Gene Literature Dashboard

Viewing March 2011 — 213 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← February 2011 April 2011 →
Also flagged:glutathione peroxidaseglutathionethioredoxinπGSH S-transferasephospholipidsperoxidase
Journal Article 2011-03-31 ✓ 5 Snippets Fisher AB.
In-Text Gene Mentions

…at cytosolic pH.Prdx6can be phosphorylated…

Prdx6is primarily cytosolic…

…potent regulators ofPrdx6gene expression.…

Prdx6has important roles…

…Abstract Peroxiredoxin 6 (Prdx6) is the prototype…

Show Full Abstract

Peroxiredoxin 6 (Prdx6) is the prototype and the only mammalian 1-Cys member of the Prdx family. Major differences from 2-Cys Prdxs include the use of glutathione (GSH) instead of thioredoxin as the physiological reductant, heterodimerization with πGSH S-transferase as part of the catalytic cycle, and the ability either to reduce the oxidized sn-2 fatty acyl group of phospholipids (peroxidase activity) or to hydrolyze the sn-2 ester (alkyl) bond of phospholipids (phospholipase A(2) [PLA(2)] activity). The bifunctional protein has separate active sites for peroxidase (C47, R132, H39) and PLA(2) (S32, D140, H26) activities. These activities are dependent on binding of the protein to phospholipids at acidic pH and to oxidized phospholipids at cytosolic pH. Prdx6 can be phosphorylated by MAP kinases at T177, which markedly increases its PLA(2) activity and broadens its pH-activity spectrum. Prdx6 is primarily cytosolic but also is targeted to acidic organelles (lysosomes, lamellar bodies) by a specific targeting sequence (amino acids 31-40). Oxidant stress and keratinocyte growth factor are potent regulators of Prdx6 gene expression. Prdx6 has important roles in both antioxidant defense based on its ability to reduce peroxidized membrane phospholipids and in phospholipid homeostasis based on its ability to generate lysophospholipid substrate for the remodeling pathway of phospholipid synthesis.

Also flagged:HdhHuntington's diseasepathogenesisHD
Journal Article 2011-03-31 No Snippets Trueman RC, Jones L, Dunnett SB, Brooks SP.
Show Full Abstract

A number of genetic mouse models of Huntington's disease have been created, in order to examine the pathogenesis of Huntington's disease and to test potential therapeutics. In the present study we demonstrate that the full-length knock-in homozygote Hdh(Q92) mice exhibit impairments at 5 months of age on the delayed alternation task, conducted in 9-hole operant chambers. This test is sensitive to cortico-striatal dysfunction and demonstrates again that although Hdh(Q92) mice do not display an overt motor phenotype, they do exhibit clear impairments that can be related to deficits seen in HD patients. This indicates that if appropriately sensitive tasks are used, the more subtle and specific Hdh(Q92) knock-in model could be of use for the examination of pathogenic mechanisms in Huntington's disease and to test potential therapeutics.

Also flagged:glycoproteinbindingcell surface receptorscell surfacepolymerasesvirion
Journal Article 2011-03-31 No Snippets Bowden TA, Jones EY, Stuart DI.
Show Full Abstract

As obligate parasites, viruses are required to enter and replicate within their host, a process which employs many of their proteins to hijack natural cellular processes. High resolution X-ray crystallographic analysis has proven to be an ideal method to visualize the mechanisms by which such virus-host interactions occur and has revealed the innovative capacity of viruses to adapt efficiently to their hosts. In this review, we draw upon recently elucidated paramyxovirus-, arenavirus-, and poxvirus-host protein complex crystal structures to reveal both the capacity of viruses to appropriate one component of a physiological protein-protein binding event (often modifying it to out-compete the host-protein), and the ability to utilize novel binding sites on host cell surface receptors. The structures discussed shed light on a number of biological processes ranging from viral entry to virulence and host antagonism. Drawn together they reveal the common strategies which viruses have evolved to interact with their natural host. The structures also support molecular level rationales for how viruses can be transmitted to unrelated organisms and thus pose severe health risks.

Also flagged:pathogenesisHuntington's diseaseHDpolyglutaminetetracyclineenhanced green fluorescence
Journal Article 2011-03-31 ✓ 5 Snippets Dong G, Ferguson JM, Duling AJ, Nicholas RG, Zhang D, Rezvani K, Fang S, Monteiro MJ, Li S, Li XJ, Wang H.
In-Text Gene Mentions

…of the huntingtin (htt) gene.…

…fluorescence protein taggedhttexon 1 (referred…

…expressing wild typehtt, the cell line…

…line expressing mutanthttshowed an increase…

htt

Show Full Abstract

Huntington's disease (HD) is caused by an abnormal expansion of CAG trinucleotide repeats encoding polyglutamine (polyQ) in the first exon of the huntingtin (htt) gene. Despite considerable efforts, the pathogenesis of HD remains largely unclear due to a paucity of models that can reliably reproduce the pathological characteristics of HD. Here, we report a neuronal cell model of HD using the previously established tetracycline regulated rat neuroprogenitor cell line, HC2S2. Stable expression of enhanced green fluorescence protein tagged htt exon 1 (referred to as 28Q and 74Q, respectively) in the HC2S2 cells did not affect rapid neuronal differentiation. However, compared to the cells expressing wild type htt, the cell line expressing mutant htt showed an increase in time-dependent cell death and neuritic degeneration, and displayed increased vulnerability to oxidative stress. Increased protein aggregation during the process of neuronal aging or when the cells were exposed to oxidative stress reagents was detected in the cell line expressing 74Q but not in its counterpart. These results suggest that the neuroprogenitor cell lines mimic the major neuropathological characteristics of HD and may provide a useful tool for studying the neuropathogenesis of HD and for high throughput screening of therapeutic compounds.

Also flagged:gene expressionhibernationlipidcatabolismprotein biosynthesisRNA binding protein motif 3
Journal Article 2011-03-31 ✓ 2 Snippets Fedorov VB, Goropashnaya AV, Tøien Ø, Stewart NC, Chang C, Wang H, Yan J, Showe LC, Showe MK, Barnes BM.
In-Text Gene Mentions

…Usp7 ) andF-box and leucine-rich repeat protein 4and leucine-rich repeat…

…protein 4 (Fbxl4) were over…

Show Full Abstract

<h4>Background</h4>Hibernation is an adaptive strategy to survive in highly seasonal or unpredictable environments. The molecular and genetic basis of hibernation physiology in mammals has only recently been studied using large scale genomic approaches. We analyzed gene expression in the American black bear, Ursus americanus, using a custom 12,800 cDNA probe microarray to detect differences in expression that occur in heart and liver during winter hibernation in comparison to summer active animals.<h4>Results</h4>We identified 245 genes in heart and 319 genes in liver that were differentially expressed between winter and summer. The expression of 24 genes was significantly elevated during hibernation in both heart and liver. These genes are mostly involved in lipid catabolism and protein biosynthesis and include RNA binding protein motif 3 (Rbm3), which enhances protein synthesis at mildly hypothermic temperatures. Elevated expression of protein biosynthesis genes suggests induction of translation that may be related to adaptive mechanisms reducing cardiac and muscle atrophies over extended periods of low metabolism and immobility during hibernation in bears. Coordinated reduction of transcription of genes involved in amino acid catabolism suggests redirection of amino acids from catabolic pathways to protein biosynthesis. We identify common for black bears and small mammalian hibernators transcriptional changes in the liver that include induction of genes responsible for fatty acid β oxidation and carbohydrate synthesis and depression of genes involved in lipid biosynthesis, carbohydrate catabolism, cellular respiration and detoxification pathways.<h4>Conclusions</h4>Our findings show that modulation of gene expression during winter hibernation represents molecular mechanism of adaptation to extreme environments.

Also flagged:chromosomesmatingbenzocaineethanolProteinase KRNase A
Journal Article 2011-03-31 No Snippets Wells DE, Gutierrez L, Xu Z, Krylov V, Macha J, Blankenburg KP, Hitchens M, Bellot LJ, Spivey M, Stemple DL, Kowis A, Ye Y, Pasternak S, Owen J, Tran T, Slavikova R, Tumova L, Tlapakova T, Seifertova E, Scherer SE, Sater AK.
Show Full Abstract

We present a genetic map for Xenopus tropicalis, consisting of 2886 Simple Sequence Length Polymorphism (SSLP) markers. Using a bioinformatics-based strategy, we identified unique SSLPs within the X. tropicalis genome. Scaffolds from X. tropicalis genome assembly 2.0 (JGI) were scanned for Simple Sequence Repeats (SSRs); unique SSRs were then tested for amplification and polymorphisms using DNA from inbred Nigerian and Ivory Coast individuals. Thus identified, the SSLPs were genotyped against a mapping cross panel of DNA samples from 190 F2 individuals. Nearly 4000 SSLPs were genotyped, yielding a 2886-marker genetic map consisting of 10 major linkage groups between 73 and 132cM in length, and 4 smaller linkage groups between 7 and 40cM. The total effective size of the map is 1658cM, and the average intermarker distance for each linkage group ranged from 0.27 to 0.75cM. Fluorescence In Situ Hybridization (FISH) was carried out using probes for genes located on mapped scaffolds to assign linkage groups to chromosomes. Comparisons of this map with the X. tropicalis genome Assembly 4.1 (JGI) indicate that the map provides representation of a minimum of 66% of the X. tropicalis genome, incorporating 758 of the approximately 1300 scaffolds over 100,000bp. The genetic map and SSLP marker database constitute an essential resource for genetic and genomic analyses in X. tropicalis.

Also flagged:neurodegenerative diseaseHDpolyglutamineglutaminesHuntington's Diseasepathogenesis
Journal Article 2011-03-31 ✓ 3 Snippets Reinhart PH, Kaltenbach LS, Essrich C, Dunn DE, Eudailey JA, DeMarco CT, Turmel GJ, Whaley JC, Wood A, Cho S, Lo DC.
In-Text Gene Mentions

…provided neuroprotection against HTT fragment-induced neurodegeneration. The…

…acellular huntingtin protein (HTT)-containing inclusions and th…

HTT

Show Full Abstract

Huntington's disease (HD) is a late-onset, neurodegenerative disease for which there are currently no cures nor disease-modifying treatments. Here we report the identification of several potential anti-inflammatory targets for HD using an ex vivo model of HD that involves the acute transfection of human mutant huntingtin-based constructs into rat brain slices. This model recapitulates key components of the human disease, including the formation of intracellular huntingtin protein (HTT)-containing inclusions and the progressive neurodegeneration of striatal neurons-both occurring within the native tissue context of these neurons. Using this "high-throughput biology" screening platform, we conducted a hypothesis-neutral screen of a collection of drug-like compounds which identified several anti-inflammatory targets that provided neuroprotection against HTT fragment-induced neurodegeneration. The nature of these targets provide further support for non-cell autonomous mechanisms mediating significant aspects of neuropathogenesis induced by mutant HTT fragment proteins.

Also flagged:neurodegenerative diseasesneurodegenerative disordersMolecular chaperonesdegradationchaperonesextracellular
Journal Article 2011-03-31 ✓ 1 Snippet Wolfe KJ, Cyr DM, Cyr DM.
In-Text Gene Mentions

Htt

Show Full Abstract

Accumulation of amyloid-like aggregates is a hallmark of numerous neurodegenerative disorders such as Alzheimer's and polyglutamine disease. Yet, whether the amyloid inclusions found in these diseases are toxic or cytoprotective remains unclear. Various studies suggest that the toxic culprit in the amyloid folding pathway is actually a soluble oligomeric species which might interfere with normal cellular function by a multifactorial mechanism including aberrant protein-protein interactions. Molecular chaperones suppress toxicity of amyloidogenic proteins by inhibiting aggregation of non-native disease substrates and targeting them for refolding or degradation. Paradoxically, recent studies also suggest a protective action of chaperones in their promotion of the assembly of large, tightly packed, benign aggregates that sequester toxic protein species.

Also flagged:cancerlung cancerprostate cancerprostate cancerstesticular cancercancers
Journal Article 2011-03-31 No Snippets Hindorff LA, Gillanders EM, Manolio TA.
Show Full Abstract

Genome-wide association studies have broadened our understanding of the genetic architecture of cancer to include common variants, in addition to the rare variants previously identified by linkage analysis. We review current knowledge on the genetic architecture of four cancers--breast, lung, prostate and colorectal--for which the balance of common and rare alleles identified ranges from fewer common alleles (lung cancer) to more common alleles (prostate cancer). Although most variants are cancer specific, pleiotropy has been observed for several variants, for example, variants at the 8q24 locus and breast, ovarian and prostate cancers or variants in KITLG in relation to hair color and testicular cancer. Although few studies have been adequately powered to investigate heterogeneity among ancestry groups, effect sizes associated with common variants have been reported to be fairly homogenous among ethnic groups. Some associations appear to be ancestry specific, such as HNF1B, which is associated with prostate cancer in European Americans and Latinos but not in African-Americans. Studies of cancer and other complex diseases suggest that a simple dichotomy between rare and common allelic architectures may be too simplistic and that future research is needed to characterize a fuller spectrum of allele frequency (common (>5%), uncommon (1-5%) and rare (<<1%) alleles) and effect size. In addition, a broadening of the concept of genetic architecture to encompass both population architecture, which reflects differences in exposures, genetic factors and population level risk among diverse groups of people, and genomic architecture, which includes structural, epigenomic and somatic variation, is envisioned.

Also flagged:TRIM5αbindingfactorsFv1capsid proteinsCA
Journal Article 2011-03-31 No Snippets Ohkura S, Goldstone DC, Yap MW, Holden-Dye K, Taylor IA, Stoye JP.
Show Full Abstract

After entry into target cells, retroviruses encounter the host restriction factors such as Fv1 and TRIM5α. While it is clear that these factors target retrovirus capsid proteins (CA), recognition remains poorly defined in the absence of structural information. To better understand the binding interaction between TRIM5α and CA, we selected a panel of novel N-tropic murine leukaemia virus (N-MLV) escape mutants by a serial passage of replication competent N-MLV in rhesus macaque TRIM5α (rhTRIM5α)-positive cells using a small percentage of unrestricted cells to allow multiple rounds of virus replication. The newly identified mutations, many of which involve changes in charge, are distributed over the outer 'top' surface of N-MLV CA, including the N-terminal β-hairpin, and map up to 29 A(o) apart. Biological characterisation with a number of restriction factors revealed that only one of the new mutations affects restriction by human TRIM5α, indicating significant differences in the binding interaction between N-MLV and the two TRIM5αs, whereas three of the mutations result in dual sensitivity to Fv1(n) and Fv1(b). Structural studies of two mutants show that no major changes in the overall CA conformation are associated with escape from restriction. We conclude that interactions involving much, if not all, of the surface of CA are vital for TRIM5α binding.

Also flagged:Ascl1transcription factorembryogenesisneurogenesistamoxifenNestin
Journal Article 2011-03-31 ✓ 2 Snippets Kim EJ, Ables JL, Dickel LK, Eisch AJ, Johnson JE.
In-Text Gene Mentions

It has also recently been shown to be a criticalcomponent in the cocktail, along with Pou3f2 and Mytl1, for directly reprogrammingfibroblasts to neurons [3], and it has aberrant expression in neural tumors such asglioblastoma [22], [23].

…cocktail, along withPou3f2and Mytl1, for…

Show Full Abstract

Ascl1 (Mash1) is a bHLH transcription factor essential for neural differentiation during embryogenesis but its role in adult neurogenesis is less clear. Here we show that in the adult brain Ascl1 is dynamically expressed during neurogenesis in the dentate gyrus subgranular zone (SGZ) and more rostral subventricular zone (SVZ). Specifically, we find Ascl1 levels low in SGZ Type-1 cells and SVZ B cells but increasing as the cells transition to intermediate progenitor stages. In vivo genetic lineage tracing with a tamoxifen (TAM) inducible Ascl1CreERT2 knock-in mouse strain shows that Ascl1 lineage cells continuously generate new neurons over extended periods of time. There is a regionally-specific difference in neuron generation, with mice given TAM at postnatal day 50 showing new dentate gyrus neurons through 30 days post-TAM, but showing new olfactory bulb neurons even 180 days post-TAM. These results show that Ascl1 is not restricted to transit amplifying populations but is also found in a subset of neural stem cells with long-term neurogenic potential in the adult brain.

Also flagged:dopamineserotoninmetabolismHuntington diseaseHDanxiety
Journal Article 2011-03-31 ✓ 2 Snippets Mochel F, Durant B, Durr A, Schiffmann R.
In-Text Gene Mentions

HD is caused by a CAG repeat expansion in the HTT gene that encodes huntingtin [1], [2].

…prior to theHTTgene identification [23]…

Show Full Abstract

The pattern of cerebral dopamine (DA) abnormalities in Huntington disease (HD) is complex, as reflected by the variable clinical benefit of both DA antagonists and agonists in treating HD symptoms. In addition, little is known about serotonin metabolism despite the early occurrence of anxiety and depression in HD. Post-mortem enzymatic changes are likely to interfere with the in vivo profile of biogenic amines. Hence, in order to reliably characterize the regional and chronological profile of brain neurotransmitters in a HD mouse model, we used a microwave fixation system that preserves in vivo concentrations of dopaminergic and serotoninergic amines. DA was decreased in the striatum of R6/2 mice at 8 and 12 weeks of age while DA metabolites, 3-methoxytyramine and homovanillic acid, were already significantly reduced in 4-week-old motorically asymptomatic R6/2 mice. In the striatum, hippocampus and frontal cortex of 4, 8 and 12-week-old R6/2 mice, serotonin and its metabolite 5-hydroxyindoleacetic acid were significantly decreased in association with a decreased turnover of serotonin. In addition, automated high-resolution behavioural analyses displayed stress-like behaviours such as jumping and grooming and altered spatial learning in R6/2 mice at age 4 and 6 weeks respectively. Therefore, we describe the earliest alterations of DA and serotonin metabolism in a HD murine model. Our findings likely underpin the neuropsychological symptoms at time of disease onset in HD.

Also flagged:ironmetabolismiron deficiencybindingTFexcretion
Journal Article 2011-03-31 ✓ 5 Snippets McLaren CE, Garner CP, Constantine CC, McLachlan S, Vulpe CD, Snively BM, Gordeuk VR, Nickerson DA, Cook JD, Leiendecker-Foster C, Beckman KB, Eckfeldt JH, Barcellos LF, Murray JA, Adams PC, Acton RT, Killeen AA, McLaren GD.
In-Text Gene Mentions

…y in theHemochromatosisand Iron Overload…

…mutation in theHFEgene; rs7787204 on…

…mutation in theHFEgene also were…

…identified in theHemochromatosisand Iron Overload…

…mutations of theHFEgene [9] .…

Show Full Abstract

The existence of multiple inherited disorders of iron metabolism in man, rodents and other vertebrates suggests genetic contributions to iron deficiency. To identify new genomic locations associated with iron deficiency, a genome-wide association study (GWAS) was performed using DNA collected from white men aged≥25 y and women≥50 y in the Hemochromatosis and Iron Overload Screening (HEIRS) Study with serum ferritin (SF)≤12 µg/L (cases) and iron replete controls (SF>100 µg/L in men, SF>50 µg/L in women). Regression analysis was used to examine the association between case-control status (336 cases, 343 controls) and quantitative serum iron measures and 331,060 single nucleotide polymorphism (SNP) genotypes, with replication analyses performed in a sample of 71 cases and 161 controls from a population of white male and female veterans screened at a US Veterans Affairs (VA) medical center. Five SNPs identified in the GWAS met genome-wide statistical significance for association with at least one iron measure, rs2698530 on chr. 2p14; rs3811647 on chr. 3q22, a known SNP in the transferrin (TF) gene region; rs1800562 on chr. 6p22, the C282Y mutation in the HFE gene; rs7787204 on chr. 7p21; and rs987710 on chr. 22q11 (GWAS observed P<1.51×10(-7) for all). An association between total iron binding capacity and SNP rs3811647 in the TF gene (GWAS observed P=7.0×10(-9), corrected P=0.012) was replicated within the VA samples (observed P=0.012). Associations with the C282Y mutation in the HFE gene also were replicated. The joint analysis of the HEIRS and VA samples revealed strong associations between rs2698530 on chr. 2p14 and iron status outcomes. These results confirm a previously-described TF polymorphism and implicate one potential new locus as a target for gene identification.

Also flagged:cardiac arrhythmiasAtrial fibrillationAFcardiac arrhythmiaparoxysmal AFheart disease
Journal Article 2011-03-31 No Snippets Schmidt C, Kisselbach J, Schweizer PA, Katus HA, Thomas D.
Show Full Abstract

Atrial fibrillation (AF) is the most frequently encountered sustained cardiac arrhythmia in clinical practice and a major cause of morbidity and mortality. Effective treatment of AF still remains an unmet medical need. Treatment of AF is based on drug therapy and ablative strategies. Antiarrhythmic drug therapy is limited by a relatively high recurrence rate and proarrhythmic side effects. Catheter ablation suppresses paroxysmal AF in the majority of patients without structural heart disease but is more difficult to achieve in patients with persistent AF or with concomitant cardiac disease. Stroke is a potentially devastating complication of AF, requiring anticoagulation that harbors the risk of bleeding. In search of novel treatment modalities, targeted pharmacological treatment and gene therapy offer the potential for greater selectivity than conventional small-molecule or interventional approaches. This paper summarizes the current understanding of molecular mechanisms underlying AF. Established drug therapy and interventional treatment of AF is reviewed, and emerging clinical and experimental therapeutic approaches are highlighted.

Also flagged:cerebral arterial stenosisfacial palsyHBV infectionlamivudineHBHepatitis B Virus Infection
Journal Article 2011-03-31 ✓ 1 Snippet Kim JT, Park MS, Nam TS, Choi SM, Lee SH, Kim BC, Kim MK, Cho KH.
In-Text Gene Mentions

…protein-C, protein-S, andantithrombin-IIIalso produced normal…

Show Full Abstract

<h4>Background</h4>There are conflicting findings regarding the association between hepatitis B (HB) virus (HBV) infection and atherosclerosis.<h4>Case report</h4>A 34-year-old man was admitted for transient dysarthria and facial palsy. Ten years previously he had been diagnosed with HBV infection and treated with lamivudine (100 mg/day). Reactivation of HBV was detected 6 months before this recent admission. Serologic tests revealed that he was positive for HB early antigen, HB surface antigen, and anti-HB core. Brain magnetic resonance images were normal, but magnetic resonance angiograms revealed severe stenosis of the right middle cerebral artery, both external carotid arteries, and the basilar artery.<h4>Conclusions</h4>This case report reveals that a young patient with reactivated HBV developed multiple arterial stenoses even though he had no risk factors for this disease.

Also flagged:lung cancercancertumortoTyrosine kinaseepidermal growth factor receptor
Journal Article 2011-03-31 No Snippets Enfield KS, Stewart GL, Pikor LA, Alvarez CE, Lam S, Lam WL, Chari R.
Show Full Abstract

Chemotherapy resistance is a key contributor to the dismal prognoses for lung cancer patients. While the majority of studies have focused on sequence mutations and expression changes in protein-coding genes, recent reports have suggested that microRNA (miRNA) expression changes also play an influential role in chemotherapy response. However, the role of genetic alterations at miRNA loci in the context of chemotherapy response has yet to be investigated. In this study, we demonstrate the application of an integrative, multidimensional approach in order to identify miRNAs that are associated with chemotherapeutic resistance and sensitivity utilizing publicly available drug response, miRNA loci copy number, miRNA expression, and mRNA expression data from independent resources. By instigating a logical stepwise strategy, we have identified specific miRNAs that are associated with resistance to several chemotherapeutic agents and provide a proof of principle demonstration of how these various databases may be exploited to derive relevant pharmacogenomic results.

Also flagged:acute lymphoblastic leukemiaALLchromosometyrosine kinaseimatinibdasatinib
Journal Article 2011-03-31 No Snippets Koo HH.
Show Full Abstract

In pediatric patients with acute lymphoblastic leukemia (ALL), the Philadelphia chromosome translocation is uncommon, with a frequency of less than 5%. However, it is classified as a high or very high risk, and only 20-30% of Philadelphia chromosome-positive (Ph+) children with ALL are cured with chemotherapy alone. Allogeneic hematopoietic stem cell transplantation from a closely matched donor cures 60% of patients in first complete remission. Recent data suggest that chemotherapy plus tyrosine kinase inhibitors (TKIs) may be the initial treatment of choice for Ph+ ALL in children. However, longer observation is required to determine whether long-term outcome with intensive imatinib and chemotherapy is indeed equivalent to that with allogeneic related or alternative donor hematopoietic stem cell transplantation (HSCT). Reports on the use of second-generation TKIs in children with Ph+ ALL are limited. A few case reports have indicated the feasibility and clinical benefit of using dasatinib as salvage therapy enabling HSCT. However, more extensive data from clinical trials are needed to determine whether the administration of second-generation TKIs in children is comparable to that in adults. Because Ph+ ALL is rare in children, the question of whether HSCT could be a dispensable part of their therapy may not be answered for some time. An international multicenter study is needed to answer the question of whether imatinib plus chemotherapy could replace sibling allogeneic HSCT in children with Ph+ ALL.

Also flagged:serotonin5-hydroxytrptamine5-hydroxyindolacetic acid5-HT transporterbehavioralhyperalgesia
Journal Article 2011-03-30 ✓ 5 Snippets Chen Y, Palm F, Lesch KP, Gerlach M, Moessner R, Sommer C.
In-Text Gene Mentions

In addition, 5-HTT is the target of antidepressants known as selective serotonin reuptake inhibitors (SSRIs) such as fluoxetine and paroxetine [11].

…the 5-HT transporter (5-HTT-/- mice) using behavioral…

…were lower in5-HTT-/- mice than in…

…used homozygous knock-out (5-HTT-/-) mice and littermate…

…of 5-HIAA in5-HTT-/- mice with known…

Show Full Abstract

<h4>Background</h4>The role of serotonin (5-hydroxytrptamine, 5-HT) in the modulation of pain has been widely studied. Previous work led to the hypothesis that 5-hydroxyindolacetic acid (5-HIAA), a main metabolite of serotonin, might by itself influence pain thresholds.<h4>Results</h4>In the present study, we investigated the role of 5-HIAA in inflammatory pain induced by intraplantar injection of complete Freund's adjuvant (CFA) into the hind paw of mice. Wild-type mice were compared to mice deficient of the 5-HT transporter (5-HTT-/- mice) using behavioral tests for hyperalgesia and high-performance liquid chromatography (HPLC) to determine tissue levels of 5-HIAA. Wild-type mice reproducibly developed thermal hyperalgesia and paw edema for 5 days after CFA injection. 5-HTT-/- mice treated with CFA had reduced thermal hyperalgesia on day 1 after CFA injection and normal responses to heat thereafter. The 5-HIAA levels in spinal cord and sciatic nerve as measured with HPLC were lower in 5-HTT-/- mice than in wild-type mice after CFA injection. Pretreatment of wild-type mice with intraperitoneal injection of para-chlorophenylalanine (p-CPA), a serotonin synthesis inhibitor, resulted in depletion of the 5-HIAA content in spinal cord and sciatic nerve and decrease in thermal hyperalgesia in CFA injected mice. The application of exogenous 5-HIAA resulted in potentiation of thermal hyperalgesia induced by CFA in 5-HTT-/- mice and in wild-type mice pretreated with p-CPA, but not in wild-type mice without p-CPA pretreatment. Further, methysergide, a broad-spectrum serotonin receptor antagonist, had no effect on 5-HIAA-induced potentiation of thermal hyperalgesia in CFA-treated wild-type mice.<h4>Conclusion</h4>Taken together, the present results suggest that 5-HIAA plays an important role in modulating peripheral thermal hyperalgesia in CFA induced inflammation, probably via a non-serotonin receptor mechanism.

Also flagged:glycosylphosphatidylinositolGlycosylphosphatidylinositolsglycosylphospholipidsglycoproteinslipophosphoglycansmembrane
Journal Article 2011-03-30 No Snippets Nikolaev AV, Al-Maharik N.
Show Full Abstract

No abstract available.

Also flagged:oxygenmetabolismcell cyclechromosomeCD93ESAM
Journal Article 2011-03-30 No Snippets Basciano L, Nemos C, Foliguet B, de Isla N, de Carvalho M, Tran N, Dalloul A.
Show Full Abstract

<h4>Background</h4>In the bone marrow, hematopietic and mesenchymal stem cells form a unique niche in which the oxygen tension is low. Hypoxia may have a role in maintaining stem cell fate, self renewal and multipotency. However, whereas most studies addressed the effect of transient in vitro exposure of MSC to hypoxia, permanent culture under hypoxia should reflect the better physiological conditions.<h4>Results</h4>Morphologic studies, differentiation and transcriptional profiling experiments were performed on MSC cultured in normoxia (21% O2) versus hypoxia (5% O2) for up to passage 2. Cells at passage 0 and at passage 2 were compared, and those at passage 0 in hypoxia generated fewer and smaller colonies than in normoxia. In parallel, MSC displayed (>4 fold) inhibition of genes involved in DNA metabolism, cell cycle progression and chromosome cohesion whereas transcripts involved in adhesion and metabolism (CD93, ESAM, VWF, PLVAP, ANGPT2, LEP, TCF1) were stimulated. Compared to normoxic cells, hypoxic cells were morphologically undifferentiated and contained less mitochondrias. After this lag phase, cells at passage 2 in hypoxia outgrew the cells cultured in normoxia and displayed an enhanced expression of genes (4-60 fold) involved in extracellular matrix assembly (SMOC2), neural and muscle development (NOG, GPR56, SNTG2, LAMA) and epithelial development (DMKN). This group described herein for the first time was assigned by the Gene Ontology program to "plasticity".<h4>Conclusion</h4>The duration of hypoxemia is a critical parameter in the differentiation capacity of MSC. Even in growth promoting conditions, hypoxia enhanced a genetic program that maintained the cells undifferentiated and multipotent. This condition may better reflect the in vivo gene signature of MSC, with potential implications in regenerative medicine.

Also flagged:Depressionosteoporosisserotoninmembranelow-density lipoprotein receptor-related protein 5tryptophan hydroxylase 2
Journal Article 2011-03-30 ✓ 2 Snippets Cocchi M, Tonello L, Gabrielli F, Pregnolato M.
In-Text Gene Mentions

Moreover, it is believed that the hereditary or acquired involvement of tryptophan hydroxylase 2 (Tph2) or 5-hydroxytryptamine transporter (5-HTT) is responsible for the reduced concentration of serotonin in the central nervous system, causing depression and affective disorders.

…ydroxytryptamine transporter (5-HTT) is responsible for…

Show Full Abstract

Due to the relationship between biology and culture, we believe that depression, understood as a cultural and existential phenomenon, has clear markers in molecular biology. We begin from an existential analysis of depression constituting the human condition and then shift to analysis of biological data confirming, according to our judgment, its original (ontological) structure. In this way philosophy is involved at the anthropological level, in as much as it detects the underlying meanings of depression in the original biological-cultural horizon of human life. Considering the integration of knowledge it is the task of molecular biology to identify the aforementioned markers, to which the existential aspects of depression are linked to. In particular, recent works show the existence of a link between serotonin and osteoporosis as a result of a modified expression of the low-density lipoprotein receptor-related protein 5 gene. Moreover, it is believed that the hereditary or acquired involvement of tryptophan hydroxylase 2 (Tph2) or 5-hydroxytryptamine transporter (5-HTT) is responsible for the reduced concentration of serotonin in the central nervous system, causing depression and affective disorders. This work studies the depression-osteoporosis relationship, with the aim of focusing on depressive disorders that concern the quantitative dynamic of platelet membrane viscosity and interactome cytoskeleton modifications (in particular Tubulin and Gsα protein) as a possible condition of the involvement of the serotonin axis (gut, brain and platelet), not only in depression but also in connection with osteoporosis.

Also flagged:gene expressioncircadian rhythmgrowth hormoneimmune responseandrogenlipid
Journal Article 2011-03-30 ✓ 2 Snippets Vedell PT, Svenson KL, Churchill GA.
In-Text Gene Mentions

Genes in the high expression subset, specifically Tnfrsf1a and Ptgis, are involved in the conversion of the essential fatty acid arachidonic acid to prostaglandins.

…specifically Tnfrsf1a andPtgis, are involved…

Show Full Abstract

<h4>Background</h4>Transcripts can exhibit significant variation in tissue samples from inbred laboratory mice. We have designed and carried out a microarray experiment to examine transcript variation across samples from adipose, heart, kidney, and liver tissues of C57BL/6J mice and to partition variation into within-mouse and between-mouse components. Within-mouse variance captures variation due to heterogeneity of gene expression within tissues, RNA-extraction, and array processing. Between-mouse variance reflects differences in transcript abundance between genetically identical mice.<h4>Results</h4>The nature and extent of transcript variation differs across tissues. Adipose has the largest total variance and the largest within-mouse variance. Liver has the smallest total variance, but it has the most between-mouse variance. Genes with high variability can be classified into groups with correlated patterns of expression that are enriched for specific biological functions. Variation between mice is associated with circadian rhythm, growth hormone signaling, immune response, androgen regulation, lipid metabolism, and the extracellular matrix. Genes showing correlated patterns of within-mouse variation are also associated with biological functions that largely reflect heterogeneity of cell types within tissues.<h4>Conclusions</h4>Genetically identical mice can experience different individual outcomes for medically important traits. Variation in gene expression observed between genetically identical mice can identify functional classes of genes that are likely to vary in the absence of experimental perturbations, can inform experimental design decisions, and provides a baseline for the interpretation of gene expression data in interventional studies. The extent of transcript variation among genetically identical mice underscores the importance of stochastic and micro-environmental factors and their phenotypic consequences.

