Gene Literature Dashboard

Viewing October 2005 — 83 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← September 2005 November 2005 →
Also flagged:γS-crystallinγ-crystallinglucosenitrogencarbonimidazole
Journal Article 2005-10-31 No Snippets Wu Z, Delaglio F, Wyatt K, Wistow G, Bax A.
Show Full Abstract

The solution structure of murine gammaS-crystallin (gammaS) has been determined by multidimensional triple resonance NMR spectroscopy, using restraints derived from two sets of dipolar couplings, recorded in different alignment media, and supplemented by a small number of NOE distance restraints. gammaS consists of two topologically similar domains, arranged with an approximate twofold symmetry, and each domain shows close structural homology to closely related (approximately 50% sequence identity) domains found in other members of the gamma-crystallin family. Each domain consists of two four-strand "Greek key" beta-sheets. Although the domains are tightly anchored to one another by the hydrophobic surfaces of the two inner Greek key motifs, the N-arm, the interdomain linker and several turn regions show unexpected flexibility and disorder in solution. This may contribute entropic stabilization to the protein in solution, but may also indicate nucleation sites for unfolding or other structural transitions. The method used for solving the gammaS structure relies on the recently introduced molecular fragment replacement method, which capitalizes on the large database of protein structures previously solved by X-ray crystallography and NMR.

Also flagged:Rheumatoid arthritischronic inflammatory diseasepathogenesistumour necrosis factoroligonucleotidearthritis
Journal Article 2005-10-28 ✓ 2 Snippets Aidinis V, Carninci P, Armaka M, Witke W, Harokopos V, Pavelka N, Koczan D, Argyropoulos C, Thwin MM, Möller S, Waki K, Gopalakrishnakone P, Ricciardi-Castagnoli P, Thiesen HJ, Hayashizaki Y, Kollias G.
In-Text Gene Mentions

…s, TGGGCTCCAGGGTAACACTG, 354),Ptgis(s, TCACAGATGACCACACTCCC; as,…

…CD14, Mb, Bsg,Ptgis) were further…

Show Full Abstract

Rheumatoid arthritis is a chronic inflammatory disease with a high prevalence and substantial socioeconomic burden. Despite intense research efforts, its aetiology and pathogenesis remain poorly understood. To identify novel genes and/or cellular pathways involved in the pathogenesis of the disease, we utilized a well-recognized tumour necrosis factor-driven animal model of this disease and performed high-throughput expression profiling with subtractive cDNA libraries and oligonucleotide microarray hybridizations, coupled with independent statistical analysis. This twin approach was validated by a number of different methods in other animal models of arthritis as well as in human patient samples, thus creating a unique list of disease modifiers of potential therapeutic value. Importantly, and through the integration of genetic linkage analysis and Gene Ontology-assisted functional discovery, we identified the gelsolin-driven synovial fibroblast cytoskeletal rearrangements as a novel pathophysiological determinant of the disease.

Also flagged:ROBO1Dyslexiareading disabilitylearning disorderChromosomespeech-sound disorder
Journal Article 2005-10-28 ✓ 3 Snippets Hannula-Jouppi K, Kaminen-Ahola N, Taipale M, Eklund R, Nopola-Hemmi J, Kääriäinen H, Kere J.
In-Text Gene Mentions

…ligand of theDCC receptorreceptor [ 32…

…activation of theDCC receptorreceptor increases transient…

…Slit/Robo/DCCsignaling has also…

Show Full Abstract

Dyslexia, or specific reading disability, is the most common learning disorder with a complex, partially genetic basis, but its biochemical mechanisms remain poorly understood. A locus on Chromosome 3, DYX5, has been linked to dyslexia in one large family and speech-sound disorder in a subset of small families. We found that the axon guidance receptor gene ROBO1, orthologous to the Drosophila roundabout gene, is disrupted by a chromosome translocation in a dyslexic individual. In a large pedigree with 21 dyslexic individuals genetically linked to a specific haplotype of ROBO1 (not found in any other chromosomes in our samples), the expression of ROBO1 from this haplotype was absent or attenuated in affected individuals. Sequencing of ROBO1 in apes revealed multiple coding differences, and the selection pressure was significantly different between the human, chimpanzee, and gorilla branch as compared to orangutan. We also identified novel exons and splice variants of ROBO1 that may explain the apparent phenotypic differences between human and mouse in heterozygous loss of ROBO1. We conclude that dyslexia may be caused by partial haplo-insufficiency for ROBO1 in rare families. Thus, our data suggest that a slight disturbance in neuronal axon crossing across the midline between brain hemispheres, dendrite guidance, or another function of ROBO1 may manifest as a specific reading disability in humans.

Also flagged:craniosynostosiscongenital developmental disorderFGFR2FGFR3chromosomeamino acid
Journal Article 2005-10-28 ✓ 5 Snippets Tagariello A, Heller R, Greven A, Kalscheuer VM, Molter T, Rauch A, Kress W, Winterpacht A.
In-Text Gene Mentions

Balanced translocation in a patient with craniosynostosis disrupts the SOX6 gene and an evolutionarily conserved non-transcribed region.

SOX6 mutation screening of another 104 craniosynostosis patients revealed one missense mutation leading to the exchange of a highly conserved amino acid (p.D68N) in a single patient and his reportedly healthy mother.

…craniosynostosis disrupts theSOX6gene and an…

…11p15 disrupts theSOX6gene, known to…

SOX6mutation screening of…

Show Full Abstract

Craniosynostosis is a congenital developmental disorder involving premature fusion of cranial sutures, which results in an abnormal shape of the skull. Significant progress in understanding the molecular basis of this phenotype has been made for a small number of syndromic craniosynostosis forms. Nevertheless, in the majority of the approximately 100 craniosynostosis syndromes and in non-syndromic craniosynostosis the underlying gene defects and pathomechanisms are unknown. Here we report on a male infant presenting at birth with brachycephaly, proptosis, midfacial hypoplasia, and low set ears. Three dimensional cranial computer tomography showed fusion of the lambdoid sutures and distal part of the sagittal suture with a gaping anterior fontanelle. Mutations in the genes for FGFR2 and FGFR3 were excluded. Standard chromosome analysis revealed a de novo balanced translocation t(9;11)(q33;p15). The breakpoint on chromosome 11p15 disrupts the SOX6 gene, known to be involved in skeletal growth and differentiation processes. SOX6 mutation screening of another 104 craniosynostosis patients revealed one missense mutation leading to the exchange of a highly conserved amino acid (p.D68N) in a single patient and his reportedly healthy mother. The breakpoint on chromosome 9 is located in a region without any known or predicted genes but, interestingly, disrupts patches of evolutionarily highly conserved non-genic sequences and may thus led to dysregulation of flanking genes on chromosome 9 or 11 involved in skull vault development. The present case is one of the very rare reports of an apparently balanced translocation in a patient with syndromic craniosynostosis, and reveals novel candidate genes for craniosynostoses and cranial suture formation.

Also flagged:immune responsetumorgranulocyte macrophage colony stimulating factorGM-CSFcarcinomatumors
Journal Article 2005-10-27 No Snippets Assudani DP, Ahmad M, Li G, Rees RC, Ali SA.
Show Full Abstract

Several vectors, viral and bacterial, have been developed over the past few years for means of generating an effective antitumor immune response. We have developed and studied a "model for immunotherapy" using a viral vector disabled infectious single cycle-herpes simplex virus (DISC-HSV), which efficiently transduces various tumor cell lines and offers a useful vehicle for the further development of cell-based vaccines. The immunotherapeutic potential of DISC-HSV encoding granulocyte macrophage colony stimulating factor (GM-CSF) was demonstrated in a number of murine carcinoma models, leading to complete regression of well-established tumors in up to 70% of the mice. Moreover, the therapeutic potential of DISC-HSV-GM-CSF was significantly enhanced when used in combination therapy with either OX40L or dendritic cells (DC), even in a poorly immunogenic tumor model. The ability of this vector to accept large gene inserts, its good safety profile, its ability to undergo only a single round of infection, the inherent viral immunostimulatory properties and its ability to infect various tumor cell lines efficiently, make DISC-HSV an ideal candidate vector for immunotherapy. The DISC- CT-26 tumor model was used to investigate the mechanisms associated with immunotherapy induced tumor rejection. Although CTL induction, was positively correlated with regression, MHC class I down regulation and accumulation of immature Gr1+ myeloid cells were shown to be the main immuno-suppressor mechanisms operating against regression and associated with progressive tumor growth. The CTL response was associated with the immuno-dominant AH-1 peptide of the retroviral glycoprotein gp70. This model of immunotherapy has provided an opportunity to dissect further the immunological events associated with tumor-rejection and escape. Since other antigens may be important in initiating tumor rejection, we have investigated the expression of MTA-1, an antigen that appears to be expressed widely in human and murine tumors. The immunogenicity of MTA-1 was studied and its potential as a tumor rejection antigen is under investigation.

Also flagged:behavioralAlzheimer diseaseCOMTAPOEADdementia
Journal Article 2005-10-27 ✓ 2 Snippets Borroni B, Grassi M, Agosti C, Costanzi C, Archetti S, Franzoni S, Caltagirone C, Di Luca M, Caimi L, Padovani A.
In-Text Gene Mentions

The present study sought to evaluate the relationship between such behavioral endophenotypes in AD and genetic variations in dopamine- or serotonin-related genes, such as catechol-O-methyltransferase (COMT) or 5-HTT gene-linked promoter region (5-HTTLPR), and apolipoprotein E (APOE).

…-O-methyltransferase (COMT) or5-HTTgene-linked promoter region…

Show Full Abstract

Several studies have been conducted to understand the genetic correlates of Alzheimer disease (AD)-related behavioral and psychological symptoms in dementia (BPSD). However, given that BPSD rarely occur in isolation, it has been suggested that targeting BPSD individually is too narrow of an approach if one wants to accurately define all the associated risk factors. To date, we know of no work on genetic polymorphisms related to behavioral endophenotypes in AD. The present study sought to evaluate the relationship between such behavioral endophenotypes in AD and genetic variations in dopamine- or serotonin-related genes, such as catechol-O-methyltransferase (COMT) or 5-HTT gene-linked promoter region (5-HTTLPR), and apolipoprotein E (APOE). Among 232 AD patients who underwent clinical and neuropsychological examination, a behavioral and psychiatric evaluation, and genotyping at COMT, 5-HTTPLR, and APOE; 66.4% showed more than one behavioral symptom. By Principal Component Analysis of Neuropsychiatric Inventory (NPI) symptoms four endophenotypes were identified, these were termed "psychosis", "moods", "apathy", and "frontal". Modeling NPI symptom-endophenotype-genotype relationships, and taking into account possible confounds (i.e. demographic characteristics, comorbidities, concomitant pharmacological treatments, and disease severity) by latent variable models, COMT and 5-HTTLPR genetic variations correlated with "frontal" and "psychosis" endophenotypes. APOE genotype did not correlate with any endophenotype. These findings suggest that the possibility of identifying distinct phenotypes on a genetic basis among AD patients exists, and suggest that clustering of BPSD into endophenotypes might provide a new strategy for guiding future research on this issue.

Also flagged:Autosomal dominant hereditary hemochromatosisFerroportin 1Hereditary hemochromatosisironmetabolismSLC40A1
Journal Article 2005-10-27 ✓ 2 Snippets Bach V, Remacha A, Altés A, Barceló MJ, Molina MA, Baiget M.
In-Text Gene Mentions

Hereditary hemochromatosis is a common disorder of iron metabolism most frequently associated with mutations in the HFE gene.

…mutations in theHFEgene.…

Show Full Abstract

Hereditary hemochromatosis is a common disorder of iron metabolism most frequently associated with mutations in the HFE gene. Hereditary hemochromatosis may be caused by other genetic mutations including those in the SLC40A1 gene. This report describes the clinical and laboratory findings of two Spanish families with autosomal dominant iron overload associated with previously unrecognized Ferroportin 1 mutations (p.R88T and p.I180T). The phenotype of iron overload in the patients carrying these mutations could correspond to the group of clinical mutations that lose their iron export function.

Also flagged:membranemonoamine transportersdopaminenorepinephrineserotoninsynaptic cleft
Journal Article 2005-10-27 No Snippets Surratt CK, Ukairo OT, Ramanujapuram S.
Show Full Abstract

The plasma membrane monoamine transporters terminate neurotransmission by removing dopamine, norepinephrine, or serotonin from the synaptic cleft between neurons. Specific inhibitors for these transporters, including the abused psychostimulants cocaine and amphetamine and the tricyclic and SSRI classes of antidepressants, exert their physiological effects by interfering with synaptic uptake and thus prolonging the actions of the monoamine. Pharmacological, biochemical, and immunological characterization of the many site-directed, chimeric, and deletion mutants generated for the plasma membrane monoamine transporters have revealed much about the commonalities and dissimilarities between transporter substrate, ion, and inhibitor binding sites. Mutations that alter the binding affinity or substrate uptake inhibition potency of inhibitors by at least 3-fold are the focus of this review. These findings are clarifying the picture regarding substrate uptake inhibitor/transporter protein interactions at the level of the drug pharmacophore and the amino acid residue, information necessary for rational design of novel medications for substance abuse and a variety of psychiatric disorders.

Also flagged:BIPinter-alpha-trypsin inhibitor heavy chain 4HTJ1membrane proteinsmolecular chaperonealpha1-antichymotrypsin
Journal Article 2005-10-26 No Snippets Kroczynska B, King-Simmons L, Alloza L, Alava MA, Elguindi EC, Blond SY.
Show Full Abstract

MTJ1/ERdj1 and its human homologue HTJ1 are membrane proteins that interact with the molecular chaperone BiP through their J-domain. HTJ1 also contains a C-terminal cytosolic region of unknown function that consists of two SANT domains separated by a spacer region. We recently showed that the second SANT domain of HTJ1 (SANT2) binds to alpha1-antichymotrypsin and alters its serpin activity [B. Kroczynska, C.M. Evangelista, S.S. Samant, E.C. Elguindi, S.Y. Blond, The SANT2 domain of the murine tumor cell DnaJ-like protein 1 human homologue interacts with alpha1-antichymotrypsin and kinetically interferes with its serpin inhibitory activity, J. Biol. Chem. 279 (2004) 11432-11443]. Here, we identified a new variant of human inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4) that also interacts with the SANT2 domain of HTJ1. Biochemical, mutagenesis, and fluorescence studies demonstrate that SANT2 binds to a carboxyl-terminal fragment that corresponds to the last third of the new ITIH4 isoform sequence (residues 588-930). ITIH4 and MTJ1 co-immunoprecipitate from total liver protein extracts and SANT2 protects the ITIH4(588-930) recombinant fragment from being processed by kallikrein in vitro. This work reveals that the SANT2 domain of HTJ1 is a genuine protein-protein interaction module.

Also flagged:antigen presentationICOSB7RP-1
Journal Article 2005-10-25 No Snippets Smith KM, Garside P, McNeil RC, Brewer JM.
Show Full Abstract

Previous studies show that the generation of maximal T cell responses requires B cell antigen presentation and the differential expression of costimulatory molecules by B cells may affect polarization of naïve T cells to Th1 or Th2 phenotypes. We have therefore characterized the expression of activation and costimulatory molecules on antigen-specific T and B cells following immunisation with Alum or Alum/LPS to induce Th2 or Th1 responses in vivo. While antigen-specific B cells show similar levels of activation with respect to MHCII upregulation following Th1 or Th2 induction, they differentially express costimulatory molecules. Although ICOS-B7RP-1 interactions were originally implicated in Th2 generation, surprisingly this receptor-ligand pair was only upregulated on antigen-specific T and B cells following Th1 induction. In conclusion, these studies indicate that during the generation of antigen-specific Th1 or Th2 responses, adjuvants induce differential costimulation in antigen-specific B cells that may subsequently influence T cell polarization.

Also flagged:POU-domain transcription factorOct-6schizophreniabipolar disordermajor depressionpsychological disorder
Journal Article 2005-10-24 ✓ 1 Snippet Ubhi K, Price J.
In-Text Gene Mentions

…member of thePOU-IIIsubfamily.…

Show Full Abstract

<h4>Background</h4>The POU-domain transcription factor Oct-6 has been reported to be differentially expressed between schizophrenic and control post-mortem brains. In this study, we attempted to replicate this finding and to discover whether Oct-6 was also dysregulated in bipolar disorder and major depression.<h4>Methods</h4>Oct-6 mRNA and protein expression were determined by in-situ hybridization and immunohistochemistry respectively in sections of post-mortem brain.<h4>Results</h4>We did not observe any differences in Oct-6 expression between any of the groups under study. Oct-6 mRNA and protein was identically expressed in the hippocampal and cortical regions of most specimens in all groups, including controls.<h4>Conclusion</h4>Oct-6 is, therefore, unlikely to be a specific marker for any psychological disorder; rather its expression in controls suggests that it is normally expressed in most adult brains.

