42</sub>-treated cells and AD model mice.<h4>Results</h4>Heat shock protein family A member 8 (HSPA8) was identified as a crucial regulator of EV biogenesis and release, mediating the Aβ-SNAP29 interaction to disrupt SNARE complex assembly and impair p-tau217<sup>+</sup> EV secretion. In AD models, HSPA8 inhibition with shRNA rescued p-tau217<sup>+</sup> EVs and improved cognitive function. Additionally, blocking the Aβ-SNAP29 interaction with a selective peptide inhibitor for HSPA8 reversed the decline in p-tau217<sup>+</sup> EV and cognitive deficits.<h4>Conclusions</h4>These findings reveal a role of HSPA8 in regulating the MVB-mediated EV release and tau propagation, and highlight HSPA8 as a promising therapeutic target for modifying AD progression.

PLCL1
Also flagged:glomerular filtrationcardiovascular diseasecardiovascular diseasestissue developmentcardiorenal diseasesatrial fibrillation
Journal Article 2026-08-27 ✓ 1 Snippet Li W, Chen Y, Xiong W, Yuan S.
In-Text Gene Mentions

…such as PLD1,PLCL1, and PLA2G6.…

Show Full Abstract

Heart and kidney diseases frequently coexist, but the genetic basis of this relationship remains unclear. We analyzed genetic data from large-scale studies to investigate how kidney function (estimated glomerular filtration rate, eGFR) and six common cardiovascular diseases share genetic risk factors. Using MiXeR method, and conjunctional false discovery rate (conjFDR) to identify overlapping genetic regions, we found 478 shared genomic loci between eGFR and cardiovascular diseases. These shared genes are involved in tissue development and structure. We also identified 29 genes that could be targeted by existing medications approved by the US Food and Drug Administration, such as PRKAG2, PDE1A, and IGF1R. Among these, genetically predicted higher level of IGF1R expression is associated with a higher eGFR, which reflects good kidney function and is protective against cardiorenal diseases, such as atrial fibrillation, and myocardial infarction. These findings reveal genetic overlap between kidney function and cardiovascular diseases, highlighting potential targets for understanding and treating cardiorenal syndrome.

SERPINC1BTN3A3
Also flagged:Breast Cancertumorwound healingtriple-negative breast cancertumorspathogenesis
Journal Article 2026-08-27 ✓ 2 Snippets Jiang M, Wang Q, Xu H.
In-Text Gene Mentions

…2 included A4GALT,BTN3A3, and NAGLU with…

…HGFAC, PLG, F2,SERPINC1, VTN, albumin, and…

Show Full Abstract

<h4>Background</h4>Breast cancer remains a leading cause of female mortality worldwide, with therapeutic benefit limited by tumor heterogeneity and drug resistance. Identification of novel therapeutic targets through integration of genetic causality inference and functional validation is urgently needed.<h4>Methods</h4>Plasma protein quantitative trait loci (pQTL) from the Fenland cohort (~10,700 individuals) and the FinnGen R10 SomaScan subset (n = 828) were integrated with breast cancer genome-wide association study data from the Breast Cancer Association Consortium (122,977 cases and 105,974 controls). Causal protein-disease relationships were inferred using summary-data-based Mendelian randomization (SMR), with colocalization and HEIDI tests. Multi-level validation was performed using TCGA-BRCA transcriptomic data. Functional validation included CCK-8, EdU, wound healing, Transwell invasion, and flow cytometry apoptosis analysis evaluated <i>CPNE1</i> knocdown and/or overexpression of <i>the MST1 gene</i> which encodes macrophage-simulating protein (MSP).<h4>Results</h4>SMR identified 23 proteins in Fenland and 10 in FinnGen at FDR < 0.05. MST1/MSP and CPNE1 were supported in both datasets with PP.H4 ≥ 0.80 and non-significant HEIDI tests. Genetically predicted circulating MSP was positively associated with breast cancer risk, whereas circulating CPNE1 showed an inverse association. TCGA-BRCA showed higher <i>CPNE1</i> mRNA in tumors (P = 2.57×10⁻<sup>25</sup>) and lower <i>MST1</i> mRNA (P = 3.04×10⁻<sup>23</sup>). <i>CPNE1</i> expression was highest in triple-negative breast cancer and correlated positively with clinical stage (ρ = 0.211), whereas <i>MST1</i> expression was lowest in triple-negative breast cancer and correlated inversely with stage (ρ = -0.164). In T47D and MDA-MB-231 cells, <i>CPNE1</i> knockdown and <i>MST1</i> overexpression each reduced proliferation, migration, and invasion and increased apoptosis; the combined group showed greater changes than either single intervention.<h4>Conclusion</h4>This study prioritizes <i>the MST1 gene</i>, which encodes MSP, and <i>CPNE1</i> as candidate proteins for further investigation in breast cancer. However, the circulating-protein associations, tumor-mRNA patterns, and cell-autonomous perturbations represent distinct and directionally discordant biological contexts. The findings therefore support context-dependent candidate roles and justify mechanistic, in vivo, and formal interaction studies, but do not yet establish therapeutic efficacy or synergy.

Also flagged:phosphorylationCFTRcystic fibrosistezacaftorivacaftorCF
Journal Article 2026-08-27 No Snippets Selvadurai H, Han VX, Keating BA, Graham M, Aryamanesh N, Marshall LL, Dervish S, Lau X, Dissanayake R, Alexander SI, Patel S, Dale RC.
Show Full Abstract

CFTR modulators like elexacaftor-tezacaftor-ivacaftor (ETI) improve morbidity in cystic fibrosis (CF), but their systemic effects on young children are not yet clear. We hypothesize that ETI has anti-inflammatory effects and reverse disease-associated molecular signatures in children with CF. This exploratory pilot study evaluates the cellular mechanisms of ETI on peripheral immune cells in children (<12 years) with CF using a multi-omics approach. Seventeen children with CF (median age 8.7 years, 26% female) and 12 controls (median age 9.6 years, 42% female) were included for blood RNA-sequencing, proteomics and phosphoproteomics. Baseline pathway enrichment analysis revealed systemic inflammation, transmembrane transporter deficiencies, reduced protein kinase, and GTPase activity. Three months post-ETI, anti-inflammatory effects, epigenetic modulation, and increased protein kinase activity were observed, indicating partial reversal of cellular abnormalities. ETI modified systemic inflammatory, epigenetic, and phosphorylation pathways in young children with CF, offering insights into CF pathology and potential biomarkers for treatment monitoring.

Also flagged:tauAlzheimer's diseasegene expressionproteinopathiescerebral amyloid angiopathyApolipoprotein E
Journal Article 2026-08-27 No Snippets Oatman SR, Quicksall ZS, Wang X, Bergman J, Reddy JS, Vanelderen F, Nguyen T, Malphrus K, Lincoln SJ, Martens YA, Zhao N, Yamazaki Y, DeTure M, Murray ME, Liu CC, Bu G, Kanekiyo T, Dickson DW, Allen M, Ertekin-Taner N.
Show Full Abstract

Identification of gene expression changes in postmortem brain tissue of Alzheimer's disease donors compared to controls has implicated numerous biological pathways for Alzheimer's disease pathophysiology. Nonetheless, there is still limited understanding of how gene expression dysregulation underpins specific proteinopathies core to Alzheimer's disease. Here, we investigate brain transcriptomic changes in a well-characterized cohort of Alzheimer's disease donors to identify genes and networks that associate with Alzheimer's disease endophenotypes, including neuropathology measures (Braak stage, Thal phase and cerebral amyloid angiopathy score) and Alzheimer's disease-related brain protein levels (Apolipoprotein E, Amyloid-β 40, Amyloid-β 42, tau and phospho-Tau). Bulk transcriptome measures were collected from the temporal cortex tissue of 477 Alzheimer's disease donors. Following quality control, transcriptome-wide association studies were performed for each endophenotype. We used weighted gene co-expression network analysis to build co-expression networks and integrated transcriptome with epigenetic and genetic data from the same donors. We detected a total of 5740 Bonferroni-significant temporal cortex gene associations with Alzheimer's disease endophenotypes, most of which were with brain tau levels. We discovered tau-associated co-expression modules enriched in known and novel Alzheimer's disease pathways. We found that a <i>beneficial (or neutral)</i> brain biochemical state of higher total tau and lower phospho-Tau is associated with increased levels of synaptic, DNA damage/repair, nucleic acid metabolism and myelin processes. In contrast, in a detrimental state with lower total and higher phospho-Tau, there is upregulation of vascular and immune, and downregulation of mitochondrial and myelin pathways. There are brain gene expression perturbations that are associated with Alzheimer's disease endophenotypes. While some of these associations are common across multiple endophenotypes, many are distinct for different Alzheimer's disease-related proteins. Based on these findings, we propose a hypothetical model of <i>dynamic brain gene expression changes</i> that track with progressive Alzheimer's disease proteostasis. These expression changes hold potential to serve as dynamic, precision biomarkers of brain Alzheimer's disease progression. This study demonstrates the potential of integrative multi-omics and deep Alzheimer's disease endophenotypes in well-characterized brain tissues to precisely uncover the complex biology of Alzheimer's disease.

Also flagged:hypomethylationOLFM1depressionpsychiatric disordergene expressionmethylation
Journal Article 2026-08-27 No Snippets Zhou C, Qing L, Zou T, Zhao M, Guo X, Yin W, Wang J, Lei Y, Li Y, Hu L, Liu L, Nie S.
Show Full Abstract

<h4>Objective</h4>Depression is a heterogeneous psychiatric disorder and a growing public health concern, characterized by its high prevalence, recurrence rate, and association with suicide. There is evidence suggesting that both genetic susceptibility and environmental factors can regulate gene expression through DNA methylation, thereby influencing the occurrence and development of depression. The olfactory sensory neuropeptide 1 (<i>OLFM1</i>) protein is a risk factor for mental disorders. However, there are no reports yet regarding the correlation between the <i>OLFM1</i> gene and depression, nor have there been any studies on the association between <i>OLFM1</i> gene DNA methylation and depression.<h4>Methods</h4>Genomic DNA was extracted from peripheral blood samples of patients with depression (<i>n</i> = 100) and healthy controls (<i>n</i> = 100) using the QIAamp DNA Blood Mini Kit. Subsequently, the extracted genomic DNA was subjected to bisulfite treatment using the EZ DNA Methylation-Gold™ kit. DNA methylation levels of 107 CpG sites in six fragments of <i>OLFM1</i> exon 1 and its downstream were detected by the Illumina HiSeq platform using MethylTarget™ technology.<h4>Results</h4>Methylation levels across the overall <i>OLFM1</i> CpG island and its six fragments (<i>OLFM1</i>-1 to <i>OLFM1</i>-6) were significantly reduced in the depression group relative to controls. Analysis of the <i>OLFM1</i> gene fragments revealed that 84 of 107 CpG sites were significantly hypomethylated in depressed individuals. When patients were divided by sex, male patients displayed hypomethylation at 65 CpG sites, substantially more than the 37 sites found in females.<h4>Conclusion</h4><i>OLFM1</i> hypomethylation is associated with depression and may serve as a potential epigenetic biomarker.

Also flagged:diabetic kidney diseasemetabolismANGIL1R1CXCL14ESAM
Journal Article 2026-08-27 No Snippets Jiang L, Chien C, Li T, Zhang H, Zhao T, Wu X.
Show Full Abstract

<h4>Objective</h4>To identify plasma protein biomarkers associated with incident non-fatal major adverse cardiovascular events (MACE) in diabetic kidney disease (DKD) patients.<h4>Research design and methods</h4>We analyzed 317 DKD patients from the UK Biobank. Plasma proteomics and clinical data (demographics, metabolism, renal function) were integrated. In an exploratory discovery phase, three sequential Cox regression models (crude, socio-demographic-adjusted, socio-demographic-metabolic adjusted) screened non-fatal MACE-associated proteins. To prevent information leakage, the cohort was then randomly split into training (70%) and testing (30%) sets; machine-learning feature selection, hyperparameter optimization, and final model development were performed exclusively within the training set. The associated proteins were input into the four-step machine-learning pipeline (LASSO-Cox, random survival forest, Boruta, XGBoost-Cox). Predictive performance was validated using Kaplan-Meier survival analyses, longitudinal trajectory modeling, and ROC benchmarking. An interactive web application was deployed for clinical implementation.<h4>Results</h4>Of 1,463 plasma proteins, 561 were associated with non-fatal MACE across Cox models, with 14 overlapping proteins. Nine core proteins (ANG, IL1R1, CXCL14, ESAM, PTGDS, HAVCR1, FGFR2, IGSF8, CCL3) were validated: ANG showed the strongest non-fatal MACE association (HR = 3.88, 95%CI 2.33-6.48, p<0.001), and all high-expression groups had elevated non-fatal MACE risk. GO/KEGG enrichment highlighted inflammatory-immune pathways like positive regulation of MAPK cascade, Cytokine-cytokine receptor interaction and PI3K-Akt signaling pathway as key mechanisms. The model integrating proteins, demographic factors, and clinical variables achieved the highest predictive performance across non-fatal MACE (AUC = 0.768), myocardial infarction (MI) (0.808), and stroke (0.816) outcomes, with superior stability in cross-validation. CoxBoost + Elastic Net framework was selected as the optimal framework via benchmarking of 101 algorithms. The model demonstrated favorable calibration in high-risk patients and yielded positive net clinical benefit across decision thresholds of 5% to 45%. The web tool (https://jiangli2941.github.io/MACE-prediction-v2/) enables input of 28 variables, outputs non-fatal MACE risk status, risk probability, and highlights abnormal indicators.<h4>Conclusion</h4>Plasma proteomics combined with machine learning identifies robust non-fatal MACE predictors in DKD.

Also flagged:galactosemetabolismlung adenocarcinomaLung cancercancertumor
Journal Article 2026-08-27 No Snippets Zhang F, Fu J, Cui X, Gao X, Kang Y.
Show Full Abstract

<h4>Background</h4>Lung cancer remains a leading cause of cancer incidence and mortality globally. Metabolic reprogramming promotes tumor progression and shapes an immunosuppressive tumor microenvironment. Galactose metabolism is involved in multiple malignancies, but its prognostic value in lung adenocarcinoma (LUAD) remains unclear. This study aimed to develop and internally validate a galactose metabolism-related multigene prognostic model for LUAD.<h4>Methods</h4>A retrospective prognostic model development and internal validation study was performed using RNA sequencing (RNA-seq) and clinical data from 585 LUAD patients in The Cancer Genome Atlas (TCGA). Differential expression, functional enrichment, univariate and multivariate Cox regression were applied to construct a prognostic gene signature. Internal validation was performed using bootstrap resampling. Model performance was evaluated by time-dependent receiver operating characteristic (ROC), C-index, calibration, and Kaplan-Meier analysis. Associations between the model and immune infiltration, immunotherapy responsiveness, and tumor stemness were also analyzed.<h4>Results</h4>A six-gene prognostic model (<i>GALT, GANC, PGM1, GALM, B4GALT1, PGM2</i>) was developed. The model showed good discrimination with 1-, 3-, and 5-year area under the curve (AUC) values of 0.719, 0.693, and 0.684, respectively. The low-risk group exhibited significantly longer survival, increased antitumor immune infiltration (CD8+ T cells, M1 macrophages, activated CD4+ memory T cells), higher expression of T cell proliferation-related genes, lower immune checkpoint expression, better predicted immunotherapy response, and lower tumor stemness compared with the high-risk group.<h4>Conclusions</h4>We developed and internally validated a six-gene prognostic model for LUAD based on galactose metabolism. The model shows moderate prognostic performance and is associated with antitumor immunity and tumor stemness. It may be used for prognostic risk stratification and to guide personalized immunotherapy in LUAD.

Also flagged:glutathione peroxidase 4translationalGPX4selenocysteinemembranephospholipid
Journal Article 2026-08-27 No Snippets Yang Q, Xia Y, Wu Y, Zeng L, Yu G, Sun L.
Show Full Abstract

Glutathione peroxidase 4 (GPX4) is a selenocysteine (Sec)-containing antioxidant enzyme and the only known mammalian enzyme capable of directly reducing membrane-embedded phospholipid and cholesterol hydroperoxides. It is recognized as a central regulator of ferroptosis, modulating cellular redox balance and influencing cell fate under oxidative stress. Despite a decade of research, critical gaps remain. Existing reviews largely focus on isolated diseases or single targeting strategies, and few provide an integrated framework that spans molecular regulation, physiological function, and clinical translation. The regulatory networks that control GPX4, from transcription to post-translational modifications and protein interactions, remain incompletely defined, and its ferroptosis-independent functions are underexplored. Moreover, the context-dependent and bidirectional roles of GPX4 across different diseases have not been systematically analyzed to guide appropriate therapeutic strategies. To address these gaps, this review delineates the structural basis and isoform-specific functions of GPX4, maps its multilayered regulatory network, and defines its roles across key physiological and pathological processes, including cancer, neurodegeneration, ischemia-reperfusion (I/R) injury, and autoimmune diseases. We also evaluate GPX4-targeted chemical strategies and analyze four core translational barriers: target specificity, systemic toxicity, acquired resistance, and tissue delivery, with evidence-based solutions for each. We conclude by identifying unresolved mechanistic questions and outlining priorities to accelerate clinical translation.

HTT
Also flagged:neurodegenerative disordersHuntington's diseaseHDgene expressionphosphorylationHuntington
Journal Article 2026-08-26 ✓ 5 Snippets Bergonzoni G, Pellegrini M, Savino A, Lazioli M, Geurs S, Graziani L, Ferrarini D, Tusi SK, Oliver E, Geurts J, Vinciguerra S, Tebaldi M, Tripathi T, Pesce I, Poli V, Romanel A, Moratalla R, Voet T, Morandell J, Sanges R, Wheeler VC, Dassi E, Biagioli M.
In-Text Gene Mentions

…Specifically, we usedHttCAG knock‐in mouse…

…harboring 18 (HttQ20 : “control”)…

…or ~190 (HttQ175 : “HD”)…

…HD gene (HTT), responsible for…

…the ones employingHttQ175 knock‐in mice,…

Show Full Abstract

Understanding the molecular mechanisms driving selective neuronal vulnerability to different neurodegenerative disorders remains a crucial, unsolved question. Here, we explored the case of Huntington's disease (HD), where the striatum and, specifically, dopamine receptor 1 (D1R) and dopamine receptor 2 (D2R) medium-sized spiny neurons (MSNs) exhibit differential susceptibility to the HTT CAG-repeat expansion mutation, with D2R-neurons being impacted earlier and more significantly. To unravel differences between D2R and D1R MSNs, we employed a multidimensional approach, integrating genomic, transcriptional, pattern distribution, and somatic instability analyses. Specifically, we used Htt CAG knock-in mouse models harboring 18 (Htt<sup>Q20</sup>: "control") or ~190 (Htt<sup>Q175</sup>: "HD") consecutive CAG repeats, expressing tdTomato and EGFP under the control of Drd1 and Drd2 promoters, respectively. First, comprehensive genomic and transcriptomic analyses following fluorescence-activated cell sorting (FACS) of dissociated striatal neurons revealed distinct gene expression profiles with a significant upregulation of oxidative phosphorylation and translation pathways in D1R-positive neurons already at the pre-symptomatic stage. These transcriptional changes were not accompanied by major copy number variations, as shown by parallel genomic analysis. Secondly, histological analyses revealed a greater proportion of D1R-positive neurons compared to D2R-positive neurons in HD mice, particularly in the ventral-medial neostriatum, with D2R-positive neurons presenting an increased nuclear accumulation of mutant huntingtin aggregates. In summary, our integrative study suggests that the distinct vulnerability of MSNs in HD might result from a combination of an early transcriptional compensatory response of D1R neurons together with specific susceptibility of D2R neurons.

HFE
Also flagged:hepatocellular carcinomaLiver cancerdeathchronic liver diseasespathogenesisViral Hepatitis
Journal Article 2026-08-26 ✓ 5 Snippets Shi Y, Huang B, Liu X, Liu Y, Hu Q, Lei T, Tang L, Xiao G, Ning T, Yue S, He J, Du Q, Li X, Zhou Y, Zhang Q, Qi C, Ren H, Ren HG.
In-Text Gene Mentions

…rs4880, TNFα rs361525,HFErs1800562 and rs1799945,…

…and NQO1 rs1800566);HFErs1800562 was deemed…

…rs430397, GSTP1 rs1695,HFErs1800562, IL‐28B rs12979860,…

…( MDM2 rs2279744,HFErs1799945, TNFα rs1800630,…

…rs4880, TNFα rs361525,HFErs1800562, and HFE…

Show Full Abstract

Associations between various genetic variants and the risk of hepatocellular carcinoma (HCC) have been extensively explored but produced contradictory results. The aim of the present systematic meta-analysis was to determine and validate genetic variants that are associated with HCC risk. Two-step literature searches of PubMed, Embase, Web of Science, and Google Scholar databases and various meta-analyses were performed, and a comprehensive field synopsis and epidemiological evidence were provided. A total of 20,081 publications were identified, of which 830 were deemed eligible for inclusion. Eventually, 36 variants in 27 genes were identified to be associated with HCC risk. Moreover, cumulative epidemiological evidence of an association was graded as moderate for nine variants in eight genes (<i>ESR1</i> rs2234693, <i>GRP78</i> rs430397, <i>HLA-DP</i> rs3077, <i>HLA-DQ</i> rs2856718, <i>MnSOD</i> rs4880, <i>TNFα</i> rs361525, <i>HFE</i> rs1800562 and rs1799945, and <i>UGT1A7</i> High/Low) and strong for three variants in three genes (<i>IL-1B</i> rs1143627, <i>COL18A1</i> rs7499, and <i>NQO1</i> rs1800566); <i>HFE</i> rs1800562 was deemed to have a false-positive association. Thus, 11 variants in 11 genes were identified to be associated with HCC risk. This synopsis helps elucidate the mechanisms of carcinogenesis of HCC and provides insights into the early diagnosis and novel treatments of HCC by targeting those potential genes.

POU3F2
Also flagged:glioblastomagliomatumorGBMcell migrationmitochondrial
Journal Article 2026-08-26 ✓ 1 Snippet Yi L, Qin S, Guo M, Wang X, Zhang Y, Guo P, Östman A, Yang X, Jiang X.
In-Text Gene Mentions

…CDH2, GLDC, WSCD1,POU3F2, KBTBD2, ZNF573) positively…

Show Full Abstract

<h4>Background</h4>Glioblastoma (GBM) is characterized by high invasiveness and metabolic heterogeneity. Protein Tyrosine Phosphatase Receptor Type Z1 (PTPRZ1) has been implicated in glioma stemness and tumor grade progression, while the molecular mechanism remains unknown.<h4>Methods</h4>Integrated bioinformatics analysis of TCGA dataset and TMA IHC profiling were used to explore clinical relevance of PTPRZ1, and potential molecular mechanisms of PTPRZ1 involved glioma progression. Ivy Glioblastoma datasets analysis and multiregional GBM IHC were performed to spatially characterize the expression patterns of PTPRZ1 in GBM tissues. Zebrafish xenograft model was established to elucidate the role of PTPRZ1 in driving glioblastoma cell migration. Western blotting, mitochondrial functional assays, Transwell migration assays, and human GBM tissue multiplexing were employed to investigate the mechanism of PTPRZ1 mediated glioma cell mobility via maintaining mitochondrial functions.<h4>Results</h4>Spatial profiling revealed that PTPRZ1 is significantly enriched in the infiltrating areas and peritumoral margins of GBM, and acts as a poor prognosis factor in lower grade astrocytoma, proneural and mesenchymal GBM. Mechanistically, PTPRZ1 expression was found to be strongly correlated with cell adhesion molecules (CAMs) and mitochondrial metabolism across multiple glioma subtypes. Knockdown of PTPRZ1 triggered a shift from elongated to fragmented mitochondrial morphology by specifically downregulating the mitochondrial fusion protein OPA1. This mitochondrial dysfunction led to a metabolic shift toward glycolysis and a marked accumulation of ROS, which suppressed N-cadherin expression, thereby impairing glioma cell migration. These findings were corroborated in vivo, where PTPRZ1 depletion significantly reduced disseminated tumor foci in a zebrafish model.<h4>Conclusion</h4>Our study demonstrates that PTPRZ1 drives glioblastoma migration by sustaining an OPA1-dependent mitochondrial fusion program, which suppresses mitochondrial ROS levels and subsequently stabilizes a pro-migratory phenotype via N-cadherin expression. Targeting the PTPRZ1/OPA1/ROS axis represents a promising therapeutic strategy to inhibit the invasive expansion of GBM cells.

CCDC92
Also flagged:neurodegenerative disorderADAlzheimerneurodegenerative disordersdeathbrain diseases
Journal Article 2026-08-26 ✓ 1 Snippet Bhatti MHR, Aly A, Khan A, Awan S.
In-Text Gene Mentions

…genes, including ANKRD28,CCDC92, DEFA3, FBXO32, GRIA4,…

Show Full Abstract

<h4>Background</h4>Alzheimer's disease (AD) is a progressive neurodegenerative disorder of late life that causes cognitive and functional decline and substantial mortality. Machine learning (ML) is increasingly used to discover patterns in clinical and biomarker data that support earlier and more accurate AD detection.<h4>Objectives</h4>This scoping review addresses three core research questions. First, we investigate recent trends in using machine-learning techniques to detect Alzheimer's disease using blood biomarkers. Second, we identify the blood biomarkers involved in Alzheimer's detection and evaluate how machine learning has been applied to improve the diagnostic capabilities of these biomarkers. Third, we highlight significant challenges associated with using machine learning for blood biomarker data in Alzheimer's detection and examine proposed advancements or solutions to handle these problems.<h4>Methods</h4>In June 2025, we searched six academic databases to identify relevant papers on blood biomarkers and ML methods for Alzheimer's Disease. Search queries were developed based on our predefined research questions. Papers were then screened using defined inclusion and exclusion criteria, where titles, abstracts, and full texts of articles were systematically reviewed.<h4>Results</h4>Following the screening approach, we selected 36 papers that fulfilled our inclusion and exclusion criteria. Through careful examination, we classified blood biomarkers into four types: transcriptomics, proteomics, multi-omic biomarkers, and general elemental blood biomarkers. Across these studies, proteomic blood biomarkers consistently emerged as significant indicators for Alzheimer's disease, including Alpha-2-Macroglobulin (A2M), Apolipoprotein E (ApoE), Eotaxin-3 (EOT3), plasma phosphorylated tau (p-tau 181), and neurofilament light chain (NfL). Furthermore, we explored challenges such as small sample sizes, lack of standardization, heterogeneity, and data imbalance.<h4>Conclusions</h4>This review provides insights into how combining blood biomarkers with ML can enhance AD prediction. The review summarizes key challenges and identifies critical gaps for future research.