Also flagged:migraineSerotoninpathogenesisserotonin transporter
Journal Article 2011-03-30 ✓ 5 Snippets Liu H, Liu M, Wang Y, Wang XM, Qiu Y, Long JF, Zhang SP.
In-Text Gene Mentions

Existing evidence indicates that the 5-HTT VNTR polymorphism (mainly the STin2.12 genotype) is associated with an increased risk of migraine in the general population.

<h4>Background/aims</h4>Serotonin is known to play an important role in the pathogenesis of migraine, but individual genetic association studies that examine the relationship between polymorphisms of serotonin transporter (5-HTT) gene and migraine have yielded inconsistent results.

This study aimed to evaluate the association between 5-HTT gene variants (including 5-HTTLPR, VNTR and SNP) and migraine using systematic review with meta-analysis.<h4>Methods</h4>Relevant studies were identified by searching English and Chinese databases extensively.

Association of 5-HTT gene polymorphisms with migraine: a systematic review and meta-analysis.

…Association of5-HTTgene polymorphisms with…

Show Full Abstract

<h4>Background/aims</h4>Serotonin is known to play an important role in the pathogenesis of migraine, but individual genetic association studies that examine the relationship between polymorphisms of serotonin transporter (5-HTT) gene and migraine have yielded inconsistent results. This study aimed to evaluate the association between 5-HTT gene variants (including 5-HTTLPR, VNTR and SNP) and migraine using systematic review with meta-analysis.<h4>Methods</h4>Relevant studies were identified by searching English and Chinese databases extensively. Allele and genotype frequencies for each included study were extracted. The odds ratio (OR) was calculated using a random-effects or fixed-effects model. Q statistic was used to evaluate homogeneity, and Egger's test and Funnel plot were used to assess publication bias. For family-based association studies, a descriptive analysis was carried out.<h4>Results</h4>A total of 15 studies were identified for meta-analysis. It was found that the 5-HTT VNTR Stin2.12 allele or 12/12 genotype had an increased risk for migraine in the general population (Stin2.12 allele: OR, 95% CI: 1.34, 1.09-1.64, p=0.006; 12/12 genotype: OR, 95% CI: 1.55, 1.17-2.05, p=0.002), but there was no significant association between migraine and 5-HTTLPR or SNP rs2020942.<h4>Conclusions</h4>Existing evidence indicates that the 5-HTT VNTR polymorphism (mainly the STin2.12 genotype) is associated with an increased risk of migraine in the general population. Future studies with larger sample sizes will be necessary to confirm the present results.

Also flagged:tyrosine kinasechronic myeloid leukemiaimatinibbindingBCR-ABLCML
Journal Article 2011-03-30 No Snippets Silver RT.
Show Full Abstract

Significant advances in treatment and monitoring for patients with chronic myeloid leukemia have occurred over the last decade. With the introduction of the tyrosine kinase inhibitor imatinib, long-term outcomes have improved and new challenges, such as resistance, including mutations, have emerged. Research efforts into mutational analysis have intensified, with emphasis on the potential of using this technique to guide second-generation tyrosine kinase inhibitor selection. Although some data suggest that a small number of mutations may be associated with a less favorable response to treatment with one second-generation tyrosine kinase inhibitor versus another, these data need to be interpreted cautiously because they are derived primarily retrospectively from single-institution studies and a small number of patients. More research and clinical experience and a better understanding of the implications of in vitro data are needed before these data can be routinely incorporated into therapeutic decisions. Currently, there is no consensus on when to screen patients for mutations, what technique should be used, or how values should be reported. Selection of a second-generation tyrosine kinase inhibitor should therefore be based upon its toxicity profile in conjunction with the patient's comorbidities and the practitioner's experience.

Also flagged:CysteineHuntington diseaseHDneurodegenerative disorderpathogenesiscopper
Journal Article 2011-03-30 ✓ 2 Snippets Fox JH, Connor T, Stiles M, Kama J, Lu Z, Dorsey K, Lieberman G, Sapp E, Cherny RA, Banks M, Volitakis I, DiFiglia M, Berezovska O, Bush AI, Hersch SM.
In-Text Gene Mentions

In this study we report that oxidation-dependent oligomers of huntingtin form spontaneously in cell and mouse HD models.

htt

Show Full Abstract

Huntington disease (HD) is a progressive neurodegenerative disorder caused by expression of polyglutamine-expanded mutant huntingtin protein (mhtt). Most evidence indicates that soluble mhtt species, rather than insoluble aggregates, are the important mediators of HD pathogenesis. However, the differential roles of soluble monomeric and oligomeric mhtt species in HD and the mechanisms of oligomer formation are not yet understood. We have shown previously that copper interacts with and oxidizes the polyglutamine-containing N171 fragment of huntingtin. In this study we report that oxidation-dependent oligomers of huntingtin form spontaneously in cell and mouse HD models. Levels of these species are modulated by copper, hydrogen peroxide, and glutathione. Mutagenesis of all cysteine residues within N171 blocks the formation of these oligomers. In cells, levels of oligomerization-blocked mutant N171 were decreased compared with native N171. We further show that a subset of the oligomerization-blocked form of glutamine-expanded N171 huntingtin is rapidly depleted from the soluble pool compared with "native " mutant N171. Taken together, our data indicate that huntingtin is subject to specific oxidations that are involved in the formation of stable oligomers and that also delay removal from the soluble pool. These findings show that inhibiting formation of oxidation-dependent huntingtin oligomers, or promoting their dissolution, may have protective effects in HD by decreasing the burden of soluble mutant huntingtin.

Also flagged:Synthesisesterscarboxylic acids2-thiohydantoincholesterolhydantoin
Journal Article 2011-03-30 No Snippets Han J, Wang J, Dong H, Lei J, Wang M, Fang J.
Show Full Abstract

A series of novel 5-(4-hydroxybenzyl)-2-thioxoimidazolidin-4-one esters were synthesized under mild conditions by the reaction of 5-(4-hydroxybenzyl)-2-thioxoimidazolidin-4-one and carboxylic acids with DCC and DMAP as the promoters. Their structures were confirmed by ¹H-NMR, IR, ESI-MS and elemental analysis. The preliminary bioassy results indicated that some of compounds exhibit good herbicidal activity against Zea mays, Triticum aestivum and Arabidopsis thaliana. The further greenhouse test showed that compounds 6-16 and 6-28 have 60%, 50% and 50% efficacy against Stellaria media, Echinochloa crus-galli and Setaria viridis at 1,000 g/ha, respectively.

Also flagged:cancerchronic diseasescancerspolymerasesleepglucose
Journal Article 2011-03-30 No Snippets Wakai K, Hamajima N, Okada R, Naito M, Morita E, Hishida A, Kawai S, Nishio K, Yin G, Asai Y, Matsuo K, Hosono S, Ito H, Watanabe M, Kawase T, Suzuki T, Tajima K, Tanaka K, Higaki Y, Hara M, Imaizumi T, Taguchi N, Nakamura K, Nanri H, Sakamoto T, Horita M, Shinchi K, Kita Y, Turin TC, Rumana N, Matsui K, Miura K, Ueshima H, Takashima N, Nakamura Y, Suzuki S, Ando R, Hosono A, Imaeda N, Shibata K, Goto C, Hattori N, Fukatsu M, Yamada T, Tokudome S, Takezaki T, Niimura H, Hirasada K, Nakamura A, Tatebo M, Ogawa S, Tsunematsu N, Chiba S, Mikami H, Kono S, Ohnaka K, Takayanagi R, Watanabe Y, Ozaki E, Shigeta M, Kuriyama N, Yoshikawa A, Matsui D, Watanabe I, Inoue K, Ozasa K, Mitani S, Arisawa K, Uemura H, Hiyoshi M, Takami H, Yamaguchi M, Nakamoto M, Takeda H, Kubo M, Tanaka H, J-MICC Study Group.
Show Full Abstract

<h4>Background</h4>Most diseases are thought to arise from interactions between environmental factors and the host genotype. To detect gene-environment interactions in the development of lifestyle-related diseases, and especially cancer, the Japan Multi-institutional Collaborative Cohort (J-MICC) Study was launched in 2005.<h4>Methods</h4>We initiated a cross-sectional study to examine associations of genotypes with lifestyle and clinical factors, as assessed by questionnaires and medical examinations. The 4519 subjects were selected from among participants in the J-MICC Study in 10 areas throughout Japan. In total, 108 polymorphisms were chosen and genotyped using the Invader assay.<h4>Results</h4>The study group comprised 2124 men and 2395 women with a mean age of 55.8 ± 8.9 years (range, 35-69 years) at baseline. Among the 108 polymorphisms examined, 4 were not polymorphic in our study population. Among the remaining 104 polymorphisms, most variations were common (minor allele frequency ≥0.05 for 96 polymorphisms). The allele frequencies in this population were comparable with those in the HapMap-JPT data set for 45 Japanese from Tokyo. Only 5 of 88 polymorphisms showed allele-frequency differences greater than 0.1. Of the 108 polymorphisms, 32 showed a highly significant difference in minor allele frequency among the study areas (P < 0.001).<h4>Conclusions</h4>This comprehensive data collection on lifestyle and clinical factors will be useful for elucidating gene-environment interactions. In addition, it is likely to be an informative reference tool, as free access to genotype data for a large Japanese population is not readily available.

Also flagged:glycerolHog1Hog1 kinasemembrane proteinSln1-1phosphorylation
Journal Article 2011-03-30 No Snippets Schaber J, Flöttmann M, Li J, Tiger CF, Hohmann S, Klipp E.
Show Full Abstract

In systems biology uncertainty about biological processes translates into alternative mathematical model candidates. Here, the goal is to generate, fit and discriminate several candidate models that represent different hypotheses for feedback mechanisms responsible for downregulating the response of the Sho1 branch of the yeast high osmolarity glycerol (HOG) signaling pathway after initial stimulation. Implementing and testing these candidate models by hand is a tedious and error-prone task. Therefore, we automatically generated a set of candidate models of the Sho1 branch with the tool modelMaGe. These candidate models are automatically documented, can readily be simulated and fitted automatically to data. A ranking of the models with respect to parsimonious data representation is provided, enabling discrimination between candidate models and the biological hypotheses underlying them. We conclude that a previously published model fitted spurious effects in the data. Moreover, the discrimination analysis suggests that the reported data does not support the conclusion that a desensitization mechanism leads to the rapid attenuation of Hog1 signaling in the Sho1 branch of the HOG pathway. The data rather supports a model where an integrator feedback shuts down the pathway. This conclusion is also supported by dedicated experiments that can exclusively be predicted by those models including an integrator feedback.modelMaGe is an open source project and is distributed under the Gnu General Public License (GPL) and is available from http://modelmage.org.

Also flagged:Multiple sclerosisMSgait disorderglucocorticoidsvitamin D deficiencybone formation
Journal Article 2011-03-30 No Snippets Zikan V.
Show Full Abstract

Multiple sclerosis (MS) is a gait disorder characterized by acute episodes of neurological defects leading to progressive disability. Patients with MS have multiple risk factors for osteoporotic fractures, such as progressive immobilization, long-term glucocorticoids (GCs) treatment or vitamin D deficiency. The duration of motor disability appears to be a major contributor to the reduction of bone strength. The long term immobilization causes a marked imbalance between bone formation and resorption with depressed bone formation and a marked disruption of mechanosensory network of tightly connected osteocytes due to increase of osteocyte apoptosis. Patients with higher level of disability have also higher risk of falls that combined with a bone loss increases the frequency of bone fractures. There are currently no recommendations how to best prevent and treat osteoporosis in patients with MS. However, devastating effect of immobilization on the skeleton in patients with MS underscores the importance of adequate mechanical stimuli for maintaining the bone structure and its mechanical competence. The physical as well as pharmacological interventions which can counteract the bone remodeling imbalance, particularly osteocyte apoptosis, will be promising for prevention and treatment of osteoporosis in patients with MS.

Also flagged:response to lightEnolaselocalizationDSPtobinding
Journal Article 2011-03-29 No Snippets Smith WC, Bolch S, Dugger DR, Li J, Esquenazi I, Arendt A, Benzenhafer D, McDowell JH.
Show Full Abstract

<h4>Purpose</h4>Arrestin is in disequilibrium in photoreceptors, translocating between inner and outer segments in response to light. The purpose of this project was to identify the cellular component with which arrestin associates in the dark-adapted retina.<h4>Methods</h4>Retinas were cross-linked with 2.5 mM dithiobis(succinimidylpropionate) (DSP), and arrestin-containing complexes purified by anion-exchange chromatography. Tandem mass spectrometric analysis was used to identify the protein components in the complex. Enolase localization in photoreceptors was assessed by immunohistochemistry. Confirmation of interacting components was performed using immunoprecipitation and surface plasmon resonance (SPR). Enolase activity was also assessed in the presence of arrestin1.<h4>Results</h4>In retinas treated with DSP, arrestin cross-linked in a 125-kDa complex. The principal components of this complex were arrestin1 and enolase1. Both arrestin1 and -4 were pulled down with enolase1 when enolase1 was immunoprecipitated. In the dark-adapted retina, enolase1 co-localized with arrestin1 in the inner segments and outer nuclear layer, but remained in the inner segments when arrestin1 translocated in response to light adaptation. SPR of purified arrestin1 and enolase1 demonstrated direct binding between arrestin1 and enolase1. Arrestin1 modulated the catalytic activity of enolase1, slowing it by as much as 24%.<h4>Conclusions</h4>The results show that in the dark-adapted retina, arrestin1 and -4 interact with enolase1. The SPR data show that the interaction between arrestin1 and enolase1 was direct, not requiring a third element to form the complex. Arrestin1 slowed the catalytic activity of enolase1, suggesting that light-driven translocation of arrestin1 may modulate the metabolic activity of photoreceptors.

Also flagged:gene expressionresponses to oxidative stresscanceroxygenglucose oxidaseresponse to oxidative stress
Journal Article 2011-03-29 No Snippets Cortes DF, Sha W, Hower V, Blekherman G, Laubenbacher R, Akman S, Torti SV, Shulaev V.
Show Full Abstract

Oxidative stress plays a key role in breast carcinogenesis. To investigate whether normal and malignant breast epithelial cells differ in their responses to oxidative stress, we examined the global gene expression profiles of three cell types, representing cancer progression from a normal to a malignant stage, under oxidative stress. Normal human mammary epithelial cells (HMECs), an immortalized cell line (HMLER-1), and a tumorigenic cell line (HMLER-5) were exposed to increased levels of reactive oxygen species (ROS) by treatment with glucose oxidase. Functional analysis of the metabolic pathways enriched with differentially expressed genes demonstrated that normal and malignant breast epithelial cells diverge substantially in their response to oxidative stress. Whereas normal cells exhibit the up-regulation of antioxidant mechanisms, cancer cells are unresponsive to the ROS insult. However, the gene expression response of normal HMECs under oxidative stress is comparable to that of the malignant cells under normal conditions, indicating that altered redox status is persistent in breast cancer cells, which makes them resistant to increased generation of ROS. We discuss some of the possible adaptation mechanisms of breast cancer cells under persistent oxidative stress that differentiate them from normal mammary epithelial cells as regards the response to acute oxidative stress.

Also flagged:Notchaxonaxonsgrowth conesAblNetrin
Journal Article 2011-03-29 ✓ 1 Snippet Kuzina I, Song JK, Giniger E.
In-Text Gene Mentions

DCC

Show Full Abstract

Development of the segmented central nerve cords of vertebrates and invertebrates requires connecting successive neuromeres. Here, we show both how a pathway is constructed to guide pioneer axons between segments of the Drosophila CNS, and how motility of the pioneers along that pathway is promoted. First, canonical Notch signaling in specialized glial cells causes nearby differentiating neurons to extrude a mesh of fine projections, and shapes that mesh into a continuous carpet that bridges from segment to segment, hugging the glial surface. This is the direct substratum that pioneer axons follow as they grow. Simultaneously, Notch uses an alternate, non-canonical signaling pathway in the pioneer growth cones themselves, promoting their motility by suppressing Abl signaling to stimulate filopodial growth while presumably reducing substratum adhesion. This propels the axons as they establish the connection between successive segments.

Also flagged:Huntington's diseaseHDHdhcadherinadhesion proteinN-cadherin
Journal Article 2011-03-29 ✓ 1 Snippet Reis SA, Thompson MN, Lee JM, Fossale E, Kim HH, Liao JK, Moskowitz MA, Shaw SY, Dong L, Haggarty SJ, MacDonald ME, Seong IS.
In-Text Gene Mentions

Thus, mutant full-length huntingtin, via energetic deficit, contributes to decreased N-cadherin levels in striatal neurons, with detrimental effects on neurite maturation, strongly suggesting that N-cadherin-mediated signaling merits investigation early in the HD pathogenic disease process.

Show Full Abstract

The expanded CAG repeat that causes striatal cell vulnerability in Huntington's disease (HD) encodes a polyglutamine tract in full-length huntingtin that is correlated with cellular [ATP] and [ATP/ADP]. Since striatal neurons are vulnerable to energy deficit, we have investigated, in Hdh CAG knock-in mice and striatal cells, the hypothesis that decreased energetics may affect neuronal (N)-cadherin, a candidate energy-sensitive adhesion protein that may contribute to HD striatal cell sensitivity. In vivo, N-cadherin was sensitive to ischemia and to the effects of full-length mutant huntingtin, progressively decreasing in Hdh(Q111) striatum with age. In cultured striatal cells, N-cadherin was decreased by ATP depletion and STHdh(Q111) striatal cells exhibited dramatically decreased N-cadherin, due to decreased Cdh2 mRNA and enhanced N-cadherin turnover, which was partially normalized by adenine supplementation to increase [ATP] and [ATP/ADP]. Consistent with decreased N-cadherin function, STHdh(Q111) striatal cells displayed profound deficits in calcium-dependent N-cadherin-mediated cell clustering and cell-substratum adhesion, and primary Hdh(Q111) striatal neuronal cells exhibited decreased N-cadherin and an abundance of immature neurites, featuring diffuse, rather than clustered, staining for N-cadherin and synaptic vesicle markers, which was partially rescued by adenine treatment. Thus, mutant full-length huntingtin, via energetic deficit, contributes to decreased N-cadherin levels in striatal neurons, with detrimental effects on neurite maturation, strongly suggesting that N-cadherin-mediated signaling merits investigation early in the HD pathogenic disease process.

Also flagged:histone H1transcription factorschromatincore histoneshistonesprogesterone
Journal Article 2011-03-29 No Snippets Vicent GP, Nacht AS, Font-Mateu J, Castellano G, Gaveglia L, Ballaré C, Beato M.
Show Full Abstract

Gene regulation by external signals requires access of transcription factors to DNA sequences of target genes, which is limited by the compaction of DNA in chromatin. Although we have gained insight into how core histones and their modifications influence this process, the role of linker histones remains unclear. Here we show that, within the first minute of progesterone action, a complex cooperation between different enzymes acting on chromatin mediates histone H1 displacement as a requisite for gene induction and cell proliferation. First, activated progesterone receptor (PR) recruits the chromatin remodeling complexes NURF and ASCOM (ASC-2 [activating signal cointegrator-2] complex) to hormone target genes. The trimethylation of histone H3 at Lys 4 by the MLL2/MLL3 subunits of ASCOM, enhanced by the hormone-induced displacement of the H3K4 demethylase KDM5B, stabilizes NURF binding. NURF facilitates the PR-mediated recruitment of Cdk2/CyclinA, which is required for histone H1 displacement. Cooperation of ATP-dependent remodeling, histone methylation, and kinase activation, followed by H1 displacement, is a prerequisite for the subsequent displacement of histone H2A/H2B catalyzed by PCAF and BAF. Chromatin immunoprecipitation (ChIP) and sequencing (ChIP-seq) and expression arrays show that H1 displacement is required for hormone induction of most hormone target genes, some of which are involved in cell proliferation.

Also flagged:serotonin transporterpersonality disorderspsychiatric disordersPersonality Disorderobsessive-compulsive personality disorderPD
Journal Article 2011-03-29 ✓ 1 Snippet Blom RM, Samuels JF, Riddle MA, Joseph Bienvenu O, Grados MA, Reti IM, Eaton WW, Liang KY, Nestadt G.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Background</h4>The serotonin transporter (SERT) polymorphism (5HTTLPR) has been reported to be associated with several psychiatric conditions. Specific personality disorders could be intermediate factors in the known relationship between 5HTTLPR and psychiatric disorders. This is the first study to test the association between this polymorphism and dimensions of all DSM-IV personality disorders in a community sample.<h4>Methods</h4>374 white participants were assessed by clinical psychologists using the International Personality Disorder Examination (IPDE). Associations between dimensions of each DSM-IV personality disorder and the long (l) and short (s) alleles of the 5HTTLPR were evaluated using non-parametric tests and regression models.<h4>Results</h4>The s allele of the 5HTTLPR polymorphism was significantly associated with higher avoidant personality trait scores in the whole sample. Males with the s allele had a significantly lower likelihood of higher obsessive-compulsive personality disorder (OCPD) trait scores, whereas females with the s allele were likely to have higher OCPD personality trait scores.<h4>Conclusion</h4>This paper provides preliminary data on the relationship between personality disorders and the 5HTTLPR polymorphism. The relationship of the s allele and avoidant PD is consistent with findings of a nonspecific relationship of this polymorphism to anxiety and depressive disorders. Concerning the unusual sexual dimorphic result with OCPD, several hypotheses are presented. These findings need further replication, including a more detailed study of additional variants in SERT.

Also flagged:anaemiainterferonerythropoiesisribavirinzidovudinecoinfection
Journal Article 2011-03-29 ✓ 1 Snippet Butt AA, Umbleja T, Andersen JW, Chung RT, Sherman KE, ACTG A5178 Study Team.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>The association of anaemia with outcomes in the HCV/HIV coinfected persons undergoing HCV treatment remains unclear.<h4>Aims</h4>To study the incidence, predictors and management of anaemia, and its association with outcomes among persons treated with pegylated interferon and weight-based ribavirin.<h4>Methods</h4>Retrospective analysis of a prospective controlled treatment trial of HCV/HIV coinfection.<h4>Results</h4>Among 329 subjects enrolled, 40% developed anaemia during the first 12-18 weeks of treatment (median haemoglobin decrease at week 4: 2.2 g/dL). Among 169 subjects who achieved early virological response and received therapy for 72 weeks, 55% eventually developed anaemia. However, median haemoglobin levels stayed stable after 12-18 weeks of initial therapy. Among these 169 subjects, 45% were prescribed an erythropoiesis stimulating agent (ESA), with 17% receiving it prior to a drop in haemoglobin meeting protocol definition of anaemia. Only 27% completed the study without any ribavirin dose modification. Age >40 years, lower BMI, zidovudine use and lower entry haemoglobin were significant predictors of anaemia in the multi-covariate model. Among all 329, sustained virological response (SVR) rate was similar in those with or without anaemia (23% vs. 30%; P=0.17) with no evidence of association between anaemia or ESA use and treatment response.<h4>Conclusions</h4>Anaemia is common in HCV/HIV coinfected persons undergoing HCV treatment, and only a minority of them are able to maintain ribavirin dose. Persons with age >40 years, lower baseline haemoglobin and lower baseline BMI should be monitored carefully. Prescription of erythropoiesis stimulating agent is common, but anaemia or erythropoiesis stimulating agent use is not associated with SVR.

Also flagged:Werner's Syndromemetabolic diseaseinsulin resistanceptosismicrocephalynucleotide
Journal Article 2011-03-29 ✓ 5 Snippets Raffan E, Hurst LA, Turki SA, Carpenter G, Scott C, Daly A, Coffey A, Bhaskar S, Howard E, Khan N, Kingston H, Palotie A, Savage DB, O'Driscoll M, Smith C, O'Rahilly S, Barroso I, Semple RK.
In-Text Gene Mentions

Although she still does not fulfill clinical diagnostic criteria for Werner syndrome, the high penetrance of mutations in the WRN gene and the defective DCC seen in her LBLs, allied to the frontal hair thinning, loss of subcutaneous tissue from the extremities, and lack of pubertal growth spurt, has permitted a confident diagnosis of Werner syndrome to be made.

DCC, decatenation checkpoint control; DM, type II diabetes mellitus; DNA, deoxyribonucleic acid; dNTP, deoxynucleotide triphosphates; GATK, Genome Analysis Tool Kit; HOCM, hypertrophic obstructive cardiomyopathy; HRDC, helicase RNAseD C-terminal; IR, insulin resistance; MIM, Mendelian Inheritance in Man; NCBI, National Center for Biotechnology Information; NHS, National Health Service; NR, normal range; PCR, polymerase chain reaction; RQC, RecQ C-terminal; SHBG, sex hormone binding globulin; SNP, single nucleotide polymorphism; SNV, single nucleotide variants; SPRI, solid phase reversible immobilization; TM, trademark; VCF, variant calling file; WES, whole exome sequencing; WS, Werner's Syndrome.

…integrity of theDCCin LBLs from…

…exhibited a defectiveDCC, indicated by increased…

…and the defectiveDCCseen in her…

Show Full Abstract

Genetic diagnosis of inherited metabolic disease is conventionally achieved through syndrome recognition and targeted gene sequencing, but many patients receive no specific diagnosis. Next-generation sequencing allied to capture of expressed sequences from genomic DNA now offers a powerful new diagnostic approach. Barriers to routine diagnostic use include cost, and the complexity of interpreting results arising from simultaneous identification of large numbers of variants. We applied exome-wide sequencing to an individual, 16-year-old daughter of consanguineous parents with a novel syndrome of short stature, severe insulin resistance, ptosis, and microcephaly. Pulldown of expressed sequences from genomic DNA followed by massively parallel sequencing was undertaken. Single nucleotide variants were called using SAMtools prior to filtering based on sequence quality and existence in control genomes and exomes. Of 485 genetic variants predicted to alter protein sequence and absent from control data, 24 were homozygous in the patient. One mutation - the p.Arg732X mutation in the WRN gene - has previously been reported in Werner's syndrome (WS). On re-evaluation of the patient several early features of WS were detected including loss of fat from the extremities and frontal hair thinning. Lymphoblastoid cells from the proband exhibited a defective decatenation checkpoint, consistent with loss of WRN activity. We have thus diagnosed WS some 15 years earlier than average, permitting aggressive prophylactic therapy and screening for WS complications, illustrating the potential of exome-wide sequencing to achieve early diagnosis and change management of rare autosomal recessive disease, even in individual patients of consanguineous parentage with apparently novel syndromes.

Also flagged:colorectal cancermismatch repairKRASBRAFTGF-βtumors
Journal Article 2011-03-29 ✓ 1 Snippet Kulendran M, Stebbing JF, Marks CG, Rockall TA.
In-Text Gene Mentions

SMAD4 and deleted in Colorectal Cancer (DCC) are two important tumor suppressor genes found on the long are of chromosome 18 [13,14].

Show Full Abstract

It is an exciting time for all those engaged in the treatment of colorectal cancer. The advent of new therapies presents the opportunity for a personalized approach to the patient. This approach considers the complex genetic mechanisms involved in tumorigenesis in addition to classical clinicopathological staging. The potential predictive and prognostic biomarkers which have stemmed from the study of the genetic basis of colorectal cancer and therapeutics are discussed with a focus on mismatch repair status, KRAS, BRAF, 18qLOH, CIMP and TGF-β.

Also flagged:HEBKORCHSCHTBGRNOR
Journal Article 2011-03-28 ✓ 3 Snippets Goh WW, Lee YH, Zubaidah RM, Jin J, Dong D, Lin Q, Chung MC, Wong L.
In-Text Gene Mentions

…liver disease, (v)hemochromatosis, and (vi) other…

…ThePEBP1cluster, also highly…

…list, comprising membersPEBP1, AKT1, ESR1, HSP90AA1,…

Show Full Abstract

Current limitations in proteome analysis by high-throughput mass spectrometry (MS) approaches have sometimes led to incomplete (or inconclusive) data sets being published or unpublished. In this work, we used an iTRAQ reference data on hepatocellular carcinoma (HCC) to design a two-stage functional analysis pipeline to widen and improve the proteome coverage and, subsequently, to unveil the molecular changes that occur during HCC progression in human tumorous tissue. The first involved functional cluster analysis by incorporating an expansion step on a cleaned integrated network. The second used an in-house developed pathway database where recovery of shared neighbors was followed by pathway enrichment analysis. In the original MS data set, over 500 proteins were detected from the tumors of 12 male patients, but in this paper we reported an additional 1000 proteins after application of our bioinformatics pipeline. Through an integrative effort of network cleaning, community finding methods, and network analysis, we also uncovered several biologically interesting clusters implicated in HCC. We established that HCC transition from a moderate to poor stage involved densely connected clusters that comprised of PCNA, XRCC5, XRCC6, PARP1, PRKDC, and WRN. From our pathway enrichment analyses, it appeared that the HCC moderate stage, unlike the poor stage, is enriched in proteins involved in immune responses, thus suggesting the acquisition of immuno-evasion. Our strategy illustrates how an original oncoproteome could be expanded to one of a larger dynamic range where current technology limitations prevent/limit comprehensive proteome characterization.

Also flagged:pancreatic cancerchronic pancreatitispeptideTIMP1ICAM1AZGP1
Journal Article 2011-03-28 No Snippets Pan S, Chen R, Crispin DA, May D, Stevens T, McIntosh MW, Bronner MP, Ziogas A, Anton-Culver H, Brentnall TA.
Show Full Abstract

Pancreatic cancer is a lethal disease that is difficult to diagnose at early stages when curable treatments are effective. Biomarkers that can improve current pancreatic cancer detection would have great value in improving patient management and survival rate. A large scale quantitative proteomics study was performed to search for the plasma protein alterations associated with pancreatic cancer. The enormous complexity of the plasma proteome and the vast dynamic range of protein concentration therein present major challenges for quantitative global profiling of plasma. To address these challenges, multidimensional fractionation at both protein and peptide levels was applied to enhance the depth of proteomics analysis. Employing stringent criteria, more than 1300 proteins total were identified in plasma across 8-orders of magnitude in protein concentration. Differential proteins associated with pancreatic cancer were identified, and their relationship with the proteome of pancreatic tissue and pancreatic juice from our previous studies was discussed. A subgroup of differentially expressed proteins was selected for biomarker testing using an independent cohort of plasma and serum samples from well-diagnosed patients with pancreatic cancer, chronic pancreatitis, and nonpancreatic disease controls. Using ELISA methodology, the performance of each of these protein candidates was benchmarked against CA19-9, the current gold standard for a pancreatic cancer blood test. A composite marker of TIMP1 and ICAM1 demonstrate significantly better performance than CA19-9 in distinguishing pancreatic cancer from the nonpancreatic disease controls and chronic pancreatitis controls. In addition, protein AZGP1 was identified as a biomarker candidate for chronic pancreatitis. The discovery and technical challenges associated with plasma-based quantitative proteomics are discussed and may benefit the development of plasma proteomics technology in general. The protein candidates identified in this study provide a biomarker candidate pool for future investigations.

Also flagged:Ki-rasmucinous tumorsmucinous tumors of the appendixcolonic adenomascarcinomasmucinous tumors of the
Journal Article 2011-03-28 ✓ 2 Snippets Zauber P, Berman E, Marotta S, Sabbath-Solitare M, Bishop T.
In-Text Gene Mentions

…for APC andDCCgene loss of…

…the APC orDCCgenes.…

Show Full Abstract

<h4>Objective</h4>Low-grade mucinous tumors of the appendix appear to have a simple histological structure. Paradoxically, reports have suggested a greater frequency of Ki-ras gene mutation in these lesions than in more complex lesions such as benign colonic adenomas and carcinomas. We assessed several molecular genetic changes, including Ki-ras gene mutations, in a large series of low-grade mucinous tumors of the appendix.<h4>Material and methods</h4>We retrospectively ascertained low-grade mucinous tumors of the appendix from computerized pathology records. Extracted DNA was analyzed for APC and DCC gene loss of heterozygosity, microsatellite instability and for the presence of Ki-ras gene mutation using standard molecular techniques. Controls consisted of normal appendices, other appendiceal neoplasms, and ovarian mucinous cystadenomas.<h4>Results</h4>A total of 31 low-grade appendiceal mucinous tumors were identified. All were microsatellite stable and none demonstrated loss of heterozygosity for the APC or DCC genes. By contrast, all 31 lesions contained a Ki-ras gene mutation.<h4>Conclusions</h4>The presence of a Ki-ras gene mutation in all lesions, with no other molecular changes identified, strongly suggests a possible etiological role of the Ki-ras mutation in the development of this particular lesion of the appendix. Based on other work regarding intestinal bacteria, we hypothesize a relationship between chronic inflammation of the appendix from bacterial overgrowth and Ki-ras gene mutation.

Also flagged:lysosomesironFerritinlysosomedegradationautophagy
Journal Article 2011-03-28 ✓ 1 Snippet Asano T, Komatsu M, Yamaguchi-Iwai Y, Ishikawa F, Mizushima N, Iwai K.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Ferritin is a cytosolic protein that stores excess iron, thereby protecting cells from iron toxicity. Ferritin-stored iron is believed to be utilized when cells become iron deficient; however, the mechanisms underlying the extraction of iron from ferritin have yet to be fully elucidated. Here, we demonstrate that ferritin is degraded in the lysosome under iron-depleted conditions and that the acidic environment of the lysosome is crucial for iron extraction from ferritin and utilization by cells. Ferritin was targeted for degradation in the lysosome even under iron-replete conditions in primary cells; however, the mechanisms underlying lysosomal targeting of ferritin were distinct under depleted and replete conditions. In iron-depleted cells, ferritin was targeted to the lysosome via a mechanism that involved autophagy. In contrast, lysosomal targeting of ferritin in iron-replete cells did not involve autophagy. The autophagy-independent pathway of ferritin delivery to lysosomes was deficient in several cancer-derived cells, and cancer-derived cell lines are more resistant to iron toxicity than primary cells. Collectively, these results suggest that ferritin trafficking may be differentially regulated by cell type and that loss of ferritin delivery to the lysosome under iron-replete conditions may be related to oncogenic cellular transformation.