Also flagged:Huntington diseasegene expressionHuntingtincytoplasmicHDautosomal
Journal Article 2005-10-21 No Snippets Omi K, Hachiya NS, Tokunaga K, Kaneko K.
Show Full Abstract

Huntingtin is a ubiquitously expressed cytoplasmic protein encoded by the Huntington disease (HD) gene, in which a CAG expansion induces an autosomal dominant progressive neurodegenerative disorder; however, its biological function has not been completely elucidated. Here, we report for the first time that short interfering RNA (siRNA)-mediated inhibition of endogenous Hdh (a mouse homologue of huntingtin) gene expression induced an aberrant configuration of the endoplasmic reticulum (ER) network in vitro. Studies using immunofluorescence microscopy with several ER markers revealed that the ER network appeared to be congregated in various types of cell lines transfected with siRNA directed against Hdh, but not with other siRNAs so far tested. Other subcellular organelles and structures, including the nucleus, Golgi apparatus, mitochondria, lysosomes, microtubules, actin cytoskeletons, cytoplasm, lipid rafts, and plasma membrane, exhibited normal configurations. Western blot analysis of cellular prion protein (PrP(C)) revealed normal glycosylation, which is a simple marker of post-translational modification in the ER and Golgi compartments, and immunofluorescence microscopy detected no altered subcellular distribution of PrP(C) in the post-ER compartments. Further investigation is required to determine whether the distorted ER network, i.e., loss of the huntingtin function, participates in the development of HD.

Also flagged:IronmetabolismanemiahbdHemoglobinchromosome
Journal Article 2005-10-20 ✓ 1 Snippet Wilkins SJ, Frazer DM, Millard KN, McLaren GD, Anderson GJ.
In-Text Gene Mentions

Hfe

Show Full Abstract

The iron requirements of the erythroid compartment modulate the expression of hepcidin in the liver, which in turn alters intestinal iron absorption and iron release from the reticuloendothelial system. We have taken advantage of an inherited anemia of the mouse (hemoglobin deficit, or hbd) to gain insights into the factors regulating hepcidin expression. hbd mice showed a significant anemia but, surprisingly, their iron absorption was not increased as it was in wild-type animals made anemic to a similar degree by dietary iron depletion. In wild-type mice hepatic hepcidin levels were decreased but in hbd animals a significant and unexpected increase was observed. The level of absorption was appropriate for the expression of hepcidin in each case, but in hbd mice did not reflect the degree of anemia. However, this apparent inappropriate regulation of hepcidin correlated with increased transferrin saturation and levels of diferric transferrin in the plasma, which in turn resulted from the reduced capacity of hbd animals to effectively use transferrin-bound iron. These data strengthen the proposal that diferric transferrin is a key indicator of body iron requirements.

Also flagged:tryptophanserotonin transporterserotoninof impulse controlamino acid
Journal Article 2005-10-19 ✓ 5 Snippets Clark L, Roiser JP, Cools R, Rubinsztein DC, Sahakian BJ, Robbins TW.
In-Text Gene Mentions

Subjects possessing the short allele of the 5-HTT polymorphism were not more impulsive on the SST than subjects homozygous for the long allele under placebo conditions and were not disproportionately sensitive to the effects of ATD.

The influences of 5-HTT polymorphism, gender and trait impulsivity were investigated.<h4>Results</h4>ATD was associated with significant depletion of plasma tryptophan levels but did not increase the stop signal reaction time in comparison to the balanced (placebo) amino acid mixture.

<h4>Rationale</h4>Reduced serotonin neurotransmission is implicated in disorders of impulse control, but the involvement of serotonin in inhibitory processes in healthy human subjects remains unclear.<h4>Objectives</h4>To investigate the effects of an acute manipulation of serotonin and genotype at a functional polymorphism in a gene coding for the serotonin transporter (5-HTT) on an established measure of response inhibition.<h4>Methods</h4>Serotonin function was reduced by the acute tryptophan depletion (ATD) procedure in a double-blind, crossover design in 42 healthy subjects.

…the serotonin transporter (5-HTT) on an established…

…The influences of5-HTTpolymorphism, gender and…

Show Full Abstract

<h4>Rationale</h4>Reduced serotonin neurotransmission is implicated in disorders of impulse control, but the involvement of serotonin in inhibitory processes in healthy human subjects remains unclear.<h4>Objectives</h4>To investigate the effects of an acute manipulation of serotonin and genotype at a functional polymorphism in a gene coding for the serotonin transporter (5-HTT) on an established measure of response inhibition.<h4>Methods</h4>Serotonin function was reduced by the acute tryptophan depletion (ATD) procedure in a double-blind, crossover design in 42 healthy subjects. The Stop Signal Task (SST) was administered 5-7 h after drink administration. The influences of 5-HTT polymorphism, gender and trait impulsivity were investigated.<h4>Results</h4>ATD was associated with significant depletion of plasma tryptophan levels but did not increase the stop signal reaction time in comparison to the balanced (placebo) amino acid mixture. Subjects possessing the short allele of the 5-HTT polymorphism were not more impulsive on the SST than subjects homozygous for the long allele under placebo conditions and were not disproportionately sensitive to the effects of ATD. There was no effect of gender or trait impulsivity on ATD-induced change.<h4>Conclusions</h4>We find no support for the involvement of brain serotonin neurotransmission in this form of inhibitory control in healthy human subjects.

This Week in The Journal

Also flagged:rassynapsin Isynaptic vesiclesactincytoskeletonphosphorylation
Journal Article 2005-10-19 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

htt

Show Full Abstract

No abstract available.

Also flagged:Sox5collagen type IIcollagenextracellularproteoglycanscupromeronic blue
Journal Article 2005-10-18 ✓ 1 Snippet Kramer J, Klinger M, Kruse C, Faza M, Hargus G, Rohwedel J.
In-Text Gene Mentions

…as Sox5 andSox6.…

Show Full Abstract

Pluripotent embryonic stem (ES) cells cultivated as cellular aggregates, so called embryoid bodies (EBs), differentiate spontaneously into different cell types of all three germ layers in vitro resembling processes of cellular differentiation during embryonic development. Regarding chondrogenic differentiation, murine ES cells differentiate into progenitor cells, which form pre-cartilaginous condensations in the EB-outgrowths and express marker molecules characteristic for mesenchymal cell types such as Sox5 and Sox6. Later, mature chondrocytes appear which express collagen type II, and the collagen fibers show a typical morphology as demonstrated by electron-microscopical analysis. These mature chondrogenic cells are organized in cartilage nodules and produce large amounts of extracellular proteoglycans as revealed by staining with cupromeronic blue. Finally, cells organized in nodules express collagen type X, indicating the hypertrophic stage. In conclusion, differentiation of murine ES cells into chondrocytes proceeds from the undifferentiated stem cell via progenitor cells up to mature chondrogenic cells, which then undergo hypertrophy. Furthermore, because the ES-cell-derived chondrocytes did not express elastin, a marker for elastic cartilage tissue, we suggest the cartilage nodules to resemble hyaline cartilage tissue.

Also flagged:Huntington diseaseHDneuropsychiatric diseasebehavioralNMDAR
Journal Article 2005-10-17 No Snippets Graham RK, Slow EJ, Deng Y, Bissada N, Lu G, Pearson J, Shehadeh J, Leavitt BR, Raymond LA, Hayden MR.
Show Full Abstract

Huntington disease (HD) is a devastating neuropsychiatric disease caused by expansion of a trinucleotide repeat (CAG) in the HD gene. Neuropathological changes include the appearance of N-terminal huntingtin fragments, decreased brain weight and apoptotic neuronal loss in a select subset of neurons located in the striatum. There is still controversy over whether homozygosity for the mutation in HD is associated with a more severe phenotype. In humans, resolution of this issue has been complicated by the small number of homozygous patients and difficulty in the definition of reliable phenotypic endpoints. In order to definitively determine whether there is a correlation between phenotypic severity and expression levels of mutant huntingtin, we undertook a behavioral and neuropathological assessment of YAC128 mice with varying levels of mutant huntingtin. The results reveal a clear relationship between levels of mutant huntingtin and phenotype defined by earlier age of onset, more rapid progression, enhanced striatal volume loss, acceleration of nuclear huntingtin fragment accumulation and increased sensitivity to NMDAR-mediated excitotoxicity. These results provide clear evidence in vivo supporting a more severe phenotype associated with increased levels of mutant huntingtin as seen in homozygotes for HD.

Also flagged:histonehistone kinasesexual reproductionchromosomeschromosomalfemale sterility
Journal Article 2005-10-17 ✓ 1 Snippet Ivanovska I, Khandan T, Ito T, Orr-Weaver TL.
In-Text Gene Mentions

Condensin

Show Full Abstract

To promote faithful propagation of the genetic material during sexual reproduction, meiotic chromosomes undergo specialized morphological changes that ensure accurate segregation of homologous chromosomes. The molecular mechanisms that establish the meiotic chromosomal structures are largely unknown. We describe a mutation in a recently identified Histone H2A kinase, nhk-1, in Drosophila that leads to female sterility due to defects in the formation of the meiotic chromosomal structures. The metaphase I arrest and the karyosome, a critical prophase I chromosomal structure, require nucleosomal histone kinase-1 (NHK-1) function. The defects are a result of failure to disassemble the synaptonemal complex and to load condensin onto the mutant chromosomes. Embryos laid by nhk-1-/- mutant females arrest with aberrant polar bodies and mitotic spindles, revealing that mitosis is affected as well. We analyzed the role of Histone H2A phosphorylation with respect to the histone code hypothesis and found that it is required for acetylation of Histone H3 and Histone H4 in meiosis. These studies reveal a critical role for histone modifications in chromosome dynamics in meiosis and mitosis.

Also flagged:pathogenesishepatocellular carcinomatumorshepatitis C virus infectionhepatitis B virus infectionalcoholic liver disease
Journal Article 2005-10-14 ✓ 1 Snippet Merle P.
In-Text Gene Mentions

…liver disease andhemochromatosis.…

Show Full Abstract

Hepatocellular carcinoma is one of the most prevalent tumors worldwide and its incidence is increasing due to hepatitis C virus infection. Other etiologic factors are hepatitis B virus infection, alcoholic liver disease and hemochromatosis. This tumor mainly develops in cirrhotic livers that are true precancerous states. Although mechanisms of hepatocarcinogenesis remain badly known, some signaling pathways are frequently deregulated: inactivation of the p53 tumor suppressor factor in 25% of HCC, activation of the Wnt signaling and the telomerase immortalization enzyme in most of tumors. Hepatitis viruses play a direct oncogenic role by interaction between viral proteins and cellular ones, which control cell homeostasis, or by integration of hepatitis B virus genome into the host genome. Furthermore, hepatitis viruses play an indirect oncogenic role by chronic inflammation and hepatocyte regeneration related to viral hepatopathy. In a near future, a better understanding of virus-specific oncogenic mechanisms should allow us to set up innovative preventive and curative therapeutic strategies.

Also flagged:Proteolysischromosomeschromosometrypsinproteinase Kdigestion
Journal Article 2005-10-12 ✓ 1 Snippet Pope LH, Xiong C, Marko JF.
In-Text Gene Mentions

Condensins

Show Full Abstract

The effect of nonspecific proteolysis on the structure of single isolated mitotic newt chromosomes was studied using chromosome elastic response as an assay. Exposure to either trypsin or proteinase K gradually decondensed and softened chromosomes but without entirely eliminating their elastic response. Analysis of chromosome morphology revealed anisotropic decondensation upon digestion, with length increasing more than width. Prolonged protease treatment resulted only in further swelling of the chromosome without complete dissolution. Mild trypsinization induced sensitivity of chromosome elasticity to five- and six-base-specific restriction enzymes. These results, combined with previous studies of effects of nucleases on mitotic chromosome structure, indicate that mild proteolysis gradually reduces the density of chromatin-constraining elements in the mitotic chromosome, providing evidence consistent with an anisotropically folded "chromatin network" model of mitotic chromosome architecture.

Also flagged:gamma-secretasemembraneaspartyl proteasetransmembranemembrane proteinsamyloid precursor protein
Journal Article 2005-10-11 ✓ 2 Snippets Dash PK, Moore AN, Orsi SA.
In-Text Gene Mentions

The gamma-secretase complex, a membrane-bound aspartyl protease, hydrolyzes the transmembrane domains of several integral membrane proteins including the key signaling molecules amyloid precursor protein (APP), Notch, deleted in colorectal cancer (DCC), and N- and E-cadherins.

…in colorectal cancer (DCC), and N- and…

Show Full Abstract

The gamma-secretase complex, a membrane-bound aspartyl protease, hydrolyzes the transmembrane domains of several integral membrane proteins including the key signaling molecules amyloid precursor protein (APP), Notch, deleted in colorectal cancer (DCC), and N- and E-cadherins. The proteolysis processing of these proteins is critical for generation of signaling molecules that may participate in neuronal communication and plasticity. Using a potent gamma-secretase inhibitor, L-685,458, we examined if blockade of its activity in the hippocampus can influence contextual and spatial memory in rats. Surprisingly, we observed that post-training blockade of gamma-secretase activity leads to enhanced long-term memory in two hippocampus-dependent tasks. This suggests that a signaling molecule(s) generated by gamma-secretase activity may have a negative influence on long-term memory formation.

Also flagged:neurodegenerative diseasesamyotrophic lateral sclerosisHuntington's diseaseSOD1YFPproteasome
Journal Article 2005-10-10 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…that, unlike mutant htt, which forms a soli…

…D1 aggregates, as it is by htt aggregates. …

Show Full Abstract

No abstract available.

Also flagged:tumorcancersquamous cell carcinomabenzoporphyrintumorsheat shock protein 70
Journal Article 2005-10-08 ✓ 1 Snippet Korbelik M, Sun J.
In-Text Gene Mentions

C57BL/six mice

Show Full Abstract

A target tumor-derived whole cancer cell therapeutic vaccine was developed based on an in vitro pre-treatment by photodynamic therapy (PDT) and was investigated using a poorly immunogenic tumor model. The vaccine was produced by incubating in vitro expanded mouse squamous cell carcinoma SCCVII cells for 1 h with photosensitizer benzoporphyrin derivative (BPD), then exposing to light (690 nm, 1 J/cm2) and finally to a lethal X-ray dose. Treatment of established subcutaneous SCCVII tumors growing in syngeneic C3H/HeN mice with 2 x 10(7) PDT-vaccine cells per mouse by a peritumoral injection produced a significant therapeutic effect, including growth retardation, regression and cures. Tumor specificity of this PDT-generated vaccine was demonstrated by its ineffectiveness when prepared from a mismatched tumor cell line. Vaccine cells retrieved from the treatment site at 1 h postinjection were intermixed with dendritic cells (DC), exhibited heat shock protein 70 on their surface, and were opsonized by complement C3. Tumor-draining lymph nodes treated by the PDT-vaccine contained dramatically increased numbers of DC as well as B and T lymphocytes (with enlarged memory phenotype fraction in the latter), while high levels of surface-bound C3 were detectable on DC and to a lesser extent on B cells. The PDT-vaccine produced no therapeutic benefit against tumors growing in C3-deficient hosts. It is suggested that surface expression of heat shock proteins and complement opsonization are the two unique features of PDT-treated cells securing avid immune recognition of vaccinated tumor and the development of a strong and effective antitumor adaptive immune response.