NEGR1
Also flagged:strokebehaviouralcognitiondepressionPost-Traumatic Stress Disorderphosphorylation
Journal Article 2026-08-26 ✓ 3 Snippets Aldridge C, Braun R, Parodi L, Lohse K, Edwardson MA, Cole JW, Lindgren AG, Hsu FC, Keene K, Worrall B, Rosand J, Holman EA, Cramer SC.
In-Text Gene Mentions

…P = 8e-4),neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1; P =…

…with PQBP1 ,NEGR1, CDNF and…

Show Full Abstract

Stroke is a major cause of long-term disability with variable recovery. While clinical factors such as initial severity play a role, genetic factors are increasingly recognized as important contributors to stroke recovery. Genotype studies are generally focused on a single post-stroke behavioural domain, but some genes might relate to broad mechanisms of plasticity. This study therefore aimed to identify cross-phenotypic genetic variants associated across two or more stroke recovery domains. DNA from Stroke, Stress, Rehabilitation, and Genetics study participants was genotyped, resulting in 9 814 610 variants. In order to examine cross-phenotypic results, we first conducted genome-wide association studies on the six recovery domains: motor (grip force), cognition (Telephone Montreal Cognitive Assessment), depression (Patient Health Questionnaire-8), stress (Primary Care Post-Traumatic Stress Disorder Screen), functional status (Stroke Impact Scale-Activities of Daily Living), and disability (modified Rankin Scale 0-2 versus 3-6), some of which were tested longitudinally, yielding nine phenotypes. Models were adjusted for age, sex, initial severity (NIH Stroke Scale score), and ancestry. Cross-phenotype associations were identified by evaluating single nucleotide polymorphisms (SNPs) associated (<i>P</i> < 5e-5) with multiple phenotypes. To determine how these genetic variants may relate to biological mechanisms of recovery, we conducted gene enrichment analyses. Participants (<i>n</i> = 565, 59% male) had mild-moderate initial stroke severity (median acute NIH Stroke Scale score = 4). After accounting for the correlation structure among the nine phenotypes, we observed 319 cross-phenotypic SNPs, 3.45 times the expected number. Five of the cross-phenotypic SNPs were linked to genes relevant to neural development, function and plasticity, e.g. <i>ERICH1</i> (rs11778883-C), <i>FOX3</i> (rs55726768-G), <i>LIFR-AS1</i> (rs76401391-T), <i>RPS6KA2</i> (rs113518460-C) and <i>TUBGCP2</i> (rs147150392-C), as were enrichments in <i>RAB5-EEA1</i>, <i>CTNNA1-CTNNB1</i>, <i>CIN85-SH3GL2</i> and <i>ELMO1-DOCK2</i> complexes. Multiple gene enrichments were found, e.g. Stroke Impact Scale-Activities of Daily Living and Patient Health Questionnaire 8 at 3 months were enriched for <i>CREB</i> phosphorylation, which is important for long-term potentiation. We identified cross-phenotypic SNPs associated with multiple behavioural domains of stroke recovery. Some of these genes encode, or regulate, druggable proteins. These genetic factors are not well captured by clinical or neuroimaging assessments and so provide a unique window into stroke recovery. These findings, if validated, suggest that some genes may be broadly important to stroke recovery.

Also flagged:Factor VIIIVenous ThromboembolismCoagulation factor VIIIcoagulationsplanchnic venous thrombosisthrombophilia
Journal Article 2026-08-26 No Snippets Mao Y, Lu Y, Wu W, Ding Q, Wang X, Dai J, Wu X.
Show Full Abstract

<b>Background</b> Coagulation factor VIII (FVIII) is a critical component of the intrinsic coagulation pathway. While elevated FVIII levels are an established risk factor for venous thromboembolism (VTE), genetic variants in the <i>F8</i> gene directly causing such elevations remain scarce. Here, we report a novel complete <i>F8</i> tandem duplication identified in a female patient with splanchnic venous thrombosis (SVT). <b>Methods</b> We performed genetic testing using a thrombophilia panel targeting 35 genes involved in thrombosis and haemostasis to detect both point variants and copy number variations (CNVs). Family co-segregation analysis and phenotypic assays for FVIII and von Willebrand factor (VWF) were conducted. The structural basis of the identified <i>F8</i> copy number gain was elucidated using optical genome mapping (OGM). Full-length <i>F8</i> mRNA amplification, quantitative PCR, plasma FVIII Western blotting, and X-chromosome inactivation analysis were performed to assess the functional consequences of the duplication. Thrombin generation test (TGT) was employed to assess the hypercoagulable state. <b>Results</b> Genetic testing identified three copies of all 26 exons of the <i>F8</i> gene in the proband, which was also detected in her mother (CNVs = 3) and son (CNVs = 2). One-stage clotting and chromogenic assays confirmed persistently elevated FVIII activity in the proband and her mother, accompanied by increased FVIII antigen levels. The OGM analysis confirmed a 229 kb tandem duplication including the <i>F8</i> gene on one of the proband's X chromosomes. The junction regions exhibited high sequence homology and were rich in repetitive sequences, which precluded precise breakpoint mapping. Full-length <i>F8</i> mRNA amplification revealed no aberrant transcripts, whereas quantitative PCR showed increased <i>F8</i> mRNA expression in all carriers. Plasma FVIII Western blotting indicated FVIII heavy and light chains of expected molecular weights with increased band intensity in carriers. X-chromosome inactivation analysis in female carriers showed no significant skewing. TGT in two available carriers showed increased thrombin generation compared with a normal control at both low (1 pM) and high (5 pM) tissue factor concentrations. <b>Conclusion</b> We identified a novel complete <i>F8</i> tandem duplication associated with increased FVIII expression and a hypercoagulable phenotype in a female patient with SVT. These findings support <i>F8</i> gene dosage gain as a rare gain-of-function mechanism contributing to elevated FVIII levels and thrombophilia, while variation in VWF levels and acquired risk factors may modify thrombotic penetrance.

Also flagged:EXOC8metabolismautophagyaltitude sickness
Journal Article 2026-08-26 No Snippets Zhao C, Guan J, Liu J, Zhang Z, Zhu M, Fu L, Dai A, Lin K, Zhang L, Wang W, He K, Shi J.
Show Full Abstract

A substantial number of genetic variants have been associated with high-altitude adaptation (HAA), yet most of them are located in non-coding genomic regions, leaving their specific functions and underlying mechanisms largely unknown. In this study, we analyze whole-genome and transcriptome sequencing data from a self-established cohort comprising 61 native highlanders (NHs) and 164 acclimatized newcomers (ANs), identifying 6,586 cis- and 34,203 trans-expression quantitative trait loci (eQTLs), along with 130 cell type-specific eQTLs. By further combining these data with a large East Asia (~30% Tibetan) genome-wide association study (GWAS) cohort, we employ colocalization and causal inference analyses to prioritize 85 cis-eQTLs associated with HAA and identify several novel candidate causal genes, including EXOC8, which is experimentally confirmed to regulate erythroid differentiation. Additionally, network analysis of these causal genes uncovers multiple regulatory pathways, mainly involving energy metabolism, autophagy, ubiquitination and inflammation. Our study offers a comprehensive eQTL map and reveals causal chains of "variant-gene-phenotype" for HAA-related traits, which provides new insights into potential regulatory mechanisms and targets for prevention and treatment of altitude sickness.

Also flagged:infectionCD117transductionE6E7oncogenes
Journal Article 2026-08-26 No Snippets Tran TM, Lee HH, Hwang TH, Kim MH, Dang NM, Lee MG, Shim J, Hwang JH, Kim JY.
Show Full Abstract

<h4>Introduction</h4>Critically low blood donation rates and recurrent shortages in the blood supply have become pressing challenges in transfusion medicine. Xenotransfusion using porcine red blood cells (pRBCs) represents a promising alternative; however, risks of immune rejection and infection necessitate the development of genetically engineered porcine models - a process that is time-consuming, costly, and technically complex. In this study, we established an immortalized porcine erythroid progenitor cell line as a platform for genetic manipulation and the evaluation of xenotransfusion potential.<h4>Methods</h4>Porcine hematopoietic progenitor cells (CD117<sup>+</sup>) were isolated from bone marrow mononuclear cells and immortalized via lentiviral transduction with E6/E7 oncogenes from Human papillomavirus type 16 (HPV16) and Sus scrofa papillomavirus (SPV2).<h4>Results</h4>The resulting cells were optimized for long-term culture and exhibited stable proliferation. The immortalized porcine erythroid progenitor cells retained the capacity to differentiate into red blood cells.<h4>Discussion</h4>Our findings demonstrate that E6/E7-mediated immortalization facilitates the generation of porcine erythroid progenitor cells capable of differentiating into red blood cells, offering a valuable tool for genetic engineering and a promising avenue toward safe, sustainable heterologous blood transfusion strategies.

Also flagged:gastric intestinal metaplasiagastric cancersodiumsalicylatedeoxycholatemucosal atrophy
Journal Article 2026-08-26 No Snippets Xiang J, Cheng Y, Wang Z, Han J, Xiao L, Wu J, Meng Y, Hua Z, Lu B, Cheng C, Zhang J.
Show Full Abstract

<h4>Background</h4>Gastric intestinal metaplasia (GIM) is a typical precancerous lesion of gastric cancer (PLGC). Previous studies have demonstrated that Xinkai Kujiang formula can effectively alleviate GIM, but its underlying mechanism remains largely unclear.<h4>Methods</h4>The GIM rat model was established using 2% sodium salicylate and 20 mmol/L sodium deoxycholate, and then the rats were treated with Banxia Xiexin Decoction (BXD) and Xinkai Kujiang Decoction (XKD) for 4 weeks. Multi-omics analyses including 16 S ribosomal RNA gene sequencing, transcriptomics, single-cell RNA sequencing, network pharmacology, and component identification were performed to explore the therapeutic mechanisms of Xinkai Kujiang formula on GIM.<h4>Results</h4>In the model rats, severe gastric mucosal atrophy was observed, characterized by disordered glands and goblet cells. Following intervention with BXD and XKD, gastric mucosal thickness was restored, glandular structures became regularly arranged, and the number of metaplastic goblet cells markedly decreased. Microbiota profiling of gastric mucosa revealed significant enrichment of <i>Lactobacillus</i> and <i>Enterococcus</i> in the model group. These abundances were reduced in the BXD group, and short-chain fatty acid-producing bacteria such as <i>Alistipes</i> and <i>Lachnospira</i> were enriched. In the intestine, opportunistic pathogens like <i>Streptococcus</i> and <i>Enterococcus</i> were enriched in the model group, whereas <i>Corynebacterium</i> and <i>Bifidobacterium</i> were enriched in the XKD group. Transcriptomic analysis presented that BXD upregulated innate immune-related genes in the gastric mucosa, and single-cell RNA sequencing (scRNA-Seq) showed that XKD alleviated GIM by inhibiting the VEGF and HIF-1α pathways, reducing angiogenesis, suppressing inflammatory infiltration, and regulating energy metabolism.<h4>Conclusion</h4>BXD and XKD improve gastrointestinal microbiota disorders and metabolic disorders, enhance gastric mucosal immunity, and inhibit the VEGF and HIF-1α pathway. Collectively, these multi-omics data provide novel insights into the therapeutic mechanisms of Xinkai Kujiang formula for GIM.

Also flagged:systemic lupus erythematosuslupus nephritisgraft-vs-host diseaseGvHDcostimulationautoimmune diseases
Journal Article 2026-08-26 No Snippets Downing M, Christiaansen A, Zhang L, Roe K, Kumar N, Deshpande A, Zhang H, Tarcic O, Toister-Achituv M, Soloviev M, Gross AW, Chen G, Sun CC.
Show Full Abstract

<h4>Background</h4>Chronically activated T-effector (Teff) cells can play a pivotal role in T-cell-mediated diseases including systemic lupus erythematosus subsets, lupus nephritis and graft-vs-host disease (GvHD). Since T cells require diverse costimulation signals to fully activate, proliferate, and differentiate into Teffs, we hypothesized that modulating two costimulatory pathways (CD28 and OX40) with a single bifunctional molecule would provide better control of pathogenic Teffs in autoimmune diseases than currently available T-cell costimulation modulators. We assessed the effects of dual-pathway blockade by M5542, a novel CD80, CD86, and OX40L antagonist and bifunctional fusion molecule. We determined the advantages of M5542 blocking both CD28 and OX40 pathways over single-pathway blockade in <i>in vitro</i> potency and <i>in vivo</i> studies, to more effectively curb T-cell-mediated inflammation in autoimmune diseases.<h4>Methods</h4>M5542, single-agent comparators CTLA-4Ig (abatacept), anti-OX40L, and both single agents in combination were tested for their ability to inhibit proinflammatory cytokine production in a mixed lymphocyte reaction of activated monocyte-derived dendritic cells and T cells from healthy donors or peripheral blood mononuclear cells from individuals with SLE. The target occupancy of CD80 and OX40L on dendritic cells was assessed by flow cytometry. The effects of M5542 and comparators on T-cell-mediated inflammation were assessed using a keyhole limpet hemocyanin (KLH) peptide-induced delayed-type hypersensitivity (DTH) humanized hOX40/hOX40L mouse model. All molecules were also tested for their efficacy to reduce disease in a humanized xenogenic GvHD (xGvHD) mouse model.<h4>Results</h4>M5542 potently reduced proinflammatory cytokine production and dampened T-cell proliferation compared with CTLA-4Ig or anti-OX40L <i>in vitro</i>. M5542 also neutralized OX40L-mediated T-regulatory cell (Treg) dysfunction <i>in vitro</i> and suppressed Teff proliferation in conjunction with Tregs <i>in vitro</i>. Moreover, M5542 dose-dependently reduced T-cell-mediated ear swelling and anti-KLH antibody production in the KLH-DTH mouse model. In the xGvHD model, M5542 demonstrated improved efficacy over CTLA-4Ig or anti-OX40L alone in suppressing human IFNγ and preventing disease.<h4>Conclusion</h4>In this preclinical study, the bifunctional M5542 blocked CD28 and OX40-mediated T-cell inflammation with greater immunomodulatory activity than monofunctional agents and in some assays comparable to or better than the combination of the monofunctional agents. These findings support further evaluation of M5542 in T-cell-driven autoimmune disease settings.

Also flagged:hydroxyapatitecapsaicincell proliferationCAPcell growth
Journal Article 2026-08-26 No Snippets Shi X, Wang T, Qiao J.
Show Full Abstract

This paper explores the fabrication of hydroxyapatite-capsaicin nanocomposite coatings on Mg-Ag alloy by the electrophoretic deposition (EPD) method at different deposition times and voltages. The microstructure, surface chemistry, hardness, corrosion behavior, and cell proliferation of the deposited layers at different deposition times and voltages were examined. Based on microstructural observations, the deposited layers became denser at higher deposition time and voltage. In addition, the hydroxyapatite-capsaicin nanocomposite became thicker at higher EPD voltage. FTIR and XPS analyses confirmed the successful incorporation of capsaicin into the HAP coating with partial retention of CAP-derived surface functionalities after annealing. Also, the hardness of the coated layer increased with voltage and time. However, EPD voltage was more effective in increasing the hardness. The maximum hardness of 141 HV was obtained at a deposition voltage of 160 V. The hardness profile of the deposited composite showed greater fluctuations with increasing deposition voltage. Electrochemical polarization tests demonstrated that corrosion resistance improved with increasing deposition voltage and time. Furthermore, cell growth was improved at higher EPD time and voltage. MTT assay results confirmed the enhanced cytocompatibility of the HAP-CAP coatings. Also, the Mg<sup>2+</sup> ion release rate and pH variation decreased as the deposited layer became thicker and denser. The minimum Mg<sup>2+</sup> ion release rate of 5.2 ppm h<sup>-1</sup> was obtained at a deposition voltage of 160 V. Compared with conventional HAP coatings, incorporation of capsaicin enhanced the biological performance while preserving the structural stability of hydroxyapatite, which thus provides a promising strategy for the development of multifunctional biodegradable implant coatings.

Also flagged:Faf2progenitor cell differentiationtranscription factorcell homeostasisadaptor proteinendoplasmic reticulum
Journal Article 2026-08-26 No Snippets Kakebeen AD, Dunphy L, Hazen HK, Niswander LA.
Show Full Abstract

Neural progenitor cell differentiation is a complex process requiring the proper integration of instructive and permissive factors. Instructive cues including signaling molecules and transcription factor networks have been well studied in this context, but permissive factors such as cell homeostasis have not. Cell homeostasis is critical to support the health and stability of a cell and enable the cell to act on instructive differentiation cues. Our study investigates a homeostasis protein, FAF2, and its function in neural progenitor cells. FAF2 is an adaptor protein involved in endoplasmic reticulum (ER) associated degradation to remove misfolded proteins and restore ER homeostasis. Here we show that knocking out <i>Faf2</i> in neural progenitor cells results in increased ER stress signature at the protein and transcription level, indicating a conserved functional role in neural progenitor cells. Induced neural differentiation of FAF2 deletion cells shows a failure of neurite development but RNA-seq indicates genes that support neural differentiation are induced. Reducing ER stress in FAF2 knockout cells with a small molecule inhibitor can rescue neural differentiation, providing evidence that excess ER stress contributes to the inhibited differentiation. Taken together, these results reveal that FAF2 is a critical protein in neural progenitor cells for the maintenance of ER homeostasis and execution of neural differentiation.

Also flagged:keloidpathogenesisimmunitymetabolismtransductionHLA
Journal Article 2026-08-26 No Snippets Liu M.
Show Full Abstract

Keloid, as a unique form of pathological scar, involves complex interactions across multiple dimensions in its pathogenesis, including genetic susceptibility, epigenetic regulation, immune microenvironment disorders, metabolic reprogramming, abnormal mechanical force transduction, and fine-tuning by non-coding RNAs. At the genetic level, alleles such as HLA-DRB1*15, HOX gene family, and high-frequency mutation genes including MUC4 constitute the foundation of congenital susceptibility; at the epigenetic level, reduced DNA methylation and imbalanced m6A modification promote fibrosis by regulating target genes such as COL1A1. In core signaling pathways, TGF-β/Smad, MAPK/ERK, PI3K/AKT/mTOR, and Wnt/β-catenin pathways form a cross-talk network, driving persistent activation of fibroblasts and excessive extracellular matrix deposition. Characteristics of the immune microenvironment include M2-like macrophage polarization, Th17/IL-17 axis activation, and chronic low-grade inflammation maintained by inflammatory factor networks such as CXCL12. Regarding metabolic reprogramming, keloid cells exhibit "Warburg effect" features, prioritizing aerobic glycolysis while suppressing oxidative phosphorylation, alongside ferroptosis resistance and abnormal sphingolipid metabolism. Mechanical forces trigger the opening of mechanosensitive PIEZO1 ion channels, inducing abnormal calcium influx and subsequent YAP/TAZ nuclear translocation, which creates a self-amplifying vicious cycle alongside elevated matrix stiffness. Furthermore, lncRNAs, circRNAs, and miRNAs finely regulate the fibrotic process through competing endogenous RNA (ceRNA) networks and m6A modification-dependent mechanisms. The integration of these multidimensional mechanisms provides a theoretical basis for developing multi-target combination therapeutic strategies. Future research should promote the application of precision medicine in keloid management through multi-omics integration and artificial intelligence algorithms. Microenvironment; Metabolic reprogramming; Mechanical force transduction.

Also flagged:membranephosphorylationlocalizationcell-surfacebindingmetabolism
Journal Article 2026-08-25 No Snippets He Q, Zhao LH, Xu HE.
Show Full Abstract

Arrestins were originally defined as terminators of G protein-coupled receptor (GPCR) signaling, yet structural and mechanistic advances now reveal them as programmable, spatiotemporal integrators of cellular signaling. Recent cryo-electron microscopy studies have revealed a diverse spectrum of GPCR-arrestin engagement modes, including core-, tail-, loop-, side-engaged, and membrane-anchored conformations, across GPCR classes and arrestin isoforms. These structures reveal that arrestin recruitment operates as a conditional, allosterically regulated process rather than a binary on-off switch. The selection of the arrestin microstate is governed by layered regulatory inputs, including GPCR kinase-dependent phosphorylation barcodes, membrane and lipid cofactors, and isoform-specific mechanics, which together define the signaling geometry, duration, and subcellular localization. This structural logic provides a mechanistic foundation for biased signaling, noncanonical endosomal signaling, and GPCR-independent arrestin functions. Importantly, emerging therapeutic strategies, including intracellular allosteric modulators and molecular glues, demonstrate that arrestin signaling can be reprogrammed by directly sculpting transducer assemblies rather than ligand efficacy alone. Here, we synthesize recent structural, biochemical, and physiological insights to outline how arrestins decode regulatory inputs into signaling outcomes and how this knowledge enables the development of next-generation, structure-guided GPCR therapeutics.

LRRC7
Also flagged:African swine fever virus infectionswine feverASFV infectionT-cell activationorganizationvesicular
Journal Article 2026-08-25 ✓ 1 Snippet Świerczek N, Ropka-Molik K, Piórkowska K, Małopolska M, Tyra M, Szmatoła T, Muszyński S, Quembo CJ.
In-Text Gene Mentions

…neuron projection (LRRC7, GRM1 ,…

Show Full Abstract

African swine fever remains a major constraint on global pig production because effective treatment is unavailable, and disease control relies primarily on biosecurity and outbreak management. Field observations from endemic regions increasingly suggest that some domestic pigs can survive exposure to ASFV. Therefore, the aim of this study was to characterize genomic differences between Mozambican Landim pigs that survived or died after natural ASFV infection and to identify variants potentially associated with differential disease survival. Whole-genome sequencing was performed on 32 naturally exposed Landim pigs, including 16 survivors and 16 non-survivors, and the resulting reads were aligned to the Sscrofa11.1 reference genome. Variant frequencies were compared between groups, and functional annotation was performed. Genetic structure was assessed using PCA, genetic distance-based clustering, and admixture. The data revealed marked genomic differentiation between survivors and non-survivors. Comparative analysis identified 4,804 polymorphisms that significantly differentiated, of which 45.0% were intergenic. Missense variants were identified in the TTC12 and WWC1 genes, and functional annotation of genes harboring significantly differentiating variants indicated processes related to immune regulation, T-cell activation, intracellular signaling, cytoskeletal organization, vesicular transport, ubiquitin-dependent proteostasis, and lipid metabolism. Given the marked genetic stratification between survivor and non-survivor groups, the observed differences between them cannot be unambiguously separated from underlying population structure. Therefore, although some of the identified variants may contribute to differential survival following ASFV exposure, the findings should be considered exploratory and require validation in larger, independent, genetically comparable populations.

Also flagged:Ferroptosiszoonotic diseasesdeathinfectionimmune responseszoonoses
Journal Article 2026-08-25 No Snippets Tian L, Cheng X, Ni J, Yang R, Ouyang W, Qi T, Liu Q, Wang D, Chen H, Wang X.
Show Full Abstract

Ferroptosis is a distinct modality of programmed cell death driven by iron-dependent lipid peroxidation, exerting a pivotal regulatory influence on the infection dynamics and immune responses associated with zoonoses. This article systematically elucidates the mechanistic interplay between significant zoonotic pathogens and the core regulatory networks of host ferroptosis, encompassing iron metabolism, the antioxidant defense systems typified by GPX4, and lipid peroxidation. Furthermore, it synthesizes current advancements and challenges regarding small molecules, natural products, and bioactive components of traditional Chinese medicine that target key ferroptotic checkpoints for anti-infective therapy. This review aims to establish a theoretical foundation for the development of novel, precision prevention and control strategies for zoonoses, grounded in ferroptosis modulation within the "One Health" perspective.

Also flagged:myelofibrosis-nucleushematopoiesishematopoiesis-supportiveextracellular
Journal Article 2026-08-25 No Snippets Dugué B, Wanner P, Ruiz Tejada Segura ML, Saad M, Greven L, Götz K, Schalla C, Fuchs S, Vroeg In de Wei G, Gleitz HFE, Galyga AK, Pritchard JE, Schlangen T, Lutterbach N, Atakhanov S, Schmidt L, Parrens M, Peyrat A, Paz DL, Copin MC, Guy A, Brett VE, Mansier O, Schmitz S, Wanek P, Banjanin B, Schmitz S, Crysandt M, Clahsen-van Groningen MC, Hebeda KM, Dietrich S, Voehringer H, Meyer-Bender M, Séré K, James C, Benabid A, Costa I, Dussiau C, Schneider RK.
Show Full Abstract

Splenomegaly is a defining feature of myelofibrosis, yet the contribution of splenic mesenchymal stroma to disease progression remains unclear. We combined spatial and single-nucleus transcriptomics of patient spleens with spatial and single-cell transcriptomics, as well as imaging analyses, of murine spleens to map extramedullary hematopoiesis niches. Activated red pulp reticular cells localize near hematopoietic stem and progenitor cells, and early disease is characterized by marginal zone disruption with lymphoid depletion preceding stromal remodeling. Trajectory analyses reveal a shift in reticular cells from hematopoiesis-supportive to inflammatory and pro-fibrotic states, driven by macrophage- and megakaryocyte-derived signals that activate complement and induce tumor necrosis factor α (TNF-α), transforming growth factor β (TGF-β), extracellular matrix, and Thbs1 programs. Non-hematopoietic complement component C3 deficiency or pharmacological C3 inhibition suppresses these pathways, restores splenic architecture, and reduces splenomegaly and bone marrow fibrosis. These findings identify complement-dependent stromal reprogramming as a mechanism governing hematopoietic niches and as a targetable axis in myelofibrosis.

