Gene Literature Dashboard

Viewing March 2007 — 102 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← February 2007 April 2007 →
Also flagged:thalassemia syndromesHereditary hemochromatosisthalassemia
Journal Article 2007-03-31 ✓ 4 Snippets Agarwal S, Tewari D, Arya V, Moorchung N, Tripathi R, Chaudhuri G, Pradhan M.
In-Text Gene Mentions

Status of HFE mutation in thalassemia syndromes in north India.

HFE mutation in thalassemia

HFE mutation in thalassemia syndromes

…Status ofHFEmutation in thalassemia…

Show Full Abstract

Hereditary hemochromatosis is an autosomal recessive and most commonly inherited single gene disorder among Caucasians, with a prevalence of 5 per 1,000 and a carrier frequency of 1 in 10. Two point mutations were described and are referred as C282Y and H63D. In the present study, we have analyzed 729 north Indian samples for C282Y and H63D mutations. Of these, no allele of the C282Y mutation was seen, while 3 homozygous and 43 heterozygous for the H63D mutation were seen in the patients of thalassemia group. However, 47 cases were found heterozygous for the H63D mutation among the normal groups (11.16%).

Also flagged:S100A1S100BSOXTranscription factorSOX9sex-determining region Y-type high mobility group box 9
Journal Article 2007-03-30 ✓ 2 Snippets Saito T, Ikeda T, Nakamura K, Chung UI, Kawaguchi H.
In-Text Gene Mentions

…coactivators SOX5 andSOX6(the SOX trio)…

SOX6

Show Full Abstract

Transcription factor SOX9 (sex-determining region Y-type high mobility group box 9) and its coactivators SOX5 and SOX6 (the SOX trio) induce early-stage chondrocyte differentiation and suppress its terminal stage. To identify possible targets of the SOX trio, we carried out a microarray analysis and identified S100A1 and S100B as possible target molecules. S100 protein expression was localized in late proliferative and pre-hypertrophic chondrocytes of the mouse growth plate. Overexpression of S100A1, S100B or their combination in cultured chondrogenic cells did not induce early differentiation, but suppressed hypertrophic differentiation and mineralization. Silencing of both S100A1 and S100B stimulated terminal differentiation and reversed the SOX-trio-mediated inhibition. Finally, luciferase reporter, electrophoretic mobility shift and chromatin immunoprecipitation analyses showed that transcription of both S100 proteins is induced by the SOX trio, and also identified their respective enhancer elements in the 5'-end flanking region. We conclude that S100A1 and S100B are transcriptional targets of the SOX trio and mediate its inhibition of terminal differentiation of chondrocytes.

Also flagged:Type 2 transglutaminasedeathHuntington's diseaseHDpolyglutamineTG2
Journal Article 2007-03-30 ✓ 5 Snippets Ruan Q, Quintanilla RA, Johnson GV.
In-Text Gene Mentions

These data suggest that mutant htt alters the activation of TG2 in response to certain stimuli and therefore differentially modulates how TG2 contributes to cell death processes.

Huntington's disease (HD), which is caused by an expanded polyglutamine tract in huntingtin (htt), is characterized by extensive loss of striatal neurons.

To understand the role of TG2 in the pathogenesis of HD, immortalized striatal cells established from mice in which mutant htt with a polyglutamine stretch of 111 Gln had been knocked-in and wild type (WT) littermates, were stably transfected with human TG2 in a tetracycline inducible vector.

…tract in huntingtin (htt), is characterized by…

…in which mutanthttwith a polyglutamine…

Show Full Abstract

Huntington's disease (HD), which is caused by an expanded polyglutamine tract in huntingtin (htt), is characterized by extensive loss of striatal neurons. The dysregulation of type 2 transglutaminase (TG2) has been proposed to contribute to the pathogenesis in HD as TG2 is up-regulated in HD brain and knocking out TG2 in mouse models of HD ameliorates the disease process. To understand the role of TG2 in the pathogenesis of HD, immortalized striatal cells established from mice in which mutant htt with a polyglutamine stretch of 111 Gln had been knocked-in and wild type (WT) littermates, were stably transfected with human TG2 in a tetracycline inducible vector. Overexpression of TG2 in the WT striatal cells resulted in significantly greater cell death under basal conditions as well as in response to thapsigargin treatment, which causes increased intracellular calcium concentrations. Furthermore, in WT striatal cells TG2 overexpression potentiated mitochondrial membrane depolarization, intracellular reactive oxygen species production, and apoptotic cell death in response to thapsigargin. In contrast, in mutant striatal cells, TG2 overexpression did not increase cell death, nor did it potentiate thapsigargin-induced mitochondrial membrane depolarization or intracellular reactive oxygen species production. Instead, TG2 overexpression in mutant striatal cells attenuated the thapsigargin-activated apoptosis. When in situ transglutaminase activity was quantitatively analyzed in these cell lines, we found that in response to thapsigargin treatment TG2 was activated in WT, but not mutant striatal cells. These data suggest that mutant htt alters the activation of TG2 in response to certain stimuli and therefore differentially modulates how TG2 contributes to cell death processes.

Also flagged:Synthesispurinealkylaminoorganic acidsalts
Journal Article 2007-03-30 No Snippets Narayanasamy J, Pullagurla MR, Sharon A, Wang J, Schinazi RF, Chu CK.
Show Full Abstract

Prodrugs of (-)-beta-D-(2R,4R)-1,3-dioxolane-2,6-diamino purine (DAPD), organic salts of DAPD, 5'-L-valyl DAPD and N-1 substituted (-)-beta-D-(2R,4R)-1,3-dioxolane guanosine (DXG) have been synthesized with the objective of finding molecules which might be superior to DAPD and DXG in solubility as well as pharmacologic profiles. Synthesized prodrugs were evaluated for anti-HIV activity against HIV-1(LAI) in primary human lymphocytes (PBM cells) as well as their cytotoxicity in PBM, CEM and Vero cells. DAPD prodrugs, modified at the C6 position of the purine ring, demonstrated several folds of enhanced anti-HIV activity in comparison to the parent compound DAPD without increasing the toxicity. The presence of alkyl amino groups at the C6 position of the purine ring increased the antiviral potency several folds, and the most potent compound (-)-beta-D-(2R,4R)-1,3-dioxolane-2-amino-6-aminoethyl purine (8) was 17 times more potent than that of DAPD. 5'-L-Valyl DAPD 20 and organic acid salts 21-24 also exhibited enhanced anti-HIV activity in comparison to DAPD, while DXG prodrugs 16 and 17 exhibited lower potency than that of DXG or DAPD.

Also flagged:immune responseslipid Alipopolysaccharidesdisaccharideinterferon-inducible protein 10TRIF
Journal Article 2007-03-29 No Snippets Zhang Y, Gaekwad J, Wolfert MA, Boons GJ.
Show Full Abstract

The lipid A moiety of lipopolysaccharides (LPS) initiates innate immune responses by interacting with Toll-like receptor 4 (TLR4), which results in the production of a wide range of cytokines. Derivatives of lipid A show potential for use as immuno-modulators for the treatment of a wide range of diseases and as adjuvants for vaccinations. Development to these ends requires a detailed knowledge of patterns of cytokines induced by a wide range of derivatives. This information is difficult to obtain by using isolated compounds due to structural heterogeneity and possible contaminations with other inflammatory components. To address this problem, we have developed a synthetic approach that provides easy access to a wide range of lipid A's by employing a common disaccharide building block functionalized with a versatile set of protecting groups. The strategy was employed for the preparation of lipid A's derived from E. coli and S. typhimurium. Mouse macrophages were exposed to the synthetic compounds and E. coli 055:B5 LPS, and the resulting supernatants were examined for tumor necrosis factor alpha (TNF-alpha), interferon beta (IFN-beta), interleukin 6 (IL-6), interferon-inducible protein 10 (IP-10), RANTES, and IL-1beta. It was found that for each compound, the potencies (EC50 values) for the various cytokines differed by as much as 100-fold. These differences did not follow a bias toward a MyD88- or TRIF-dependent response. Instead, it was established that the observed differences in potencies of secreted TNF-alpha and IL-1beta were due to differences in the processing of respective pro-proteins. Examination of the efficacies (maximum responses) of the various cytokines showed that each synthetic compound and E. coli 055:B5 LPS induced similar efficacies for the production of IFN-beta and IP-10. However, lipid A's 1-4 gave lower efficacies for the production of RANTES and IL-6 as compared to LPS. Collectively, the presented results demonstrate that cytokine secretion induced by LPS and lipid A is complex, which can be exploited for the development of immuno-modulating therapies.

Also flagged:Aurora Bcondensin Imitosischromosomechromatinchromosomes
Journal Article 2007-03-28 ✓ 1 Snippet Takemoto A, Murayama A, Katano M, Urano T, Furukawa K, Yokoyama S, Yanagisawa J, Hanaoka F, Kimura K.
In-Text Gene Mentions

Condensin(s) plays a more…

Show Full Abstract

During mitosis, chromosome condensation takes place, which entails the conversion of interphase chromatin into compacted mitotic chromosomes. Condensin I is a five-subunit protein complex that plays a central role in this process. Condensin I is targeted to chromosomes in a mitosis-specific manner, which is regulated by phosphorylation by mitotic kinases. Phosphorylation of histone H3 at serine 10 (Ser10) occurs during mitosis and its physiological role is a longstanding question. We examined the function of Aurora B, a kinase that phosphorylates Ser10, in the chromosomal binding of condensin I and mitotic chromosome condensation, using an in vitro system derived from Xenopus egg extract. Aurora B depletion from a mitotic egg extract resulted in the loss of H3 phosphorylation, accompanied with a 50% reduction of chromosomal targeting of condensin I. Alternatively, a portion of condensin I was bound to sperm chromatin, and chromosome-like structures were assembled when okadaic acid (OA) was supplemented in an interphase extract that lacks Cdc2 activity. However, chromosomal targeting of condensin I was abolished when Aurora B was depleted from the OA-treated interphase extract. From these results, it is suggested that Aurora B-dependent and Cdc2-independent pathways of the chromosomal targeting of condensin I are present.

Also flagged:copperHuntington's diseaseHDironmetalspathogenesis
Journal Article 2007-03-28 ✓ 1 Snippet Fox JH, Kama JA, Lieberman G, Chopra R, Dorsey K, Chopra V, Volitakis I, Cherny RA, Bush AI, Hersch S.
In-Text Gene Mentions

We focused on two proteins: huntingtin, because of its centrality to HD, and lactate dehydrogenase (LDH), because of its documented sensitivity to copper, necessity for normoxic brain energy metabolism and evidence for altered lactate metabolism in HD brain.

Show Full Abstract

Huntington's disease (HD) is caused by a dominant polyglutamine expansion within the N-terminus of huntingtin protein and results in oxidative stress, energetic insufficiency and striatal degeneration. Copper and iron are increased in the striata of HD patients, but the role of these metals in HD pathogenesis is unknown. We found, using inductively-coupled-plasma mass spectroscopy, that elevations of copper and iron found in human HD brain are reiterated in the brains of affected HD transgenic mice. Increased brain copper correlated with decreased levels of the copper export protein, amyloid precursor protein. We hypothesized that increased amounts of copper bound to low affinity sites could contribute to pro-oxidant activities and neurodegeneration. We focused on two proteins: huntingtin, because of its centrality to HD, and lactate dehydrogenase (LDH), because of its documented sensitivity to copper, necessity for normoxic brain energy metabolism and evidence for altered lactate metabolism in HD brain. The first 171 amino acids of wild-type huntingtin, and its glutamine expanded mutant form, interacted with copper, but not iron. N171 reduced Cu(2+)in vitro in a 1:1 copper:protein stoichiometry indicating that this fragment is very redox active. Further, copper promoted and metal chelation inhibited aggregation of cell-free huntingtin. We found decreased LDH activity, but not protein, and increased lactate levels in HD transgenic mouse brain. The LDH inhibitor oxamate resulted in neurodegeneration when delivered intra-striatially to healthy mice, indicating that LDH inhibition is relevant to neurodegeneration in HD. Our findings support a role of pro-oxidant copper-protein interactions in HD progression and offer a novel target for pharmacotherapeutics.

Also flagged:L1reverse transcriptionRetrotransposon Insertionsynthesislong interspersed element-1retrotransposition
Journal Article 2007-03-28 No Snippets Chen JM, Férec C, Cooper DN.
Show Full Abstract

LINE-1 or L1 has driven the generation of at least 10% of the human genome by mobilising Alu sequences. Although there is no doubt that Alu insertion is initiated by L1-dependent target site-primed reverse transcription, the mechanism by which the newly synthesised 3' end of a given Alu cDNA attaches to the target genomic DNA is less well understood. Intrigued by observations made on 28 pathological simple Alu insertions, we have sought to ascertain whether microhomologies could have played a role in the integration of shorter Alu sequences into the human genome. A meta-analysis of the 1624 Alu insertion polymorphisms deposited in the Database of Retrotransposon Insertion Polymorphisms in Humans (dbRIP), when considered together with a re-evaluation of the mechanism underlying how the three previously annotated large deletion-associated short pathological Alu inserts were generated, enabled us to present a unifying model for Alu insertion into the human genome. Since Alu elements are comparatively short, L1 RT is usually able to complete nascent Alu cDNA strand synthesis leading to the generation of full-length Alu inserts. However, the synthesis of the nascent Alu cDNA strand may be terminated prematurely if its 3' end anneals to the 3' terminal of the top strand's 5' overhang by means of microhomology-mediated mispairing, an event which would often lead to the formation of significantly truncated Alu inserts. Furthermore, the nascent Alu cDNA strand may be 'hijacked' to patch existing double strand breaks located in the top-strand's upstream regions, leading to the generation of large genomic deletions.

Also flagged:Synthesisphosphatidylinositol dimannosidetuberculostearic acidcitronellolcarboncopper
Journal Article 2007-03-27 No Snippets Dyer BS, Jones JD, Ainge GD, Denis M, Larsen DS, Painter GF.
Show Full Abstract

(R)-tuberculostearic acid (2) was synthesized in seven steps from (S)-citronellol (5). The carbon chain of 2 was assembled by copper-catalyzed cross coupling of (S)-citronellol tosylate (6) and hexylmagnesium bromide; subsequent ozonolysis and reaction with 6-benzyloxyhexylmagnesium bromide furnished alcohol 10. Functional group manipulation afforded (R)-2 in 49% overall yield from 5. DCC coupling of (R)-2 with 3-O-benzyl-1-O-palmitoyl-sn-glycerol (16), followed by hydrogenolytic removal of the benzyl group and treatment with benzyl bis(diisopropyl)phosphoramidite, afforded phosphoramidite 20. Tetrazole-mediated coupling of 20 with PIM1 head group 21 gave 22, and subsequent debenzylation afforded phosphatidylinositol mono-mannoside, PIM1 (23). Similarly, coupling of 20 and 24 and removal of the benzyl protecting groups gave PIM2 (1c). Both 23 and 1c have a clearly defined acylation pattern, which was confirmed by mass spectrometry, with sn-1 palmitoyl and sn-2 tuberculostearoyl groups on the glycerol moiety. Both 23 and 1c were shown to modulate the release of the pro-inflammatory cytokine, IL-12, in a dendritic cell assay.

Also flagged:Ironinsulin resistancenonalcoholic fatty liver diseasehyperferritinemiaNAFLDmetabolic syndrome
Journal Article 2007-03-27 ✓ 3 Snippets Valenti L, Fracanzani AL, Dongiovanni P, Bugianesi E, Marchesini G, Manzini P, Vanni E, Fargion S.
In-Text Gene Mentions

Iron depletion was more effective in reducing HOMA-R in patients in the top two tertiles of ferritin concentrations (P<0.05 vs controls), and in carriers of the mutations in the HFE gene of hereditary hemochromatosis (P<0.05 vs noncarriers).

HFE gene of hereditary hemochromatosis

…mutations in theHFEgene of hereditary…

Show Full Abstract

<h4>Objectives</h4>Hyperferritinemia is frequently observed in nonalcoholic fatty liver disease (NAFLD), the hepatic manifestation of the metabolic syndrome characterized by hepatic insulin resistance and considered high cardiovascular risk. Iron depletion by phlebotomy has been reported to decrease insulin resistance in NAFLD in small, uncontrolled studies. Aims of this study were to define the relationship between ferritin and iron stores in patients with NAFLD, the effect of iron depletion on insulin resistance, and whether basal ferritin levels influence treatment outcome.<h4>Methods</h4>Subjects were included if ferritin and/or ALT were persistently elevated after 4 months of standard therapy. Sixty-four phlebotomized subjects were matched 1:1 for age, sex, ferritin, obesity, and ALT levels with patients who underwent lifestyle modifications only. Insulin resistance was evaluated by insulin levels, determined by RIA and the HOMA-R index, at baseline and after 8 months.<h4>Results</h4>Baseline ferritin levels were associated with body iron stores (P<0.0001). Iron depletion produced a significantly larger decrease in insulin resistance (P=0.0016 for insulin, P=0.0042 for HOMA-R) compared with nutritional counseling alone, independent of changes in BMI, baseline HOMA-R, and the presence of the metabolic syndrome. Iron depletion was more effective in reducing HOMA-R in patients in the top two tertiles of ferritin concentrations (P<0.05 vs controls), and in carriers of the mutations in the HFE gene of hereditary hemochromatosis (P<0.05 vs noncarriers).<h4>Conclusions</h4>Given that phlebotomy reduces insulin resistance, which is associated with liver tissue damage, future studies should evaluate the effect of iron depletion on liver histology and cardiovascular end points.

Also flagged:parabensTriclosanluciferase reportingsex hormone sensitive diseaseslactationcancer
Journal Article 2007-03-27 ✓ 1 Snippet Chen J, Ahn KC, Gee NA, Gee SJ, Hammock BD, Lasley BL.
In-Text Gene Mentions

10% DCC-FBS

Show Full Abstract

To identify the androgenic potency of commonly used antimicrobials, an in vitro androgen receptor-mediated transcriptional activity assay was employed to evaluate the androgenic/antiandrogenic activity of parabens and selected other antimicrobials containing a phenolic moiety. This cell-based assay utilizes a stably transfected cell line that lacks critical steroid metabolizing enzymes and is formatted in a 96-well format. At a concentration of 10 microM, methyl-, propyl- and butyl-4-hydroxybenzoate (parabens) inhibited testosterone (T)-induced transcriptional activity by 40%, 33% and 19%, respectively (P<0.05), while 4-hydroxybenzoic acid, the major metabolite of parabens, had no effect on T-induced transcriptional activity. Triclosan inhibited transcriptional activity induced by T by more than 92% at a concentration of 10 microM, and 38.8% at a concentration of 1.0 microM (P<0.05). Thirty-four percent of T-induced transcriptional activity was inhibited by thymol at 10 microM (P<0.05). Cell proliferation and/or cytotoxicity were not observed in any of the treatments. None of the compounds appeared to be androgenic when tested individually without T. The data presented in this report demonstrate that some widely used antimicrobial compounds have antiandrogenic properties and warrant further investigation to fully understand their potential impact on human reproductive health.

Also flagged:AflatoxinsmycotoxinsAflatoxinsynthesisalbuminantibodies
Journal Article 2007-03-27 No Snippets Cervino C, Knopp D, Weller MG, Niessner R.
Show Full Abstract

Aflatoxins, a group of structurally related mycotoxins, are well known for their toxic and carcinogenic effects in humans and animals. Aflatoxin derivatives and protein conjugates are needed for diverse analytical applications. This work describes a reliable and fast synthesis of novel aflatoxin derivatives, purification by preparative HPLC and characterisation by ESI-MS and one- and two-dimensional NMR. Novel aflatoxin bovine serum albumin conjugates were prepared and characterised by UV absorption and MALDI-MS. These aflatoxin protein conjugates are potentially interesting as immunogens for the generation of aflatoxin selective antibodies with novel specificities.

Also flagged:HMGB1polyglutamine diseasespolyglutamine (polyQ) diseasesnucleusataxin-1AT1
Journal Article 2007-03-25 ✓ 4 Snippets Qi ML, Tagawa K, Enokido Y, Yoshimura N, Wada Y, Watase K, Ishiura S, Kanazawa I, Botas J, Saitoe M, Wanker EE, Okazawa H.
In-Text Gene Mentions

…eurons expressing huntingtin (Htt) or ataxin-1 (AT1)…

…mutant AT1 andHttsimilarly reduce the…

…mutant AT1 andHtt.…

…induced by mutantHttor transcriptional repression.…

Show Full Abstract

Nuclear dysfunction is a key feature of the pathology of polyglutamine (polyQ) diseases. It has been suggested that mutant polyQ proteins impair functions of nuclear factors by interacting with them directly in the nucleus. However, a systematic analysis of quantitative changes in soluble nuclear proteins in neurons expressing mutant polyQ proteins has not been performed. Here, we perform a proteome analysis of soluble nuclear proteins prepared from neurons expressing huntingtin (Htt) or ataxin-1 (AT1) protein, and show that mutant AT1 and Htt similarly reduce the concentration of soluble high mobility group B1/2 (HMGB1/2) proteins. Immunoprecipitation and pulldown assays indicate that HMGBs interact with mutant AT1 and Htt. Immunohistochemistry showed that these proteins were reduced in the nuclear region outside of inclusion bodies in affected neurons. Compensatory expression of HMGBs ameliorated polyQ-induced pathology in primary neurons and in Drosophila polyQ models. Furthermore, HMGBs repressed genotoxic stress signals induced by mutant Htt or transcriptional repression. Thus, HMGBs may be critical regulators of polyQ disease pathology and could be targets for therapy development.