Also flagged:myocardial infarctiondystrophic cardiac calcinosischromosomecalciummitochondria
Journal Article 2005-10-07 ✓ 2 Snippets Korff S, Riechert N, Schoensiegel F, Weichenhan D, Autschbach F, Katus HA, Ivandic BT.
In-Text Gene Mentions

…were resistant toDCC, showing formation of…

…The development ofDCCwas studied in…

Show Full Abstract

Independent of the severity, phenotypes and clinical outcomes of myocardial infarction may vary considerably in patients, suggesting a strong genetic influence on healing and adaptive processes. Since little is known about these genetic determinants, we examined the tissue response to myocardial injury in seven inbred mouse strains, including those employed for gene targeting or transgenic overexpression. Myocardial necrosis was produced by non-ischemic, trans-diaphragmal freeze-thaw injury in strains C57BL/6, C3H/He, DBA/2, BALB/c, 129S1, FVB/n and A/J. Two days after injury, necrotic cardiomyocytes calcified in C3H/He, DBA/2, BALB/c and 129S1, a phenotype known as dystrophic cardiac calcinosis (DCC). The susceptibility to DCC of 129S1 was determined by Dyscalc1, a locus on chromosome 7, which was identified previously in C3H/He and DBA/2. DCC was also observed in C3H/He following ischemic injury by permanent coronary artery ligation, indicating that DCC was independent of the mode of injury. In contrast, strains C57BL/6, FVB and A/J were resistant to DCC, showing formation of a fibrous scar without calcification. The development of DCC was studied in detail in C3H/He and C57BL/6. In both strains, no calcium deposition and only little structural disintegration were noted in necrotic myocardium 24 h after injury upon calcium-sensitive fluorescence staining. Ultrastructural examination revealed calcified mitochondria in C3H/He that may have served later as a nidus for rapid intracellular calcification of cardiomyocytes. We concluded that the susceptibility to calcification of myocardial necrosis may be common among inbred strains and should be recognised as a strong genetic modifier of experimental myocardial injury.

Also flagged:thrombinmembranetissue factorTFplatelet activationfibrinogen
Journal Article 2005-10-07 ✓ 1 Snippet Orfeo T, Butenas S, Brummel-Ziedins KE, Mann KG.
In-Text Gene Mentions

ATIII

Show Full Abstract

Formation of thrombin is triggered when membrane-localized tissue factor (TF) is exposed to blood. In closed models of this process, thrombin formation displays an initiation phase (low rates of thrombin production cause platelet activation and fibrinogen clotting), a propagation phase (>95% of thrombin production occurs), and a termination phase (prothrombin activation ceases and free thrombin is inactivated). A current controversy centers on whether the TF stimulus requires supplementation from a circulating pool of blood TF to sustain an adequate procoagulant response. We have evaluated the requirement for TF during the progress of the blood coagulation reaction and have extended these analyses to assess the requirement for TF during resupply ("flow replacement"). Elimination of TF activity at various times during the initiation phase indicated: a period of absolute dependence (<10 s); a transitional period in which the dependence on TF is partial and decreases as the reaction proceeds (10-240 s); and a period in which the progress of the reaction is TF independent (>240 s). Resupply of reactions late during the termination phase with fresh reactants, but no TF, yielded immediate bursts of thrombin formation similar in magnitude to the original propagation phases. Our data show that independence from the initial TF stimulus is achieved by the onset of the propagation phase and that the ensemble of coagulation products and intermediates that yield this TF independence maintain their prothrombin activating potential for considerable time. These observations support the hypothesis that the transient, localized expression of TF is sufficient to sustain a TF-independent procoagulant response as long as flow persists.

Also flagged:Haemochromatosisironantibodypeptidemembraneendosomes
Journal Article 2005-10-06 ✓ 5 Snippets West AR, Thomas C, Sadlier J, Oates PS.
In-Text Gene Mentions

…The haemochromatosis protein (HFE) is an important…

HFEis also present…

…raised against ratHFEand validated by…

…sub-cellular location ofHFEin enterocytes of…

HFEco-localised exclusively with…

Show Full Abstract

The haemochromatosis protein (HFE) is an important regulator of body iron stores. In the liver, HFE is required for appropriate expression of hepcidin, a humoral mediator of iron absorption. HFE is also present in enterocytes, though its function in the intestine is unknown; it is not intrinsically required for iron absorption, but can augment iron absorption when over-expressed-independent of hepcidin regulation by the liver. In this study, an antibody was raised against rat HFE and validated by enzyme-linked immunosorbent assay, Western blot and quenching of antibody function by the immunising peptide. The sub-cellular location of HFE in enterocytes of iron-deficient and control rats was determined by double-labelling experiments with markers for the microvillus membrane, terminal web, early endosomes, lysosomes and the transferrin receptor. Parallel studies were performed for the primary iron absorption protein, divalent metal transporter 1 (DMT1). HFE co-localised exclusively with the terminal web of intestinal enterocytes. HFE expression was increased in iron deficiency, consistent with a second regulatory role for HFE in iron absorption, independent of hepcidin from the liver. DMT1 was localised primarily on the microvillus membrane, but did partially co-localise with HFE raising the possibility that the two proteins may interact to regulate iron absorption.

Also flagged:serotonin transportersertralineserotoninpositron5binding
Journal Article 2005-10-06 ✓ 2 Snippets Parsey RV, Kent JM, Oquendo MA, Richards MC, Pratap M, Cooper TB, Arango V, Mann JJ.
In-Text Gene Mentions

<h4>Background</h4>In vivo determination of serotonin transporter (5-HTT) occupancy by selective serotonin reuptake inhibitors (SSRI) using positron emission tomography (PET) can aid in determination of dosing.

…of serotonin transporter (5-HTT) occupancy by selective…

Show Full Abstract

<h4>Background</h4>In vivo determination of serotonin transporter (5-HTT) occupancy by selective serotonin reuptake inhibitors (SSRI) using positron emission tomography (PET) can aid in determination of dosing. Previous studies used chronic SSRI administration that may down-regulate 5-HTT and used the cerebellum as reference region despite measurable 5-HTT. We examine the reference region and occupancy after acute sertraline dosing.<h4>Methods</h4>We conducted autoradiography of human postmortem cerebellum to determine an optimal reference region. We quantified 5-HTT binding using [(11)C]DASB and arterial input functions in 17 healthy volunteers. Baseline PET scans were followed by a scan 4-6 days after 25 mg to 100mg of daily sertraline. Several modeling methods and outcome measures were assessed.<h4>Results</h4>Cerebellar gray matter is the optimal reference region. Occupation of 5-HTT sites saturates at low plasma sertraline levels (K(D) = 1.9 ng/ml) with maximal occupancies of 106.8 +/- 8.3% across all brain regions. There is a weak correlation between oral sertraline and plasma sertraline. Occupancy measures vary based on the reference region and outcome measure used.<h4>Conclusions</h4>Occupancy studies and postmortem autoradiography can help define the optimal reference region. Reference tissue modeling using the optimal reference region returns the same occupancy measures as those determined using an arterial input function.

Also flagged:gene expressionnucleotideAMY2AlocalizationATP1B1Chromosome
Journal Article 2005-10-05 No Snippets Bonizzoni P, Rizzi R, Pesole G.
Show Full Abstract

<h4>Background</h4>Currently available methods to predict splice sites are mainly based on the independent and progressive alignment of transcript data (mostly ESTs) to the genomic sequence. Apart from often being computationally expensive, this approach is vulnerable to several problems--hence the need to develop novel strategies.<h4>Results</h4>We propose a method, based on a novel multiple genome-EST alignment algorithm, for the detection of splice sites. To avoid limitations of splice sites prediction (mainly, over-predictions) due to independent single EST alignments to the genomic sequence our approach performs a multiple alignment of transcript data to the genomic sequence based on the combined analysis of all available data. We recast the problem of predicting constitutive and alternative splicing as an optimization problem, where the optimal multiple transcript alignment minimizes the number of exons and hence of splice site observations. We have implemented a splice site predictor based on this algorithm in the software tool ASPIC (Alternative Splicing PredICtion). It is distinguished from other methods based on BLAST-like tools by the incorporation of entirely new ad hoc procedures for accurate and computationally efficient transcript alignment and adopts dynamic programming for the refinement of intron boundaries. ASPIC also provides the minimal set of non-mergeable transcript isoforms compatible with the detected splicing events. The ASPIC web resource is dynamically interconnected with the Ensembl and Unigene databases and also implements an upload facility.<h4>Conclusion</h4>Extensive bench marking shows that ASPIC outperforms other existing methods in the detection of novel splicing isoforms and in the minimization of over-predictions. ASPIC also requires a lower computation time for processing a single gene and an EST cluster. The ASPIC web resource is available at http://aspic.algo.disco.unimib.it/aspic-devel/.

Also flagged:osteoarthritisarthritispolyarticular osteoarthritisOAarthropathyhereditary haemochromatosis
Journal Article 2005-10-05 ✓ 2 Snippets Carroll GJ.
In-Text Gene Mentions

…peoples, notably theHFEgene and an…

…mutations in theHFEgene will associate…

Show Full Abstract

Osteoarthritis is the commonest form of arthritis, at least amongst Caucasians and is frequently polyarticular. Genetic factors are now considered pivotal in the aetiopathogenesis of polyarticular osteoarthritis (POA). This document proposes a nexus between the gene most commonly mutated amongst Caucasian peoples, notably the HFE gene and an appreciable subset of POA patients who have a clinically recognisable OA phenotype. It is hypothesised that there are at least 2 major POA phenotypes each of which is associated with discrete genotypes. Type 1 POA characterized by Heberden's or Bouchard's nodes with prominent DIP, PIP, knee joint (medial compartment) and Great toe MTP joint involvement corresponds to the putative nodal generalized form of OA or NGOA (proposed Type 1 POA phenotype). As yet no genetic marker has been defined for this POA subset. The second is a hitherto less well recognized phenotype characterized by involvement of the index and/or middle finger metacarpophalangeal (MCP2,3) joints and the elbows, ankles and possibly the intertarsal and tarsometatarsal joints. The hip and knee joints may sometimes also be involved. This different joint distribution corresponds closely to the pattern observed in the arthropathy that often accompanies hereditary haemochromatosis. It is predicted that mutations in the HFE gene will associate strongly with the proposed Type 2 POA phenotype and serve as a genetic marker for this clinically recognisable subset.

Also flagged:synthesisendocannabinoidanandamidepentyletheralkylcarbamic acid
Journal Article 2005-10-05 No Snippets Mahadevan A, Razdan RK.
Show Full Abstract

Recent advances in the synthesis of endocannabinoid-related ligands for the period 2001-2004 are covered in this review. During this period the first solid phase synthesis of anandamide (AEA) analogs was developed, which allows modification at both the head group and the end pentyl chain. Synthesis of water-soluble prodrugs of noladin ether was reported, which are chemically stable, rapidly release noladin ether under enzymatic conditions and are shown to reduce intraocular pressure. The structure-activity relationships (SAR) of alkylcarbamic acid aryl esters and the discovery of potent archidonylsulfonyl derivatives as fatty acid amide hydrolase (FAAH) inhibitors are summarized. Recent synthetic developments in the controversial area of anandamide membrane transporter (AMT) inhibitors are also discussed.

This Week in The Journal

Also flagged:axonsaxon collateralshippocampal mossy fibersdendritesboutonsplexin-A3
Journal Article 2005-10-05 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

Htt

Show Full Abstract

No abstract available.

Also flagged:hsp104polyglutamineHuntington's diseaseParkinsons's diseasechaperonedeath
Journal Article 2005-10-04 ✓ 1 Snippet Vacher C, Garcia-Oroz L, Rubinsztein DC.
In-Text Gene Mentions

Huntington's disease is a devastating neurodegenerative condition associated with the formation of intraneuronal aggregates by mutant huntingtin.

Show Full Abstract

Huntington's disease is a devastating neurodegenerative condition associated with the formation of intraneuronal aggregates by mutant huntingtin. Aggregate formation is a property shared by the nine related diseases caused by polyglutamine codon expansion mutations and also by other neurodegenerative conditions like Parkinsons's disease. The roles of aggregates and aggregation in these diseases have been a subject of heated controversy. Here, we have addressed the question in vivo by generating a new transgenic mouse overexpressing the yeast chaperone hsp104, as hsp104 overexpression reduced mutant huntingtin aggregation and toxicity in cell models. Hsp104 has no close mammalian orthologues and does not appear to have effects on mammalian cell death pathways. We crossed hsp104 transgenic mice with mice expressing the first 171 residues of mutant huntingtin. Hsp104 reduced aggregate formation and prolonged the lifespan of the HD mice by 20%. This protection may be mediated at the level of changing the conformation of a putative toxic monomer, reducing oligomerization or aggregation, reducing the levels of oligomeric species or aggregates or combinations of these non-mutually exclusive possibilities.

Also flagged:Huntington diseaseTP53HDaminotranscription factorscaspase activated DNase
Journal Article 2005-10-03 ✓ 5 Snippets Arning L, Kraus PH, Saft C, Andrich J, Epplen JT.
In-Text Gene Mentions

TP53 is an attractive candidate for modifying age of onset (AO) in Huntington disease (HD): The amino-terminus of the mutated huntingtin (htt) exon 1 translation product has functional properties which may affect critically the TP53 pathway in HD neurons.

It has been proposed that the amino-terminal portion of mutant htt encoded by exon 1 exertsfunctional properties with significant consequences for the TP53 pathway in HD neurons.

…the mutated huntingtin (htt) exon 1 translation…

…domain of mutanthttinteracts with nuclear…

…the protein huntingtin (htt), which apparently acquires…

Show Full Abstract

<h4>Background</h4>TP53 is an attractive candidate for modifying age of onset (AO) in Huntington disease (HD): The amino-terminus of the mutated huntingtin (htt) exon 1 translation product has functional properties which may affect critically the TP53 pathway in HD neurons. The pathogenic domain of mutant htt interacts with nuclear transcription factors, and it potentially modulates TP53-induced transcriptional events. A single nucleotide polymorphism (SNP) resulting in the R72P exchange in TP53 protein might modulate the variation in AO. In addition, also the R196K replacement in human caspase activated DNase (hCAD) may theoretically affect the AO.<h4>Methods</h4>We have genotyped the polymorphisms R72P and R196K in a well established cohort of 167 unrelated HD patients.<h4>Results</h4>The expanded CAG repeat explained 30.8% of the variance in AO. Adding the genotypes of the SNPs investigated did not affect the variance of the AO variance explained.<h4>Conclusion</h4>In this replication study, no association was found explaining a significant amount of the variability in AO of HD thus contradicting a recent report.

Also flagged:Netrin-1leukocyte migrationCell migrationneuronal migrationUNC5b receptorinflammatory
Journal Article 2005-10-03 ✓ 1 Snippet Ly NP, Komatsuzaki K, Fraser IP, Tseng AA, Prodhan P, Moore KJ, Kinane TB.
In-Text Gene Mentions

DCC

Show Full Abstract

Cell migration plays important roles in embryonic development and inflammation, and this process is highly regulated to ensure tissue homeostasis. A number of barriers exist to prevent the inappropriate migration of leukocytes into healthy peripheral tissues, including retention of these cells in the inactive state and maintenance of the integrity and charge of the vascular endothelium. However, active signals also are likely to exist that can repulse cells or abolish existing cell migration. One such paradigm exists in the developing nervous system, where neuronal migration is mediated by a balance between chemoattractive and chemorepulsive signals. The ability of the guidance molecule netrin-1 to repulse or abolish attraction of neuronal cells expressing the UNC5b receptor makes it an attractive candidate for the regulation of inflammatory cell migration. Here, we show that netrin-1 is expressed on vascular endothelium, where it is regulated by infection and inflammatory cytokines. The netrin-1 receptor UNC5b is strongly expressed by leukocytes, upon which netrin-1 acts as a potent inhibitor of migration to different chemotactic stimuli both in vivo and in vitro. These data suggest that endothelial expression of netrin-1 may inhibit basal cell migration into tissues and that its down-regulation with the onset of sepsis/inflammation may facilitate leukocyte recruitment.

Also flagged:amino acidsembryogenesisnucleusSktchromosomeSd
Journal Article 2005-10-03 ✓ 1 Snippet Semba K, Araki K, Li Z, Matsumoto K, Suzuki M, Nakagata N, Takagi K, Takeya M, Yoshinobu K, Araki M, Imai K, Abe K, Yamamura K.
In-Text Gene Mentions

Sox6

Show Full Abstract

We established the mutant mouse line, B6;CB-SktGtAyu8021IMEG (SktGt), through gene-trap mutagenesis in embryonic stem cells. The novel gene identified, called Sickle tail (Skt), is composed of 19 exons and encodes a protein of 1352 amino acids. Expression of a reporter gene was detected in the notochord during embryogenesis and in the nucleus pulposus of mice. Compression of some of the nuclei pulposi in the intervertebral discs (IVDs) appeared at embryonic day (E) 17.5, resulting in a kinky-tail phenotype showing defects in the nucleus pulposus and annulus fibrosus of IVDs in SktGt/Gt mice. These phenotypes were different from those in Danforth's short tail (Sd) mice in which the nucleus pulposus was totally absent and replaced by peripheral fibers similar to those seen in the annulus fibrosus in all IVDs. The Skt gene maps to the proximal part of mouse chromosome 2, near the Sd locus. The genetic distance between them was 0.95 cM. The number of vertebrae in both [Sd +/+ SktGt] and [Sd SktGt/+ +] compound heterozygotes was less than that of Sd heterozygotes. Furthermore, the enhancer trap locus Etl4lacZ, which was previously reported to be an allele of Sd, was located in the third intron of the Skt gene.