Also flagged:gene-expressionSLC6A4reflexNFR5-HT receptorsSerotonin Transporter
Journal Article 2011-03-28 ✓ 5 Snippets Lindstedt F, Berrebi J, Greayer E, Lonsdorf TB, Schalling M, Ingvar M, Kosek E.
In-Text Gene Mentions

The 5-HTT regulates serotonin plasma levels through uptake into platelets [51] with higher transporter expression implying lower levels of serotonin in the blood [52].

We recently reported that low 5-HTT-expressing individuals experience greater pain relief than high 5-HTT-expressing individuals after an injection of the short-acting opioid remifentanil and suggested how this may be linked to a desensitization of 5-HT1A receptors [71].

…Low5-HTTgene-expression has also…

…function of differential5-HTT-expression.…

…the serotonin transporter (5-HTT) gene ( SLC6A4…

Show Full Abstract

<h4>Background</h4>Variation in the serotonin transporter (5-HTT) gene (SLC6A4) has been shown to influence a wide range of affective processes. Low 5-HTT gene-expression has also been suggested to increase the risk of chronic pain. Conditioned pain modulation (CPM)--i.e. 'pain inhibits pain'--is impaired in chronic pain states and, reciprocally, aberrations of CPM may predict the development of chronic pain. Therefore we hypothesized that a common variation in the SLC6A4 is associated with inter-individual variation in CPM. Forty-five healthy subjects recruited on the basis of tri-allelic 5-HTTLPR genotype, with inferred high or low 5-HTT-expression, were included in a double-blind study. A submaximal-effort tourniquet test was used to provide a standardized degree of conditioning ischemic pain. Individualized noxious heat and pressure pain thresholds (PPTs) were used as subjective test-modalities and the nociceptive flexion reflex (NFR) was used to provide an objective neurophysiological window into spinal processing.<h4>Results</h4>The low, as compared to the high, 5-HTT-expressing group exhibited significantly reduced CPM-mediated pain inhibition for PPTs (p = 0.02) and heat-pain (p = 0.02). The CPM-mediated inhibition of the NFR, gauged by increases in NFR-threshold, did not differ significantly between groups (p = 0.75). Inhibition of PPTs and heat-pain were correlated (Spearman's rho = 0.35, p = 0.02), whereas the NFR-threshold increase was not significantly correlated with degree of inhibition of these subjectively reported modalities.<h4>Conclusions</h4>Our results demonstrate the involvement of the tri-allelic 5-HTTLPR genotype in explaining clinically relevant inter-individual differences in pain perception and regulation. Our results also illustrate that shifts in NFR-thresholds do not necessarily correlate to the modulation of experienced pain. We discuss various possible mechanisms underlying these findings and suggest a role of regulation of 5-HT receptors along the neuraxis as a function of differential 5-HTT-expression.

Also flagged:extracellularneuronal migrationcytoskeletonneuroblast migrationtransmembrane receptorstransporters
Journal Article 2011-03-28 No Snippets Khodosevich K, Monyer H.
Show Full Abstract

During prenatal and postnatal development of the mammalian brain, new neurons are generated by precursor cells that are located in the germinal zones. Subsequently newborn neurons migrate to their destined location in the brain. On the migrational route immature neurons interact via a series of recognition molecules with a plethora of extracellular cues. Stimuli that are conveyed by extracellular cues are translated into complex intracellular signaling networks that eventually enable neuronal migration. In this Focused Review we discuss signaling networks underlying neuronal migration emphasizing molecules and pathways that appear to be neuron-specific.

Also flagged:ATOH7neurogenesistranscription factoropticretinal detachmenteye development
Journal Article 2011-03-27 ✓ 1 Snippet Ghiasvand NM, Rudolph DD, Mashayekhi M, Brzezinski JA, Goldman D, Glaser T.
In-Text Gene Mentions

…, Sox2 ,Dcc, Ntn1 and…

Show Full Abstract

Individuals with nonsyndromic congenital retinal nonattachment (NCRNA) are totally blind from birth. The disease afflicts ∼1% of Kurdish people living in a group of neighboring villages in North Khorasan, Iran. We found that NCRNA is caused by a 6,523-bp deletion that spans a remote cis regulatory element 20 kb upstream from ATOH7 (Math5), a bHLH transcription factor gene that is required for retinal ganglion cell (RGC) and optic nerve development. In humans, the absence of RGCs stimulates massive neovascular growth of fetal blood vessels in the vitreous and early retinal detachment. The remote ATOH7 element appears to act as a secondary or 'shadow' transcriptional enhancer. It has minimal sequence similarity to the primary enhancer, which is close to the ATOH7 promoter, but drives transgene expression with an identical spatiotemporal pattern in the mouse retina. The human transgene also functions appropriately in zebrafish, reflecting deep evolutionary conservation. These dual enhancers may reinforce ATOH7 expression during early critical stages of eye development when retinal neurogenesis is initiated.

Also flagged:gene expressiontransferrin receptor-1iron-regulatory proteinsleukocytosisironmetabolism
Journal Article 2011-03-26 ✓ 5 Snippets Malik IA, Naz N, Sheikh N, Khan S, Moriconi F, Blaschke M, Ramadori G.
In-Text Gene Mentions

…ferroportin-1, and thehemochromatosisgene was significantly…

…the absence ofhemochromatosis(Eng et al.…

…genes for DMT1,HFE, and Dcytb was…

…the genes forHFE, Dcytb, and IRPs…

…and hepatocytes ofHFE-knockout mice (Chua et…

Show Full Abstract

The "acute phase" is clinically characterized by homeostatic alterations such as somnolence, adinamia, fever, muscular weakness, and leukocytosis. Dramatic changes in iron metabolism are observed under acute-phase conditions. Rats were administered turpentine oil (TO) intramuscularly to induce a sterile abscess and killed at various time points. Tissue iron content in the liver and brain increased progressively after TO administration. Immunohistology revealed an abundant expression of transferrin receptor-1 (TfR1) in the membrane and cytoplasm of the liver cells, in contrast to almost only nuclear expression of TfR1 in brain tissue. The expression of TfR1 increased at the protein and RNA levels in both organs. Gene expression of hepcidin, ferritin-H, iron-regulatory protein-1, and heme oxygenase-1 was also upregulated, whereas that of hemojuvelin, ferroportin-1, and the hemochromatosis gene was significantly downregulated at the same time points in both the brain and the liver at the RNA level. However, in contrast to observations in the liver, gene expression of the main acute-phase cytokine (interleukin-6) in the brain was significantly upregulated. In vitro experiments revealed TfR1 membranous protein expression in the liver cells, whereas nuclear and cytoplasmic TfR1 protein was detectable in brain cells. During the non-bacterial acute phase, iron content in the liver and brain increased together with the expression of TfR1. The iron metabolism proteins were regulated in a way similar to that observed in the liver, possibly by locally produced acute-phase cytokines. The significance of the presence of TfR1 in the nucleus of the brain cells has to be clarified.

Also flagged:SynthesismorphinancarbonesterbindingATPM
Journal Article 2011-03-26 No Snippets Zhang B, Zhang T, Sromek AW, Scrimale T, Bidlack JM, Neumeyer JL.
Show Full Abstract

A novel series of homo- and heterodimeric ligands containing κ/μ agonist and μ agonist/antagonist pharmacophores joined by a 10-carbon ester linker chain were synthesized and evaluated for their in vitro binding affinity at κ, μ, and δ opioid receptors, and their functional activities were determined at κ and μ receptors in [(35)S]GTPγS functional assays. Most of these compounds had high binding affinity at μ and κ receptors (K(i) values less than 1nM). Compound 15b, which contains butorphan (1) at one end of linking chain and butorphanol (5) at the other end, was the most potent ligand in this series with binding affinity K(i) values of 0.089nM at the μ receptor and 0.073nM at the κ receptor. All of the morphinan-derived ligands were found to be partial κ and μ agonists; ATPM-derived ligands 12 and 11 were found to be full κ agonists and partial μ agonists.

Also flagged:RKIPRhoGDIgalectinc-Mycp53chromium
Journal Article 2011-03-25 No Snippets Tsao DA, Tseng WC, Chang HR.
Show Full Abstract

Hexavalent chromium (CrVI) is considered to be a risk factor in the formation of human cancer. Raf kinase inhibitor protein (RKIP), Rho-GDIα, galectin, c-Myc and p53 play important roles in cancer formation. The purpose of this study was to determine if Cr(VI) induces the formation of gastrointestinal cancer. We explored the expression of RKIP, Rho-GDIα, galectin, c-Myc and p53 in the colon and stomach in rats exposed to chromium (CrVI). Thirty Wistar rats were divided into six groups which were chronically fed with 250, 500, 750, 1000 and 1250 ppm Na(2) Cr(2) O(7) and water for 60 days. The level of Cr(VI) was determined by electrothermal atomic absorption spectrometry. The expression of RKIP, Rho-GDIα, galectin, c-Myc and p53 of stomach and colon was measured by western blot. The gene expression of RKIP, Rho-GDIα, galectin, c-Myc and p53 of the stomach and colon was determined by RT-PCR. The results showed that the expression of p53 and Rho-GDIα was decreased in the stomach and colon of rats with Cr(VI) treatment. The expression of RKIP was decreased in the stomach and colon of rats treated with high-dose Cr(VI). The expression of c-Myc and gelectin-1 was increased in the stomach and colon of rats with Cr(VI) treatment. We concluded that the anomalous expression of RKIP, Rho-GDIα, galectin, c-Myc and p53 might be a dangerous index of cancer formation in the stomach and colon of rats with Cr(VI) exposure.

Also flagged:serotoninreuptakeescitalopramserotonin transporterserotonin (5-HT) transporterSERT
Journal Article 2011-03-25 ✓ 2 Snippets Guiard BP, Mansari ME, Murphy DL, Blier P.
In-Text Gene Mentions

A serotonin (5-HT) transporter (5-HTT; SERT) polymorphism has been associated with depressive states and poor responses to selective serotonin reuptake inhibitors (SSRIs).

…serotonin (5-HT) transporter (5-HTT; SERT) polymorphism has…

Show Full Abstract

A serotonin (5-HT) transporter (5-HTT; SERT) polymorphism has been associated with depressive states and poor responses to selective serotonin reuptake inhibitors (SSRIs). Given the similar attenuation of SERT activity in SERT+/- mice and in humans with short allele(s) of SERT in its promoter region, it is conceivable that SERT+/- mice offer an adequate model to mimic the human subpopulation with respect to their altered response to SSRIs. This study investigated the effects of the most selective SSRI escitalopram, in heterozygous SERT+/- mice using a combined electrophysiological and neurochemical approach. Results indicated that administration of escitalopram for 2 d resulted in a 72% and 63% decrease in dorsal raphe 5-HT neuronal firing rate in SERT+/+ and SERT+/- mice, respectively. In contrast, administration of escitalopram for 21 d produced a gradual recovery of 5-HT neuronal firing rate to basal level in SERT+/+, but not in SERT+/- mice. In the hippocampus, microdialysis revealed that sustained administration of escitalopram produced a greater increase in extracellular 5-HT ([5-HT]ext) outflow in SERT+/- than in the wild-types with or without a washout of the SSRI. Nevertheless, the ability of microiontophoretically applied 5-HT to inhibit the firing rate of CA3 pyramidal neurons was not different between SERT+/+ and SERT+/- mice given escitalopram for 21 d. The data indicate that the poor response to SSRIs of depressive patients with short allele(s) of SERT is not attributable to a lesser increase in 5-HT transmission in the hippocampus.

Also flagged:cancerantibodiesoligopeptidesoligonucleotidesconjugationsynthesis
Journal Article 2011-03-25 No Snippets Zeglis BM, Lewis JS.
Show Full Abstract

Positron emission tomography (PET) has become a vital imaging modality in the diagnosis and treatment of disease, most notably cancer. A wide array of small molecule PET radiotracers have been developed that employ the short half-life radionuclides (11)C, (13)N, (15)O, and (18)F. However, PET radiopharmaceuticals based on biomolecular targeting vectors have been the subject of dramatically increased research in both the laboratory and the clinic. Typically based on antibodies, oligopeptides, or oligonucleotides, these tracers have longer biological half-lives than their small molecule counterparts and thus require labeling with radionuclides with longer, complementary radioactive half-lives, such as the metallic isotopes (64)Cu, (68)Ga, (86)Y, and (89)Zr. Each bioconjugate radiopharmaceutical has four component parts: biomolecular vector, radiometal, chelator, and covalent link between chelator and biomolecule. With the exception of the radiometal, a tremendous variety of choices exists for each of these pieces, and a plethora of different chelation, conjugation, and radiometallation strategies have been utilized to create agents ranging from (68)Ga-labeled pentapeptides to (89)Zr-labeled monoclonal antibodies. Herein, the authors present a practical guide to the construction of radiometal-based PET bioconjugates, in which the design choices and synthetic details of a wide range of biomolecular tracers from the literature are collected in a single reference. In assembling this information, the authors hope both to illuminate the diverse methods employed in the synthesis of these agents and also to create a useful reference for molecular imaging researchers both experienced and new to the field.

Also flagged:HuntingtinTRAF6Tumor Necrosis Factorubiquitinligase activityHEK
Journal Article 2011-03-25 ✓ 5 Snippets Zucchelli S, Marcuzzi F, Codrich M, Agostoni E, Vilotti S, Biagioli M, Pinto M, Carnemolla A, Santoro C, Gustincich S, Persichetti F.
In-Text Gene Mentions

Huntington disease (HD) is a neurodegenerative disorder caused by an expansion of polyglutamines in the first exon of huntingtin (HTT), which confers aggregation-promoting properties to amino-terminal fragments of the protein (N-HTT).

To evaluate whether TRAF6 might have a role in HD, we studied its ability to bind huntingtin amino-terminal fragments (residues 1–171) fused to green fluorescent protein (N-HTT-GFP), with either a physiological (Gln21), or short (Gln60) or long (Gln150) pathological polyQ stretch.

TRAF6 promotes atypical ubiquitination of WT and mutant N-HTT. HA-ubiquitin (Ub) mutants were used in which only the indicated lysine is available for chain formation.

…of huntingtin (HTT), which confers…

…encoding for huntingtin (HTT) protein ( 1…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disorder caused by an expansion of polyglutamines in the first exon of huntingtin (HTT), which confers aggregation-promoting properties to amino-terminal fragments of the protein (N-HTT). Mutant N-HTT aggregates are enriched for ubiquitin and contain ubiquitin E3 ligases, thus suggesting a role for ubiquitination in aggregate formation. Here, we report that tumor necrosis factor receptor-associated factor 6 (TRAF6) binds to WT and polyQ-expanded N-HTT in vitro as well as to endogenous full-length proteins in mouse and human brain in vivo. Endogenous TRAF6 is recruited to cellular inclusions formed by mutant N-HTT. Transient overexpression of TRAF6 promotes WT and mutant N-HTT atypical ubiquitination with Lys(6), Lys(27), and Lys(29) linkage formation. Both interaction and ubiquitination seem to be independent from polyQ length. In cultured cells, TRAF6 enhances mutant N-HTT aggregate formation, whereas it has no effect on WT N-HTT protein localization. Mutant N-HTT inclusions are enriched for ubiquitin staining only when TRAF6 and Lys(6), Lys(27), and Lys(29) ubiquitin mutants are expressed. Finally, we show that TRAF6 is up-regulated in post-mortem brains from HD patients where it is found in the insoluble fraction. These results suggest that TRAF6 atypical ubiquitination warrants investigation in HD pathogenesis.

Also flagged:seleniumdextrancancersironcolorectal cancercolon cancer
Journal Article 2011-03-25 No Snippets Kim JH, Hue JJ, Kang BS, Park H, Nam SY, Yun YW, Kim JS, Lee BJ.
Show Full Abstract

Selenium (Se) is known to prevent several cancers while the relationship between high iron and the risk of colorectal cancer is controversial. To investigate the effects of Se in colon carcinogenesis, we subjected three different levels of Se and high-iron diet to a mouse model of colon cancer in which animals were treated with three azoxymethane (AOM) injections followed by dextran sodium sulfate (DSS) administration. There were five experimental groups including vehicle group [normal-Fe (NFe, 45 ppm)+medium-Se (MSe, 0.1 ppm)], positive control group (AOM/DSS+NFe+MSe), AOM/DSS+high-Fe (HFe, 450 ppm)+low-Se (LSe, 0.02 ppm), AOM/DSS+HFe+MSe, and AOM/DSS+HFe+high-Se (HSe, 0.5 ppm). The animals were fed on the three different Se diets for 24 weeks. The incidence of colon tumor in the high-Se diet group (AOM/DSS+HFe+HSe) showed 19.4% lower than positive control group, 5.9% lower than AOM/DSS+HFe+MSe diet group, and 11.1% lower than AOM/DSS+HFe+LSe group. The tumor multiplicity was significantly higher in the low-Se diet group (AOM/DSS+HFe+LSe) compare to all other AOM/DSS treated groups. In the high-Se diet group, the activity of hepatic GPx was comparable to that of positive control group, and significantly higher than those of low-Se or medium-Se diet groups. Expression level of hepatic GPx-1 showed similar results. Hepatic malondialdehyde (MDA) level (indicator of oxidative stress) in the low-Se diet group showed the highest compared to the other groups, and it was significantly higher than positive control group. In the high-Se diet group the level of MDA in the liver was significantly lower than all other AOM/DSS treated groups. High-Se diet group showed significantly lower proliferative index than low-Se and medium-Se groups. The apoptotic indices in low-Se group and medium-Se group were significantly lower than positive control group. However, apoptotic index of high-Se diet group was significantly higher than all other AOM/DSS treated groups. These findings suggest that dietary Se supplement may have protective effect against colon cancer by decreasing proliferation, increasing apoptosis of tumor cells, and reducing oxidative stress in mice with high iron diet.

Also flagged:Gene SilencingFatty Acid Amidesnucleotidesgene expressionfatty acids1
Journal Article 2011-03-25 No Snippets Metwally AA, Pourzand C, Blagbrough IS.
Show Full Abstract

Gene silencing by siRNA (synthetic dsRNA of 21-25 nucleotides) is a well established biological tool in gene expression studies and has a promising therapeutic potential for difficult-to-treat diseases. Five fatty acids of various chain length and oxidation state (C12:0, C18:0, C18:1, C18:2, C22:1) were conjugated to the naturally occurring polyamine, spermine, and evaluated for siRNA delivery and gene knock-down. siRNA delivery could not be related directly to gene silencing efficiency as N4,N9-dierucoyl spermine resulted in higher siRNA delivery compared to N4,N9-dioleoyl spermine. GFP silencing in HeLa cells showed that the unsaturated fatty acid amides are more efficient than saturated fatty acid amides, with N4,N9-dioleoyl spermine resulting in the most efficient gene silencing in the presence of serum. The alamarBlue cell viability assay showed that fatty acid amides of spermine have good viability (75%-85% compared to control) except N4,N9-dilauroyl spermine which resulted in low cell viability. These results prove that unsaturated fatty acid amides of spermine are efficient, non-toxic, non-viral vectors for siRNA mediated gene silencing.

Also flagged:tumorsantibodiestumorantibodyconjugationcysteine
Journal Article 2011-03-24 No Snippets Li L, Crow D, Turatti F, Bading JR, Anderson AL, Poku E, Yazaki PJ, Carmichael J, Leong D, Wheatcroft D, Raubitschek AA, Hudson PJ, Colcher D, Shively JE.
Show Full Abstract

Optimal PET imaging of tumors with radiolabeled engineered antibodies requires, among other parameters, matching blood clearance and tumor uptake with the half-life of the engineered antibody. Although diabodies have favorable molecular sizes (50 kDa) for rapid blood clearance (t(1/2) = 30-60 min) and are bivalent, thereby increasing tumor uptake, they exhibit substantial kidney uptake as their major route of clearance, which is especially evident when they are labeled with the PET isotope (64)Cu (t(1/2) = 12 h). To overcome this drawback, diabodies may be conjugated to PEG, a modification that increases the apparent molecular size of the diabody and reduces kidney uptake without adversely affecting tumor uptake or the tumor to blood ratio. We show here that site-specific attachment of monodispersed PEGn of increasing molecular size (n = 12, 24, and 48) can uniformly increase the apparent molecular size of the PEG-diabody conjugate, decrease kidney uptake, and increase tumor uptake, the latter due to the increased residence time of the conjugate in the blood. Since the monodispersed PEGs were preconjugated to the chelator DOTA, the conjugates were able to bind radiometals such as (111)In and (64)Cu that can be used for SPECT and PET imaging, respectively. To allow conjugation of the DOTA-PEG to the diabody, the DOTA-PEG incorporated a terminal cysteine conjugated to a vinyl sulfone moiety. In order to control the conjugation chemistry, we have engineered a surface thiolated diabody that incorporates two cysteines per monomer (four per diabody). The thiolated diabody was expressed and purified from bacterial fermentation and only needs to be reduced prior to conjugation to the DOTA-PEGn-Cys-VS. This novel imaging agent (a diabody with DOTA-PEG48-Cys-VS attached to introduced thiols) gave up to 80%ID/g of tumor uptake with a tumor to blood ratio (T/B) of 8 at 24 h when radiolabeled with (111)In and 37.9% ID/g of tumor uptake (T/B = 8) at 44 h when radiolabeled with (64)Cu in PET imaging in an animal model. Tumor uptake was significantly improved from the 50% ID/g at 24 h observed with diabodies that were pegylated on surface lysine residues. Importantly, there was no loss of immunoreactivity of the site-specific Cys-conjugated diabody to its antigen (TAG-72) compared to the parent, unconjugated diabody. We propose that thiolated diabodies conjugated to DOTAylated monodisperse PEGs have the potential for superior SPECT and PET imaging in a clinical setting.

Also flagged:CisplatinRAD50cell deathHexachlorocyclohexaneHedgehog signaling pathwayThiamine metabolism
Journal Article 2011-03-24 No Snippets Chao SY, Chiang JH, Huang AM, Chang WS.
Show Full Abstract

<h4>Background</h4>Resistance to chemotherapy severely limits the effectiveness of chemotherapy drugs in treating cancer. Still, the mechanisms and critical pathways that contribute to chemotherapy resistance are relatively unknown. This study elucidates the chemoresistance-associated pathways retrieved from the integrated biological interaction networks and identifies signature genes relevant for chemotherapy resistance.<h4>Methods</h4>An integrated network was constructed by collecting multiple metabolic interactions from public databases and the k-shortest path algorithm was implemented to identify chemoresistant related pathways. The identified pathways were then scored using differential expression values from microarray data in chemosensitive and chemoresistant ovarian and lung cancers. Finally, another pathway database, Reactome, was used to evaluate the significance of genes within each filtered pathway based on topological characteristics.<h4>Results</h4>By this method, we discovered pathways specific to chemoresistance. Many of these pathways were consistent with or supported by known involvement in chemotherapy. Experimental results also indicated that integration of pathway structure information with gene differential expression analysis can identify dissimilar modes of gene reactions between chemosensitivity and chemoresistance. Several identified pathways can increase the development of chemotherapeutic resistance and the predicted signature genes are involved in drug resistant during chemotherapy. In particular, we observed that some genes were key factors for joining two or more metabolic pathways and passing down signals, which may be potential key targets for treatment.<h4>Conclusions</h4>This study is expected to identify targets for chemoresistant issues and highlights the interconnectivity of chemoresistant mechanisms. The experimental results not only offer insights into the mode of biological action of drug resistance but also provide information on potential key targets (new biological hypothesis) for further drug-development efforts.

Also flagged:carbohydratecellulasecellulasescellulosemonosaccharidedisaccharides
Journal Article 2011-03-24 No Snippets Bu L, Beckham GT, Shirts MR, Nimlos MR, Adney WS, Himmel ME, Crowley MF.
Show Full Abstract

Understanding the enzymatic mechanism that cellulases employ to degrade cellulose is critical to efforts to efficiently utilize plant biomass as a sustainable energy resource. A key component of cellulase action on cellulose is product inhibition from monosaccharide and disaccharides in the product site of cellulase tunnel. The absolute binding free energy of cellobiose and glucose to the product site of the catalytic tunnel of the Family 7 cellobiohydrolase (Cel7A) of Trichoderma reesei (Hypocrea jecorina) was calculated using two different approaches: steered molecular dynamics (SMD) simulations and alchemical free energy perturbation molecular dynamics (FEP/MD) simulations. For the SMD approach, three methods based on Jarzynski's equality were used to construct the potential of mean force from multiple pulling trajectories. The calculated binding free energies, -14.4 kcal/mol using SMD and -11.2 kcal/mol using FEP/MD, are in good qualitative agreement. Analysis of the SMD pulling trajectories suggests that several protein residues (Arg-251, Asp-259, Asp-262, Trp-376, and Tyr-381) play key roles in cellobiose and glucose binding to the catalytic tunnel. Five mutations (R251A, D259A, D262A, W376A, and Y381A) were made computationally to measure the changes in free energy during the product expulsion process. The absolute binding free energies of cellobiose to the catalytic tunnel of these five mutants are -13.1, -6.0, -11.5, -7.5, and -8.8 kcal/mol, respectively. The results demonstrated that all of the mutants tested can lower the binding free energy of cellobiose, which provides potential applications in engineering the enzyme to accelerate the product expulsion process and improve the efficiency of biomass conversion.

Also flagged:methylmalonyl-CoA mutasecobalaminsmegaloblastic anemiahomocysteinemethylmalonic acidfolates
Journal Article 2011-03-24 ✓ 1 Snippet Hannibal L, DiBello PM, Yu M, Miller A, Wang S, Willard B, Rosenblatt DS, Jacobsen DW.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Cobalamin (Cbl, B(12)) is an essential micronutrient required to fulfill the enzymatic reactions of cytosolic methylcobalamin-dependent methionine synthase and mitochondrial adenosylcobalamin-dependent methylmalonyl-CoA mutase. Mutations in the MMACHC gene (cblC complementation group) disrupt processing of the upper-axial ligand of newly internalized cobalamins, leading to functional deficiency of the vitamin. Patients with cblC disease present with both hyperhomocysteinemia and methylmalonic acidemia, cognitive dysfunction, and megaloblastic anemia. In the present study we show that cultured skin fibroblasts from cblC patients export increased levels of both homocysteine and methylmalonic acid compared to control skin fibroblasts, and that they also have decreased levels of total intracellular folates. This is consistent with the clinical phenotype of functional cobalamin deficiency in vivo. The protein changes that accompany human functional Cbl deficiency are unknown. The proteome of control and cblC fibroblasts was quantitatively examined by two dimensional difference in-gel electrophoresis (2D-DIGE) and liquid chromatography-electrospray ionization-mass spectrometry (LC/ESI/MS). Major changes were observed in the expression levels of proteins involved in cytoskeleton organization and assembly, the neurological system and cell signaling. Pathway analysis of the differentially expressed proteins demonstrated strong associations with neurological disorders, muscular and skeletal disorders, and cardiovascular diseases in the cblC mutant cell lines. Supplementation of the cell cultures with hydroxocobalamin did not restore the cblC proteome to the patterns of expression observed in control cells. These results concur with the observed phenotype of patients with the cblC disorder and their sometimes poor response to treatment with hydroxocobalamin. Our findings could be valuable for designing alternative therapies to alleviate the clinical manifestation of the cblC disorder, as some of the protein changes detected in our study are common hallmarks of known pathologies such as Alzheimer's and Parkinson's diseases as well as muscular dystrophies.

Also flagged:ERCC1cisplatinsquamous cell carcinoma of head andexcision repair cross-complementation group 1head and neck squamous cell carcinomaHNSCC
Journal Article 2011-03-23 No Snippets Chiu TJ, Chen CH, Chien CY, Li SH, Tsai HT, Chen YJ.
Show Full Abstract

<h4>Background</h4>This study was to evaluate the effect of excision repair cross-complementation group 1(ERCC1) expression on response to cisplatin-based induction chemotherapy (IC) followed by concurrent chemoradiation (CCRT) in locally advanced unresectable head and neck squamous cell carcinoma (HNSCC) patients.<h4>Methods</h4>Fifty-seven patients with locally advanced unresectable HNSCC who received cisplatin-based IC followed by CCRT from January 1, 2006 through January 1, 2008. Eligibility criteria included presence of biopsy-proven HNSCC without a prior history of chemotherapy or radiotherapy. Immunohistochemistry was used to assess ERCC1 expression in pretreatment biopsy specimens from paraffin blocks. Clinical parameters, including smoking, alcohol consumption and betel nuts chewing, were obtained from the medical records.<h4>Results</h4>The 12-month progression-free survival (PFS) and 2-year overall survival (OS) rates of fifty-seven patients were 61.1% and 61.0%, respectively. Among these patients, thirty-one patients had low ERCC1 expression and forty-one patients responded to IC followed by CCRT. Univariate analyses showed that patients with low expression of ERCC1 had a significantly higher 12-month PFS rates (73.3% vs. 42.3%, p < 0.001) and 2-year OS (74.2 vs. 44.4%, p = 0.023) rates. Multivariate analysis showed that for patients who did not chew betel nuts and had low expression of ERCC1 were independent predictors for prolonged survival.<h4>Conclusions</h4>Our study suggest that a high expression of ERCC1 predict a poor response and survival to cisplatin-based IC followed by CCRT in patients with locally advanced unresectable HNSCC in betel nut chewing area.

Also flagged:peptidesvasopressinoxytocin receptorslocalizationlysinemembrane
Journal Article 2011-03-23 No Snippets Corbani M, Trueba M, Stoev S, Murat B, Mion J, Boulay V, Guillon G, Manning M.
Show Full Abstract

Among the four known vasopressin and oxytocin receptors, the specific localization of the V1b isoform is poorly described because of the lack of selective pharmacological tools. In an attempt to address this need, we decided to design, synthesize, and characterize fluorescent selective V1b analogues. Starting with the selective V1b agonist [deamino-Cys(1),Leu(4),Lys(8)]vasopressin (d[Leu(4),Lys(8)]VP) synthesized earlier, we added blue, green, or red fluorophores to the lysine residue at position 8 either directly or by the use of linkers of different lengths. Among the nine analogues synthesized, two exhibited very promising properties. These are d[Leu(4),Lys(Alexa 647)(8)]VP (3) and d[Leu(4),Lys(11-aminoundecanoyl-Alexa 647)(8)]VP (9). They remained full V1b agonists with nanomolar affinity and specifically decorated the plasma membrane of CHO cells stably transfected with the human V1b receptor. These new selective fluorescent peptides will allow the cellular localization of V1b or OT receptor isoforms in native tissues.

Also flagged:NF-κBsterol glucosidexanthoneNF-κB p65methylationprenylxanthone
Journal Article 2011-03-23 ✓ 1 Snippet Ren Y, Matthew S, Lantvit DD, Ninh TN, Chai H, Fuchs JR, Soejarto DD, de Blanco EJ, Swanson SM, Kinghorn AD.
In-Text Gene Mentions

DCC

Show Full Abstract

A new caged xanthone (1), a new prenylxanthone (2), seven known xanthones, and a known sterol glucoside were isolated from the stems of Cratoxylum cochinchinense, collected in Vietnam. Compounds 1 and 2 were determined structurally by analysis of their spectroscopic data. In addition, five new (10 and 16-19) and eight known prenylated xanthone derivatives were synthesized from the known compounds α-mangostin (3) and cochinchinone A (6). Several of these substances were found to be cytotoxic toward HT-29 human colon cancer cells, with the most potent being 3,6-di-O-acetyl-α-mangostin (8, ED50, 1.0 μM), which was tested further in an in vivo hollow fiber assay, but found to be inactive at the highest dose used (20 mg/kg; ip). Of the substances evaluated in a NF-κB p65 inhibition assay, 1,3,7-trihydroxy-2,4-diisoprenylxanthone (5) exhibited the most potent activity (IC50, 2.9 μM). In a mitochondrial transmembrane potential assay, two new compounds, 1 (IC50, 3.3 μM) and 10 (IC50, 1.4 μM), and two known compounds, 3 (α-mangostin, IC50, 0.2 μM) and 11 (3,6-di-O-methyl-α-mangostin, IC50, 0.9 μM), were active. A preliminary analogue development study showed that 3,6-diacetylation and 6-benzoylation both slightly increased the cytotoxicity of α-mangostin (3), whereas methylation reduced such activity. In contrast, neither acetylation, benzoylation, nor methylation enhanced the cytotoxicity of cochinchinone A (6).

Also flagged:Fluoxetinedesipraminemilnacipranalcohol5-HT(
Journal Article 2011-03-23 ✓ 2 Snippets Simon O'Brien E, Legastelois R, Houchi H, Vilpoux C, Alaux-Cantin S, Pierrefiche O, André E, Naassila M.
In-Text Gene Mentions

…NET and5-HTTinhibition reduces alcohol-ind…

5-HTT

Show Full Abstract

A few clinical studies have shown that dual antidepressants (serotonergic (5-HT) and noradrenergic (NE) transporter inhibitors, SNRIs) may be effective in alcoholism treatment. We studied the effect of the dual antidepressant milnacipran on ethanol operant self-administration in acutely withdrawn ethanol-dependent and in -non-dependent Wistar rats, and used fluoxetine and desipramine to dissect both 5-HT and NE components, respectively, in the effect of milnacipran. Milnacipran was also tested for relapse after protracted abstinence and on ethanol-induced (1.0 g/kg) conditioned place preference in control rats and ethanol-induced locomotor sensitization in DBA/2J female mice. Milnacipran dose dependently (5-40 mg/kg) attenuated the increased ethanol self-administration observed during early withdrawal and was more potent in preventing reinstatement in dependent rats after protracted abstinence as compared with non-dependent rats. Desipramine and fluoxetine (10 mg/kg) blocked ethanol self-administration during early withdrawal, and recovery was delayed in dependent animals, indicating a potent effect. Ethanol self-administration was also reduced 1 day after treatment with desipramine and fluoxetine but not with milnacipran. Finally, milnacipran prevented ethanol-induced place preference in ethanol-naive rats and reduced the magnitude of ethanol-induced sensitization associated with a delayed induction in mice. Desipramine (20 mg/kg) countered sensitization development and reduced its expression at 1 week after treatment; fluoxetine (10 mg/kg) reduced sensitization expression. Thus, 5-HT and NE transmissions during sensitization expression may mediate the effect of milnacipran on sensitization induction. These results support that SNRIs may have a potential use in alcoholism treatment.