ZNFX1
Also flagged:AscitesMycobacterial DiseaseMSMDclinicalinfectionsabscess
Journal Article 2026-08-25 ✓ 1 Snippet Dolikhani M, Shakibamaram G, Rashtian P, Saberi M, Reshadmanesh A, Ghafaripour H, Moradian E, Mahdaviani SA, Bustamante J.
In-Text Gene Mentions

…, USP18 andZNFX1[ 7 –…

Show Full Abstract

<h4>Background</h4>Mendelian susceptibility to mycobacterial disease (MSMD) is a subset of inborn errors of immunity (IEIs) predisposing to clinical infections from less virulent mycobacterial species. Variants in 22 genes, particularly in IL-12Rβ1, have been identified that impair interferon-gamma (IFN-γ)-mediated immunity. We report a new rare MSMD patient with a homozygous <i>IL12RB1</i> variant who presented with severe and persistent ascites.<h4>Case report</h4>We investigated a 30-month-old girl who developed an abscess and lymphadenopathy (LAP) in the left axilla after receiving a BCG vaccine. She was diagnosed and treated for BCG-osis. She presented with ascites, which gradually worsened, along with symptoms of liver dysfunction. Her portal hypertension (PHT) was considered the most likely cause of ascites after exclusion of other common causes. The whole exome sequencing (WES) revealed a homozygous rare variant (c.635G>A; p.Arg212Gln) in the <i>IL12RB1</i> gene. Sanger sequencing analysis confirmed that both parents were heterozygous carriers of the variant. She made a good recovery after receiving the appropriate antimycobacterial and ascites treatments, with significant resolution of her symptoms. Because disseminated <i>M. bovis</i> BCG infection occurred in the setting of IL-12Rβ1 deficiency, prolonged susceptibility-guided antimycobacterial therapy with adjunctive IFN-γ1b and close follow-up by infectious disease and immunology, was planned.<h4>Conclusion</h4>This case highlights severe persistent ascites as an unusual manifestation of PHT in IL-12Rβ1 deficiency associated with MSMD. Evaluation for PHT should be considered in MSMD patients with abdominal distension, gastrointestinal symptoms, hepatosplenomegaly, abnormal liver function tests, growth failure, or unexplained free abdominal fluid.

SLC2A14
Also flagged:diabetesDNGene ExpressionDiabetic Nephropathyferroptosisdiabetic kidney disease
Journal Article 2026-08-25 ✓ 5 Snippets Li Y, Bao J, Sun R, Mei W, Liu Y, Bai Y, Hu C, Jiang H.
In-Text Gene Mentions

…including SLC7A5 andSLC2A14, which consistently upregulat…

…identify SLC7A5 andSLC2A14as candidate circulating…

…TheSLC2A14belongs to the…

…of SLC7A5 andSLC2A14as circulating molecular…

…, WIPI1 ,SLC2A14, PARP1 ,…

Show Full Abstract

Diabetic nephropathy (DN) is a major microvascular complication of diabetes. Hypoxia-inducible factor 1-alpha (HIF1A) and ferroptosis contribute to the progression of DN, but the circulating biomarkers associated with these pathways are still unknown. In this study, the whole-blood transcriptomic datasets in the Gene Expression Omnibus were combined with ferroptosis-related genes from the FerrDb database and published literature. The differentially expressed genes of HIF1A and of DN were intersected, and then the feature selection with Boruta and SVM-RFE was performed, followed by external validation, immune infiltration analysis, prediction of regulatory network, drug-target prediction, and RT-qPCR validation. We identified 773 HIF1A-related genes, 1445 DN-related genes, and 22 overlapping candidate genes. Using machine-learning analysis, nine core genes were identified, including SLC7A5 and SLC2A14, which consistently upregulated in both training and validation datasets and corroborated by RT-qPCR. Both genes were positively associated with activated natural killer cells and negatively associated with monocytes in estimated circulating immune-cell composition analysis. Regulatory-network and DrugBank analyses generated hypotheses regarding upstream miRNAs and potential compound interaction. These findings identify SLC7A5 and SLC2A14 as candidate circulating biomarkers related to HIF1A expression and ferroptosis-related gene signatures in DN. Further large-cohort and functional studies are required to confirm their diagnostic and mechanistic relevance.

Also flagged:c-METhead and neck squamous cell carcinomaUpconversion nanoparticleslutetiumphotontumor
Journal Article 2026-08-25 No Snippets Lin KH, Wu CY, Chang YC, Chan MH.
Show Full Abstract

Upconversion nanoparticles (UCNPs) convert tissue-penetrating near-infrared photons into sharp visible emissions, offering background-free optical readouts for deep-tissue imaging. Here we report multilayer NaLuF<sub>4</sub>:Yb,Tm@NaLuF<sub>4</sub> UCNPs that simultaneously act as fluorescent probes and radioisotope precursors. Under 980 nm excitation, the particles generate bright blue and red upconversion signals for real-time tracking. At the same time, their lutetium-rich core can be neutron-activated in a single step to yield β<sup>-</sup>- and γ-emitting <sup>177</sup>Lu. The β-particles confine cytotoxic dose within a 2 mm range, whereas the co-emitted γ photons enable quantitative single-photon emission computed tomography (SPECT). To enhance the tumor selectivity of the nanoplatform, we grafted a c-Met DNA aptamer onto the PEGylated shell, guiding the nanoconstructs to target head and neck squamous cell carcinoma (HNSCC) with amplified c-Met receptor levels. The aptamer markedly enhances cellular uptake, improves therapeutic indices, and limits off-target irradiation. Moreover, the optical modality remains non-radioactive, allowing pre-treatment imaging without patient exposure, and supplements the relatively low (∼10%) γ yield of <sup>177</sup>Lu for accurate intra-procedural localization. Collectively, this single nanosystem unites targeted radiotherapy, radionuclide therapy, SPECT, and NIR-mediated optical imaging, delivering a coherent "see-and-treat" strategy for HNSCC. The modular design also provides a versatile platform that can be transferred to other solid tumors bearing actionable biomarkers across diverse clinical oncology imaging and therapy settings.

Also flagged:episodic migraineMigraineneurological disordercalcitonin gene-related peptideCGRPantibodies
Journal Article 2026-08-25 No Snippets Montisano DA, Fedeli D, Demichelis G, Ciullo G, Medina Carrion JP, Ciusani E, Erbetta A, Grisoli M, Marcassoli A, Regonesi G, Parisi A, Raggi A, Nigri A, Grazzi L.
Show Full Abstract

<h4>Aim</h4>Episodic Migraine (EM) is a highly prevalent and disabling neurological disorder. Recent therapeutic advances have targeted the calcitonin gene-related peptide (CGRP), a neuropeptide implicated in the pathophysiology of migraine. Promising outcomes have been obtained with monoclonal antibodies and, more recently, with a new class of drugs consisting of small-molecule CGRP receptor antagonists, known as gepants. Atogepant, an oral agent of the gepant class, has demonstrated efficacy in migraine prevention, yet its effects on central brain activity and neurotransmitter circuits remain largely unclear. This exploratory study investigates changes in brain functional connectivity and changes related to key neurotransmitter systems, following 12 weeks of treatment with atogepant in a group of EM patients.<h4>Methods</h4>This is an exploratory single-arm longitudinal study assessing clinical and neuroimaging changes before and after 12 weeks of atogepant treatment. We enrolled patients diagnosed with EM according to ICHD-3 criteria, without prior exposure to anti-CGRP therapies. Participants underwent clinical assessments (monthly migraine days MMD, acute drugs intake MAM) and resting-state functional MRI (rs-fMRI) before and after 12 weeks of treatment with atogepant 60 mg once daily. Longitudinal functional connectivity analyses were performed at the whole-brain level with a region-of-interest analysis. Additionally, longitudinal neurotransmitter-related functional connectivity was investigated within the serotoninergic and the dopaminergic systems.<h4>Results</h4>A total of 15 patients completed the evaluation. A significant group-level reduction in MMD (T = -7.09, <i>p</i> < 0.001) and MAM (T = -6.35, <i>p</i> < 0.001) following 12 weeks of atogepant treatment was observed, accompanied by a reduction of allodynia symptoms, albeit not statistically significant. Patients exhibited significant longitudinally increased functional connectivity, involving the right superior frontal gyrus, bilateral putamen, left pallidum, left anterior and bilateral posterior cingulate cortex. The greater the longitudinal increase in anterior-posterior cingulate cortices connectivity, the larger the improvement in MMD, MAM, and allodynia symptoms after treatment. Additionally, longitudinal connectivity changes were observed within the orbitofrontal cortex in the mesocorticolimbic dopaminergic system.<h4>Discussion</h4>In this exploratory cohort, significant clinical improvement after atogepant treatment was accompanied by longitudinal functional connectivity changes in EM patients. These preliminary findings may reflect either direct or indirect central modulation linked to atogepant treatment. A deeper understanding of the observed central changes may help to clarify the mechanisms underlying anti-CGRP therapies for migraine.

Also flagged:Autoimmune gastritisadenocarcinomaAIGgastric adenocarcinomaspasmolytic polypeptideintestinal metaplasia
Journal Article 2026-08-25 No Snippets Tao J, Meng L, Zhang X, Zhang L, Li T, Li Z.
Show Full Abstract

Autoimmune gastritis (AIG) arises from a T-cell-mediated immune attack on the gastric parietal cell and carries a dual neoplastic risk: gastric adenocarcinoma through spasmolytic polypeptide-expressing metaplasia (SPEM) and intestinal metaplasia, and type-1 gastric neuroendocrine tumour (NET) through hypergastrinaemia-driven enterochromaffin-like (ECL) cell hyperplasia. This "one origin, two fates" framework is conceptually established but has never been given a molecular trajectory from an AIG origin, and molecular data for the neuroendocrine endpoint are essentially absent. We integrated public single-cell transcriptomes of the human AIG corpus (GSE271866; three samples, 14,323 cells) and of a histologically staged premalignant cascade (GSE134520; 44,012 cells) with a cross-sectional cohort of approximately 203 AIG patients, treating the two axes asymmetrically: the adenocarcinoma axis was reconstructed at the molecular level, whereas the neuroendocrine axis was clinically and literature anchored. The AIG corpus showed near-absent parietal cells (0.45%) with extensive SPEM (18.6%) and intestinal metaplasia (16.3%). Cascade pseudotime increased monotonically with histological stage (Spearman's <i>ρ</i> = 0.496; unchanged on the unbridged graph) and defined a gastric-to-intestinal progression signature that, transferred to the AIG corpus, tracked the AIG-intrinsic pseudotime (<i>ρ</i> = 0.673). Most AIG metaplastic cells were projected to the strong-metaplasia stage (90.9%; bootstrap 95% CI 84-98%; <i>n</i> = 55), a suggestive rather than definitive placement that is nonetheless consistent with AIG occupying the atrophy-to-metaplasia segment of the adenocarcinoma axis. In the cohort, hypergastrinaemia scaled with corpus atrophy (gastrin-17 versus pepsinogen I/II ratio <i>ρ</i> = -0.413, <i>p</i> = 9.9 × 10<sup>-8</sup>), and single-cell analysis confirmed a gastrin-responsive ECL population (<i>HDC</i> <sup>+</sup> 93%, <i>CCKBR</i> <sup>+</sup> 76%) whose neuroendocrine programme was orthogonal to the intestinal programme of the adenocarcinoma arm. Because AIG is a prototypic autoimmune disease, we frame how the autoimmune infiltrate steers each fate as the central open immunological question. AIG thus enters the metaplasia-to-cancer axis from a corpus, parietal-cell-loss origin and diverges, through a serum-gastrin-ECL bridge, towards the neuroendocrine fate; we provide an interpretable progression signature and a severity-anchored, hypothesis-generating framework-not an outcome predictor, since the cohort is cross-sectional with essentially no neoplastic endpoints-and report the molecular data gap for the neuroendocrine endpoint as a field-level priority.

Also flagged:reproductionantibodiesinseminationovulationtranslational
Journal Article 2026-08-25 No Snippets Landinez-Aponte J, Wang Z.
Show Full Abstract

The alpaca (<i>Vicugna pacos</i>) is a domesticated South American camelid of increasing global relevance, valued for its high-quality fiber, cultural significance, and unique biological traits including heavy-chain-only antibodies. Its reproductive physiology differs fundamentally from that of conventional livestock, encompassing an induced rather than spontaneous ovulatory mechanism in females and an unusually viscous ejaculate in males, differences that constrain the direct application of protocols developed for cattle, sheep, and swine and that have historically limited the pace of genetic improvement in the species. This review provides an integrated account of alpaca reproductive anatomy, follicular and neuroendocrine physiology, seminal plasma biochemistry, and semen cryopreservation, together with the current state of artificial insemination, multiple ovulation and embryo transfer, laparoscopic ovum pick-up, <i>in vitro</i> embryo production, and intracytoplasmic sperm injection. By examining female and male reproductive biology within a single mechanistic framework rather than treating each in isolation, this review draws out the regulatory pathways that connect the two systems and identifies the knowledge gaps that a fragmented, single-sex treatment of the subject would otherwise leave unaddressed. Particular attention is given to the biological determinants that most directly limit ART efficiency and to the translational steps required to move current protocols from experimental proof of concept toward standardized, field-applicable practice. Building on prior reviews that have illuminated individual ART modalities and single-sex reproductive biology, this work is intended to support researchers and practitioners advancing reproductive technology in camelids and the broader effort to conserve and genetically improve alpaca populations worldwide.

SOX6
Also flagged:locomotioninnervationnucleusaxonalanxietygrooming
Journal Article 2026-08-24 ✓ 2 Snippets Bolduc C, Oram C, Donovan S, Bach H, Liu M, Marier R, Sharpe M, Liu S, Campeau C, Spencer CD, Martin SA, Awatramani R, Poulin JF.
In-Text Gene Mentions

…correspond broadly toSOX6+ DA neurons,…

…subset of theSOX6+ population.…

Show Full Abstract

Despite advances in delineating the molecular diversity and projection patterns of midbrain dopamine (DA) neurons, subtype-specific contributions to motor learning and movement execution remain poorly defined. Here, we applied intersectional ablation and inhibitory chemogenetics to dissect the roles of calbindin-expressing (CALB1<sup>+</sup>) and nonexpressing (CALB1<sup>-</sup>) DA neurons in locomotion. Using newly engineered intersectional autocleavable Caspase3 constructs, we ablated CALB1<sup>+</sup> or CALB1<sup>-</sup> DA neurons in the mouse midbrain. CALB1<sup>-</sup> DA neuron ablation caused severe weight loss, whereas CALB1<sup>+</sup> DA neuron ablation produced no overt health impairments. Nonetheless, loss of either subtype led to a bradykinetic-like phenotype on the initiation and vigor of voluntary movements. Only ablation of CALB1<sup>-</sup> DA neurons impaired performance on the accelerated rotarod. To test if these phenotypes are the result of DA subtype activity, we silenced either population using the inhibitory DREADD hM4Di. Consistent with ablation, silencing CALB1<sup>-</sup> DA neurons impacted the initial performance on the rotarod, whereas inhibition of CALB1<sup>+</sup> DA neurons did not impact performance on the first day, but prevented across-day improvement. Silencing both populations impaired the initiation and vigor of voluntary movements. We next investigated whether this locomotor phenotype stemmed from reduced DA release in the dorsolateral striatum (DLS). While CALB1<sup>-</sup> silencing abrogated DA transients in the DLS, CALB1<sup>+</sup> silencing unexpectedly resulted in increased transients in DLS. Thus, our results demonstrate that DA transients in the DLS are not invariably coupled with movement execution. Altogether, these findings uncover both distinct and shared roles of molecularly defined DA subtypes in shaping different aspects of locomotion.

Also flagged:immunometabolismtranslational modificationsmetabolismtumormitochondrialextracellular
Journal Article 2026-08-24 No Snippets Thakur M, Mutyala D, Amoliga AA, Ortega MC, Batra S.
Show Full Abstract

NADPH oxidases (NOXs) have emerged as central hubs that link environmental, metabolic, and immune cues through spatially organized redox signaling. However, their roles across tissues and disease states have not been comprehensively evaluated in an integrated manner. This review integrates recent advances in structural biology, immunometabolism, toxicology, and systems biology to provide an updated, comprehensive, and accessible view of NOX biology. Recent advances in high‑resolution cryo-EM, AlphaFold‑based modeling and molecular dynamics studies have provided new insights into NOX architecture, catalytic sites, post‑translational modifications and regulatory mechanisms, and docking interfaces for RAC1 and p47<sup>phox</sup>. Emerging evidence further indicates that cellular NOX-derived ROS can reprogram macrophage and T-cell metabolism, stabilize HIF-1α, and tune the balance between effector and regulatory states, thereby linking NOX activity to checkpoint control and tumor immune escape. A second focus is on how real‑world pollutants converge on NOX isoforms as proximal mediators of redox signaling across lung, vascular, hepatic, renal, and neural tissues. NOX activation during cellular injury may contribute to oxidative stress, mitochondrial dysfunction, inflammasome activation, and fibrotic signaling, through extracellular vesicles, lipid rafts, and noncoding RNAs. Finally, the review evaluates emerging therapeutic strategies, including isoform-selective/pan-NOX/peptide inhibitors, and nanozymes. It also discusses emerging approaches such as exosome-based biomarkers, network pharmacology, and machine learning for patient stratification and pharmacodynamic monitoring. By highlighting key mechanistic gaps and translational opportunities, this review establishes NOXs as actionable nodal regulators at the intersection of immunity, metabolism, environmental exposure, and human disease.

OLFM4
Also flagged:T1DMchronic diseaseGene Expressiontype 1 diabetes mellitusType 1 diabetes mellituschronic autoimmune disease
Journal Article 2026-08-24 ✓ 1 Snippet Li J, Zhang S, Wang X, Yan D, Gu C, Mou Z, Zhang X, Shu J, Zhang M, Cai C.
In-Text Gene Mentions

…DEFA4, UTY, LTF,OLFM4, FOS, TNFRSF17, CTSG,…

Show Full Abstract

<h4>Background</h4>Type 1 diabetes mellitus (T1DM) is a chronic disease that significantly impacts patients' quality of life. Its prevalence is rising globally each year. This study aims to identify potential biomarkers associated with T1DM through comprehensive bioinformatics analysis, further enhancing T1DM early diagnosis and treatment.<h4>Methods</h4>Transcriptome datasets from T1DM patients and the control group were from the Gene Expression Omnibus (GEO) database. Differentially Expressed Genes (DEGs) were identified and subsequently analyzed using Gene Ontology (GO) enrichment, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment, and protein-protein interaction (PPI) network analysis. Hub genes were identified using Enzyme-Linked Immunosorbent Assay (ELISA) on clinical samples comprising 17 T1DM patients and 19 controls. Immune cell infiltration was estimated using the Cell-type Identification By Estimating Relative Subsets Of RNA Transcripts (CIBERSORT) algorithm, while the diagnostic performance of the hub genes was evaluated <i>via</i> receiver operating characteristic (ROC) curve analysis.<h4>Results</h4>A total of 20 up-regulated and eight down-regulated DEGs were identified in the GEO database. Functional enrichment analysis showed that immune activation played an important role in T1DM. The expression levels of the hub genes, <i>CTSG</i> and <i>LTF</i>, were further validated in clinical samples. ROC analysis showed moderate diagnostic performance, with AUC values of 0.75 (training set) and 0.67 (validation set).<h4>Conclusions</h4>The results indicate that <i>CTSG</i> and <i>LTF</i> may serve as promising diagnostic biomarkers for T1DM. Our study is positioned as exploratory with moderate diagnostic relevance rather than definitive biomarker discovery. The findings are preliminary and require further validation before any clinical application.

Also flagged:gastric melanomaPrimary gastric melanomamalignant melanomatumor
Journal Article 2026-08-24 No Snippets Pham BV, Ha NH, Ta VT, Nguyen HTT.
Show Full Abstract

<h4>Introduction and importance</h4>Primary gastric melanoma (PGM) is an exceedingly rare malignancy, especially in Asian populations, that presents major diagnostic and therapeutic dilemmas.<h4>Presentation of the case</h4>We report the case of a 53-year-old Vietnamese man who presented with only vague epigastric discomfort. During a routine esophagogastroduodenoscopy, a small pigmented lesion was incidentally discovered in the stomach. An initial biopsy confirmed the presence of malignant melanoma, supported by immunohistochemical positivity for SOX10. A subsequent comprehensive workup - including dermatological and ophthalmological evaluations and comprehensive systemic imaging - found no other primary melanocytic sites, thereby fulfilling three of Blecker's criteria. A total laparoscopic gastrectomy with D2 lymphadenectomy was performed. Postoperative histopathology showed no residual tumor in the gastric specimen or in any of the lymph nodes examined.<h4>Clinical discussion</h4>The absence of established treatment standards for PGM necessitated a complex multidisciplinary discussion. Key questions centered on balancing oncologic radicality (total gastrectomy, D2 lymphadenectomy) with patient quality of life, especially given the likelihood of complete excision at the time of the initial biopsy. The finding of no residual disease post-resection complicated the indication for adjuvant systemic therapy. The diagnosis was supported by SOX10 staining and the fulfillment of Blecker's criteria (pending completion of the 6-month surveillance period). The upfront radical approach, though potentially excessive, preempted the need for a second operation to confirm pathological clearance.<h4>Conclusion</h4>This report contributes to the limited literature on PGM, highlighting the importance of early detection, multidisciplinary discussion, and long-term follow-up in such rare presentations.

Also flagged:valdiateSIRT1Huntington's diseasechoreadepressionParkinson's disease
Journal Article 2026-08-24 No Snippets Shyam M, Ismail MDW, Sharma D, Srirangan P, Muniyan R, Prince SE.
Show Full Abstract

<h4>Background</h4>Huntington's disease is prevalent globally, with approximately 4.88 cases per 100,000 people, based on a systematic review and meta-analysis of 33 studies published between 2010 and 2022. Despite its significant prevalence, no proper treatment is available that directly addresses Huntington's disease. The existing treatments focus on symptom management, such as controlling chorea and psychiatric symptoms. The drugs used for this purpose may also cause side effects, including depression and Parkinson's disease.<h4>Methods</h4>An integrated experimental and computational approach was employed, involving cold maceration extraction of <i>Sesamum indicum</i>, LC-MS/MS based phytochemical profiling, ADMET screening, molecular docking, molecular dynamics simulations, and MMBPSA binding free energy analysis to identify potential inhibitors of Huntington's diseases associated targets.<h4>Results</h4>Among the LC-MS/MS identified compounds, eight compounds satisfied the ADMET criteria. Valdiate (PubChem CID: 129715809) demonstrated favourable multi-target binding with docking score of -7.3 kcal/mol against HDAC4 and -8.9 kcal/mol against HDAC7. Molecular dynamics simulations confirmed stable protein-ligand interactions, while MMPBSA analysis yielded binding free energies of -23.22 ± 2.45 kcal/mol (HDAC4) and -28.27 ± 2.28 kcal/mol (HDAC7), identifying Valdiate as the most promising potential inhibitor.<h4>Conclusion</h4>Valdiate may serve as a potential inhibitor of mutant huntingtin-associated pathological pathways, pending further <i>in-vitro</i> and <i>in-vivo</i> validation.

Also flagged:proteasesbiofilm formationoral diseasesdental cariesperiodontal diseaseoral mucosal disorders
Journal Article 2026-08-24 No Snippets Rarinca V, Ionescu C, Visternicu M, Ciobica A, Vlasie I, Trifan A, Burlui V, Miler AA, Luca A, Novac O, Novac B.
Show Full Abstract

The oral cavity represents a highly complex biochemical ecosystem in which host tissues, saliva, microbial communities, and environmental factors interact dynamically to maintain health or promote disease. This narrative review examines a comprehensive overview of the biochemical processes occurring within the oral cavity and examines their implications for oral health and disease. Key aspects discussed include the biochemical composition and functions of saliva, the metabolic activity of the oral microbiota, biofilm formation, and the molecular mechanisms underlying major oral diseases such as dental caries, periodontal disease, and oral mucosal disorders. Particular emphasis is placed on the role of biochemical homeostasis, microbial dysbiosis, inflammation, and oxidative stress in disease pathogenesis. Although substantial progress has been made in characterizing these mechanisms, current evidence remains largely derived from <i>in vitro</i> or reductionist models that do not fully replicate the complexity of the oral environment. In addition, inter-individual variability and host-microbial interactions are still incompletely understood, limiting full translational application. This review also discusses the emerging role of salivary biomarkers as non-invasive diagnostic and prognostic tools, as well as potential therapeutic strategies targeting biochemical pathways. By critically integrating current evidence, this work highlights both advances and remaining gaps in oral biochemistry, emphasizing its relevance for the development of more precise preventive, diagnostic, and personalized approaches in oral healthcare.