Also flagged:cannabinoidfluoxetineserotonin transportertyrosine hydroxylaseTHCB1 receptor
Journal Article 2005-10-01 ✓ 1 Snippet Oliva JM, Urigüen L, Pérez-Rial S, Manzanares J, Manzanares J.
In-Text Gene Mentions

…on serotonin transporter (5-HTT), opioid, tyrosine hydroxylas…

Show Full Abstract

This study examined the time course effects (8, 16 and 31 days) of fluoxetine administration (1 mg/kg, p.o./day) on serotonin transporter (5-HTT), opioid, tyrosine hydroxylase (TH) and cannabinoid CB1 receptor gene expressions in selected regions of the rat brain. Treatment with fluoxetine progressively decreased (35-55%) 5-HTT gene expression in dorsal raphe nucleus at 8, 16 and 31 days. The results revealed that fluoxetine administration decreased (30%) proenkephalin gene expression in nucleus accumbens shell (AcbS) and caudate-putamen (CPu) (31 days) but was without effect in nucleus accumbens core AcbC. A pronounced and time related decrease (25-65%) in prodynorphin gene expression was detected in AcbC, AcbS, CPu, hypothalamic supraoptic and paraventricular nuclei at all time points as well as in proopiomelanocortin gene expression (20-30%) in the arcuate nucleus (ARC) of the hypothalamus. On days 16 and 31, tyrosine hydroxylase gene expression in ventral tegmental area and substantia nigra and cannabinoid CB1 receptor gene expression in the CPu decreased (approximately 45-50% from vehicle). In conclusion, fluoxetine by inhibiting the reuptake of serotonin produced pronounced and time related alterations in genes involved in the regulation of emotional behaviour, suggesting that these neuroplastic changes may be involved, at least in part, in the clinical efficacy of this drug in neuropsychiatric disorders.

Also flagged:ironmatingscarbonylliver tumorsASP
Journal Article 2005-10-01 ✓ 2 Snippets Wolff GL, Whittaker P.
In-Text Gene Mentions

…the study ofhemochromatosis.…

…tool for investigatinghemochromatosiswas not confirmed,…

Show Full Abstract

Isogenic and congenic offspring from matings of inbred black a/a dams by sibling (or non-sibling from another inbred strain) yellow agouti Avy/a sires provide an animal model of obese yellow agouti Avy/a and isogenic lean pseudoagouti Avy/a mice exhibiting two different in vivo concentrations (high, very low) of ectopic agouti protein (ASP) with congenic lean black a/a mice as null controls. This makes it possible to differentiate between the high and very low dose levels of ectopic ASP with respect to interactions with diverse physiological and molecular pathways. Assay of differential responses to 12 or 24 months of carbonyl iron overload assessed the possible suitability of this animal model for the study of hemochromatosis. Agouti A/a B6C3F1 mice were used as non-congenic null controls. The age-related waxing and waning of body weight, food consumption, and caloric efficiency, as well as associated changes in pancreatic islets and islet cells, and formation of liver tumors were assayed. While the hypothesis that these mice might serve as a tool for investigating hemochromatosis was not confirmed, the data did provide evidence that even the very low levels of ASP in pseudoagouti Avy/a mice affect the network of molecular/metabolic/physiological response pathways that comprises the yellow agouti obese phenome. We suggest that the combination of yellow agouti Avy/a, pseudoagouti Avy/a, and black a/a congenic mice provides a practical tool for applying a dose-response systems biology approach to understanding the dysregulatory influence of ectopic ASP on the molecular-physiological matrix of the organism.

Also flagged:neurodegenerative disorderpolyglutamineHDpreproenkephalindopaminecAMP-responsive phosphoprotein 32
Journal Article 2005-10-01 ✓ 2 Snippets Rodriguez-Lebron E, Denovan-Wright EM, Nash K, Lewin AS, Mandel RJ.
In-Text Gene Mentions

Intrastriatal rAAV-mediated delivery of anti-huntingtin shRNAs induces partial reversal of disease progression in R6/1 Huntington's disease transgenic mice.

Htt

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disorder caused by the presence of an abnormally expanded polyglutamine domain in the N-terminus of huntingtin. We developed a recombinant adeno-associated viral serotype 5 (rAAV5) gene transfer strategy to posttranscriptionally suppress the levels of striatal mutant huntingtin (mHtt) in the R6/1 HD transgenic mouse via RNA interference. Transient cotransfection of HEK293 cells with plasmids expressing a portion of human mHtt derived from R6/1 transgenic HD mice and a short-hairpin RNA directed against the 5' UTR of the mHtt mRNA (siHUNT-1) resulted in reduction in the levels of mHtt mRNA (-75%) and protein (-60%). Long-term in vivo rAAV5-mediated expression of siHUNT-1 in the striatum of R6/1 mice reduced the levels of mHtt mRNA (-78%) and protein (-28%) as determined by quantitative RT-PCR and Western blot analysis, respectively. The reduction in mHtt was concomitant with a reduction in the size and number of neuronal intranuclear inclusions and a small but significant normalization of the steady-state levels of preproenkephalin and dopamine- and cAMP-responsive phosphoprotein 32 kDa mRNA. Finally, bilateral expression of rAAV5-siHUNT-1 resulted in delayed onset of the rear paw clasping phenotype exhibited by the R6/1 mice. These results suggest that a reduction in the levels of striatal mHtt can ameliorate the HD phenotype of R6/1 mice.

Also flagged:Hepcidinpeptideironmetabolismlocalisationantibodies
Journal Article 2005-10-01 ✓ 1 Snippet Wallace DF, Summerville L, Lusby PE, Subramaniam VN.
In-Text Gene Mentions

Hfeand beta2-microglobulin knocko…

Show Full Abstract

<h4>Background/aims</h4>Hepcidin is a liver-expressed peptide which plays an important role in the regulation of iron metabolism. It is a negative regulator of iron absorption and release of iron from cells. The aims of this study were to analyse the expression and localisation of prohepcidin in liver and cell lines.<h4>Methods</h4>We generated antibodies against recombinant mouse prohepcidin and studied its expression in cell lines, primary hepatocytes and livers of normal mice and mice with abnormalities in iron metabolism.<h4>Results</h4>Prohepcidin localised to the secretory pathway, primarily the Golgi apparatus in liver cells and tissues. Hfe and beta2-microglobulin knockout mice have similar levels of prohepcidin protein expression as compared to wild-type mice despite increased iron stores. Sex-linked anaemia mice have iron deficiency and no prohepcidin expression in the liver.<h4>Conclusions</h4>Prohepcidin protein is present in the secretory pathway of liver cells. Despite iron loading, mouse models of haemochromatosis have comparatively normal levels of prohepcidin expression whereas mice with iron deficiency have no prohepcidin expression.

Also flagged:iron overloadcardiomyopathyhypogonadismtransferrin receptor 2chronic infection
Journal Article 2005-10-01 ✓ 5 Snippets Koyama C, Hayashi H, Wakusawa S, Ueno T, Yano M, Katano Y, Goto H, Kidokoro R.
In-Text Gene Mentions

…patients with middle-age-onsethemochromatosiscaused by novel…

Hemochromatosisis a genetically…

…patients with juvenilehemochromatosis, who usually manifest…

…damage compatible withhemochromatosisat around 50…

…l presentation of hemojuvelin-hemochromatosisoccurs over a…

Show Full Abstract

Hemochromatosis is a genetically heterogeneous condition. Mutations in the recently described hemojuvelin gene were found in patients with juvenile hemochromatosis, who usually manifest clinical signs of iron overload, including cardiomyopathy and hypogonadism, in their teens and early 20s. In this report, we describe three Japanese patients who showed typical clinical and hepatic histological damage compatible with hemochromatosis at around 50 years of age. Genetic analyses showed that all three patients carried mutations in the hemojuvelin gene. The first patient was homozygous for a novel mutation (745G > C [D249H]), and the second and third patients from the same family were homozygous for another novel mutation (934C > T [Q312X]). No mutations in their HFE, hepcidin, transferrin receptor 2, or ferroportin genes were found. One patient had chronic infection with Helicobacter pylori. The age at initial presentation of hemojuvelin-hemochromatosis occurs over a wider range than previously described.

Also flagged:nucleotidepeptidespeptidelysinecarboxymetalloproteases
Journal Article 2005-10-01 ✓ 1 Snippet Francischetti IM, My Pham V, Mans BJ, Andersen JF, Mather TN, Lane RS, Ribeiro JM.
In-Text Gene Mentions

ATIII

Show Full Abstract

Sequencing of an Ixodes pacificus salivary gland cDNA library yielded 1068 sequences with an average undetermined nucleotide of 1.9% and an average length of 487 base pairs. Assembly of the expressed sequence tags yielded 557 contigs, 138 of which appear to code for secreted peptides or proteins based on translation of a putative signal peptide. Based on the BLASTX similarity of these contigs to 66 matches of Ixodes scapularis peptide sequences, only 58% sequence identity was found, indicating a rapid divergence of salivary proteins as observed previously for mosquito and triatomine bug salivary proteins. Here we report 106 mostly full-length sequences that clustered in 16 different families: Basic-tail proteins rich in lysine in the carboxy-terminal, Kunitz-containing proteins (monolaris, ixolaris and penthalaris families), proline-rich peptides, 5-, 9.4- and 18.7-kDa proteins of unknown functions, in addition to metalloproteases (class PIII-like) similar to reprolysins. We also have found a family of disintegrins, named ixodegrins that display homology to variabilin, a GPIIb/IIIa antagonist from the tick Dermacentor variabilis. In addition, we describe peptides (here named ixostatins) that display remarkable similarities to the cysteine-rich domain of ADAMST-4 (aggrecanase). Many molecules were assigned in the lipocalin family (histamine-binding proteins); others appear to be involved in oxidant metabolism, and still others were similar to ixodid proteins such as the anticomplement ISAC. We also identified for the first time a neuropeptide-like protein (nlp-31) with GGY repeats that may have antimicrobial activity. In addition, 16 novel proteins without significant similarities to other tick proteins and 37 housekeeping proteins that may be useful for phylogenetic studies are described. Some of these proteins may be useful for studying vascular biology or the immune system, for vaccine development, or as immunoreagents to detect prior exposure to ticks. Electronic version of the manuscript can be found at.

Also flagged:cholinenetrin-1neuronal migrationcell migration
Journal Article 2005-10-01 ✓ 4 Snippets Albright CD, Mar MH, Craciunescu CN, Song J, Zeisel SH.
In-Text Gene Mentions

Alterations in maternal dietary choline availability during days 12-17 of pregnancy led to an increase in the level of immunoreactive netrin-1 and a decrease in the level of DCC protein in the developing fetal mouse brain hippocampus compared with controls.

Maternal dietary choline availability alters the balance of netrin-1 and DCC neuronal migration proteins in fetal mouse brain hippocampus.

…of netrin-1 andDCCneuronal migration proteins…

…the level ofDCCprotein in the…

Show Full Abstract

Alterations in maternal dietary choline availability during days 12-17 of pregnancy led to an increase in the level of immunoreactive netrin-1 and a decrease in the level of DCC protein in the developing fetal mouse brain hippocampus compared with controls. Changes in the expression of cell migration cues during development could account for some of the lifelong consequences of maternal dietary choline availability for cognitive and memory processes.

Also flagged:gene expressionmyotube formation
Journal Article 2005-10-01 ✓ 5 Snippets Hagiwara N, Ma B, Ly A.
In-Text Gene Mentions

…muscle of theSox6mutant, p100H.…

…lack a functionalSox6gene, exhibit skeletal…

…the role ofSox6in skeletal muscle…

…defects in theSox6null-p100H mutant, the…

…results suggest thatSox6likely plays an…

Show Full Abstract

We have previously demonstrated that p100H mutant mice, which lack a functional Sox6 gene, exhibit skeletal and cardiac muscle degeneration and develop cardiac conduction abnormalities soon after birth. To understand the role of Sox6 in skeletal muscle development, we identified muscle-specific genes differentially expressed between wild-type and p100H mutant skeletal muscles and investigated their temporal expression in the mutant muscle. We found that, in the mutant skeletal muscle, slow fiber and cardiac isoform genes are expressed at significantly higher levels, whereas fast fiber isoform genes are expressed at significantly lower levels than wild-type. Onset of this aberrant fiber type-specific gene expression in the mutant coincides with the beginning of the secondary myotube formation, at embryonic day 15-16 in mice. Together with our earlier report, demonstrating early postnatal muscle defects in the Sox6 null-p100H mutant, the present results suggest that Sox6 likely plays an important role in muscle development.

Also flagged:bone remodelingNeuropeptidestransportersCGRPβ2-adrenergic receptor
Journal Article 2005-10-01 No Snippets Elefteriou F.
Show Full Abstract

An increasing number of studies suggest that nerve-derived signals play an important role in the regulation of bone remodeling. Neuropeptides and receptors/transporters of adrenergic, glutaminergic, serotoninergic, dopaminergic and sensory nature have been described in osteoblasts in vitro. Downstream signaling pathways and targets genes have been identified, but the in vivo relevance of these findings remained controversial until more recent gene gain and loss of function studies confirmed the role of CGRP and beta2-adrenergic receptor signaling in osteoblasts. Tissue and time-conditional mutant mice originally generated for studies unrelated to bone are now available tools to determine the role of neuronal signaling in bone and to dissociate the central and peripheral role of these signals. Lastly, understanding how the central nervous system integrates homeostatic signals with the regulation of bone homeostasis will be the next exciting subject of research in the field.

Also flagged:hydroxyapatitetetracalcium phosphatecalcium phosphatescalcium phosphatesynthesiswater
Journal Article 2005-10-01 No Snippets Kim H, Camata RP, Vohra YK, Lacefield WR.
Show Full Abstract

Biphasic calcium phosphates comprising well-controlled mixtures of nonresorbable hydroxyapatite and other resorbable calcium phosphate phases often exhibit a combination of enhanced bioactivity and mechanical stability that is difficult to achieve in single-phase materials. This makes these biphasic bioceramics promising substrate materials for applications in bone tissue regeneration and repair. In this paper we report the synthesis of highly crystalline, biphasic coatings of hydroxyapatite/tetracalcium phosphate with control over the weight fraction of the constituent phases. The coatings were produced by pulsed laser deposition using ablation targets of pure crystalline hydroxyapatite. The fraction of tetracalcium phosphate phase in the coatings was controlled by varying the substrate temperature and the partial pressure of water vapor in the deposition chamber. A systematic study of phase composition in the hydroxyapatite/tetracalcium phosphate biphasic coatings was performed with X-ray diffraction. Tetracalcium phosphate in the coatings obtained at high substrate temperature is not formed by partial conversion of previously deposited hydroxyapatite. Instead, it is produced by nucleation and growth of tetracalcium phosphate itself from the ablation products of the hydroxyapatite target or by accretion of tetracalcium phosphate grains formed during ablation. This finding was confirmed by formation of calcium oxide, not tetracalcium phosphate, after annealing of pure hydroxyapatite coatings at high temperatures of 700-850 degrees C.

Also flagged:ironbrush bordermembranetransporterDMT1ferric reductase
Journal Article 2005-10-01 ✓ 1 Snippet Anderson GJ, Frazer DM.
In-Text Gene Mentions

…pathway that involvesHFE, TfR2, and hemojuvelin.…

Show Full Abstract

Our understanding of intestinal iron absorption and its regulation has expanded enormously in recent years. Dietary iron crosses the enterocyte brush border membrane through the transporter DMT1 after first being reduced by the ferric reductase Dcytb. The subsequent movement of iron across the basolateral membrane and into the circulation is mediated by ferroportin1 in conjunction with the iron oxidase hephaestin. The activity of ferroportin1 is controlled by the liver-derived peptide hepcidin, and the expression of hepcidin in turn is influenced by plasma transferrin saturation via a pathway that involves HFE, TfR2, and hemojuvelin. Future studies investigating how these molecules interact will provide a comprehensive understanding of this essential physiologic process.