Also flagged:spindleMicrotubulesdyneindynactinlarge nuclear mitotic apparatus NuMAlocalization
Journal Article 2011-03-23 No Snippets Godin JD, Humbert S.
Show Full Abstract

Mitotic spindle assembly and orientation are tightly regulated to allow the appropriate segregation of genetic material and cell fate determinants during symmetric and asymmetric divisions. Microtubules and many proteins including the dynein/dynactin complex and the large nuclear mitotic apparatus NuMA protein, are fundamental players in these mechanisms. A recent study reported that huntingtin regulates spindle orientation by ensuring the proper localization of the p150(Glued) subunit of dynactin, dynein and NuMA. This function of huntingtin is conserved in Drosophila. Among other events, spindle orientation influences the fate of daughter cells. In agreement with this, huntingtin changes the direction of division of mouse cortical progenitors and promotes neurogenesis in the neocortex. We will also discuss the involvement of mitotic spindle components in neuronal disorders.

Also flagged:CD20NF-κBRKIPPTENTRAILantibody
Journal Article 2011-03-23 No Snippets Baritaki S, Militello L, Malaponte G, Spandidos DA, Salcedo M, Bonavida B.
Show Full Abstract

LFB-R603 is a chimeric anti-CD20 mouse/human monoclonal antibody with a human IgG1 constant (Fc) region. In comparison to rituximab, LFB-R603 exhibits a high affinity to the Fcγ RIII (CD16) and a potent in vitro antibody-dependent cellular cytotoxicity (ADCC). We examined several experimental designs for the biological anti-tumor activity of LFB-R603 as well as its sensitizing activity to apoptosis in resistant non-Hodgin's B-cell lymphoma (B-NHL) in comparison to rituximab. Treatment of the B-NHL cell line Ramos with LFB-R603 was not toxic at the concentrations used and induced cell aggregation following culture at 24 and 48 h similarly to rituximab. Hence, we hypothesized that LFB-R603 may signal the tumor cells and modify intracellular survival/anti-apoptotic pathways. Treatment of Ramos cells with LFB-R603 inhibited the constitutively active NF-κB survival pathway, followed by significant potentiation of TRAIL-mediated apoptosis. We examined the underlying molecular mechanism by which the LFB-R603-mediated NF-κB inhibition results in the reversal of tumor cell resistance to TRAIL. We hypothesized that downstream gene products regulated by NF-κB that are involved in the resistance may be involved in LFB-R603-mediated sensitization. We found that LFB-R603 inhibited NF-κB activation and the anti-apoptotic factor Snail and induced the pro-apoptotic factor RKIP. The direct roles of Snail and RKIP modulation by LFB-R603 in the reversal of B-NHL resistance to TRAIL were examined by knocking down Snail and overexpressing RKIP in Ramos cells, respectively. Both approaches increased significantly the cell sensitivity to TRAIL apoptosis. In addition to changes observed in the expression levels of Snail and RKIP, Ramos cells treated with LFB-R603 induced the expression of PTEN along with inhibition of the PI3K-AKT activated pathway. PTEN silencing in Ramos cells pretreated with LFB-R603 and TRAIL inhibited TRAIL apoptosis; thus, demonstrating that PTEN induction by LFB-R603 has a direct role in tumor cell sensitization to TRAIL apoptosis. Several of the findings obtained in the experimental designs with LFB-R603 were superior to those obtained with rituximab. Overall, the findings demonstrate that LFB-R603 interferes with the dysregulated NF-κB/Snail/RKIP/PTEN/AKT resistance circuitry in B-NHL cells. Further, the findings suggest that LFB-R603 may sensitize tumor cells to various apoptotic stimuli including cytotoxic ligands such as TRAIL and chemotherapeutic drugs.

Also flagged:rheumatoid arthritisRAsignal transductionnitric oxideoxygencell surface
Journal Article 2011-03-22 No Snippets de Almeida DE, Ling S, Holoshitz J.
Show Full Abstract

The shared epitope (SE) - an HLA-DRB1-encoded 5-amino acid sequence motif carried by the vast majority of rheumatoid arthritis (RA) patients - is a risk factor for severe disease. The mechanistic basis of RA-SE association is unknown. This group has previously demonstrated that the SE acts as a signal transduction ligand that activates nitric oxide and reactive oxygen species production. SE-activated signaling depends on cell surface calreticulin, a known innate immunity receptor previously implicated in immune regulation, autoimmunity and angiogenesis. Recent evidence that the SE enhances the polarization of Th17 cells, which is a key mechanism in autoimmunity, is discussed highlighting one of several potential functional effects of the SE in RA.

Also flagged:telomeric proteinstelomeresRAP1TRF1TRF2TIN2
Journal Article 2011-03-22 No Snippets Yang D, Xiong Y, Kim H, He Q, Li Y, Chen R, Songyang Z.
Show Full Abstract

Human telomeres are bound and protected by protein complexes assembled around the six core telomeric proteins RAP1, TRF1, TRF2, TIN2, TPP1, and POT1. The function of these proteins on telomeres has been studied extensively. Recently, increasing evidence has suggested possible roles for these proteins outside of telomeres. However, the non-canonical (extra-telomeric) function of human telomeric proteins remains poorly understood. To this end, we systematically investigated the binding sites of telomeric proteins along human chromosomes, by performing whole-genome chromatin immunoprecipitation (ChIP) for RAP1 and TRF2. ChIP sequencing (ChIP-seq) revealed that RAP1 and TRF2 could be found on a small number of interstitial sites, including regions that are proximal to genes. Some of these binding sites contain short telomere repeats, suggesting that telomeric proteins could directly bind to interstitial sites. Interestingly, only a small fraction of the available interstitial telomere repeat-containing regions were occupied by RAP1 and TRF2. Ectopically expressed TRF2 was able to occupy additional interstitial telomere repeat sites, suggesting that protein concentration may dictate the selective targeting of telomeric proteins to interstitial sites. Reducing RAP1 and TRF2 expression by RNA interference led to altered transcription of RAP1- and TRF2-targeted genes. Our results indicate that human telomeric proteins could occupy a limited number of interstitial sites and regulate gene transcription.

Also flagged:HDgenetic diseasestrinucleotidefragile X syndromemyotonic dystrophy type 1spinocerebellar ataxias
Journal Article 2011-03-22 ✓ 5 Snippets Fiszer A, Mykowska A, Krzyzosiak WJ.
In-Text Gene Mentions

…( ATXN andHTT, respectively) are…

…Both alleles ofHTTand ATXN3 genes…

…A) for theirHTTprotein inhibitory activity,…

…duplexes inhibited theHTTprotein with allele…

…mutant mRNAs ofHTTand ATXN3 genes…

Show Full Abstract

The specific silencing of the gene of interest is the major objective of RNA interference technology; therefore, unique sequences but not abundant sequence repeats are targeted by silencing reagents. Here, we describe the targeting of expanded CAG repeats that occur in transcripts derived from the mutant allele of the gene implicated in Huntington's disease (HD) in the presence of the normal allele and other human mRNAs containing CAG and CUG repeat tracts. We show that a high degree of silencing selectivity may be achieved between the repeated sequences. We demonstrate preferential suppression of the mutant huntingtin allele and concomitant activation of the normal huntingtin allele in cell lines derived from HD patients that were transfected with short RNA duplexes composed of CAG and CUG repeats containing mutations at specific positions. These effects may lead to promising therapeutic modalities for HD, a condition for which no therapy presently exists.

Also flagged:β2-microglobulinepithelial to mesenchymal transitioncancerβ2-Mironrenal cancer
Journal Article 2011-03-22 ✓ 4 Snippets Josson S, Nomura T, Lin JT, Huang WC, Wu D, Zhau HE, Zayzafoon M, Weizmann MN, Gururajan M, Chung LW.
In-Text Gene Mentions

β2-M interacts with its receptor, hemochromatosis (HFE) protein, to modulate iron responsive pathways in cancer cells.

…with its receptor,hemochromatosis(HFE) protein, to…

…ts receptor, hemochromatosis (HFE) protein, to modulate…

HFE

Show Full Abstract

Bone metastasis is one of the predominant causes of cancer lethality. This study demonstrates for the first time how β2-microglobulin (β2-M) supports lethal metastasis in vivo in human prostate, breast, lung, and renal cancer cells. β2-M mediates this process by activating epithelial to mesenchymal transition (EMT) to promote lethal bone and soft tissue metastases in host mice. β2-M interacts with its receptor, hemochromatosis (HFE) protein, to modulate iron responsive pathways in cancer cells. Inhibition of either β2-M or HFE results in reversion of EMT. These results demonstrate the role of β2-M in cancer metastasis and lethality. Thus, β2-M and its downstream signaling pathways are promising prognostic markers of cancer metastases and novel therapeutic targets for cancer therapy.

Also flagged:progressive leukoencephalopathyanemialeukodystrophymetabolic diseasesrespiratory chainmitochondrial
Journal Article 2011-03-22 ✓ 2 Snippets Orcesi S, La Piana R, Uggetti C, Tonduti D, Pichiecchio A, Pasin M, Viselner G, Comi GP, Del Bo R, Ronchi D, Bastianello S, Balottin U.
In-Text Gene Mentions

Of interest, we found an intronic variant in DARS2, a gene involved in mitochondrial DNA translation, responsible for the syndrome of leukoencephalopathy with brainstem and spinal cord involvement and high brain lactate.

…intronic variant inDARS2, a gene involved…

Show Full Abstract

Spinal cord calcifications are an unusual finding in pediatric neurology. We here describe a young child who presented severe psychomotor delay, tetraplegia, deafness, and anemia. Neuroradiological investigations revealed severe leukodystrophy and unusual calcifications in the cerebral white matter and all along the medullary pathways. Common infectious and metabolic diseases were ruled out. A mild reduction in the activity of several respiratory chain complexes was documented on muscle biopsy. Of interest, we found an intronic variant in DARS2, a gene involved in mitochondrial DNA translation, responsible for the syndrome of leukoencephalopathy with brainstem and spinal cord involvement and high brain lactate. In our opinion, our case, and probably 2 previously reported Japanese siblings with a picture very similar to that of our patient, could represent a new, progressive leukoencephalomyelopathy.

Also flagged:obesitycellular adhesion moleculesGene expressionmethylationmetabolic syndromeCD36
Journal Article 2011-03-22 ✓ 5 Snippets Walley AJ, Jacobson P, Falchi M, Bottolo L, Andersson JC, Petretto E, Bonnefond A, Vaillant E, Lecoeur C, Vatin V, Jernas M, Balding D, Petteni M, Park YS, Aitman T, Richardson S, Sjostrom L, Carlsson LM, Froguel P.
In-Text Gene Mentions

Our data suggest that in addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

The GiANT consortium meta-analysis of obesity GWA studies reported that genetic markers near the NEGR1 gene are associated with obesity 7.

The NEGR1 protein is a member of the immunoglobulin superfamily, is highly expressed in the hypothalamus 56 where it appears to modulate synapse number in neurons 57 and this makes it a good functional candidate for obesity 58, especially when considering obesity as a disorder having a neurobehavioral origin 59.

By using a novel approach to contrast CAMs co-expression networks between lean and obese siblings, a subset of differentially regulated genes was identified, with the previously GWAS obesity-associated NEGR1 as a central hub.

Our data suggests that, in addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central “hub” in an obesity-related transcript network.

Show Full Abstract

<h4>Objective</h4>To use a unique obesity-discordant sib-pair study design to combine differential expression analysis, expression quantitative trait loci (eQTLs) mapping and a coexpression regulatory network approach in subcutaneous human adipose tissue to identify genes relevant to the obese state.<h4>Study design</h4>Genome-wide transcript expression in subcutaneous human adipose tissue was measured using Affymetrix U133 Plus 2.0 microarrays (Affymetrix, Santa Clara, CA, USA), and genome-wide genotyping data was obtained using an Applied Biosystems (Applied Biosystems; Life Technologies, Carlsbad, CA, USA) SNPlex linkage panel.<h4>Subjects</h4>A total of 154 Swedish families ascertained through an obese proband (body mass index (BMI) >30 kg m(-2)) with a discordant sibling (BMI>10 kg m(-2) less than proband).<h4>Results</h4>Approximately one-third of the transcripts were differentially expressed between lean and obese siblings. The cellular adhesion molecules (CAMs) KEGG grouping contained the largest number of differentially expressed genes under cis-acting genetic control. By using a novel approach to contrast CAMs coexpression networks between lean and obese siblings, a subset of differentially regulated genes was identified, with the previously GWAS obesity-associated neuronal growth regulator 1 (NEGR1) as a central hub. Independent analysis using mouse data demonstrated that this finding of NEGR1 is conserved across species.<h4>Conclusion</h4>Our data suggest that in addition to its reported role in the brain, NEGR1 is also expressed in subcutaneous adipose tissue and acts as a central 'hub' in an obesity-related transcript network.

Also flagged:tumoralendronateBone neoplasmsosteosarcomaaminobisphosphonatetranslational
Journal Article 2011-03-22 No Snippets Segal E, Pan H, Benayoun L, Kopečková P, Shaked Y, Kopeček J, Satchi-Fainaro R.
Show Full Abstract

Bone neoplasms, such as osteosarcoma, exhibit a propensity for systemic metastases resulting in adverse clinical outcome. Traditional treatment consisting of aggressive chemotherapy combined with surgical resection, has been the mainstay of these malignances. Therefore, bone-targeted non-toxic therapies are required. We previously conjugated the aminobisphosphonate alendronate (ALN), and the potent anti-angiogenic agent TNP-470 with N-(2-hydroxypropyl)methacrylamide (HPMA) copolymer. HPMA copolymer-ALN-TNP-470 conjugate exhibited improved anti-angiogenic and anti-tumor activity compared with the combination of free ALN and TNP-470 when evaluated in a xenogeneic model of human osteosarcoma. The immune system has major effect on toxicology studies and on tumor progression. Therefore, in this manuscript we examined the safety and efficacy profiles of the conjugate using murine osteosarcoma syngeneic model. Toxicity and efficacy evaluation revealed superior anti-tumor activity and decreased organ-related toxicities of the conjugate compared with the combination of free ALN plus TNP-470. Finally, comparative anti-angiogenic activity and specificity studies, using surrogate biomarkers of circulating endothelial cells (CEC), highlighted the advantage of the conjugate over the free agents. The therapeutic platform described here may have clinical translational relevance for the treatment of bone-related angiogenesis-dependent malignances.

Also flagged:synthesisMismatchpolymerasesDNA polymerasenucleotidesexonucleases
Journal Article 2011-03-22 No Snippets Abdulovic AL, Hile SE, Kunkel TA, Eckert KA.
Show Full Abstract

Elucidating the sources of genetic variation within microsatellite alleles has important implications for understanding the etiology of human diseases. Mismatch repair is a well described pathway for the suppression of microsatellite instability. However, the cellular polymerases responsible for generating microsatellite errors have not been fully described. We address this gap in knowledge by measuring the fidelity of recombinant yeast polymerase δ (Pol δ) and ɛ (Pol ɛ) holoenzymes during synthesis of a [GT/CA] microsatellite. The in vitro HSV-tk forward assay was used to measure DNA polymerase errors generated during gap-filling of complementary GT(10) and CA(10)-containing substrates and ∼90 nucleotides of HSV-tk coding sequence surrounding the microsatellites. The observed mutant frequencies within the microsatellites were 4 to 30-fold higher than the observed mutant frequencies within the coding sequence. More specifically, the rate of Pol δ and Pol ɛ misalignment-based insertion/deletion errors within the microsatellites was ∼1000-fold higher than the rate of insertion/deletion errors within the HSV-tk gene. Although the most common microsatellite error was the deletion of a single repeat unit, ∼ 20% of errors were deletions of two or more units for both polymerases. The differences in fidelity for wild type enzymes and their exonuclease-deficient derivatives were ∼2-fold for unit-based microsatellite insertion/deletion errors. Interestingly, the exonucleases preferentially removed potentially stabilizing interruption errors within the microsatellites. Since Pol δ and Pol ɛ perform not only the bulk of DNA replication in eukaryotic cells but also are implicated in performing DNA synthesis associated with repair and recombination, these results indicate that microsatellite errors may be introduced into the genome during multiple DNA metabolic pathways.

Also flagged:regulation ofgene expressiontranslationalbindingnucleotidesdegradation
Journal Article 2011-03-22 ✓ 1 Snippet Gennarino VA, Sardiello M, Mutarelli M, Dharmalingam G, Maselli V, Lago G, Banfi S.
In-Text Gene Mentions

We found that TFEB overexpression was able to prevent the accumulation of mutant huntingtin (HTT) in cell lines containing a transgenic, aggregate-prone HTT allele with 105 CAG repeats responsible for Huntington's disease (Sardiello et al., 2009).

Show Full Abstract

microRNAs (miRNAs) are the most abundant class of small RNAs in mammals. They play an important role in regulation of gene expression by inducing mRNA cleavage or translational inhibition. Each miRNA targets an average of 100-200 genes by binding, preferentially, to their 3' UTRs by means of partial sequence complementarity. Most miRNAs are localized within transcriptional units, termed host genes, and show similar expression behavior with respect to their corresponding host genes. Considering the impact of miRNA in the regulation of gene expression and their involvement in a growing number of human disorders, it is vital to develop sensitive computational approaches able to identify miRNA target genes. The HOCTAR database (db) is a publicly available resource collecting ranked list of predicted target genes for 290 intragenic miRNAs annotated in human. HOCTARdb is a unique resource that integrates miRNA target prediction genes and transcriptomic data to score putative miRNA targets looking at the expression behavior of their host genes. We demonstrated, by testing 135 known validated target genes (either at the translational or transcriptional level) for different miRNAs, that the miRNA target prediction lists present in HOCTARdb are highly reliable. Moreover, HOCTARdb associates biological roles to each miRNA-controlled transcriptional network by means of Gene Ontology analysis. This information is easily accessible through a user-friendly query page. The HOCTARdb is available at http://hoctar.tigem.it/. We believe that a detailed relationship between miRNAs and their target genes and a constant update of the information contained in HOCTARdb will provide an extremely valuable resource to assist the researcher in the discovery of miRNA target genes.

Also flagged:neuropsychiatric disorderstransporterspositronphotonpositronselectrons
Journal Article 2011-03-22 No Snippets Shen LH, Tseng YC, Liao MH, Fu YK.
Show Full Abstract

Neuropsychiatric disorders are becoming a major socioeconomic burden to modern society. In recent years, a dramatic expansion of tools has facilitated the study of the molecular basis of neuropsychiatric disorders. Molecular imaging has enabled the noninvasive characterization and quantification of biological processes at the cellular, tissue, and organism levels in intact living subjects. This technology has revolutionized the practice of medicine and has become critical to quality health care. New advances in research on molecular imaging hold promise for personalized medicine in neuropsychiatric disorders, with adjusted therapeutic doses, predictable responses, reduced adverse drug reactions, early diagnosis, and personal health planning. In this paper, we discuss the development of radiotracers for imaging dopaminergic, serotonergic, and noradrenergic systems and β-amyloid plaques. We will underline the role of molecular imaging technologies in various neuropsychiatric disorders, describe their unique strengths and limitations, and suggest future directions in the diagnosis and management of neuropsychiatric disorders.

Also flagged:collagensproprioceptiondegenerativerotator cuff tearrotator cuff tearsextracellular
Journal Article 2011-03-21 No Snippets Liu CF, Aschbacher-Smith L, Barthelery NJ, Dyment N, Butler D, Wylie C.
Show Full Abstract

Tendons connect muscles to bones, and serve as the transmitters of force that allow all the movements of the body. Tenocytes are the basic cellular units of tendons, and produce the collagens that form the hierarchical fiber system of the tendon. Tendon injuries are common, and difficult to repair, particularly in the case of the insertion of tendon into bone. Successful attempts at cell-based repair therapies will require an understanding of the normal development of tendon tissues, including their differentiated regions such as the fibrous mid-section and fibrocartilaginous insertion site. Many genes are known to be involved in the formation of tendon. However, their functional roles in tendon development have not been fully characterized. Tissue engineers have attempted to generate functional tendon tissue in vitro. However, a lack of knowledge of normal tendon development has hampered these efforts. Here we review studies focusing on the developmental mechanisms of tendon development, and discuss the potential applications of a molecular understanding of tendon development to the treatment of tendon injuries.

Also flagged:gene expressionfollicular thyroid neoplasmsdeathfollicular adenomasfollicular carcinomasoligonucleotide
Journal Article 2011-03-21 ✓ 1 Snippet Williams MD, Zhang L, Elliott DD, Perrier ND, Lozano G, Clayman GL, El-Naggar AK.
In-Text Gene Mentions

PEBP1

Show Full Abstract

The classification of follicular thyroid neoplasms requires surgical resection for histologic evaluation of malignancy. Because variable clinical behavior exists, genomic expression profiling may lead to the identification of novel markers that facilitate better biologic classification. We performed for the first time gene expression analysis on clinically aggressive and nonaggressive follicular carcinomas (FCs) from patients for whom long-term follow-up data were available. We examined matched fresh-frozen tissue from 15 histopathologically diagnosed follicular carcinomas (7 patients with documented distant metastasis and/or death from disease and 8 patients without recurrence). For categorical comparison, we analyzed 4 follicular adenomas (FAs). The biologic control comprised 11 normal thyroid tissue specimens. High-quality RNA was extracted from the tissues, labeled, and hybridized to an Affymetrix (Santa Clara, CA) oligonucleotide microarray (HG-U133A). With the exceptions of 1 follicular adenoma and 1 follicular carcinoma, unsupervised hierarchical cluster analysis revealed 2 distinct groups--one containing normal thyroid tissue and follicular adenomas and another containing follicular carcinomas. We identified 421 genes that were differentially expressed between histologically normal thyroid tissues and all follicular neoplasms (P < 0.01; fold-change >2), 94 genes that distinguished follicular carcinomas from follicular adenomas (including PBP and CKS2), and 4 genes that distinguished aggressive follicular carcinomas from nonaggressive follicular carcinomas (NID2, TM7SF2, TRIM2, and GLTSCR2). Comparative genomic groupings identified differentially expressed genes that may lead to better classification of follicular thyroid neoplasms. Such genes may be used in future prospective validation studies to establish clinically useful and complementary diagnostic markers.

Also flagged:recombinaseRAD51HRchromosomescancerscell proliferation
Journal Article 2011-03-21 ✓ 2 Snippets Pal J, Bertheau R, Buon L, Qazi A, Batchu RB, Bandyopadhyay S, Ali-Fehmi R, Beer DG, Weaver DW, Shmookler Reis RJ, Goyal RK, Huang Q, Munshi NC, Shammas MA.
In-Text Gene Mentions

Most human cancers show multiple mutations, arising as independent events (Neiman and Hartwell, 1991), frequently observed in genes, such as c-myc, APC, c-K-ras, DCC, MCC, p53, Rad51, BRCA1, BRCA2 and related genes.

…c-myc, APC, c-K-ras,DCC, MCC, p53, Rad51,…

Show Full Abstract

A prominent feature of most cancers including Barrett's adenocarcinoma (BAC) is genetic instability, which is associated with development and progression of disease. In this study, we investigated the role of recombinase (hsRAD51), a key component of homologous recombination (HR)/repair, in evolving genomic changes and growth of BAC cells. We show that the expression of RAD51 is elevated in BAC cell lines and tissue specimens, relative to normal cells. HR activity is also elevated and significantly correlates with RAD51 expression in BAC cells. The suppression of RAD51 expression, by short hairpin RNA (shRNA) specifically targeting this gene, significantly prevented BAC cells from acquiring genomic changes to either copy number or heterozygosity (P<0.02) in several independent experiments employing single-nucleotide polymorphism arrays. The reduction in copy-number changes, following shRNA treatment, was confirmed by Comparative Genome Hybridization analyses of the same DNA samples. Moreover, the chromosomal distributions of mutations correlated strongly with frequencies and locations of Alu interspersed repetitive elements on individual chromosomes. We conclude that the hsRAD51 protein level is systematically elevated in BAC, contributes significantly to genomic evolution during serial propagation of these cells and correlates with disease progression. Alu sequences may serve as substrates for elevated HR during cell proliferation in vitro, as they have been reported to do during the evolution of species, and thus may provide additional targets for prevention or treatment of this disease.

Also flagged:hemoglobinopathiesthalassemiaglobinthalassemiasgenetic diseasescation
Journal Article 2011-03-20 ✓ 1 Snippet Giardine B, Borg J, Higgs DR, Peterson KR, Philipsen S, Maglott D, Singleton BK, Anstee DJ, Basak AN, Clark B, Costa FC, Faustino P, Fedosyuk H, Felice AE, Francina A, Galanello R, Gallivan MV, Georgitsi M, Gibbons RJ, Giordano PC, Harteveld CL, Hoyer JD, Jarvis M, Joly P, Kanavakis E, Kollia P, Menzel S, Miller W, Moradkhani K, Old J, Papachatzopoulou A, Papadakis MN, Papadopoulos P, Pavlovic S, Perseu L, Radmilovic M, Riemer C, Satta S, Schrijver I, Stojiljkovic M, Thein SL, Traeger-Synodinos J, Tully R, Wada T, Waye JS, Wiemann C, Zukic B, Chui DH, Wajcman H, Hardison RC, Patrinos GP.
In-Text Gene Mentions

SOX6

Show Full Abstract

We developed a series of interrelated locus-specific databases to store all published and unpublished genetic variation related to hemoglobinopathies and thalassemia and implemented microattribution to encourage submission of unpublished observations of genetic variation to these public repositories. A total of 1,941 unique genetic variants in 37 genes, encoding globins and other erythroid proteins, are currently documented in these databases, with reciprocal attribution of microcitations to data contributors. Our project provides the first example of implementing microattribution to incentivise submission of all known genetic variation in a defined system. It has demonstrably increased the reporting of human variants, leading to a comprehensive online resource for systematically describing human genetic variation in the globin genes and other genes contributing to hemoglobinopathies and thalassemias. The principles established here will serve as a model for other systems and for the analysis of other common and/or complex human genetic diseases.

Also flagged:Huntington's diseaseHDHuntingtindegradation
Journal Article 2011-03-19 No Snippets Gaughwin PM, Ciesla M, Lahiri N, Tabrizi SJ, Brundin P, Björkqvist M.
Show Full Abstract

Huntington's disease (HD) is a devastating, neurodegenerative condition, which lacks effective treatment. Normal Huntingtin (HTT) and mutant Huntingtin (mHTT) are expressed in multiple tissues and can alter transcription of microRNAs (miRs). Importantly, miRs are present in a bio-stable form in human peripheral blood plasma and have recently been shown to be useful biomarkers in other diseases. We therefore sought to identify potential miR biomarkers of HD that are present in, and have functional consequences for, neuronal and non-neuronal tissues. In a cell line over-expressing mHTT-Exon-1, miR microarray analysis was used to identify candidate miRs. We then examined their presence and bio-stability in control and HD plasma. We found that miR-34b is significantly elevated in response to mHTT-Exon-1, and its blockade alters the toxicity of mHTT-Exon-1 in vitro. We also show that miR-34b is detectable in plasma from small input volumes and is insensitive to freeze-thaw-induced RNA degradation. Interestingly, miR-34b is significantly elevated in plasma from HD gene carriers prior to symptom onset. This is the first study suggesting that plasma miRs might be used as biomarkers for HD.

Also flagged:arthritisinterleukin-1 receptorchromosomal regionschromosomeschromosomeMr1
Journal Article 2011-03-18 No Snippets Jiao Y, Jiao F, Yan J, Xiong Q, Shriner D, Hasty K, Stuart J, Gu W.
Show Full Abstract

To identify genetic loci that regulate spontaneous arthritis in interleukin-1 receptor antagonist (IL-1ra)-deficient mice, an F2 population was created from a cross between Balb/c IL-1ra-deficient mice and DBA/1 IL-1ra-deficient mice. Spontaneous arthritis in the F2 population was examined and recorded. Genotypes of those F2 mice were determined using microsatellite markers. Quantitative trail locus (QTL) analysis was conducted with R/qtlbim. Functions of genes within QTL chromosomal regions were evaluated using a bioinformatics tool, PGMapper, and microarray analysis. Potential candidate genes were further evaluated using GeneNetwork. A total of 137 microsatellite markers with an average of 12 cM spacing along the whole genome were used for determining the correlation of arthritis phenotypes with genotypes of 191 F2 progenies. By whole-genome mapping, we obtained QTLs on chromosomes 1 and 6 that were above the significance threshold for strong Bayesian evidence. The QTL on chromosome 1 had a peak near D1Mit55 and D1Mit425 at 82·6 cM. It may account for as much as 12% of the phenotypic variation in susceptibility to spontaneous arthritis. The QTL region contained 208 known transcripts. According to their functions, Mr1, Pla2g4a and Fasl are outstanding candidate genes. From microarray analysis, 11 genes were selected as favourable candidates based on their function and expression profiles. Three of those 11 genes, Prg4, Ptgs2 and Mr1, correlated with the IL-1ra pathway. Those genes were considered to be the best candidates.

Also flagged:tumor necrosis factorPeroxiredoxin 6peroxidasearachidonic acidcycloheximidehydrogen
Journal Article 2011-03-18 ✓ 5 Snippets Kim SY, Chun E, Lee KY.
In-Text Gene Mentions

Our results provide new insights into the distinct roles of bifunctional Prdx6 with peroxidase and PLA(2) activities in oxidative stress-induced and TNF-induced apoptosis, respectively.

Surprisingly, Prdx6(KD) cells are markedly resistant to apoptosis induced by TNF-α in the presence of cycloheximide, but are highly sensitive to hydrogen peroxide-induced apoptosis.

…Peroxiredoxin 6 (Prdx6) is a bifunctional…

…the peroxidase ofPrdx6has been well…

…the restoration ofPrdx6expression with wild-type…

Show Full Abstract

Peroxiredoxin 6 (Prdx6) is a bifunctional enzyme with peroxidase and phospholipase A(2) (PLA(2)) activities. Although the cellular function of the peroxidase of Prdx6 has been well elucidated, the function of the PLA(2) of Prdx6 is largely unknown. Here, we report a novel function for the PLA(2) in regulating TNF-induced apoptosis through arachidonic acid (AA) release and interleukin-1β (IL-1β) production. Prdx6 knockdown (Prdx6(KD)) in human bronchial epithelial cells (BEAS2B) shows severe decreases of peroxidase and PLA(2) activities. Surprisingly, Prdx6(KD) cells are markedly resistant to apoptosis induced by TNF-α in the presence of cycloheximide, but are highly sensitive to hydrogen peroxide-induced apoptosis. Furthermore, the release of AA and the production of IL-1β induced by proinflammatory stimuli, such as TNF-α, LPS, and poly I/C, are severely decreased in Prdx6(KD) cells. More interestingly, the restoration of Prdx6 expression with wild-type Prdx6, but not PLA(2)-mutant Prdx6 (S32A), in Prdx6(KD) cells dramatically induces the recovery of TNF-induced apoptosis, AA release, and IL-1β production, indicating specific roles for the PLA(2) activity of Prdx6. Our results provide new insights into the distinct roles of bifunctional Prdx6 with peroxidase and PLA(2) activities in oxidative stress-induced and TNF-induced apoptosis, respectively.

Also flagged:atherosclerosisacute coronary syndromesmyocardial infarctionMIchromatinactivated polymerase II
Journal Article 2011-03-18 ✓ 5 Snippets Ria M, Lagercrantz J, Samnegård A, Boquist S, Hamsten A, Eriksson P.
In-Text Gene Mentions

Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes.

A common polymorphism in the promoter region of the TNFSF4 gene is associated with lower allele-specific expression and risk of

The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity.

Identification of a novel TNFSF4 promoter polymorphism associated with risk of MI in women

Show Full Abstract

<h4>Background</h4>The TNFSF4/TNFRSF4 system, along with several other receptor-ligand pairs, is involved in the recruitment and activation of T-cells and is therefore tentatively implicated in atherosclerosis and acute coronary syndromes. We have previously shown that genetic variants in TNFSF4 are associated with myocardial infarction (MI) in women. This prompted functional studies of TNFSF4 expression.<h4>Methods and results</h4>Based on a screening of the TNFSF4 genomic region, a promoter polymorphism (rs45454293) and a haplotype were identified, conceivably involved in gene regulation. The rs45454293T-allele, in agreement with the linked rs3850641G-allele, proved to be associated with increased risk of MI in women. Haplotype-specific chromatin immunoprecipitation of activated polymerase II, as a measure of transcriptional activity in vivo, suggested that the haplotype including the rs45454293 and rs3850641 polymorphisms is functionally important, the rs45454293T- and rs3850641G-alleles being associated with lower transcriptional activity in cells heterozygous for both polymorphisms. The functional role of rs45454293 on transcriptional levels of TNFSF4 was clarified by luciferase reporter assays, where the rs45454293T-allele decreased gene expression when compared with the rs45454293C-allele, while the rs3850641 SNP did not have any effect on TNFSF4 promoter activity. Electromobility shift assay showed that the rs45454293 polymorphism, but not rs3850641, affects the binding of nuclear factors, thus suggesting that the lower transcriptional activity is attributed to binding of one or more transcriptional repressor(s) to the T-allele.<h4>Conclusions</h4>Our data indicate that the TNFSF4 rs45454293T-allele is associated with lower TNFSF4 expression and increased risk of MI.