Also flagged:mineral formationmineralizationdepressive disordersosteoporosisextracellulardepression
Journal Article 2026-08-22 No Snippets Schröder HC, Wiens M, Wang S, Neufurth M, Louw S, Johnson O, Hoff S, Wang X, Müller WEG, Kapewangolo P, Shafombabi F.
Show Full Abstract

<h4>Background</h4>Sceletium tortuosum is an endemic plant in Southern Africa, traditionally used as kanna by the indigenous people and also exploited commercially due to its mood-elevating properties. Mesembrine, a major alkaloid from this plant, acts as a selective serotonin reuptake inhibitor (SSRI), a group of drugs commonly used in antidepressant therapy but with the undesirable side effect of impairing bone mineral formation. The aim of this study was to investigate the potential effects and mechanisms of extracts from this plant on mineralization.<h4>Methods</h4>Both aqueous and ethanolic extracts were prepared from S. tortuosum. Their effects on mineralization were studied using bone-forming SaOS-2 cells. In addition to the effects on cell viability and alkaline phosphatase (ALP) activity, the radical scavenging activity of the extracts was determined using the 2,2-diphenyl-1-picrylhydrazyl (DPPH) and 2',7'-dichlorodihydrofluorescein diacetate (H<sub>2</sub>DCF-DA) assays. The alkaloid composition was analyzed by liquid chromatography-mass spectrometry (LC-MS).<h4>Results</h4>It is shown that the S. tortuosum extracts, in contrast to SSRIs, have a significant mineralization-promoting activity in vitro. This result was obtained despite the fact that, as is characteristic for SSRIs, the transient attenuation of the serotonin-induced suppression of cell viability that occurs with increasing serotonin concentrations was inhibited in SaOS-2. The activity of ALP, a marker of differentiated osteoblasts, remained unchanged. It was found that the plant extracts exhibit a pronounced radical scavenging activity not only in the DPPH assay, but also intracellularly using the cell-permeant probe H<sub>2</sub>DCF-DA. The alkaloid fraction of the aqueous extract of S. tortuosum consists primarily of the two bioactive alkaloids mesembrine and mesembrenone. Mesembrine proved to be only a weak inducer of mineralization.<h4>Conclusions</h4>The results suggest that the observed osteogenic effects of S. tortuosum are due to a tuned interaction with signaling pathways involving serotonin receptors, serotonin transporters and reactive oxygen species. Due to its mineralization-promoting properties, we conclude that S. tortuosum is of potential interest for the long-term treatment of depressive disorders as an adjunct to antidepressant drugs that increase the risk of osteoporosis.

SERPINC1
Also flagged:Frontotemporal dementiabehaviouralprimary progressive aphasiasemantic dementiaSDprogressive nonfluent aphasia
Journal Article 2026-08-22 ✓ 1 Snippet Savage S, Aung O, Foxe D, Piguet O.
In-Text Gene Mentions

…bvFTD groups (totalACE-III, both p values…

Show Full Abstract

<h4>Introduction</h4>Recent evidence suggests that individuals with behavioural variant frontotemporal dementia (bvFTD) may experience language changes in a similar, but less severe manner, than what is observed in semantic dementia (SD). Few studies, however, have specifically compared these patient groups or considered the cognitive underpinnings. To explore this in more depth, this study aimed to profile patterns of language performance within both "probable" and "possible" categories of bvFTD and to compare them to SD, while also considering the relationships between language and executive function measures.<h4>Methods</h4>Participants included 106 probable bvFTD, 43 possible bvFTD, 42 SD, and 112 healthy controls from the FRONTIER clinic. Data analysed included the Addenbrooke's Cognitive Examination (ACE-III), single word processing (SYDBAT) and executive function measures (word generativity, mental flexibility, response inhibition and working memory).<h4>Results</h4>Naming and semantic association impairments frequently occurred in probable bvFTD (51% and 49% respectively). Approximately one quarter of possible bvFTD patients also showed language impairments. The SD pattern of pronounced naming impairment as compared to other single word tasks, was not found in the bvFTD groups. Semantic measures from the ACE-III predicted language performance in bvFTD groups; response initiation and suppression also emerged as a significant predictor.<h4>Conclusion</h4>Naming and semantic association deficits commonly arise in probable bvFTD, but may also be observed in some patients with possible bvFTD. The pattern of impairments in bvFTD were not wholly consistent with those seen in SD. Both semantic and executive function measures may be associated with language performance deficits observed in bvFTD.

HTT
Also flagged:Huntington's DiseaseHDhereditaryneurodegenerative diseasemitochondrialMotor dysfunction
Journal Article 2026-08-22 ✓ 1 Snippet Singh S, Kumar A, Goel F, Pandey RK, Singh L, Kumar D, Sharma PK.
In-Text Gene Mentions

…repeat in theHTTgene, leading to…

Show Full Abstract

<h4>Introduction</h4>HD is a hereditary neurodegenerative disease caused by the amplification of the CAG trinucleotide repeat in the HTT gene, leading to a Mutant Huntingtin (mHTT) protein that dysregulates transcription, promotes protein aggregation, induces neuroinflammation, and impairs mitochondrial function. Motor dysfunction, cognitive decline, and mental disorders are manifestations of these biochemical abnormalities. Effective disease-modifying treatments are still limited, even with recent improvements. This review investigates the increasing relevance of Klotho, an anti-aging protein with neuroprotective, antioxidant, and anti-inflammatory characteristics, as a possible therapeutic target in Huntington disease.<h4>Methods</h4>We did a comprehensive literature search across PubMed, Scopus, and Web of Science databases. Klotho's molecular functions in neural protection, energy metabolism, oxidative stress reduction, and anti-inflammatory signalling were investigated in the context of HD pathogenesis.<h4>Results</h4>Klotho appears to influence critical neurodegenerative processes involved in HD. It inhibits NF-κB and NLRP3 inflammasome activity, stimulates antioxidant enzyme expression (SOD, catalase), promotes GluN2B-NMDA receptor-mediated synaptic plasticity, and increases astrocytic aerobic glycolysis via FGFR1-ERK signaling. These functions may mitigate mHTT- induced neuronal damage. Pharmacologic treatments (e.g., PPAR-γ agonists), vitamin D, and lifestyle interventions can all modulate klotho expression.<h4>Discussion</h4>Klotho exhibits neuroprotective effects in Huntington's disease by reducing NF-κB/NLRP3- mediated inflammation, strengthening antioxidant defenses, promoting GluN2B-NMDA- dependent synaptic plasticity, and improving astrocytic metabolic support via FGFR1-ERK signaling. One intriguing treatment approach for mutant huntingtin-induced neurotoxicity is the modification of klotho expression.<h4>Conclusion</h4>Klotho is a promising neurochemical modulator with disease-modifying properties in HD. Its multifunctional protective activities are consistent with important pathological markers of HD, necessitating more preclinical and clinical studies to confirm its translational value.

Also flagged:oxygenheat-shock proteinsendoplasmic-reticulum proteinmitochondrialorganizationmetabolism
Journal Article 2026-08-22 No Snippets Uchuwittayakul A, Phuthong W, Kong C, Rajitdumrong C, Adisornprasert Y, Kumwan B, Meachasompop P, Ely SSP, Vangnai K, Srikulnath K, Srisapoome P.
Show Full Abstract

Semah mahseer (<i>Tor douronensis</i>) is a high-value freshwater cyprinid native to Southeast Asia. This study characterized acute transcriptomic responses in liver and white skeletal muscle following 6 h exposure to hyperthermia (35 °C), hypoxia (dissolved oxygen 2 mg/L), or their combination. Thirty-two RNA-seq libraries yielded approximately 48,504 annotated unigenes. Relative to the control, hyperthermia produced 7776 differentially expressed genes (DEGs) in liver and 1121 in muscle, hypoxia produced 2451 and 318 DEGs, and combined exposure produced 4952 and 717 DEGs, respectively. The response involved heat-shock proteins, endoplasmic-reticulum protein processing, glycolytic and oxygen-sensing pathways, mitochondrial and contractile programs, and apoptosis-associated signaling. Expression directions for 20 selected transcripts were compared by qRT-PCR; the reported cross-platform correlation was <i>r</i> = 0.91, although interpretation remains conditional on validation of reference-gene stability. Qualitative scanning electron microscopy showed region-dependent disruption of skeletal-muscle organization under the stress treatments. Because the study used one acute endpoint, two replicate tanks per condition, a de novo transcriptome, and no direct postmortem flesh-quality measurements, the findings should be interpreted as mechanistic hypotheses requiring independent validation.

Also flagged:Prion proteinPrPprionpathogenesisprion diseasesprion disease
Journal Article 2026-08-22 No Snippets Laginha I, Schmitz M, da Silva Correia Â, Saleem T, da Silva Correia S, Zafar S, Younas N, Canaslan S, Göbel S, Root E, Breitbarth M, Fischer AL, Dittmar K, Žakova D, Hermann P, Zerr I.
Show Full Abstract

The conversion of native prion protein (PrP) into its misfolded isoform, scrapie (PrP<sup>Sc</sup>) and its intracellular accumulation represent central events in the pathogenesis of prion diseases. Reduction of native PrP in the central nervous system (CNS) has emerged as a promising strategy for treatment and prevention of prion diseases in humans. To facilitate translation into clinical practice, it is essential to identify at-risk individuals through biomarker development and to elucidate PrP behaviour across prion disease subtypes and biological fluids. Measurements of PrP in accessible biofluids, such as plasma and cerebrospinal fluid (CSF), may provide a pharmacodynamic readout and enable monitoring for PrP-targeted therapies. This study systematically quantifies PrP in plasma and CSF of individuals with sporadic and genetic prion diseases, healthy controls (HC), patients with non-neurodegenerative neurological conditions (ND) and Alzheimer's disease (AD). We analysed 136 plasma and 84 CSF samples, including HC, AD, sporadic Creutzfeldt-Jakob disease (sCJD), as well as symptomatic patients and asymptomatic carriers of the mutations D178N, E200K and P102L. Quantification of PrP was performed using a BetaPrion Human ELISA. Statistical analyses assessed differences between diagnostic groups, associations with demographic factors and <i>PRNP</i> codon 129 polymorphism, and diagnostic accuracy via ROC curves. Plasma PrP was significantly reduced in patients with sCJD (<i>P</i> = 0.043), in symptomatic patients with the E200K (<i>P</i> = 0.0078) and in both symptomatic and asymptomatic D178N carriers (<i>P</i> = 0.0002) compared to HC. Furthermore, symptomatic and asymptomatic D178N carriers had significantly lower plasma PrP levels than patients with AD (<i>P</i> = 0.0025 and <i>P</i> = 0.0041, respectively). In CSF, PrP concentrations were notably lower in D178N symptomatic patients (<i>P</i> = 0.0026) versus non-neurodegenerative (ND) controls. Plasma PrP levels showed no association with age, sex or disease onset and were lower in genetic prion disease patients with the methionine/valine (MV) genotype at <i>PRNP</i> codon 129. The diagnostic accuracy for PrP quantification in plasma as a biomarker discriminated D178N asymptomatic carriers [area under the curve (AUC) = 0.96] and D178N symptomatic patients (AUC = 0.90) from HC with excellent accuracy. In CSF, PrP quantification discriminated D178N symptomatic patients from ND with good accuracy (AUC = 0.64). Taken together, this study defines a characteristic profile of persistently low plasma and CSF PrP in D178N symptomatic and asymptomatic mutation carriers. Low plasma levels in sCJD and E200K, in contrast to P102L, are puzzling. Mutation-specific patterns of PrP need to be considered for monitoring purposes in clinical trials.

medRxiv 2026-08-22 Preprint (No Snippets API) Banfield LR, Pilling LC, Melzer D, Shearman JD, Knapp KM, Atkins JL.
Show Full Abstract

<h4>Purpose</h4> Haemochromatosis due to HFE -C282Y homozygosity can lead to excess iron absorption and is typically associated with liver malignancy, plus widespread arthritis. Recent evidence suggests that limb fractures are more common, but little is known about vertebral effects. This study investigated the association of vertebral compression fractures, assessed with intelligent dual-energy X-ray absorptiometry (iDXA), and HFE genotype in a large community cohort. <h4>Methods</h4> UK Biobank data from 227 European genetic ancestry C282Y homozygotes (mean 64.6 years) and 234 age, sex, and BMI-matched controls without common HFE haemochromatosis variants were included. Lateral vertebral assessment scans (iDXA, GE-Lunar) were acquired at imaging reassessment (2014-2020) and reviewed, blind to genotype, for radiological evidence of vertebral fracture. Matched logistic regression models assessed associations between C282Y homozygosity and vertebral fractures. <h4>Results</h4> 78 vertebral fractures (16.9%) were identified within 461 participants. Male C282Y homozygotes had increased odds of vertebral fracture (n=22/89, 24.7%) compared to participants without HFE alleles (n=9/90, 10.0%); Odds Ratio [OR]: 2.95, 95%CI: 1.28–6.85, p=0.01. The association persisted after excluding individuals with a diagnosis of haemochromatosis (OR: 3.37, 95% CI: 1.41–8.10, p=0.007). No excess fracture risk was observed in female C282Y homozygotes (n=23/138, 16.7%) vs those without HFE alleles (n=24/144, 16.7%); OR: 0.99, 95%CI: 0.53-1.87, p=1.00. <h4>Conclusion</h4> In this community-based imaging study, male HFE C282Y homozygotes had a markedly higher likelihood of vertebral fractures than those without HFE variants. These findings support further evaluation of vertebral fracture assessment in C282Y homozygous men to ensure prompt treatment to prevent future fracture if appropriate.

medRxiv 2026-08-22 Preprint (No Snippets API) Pagnuco I, Eyre S, Rattray M, Morris AP.
Show Full Abstract

Type 2 diabetes (T2D) is a complex metabolic disorder characterized by hyperglycemia and insulin resistance. Although genome-wide association studies (GWAS) have identified >600 T2D risk loci, the causal genes and the relevant tissues mediating these associations remain largely unresolved. To address this challenge, we performed tissue-specific, ancestry-aware transcriptome-wide association studies (TWAS) across six T2D-relevant tissues: subcutaneous adipose, visceral adipose, brain hypothalamus, liver, skeletal muscle, and pancreas. We conducted ancestry-specific multi-tissue TWAS in European ancestry (EUR) data using summary statistics from the largest EUR GWAS (242,283 cases and 1,569,734 controls) and pre-trained gene expression prediction models derived from 689 EUR individuals from the Genotype-Tissue Expression (GTEx) Project. Conditional analyses were performed to identify independent TWAS signals. We identified 684-750 significant gene-T2D associations per tissue (P < 1.919 × 10 −6 ), implicating both established and novel candidate genes. Among these, JAZF1 and IDE showed consistent association signals across all six tissues, whereas TCF7L2 and WSF1 exhibited heterogeneous effects restricted to a subset of T2D-relevant tissues. Conditional analyses further refined these signals to 289–322 independent TWAS signals per tissue. Together, these finding highlight substantial regulatory heterogeneity in the genetic architecture of T2D and underscore the importance of tissue context in interpreting disease-associated loci. Cross-ancestry replication of EUR-derived TWAS signals was evaluated in African American (AFA) individuals. We conducted an AFA-TWAS using summary statistics from the largest AFA GWAS (50,251 cases and 103,909 controls) in combination with gene expression prediction models trained in 111 AFA individuals from GTEx. We observed significant enrichment of EUR-derived T2D TWAS signals in the AFA TWAS across subcutaneous adipose, visceral adipose, skeletal muscle, and pancreas, whilst enrichment was weaker in liver, likely reflecting limited sample size. Overall, our findings demonstrate that integrating tissue-specific and ancestry-aware TWAS refines the identification of causal genes for T2D, with cross-ancestry replication supporting the robustness of these signals and cross-tissue analyses revealing context-specific effects. However, they also highlight the limited availability of non-EUR datasets and the need for larger, more diverse ancestry-specific transcriptomic resources.

Also flagged:CREBsleepoctopaminebiogenicaminetranscription factor
Journal Article 2026-08-21 No Snippets Zhu S, Rao Z, Yin Y, Chen S, Deng H.
Show Full Abstract

Starvation induces robust food-seeking behavior in animals as a fundamental survival response. In Drosophila, biogenic amine octopamine (OA) plays a critical role in starvation-induced locomotor hyperactivity and awakeness, while the underlying signaling cascade remains not fully understood. Here, we demonstrated that the conserved transcription factor cAMP-Responsible Element Binding Protein (CREB), activated during starvation through the SIK2-CRTC pathway, contributes to starvation-induced sleep reduction. Mechanistically, we found that tyramine β-hydroxylase, the rate-limiting enzyme for OA synthesis, is upregulated by starvation in a CREB-dependent manner. Selective silencing of CREB in OA-producing neurons ameliorated OA-induced sleep suppression, and CREB loss-of-function mutations can partially rescue sleep fragmentation in a Drosophila model of Huntington's disease. Collectively, these findings reveal a novel regulatory role for CREB in sleep homeostasis through the transcriptional control of OA biosynthesis.

Also flagged:spliceosomechromatincancerneoplastic diseasestumormethylation
Journal Article 2026-08-21 No Snippets Huang H, Yu Y, Zhou Q, Deng G, Li Y, Zeng F.
Show Full Abstract

RNA splicing expands the functional output of eukaryotic genomes by enabling individual precursor messenger RNA (pre-mRNA) to generate multiple mature transcripts with protein‑coding and regulatory properties. Its fidelity and plasticity depend on coordinated interactions among the spliceosome, trans-acting splicing factors, cis-regulatory elements, and chromatin- and RNA-associated regulatory mechanisms. However, how these components collectively generate cell- and tissue-specific splicing programs, and how their disruption drives disease, remain incompletely understood. In this review, we integrate the molecular regulation of RNA splicing with its physiological, pathological and therapeutic consequences. We describe how spliceosome assembly, splicing regulatory elements, splicing factors, epigenetic modifications, and post-transcriptional processes determine splice-site selection. We then examine how regulated isoform programs support development, tissue specialization, homeostasis, circadian timing, and stress adaptation, and how their failure contributes to cancer and diverse non-neoplastic diseases. In cancer, we highlight the bidirectional interplay between splicing dysregulation and the tumor microenvironment, through which metabolic reprogramming and immune suppression reinforce aberrant splicing. Finally, we assess strategies that modulate the spliceosome, splicing-factor activity, or disease-associated transcripts, and present a perspective on how multi-omics, artificial intelligence, targeted delivery, and combination with immunotherapy could collectively advance the discovery and precision of splicing-directed therapies. We suggest that safe clinical translation will require greater selectivity, reduced off-target toxicity, and preservation of essential physiological splicing.

Also flagged:shikonintriple‑negative breast cancercancerdeathIDO1SHK
Journal Article 2026-08-21 No Snippets Pan T, Feng Z, Shang T, Jiang J, Zhang F.
Show Full Abstract

Shikonin (SHK) possesses potent antitumor activity; however, its severe non‑selective toxicity greatly limits the feasibility of conventional systemic administration for cancer therapy. Likewise, mild photothermal therapy (PTT) has intrinsic limitations, including inadequate induction of immunogenic cell death (ICD) and compensatory activation of immunosuppressive pathways, such as increased IDO1 activity and PD‑L1 expression. In the present study, low‑dose SHK and gold nanorods were co‑encapsulated within a supramolecular hydrogel (mPECT) and administered by intratumoral injection to achieve localized combination therapy with mild PTT. Mild PTT rapidly triggered antitumor immune activation within the immunosuppressive tumor microenvironment, whereas SHK sustained this response by suppressing PTT‑induced IDO1 activation and PD‑L1 upregulation and by markedly enhancing ICD. The mPECT hydrogel enabled prolonged local retention and controlled release of SHK, minimizing rapid systemic exposure while preserving therapeutic efficacy at the tumor site. This localized combination of SHK and mild PTT elicited a robust adaptive antitumor immune response that not only inhibited primary tumor growth but also suppressed the progression of untreated distant tumors and generated durable antitumor immune memory. These findings indicate that a single intratumoral administration of low‑dose SHK‑loaded hydrogel combined with mild PTT can induce potent systemic antitumor immunity, supporting the further development of localized SHK‑based therapeutic strategies for the treatment of immune‑cold tumors.

PCDH17
Also flagged:organizationpsychiatric disordersautism spectrum disorderobsessive-compulsive disorderschizophreniadepression
Journal Article 2026-08-21 ✓ 5 Snippets Hoshina N, Boeckers JM, Johnson-Venkatesh EM, Hoshina M, Matsumoto K, Das A, Rally VR, Sant J, Terauchi A, Kinoshita S, Inoue T, Umemori H.
In-Text Gene Mentions

…two δ2-protocadherins (PCDHs),PCDH17and PCDH10, which…

PCDH17and PCDH10 are…

…These results identifyPCDH17and PCDH10 as…

…( 9 ),PCDH17and PCDH10, are…

…10 ), withPCDH17and PCDH10 expression…

Show Full Abstract

The basal ganglia (BG) contain multiple parallel neural circuits, each of which may control different behaviors. However, how the distinct parallel BG circuits are molecularly organized is not known. Here, we show that two δ2-protocadherins (PCDHs), PCDH17 and PCDH10, which are homophilic cell adhesion molecules, establish and define two distinct indirect BG circuits that regulate different behaviors. PCDH17 and PCDH10 are expressed in a complementary expression pattern in the BG, anatomically defining two parallel indirect BG connections. Indirect pathway-specific <i>Pcdh17</i> and <i>Pcdh10</i> conditional knockout (cKO) mice show impaired establishment of the indirect BG circuits in a region-preferential manner. Last, the <i>Pcdh17</i> cKO mice show defects in task learning, while the <i>Pcdh10</i> cKO mice show defects in motor/sensory habituation. These results identify PCDH17 and PCDH10 as the molecular organizers for two distinct indirect BG circuits regulating different behaviors and reveal the molecular mechanisms for organizing parallel BG circuits.

Also flagged:Wilson diseaseWDhepatic steatosiscirrhosismetabolic syndromecryptogenic cirrhosis
Journal Article 2026-08-21 No Snippets Alkhateb O, Rockey DC, Barada K.
Show Full Abstract

Wilson disease (WD) is a rare disorder that may be missed because of atypical presentations. We present a 47-year-old asymptomatic man who was incidentally discovered to have hepatic steatosis and cirrhosis without features of the metabolic syndrome and with normal physical examination and liver function tests. Very low ceruloplasmin and high urine copper prompted evaluation for WD. He had no Kayser-Fleischer rings. Genetic testing revealed a novel homozygous splice-site <i>ATP7B</i> variant (NM_000053.2:c.1707+2dupT p.(?)), the first reported case of homozygosity for this mutation. This case highlights the importance of considering WD in patients with unexplained hepatic steatosis and cryptogenic cirrhosis.

Also flagged:Metabolic Diseasesredox homeostasismitochondrialmetabolismsynthesisprotein S-glutathionylation
Journal Article 2026-08-21 No Snippets Gromadzka G, Kąkol M, Klimkiewicz M, Bendykowska M.
Show Full Abstract

Glutathione is an abundant intracellular low-molecular-weight thiol that contributes importantly to cellular redox homeostasis. Besides its well-established role in the antioxidant defense of the cell, glutathione regulates mitochondrial function, metabolism of toxicants, protein thiol oxidation/reduction, redox signaling, and immunity. Disturbances in glutathione metabolism have been shown to play a role in various diseases; however, it has become clear that changes in glutathione metabolism are a part of a complex, multifactorial process. In this review, we summarize current knowledge of the molecular mechanisms governing glutathione synthesis, recycling, compartmentalization, and biological functions, with particular emphasis on redox signaling, the nuclear factor erythroid 2-related factor 2/Kelch-like ECH-associated protein 1 (Nrf2/Keap1) pathway, and reversible protein S-glutathionylation. We further examine how disturbances in glutathione homeostasis interact with mitochondrial dysfunction, chronic inflammation, metabolic stress, and impaired cellular signaling in Parkinson's disease, Alzheimer's disease, Huntington's disease, multiple sclerosis, Wilson's disease, type 2 diabetes, and nonalcoholic fatty liver disease. We also evaluate current translational interventions targeting restoration of glutathione balance through glutathione supplementation, precursor supplementation, pharmacological modulation of endogenous antioxidant mechanisms, dietary interventions, and changes in lifestyle. Despite the fact that many interventions have been promising at the mechanistic and experimental level, there are still insufficient clinical data because of the problems associated with glutathione availability, tissue specificity, disease variability, and a lack of sufficiently powered clinical trials. The conclusion of this review is that glutathione should not be viewed as a universal therapeutic target; instead, glutathione should be perceived as an important factor contributing to cellular resilience and able to help other disease-specific interventions. Future progress in glutathione-based interventions will likely depend on integrating redox biomarkers, patient stratification, and precision medicine strategies to identify individuals most likely to benefit from targeted modulation of glutathione homeostasis.

Also flagged:cell-cyclecancerinfectionscell cycleuterine cancerslung cancer
Journal Article 2026-08-21 No Snippets Do AT, Pham QL, Phung HTT, Pham MQ.
Show Full Abstract

<b>Background/Objectives:</b> Cyclin-dependent kinase 2 (CDK2) is a key regulator of cell-cycle progression and a potential anticancer target. This study aimed to identify alkaloid-derived CDK2 ligands using an integrated computational workflow and to obtain preliminary evidence of their effects on cancer-cell viability. <b>Methods:</b> Molecular docking with mVina and fast pulling of ligand (FPL) simulations were benchmarked using 20 experimentally characterized CDK2 inhibitors. A library of 2692 PubChem-derived alkaloids was screened, followed by ADMET evaluation, 100 ns molecular dynamics simulations, and FPL-based relative-affinity re-ranking. The three prioritized compounds were evaluated in HepG2 and HGC-27 cells using an MTT assay after 48 h of exposure. <b>Results:</b> Docking and FPL showed correlations with experimental affinity data of R<sub>Dock</sub> = 0.549 ± 0.180 and R<sub>W</sub> = -0.676 ± 0.119, respectively. <b>CID 636885</b>, <b>CID 46184320</b>, <b>and CID 101691758</b> were prioritized for detailed evaluation. All three compounds reduced cell viability, with lower IC<sub>50</sub> values observed in HepG2 cells than in HGC-27 cells. <b>CID 101691758</b> exhibited the highest growth-inhibitory activity among the tested compounds, with IC<sub>50</sub> values of 15.37 ± 0.46 µg mL<sup>-1</sup> in HepG2 cells and 52.64 ± 1.33 µg mL<sup>-1</sup> in HGC-27 cells. <b>Conclusions:</b> The workflow identified three preliminary alkaloid hits, with <b>CID 101691758</b> showing the most favorable combined computational and cell-viability profile. However, the MTT assay does not establish direct CDK2 inhibition or kinase selectivity. Biochemical CDK2 inhibition, target-engagement, and kinase-panel studies are therefore required.