Also flagged:Mitochondrialaspartyl-tRNA synthetasedeficiencyleukoencephalopathylactateLBSL
Journal Article 2007-03-25 ✓ 1 Snippet Scheper GC, van der Klok T, van Andel RJ, van Berkel CG, Sissler M, Smet J, Muravina TI, Serkov SV, Uziel G, Bugiani M, Schiffmann R, Krägeloh-Mann I, Smeitink JA, Florentz C, Van Coster R, Pronk JC, van der Knaap MS.
In-Text Gene Mentions

…uncovered mutations inDARS2, which encodes mitochondrial…

Show Full Abstract

Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) has recently been defined based on a highly characteristic constellation of abnormalities observed by magnetic resonance imaging and spectroscopy. LBSL is an autosomal recessive disease, most often manifesting in early childhood. Affected individuals develop slowly progressive cerebellar ataxia, spasticity and dorsal column dysfunction, sometimes with a mild cognitive deficit or decline. We performed linkage mapping with microsatellite markers in LBSL families and found a candidate region on chromosome 1, which we narrowed by means of shared haplotypes. Sequencing of genes in this candidate region uncovered mutations in DARS2, which encodes mitochondrial aspartyl-tRNA synthetase, in affected individuals from all 30 families. Enzyme activities of mutant proteins were decreased. We were surprised to find that activities of mitochondrial complexes from fibroblasts and lymphoblasts derived from affected individuals were normal, as determined by different assays.

Also flagged:ironcopperamino acidceruloplasmin oxidaseIron deficiencyMacroglobulin
Journal Article 2007-03-23 ✓ 1 Snippet Liu N, Lo LS, Askary SH, Jones L, Kidane TZ, Trang T, Nguyen M, Goforth J, Chu YH, Vivas E, Tsai M, Westbrook T, Linder MC.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Transcuprein is a high-affinity copper carrier in the plasma that is involved in the initial distribution of copper entering the blood from the digestive tract. To identify and obtain cDNA for this protein, it was purified from rat plasma by size exclusion and copper-chelate affinity chromatography, and amino acid sequences were obtained. These revealed a 190-kDa glycosylated protein identified as the macroglobulin alpha(1)-inhibitor III, the main macroglobulin of rodent blood plasma. Albumin (65 kDa) copurified in variable amounts and was concluded to be a contaminant (although it can transiently bind the macroglobulin). The main macroglobulin in human blood plasma (alpha(2)-macroglobulin), which is homologous to alpha(1)-inhibitor III, also bound copper tightly. Expression of alpha(1)I3 (transcuprein) mRNA by the liver was examined in rats with and without copper deficiency, using quantitative polymerase chain reaction methodology and Northern blot analysis. Protein expression was examined by Western blotting. Deficient rats with 40% less ceruloplasmin oxidase activity and liver copper concentrations expressed about twice as much alpha(1)I3 mRNA, but circulating levels of transcuprein did not differ. Iron deficiency, which increased liver copper concentrations by threefold, reduced transcuprein mRNA expression and circulating levels of transcuprein relative to what occurred in rats with normal or excess iron. We conclude that transcupreins are specific macroglobulins that not only carry zinc but also carry transport copper in the blood, and that their expression can be modulated by copper and iron availability.

Also flagged:gene expressionquorum sensingacylcarbonsbindingSingle Molecule Protein
Journal Article 2007-03-23 No Snippets Bartels FW, McIntosh M, Fuhrmann A, Metzendorf C, Plattner P, Sewald N, Anselmetti D, Ros R, Becker A.
Show Full Abstract

Intercellular communication by means of small signal molecules coordinates gene expression among bacteria. This population density-dependent regulation is known as quorum sensing. The symbiotic nitrogen-fixing bacterium Sinorhizobium meliloti Rm1021 possesses the Sin quorum sensing system based on N-acyl homoserine lactones (AHL) as signal molecules. Here, we demonstrate that the LuxR-type regulator ExpR binds specifically to a target sequence in the sinRI locus in the presence of different AHLs with acyl side chains from 8 to 20 carbons. Dynamic force spectroscopy based on the atomic force microscope provided detailed information about the molecular mechanism of binding upon activation by six different AHLs. These single molecule experiments revealed that the mean lifetime of the bound protein-DNA complex varies depending on the specific effector molecule. The small differences between individual AHLs also had a pronounced influence on the structure of protein-DNA interaction: The reaction length of dissociation varied from 2.6 to 5.8 A. In addition, dynamic force spectroscopy experiments indicate that N-heptanoyl-DL-homoserine lactone binds to ExpR but is not able to stimulate protein-DNA interaction.

Also flagged:smooth muscle actinepidermal differentiationwound healingagingtissue developmentfollicle development
Journal Article 2007-03-23 ✓ 1 Snippet Crigler L, Kazhanie A, Yoon TJ, Zakhari J, Anders J, Taylor B, Virador VM.
In-Text Gene Mentions

POU3F2

Show Full Abstract

The skin contains two known subpopulations of stem cells/epidermal progenitors: a basal keratinocyte population found in the interfollicular epithelium and cells residing in the bulge region of the hair follicle. The major role of the interfollicular basal keratinocyte population may be epidermal renewal, whereas the bulge population may only be activated and recruited to form a cutaneous epithelium in case of trauma. Using 3-dimensional cultures of murine skin under stress conditions in which only reserve epithelial cells would be expected to survive and expand, we demonstrate that a mesenchymal population resident in neonatal murine dermis has the unique potential to develop an epidermis in vitro. In monolayer culture, this dermal subpopulation has long-term survival capabilities in restricted serum and an inducible capacity to evolve into multiple cell lineages, both epithelial and mesenchymal, depending on culture conditions. When grafted subcutaneously, this dermal subpopulation gave rise to fusiform structures, reminiscent of disorganized muscle, that stained positive for smooth muscle actin and desmin; on typical epidermal grafts, abundant melanocytes appeared throughout the dermis that were not associated with hair follicles. The multipotential cells can be repeatedly isolated from neonatal murine dermis by a sequence of differential centrifugation and selective culture conditions. These results suggest that progenitors capable of epidermal differentiation exist in the mesenchymal compartment of an abundant tissue source and may have a function in mesenchymal-epithelial transition upon insult. Moreover, these cells could be available in sufficient quantities for lineage determination or tissue engineering applications.

Also flagged:HexachlorobenzeneuroporphyriaAHRCYP1A2aryl hydrocarbon receptorURO
Journal Article 2007-03-23 ✓ 1 Snippet Gorman N, Trask HS, Robinson SW, Sinclair JF, Gerhard GS, Smith AG, Sinclair PR.
In-Text Gene Mentions

…accumulated in 129Hfe(-/-) mice.…

Show Full Abstract

Hexachlorobenzene (HCB), a weak ligand of the aryl hydrocarbon receptor (AHR), causes hepatic uroporphyrin (URO) accumulation (uroporphyria) in humans and animals. CYP1A2 has been shown to be necessary in the development of uroporphyria in mice. Using mice expressing the low affinity form of the AH receptor (AHRd), we investigated whether the enhancement of uroporphyria by HCB involves an obligatory increase in CYP1A2 as measured by specific enzyme assays and immunoblotting. We compared the ability of HCB, in combination with iron dextran and the porphyrin precursor, 5-aminolevulinate (ALA), to cause uroporphyria in a strain of mice (C57BL/6) which expresses the high affinity form of the receptor (AHRb(1)), with three strains of mice (SWR and two 129 sublines) expressing the low affinity AHRd. In C57BL/6 mice, HCB-enhanced uroporphyria was associated with a doubling of CYP1A2. HCB treatment produced uroporphyria in iron-loaded mice expressing AHRd, even though there was little or no increase in CYP1A2. Cyp1a2(-/-) mice in a 129 background were completely resistant to HCB-induced uroporphyria, and female Hfe(-/-) 129 mice, in which the levels of hepatic CYP1A2 were half of those of the male levels, responded poorly. The effect of exogenous iron, administered in the form of iron dextran, on HCB enhancement of uroporphryia could be replicated utilizing the endogenous hepatic iron accumulated in 129 Hfe(-/-) mice. In conclusion, some minimal basal expression of CYP1A2 is essential for HCB-mediated enhancement of uroporphyria, but increases in CYP1A2 above that level are not essential.

Also flagged:dependence receptor RetPit-1p53RetGDNFAkt
Journal Article 2007-03-22 ✓ 1 Snippet Cañibano C, Rodriguez NL, Saez C, Tovar S, Garcia-Lavandeira M, Borrello MG, Vidal A, Costantini F, Japon M, Dieguez C, Alvarez CV.
In-Text Gene Mentions

DCC

Show Full Abstract

Somatotrophs are the only pituitary cells that express Ret, GFRalpha1 and GDNF. This study investigated the effects of Ret in a somatotroph cell line, in primary pituitary cultures and in Ret KO mice. Ret regulates somatotroph numbers by inducing Pit-1 overexpression, leading to increased p53 expression and apoptosis, both of which can be prevented with Ret or Pit-1 siRNA. The Pit-1 overexpression is mediated by sustained activation of PKCdelta, JNK, c/EBPalpha and CREB induced by a complex of Ret, caspase 3 and PKCdelta. In the presence of GDNF, Akt is activated, and the Pit-1 overexpression and resulting apoptosis are blocked. The adenopituitary of Ret KO mice is larger than normal, showing Pit-1 and somatotroph hyperplasia. In normal animals, activation of the Ret/Pit-1/p53 pathway by retroviral introduction of Ret blocked tumor growth in vivo. Thus, somatotrophs have an intrinsic mechanism for controlling Pit-1/GH production through an apoptotic/survival pathway. Ret might be of value for treatment of pituitary adenomas.

Also flagged:Cav2.3 E/R-type voltage-gated calcium channelVoltage-gated calcium channelspathogenesisepilepsiesCa(v)3.2 Ca(2+) channelsCa(v)2.3 E/R-
Journal Article 2007-03-21 No Snippets Weiergräber M, Henry M, Radhakrishnan K, Hescheler J, Schneider T.
Show Full Abstract

Voltage-gated calcium channels are key components in the etiology and pathogenesis of epilepsies. Former studies mainly focused on P/Q-type Ca(v)2.1 and T-type Ca(v)3.2 Ca(2+) channels involved in absence epileptogenesis, but recent findings also point to an intriguing role of the Ca(v)2.3 E/R-type Ca(2+) channel in ictogenesis and seizure propagation. Based on the observation that Ca(v)2.3 is thought to induce plateau potentials in CA1 pyramidal cells, which can trigger epileptiform activity, our recent investigation revealed reduced PTZ-seizure susceptibility and altered seizure architecture in Ca(v)2.3(-/-) mice compared with controls. In the present study we tested hippocampal seizure susceptibility in Ca(v)2.3-deficient mice using surface and deep intrahippocampal telemetric EEG recordings as well as phenotypic seizure video analysis. Administration of kainic acid (30 mg/kg ip) revealed clear alteration in behavioral seizure architecture and dramatic resistance to limbic seizures in Ca(v)2.3(-/-) mice compared with controls, whereas no difference in hippocampal EEG seizure activity between both genotypes could be detected at this suprathreshold dosage. The same tendency was observed for NMDA seizure susceptibility (150 mg/kg ip) approaching the level of significance. In addition, histochemical analysis within the hippocampus revealed that excitotoxic effects after kainic acid administration are absent in Ca(v)2.3(-/-) mice, whereas Ca(v)2.3(+/+) animals exhibited clear and typical signs of excitotoxic cell death. These findings clearly indicate that the Ca(v)2.3 voltage-gated calcium channel plays a crucial role in both hippocampal ictogenesis and seizure generalization and is of central importance in neuronal degeneration after excitotoxic events.

Also flagged:SSTsulfatetransportbindrycarbon dioxide
Journal Article 2007-03-20 ✓ 1 Snippet Zhang R, Li G, Fan J, Wu DL, Molina MJ.
In-Text Gene Mentions

DCC

Show Full Abstract

Indirect radiative forcing of atmospheric aerosols by modification of cloud processes poses the largest uncertainty in climate prediction. We show here a trend of increasing deep convective clouds over the Pacific Ocean in winter from long-term satellite cloud measurements (1984-2005). Simulations with a cloud-resolving weather research and forecast model reveal that the increased deep convective clouds are reproduced when accounting for the aerosol effect from the Asian pollution outflow, which leads to large-scale enhanced convection and precipitation and hence an intensified storm track over the Pacific. We suggest that the wintertime Pacific is highly vulnerable to the aerosol-cloud interaction because of favorable cloud dynamical and microphysical conditions from the coupling between the Pacific storm track and Asian pollution outflow. The intensified Pacific storm track is climatically significant and represents possibly the first detected climate signal of the aerosol-cloud interaction associated with anthropogenic pollution. In addition to radiative forcing on climate, intensification of the Pacific storm track likely impacts the global general circulation due to its fundamental role in meridional heat transport and forcing of stationary waves.

Also flagged:SOX2glioma-associated antigenmalignant gliomagliomastumour
Journal Article 2007-03-20 ✓ 1 Snippet Schmitz M, Temme A, Senner V, Ebner R, Schwind S, Stevanovic S, Wehner R, Schackert G, Schackert HK, Fussel M, Bachmann M, Rieber EP, Weigle B.
In-Text Gene Mentions

…) could detect anti-SOX6antibodies but so…

Show Full Abstract

Prognosis for patients suffering from malignant glioma has not substantially improved. Specific immunotherapy as a novel treatment concept critically depends on target antigens, which are highly overexpressed in the majority of gliomas, but the number of such antigens is still very limited. SOX2 was identified by screening an expression database for transcripts that are overexpressed in malignant glioma, but display minimal expression in normal tissues. Expression of SOX2 mRNA was further investigated in tumour and normal tissues by real-time PCR. Compared to cDNA from pooled normal brain, SOX2 was overexpressed in almost all (9 out of 10) malignant glioma samples, whereas expression in other, non-malignant tissues was almost negligible. SOX2 protein expression in glioma cell lines and tumour tissues was verified by Western blot and immunofluorescence. Immunohistochemistry demonstrated SOX2 protein expression in all malignant glioma tissues investigated ranging from 6 to 66% stained tumour cells. Human leucocyte antigen-A(*)0201-restricted SOX2-derived peptides were tested for the activation of glioma-reactive CD8+ cytotoxic T lymphocytes (CTLs). Specific CTLs were raised against the peptide TLMKKDKYTL and were capable of lysing glioma cells. The abundant and glioma-restricted overexpression of SOX2 and the generation of SOX2-specific and tumour-reactive CTLs may recommend this antigen as target for T-cell-based immunotherapy of glioma.

Also flagged:Hsp104Hsp27Huntington's diseaseHDneurodegenerative disorderglutamine
Journal Article 2007-03-20 ✓ 5 Snippets Perrin V, Régulier E, Abbas-Terki T, Hassig R, Brouillet E, Aebischer P, Luthi-Carter R, Déglon N.
In-Text Gene Mentions

In primary rat striatal cultures, production of hsp104 or hsp27 with htt171-82Q restored neuronal nuclei (NeuN)-positive cell density to that measured after infection with vector expressing the wild-type htt fragment (htt171-19Q).

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by an expansion of glutamine repeats in the huntingtin (htt) protein.

…in the huntingtin (htt) protein.…

…accumulation of mutatedhttare hallmarks of…

…of a mutatedhttfragment.…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by an expansion of glutamine repeats in the huntingtin (htt) protein. Abnormal protein folding and the accumulation of mutated htt are hallmarks of HD neuropathology. Heat-shock proteins (hsps), which refold denatured proteins, might therefore mitigate HD. We show here that hsp104 and hsp27 rescue striatal dysfunction in primary neuronal cultures and HD rat models based on lentiviral-mediated overexpression of a mutated htt fragment. In primary rat striatal cultures, production of hsp104 or hsp27 with htt171-82Q restored neuronal nuclei (NeuN)-positive cell density to that measured after infection with vector expressing the wild-type htt fragment (htt171-19Q). In vivo, both chaperones significantly reduced mutated-htt-related loss of DARPP-32 expression. Furthermore, hsps affected the distribution and size of htt inclusions, with the density of neuritic aggregates being remarkably increased in striatal neurons overexpressing hsps. We also found that htt171-82Q induced the up-regulation of endogenous hsp70 that was co-localized with htt inclusions, and that the overexpression of hsp104 and hsp27 modified the subcellular localization of hsp70 that became cytoplasmic. Finally, hsp104 induced the production of endogenous hsp27. These data demonstrate the protective effects of chaperones in mammalian models of HD.

Also flagged:Oestrogenc-RelIE1RELBbreast diseasesynthesis
Journal Article 2007-03-18 No Snippets Wang X, Belguise K, Kersual N, Kirsch KH, Mineva ND, Galtier F, Chalbos D, Sonenshein GE.
Show Full Abstract

Aberrant constitutive expression of c-Rel, p65 and p50 NF-kappaB subunits has been reported in over 90% of breast cancers. Recently, we characterized a de novo RelB NF-kappaB subunit synthesis pathway, induced by the cytomegalovirus (CMV) IE1 protein, in which binding of p50-p65 NF-kappaB and c-Jun-Fra-2 AP-1 complexes to the RELB promoter work in synergy to potently activate transcription. Although RelB complexes were observed in mouse mammary tumours induced by either ectopic c-Rel expression or carcinogen exposure, little is known about RelB in human breast disease. Here, we demonstrate constitutive de novo RelB synthesis is selectively active in invasive oestrogen receptor alpha (ERalpha)-negative breast cancer cells. ERalpha signalling reduced levels of functional NF-kappaB and Fra-2 AP-1 and inhibited de novo RelB synthesis, leading to an inverse correlation between RELB and ERalpha gene expression in human breast cancer tissues and cell lines. Induction of Bcl-2 by RelB promoted the more invasive phenotype of ERalpha-negative cancer cells. Thus, inhibition of de novo RelB synthesis represents a new mechanism whereby ERalpha controls epithelial to mesenchymal transition (EMT).

Also flagged:tumorcancertumorsPaclitaxeldocetaxelTaxotere
Journal Article 2007-03-18 No Snippets Ganesh T.
Show Full Abstract

Paclitaxel (Taxol) and docetaxel (Taxotere) are very important anti-tumor drugs in clinical use for cancer. However, their clinical utility is limited due to systemic toxicity, low solubility and inactivity against drug resistant tumors. To improve chemotherapeutic levels of these drugs, it would be highly desirable to design strategies which bypass the above limitations. In this respect various prodrug and drug targeting strategies have been envisioned either to improve oral bioavailability or tumor specific delivery of taxoids. Abnormal properties of cancer cells with respect to normal cells have guided in designing of these protocols. This review article records the designed biochemical strategies and their biological efficacies as potential taxoid chemotherapeutics.

Also flagged:regulationgene expressiontype I interferonnucleotidedegradationendonuclease
Journal Article 2007-03-16 No Snippets Aagaard L, Rossi JJ.
Show Full Abstract

RNA interference (RNAi) was discovered less than a decade ago and already there are human clinical trials in progress or planned. A major advantage of RNAi versus other antisense based approaches for therapeutic applications is that it utilizes cellular machinery that efficiently allows targeting of complementary transcripts, often resulting in highly potent down-regulation of gene expression. Despite the excitement about this remarkable biological process for sequence specific gene regulation, there are a number of hurdles and concerns that must be overcome prior to making RNAi a real therapeutic modality, which include off-target effects, triggering of type I interferon responses, and effective delivery in vivo. This review discusses mechanistic aspects of RNAi, the potential problem areas and solutions and therapeutic applications. It is anticipated that RNAi will be a major therapeutic modality within the next several years, and clearly warrants intense investigation to fully understand the mechanisms involved.