Also flagged:axonsaxonreceptor tyrosine kinaseEph receptorsephrinaxonal
Journal Article 2005-10-01 ✓ 1 Snippet Plas DT, Lopez JE, Crair MC.
In-Text Gene Mentions

DCC

Show Full Abstract

The map of the retina onto the optic tectum is a highly conserved feature of the vertebrate visual system; the mechanism by which this mapping is accomplished during development is a long-standing problem of neurobiology. The early suggestion by Roger Sperry that the map is formed through interactions between retinal ganglion cell axons and target cells within the tectum has gained significant experimental support and widespread acceptance. Nonetheless, reports in a variety of species indicate that some aspects of retinotopic order exist within the optic tract, leading to the suggestion that this "preordering" of retinal axons may play a role in the formation of the mature tectal map. A satisfactory account of pretarget order must provide the mechanism by which such axon order develops. Insofar as this mechanism must ultimately be determined genetically, the mouse suggests itself as the natural species in which to pursue these studies. Quantitative and repeatable methods are required to assess the contribution of candidate genes in mouse models. For these reasons, we have undertaken a quantitative study of the degree of retinotopic order within the optic tract and nerve of wild-type mice both before and after the development of the retinotectal map. Our methods are based on tract tracing using lipophilic dyes, and our results indicate that there is a reestablishment of dorsoventral but not nasotemporal retinal order when the axons pass through the chiasm and that this order is maintained throughout the subsequent tract. Furthermore, this dorsoventral retinotopic order is well established by the day after birth, long before the final target zone is discernible within the tectum. We conclude that pretarget sorting of axons according to origin along the dorsoventral axis of the retina is both spatially and chronologically appropriate to contribute to the formation of the retinotectal map, and we suggest that these methods be used to search for the molecular basis of such order by using available mouse genetic models.

Also flagged:serotoninautoimmune diseaseinterferon-gamma5-hydroxytryptamineexperimental autoimmune encephalomyelitismultiple sclerosis
Journal Article 2005-10-01 ✓ 3 Snippets Hofstetter HH, Mössner R, Lesch KP, Linker RA, Toyka KV, Gold R.
In-Text Gene Mentions

We studied EAE in knockout (KO) mice lacking the 5-HT transporter (5-HTT) on a C57.BL/6 background, in comparison with wild-type C57.BL/6 animals.

…the 5-HT transporter (5-HTT) on a C57.BL/6…

…courses of the5-HTTknockout mice were…

Show Full Abstract

Serotonin (5-hydroxytryptamine, 5-HT) is one of the most extensively studied neurotransmitters of the central nervous system. It also has been identified in constituents of the immune system. Therefore serotonin has been suggested to serve as a mediator of bidirectional interactions between the nervous system and the immune system. We investigated this interaction in experimental autoimmune encephalomyelitis (EAE), a well-defined animal model of autoimmune disease of the central nervous system (CNS) mimicking features of the human disease multiple sclerosis. EAE was induced by immunization with the autoantigens myelin basic protein (MBP) or the immunodominant peptide of myelin oligodendrocyte glycoprotein (MOG) spanning amino acids 35-55 (MOGp 35-55). We studied EAE in knockout (KO) mice lacking the 5-HT transporter (5-HTT) on a C57.BL/6 background, in comparison with wild-type C57.BL/6 animals. After immunization with MOGp 35-55, or with rat MBP, the disease courses of the 5-HTT knockout mice were attenuated as compared to wildtype control mice. This difference was more pronounced in female animals. To dissect potential immune mechanisms underlying this phenomenon, histological studies of the CNS and cytokine measurements in mononuclear cells from the spleens of 5-HTT KO mice and wild-type controls were performed. We found a reduction of the inflammatory infiltrate in the CNS and of the neuroantigen-specific production of IFN-gamma in splenocytes, again accompanied by a gender difference. These findings suggest a potential role of extracellular 5-HT homeostasis in the fine-tuning of neuroantigen-specific immune responses.

Also flagged:cluster headacheCHironmetabolismprimary headaches
Journal Article 2005-10-01 ✓ 5 Snippets Rainero I, Rivoiro C, Rubino E, Milli V, Valfrè W, De Martino P, Lo Giudice R, Angilella G, Savi L, Gallone S, Pinessi L.
In-Text Gene Mentions

Prevalence of HFE (hemochromatosis) gene mutations in patients with cluster headache.

HFE (hemochromatosis) gene mutations in patients with cluster headache

HFE gene would modify the occurrence and the clinical features of cluster headache

HFE (hemochromatosis

…Prevalence ofHFE(hemochromatosis) gene mutatio…

Show Full Abstract

<h4>Objective</h4>To evaluate whether polymorphisms of the HFE gene would modify the occurrence and the clinical features of cluster headache (CH).<h4>Background</h4>Recent studies suggested that iron metabolism may be involved in the pathophysiology of primary headaches. The HFE gene encodes for a protein that modulates iron absorption. Mutations in this gene are responsible for toxic iron overload in several body organs.<h4>Methods</h4>Genomic DNA was extracted from 109 CH patients and 211 age and sex-matched healthy controls and genotyped for the C282Y and H63D mutations of the HFE gene. Allele and genotype frequencies of the HFE gene were compared between cases and controls. The clinical characteristics of the disease were compared according to the different HFE gene genotypes.<h4>Results</h4>No C282Y mutation was found in both cases and controls. The prevalence of the H63D mutation was nearly identical in cases and controls. The four patients carrying the HFE D63D genotype showed a significantly (P < .001) later age at onset of the disease in comparison with both H63H and H63D patients. The remaining clinical characteristics of the disease did not significantly differ in the presence or absence of the H63D mutation.<h4>Conclusion</h4>Our data do not support the hypothesis that genetic variations within the HFE gene are associated with CH. However, the HFE gene may influence the disease phenotype and may be regarded as a disease modifier gene.

Also flagged:tension-type headachechronic tension-type headacheserotoninmetabolismsubstance abuseserotonin transporter
Journal Article 2005-10-01 ✓ 2 Snippets Park JW, Kim JS, Kim YI, Lee KS.
In-Text Gene Mentions

The genetic factors for serotonin metabolism and the harm avoidance (HA) personality dimension are known to be associated with various substance abuse patterns.<h4>Design</h4>We performed serotonin transporter protein (5-HTT) gene-linked polymorphic region (5-HTTLPR) genotype polymorphism analyses, and investigated serotonin-related personality traits by assessing the HA dimension using tridimensional personality questionnaire, given to 48 patients with CTTHs and reported analgesic overuse (CTTH-AO), in 50 patients with CTTHs without analgesic overuse (CTTH-NO), and in 100 healthy controls.

…erotonin transporter protein (5-HTT) gene-linked polymorphic regi…

Show Full Abstract

<h4>Objective</h4>To evaluate the possible existence of a genetically determined innate factor that could exert a profound influence on the development of analgesic overuse in chronic tension-type headache (CTTH).<h4>Background</h4>Many patients with CTTHs report the regular use of analgesics. Continuous use of analgesics results in the ultimate worsening of headaches. The factors related to development of analgesic overuse, however, remain poorly understood. The genetic factors for serotonin metabolism and the harm avoidance (HA) personality dimension are known to be associated with various substance abuse patterns.<h4>Design</h4>We performed serotonin transporter protein (5-HTT) gene-linked polymorphic region (5-HTTLPR) genotype polymorphism analyses, and investigated serotonin-related personality traits by assessing the HA dimension using tridimensional personality questionnaire, given to 48 patients with CTTHs and reported analgesic overuse (CTTH-AO), in 50 patients with CTTHs without analgesic overuse (CTTH-NO), and in 100 healthy controls. We compared their headache characteristics using standardized questionnaires.<h4>Results</h4>We discovered an excess frequency of 5-HTTLPR short allele and a different genotypic distribution in patients with CTTH-AO. The S/S genotype frequency was significantly higher in patients with CTTH-AO (83%) than in CTTH-NO (72%) and control (59%; P= .010) groups. Patients with CTTH-AO exhibited the highest HA scores (23.3 +/- 5.4), as compared to CTTH-NO (19.9 +/- 6.7) and control (16.3 +/- 6.1) groups. Individuals with the S/S genotype showed a greater tendency toward analgesic overuse (13.3 +/- 11.3 days per month) than did those with the non-S/S genotype (7.0 +/- 8.6 days per month: P= .02).<h4>Conclusions</h4>Our data suggest that serotonergic activity may be involved in the development of analgesic overuse in CTTH and that 5-HTTLPR might be one of the genetically contributing factors.

Also flagged:Netrinin Colorectal Canceraxonaxonsnetrin-1Deleted in Colorectal Cancer
Journal Article 2005-10-01 ✓ 5 Snippets Kim TH, Lee HK, Seo IA, Bae HR, Suh DJ, Wu J, Rao Y, Hwang KG, Park HT.
In-Text Gene Mentions

We suggest that the ligand-mediated down-regulation of DCC might participate in the loss of netrin-responsiveness in the developing nervous system.

DCC might participate in the loss of netrin-responsiveness in the developing nervous

Colorectal Cancer (DCC

…dramatic decrease ofDCClevel particularly on…

…prevented the netrin-inducedDCCcleavage and decrease…

Show Full Abstract

The proper regulation of temporal and spatial expression of the axon guidance cues and their receptors is critical for the normal wiring of nervous system during development. Netrins, a family of secreted guidance cues, are involved in the midline crossing of spinal commissural axons and in the guidance of cortical efferents. Axons normally lose the responsiveness to their attractants when they arrive at their targets, where the attractant is produced. However the molecular mechanism is still unknown. We investigated the molecular mechanism of down-regulation of netrin-1 signaling in the embryonic cortical neurons. Netrin-1 induced the ubiquitination and proteolytic cleavage of Deleted in Colorectal Cancer (DCC), a transmembrane receptor for netrin, in dissociated cortical neurons. A dramatic decrease of DCC level particularly on the cell surface was also observed after netrin-1 stimulation. Specific ubiquitin-proteasome inhibitors prevented the netrin-induced DCC cleavage and decrease of cell surface DCC. We suggest that the ligand-mediated down-regulation of DCC might participate in the loss of netrin-responsiveness in the developing nervous system.

Also flagged:Huntington's diseasepolyglutaminedeathendopeptidasesformic acidendopeptidase
Journal Article 2005-10-01 No Snippets Hoffner G, Island ML, Djian P.
Show Full Abstract

Huntington's disease resulting from huntingtin containing an expanded polyglutamine is associated with aggregates largely confined to neuronal inclusions, and with neuronal death. Inclusions are thought to originate from discrete N-terminal fragments of expanded huntingtin produced by specific endopeptidases. We have now purified the neuronal inclusions of Huntington's disease brain. When incubated in concentrated formic acid, purified inclusions release a polymer, an oligomer and a broad range of N-terminal fragments of expanded huntingtin. The fragments and the polymeric forms are linked to each other by non-covalent bonds as they are both released by formic acid, whereas the polymeric forms themselves are presumably stabilized by covalent bonds, as they are resistant to formic acid. We also demonstrate the presence in affected areas of the brain but not in unaffected areas of a broad range of soluble N-terminal fragments of expanded huntingtin not yet associated with the inclusions and which are likely to be the precursors of the inclusions. Fragmentation of expanded huntingtin in Huntington's disease must result from the operation of multiple proteolytic activities with little specificity and not from that of a specific endopeptidase; subsequent aggregation of the fragments by covalent and non-covalent bonds leads to the formation of the inclusions.

Also flagged:CystamineHuntington diseaseHDadult onset neurodegenerative disorderTransglutaminaseTG
Journal Article 2005-10-01 No Snippets Van Raamsdonk JM, Pearson J, Bailey CD, Rogers DA, Johnson GV, Hayden MR, Leavitt BR.
Show Full Abstract

Huntington disease (HD) is an adult onset neurodegenerative disorder characterized by selective atrophy and cell loss within the striatum. There is currently no treatment that can prevent the striatal neuropathology. Transglutaminase (TG) activity is increased in HD patients, is associated with cell death, and has been suggested to contribute to striatal neuronal loss in HD. This work assesses the therapeutic potential of cystamine, an inhibitor of TG activity with additional potentially beneficial effects. Specifically, we examine the effect of cystamine on striatal neuronal loss in the YAC128 mouse model of HD. We demonstrate here for the first time that YAC128 mice show a forebrain-specific increase in TG activity compared with wild-type (WT) littermates which is decreased by oral delivery of cystamine. Treatment of symptomatic YAC128 mice with cystamine starting at 7 months prevented striatal neuronal loss. Cystamine treatment also ameliorated the striatal volume loss and striatal neuronal atrophy observed in these animals, but was unable to prevent motor dysfunction or the down-regulation of dopamine and cyclic adenosine monophsophate-regulated phosphoprotein (DARPP-32) expression in the striatum. While the exact mechanism responsible for the beneficial effects of cystamine in YAC128 mice is uncertain, our findings suggest that cystamine is neuroprotective and may be beneficial in the treatment of HD.

Also flagged:Proteinasediabetic retinopathymatrix metalloproteinaseGene expressioncathepsincathepsin F
Journal Article 2005-10-01 No Snippets Saghizadeh M, Kramerov AA, Tajbakhsh J, Aoki AM, Wang C, Chai NN, Ljubimova JY, Sasaki T, Sosne G, Carlson MR, Nelson SF, Ljubimov AV.
Show Full Abstract

<h4>Purpose</h4>To identify proteinases and growth factors abnormally expressed in human corneas of donors with diabetic retinopathy (DR), additional to previously described matrix metalloproteinase (MMP)-10 and -3 and insulin-like growth factor (IGF)-I.<h4>Methods</h4>RNA was isolated from 35 normal, diabetic, and DR autopsy human corneas ex vivo or after organ culture. Amplified cRNA was analyzed using 22,000-gene microarrays (Agilent Technologies, Palo Alto, CA). Gene expression in each diabetic corneal cRNA was assessed against pooled cRNA from 7 to 9 normal corneas. Select differentially expressed genes were validated by quantitative real-time RT-PCR (QPCR) and immunohistochemistry. Organ cultures were treated with a cathepsin inhibitor, cystatin C, or MMP-10.<h4>Results</h4>More than 100 genes were upregulated and 2200 were downregulated in DR corneas. Expression of cathepsin F and hepatocyte growth factor (HGF) genes was increased in ex vivo and organ-cultured DR corneas compared with normal corneas. HGF receptor c-met, fibroblast growth factor (FGF)-3, its receptor FGFR3, tissue inhibitor of metalloproteinase (TIMP)-4, laminin alpha4 chain, and thymosin beta(4) genes were downregulated. The data were corroborated by QPCR and immunohistochemistry analyses; main changes of these components occurred in corneal epithelium. In organ-cultured DR corneas, cystatin C increased laminin-10 and integrin alpha(3)beta(1), whereas in normal corneas MMP-10 decreased laminin-10 and integrin alpha(3)beta(1) expression.<h4>Conclusions</h4>Elevated cathepsin F and the ability of its inhibitor to produce a more normal phenotype in diabetic corneas suggest increased proteolysis in these corneas. Proteinase changes may result from abnormalities of growth factors, such as HGF and FGF-3, in DR corneas. Specific modulation of proteinases and growth factors could reduce diabetic corneal epitheliopathy.

Also flagged:transcription factorsGATA4GATA6factorsNotchHey2
Journal Article 2005-10-01 ✓ 1 Snippet Fischer A, Klattig J, Kneitz B, Diez H, Maier M, Holtmann B, Englert C, Gessler M.
In-Text Gene Mentions

histone deacetylase complex

Show Full Abstract

The Hey basic helix-loop-helix transcription factors are downstream effectors of Notch signaling in the cardiovascular system. Mice lacking Hey2 develop cardiac hypertrophy, often associated with congenital heart defects, whereas combined Hey1/Hey2 deficiency leads to severe vascular defects and embryonic lethality around embryonic day E9.5. The molecular basis of these disorders is poorly understood, however, since target genes of Hey transcription factors in the affected tissues remain elusive. To identify genes regulated by Hey factors we have generated a conditional Hey1 knockout mouse. This strain was used to generate paired Hey2- and Hey1/2-deficient embryonic stem cell lines. Comparison of these cell lines by microarray analysis identified GATA4 and GATA6 as differentially expressed genes. Loss of Hey1/2 leads to elevated GATA4/6 and ANF mRNA levels in embryoid bodies, while forced expression of Hey factors strongly represses expression of the GATA4 and GATA6 promoter in various cell lines. In addition, the promoter activity of the GATA4/6 target gene ANF was inhibited by Hey1, Hey2, and HeyL. Protein interaction and mutation analyses suggest that repression is due to direct binding of Hey proteins to GATA4 and GATA6, blocking their transcriptional activity. In Hey2-deficient fetal hearts we observed elevated mRNA levels of ANF and CARP. Expression of ANF and Hey2 is normally restricted to the trabecular and compact myocardial layer, respectively. Intriguingly, loss of Hey2 leads to ectopic ANF expression in the compact layer, suggesting a direct role for Hey2 in limiting ANF expression in this cardiac compartment.