NEGR1
Also flagged:lactylationtranslationalcervical cancerCCtumorGene Expression
Journal Article 2026-08-21 ✓ 1 Snippet Song J, Zhao Y, Dong C, Qi X, Guo Q, Zhuang Y, Yu C, Dong R.
In-Text Gene Mentions

…, LIPG ,NEGR1, SDR16C5 ,…

Show Full Abstract

Previous studies indicate that lactylation, a post-translational modification, may play an important role in the progression of cervical cancer (CC). However, the comprehensive roles of lactylation in influencing the tumor microenvironment, immune landscape, and prognosis of CC have yet to be fully elucidated. The bulk RNA-seq and single-cell RNA-seq datasets of CC patients were downloaded from the Cancer Genome Atlas and Gene Expression Omnibus databases, respectively. A total of 630 genes associated with lactylation activity were identified using AUCell algorithm, differential expression, and correlation analyses. Subsequently, a prognostic risk model comprising 17 genes was constructed through univariate Cox and LASSO analyses, which accurately predicted the prognosis of CC patients and was validated in an independent dataset. The nomogram, including risk scores and N staging, outperformed other clinical parameters. The high-risk group was positively related to the glycolysis pathway. Furthermore, bioinformatics analyses further indicated that the high-risk group was associated with a poorer prognosis, pro-tumorigenic pathways, and immunosuppression, and was sensitive to ulixertinib, dasatinib, nutlin-3a, and trametinib. Mendelian randomization analysis suggested that ITGA5 may be causally associated with an increased risk of CC, with caution in causal inference. Additionally, the expressions of several risk genes were validated using real-time qPCR on tissue samples from six CC patients. In conclusion, the lactylation-related gene risk model could accurately and independently predict the prognosis of CC patients, providing insights into therapeutic strategies for CC patients. These bioinformatics-based findings are exploratory and warrant further validation in preclinical and clinical settings.

VRK2
Also flagged:tumordegradationproteasomebindingmetabolismcell division
Journal Article 2026-08-21 ✓ 5 Snippets Yun Y, Gao Y, Shi Y, Zhang J.
In-Text Gene Mentions

…the homologous kinaseVRK2.…

…Notably,VRK2(PDB ID: 8Q1Z)…

…and T4 boundVRK2with lower affinity…

…VRK1, moreover, theVRK2/VRK1 affinity ratio for…

…the close homologVRK2(Fig. S19) and…

Show Full Abstract

Vaccinia-related kinase 1 (VRK1) is an oncogenic serine/threonine kinase implicated in tumor progression, yet it remains an intractable target for catalytic degradation. Herein, we report the structure-guided design of a first aptamer-PROTAC chimera for potent and selective degradation of VRK1. Through structure-guided computational truncation and optimization of a parent DNA aptamer, we engineered a high-affinity variant (T4) with a 2.4-fold improved binding affinity (<i>K</i> <sub>D</sub> = 0.61 nM) and enhanced selectivity over the homologous kinase VRK2. Conjugating T4 to a CRBN E3 ligase ligand <i>via</i> a flexible linker produced PROTAC-e, which induced rapid, sustained, and dose-dependent VRK1 degradation in HeLa cells, with a DC<sub>50</sub> of 105.8 nM and <i>D</i> <sub>max</sub> of 91%. Degradation was mechanistically confirmed to depend on the ubiquitin-proteasome system. Functionally, PROTAC-e elicited potent anti-proliferative activity (IC<sub>50</sub> = 193.8 nM) and S-phase arrest, directly linking VRK1 depletion to antitumor efficacy. This work not only provides a first aptamer-PROTAC targeting VRK1, a previously intractable kinase, but also establishes a generalizable strategy for the rational design of aptamer-PROTACs, opening a route to target kinases beyond conventional small-molecule scaffolds.

TAOK3
Also flagged:chromatininfluenza virus infectioninfectiongene expressionNRF2mitochondrial
Journal Article 2026-08-21 ✓ 1 Snippet Yang WY, Saaoud F, Xu K, Ben Issa M, Lu Y, Shao Y, Han B, Wang X, Jiang X, Wu S, Martinez L, Vazquez-Padron RI, Zhong Y, Fu M, Wang H, Yang X.
In-Text Gene Mentions

…p = 0.04),TAOK3(1.49 log2FC, p…

Show Full Abstract

<h4>Introduction</h4>R-loops, RNA-DNA hybrid structures with a displaced single-stranded DNA loop, are key regulators of transcriptional control, chromatin architecture, and genome stability and have emerging roles in inflammatory signaling. However, the relationship between R-loop abundance and strongly modulated inflammatory effector genes in metabolic inflammation and influenza virus infection remains underexplored.<h4>Methods</h4>We performed a locus-centric integrative analysis combining robust differentially expressed genes (DEGs) from multiple inflammatory and infection-related murine and human transcriptomic disease models with experimentally validated multi-cell R-loop annotations from the reference atlas RLoopBase. Our correlation framework evaluated the directional relationship between R-loop abundance and inflammatory gene expression rather than assuming disease-sample-matched R-loop measurements. We further analyzed R-loop regulatory proteins, NRF2-associated R-loop regulators, and overlaps between R-loop regulators and CRISPRi-identified mitochondrial and cellular reactive oxygen species (ROS) regulators.<h4>Results</h4>In angiotensin II-infused apolipoprotein E-deficient (ApoE-/-) mice, a model of abdominal aortic aneurysm (AAA), genomic regions encoding the top significantly upregulated genes exhibited significantly fewer R-loops than those encoding downregulated genes at days 14 and 28. Similarly, in atherosclerotic ApoE-/- mice fed a high-fat diet for 32 and 78 weeks, upregulated genes were associated with fewer R-loops than downregulated genes. Reduced R-loop abundance was also observed in genomic regions encoding the top significantly upregulated genes in liver tissues from patients with non-alcoholic steatohepatitis (NASH), as well as in monosodium urate (MSU)-stimulated lymphatic endothelial cells (LECs) and influenza virus-infected human umbilical vein endothelial cells (HUVECs). R-loop regulatory proteins upregulated during metabolic inflammation were enriched in immune and inflammatory pathways. NRF2 was identified as a regulator of 27 R-loop regulatory proteins, including 10 positively and 17 negatively regulated proteins. Furthermore, 54 R-loop regulatory proteins overlapped with CRISPRi-identified mitochondrial and cellular ROS regulators, suggesting potential reciprocal regulation between R-loop homeostasis and ROS signaling. Disease-associated changes in pro-ROS and anti-ROS R-loop regulatory proteins further linked R-loop regulation to inflammatory and oxidative stress pathways.<h4>Discussion</h4>These findings identify reduced R-loop abundance at genomic regions encoding strongly upregulated inflammatory genes as a shared feature across multiple models of metabolic inflammation and influenza virus infection. The results further suggest that immune-associated R-loop regulatory proteins and the NRF2-ROS axis may contribute to R-loop remodeling during inflammatory disease. This integrative framework provides new insight into the potential role of R-loops and ROS-sensitive R-loop regulators in inflammatory and metabolic diseases and identifies candidate pathways for future mechanistic investigation and therapeutic targeting.

DARS2
Also flagged:Leukoencephalopathycerebellar ataxiaepilepsycognitive declinedeathLBSL
Journal Article 2026-08-20 ✓ 3 Snippets Engelen M, Abbink TEM, Salomons GS, van der Knaap MS.
In-Text Gene Mentions

…pathogenic variants inDARS2identified by molecular…

…heterozygous for aDARS2pathogenic variant, each…

…Once theDARS2pathogenic variants have…

Show Full Abstract

<h4>Clinical characteristics</h4>Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) is characterized by slowly progressive cerebellar ataxia and spasticity with dorsal column dysfunction (decreased position and vibration sense) in most individuals. The neurologic dysfunction typically involves the legs more than the arms. Deep tendon reflexes are retained. Deterioration of motor skills usually starts in childhood or adolescence but may not start until adulthood. Dysarthria develops over time. Other less common features include epilepsy; learning problems; cognitive decline; and reduced consciousness, neurologic deterioration, and fever following minor head trauma. Individuals with neonatal or early-infantile onset have a severe disease course often associated with early death. Those with childhood onset have slow progression with wheelchair dependence in the teens or twenties. Adult onset is associated with slow progression and mild impairment.<h4>Diagnosis/testing</h4>The clinical diagnosis of LBSL can be established in a proband with characteristic abnormalities observed on brain and spinal cord MRI. The molecular diagnosis can be established in a proband with suggestive findings and biallelic pathogenic variants in DARS2 identified by molecular genetic testing. If molecular results are inconclusive, a functional assay to identify reduced MtAspRS enzyme activity in lymphoblasts can confirm the diagnosis.<h4>Management</h4>Treatment of manifestations: Supportive therapy includes: physical therapy and rehabilitation to improve motor function and prevent contractures and scoliosis; and anti-seizure medication, speech therapy, special education, and social work support as needed. Surveillance: Assess for new neurologic manifestations at each visit; monitor those with seizures as needed; consider brain MRI every few years to monitor progression; monitor developmental progress and educational needs at each visit throughout childhood; assess for family support needs at each visit.<h4>Genetic counseling</h4>LBSL is inherited in an autosomal recessive manner. If both parents are known to be heterozygous for a DARS2 pathogenic variant, each sib of an affected individual has at conception a 25% chance of being affected, a 50% chance of being an asymptomatic carrier, and a 25% chance of being unaffected and not a carrier. Once the DARS2 pathogenic variants have been identified in an affected family member, prenatal testing for a pregnancy at increased risk and preimplantation genetic testing are possible.

PTGIS
Also flagged:breast cancerbreast cancerslocalized diseasetumorstumorimmune responses
Journal Article 2026-08-20 ✓ 2 Snippets Rezaei Benam S, Maleknia S, Williams K, Apetoh L, Shahbazi R.
In-Text Gene Mentions

…IER3, OLAH, PRSS23,PTGIS, SLC6A9 , and…

…of HMGCS1 andPTGISperturbs lipid metabolism,…

Show Full Abstract

Triple-negative breast cancer (TNBC) is an aggressive and immunogenic subtype lacking targeted therapies. While tumor-derived exosomes are known to modulate immune function, their direct impact on human T cell plasticity and antigen specificity remains poorly defined. Here, we conducted a comprehensive single-cell multiomic analysis of primary human T cells exposed to exosomes derived from 17 genomically diverse TNBC cell lines and 35 patient samples. Integrating single-cell RNA-seq, V(D)J sequencing, non-coding RNA profiling, bulk and single-cell cytokine analyses, we uncovered conserved and subtype-specific immunomodulatory programs induced by TNBC exosomes. Exosome-treated T cells displayed skewing toward regulatory and dysfunctional phenotypes, including Th17-like, Treg, and PD-1⁺/PD-L1⁺ Tfh cells. Functional profiling revealed suppression of early activation markers and cytokine responses, alongside selective preservation of cytotoxic features in γδ T and NKT subsets. Transcriptomic and miRNA network analyses demonstrated widespread downregulation of immune effector genes (e.g., HBEGF and TNFSF9) mediated by exosome-delivered regulatory miRNAs (has-miR-98-5p). Notably, exosome-stimulated T cells displayed distinct clonotypic expansions, characterized by the emergence of five tumor-specific γδ TCR clonotypes and 30 unique αβ TCR CDR3 sequences that were absent in mock-treated controls, underscoring the role of exosomes in shaping TCR repertoire dynamics.

GPR52
Also flagged:breast cancerorganizationmembranecancerbreast tumourstriple-negative breast cancer
Journal Article 2026-08-20 ✓ 5 Snippets Hanif SZ, Kutz C, Au CC, Torregroza I, Palikhe S, Jannath SY, Fabiha T, Bhinder B, Washburn MP, Devost D, Liu S, Bhardwaj P, Evans T, Liang X, Anand PK, Tarran R, Elemento O, Dow LE, Blenis J, Hébert TE, Brown KA.
In-Text Gene Mentions

…G protein-coupled receptorGPR52in breast cancer…

…of orphan GPCRGPR52in cancer has…

…mRNA expression ofGPR52in breast tumours…

…that loss ofGPR52supports breast cancer…

…to knock outGPR52in the human…

Show Full Abstract

<h4>Background</h4>G protein-coupled receptors (GPCRs) are the largest class of membrane-bound receptors and are emerging as targets for the effective treatment of cancer. The role of orphan GPCR GPR52 in cancer has not been characterized. Low mRNA expression of GPR52 in breast tumours correlates with reduced overall survival, leading to the hypothesis that loss of GPR52 supports breast cancer progression.<h4>Methods</h4>CRISPR-Cas9 was used to knock out GPR52 in the human triple-negative breast cancer cell lines MDA-MB-468 and MDA-MB-231. 2D and 3D in vitro studies, electron microscopy, and a zebrafish xenograft model were used to assess the morphology and behaviour of GPR52 KO cells.<h4>Results</h4>Loss of GPR52 was associated with elevated levels of cAMP, increased cell-cell interaction in 2D cultures, more spindle-like morphology on collagen, altered 3D spheroid morphology, and increased propensity to organize and invade collectively. Zebrafish injected with GPR52 KO cells developed a greater total cancer area than control. RNA sequencing and proteomic analyses of GPR52-null cells revealed an increased cAMP signalling signature. Re-expression of GPR52 and inhibition of cAMP production rescued some GPR52 KO phenotypes.<h4>Conclusions</h4>GPR52 loss is a potential mechanism by which breast cancer progression may occur and supports the investigation of GPR52 agonism as a therapeutic option for breast cancer.<h4>Statement of significance</h4>Loss of the orphan GPCR GPR52 in human breast cell lines leads to increased cell clustering, hybrid/partial EMT, and increased tumour burden in zebrafish, further expanding our understanding of mechanisms driving cancer progression and opening the door to novel therapeutic approaches.

Also flagged:Tumorangiogenesistumorscancerglioblastomapancreatic ductal adenocarcinoma
Journal Article 2026-08-20 No Snippets Marcos-Zazo L, Carrera-Aguado I, Gómez-Escudero J, Berlana-Galán P, Torre-Cea I, Guerra-Paes E, Redondo-Gonzalez C, Sánchez-Mateos J, Cáceres-Calle D, Maiques Ó, Pericacho M, Fraile S, Rodrigues-Teixeira T, García-Macías C, García-Sánchez O, Benito-Garzón L, Sánchez-Juanes F, Muñoz-Félix JM.
Show Full Abstract

Tumor progression depends on an adequate blood supply to sustain oxygen and nutrients delivery. While tumor angiogenesis involves the formation of new blood vessels from pre-existing ones, vessel co-option represents a non-angiogenic vascularization strategy whereby tumor cells utilize pre-existing host vessels. Co-opted vessels have been considered refractory to anti-angiogenic therapies, and pharmacological modulation of co-opted vessels remains limited. In this study, we investigate the effects of low-dose cilengitide on tumor vascular remodeling in vessel co-option and angiogenic metastatic models. Our results reveal that cilengitide exerts distinct vascular effects depending on the mode of tumor vascularization. In vessel co-option-driven tumors, cilengitide treatment is associated with the remodeling of the co-opted vasculature into a more organized normalized vascular network, characterized by an increased number of functional blood vessels and enhanced vascular barrier integrity. In contrast, in angiogenic-driven tumors, cilengitide treatment promotes an expansion of the vascular network consistent with augmented, but structurally immature angiogenesis. Importantly, vascular remodeling in vessel co-option metastases is accompanied by enhanced blood vessel perfusion and reduced hypoxia, which correlates with enhanced responsiveness to chemotherapy. Conversely, in angiogenic metastases, the vascular network induced by low-dose cilengitide fails to support immunocompetent microenvironmental features and is associated with increased chemotherapy resistance. This study provides the first evidence that co-opted vasculature can be therapeutically targeted via integrin inhibition, suggesting vascular normalization remodeling as a potential strategy to overcome resistance in tumors undergoing vessel co-option.

Also flagged:Diarrhearotavirus gastroenteritisinfectionreverse transcriptionenvelopesrotavirus infections
Journal Article 2026-08-20 No Snippets Ali KB, Yaqub Y, Kadaura MU, Yakubu YM, Daggash BB, Shettima AB, Zango NG, Dauda MI, Daninna ZR, Yahaya M, Gadzama GB, Zailani SB.
Show Full Abstract

<h4>Background</h4>Diarrhea is a leading cause of morbidity and mortality among children in developing countries. Rotavirus is a significant cause of acute watery diarrhea in children under 5 years of age, which can be fatal. This study is aimed at investigating the prevalence of rotavirus gastroenteritis (RVGE) in children and characterizing the prevalent circulating genotypes.<h4>Material and methods</h4>A cross-sectional study was conducted, enrolling 173 children under the age of 5 years who presented with acute diarrhea lasting less than 2 weeks at the University of Maiduguri Teaching Hospital between 2017 and 2018. Stool samples were collected and screened for rotavirus antigen using the lateral flow immunochromatographic method. Stool samples that screened positive were further investigated for VP7 (i.e., G type) and VP4 (i.e., P type) rotavirus genotypes using reverse transcription-polymerase chain reaction (RT-PCR).<h4>Results</h4>The prevalence was determined to be 28% by the immunochromatographic method and 14.5% by RT-PCR (<i>N</i> = 173). The identified G types included G1, G2, G1G2, G9, G12, and G NT (G nontypeable), whereas the P types identified were P4, P6, and P8. The most frequently observed rotavirus genotype combination was G9P[6] 7 (28%), while mixed genotype infection with unusual strain G1G2P[4, 6, 8] 1 (4%) was also detected.<h4>Conclusion</h4>This study reported a high prevalence of RVGE in the northeast region of Nigeria. As the current ROTAVAC in use in routine immunization in Nigeria comes to its third year, it is necessary to evaluate the vaccine efficacy so as to reduce the deaths associated with RVGE in Nigeria.

Also flagged:Neurodegenerationphosphorylationmitochondrialneurodegenerative diseasemembranemitochondrial disease
Journal Article 2026-08-20 No Snippets Harris KE, Lascaratos G, Chau KY.
Show Full Abstract

<h4>Background/objectives</h4>Mitochondrial Complex V (Complex V [CX-V], or ATP synthase) is the terminal enzyme of oxidative phosphorylation and is responsible for the majority of cellular ATP production. An increasing body of evidence suggests that CX-V dysfunction may contribute to mitochondrial impairment observed in neurodegenerative disease. This review evaluated current research on the structure, regulation, and function of CX-V, examined the consequences of CX-V dysfunction, and assessed its proposed role in neurodegenerative disorders.<h4>Methods</h4>A comprehensive review of the published literature was carried out, with emphasis on primary research investigating CX-V structure and function, inherited CX-V disorders, and experimental evidence linking CX-V dysfunction to neurodegenerative disease. The reviewed studies used a range of experimental approaches, including structural biology, biochemical studies, patient-derived cellular models, animal models and post-mortem human tissue.<h4>Results</h4>Current evidence demonstrates that disruption of CX-V impairs ATP production, alters mitochondrial membrane potential, and oxidative phosphorylation, and that pathogenic variants cause primary mitochondrial disease. Across Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis/frontotemporal dementia, glaucoma and inherited optic neuropathies, alterations in CX-V activity, regulation and structural integrity are consistently associated with mitochondrial dysfunction. Direct evidence supporting CX-V as a primary driver of neurodegeneration remains very limited, with many observations originating from broader studies of general mitochondrial dysfunction.<h4>Conclusions</h4>CX-V dysfunction represents a recurring feature of mitochondrial impairment across a variety of neurodegenerative disorders and may exacerbate neuronal vulnerability by disrupting cellular bioenergetics. Current evidence indicates that CX-V may serve as a common downstream target of multiple pathological pathways rather than acting as a primary pathological factor. Future studies require direct assessment of CX-V activity in clinically relevant human models and patient tissues to determine its contribution to disease progression and examine its potential as a therapeutic target.

DCC
Also flagged:osteogenesiscartilage developmentcartilage formationmetabolismchromosomechromosomes
Journal Article 2026-08-20 ✓ 3 Snippets Azbergenov E, Jiang T, Yang R, Gao Q, Kou F, Liao Y, Yang Y, Liu S.
In-Text Gene Mentions

…51,905,023 bp (DCC; −log 10…

…XCR1 , andDCCwere identified.…

…42 ], andDCCparticipates in cartilage–bone…

Show Full Abstract

Growth and body conformation traits are key determinants of meat production efficiency and economic performance in sheep. However, the genetic architecture underlying these complex traits remains incompletely understood, particularly across multi-breed populations. In this study, we performed a genome-wide association study (GWAS) for seven growth and developmental traits in a combined population of 401 sheep, including Qira Black, Kyrgyz, Dorset × Hu crossbred, and Suffolk × Karakul crossbred sheep. After genotype harmonization and quality control, 47,674 autosomal SNPs were retained for analysis. Population structure was assessed using principal component analysis, and association testing was conducted using a mixed linear model incorporating breed, principal components, and a kinship matrix. A total of 44 independent loci were detected at a nominal significance threshold, encompassing 112 candidate genes. The strongest association was identified for cannon bone circumference near <i>RPS6KA5</i> (Chr7; <i>p</i> = 1.40 × 10<sup>-7</sup>). Several biologically relevant genes involved in osteogenesis, cartilage development, and metabolic regulation were detected, including <i>STEAP3</i>, <i>SLC26A2</i>, <i>PPARGC1B</i>, <i>COL11A1</i>, <i>CALN1</i>, and <i>CITED2</i>. Two genomic regions exhibited pleiotropic effects, which were identified as being associated with multiple traits, suggesting shared genetic regulation of correlated skeletal characteristics. These findings are consistent with a polygenic architecture underlying growth trait in sheep and highlight candidate genomic regions potentially involved in skeletal development and body conformation. Although further validation is required, the identified loci provide preliminary evidence for regions that may influence growth-related phenotypes and offer a reference for future molecular breeding efforts in indigenous and crossbred sheep populations.

HFEDCC
Also flagged:cancergene expressionbindingColorectal Cancerpathogenesismetastatic colorectal cancer
Journal Article 2026-08-20 ✓ 2 Snippets Hunachagi S, Alqudihi HH, AbdulAzeez S, Borgio JF, Almohazey D.
In-Text Gene Mentions

…including APC ,DCC, TP53 ,…

…mutations in theHFEgene and/or excessive…

Show Full Abstract

<b>Background/Objectives</b>: Colorectal cancer (CRC) remains a leading cause of cancer-associated mortality worldwide. The current therapeutic interventions are heavily constrained by the development of resistance and severe systemic toxicity. To address these challenges, this study integrated a multi-disciplinary framework involving high-throughput in silico screening followed by in vitro experimental validation to identify novel genetic targets of CRC and evaluate the efficacy of FDA-approved drugs. The primary objective was to identify safe and selective therapeutic agents capable of modulating their effect. <b>Methods</b>: The methodology employed a systematic screening of recent large-scale Genome-Wide Association Studies (GWASs) to pinpoint novel targets, followed by in silico pathogenicity prediction, homology modelling and high-throughput virtual screening of over 1615 FDA-approved drugs. The prioritized candidates were validated in vitro using MTT cytotoxicity assays and differential gene expression analysis across CRC cell lines (HCT116 and HT29) and a non-tumorigenic control, Human embryonic kidney cell line HEK293. <b>Results</b>: In silico analysis identified <i>CLUH</i>, <i>CLSTN3</i> and <i>SLC11A2</i> as novel potential targets. Based on in silico predicted deleterious mutations and subsequent molecular docking-based virtual screening, Telmisartan, Dutasteride and Venetoclax were prioritized. This prioritization was supported by their high binding affinity and dose-dependent cytotoxicity in MTT assays; thus, suggesting their repurposing potential for CRC treatment. Telmisartan exhibited a superior therapeutic profile not only in terms of the statistically significant cytotoxicity (<i>p</i> < 0.01), but also its selective effect on HCT116 and HT29 when compared to high safety profile in HEK293. This was further validated when Telmisartan selectively downregulated <i>CLUH</i> and <i>SLC11A2</i> in CRC cell lines, HCT116 and HT29 while maintaining expression levels in the non-cancerous HEK293 cell line remained significantly unaffected. Furthermore, a 100 ns molecular dynamics simulation confirmed the stable binding conformation and structural reliability of the SLC11A2 (Trp179Ser)-Telmisartan complex. <b>Conclucions</b>: Our findings conclude that Telmisartan is a promising candidate for drug repurposing for CRC treatment and capable of modulating selected novel biomarkers <i>CLUH</i> and <i>SLC11A2</i>. However, further multi-omics-based confirmatory studies and pre-clinical validation studies are needed in the future to confirm the long-term efficacy of this repositioning strategy.

SOX6
Also flagged:hibernationMstnSlnatrophymalnutritionneuromuscular diseases
Journal Article 2026-08-20 ✓ 1 Snippet Matsuoka N, Yamauchi A, Yamaguchi Y.
In-Text Gene Mentions

…including Tbx15 andSox6, are also…

Show Full Abstract

Skeletal muscles can undergo remodeling in response to physical, nutritional, and environmental conditions. To understand skeletal muscle remodeling associated with mammalian hibernation, we investigated the remodeling of skeletal muscles throughout hibernation in Syrian hamsters. We found that hibernating hamsters under winter-like hibernation-induction conditions exhibited lower skeletal muscle mass and thinner muscle fibers, particularly fast-twitch fibers of Type IIb and IIx, than euthermic hamsters kept under summer-like conditions. However, hamsters that were unresponsive to hibernation induction under winter-like conditions (UnHIB) were less susceptible to decreases in muscle mass and fiber size. The expression levels of Mstn and Sln, which were predominantly detected in fast-twitch or slow-twitch muscle fibers, respectively, were significantly altered in hibernating but not in UnHIB hamsters. Thus, we identified skeletal muscle remodeling associated with hibernation.