Also flagged:gene expressionbrainmorpholinomacromoleculemembraneacids
Journal Article 2007-03-15 ✓ 1 Snippet Hendricks M, Jesuthasan S.
In-Text Gene Mentions

…in Colorectal Carcinoma (DCC), and Robos.…

Show Full Abstract

<h4>Background</h4>Electroporation is a technique for the introduction of nucleic acids and other macromolecules into cells. In chick embryos it has been a particularly powerful technique for the spatial and temporal control of gene expression in developmental studies. Electroporation methods have also been reported for Xenopus, zebrafish, and mouse.<h4>Results</h4>We present a new protocol for zebrafish brain electroporation. Using a simple set-up with fixed spaced electrodes and microinjection equipment, it is possible to electroporate 50 to 100 embryos in 1 hour with no lethality and consistently high levels of transgene expression in numerous cells. Transfected cells in the zebrafish brain are amenable to in vivo time lapse imaging. Explants containing transfected neurons can be cultured for in vitro analysis. We also present a simple enzymatic method to isolate whole brains from fixed zebrafish for immunocytochemistry.<h4>Conclusion</h4>Building on previously described methods, we have optimized several parameters to allow for highly efficient unilateral or bilateral transgenesis of a large number of cells in the zebrafish brain. This method is simple and provides consistently high levels of transgenesis for large numbers of embryos.

Also flagged:Sox15Fhl3Foxk1transcription factorsgene expressioncell cycle
Journal Article 2007-03-15 ✓ 1 Snippet Meeson AP, Shi X, Alexander MS, Williams RS, Allen RE, Jiang N, Adham IM, Goetsch SC, Hammer RE, Garry DJ.
In-Text Gene Mentions

Sox6

Show Full Abstract

The regulation of myogenic progenitor cells during muscle regeneration is not clearly understood. We have previously shown that the Foxk1 gene, a member of the forkhead/winged helix family of transcription factors, is expressed in myogenic progenitor cells in adult skeletal muscle. In the present study, we utilize transgenic technology and demonstrate that the 4.6 kb upstream fragment of the Foxk1 gene directs beta-galactosidase expression to the myogenic progenitor cell population. We further establish that Sox15 directs Foxk1 expression to the myogenic progenitor cell population, as it binds to an evolutionarily conserved site and recruits Fhl3 to transcriptionally coactivate Foxk1 gene expression. Knockdown of endogenous Sox15 results in perturbed cell cycle kinetics and decreased Foxk1 expression. Furthermore, Sox15 mutant mice display perturbed skeletal muscle regeneration, due in part to decreased numbers of satellite cells and decreased Foxk1 expression. These studies demonstrate that Sox15, Fhl3 and Foxk1 function to coordinately regulate the myogenic progenitor cell population and skeletal muscle regeneration.

Also flagged:monovalent cationNucleic acidsgene expressionnucleotidesynthesispairing
Journal Article 2007-03-14 No Snippets Kraeva RI, Krastev DB, Roguev A, Ivanova A, Nedelcheva-Veleva MN, Stoynov SS.
Show Full Abstract

Nucleic acids, due to their structural and chemical properties, can form double-stranded secondary structures that assist the transfer of genetic information and can modulate gene expression. However, the nucleotide sequence alone is insufficient in explaining phenomena like intron-exon recognition during RNA processing. This raises the question whether nucleic acids are endowed with other attributes that can contribute to their biological functions. In this work, we present a calculation of thermodynamic stability of DNA/DNA and mRNA/DNA duplexes across the genomes of four species in the genus Saccharomyces by nearest-neighbor method. The results show that coding regions are more thermodynamically stable than introns, 3'-untranslated regions and intergenic sequences. Furthermore, open reading frames have more stable sense mRNA/DNA duplexes than the potential antisense duplexes, a property that can aid gene discovery. The lower stability of the DNA/DNA and mRNA/DNA duplexes of 3'-untranslated regions and the higher stability of genes correlates with increased mRNA level. These results suggest that the thermodynamic stability of DNA/DNA and mRNA/DNA duplexes affects mRNA transcription.

Also flagged:peroxiredoxinsascorbatethiolPrxperoxidasescysteine
Journal Article 2007-03-14 ✓ 1 Snippet Monteiro G, Horta BB, Pimenta DC, Augusto O, Netto LE.
In-Text Gene Mentions

Prdx6

Show Full Abstract

Peroxiredoxins (Prx) are widely distributed peroxidases that can be divided into 1-Cys and 2-Cys Prx groups based on the number of conserved cysteine residues that participate in their catalytical cycle. Prx have been described to be strictly dependent on thiols, but here, we show that ascorbate (vitamin C) also reduces 1-Cys Prx, but not 2-Cys Prx, from several taxonomic groups. Reduction by ascorbate is partly related to the fact that the oxidized form of 1-Cys Prx is a stable sulfenic acid (Cys-SOH) instead of a disulfide. In addition, a histidine residue in the active site is required. In fact, we engineered a 2-Cys Prx with these two features, and it displayed ascorbate peroxidase activity. These data represent a breakthrough in the thiol-specific antioxidant paradigm. Ascorbate may be the long-sought-after biological reductant of 1-Cys Prx. Because ascorbate is present in high amounts in cells, the ascorbate/protein sulfenic acid pair represents an aspect of redox biochemistry that has yet to be explored in vivo.

Also flagged:Sox9proproteinfurinproprotein convertaseproproteinschondrogenesis
Journal Article 2007-03-14 ✓ 2 Snippets Guimont P, Grondin F, Dubois CM.
In-Text Gene Mentions

Sox6inhibitory effect was…

…reduced when usingSox6-HMG-box mutants, indicating a…

Show Full Abstract

The proprotein convertase furin participates in the maturation/bioactivation of a variety of proproteins involved in chondrogenesis events. These include parathyroid hormone-related peptide (PTHrP), an autocrine/paracrine factor that is crucial to both normal cartilage development and cartilage-related pathological processes. Despite the known importance of furin activity in the bioactivation of the polypeptides, the mechanisms that control furin regulation in chondrogenesis remain unknown. To gain insight into the molecular regulation of furin, we used the mouse prechondrogenic ATDC5 cell line, an established in vitro model of cartilage differentiation. Peak expression of both furin mRNA and furin PTHrP maturation was observed during chondrocyte nodule formation stage, an event that correlated with increased mRNA levels of Sox9, a potent high-mobility-group (HMG) box-containing transcription factor required for cartilage formation. Inhibition of furin activity led to a diminution in maturation of PTHrP, suggesting a relationship between Sox9-induced regulation of furin and chondrogenesis events. Transient transfection of Sox9 in nonchondrogenic cells resulted in a marked increase in furin mRNA and in the transactivation of the furin P1A promoter. Direct Sox9 action on the P1A promoter was narrowed down to a critical paired site with Sox9 binding capability in vitro and in vivo. Sox9 transactivation effect was inhibited by L-Sox5 and Sox-6, two Sox9 homologs also expressed in ATDC5 cells. Sox6 inhibitory effect was reduced when using Sox6-HMG-box mutants, indicating a repressive effect through direct HMG-box/DNA binding. Our work suggests a mechanism by which furin is regulated during chondrogenesis. It also adds to the complexity of Sox molecule interaction during gene regulation.

Also flagged:norepinephrineserotoninreflexamphetaminecalciumspinal cord injury
Journal Article 2007-03-14 No Snippets Rank MM, Li X, Bennett DJ, Gorassini MA.
Show Full Abstract

The recovery of persistent inward currents (PICs) and motoneuron excitability after chronic spinal cord transection is mediated, in part, by the development of supersensitivity to residual serotonin (5HT) below the lesion. The purpose of this paper is to investigate if, like 5HT, endogenous sources of norepinephrine (NE) facilitate motoneuron PICs after chronic spinal transection. Cutaneous-evoked reflex responses in tail muscles of awake chronic spinal rats were measured after increasing presynaptic release of NE by administration of amphetamine. An increase in long-lasting reflexes, known to be mediated by the calcium component of the PIC (CaPIC), was observed even at low doses (0.1-0.2 mg/kg) of amphetamine. These findings were repeated in a reduced S2 in vitro preparation, demonstrating that the increased long-lasting reflexes by amphetamine were neural. Under intracellular voltage clamp, amphetamine application led to a large facilitation of the motoneuron CaPIC. This indicates that the increases in long-lasting reflexes induced by amphetamine in the awake animal were, in part, due to actions directly on the motoneuron. Reflex responses in acutely spinal animals were facilitated by amphetamine similar to chronic animals but only at doses that were ten times greater than that required in chronic animals (0.2 mg/kg chronic vs. 2.0 mg/kg acute), pointing to a development of supersensitivity to endogenous NE in chronic animals. In summary, the increases in long-lasting reflexes and associated motoneuron CaPICs by amphetamine are likely due to an increased release of endogenous NE, which motoneurons become supersensitive to in the chronic stages of spinal cord injury.

Also flagged:ApamincalciumpotassiumsodiumN, P-type calcium channelL-type calcium channel
Journal Article 2007-03-14 No Snippets Li X, Bennett DJ.
Show Full Abstract

Low voltage-activated persistent inward calcium currents (Ca PICs) occur in rat motoneurons and are mediated by Cav1.3 L-type calcium channels (L-Ca current). The objectives of this paper were to determine whether this L-Ca current activates a sustained calcium-activated potassium current (SK current) and examine how such SK currents change with spinal injury. For comparison, the SK current that produces the postspike afterhyperpolarization (mAHP) was also quantified. Intracellular recordings were made from motoneurons of adult acute and chronic spinal rats while the whole sacrocaudal spinal cord was maintained in vitro. Spikes/AHPs were evoked with current injection or ventral root stimulation. Application of the SK channel blocker apamin completely eliminated the mAHP, which was not significantly different in chronic and acute spinal rats. The Ca PICs were measured with slow voltage ramps (or steps) with TTX to block sodium currents. In chronic spinal rats, the PICs were activated at -58.6 +/- 6.0 mV and were 2.2 +/- 1.2 nA in amplitude, significantly larger than in acute spinal rats. Apamin significantly increased the PIC, indicating that there was an SK current activated by L-Ca currents (SK(L) current), which ultimately reduced the net PIC. This SK(L) current was not different in acute and chronic spinal rats. The SK(AHP) and the SK(L) currents were activated by different calcium currents because the mAHP/SK(AHP) was blocked by the N, P-type calcium channel blocker omega-conotoxin MVIIC and was resistant to the L-type calcium channel blocker nimodipine, whereas the L-Ca and SK(L) currents were blocked by nimodipine. Furthermore, the SK(AHP) current activated within 10 ms of the spike, whereas the SK(L) current was delayed approximately 100 ms after the onset of the L-Ca current, suggesting that the SK(L) currents were not as spatially close to the L-Ca currents. Finally, the SK(L) and the L-Ca currents were poorly space clamped, with oscillations at their onset and hysteresis in their activation and deactivation voltages, consistent with currents of dendritic origin. The impact of these dendritic currents was especially pronounced in 15% of motoneurons, where apamin led to uncontrollable L-Ca currents that could not be deactivated, even with large hyperpolarizations of the soma. Thus, although the SK(L) currents are fairly small, they play a critical role in terminating the dendritic L-Ca currents.

Also flagged:ironiron deficiencymetabolismmaternal diabetes mellitusintrauterine growth restrictiongestation
Journal Article 2007-03-14 ✓ 1 Snippet Siddappa AM, Rao R, Long JD, Widness JA, Georgieff MK.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Serum ferritin measurements are used in clinical populations to estimate total body iron stores and the risk of subsequent iron deficiency or overload. The lack of normative newborn serum ferritin concentration data between 23 and 41 weeks has led to difficulty in establishing the incidence and degree of abnormal iron status in the neonatal period.<h4>Objectives</h4>The primary objective of this review was to summarize the maternal and gestational factors that determine ferritin concentrations in full-term and pre-term newborn infants and to generate comprehensive reference values. The secondary objective was to assess serum ferritin concentrations in newborn infants at risk for abnormal fetal iron metabolism, including maternal diabetes mellitus, intrauterine growth restriction and maternal smoking during pregnancy.<h4>Methods</h4>Serum ferritin and gestational age data at birth from 457 low-risk pre-term and term infants of 23-41 weeks gestation obtained from 35 published studies reviewed from a period of 25 years and from recently collected data from our centers were assessed by regression analysis. Slopes and intercepts of the high-risk groups were compared with the standard curve.<h4>Results</h4>Umbilical cord serum ferritin concentrations increased with advancing gestational age, from a mean of 63 mug/l at 23 weeks to 171 mug/l at 41 weeks gestation (p < 0.001). The infants of diabetic mothers had a lower intercept than the control infants (p < 0.001).<h4>Conclusions</h4>Iron deficiency and overload have been implicated in neurodevelopmental impairments. Normative cord serum ferritin data may permit a more precise assessment of infants who are at risk for abnormal iron status at birth.

Also flagged:Serotonin transporterdepressionanxietycortisolcognition5
Journal Article 2007-03-13 ✓ 5 Snippets O'Hara R, Schröder CM, Mahadevan R, Schatzberg AF, Lindley S, Fox S, Weiner M, Kraemer HC, Noda A, Lin X, Gray HL, Hallmayer JF.
In-Text Gene Mentions

The s allele variant of the serotonin transporter gene (5-HTT) has recently been observed to moderate the relationship of stress to depression and anxiety.

No impact or interactions of cumulative life stress with 5-HTT or cortisol were observed.

…serotonin transporter gene (5-HTT) has recently been…

…interactive effects of5-HTTgenotype, stress and…

…We investigated whether5-HTTgenotype interacts with…

Show Full Abstract

The s allele variant of the serotonin transporter gene (5-HTT) has recently been observed to moderate the relationship of stress to depression and anxiety. To date no study has considered interactive effects of 5-HTT genotype, stress and hypothalamic-pituitary-adrenal (HPA) function on cognition in healthy, older adults, which may reflect developmental, functional or neurodegenerative effects of the serotonin transporter polymorphism. We investigated whether 5-HTT genotype interacts with cumulative life stress and HPA-axis measures of waking and diurnal cortisol slope to impact cognition in 154 non-depressed, older adults. Structural images of hippocampal volume were acquired on a subsample of 56 participants. The 5-HTT s allele was associated with both significantly lower delayed recall and higher waking cortisol levels. Presence of the s allele interacted with higher waking cortisol to negatively impact memory. We also observed a significant interaction of higher waking cortisol and the s allele on lower hippocampal volume. Smaller hippocampi and higher cortisol were associated with lower delayed recall only in s allele carriers. No impact or interactions of cumulative life stress with 5-HTT or cortisol were observed. This is the first investigation to identify an association of the 5-HTT s allele with poorer memory function in older adults. The interactive effects of the s allele and waking cortisol levels on reduced hippocampal volume and lower memory suggest that the negative effect of the serotonin polymorphism on memory is mediated by the HPA axis. Further, given the significant association of the s allele with higher waking cortisol in our investigation, future studies may be needed to evaluate the impact of the serotonin transporter polymorphism on any neuropsychiatric or behavioral outcome which is influenced by HPA axis function in older adults.

Also flagged:polyglutaminemitochondrial complex IIIproteasomeHuntington's diseaseHDneurodegenerative disease
Journal Article 2007-03-13 ✓ 5 Snippets Fukui H, Moraes CT.
In-Text Gene Mentions

Mitochondrial abnormalities represent a major cytopathology in Huntington's disease (HD), a fatal neurodegenerative disease caused by CAG repeat expansions in the gene encoding huntingtin (Htt).

…gene encoding huntingtin (Htt).…

…expression of mutantHttor they promote…

…the formation ofHttaggregates.…

…cells expressing mutantHttin an inducible…

Show Full Abstract

Mitochondrial abnormalities represent a major cytopathology in Huntington's disease (HD), a fatal neurodegenerative disease caused by CAG repeat expansions in the gene encoding huntingtin (Htt). In the present study, we investigated whether defects in the mitochondrial respiratory function are consequences of the expression of mutant Htt or they promote the formation of Htt aggregates. To take advantage of existing mitochondrial DNA mutants, we developed human osteosarcoma 143B cells expressing mutant Htt in an inducible manner and found that cells expressing mutant Htt but not wild-type Htt exhibited a reduced activity of complex III and an increased activity of complex IV. Conversely, pharmacological treatments that inhibited complex III activity significantly promoted the formation of Htt aggregates. This complex III-mediated modulation of Htt aggregates was also observed in a neuronal progenitor RN33B cell line transduced by lentivirus carrying mutant Htt. This effect of complex III inhibition on the Htt aggregates appeared to be mediated by the inhibition of proteasome activity, but not by ATP depletion or production of reactive oxygen species. Accordingly, complex III mutant cells also showed decreased proteasome activity. These results suggest the presence of a feedback system connecting the mitochondrial respiratory complex III and the production of Htt aggregates. Our results suggest that therapeutic interventions targeting complex III and/or proteasome could ameliorate the progress of HD.

Also flagged:Serotonin transporteroral lichen planusdepressionserotoninpathogenesis
Journal Article 2007-03-13 ✓ 3 Snippets Perdigão PF, Guimarães AL, Victoria JM, Xavier GM, Romano-Silva MA, Gomez RS.
In-Text Gene Mentions

Recent findings have demonstrated that depression and stress are influenced by polymorphism of the promoter region of 5-HTT (5-HTTLPR) and that the short allele (S) is associated with reduced transcriptional efficiency resulting in reduced serotonin expression and uptake.

…the serotonin transporter (5-HTT) may be involved…

…promoter region of5-HTT(5-HTTLPR) and that…

Show Full Abstract

<h4>Background</h4>Considerable evidence indicates that serotonergic mechanisms, particularly the serotonin transporter (5-HTT) may be involved in psychiatric alterations. Recent findings have demonstrated that depression and stress are influenced by polymorphism of the promoter region of 5-HTT (5-HTTLPR) and that the short allele (S) is associated with reduced transcriptional efficiency resulting in reduced serotonin expression and uptake. As psychiatric and genetic factors have been implicated in the pathogenesis of oral lichen planus (OLP), the purpose of the present study was to investigate 5-HTTLPR polymorphism in patients with OLP compared to control subjects.<h4>Subjects and methods</h4>Fifty-four subjects affected by OLP and 54 healthy volunteers were genotyped at 5-HTTLPR. The chi-squared test was used for statistical analysis. To investigate the association between the single nucleotide polymorphisms and risk of OLP, binary logistic regression models were fitted.<h4>Results</h4>No statistical difference was observed between the genotype and allele frequency in the group of OLP and controls (p=0.51). Moreover no association between 5HTTLPR alleles and OLP was found in the multivariate analyses.<h4>Conclusion</h4>Our study demonstrates that polymorphism on the 5-HTTLPR is not associated with OLP pathogenesis.

Also flagged:Benzo(a)pyrenebreast cancerdetoxification-quinonescytochrome P450peroxidase
Journal Article 2007-03-13 ✓ 1 Snippet Burchiel SW, Thompson TA, Lauer FT, Oprea TI.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

Benzo(a)pyrene (BaP) is a known human carcinogen and a suspected breast cancer complete carcinogen. BaP is metabolized by several metabolic pathways, some having bioactivation and others detoxification properties. BaP-quinones (BPQs) are formed via cytochrome P450 and peroxidase dependent pathways. Previous studies by our laboratory have shown that BPQs have significant growth promoting and anti-apoptotic activities in human MCF-10A mammary epithelial cells examined in vitro. Previous results suggest that BPQs act via redox-cycling and oxidative stress. However, because two specific BPQs (1,6-BPQ and 3,6-BPQ) differed in their ability to produce reactive oxygen species (ROS) and yet both had strong proliferative and EGF receptor activating activity, we utilized mRNA expression arrays and qRT-PCR to determine potential pathways and mechanisms of gene activation. The results of the present studies demonstrated that 1,6-BPQ and 3,6-BPQ activate dioxin response elements (DRE, also known as xenobiotic response elements, XRE) and anti-oxidant response elements (ARE, also known as electrophile response elements, EpRE). 3,6-BPQ had greater DRE activity than 1,6-BPQ, whereas the opposite was true for the activation of ARE. Both 3,6-BPQ and 1,6-BPQ induced oxidative stress-associated genes (HMOX1, GCLC, GCLM, and SLC7A11), phase 2 enzyme genes (NQO1, NQO2, ALDH3A1), PAH metabolizing genes (CYP1B1, EPHX1, AKR1C1), and certain EGF receptor-associated genes (EGFR, IER3, ING1, SQSTM1 and TRIM16). The results of these studies demonstrate that BPQs activate numerous pathways in human mammary epithelial cells associated with increased cell growth and survival that may play important roles in tumor promotion.