Also flagged:heterochromatinmitosiscell divisionchromatinchromosomescondensins I
Journal Article 2005-10-01 ✓ 1 Snippet Oliveira RA, Coelho PA, Sunkel CE.
In-Text Gene Mentions

Condensins, abundant components of…

Show Full Abstract

During cell division, chromatin undergoes structural changes essential to ensure faithful segregation of the genome. Condensins, abundant components of mitotic chromosomes, are known to form two different complexes, condensins I and II. To further examine the role of condensin I in chromosome structure and in particular in centromere organization, we depleted from S2 cells the Drosophila CAP-H homologue Barren, a subunit exclusively associated with condensin I. In the absence of Barren/CAP-H the condensin core subunits DmSMC4/2 still associate with chromatin, while the other condensin I non-structural maintenance of chromosomes family proteins do not. Immunofluorescence and in vivo analysis of Barren/CAP-H-depleted cells showed that mitotic chromosomes are able to condense but fail to resolve sister chromatids. Additionally, Barren/CAP-H-depleted cells show chromosome congression defects that do not appear to be due to abnormal kinetochore-microtubule interaction. Instead, the centromeric and pericentromeric heterochromatin of Barren/CAP-H-depleted chromosomes shows structural problems. After bipolar attachment, the centromeric heterochromatin organized in the absence of Barren/CAP-H cannot withstand the forces exerted by the mitotic spindle and undergoes irreversible distortion. Taken together, our data suggest that the condensin I complex is required not only to promote sister chromatid resolution but also to maintain the structural integrity of centromeric heterochromatin during mitosis.

Also flagged:Endoplasmic reticulumdeathheart diseasediabetesGrp78protein-disulfide isomerase
Journal Article 2005-10-01 ✓ 5 Snippets Xu C, Bailly-Maitre B, Reed JC.
In-Text Gene Mentions

…associates with Huntingtin (Htt), the protein implicated…

…of neurons containingHttpolyglutamine (polyQ) expansio…

Httwith polyQ expansion…

…with the normalHttprotein, a circumstance…

…nonapoptotic functions ofHttand its interacting…

Show Full Abstract

Disturbances in the normal functions of the ER lead to an evolutionarily conserved cell stress response, the unfolded protein response, which is aimed initially at compensating for damage but can eventually trigger cell death if ER dysfunction is severe or prolonged. The mechanisms by which ER stress leads to cell death remain enigmatic, with multiple potential participants described but little clarity about which specific death effectors dominate in particular cellular contexts. Important roles for ER-initiated cell death pathways have been recognized for several diseases, including hypoxia, ischemia/reperfusion injury, neurodegeneration, heart disease, and diabetes.

Also flagged:hereditary hemochromatosisgenetic disorderironmetabolism
Journal Article 2005-10-01 ✓ 2 Snippets Qaseem A, Aronson M, Fitterman N, Snow V, Weiss KB, Owens DK, Clinical Efficacy Assessment Subcommittee of the American College of Physicians.
In-Text Gene Mentions

HFE gene and the absence of any definitive trials addressing the benefits and risks of therapeutic phlebotomy in asymptomatic patients or those with only laboratory abnormalities

…mutations of theHFEgene and the…

Show Full Abstract

Hereditary hemochromatosis is a genetic disorder of iron metabolism. Diagnosis of hereditary hemochromatosis is usually based on a combination of various genetic or phenotypic criteria. Decisions regarding screening are difficult because of the variable penetrance of mutations of the HFE gene and the absence of any definitive trials addressing the benefits and risks of therapeutic phlebotomy in asymptomatic patients or those with only laboratory abnormalities. The purpose of this guideline is to increase physician awareness of hereditary hemochromatosis, particularly the variable penetrance of genetic mutations; aid in case finding; and explain the role of genetic testing. This guideline provides recommendations based on a review of evidence in the accompanying background paper by Schmitt and colleagues. The target audience for this guideline is internists and other primary care physicians. The target patient population is all persons who have a probability or susceptibility of developing hereditary hemochromatosis, including the relatives of individuals who already have the disease.

Also flagged:CHIPpolyglutamineHuntington's diseaseHDpolyglutamine (polyQ) neurodegenerative diseasesubiquitin ligase
Journal Article 2005-10-01 ✓ 1 Snippet Miller VM, Nelson RF, Gouvion CM, Williams A, Rodriguez-Lebron E, Harper SQ, Davidson BL, Rebagliati MR, Paulson HL.
In-Text Gene Mentions

Htt

Show Full Abstract

Huntington's disease (HD) and other polyglutamine (polyQ) neurodegenerative diseases are characterized by neuronal accumulation of the disease protein, suggesting that the cellular ability to handle abnormal proteins is compromised. As both a cochaperone and ubiquitin ligase, the C-terminal Hsp70 (heat shock protein 70)-interacting protein (CHIP) links the two major arms of protein quality control, molecular chaperones, and the ubiquitin-proteasome system. Here, we demonstrate that CHIP suppresses polyQ aggregation and toxicity in transfected cell lines, primary neurons, and a novel zebrafish model of disease. Suppression by CHIP requires its cochaperone function, suggesting that CHIP acts to facilitate the solubility of mutant polyQ proteins through its interactions with chaperones. Conversely, HD transgenic mice that are haploinsufficient for CHIP display a markedly accelerated disease phenotype. We conclude that CHIP is a critical mediator of the neuronal response to misfolded polyQ protein and represents a potential therapeutic target in this important class of neurodegenerative diseases.

Also flagged:methicillinspaagrSCC mec type IVHSAmecA
Journal Article 2005-10-01 No Snippets Aires de Sousa M, Conceição T, Simas C, de Lencastre H.
Show Full Abstract

In order to understand the origins of the dominant methicillin-resistant Staphylococcus aureus (MRSA) clones in Portuguese hospitals, we compared the genetic backgrounds of nosocomial MRSA with methicillin-susceptible S. aureus (MSSA) isolates from the same hospitals (n=155) and from the community (n=157) where they were located. Pulsed-field gel electrophoresis, spa typing, multilocus sequence typing, and agr type analysis revealed that the genetic backgrounds correspondent to the dominant MRSA clones in Portuguese hospitals during the last 15 years (Iberian ST 247, Brazilian ST 239, and EMRSA-15 ST 22) were scarcely or not found among the present MSSA collection. The four major MSSA clones encountered (A-ST 30, B-ST 34, C-ST 5, and H-ST 45) correspond, or are very similar, to the background of other international MRSA pandemic clones, i.e., EMRSA-16, New York/Japan, Pediatric, and Berlin clones. However, with the exception of the Pediatric clone, none of these MRSA clones has been detected in Portugal. Our findings suggest the three major MRSA clones identified in Portuguese hospitals have not originated from the introduction of SCCmec into dominant MSSA backgrounds present in the Portuguese nosocomial or community environment but were probably imported from abroad. In contrast, the MRSA Pediatric clone might have originated in our country by the acquisition of SCCmec type IV into MSSA clone C. Furthermore, we provide evidence that the introduction of SCCmec into sensitive clones is most likely a relatively infrequent event that seems to depend not exclusively on the presence of a successful MSSA lineage.

Also flagged:serotonin transporteracute myocardial infarctionserotoninpsychiatric diseasesdeathheart failure
Journal Article 2005-10-01 ✓ 4 Snippets Nakatani D, Sato H, Sakata Y, Shiotani I, Kinjo K, Mizuno H, Shimizu M, Ito H, Koretsune Y, Hirayama A, Hori M, Osaka Acute Coronary Insufficiency Study Group.
In-Text Gene Mentions

The S allele in the 5-HTT gene-linked polymorphic region is associated with an increased risk for subsequent cardiac events, which is mediated, at least in part, by the depressive symptoms in patients after AMI.

Recently, the S allele of the serotonin transporter (5-HTT) gene-linked polymorphic region was shown to reduce transcription of this gene and thus reduce serotonin reuptake, and this allele is linked with depressive symptoms as well as other psychiatric diseases.

…the serotonin transporter (5-HTT) gene-linked polymorphic regi…

…allele in the5-HTTgene-linked polymorphic region…

Show Full Abstract

<h4>Background</h4>In patients with acute myocardial infarction (AMI), depressive symptoms increase the risk for cardiac events. Recently, the S allele of the serotonin transporter (5-HTT) gene-linked polymorphic region was shown to reduce transcription of this gene and thus reduce serotonin reuptake, and this allele is linked with depressive symptoms as well as other psychiatric diseases. However, the influence of the S allele on depressive symptoms and cardiac events after AMI is unclear.<h4>Methods</h4>To investigate whether the S allele was associated with depressive symptoms and cardiac events after AMI, we prospectively examined depressive symptoms and new cardiac events in 2509 genotyped patients with AMI.<h4>Results</h4>Depressive symptoms were more common in patients with the S allele than in those without it (48.3% vs 35.0%, P = .02). Multivariate analysis revealed that the S allele was independently associated with depressive symptoms (odds ratio 2.19, 95% confidence interval [CI] 1.21-3.98, P = .01). Cardiac events (cardiac death, revascularization, heart failure, reinfarction, arrhythmia, and unstable angina) were more frequent in patients with the S allele than in those without it (31.3% vs 22.3%, P = .046). Multivariate Cox regression analysis revealed an association between the S allele and an increased risk for cardiac events (hazard ratio [HR] 1.69, 95% CI 1.03-2.78, P = .04). However, the HR became insignificant after an adjustment for depressive symptoms (HR 1.30, 95% CI 0.84-2.01, P = .24).<h4>Conclusions</h4>The S allele in the 5-HTT gene-linked polymorphic region is associated with an increased risk for subsequent cardiac events, which is mediated, at least in part, by the depressive symptoms in patients after AMI.

Also flagged:CD4CD84-1BB ligandICOS ligandOX40 ligandTNF
Journal Article 2005-10-01 No Snippets Shiao SL, McNiff JM, Pober JS.
Show Full Abstract

Both CD4(+) and CD8(+) human memory but not naive T cells respond to allogeneic human dermal microvascular endothelial cells (HDMEC) in vitro by secreting cytokines and by proliferating. Several recently identified costimulators, namely, 4-1BB ligand, ICOS ligand, and OX40 ligand, are up-regulated on cultured HDMEC in response to TNF or coculture with allogeneic T cells. Blockade of these costimulators each partially reduces IFN-gamma and IL-2 secretion and proliferation of previously resting memory T cells. The effects of these costimulators are overlapping but not identical. Memory but not naive T cells are the principal effectors of microvascular injury in human skin allografts following adoptive transfer into immunodeficient mice. Furthermore, blocking 4-1BB ligand, ICOS ligand, or OX40 ligand in this model reduces human skin allograft injury and T cell effector molecule expression. These data demonstrate that human memory T cells respond to microvascular endothelial cells and can injure allografts in vivo without priming. Furthermore, several recently described costimulators contribute to these processes.

Also flagged:ironhememenopause
Journal Article 2005-10-01 ✓ 3 Snippets Cade JE, Moreton JA, O'Hara B, Greenwood DC, Moor J, Burley VJ, Kukalizch K, Bishop DT, Worwood M.
In-Text Gene Mentions

…and nutrient intakes,HFEgenotype, and iron…

…mutations associated withhemochromatosis, were explored.<h4>Design</h4…

…menopausal status, andHFEgenotype.<h4>Conclusions</h4>P…

Show Full Abstract

<h4>Background</h4>Gene mutations associated with iron overload have been identified. How food and nutrient intakes affect iron status in persons who may be at risk of iron overload because their genetic status is unknown.<h4>Objective</h4>The objective was to determine the relation between food and nutrient intakes, HFE genotype, and iron status. Foods and nutrients associated with iron stores, with adjustment for gene mutations associated with hemochromatosis, were explored.<h4>Design</h4>A prospective cohort of women aged 35-69 y (the UK Women's Cohort Study) provided information on diet through a questionnaire and food diary; 6779 women in the cohort provided cheek cell samples, blood samples, or both, which were genotyped for C282Y and H63D mutations, and 2489 women also had their iron status assessed. Relations between serum ferritin and iron intake were investigated by using multiple linear regression, with adjustment for potential confounders.<h4>Results</h4>The strongest dietary association with serum ferritin concentration was a positive association with heme iron and not with nonheme or total iron. Weaker positive associations were seen with red and white meat, and negative associations were seen with total energy and white and brown whole-meal bread, independent of genotype and other potential confounders. The effect of genotype on ferritin concentrations primarily occurred after menopause, at which time a strong interaction between genotype and heme iron intake was observed. Other factors associated with serum ferritin concentrations were age, body mass index, blood donation, menopausal status, and HFE genotype.<h4>Conclusions</h4>Postmenopausal women eating a diet rich in heme iron and who were C282Y homozygotes had the highest serum ferritin concentrations.

Also flagged:sleep apnea syndromeserotonin transporterpolymerasepolyacrylamidepathogenesis
Journal Article 2005-10-01 ✓ 5 Snippets Yue WH, Liu PZ, Hao W, Zhang XH, Wang XP, Zhang JS, Zhou XH, Xie YB, Ni M.
In-Text Gene Mentions

The allele 10 of 5-HTT-VNTR might be a susceptible factor in the pathogenesis of SAS.

<h4>Objective</h4>To identify polymorphisms of the serotonin transporter(5-HTT) gene and to find out whether there was relationship between any such polymorphisms and sleep apnea syndrome (SAS).<h4>Methods</h4>For two polymorphisms of 5-HTT target DNA gene was amplified using polymerase chain reaction (PCR) and 6% non-denaturing polyacrylamide gels electrophoresis.

The frequencies of the different forms of the genotypes and alleles of 5-HTT gene were analyzed in 104 patients with SAS and 150 healthy controls.<h4>Results</h4>The frequencies of the S or L alleles and the S/S, S/L or L/L genotypes in promoter region of 5-HTT gene in SAS group were not significantly different to those in healthy controls (P > 0.05).

…of the serotonin transporter(5-HTT) gene and to…

…two polymorphisms of5-HTTtarget DNA gene…

Show Full Abstract

<h4>Objective</h4>To identify polymorphisms of the serotonin transporter(5-HTT) gene and to find out whether there was relationship between any such polymorphisms and sleep apnea syndrome (SAS).<h4>Methods</h4>For two polymorphisms of 5-HTT target DNA gene was amplified using polymerase chain reaction (PCR) and 6% non-denaturing polyacrylamide gels electrophoresis. The frequencies of the different forms of the genotypes and alleles of 5-HTT gene were analyzed in 104 patients with SAS and 150 healthy controls.<h4>Results</h4>The frequencies of the S or L alleles and the S/S, S/L or L/L genotypes in promoter region of 5-HTT gene in SAS group were not significantly different to those in healthy controls (P > 0.05). However, the frequencies of 10/10, 12/10 genotypes of 5-HTT-VNTR in SAS patients were significantly higher than those in healthy control subjects (P < 0.05). Moreover, the frequency of the allele 10 of 5-HTT-VNTR in SAS patients was significantly higher than that in healthy controls (P<0.01).<h4>Conclusion</h4>The allele 10 of 5-HTT-VNTR might be a susceptible factor in the pathogenesis of SAS.

Also flagged:headachedental diseasedental diseasestemporomandibular disordercircadian rhythmtension-type headache
Journal Article 2005-10-01 ✓ 1 Snippet Watanabe N, Shimohira M.
In-Text Gene Mentions

…of a serotonin transporter(5-HTT) gene promoter polymorphism…

Show Full Abstract

This report summarizes the secondary headache attributed to dental disease. Among a lot of dental diseases, the temporomandibular disorder(TMD) is the most important for understanding the mechanism of this type of headache. Our recent study showed that TMD patients had the following symptoms: dysdiadochokinesia, abnormal induced-rigidity in forearms, abnormal circadian rhythm, tension-type headache and mental torment. All these abnormal symptoms were relieved by the improvement of the patient's sleep-quality. The brain monoaminergic systems are known to be related to muscle tonus, sleep problems and mental symptoms. Our studies of a serotonin transporter(5-HTT) gene promoter polymorphism showed that the L and XL alleles were more frequent and S allele was less frequent in the TMD compared to the controls. We speculate the brain monoaminergic systems play the important pathophysiological roles on the TMD.