Also flagged:Alzheimer diseaseADcircadian rhythmsmitochondrialcircadian rhythmretinal degenerative diseases
Journal Article 2026-08-20 No Snippets Chintalapally S, Rajanala K, Upadhyay A.
Show Full Abstract

The development of Alzheimer disease (AD) involves a cluster of pathogenic processes, including amyloid-beta (Aβ) deposition, tau-mediated neurodegeneration, chronic neuroinflammation, oxidative stress (OS), metabolic dysregulation, and disruption of circadian rhythms. Nuclear hormone receptor, Retinoic Acid-Related Orphan Receptor Alpha (RORα) was shown to regulate multiple neuroprotective pathways such as inflammatory signaling (NF-κB suppression), mitochondrial integrity and mitophagy, redox homeostasis [upregulation of glutathione peroxidase 1 (GPX1), and mitochondrial superoxide dismutase 2, (SOD2)], calcium-dependent synaptic architecture [inositol 1,4,5-trisphosphate receptor type 1 (ITPR1), Purkinje cell protein 4 (PCP4)], and circadian rhythm stability [period 2 (PER2), brain and muscle ARNT-like 1 (BMAL1)]. Multi-omics network analyses place RORα within regulatory networks that are co-associated with key AD-related genes and supports an associational, network-based relationship for <i>RORA</i>. Preclinical gene-augmentation studies using adeno-associated viral vectors report that RORα overexpression reduces APP levels, remodels the complement regulator CD59 glycoprotein (CD59), inhibits OS, and enhances neuronal survival, although these effects were established largely in retinal and other non-AD systems. These findings support the potential of <i>RORA</i> as a therapeutic target through genetic intervention, but direct demonstration of AD-modifying efficacy <i>in-vivo</i> is still lacking. Investigational <i>RORA</i>-focused gene therapy in retinal degenerative diseases provides proof-of-concept for, but does not yet establish, applicability within the central nervous system. Taken together, this evidence nominates <i>RORA</i> as a candidate system-level regulator that may help restore disrupted homeostatic transcriptional networks in AD, a hypothesis that remains to be tested. We propose that RORα functions as a transcriptional hub coupling three homeostatic axes that fail in AD; the circadian, mitochondrial-metabolic, and immune-inflammatory axes, and that its regional expression changes in AD (hippocampal up-regulation vs. suprachiasmatic down-regulation) represent a compensatory response that ultimately fails. Cell-type-specific expression profiling is required to determine in which regions augmentation may be therapeutically appropriate. Restoring RORα is therefore could be network-stabilizing rather than single-pathway intervention.

OLFM4
Also flagged:ulcerative colitisCell-cell communicationsecretionidiopathic inflammatory disorderpathogenesisimmune responses
Journal Article 2026-08-20 ✓ 1 Snippet Li P, Zhang Y, Zhao L, Wang Y, Hu H, Guo S, Zhang T, Lin Z, Lin J, Zeng K, Zhong L, Liu C, Sun B.
In-Text Gene Mentions

…upregulated genes, includingOLFM4, DMBT1, and IGHG3.…

Show Full Abstract

<h4>Background</h4>Resistance to anti-TNFα therapy (e.g., infliximab) in ulcerative colitis (UC) remains a significant clinical challenge, with the underlying cellular and spatial mechanisms poorly understood.<h4>Methods</h4>We integrated bulk transcriptomics, single-cell RNA sequencing (scRNA-seq), and spatial transcriptomics (ST) from clinical cohorts to systematically map the cellular landscape and identify key determinants of treatment response, followed by validation in independent clinical cohorts and <i>in vitro</i> functional experiments.<h4>Results</h4>Multi-omics cross-analysis pinpointed insulin-like growth factor-binding protein 5 (IGFBP5) as a fibroblast-specific, spatially enriched gene strongly associated with infliximab non-response. Functional analyses linked IGFBP5 to inflammatory pathways and a distinct immune-activated microenvironment. Cell-cell communication analysis revealed that IGFBP5-high fibroblasts exhibit enhanced crosstalk with monocytes, endothelial cells, and T cells via VEGF, MIF, and WNT signaling. Validation in clinical samples and functional experiments confirmed elevated expression of IGFBP5 and its downstream effectors EGR1 and VEGFR2 in non-responders, Mechanistically, IGFBP5 promoted activation of the VEGFR2/EGR1 signaling axis and enhanced the secretion of inflammatory mediators, including IL-6, CXCL12, and CCL2, thereby contributing to a pro-inflammatory fibroblast phenotype.<h4>Conclusions</h4>This study establishes fibroblast-derived IGFBP5 as a central mediator of anti-TNFα resistance in UC. The IGFBP5-EGR1-VEGFR2 axis may represent a candidate predictive biomarker and a promising target for overcoming treatment resistance.

CACNA1E
Also flagged:epileptic encephalopathiesinfantile epileptic spasms syndrome
Journal Article 2026-08-19 ✓ 2 Snippets Kayar ÇD, Akbaş S, Kürekçi F, Güçlü BY, Kılıç MA, Genç HM, Yıldız EP.
In-Text Gene Mentions

…patients (SCN2A, ELOVL4,CACNA1E, TRRAP) achieved seizure…

…teractions between CALM-SCN2A/CACNA1Eand PRKAC-SCN1A, whereas…

Show Full Abstract

<h4>Objective</h4>Adrenocorticotropic hormone (ACTH) is an effective treatment for infantile epileptic spasms syndrome (IESS); however, its mechanism of action remains incompletely understood. This study aimed to evaluate ACTH treatment response at the level of protein-protein interactions (PPIs) in patients with confirmed and presumed monogenic developmental and epileptic encephalopathies (DEEs).<h4>Methods</h4>Medical records of patients with DEEs followed at our center between 2017 and 2025 were retrospectively reviewed. Patients receiving ACTH therapy who harbored pathogenic, likely pathogenic, or variants of uncertain significance (VUS) were included in the study, whereas those with chromosomal abnormalities and insufficient clinical or follow-up data were excluded. Clinical and electroencephalographic (EEG) responses to ACTH therapy were evaluated at the 2-week (day 14) and 3-month follow-up visits. Maintenance of a ≥50% reduction in seizure frequency at 3-month follow-up defined responders. Gene Ontology and PPI network analyses were performed to investigate relationships between genotype and treatment response.<h4>Results</h4>Among the 245 patients with DEEs, 69 had a confirmed genetic etiology, of whom 10 met the inclusion criteria. At 2-week follow-up, 5 of 10 patients (SCN2A, ELOVL4, CACNA1E, TRRAP) achieved seizure freedom, while 3 (PIGT, SCN1A, ZNF526) showed ≥50% reduction. At month 3, 66.6% (6/9) of patients were classified as responders. At 1 year, patients with SCN2A and PIGT variants showed sustained ≥50% seizure reduction, normalization of background EEG activity, and resolution of epileptiform discharges. PPI analysis revealed network interactions between CALM-SCN2A/CACNA1E and PRKAC-SCN1A, whereas the TRRAP-ATF2 interaction showed low confidence, and no reliable interaction was identified for PIGT.<h4>Significance</h4>These findings suggest that ACTH may be associated with sustained electroclinical improvement in selected genetically defined DEEs. The identified network-level interactions between ion channel-related genes and intracellular signaling pathways provide a potential molecular framework for understanding variability in treatment response.

HTT
Also flagged:anxiety-related disordersanxietystress-related disorders
Journal Article 2026-08-19 ✓ 5 Snippets Schwert H, Salur E, Richard M, Pöllmann M, Lesch KP, Asan E, Schmitt-Böhrer A.
In-Text Gene Mentions

…(5-HT) transporter knockout (5-HTTKO) mice, a…

…in WT and5-HTTKO mice documents…

…the BLA of5-HTTKO mice.…

…is reduced in5-HTTKO mice.…

…anxiety-like behavior in5-HTTKO mice.…

Show Full Abstract

Hyperexcitability of lateral (La) and basolateral (BL) amygdalar nuclei (BLA) is a hallmark of anxiety-related disorders in humans. Excitation of BLA projection neurons (PN) is fine-tuned by inhibitory interneurons (INs), and monoaminergic afferents to the BLA modulate PN and IN activity. In the present study, BLA-neurons immunoreactive(ir) for parvalbumin (PV) or neuropeptide Y (NPY) and their interrelations with serotonergic and catecholaminergic afferents were analyzed in wildtype (WT) and in serotonin (5-HT) transporter knockout (5-HTT KO) mice, a mouse model for anxiety- and stress-related disorders. In both genotypes, PV- and NPY-ir neurons possess perisomatic appositions by serotonergic and tyrosine hydroxylase-ir afferents. Dual immunolabeling shows no colocalization of PV and NPY. Qualitative analysis of NPY/somatostatin(SOM) dual labeling in WT and 5-HTT KO mice documents colocalization of the peptides in neurons with predominantly fusiform somata, and single labeling for NPY in neurons with predominantly round somata. Quantification of PV- and NPY-ir neurons documents a reduction in numbers and densities of NPY-ir neurons of the BLA in 5-HTT KO mice while PV-ir neuron numbers and densities remain unchanged. Quantitative PCR shows increased expression of Npy receptor 2, Som receptor 4, and corticotropin releasing factor receptor 1 in the BLA of 5-HTT KO mice. mRNA for the peptides is unchanged, indicating that it may be NPY propeptide translation which is reduced in 5-HTT KO mice. Taken together, the results document an effect of life-long serotonin imbalance on the BLA NPY-system, which may contribute to increased anxiety-like behavior in 5-HTT KO mice.

Also flagged:AMLPediatricacute myeloid leukemiaLeukemiacanceracute lymphoblastic leukemia
Journal Article 2026-08-19 No Snippets Ayerbe C, Fan AE, Scanlan R, Raj R, Catueno S, Ray A, Aguirre H, McCall D, Roth M, Garcia MB, Nunez C, Sheikh IN, Garcia-Manero G, Cuglievan B, Gibson A.
Show Full Abstract

Pediatric acute myeloid leukemia (AML) is a highly heterogeneous malignancy, with cytogenetic and molecular abnormalities playing a critical role in determining prognosis and guiding treatment decisions. Despite therapeutic advances, patients with high-risk genetic mutations and translocations continue to experience suboptimal outcomes. As new targeted therapies emerge, the treatment of pediatric AML could undergo a paradigm shift, where "one-size-fits-all" chemotherapy is no longer the only frontline approach. Identifying genetic markers inform risk stratification and have greater impact on shaping the therapeutic approach, including the integration of targeted therapies such as FLT3 and menin inhibitors into frontline therapy. Furthermore, pediatric AML treatment options are being driven by recent discoveries in adult AML, broadening their clinical trials to include pediatric patients, in part due to the RACE for Children Act that went into effect in August 2020. This review identifies the most prevalent high-risk cytogenetic lesions in pediatric AML, emphasizing their incidence, prognostic significance, and implications for clinical management. By synthesizing current research on these key genetic abnormalities and their associated therapies, we aim to provide an updated perspective on the evolving landscape of high-risk pediatric AML management that can then lead to the establishment of an agile framework to rapidly evaluate, approve, and deploy novel agents.

HTT
Also flagged:AnxietyDepressionsubstance useanhedonic depressionanxiety disorderssecretion
Journal Article 2026-08-19 ✓ 4 Snippets Odierna GL, Sharpley CF, Bitsika V.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) gene promoter region…

…the serotonin transporter (5-HTT) directly influencing the…

…both BDNF and5-HTT[ 98 ,…

…the constitutionally low5-HTTexpression caused by…

Show Full Abstract

<h4>Background/objectives</h4>Depression and anxiety disorders exhibit significant clinical heterogeneity, which complicates diagnosis and treatment. This study investigated whether tripartite interactions between biological sex, the serotonin transporter gene promoter region (5-HTTLPR), and brain-derived neurotrophic factor (BDNF) G196A polymorphisms explain specific symptom-level variations.<h4>Methods</h4>A community sample of 271 Australian adults was genotyped for common 5-HTTLPR (short/long) and BDNF (G/A) variants. Participants completed self-reported measures of anxiety (SAS), depression subtypes (SDS; clinical content scales), and psychological resilience (CDRISC). Morning salivary cortisol, BMI, and substance use were assessed as potential confounds. Statistical analyses utilised a three-way factorial ANCOVA to test for interactions on raw scores, controlling for age. Significant omnibus interactions were decomposed via planned stratified ANCOVAs within each 5-HTTLPR stratum.<h4>Results</h4>The BDNF GA genotype exerted opposite effects on anxiety and anhedonia depending on sex and 5-HTTLPR background. In females, GA was associated with increased symptoms on an ss background, whereas in males, GA was associated with increased symptoms on an ll background. These effects were highly specific to anxiety and anhedonic depression, while depressed mood, cognitive, and somatic subtypes remained unaffected. Findings were independent of cortisol, BMI, smoking, alcohol use, and psychological resilience.<h4>Conclusions</h4>The findings reveal a complex, sex-dependent genetic interaction that selectively influences anhedonia and anxiety. They should be interpreted in the context of modest subgroup sizes following genotype stratification and require replication in larger independent cohorts. Nonetheless, this study highlights the value of considering sex-stratified genetic backgrounds and symptom specificity to advance personalised precision medicine in psychiatry.

SERPINC1
Also flagged:extracellulartissue homeostasiscell adhesiontumordigestionorganization
Journal Article 2026-08-19 ✓ 1 Snippet Irastorza A, Vázquez-Aristizabal P, Zumeta-Olaskoaga L, Mateo-Abad M, Guerrero P, de la Caba K, Izeta A.
In-Text Gene Mentions

…SERPINH1 , andSERPINC1), and nidogens…

Show Full Abstract

Regenerative medicine and tissue engineering approaches based on decellularized extracellular matrix (dECM) present the advantage of a relatively biomolecule-rich matrix that directs cell function in a tissue-specific manner. To evaluate compositional changes during standard ink processing, six porcine tissues (artery, breast, dermis, epidermis, muscle, and nerve) were independently decellularized and formulated into biocompatible inks, tracking matrisome complexity via comparative liquid chromatography-tandem mass spectrometry (LC-MS/MS). Results revealed a core matrisome found overlapping in all decellularized tissues, alongside tissue-specific components correlating with predicted functional definitions. Although the proportion of collagens (mostly the α1 chains of collagen type I and III) increased in the final inks, a median of 55 matrisomal proteins was detected. This complexity is far superior to non-dECM-based inks in terms of mimicking native tissues. Our results support the use of dECM-based inks and biomaterials in mimicking native tissue ECM complexity, demonstrating tissue-specific composition, which can improve future therapeutic approximations.

HTT
Also flagged:opioid dependenceopioid use disordertransmembranebindingphosphorylationneuroblastoma
Journal Article 2026-08-19 ✓ 1 Snippet Swingler M, Donadoni M, Cakir S, Bishir M, Huang W, Chang SL, Sariyer IK.
In-Text Gene Mentions

…and above includeHTT, DTNBP1, BLOC1S5, Peg13,…

Show Full Abstract

Clinically used opioids, such as morphine, primarily act through the <i>μ</i>-opioid receptor (MOR), encoded by the <i>OPRM1</i> gene, which undergoes extensive alternative splicing. More than 20 <i>OPRM1</i> isoforms have been identified, yet functional characterization has largely focused on the canonical MOR-1 variant. With the emergence of three-dimensional human cerebral organoids (hCOs) derived from induced pluripotent stem cells (iPSCs), it is now possible to model human-specific neuronal responses to opioids more accurately. In this study, we established hCOs as a functional platform to investigate the impact of morphine on <i>OPRM1</i> pre-mRNA splicing and opioid signaling. We generated iPSC-derived hCOs and neurons, after which they were treated with or without morphine and screened using cellular and molecular/biochemical assays. Our results revealed that morphine exposure selectively induced the MOR-1X isoform in hCOs and iPSC-derived neurons in a dose-dependent manner as revealed by RT-PCR and RT-qPCR. We utilized CRE/CREB overexpression plasmid and lentiviral constructs to measure effects of morphine on cyclic AMP (cAMP) signaling. Upon morphine withdrawal, cells expressing MOR-1X exhibited markedly enhanced cAMP superactivation, a molecular hallmark of opioid dependence, compared with MOR-1. Furthermore, isoform-specific knockdown of MOR-1X by a short hairpin RNA (shRNA) effectively abolished this cAMP overshoot in iPSC-derived neurons. Collectively, these findings identify MOR-1X as a morphine-inducible isoform with a potential key role in the molecular mechanisms underlying opioid signaling, adaptation, and dependence in the brain.

Also flagged:Extracellulardiabetes mellitusimmune-mediated disorderstype 1 diabetes mellitusT1DMautoimmune thyroiditis
Journal Article 2026-08-19 No Snippets Ma Y, Jiang WN, Zhou T, Sun B, Gong CJ, Guan L, Wang QF.
Show Full Abstract

Hashimoto's thyroiditis (HT) and diabetes mellitus are highly prevalent chronic immune-mediated disorders that frequently co-occur and share genetic susceptibility, T-helper (Th) 1/Th17 skewing, and regulatory T-cell (Treg) dysfunction. Among individuals with type 1 diabetes mellitus (T1DM), autoimmune thyroiditis is the most common comorbid autoimmune disease. Extracellular vesicles (EVs) have emerged as important mediators linking autoimmune and metabolic inflammation. This review compares how EVs remodel the immune microenvironment in HT, type 2 diabetes mellitus (T2DM), and related disease contexts, with attention to donor cells, cargo, recipient pathways, biomarkers, and therapeutic implications. In HT and T1DM, EVs can deliver organ-specific autoantigens, whereas in classical T2DM current evidence more strongly supports EVs as carriers of stress signals, chemokines, and immunoregulatory miRNAs that shape islet inflammation and insulin resistance rather than autoantigen presentation; latent autoimmune diabetes in adults is considered separately. Across these diseases, recurrent EV-miRNA programs and DAMP/NLRP3 signaling converge on Treg/Th17 imbalance and M1/M2 macrophage polarization. We also emphasize the marked asymmetry of evidence maturity, with substantially stronger <i>in-vivo</i> and clinical support on the T2DM side than on the HT side. This asymmetry is treated as an explicit interpretive boundary throughout the review. We assess circulating and urinary EV cargoes as liquid-biopsy candidates and discuss EV-based drug delivery, engineered immunomodulatory EVs, and modulation of EV biogenesis. Translational claims remain limited by heterogeneity, manufacturing, and safety challenges, particularly in organ-specific autoimmune disease. In this review, the term "immune-metabolic crossroads" refers to shared mechanisms, shared biomarker opportunities, and partially overlapping therapeutic entry points.

Also flagged:deathmembranescell communicationimmune responsesautophagymultiple sclerosis
Journal Article 2026-08-19 No Snippets Li X, Li L, Liu X, Liu S, Yang W, Gao J, Kang S, Wang L, Li J, Wang X, Du H, Su S, Li Z, Xu W.
Show Full Abstract

α2-3-sialylated glycosphingolipids (α2-3-GSLs) are major constituents of neuronal membranes and lipid rafts, where they shape receptor compartmentalization, signal-complex assembly, and cell-cell communication. Their biological effects, however, vary by molecular subtype, cell type, disease stage, concentration, and local microenvironment. This review synthesizes evidence on spatiotemporal alterations in α2-3-GSL profiles and their relationships to neuroinflammation, immune responses, proteostasis, and programmed cell death across Parkinson's disease, Alzheimer's disease, Huntington's disease, multiple sclerosis, and Guillain-Barré syndrome. Particular attention is given to GM1, GD1a, and GD3 and to mechanisms involving TLR4/NF-κB, PI3K/AKT, autophagy-lysosomal function, complement, damage-associated molecular patterns (DAMPs) recognition, and death-receptor signaling. Evidence is stratified into relatively well-supported, model-specific or incomplete, and conceptually inferred mechanisms. On this basis, we propose a lipid-inflammation-immunity-cell death framework that organizes potentially shared downstream processes while explicitly retaining disease-specific differences. This framework is not a validated universal causal pathway; rather, it provides an analytical structure for identifying evidence gaps and testable hypotheses. Disease-specific and parallel cross-disease studies, coupled with spatial lipidomics, <i>in vivo</i> tracing, and subtype-selective interventions, will be required to determine when α2-3-GSL manipulation is protective, neutral, or harmful and to support rational clinical translation.

Also flagged:Endometriosisbone remodelingsystemic inflammationbone resorptionHypoestrogenismferroptosis
Journal Article 2026-08-19 No Snippets Motafeghi F, Saei Ghare Naz M, Ramezani Tehrani F, Behboudi-Gandevani S.
Show Full Abstract

Endometriosis is frequently managed with hormonal suppression that can induce hypoestrogenism during a period when many patients are still accruing peak bone mass. This narrative review summarizes current clinical and mechanistic evidence on bone health in endometriosis and its treatments and discusses a preliminary conceptual framework for risk stratification and monitoring. This review discusses two hypothetical converging pathways: (1) an intrinsic pathway in which chronic systemic inflammation may shift bone remodeling toward resorption (via cytokine-mediated effects on osteoclastogenic and Wnt signaling pathways and oxidative stress), and (2) an iatrogenic pathway in which ovarian suppression, most notably with gonadotropin-releasing hormone agonists/antagonists and some progestin-based regimens, reduces estrogen exposure and can lead to measurable short-term bone mineral density loss. Available observational data generally do not show clinically meaningful bone mineral density deficits or excess fracture incidence in untreated endometriosis, but treatment-associated bone mineral density loss is well documented; long-term fracture outcomes and bone-quality measures remain insufficiently studied. We compare the skeletal safety signals across commonly used therapies, discuss the role and limitations of add-back therapy, and highlight when baseline evaluation and follow-up assessment (including consideration of trabecular bone score) may be warranted in higher-risk patients.

HTT
Also flagged:mitochondrialADPDbehavioralneurodegenerative diseasesHD
Journal Article 2026-08-19 ✓ 1 Snippet Sun L, Yu X, Yin H, Bi J, Lou H, Pei H.
In-Text Gene Mentions

…ALS, and mutantHttin HD, all…

Show Full Abstract

<h4>Background</h4>Neurodegenerative diseases (NDDs) pose a major health challenge due to their high prevalence and the lack of effective treatments; ginseng, as medicine and food homology, has potential neuroprotective effects.<h4>Methods</h4>This article provides a systematic review of research conducted over the past five years on the use of ginseng to treat NDDs, summarizing and analyzing the findings in four key areas: active components, mechanisms of action, clinical applications, and novel delivery strategies.<h4>Results</h4>Ginsenosides are the core active ingredients in ginseng, while polysaccharides, essential oils, and peptides also exert synergistic effects through various pathways; their mechanisms of action include regulating Aβ/tau protein aggregation, inhibiting microglial activation, reducing glutamate excitotoxicity, and restoring mitochondrial function and antioxidant balance. In models of AD, PD, HD, and ALS, ginseng's active components have been shown to improve both behavioral and pathological indicators, while novel delivery strategies (nanoparticles, exosomes, and engineered cellular carriers) can significantly enhance blood-brain barrier permeability and brain-targeting efficiency.<h4>Conclusion</h4>Ginseng exhibits protective effects against NDDs through multiple mechanisms of action. However, current evidence is largely limited to preclinical studies, and future efforts should focus on advancing the clinical translation of safe and effective brain-targeted delivery systems.

Research Square 2026-08-19 Preprint (No Snippets API) Karunakaran KB, Ganesh S, Mahadevan J, Purushottam M, Balakrishnan N, Amemori K, Jain S, Viswanath B.
Show Full Abstract

<title>Abstract</title> <p>Psychiatric and neurological clinical syndromes show considerable overlap, and these have been largely captured by genetic correlation studies. Detailed, hypothesis-generating investigations into the transcriptomic and interactome patterns of risk-related genes, particularly that of their first-order interactors, are lacking. In this study, we examined brain spatiotemporal expression and interactome patterns of risk genes associated with five syndromes with overlapping symptom clusters: obsessive-compulsive disorder (OCD), Huntington’s disease (HD), Parkinson’s disease (PD), schizophrenia (SZ), and bipolar disorder (BD). The disease gene set, when taken alone, showed no significant interconnectivity in the interactome. However, inclusion of first-order interactors revealed extensive connectivity, exceeding degree-matched random expectations, indicating that the disease genes are embedded within cohesive subnetworks. This enrichment persisted after hub removal, suggesting connectivity is driven by distributed, disease-relevant interactions, rather than global network structure. At the network level, OCD showed a prenatal expression signature with enrichment in foetal structures. Interestingly, the network expression profile of PD, a late-onset syndrome, resembled that of OCD, which presents earlier in life. Further analyses showed that these co-expression signals did not come uniformly from the full syndrome networks, but from groups of highly interconnected proteins that formed specific PD and OCD network modules, and occurred in close proximity in the interactome. They show a prenatal expression signature in the developing prefrontal cortex, and share enrichment for ribosome-related processes. Together, our findings support a network-based model of brain disorders in which genetic risks act through distributed, yet coherent, modules which are organised across brain regions and developmental time periods.</p>

Also flagged:autophagylysosomeHuntington diseaseHDneurodegenerative diseasepathogenesis
Journal Article 2026-08-18 No Snippets Chen KP, Ju TC.
Show Full Abstract

Huntington disease (HD) is a progressive neurodegenerative disease caused by an expanded CAG repeat in the <i>HTT</i> (<i>huntingtin</i>) gene, leading to the accumulation of mutant HTT (mHTT). IL17A (interleukin 17A), a proinflammatory cytokine primarily secreted by Th17 and γδ T cells, has been implicated in immune-mediated neurodegeneration. However, the role of IL17A in the pathogenesis of HD remains poorly understood. Here, we identify IL17A as a critical pathogenic factor in HD that promotes neuroinflammation, mHTT aggregation, and autophagy-lysosomal dysfunction. IL17A disrupts autophagic flux by downregulating CTSB and CTSD, inducing SQSTM1/p62 and MAP1LC3B-II/LC3-II accumulation, and impairing lysosomal reformation. Mechanistically, IL17A suppresses lysosomal biogenesis by inhibiting the nuclear translocation of TFE3. This regulation occurs via a novel GSK3B/GSK-3β-TFE3 signaling pathway. Therapeutic neutralization of IL17A with a monoclonal antibody (IL17A mAb) ameliorates disease phenotypes in R6/2 HD mice, improving motor performance, extending survival, and reducing gliosis. IL17A mAb also attenuates mHTT aggregation and enhances neuroprotective signaling, as evidenced by increased expression of DLG4/PSD-95, phosphorylated CREB1, and BDNF. Moreover, IL17A mAb restores autophagy-lysosomal function by facilitating the clearance of protein aggregates and upregulating lysosomal enzymes and biogenesis markers, including CTSB, CTSD, PIP5K1A, and LAMP2. These findings establish IL17A as a key modulator of HD pathophysiology and highlight IL17A inhibition as a promising therapeutic strategy for targeting autophagy-lysosomal dysfunction in HD.<b>Abbreviations:</b> 3-MA; 3-methyladenine; Aβ, amyloid beta; AIF1/Iba1, allograft inflammatory factor 1; ALP, autophagy-lysosomal pathway; ALR, autophagic lysosomal reformation; ATG7, autophagy related 7; ATG5, autophagy related 5; Baf A1, bafilomycin A1; BBB, blood-brain barrier; BDNF, brain derived neurotrophic factor; CSF, cerebrospinal fluid; CTSB, cathepsin B; CTSD, cathepsin D; DLG4/PSD-95, discs large MAGUK scaffold protein 4; GFAP, glial fibrillary acidic protein; GSK3B/GSK-3β, glycogen synthase kinase 3 beta; HD, Huntington disease; HTT, huntingtin; ICV, intracerebroventricular; IL17A, interleukin 17A; IL17A mAb, IL17A monoclonal antibody; IL17RA, interleukin 17 receptor A; IV, intravenous; LAMP2, lysosomal-associated membrane protein 2; MAP1LC3B/LC3B, microtubule-associated protein 1 light chain 3 beta; mHTT, mutant HTT; RBFOX3/NeuN, RNS binding protein, fox-1 homolog (C. elegans) 3; p-CREB1/CREB, phospho-cAMP responsive element binding protein 1; PIP5K1A, phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha; PPP1R1B/DARPP-32, protein phosphatase 1 regulatory inhibitor subunit 1B; rIL17A, recombinant IL17A; SQS, self-quenched substrate; SQSTM1/p62, sequestosome 1; MAPT/tau, microtubule-associated protein tau; TDG, tideglusib; TFE3, transcript factor E3; TFEB, transcript factor EB; Th17, T helper 17; TX-100, Triton X-100; WT, wild-type.