Also flagged:DementiabodiesAlzheimer's diseaseADbindingdeath
Journal Article 2007-03-12 No Snippets Walker Z, Jaros E, Walker RW, Lee L, Costa DC, Livingston G, Ince PG, Perry R, McKeith I, Katona CL.
Show Full Abstract

<h4>Background</h4>Dementia with Lewy bodies (DLB) is a common form of dementia. The presence of Alzheimer's disease (AD) pathology modifies the clinical features of DLB, making it harder to distinguish DLB from AD clinically during life. Clinical diagnostic criteria for DLB applied at presentation can fail to identify up to 50% of cases. Our aim was to determine, in a series of patients with dementia in whom autopsy confirmation of diagnosis was available, whether functional imaging of the nigrostriatal pathway improves the accuracy of diagnosis compared with diagnosis by means of clinical criteria alone.<h4>Methods</h4>A single photon emission computed tomography (SPECT) scan was carried out with a dopaminergic presynaptic ligand [123I]-2beta-carbometoxy-3beta-(4-iodophenyl)-N-(3-fluoropropyl) nortropane (FP-CIT; ioflupane) on a group of patients with a clinical diagnosis of DLB or other dementia. An abnormal scan was defined as one in which right and left posterior putamen binding, measured semiquantitatively, was more than 2 SDs below the mean of the controls.<h4>Results</h4>Over a 10 year period it was possible to collect 20 patients who had been followed from the time of first assessment and time of scan through to death and subsequent detailed neuropathological autopsy. Eight patients fulfilled neuropathological diagnostic criteria for DLB. Nine patients had AD, mostly with coexisting cerebrovascular disease. Three patients had other diagnoses. The sensitivity of an initial clinical diagnosis of DLB was 75% and specificity was 42%. The sensitivity of the FP-CIT scan for the diagnosis of DLB was 88% and specificity was 100%.<h4>Conclusion</h4>FP-CIT SPECT scans substantially enhanced the accuracy of diagnosis of DLB by comparison with clinical criteria alone.

Also flagged:Huntington's diseaseHDDCXpolysialylated neural cell adhesion moleculePSA-NCAMPSA
Journal Article 2007-03-12 No Snippets Lazic SE, Goodman AO, Grote HE, Blakemore C, Morton AJ, Hannan AJ, van Dellen A, Barker RA.
Show Full Abstract

Reduced neuronal plasticity in the striatum, hippocampus, and neocortex is a common feature of transgenic mouse models of Huntington's disease (HD). Doublecortin (DCX) and polysialylated neural cell adhesion molecule (PSA-NCAM) are associated with structural plasticity in the adult mammalian brain, are markers of newly formed neurons in the dentate gyrus of the adult hippocampus, and are highly expressed in primary olfactory (piriform) cortex. Animal studies have demonstrated that a reduction in plasticity in the piriform cortex is associated with a selective impairment in odour discrimination. Therefore, the number of DCX and PSA-NCAM immunoreactive cells in the piriform cortex were quantified as measures of plasticity in early stage (fifteen week old) R6/1 transgenic HD mice. The transgenic mice had a large reduction in the number of DCX and PSA-NCAM immunoreactive cells in the piriform cortex, similar to that previously reported in the R6/2 mice. We also tested whether odour discrimination, as well as identification and detection, were impaired in HD patients and found that patients (at a similar disease stage as the mice) had an impairment in odour discrimination and identification, but not odour detection. These results suggest that olfactory impairments observed in HD patients may be the result of reduced plasticity in the primary olfactory cortex.

Also flagged:innervationaxonsglyceroln-propyl gallatenerve terminalsperchlorate
Journal Article 2007-03-12 ✓ 1 Snippet Murphy MC, Fox EA.
In-Text Gene Mentions

DCC

Show Full Abstract

The mouse is an extremely valuable model for studying vagal development in relation to strain differences, genetic variation, gene manipulations or pharmacological manipulations. Therefore, a method using 1,1'-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine perchlorate (DiI) was developed for labeling vagal innervation of the gastrointestinal (GI) tract in embryonic and postnatal mice. DiI labeling was adapted and optimized for this purpose by varying several facets of the method. For example, insertion and crushing of DiI crystals into the nerve led to faster DiI diffusion along vagal axons and diffusion over longer distances as compared with piercing the nerve with a micropipette tip coated with dried DiI oil. Moreover, inclusion of EDTA in the fixative reduced leakage of DiI out of nerve fibers that occurred with long incubations. Also, mounting labeled tissue in PBS was superior to glycerol with n-propyl gallate, which resulted in reduced clarity of DiI labeling that may have been due to DiI leaking out of fibers. Optical sectioning of flattened wholemounts permitted examination of individual tissue layers of the GI tract wall. This procedure aided identification of nerve ending types because in most instances each type innervates a different tissue layer. Between embryonic day 12.5 and postnatal day 8, growth of axons into the GI tract, formation and patterning of fiber bundles in the myenteric plexus and early formation of putative afferent and efferent nerve terminals were observed. Thus, the DiI tracing method developed here has opened up a window for investigation during an important phase of vagal development.

Also flagged:fibromyalgiamajor depressiondepressionaffective spectrum disorderFMSfibromyalgia syndrome
Journal Article 2007-03-09 ✓ 1 Snippet Nordahl HM, Stiles TC.
In-Text Gene Mentions

…region of the5-HTTgene among patients…

Show Full Abstract

<h4>Background</h4>The fibromyalgia syndrome (FMS) is suggested to be a manifestation of depression or affective spectrum disorder. We measured the cognitive style of patients with FMS to assess personality styles in 44 patients with fibromyalgia syndrome (FMS) by comparing them with 43 patients with major depressive disorder (MDD) and 41 healthy controls (HC).<h4>Methods</h4>Personality styles were measured by the Sociotropy and Autonomy Scale (SAS) and the Dysfunctional Attitude Scale (DAS). The Structured Clinical interview for DSM Axis I was applied to Axis I disorders, while the Beck Depression Inventory was used to measure depression severity.<h4>Results</h4>Patients with FMS in general have a sociotropic personality style similar to patients with MDD, and different from HC, but FMS patients without a lifetime history of MDD had a cognitive personality style different from patients with MDD and similar to HC.<h4>Conclusion</h4>These findings suggest that a depressotypic personality style is related to depressive disorder, but not to FMS.

Also flagged:uroporphyrinogen decarboxylasePorphyriaURO-Dcatalytic activityrhURO-Dcarbon
Journal Article 2007-03-09 ✓ 5 Snippets Phillips JD, Bergonia HA, Reilly CA, Franklin MR, Kushner JP.
In-Text Gene Mentions

Here, we describe the identification and characterization of an inhibitor of URO-D in liver cytosolic extracts from two murine models of PCT: wild-type mice treated with iron, delta-aminolevulinic acid, and polychlorinated biphenyls; and mice with one null allele of Uro-d and two null alleles of the hemochromatosis gene (Uro-d(+/-), Hfe(-/-)) that develop PCT with no treatments.

…alleles of thehemochromatosisgene ( Uro-d…

…Uro-d +/− ,Hfe−/− ) that…

Hfe

hemochromatosis

Show Full Abstract

Porphyria cutanea tarda (PCT), the most common form of porphyria in humans, is due to reduced activity of uroporphyrinogen decarboxylase (URO-D) in the liver. Previous studies have demonstrated that protein levels of URO-D do not change when catalytic activity is reduced, suggesting that an inhibitor of URO-D is generated in hepatocytes. Here, we describe the identification and characterization of an inhibitor of URO-D in liver cytosolic extracts from two murine models of PCT: wild-type mice treated with iron, delta-aminolevulinic acid, and polychlorinated biphenyls; and mice with one null allele of Uro-d and two null alleles of the hemochromatosis gene (Uro-d(+/-), Hfe(-/-)) that develop PCT with no treatments. In both models, we identified an inhibitor of recombinant human URO-D (rhURO-D). The inhibitor was characterized by solid-phase extraction, chromatography, UV-visible spectroscopy, and mass spectroscopy and proved to be uroporphomethene, a compound in which one bridge carbon in the uroporphyrinogen macrocycle is oxidized. We synthesized uroporphomethene by photooxidation of enzymatically generated uroporphyrinogen I or III. Both uroporphomethenes inhibited rhURO-D, but the III isomer porphomethene was a more potent inhibitor. Finally, we detected an inhibitor of rhURO-D in cytosolic extracts of liver biopsy samples of patients with PCT. These studies define the mechanism underlying clinical expression of the PCT phenotype, namely oxidation of uroporphyrinogen to uroporphomethene, a competitive inhibitor of URO-D. The oxidation reaction is iron-dependent.

Also flagged:collagentype XI collagensinsulintype X collagenChondrogenesisextracellular
Journal Article 2007-03-09 ✓ 1 Snippet Matsushita H, Blackburn ML, Klineberg E, Zielinska-Kwiatkowska A, Bolander ME, Sarkar G, Suva LJ, Chansky HA, Yang L.
In-Text Gene Mentions

Sox6

Show Full Abstract

During the differentiation of chondroprogenitors into mature chondrocytes, the alternative splicing of collagen genes switches from longer isoforms to shorter ones. To investigate the underlying mechanisms, we infected mouse ATDC5 chondroprogenitor cells with retrovirus for stable expression of two closely related SR splicing factors. RT-PCR analysis revealed that TASR-1, but not TASR-2, influenced alternative splicing of type II and type XI collagens in ATDC5 cells. The effect of TASR-1 on splicing could be reversed with the addition of insulin. Results from our microarray analysis of ATDC5 cells showed that TASR-1 and TASR-2 differentially affect genes involved in the differentiation of chondrocytes. Of special interest is the finding that TASR-1 could down-regulate expression of type X collagen, a hallmark of hypertrophic chondrocytes. Immunohistostaining demonstrated that TASR-1 protein is more abundantly expressed than TASR-2 in mouse articular chondrocytes, raising the possibility that TASR-1 might be involved in phenotype maintenance of articular chondrocytes.

Also flagged:autistic disorderserotoninsynthesisTPH2obsessive-compulsive disorderautism
Journal Article 2007-03-08 ✓ 5 Snippets Sacco R, Papaleo V, Hager J, Rousseau F, Moessner R, Militerni R, Bravaccio C, Trillo S, Schneider C, Melmed R, Elia M, Curatolo P, Manzi B, Pascucci T, Puglisi-Allegra S, Reichelt KL, Persico AM.
In-Text Gene Mentions

5-HT, serotonin; 5-HTT, serotonin transporter; CNS, central nervous system; FBAT, family-based association test; GLO1, glyoxalase I; K-W, Kruskal-Wallis non parametric ANOVA; MS, motor stereotypies; OCD, obsessive-compulsive disorder; SNP, single nucleotide polymorphism; TDT, transmission/disequilibrium test; TPH2, tryptophan hydroxylase-2; VS, verbal stereotypies.

…the 5-HT transporter (5-HTT) play pivotal roles…

…autistic patients carrying5-HTTgene variants yielding…

…results obtained in5-HTTknockout mice backcrossed…

…5-HT, serotonin;5-HTT, serotonin transporter; CNS,…

Show Full Abstract

<h4>Background</h4>The TPH2 gene encodes the enzyme responsible for serotonin (5-HT) synthesis in the Central Nervous System (CNS). Stereotypic and repetitive behaviors are influenced by 5-HT, and initial studies report an association of TPH2 alleles with childhood-onset obsessive-compulsive disorder (OCD) and with autism. GLO1 encodes glyoxalase I, the enzyme which detoxifies alpha-oxoaldehydes such as methylglyoxal in all living cells. The A111E GLO1 protein variant, encoded by SNP C419A, was identified in autopsied autistic brains and proposed to act as an autism susceptibility factor. Hyperserotoninemia, macrocephaly, and peptiduria represent some of the best-characterized endophenotypes in autism research.<h4>Methods</h4>Family-based and case-control association studies were performed on clinical samples drawn from 312 simplex and 29 multiplex families including 371 non-syndromic autistic patients and 156 unaffected siblings, as well as on 171 controls. TPH2 SNPs rs4570625 and rs4565946 were genotyped using the TaqMan assay; GLO1 SNP C419A was genotyped by PCR and allele-specific restriction digest. Family-based association analyses were performed by TDT and FBAT, case-control by chi2, endophenotypic analyses for 5-HT blood levels, cranial circumference and urinary peptide excretion rates by ANOVA and FBAT.<h4>Results</h4>TPH2 alleles and haplotypes are not significantly associated in our sample with autism (rs4570625: TDT P = 0.27, and FBAT P = 0.35; rs4565946: TDT P = 0.45, and FBAT P = 0.55; haplotype P = 0.84), with any endophenotype, or with the presence/absence of prominent repetitive and stereotyped behaviors (motor stereotypies: P = 0.81 and 0.84, verbal stereotypies: P = 0.38 and 0.73 for rs4570625 and rs4565946, respectively). Also GLO1 alleles display no association with autism (191 patients vs 171 controls, P = 0.36; TDT P = 0.79, and FBAT P = 0.37), but unaffected siblings seemingly carry a protective gene variant marked by the A419 allele (TDT P < 0.05; patients vs unaffected siblings TDT and FBAT P < 0.00001).<h4>Conclusion</h4>TPH2 gene variants are unlikely to contribute to autism or to the presence/absence of prominent repetitive behaviors in our sample, although an influence on the intensity of these behaviors in autism cannot be excluded. GLO1 gene variants do not confer autism vulnerability in this sample, but allele A419 apparently carries a protective effect, spurring interest into functional correlates of the C419A SNP.

Also flagged:transcription factorhypoxia inducible factorHIFvascular endothelial growth factoroxygenstroke
Journal Article 2007-03-07 No Snippets Siddiq A, Aminova LR, Ratan RR.
Show Full Abstract

Studies of adaptive mechanisms to hypoxia led to the discovery of the transcription factor called hypoxia inducible factor (HIF). HIF is a ubiquitously expressed, heterodimeric transcription factor that regulates a cassette of genes that can provide compensation for hypoxia, metabolic compromise, and oxidative stress including erythropoietin, vascular endothelial growth factor, or glycolytic enzymes. Diseases associated with oxygen deprivation and consequent metabolic compromise such as stroke or Alzheimer's disease may result from inadequate engagement of adaptive signaling pathways that culminate in HIF activation. The discovery that HIF stability and activation are governed by a family of dioxygenases called HIF prolyl 4 hydroxylases (PHDs) identified a new target to augment the transcriptional activity of HIF and thus the adaptive machinery that governs neuroprotection. PHDs lose activity when cells are deprived of oxygen, iron or 2-oxoglutarate. Inhibition of PHD activity triggers the cellular homeostatic response to oxygen and glucose deprivation by stabilizing HIF and other proteins. Herein, we discuss the possible role of PHDs in regulation of both HIF-dependent and -independent cell survival pathways in the nervous system with particular attention to the co-substrate requirements for these enzymes. The emergence of neuroprotective therapies that modulate genes capable of combating metabolic compromise is an affirmation of elegant studies done by John Blass and colleagues over the past five decades implicating altered metabolism in neurodegeneration.

Also flagged:Proton pumphereditary haemochromatosisHHironcirrhosissiderosis
Journal Article 2007-03-07 ✓ 1 Snippet Hutchinson C, Geissler CA, Powell JJ, Bomford A.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background and aims</h4>During the long-term treatment of patients with hereditary haemochromatosis (HH) the authors observed that proton pump inhibitors (PPI) reduced the requirement for maintenance phlebotomy. Gastric acid plays a crucial role in non-haem iron absorption and the authors performed a case review and intervention study to investigate if PPI-induced suppression of gastric acid would reduce dietary iron absorption in C282Y homozygous patients.<h4>Methods</h4>Phlebotomy requirements to keep serum ferritin approximately 50 microg/l before (mean 6.1 (SE 0.6) years) and during (3.8 (0.9) years) administration of a PPI were evaluated in seven patients and a post-prandial study was performed to determine whether PPIs reduce absorption of non-haem iron (14.5 mg) from a test meal in a further 14 phlebotomised patients with normal iron stores.<h4>Results</h4>There was a significant reduction (p<0.001) in the volume of blood removed annually before (2.5 (0.25) l) and while taking (0.5 (0.25) l) a PPI. Administration of a PPI for 7d suppressed absorption of non-haem iron from the meal as shown by a significant reduction (all p<0.01) in: area under the serum curve (2145 (374) versus 1059 (219)), % recovery of administered iron at peak serum iron (20.5 (3.2) versus 11.0 (2.0)%) and peak serum iron (13.6 (2.4) vs 6.1 (1.2) micromol/l) (all values are before vs during PPI).<h4>Conclusions</h4>Administration of a PPI to patients with HH can inhibit the absorption of non-haem iron from a test meal and the habitual diet.

Also flagged:neuroticismserotonin transporterbindingdepressionanxietypositron
Journal Article 2007-03-06 ✓ 5 Snippets Takano A, Arakawa R, Hayashi M, Takahashi H, Ito H, Suhara T.
In-Text Gene Mentions

The relation between serotonin transporter (5-HTT) polymorphism and anxiety-related personality has been investigated in genetic research.

Within the neuroticism dimension, the facet of depression was positively correlated with 5-HTT binding in the thalamus (p = .001).

Subjects with higher thalamic 5-HTT binding are more likely to express higher levels of neuroticism and depressive feeling.

…etween serotonin transporter (5-HTT) polymorphism and anxiety-rel…

…in vivo regional5-HTTbinding in the…

Show Full Abstract

<h4>Background</h4>Personality trait is thought to be one of the important factors for vulnerability to depression. The relation between serotonin transporter (5-HTT) polymorphism and anxiety-related personality has been investigated in genetic research. In this study, we investigated the relation between in vivo regional 5-HTT binding in the brain and personality inventory measures in normal male volunteers.<h4>Methods</h4>Thirty-one healthy male volunteers underwent positron emission tomography scans with (11)C-labeled 3-amino-4-(2-dimethylaminomethyl-phenylsulfanyl) benzonitrile ([(11)C]DASB) to measure 5-HTT and completed revised NEO Personality Inventory. Correlation of [(11)C]DASB binding potentials (BP) with personality inventory measures was calculated using region-of-interest analysis and statistical parametric mapping based on the BP images.<h4>Results</h4>Neuroticism was positively correlated with 5-HTT binding in the thalamus (p = .004). No significant correlation was observed in any other brain region. Within the neuroticism dimension, the facet of depression was positively correlated with 5-HTT binding in the thalamus (p = .001).<h4>Conclusions</h4>Subjects with higher thalamic 5-HTT binding are more likely to express higher levels of neuroticism and depressive feeling. Serotonin transporter binding in the thalamus might be a marker of vulnerability to depression.

Also flagged:amyloid-betapeptidesneurodegenerative dementiasdementiaAlzheimer's diseaseAD
Journal Article 2007-03-06 No Snippets Bibl M, Mollenhauer B, Lewczuk P, Esselmann H, Wolf S, Trenkwalder C, Otto M, Stiens G, Rüther E, Kornhuber J, Wiltfang J.
Show Full Abstract

Biomarkers for differential diagnosis of the three most frequent degenerative forms of dementia, Alzheimer's disease (AD), dementia with Lewy bodies (DLB) and frontotemporal dementias (FTD), are currently under intensive investigation, but disease-specific biomarkers for FTD and DLB are still lacking. We analyzed 303 cerebrospinal fluid (CSF) samples of 71 AD, 32 DLB and 36 FTD patients in comparison to 93 various other dementias (OD), 20 peripheral neurologic disease (PND) controls, 25 neurodegenerative disorders without dementia (ND) and 26 depressive cognitive complainers (DCC) for distinct CSF amyloid-beta (Abeta) peptide patterns, using the quantitative Abeta-SDS-PAGE/immunoblot. Additionally, the novel electrochemiluminescence technique (MSD) was used to validate the measures on Abeta1-38. The main outcome measures were a striking decrease of Abeta1-42 in AD (P=7.4 x 10(-19)), and most interestingly a pronounced decrease of Abeta1-38 in FTD (P=9.6 x 10(-7)). Moreover, a novel peptide that most probably represents an oxidized alpha-helical form of Abeta1-40 (Abeta1-40(ox)) displayed a highly significant increase in DLB (P=3.7 x 10(-3)) as compared to non-demented disease controls. The overall diagnostic accuracy of percentage Abeta peptide abundances (Abeta1-X%) was clearly superior to absolute CSF Abeta levels. Abeta1-42% and Abeta1-38% enabled contrasts of 85% or beyond to distinguish AD and FTD, respectively, from all other investigated subjects. Abeta1-40(ox)% yielded a diagnostic sensitivity and specificity of 88 and 73% for the detection of DLB among all other investigated patients. We found a strong correlation between Abeta1-38 levels as measured by the Abeta-SDS-PAGE/immunoblot and MSD, respectively. CSF Abeta peptides may reflect disease-specific impact of distinct neurodegenerative processes on Abeta peptide metabolism and represent a potential diagnostic biomarker for AD, FTD and DLB.