Also flagged:Endocannabinoidion channelsendocannabinoidslipidCB1synaptic transmission
Journal Article 2005-10-01 No Snippets Heinbockel T, Brager DH, Reich CG, Zhao J, Muralidharan S, Alger BE, Kao JP.
Show Full Abstract

Intercellular signaling dynamics critically influence the functional roles that the signals can play. Small lipids are synthesized and released from neurons, acting as intercellular signals in regulating neurotransmitter release, modulating ion channels on target cells, and modifying synaptic plasticity. The repertoire of biological effects of lipids such as endocannabinoids (eCBs) is rapidly expanding, yet lipid signaling dynamics have not been studied. The eCB system constitutes a powerful tool for bioassaying the dynamics of lipid signaling. The eCBs are synthesized in, and released from, postsynaptic somatodendritic domains that are readily accessible to whole-cell patch electrodes. The dramatic effects of these lipid signals are detected electrophysiologically as CB1-dependent alterations in conventional synaptic transmission, which therefore serve as a sensitive reporter of eCB actions. We used electrophysiological recording, photolytic release of caged glutamate and a newly developed caged AEA (anandamide), together with rapid [Ca2+]i measurements, to investigate the dynamics of retrograde eCB signaling between CA1 pyramidal cells and GABAergic synapses in rat hippocampus in vitro. We show that, at 22 degrees C, eCB synthesis and release must occur within 75-190 ms after the initiating stimulus, almost an order of magnitude faster than previously thought. At 37 degrees C, the time could be < 50 ms. Activation of CB1 and downstream processes constitute a significant fraction of the total delay and are identified as major rate-limiting steps in retrograde signaling. Our findings imply that lipid messenger dynamics are comparable with those of metabotropic neurotransmitters and can modulate neuronal interactions on a similarly fast time scale.

Also flagged:coagulationfibrinolysislung fibrosisvWFAT-IIIplasminogen activity inhibitor-1
Journal Article 2005-10-01 ✓ 1 Snippet Zhang YP, Ma JY.
In-Text Gene Mentions

…the activities ofAntithrombin-III(AT-III) , plasminogen activit…

Show Full Abstract

<h4>Objective</h4>To investigate the activity of coagulation and fibrinolysis systems in bronchoalveolar lavage fluid (BALF) in lung fibrosis in rats, and to study their role in diagnosis of lung fibrosis.<h4>Methods</h4>Thirty-six Sprague-Dawley rats were randomly divided into 2 groups (n=18 in each group ). Lung fibrosis and control models were made by tracheal instillation bleomycinA(5) (BLMA(5)) (5 mg/kg) and saline. On days 7, 14 and 28, the recalcification time points of normal pooled plasma for studying procoagulation activity (PCA), the levels of von Willebrand Factor (vWF), the activities of Antithrombin-III(AT-III) , plasminogen activity inhibitor-1 (PAI-1) and urokanise-type plasminogen activator (uPA) in BALF were measured respectively.<h4>Results</h4>(1) In BLM group,the recalcification time points in BALF were (56+/-10), (78+/-3) and (172+/-11) seconds respectively, they were (190+/-10), (186+/-8) and (184+/-6) seconds respectively in control group. The difference was significant (P<0.01) except on day 28; (2) The differences in level of vWF and activity of AT-III in BALF were not significant in BLM group versus control group; (3) Activities of PAI-1 in BALF in BLM group were (1.04+/-0.08), (1.47+/-0.06), (3.03+/-0.18) u/mL respectively, while they were (0.66+/-0.11), (0.71+/-0.09), (0.70+/-0.08) u/mL respectively in control group. The difference was significant (P<0.01); (4) Activities of uPA in BALF in BLM group were (0.19+/-0.03), (0.16+/-0.02), (0.12+/-0.05) u/mL respectively, while they were (0.26+/-0.05), (0.25+/-0.06), (0.24+/- 0.07) u/mL respectively. The difference was significant (P<0.01).<h4>Conclusion</h4>The PCA upregulation might be means to diagnose alveolitis. The activity of the fibrinolysis system was injured progressively by PAI-1 activity upregulation and uPA activity downregulation, which might be taken as means to study the occurrence of early lung fibrosis and its development,vWF and AT-III rendered no help in diagnosis of lung fibrosis.

Also flagged:antibodyHuntington's diseaseneurodegenerative disorderamino acidglutamic acids
Journal Article 2005-10-01 No Snippets Cong SY, Pepers BA, Roos RA, Van Ommen GJ, Dorsman JC.
Show Full Abstract

Huntington's disease is a dominantly inherited, devastating neurodegenerative disorder, caused by a polyglutamine expansion (>37) in the N-terminal region of huntingtin, a protein of unknown function. In patients and normal individuals, N-terminal fragments of huntingtin are found, and the N-terminal fragments of mutant huntingtin are cytotoxic. The functions of wild-type huntingtin and the mechanisms underlying the toxic effects of mutant huntingtin are still ill defined. To get more insight into these topics, monoclonal antibodies (MAbs) are indispensable tools. Antibodies raised against the N-terminus are especially important. Among these, the 4C8 mouse MAb has been extensively used in various approaches. In this study, we have mapped the epitope of 4C8 to a 15-amino acid (aa) region spanning from aa 443 to 457 of the human protein, and found that mutation of three consecutive glutamic acids present in this region disrupts the recognition by 4C8. These results allow a more accurate interpretation of the results obtained by usage of the 4C8 antibody and broaden the utility of this antibody.

Also flagged:small cell lung carcinomaslarge cell neuroendocrine carcinomastumorstumorneuroendocrine tumorsneuroendocrine tumors of the lung
Journal Article 2005-10-01 No Snippets Peng WX, Shibata T, Katoh H, Kokubu A, Matsuno Y, Asamura H, Tsuchiya R, Kanai Y, Hosoda F, Sakiyama T, Ohki M, Imoto I, Inazawa J, Hirohashi S.
Show Full Abstract

We examined a large number of primary high-grade neuroendocrine tumors of the lung (10 small cell lung carcinomas and 31 large cell neuroendocrine carcinomas) by using array-based comparative genomic hybridization using microarrays spotted with 800 bacterial artificial chromosome clones containing tumor-related genes from throughout the human genome. We identified the genome-wide copy number alteration profiles of these tumors, including recurrent amplifications located at 2q21.2, 3q21-27, 3q26, 3q27-29, 5p14.2, 5p13, 7q21.1, 8q21, and 8q24 and homozygous deletions at 1p36, 4p16, 4p16.3, 9p21.3, 9p21, 19p13.3, and 20q13. Our results revealed that small cell lung carcinomas and large cell neuroendocrine carcinomas have multiple characteristic chromosomal alterations in common, but that distinctive alterations also exist between the two subtypes. Moreover, we found that the two subtypes undergo different processes of accumulating these genetic alterations during tumor development. By comparing the genetic profiles with the clinicopathological features, we discovered many chromosomal loci whose alterations were significantly associated with clinical stage and patient prognosis. These results will be valuable for evaluating clinical status, including patient prognosis, and for identifying novel molecular targets for effective therapies.

Also flagged:iron overload syndromesironoverloadferroportin 1FPN1transferrin receptor 2
Journal Article 2005-10-01 ✓ 5 Snippets Zoller H, Cox TM.
In-Text Gene Mentions

Rare defects, including mutations in the transferrin receptor 2 (TFR2) gene, have also been identified in pedigrees affected with "non-HFE hemochromatosis.

Although most adult patients with hereditary iron overload are homozygous for the C282Y mutation of the HFE gene, an increasing number with hereditary iron storage have an HFE genotype not characteristic of the disease.

…pedigrees affected with `` non-HFE hemochromatosis. '' Homozygous mutations in the newly…

Rare defects, including mutations in the transferrin receptor 2 (TFR2) gene, have also been identified in pedigrees affected with "non-HFE hemochromatosis." Homozygous mutations in the newly identified genes encoding hemojuvelin (HFE2) and hepcidin (HAMP) cause juvenile hemochromatosis.

Hemochromatosis: genetic testing and…

Show Full Abstract

The availability of a facile treatment for hemochromatosis renders early diagnosis of iron overload syndromes mandatory, and in many instances genetic testing allows identification of individuals at risk of developing clinical disease before pathologic iron storage occurs. Numerous proteins implicated in iron homeostasis have recently come to light, and defects in the cognate genes are associated with iron storage. Although most adult patients with hereditary iron overload are homozygous for the C282Y mutation of the HFE gene, an increasing number with hereditary iron storage have an HFE genotype not characteristic of the disease. Heterozygosity for mutations in the gene encoding ferroportin 1 (FPN1) is probably the second most common genetic cause of hereditary iron storage in adults; here the primarily affected cell is the macrophage. Rare defects, including mutations in the transferrin receptor 2 (TFR2) gene, have also been identified in pedigrees affected with "non-HFE hemochromatosis." Homozygous mutations in the newly identified genes encoding hemojuvelin (HFE2) and hepcidin (HAMP) cause juvenile hemochromatosis. At the same time, heterozygosity for mutations in these genes can modify the clinical expression of iron storage in patients predisposed to iron storage in adult life. Hemochromatosis might thus be considered as a polygenic disease with strong environmental influences on its clinical expression. As our mechanistic understanding of iron pathophysiology improves, our desire to integrate clinical decision making with the results of laboratory tests and molecular analysis of human genes poses increasing challenges.

Journal Article 2005-10-01 ✓ 5 Snippets Lazarescu A, Snively BM, Adams PC.
In-Text Gene Mentions

hemochromatosis patients are homozygous for the C282Y mutation of the HFE

…homozygotes for thehemochromatosisgene.…

…>Background & aims</h4>Typicalhemochromatosispatients are homozygous…

…mutation of theHFEgene.…

…Y homozygotes.<h4>Methods</h4>Hemochromatosisfamilies that each…

Show Full Abstract

<h4>Background & aims</h4>Typical hemochromatosis patients are homozygous for the C282Y mutation of the HFE gene. However, approximately 50% of women and 20% of men do not have an increase in serum ferritin level. This study assessed factors, genetic and otherwise, that may modify biochemical expression in C282Y homozygotes.<h4>Methods</h4>Hemochromatosis families that each had at least 2 untreated C282Y homozygotes were included. Nonexpressors were defined as having a ferritin level less than 300 microg/L for a male and a ferritin level less than 200 microg/L for a female. A multivariate linear stepwise regression analysis was performed to assess the contribution of sex, age, and the presence of a nonexpressor in the family on serum ferritin level. Heritability calculations were performed using variance component analysis.<h4>Results</h4>Fifty-three pedigrees consisting of 148 C282Y homozygotes (92 males, 56 females) were identified. Twenty-nine homozygotes were nonexpressors (19.6%), of which 11 of 29 were male (37.9%) (P=.0054). Based on multivariate analysis, highly significant associations with increased ferritin levels in C282Y homozygotes were male sex (P=.00005), increasing age (P=.009), and absence of a nonexpressor in the family (P=.01). Variance component modeling using age, sex, and C282Y genotype as covariates in 39 pedigrees (n=296) showed a residual heritability for serum ferritin of .35+/-.10 (P<.001).<h4>Conclusions</h4>These findings suggest that male sex is the major clinical factor associated with an increased serum ferritin level in hemochromatosis. In addition, these results support the hypothesis that other genes contribute to the variance in serum ferritin concentration among C282Y homozygotes.

Also flagged:Huntington's diseaseprotein degradationmitochondrialgene silencingthioflavin-Sgene-silencing
Journal Article 2005-10-01 ✓ 1 Snippet Díaz-Hernández M, Torres-Peraza J, Salvatori-Abarca A, Morán MA, Gómez-Ramos P, Alberch J, Lucas JJ.
In-Text Gene Mentions

htt

Show Full Abstract

The primary mechanism responsible for Huntington's disease remains unknown. Postulated early pathogenic events include the following: impaired protein folding, altered protein degradation, mitochondrial dysfunction, and transcriptional dysregulation. Although related therapies can delay disease progression in mouse models, they target downstream and probably indirect effects of mutant-huntingtin expression. Accordingly, in case they prove beneficial in humans, they might only palliate some aspects of disease. Our previous studies in the Tet/HD94 conditional model and the recently reported efficacy of RNA interference against mutant huntingtin in another mouse model support silencing mutant-huntingtin expression as a valid therapeutic approach that has the advantage of targeting toxicity at its root. Here, we address whether gene silencing can still be beneficial in the late stages of disease with detectable striatal neuron loss. Stereological analysis was applied to determine an age at which Tet/HD94 mice show a decrease in the number of striatal neurons. Then, progression of neuropathology and motor phenotype were analyzed in mice that were allowed to continue expressing mutant huntingtin and in mice that no longer expressed it. Neuronal loss did not revert in gene-off mice, but the additional loss that takes place in gene-on mice was prevented. The total number of huntingtin-containing inclusions dramatically reverted, but a small fraction of inclusions positive for the amyloid dye thioflavin-S remained. Interestingly, despite a 20% decrease in striatal neurons and the presence of amyloid-like irreversible inclusions, gene-off mice fully recover from their motor deficit, thus ruling out amyloid-like huntingtin inclusions as the main toxic species and suggesting that gene-silencing therapies might work in late stages of disease.

Also flagged:polymerasechromosomecolorectal carcinomacolorectal tumorstumorspolyacrylamide
Journal Article 2005-10-01 ✓ 1 Snippet Erill N, Colomer A, Calvo M, Vidal A, Román R, Verdú M, Cordón-Cardó C, Puig X.
In-Text Gene Mentions

DCC

Show Full Abstract

Chromosome 18q allelic loss has been reported to have prognostic significance in stage II colorectal carcinoma. We have developed a fluorescent multiplex polymerase chain reaction assay to analyze five microsatellite markers (D18S55, D18S58, D18S61, D18S64, and D18S69) for allelic loss at the long arm of chromosome 18. Amplicon detection and evaluation was accomplished by capillary electrophoresis using an ABI 310 genetic analyzer. Robustness of the assay when performed on DNA extracted from formalin-fixed, paraffin-embedded tissue sections was confirmed by analyzing its repeatability and reproducibility. Allelic loss was assessed in 61 stage II colorectal tumors and was detected in 58% (31 of 53) of tumors not showing instability. As part of the study, results of 207 previous polymerase chain reaction/polyacrylamide-based assays were re-evaluated by two independent observers to determine the degree of concordance of visual evaluation. In the case of stage II colorectal tumors, when electropherogram results were compared with those obtained from visual evaluation of the same markers after polyacrylamide gel electrophoresis, discrepancies between observers were detected in 16.4% of determinations. In conclusion, we have developed a robust and reliable assay for multiplexed loss of heterozygosity determination that improves assessment of chromosome 18q allelic loss in colorectal tumors processed as routine formalin-fixed, paraffin-embedded specimens.

Also flagged:Raf-1 kinasebreast cancerRKIPRafmitogen-activated protein kinase kinaseextracellular signal-regulated kinase
Journal Article 2005-10-01 No Snippets Hagan S, Al-Mulla F, Mallon E, Oien K, Ferrier R, Gusterson B, García JJ, Kolch W.
Show Full Abstract

<h4>Purpose</h4>Raf-1 kinase inhibitor protein (RKIP) was originally identified as the first physiologic inhibitor of the Raf/mitogen-activated protein kinase kinase/extracellular signal-regulated kinase (ERK) pathway. This pathway regulates fundamental cellular functions, including those that are subverted in cancer cells, such as proliferation, transformation, survival, and metastasis. Recently, RKIP has been recognized as a strong candidate for a metastasis suppressor gene in cell and animal model systems. Therefore, we investigated whether RKIP expression is altered in clinical specimens of human primary breast cancers and their lymph node metastases.<h4>Experimental design</h4>Paraffin-embedded tumor samples from 103 breast cancer patients were examined immunohistochemically for the expression of RKIP, activated ERK, and apoptosis. The specificity of the antibodies used was validated by competition experiments with purified recombinant RKIP protein.<h4>Results</h4>RKIP expression was high in breast duct epithelia and retained to varying degrees in primary breast tumors. However, in lymph node metastases, RKIP expression was highly significantly reduced or lost (P = 0.000003). No significant correlations were observed between RKIP expression and histologic type, tumor differentiation grade, size, or estrogen receptor status.<h4>Conclusion</h4>This is the first study of RKIP expression in a large clinical cohort. It confirms the results of cell culture and animal studies, suggesting that in human breast cancer, RKIP is a metastasis suppressor gene whose expression must be down-regulated for metastases to develop. RKIP expression is independent of other markers for breast cancer progression and prognosis.