Also flagged:Histone demethylaseJMJD2Bestrogen receptorbreast cancerEstrogenKDM4B
Journal Article 2011-03-18 No Snippets Kawazu M, Saso K, Tong KI, McQuire T, Goto K, Son DO, Wakeham A, Miyagishi M, Mak TW, Okada H.
Show Full Abstract

Estrogen is a key regulator of normal function of female reproductive system and plays a pivotal role in the development and progression of breast cancer. Here, we demonstrate that JMJD2B (also known as KDM4B) constitutes a key component of the estrogen signaling pathway. JMJD2B is expressed in a high proportion of human breast tumors, and that expression levels significantly correlate with estrogen receptor (ER) positivity. In addition, 17-beta-estradiol (E2) induces JMJD2B expression in an ERα dependent manner. JMJD2B interacts with ERα and components of the SWI/SNF-B chromatin remodeling complex. JMJD2B is recruited to ERα target sites, demethylates H3K9me3 and facilitates transcription of ER responsive genes including MYB, MYC and CCND1. As a consequence, knockdown of JMJD2B severely impairs estrogen-induced cell proliferation and the tumor formation capacity of breast cancer cells. Furthermore, Jmjd2b-deletion in mammary epithelial cells exhibits delayed mammary gland development in female mice. Taken together, these findings suggest an essential role for JMJD2B in the estrogen signaling, and identify JMJD2B as a potential therapeutic target in breast cancer.

Also flagged:autoantibodyprimary Sjögren's syndromeautoimmune diseaseImmune-responseautoantibodiesSLE
Journal Article 2011-03-17 ✓ 1 Snippet Hu S, Vissink A, Arellano M, Roozendaal C, Zhou H, Kallenberg CG, Wong DT.
In-Text Gene Mentions

TAOK3

Show Full Abstract

Sjögren’s syndrome (SS) is a chronic, progressive autoimmune disease primarily affecting women. Diagnosis of SS requires an invasive salivary gland tissue biopsy and a long delay from the start of the symptoms to final diagnosis has been frequently observed. In this study,we aim to identify salivary autoantibody biomarkers for primary SS (pSS) using a protein microarray approach. Immune-response protoarrays were used to profile saliva autoantibodies from patients with pSS (n = 514), patients with systemic lupus erythematosus(SLE, n = 513), and healthy control subjects (n = 513). We identified 24 potential autoantibody biomarkers that can discriminate patients with pSS from both patients with SLE and healthy individuals. Four saliva autoantibody biomarkers, anti-transglutaminase, anti-histone, anti-SSA, and anti-SSB, were further tested in independent pSS (n = 534), SLE (n = 534), and healthy control (n = 534) subjects and all were successfully validated with ELISA. This study has demonstrated the potential of a high-throughput protein microarray approach for the discovery of autoantibody biomarkers. The identified saliva autoantibody biomarkers may lead to a clinical tool for simple, noninvasive detection of pSS at low cost.

Also flagged:bindingcentral nervous system disordersinflammatory disorderscardiovascular diseasecancerdiabetes
Journal Article 2011-03-17 No Snippets Pandey UB, Nichols CD.
Show Full Abstract

The common fruit fly, Drosophila melanogaster, is a well studied and highly tractable genetic model organism for understanding molecular mechanisms of human diseases. Many basic biological, physiological, and neurological properties are conserved between mammals and D. melanogaster, and nearly 75% of human disease-causing genes are believed to have a functional homolog in the fly. In the discovery process for therapeutics, traditional approaches employ high-throughput screening for small molecules that is based primarily on in vitro cell culture, enzymatic assays, or receptor binding assays. The majority of positive hits identified through these types of in vitro screens, unfortunately, are found to be ineffective and/or toxic in subsequent validation experiments in whole-animal models. New tools and platforms are needed in the discovery arena to overcome these limitations. The incorporation of D. melanogaster into the therapeutic discovery process holds tremendous promise for an enhanced rate of discovery of higher quality leads. D. melanogaster models of human diseases provide several unique features such as powerful genetics, highly conserved disease pathways, and very low comparative costs. The fly can effectively be used for low- to high-throughput drug screens as well as in target discovery. Here, we review the basic biology of the fly and discuss models of human diseases and opportunities for therapeutic discovery for central nervous system disorders, inflammatory disorders, cardiovascular disease, cancer, and diabetes. We also provide information and resources for those interested in pursuing fly models of human disease, as well as those interested in using D. melanogaster in the drug discovery process.

Also flagged:tumorgastric cancercancersgastric tumorsSCHAGS
Journal Article 2011-03-17 ✓ 5 Snippets Oh HK, Tan AL, Das K, Ooi CH, Deng NT, Tan IB, Beillard E, Lee J, Ramnarayanan K, Rha SY, Palanisamy N, Voorhoeve PM, Tan P.
In-Text Gene Mentions

Its antioncogenic activity may involve the direct targeting and inhibition of OLFM4.

Genomic loss of miR-486 regulates tumor progression and the OLFM4 antiapoptotic factor in gastric cancer.

Supporting the biological relevance of OLFM4 as a miR-486 target, proliferation in GC cells was also significantly reduced by OLFM4 silencing.<h4>Conclusions</h4>miR-486 may function as a novel tumor-suppressor miRNA in GC.

…progression and theOLFM4antiapoptotic factor in…

…ted antiapoptotic glycoproteinOLFM4as a potential…

Show Full Abstract

<h4>Purpose</h4>MicroRNAs (miRNA) play pivotal oncogenic and tumor-suppressor roles in several human cancers. We sought to discover novel tumor-suppressor miRNAs in gastric cancer (GC).<h4>Experimental design</h4>Using Agilent miRNA microarrays, we compared miRNA expression profiles of 40 primary gastric tumors and 40 gastric normal tissues, identifying miRNAs significantly downregulated in gastric tumors.<h4>Results</h4>Among the top 80 miRNAs differentially expressed between gastric tumors and normals (false discovery rate < 0.01), we identified hsa-miR-486 (miR-486) as a significantly downregulated miRNA in primary GCs and GC cell lines. Restoration of miR-486 expression in GC cell lines (YCC3, SCH and AGS) caused suppression of several pro-oncogenic traits, whereas conversely inhibiting miR-486 expression in YCC6 GC cells enhanced cellular proliferation. Array-CGH analysis of 106 primary GCs revealed genomic loss of the miR-486 locus in approximately 25% to 30% of GCs, including two tumors with focal genomic losses specifically deleting miR-486, consistent with miR-486 playing a tumor-suppressive role. Bioinformatic analysis identified the secreted antiapoptotic glycoprotein OLFM4 as a potential miR-486 target. Restoring miR-486 expression in GC cells decreased endogenous OLFM4 transcript and protein levels, and also inhibited expression of luciferase reporters containing an OLFM4 3' untranslated region with predicted miR-486 binding sites. Supporting the biological relevance of OLFM4 as a miR-486 target, proliferation in GC cells was also significantly reduced by OLFM4 silencing.<h4>Conclusions</h4>miR-486 may function as a novel tumor-suppressor miRNA in GC. Its antioncogenic activity may involve the direct targeting and inhibition of OLFM4.

Also flagged:heparinbindingserine proteaseantithrombin IIIdisaccharidethrombin
Journal Article 2011-03-17 ✓ 1 Snippet Beaudet JM, Weyers A, Solakyildirim K, Yang B, Takieddin M, Mousa S, Zhang F, Linhardt RJ.
In-Text Gene Mentions

ATIII

Show Full Abstract

The stability of a formulated heparin was examined during its sterilization by autoclaving. A new method to follow loss in heparin binding to the serine protease inhibitor, antithrombin III, and the serine protease, thrombin, was developed using a surface plasmon resonance competitive binding assay. This loss in binding affinity correlated well with loss in antifactor IIa (thrombin) activity as well as antifactor Xa activity as measured using conventional amidolytic assays. Autoclaving also resulted in a modest breakdown of the heparin backbone as confirmed by a slight reduction in number-averaged and weight-averaged molecular weight and an increase in polydispersity. Although no clear changes were observed by nuclear magnetic resonance spectroscopy, disaccharide composition analysis using high-performance liquid chromatography-electrospray ionization-mass spectrometry suggested that loss of selected sulfo groups had taken place. It is this sulfo group loss that probably accounts for a decrease in the binding of autoclaved heparin to antithrombin III and thrombin as well as the observed decrease in its amidolytic activity.

Also flagged:Hypoxia-inducible factor-2αironFPNvon Hippel-Lindau tumor suppressor proteinVhlhypoxia-inducible factor
Journal Article 2011-03-17 ✓ 1 Snippet Taylor M, Qu A, Anderson ER, Matsubara T, Martin A, Gonzalez FJ, Shah YM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Iron deficiency and iron overload affect over a billion people worldwide. Dietary iron absorption in the small intestine is required for systemic iron homeostasis. Ferroportin (FPN) is the only characterized, mammalian, basolateral iron exporter. Despite the importance of FPN in maintaining iron homeostasis, its in vivo mechanisms of regulation are unclear.<h4>Methods</h4>Systemic iron homeostasis was assessed in mice with intestine-specific disruption of genes encoding the von Hippel-Lindau tumor suppressor protein (Vhl), hypoxia-inducible factor (HIF)-1α, HIF-2α, and aryl hydrocarbon nuclear translocator (ARNT).<h4>Results</h4>We observed biphasic regulation of Fpn during iron deficiency. Fpn was rapidly induced under conditions of low iron, which required the transcription factor HIF-2α. Targeted disruption of HIF-2α in the intestine inhibited Fpn induction in mice with low iron, through loss of transcriptional activation. Analysis of the Fpn promoter and in vivo chromatin immunoprecipitation assays demonstrated that HIF-2α directly binds to the Fpn promoter and induces its expression, indicating a mechanism of transcriptional regulation of Fpn following changes in systemic levels of iron. During chronic iron deficiency, FPN protein levels also increased, via increased stability through a HIF-2α-independent pathway.<h4>Conclusions</h4>In mice, expression of the gene that encodes Fpn and its protein levels are regulated by distinct pathways to provide a rapid and sustained response to acute and chronic iron deficiency. Therapies that target FPN might be developed for patients with iron-related disorders.

Also flagged:Serotonin transportervincristine neuropathyvincristineneuropathycancerserotonin
Journal Article 2011-03-17 ✓ 5 Snippets Hansen N, Uçeyler N, Palm F, Zelenka M, Biko L, Lesch KP, Gerlach M, Sommer C.
In-Text Gene Mentions

Here, we investigated how pain behavior is modulated in mice lacking the serotonin transporter (5-HTT-/- mice) after inducing neuropathy by intraperitoneal injections of VCR.

Our results suggest that the reduced peripheral 5-HT levels of 5-HTT-/- mice in VCR neuropathy underlie the lack of heat hyperalgesia.

…the serotonin transporter (5-HTT-/- mice) after inducing…

…Thus the5-HTT-/- genotype did not…

…5-HT levels of5-HTT-/- mice in VCR…

Show Full Abstract

Painful vincristine (VCR) neuropathy is a frequent and dose-limiting problem in cancer treatment. Here, we investigated how pain behavior is modulated in mice lacking the serotonin transporter (5-HTT-/- mice) after inducing neuropathy by intraperitoneal injections of VCR. We used standard tests for evoked pain, high performance liquid chromatography to measure serotonin (5-HT), and immunohistochemistry of L4/5 dorsal root ganglia (DRG) to assess neuronal injury and inflammation. After injections of VCR, 5-HTT-/- mice did not develop hypersensitivity to heat, in contrast to their wildtype (wt) littermates (p<0.05). Also, 5-HTT-/- mice recovered faster from mechanical hypersensitivity than wt mice (p<0.05). 5-HT levels were lower in the peripheral and central nervous tissue of vehicle or VCR-treated 5-HTT-/- mice compared to wt mice. VCR-treated mice had higher numbers of injured neurons as identified by immunostaining for activating transcription factor 3, and more immunoreactive macrophages in the L4/5 DRG than vehicle-treated mice. There was no difference between genotypes. Thus the 5-HTT-/- genotype did not protect mice from VCR-induced neuronal injury and macrophage infiltration in the DRG. Our results suggest that the reduced peripheral 5-HT levels of 5-HTT-/- mice in VCR neuropathy underlie the lack of heat hyperalgesia. Conversely, attenuation of mechanical allodynia in 5-HTT-/- mice may indicate reduced 5-HT-mediated facilitation in the central nervous system.

Also flagged:ChemotaxistaxDiacetylBenzaldehydedaDendrites
Journal Article 2011-03-17 ✓ 1 Snippet Arellano-Carbajal F, Briseño-Roa L, Couto A, Cheung BH, Labouesse M, de Bono M.
In-Text Gene Mentions

…athways (UNC-6/netrin; UNC-40/DCC; ROBO [10] )…

Show Full Abstract

Genome sequence comparisons have highlighted many novel gene families that are conserved across animal phyla but whose biological function is unknown. Here, we functionally characterize a member of one such family, the macoilins. Macoilins are characterized by several highly conserved predicted transmembrane domains towards the N-terminus and by coiled-coil regions C-terminally. They are found throughout Eumetazoa but not in other organisms. Mutants for the single Caenorhabditis elegans macoilin, maco-1, exhibit a constellation of behavioral phenotypes, including defects in aggregation, O₂ responses, and swimming. MACO-1 protein is expressed broadly and specifically in the nervous system and localizes to the rough endoplasmic reticulum; it is excluded from dendrites and axons. Apart from subtle synapse defects, nervous system development appears wild-type in maco-1 mutants. However, maco-1 animals are resistant to the cholinesterase inhibitor aldicarb and sensitive to levamisole, suggesting pre-synaptic defects. Using in vivo imaging, we show that macoilin is required to evoke Ca²(+) transients, at least in some neurons: in maco-1 mutants the O₂-sensing neuron PQR is unable to generate a Ca²(+) response to a rise in O₂. By genetically disrupting neurotransmission, we show that pre-synaptic input is not necessary for PQR to respond to O₂, indicating that the response is mediated by cell-intrinsic sensory transduction and amplification. Disrupting the sodium leak channels NCA-1/NCA-2, or the N-,P/Q,R-type voltage-gated Ca²(+) channels, also fails to disrupt Ca²(+) responses in the PQR cell body to O₂ stimuli. By contrast, mutations in egl-19, which encodes the only Caenorhabditis elegans L-type voltage-gated Ca²(+) channel α1 subunit, recapitulate the Ca²(+) response defect we see in maco-1 mutants, although we do not see defects in localization of EGL-19. Together, our data suggest that macoilin acts in the ER to regulate assembly or traffic of ion channels or ion channel regulators.

Also flagged:ironinfectionsHIV infectiontuberculosiscanceroverload
Journal Article 2011-03-17 ✓ 5 Snippets Nevitt T, Thiele DJ.
In-Text Gene Mentions

Given the high prevalence of HFE mutations, it has been postulated that this mutation was positively selected for conferring protection during outbreaks of infections caused by intracellular pathogens such as Chlamydia and Yersinia[44], [45] highlighting the intimate association between host Fe status and infectious disease.

…in patients carryingHFEmutations present in…

…high prevalence ofHFEmutations, it has…

…The FPN C326Y disease-associated mutation results in a similar clinical outcome to that observed in patients carryingHFEmutations present in approximately 80% of HH patients and exhibiting an allelic frequency of over 10% in Caucasians of European descent [13] .…

…Given the high prevalence ofHFEmutations, it has been postulated that this mutation was positively selected for conferring protection during outbreaks of infections caused by intracellular pathogens such as Chlamydia and Yersinia [44] , [45] highlighting the intimate association between host Fe status and infectious disease.…

Show Full Abstract

The fungal pathogen Candida glabrata has risen from an innocuous commensal to a major human pathogen that causes life-threatening infections with an associated mortality rate of up to 50%. The dramatic rise in the number of immunocompromised individuals from HIV infection, tuberculosis, and as a result of immunosuppressive regimens in cancer treatment and transplant interventions have created a new and hitherto unchartered niche for the proliferation of C. glabrata. Iron acquisition is a known microbial virulence determinant and human diseases of iron overload have been found to correlate with increased bacterial burden. Given that more than 2 billion people worldwide suffer from iron deficiency and that iron overload is one of the most common single-gene inherited diseases, it is important to understand whether host iron status may influence C. glabrata infectious disease progression. Here we identify Sit1 as the sole siderophore-iron transporter in C. glabrata and demonstrate that siderophore-mediated iron acquisition is critical for enhancing C. glabrata survival to the microbicidal activities of macrophages. Within the Sit1 transporter, we identify a conserved extracellular SIderophore Transporter Domain (SITD) that is critical for siderophore-mediated ability of C. glabrata to resist macrophage killing. Using macrophage models of human iron overload disease, we demonstrate that C. glabrata senses altered iron levels within the phagosomal compartment. Moreover, Sit1 functions as a determinant for C. glabrata to survive macrophage killing in a manner that is dependent on macrophage iron status. These studies suggest that host iron status is a modifier of infectious disease that modulates the dependence on distinct mechanisms of microbial Fe acquisition.

Also flagged:degradationmembrane proteinsproteasomemembrane proteinprionPrP
Journal Article 2011-03-16 ✓ 5 Snippets Chakrabarti O, Rane NS, Hegde RS.
In-Text Gene Mentions

…PrP. Ub-GFP and GFP-Htt103 were gifts…

…1 of Huntingtin (Htt).…

…een fluorescent protein (GFP)-Htt Q103Q103 with a…

…coexpressed with theseHttaggregates, PrP and…

…of cells containingHttQ103 aggregates (…

Show Full Abstract

A wide range of diseases are associated with the accumulation of cytosolic protein aggregates. The effects of these aggregates on various aspects of normal cellular protein homeostasis remain to be determined. Here we find that cytosolic aggregates, without necessarily disrupting proteasome function, can markedly delay the normally rapid degradation of nontranslocated secretory and membrane protein precursors. In the case of mammalian prion protein (PrP), the nontranslocated fraction is recruited into preexisting aggregates before its triage for degradation. This recruitment permits the growth and persistence of cytosolic PrP aggregates, explaining their apparent "self-conversion" seen in earlier studies of transient proteasome inhibition. For other proteins, the aggregate-mediated delay in precursor degradation led to aggregation and/or soluble residence in the cytosol, often causing aberrant cellular morphology. Remarkably, improving signal sequence efficiency mitigated these effects of aggregates. These observations identify a previously unappreciated consequence of cytosolic aggregates for nontranslocated secretory and membrane proteins, a minor but potentially disruptive population the rapid disposal of which is critical to maintaining cellular homeostasis.

Also flagged:transcription factorTCFimmediateserum response factorSRFphosphorylation
Journal Article 2011-03-16 ✓ 1 Snippet Besnard A, Galan-Rodriguez B, Vanhoutte P, Caboche J.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disorder due to abnormal polyglutamine expansion in the N-terminal region of huntingtin (Htt) protein.

Show Full Abstract

The ternary complex factor (TCF) Elk-1 is a transcription factor that regulates immediate early gene (IEG) expression via the serum response element (SRE) DNA consensus site. Elk-1 is associated with a dimer of serum response factor (SRF) at the SRE site, and its phosphorylation occurs at specific residues in response to mitogen-activated protein kinases (MAPKs), including c-Jun-N terminal kinase (JNK), p38/MAPK, and extracellular-signal regulated kinase (ERK). This phosphorylation event is critical for triggering SRE-dependent transcription. Although MAPKs are fundamental actors for the instatement and maintenance of memory, and much investigation of their downstream signaling partners have been conducted, no data yet clearly implicate Elk-1 in these processes. This is partly due to the complexity of Elk-1 sub-cellular localization, and hence functions, within neurons. Elk-1 is present in its resting state in the cytoplasm, where it colocalizes with mitochondrial proteins or microtubules. In this particular sub-cellular compartment, overexpression of Elk-1 is toxic for neuronal cells. When phosphorylated by the MAPK/ERK, Elk-1 translocates to the nucleus where it is implicated in regulating chromatin remodeling, SRE-dependent transcription, and neuronal differentiation. Another post-translational modification is the conjugation to SUMO (Small Ubiquitin-like MOdifier), which relocalizes Elk-1 in the cytoplasm. Thus, Elk-1 plays a dual role in neuronal functions: pro-apoptotic within the cytoplasm, and pro-differentiation within the nucleus. To address the role of Elk-1 in the brain, one must be aware of its multiple facets, and design molecular tools that will shut down Elk-1 expression, trafficking, or activation, in specific neuronal compartments. We summarize in this review the known molecular functions of Elk-1, its regulation in neuronal cells, and present evidence of its possible implication in model systems of synaptic plasticity, learning, but also in neurodegenerative diseases.

Also flagged:chronic hepatitisliver cirrhosishepatocellular carcinomaHepatitis B e antigenHBeAgHBV infection
Journal Article 2011-03-16 ✓ 1 Snippet Cho EY, Choi CS, Cho JH, Kim HC.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background/aims</h4>Few reports have described the association between mutations in the entire X gene of the hepatitis B virus (HBV) and the clinical status of HBV-infected patients. We studied the association between HBV X gene mutations and the disease status of patients infected with HBV genotype C.<h4>Methods</h4>Mutations in the HBV X genes of 194 patients were determined by direct sequencing. The subject population consisted of patients with chronic hepatitis (n=60), liver cirrhosis (n=65), and hepatocellular carcinoma (HCC) (n=69). The sequencing results of these 3 groups were compared.<h4>Results</h4>Each of the mutations G1386M, C1485T, C1653T, T1753V, A1762T, and G1764A was significantly associated with the patient's clinical status. The T1753V (p<0.001) and A1762T/G1764A (p<0.001) mutations were found more frequently in Hepatitis B e antigen (HBeAg)-negative than in HBeAg-positive patients. Specific X gene mutations (G1386M, C1653T, and A1762T/G1764A) were more prevalent in patients with liver cirrhosis and HCC than in chronic hepatitis patients (p<0.005 for all). In addition, the T1753V (p<0.001) and C1485T (p<0.001) mutations were significantly more prevalent in HCC patients than in chronic hepatitis patients. Only the prevalence of the T1753V mutation increased as the HBV infection progressed from liver cirrhosis to HCC (p=0.023).<h4>Conclusions</h4>Our findings show a difference in the pattern of X gene mutations that were associated with the clinical status of patients with chronic HBV infection.

Also flagged:antithrombin deficiencyAntithrombinATdeep vein thrombosispulmonary embolismdeath
Journal Article 2011-03-15 No Snippets Cooper PC, Coath F, Daly ME, Makris M.
Show Full Abstract

<h4>Introduction</h4>Antithrombin (AT) deficiency is associated with an increased risk of deep vein thrombosis and pulmonary embolism which are major causes of morbidity and death. The incidence of deficiency in healthy populations has been reported to vary from 1/600 to 1/5000, with the variation being due to the different populations studied and detection methods used. When reduced activity levels are identified it is important to measure the AT antigen levels to differentiate type I from type II disorders, as type II defects have varying thrombotic risk.<h4>Methods</h4>Functional AT assays detect the ability of AT to inactivate thrombin or factor Xa, and AT antigen assays detect the quantity of AT in plasma. In functional assays, reducing the incubation time of sample with enzyme/heparin reagent may increase sensitivity to type II defects. An excess of antigen over activity level suggests the presence of functionally defective AT, which can be characterized further by assaying AT in the absence of heparin, electrophoresis to investigate the ability of heparin to bind to AT, and gene sequencing.<h4>Results</h4>Many patients with AT deficiency have a type II defect and these defects may not be detected by all routine diagnostic assays. Assays using human thrombin may lack specificity and assays that use factor Xa may fail to detect the common variant, AT Cambridge II, which can be detected by assays using bovine thrombin, especially if activity is compared to antigen by ratio. Factor Xa based assays may be particularly sensitive to certain heparin binding defects, and sensitivity of assays to both heparin binding and reactive site defects can be improved by shortening the incubation time with enzyme.<h4>Conclusion</h4>uAT activity assays are essential for the detection of AT deficiency because type II defects are relatively common in patients with heritable deficiency. No one functional assay can be assumed to detect all forms of AT deficiency, and assays can sometimes be improved by reducing reaction time of AT with thrombin or factor Xa.

Also flagged:Huntington diseasedevelopmental delayJuvenile Huntington diseaseataxiadementiaHD
Journal Article 2011-03-15 ✓ 2 Snippets Nicolas G, Devys D, Goldenberg A, Maltête D, Hervé C, Hannequin D, Guyant-Maréchal L.
In-Text Gene Mentions

Patients with JHD usually carry more than 60 CAG repeats within the HTT gene.

…expansion of theHTTgene in the…

Show Full Abstract

Juvenile Huntington disease (JHD) is a rare clinical entity characterized by disease onset before the age of 21. JHD accounts for <10% of Huntington disease patients. Transmission of JHD is paternal in 80-90% of cases. Patients with JHD usually carry more than 60 CAG repeats within the HTT gene. We report here on a 23-month-old boy presenting with global developmental delay first noted at 18 months of age. Clinical examination showed truncal hypotonia, postural and intentional tremor, limb rigidity, and ataxia. Cerebral magnetic resonance imagery (MRI) showed reduced cerebellar volume. Six months later, his 47-year-old father was seen for a 4-year history of progressive dementia with severe behavioral disturbance and chorea. Cerebral MRI showed discrete global and caudate atrophy. DNA analysis revealed a very large and heterogeneous expansion (210-250 CAG) in the child and a 43 CAG expansion of the HTT gene in the father. This unusual case demonstrates that very early onset JHD due to large CAG expansions should be considered in cases of global developmental delay associated with reduced cerebellar volume, including cases without known HD family history.

Also flagged:5-HT transporterhypoalgesiadepressionSerotonin Transporteraffective disordersmajor depression
Journal Article 2011-03-15 ✓ 5 Snippets Lindstedt F, Lonsdorf TB, Schalling M, Kosek E, Ingvar M.
In-Text Gene Mentions

The main aim of this study was to assess if the perception of thermal pain thresholds is associated with genetically inferred levels of expression of the 5-HT transporter (5-HTT).

Low 5-HTT expression is, however, also a risk factor for depression where thermal insensitivity is often seen.

Despite the fact that reduced 5-HTT expression is a risk factor for chronic pain we found it to be related to hypoalgesia for threshold thermal pain.

Reports of 5-HTT-knockout mice exhibiting markedly reduced thermal hyperalgesia in a model of neuropathic pain [24], [25] suggest that the human tri-allelic 5-HTTLPR could be an ideal candidate gene for exploring 5-HT related individual differences in thermal pain perception and, possibly, perception of neuropathic pain.

…the 5-HT transporter (5-HTT).…

Show Full Abstract

<h4>Aim</h4>The main aim of this study was to assess if the perception of thermal pain thresholds is associated with genetically inferred levels of expression of the 5-HT transporter (5-HTT). Additionally, the perception of the so-called thermal grill illusion (TGI) was assessed. Forty-four healthy individuals (27 females, 17 males) were selected a-priori based on their 5-HTTLPR/rs25531 ('tri-allelic 5-HTTLPR') genotype, with inferred high or low 5-HTT expression. Thresholds for heat- and cold-pain were determined along with the sensory and affective dimensions of the TGI.<h4>Results</h4>Thresholds to heat- and cold-pain correlated strongly (rho  = -0.58, p<0.001). Individuals in the low 5-HTT-expressing group were significantly less sensitive to heat-pain (p = 0.02) and cold-pain (p = 0.03), compared to the high-expressing group. A significant gender-by-genotype interaction also emerged for cold-pain perception (p = 0.02); low 5-HTT-expressing females were less sensitive. The TGI was rated as significantly more unpleasant (affective-motivational dimension) than painful (sensory-discriminatory dimension), (p<0.001). Females in the low 5-HTT expressing group rated the TGI as significantly less unpleasant than high 5-HTT expressing females (p<0.05), with no such differences among men.<h4>Conclusion/significance</h4>We demonstrate an association between inferred low 5-HTT expression and elevated thresholds to thermal pain in healthy non-depressed individuals. Despite the fact that reduced 5-HTT expression is a risk factor for chronic pain we found it to be related to hypoalgesia for threshold thermal pain. Low 5-HTT expression is, however, also a risk factor for depression where thermal insensitivity is often seen. Our results may thus contribute to a better understanding of the molecular underpinnings of such paradoxical hypoalgesia. The results point to a differential regulation of thermoafferent-information along the neuraxis on the basis of 5-HTT expression and gender. The TGI, suggested to rely on the central integration of thermoafferent-information, may prove a valuable tool in probing the affective-motivational dimension of these putative mechanisms.

Also flagged:cancersmethylationL1gene expressionhypomethylationcancer
Journal Article 2011-03-15 ✓ 3 Snippets Aporntewan C, Phokaew C, Piriyapongsa J, Ngamphiw C, Ittiwut C, Tongsima S, Mutirangura A.
In-Text Gene Mentions

…control primers were,TRIM38, GCAAAAACCACAATTACTTTTGCAC an…

TRIM38was predicted to…

TRIM38was up-regulated in…

Show Full Abstract

In human cancers, the methylation of long interspersed nuclear element -1 (LINE-1 or L1) retrotransposons is reduced. This occurs within the context of genome wide hypomethylation, and although it is common, its role is poorly understood. L1s are widely distributed both inside and outside of genes, intragenic and intergenic, respectively. Interestingly, the insertion of active full-length L1 sequences into host gene introns disrupts gene expression. Here, we evaluated if intragenic L1 hypomethylation influences their host gene expression in cancer. First, we extracted data from L1base (http://l1base.molgen.mpg.de), a database containing putatively active L1 insertions, and compared intragenic and intergenic L1 characters. We found that intragenic L1 sequences have been conserved across evolutionary time with respect to transcriptional activity and CpG dinucleotide sites for mammalian DNA methylation. Then, we compared regulated mRNA levels of cells from two different experiments available from Gene Expression Omnibus (GEO), a database repository of high throughput gene expression data, (http://www.ncbi.nlm.nih.gov/geo) by chi-square. The odds ratio of down-regulated genes between demethylated normal bronchial epithelium and lung cancer was high (p<1E(-27); OR = 3.14; 95% CI = 2.54-3.88), suggesting cancer genome wide hypomethylation down-regulating gene expression. Comprehensive analysis between L1 locations and gene expression showed that expression of genes containing L1s had a significantly higher likelihood to be repressed in cancer and hypomethylated normal cells. In contrast, many mRNAs derived from genes containing L1s are elevated in Argonaute 2 (AGO2 or EIF2C2)-depleted cells. Hypomethylated L1s increase L1 mRNA levels. Finally, we found that AGO2 targets intronic L1 pre-mRNA complexes and represses cancer genes. These findings represent one of the mechanisms of cancer genome wide hypomethylation altering gene expression. Hypomethylated intragenic L1s are a nuclear siRNA mediated cis-regulatory element that can repress genes. This epigenetic regulation of retrotransposons likely influences many aspects of genomic biology.

Also flagged:cell migrationtissue developmentchitinwound healingacetylglucosamine
Journal Article 2011-03-15 No Snippets Jayakumar R, Chennazhi KP, Srinivasan S, Nair SV, Furuike T, Tamura H.
Show Full Abstract

Tissue engineering/regeneration is based on the hypothesis that healthy stem/progenitor cells either recruited or delivered to an injured site, can eventually regenerate lost or damaged tissue. Most of the researchers working in tissue engineering and regenerative technology attempt to create tissue replacements by culturing cells onto synthetic porous three-dimensional polymeric scaffolds, which is currently regarded as an ideal approach to enhance functional tissue regeneration by creating and maintaining channels that facilitate progenitor cell migration, proliferation and differentiation. The requirements that must be satisfied by such scaffolds include providing a space with the proper size, shape and porosity for tissue development and permitting cells from the surrounding tissue to migrate into the matrix. Recently, chitin scaffolds have been widely used in tissue engineering due to their non-toxic, biodegradable and biocompatible nature. The advantage of chitin as a tissue engineering biomaterial lies in that it can be easily processed into gel and scaffold forms for a variety of biomedical applications. Moreover, chitin has been shown to enhance some biological activities such as immunological, antibacterial, drug delivery and have been shown to promote better healing at a faster rate and exhibit greater compatibility with humans. This review provides an overview of the current status of tissue engineering/regenerative medicine research using chitin scaffolds for bone, cartilage and wound healing applications. We also outline the key challenges in this field and the most likely directions for future development and we hope that this review will be helpful to the researchers working in the field of tissue engineering and regenerative medicine.

Also flagged:paraformaldehydeRPEluciferaseDHFRcalciumnucleic acid
Journal Article 2011-03-14 ✓ 1 Snippet Testoni B, Schinzari V, Guerrieri F, Guerrieri F, Gerbal-Chaloin S, Blandino G, Levrero M.
In-Text Gene Mentions

…part of thePcG repressive complexrepressive complex 2…

Show Full Abstract

The DNp73 proteins act as trans-repressors of p53 and p73-dependent transcription and exert both anti-apoptotic activity and pro-proliferative activity. DNp73s are frequently up-regulated in a variety of human cancers, including human hepatocellular carcinomas (HCCs). Increased levels of DNp73 proteins confer to HCC cells resistance to apoptosis and, irrespective to p53 status, a chemoresistant phenotype. Here, we show that interferon (IFN)α down-regulates DNp73 expression in primary human hepatocytes (PHHs) and HCC cell lines. IFNα has been used as pro-apoptotic agent in the treatment of malignancies and there is increasing evidence of IFNα effectiveness in HCC treatment and prevention of recurrence. The precise mechanisms by which class I IFNs exert their anti-proliferative and anti-tumor activity remain unclear. IFNα binding to its receptor activates multiple intracellular signaling cascades regulating the transcription of numerous direct target genes through the recruitment of a complex comprising of STAT1, STAT2 and IFN regulatory factor (IRF)9 to their promoters. We found that, in response to IFNα, the P2p73 promoter undergoes substantial chromatin remodeling. Histone deacetylases (HDACs) replace histone acetyl transferases. STAT2 is recruited onto the endogenous P2p73 promoter together with the polycomb group protein Ezh2, leading to increased H3K27 methylation and transcriptional repression. The reduction of DNp73 levels by IFNα is paralleled by an increased susceptibility to IFNα-triggered apoptosis of Huh7 hepatoma cells. Our results show, for the first time, that IFN-stimulated gene factor 3 recruitment may serve both in activating and repressing gene expression and identify the down-regulation of DNp73 as an additional mechanism to counteract the chemoresistance of liver cancer cells.