Also flagged:type II collagensynthesisknee OACollagentype II procollagencollagenase
Journal Article 2007-03-06 ✓ 1 Snippet Cahue S, Sharma L, Dunlop D, Ionescu M, Song J, Lobanok T, King L, Poole AR.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>To examine whether the baseline ratio of a type II collagen breakdown marker to a synthesis marker, or the level of these markers individually, is associated with the likelihood of knee osteoarthritis (OA) progression between baseline and 18 months.<h4>Methods</h4>Participants were recruited from community sources and had knee OA. Blood was drawn at baseline. Collagen synthesis was measured by commercial enzyme-linked immunosorbent assay (ELISA) assay that detects c-propeptide of type II procollagen (CPII). Serum markers of collagenase cleavage of cartilage type II collagen [C2C epitope (COL2-3/4Clong mono) and C1,2C epitope (COL2-3/4Cshort)] were also assayed. Knee radiographs (semi-flexed with fluoro confirmation) were obtained at baseline and 18 months. OA progression was examined using worsening of joint space grade and worsening of Kellgren/Lawrence grade. The relationship between baseline serum markers and subsequent progression was analyzed from logistic regression.<h4>Results</h4>Baseline levels of these markers, considered individually, were not associated with a change in the odds of progression. Belonging to the low synthesis tertile was associated with a greater likelihood of progression, approaching significance (adjusted odds ratio [OR] 1.86, 95% confidence interval [CI] 0.96, 3.63). A greater C2C:CPII ratio and C1,2C:CPII ratio were each associated with an increase in the odds of joint space grade progression, which approached significance (e.g., adjusted OR of C2C:CPII ratio was 3.15, 95% CI 0.91, 10.85).<h4>Conclusion</h4>While the degradation markers individually, considered as continuous variables, did not predict OA progression, belonging to the lower synthesis marker tertile and greater degradation/synthesis marker ratios were associated with an elevation in the odds of progression albeit not achieving significance.

Also flagged:Abcc6cardiac calcificationgene expressionATP-binding cassette transportermineralizationBMP2
Journal Article 2007-03-06 ✓ 4 Snippets Meng H, Vera I, Vera I, Che N, Wang X, Wang SS, Ingram-Drake L, Schadt EE, Drake TA, Lusis AJ.
In-Text Gene Mentions

calcification (DCC

calcification, suggesting potential pathways for the action of Abcc6 in DCC

…of Abcc6 inDCC.…

DCC

Show Full Abstract

The genetic factors contributing to the complex disorder of myocardial calcification are largely unknown. Using a mouse model, we fine-mapped the major locus (Dyscalc1) contributing to the dystrophic cardiac calcification (DCC) to an 840-kb interval containing 38 genes. We then identified the causal gene by using an approach integrating genetic segregation and expression array analyses to identify, on a global scale, cis-acting DNA variations that perturb gene expression. By studying two intercrosses, in which the DCC trait segregates, a single candidate gene (encoding the ATP-binding cassette transporter ABCC6) was identified. Transgenic complementation confirmed Abcc6 as the underlying causal gene for Dyscalc1. We demonstrate that in the cross, the expression of Abcc6 is highly correlated with the local mineralization regulatory system and the BMP2-Wnt signaling pathway known to be involved in the systemic regulation of calcification, suggesting potential pathways for the action of Abcc6 in DCC. Our results demonstrate the power of the integrative genomics in discovering causal genes and pathways underlying complex traits.

Also flagged:depressionanxietyserotonin reuptake transportereating disordersserotoninhydroxy
Journal Article 2007-03-06 ✓ 2 Snippets Jahng JW, Kim JG, Kim HJ, Kim BT, Kang DW, Lee JH.
In-Text Gene Mentions

…5-HT reuptake transporter (5-HTT) by in situ…

5-HTTmRNA expression decreased…

Show Full Abstract

Evidence of semi-starvation is commonly found in patients with eating disorders. This study was conducted to examine the adverse effects of chronic caloric restriction in young rats, since there have been increasing incidence of eating disorders especially among young populations. Food restriction group was supplied daily with 50% of chow consumed by its ad libitum fed control group from postnatal day 28. After 5 weeks of food restriction, brain contents of serotonin (5-hydroxy-tryptamine; 5-HT) and its metabolite 5-hydroxyindol acetic acid were analyzed by high-performance liquid chromatography and mRNA expression of 5-HT reuptake transporter (5-HTT) by in situ hybridization. Plasma corticosterone levels were determined by radioimmunoassay. Behavioral assessments were performed with Porsolt swim test for depressive behavior and with elevated plus maze test for anxiety. Five weeks of food restriction markedly increased plasma level of corticosterone, and significantly decreased 5-HT turnover rates in the hippocampus and the hypothalamus. 5-HTT mRNA expression decreased in the raphe nucleus of food restricted rats compared with free fed controls. Immobility time during the swim test increased in the food restricted group, compared to the control group. Food restricted rats spent more time in the closed arms, less time in the open arms, of elevated plus maze compared with control rats. These results suggest that chronic caloric restriction in young rats may lead to the development of depressive and/or anxiety disorders, likely, in relation with dysfunction of brain 5-HT system.

Also flagged:COMTMAOAstress-related disordersmajor depressionMDserotonin transporter
Journal Article 2007-03-06 ✓ 4 Snippets Jabbi M, Korf J, Kema IP, Hartman C, van der Pompe G, Minderaa RB, Ormel J, den Boer JA.
In-Text Gene Mentions

By including individuals varying in their degree of susceptibility to MD, we showed evidence of interactions between 5-HTT and MD susceptibility in baseline cortisol, and between MAOA and MD susceptibility in baseline ACTH measures, indicating a role for these genotypes in stable-state endocrine regulation.

…polymorphic variations of5-HTT, COMT and MAOA.…

…for serotonin transporter (5-HTT), catechol-O-methyl transfera…

…of interactions between5-HTTand MD susceptibility…

Show Full Abstract

Highly prevalent stress-related disorders such as major depression (MD) are characterised by a dysregulation of the neuroendocrine system. Although heritability for these disorders is high, the role of genes in the underlying pathophysiology is poorly understood. Here, we show that polymorphic variations in genes coding for serotonin transporter (5-HTT), catechol-O-methyl transferase (COMT) and monoamine oxidase A (MAOA) as well as sex differences influence the regulation of hypothalamic-pituitary-adrenal (HPA)-axis response to acute psychological and endocrine challenges. In our sample, the effects of COMT on the release of adrenocorticotrophin hormone (ACTH) depend on the presence of the low-expression MAOA variant in the same individual. By including individuals varying in their degree of susceptibility to MD, we showed evidence of interactions between 5-HTT and MD susceptibility in baseline cortisol, and between MAOA and MD susceptibility in baseline ACTH measures, indicating a role for these genotypes in stable-state endocrine regulation. Collectively, these results indicate that the simultaneous investigation of multiple monoaminergic genes in interaction with gender have to be measured to understand the endocrine regulation of stress. These findings point towards a genetic susceptibility to stress-related disorders.

Also flagged:netrin-1cancertumorDeleted incolon cancernetrin dependence receptors
Journal Article 2007-03-05 ✓ 5 Snippets Rodrigues S, De Wever O, Bruyneel E, Rooney RJ, Gespach C.
In-Text Gene Mentions

Both netrin-1 and A2B-R activation induced the invasive phenotype through the Rho-Rho kinase axis in DCC-deficient human colorectal cancer cells.

Opposing roles of netrin-1 and the dependence receptor DCC in cancer cell invasion, tumor growth and metastasis.

Deleted in colon cancer (DCC) and UNC5 function as netrin dependence receptors by inducing apoptosis in the absence of their ligand and accordingly were recently designated as putative conditional tumor suppressors.

The impact of DCC restitution and netrin-1 was evaluated on collagen type I invasion, tumor growth and metastasis in nude mice, cancer cell survival and gene expression profiling.

…the dependence receptorDCCin cancer cell…

Show Full Abstract

Deleted in colon cancer (DCC) and UNC5 function as netrin dependence receptors by inducing apoptosis in the absence of their ligand and accordingly were recently designated as putative conditional tumor suppressors. Herein, we determined whether netrin-1 and its receptors are implicated in cancer cell invasion and tumor progression. Expression of DCC, UNC5 and adenosine A2B-receptors (A2B-Rs) was investigated by reverse transcription polymerase chain reaction in human colon cancer cells. The impact of DCC restitution and netrin-1 was evaluated on collagen type I invasion, tumor growth and metastasis in nude mice, cancer cell survival and gene expression profiling. Flow cytometry, poly(ADP-ribose)polymerase-1 and caspase-8 activation were used to evaluate the impact of DCC on cell death. Both netrin-1 and A2B-R activation induced the invasive phenotype through the Rho-Rho kinase axis in DCC-deficient human colorectal cancer cells. Restitution of wild-type DCC blocked invasion induced by netrin-1, A2B-R agonist and other agents. Ectopic expression of netrin-1 led to increased growth of human colon tumor xenografts in athymic mice. Conversely, introduction of wt-DCC in kidney MDCKts.src-ggl cells strongly inhibited metastasis in lymph nodes and lungs and increased sensitivity to apoptosis in hypoxia. DNA microarrays revealed that netrin and DCC had common and divergent impacts on gene expression linked to cell cycle, survival, surface signaling and adhesion. Our findings underscore that netrin is a potent invasion and tumor growth-promoting agent and that DCC is a metastasis suppressor gene targeting both proinvasive and survival pathways in a cumulative manner.

Also flagged:Mitochondriadeathmitochondrial permeabilitymitochondrialmembraneapoptotic cell death
Journal Article 2007-03-04 No Snippets Norenberg MD, Rao KV.
Show Full Abstract

Mitochondria, being the principal source of cellular energy, are vital for cell life. Yet, ironically, they are also major mediators of cell death, either by necrosis or apoptosis. One means by which these adverse effects occur is through the mitochondrial permeability transition (mPT) whereby the inner mitochondrial membrane suddenly becomes excessively permeable to ions and other solutes, resulting in a collapse of the inner membrane potential, ultimately leading to energy failure and cell necrosis. The mPT may also bring about the release of various factors known to cause apoptotic cell death. The principal factors leading to the mPT are elevated levels of intracellular Ca2+ and oxidative stress. Characteristically, the mPT is inhibited by cyclosporin A. This article will briefly discuss the concept of the mPT, its molecular composition, its inducers and regulators, agents that influence its activity and describe the consequences of its induction. Lastly, we will review its potential contribution to acute neurological disorders, including ischemia, trauma, and toxic-metabolic conditions, as well as its role in chronic neurodegenerative conditions such as Alzheimer's disease, Parkinson's disease, Huntington's disease and amyotrophic lateral sclerosis.

Also flagged:endomorphin-2phenylalaninephenylglycinehomophenylalaninebindingmicro-opioid receptor
Journal Article 2007-03-03 No Snippets Shao X, Gao Y, Zhu C, Liu X, Yao J, Cui Y, Wang R.
Show Full Abstract

We investigated a series of conformations of endomorphin-2 (EM-2) analogs substituted by phenylglycine (Phg) and homophenylalanine (Hfe) in the position 3 or 4 by two-dimensional (1)H NMR spectroscopy and molecular modeling. Evaluating the aromatic interactions and the dihedral angles in these phenylalanine mimics, we have observed that the conformations in trans isomer have varied from extended to folded as bioactivity decreases. It is suggested that the flexibility of aromatic side chain affects the backbone of EM-2 to adopt folded structures, which may block the ligands in binding to micro-opioid receptor.

Also flagged:dibenzofurandibenzothiophenecarbazolecarbonnitrogenhydroxy
Journal Article 2007-03-02 ✓ 1 Snippet Gai Z, Yu B, Li L, Wang Y, Ma C, Feng J, Deng Z, Xu P.
In-Text Gene Mentions

Pseudomonas sp. strain CA10

Show Full Abstract

A carbazole-utilizing bacterium was isolated by enrichment from petroleum-contaminated soil. The isolate, designated Sphingomonas sp. strain XLDN2-5, could utilize carbazole (CA) as the sole source of carbon, nitrogen, and energy. Washed cells of strain XLDN2-5 were shown to be capable of degrading dibenzofuran (DBF) and dibenzothiophene (DBT). Examination of metabolites suggested that XLDN2-5 degraded DBF to 2-hydroxy-6-(2-hydroxyphenyl)-6-oxo-2,4-hexadienic acid and subsequently to salicylic acid through the angular dioxygenation pathway. In contrast to DBF, strain XLDN2-5 could transform DBT through the ring cleavage and sulfoxidation pathways. Sphingomonas sp. strain XLDN2-5 could cometabolically degrade DBF and DBT in the growing system using CA as a substrate. After 40 h of incubation, 90% of DBT was transformed, and CA and DBF were completely removed. These results suggested that strain XLDN2-5 might be useful in the bioremediation of environments contaminated by these compounds.

Also flagged:Prion diseasesprionbindingcoppertransmembranesynapses
Journal Article 2007-03-02 No Snippets Westergard L, Christensen HM, Harris DA.
Show Full Abstract

Prion diseases are caused by conversion of a normal cell-surface glycoprotein (PrP(C)) into a conformationally altered isoform (PrP(Sc)) that is infectious in the absence of nucleic acid. Although a great deal has been learned about PrP(Sc) and its role in prion propagation, much less is known about the physiological function of PrP(C). In this review, we will summarize some of the major proposed functions for PrP(C), including protection against apoptotic and oxidative stress, cellular uptake or binding of copper ions, transmembrane signaling, formation and maintenance of synapses, and adhesion to the extracellular matrix. We will also outline how loss or subversion of the cytoprotective or neuronal survival activities of PrP(C) might contribute to the pathogenesis of prion diseases, and how similar mechanisms are probably operative in other neurodegenerative disorders.

Also flagged:HIP1Huntingtin interacting protein 1endocytic adaptor proteincytoplasmicF-actintubulin
Journal Article 2007-03-01 ✓ 1 Snippet Khatchadourian K, Smith CE, Metzler M, Gregory M, Hayden MR, Cyr DG, Hermo L.
In-Text Gene Mentions

…tubulin, and huntingtin (htt).…

Show Full Abstract

Huntingtin interacting protein 1 (HIP1) is an endocytic adaptor protein with clathrin assembly activity that binds to cytoplasmic proteins, such as F-actin, tubulin, and huntingtin (htt). To gain insight into diverse functions of HIP1, we characterized the male reproductive defect of HIP1(-/-) mice from 7 to 30 weeks of age. High levels of HIP1 protein were expressed in the testis of wild-type mice as seen by Western blots and as a reaction over Sertoli cells and elongating spermatids as visualized by immunocytochemistry. Accordingly, major structural abnormalities were evident in HIP1(-/-) mice with vacuolation of seminiferous tubules caused by an apparent loss of postmeiotic spermatids and a significant reduction in mean profile area. Remaining spermatids revealed deformations of their heads, flagella, and/or acrosomes. In some Sertoli cells, ectoplasmic specializations (ES) were absent or altered in appearance accounting for the presence of spherical germ cells in the epididymal lumen. Quantitative analyses of sperm counts from the cauda epididymidis demonstrated a significant decrease in HIP1(-/-) mice compared to wild-type littermates. In addition, computer-assisted sperm analyses indicated that velocities, amplitude of lateral head displacements (ALH), and numbers and percentages of sperm in the motile, rapid, and progressive categories were all significantly reduced in HIP1(-/-) mice, while the numbers and percentages of sperm in the static category were greatly increased. Taken together, these various abnormalities corroborate reduced fertility levels in HIP1(-/-) mice and suggest a role for HIP1 in stabilizing actin and microtubules, which are important cytoskeletal elements enabling normal spermatid and Sertoli cell morphology and function.

Also flagged:liver fibrosisalbuminsugarmannosePDGF-receptorbinding
Journal Article 2007-03-01 No Snippets Hagens WI, Mattos A, Greupink R, de Jager-Krikken A, Reker-Smit C, van Loenen-Weemaes A, Gouw IA, Poelstra K, Beljaars L.
Show Full Abstract

<h4>Purpose</h4>Delivery of apoptosis-inducing compounds to hepatic stellate cells (HSC) may be an effective strategy to reverse liver fibrosis. The aim of this study was therefore to examine the selective targeting of the apoptosis-inducing drug 15-deoxy-delta12,14-prostaglandin J2 (15dPGJ2) with two different HSC-carriers: human serum albumin modified with the sugar mannose-6-phosphate (M6PHSA) or albumin modified with PDGF-receptor recognizing peptides (pPBHSA).<h4>Methods and results</h4>After chemical conjugation of 15dPGJ2 to the carriers, the constructs displayed pharmacological activity and specific receptor-mediated binding to HSC in vitro. Unlike 15dPGJ2-pPBHSA, the cellular binding of 15dPGJ2-M6PHSA was reduced by a scavenger receptor antagonist. In vivo, both conjugates rapidly accumulated in fibrotic livers. Intrahepatic analysis revealed that 15dPGJ2-M6PHSA mainly accumulated in HSC, and to a lesser extent in Kupffer cells. 15dPGJ2-pPBHSA also predominantly accumulated in HSC with additional uptake in hepatocytes. Assessment of target receptors in human cirrhotic livers revealed that M6P/IGFII-receptor expression was present in fibrotic areas. PDGF-P receptor expression was abundantly expressed on human fibroblasts.<h4>Conclusions</h4>These studies show that 15dPGJ2 coupled to either M6PHSA or pPBHSA is specifically taken up by HSC and is highly effective within these cells. Both carriers differ with respect to receptor specificity, leading to differences in intrahepatic distribution. Nevertheless, both carriers can be used to deliver the apoptosis-inducing drug 15dPGJ2 to HSC in vivo.

Also flagged:lung cancercancercancersbreast cancerolfactomedin 4hyperplastic polyp
Journal Article 2007-03-01 ✓ 5 Snippets Koshida S, Kobayashi D, Moriai R, Tsuji N, Watanabe N.
In-Text Gene Mentions

…Specific overexpression of OLFM4 ( GW112/HGC-1 ) mRNA in colon ,…

Thus, OLFM4 mRNA might be a useful tool to support the diagnosis of cancer, irrespective of the clinical stages.

Overexpression of the olfactomedin 4 (OLFM4(GW112,/hGC-1)) gene was recently reported to inhibit various apoptotic pathways and promote proliferation of cancer cells, suggesting that OLFM4 might serve as a diagnostic marker for human cancers.

The expression of OLFM4 mRNA did not correlate with that of the antiapoptotic molecule survivin, indicating that it can be used independently in cancer diagnosis.

OLFM4 mRNA expression was observed even in the early stages of each cancer type.

Show Full Abstract

Overexpression of the olfactomedin 4 (OLFM4(GW112,/hGC-1)) gene was recently reported to inhibit various apoptotic pathways and promote proliferation of cancer cells, suggesting that OLFM4 might serve as a diagnostic marker for human cancers. Therefore, we examined cancer-specific OLFM4 overexpression. OLFM4 mRNA was highly expressed in cancerous tissues obtained from the colon, breast and lung. Positivity for OLFM4 mRNA, defined as the mean + 2 SD in non-cancerous colon and breast tissues, was observed in 68 and 50% of the studied colon and breast cancer tissues. OLFM4 mRNA expression was not detected in non-cancerous lung tissues but was evident in 62% of the lung cancer tissues. On comparing paired samples, the expression of OLFM4 mRNA was observed to be elevated in 90, 69 and 85% of colon, breast and lung cancer tissues, respectively. OLFM4 mRNA expression was observed even in the early stages of each cancer type. The expression of OLFM4 mRNA did not correlate with that of the antiapoptotic molecule survivin, indicating that it can be used independently in cancer diagnosis. Combining OLFM4 and survivin resulted in higher positivity. Thus, OLFM4 mRNA might be a useful tool to support the diagnosis of cancer, irrespective of the clinical stages.

Also flagged:bindingcancerpancreatic cancercell cyclesynthesisolfactomedin 4
Journal Article 2007-03-01 ✓ 5 Snippets Kobayashi D, Koshida S, Moriai R, Tsuji N, Watanabe N.
In-Text Gene Mentions

Olfactomedin 4 promotes S-phase transition in proliferation of pancreatic cancer cells.

Induction of olfactomedin 4 (OLFM4(GW112/hGC-1)) in cancer cells was recently reported to have a novel antiapoptotic action via binding to the potent apoptosis inducer GRIM-19.

We sought to clarify undiscovered functions of constitutively expressed OLFM4 in cancer cells.

…of constitutively expressedOLFM4in cancer cells.…

OLFM4mRNA was highly…

Show Full Abstract

Induction of olfactomedin 4 (OLFM4(GW112/hGC-1)) in cancer cells was recently reported to have a novel antiapoptotic action via binding to the potent apoptosis inducer GRIM-19. We sought to clarify undiscovered functions of constitutively expressed OLFM4 in cancer cells. OLFM4 mRNA was highly expressed in pancreatic cancer tissues. In PANC-1 cell cultures, expression was especially elevated during early S phase of the cell cycle. Transduction of small interfering RNA for OLFM4 to decrease mRNA expression caused time-dependent growth inhibition, with typical early S-phase arrest after 6 days. In addition, cell volume increased without increases in multinucleated cells, consistent with premitotic inhibition of DNA synthesis. Inhibition of OLFM4 mRNA expression by small interfering RNA did not promote apoptosis. Taken together, the results indicate that OLFM4 promotes proliferation of PANC-1 cells by favoring transition from the S to G(2)/M phase.