SOX6
Also flagged:extracellularaxonsynthesisoptic vesicleepithelial cell differentiationReverse Transcription
Journal Article 2026-08-18 ✓ 1 Snippet Sun L, Li YM, Song YW, Yang YC, Duan L, Gao Y, Li JX, Yu YK, Pang KP, Dang GF, Zhang CW.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Aim</h4>To investigate the transcriptional profiling of ocular surface ectoderm (OSE) derived from human embryonic stem cells (hESC), and identified CACNG6 and AQP3 as the surface markers of OSE.<h4>Methods</h4>hESCs were differentiated into OSE, neuroectoderm (NE), surface ectoderm (SE), and other surface ectoderm (OE) cells <i>in vitro</i>. RNA-seq was performed to analyze transcriptomic profiling of hESC-derived OSE, NE, OE, and SE. The differential expressed genes (DEGs) were identified, and Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG) databases, and protein-protein interaction (PPI) network analyses were performed to screen the signals and hub genes associated to OSE commitment. Also, the highly expressed transcription factors (TFs) and membrane proteins (MPs) in OSE cells were identified.<h4>Results</h4>Transcriptome analysis revealed that OSE development is dually regulated by signals associated with both SE and NE development. The signaling pathways such as Hippo, encoding extracellular matrix (ECM)-receptor interaction, and transforming growth factor-β (TGF-β) might delineate the surface ectodermal phenotype of OSE, with <i>FN1</i>, <i>COL1A1</i>, and <i>TGFB1</i> identified as hub genes. Additionally, pathways such as axon guidance, might elucidate the influence of NE in OSE commitment, and with <i>PAX6</i>, <i>LHX2</i>, <i>FOXG1</i>, <i>SOX2</i>, <i>MSI1</i>, and <i>DCLK1</i> recognized as the hub genes. Genes implicated in retinoic acid (RA) synthesis (<i>ALDH1A1</i>, <i>ALDH1A3</i>, and <i>RDH10</i>) exhibited high expression in OSE, indicating the significant role of the RA signaling pathway in OSE development. Furthermore, OSE-specific transcription factors and surface markers (<i>CACNG6</i> and <i>AQP3</i>) were identified.<h4>Conclusion</h4>This study reveals the transcriptome profiling of OSE, which could provide insights into the characteristics of OSE and the underlying molecular mechanisms involved in its derivation.

Also flagged:embryogenesiscell differentiationbindingparaspecklesChromatinmethylation
Journal Article 2026-08-18 No Snippets Ju LF, Han X, Zhang D, Xu HJ, Jia S, Liu MX, Liu Y, Cai YT, Chen YS, Gao CC, Zhao YL, Hao Y, Wang XJ, Li D, Zhou X, Yang Y, Han J, Yang YG.
Show Full Abstract

Asymmetric transcription of noncoding RNA LincGET is currently recognized as the earliest event regulating the first cell fate decision in mammalian embryogenesis. However, whether key protein factors modulate this process remains elusive. Here, we identify RBBP7 as the earliest protein factor regulating developmental cell fate in mammals. Loss of RBBP7 drives cells towards ICM lineage. In mouse late 2-cell embryos, unequal translation of Rbbp7 contributes to its asymmetric protein distribution, which subsequently induces inversed asymmetric histone acetylation H3K9ac by interaction with HDAC1, thereby promoting cell differentiation. Interestingly, RBBP7 and LincGET exhibit a consistent asymmetric tendency but direct different cell fates; depletion or overexpression of both Rbbp7 and LincGET restored the cell fate bias, suggesting a coordinated regulatory mechanism during initial lineage specification. In summary, our study reveals RBBP7 as a new protein factor and elucidates its role in the first cell fate decision.

Also flagged:MetabolismNeurodegenerationmovement disordersmitochondrialneuroferritinopathysynthesis
Journal Article 2026-08-18 No Snippets Vijeev A, Basha S, Nadig SS, Agarwal K, Meharchandani V, Pai AR, Mahato KK.
Show Full Abstract

Neurodegeneration with brain iron accumulation (NBIA) comprises a genetically heterogeneous group of rare movement disorders characterized by progressive neurodegeneration and selective basal ganglia iron deposition. Recent discoveries have fundamentally reshaped the understanding of NBIA, indicating that defects in coenzyme A metabolism, mitochondrial bioenergetics, lipid remodeling, autophagy-lysosomal pathways, and ferroptosis precede and promote secondary iron dyshomeostasis rather than resulting from primary abnormalities in iron metabolism. This review integrates recent mechanistic and translational evidence (2020-2026) across both common and underrepresented NBIA subtypes, including pantothenate kinase-associated neurodegeneration, phospholipase A2-associated neurodegeneration, COASY protein-associated neurodegeneration, mitochondrial enoyl-CoA reductase protein-associated neurodegeneration, mitochondrial membrane protein-associated neurodegeneration, β-propeller protein-associated neurodegeneration, fatty acid hydroxylase-associated neurodegeneration, neuroferritinopathy, and mitochondrial DNA-associated forms. Unlike previous reviews, this synthesis consolidates findings from patient-derived induced pluripotent stem cell neuronal and glial models, compartment-specific iron localization, advanced neuroimaging biomarkers, and emerging therapeutic strategies within a unified mechanistic framework. Collectively, the evidence supports a paradigm in which mitochondrial dysfunction and lipid metabolic failure initiate disease progression, whereas iron accumulation amplifies oxidative injury and lipid peroxidation, thereby increasing ferroptotic cell death and neuronal degeneration, providing an updated foundation for biomarker discovery, mechanistically informed therapeutic development, and precision medicine approaches in NBIA.

OLFM4
Also flagged:Gastric CarcinogenesisGastric cancercancerGastric intestinal metaplasiaintestinal metaplasiaIIM
Journal Article 2026-08-18 ✓ 1 Snippet Wei H, Chen W, Chen X, Zheng R, Chen H, Huang Y, Cai D, Ma C, Zheng Y, Zhang F, Qiu S.
In-Text Gene Mentions

…AQP5, TROP2, andOLFM4) show promise for…

Show Full Abstract

<h4>Background</h4>Gastric cancer remains a leading cause of cancer-related mortality worldwide, underscoring the critical need for effective prevention through the management of precancerous lesions. Gastric intestinal metaplasia (GIM) is a key precursor, with its incomplete subtype (IIM) conferring a substantially higher risk of malignant progression compared to complete intestinal metaplasia (CIM). However, IIM is not merely a static histological variant but represents a dynamic, transitional epithelial state of mixed gastric and intestinal differentiation, driven by chronic inflammation. Its accurate identification and clinical management pose significant challenges.<h4>Summary</h4>This review synthesizes current evidence on IIM as a high-risk transitional phenotype in gastric carcinogenesis. We detail its cellular origins, primarily from spasmolytic polypeptide-expressing metaplasia (SPEM) via chief cell reprogramming (paligenosis), and its characteristic hybrid molecular signature. Diagnostically, definitive subtyping relies on histochemical staining (e.g., AB-PAS), as conventional endoscopy and histology lack sufficient precision, highlighting a barrier to routine risk stratification. Epidemiologically, IIM is associated with a 4- to 11-fold increased risk of gastric cancer compared to CIM. While Helicobacter pylori eradication may induce partial regression, patients with IIM retain a significant residual cancer risk, necessitating ongoing surveillance. Emerging endoscopic techniques (e.g., narrow-band imaging) and molecular biomarkers (including DMBT1, AQP5, TROP2, and OLFM4) show promise for improving in vivo detection and risk assessment, with combinatorial biomarker strategies potentially better capturing IIM's hybrid phenotype. Current classification systems have limitations, including the frequent coexistence of subtypes and a lack of validated biomarkers for precise risk stratification.<h4>Key messages</h4>1、IIM is a biologically unstable, transitional lesion with a markedly elevated risk of progression to gastric adenocarcinoma, warranting its distinction from CIM in clinical practice. 2、 Reliance on specialized pathology for diagnosis limits widespread risk stratification, creating an urgent need for reliable endoscopic predictors and validated molecular biomarkers. 3、Even after successful H. pylori eradication, patients with IIM require long-term endoscopic surveillance due to persistent cancer risk. Future strategies must integrate IIM subtyping into personalized surveillance protocols to enhance gastric cancer prevention.

Also flagged:infectionprovirusesHIV infectionproviruscell surfacecell-surface
Journal Article 2026-08-18 No Snippets Delley CL, Shah S, Joslin KM, Park YP, Demaree B, Busch MP, Stone M, Deeks SG, Boritz EA, Abate AR, Clark IC.
Show Full Abstract

In individuals on effective antiretroviral therapy (ART), integrated HIV proviruses persist within CD4 T cells, forming a viral reservoir that rebounds if treatment is stopped. Identifying and targeting these rare, infected cells is critical for advancing therapies, but methods to study reservoir cells are limited, and their unique properties remain largely unknown. We applied DAb-seq, a high-throughput method that combines single-cell DNA and surface protein sequencing, to profile ~527,000 CD4 T cells from the blood of six individuals on ART. Infected cells were distributed across all CD4 T cell subsets but were enriched in central memory subsets and in a CD4 subset with Th17-like signatures expressing high levels of integrin β7. Attempts to identify surface markers distinguishing infected from uninfected cells revealed epitopes that largely reflected the subsets most enriched for infection. However, while central memory T cells harbored the majority of HIV, proviruses with a greater number of genomic regions were enriched relative to their more defective counterparts in the CD4 Naïve, transitional memory (Ttm), and regulatory (Treg) subsets, suggesting that these subsets differentially maintain more complete proviral genomes. In summary, we developed DAb-seq as an open-source platform to link proviral sequences to cellular phenotypes, revealing heterogeneity in surface protein expression and proviral fate across infected subsets.

Also flagged:Pancreatic Ductal AdenocarcinomaPDACtumordetoxificationdeathferroptosis
Journal Article 2026-08-18 No Snippets Yoon S, Son J, Choi Y, Kim J, Jang J, Lee HY, Choi J.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) has a very poor prognosis and remains highly refractory to standard chemotherapy owing to its unique tumor microenvironment (TME) and metabolic reprogramming. A defining feature of PDAC is that the near-ubiquitous presence of oncogenic KRAS mutations, together with NRF2 activation, generates abnormally high levels of reactive oxygen species (ROS) and renders the cells strongly dependent on an amplified glutathione (GSH)-based antioxidant program (the SLC7A11-GSH-GPx4 axis) for survival. This single metabolic axis simultaneously neutralizes drug-induced ROS to sustain chemoresistance and, through GPx4-mediated detoxification of lipid peroxides, suppresses ferroptosis-an iron-dependent, apoptosis-independent form of cell death. Because ferroptosis does not rely on the apoptotic or immune machinery that PDAC readily evades, its induction directly exploits this redox-metabolic vulnerability, distinguishing the GSH-GPx4 and iron-metabolism axes from conventional immune- or DNA-damage-based targets. This review analyzes the regulatory mechanisms of GSH homeostasis linked to treatment resistance in PDAC and discusses nanoparticle therapeutics rationally designed around the two central ferroptosis pathways: the GSH-GPx4 axis and the iron-metabolism axis.

HTT
Also flagged:DementiaDementia with Lewy bodiesdeathprimary synaptopathysynaptic transmissiontranslational modifications
Journal Article 2026-08-18 ✓ 1 Snippet Bougea A.
In-Text Gene Mentions

…PSEN1/PSEN2, MAPT, orHTT, and we summarise…

Show Full Abstract

Dementia with Lewy bodies (DLB) is increasingly conceptualised not merely as a disorder of neuronal death but as a primary synaptopathy in which the functional collapse of synaptic transmission and plasticity precedes, and predicts, neurodegeneration and clinical decline. Two genetic determinants dominate the heritable risk architecture of DLB: the α-synuclein gene <i>SNCA</i>, in which both copy-number variation and missense mutations exert dose- and conformation-dependent effects, and GBA1, encoding the lysosomal hydrolase glucocerebrosidase (GCase), the single most influential genetic risk factor for the disease. Here we synthesise evidence that these loci converge on a shared pathogenic endpoint-the impairment of activity-dependent synaptic plasticity. We argue that <i>GBA1</i> loss-of-function and the resulting accumulation of glucosylceramide stabilise specific neurotoxic α-synuclein proteoforms, including soluble oligomers and self-templating conformational strains bearing defined post-translational modifications. These proteoforms are trafficked to, and enriched within, presynaptic terminals, where they disrupt SNARE-complex assembly and synaptic-vesicle dynamics, while postsynaptically they perturb NMDA and AMPA receptor trafficking, dysregulate dendritic calcium, and compromise synaptic mitochondrial bioenergetics. The net consequence is a metaplastic shift away from long-term potentiation (LTP) and toward aberrant long-term depression (LTD), a signature of synaptic failure detectable before frank pathology. We map these molecular events onto disease-relevant circuits-particularly the cholinergic basal forebrain and hippocampal-cortical and thalamocortical networks-and relate them to the defining neuropsychiatric features of DLB, including cognitive fluctuations and recurrent visual hallucinations. Finally, we evaluate emerging therapeutic strategies that target the GBA1-α-synuclein axis and that aim to restore synaptic plasticity directly. Positioning DLB within the framework of genetically determined plasticity deficits clarifies its kinship with other neuropsychiatric disorders and identifies the synapse as the most tractable node for early, disease-modifying intervention. We further examine how GBA1 allele severity and zygosity grade the phenotype, which genetic and environmental factors modify penetrance in carriers, and what distinguishes this synaptopathy from those driven by PSEN1/PSEN2, MAPT, or HTT, and we summarise the therapeutic pipeline-including enzyme augmentation and adeno-associated viral GBA1 gene therapy-that targets it.

DCC
Also flagged:neurodevelopmental disordersautismAutism spectrum disordersensorybrain developmentbehavioral
Journal Article 2026-08-18 ✓ 1 Snippet Czyrska J, Poznański P, Bernat A, Winiarczyk D, Ziętek MM, Sampino S.
In-Text Gene Mentions

…Netrin-1 signaling throughDCC[ 21 ,…

Show Full Abstract

The BTBR T+ Itpr3tf/J (BTBR) strain is a widely used model of neurodevelopmental disorders, characterized by an altered neuroanatomy, including a full-penetrant agenesis of the corpus callosum. While the adult BTBR brain has been studied thoroughly, less is known about how its brain develops prenatally and about when neurodevelopmental trajectories begin to differ from neurotypical strains. Here, we conducted a comparative histological analysis of fetal brain development across multiple developmental stages in BTBR and C57BL/6J (B6) mice, focusing on neocortical and midline development. BTBR mice showed lower fetal weight but comparable somite counts (assessed at 12.5 days post coitum, dpc) compared to B6 controls, indicating similar developmental timing. Neocortical layering showed a reduced ventricular zone fraction in BTBR fetuses at 15.5 dpc, without a change in overall cortical thickness. Concurrently, midline cell populations immunoreactive for the glutamate aspartate transporter (GLAST) failed to undergo remodeling in subsequent stages, resulting in the failure to form a GLAST+ indusium griseum and the lack of callosal projections crossing the midline at 17.5 dpc, which instead develop normally in B6 fetuses. These findings offer structural correlates for the early neuropathology of the BTBR brain.

SOX6
Also flagged:methylationmyoblast proliferationmetabolismmuscle diseaseschromosomebinding
Journal Article 2026-08-18 ✓ 3 Snippets Rovetta G, Ferrari G, Ronzio M, Gallo A, Epis R, Bonfanti C, Dolfini D, Careccia G, Messina G.
In-Text Gene Mentions

…the modulation ofSox6activity [ 7…

…MYOG, MYOD1, andSOX6were detected in…

…including MYOD1, MYOG,SOX6, and MYCN, in…

Show Full Abstract

Skeletal muscle development and regeneration rely on coordinated transcriptional programs controlled by muscle stem cells and their progeny. Nuclear Factor I X (NFIX) plays essential roles in fetal myogenesis and adult muscle regeneration. However, the mechanisms regulating its transcription and isoform expression remain unclear. Here, integrating multi-omics analyses with in vitro functional assays, we define the transcriptional and epigenetic landscape controlling Nfix expression during skeletal muscle development and regeneration. We show that <i>Nfix</i> promoter usage is dynamically regulated according to myogenic cell state: promoter 2 is associated with quiescent and stem-like states, whereas promoter 1 is activated during myogenic commitment and regeneration. These programs are accompanied by differential enhancer accessibility and DNA methylation changes within the <i>Nfix</i> locus, indicating coordinated epigenetic regulation. We further demonstrate that alternative promoter usage and exon 7/9 splicing generate distinct NFIX isoforms affecting myoblast proliferation and fusion, while transcriptomic profiling identified NFIX-dependent networks involved in muscle structure and metabolism. Overall, our findings uncover multilayered mechanisms controlling Nfix expression and identify promoter- and isoform-specific NFIX programs associated with stem, regenerative, and differentiated myogenic states. These results provide a molecular framework for future therapeutic strategies targeting NFIX in muscle diseases.

TNFSF4
Also flagged:Systemic Lupus ErythematosusLupus NephritisSLEautoimmune diseaseantigen presentationB-cell activation
Journal Article 2026-08-18 ✓ 5 Snippets Obadic BG, Katsukunya JN, Davidson B, Jones ESW, Hodkinson B, Freercks R, Dandara C, Mnika K.
In-Text Gene Mentions

…including HLA-DRB1 ,TNFSF4, IRF5 ,…

…( HLA region,TNFSF4), innate immune…

…Superfamily Member 4 (TNFSF4, also called…

…et al. highlightedTNFSF4as a candidate…

…gene–gene interactions betweenTNFSF4and other known…

Show Full Abstract

Systemic lupus erythematosus (SLE) is a complex autoimmune disease with a strong genetic component, and lupus nephritis (LN) represents one of its most common and severe organ-specific manifestations. This review synthesises current evidence on the genetic architecture of SLE and LN, with a particular focus on identifying shared and distinct genetic susceptibility loci and highlighting knowledge and data gaps in highly burdened African populations. Across studies, most risk loci, including <i>HLA-DRB1</i>, <i>TNFSF4</i>, <i>IRF5</i>, <i>STAT4</i>, <i>TNFAIP3</i>, <i>BANK1</i>, <i>BLK</i>, <i>ITGAM</i>, and <i>FcγR2A/FcγR3A</i>, converge on key immune pathways such as antigen presentation, type I IFN signalling, B-cell activation, and immune complex clearance. The findings support a substantial genomic overlap between SLE and LN, with most variants contributing to systemic immune dysregulation rather than kidney-specific susceptibility. A limited number of loci, including <i>PDGFRA</i>, <i>HAS2</i>, and <i>SLC5A11</i>, have been implicated in renal involvement, while <i>APOL1</i> G1/G2 risk variants are associated with renal disease progression and adverse kidney outcomes among individuals of African ancestry. Despite these advances, relatively few loci have been definitively linked to LN independent of SLE, reflecting both biological overlap and limitations in study design. Moreover, the existing literature is heavily skewed toward European, Asian, and admixed populations, with minimal representation of continental African cohorts. Given the high genetic diversity and disproportionate disease burden in African populations, this represents a critical knowledge gap. Improved inclusion of diverse populations, coupled with high-resolution genomic and functional studies, will be essential to refine causal variant identification and enhance understanding of disease mechanisms. Ultimately, insights into population-specific genetic risk may enable earlier identification of high-risk individuals and support the development of precision medicine strategies for SLE, specifically LN.

OLFM4
Also flagged:extracellulargene expressionepithelial-mesenchymal transitionmetabolismtumortissue development
Journal Article 2026-08-17 ✓ 1 Snippet Cherne MD, Gattiker JL, Lyon KN, Russell D, Sebrell TA, Burcham-Carter A, Richard AP, Mathew EN, Mackintosh SG, Gorzalski AJ, Bimczok D.
In-Text Gene Mentions

…cell markers LGR5,OLFM4(figure 9 (A))…

Show Full Abstract

Human gastric organoids (HGOs) are 3D cultures of primary gastric epithelial cells that serve as in vitro models for gastric epithelial physiology, development, and disease. The extracellular matrix (ECM) material that organoids are maintained in provides crucial signals to the epithelial cells, regulating their function and growth. We here describe the application of human gastric ECM (hgECM) for HGO cultures, to provide a tissue- and species-specific growth matrix. We prepared hgECM from human gastric tissue by decellularization and then compared HGO growth, differentiation, and function in hgECM and in the traditionally used Matrigel. The composition, structure, and rheological properties of the hgECM were determined using tandem mass spectrometry, scanning electron microscopy, and rheometry. Transcriptional profiles of HGOs grown in hgECM and Matrigel were compared using single cell RNA sequencing (scRNAseq). Proteome analysis showed that hgECM was rich in collagens, whereas Matrigel was predominantly composed of glycoproteins such as laminin. The structure of hgECM was fibrous, befitting its collagen composition, while Matrigel was porous. The viscosity and stiffness of hgECM were found to be lower than Matrigel. HgECM supported robust growth of HGOs. ScRNAseq showed that cell type composition of HGOs in each ECM was comparable. However, HGOs in hgECM had reduced expression of genes associated with stem cells, epithelial-mesenchymal transition, stress, and inflammation compared to HGO grown in Matrigel. Conversely, HGO culture in hgECM increased expression of gastric tissue-specific genes and of genes associated with growth and metabolism. HgECM hydrogels were highly compatible with HGO culture, and improved homeostatic functions of HGOs, including growth, differentiation, and reduced inflammation. HgECM may serve as a tissue- and species-specific growth matrix for HGO culture to improve the physiological relevance of organoid models.

Also flagged:metabolismmitochondrialphosphorylationmetabolic disordersobesitynonalcoholic fatty liver disease
Journal Article 2026-08-17 No Snippets Wu W, Wang W, Zhang J, Liang Q, Wang N, Chen L, Wang C, Li J, Cong Y, Hong H, Cheng X, Yang M, Fang L, Kong L.
Show Full Abstract

Excessive dietary fructose consumption contributes to the rapidly increasing prevalence of obesity, metabolic syndrome, and chronic kidney disease worldwide, and accumulating preclinical evidence has confirmed that excess fructose exposure provokes severe mitochondrial dysfunction, which serves as a critical upstream driver of progressive metabolic disturbance and renal tissue injury. Conventionally, fructose-induced mitochondrial damage is thought to originate from harmful intermediate metabolites produced during intracellular fructose catabolism, while the potential direct pathogenic effect of intact unmetabolized fructose is largely overlooked. It remains unclear whether free fructose can directly target core mitochondrial complexes to initiate functional defects independent of its metabolic breakdown. Here, we report a fructose metabolism-independent mechanism in which fructose structurally remodels the translocase of the outer membrane (TOM) complex, obstructing the import of nuclear-encoded mitochondrial proteins and inhibiting mitochondrial ribosome biogenesis as well as oxidative phosphorylation. In vitro biochemical assays confirm that fructose non-covalently binds to TOM22 and induces subtle but functionally critical conformational changes in the TOM complex, thereby blocking the transmembrane translocation of mitochondrial ribosome subunits. Notably, disrupting the fructose-TOM22 binding efficiently recovers abnormal ribosome trafficking, restores compromised oxidative phosphorylation, and ameliorates mitochondrial dysfunction and glomerular pathological lesions in fructose-treated podocytes and mouse injury models. Our findings establish an innovative mechanistic paradigm that fructose acts as a direct allosteric modulator of mitochondrial membrane complexes, identifying TOM structural remodeling as a previously unrecognized molecular trigger of fructose-associated mitochondrial and metabolic disorders.