Also flagged:Coagulationfibrinolysispreeclampsiagestationurokinase-like plasminogen activatoru-PA
Journal Article 2005-10-01 ✓ 2 Snippets Tanjung MT, Siddik HD, Hariman H, Koh SC.
In-Text Gene Mentions

…reduced antithrombin III (ATIII) and PAI-2 levels…

…with reduced fibrinogen,ATIII, t-PA, u-PA antigen,…

Show Full Abstract

Coagulation and fibrinolysis were determined in 67 Indonesian women admitted to the University Hospitals for delivery in Medan. They were diagnosed to be at term gestation (mean 39.3 +/- 1.1 weeks) with moderate and severe preeclampsia (n=32) and in labor, and 8 had preterm labor (gestation mean 33.5 +/- 2.6 weeks). Twenty-seven normal pregnant women in labor (gestation mean 39.7 +/- 1.0 weeks) served as controls. Cord blood from 23 neonates from normal pregnancy and 31 neonates from preeclampsia was also evaluated. Preeclamptic women in labor showed further enhanced coagulation activation (F(1+2)) with raised urokinase-like plasminogen activator (u-PA) activity and reduced plasminogen activator inhibitor-2 (PAI-2) levels. In preterm preeclampsia, significantly reduced antithrombin III (ATIII) and PAI-2 levels with further elevated tissue-type PA (t-PA) antigen and plasminogen activator inhibitor-1 (PAI-1) antigen were seen compared to normal pregnancy. These would suggest a state of enhanced thrombin generation with elevated fibrinolytic/inhibitor proteins in preterm preeclampsia. The reduced PAI-2 levels seen in preeclampsia have been suggested to be associated with reduced placental function. Neonates born to mothers of either normal pregnancy or preeclampsia at term showed similar hemostatic changes with reduced fibrinogen, ATIII, t-PA, u-PA antigen, PAI-1 levels, and coagulation activation compared to their respective maternal plasma levels. No significant differences in hemostatic parameters studied between the neonates of both cohorts were seen, and this would suggest that the neonates were protected from the adverse effects of preeclampsia and their hemostatic system was physiologically balanced.

Also flagged:tumor-suppressorO6-methylguanine-DNA methyltransferaseMGMThematological malignanciestumor-suppressor
Journal Article 2005-10-01 ✓ 5 Snippets Nakayama K, Inokuchi K, Dan K.
In-Text Gene Mentions

Although unmethylated patterns of the CpG region in the DCC, p51, and MGMT genes were observed in all 11 normal controls, abnormal methylation patterns of these genes were found even in many cell lines expressing these genes.

Hypermethylation of the putative tumor-suppressor genes DCC, p51/63 and O6-methylguanine-DNA methyltransferase (MGMT) and loss of their expressions in cell lines of hematological malignancies.

Alterations and defective expression of three putative tumor-suppressor genes, the deleted in colorectal cancer (DCC), p51, and O(6)-methylguanine-DNA methyltransferase (MGMT), have been demonstrated in many cancers.

…utative tumor-suppressor genesDCC, p51/63 and O6-methylguanine-…

…in colorectal cancer (DCC), p51, and O(6)-methylguanine…

Show Full Abstract

Alterations and defective expression of three putative tumor-suppressor genes, the deleted in colorectal cancer (DCC), p51, and O(6)-methylguanine-DNA methyltransferase (MGMT), have been demonstrated in many cancers. However, it is not known whether the defective expression of each of these genes is independent or whether it reflects a specific methylation abnormality. Here, we investigated the expression of the DCC, p51 and MGMT genes and the methylation status of the 5' flanking CpG region in 17 cell lines established from hematological malignancies. The reverse transcriptase-polymerase chain reaction method showed DCC expression to be absent in 13 of the 17 cell lines and showed expression of both p51 and MGMT to be absent in 5 of the 17 cell lines. The methylation patterns were analyzed with methylation-specific polymerase chain reaction (MSP) of the 5'flanking region of the DCC and p51 genes and the promoter region of the MGMT gene. Although unmethylated patterns of the CpG region in the DCC, p51, and MGMT genes were observed in all 11 normal controls, abnormal methylation patterns of these genes were found even in many cell lines expressing these genes. A hypermethylation pattern was detected for the CpG region of MGMT and p51 in cells that did not express these genes. In contrast, a hypermethylation pattern was not always detected for the CpG region of DCC in cells with reduced DCC expression. The results of this study indicate that in many hematological cell lines, the DCC, p51, and MGMT genes have been abnormally methylated in the CpG region. Hypermethylation of these three genes may be independent events in each cell line.

Also flagged:cholesterolpolyglutamineHuntington's diseaseHDneurodegenerative diseasebiosynthesis
Journal Article 2005-10-01 ✓ 2 Snippets Valenza M, Rigamonti D, Goffredo D, Zuccato C, Fenu S, Jamot L, Strand A, Tarditi A, Woodman B, Racchi M, Mariotti C, Di Donato S, Corsini A, Bates G, Pruss R, Olson JM, Sipione S, Tartari M, Cattaneo E.
In-Text Gene Mentions

In particular, the transcription of key genes of the cholesterol biosynthetic pathway is severely affected in vivo in brain tissue from HD mice and in human postmortem striatal and cortical tissue; this molecular dysfunction is biologically relevant because cholesterol biosynthesis is reduced in cultured human HD cells, and total cholesterol mass is significantly decreased in the CNS of HD mice and in brain-derived ST14A cells in which the expression of mutant huntingtin has been turned on.

The expansion of a polyglutamine tract in the ubiquitously expressed huntingtin protein causes Huntington's disease (HD), a dominantly inherited neurodegenerative disease.

Show Full Abstract

The expansion of a polyglutamine tract in the ubiquitously expressed huntingtin protein causes Huntington's disease (HD), a dominantly inherited neurodegenerative disease. We show that the activity of the cholesterol biosynthetic pathway is altered in HD. In particular, the transcription of key genes of the cholesterol biosynthetic pathway is severely affected in vivo in brain tissue from HD mice and in human postmortem striatal and cortical tissue; this molecular dysfunction is biologically relevant because cholesterol biosynthesis is reduced in cultured human HD cells, and total cholesterol mass is significantly decreased in the CNS of HD mice and in brain-derived ST14A cells in which the expression of mutant huntingtin has been turned on. The transcription of the genes of the cholesterol biosynthetic pathway is regulated via the activity of sterol regulatory element-binding proteins (SREBPs), and we found an approximately 50% reduction in the amount of the active nuclear form of SREBP in HD cells and mouse brain tissue. As a consequence, mutant huntingtin reduces the transactivation of an SRE-luciferase construct even under conditions of SREBP overexpression or in the presence of an exogenous N-terminal active form of SREBP. Finally, the addition of exogenous cholesterol to striatal neurons expressing mutant huntingtin prevents their death in a dose-dependent manner. We conclude that the cholesterol biosynthetic pathway is impaired in HD cells, mice, and human subjects, and that the search for HD therapies should also consider cholesterol levels as both a potential target and disease biomarker.

Also flagged:mtDNAchromosomestumoursorganizationcentromereschromosome
Journal Article 2005-10-01 No Snippets International HapMap Consortium.
Show Full Abstract

Inherited genetic variation has a critical but as yet largely uncharacterized role in human disease. Here we report a public database of common variation in the human genome: more than one million single nucleotide polymorphisms (SNPs) for which accurate and complete genotypes have been obtained in 269 DNA samples from four populations, including ten 500-kilobase regions in which essentially all information about common DNA variation has been extracted. These data document the generality of recombination hotspots, a block-like structure of linkage disequilibrium and low haplotype diversity, leading to substantial correlations of SNPs with many of their neighbours. We show how the HapMap resource can guide the design and analysis of genetic association studies, shed light on structural variation and recombination, and identify loci that may have been subject to natural selection during human evolution.

Also flagged:pulmonary thromboembolismtissue-type plasminogen activatort-PAplasminogen activator inhibitor1PAI-1protein S
Journal Article 2005-10-01 ✓ 1 Snippet Pang BS, Wang C, Zhai ZG, Yang YH, Mao YL, Huang XX, Zhu J.
In-Text Gene Mentions

Antithrombin-III(AT-III) activity was…

Show Full Abstract

<h4>Objective</h4>To explore the changes of blood coagulative and fibrinolytic systems and functions of pulmonary vascular endothelium in patients with pulmonary thromboembolism (PTE).<h4>Methods</h4>Twenty patients with acute massive PTE, 40 patients with acute non-massive PTE and 40 control subjects without PTE were included in the study. D-Dimer (D-D), tissue-type plasminogen activator (t-PA), plasminogen activator inhibitor1 (PAI-1), plasma protein S (Ps), plasma protein C (Pc), thrombomodulin (TM), anticardiolipin antibody (ACA) and homocysteine (Hcy) were measured by the method of ELISA. Antithrombin-III (AT-III) activity was measured by chromo-substrate method.<h4>Results</h4>The levels of D-D, t-PA, PAI-1, and TM were (1.46 +/- 0.62) mg/L, (11.4 +/- 6.9) microg/L, (88.2 +/- 27.5) microg/L, (6.8 +/- 1.1) microg/L respectively in patients with acute massive PTE and (0.92 +/- 0.27) mg/L, (6.6 +/- 1.5) microg/L, (60.1 +/- 26.1) microg/L, and (6.30 +/- 1.50) mg/L in patients with acute non-massive PTE. The levels of both PET groups were significantly higher than those of the control subjects [(0.38 +/- 0.10) mg/L, (4.7 +/- 1.4) microg/L, (35.7 +/- 9.2) microg/L, (3.0 +/- 0.5) microg/L and P < 0.05]. The levels of AT-III were (86.0 +/- 11.8)% in patients with acute massive PTE and (90.1 +/- 9.0)% in patients with acute non-massive PTE. The levels of AT-III in both groups were significantly lower than those of the control subjects, which were (102.6 +/- 9.2)% (P < 0.01 and P < 0.05 respectively). The levels of ACA-IgG, IgM and IgA in patients with acute massive PTE and non-massive PTE were also significantly higher than those in the control group (P < 0.05).<h4>Conclusion</h4>Imbalance of blood coagulation and fibrolytic systems and pulmonary vascular endothelium damage occur in patients with PTE.

Also flagged:heparincoagulationclottingacetylsalicylic acidprothrombin
Journal Article 2005-10-01 ✓ 1 Snippet Hughes P, Hasenkam JM, Severinsen IK, Steinbrüchel DA.
In-Text Gene Mentions

…and functional antithrombin (ATIII) were measured.…

Show Full Abstract

Right heart assist (RHA) was used for coronary artery bypass grafting (CABG). We explored the affection of the coagulation system during surgery and evaluated two different antithrombotic treatments postoperatively. The pilot study comprised 14 patients. During surgery activated clotting time (ACT) was kept > 200 sec. By random the patients were selected to different postoperative treatments. The control group received acetyl salicylic acid (ASA) 150 mg daily, the intervention group received ASA 150 mg daily and Low Molecular Weight Heparin (LMWH) 5000 IU x2 for three days. Serum levels of prothrombin fragment 1 and 2 (F 1 + 2), plasmin-antiplasmin product (PAP), anti-Xa activity and functional antithrombin (ATIII) were measured. During surgery there was no increase of F 1 + 2 or PAP. After protamin was administered there was a significant increase of F 1 + 2 but not in PAP during the next 6 hours. Postoperative antithrombotic treatment with LMWH seems to normalise F1 + 2 while ASA does not. ACT level > 200 sec. seems sufficient for RHA-CABG surgery. Fibrinolytic agents are not necessary. It seems that postoperative LMWH treatment prevents increased thrombin formation. General recommendations with respect to antithrombotic treatment beyond ASA can not be made based on study.

Also flagged:glucocorticoidscarcinomaGC receptorsGRcisplatincancer
Journal Article 2005-10-01 ✓ 1 Snippet Lu YS, Lien HC, Yeh PY, Yeh KH, Kuo ML, Kuo SH, Cheng AL.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Aim</h4>To determine how glucocorticoids (GCs) may affect the growth and chemosensitivity of common carcinoma cells.<h4>Methods</h4>The effect of dexamethasone (DEX) on growth and chemosensitivity was assessed in 14 carcinoma cell lines. The function of GC receptors (GR) was assessed by MMTV reporter assay. Overexpression of GR was done by in vitro transfection and expression of a GR-expressing vector. Immunohistochemical stain of tissues and cells were done by PA1-511A, an anti-GR monoclonal antibody.<h4>Results</h4>DEX inhibited cell growth of four (MCF-7, MCF-7/MXR1, MCF-7/TPT300, and HeLa), increased cisplatin cytotoxicity of one (SiHa), and decreased cisplatin cytotoxicity of two (H460 and Hep3B) cell lines. The GR content of the seven cell lines affected by DEX was significantly higher than those of the seven cell lines unaffected by DEX (5.2+/-2.5 x 10(4) sites/cell vs 1.3+/-1.4 x 10(4) sites/cell, P = 0.005). Only two DEX-unresponsive cell lines (NPC-TW01 and NPC-TW04) contained high GR amounts in the range (1.9-8.1 x 10(4) sites/cell) of the seven DEX-responsive cell lines. The GR function of NPC-TW01 and NPC-TW04, however, was found to be impaired. The importance of high cellular amount of GR in mediating DEX susceptibility of the cells was further exemplified by GR dose-dependent drug resistance to cisplatin of AGS, a cell line with low GR content and was unaffected by DEX before transfection of GR-expressing vector. Immunohistochemical studies of human cancer tissues showed that 5 of the 45 (11.1%) breast cancer and 43 of the 85 (50.6%) non-small cell lung cancer had high GR contents at the ranges of the GC-responsive carcinoma cell lines.<h4>Conclusion</h4>The growth and chemosensitivity of human carcinomas with high GR contents may be affected by GC. However, in light of the heterogeneous and even contradictive effects of GC on these cells, routine examination of GR contents of human carcinoma tissues may not be clinically useful until other markers that help predict the ultimate effect of GC on individual patients are identified.

Also flagged:vestibular neuritisacute neuritisnystagmusvestibular dysfunctiondeficitcentral vestibular disorders
Journal Article 2005-10-01 No Snippets Nuti D, Mandalà M.
Show Full Abstract

Aim of this study was to determine sensitivity and specificity of the mastoid vibration test in patients who had suffered an attack of vestibular neuritis. Results were compared with the caloric test and two bedside tests of vestibular function (head shaking test and head thrust test). Results are reported in 28 patients who had a residual vestibular deficit 6 months after acute neuritis and in 25 healthy subjects. Mastoid vibration nystagmus was evoked in 21 patients but not in controls. In these patients, mastoid vibration test had a sensitivity of 75% and specificity of 100%. Since one patient had inverted mastoid vibration nystagmus, specificity of identification on the pathological side was 95%. Sensitivity of the test increased with increasing severity of the vestibular lesion. Indeed, mastoid vibration nystagmus was induced in 93% of patients with caloric paralysis and in 58% of those with caloric paresis. Nystagmus could usually be modulated or elicited by stimulation of either mastoid. In the few patients in whom mastoid vibration nystagmus was elicited only from one side, or when there was a clear difference in intensity of the nystagmus induced on the two sides, the stimulated side was more often the affected side. Four patients still showed spontaneous nystagmus. The caloric test was abnormal in 26/28 patients (93%) with paralysis in 16 and paresis in 12; 71% of patients had a head shaking induced nystagmus: 64% had an asymmetrical response in head thrust test. In conclusion, mastoid vibration test was overall more sensitive than head thrust test. Mastoid vibration test was slightly less sensitive than head shaking test in patients with severe residual deficit and more sensitive in patients with partial deficit. Mastoid vibration test, a valid, low cost clinical screening test for rapid detection of asymmetrical vestibular function, does not cause patient discomfort. It is suggested that this test be included in the diagnostic workup of all patients with suspected vestibular dysfunction.

Also flagged:Cell Proliferationmetaphasemetaphasescircadian rhythmCD133hTERT
Journal Article 2005-10-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

DCC

Show Full Abstract

No abstract available.