Also flagged:calciumlactationbone resorptioncalcium carbonateexcretionMetabolism
Journal Article 2007-03-01 No Snippets Ettinger AS, Hu H, Hernandez-Avila M.
Show Full Abstract

Pregnancy and lactation are states known to be accompanied by physiologically up regulated bone resorption in response to the calcium demands of the developing fetus and nursing infant. The role of calcium supplements in altering maternal responses to fetal demand for calcium is not fully understood. Exposure to the toxicant lead is known to pose a major hazard to fetal neurodevelopment and growth. Since >95% of maternal lead is stored in the bone, mobilization of cumulative maternal lead stores into the circulation represents an endogenous source of exposure, which may pose a significant hazard for the fetus and infant. Maternal dietary calcium supplementation has been associated with reductions in lead levels in both animal and human studies when administered during pregnancy and lactation. Therefore, supplementation of the maternal diet with calcium may represent an important secondary prevention strategy aimed not only at reducing circulating levels of lead in the mother but also at reducing lead exposure to the developing fetus and nursing infant.

Also flagged:serotonin transporterheart failurePulmonary hypertensionleft ventricular dysfunction
Journal Article 2007-03-01 ✓ 3 Snippets Olson TP, Snyder EM, Frantz RP, Turner ST, Johnson BD.
In-Text Gene Mentions

These results suggest that the LL variant of the 5-HTT is associated with elevated PAP in patients with HF.

…the serotonin transporter (5-HTT) gene have been…

…variant of the5-HTTis associated with…

Show Full Abstract

<h4>Background</h4>Pulmonary hypertension is common in patients with heart failure (HF); however, for a given degree of left ventricular dysfunction, the range in pulmonary artery pressures (PAPs) is large. Polymorphisms of the serotonin transporter (5-HTT) gene have been implicated in contributing to smooth muscle dysfunction and remodeling of the pulmonary vasculature. This study examined the influence of a repeat length polymorphism in the promoter region of the 5-HTT gene on PAP between patients with HF and healthy control participants.<h4>Methods</h4>A total of 90 patients with HF (age, 55 +/- 14 years; left ventricular ejection fraction, 28% +/- 10%; New York Heart Association, 2.0 +/- 0.9) and 90 age- and sex-matched controls (CTL) (age, 51 +/- 15 years; left ventricular ejection fraction, 63% +/- 7%) were recruited. Patients with HF and CTL participants were divided into 3 genotype groups: homozygotes for the short variant (SS), homozygotes for the long variant (LL), and heterozygotes (LS). For both HF and CTL, there are 20 patients in the SS group, 41 in the LS, and 29 in the LL. Pulmonary artery pressure was calculated from the tricuspid regurgitant velocity.<h4>Results</h4>Age and sex did not differ between the HF and CTL groups. Pulmonary artery pressure was higher in HF patients compared with CTL (38.9 +/- 12.5 vs 27.7 +/- 8.2 mm Hg, respectively; P < .01). There was a significant interaction between the HF and CTL groups for PAP by genotype (P < .03), with a significant genotype effect in HF (SS = 34.2 +/- 8.6 vs LL = 43.2 +/- 15.2 mm Hg; P < .05) but not in CTL. The HF group also demonstrated elevated left atrial diameter compared with CTL (48.0 +/- 8.7 vs 32.8 +/- 4.8 mm, respectively; P < .01), although no significant genotype difference was seen within either group.<h4>Conclusion</h4>These results suggest that the LL variant of the 5-HTT is associated with elevated PAP in patients with HF.

Also flagged:amyotrophic lateral sclerosis
Journal Article 2007-03-01 ✓ 1 Snippet Restagno G, Lombardo F, Ghiglione P, Calvo A, Cocco E, Sbaiz L, Mutani R, Chiò A.
In-Text Gene Mentions

HFEH63D polymorphism is…

Show Full Abstract

No abstract available.

Also flagged:epsilon y globinerythropoiesisSox transcription factorgene expressionepsilon yhemoglobinopathies
Journal Article 2007-03-01 ✓ 5 Snippets Cohen-Barak O, Erickson DT, Badowski MS, Fuchs DA, Klassen CL, Harris DT, Brilliant MH.
In-Text Gene Mentions

Sox6, a member of the Sox transcription factor family, is essential for the silencing of epsilon y globin gene expression in definitive erythropoiesis of mice.

Therefore, Sox6 may provide a novel therapeutic target by reactivating epsilon y in patients with hemoglobinopathies such as sickle cell anemia and beta-thalassemia.

…nsplantation demonstrates thatSox6represses epsilon y…

Sox6, a member of…

…HomozygousSox6-null mice are neonatally…

Show Full Abstract

Sox6, a member of the Sox transcription factor family, is essential for the silencing of epsilon y globin gene expression in definitive erythropoiesis of mice. Homozygous Sox6-null mice are neonatally lethal, precluding analysis at later stages. We created adult mice that are deficient in Sox6 specifically in hematopoietic tissues by transplanting embryonic liver stem cells from Sox6-deficient mice into lethally irradiated congenic wild-type adult mice. The mice receiving mutant stem cells (mutant engrafted) showed high expression levels of epsilon y in bone marrow, spleen, and circulating blood compared with mice receiving wild-type and heterozygous stem cells (control engrafted). The level of expression of epsilon y in circulating blood was directly correlated with the percentage of successful mutant donor cell engraftment. Additionally, the mutant engrafted adult mice showed an increase in erythroid precursor cells in bone marrow, spleen, and blood. Thus, Sox6 continues to function as a major regulator of epsilon y in adult definitive erythropoiesis and is required for normal erythrocyte maturation. Therefore, Sox6 may provide a novel therapeutic target by reactivating epsilon y in patients with hemoglobinopathies such as sickle cell anemia and beta-thalassemia.

Also flagged:ironhereditary haemochromatosisHepcidinhaemochromatosis
Journal Article 2007-03-01 ✓ 1 Snippet Roe MA, Spinks C, Heath AL, Harvey LJ, Foxall R, Wimperis J, Wolf C, Fairweather-Tait SJ.
In-Text Gene Mentions

…in men carryingHFEmutations, hereditary haemochr…

Show Full Abstract

Hepcidin plays a major role in iron homeostasis, but understanding its role has been hampered by the absence of analytical methods for quantification in blood. A commercial ELISA has been developed for serum prohepcidin, a hepcidin precursor, and there is interest in its potential use in the clinical and research arena. We investigated the association between serum prohepcidin concentration and iron absorption in healthy men, and its relationship with iron status in men carrying HFE mutations, hereditary haemochromatosis patients, and pregnant women. Iron absorption was determined in thirty healthy men (fifteen wild-type, fifteen C282Y heterozygote) using the stable isotope red cell incorporation technique. Iron status was measured in 138 healthy men (ninety-one wild-type, forty-seven C282Y heterozygote), six hereditary haemochromatosis patients, and thirteen pregnant women. Mean serum prohepcidin concentrations were 214 (SD 118) ng/ml [208 (SD 122) ng/ml in wild-type and 225 (SD 109) ng/ml in C282Y heterozygotes] in healthy men, 177 (SD 36) ng/ml in haemochromatosis patients, and 159 (SD 59) ng/ml in pregnant women. There was no relationship between serum prohepcidin concentration and serum ferritin in any subject groups, nor was it associated with efficiency of iron absorption. Serum prohepcidin is not a useful biomarker for clinical or research purposes.

Also flagged:ErythrophagocytosispathogenesisNonalcoholic steatohepatitisNASHfibrotic diseasecholesterol
Journal Article 2007-03-01 ✓ 1 Snippet Otogawa K, Kinoshita K, Fujii H, Sakabe M, Shiga R, Nakatani K, Ikeda K, Nakajima Y, Ikura Y, Ueda M, Arakawa T, Hato F, Kawada N.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Nonalcoholic steatohepatitis (NASH) is a progressive fibrotic disease, the pathogenesis of which has not been fully elucidated. Here, we report a molecular aspect of this disease elucidated using rabbits fed a cholesterol-rich high-fat diet and exhibiting insulin resistance. The liver in this model showed steatohepatitis with fibrosis and high mRNA expression for some cytokines, heme oxygenase-1, transforming growth factor-beta1, and collagen alpha1(I). Erythrocytes isolated from the model showed marked fragility and the externalization of phosphatidylserine (PS) on the outer leaflet of the membrane and were frequently engulfed by Kupffer cells/macrophages in the hepatic sinusoids. Expression of milk fat globule-epidermal growth factor (EGF)-factor 8, a PS-binding protein, was augmented in the liver. In culture, RAW 264.7 cells engulfed erythrocytes oxidized by tert-butyl hydroperoxide, a process that was inhibited by anti-milk fat globule-EGF-factor 8 antibody. In addition, PS-positive erythrocytes appeared entrapped in the model liver in ex vivo perfusion experiments. Finally, in specimens from NASH patients, the aggregation of erythrocytes in inflammatory hepatic sinusoids was notable. These results indicate that the engulfment of PS-externalized, apoptotic signal-positive, erythrocytes by hepatic macrophages may lead to the deposition of iron derived from hemoglobin in the liver and be involved in the pathogenesis of steatohepatitis.

Also flagged:ironβ-thalassemiahemoglobin Edyserythropoietic anemiadiamondshereditary hemochromatosis
Journal Article 2007-03-01 ✓ 1 Snippet Storey P, Thompson AA, Carqueville CL, Wood JC, de Freitas RA, Rigsby CK.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Purpose</h4>To determine normative R2* values in the liver and heart at 3T, and establish the relationship between R2* at 3T and 1.5T over a range of tissue iron concentrations.<h4>Materials and methods</h4>A total of 20 healthy control subjects and 14 transfusion-dependent patients were scanned at 1.5T and 3T. At each field strength R2* imaging was performed in the liver and heart.<h4>Results</h4>Normative R2* values in the liver were estimated from the control group to be 39.2 +/- 9.0 second(-1) at 1.5T and 69.1 +/- 21.9 second(-1) at 3T. Normative cardiac values were estimated as 23.4 +/- 2.2 second(-1) at 1.5T and 30.0 +/- 3.7 second(-1) at 3T. The combined R2* data from patients and control subjects exhibited a linear relationship between 3T and 1.5T. In the liver, the line of best fit to the 3T vs. 1.5T data had a slope of 2.00 +/- 0.06 and an intercept of -11 +/- 4 second(-1). In the heart, it had a slope of 1.88 +/- 0.14 and an intercept of -15 +/- 4 second(-1).<h4>Conclusion</h4>These preliminary data suggest that the iron-dependent component of R2* scales linearly with field strength over a wide range of tissue iron concentrations. The incidence of susceptibility artifacts may, however, also increase with field strength.

Also flagged:CBX8bindingARFembryogenesiscancerpolycomb repressive complexes 1
Journal Article 2007-03-01 No Snippets Dietrich N, Bracken AP, Trinh E, Schjerling CK, Koseki H, Rappsilber J, Helin K, Hansen KH.
Show Full Abstract

The Polycomb group (PcG) proteins are essential for embryogenesis, and their expression is often found deregulated in human cancer. The PcGs form two major protein complexes, called polycomb repressive complexes 1 and 2 (PRC1 and PRC2) whose function is to maintain transcriptional repression. Here, we demonstrate that the chromodomain-containing protein, CBX8, which is part of one of the PRC1 complexes, regulates proliferation of diploid human and mouse fibroblasts through direct binding to the INK4A-ARF locus. Furthermore, we demonstrate that CBX8 is limiting for the regulation of INK4A-ARF, and that ectopic expression of CBX8 leads to repression of the Ink4a-Arf locus and bypass of senescence, leading to cellular immortalization. Gene expression and location analysis demonstrate that besides the INK4A-ARF locus, CBX8 also regulates a number of other genes important for cell growth and survival. On the basis of these results, we conclude that CBX8 is an essential component of one of the PRC1 complexes, which directly regulate the expression of numerous target genes, including the INK4A-ARF locus, involved in cell-fate decisions.

Also flagged:ironanemiabeta-thalassemia majorsickle cell disease
Journal Article 2007-03-01 ✓ 3 Snippets Barton JC.
In-Text Gene Mentions

The availability of three licensed iron chelation drugs (one parenteral, two oral) and the development and clinical investigation of other oral chelators represent new opportunities to prevent or manage iron overload in patients with heritable types of severe anemia, such as beta-thalassemia major and sickle cell disease, and for the formulation of alternatives to phlebotomy therapy for patients with iron overload associated with the HFE gene and other adult age-of-onset types of hemochromatosis, African iron overload, and African-American iron overload.

…associated with theHFEgene and other…

…age-of-onset types ofhemochromatosis, African iron overload,…

Show Full Abstract

Iron overload is characterized by excessive iron deposition and consequent injury and dysfunction of the heart, liver, anterior pituitary, pancreas, and joints. Because physiologic mechanisms to excrete iron are very limited, patients with iron overload and its complications need safe, effective therapy that is compatible with their coexisting medical conditions. The availability of three licensed iron chelation drugs (one parenteral, two oral) and the development and clinical investigation of other oral chelators represent new opportunities to prevent or manage iron overload in patients with heritable types of severe anemia, such as beta-thalassemia major and sickle cell disease, and for the formulation of alternatives to phlebotomy therapy for patients with iron overload associated with the HFE gene and other adult age-of-onset types of hemochromatosis, African iron overload, and African-American iron overload.

Also flagged:embryonal carcinomacoactivatorretinoic-acidstem cell differentiationcancersPSF
Journal Article 2007-03-01 ✓ 5 Snippets Yang Z, Sui Y, Xiong S, Liour SS, Phillips AC, Ko L.
In-Text Gene Mentions

Overexpression of CoAM induces differentiation marker Sox6 in the absence of retinoic acid (RA), suggesting the switch from CoAA to CoAM expression may play an important role in promoting differentiation.

…gulates differentiation markerSox6.…

…induces differentiation markerSox6in the absence…

…gag, ctgtagggagggcttcgggcactt;Sox6, cagcggatggagaggaagcaatg, ctt…

…expression levels ofSox6, a member of…

Show Full Abstract

Alternative splicing produces functionally distinct proteins participating in cellular processes including differentiation and development. CoAA is a coactivator that regulates transcription-coupled splicing and its own pre-mRNA transcript is alternatively spliced. We show here that the CoAA gene is embryonically expressed and alternatively spliced in multiple tissues to three splice variants, CoAA, CoAM and CoAR. During retinoic-acid-induced P19 stem cell differentiation, the expression of CoAA undergoes a rapid switch to its dominant negative splice variant CoAM in the cavity of the embryoid body. CoAM functionally inhibits CoAA, and their switched expression up-regulates differentiation marker Sox6. Using a CoAA minigene cassette, we find that the switched alternative splicing of CoAA and CoAM is regulated by the cis-regulating sequence upstream of the CoAA basal promoter. Consistent to this, we show that p54(nrb) and PSF induce CoAM splice variant through the cis-regulating sequence. We have previously shown that the CoAA gene is amplified in human cancers with a recurrent loss of this cis-regulating sequence. These results together suggest that the upstream regulatory sequence contributes to alternative splicing of the CoAA gene during stem cell differentiation, and its selective loss in human cancers potentially deregulates CoAA alternative splicing and alters stem cell differentiation.

Also flagged:bone morphogenetic protein receptor type 2transforming growth factor betaBMPR2pulmonary arterial hypertensionneoplasiacell proliferation
Journal Article 2007-03-01 No Snippets Austin ED, Loyd JE.
Show Full Abstract

Pulmonary arterial hypertension (PAH) is an uncommon disorder of the pulmonary vasculature characterized by remodeling of the smallest pulmonary arteries, leading to a progressive increase in pulmonary vascular resistance. Various forms of PAH exist, including familial (FPAH) and idiopathic (IPAH) forms and associated conditions. FPAH transmits as an autosomal dominant trait that exhibits genetic anticipation but also markedly reduced penetrance (20%). The primary genetic defect of FPAH, identifiable in more than 70% of cases of FPAH, is a mutation in the gene encoding bone morphogenetic protein receptor type 2 (BMPR2), a member of the transforming growth factor beta superfamily. The true prevalence of BMPR2 mutations in IPAH is unknown, with reports ranging from 10% to 40% of patients. The cause of the variable phenotypic expression of PAH among carriers of mutated BMPR2 genes and patients is unclear, and likely related to environmental and genetic modifiers of disease not yet fully elucidated. Although BMPR2-related pathways seem to be pivotal, many other mediator pathways participate in the pathogenesis of different forms of PAH and are being actively investigated, both independently and in combination. As understanding of the molecular basis of this devastating disease improves, opportunities for earlier diagnosis, additional therapeutic regimens, and perhaps disease prevention will emerge.

Also flagged:Juvenile hemochromatosisironHJV
Journal Article 2007-03-01 ✓ 1 Snippet Aguilar-Martinez P, Lok CY, Cunat S, Cadet E, Robson K, Rochette J.
In-Text Gene Mentions

…H63D mutation inHFE.…

Show Full Abstract

During a screening program we identified a 5-year old girl with elevated iron parameters. The child was found to have a combination of a novel R176C mutation together with the G320V mutation in the juvenile hemochromatosis gene (HJV). The girl was also homozygous for the H63D mutation in HFE. The possibility of detecting juvenile hemochromatosis before the onset of clinical manifestations raises questions about the management of such young children in order to prevent iron overload.

Also flagged:MHC class Iendoplasmic reticulumMHC-IH chain binding proteinGRP94C/EBP homologous protein
Journal Article 2007-03-01 No Snippets de Almeida SF, Fleming JV, Azevedo JE, Carmo-Fonseca M, de Sousa M.
Show Full Abstract

HFE C282Y is an example of a mutant protein that does not fold correctly, is retained in the endoplasmic reticulum, and was found previously to diminish surface expression of MHC class I (MHC-I). We now show that its expression in 293T cells triggers an unfolded protein response (UPR), as revealed by the increased levels of H chain binding protein, GRP94, and C/EBP homologous protein. Elevated levels of these proteins were also found in HFE C282Y homozygous PBMCs. Following the UPR induction, a decrease in MHC-I cell surface expression was observed. This defect in MHC-I could be mimicked, however, by overexpression of transcriptionally active isoforms of activating transcription factor-6 and X box-binding protein-1, which induced the UPR, and reversed in HFE C282Y-expressing cells by using dominant-negative constructs that block UPR signaling. The present results provide evidence to the finding that stimulation of an UPR affects MHC-I expression.

Also flagged:Netrin-1axonalaxonsangiogenesiscolorectal cancerbeta-actin
Journal Article 2007-03-01 ✓ 3 Snippets Mehlen P, Rama N.
In-Text Gene Mentions

netrin-1 signaling, we propose here to describe the recent insight in netrin-1 signaling via its main receptor DCC (deleted in colorectal cancer

DCC (deleted in colorectal cancer

…its main receptorDCC(deleted in colorectal…

Show Full Abstract

More than 10 years after its initial discovery, netrin-1 - the first described chimioattractive molecule controlling the guidance of the commissural axons - has recently known a unsuspected wave of interest because of its implication in the development of the nervous system but also, more recently, fot its role in angiogenesis and tumorigenesis. Because, of a series of recent publications on netrin-1 signaling, we propose here to describe the recent insight in netrin-1 signaling via its main receptor DCC (deleted in colorectal cancer), and the recent discovery that netrin controls the assymetric distribution of beta-actin in the growth cone. Thus, it seems that netrin-1, but also the neurotrophic factor BDNF, controls acute growth cone responses such as collapse and turning by the regulation of localized protein translation, such as beta-actin. This process involves both transport of beta-actin mRNA, bound to Vg1RBP, to specific locations, and mRNA translation upon stimulation by local activation of the translation initiation regulator eIF-4E-binding protein 1. Indeed, Netrin-1 induces the movement of Vg1RBP granules into filopodia, and triggers a polarized increase in beta-actin translation on the near side of the growth cone before growth cone turning. The binding of BDNF to its receptor Trk has a similar effect for growth cone attraction, althought it is differentially regulated. Thus, this asymetrically synthesized beta-actin may direct actin polymerization and consequently the migration of the growth cone toward the cue.

Also flagged:serotonin transportermajor depressive disorderbenzonitrilebindingmajor depressive episodespessimism
Journal Article 2007-03-01 ✓ 4 Snippets Meyer JH.
In-Text Gene Mentions

With selective serotonin reuptake inhibitor (SSRI) treatment at doses that distinguish from placebo in the treatment of major depressive episodes, 5-HTT occupancy is approximately 80%, and there is a strong relation between plasma level and occupancy that is not predictable based on affinity alone.