Also flagged:stem cell differentiationgap junctionRod1myocyte differentiationheart failurec-kit
Journal Article 2011-03-14 ✓ 2 Snippets Hosoda T, Zheng H, Cabral-da-Silva M, Sanada F, Ide-Iwata N, Ogórek B, Ferreira-Martins J, Arranto C, D'Amario D, del Monte F, Urbanek K, D'Alessandro DA, Michler RE, Anversa P, Rota M, Kajstura J, Leri A.
In-Text Gene Mentions

…miR-499 target genesSox6and Rod1, enhancing…

Sox6

Show Full Abstract

<h4>Background</h4>Cardiac stem cells (CSCs) delivered to the infarcted heart generate a large number of small fetal-neonatal cardiomyocytes that fail to acquire the differentiated phenotype. However, the interaction of CSCs with postmitotic myocytes results in the formation of cells with adult characteristics.<h4>Methods and results</h4>On the basis of results of in vitro and in vivo assays, we report that the commitment of human CSCs (hCSCs) to the myocyte lineage and the generation of mature working cardiomyocytes are influenced by microRNA-499 (miR-499), which is barely detectable in hCSCs but is highly expressed in postmitotic human cardiomyocytes. miR-499 traverses gap junction channels and translocates to structurally coupled hCSCs favoring their differentiation into functionally competent cells. Expression of miR-499 in hCSCs represses the miR-499 target genes Sox6 and Rod1, enhancing cardiomyogenesis in vitro and after infarction in vivo. Although cardiac repair was detected in all cell-treated infarcted hearts, the aggregate volume of the regenerated myocyte mass and myocyte cell volume were greater in animals injected with hCSCs overexpressing miR-499. Treatment with hCSCs resulted in an improvement in ventricular function, consisting of a better preservation of developed pressure and positive and negative dP/dt after infarction. An additional positive effect on cardiac performance occurred with miR-499, pointing to enhanced myocyte differentiation/hypertrophy as the mechanism by which miR-499 potentiated the restoration of myocardial mass and function in the infarcted heart.<h4>Conclusions</h4>The recognition that miR-499 promotes the differentiation of hCSCs into mechanically integrated cardiomyocytes has important clinical implications for the treatment of human heart failure.

Also flagged:creatine kinasehearingHuntington diseaseHDdegenerative disorderhearing impairment
Journal Article 2011-03-14 ✓ 4 Snippets Lin YS, Chen CM, Soong BW, Wu YR, Chen HM, Yeh WY, Wu DR, Lin YJ, Poon PW, Cheng ML, Wang CH, Chern Y.
In-Text Gene Mentions

Immunohistochemical analyses demonstrated the presence of mutant huntingtin that formed intranuclear inclusions in the organ of Corti of HD mice, which might interfere with normal auditory function.

Huntington disease (HD) is a degenerative disorder caused by expanded CAG repeats in exon 1 of the huntingtin gene (HTT).

…huntingtin gene (HTT).…

HTT

Show Full Abstract

Huntington disease (HD) is a degenerative disorder caused by expanded CAG repeats in exon 1 of the huntingtin gene (HTT). Patients with late-stage HD are known to have abnormal auditory processing, but the peripheral auditory functions of HD patients have yet to be thoroughly assessed. In this study, 19 HD patients (aged 40-59 years) were assessed for hearing impairment using pure-tone audiometry and assessment of auditory brainstem responses (ABRs). PTA thresholds were markedly elevated in HD patients. Consistent with this, elevated ABR thresholds were also detected in two mouse models of HD. Hearing loss thus appears to be an authentic symptom of HD. Immunohistochemical analyses demonstrated the presence of mutant huntingtin that formed intranuclear inclusions in the organ of Corti of HD mice, which might interfere with normal auditory function. Quantitative RT-PCR and Western blot analyses further revealed reduced expression of brain creatine kinase (CKB), a major enzyme responsible for ATP regeneration via the phosphocreatine-creatine kinase (PCr-CK) system, in the cochlea of HD mice. Treatment with creatine supplements ameliorated the hearing impairment of HD mice, suggesting that the impaired PCr-CK system in the cochlea of HD mice may contribute to their hearing impairment. These data also suggest that creatine may be useful for treating the hearing abnormalities of patients with HD.

Also flagged:benzamideselectron transportisoniazidfluconazolepenicillin Gciprofloxacin
Journal Article 2011-03-14 No Snippets Imramovsky A, Pesko M, Kralova K, Vejsova M, Stolarikova J, Vinsova J, Jampilek J.
Show Full Abstract

In this study, a series of twenty-two 5-chloro-2-hydroxy-N-[2-(arylamino)-1-alkyl-2-oxoethyl]benzamides and ten 4-chloro-2-hydroxy-N-[2-(arylamino)-1-alkyl-2-oxoethyl]benzamides is described. The compounds were analyzed using RP-HPLC to determine lipophilicity. Primary in vitro screening of the synthesized compounds was performed against mycobacterial, bacterial and fungal strains. They were also evaluated for their activity related to the inhibition of photosynthetic electron transport (PET) in spinach (Spinacia oleracea L.) chloroplasts. The compounds showed biological activity comparable with or higher than the standards isoniazid, fluconazole, penicillin G or ciprofloxacin. For all the compounds, the relationships between the lipophilicity and the chemical structure of the studied compounds as well as their structure-activity relationships are discussed.

Also flagged:SepsisNeonatal sepsisC-reactive proteinCRPserum amyloid ASAA
Journal Article 2011-03-14 ✓ 3 Snippets Bartolovic D, Ignjatovic S, Stankovic S, Nada Majkić S.
In-Text Gene Mentions

…(r=0.556), CRP andATIII(r=0.497), SAA and…

…(r=0.463), plasminogen andATIII(0.424), protein C…

…protein C andATIII(p=0.449).…

Show Full Abstract

Neonatal sepsis is one of the most significant causes of mortality and morbidity in infants. Among numerous parameters available to confirm the presence of sepsis in newborns procalcitonin (PCT) has been chosen. The aim of this study was the determination of PCT, C-reactive protein (CRP) serum amyloid A (SAA), plasminogen, protein C, antithrombin III (AT III) and white blood cell count (WBC) in blood sample obtained by puncture of the umbilical vein. Sixty two newborn infants were included in the study: 31 with suspected bacterial infection and 31 healthy babies Serum procalcitonin was measured using Kryptor analyzer (Brahms Aktiengesellschaft, Germany); serum hsCRP and SAA on the Behring Nephelometer II (Dade Behring Diagnostics GmbH, Marburg, Germany); plasma plasminogen, protein C and AT III on BCT Coagulation system, (Dade Behring Diagnostics GmbH, Marburg, Germany); and WBC count was determined in the whole blood using hematological analyzer ADVIA 120 Hematology System (Bayer, Germany). The obtained mean values of PCT, hsCRP, SAA, WBC, plasminogen, AT III, protein C in newborn's samples with suspected bacterial infection/healthy newborns were: 0.188 ng/L / 0.121 ng/L; 1.20 mg/L / 1.30 mg/L, 1.28% / 1.70%; 16.0 x 10(9)/L/12.0 x 10(9) / L, 61.0% / 59.0%, 52.0% / 64.5%, 39.0% / 41.0%, respectively. Neonates with bacterial infection had significantly higher values of PCT (p <0.001), WBC (p <0.001) and CRP (p <0.05) compared to healthy babies. Based on these results, it may be concluded that procalcitonin is useful for early diagnosis of sepsis in newborns.

Also flagged:Tumorductal carcinoma T10tumorsHer2breast cancerNucleus
Journal Article 2011-03-13 No Snippets Navin N, Kendall J, Troge J, Andrews P, Rodgers L, McIndoo J, Cook K, Stepansky A, Levy D, Esposito D, Muthuswamy L, Krasnitz A, McCombie WR, Hicks J, Wigler M.
Show Full Abstract

Genomic analysis provides insights into the role of copy number variation in disease, but most methods are not designed to resolve mixed populations of cells. In tumours, where genetic heterogeneity is common, very important information may be lost that would be useful for reconstructing evolutionary history. Here we show that with flow-sorted nuclei, whole genome amplification and next generation sequencing we can accurately quantify genomic copy number within an individual nucleus. We apply single-nucleus sequencing to investigate tumour population structure and evolution in two human breast cancer cases. Analysis of 100 single cells from a polygenomic tumour revealed three distinct clonal subpopulations that probably represent sequential clonal expansions. Additional analysis of 100 single cells from a monogenomic primary tumour and its liver metastasis indicated that a single clonal expansion formed the primary tumour and seeded the metastasis. In both primary tumours, we also identified an unexpectedly abundant subpopulation of genetically diverse 'pseudodiploid' cells that do not travel to the metastatic site. In contrast to gradual models of tumour progression, our data indicate that tumours grow by punctuated clonal expansions with few persistent intermediates.

Also flagged:ironinfectionsecretionsiderophoremembranereceptors
Journal Article 2011-03-12 ✓ 1 Snippet Kustusch RJ, Kuehl CJ, Crosa JH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The Vibrios are a unique group of bacteria inhabiting a vast array of aquatic environments. Many Vibrio species are capable of infecting a wide assortment of hosts. Some of these species include V. parahaemolyticus, V. alginolyticus, V. vulnificus, V. anguillarum, and V. cholerae. The ability of these organisms to utilize iron is essential in establishing both an infection in their hosts as well as surviving in the environment. Bacteria are able to sequester iron through the secretion of low molecular weight iron chelators termed siderophores. The iron-siderophore complexes are bound by specific outer membrane receptors and are brought through both the outer and inner membranes of the cell. The energy needed to drive this active transport is achieved through the TonB energy transduction system. When first elucidated in E. coli, the TonB system was shown to be a three protein complex consisting of TonB, ExbB and ExbD. Most Vibrio species carry two TonB systems. The second TonB system includes a fourth protein; TtpC, which is essential for TonB2 mediated iron transport. Some Vibrio species have been shown to carry a third TonB system that also includes a TtpC protein.

Also flagged:Neurological DiseasesBehaviorGrowth FactorsNeurodegenerative DiseasesCarnitinechronic kidney disease
Journal Article 2011-03-12 ✓ 1 Snippet Pandey K, Sharma SK.
In-Text Gene Mentions

…in receptor of a second type, a leech-DCC. …

Show Full Abstract

Posttranslational modifications in proteins play critical roles in synaptic plasticity and memory. In addition, the enduring form of long-term potentiation (LTP) and long-term memory require synthesis of proteins. Some of the mRNAs are present in the dendrites and are locally translated into proteins. Microtubules play critical roles in neuronal transport including the transport of mRNAs from the cell body to the dendrites. Here, we show that KCl depolarization increases acetylation of α-tubulin, a constituent of microtubules, in the CA1 region of the hippocampal slices. Furthermore, activation of N-methyl-D: -aspartate receptor, a type of glutamate receptor that plays critical roles in LTP and memory, also enhances α-tubulin acetylation. These results show that acetylation of α-tubulin is modulated in an activity-dependent manner.

Also flagged:CD34
Journal Article 2011-03-11 ✓ 1 Snippet Gokmen Z, Ozkiraz S, Tarcan A, Kozanoglu I, Ozcimen EE, Ozbek N.
In-Text Gene Mentions

CD34+ cell counts were 45.3 ± 36.6/μL in the ICC and 33.2 ± 26.6/μL in the DCC group (P=0.33); multi-potent progenitor cell counts were 43.2 ± 35/μL in the ICC and 31.1 ± 26.6/μL in the DCC group (P=0.28); and hematopoietic stem cell counts were 2.1 ± 2.1/μL in the ICC and 2.1 ± 3.1/μL in the DCC group (P=0.66).<h4>Conclusion</h4>Contrary to our expectation, all HPC counts were lower in the DCC group.

Show Full Abstract

<h4>Aim</h4>To investigate the effects of delayed cord clamping (DCC) on peripheral hematopoietic progenitor cells (HPCs) and hematological parameters in premature infants (<32 weeks) during the neonatal period.<h4>Methods</h4>This was a prospective, randomized, and controlled, single-center study. Prior to delivery, 21 infants were randomly assigned to immediate cord clamping (ICC) at 5-10 s and 21 infants to DCC at 30-45 s. One milliliter blood sample was taken in the first 30 min of life. HPCs were measured by three-color flow cytometry using monoclonal antibodies.<h4>Results</h4>There were no significant differences between groups in either maternal or neonatal demographics. All HPC counts were higher in the ICC group, but the difference was not significant. CD34+ cell counts were 45.3 ± 36.6/μL in the ICC and 33.2 ± 26.6/μL in the DCC group (P=0.33); multi-potent progenitor cell counts were 43.2 ± 35/μL in the ICC and 31.1 ± 26.6/μL in the DCC group (P=0.28); and hematopoietic stem cell counts were 2.1 ± 2.1/μL in the ICC and 2.1 ± 3.1/μL in the DCC group (P=0.66).<h4>Conclusion</h4>Contrary to our expectation, all HPC counts were lower in the DCC group.

Also flagged:NeurexinsneuroliginssynapsessynapticNeurexinNeuroligin
Journal Article 2011-03-11 No Snippets Bottos A, Rissone A, Bussolino F, Arese M.
Show Full Abstract

The scientific interest in the family of the so-called nervous vascular parallels has been growing steadily for the past 15 years, either by addition of new members to the group or, lately, by deepening the analysis of established concepts and mediators. Proteins governing both neurons and vascular cells are known to be involved in events such as cell fate determination and migration/guidance but not in the last and apparently most complex step of nervous system development, the formation and maturation of synapses. Hence, the recent addition to this family of the specific synaptic proteins, Neurexin and Neuroligin, is a double innovation. The two proteins, which were thought to be "simple" adhesive links between the pre- and post-synaptic sides of chemical synapses, are in fact extremely complex and modulate the most subtle synaptic activities. We will discuss the relevant data and the intriguing challenge of transferring synaptic activities to vascular functions.

Also flagged:vitamin B12Vitamin B12 deficiencymacrocytic anaemianeuropathymegaloblastic anaemiavitamin B12 insufficiency
Journal Article 2011-03-11 ✓ 1 Snippet Dangour AD, Allen E, Clarke R, Elbourne D, Fasey N, Fletcher AE, Letley L, Richards M, Whyte K, Mills K, Uauy R.
In-Text Gene Mentions

CMAP: Compound muscle action potential; CMCT: Central motor conduction time; DCC: Data Co-ordinating Centre; DMSC: Data Monitoring and Safety Committee; GHQ-30: 30-item General Health Questionnaire; GPRF: General Practice Research Framework; holoTC: Holotranscobalamin; MEP: Motor evoked potential; MI: Myocardial infarction; MMSE: Mini Mental State Examination; NHS: National Health Service; tHcy: total homocysteine.

Show Full Abstract

<h4>Background</h4>Vitamin B12 deficiency is common in older people and the prevalence increases with age. Vitamin B12 deficiency may present as macrocytic anaemia, subacute combined degeneration of the spinal cord, or as neuropathy, but is often asymptomatic in older people. The diagnosis and indications for treatment are clear for individuals with low plasma levels of vitamin B12 in the setting of megaloblastic anaemia and neuropathy, but the relevance of treatment of vitamin B12 deficiency in the absence of such clinical signs is uncertain.<h4>Methods</h4>The aim of the present study is to assess whether dietary supplementation with crystalline vitamin B12 will improve electrophysiological indices of neurological function in older people who have biochemical evidence of vitamin B12 insufficiency in the absence of anaemia. To test this hypothesis we designed a randomized double-blind placebo-controlled trial involving 200 older people aged 75 years or greater who were randomly allocated to receive either a daily oral tablet containing 1 mg vitamin B12 or a matching placebo tablet. The primary outcome assessed at 12 months is change in electrophysiological indices of peripheral and central neurosensory responses required for mobility and sensory function. We here report the detailed study protocol.<h4>Conclusions</h4>In view of the high prevalence of vitamin B12 deficiency in later life, the present trial could have considerable significance for public health.

Also flagged:chromosomesschizophreniaAlzheimer's diseaseParkinson's diseasechromosomeimmunoglobulin
Journal Article 2011-03-11 No Snippets Johnson TA, Niimura Y, Tanaka H, Nakamura Y, Tsunoda T.
Show Full Abstract

The analysis of contiguous homozygosity (runs of homozygous loci) in human genotyping datasets is critical in the search for causal disease variants in monogenic disorders, studies of population history and the identification of targets of natural selection. Here, we report methods for extracting homozygous segments from high-density genotyping datasets, quantifying their local genomic structure, identifying outstanding regions within the genome and visualizing results for comparative analysis between population samples.

Also flagged:centrosomesorganellescentriolesmicrotubulecytoskeletonspindle apparatus
Journal Article 2011-03-11 ✓ 1 Snippet Jakobsen L, Vanselow K, Skogs M, Toyoda Y, Lundberg E, Poser I, Falkenby LG, Bennetzen M, Westendorf J, Nigg EA, Uhlen M, Hyman AA, Andersen JS.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

Centrosomes in animal cells are dynamic organelles with a proteinaceous matrix of pericentriolar material assembled around a pair of centrioles. They organize the microtubule cytoskeleton and the mitotic spindle apparatus. Mature centrioles are essential for biogenesis of primary cilia that mediate key signalling events. Despite recent advances, the molecular basis for the plethora of processes coordinated by centrosomes is not fully understood. We have combined protein identification and localization, using PCP-SILAC mass spectrometry, BAC transgeneOmics, and antibodies to define the constituents of human centrosomes. From a background of non-specific proteins, we distinguished 126 known and 40 candidate centrosomal proteins, of which 22 were confirmed as novel components. An antibody screen covering 4000 genes revealed an additional 113 candidates. We illustrate the power of our methods by identifying a novel set of five proteins preferentially associated with mother or daughter centrioles, comprising genes implicated in cell polarity. Pulsed labelling demonstrates a remarkable variation in the stability of centrosomal protein complexes. These spatiotemporal proteomics data provide leads to the further functional characterization of centrosomal proteins.

Also flagged:HuntingtinCID 2432214neurodegenerative diseases
Journal Article 2011-03-11 ✓ 1 Snippet Titus S, Elia N, Southall N, Zheng W, Marugan JJ, MacDonald M.
In-Text Gene Mentions

…poly-Q expansion Huntingtin (HTT) protein by inhibiting…

Show Full Abstract

In this report, we present data on a compound, ML168 (CID 2432214), which is able to protect cells from cytotoxicity induced by the expression of a large mutant poly-Q expansion Huntingtin (HTT) protein by inhibiting the activation of the intrinsic apoptotic pathway. This probe can be used in cellular assays and ex vivo experiments to study and inhibit the initiation of apoptosis induced by the expression of mutant, cytotoxic HTT protein. This probe will be of great interest to the scientific community that studies Huntington’s disease and other neurodegenerative diseases.

Also flagged:brain developmentgene expressionserotonin transporterdepressionserotonin receptorneuropsychiatric disorder
Journal Article 2011-03-10 ✓ 2 Snippets Lenroot RK, Giedd JN.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT) contains a polymorphism…

…of the short5-HTTallele (see Caspi,…

Show Full Abstract

Biological development is driven by a complex dance between nurture and nature, determined not only by the specific features of the interacting genetic and environmental influences but also by the timing of their rendezvous. The initiation of large-scale longitudinal studies, ever-expanding knowledge of genetics, and increasing availability of neuroimaging data to provide endophenotypic bridges between molecules and behavior are beginning to provide some insight into interactions of developmental stage, genes, and the environment, although daunting challenges remain. Prominent amongst these challenges are difficulties in identifying and quantifying relevant environmental factors, discerning the relative contributions to multiply determined outcomes, and the likelihood that brain development is a non-linear dynamic process in which small initial differences may yield large later effects. Age-sensitive mechanisms include developmental changes in gene expression, epigenetic modifications, synaptic arborization/pruning, and maturational improvements in our capacity to seek out environments of our choosing. Greater understanding of how genetic and environmental factors interact differently across ages is an important step toward elucidating the mechanisms by which phenotypes are created - and how they may differ in health and disease. This knowledge may also provide clues to guide the type and timing of interventions to maximize outcomes.

Also flagged:peripartum cardiomyopathymembranemultiple organ dysfunction syndromeheart failurePPCMleft ventricular systolic dysfunction
Journal Article 2011-03-10 ✓ 4 Snippets Gevaert S, Van Belleghem Y, Bouchez S, Herck I, De Somer F, De Block Y, Tromp F, Vandecasteele E, Martens F, De Pauw M.
In-Text Gene Mentions

…Antithrombin III (ATIII) levels are analyzed…

…are analyzed daily,ATIIIconcentrate is given…

…given if theATIIIactivity drops below…

…partial thromboplastin time;ATIII: antithrombin III; ECMO:…

Show Full Abstract

<h4>Introduction</h4>Peripartum cardiomyopathy (PPCM) patients refractory to medical therapy and intra-aortic balloon pump (IABP) counterpulsation or in whom weaning from these therapies is impossible, are candidates for a left ventricular assist device (LVAD) as a bridge to recovery or transplant. Continuous-flow LVADs are smaller, have a better long-term durability and are associated with better outcomes. Extra corporeal membrane oxygenation (ECMO) can be used as a temporary support in patients with refractory cardiogenic shock. The aim of this study was to evaluate the efficacy and safety of mechanical support in acute and critically ill PPCM patients.<h4>Methods</h4>This was a retrospective search of the patient database of the Ghent University hospital (2000 to 2010).<h4>Results</h4>Six PPCM-patients were treated with mechanical support. Three patients presented in the postpartum period and three patients at the end of pregnancy. All were treated with IABP, the duration of IABP support ranged from 1 to 13 days. An ECMO was inserted in one patient who presented with cardiogenic shock, multiple organ dysfunction syndrome and a stillborn baby. Two patients showed partial recovery and could be weaned off the IABP. Four patients were implanted with a continuous-flow LVAD (HeartMate II, Thoratec Inc.), including the ECMO-patient. Three LVAD patients were successfully transplanted 78, 126 and 360 days after LVAD implant; one patient is still on the transplant waiting list. We observed one peripheral thrombotic complication due to IABP and five early bleeding complications in three LVAD patients. One patient died suddenly two years after transplantation.<h4>Conclusions</h4>In PPCM with refractory heart failure IABP was safe and efficient as a bridge to recovery or as a bridge to LVAD. ECMO provided temporary support as a bridge to LVAD, while the newer continuous-flow LVADs offered a safe bridge to transplant.

Also flagged:TNFNOS2AIL6RPPARAIL1AHABP2
Journal Article 2011-03-10 ✓ 3 Snippets Gardener H, Beecham A, Cabral D, Yanuck D, Slifer S, Wang L, Blanton SH, Sacco RL, Juo SH, Rundek T.
In-Text Gene Mentions

…TNF, NOS2A, IL6R,TNFSF4, PPARA, IL1A, TLR4,…

…SNPs inTNFSF4, PPARA, TLR4, ITGA2,…

TNFSF4

Show Full Abstract

<h4>Background and purpose</h4>The genetic influence on carotid atherosclerotic plaque is mostly unknown. This study examines the association between carotid plaque and single nucleotide polymorphisms in selected genes implicated in inflammation and endothelial function.<h4>Methods</h4>A total of 43 genes (197 single nucleotide polymorphisms) involved in inflammation and endothelial function were interrogated in 287 Dominicans from the Northern Manhattan Study (mean age, 64±7 years; 58% women) who had undergone high-resolution B-mode ultrasound for examination of carotid plaque. Using an additive genetic model, multiple logistic regression analyses were conducted, a within-gene haplotype analysis was performed, and interactions between genes were examined. Results were validated in an independent set of 301 Dominicans.<h4>Results</h4>Carotid plaque was present in 143 (47%) participants. Nine genes had at least 1 single nucleotide polymorphism associated (P≤0.01) with carotid plaque phenotypes: TNF, NOS2A, IL6R, TNFSF4, PPARA, IL1A, TLR4, ITGA2, and HABP2. Single nucleotide polymorphisms in TNFSF4, PPARA, TLR4, ITGA2, and HABP2 were also implicated with the same carotid phenotype in the validation analysis. Haplotype analysis revealed an additional gene of interest, VCAM1.<h4>Conclusions</h4>We report novel associations between variations in 10 genes involved in inflammation and endothelial function and carotid plaque phenotypes in a Dominican sample, with replication for 5 genes in an independent Dominican sample.

Also flagged:tandem kinaseJIL-1polytenechromosomeschromosomekinase
Journal Article 2011-03-10 ✓ 5 Snippets Regnard C, Straub T, Mitterweger A, Dahlsveen IK, Fabian V, Becker PB.
In-Text Gene Mentions

…on a functionalDCC[2] , [22]…

…Dosage Compensation Complex (DCC, also known as…

…chromosome involves theDCCsubunit MOF on…

…modifications, and ofDCCsubunits.…

…subunits of theDCCon the X…

Show Full Abstract

The ubiquitous tandem kinase JIL-1 is essential for Drosophila development. Its role in defining decondensed domains of larval polytene chromosomes is well established, but its involvement in transcription regulation has remained controversial. For a first comprehensive molecular characterisation of JIL-1, we generated a high-resolution, chromosome-wide interaction profile of the kinase in Drosophila cells and determined its role in transcription. JIL-1 binds active genes along their entire length. The presence of the kinase is not proportional to average transcription levels or polymerase density. Comparison of JIL-1 association with elongating RNA polymerase and a variety of histone modifications suggests two distinct targeting principles. A basal level of JIL-1 binding can be defined that correlates best with the methylation of histone H3 at lysine 36, a mark that is placed co-transcriptionally. The additional acetylation of H4K16 defines a second state characterised by approximately twofold elevated JIL-1 levels, which is particularly prominent on the dosage-compensated male X chromosome. Phosphorylation of the histone H3 N-terminus by JIL-1 in vitro is compatible with other tail modifications. In vivo, phosphorylation of H3 at serine 10, together with acetylation at lysine 14, creates a composite histone mark that is enriched at JIL-1 binding regions. Its depletion by RNA interference leads to a modest, but significant, decrease of transcription from the male X chromosome. Collectively, the results suggest that JIL-1 participates in a complex histone modification network that characterises active, decondensed chromatin. We hypothesise that one specific role of JIL-1 may be to reinforce, rather than to establish, the status of active chromatin through the phosphorylation of histone H3 at serine 10.

Also flagged:amino acidsHuntington's diseasemyotonic dystrophyfragile X syndromespinocerebellar ataxiaspathogenesis
Journal Article 2011-03-10 No Snippets Pearson CE.
Show Full Abstract

Diseases associated with unstable repetitive elements in the DNA, RNA, and amino acids have consistently revealed scientific surprises. Most diseases are caused by expansions of trinucleotide repeats, which ultimately lead to diseases like Huntington's disease, myotonic dystrophy, fragile X syndrome, and a series of spinocerebellar ataxias. These repeat mutations are dynamic, changing through generations and within an individual, and the repeats can be bi-directionally transcribed. Unsuspected modes of pathogenesis involve aberrant loss of protein expression; aberrant over-expression of non-mutant proteins; toxic-gain-of-protein function through expanded polyglutamine tracts that are encoded by expanded CAG tracts; and RNA-toxic-gain-of-function caused by transcripts harboring expanded CUG, CAG, or CGG tracts. A recent advance reveals that RNA transcripts with expanded CAG repeats can be translated in the complete absence of a starting ATG, and this Repeat Associated Non-ATG translation (RAN-translation) occurs across expanded CAG repeats in all reading frames (CAG, AGC, and GCA) to produce homopolymeric proteins of long polyglutamine, polyserine, and polyalanine tracts. Expanded CTG tracts expressing CUG transcripts also show RAN-translation occurring in all three frames (CUG, UGC, and GCU), to produce polyleucine, polycysteine, and polyalanine. These RAN-translation products can be toxic. Thus, one unstable (CAG)•(CTG) DNA can produce two expanded repeat transcripts and homopolymeric proteins with reading frames (the AUG-directed polyGln and six RAN-translation proteins), yielding a total of potentially nine toxic entities. The occurrence of RAN-translation in patient tissues expands our horizons of modes of disease pathogenesis. Moreover, since RAN-translation counters the canonical requirements of translation initiation, many new questions are now posed that must be addressed. This review covers RAN-translation and some of the pertinent questions.

Also flagged:membraneextracellularaxonsgrowth conesexocytosisendocytosis
Journal Article 2011-03-09 No Snippets Tojima T, Hines JH, Henley JR, Kamiguchi H.
Show Full Abstract

Graded distributions of extracellular cues guide developing axons toward their targets. A network of second messengers - Ca(2+) and cyclic nucleotides - shapes cue-derived information into either attractive or repulsive signals that steer growth cones bidirectionally. Emerging evidence suggests that such guidance signals create a localized imbalance between exocytosis and endocytosis, which in turn redirects membrane, adhesion and cytoskeletal components asymmetrically across the growth cone to bias the direction of axon extension. These recent advances allow us to propose a unifying model of how the growth cone translates shallow gradients of environmental information into polarized activity of the steering machinery for axon guidance.

Also flagged:Fanconi anaemiaGene expressionGADCDK5Alzheimer's diseasesynaptic transmission
Journal Article 2011-03-09 ✓ 1 Snippet Zhang X, Zhang R, Jiang Y, Sun P, Tang G, Wang X, Lv H, Li X.
In-Text Gene Mentions

HTT

Show Full Abstract

The human disease network (HDN) has become a powerful tool for revealing disease-disease associations. Some studies have shown that genes that share similar or same disease phenotypes tend to encode proteins that interact with each other. Therefore, protein-protein interactions (PPIs) may help us to further understand the relationships between diseases with overlapping clinical phenotypes. In this study, we constructed the expanded HDN (eHDN) by combining disease gene information with PPI information, and analyzed its topological features and functional properties. We found that the network is hierarchical and, most diseases are connected to only a few diseases, whereas a small part of diseases are linked to many different diseases. Diseases in a specific disease class tend to cluster together, and genes associated with the same disease are functionally related. Comparing the eHDN with the original HDN (oHDN, constructed using disease gene information) revealed high consistency over all topological and functional properties. This, to some extent, indicates that our eHDN is reliable. In the eHDN, we found some new associations among diseases resulting from the shared genes interacting with disease genes. The new eHDN will provide a valuable reference for clinicians and medical researchers.

Also flagged:Sexual dysfunctionserotoninDepressionserotonin transporterescitaloprammajor depression
Journal Article 2011-03-09 ✓ 1 Snippet Strohmaier J, Wüst S, Uher R, Henigsberg N, Mors O, Hauser J, Souery D, Zobel A, Dernovsek MZ, Streit F, Schmäl C, Kozel D, Placentino A, Farmer A, McGuffin P, Aitchison KJ, Rietschel M.
In-Text Gene Mentions

…erotonin transporter protein (5-HTT; Bishop et al.…

Show Full Abstract

<h4>Objectives</h4>Sexual dysfunction (SD) is a frequently reported side-effect of antidepressant treatment, particularly of selective serotonin reuptake inhibitors (SSRIs). In the multicentre clinical and pharmacogenetic GENDEP study (Genome-based Therapeutic Drugs for Depression), the effect of the serotonin transporter gene promoter polymorphism 5-HTTLPR on sexual function was investigated during treatment with escitalopram (SSRI) and nortriptyline (tricyclic antidepressant).<h4>Methods</h4>A total of 494 subjects with an episode of DSM-IV major depression were randomly assigned to treatment with escitalopram or nortriptyline. Over 12 weeks, depressive symptoms and SD were measured weekly with the Montgomery-Asberg Depression Rating Scale, the Antidepressant Side-Effect Checklist, the UKU Side Effect Rating Scale, and the Sexual Functioning Questionnaire.<h4>Results</h4>The incidence of reported SD after 12 weeks of treatment was relatively low, and did not differ significantly between antidepressants (14.9% escitalopram, 19.7% nortriptyline). There was no significant interaction between the 5-HTTLPR and antidepressant on SD. Improvement in depressive symptoms and younger age were both associated with lower SD. The effect of age on SD may have been moderated by the 5-HTTLPR.<h4>Conclusions</h4>In GENDEP, rates of reported SD during treatment were lower than those described in previous reports. There was no apparent effect of the 5-HTTLPR on the observed decline in SD.

Also flagged:airway hyperresponsivenessperoxiredoxin-6response to oxidative stressglucocorticoid receptorasthmaannexin A8
Journal Article 2011-03-09 ✓ 5 Snippets Balakrishna S, Saravia J, Thevenot P, Ahlert T, Lominiki S, Dellinger B, Cormier SA.
In-Text Gene Mentions

…egulation of peroxiredoxin-6 (PRDX6) in the lungs…

…two proteins arePRDX6and CFL1.…

PRDX6is believed to…

…Further,PRDX6can emulate glutathione…

…the hypothesis thatPRDX6plays a key…

Show Full Abstract

<h4>Background</h4>Increased asthma risk/exacerbation in children and infants is associated with exposure to elevated levels of ultrafine particulate matter (PM). The presence of a newly realized class of pollutants, environmentally persistent free radicals (EPFRs), in PM from combustion sources suggests a potentially unrecognized risk factor for the development and/or exacerbation of asthma.<h4>Methods</h4>Neonatal rats (7-days of age) were exposed to EPFR-containing combustion generated ultrafine particles (CGUFP), non-EPFR containing CGUFP, or air for 20 minutes per day for one week. Pulmonary function was assessed in exposed rats and age matched controls. Lavage fluid was isolated and assayed for cellularity and cytokines and in vivo indicators of oxidative stress. Pulmonary histopathology and characterization of differential protein expression in lung homogenates was also performed.<h4>Results</h4>Neonates exposed to EPFR-containing CGUFP developed significant pulmonary inflammation, and airway hyperreactivity. This correlated with increased levels of oxidative stress in the lungs. Using differential two-dimensional electrophoresis, we identified 16 differentially expressed proteins between control and CGUFP exposed groups. In the rats exposed to EPFR-containing CGUFP; peroxiredoxin-6, cofilin1, and annexin A8 were upregulated.<h4>Conclusions</h4>Exposure of neonates to EPFR-containing CGUFP induced pulmonary oxidative stress and lung dysfunction. This correlated with alterations in the expression of various proteins associated with the response to oxidative stress and the regulation of glucocorticoid receptor translocation in T lymphocytes.