HTT
Also flagged:Huntington DiseaseHDhereditary neurodegenerative disorderneurodegenerative diseases-cell activationCP
Journal Article 2026-08-17 ✓ 4 Snippets Gao Y, Ásbjörnsdóttir B, Vinther-Jensen T, Von Essen MR, Hellem MNN, Hjermind LE, Ejlerskov P, Landwehrmeyer GB, Sellebjerg F, Nielsen JE, Lewerenz J.
In-Text Gene Mentions

…repeat-expanded Huntingtin (HTT) allele (N…

…1 of theHTTgene encoding the…

…encoding the huntingtin (HTT) protein.…

…that the mutatedHTTgene renders myelomonocytic…

Show Full Abstract

<h4>Background and objectives</h4>CSF inflammatory biomarkers in Huntington disease (HD), a neurodegenerative CAG-triplet expansion disorder, usually increase with disease progression. CSF leukocytes as an inflammatory marker have not been explored in HD. We explored high-precision CSF-leukocyte counts across different HD stages in the multicenter prospective biosample HD study HDClarity and their association with CSF neurofilament light chain (NFL) and cytokine and chemokine patterns.<h4>Methods</h4>A cross-sectional case-control study of the first average CSF leukocyte count of HDClarity study control participants (N = 94) and those carrying a repeat-expanded Huntingtin (<i>HTT</i>) allele (N = 335) categorized as having successive stages of presymptomatic and motor manifest HD as predefined by the HDClarity protocol (early presymptomatic [N = 48]: disease burden score [DBS] <250; late presymptomatic [N = 93]: DBS ≥ 250; early manifest HD [N = 171]: total functional capacity [TFC] 7-11; and late motor manifest HD [N = 23]: TFC < 11) was performed. CSF-NFL was available in 165. Results were juxtaposed with an independent single-center data set of 18 CSF cytokines and chemokines (57 CSFs, 19 control, 6 early and 8 late presymptomatic HD CSFs, and 19 manifest HD CSFs).<h4>Results</h4>CSF leukocytes peaked in late premanifest (median, interquartile range: 1.0/µL, 0.33-1.33/µL) when compared with early premanifest (0.0/µL, 0.0-1.0/µL) but also early (0.33/µL, 0.0-1.0/µL) and late manifest HD (0.0/µL, 0.0-0.67/µL). CSF leukocytes in late premanifest HD were higher than in controls (0.0/µL, 0.0-1.0/µL). A CSF-leukocyte peak at a DBS between 256 and 344 closely corresponded to the late premanifest HD peak. Higher CSF leukocytes in late premanifest HD were associated with higher CSF-NFL levels. Exploratory analysis of CSF cytokine and chemokine levels revealed that low interleukin (IL)-7 but high vascular endothelial growth factor (VEGF) and C-C motif chemokine ligand (CCL)22 levels may distinguish HD from control CSF; high VEGF, IL-6, and IL-15 early from late premanifest HD CSF; and low CCL2, CCL17, and IL-8 late premanifest from manifest HD CSF. When consecutively applied, these patterns identified late premanifest HD participants with a 75% sensitivity (95% CI 41%-96%) and 90% specificity (78%-96%).<h4>Discussion</h4>CSF leukocytes peaking in late premanifest HD, their association with increased CSF-NFL, and the corresponding stage-specific chemokine/cytokine changes indicate a temporally dynamic, probably neurotoxic inflammatory signaling network in HD.

OLFM4
Also flagged:nucleuspost-translational modificationsphototoxicity-deathtransduction
Journal Article 2026-08-17 ✓ 1 Snippet Zhou FY, Jacobs BA, Norton-Steele A, Han X, Zhou L, Carroll TM, Ruiz Puig C, Chadwick J, Qin X, Lisle R, Marsh L, Byrne HM, Harrington HA, Lu X.
In-Text Gene Mentions

…meostasis, WNT-dependent Lgr5/Olfm4/Axin2- expressing CBC stem…

Show Full Abstract

Live cells in tissue are plastic, phenotypically dynamic, and modify their function in response to genetic and environmental perturbations. To unleash the power of live-cell imaging to identify phenotype-genotype-function coupling over time, we report the development of a standardized Shape-Appearance-Motion (SAM) "phenome" and SAM-Phenotype-Observation-Tool (SPOT), that act as an image-"transcriptome" and image-"transcriptome analyzer" respectively, and provide an unbiased and comprehensive description of morpho-dynamic phenotypes without prior knowledge. We apply SAM-SPOT to our simulated organoids database with known ground-truth and >1.6 million mouse and human organoid instances with defined genetic and chemical perturbations. SAM-SPOT can effectively and robustly characterize 3D morpho-dynamics from 2D projection videos. Combined with single-cell RNA sequencing, SAM-SPOT reveals that altered WNT signaling, but not mutant RAS or p53, predisposes intestinal organoids to irregular morphogenesis. SAM-SPOT advances biomedical discovery by empowering live-cell imaging to identify phenotype-genotype-function relationships through large-scale and cost-effective label-free live-cell imaging.

TRIM38
Also flagged:Rheumatoid ArthritisRAosteoarthritisarthritis
Journal Article 2026-08-17 ✓ 4 Snippets Chen L, Wu J, Zhou T, Zou Z, Cheng Q, Chen D, Li H, Yang P, Yang C, Wang H, Li K.
In-Text Gene Mentions

…Progression via InhibitingTRIM38-Mediated Ubiquitination of IG…

…rmation, spatially sequesteredtripartite motif-containing protein 38motif-containing protein 38…

…motif-containing protein 38 (TRIM38), inhibited TRIM38-mediated I…

…38 (TRIM38), inhibitedTRIM38-mediated IGF2BP1 ubiquitinati…

Show Full Abstract

<h4>Objective</h4>Fibroblast-like synoviocytes (FLS) in rheumatoid arthritis (RA) synovium acquire a unique aggressive phenotype and produce cytokines that perpetuate inflammation and proteases that contribute to cartilage destruction. Actin-bundling protein Fascin-1 (FSCN1) is involved in FLS migration and invasion, but its role and mechanism in FLS phenotypic activation remain unclear.<h4>Methods</h4>FSCN1 expression was analyzed in the synovium from healthy controls (n = 6), patients with RA (n = 6), and patients with osteoarthritis (n = 6) with written informed consent obtained before sample collection, as well as synovium from control (n = 6) and arthritic mice (n = 6). Transcriptome profiling, RNA immunoprecipitation sequencing, and mass spectrometry analysis were performed to determine the underlying mechanism. FLS-specific FSCN1 knockout, FSCN1 intra-articular overexpression mice, and FSCN1 inhibitors were used to characterize the role and therapeutic potential of FSCN1 in experimental arthritis (n = 5-8).<h4>Results</h4>FSCN1 was significantly increased in RA synovium and predominantly localized to PDPN-positive FLS (P < 0.001). FSCN1 overexpression enhanced F-actin remodeling, FLS migration, invasion, proliferation, and inflammatory activation and exacerbated synovitis and cartilage damage in arthritis mouse models (P < 0.0026). Conversely, FLS-specific FSCN1 ablation reduced knee swelling, pain-related behavior, synovial inflammation, and Osteoarthritis Research Society International scores in arthritis mouse models (P < 0.0196). Mechanistically, FSCN1 promoted F-actin fiber formation, spatially sequestered tripartite motif-containing protein 38 (TRIM38), inhibited TRIM38-mediated IGF2BP1 ubiquitination, and sustained PI3K-AKT/NF-κB signaling. The FSCN1 inhibitors imipramine and NP-G2-044 suppressed FLS activation and alleviated arthritis pathology in mice (P < 0.001).<h4>Conclusion</h4>Pharmacologic inhibition of FSCN1 restrains synovial inflammation and joint destruction by suppressing the aggressive phenotype change of FLS, representing a promising therapeutic strategy against RA.

Also flagged:DeathNeurodegenerative DiseasesmitochondrialautophagyAlzheimer's diseaseParkinson's disease
Journal Article 2026-08-17 No Snippets Li T, Zhang Q, Wu Y, Huang R.
Show Full Abstract

Neurodegenerative diseases (NDs) are marked by selective neuronal vulnerability and progressive failure of neural circuits. Increasing evidence indicates that neuronal loss is not driven by a single terminal event, but emerges from interacting regulated cell death (RCD) programs. These programs are closely coupled to mitochondrial injury, proteostatic collapse, lysosomal stress, metabolic imbalance, glial state transitions, and chronic neuroinflammation. Yet, how distinct death pathways are organized across cell types, disease stages, and disease-specific microenvironments remains unresolved. This review examines RCD as an integrated pathogenic network in major NDs. Caspase and B-cell lymphoma 2 (BCL2) family signaling, receptor-interacting protein kinase 1 (RIPK1), RIPK3, and mixed lineage kinase domain-like protein activation, NOD-like receptor family pyrin domain containing 3 and gasdermin signaling, GPX4-linked lipid peroxidation control, and autophagy lysosomal failure are discussed as convergent stress response modules rather than isolated pathways. Across Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, and Huntington's disease, these modules shape neuronal fate through disease-specific interactions with mitochondrial dysfunction, iron dyshomeostasis, inflammasome activation, and microglial metabolic remodeling. We further evaluate emerging therapeutic strategies that target cell death crosstalk, restore autophagy lysosomal competence, or improve delivery to the central nervous system, highlighting the importance of molecular selectivity, cellular context, disease stage, and translational feasibility.

HTT
Also flagged:Huntington's diseaseHDneurodegenerative disorderdegradationsynthesis
Journal Article 2026-08-17 ✓ 1 Snippet Jiang Y, Chen X, Xu Z, Chen X, Wang Q, Ma J, Wu X, Deng G, Li S, Sun H, Chen Y.
In-Text Gene Mentions

…within the huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is a devastating neurodegenerative disorder characterized by the expansion of cytosine-adenine-guanine (CAG) repeats within the huntingtin (HTT) gene. Given their therapeutic potential, small-molecule strategies have gained significant traction, leading to the design of numerous lead candidates aimed at diverse pathological hallmarks of HD. These developmental efforts target various facets of the disease, including the inhibition and degradation of mutant huntingtin (mHTT) proteins, alleviation of motor dysfunction, and the provision of neuroprotective effects. For instance, gossypol acetate has been identified to induce the autophagic degradation of mHTT. Furthermore, these small molecules modulate critical signaling pathways within HD neurons, such as the store-operated calcium (SOC) channels, dopamine- and cAMP-regulated phosphoprotein 32 (DARPP-32), ataxia-telangiectasia mutated (ATM)/ataxia-telangiectasia and rad3-related (ATR)-p53 pathway, and the kynurenine (KYN) metabolic pathway. While currently explored small-molecule therapies have demonstrated preclinical efficacy, further clinical investigation is imperative to expand the chemical space of viable HD therapeutics. This review critically summarizes the design, synthesis, and structural motifs of small-molecule candidates, clinically used agents, and antioxidant natural products, providing a structural framework to guide the rational design and development of next-generation anti-HD compounds.

Also flagged:Rheumatoid ArthritisRAinflammatory bowel diseasearthritispathogenesiscolitis
Journal Article 2026-08-17 No Snippets Yan L, Shi C, Yuan S, Zhang L, Zhang X, Zheng G, Geng Q, Lu C.
Show Full Abstract

<h4>Purpose</h4>There is a bidirectional association between rheumatoid arthritis (RA) and inflammatory bowel disease (IBD). Patients with RA exhibit a higher prevalence of IBD, those with IBD are at a significantly increased risk of developing RA. The shared molecular mechanisms and key bridging molecules underlying remain to be explored.<h4>Methods</h4>Transcriptomic datasets from GEO were analyzed using WGCNA, differential expression, and immune-related genes to identify shared RA-IBD signatures. Least Absolute Shrinkage and Selection Operator (LASSO) and Support Vector Machine-Recursive Feature Elimination (SVM-RFE), were employed to prioritize diagnostic markers. Single-cell RNA sequencing datasets were used to localize the cellular source of the hub gene. Subsequently, two independent large-scale peripheral blood datasets were retrieved to further provide transcriptomic profiles of circulating immune cells, serving as a "bridge" between RA and IBD. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed. Findings were validated using collagen-induced arthritis (CIA) and dextran sulfate sodium (DSS) mice models, as well as in vitro TNF-α stimulation of MH7A and Caco-2 cells.<h4>Results</h4>Intersection analysis identified 19 core immune-driven genes shared between RA and IBD, both diseases are characterized by a highly activated immune profile, particularly T cell lineages. Among these, ISG20 emerged as a critical molecular link, exhibiting high diagnostic efficacy for RA and IBD. Single-cell transcriptomic analysis further revealed that ISG20 is predominantly expressed in T cell populations in both RA synovium and IBD colon. In peripheral blood datasets, 29 "bridge genes" were identified and found to be significantly enriched in chemokine signaling. Experimental validation confirmed that ISG20 mRNA levels were significantly upregulated in inflamed synovial tissues of CIA and colon of DSS mice, and in TNF-α-stimulated MH7A and Caco-2 cells.<h4>Conclusion</h4>ISG20 serves as a crosstalk molecular link across the RA and IBD. These findings provide molecular landscape for shared pathogenesis and diagnostic window for patients predisposed to the RA-IBD co-occurrence clinical phenotype.

MRPL39
Also flagged:Multiple SclerosisMSchronic autoimmune disease of thenervous systemisolated syndromeribosome
Journal Article 2026-08-17 ✓ 3 Snippets D'Angiolini S, Minuti A.
In-Text Gene Mentions

…machinery ( MRPL15,MRPL39) strongly implies…

…( RPLP0, MRPL24,MRPL39) common to…

…MRPL34 , andMRPL39.…

Show Full Abstract

Multiple sclerosis (MS) is a chronic autoimmune disease of the central nervous system characterized by inflammatory demyelination, neurodegeneration, and progressive disability. Clinically isolated syndrome (CIS) often represents the first overt presentation of MS. We performed an exploratory cross-sectional transcriptomic investigation of peripheral blood mononuclear cells (PBMCs) from healthy controls (HC, <i>n</i> = 40), CIS patients (<i>n</i> = 49), and Relapsing-Remitting MS (RRMS, <i>n</i> = 53) patients using the ArrayExpress dataset E-MTAB-11415. Differential expression analysis was performed using limma, adjusting for age and sex. Functional enrichment and network analyses were conducted using clusterProfiler, STRING, and Cytoscape. Although Principal Component Analysis (PCA) showed partial overlap among groups, pathway-level analyses revealed coherent alterations in translation, ribosome biology, mitochondrial protein synthesis, and stress-response regulation. In CIS compared with HC, cytoplasmic and mitochondrial ribosomal genes were predominantly downregulated, suggesting reduced translational capacity in PBMCs. This was accompanied by altered expression of translation-initiation and transcriptional regulators, whereas genes involved in stress-adaptive translational control, including <i>GCN1</i>, <i>YARS1</i>, <i>QARS1</i>, and <i>SIL1</i>, were selectively upregulated. Conversely, RRMS compared with CIS showed upregulation of ribosome-related and biosynthetic programs. Overall, these findings suggest that CIS may be characterized by peripheral translational restraint and adaptive stress response activation, whereas RRMS progression is associated with biosynthetic reactivation.

Also flagged:fertilizationgene expressionsignal transductionmetabolismfloweringdeath
Journal Article 2026-08-17 No Snippets Anwar W, Cai RH, Pang T, Li Y, Dissanayaka DDNV, Lai YS.
Show Full Abstract

Xishuangbanna (XIS) cucumber (<i>Cucumis sativus</i>) originated from low-altitude southwest China and shows extreme cold sensitivity. Nano-hydroxyapatite (nHAP), known for its high bioavailability and surface reactivity relative to bulk HAP, was applied to enhance the cold tolerance of XIS seedlings. We optimized fertilization timing and fertilizer concentration. By determining physiological parameters alongside gene expression profiling and transcriptomic analysis, we preliminarily dissected the physiological and molecular mechanisms underlying nHAP-enhanced chilling tolerance. nHAP application preserved free and bound water even at 24 h into the cold-stress treatment, as detected by nuclear magnetic resonance (NMR) and magnetic resonance imaging (MRI). Exposure to cold stress caused a chilling injury index (CII) of 73.33%, while foliar spraying of nHAP at gradient concentration reduced CII values by 9.09-54.55%. At the same time, electrolyte leakage and malondialdehyde content were decreased by 6.68-61.41% and 12.92-67.16% respectively; chlorophyll content increased by 0.01-73.42%; SOD, POD, and soluble protein content increased by 10.54-161.53%, 16.50-154.33%, and 2.03-63.26%, respectively. Soil application of nHAP showed a similar but weaker effect than foliar spraying on alleviating chilling injury, and the optimal concentration was 1000 mg/L. Quantitative Real-Time PCR (qRT-PCR) revealed that foliar spraying of nHAP upregulated the gene expression of Superoxide dismutase genes (<i>CsCu/ZnSOD</i> and <i>CsMnSOD</i>) and major facility superfamily genes (<i>CsSPX-MFS1</i> and <i>CsSPX-MFS2</i>) in the cold treatment. We then profiled the transcriptome changes in seedling leaves during the cold treatment after foliar spraying of nHAP. Without nHAP application, cold stress resulted in a total of 6795 differentially expressed genes (DEGs), which were functionally enriched in plant-pathogen interaction and plant hormone signal transduction pathways. Under nHAP application, cold stress only caused 776 DEGs, which were functionally enriched in plant hormone signal transduction and galactose metabolism. These findings suggest that nHAP could improve the cold tolerance of cucumber seedlings through boosting antioxidant activity and plant hormone signaling pathways.

TNFSF4
Also flagged:viral infectionscancergene expressioncell differentiationmitochondrialT-cell differentiation
Journal Article 2026-08-17 ✓ 1 Snippet Chandiran K, Karingari NC, Sirigineedi S, Cauley LS.
In-Text Gene Mentions

…of Cd28 andTnfsf4(encodes OX40L) is…

Show Full Abstract

The ability of CD8 T cells to mediate protective immunity while limiting immunopathology depends on critical transcription factors such as Smad4 and Eomes that regulate differentiation of activated CTLs. Disruption of transcriptional programs mediated by Eomes and Smad4 in activated CTLs has been implicated in viral infections, chronic inflammation and cancer. Smad4 and Eomes have been shown to be critical for differentiation of memory cells, particularly TRM cells. To understand the gene regulation programs mediated by Smad4 and Eomes, we have done an integrated RNAseq and ChIPseq analysis using CD8 T cells that are isolated from Smad4KO (S4KO), EomesKO, and Smad3/Smad4-DKO (S34-DKO) mice. We identified overlapping and distinct gene expression programs mediated by Smad4 and Eomes that are associated with shaping CD8 T cell identity and functional bias. They act as critical regulators of genes involved in T cell differentiation, metabolic programming and epigenetic control in CD8 T cells. Smad4 and Eomes regulate the genes involved in tissue residency and OXPHOS-linked mitochondrial bioenergetics. Finally, we showed that canonical TGF-beta signaling is active in the absence of Smad4 or Eomes and abrogated only when both Smad3 and Smad4 are deleted. Surprisingly, CD8 T cells lacking both Smad3 and Smad4 are more enriched for TRM signature genes compared to Smad4 or Eomes-deficient CD8 T cells.

Also flagged:post-translational modificationsosteonecrosis of the femoral headorthopedic disorderbone remodelingphosphorylationmethylation
Journal Article 2026-08-17 No Snippets An L, Cao L, Zhao J, Yang X, Ma H, Shi Z, Deng Z, Liu Z, Feng N, Sun X.
Show Full Abstract

<h4>Background</h4>Osteonecrosis of the femoral head (ONFH) is a progressive and disabling orthopedic disorder characterized by impaired bone remodeling and microvascular dysfunction. Emerging evidence identifies post-translational modifications (PTMs) as critical molecular switches linking external pathogenic stimuli, such as glucocorticoids and alcohol, to intracellular signaling dysregulation in ONFH.<h4>Main body</h4>This review comprehensively summarizes the regulatory roles of major PTMs-including phosphorylation, acetylation, methylation, and ubiquitination-in key cell types governing femoral head homeostasis, namely, bone marrow-derived mesenchymal stem cells, osteoblasts, osteocytes, osteoclasts, and vascular endothelial cells. Aberrant PTMs disrupt the osteogenic-adipogenic balance, impair angiogenesis, and trigger multiple forms of programmed cell death, including apoptosis and ferroptosis, collectively driving the pathological progression towards bone necrosis. Particular emphasis is placed on phosphorylation-dependent signaling pathways (e.g., PI3K/Akt, GSK-3β/β -catenin, JAK2/STAT3, and AMPK/mTOR), ubiquitin-mediated mitochondrial quality control, and acetylation-driven epigenetic regulation. Furthermore, we highlight emerging PTM-targeted small-molecule interventions that show promise in restoring osteogenesis, preserving endothelial function, or suppressing cell death.<h4>Conclusion</h4>Future research directions include decoding cell type-specific "PTM codes", integrating multi-omics analyses, and developing patient-derived organoid models. Advancing these areas may collectively enable earlier diagnosis and more precise, mechanism-based therapies for ONFH.

Also flagged:Inflammatory Bowel Diseaseulcerative colitisCrohn's diseasechronic disordermediatedlocalization
Journal Article 2026-08-16 No Snippets Papait A, Cargnoni A, Scaldaferri F, Lopetuso L, Silini AR, Parolini O.
Show Full Abstract

Inflammatory bowel disease (IBD), which includes ulcerative colitis and Crohn's disease, represents a chronic, immune-mediated pathology in which genetic susceptibility, environmental exposures, and microbial perturbations converge to destabilize intestinal homeostasis. Despite a steady global rise in incidence affecting more than 10 million people worldwide, current single-pathway biologic and small-molecule therapies still leave 30-40% of patients without durable remission, with progression to stricturing, fistulizing, or transmural complications. Yet the mechanistic integration of innate and adaptive immune networks, epithelial barrier dysfunction, and microbiota‑driven inflammation remains fragmented. This review summarizes recent advances in understanding the pathophysiological mechanisms driving IBD, focusing on innate and adaptive immune networks. Current therapies, including cytokine or integrin-targeting biologics and small-molecule inhibitors like Janus Kinase (JAK) antagonists, are critically evaluated in light of their restricted pathway coverage. In response to these challenges, emerging strategies are examined targeting nonimmune pathways, including microRNA‑124-mediated gene regulation, fecal microbiota transplantation, and mesenchymal stromal cell therapies that combine immunomodulation with tissue repair. The development of effective IBD therapies is likely to benefit from combining complementary treatment strategies, guided by molecular and cellular profiling. This review underscores a paradigm shift from monotherapies to integrated, multitarget approaches as the new frontier in IBD management.

DCC
Also flagged:TumorHead and Neck Squamous Cell CarcinomaHNSCCtumorshead and neck cancersPathogenesis
Journal Article 2026-08-16 ✓ 2 Snippets Drăgan CD, Marin AM, Frasina-Vlad OC, Măruțescu L, Ancuța P, Cîrstea AI, Tudosie MD, Nicolaescu A, Simion-Antonie CB, Rujan SA, Taher BP, Voiculescu D, Berteşteanu ŞVG, Grigore R.
In-Text Gene Mentions

…Hypermethylation of theDCC(a tumor suppressor…

…Immune checkpoint inhibitorDCCDeleted in Colorectal…

Show Full Abstract

Currently, the global incidence of head and neck squamous cell carcinoma (HNSCC) continues to increase, with a large proportion of cases being diagnosed at advanced stages. Conventional oncological treatments are often associated with poor quality of life, while the aggressive biological behavior of these tumors results in recurrence in approximately half of treated patients according to current evidence. The need for rapid, targeted diagnosis and personalized treatment has driven research toward the identification of tumor biomarkers with diagnostic, prognostic, and predictive value for treatment response. In this scoping review, we performed a comprehensive literature search to map the available evidence on tumor biomarkers in HNSCC. We identified a wide range of biomarkers, several of which exhibit overlapping roles, and classified them according to their genomic, proteomic, cytokine-related, tumor microenvironment, metabolic, and microbiota-associated characteristics. This scoping review also summarizes the current evidence regarding biomarkers involved in carcinogenesis, treatment response and therapy resistance, while highlighting their current level of clinical applicability. Although only a limited number of biomarkers have currently been implemented in routine clinical practice in head and neck cancers, the studies included in this review identified several promising candidates with the potential to be incorporated into clinical practice following further prospective validation and methodological standardization. Many additional biomarkers are still under investigation, opening new perspectives for future diagnostic and therapeutic targets and supporting the development of personalized multimodal treatment strategies for patients with HNSCC.

Also flagged:COVID-19coronavirus disease 2019mitochondrialpneumoniaacute respiratory distress syndromeARDS
Journal Article 2026-08-15 No Snippets Nguyen HTT, Ta TV, Le TT, Nguyen QD, Cao V, Nguyen CDK, Duc TN, Nguyen NT.
Show Full Abstract

<b>Background/Objectives</b>: Host genetic variation contributes to the heterogeneous clinical outcomes of coronavirus disease 2019 (COVID-19), yet evidence from Southeast Asian populations remains limited. <b>Methods</b>: We investigated host genetic factors associated with COVID-19 severity in Vietnamese patients infected with the SARS-CoV-2 Delta variant using whole-exome sequencing. A total of 48 unvaccinated patients were enrolled. During sample-level quality control, one sample was excluded because the genetically inferred sex was discordant with the information recorded in the clinical medical record, leaving 47 samples (23 severe/critical and 24 mild/asymptomatic) for downstream genetic analyses. Gene-based association analysis was performed using MAGMA, followed by functional enrichment and interaction network analyses with Metascape and GeneMANIA. <b>Results</b>: Population structure analysis showed that the study participants clustered closely with the East Asian (EAS) reference population. No individual variant reached the prespecified multiple-testing-adjusted threshold, and no gene-level association survived Benjamini-Hochberg correction. Using a nominal MAGMA gene-based <i>p</i> < 0.01 threshold solely for exploratory prioritization, 44 genes were selected for downstream functional analyses. Functional enrichment highlighted RNA processing and mRNA maturation, together with mitochondrial, metabolic, immune-regulatory, and cellular homeostasis pathways. Network topology analysis further identified several highly connected genes, including CPSF4, MRPS34, ATP5MF, BUD31, SNRPD3, and HDAC1. <b>Conclusions</b>: These hypothesis-generating findings are consistent with a potentially polygenic contribution to severe COVID-19 and provide an exploratory systems-level framework for understanding host genetic susceptibility in the Vietnamese population, while identifying biologically plausible candidate genes and pathways for future validation.