…on serotonin transporter5-HTTimaging to investigate…

…major depressive episodes,5-HTToccupancy is approximately…

5-HTT

Show Full Abstract

This paper focuses on serotonin transporter 5-HTT imaging to investigate major depressive disorder (MDD) and antidepressant occupancy. Such investigations have only recently been possible as a result of major advances in ligand development. The state of the art method is [11C]DASB PET or [11C]-3-amino-4-(2-dimethylaminomethyl-phenylsulfanyl)-benzonitrile) positron emission tomography. [11C]DASB is a breakthrough for brain imaging 5-HTT. Compared with previous radioligands, [11C]DASB offers both high selectivity and a favourable ratio of specific binding relative to free and nonspecific binding. These characteristics contribute to valid, reliable quantitation of the 5-HTT binding potential (BP). The 5-HTT BP can be viewed as an index of 5-HTT density in a medication free state, or unblocked 5-HTT density in a medication-treated state. During major depressive episodes with no other axis I comorbidity, either no difference in regional 5-HTT BP or a trend toward elevated 5-HTT BP is typically found. During major depressive episodes (of MDD) with more severe symptoms of pessimism (dysfunctional attitudes), regional 5-HTT BP is elevated. In subjects with major depressive episodes and comorbid axis I psychiatric illnesses, decreased regional 5-HTT BP is often reported. With selective serotonin reuptake inhibitor (SSRI) treatment at doses that distinguish from placebo in the treatment of major depressive episodes, 5-HTT occupancy is approximately 80%, and there is a strong relation between plasma level and occupancy that is not predictable based on affinity alone. Implications of 5-HTT imaging findings for understanding major depressive disorder and antidepressant treatment will be discussed.

Also flagged:Robo1Slit1Slit2axonsSlit receptorsroundabout (Robo
Journal Article 2007-03-01 ✓ 1 Snippet Fouquet C, Di Meglio T, Ma L, Kawasaki T, Long H, Hirata T, Tessier-Lavigne M, Chédotal A, Nguyen-Ba-Charvet KT.
In-Text Gene Mentions

DCC

Show Full Abstract

The development of olfactory bulb projections that form the lateral olfactory tract (LOT) is still poorly understood. It is known that the septum secretes Slit1 and Slit2 which repel olfactory axons in vitro and that in Slit1-/-;Slit2-/- mutant mice, the LOT is profoundly disrupted. However, the involvement of Slit receptors, the roundabout (Robo) proteins, in guiding LOT axons has not been demonstrated. We show here that both Robo1 and Robo2 receptors are expressed on early developing LOT axons, but that only Robo2 is present at later developmental stages. Olfactory bulb axons from Robo1-/-;Robo2-/- double-mutant mice are not repelled by Slit in vitro. The LOT develops normally in Robo1-/- mice, but is completely disorganized in Robo2-/- and Robo1-/-;Robo2-/- double-mutant embryos, with many LOT axons spreading along the ventral surface of the telencephalon. Finally, the position of lot1-expressing cells, which have been proposed to be the LOT guidepost cells, appears unaffected in Slit1-/-;Slit2-/- mice and in Robo1-/-;Robo2-/- mice. Together, our results indicate that Robo1 and Robo2 directly mediate the repulsive activity of Slit receptors on LOT axons, and are required for normal guidance of these axons in vivo.

Also flagged:ironhepatitis B virus infectioninfectionHBV infectionchronic progressive liver diseasefibrosis
Journal Article 2007-03-01 ✓ 5 Snippets Ghaziani T, Alavian SM, Zali MR, Shahraz S, Agah M, Jensen KP, Ansari S, Sendi H, Lambrecht RW, Covault J, Bonkovsky HL.
In-Text Gene Mentions

None of the serum iron measures was related to liver fibrosis stage or necroinflammatory grade.<h4>Conclusion</h4>Serum iron measures are associated with chronic progressive hepatitis B. Carriage of HFE mutations is not associated with the presence of chronic HBV infection or values of serum iron measures in this population, although HFE H63D is associated with more advanced hepatic fibrosis.

We also explored measures of total body iron status and their association with chronic HBV infection.<h4>Methods</h4>Serum measures of iron status and HFE mutations (C282Y, H63D, and S65C) were assessed in 344 Iranian patients with chronic HBV infection (214 asymptomatic carriers, 130 patients with chronic progressive liver disease [CPLD]) and 302 controls.<h4>Results</h4>Frequencies of HFE mutations did not differ between patients with chronic HBV infection and controls (C282Y: P=0.9, H63D: P= 0.8, S65C: P=0.9).

…iron status andHFEgene mutations in…

…tested associations betweenHFEmutations and hepatitis…

…iron status andHFEmutations (C282Y, H63D,…

Show Full Abstract

<h4>Aim</h4>We tested associations between HFE mutations and hepatitis B virus (HBV) infection. We also explored measures of total body iron status and their association with chronic HBV infection.<h4>Methods</h4>Serum measures of iron status and HFE mutations (C282Y, H63D, and S65C) were assessed in 344 Iranian patients with chronic HBV infection (214 asymptomatic carriers, 130 patients with chronic progressive liver disease [CPLD]) and 302 controls.<h4>Results</h4>Frequencies of HFE mutations did not differ between patients with chronic HBV infection and controls (C282Y: P=0.9, H63D: P= 0.8, S65C: P=0.9). By logistic regression, advanced hepatic fibrosis was associated with HFE H63D mutation (OR=13.1, P=0.006; 95% CI=2.0-84.1). Higher levels of serum ferritin and transferrin saturation were observed in patients with CPLD than in healthy controls (P=0.0001 and 0.01, respectively, adjusted for age and sex). None of the serum iron measures was related to liver fibrosis stage or necroinflammatory grade.<h4>Conclusion</h4>Serum iron measures are associated with chronic progressive hepatitis B. Carriage of HFE mutations is not associated with the presence of chronic HBV infection or values of serum iron measures in this population, although HFE H63D is associated with more advanced hepatic fibrosis.

Also flagged:methylationacute lymphoblastic leukemiaALLgene silencingchromosomesDLC-1
Journal Article 2007-03-01 ✓ 4 Snippets Taylor KH, Pena-Hernandez KE, Davis JW, Arthur GL, Duff DJ, Shi H, Rahmatpanah FB, Sjahputera O, Caldwell CW.
In-Text Gene Mentions
⭐ same-sentence co-mention

The methylation status of 10 clones encompassing 11 genes (DCC, DLC-1, DDX51, KCNK2, LRP1B, NKX6-1, NOPE, PCDHGA12, RPIB9, ABCB1, and SLC2A14) identified as differentially methylated between ALL patients and controls was independently verified.

…encompassing 11 genes (DCC, DLC-1, DDX51, KCNK2,…

…RPIB9, ABCB1, andSLC2A14) identified as differentially…

…genes (DLC-1 andDCC) and also for…

Show Full Abstract

This study examined DNA methylation associated with acute lymphoblastic leukemia (ALL) and showed that selected molecular targets can be pharmacologically modulated to reverse gene silencing. A CpG island (CGI) microarray containing more than 3,400 unique clones that span all human chromosomes was used for large-scale discovery experiments and led to 262 unique CGI loci being statistically identified as methylated in ALL lymphoblasts. The methylation status of 10 clones encompassing 11 genes (DCC, DLC-1, DDX51, KCNK2, LRP1B, NKX6-1, NOPE, PCDHGA12, RPIB9, ABCB1, and SLC2A14) identified as differentially methylated between ALL patients and controls was independently verified. Consequently, the methylation status of DDX51 was found to differentiate patients with B- and T-ALL subtypes (P = 0.011, Fisher's exact test). Next, the relationship between methylation and expression of these genes was examined in ALL cell lines (NALM-6 and Jurkat) before and after treatments with 5-aza-2-deoxycytidine and trichostatin A. More than a 10-fold increase in mRNA expression was observed for two previously identified tumor suppressor genes (DLC-1 and DCC) and also for RPIB9 and PCDHGA12. Although the mechanisms that lead to the CGI methylation of these genes are unknown, bisulfite sequencing of the promoter of RPIB9 suggests that expression is inhibited by methylation within SP1 and AP2 transcription factor binding motifs. Finally, specific chromosomal methylation hotspots were found to be associated with ALL. This study sets the stage for acquiring a better biological understanding of ALL and for the identification of epigenetic biomarkers useful for differential diagnosis, therapeutic monitoring, and the detection of leukemic relapse.

Also flagged:axoncordaxonogenesisNetrinaxon guidancenerve cord
Journal Article 2007-03-01 ✓ 1 Snippet Duman-Scheel M, Clark SM, Grunow ET, Hasley AO, Hill BL, Simanton WL.
In-Text Gene Mentions

DCC

Show Full Abstract

Although many similarities in arthropod central nervous systems (CNS) development exist, differences in midline cell formation and ventral nerve cord axonogenesis have been noted in arthropods. It is possible that changes in the expression of axon guidance molecules such as Netrin, which functions during commissural axon guidance in Drosophila and many other organisms, may parallel these differences. In this investigation, we analyze this hypothesis by examining Netrin accumulation during development of the brine shrimp Artemia franciscana, a branchiopod crustacean. An Artemia franciscana netrin (afrnet) orthologue was cloned. An antibody to the afrNet protein was generated and used to examine the pattern of afrNet accumulation during Artemia development. Despite differences between Drosophila and Artemia nerve cord development, examination of afrNet accumulation suggests that this protein functions to regulate commissure formation during Artemia CNS development. However, detection of afrNet at the midline and on commissural axons occurs at a relatively later time point in Artemia as compared with Drosophila. Detection of afrNet in a subset of midline cells that closely resemble Netrin-expressing cells at the Drosophila midline provides evidence for homology of midline cells in arthropods. Expression of Netrins in many other tissues is comparable, suggesting that Netrin proteins may play many conserved roles during arthropod development.

Also flagged:deferasiroxbortezomibdasatinibcyclosporinedermatologic diseasesiron
Journal Article 2007-03-01 ✓ 1 Snippet Scheinfeld N.
In-Text Gene Mentions

…porphyria cutanea tarda,hemochromatosis, and pathogens such…

Show Full Abstract

Recently, a number of medications approved for nondermatologic use have proved useful against dermatologic diseases. This article reviews the dermatologic uses and effects of deferasirox, bortezomib, dasatinib, and cyclosporine eye drops. Deferasirox--an oral iron chelator--could be an effective treatment against porphyria cutanea tarda, hemochromatosis, and pathogens such as mucor that thrive in iron rich environments. Bortezomib, a proteasome inhibitor and multiple myeloma treatment, may be effective against nodular amyloid and has been effectively used against squamous cell carcinoma; although trials demonstrate it is ineffective against metastatic melanoma. Bortezomib has many cutaneous side effects including erythematous plaques or nodules, a generalized morbilliform erythema with ulcerations and fever, purpuric eruptions, leukocytoclastic vasculitis, Sweet's syndrome, and folliculitis. Dasatinib is a multi-targeted tyrosine kinase inhibitor active in vitro against most cell lines containing BCR-ABL mutations that confer resistance to imatinib. Dasatinib is likely to be effective against dermatofibroma sarcoma protuberans and cutaneous acute lymphoblastic leukemia, and has caused panniculitis. Cyclosporine 0.05% ocular emulsion (eye drops) are approved to treat dry eyes including dry eyes caused by collagen vascular disease. Cyclosporine eye drops might also have utility in treating eye pathology of ocular rosacea, atopic keratoconjunctivitis, graft versus host disease, herpes keratitis, chronic sarcoidosis of the conjunctiva, conjunctival manifestations of actinic prurigo, keratitis of keratitis-ichthyosis deafness (KID) syndrome, and lichen planus-related kerato-conjunctivitis. This article speculates that cyclosporine eye drops would also be useful for any disease causing ectropion or eclabion of the eye as well as toxic epidermal necrolysis-related eye pathology (in particular corneal scarring).

Also flagged:coagulationAT-IIIendotoxaemiacoagulopathylipopolysaccharidepartial thromboplastin
Journal Article 2007-03-01 ✓ 2 Snippets Qiao YJ, Zhu JM, You XL, Zhang Y.
In-Text Gene Mentions

…[Treatment effects ofantithrombin-IIIon coagulation abnormalities…

…treatment effects ofantithrombin-III(AT-III) on coagulation…

Show Full Abstract

<h4>Objective</h4>To study the treatment effects of antithrombin-III (AT-III) on coagulation abnormalities in rats with endotoxaemia.<h4>Methods</h4>Twenty-four Wistar rats were randomly divided into control group, coagulation abnormality group and AT-III group (each n=8). Endotoxaemia coagulopathy model was reproduced by intravenous injection of lipopolysaccharide (LPS) in two doses of 1.4 ml/kg (100 microg) and 2.8 ml/kg (200 microg) 12 hours apart. In the AT-III group, AT-III 25 U/kg was given intravenously 1 hour after second injection of LPS. The changes in blood platelet (PLT) count, activated partial thromboplastin time (APTT), prothrombin time (PT), D-dimer (DD), AT-III activity, fibrinogen (FI), alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP) and lactate dehydrogenase (LDH) were determined 3 hours later.<h4>Results</h4>Levels of PLT, FI and AT-III in coagulation abnormality group were lowered compared with control group (all P<0.01), while APTT, DD, PT, ALT, AST, ALP and LDH were increased (all P<0.01). All indexes were significantly improved in AT-III group, the values were close to those of normal control group (all P>0.05), and the differences were significant when compared with those of coagulation abnormality group (all P<0.01). Pathological changes of the lung, kidney and liver tissues were lighter in AT-III group than those of coagulation abnormality group.<h4>Conclusion</h4>These findings indicate that AT-III can be used to treat disseminated intravascular coagulation (DIC) in rats with endotoxaemia. Preventive use of AT-III in rats with endotoxaemia is therapeutically effective.

Also flagged:tamoxifencolorectal cancerestrogen receptorERestrogencolorectal carcinoma
Journal Article 2007-03-01 ✓ 1 Snippet Wan DS, Li LR, Li GC, Pan ZZ, Zhou ZW, Chen MS, Zhang YQ, Gui ZN, Zhang HD.
In-Text Gene Mentions

<h4>Objective</h4>To investigate estrogen receptor (ER) expression and the effects of anti-estrogen therapy on the prognosis of colorectal carcinoma.<h4>Methods</h4>ER was measured in fresh colorectal cancer tissues by Dextran-coated charcoal (DCC) assay.

Show Full Abstract

<h4>Objective</h4>To investigate estrogen receptor (ER) expression and the effects of anti-estrogen therapy on the prognosis of colorectal carcinoma.<h4>Methods</h4>ER was measured in fresh colorectal cancer tissues by Dextran-coated charcoal (DCC) assay. The relationships between ER expression and clinicopathological parameters in colorectal cancer were analyzed. Tamoxifen was administrated postoperatively as adjuvant treatment.<h4>Results</h4>The positive rate of ER in colorectal tumor tissues was 37.0%. The 5-year survival rates of tamoxifen group and control group were 66.7% and 72.5% respectively, and there was no significant difference between the two groups. The distant metastasis rate of Tamoxifen group was significantly lower than that of control group (3% versus 20%).<h4>Conclusion</h4>Some colorectal carcinomas are hormone-dependent tumors, and anti-estrogen therapy has no effect on them.

Also flagged:Histone deacetylase 6Huntington's diseasemicrotubuleHDHistone deacetylaseHDAC
Journal Article 2007-03-01 ✓ 1 Snippet Dompierre JP, Godin JD, Charrin BC, Cordelières FP, King SJ, Humbert S, Saudou F.
In-Text Gene Mentions

htt

Show Full Abstract

A defect in microtubule (MT)-based transport contributes to the neuronal toxicity observed in Huntington's disease (HD). Histone deacetylase (HDAC) inhibitors show neuroprotective effects in this devastating neurodegenerative disorder. We report here that HDAC inhibitors, including trichostatin A (TSA), increase vesicular transport of brain-derived neurotrophic factor (BDNF) by inhibiting HDAC6, thereby increasing acetylation at lysine 40 of alpha-tubulin. MT acetylation in vitro and in cells causes the recruitment of the molecular motors dynein and kinesin-1 to MTs. In neurons, acetylation at lysine 40 of alpha-tubulin increases the flux of vesicles and the subsequent release of BDNF. We show that tubulin acetylation is reduced in HD brains and that TSA compensates for the transport- and release-defect phenotypes that are observed in disease. Our findings reveal that HDAC6 inhibition and acetylation at lysine 40 of alpha-tubulin may be therapeutic targets of interest in disorders such as HD in which intracellular transport is altered.

Also flagged:NetrinaxonalDeleted inColorectal Carcinomaaxonsaxon
Journal Article 2007-03-01 ✓ 4 Snippets Garbe DS, Bashaw GJ.
In-Text Gene Mentions

Studies of both invertebrate and vertebrate systems support the idea that Netrin, secreted by midline cells, signals through DCC (Deleted in Colorectal Carcinoma)/UNC40/Frazzled receptors to attract commissural axons toward and across the midline, whereas Slit signals through Robo family receptors to prevent commissural axons from recrossing the midline, as well as to prevent ipsilateral axons from ever crossing.

…cells, signals throughDCC(Deleted in Colorectal…

DCC

DCC receptors

Show Full Abstract

Slit and Netrin and their respective neuronal receptors play critical roles in patterning axonal connections in the developing nervous system by regulating the decision of whether or not to cross the midline. Studies of both invertebrate and vertebrate systems support the idea that Netrin, secreted by midline cells, signals through DCC (Deleted in Colorectal Carcinoma)/UNC40/Frazzled receptors to attract commissural axons toward and across the midline, whereas Slit signals through Robo family receptors to prevent commissural axons from recrossing the midline, as well as to prevent ipsilateral axons from ever crossing. Recent evidence from both Xenopus neuronal cell culture and Drosophila genetics have suggested that these signals may interact more directly in a hierarchical relationship, such that one response extinguishes the other. Here we present loss- and gain-of-function genetic evidence showing that the influence of Slit and Netrin on midline axon crossing is dictated by both independent and interdependent signaling functions of the Robo and Frazzled (Fra) receptors. Our results are not consistent with the proposal based on genetic analysis in Drosophila that the sole function of Slit and Robo during midline guidance is to repress Netrin attraction.

Also flagged:indomethacinmetabolismextracellularsolid tumorsinflammatory responseseicosanoids
Journal Article 2007-03-01 No Snippets Ackerstaff E, Gimi B, Artemov D, Bhujwalla ZM.
Show Full Abstract

Hostile physiological environments such as hypoxia and acidic extracellular pH, which exist in solid tumors, may promote invasion and metastasis through inflammatory responses and formation of eicosanoids. Here, we have investigated the effects of the anti-inflammatory agent indomethacin on the invasion and metabolism of the human breast cancer cell line MDA-MB-435 in Dulbecco's Modified Eagles (DME)-based or Roswell Park Memorial Institute (RPMI)-based cell medium, using a magnetic resonance-compatible invasion assay. Indomethacin treatment significantly reduced the invasion of MDA-MB-435 cells independent of the culture and perfusion conditions examined. Significant changes were detected in levels of intracellular choline phospholipid metabolites and in triglyceride (TG) concentrations of these cells, depending on indomethacin treatment and basal cell medium used. Additionally, genetic profiling of breast cancer cells, grown and treated with low-dose indomethacin in cell culture using an RPMI-based medium, revealed the upregulation of several genes implicating cyclooxygenase-independent targets of indomethacin. These data confirm the ability of an anti-inflammatory agent to reduce breast cancer invasion and demonstrate, depending on cell culture and perfusion conditions, that the indomethacin-induced decrease in invasion is associated with changes in choline phospholipid metabolism, TG metabolism, and gene expression.

Also flagged:p53K-rascolorectal cancerscolorectal cancertumortumors
Journal Article 2007-03-01 ✓ 5 Snippets Akkiprik M, Ataizi-Celikel C, Düşünceli F, Sönmez O, Gulluoglu BM, Sav A, Ozer A.
In-Text Gene Mentions

The aim of this study was to clarify the association between K-ras mutations, p53 aberrations and DCC loss of heterozygosity (LOH), with the patient outcome and tumor characteristics in 43 stage I-II colorectal cancer patients.<h4>Methods</h4>Mutations in exons 5-8 of the p53 gene and codon 12 and/or 13 of the K-ras gene were assayed by PCR-SSCP and then confirmed by DNA sequencing.

DCC LOH was studied by PCR-RFLP, while p53 immunohistochemistry was also made.<h4>Results</h4>Mutations of the p53 gene were found in 14 (32.5%) tumors.