Also flagged:ironneurodegenerative disordersAlzheimer's diseaseADmetabolismtransferrin C2
Journal Article 2011-03-09 ✓ 5 Snippets Bartzokis G, Lu PH, Tingus K, Peters DG, Amar CP, Tishler TA, Finn JP, Villablanca P, Altshuler LL, Mintz J, Neely E, Connor JR.
In-Text Gene Mentions

Higher brain iron levels are associated with male gender and presence of highly prevalent allelic variants in genes encoding for iron metabolism proteins (hemochromatosis H63D (HFE H63D) and transferrin C2 (TfC2)).

hemochromatosis H63D (HFE H63D) and transferrin

hemochromatosis H63D (HFE

…iron metabolism proteins (hemochromatosisH63D (HFE H63D)…

…oteins (hemochromatosis H63D (HFEH63D) and transferrin…

Show Full Abstract

Brain iron increases with age and is abnormally elevated early in the disease process in several neurodegenerative disorders that impact memory including Alzheimer's disease (AD). Higher brain iron levels are associated with male gender and presence of highly prevalent allelic variants in genes encoding for iron metabolism proteins (hemochromatosis H63D (HFE H63D) and transferrin C2 (TfC2)). In this study, we examined whether in healthy older individuals memory performance is associated with increased brain iron, and whether gender and gene variant carrier (IRON+) vs noncarrier (IRON-) status (for HFE H63D/TfC2) modify the associations. Tissue iron deposited in ferritin molecules can be measured in vivo with magnetic resonance imaging utilizing the field-dependent relaxation rate increase (FDRI) method. FDRI was assessed in hippocampus, basal ganglia, and white matter, and IRON+ vs IRON- status was determined in a cohort of 63 healthy older individuals. Three cognitive domains were assessed: verbal memory (delayed recall), working memory/attention, and processing speed. Independent of gene status, worse verbal-memory performance was associated with higher hippocampal iron in men (r=-0.50, p=0.003) but not in women. Independent of gender, worse verbal working memory performance was associated with higher basal ganglia iron in IRON- group (r=-0.49, p=0.005) but not in the IRON+ group. Between-group interactions (p=0.006) were noted for both of these associations. No significant associations with white matter or processing speed were observed. The results suggest that in specific subgroups of healthy older individuals, higher accumulations of iron in vulnerable gray matter regions may adversely impact memory functions and could represent a risk factor for accelerated cognitive decline. Combining genetic and MRI biomarkers may provide opportunities to design primary prevention clinical trials that target high-risk groups.

Also flagged:SLC40A1ironhyperferritinemiamembranepeptideamino acids
Journal Article 2011-03-09 ✓ 2 Snippets Mayr R, Griffiths WJ, Hermann M, McFarlane I, Halsall DJ, Finkenstedt A, Douds A, Davies SE, Janecke AR, Vogel W, Cox TM, Zoller H.
In-Text Gene Mentions

SLC40A1 was sequenced in patients from 2 independent pedigrees affected by hepatic iron overload unrelated to HFE.

…overload unrelated toHFE.…

Show Full Abstract

<h4>Background & aims</h4>Patients with ferroportin iron overload due to loss-of-function mutations in SLC40A1 have macrophage iron overload, hyperferritinemia, and normal transferrin saturation. In contrast, hepatocellular iron storage, hyperferritinemia, and increased saturation of transferrin are a distinct clinical presentation of ferroportin iron overload that results from SLC40A1 mutations that confer resistance of ferroportin to hepcidin-mediated inactivation.<h4>Methods</h4>SLC40A1 was sequenced in patients from 2 independent pedigrees affected by hepatic iron overload unrelated to HFE. Functions of the ferroportin variants were tested in vitro.<h4>Results</h4>A patient heterozygous for the variant p.W158C in SLC40A1 presented with macrophage iron overload, hyperferritinemia, and normal transferrin saturation. A patient with hepatocellular iron storage, hyperferritinemia, and increased transferrin saturation was heterozygous for p.H507R. Expression of the p.W158C form of ferroportin in 293T cells resulted in defective trafficking to the plasma membrane and reduced iron export activity; the iron export activity of cells that expressed the p.H507R form of ferroportin did not differ from cells that expressed ferroportin without this mutation. The p.H507R of ferroportin localizes normally to the plasma membrane but is resistant to hepcidin-mediated inactivation. Addition of a synthetic peptide derived from ferroportin without these mutations (amino acids 500-518) decreased the inhibitory activity of hepcidin in cells, whereas a peptide from the same region, with p.H507R, had no effect on hepcidin activity.<h4>Conclusions</h4>The variant p.W158C in SLC40A1 impairs intracellular trafficking of ferroportin, resulting in reduced iron export. The variant p.H507R does not bind hepcidin in vitro and results in apparent hepcidin resistance.

Also flagged:HaemostasisF7F9F12PLGnucleotides
Journal Article 2011-03-09 ✓ 2 Snippets Teruel R, Corral J, Pérez-Andreu V, Martínez-Martínez I, Vicente V, Martínez C.
In-Text Gene Mentions

…, PLG andSERPINC1mRNA.…

…(encoding plasminogen), andSERPINC1(encoding the anticoagulant…

Show Full Abstract

MicroRNAs (miRNAs) are an abundant class of small non-coding RNAs that are negative regulators in a crescent number of physiological and pathological processes. However, their role in haemostasis, a complex physiological process involving multitude of effectors, is just beginning to be characterized. We evaluated the changes of expression of miRNAs in livers of neonates (day one after birth) and adult mice by microarray and qRT-PCR trying to identify miRNAs that potentially may also be involved in the control of the dramatic change of hepatic haemostatic protein levels associated with this transition. Twenty one out of 41 miRNAs overexpressed in neonate mice have hepatic haemostatic mRNA as potential targets. Six of them identified by two in silico algorithms potentially bind the 3'UTR regions of F7, F9, F12, FXIIIB, PLG and SERPINC1 mRNA. Interestingly, miR-18a and miR-19b, overexpressed 5.4 and 8.2-fold respectively in neonates, have antithrombin, a key anti-coagulant with strong anti-angiogenic and anti-inflammatory roles, as a potential target. The levels of these two miRNAs inversely correlated with antithrombin mRNA levels during development (miR-19b: R = 0.81; p = 0.03; miR-18a: R = 0.91; p<0.001). These data suggest that miRNAs could be potential modulators of the haemostatic system involved in developmental haemostasis.

Also flagged:TFParkinson's diseaseIronneurodegenerative disordersPDpathogenesis
Journal Article 2011-03-08 ✓ 5 Snippets Greco V, De Marco EV, Rocca FE, Annesi F, Civitelli D, Provenzano G, Tarantino P, Scornaienchi V, Pucci F, Salsone M, Novellino F, Morelli M, Paglionico S, Gambardella A, Quattrone A, Annesi G.
In-Text Gene Mentions

No significant differences were found in genotype and allele frequencies between PD and controls for all the polymorphisms studied, suggesting that these variants do not contribute significantly to the risk of PD.

The gene of haemochromatosis (HFE) encodes the HFE protein which interacts with the transferrin receptor (TFR), lowering its affinity for iron-bound transferrin (TF).

We examined four known polymorphisms, C282Y and H63D in the HFE gene, G258S in the TF gene and S82G in the TFR gene, in 181 sporadic PD patients and 180 controls from Southern Italy to investigate their possible role in susceptibility to PD.

Association study between four polymorphisms in the HFE, TF and TFR genes and Parkinson's disease in southern Italy.

…polymorphisms in theHFE, TF and TFR…

Show Full Abstract

Iron overload may lead to neurodegenerative disorders such as Parkinson's disease (PD) and alterations of iron-related genes might be involved in the pathogenesis of this disease. The gene of haemochromatosis (HFE) encodes the HFE protein which interacts with the transferrin receptor (TFR), lowering its affinity for iron-bound transferrin (TF). We examined four known polymorphisms, C282Y and H63D in the HFE gene, G258S in the TF gene and S82G in the TFR gene, in 181 sporadic PD patients and 180 controls from Southern Italy to investigate their possible role in susceptibility to PD. No significant differences were found in genotype and allele frequencies between PD and controls for all the polymorphisms studied, suggesting that these variants do not contribute significantly to the risk of PD.

Also flagged:hydroxyloxygenCOumarinneutral redcoumarin 3carboxylic acid
Journal Article 2011-03-08 No Snippets Ganea GM, Kolic PE, El-Zahab B, Warner IM.
Show Full Abstract

Excessive production of reactive oxygen species can lead to alteration of cellular functions responsible for many diseases including cardiovascular diseases, neurodegenerative diseases, cancer, and aging. Hydroxyl radical is a short-lived radical which is considered very aggressive due to its high reactivity toward biological molecules. In this study, a COumarin-NEutral Red (CONER) nanoprobe was developed for detection of hydroxyl radical based on the ratiometric fluorescence signal between 7-hydroxy coumarin 3-carboxylic acid and neutral red dyes. Biocompatible poly lactide-co-glycolide (PLGA) nanoparticles containing encapsulated neutral red were produced using a coumarin 3-carboxylic acid conjugated poly(sodium N-undecylenyl-Nε-lysinate) (C3C-poly-Nε-SUK) as moiety reactive to hydroxyl radicals. The response of the CONER nanoprobe was dependent on various parameters such as reaction time and nanoparticle concentration. The probe was selective for hydroxyl radicals as compared with other reactive oxygen species including O(2)(•-), H(2)O(2), (1)O(2), and OCl(-). Furthermore, the CONER nanoprobe was used to detect hydroxyl radicals in vitro using viable breast cancer cells exposed to oxidative stress. The results suggest that this nanoprobe represents a promising approach for detection of hydroxyl radicals in biological systems.

Also flagged:Antibodyinfectionacute encephalitisand mouth diseasepathogenesisEV71 infection
Journal Article 2011-03-08 ✓ 2 Snippets Han JF, Cao RY, Deng YQ, Tian X, Jiang T, Qin ED, Qin CF.
In-Text Gene Mentions

Two closely related viruses, coxsackievirus 16 (CA16) and enterovirus 71 (EV71) have been identified as the most frequent pathogens of HFMD, and other enteroviruses, including CA5 and CA10, can also cause HFMD.

…including CA5 andCA10, can also cause…

Show Full Abstract

<h4>Background</h4>Human enterovirus 71 (EV71) has emerged as a significant cause of acute encephalitis and deaths in young children. The clinical manifestations caused by EV71 varied from mild hand, foot and mouth disease to severe neurological complications and deaths, but its pathogenesis remains elusive. Antibody dependent enhancement (ADE) infection has been reported in various viruses and has been shown to contribute to disease severity.<h4>Results</h4>In this study, the presence of sub-neutralizing antibody was demonstrated to enhance EV71 infection in THP-1 cells and increase the mortality of EV71 infection in a suckling mouse model. Further, a secondary infection model was established to characterize the correlation between ADE and disease severity, and primary asymptomatic EV71 infection was shown to increase the mortality of the secondary EV71 infection in suckling mice.<h4>Conclusions</h4>Together, these in vitro and in vivo experiments strongly supported the hypothesis of ADE infection of EV71. The present findings indicate ADE might contribute to the pathogenesis of severe EV71 infection, and raise practical issues of vaccine development and antibody-based therapy.

Also flagged:hemolytic anemiaerythropoiesisthalassemiaportal fibrosisironBeta thalassemia major
Journal Article 2011-03-08 ✓ 1 Snippet Caocci G, La Nasa G, d'Aloja E, Vacca A, Piras E, Pintor M, Demontis R, Pisu S.
In-Text Gene Mentions

…erythropoiesis, contributes tohemochromatosis-induced organ damage.…

Show Full Abstract

<h4>Background</h4>Beta thalassemia major is a severe inherited form of hemolytic anemia that results from ineffective erythropoiesis. Allogenic hematopoietic stem cell transplantation (HSCT) remains the only potentially curative therapy. Unfortunately, the subgroup of adult thalassemia patients with hepatomegaly, portal fibrosis and a history of irregular iron chelation have an elevated risk for transplantation-related mortality that is currently estimated to be about 29 percent.<h4>Discussion</h4>Thalassemia patients may be faced with a difficult choice: they can either continue conventional transfusion and iron chelation therapy or accept the high mortality risk of HSCT in the hope of obtaining complete recovery.Throughout the decision making process, every effort should be made to sustain and enhance autonomous choice. The concept of conscious consent becomes particularly important. The patient must be made fully aware of the favourable and adverse outcomes of HSCT. Although it is the physician's duty to illustrate the possibility of completely restoring health, considerable emphasis should be put on the adverse effects of the procedure. The physician also needs to decide whether the patient is eligible for HSCT according to the "rule of descending order". The patient must be given full details on self-care and fundamental lifestyle changes and be fully aware that he/she will be partly responsible for the outcome.<h4>Summary</h4>Only if all the aforesaid conditions are satisfied can it be considered reasonable to propose unrelated HSCT as a potential cure for high risk thalassemia patients.

Also flagged:survival motor neuron 1SMN1spinal muscular atrophyneuromuscular diseasedeathSMN
Journal Article 2011-03-08 No Snippets Wu CY, Whye D, Glazewski L, Choe L, Kerr D, Lee KH, Mason RW, Wang W.
Show Full Abstract

<h4>Background</h4>Deletion or mutation(s) of the survival motor neuron 1 (SMN1) gene causes spinal muscular atrophy (SMA), a neuromuscular disease characterized by spinal motor neuron death and muscle paralysis. Complete loss of the SMN protein is embryonically lethal, yet reduced levels of this protein result in selective death of motor neurons. Why motor neurons are specifically targeted by SMN deficiency remains to be determined. In this study, embryonic stem (ES) cells derived from a severe SMA mouse model were differentiated into motor neurons in vitro by addition of retinoic acid and sonic hedgehog agonist. Proteomic and western blot analyses were used to probe protein expression alterations in this cell-culture model of SMA that could be relevant to the disease.<h4>Results</h4>When ES cells were primed with Noggin/fibroblast growth factors (bFGF and FGF-8) in a more robust neural differentiation medium for 2 days before differentiation induction, the efficiency of in vitro motor neuron differentiation was improved from ~25% to ~50%. The differentiated ES cells expressed a pan-neuronal marker (neurofilament) and motor neuron markers (Hb9, Islet-1, and ChAT). Even though SMN-deficient ES cells had marked reduced levels of SMN (~20% of that in control ES cells), the morphology and differentiation efficiency for these cells are comparable to those for control samples. However, proteomics in conjunction with western blot analyses revealed 6 down-regulated and 14 up-regulated proteins with most of them involved in energy metabolism, cell stress-response, protein degradation, and cytoskeleton stability. Some of these activated cellular pathways showed specificity for either undifferentiated or differentiated cells. Increased p21 protein expression indicated that SMA ES cells were responding to cellular stress. Up-regulation of p21 was confirmed in spinal cord tissues from the same SMA mouse model from which the ES cells were derived.<h4>Conclusion</h4>SMN-deficient ES cells provide a cell-culture model for SMA. SMN deficiency activates cellular stress pathways, causing a dysregulation of energy metabolism, protein degradation, and cytoskeleton stability.

Also flagged:peptidesironHepcidin-1Hepcidin-2peptidetransferrin receptor 2
Journal Article 2011-03-08 ✓ 5 Snippets Tjalsma H, Laarakkers CM, van Swelm RP, Theurl M, Theurl I, Kemna EH, van der Burgt YE, Venselaar H, Dutilh BE, Russel FG, Weiss G, Masereeuw R, Fleming RE, Swinkels DW.
In-Text Gene Mentions

In-line with previous studies showing that defects in the HFE and TfR2 proteins (and their combination) upstream from hepcidin synthesis resulted in low circulating hepcidin levels [22]–[27], our 3 mouse hemochromatosis models all showed impaired Hep-1 production, being most prominently present in double affected Hfe/TfR2y245x mice.

Accordingly, the combined defect in HFE and TfR2 in man has been shown to lead to more severe iron loading and a juvenile form of hemochromatosis [30], suggesting that these two genes have a least some hepcidin regulatory functions that do not overlap.

Mouse models for hemochromatosis (homozygous Hfe knock-out mice (Hfe KO), homozygous Tfr2 y245x mutated mice (Tfr2y245x) and double affected mice (Hfe/TfR2y245x), dietary iron challenge, infection (LPS challenge), and acute hepatotoxicity following paracetamol administration were used to validate and evaluate the utility of Hep-1/Hep-2 analysis by mass spectrometry (see Supporting information for details).

To evaluate the functional importance of measured Hep-1 and Hep-2 levels in various genetic variants of hemochromatosis, serum was collected from wild-type mice (wt), Hfe KO, Tfr2y245x or Hfe/TfR2y245x mouse.

This method was biologically validated by hepcidin assessment in: i) 3 mouse strains (C57Bl/6; DBA/2 and BABL/c) upon stimulation with intravenous iron and LPS, ii) homozygous Hfe knock out, homozygous transferrin receptor 2 (Y245X) mutated mice and double affected mice, and iii) mice treated with a sublethal hepatotoxic dose of paracetamol.

Show Full Abstract

The mouse is a valuable model for unravelling the role of hepcidin in iron homeostasis, however, such studies still report hepcidin mRNA levels as a surrogate marker for bioactive hepcidin in its pivotal function to block ferroportin-mediated iron transport. Here, we aimed to assess bioactive mouse Hepcidin-1 (Hep-1) and its paralogue Hepcidin-2 (Hep-2) at the peptide level. To this purpose, Fourier transform ion cyclotron resonance (FTICR) and tandem-MS was used for hepcidin identification, after which a time-of-flight (TOF) MS-based methodology was exploited to routinely determine Hep-1 and -2 levels in mouse serum and urine. This method was biologically validated by hepcidin assessment in: i) 3 mouse strains (C57Bl/6; DBA/2 and BABL/c) upon stimulation with intravenous iron and LPS, ii) homozygous Hfe knock out, homozygous transferrin receptor 2 (Y245X) mutated mice and double affected mice, and iii) mice treated with a sublethal hepatotoxic dose of paracetamol. The results showed that detection of Hep-1 was restricted to serum, whereas Hep-2 and its presumed isoforms were predominantly present in urine. Elevations in serum Hep-1 and urine Hep-2 upon intravenous iron or LPS were only moderate and varied considerably between mouse strains. Serum Hep-1 was decreased in all three hemochromatosis models, being lowest in the double affected mice. Serum Hep-1 levels correlated with liver hepcidin-1 gene expression, while acute liver damage by paracetamol depleted Hep-1 from serum. Furthermore, serum Hep-1 appeared to be an excellent indicator of splenic iron accumulation. In conclusion, Hep-1 and Hep-2 peptide responses in experimental mouse agree with the known biology of hepcidin mRNA regulators, and their measurement can now be implemented in experimental mouse models to provide novel insights in post-transcriptional regulation, hepcidin function, and kinetics.

Also flagged:Serotonin transporterobsessive-compulsive disorder
Journal Article 2011-03-08 ✓ 5 Snippets Atmaca M, Onalan E, Yildirim H, Yuce H, Koc M, Korkmaz S, Mermi O.
In-Text Gene Mentions

In conclusion, we found a significant genotype-diagnosis interaction effects on key brain structures, with a stronger effects of 5-HTT polymorphism in OFC and thalamus of OCD patients, whereas no morphological changes related to the polymorphism were found in normal individuals.

…region of the5-HTTgene (5-HTTLPR) is…

5-HTTgenotypes (SS, SL,…

…stronger effects of5-HTTpolymorphism on brain…

…stronger effects of5-HTTpolymorphism in OFC…

Show Full Abstract

Although a number of magnetic resonance imaging (MRI) and genetic studies have been performed on obsessive-compulsive disorder (OCD), only limited studies in which genetic and neuroanatomical variables are evaluated concurrently have been performed. Therefore, the aim of our present study is (to understand) better understanding how genetic variation in the promoter region of the 5-HTT gene (5-HTTLPR) is associated with key brain structures in OCD, orbito-frontal cortex (OFC), thalamus and anterior cingulate. 5-HTT genotypes (SS, SL, LL) were determined for 40 patients with OCD and the same number of healthy controls. MRI-derived volumes of the OFC, thalamus, and anterior cingulate were determined by reliable tracing techniques. Volumetric measurements were made with T1-weighted coronal MRI images, with 1.5-mm-thick slices, at 1.5T, and were done blindly. In comparison with controls, OCD patients demonstrated volumes reduction in OFC, increased volumes of thalamus and total white matter volumes, but no difference in total brain volume, total gray matter volumes and anterior cingulate volumes. No significant difference was observed in allelic frequencies between the patients and controls. The stronger effects of 5-HTT polymorphism on brain morphology in OCD than those in controls were determined in the both OFC and thalamus. On the other hand, for the OCD patients, ANCOVA revealed a significant main effect of genotype for both the OFC and thalamus and a significant genotype-by-side interaction for the OFC, demonstrating that the short variants had a smaller right OFC than the long variants. In conclusion, we found a significant genotype-diagnosis interaction effects on key brain structures, with a stronger effects of 5-HTT polymorphism in OFC and thalamus of OCD patients, whereas no morphological changes related to the polymorphism were found in normal individuals.

Also flagged:SynthesisD-glucoseglycogen phosphorylasetetrazolecyanideethynyl
Journal Article 2011-03-08 No Snippets Kun S, Nagy GZ, Tóth M, Czecze L, Van Nhien AN, Docsa T, Gergely P, Charavgi MD, Skourti PV, Chrysina ED, Patonay T, Somsák L.
Show Full Abstract

5-(O-Perbenzoylated-β-D-glucopyranosyl)tetrazole was obtained from O-perbenzoylated-β-D-glucopyranosyl cyanide by Bu(3)SnN(3) or Me(3)SiN(3)-Bu(2)SnO. This tetrazole was transformed into 5-ethynyl- as well as 5-chloromethyl-2-(O-perbenzoylated-β-D-glucopyranosyl)-1,3,4-oxadiazoles by acylation with propiolic acid-DCC or chloroacetyl chloride, respectively. The chloromethyl oxadiazole gave the corresponding azidomethyl derivative on treatment with NaN(3). These compounds were reacted with several alkynes and azides under Cu(I) catalysed cycloaddition conditions to give, after removal of the protecting groups by the Zemplén protocol, β-D-glucopyranosyl-1,3,4-oxadiazolyl-1,2,3-triazole, β-D-glucopyranosyl-1,2,3-triazolyl-1,3,4-oxadiazole, and β-D-glucopyranosyl-1,3,4-oxadiazolylmethyl-1,2,3-triazole type compounds. 5-Phenyltetrazole was also transformed under the above conditions into a series of aryl-1,3,4-oxadiazolyl-1,2,3-triazoles, aryl-1,2,3-triazolyl-1,3,4-oxadiazoles, and aryl-1,3,4-oxadiazolylmethyl-1,2,3-triazoles. The new compounds were assayed against rabbit muscle glycogen phosphorylase b and the best inhibitors had inhibition constants in the upper micromolar range (2-phenyl-5-[1-(β-D-glucopyranosyl)-1,2,3-triazol-4-yl]-1,3,4-oxadiazole 36: K(i)=854μM, 2-(β-D-glucopyranosyl)-5-[1-(naphthalen-2-yl)-1,2,3-triazol-4-yl]-1,3,4-oxadiazole 47: K(i)=745μM).

Also flagged:cytoplasmiclocalization-relatedHuntington's diseaseHDHuntingtinnuclear export
Journal Article 2011-03-08 ✓ 5 Snippets Yan Y, Peng D, Tian J, Chi J, Tan J, Yin X, Pu J, Xia K, Zhang B.
In-Text Gene Mentions

We demonstrated that Htt(4-17) was the essential sequence for htt cytoplasmic localization.

Huntington's disease (HD) is caused by abnormal CAG repeat expansion in the 5'-end of the Huntingtin (HTT) gene.

These studies provide new insight into the molecular mechanism of htt aggregation in HD.

We also found that the subcellular distribution of htt was altered when Htt(1-17) was mutated to contain amino acids of different charges, suggesting a structural requirement of Htt(1-17) for the cytoplasmic localization of htt.

…of the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is caused by abnormal CAG repeat expansion in the 5'-end of the Huntingtin (HTT) gene. In addition to the canonical C-terminal full-length huntingtin (htt) nuclear export signal, a cytoplasmic localization-related domain (CLRD) in the N-terminus of htt has recently been reported. Here, we analyzed this domain by introducing deletion and substitution mutations in a truncated N-terminal htt protein and subsequently monitored htt expression, aggregation and subcellular localization by immunocytochemistry and Western blot analysis. We demonstrated that Htt(4-17) was the essential sequence for htt cytoplasmic localization. We also found that the subcellular distribution of htt was altered when Htt(1-17) was mutated to contain amino acids of different charges, suggesting a structural requirement of Htt(1-17) for the cytoplasmic localization of htt. Deletion of the first three amino acids did not affect its association with mitochondria. We observed that defective cytoplasmic localization resulted in a reduction of total htt aggregates and increased nuclear aggregates, indicating that the subcellular distribution of the protein might influence the aggregation process. These studies provide new insight into the molecular mechanism of htt aggregation in HD.

Also flagged:nicotinedrug addictiongene expressionmecamylaminenicotinic acetylcholine receptorsdeath
Journal Article 2011-03-08 No Snippets Wang J, Cui W, Wei J, Sun D, Gutala R, Gu J, Li MD.
Show Full Abstract

Previous human and animal studies demonstrate that acute nicotine exposure has complicated influences on the function of the nervous system, which may lead to long-lasting effects on the behavior and physiology of the subject. To determine the genes and pathways that might account for long-term changes after acute nicotine exposure, a pathway-focused oligoarray specifically designed for drug addiction research was used to assess acute nicotine effect on gene expression in the neuron-like SH-SY5Y cells. Our results showed that 295 genes involved in various biological functions were differentially regulated by 1 h of nicotine treatment. Among these genes, the expression changes of 221 were blocked by mecamylamine, indicating that the majority of nicotine-modulated genes were altered through the nicotinic acetylcholine receptors (nAChRs)-mediated signaling process. We further identified 14 biochemical pathways enriched among the nicotine-modulated genes, among which were those involved in neural development/synaptic plasticity, neuronal survival/death, immune response, or cellular metabolism. In the genes significantly regulated by nicotine but blocked by mecamylamine, 13 enriched pathways were detected. Nine of these pathways were shared with those enriched in the genes regulated by nicotine, including neuronal function-related pathways such as glucocorticoid receptor signaling, p38 MAPK signaling, PI3K/AKT signaling, and PTEN signaling, implying that nAChRs play important roles in the regulation of these biological processes. Together, our results not only provide insights into the mechanism underlying the acute response of neuronal cells to nicotine but also provide clues to how acute nicotine exposure exerts long-term effects on the nervous system.

Also flagged:SynthesisHeterobactins Asiderophoresbiosynthesisparabactinornithine
Journal Article 2011-03-08 No Snippets Bergeron RJ, Singh S, Bharti N.
Show Full Abstract

The synthesis of the Rhodococcus erythropolis siderophores heterobactins A and B, and the structurally related Nocardia heterobactin, is described. Two approaches for the assembly of these asymmetric ligand donor chelators are explored. In the first approach, a scheme predicated on the biosynthesis of the Paracoccus denitrificans siderophore, parabactin, is employed. In this approach, the central donor synthon is added last. In the second scheme, the central donor and the terminal 2,3-dihydroxybenzoyl fragment are first fixed to the ligand's D-ornithine backbone. This is followed by condensation with the cyclic ornithine hydroxamate glycine segment. The schemes offer a flexible approach to other heterobactins. Job's plots suggest that heterobactin A and Nocardia heterobactin form 1:1 ligand/metal complexes, while heterobactin B forms a 3:2 ligand/metal complex.

Also flagged:triclocarbanexcretionsoluble epoxide hydrolaseglucuronidesglucuronidewater
Journal Article 2011-03-07 No Snippets Schebb NH, Inceoglu B, Ahn KC, Morisseau C, Gee SJ, Hammock BD.
Show Full Abstract

The antibacterial soap additive triclocarban (TCC) is widely used in personal care products. TCC has a high environmental persistence. We developed and validated a sensitive online solid-phase extraction-LC-MS/MS method to rapidly analyze TCC and its major metabolites in urine and other biological samples to assess human exposure. We measured human urine concentrations 0-72 h after showering with a commercial bar soap containing 0.6% TCC. The major route of renal elimination was excretion as N-glucuronides. The absorption was estimated at 0.6% of the 70±15 mg of TCC in the soap used. The TCC-N-glucuronide urine concentration varied widely among the subjects, and continuous daily use of the soap led to steady state levels of excretion. In order to assess potential biological effects arising from this exposure, we screened TCC for the inhibition of human enzymes in vitro. We demonstrate that TCC is a potent inhibitor of the enzyme soluble epoxide hydrolase (sEH), whereas TCC's major metabolites lack strong inhibitory activity. Topical administration of TCC at similar levels to rats in a preliminary in vivo study, however, failed to alter plasma biomarkers of sEH activity. Overall the analytical strategy described here revealed that use of TCC soap causes exposure levels that warrant further evaluation.

Also flagged:peptidefibrilswaterfibril formationfibrilamino acid
Journal Article 2011-03-07 ✓ 5 Snippets Sivanandam VN, Jayaraman M, Hoop CL, Kodali R, Wetzel R, van der Wel PC.
In-Text Gene Mentions

The 17-residue N-terminus (htt(NT)) directly flanking the polyQ sequence in huntingtin (htt) N-terminal fragments plays a crucial role in initiating and accelerating the aggregation process that is associated with Huntington's disease pathogenesis.

…sequence in huntingtin (htt) N-terminal fragments plays…

…aggregates of anhttN-terminal fragment.…

…The 17-residue N-terminus (httNT ) directly…

…In contrast, thehttNT sequence in…

Show Full Abstract

The 17-residue N-terminus (htt(NT)) directly flanking the polyQ sequence in huntingtin (htt) N-terminal fragments plays a crucial role in initiating and accelerating the aggregation process that is associated with Huntington's disease pathogenesis. Here we report on magic-angle-spinning solid-state NMR studies of the amyloid-like aggregates of an htt N-terminal fragment. We find that the polyQ portion of this peptide exists in a rigid, dehydrated amyloid core that is structurally similar to simpler polyQ fibrils and may contain antiparallel β-sheets. In contrast, the htt(NT) sequence in the aggregates is composed in part of a well-defined helix, which likely also exists in early oligomeric aggregates. Further NMR experiments demonstrate that the N-terminal helical segment displays increased dynamics and water exposure. Given its specific contribution to the initiation, rate, and mechanism of fibril formation, the helical nature of htt(NT) and its apparent lack of effect on the polyQ fibril core structure seem surprising. The results provide new details about these disease-associated aggregates and also provide a clear example of an amino acid sequence that greatly enhances the rate of amyloid formation while itself not taking part in the amyloid structure. There is an interesting mechanistic analogy to recent reports pointing out the early-stage contributions of transient intermolecular helix-helix interactions in the aggregation behavior of various other amyloid fibrils.

Also flagged:synthesispyranmacrocyclesmacrocyclenitrilesilica
Journal Article 2011-03-07 No Snippets Comer E, Liu H, Joliton A, Clabaut A, Johnson C, Akella LB, Marcaurelle LA.
Show Full Abstract

Complexity and the presence of stereogenic centers have been correlated with success as compounds transition from discovery through the clinic. Here we describe the synthesis of a library of pyran-containing macrocycles with a high degree of structural complexity and up to five stereogenic centers. A key feature of the design strategy was to use a modular synthetic route with three fragments that can be readily interchanged or "shuffled" to produce subtly different variants with distinct molecular shapes. A total of 352 macrocycles were synthesized ranging in size from 14- to 16-membered rings. In order to facilitate the generation of stereostructure-activity relationships, the complete matrix of stereoisomers was prepared for each macrocycle. Solid-phase assisted parallel solution-phase techniques were employed to allow for rapid analogue generation. An intramolecular nitrile-activated nucleophilic aromatic substitution reaction was used for the key macrocyclization step.

Also flagged:RAFmelanomatumorskinasetranslationaltumor
Journal Article 2011-03-07 No Snippets Wagle N, Emery C, Berger MF, Davis MJ, Sawyer A, Pochanard P, Kehoe SM, Johannessen CM, Macconaill LE, Hahn WC, Meyerson M, Garraway LA.
Show Full Abstract

A detailed understanding of the mechanisms by which tumors acquire resistance to targeted anticancer agents should speed the development of treatment strategies with lasting clinical efficacy. RAF inhibition in BRAF-mutant melanoma exemplifies the promise and challenge of many targeted drugs; although response rates are high, resistance invariably develops. Here, we articulate overarching principles of resistance to kinase inhibitors, as well as a translational approach to characterize resistance in the clinical setting through tumor mutation profiling. As a proof of principle, we performed targeted, massively parallel sequencing of 138 cancer genes in a tumor obtained from a patient with melanoma who developed resistance to PLX4032 after an initial dramatic response. The resulting profile identified an activating mutation at codon 121 in the downstream kinase MEK1 that was absent in the corresponding pretreatment tumor. The MEK1(C121S) mutation was shown to increase kinase activity and confer robust resistance to both RAF and MEK inhibition in vitro. Thus, MEK1(C121S) or functionally similar mutations are predicted to confer resistance to combined MEK/RAF inhibition. These results provide an instructive framework for assessing mechanisms of acquired resistance to kinase inhibition and illustrate the use of emerging technologies in a manner that may accelerate personalized cancer medicine.