…p53, K-ras andDCCgene alterations in…

…p53, K-ras andDCCgenes have a…

…p53 aberrations andDCCloss of heterozygosity…

Show Full Abstract

<h4>Background and aims</h4>Genetic alterations of p53, K-ras and DCC genes have a pivotal role in the colorectal cancer progression. The aim of this study was to clarify the association between K-ras mutations, p53 aberrations and DCC loss of heterozygosity (LOH), with the patient outcome and tumor characteristics in 43 stage I-II colorectal cancer patients.<h4>Methods</h4>Mutations in exons 5-8 of the p53 gene and codon 12 and/or 13 of the K-ras gene were assayed by PCR-SSCP and then confirmed by DNA sequencing. DCC LOH was studied by PCR-RFLP, while p53 immunohistochemistry was also made.<h4>Results</h4>Mutations of the p53 gene were found in 14 (32.5%) tumors. Five (12%) cases showed mutation of the K-ras gene. Nuclear staining of p53 was found in 22 (51 %) cases. DCC LOH was found in 5 (12%) cases. Cases with guanine to thymine substitution that occurred in K-ras codon 12 and DCC LOH were found to be more aggressive than other cases with codon 12 mutations or DCC wild-type phenotype. Many tumors with p53 over-expression were localized on the left side of the colon (p=0.005). The stage of the tumor was higher in patients who died during the follow-up period, when compared to the ones who have survived.<h4>Conclusions</h4>Although none of these genetic alterations showed a significant prognostic value, specific mutation of K-ras gene and DCC LOH phenotype might have a predictive prognostic implication in colorectal cancer. Furthermore, different etiopathogenetic mechanisms might be involved in the tumorigenesis of the left and right colon.

Also flagged:angiosarcomahemangiomahepatic tumorsmesenchymal tumor of the liverthorium dioxidevinyl chloride
Journal Article 2007-03-01 ✓ 1 Snippet Heo SH, Jeong YY, Shin SS, Chung TW, Kang HK.
In-Text Gene Mentions

…also associated withhemochromatosisand von Recklinghausen…

Show Full Abstract

We report an uncommon case of solitary, small hepatic angiosarcoma that was initially considered as a hemangioma. We present the imaging findings, with an emphasis on the initial and follow-up CT and MR findings, as well as report on the more suggestive findings of angiosarcoma than those of a hemangioma.

Also flagged:Glucosemetabolisminsulinsecretiondiabetespancreatopathies
Journal Article 2007-03-01 ✓ 2 Snippets Angelopoulos N, Papanikolaou G, Noutsou M, Rombopoulos G, Goula A, Tolis G.
In-Text Gene Mentions

…sensitivity in juvenilehemochromatosis. A case report…

…that in juvenilehemochromatosis, the efficacy of…

Show Full Abstract

Among specific diabetes subtypes secondary to pancreatopathies, hereditary hemochromatosis is an inherited disorder of iron metabolism resulting in excessive iron overload and tissue damage in various organs. We here report the case of a man with the young-onset form of the disease and describe his glycaemic status before and during venesection therapy. A 25-year old man visited our clinic in Athens, Greece, with hypogonadotropic hypogonadism due to hereditary hemochromatosis. Genetic analysis revealed that he was suffering from the juvenile aggressive form and treatment was initiated with frequent phlebotomies in conjunction with androgen substitution. Within 18 months of therapy ferritin level was normalized and hypogonadism was fully restored. Despite severe iron overload, glucose tolerance remained normal during the various stages of the disease, although alterations in both insulin secretion and sensitivity were detected. Present data indicate that in juvenile hemochromatosis, the efficacy of the chelation therapy and probably the chronic interval required to restore normal iron concentration both play important roles in the formation of glucose metabolism characteristics.

Also flagged:Hereditary hemochromatosisironTransferrin
Journal Article 2007-03-01 ✓ 4 Snippets Yönal O, Hatirnaz O, Akyüz F, Köroğlu G, Ozbek U, Cefle K, Mungan Z.
In-Text Gene Mentions

…in a hereditaryhemochromatosisfamily from Turkey.…

…mutation of theHFEgene.…

…was diagnosed withhemochromatosis(transferrin saturation rate…

…also diagnosed withhemochromatosis.…

Show Full Abstract

Hereditary hemochromatosis is an autosomal recessive disorder associated with the mutation of the HFE gene. C282Y and H63D mutations in this gene have been described. Hereditary hemochromatosis is primarily associated with the C282Y mutation; the importance of H63D is not well known. In previously reported studies, the C282Y mutation was not detected in Turkey. We herein present a family in which the C282Y mutation was detected. A consanguineous marriage produced 10 children. A 33-year-old man (index case) was diagnosed with hemochromatosis (transferrin saturation rate 80%, ferritin 514 ng/ml, liver biopsy showed +3 iron accumulation, liver involvement in MRI), and genetic analysis showed homozygous C282Y mutation. With family screening, another brother was also diagnosed with hemochromatosis. Transferrin saturation rate was high (>45%) in seven healthy brothers and the father. Genetic analysis revealed two cases with C282Y homozygous mutations, three with C282Y/H63D compound heterozygous mutations, one C282Y heterozygous and three H63D heterozygous among the family members. This is the first family in Turkey in which the C282Y mutation has been detected.

Also flagged:Colorectal cancercancerstumourColorectal cancerslumenWnt
Journal Article 2007-03-01 ✓ 1 Snippet van Leeuwen IM, Edwards CM, Ilyas M, Byrne HM.
In-Text Gene Mentions

DCC

Show Full Abstract

Colorectal cancer (CRC) is one of the best characterised cancers, with extensive data documenting the sequential gene mutations that underlie its development. Complementary datasets are also being generated describing changes in protein and RNA expression, tumour biology and clinical outcome. Both the quantity and the variety of information are inexorably increasing and there is now an accompanying need to integrate these highly disparate datasets. In this article we aim to explain why we believe that mathematical modelling represents a natural tool or language with which to integrate these data and, in so doing, to provide insight into CRC.

Also flagged:Gene expressionesophageal cancertumoresophageal squamous cell carcinomaMAPKG-protein coupled receptor
Journal Article 2007-03-01 ✓ 2 Snippets Chattopadhyay I, Kapur S, Purkayastha J, Phukan R, Kataki A, Mahanta J, Saxena S.
In-Text Gene Mentions

PRDX6

DCC

Show Full Abstract

<h4>Aim</h4>To identify alterations in genes and molecular functional pathways in esophageal cancer in a high incidence region of India where there is a widespread use of tobacco and betel quid with fermented areca nuts.<h4>Methods</h4>Total RNA was isolated from tumor and matched normal tissue of 16 patients with esophageal squamous cell carcinoma. Pooled tumor tissue RNA was labeled with Cy3-dUTP and pooled normal tissue RNA was labeled with Cy5-dUTP by direct labeling method. The labeled probes were hybridized with human 10K cDNA chip and expression profiles were analyzed by Genespring GX V 7.3 (Silicon Genetics).<h4>Results</h4>Nine hundred twenty three genes were differentially expressed. Of these, 611 genes were upregulated and 312 genes were downregulated. Using stringent criteria (P < or = 0.05 and > or = 1.5 fold change), 127 differentially expressed genes (87 upregulated and 40 downregulated) were identified in tumor tissue. On the basis of Gene Ontology, four different molecular functional pathways (MAPK pathway, G-protein coupled receptor family, ion transport activity, and serine or threonine kinase activity) were most significantly upregulated and six different molecular functional pathways (structural constituent of ribosome, endopeptidase inhibitor activity, structural constituent of cytoskeleton, antioxidant activity, acyl group transferase activity, eukaryotic translation elongation factor activity) were most significantly downregulated.<h4>Conclusion</h4>Several genes that showed alterations in our study have also been reported from a high incidence area of esophageal cancer in China. This indicates that molecular profiles of esophageal cancer in these two different geographic locations are highly consistent.

Also flagged:colorectal neoplasiacolon polypgastric cancercolon canceradenomacolon polyps
Journal Article 2007-03-01 ✓ 1 Snippet Jun DW, Lee OY, Lim HC, Kwon SJ, Lee HL, Yoon BC, Choi HS, Hahm JS, Lee MH, Lee DH.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Aim</h4>To examine the diagnostic yield of colorectal neoplasia at computed tomographic colonoscopy (CTC) as well as the feasibility of contrast enhanced CTC in patients with gastric cancer.<h4>Methods</h4>To examine the incidence of colon polyp we selected postoperative 188 gastric cancer patients, which we refer to as the 'colon polyp survey group'. To examine the feasibility of CTC for early detection of colon cancer or advanced colon adenoma, we selected 47 gastric cancer patients (M:F 29:18, mean age 53.8 years), which we call the 'CT colonoscopy group'. All the 47 patients underwent successive CTC and colonoscopy on the same day.<h4>Results</h4>Totally 109 colon polyps were observed from 59 out of 188 gastric cancer patients, the incidence rate of colon polyps in gastric cancer patients being 31.4%. The sensitivity of CTC in detecting individuals with at least 1 lesion of any size was 57.1%, the specificity was 72.7%, the positive predictive value was 47.1%, and the negative predictive value was 71.9%. When the cutoff size was decreased to 6 mm, the sensitivity and specificity were 80.0% and 92.9%, respectively, with positive and negative predictive values of 57.1% and 97.5%, respectively. Only one patient was classified as false negative by virtual colonoscopy.<h4>Conclusion</h4>The diagnostic yield of colorectal polyp was 31.4% in patients with gastric cancer, and contrast enhanced CTC is an acceptable tool for the detection of synchronous colorectal advanced adenoma and postoperative surveillance of gastric cancer patients.

Also flagged:diffuse large B-cell lymphomasDLBCLchromosomelymphomatumorchromosomes
Journal Article 2007-03-01 ✓ 1 Snippet Jiang HY, Huang ZX, Zhang XF, Desper R, Zhao T.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Aim</h4>To construct tree models for classification of diffuse large B-cell lymphomas (DLBCL) by chromosome copy numbers, to compare them with cDNA microarray classification, and to explore models of multi-gene, multi-step and multi-pathway processes of DLBCL tumorigenesis.<h4>Methods</h4>Maximum-weight branching and distance-based models were constructed based on the comparative genomic hybridization (CGH) data of 123 DLBCL samples using the established methods and software of Desper et al. A maximum likelihood tree model was also used to analyze the data. By comparing with the results reported in literature, values of tree models in the classification of DLBCL were elucidated.<h4>Results</h4>Both the branching and the distance-based trees classified DLBCL into three groups. We combined the classification methods of the two models and classified DLBCL into three categories according to their characteristics. The first group was marked by +Xq, +Xp, -17p and +13q; the second group by +3q, +18q and +18p; and the third group was marked by -6q and +6p. This chromosomal classification was consistent with cDNA classification. It indicated that -6q and +3q were two main events in the tumorigenesis of lymphoma.<h4>Conclusion</h4>Tree models of lymphoma established from CGH data can be used in the classification of DLBCL. These models can suggest multi-gene, multi-step and multi-pathway processes of tumorigenesis. Two pathways, -6q preceding +6q and +3q preceding +18q, may be important in understanding tumorigenesis of DLBCL. The pathway, -6q preceding +6q, may have a close relationship with the tumorigenesis of non-GCB DLBCL.

Also flagged:Pathogenesiscolorectal carcinomacolorectal cancerAPCK-rasSmad4
Journal Article 2007-03-01 No Snippets Voutsadakis IA.
Show Full Abstract

Pathways of the molecular pathogenesis of colorectal carcinoma have been extensively studied and molecular lesions during the development of the disease have been revealed. High up in the list of colorectal cancer lesions are APC (adenomatous polyposis coli), K-ras, Smad4 (or DPC4-deleted in pancreatic cancer 4) and p53 genes. All these molecules are part of important pathways for the regulation of cell proliferation and apoptosis and as a result perturbation of these processes lead to carcinogenesis. The ubiquitin-proteasome system (UPS) is comprised of a multi-unit cellular protease system that regulates several dozens of cell proteins after their ligation with the protein ubiquitin. Given that among these proteins are regulators of the cell cycle, apoptosis, angiogenesis, adhesion and cell signalling, this system plays a significant role in cell fate and carcinogenesis. UPS inhibition has been found to be a pre-requisite for apoptosis and is already clinically exploited with the proteasome inhibitor bortezomib in multiple myeloma. Cyclooxygenase-2 (Cox-2) is the inducible form of the enzyme that metabolizes the lipid arachidonic acid to prostaglandin H2, the first step of prostaglandins production. This enzyme is up-regulated in colorectal cancer and in several other cancers. Inhibition of Cox-2 by aspirin and other non-steroidal anti-inflammatory drugs (NSAIDs) has been found to inhibit proliferation of colorectal cancer cells and in epidemiologic studies has been shown to reduce colon polyp formation in genetically predisposed populations and in the general population. NSAIDs have also Cox-independent anti-proliferative effects. Targeted therapies, the result of increasingly understanding carcinogenesis in the molecular level, have entered the field of anti-neoplastic treatment and are used by themselves and in combination with chemotherapy drugs. Combinations of targeted drugs have started also to be investigated. This article reviews the molecular pathogenesis of colorectal cancer, the roles of UPS and Cox-2 in it and puts forward a rational for their combined inhibition in colorectal cancer treatment.

Also flagged:gene expressionnucleusalcoholdeathsynapseneuropeptide Y
Journal Article 2007-03-01 No Snippets Kimpel MW, Strother WN, McClintick JN, Carr LG, Liang T, Edenberg HJ, McBride WJ.
Show Full Abstract

The objective of this study was to determine if there are innate differences in gene expression in selected CNS regions between inbred alcohol-preferring (iP) and -non-preferring (iNP) rats. Gene expression was determined in the nucleus accumbens (ACB), amygdala (AMYG), frontal cortex (FC), caudate-putamen (CPU), and hippocampus (HIPP) of alcohol-naïve adult male iP and iNP rats, using Affymetrix Rat Genome U34A microarrays (n = 6/strain). Using Linear Modeling for Microarray Analysis with a false discovery rate threshold of 0.1, there were 16 genes with differential expression in the ACB, 54 in the AMYG, 8 in the FC, 24 in the CPU, and 21 in the HIPP. When examining the main effect of strain across regions, 296 genes were differentially expressed. Although the relatively small number of genes found significant within individual regions precluded a powerful analysis for over-represented Gene Ontology categories, the much larger list resulting from the main effect of strain analysis produced 17 over-represented categories (P < .05), including axon guidance, gliogenesis, negative regulation of programmed cell death, regulation of programmed cell death, regulation of synapse structure function, and transmission of nerve impulse. Co-citation analysis and graphing of significant genes revealed a network involved in the neuropeptide Y (NPY) transmitter system. Correlation of all significant genes with those located within previously established rat alcohol QTLs revealed that of the total of 313 significant genes, 71 are located within such QTLs. The many regional and overall gene expression differences between the iP and iNP rat lines may contribute to the divergent alcohol drinking phenotypes of these rats.

Also flagged:CASTNFR-1p53interferon-gammaadriamycinhepatoma
Journal Article 2007-03-01 ✓ 1 Snippet Jiang MC, Luo SF, Li LT, Lin CC, Du SY, Lin CY, Hsu YW, Liao CF.
In-Text Gene Mentions

…Interferon-y increased TNFR-1,CSE1L/CAS (cellular apoptosis susce…

Show Full Abstract

Many cancers are chemotherapy-resistant. Chemotherapy combined with immunotherapy offers a potential avenue for the treatment of chemotherapy-resistant cancers. In this study, we investigated the apoptotic pathways induced by combined interferon-gamma/adriamycin treatment in Hep G2 cells. Our data showed that Hep G2 cells treated with combined interferon-gamma/adriamycin enhanced cell apoptosis in comparison with that of cells treated with adriamycin. Interferon-y increased TNFR-1, CSE1L/CAS (cellular apoptosis susceptibility protein), Bax, and Bad levels. Adriamycin increased p53 and Bax, but not TNFR- 1 and CAS levels. Interferon-y did not increase p53 accumulation; nevertheless it enhanced adriamycin-induced p53 accumulation. Overexpression of IRF-1 augmented the combined interferon-gamma/adriamycin-induced p53 accumulation. Interferon-gamma co-treatment increased the stability of p53 protein induced by adriamycin. Our data suggest that TNF-gamma may greatly enhance the combined interferon-gamma/chemotherapeutic drug-induced apoptosis of cancers. Our findings also indicate that CAS, TN-FR-1, p53, Bax, and Bad may be the targets for the interferon-y-based chemo-immunotherapy of the chemotherapy-resistant cancers.

Also flagged:behavioraldopaminenucleuslocalizationdopamine D2 receptors
Journal Article 2007-03-01 No Snippets Cohen MX.
Show Full Abstract

Reward expectation and reward prediction errors are thought to be critical for dynamic adjustments in decision-making and reward-seeking behavior, but little is known about their representation in the brain during uncertainty and risk-taking. Furthermore, little is known about what role individual differences might play in such reinforcement processes. In this study, it is shown behavioral and neural responses during a decision-making task can be characterized by a computational reinforcement learning model and that individual differences in learning parameters in the model are critical for elucidating these processes. In the fMRI experiment, subjects chose between high- and low-risk rewards. A computational reinforcement learning model computed expected values and prediction errors that each subject might experience on each trial. These outputs predicted subjects' trial-to-trial choice strategies and neural activity in several limbic and prefrontal regions during the task. Individual differences in estimated reinforcement learning parameters proved critical for characterizing these processes, because models that incorporated individual learning parameters explained significantly more variance in the fMRI data than did a model using fixed learning parameters. These findings suggest that the brain engages a reinforcement learning process during risk-taking and that individual differences play a crucial role in modeling this process.

Also flagged:diabetesangiopathychronic liver diseaseglucose intolerancediabetes mellitusdiabetic angiopathies
Journal Article 2007-03-01 ✓ 1 Snippet Kuriyama S, Miwa Y, Fukushima H, Nakamura H, Toda K, Shiraki M, Nagaki M, Yamamoto M, Tomita E, Moriwaki H.
In-Text Gene Mentions

…hepatitis, Wilson’s disease,hemochromatosis, drug-induced hepatitis, or…

Show Full Abstract

Patients with chronic liver disease (CLD) often develops glucose intolerance. We explored the prevalence of diabetes mellitus in viral CLD, and analyzed factors profoundly affecting the diabetic angiopathies. 229 CLD patients (124 chronic hepatitis and 105 liver cirrhosis) entered the study. The diagnosis of diabetes was made with the criteria by World Health Organization. Laboratory investigation included serum asparate aminotransferase, alanine aminotransferase, albumin, fasting blood sugar, hemoglobin A1c (HbA1c), fasting immunoreactive insulin, and HOMA-R (FBS*IRI/405). The incidence of macro- and microangiopathy were also examined. Forty (17.5%) CLD patients were diagnosed diabetes, giving a significantly higher incidence than that of general cohort (5.3%) (p<0.001). Among them, 12 (30%) had the triopathy, significantly lower than that in a matched group of diabetic patients without CLD (65%) (p<0.001). Significantly increased levels of HbA1c and HOMA-R were observed in diabetic CLD with angiopathy compared with diabetic CLD without. Incidence of diabetes was increased in viral CLD patients. The rate of diabetic angiopathies in CLD, however, was relatively low, this could be explained by low coagulability in these patients. Poor control of hyperglycemia, partly due to insulin resistance, might explain the onset of angiopathy in diabetic CLD.

Also flagged:diabetesInsulin-dependent diabetes mellitusmembraneC-
Journal Article 2007-03-01 No Snippets Akbarzadeh A, Noruzian D, Jamshidi Sh, Farhangi A, Mehrabi MR, Rad BL, Mofidian M, Allahverdi A.
Show Full Abstract

Insulin injection is the main way to combat against insulin-dependent diabetes mellitus effects. Today in some laboratories in the world, the investigators are trying to find some treatments for this disease with insulin-secreting pancreatic islet cells transplantation. Donor tissue in each step of work was prepared from 36 adult male wistar Rats weighted 250-300 grams (75-90 days). Transplantation was done in rats after 2-4 weeks induction of diabetes with 60mg/kg of streptozotocin injection by intravenous method. Encapsulation of pancreatic islet cells allows for transplantation in the absence of immunosuppression. This technique that is called "immunoisolation" is based on the principle that transplanted tissue is protected for the host immune system by an artificial or natural membrane. In this study, the levels of insulin, C-peptide and glucose in diabetic rats have been reached to normal range as compared to un-diabetic rats in 20 days after transplantation of islet cells, so that testis is immunoisolated place for islet cells transplantation. Inside the testis subcutaneously and intrapretoneally implantation of pure islet cells graft, that is a natural immunoisolation method, rapidly and permanently normalized the diabetic state of streptozocin-administered animals.

Also flagged:Head and neck squamous cell cancertumorhead and neck squamous cell carcinomaSCCHNcancertranslational
Journal Article 2007-03-01 No Snippets Mishra A, Pandey A, Nong X.
Show Full Abstract

This review is the first section of tumor biology pertaining to head and neck squamous cell carcinoma (SCCHN). It is intended to introduce the basic concepts of cancer biology to enhance the translational research. The basic tumour biology relates to the aberrations in the normal cell cycle. cell growth and cell death. The genetic aspects of cancer focus upon the roles of oncogenes, tumor suppressor genes and stability genes. The epigenetic mechanisms of the cancer relates to DNA methylation and histone acetylation. This review, discusses the basics of these concepts.