Also flagged:glioblastomaretinoic acidtumorcancerGBMcyclin D1
Journal Article 2011-03-07 ✓ 1 Snippet Ying M, Wang S, Sang Y, Sun P, Lal B, Goodwin CR, Guerrero-Cazares H, Quinones-Hinojosa A, Laterra J, Xia S.
In-Text Gene Mentions

Sox6

Show Full Abstract

It is necessary to understand mechanisms by which differentiating agents influence tumor-initiating cancer stem cells. Toward this end, we investigated the cellular and molecular responses of glioblastoma stem-like cells (GBM-SCs) to all-trans retinoic acid (RA). GBM-SCs were grown as non-adherent neurospheres in growth factor supplemented serum-free medium. RA treatment rapidly induced morphology changes, induced growth arrest at G1/G0 to S transition, decreased cyclin D1 expression and increased p27 expression. Immunofluorescence and western blot analysis indicated that RA induced the expression of lineage-specific differentiation markers Tuj1 and GFAP and reduced the expression of neural stem cell markers such as CD133, Msi-1, nestin and Sox-2. RA treatment dramatically decreased neurosphere-forming capacity, inhibited the ability of neurospheres to form colonies in soft agar and inhibited their capacity to propagate subcutaneous and intracranial xenografts. Expression microarray analysis identified ∼350 genes that were altered within 48 h of RA treatment. Affected pathways included retinoid signaling and metabolism, cell-cycle regulation, lineage determination, cell adhesion, cell-matrix interaction and cytoskeleton remodeling. Notch signaling was the most prominent of these RA-responsive pathways. Notch pathway downregulation was confirmed based on the downregulation of HES and HEY family members. Constitutive activation of Notch signaling with the Notch intracellular domain rescued GBM neurospheres from the RA-induced differentiation and stem cell depletion. Our findings identify mechanisms by which RA targets GBM-derived stem-like tumor-initiating cells and novel targets applicable to differentiation therapies for glioblastoma.

Also flagged:Calcium phosphateALPcollagencarboxymethylcellulosealginatecell proliferation
Journal Article 2011-03-07 No Snippets Park SH, Tofighi A, Wang X, Strunk M, Ricketts T, Chang J, Kaplan DL.
Show Full Abstract

A new class of biomimetic, bioresorbable apatitic calcium phosphate cement (CPC) was recently developed. The handling characteristics, and the ability to harden at body temperature in the presence of physiological saline, make this material an attractive clinical bone substitute and delivery vehicle for therapeutic agents in orthopedic applications. The major challenge with the material is formulating an injectable paste with options for cell delivery, in order to regenerate new bone faster and with high quality. In this study, three different additives and/or viscosity modifiers (carboxymethylcellulose, silk, and alginate) were incorporated into a CPC matrix. Injectability, cell viability, cell proliferation, surface morphology, and gene expression for osteogenesis of hMSCs were all evaluated. Injectable CPC-gel composites with cell protection were achieved. The CPC modified with alginate provided the best results based on cell proliferation, ALP and collagen production, and osteogenic transcript increases (for ALP, type I collagen, BSP, and OP). Furthermore, osteogenic analysis indicated lineage-specific differentiation of hMSCs into osteogenic outcomes. The results suggest that CPC mixed with alginate can be used as a cell delivery vehicle for bone regeneration.

Also flagged:sexually transmitted diseasesinfectioncapsid protein L1syndecan-1E6E7
Journal Article 2011-03-07 ✓ 1 Snippet Foresta C, Patassini C, Bertoldo A, Menegazzo M, Francavilla F, Barzon L, Ferlin A.
In-Text Gene Mentions

…with 3.5 U/mlHeparinase-III(Sigma Aldrich, St.…

Show Full Abstract

Human papillomaviruses (HPVs) are agents of the most common sexually transmitted diseases in females and males. Precise data about the presence, mechanism of infection and clinical significance of HPV in the male reproductive tract and especially in sperm are not available. Here we show that HPV can infect human sperm, it localizes at the equatorial region of sperm head through interaction between the HPV capsid protein L1 and syndecan-1. Sperm transfected with HPV E6/E7 genes and sperm exposed to HPV L1 capsid protein are capable to penetrate the oocyte and transfer the virus into oocytes, in which viral genes are then activated and transcribed. These data show that sperm might function as vectors for HPV transfer into the oocytes, and open new perspectives on the role of HPV infection in males and are particularly intriguing in relation to assisted reproduction techniques.

Also flagged:naphthaleneDRXwatercyclodextrinUSPacetonitrile
Journal Article 2011-03-07 No Snippets Wang Q, Yang C, Fukuhara G, Mori T, Liu Y, Inoue Y.
Show Full Abstract

γ-Cyclodextrin (CD) derivatives with a naphthalene moiety anchored to one or two of the glucose units of the CD were synthesized in order to investigate the effects of flexible and rigid capping upon complexation, as well as Förster resonance energy transfer (FRET) and photochirogenic behavior of anthracenecarboxylate (AC) moieties. UV-vis, circular dichroism and fluorescence spectral studies revealed that two AC molecules are simultaneously included in the modified γ-CD cavity to form a right-handed screw and also that the naphthalene cap efficiently transfers the singlet energy to AC included in the CD cavity via the FRET mechanism. Compared to native γ-CD, the modified γ-CDs showed much higher first association constants (K(1)) but relatively lower second association constants (K(2)) for AC, leading to two-fold larger overall affinities (K(1)K(2)). Photocyclodimerization of AC with these modified γ-CDs produced more head-to-head (HH) dimers in much better enantiomeric excesses (ee) for anti-HH dimer compared to native γ-CD. Interestingly, FRET excitation further enhanced the chemical and optical yields of anti-HH dimer up to 36% and 35% ee, for which the highly efficient FRET sensitization within the CD cavity, minimizing the "contamination" from the achiral "outside" photoreaction, is responsible. FRET sensitization also enabled us to achieve the catalytic photocyclodimerization of AC with a sub-equivalent amount of chiral supramolecular host.

Also flagged:ironJNKp38 MAPKASK1thioredoxinmetabolism
Journal Article 2011-03-05 ✓ 1 Snippet Yu Y, Richardson DR, Richardson DR.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

The role of signaling pathways in the regulation of cellular iron metabolism is becoming increasingly recognized. Iron chelation is used for the treatment of iron overload but also as a potential strategy for cancer therapy, because iron depletion results in cell cycle arrest and apoptosis. This study examined potential signaling pathways affected by iron depletion induced by desferrioxamine (DFO) or di-2-pyridylketone-4,4-dimethyl-3-thiosemicarbazone (Dp44mT). Both chelators affected multiple molecules in the mitogen-activated protein kinase (MAPK) pathway, including a number of dual specificity phosphatases that directly de-phosphorylate MAPKs. Examination of the phosphorylation of major MAPKs revealed that DFO and Dp44mT markedly increased phosphorylation of stress-activated protein kinases, JNK and p38, without significantly affecting the extracellular signal-regulated kinase (ERK). Redox-inactive DFO-iron complexes did not affect phosphorylation of JNK or p38, whereas the redox-active Dp44mT-iron complex significantly increased the phosphorylation of these kinases similarly to Dp44mT alone. Iron or N-acetylcysteine supplementation reversed Dp44mT-induced up-regulation of phospho-JNK, but only iron was able to reverse the effect of DFO on JNK. Both iron chelators significantly reduced ASK1-thioredoxin complex formation, resulting in the increased phosphorylation of ASK1, which activates the JNK and p38 pathways. Thus, dissociation of ASK1 could serve as an important signal for the phosphorylation of JNK and p38 activation observed after iron chelation. Phosphorylation of JNK and p38 likely play an important role in mediating the cell cycle arrest and apoptosis induced by iron depletion.

Also flagged:glucosetoleranceinsulin
Journal Article 2011-03-05 No Snippets Shaw CS, Cooper NM, Shaw O, Salomao P, Wagenmakers AJ.
Show Full Abstract

Our first aim was to investigate whether the ingestion of a single high-fat meal impairs glucose tolerance. Our second aim was to investigate whether improvements in glucose tolerance that are seen after resistance exercise remain when exercise is performed after ingestion of a high-fat meal. Eight young males consumed either a high fat (HF) or an isocaloric control (CON) meal in the morning and underwent an oral glucose tolerance test (OGTT) 6 h later. On two other occasions, a single 1 h bout of resistance exercise was completed 2 h after consumption of each meal (HFE and CONE). There were no significant differences in plasma glucose and plasma insulin areas under the curve (AUC) or estimates of insulin sensitivity between the HF and CON trials (P > 0.05). The HFE and CONE trials elicited a ~20% lower plasma glucose AUC (P < 0.05) compared to their respective control trials. The HFE also elicited a ~25% lower plasma insulin AUC (P < 0.05) in comparison to the HF trial. The HFE trial also significantly improved estimates of insulin sensitivity in comparison to the HF condition (P < 0.05). In conclusion, this study demonstrates that consumption of a single HF meal does not impair glucose tolerance in the resting state in lean individuals and that an acute bout of resistance exercise remains effective in enhancing glucose tolerance following the ingestion of a single high-fat meal.

Also flagged:hibernationureaamino acidcarbohydratedegradationlipid
Journal Article 2011-03-05 No Snippets Rose JC, Epperson LE, Carey HV, Martin SL.
Show Full Abstract

Hibernation is an energy-saving strategy used by diverse species of mammals to survive winter. It is characterized by cycles between multi-day periods of torpor with low body temperature (T(b)), and short periods of rapid, spontaneous rewarming. The ability to retain cellular integrity and function throughout torpor and rewarming is a key attribute of hibernation. Livers from winter hibernators are resistant to cellular damage induced by cold storage followed by warm reperfusion. Identifying proteins that differ between the summer-sensitive and winter-protected phenotypic states is one useful approach that may elucidate the molecular mechanisms that underlie this protection. Here we employ a novel quantitative proteomics screening strategy whereby a newly-weaned 13-lined ground squirrel was metabolically labeled by ingesting heavy-isotope substituted ((15)N) Spirulina. The liver protein extract from this animal provided a common reference for quantitative evaluation of protein differences by its addition to extracts from pooled samples of summer active (SA) or winter entrance (Ent) phase hibernating ground squirrels. We identified 61 significantly different proteins between the two groups and compared them to proteins identified previously in the same samples using 2D gels. Of the 20 proteins common to the two datasets, the direction and magnitude of their differences were perfectly concordant for 18, providing confidence that both sets of altered proteins reflect bona fide differences between the two physiological states. Furthermore, the 41 novel proteins recovered in this study included many new enzymes in pathways identified previously: specifically, additional enzymes belonging to the urea cycle, amino acid and carbohydrate degradation, and lipid biosynthetic pathways were decreased, whereas enzymes involved in ketone body synthesis, fatty acid utilization, protein synthesis and gluconeogenesis were increased in the samples from entrance hibernators compared to summer active animals, providing additional specific evidence for the importance of these pathways in the hibernating phenotype.

Also flagged:acute encephalopathypattern recognition receptorsJapanese encephalitis virus infectionJapanese encephalitisinfectionhost cell
Journal Article 2011-03-04 No Snippets Gupta N, Rao PV.
Show Full Abstract

<h4>Background</h4>Japanese encephalitis (JE) is one of the leading causes of acute encephalopathy with the highest mortality rate of 30-50%. The purpose of this study was to understand complex biological processes of host response during the progression of the disease. Virus was subcutaneously administered in mice and brain was used for whole genome expression profiling by cDNA microarray.<h4>Results</h4>The comparison between viral replication efficiency and disease progression confirms the active role of host response in immunopathology and disease severity. The histopathological analysis confirms the severe damage in the brain in a time dependent manner. Interestingly, the transcription profile reveals significant and differential expression of various pattern recognition receptors, chemotactic genes and the activation of inflammasome. The increased leukocyte infiltration and aggravated CNS inflammation may be the cause of disease severity.<h4>Conclusion</h4>This is the first report that provides a detailed picture of the host transcriptional response in a natural route of exposure and opens up new avenues for potential therapeutic and prophylactic strategies against Japanese encephalitis virus.

Also flagged:mastitissubclinical mastitisintramammary infectionlactationinfectionintramammary infections
Journal Article 2011-03-04 ✓ 5 Snippets Persson Y, Olofsson I.
In-Text Gene Mentions

CMT) and direct measurement of SCC using a portable deLaval cell counter (DCC

CMT and DCC

CMT) corresponded to direct measurement of SCC (DCC

CMT was well correlated with SCC measured by DCC

CMT or DCC

Show Full Abstract

<h4>Background</h4>Mastitis is the most important and costly disease in dairy goat production. Subclinical mastitis is common in goats and is mainly caused by contagious bacteria. Several methods to diagnose subclinical mastitis are available. In this study indirect measurement of somatic cell count (SCC) by California Mastitis Test (CMT) and direct measurement of SCC using a portable deLaval cell counter (DCC) are evaluated. Swedish goat farmers would primarily benefit from diagnostic methods that can be used at the farm. The purpose of the study was to evaluate SCC measured by CMT and DCC as possible markers for intramammary infection (IMI) in goats without clinical symptoms of mastitis. Moreover to see how well indirect measurement of SCC (CMT) corresponded to direct measurement of SCC (DCC).<h4>Method</h4>Udder half milk samples were collected once from dairy goats (n = 111), in five different farms in Northern and Central Sweden. Only clinically healthy animals were included in the study. All goats were in mid to late lactation at sampling. Milk samples were analyzed for SCC by CMT and DCC at the farm, and for bacterial growth at the laboratory.<h4>Results</h4>Intramammary infection, defined as growth of udder pathogens, was found in 39 (18%) of the milk samples. No growth was found in 180 (81%) samples while 3 (1%) samples were contaminated. The most frequently isolated bacterial species was coagulase negative staphylococci (CNS) (72% of all isolates), followed by Staphylococcus aureus (23% of all isolates). Somatic cell count measured by DCC was strongly (p = 0.000) associated with bacterial growth. There was also a very strong association between CMT and bacterial growth. CMT 1 was associated with freedom of IMI while CMT ≥2 was associated with IMI. Indirect measurement of SCC by CMT was well correlated with SCC measured by DCC.<h4>Conclusions</h4>According to the results, SCC measured with CMT or DCC can predict udder infection in goats, and CMT can be used as a predictor of the SCC.

Also flagged:β-globinβ-globinsc-mybglobinRNA polymeraseεy-globin
Journal Article 2011-03-04 ✓ 2 Snippets McGrath KE, Frame JM, Fromm GJ, Koniski AD, Kingsley PD, Little J, Bulger M, Palis J.
In-Text Gene Mentions

…anscriptional modifiers c-myb,Sox6, and Bcl11A.…

Sox6

Show Full Abstract

A transient erythromyeloid wave of definitive hematopoietic progenitors (erythroid/myeloid progenitors [EMPs]) emerges in the yolk sac beginning at embryonic day 8.25 (E8.25) and colonizes the liver by E10.5, before adult-repopulating hematopoietic stem cells. At E11.5, we observe all maturational stages of erythroid precursors in the liver and the first definitive erythrocytes in the circulation. These early fetal liver erythroblasts express predominantly adult β-globins and the definitive erythroid-specific transcriptional modifiers c-myb, Sox6, and Bcl11A. Surprisingly, they also express low levels of "embryonic" βH1-, but not εy-, globin transcripts. Consistent with these results, RNA polymerase and highly modified histones are found associated with βH1- and adult globin, but not εy-globin, genes. E11.5 definitive proerythroblasts from mice transgenic for the human β-globin locus, like human fetal erythroblasts, express predominately human γ-, low β-, and no ε-globin transcripts. Significantly, E9.5 yolk sac-derived EMPs cultured in vitro have similar murine and human transgenic globin expression patterns. Later liver proerythroblasts express low levels of γ-globin, while adult marrow proerythroblasts express only β-globin transcripts. We conclude that yolk sac-derived EMPs, the first of 2 origins of definitive erythropoiesis, express a unique pattern of globin genes as they generate the first definitive erythrocytes in the liver of the mammalian embryo.

Also flagged:gene expressionschizophreniacognitionN-methyl D-aspartate receptor subtype 2BGrin2btumor necrosis factor-alpha
Journal Article 2011-03-04 No Snippets Neeley EW, Berger R, Koenig JI, Leonard S.
Show Full Abstract

Multiple animal models have been developed to recapitulate phenotypes of the human disease, schizophrenia. A model that simulates many of the cognitive and sensory deficits of the disorder is the use of random variable prenatal stress (PS) in the rat. These deficits suggest a molecular origin in the hippocampus, a brain region that plays a role in the regulation of stress. To study both hippocampal gene expression changes in offspring of prenatally stressed dams and to address genetic variability, we used a random array of prenatal stressors in three different rat strains with diverse responses to stress: Fischer, Sprague-Dawley, and Lewis rats. Candidate genes involved in stress, schizophrenia, cognition, neurotrophic effects, and immunity were selected for assessment by real-time quantitative PCR under resting conditions and following a brief exposure to restraint stress. PS resulted in significant differences in gene expression in the offspring that were strain dependent. mRNA expression for the N-methyl-D-aspartate receptor subtype 2B (Grin2b) was increased, and tumor necrosis factor-alpha (Tnfα) transcript was decreased in PS Sprague-Dawley and Lewis rats, but not in the Fischer rats. Expression of brain-derived neurotrophic factor (Bdnf) mRNA in the hippocampus was increased after an acute stress in all controls of each strain, yet a decrease was seen after acute stress in the PS Sprague-Dawley and Lewis rats. Expression of the glucocorticoid receptor (Nr3c1) was decreased in the Fischer strain when compared to Lewis or Sprague-Dawley rats, though the Fischer rats had markedly higher α7 nicotinic receptor (Chrna7) expression. The expression differences seen in these animals may be important elements of the phenotypic differences seen due to PS and genetic background.

Also flagged:p53tumor suppressor p53Actinomycin DEtoposidebindingpost-translational modifications
Journal Article 2011-03-04 ✓ 2 Snippets Smeenk L, van Heeringen SJ, Koeppel M, Gilbert B, Janssen-Megens E, Stunnenberg HG, Lohrum M.
In-Text Gene Mentions

… susceptibility protein (hCAS/CSE1L) has been shown…

… susceptibility protein (hCAS/CSE1L) was described to…

Show Full Abstract

The tumor suppressor p53 plays a crucial role in cellular growth control inducing a plethora of different response pathways. The molecular mechanisms that discriminate between the distinct p53-responses have remained largely elusive. Here, we have analyzed the p53-regulated pathways induced by Actinomycin D and Etoposide treatment resulting in more growth arrested versus apoptotic cells respectively. We found that the genome-wide p53 DNA-binding patterns are almost identical upon both treatments notwithstanding transcriptional differences that we observed in global transcriptome analysis. To assess the role of post-translational modifications in target gene choice and activation we investigated the genome-wide level of phosphorylation of Serine 46 of p53 bound to DNA (p53-pS46) and of Serine 15 (p53-pS15). Interestingly, the extent of S46 phosphorylation of p53 bound to DNA is considerably higher in cells directed towards apoptosis while the degree of phosphorylation at S15 remains highly similar. Moreover, our data suggest that following different chemotherapeutical treatments, the amount of chromatin-associated p53 phosphorylated at S46 but not at pS15 is higher on certain apoptosis related target genes. Our data provide evidence that cell fate decisions are not made primarily on the level of general p53 DNA-binding and that post-translationally modified p53 can have distinct DNA-binding characteristics.

Also flagged:bronchopulmonary dysplasiadeathgestationCPAPHood1241
Journal Article 2011-03-04 No Snippets Laughon MM, Langer JC, Bose CL, Smith PB, Ambalavanan N, Kennedy KA, Stoll BJ, Buchter S, Laptook AR, Ehrenkranz RA, Cotten CM, Wilson-Costello DE, Shankaran S, Van Meurs KP, Davis AS, Gantz MG, Finer NN, Yoder BA, Faix RG, Carlo WA, Schibler KR, Newman NS, Rich W, Das A, Higgins RD, Walsh MC, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Rationale</h4>Benefits of identifying risk factors for bronchopulmonary dysplasia in extremely premature infants include providing prognostic information, identifying infants likely to benefit from preventive strategies, and stratifying infants for clinical trial enrollment.<h4>Objectives</h4>To identify risk factors for bronchopulmonary dysplasia, and the competing outcome of death, by postnatal day; to identify which risk factors improve prediction; and to develop a Web-based estimator using readily available clinical information to predict risk of bronchopulmonary dysplasia or death.<h4>Methods</h4>We assessed infants of 23-30 weeks' gestation born in 17 centers of the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network and enrolled in the Neonatal Research Network Benchmarking Trial from 2000-2004.<h4>Measurements and main results</h4>Bronchopulmonary dysplasia was defined as a categorical variable (none, mild, moderate, or severe). We developed and validated models for bronchopulmonary dysplasia risk at six postnatal ages using gestational age, birth weight, race and ethnicity, sex, respiratory support, and Fi(O(2)), and examined the models using a C statistic (area under the curve). A total of 3,636 infants were eligible for this study. Prediction improved with advancing postnatal age, increasing from a C statistic of 0.793 on Day 1 to a maximum of 0.854 on Day 28. On Postnatal Days 1 and 3, gestational age best improved outcome prediction; on Postnatal Days 7, 14, 21, and 28, type of respiratory support did so. A Web-based model providing predicted estimates for bronchopulmonary dysplasia by postnatal day is available at https://neonatal.rti.org.<h4>Conclusions</h4>The probability of bronchopulmonary dysplasia in extremely premature infants can be determined accurately using a limited amount of readily available clinical information.

Also flagged:Synthesis4-Halocolchicinescolchicinecancercolorectal carcinomacolchicines
Journal Article 2011-03-04 No Snippets Yasobu N, Kitajima M, Kogure N, Shishido Y, Matsuzaki T, Nagaoka M, Takayama H.
Show Full Abstract

Novel colchicine derivatives possessing various substituents at the C4 position were prepared. Among them, 4-halo derivatives 3-6 were found to exhibit higher activity against cancer cell lines (A549, HT29, HCT116) as well as on mice transplanted with the HCT116 human colorectal carcinoma cell line than colchicine (1). Further, utilizing the 4-substituted colchicines, we prepared pro-drugs having a dipeptide side chain and demonstrated that these pro-drugs were activated by cathepsin B, an enzyme overexpressed in tumor cells, and exhibited selective toxicity to the tumor cells.

Also flagged:titaniumspine diseasehydroxyapatiteapatitewollastonitetumor
Journal Article 2011-03-03 No Snippets Fujibayashi S, Takemoto M, Neo M, Matsushita T, Kokubo T, Doi K, Ito T, Shimizu A, Nakamura T.
Show Full Abstract

The objective of this study was to establish the efficacy and safety of porous bioactive titanium metal for use in a spinal fusion device, based on a prospective human clinical trial. A high-strength spinal interbody fusion device was manufactured from porous titanium metal. A bioactive surface was produced by simple chemical and thermal treatment. Five patients with unstable lumbar spine disease were treated surgically using this device in a clinical trial approved by our Ethics Review Committee and the University Hospital Medical Information Network. Clinical and radiological results were reported at the minimum follow-up period of 1 year. The optimal mechanical strength and interconnected structure of the porous titanium metal were adjusted for the device. The whole surface of porous titanium metal was treated uniformly and its bioactive ability was confirmed before clinical use. Successful bony union was achieved in all cases within 6 months without the need for autologous iliac crest bone grafting. Two specific findings including an anchoring effect and gap filling were evident radiologically. All clinical parameters improved significantly after the operation and no adverse effects were encountered during the follow-up period. Although a larger and longer-term follow-up clinical study is mandatory to reach any firm conclusions, the study results show that this porous bioactive titanium metal is promising material for a spinal fusion device.

Also flagged:gene expressionironlocalizationGFPβ2MTfR1
Journal Article 2011-03-03 ✓ 5 Snippets Martins R, Silva B, Proença D, Faustino P.
In-Text Gene Mentions

Altogether, our results show that HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism.

HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism.

HFE-derived Hereditary Hemochromatosis

HFE is a major histocompatibility complex (MHC) class I-like protein that is mutated in Hereditary Hemochromatosis

…the function ofHFEprotein in iron…

Show Full Abstract

<h4>Background</h4>The pathophysiology of HFE-derived Hereditary Hemochromatosis and the function of HFE protein in iron homeostasis remain uncertain. Also, the role of alternative splicing in HFE gene expression regulation and the possible function of the corresponding protein isoforms are still unknown. The aim of this study was to gain insights into the physiological significance of these alternative HFE variants.<h4>Methodology/principal findings</h4>Alternatively spliced HFE transcripts in diverse human tissues were identified by RT-PCR, cloning and sequencing. Total HFE transcripts, as well as two alternative splicing transcripts were quantified using a real-time PCR methodology. Intracellular localization, trafficking and protein association of GFP-tagged HFE protein variants were analysed in transiently transfected HepG2 cells by immunoprecipitation and immunofluorescence assays. Alternatively spliced HFE transcripts present both level- and tissue-specificity. Concerning the exon 2 skipping and intron 4 inclusion transcripts, the liver presents the lowest relative level, while duodenum presents one of the highest amounts. The protein resulting from exon 2 skipping transcript is unable to associate with β2M and TfR1 and reveals an ER retention. Conversely, the intron 4 inclusion transcript gives rise to a truncated, soluble protein (sHFE) that is mostly secreted by cells to the medium in association with β2M.<h4>Conclusions/significance</h4>HFE gene post-transcriptional regulation is clearly affected by a tissue-dependent alternative splicing mechanism. Among the corresponding proteins, a sHFE isoform stands out, which upon being secreted into the bloodstream, may act in remote tissues. It could be either an agonist or antagonist of the full length HFE, through hepcidin expression regulation in the liver or by controlling dietary iron absorption in the duodenum.

Also flagged:morphogenesisnuclear hormone receptorstranscription factorselt-6nhr-25dmd-3
Journal Article 2011-03-03 No Snippets Nelson MD, Zhou E, Kiontke K, Fradin H, Maldonado G, Martin D, Shah K, Fitch DH.
Show Full Abstract

During animal development, cellular morphogenesis plays a fundamental role in determining the shape and function of tissues and organs. Identifying the components that regulate and drive morphogenesis is thus a major goal of developmental biology. The four-celled tip of the Caenorhabditis elegans male tail is a simple but powerful model for studying the mechanism of morphogenesis and its spatiotemporal regulation. Here, through a genome-wide post-embryonic RNAi-feeding screen, we identified 212 components that regulate or participate in male tail tip morphogenesis. We constructed a working hypothesis for a gene regulatory network of tail tip morphogenesis. We found regulatory roles for the posterior Hox genes nob-1 and php-3, the TGF-β pathway, nuclear hormone receptors (e.g. nhr-25), the heterochronic gene blmp-1, and the GATA transcription factors egl-18 and elt-6. The majority of the pathways converge at dmd-3 and mab-3. In addition, nhr-25 and dmd-3/mab-3 regulate each others' expression, thus placing these three genes at the center of a complex regulatory network. We also show that dmd-3 and mab-3 negatively regulate other signaling pathways and affect downstream cellular processes such as vesicular trafficking (e.g. arl-1, rme-8) and rearrangement of the cytoskeleton (e.g. cdc-42, nmy-1, and nmy-2). Based on these data, we suggest that male tail tip morphogenesis is governed by a gene regulatory network with a bow-tie architecture.

Also flagged:Rad60SUMO ligaseSUMO-targeted ubiquitin ligaseTdp1cell cycleSUMO E3 ligase
Journal Article 2011-03-03 ✓ 1 Snippet Heideker J, Prudden J, Perry JJ, Tainer JA, Boddy MN.
In-Text Gene Mentions

…the Cohesin andCondensincomplexes, but interestingly,…

Show Full Abstract

Through as yet undefined proteins and pathways, the SUMO-targeted ubiquitin ligase (STUbL) suppresses genomic instability by ubiquitinating SUMO conjugated proteins and driving their proteasomal destruction. Here, we identify a critical function for fission yeast STUbL in suppressing spontaneous and chemically induced topoisomerase I (Top1)-mediated DNA damage. Strikingly, cells with reduced STUbL activity are dependent on tyrosyl-DNA phosphodiesterase 1 (Tdp1). This is notable, as cells lacking Tdp1 are largely aphenotypic in the vegetative cell cycle due to the existence of alternative pathways for the removal of covalent Top1-DNA adducts (Top1cc). We further identify Rad60, a SUMO mimetic and STUbL-interacting protein, and the SUMO E3 ligase Nse2 as critical Top1cc repair factors in cells lacking Tdp1. Detection of Top1ccs using chromatin immunoprecipitation and quantitative PCR shows that they are elevated in cells lacking Tdp1 and STUbL, Rad60, or Nse2 SUMO ligase activity. These unrepaired Top1ccs are shown to cause DNA damage, hyper-recombination, and checkpoint-mediated cell cycle arrest. We further determine that Tdp1 and the nucleotide excision repair endonuclease Rad16-Swi10 initiate the major Top1cc repair pathways of fission yeast. Tdp1-based repair is the predominant activity outside S phase, likely acting on transcription-coupled Top1cc. Epistasis analyses suggest that STUbL, Rad60, and Nse2 facilitate the Rad16-Swi10 pathway, parallel to Tdp1. Collectively, these results reveal a unified role for STUbL, Rad60, and Nse2 in protecting genome stability against spontaneous Top1-mediated DNA damage.

Also flagged:cytokineextracellularsignalpost-translational modificationsphosphorylationlocalization
Journal Article 2011-03-03 No Snippets Morris MK, Saez-Rodriguez J, Clarke DC, Sorger PK, Lauffenburger DA.
Show Full Abstract

Predictive understanding of cell signaling network operation based on general prior knowledge but consistent with empirical data in a specific environmental context is a current challenge in computational biology. Recent work has demonstrated that Boolean logic can be used to create context-specific network models by training proteomic pathway maps to dedicated biochemical data; however, the Boolean formalism is restricted to characterizing protein species as either fully active or inactive. To advance beyond this limitation, we propose a novel form of fuzzy logic sufficiently flexible to model quantitative data but also sufficiently simple to efficiently construct models by training pathway maps on dedicated experimental measurements. Our new approach, termed constrained fuzzy logic (cFL), converts a prior knowledge network (obtained from literature or interactome databases) into a computable model that describes graded values of protein activation across multiple pathways. We train a cFL-converted network to experimental data describing hepatocytic protein activation by inflammatory cytokines and demonstrate the application of the resultant trained models for three important purposes: (a) generating experimentally testable biological hypotheses concerning pathway crosstalk, (b) establishing capability for quantitative prediction of protein activity, and (c) prediction and understanding of the cytokine release phenotypic response. Our methodology systematically and quantitatively trains a protein pathway map summarizing curated literature to context-specific biochemical data. This process generates a computable model yielding successful prediction of new test data and offering biological insight into complex datasets that are difficult to fully analyze by intuition alone.

Also flagged:synthesishistone deacetylasesuberoylanilide hydroxamic acidHDACcancerCell proliferation
Journal Article 2011-03-03 No Snippets Zeglis BM, Pillarsetty N, Divilov V, Blasberg RA, Lewis JS.
Show Full Abstract

<h4>Introduction</h4>Given the significant utility of suberoylanilide hydroxamic acid (SAHA) in chemotherapeutic protocols, a PET tracer that mimics the histone deacetylase (HDAC) inhibition of SAHA could be a valuable tool in the diagnosis, treatment planning and treatment monitoring of cancer. Here, we describe the synthesis, characterization and evaluation of N(1)-(4-(2-[(18)F]-fluoroethyl)phenyl)-N(8)-hydroxyoctanediamide ([(18)F]-FESAHA), a PET tracer designed for the delineation of HDAC expression in cancer.<h4>Methods</h4>FESAHA was synthesized and biologically characterized in vivo and in vitro. [(18)F]-FESAHA was then synthesized in high radiochemical purity, and the logP and serum stability of the radiotracer were determined. In vitro cellular uptake experiments and acute biodistribution and small-animal PET studies were performed with [(18)F]-FESAHA in mice bearing LNCaP xenografts.<h4>Results</h4>[(18)F]-FESAHA was synthesized in high radiochemical purity via an innovative one-pot procedure. Enzymatic inhibition assays illustrated that FESAHA is a potent HDAC inhibitor, with IC(50) values from 3 nM to 1.7 μM against the 11 HDAC subtypes. Cell proliferation experiments revealed that the cytostatic properties of FESAHA very closely resemble those of SAHA in both LNCaP cells and PC-3 cells. Acute biodistribution and PET imaging experiments revealed tumor uptake of [(18)F]-FESAHA and substantially higher values in the small intestine, kidneys, liver and bone.<h4>Conclusion</h4>The significant non-tumor background uptake of [(18)F]-FESAHA presents a substantial obstacle to the use of the radiotracer as an HDAC expression imaging agent. The study at hand, however, does present a number of lessons critical to both the synthesis of hydroxamic acid containing PET radiotracers and imaging agents aimed at delineating HDAC expression.

Also flagged:cyclosporin AP-glycoproteinABC efflux transportersbehavioralABC transportersbenzamide
Journal Article 2011-03-03 No Snippets Tu Z, Li S, Xu J, Chu W, Jones LA, Luedtke RR, Mach RH.
Show Full Abstract

<h4>Introduction</h4>Four benzamide analogs having a high affinity and selectivity for D(3) versus D(2) receptors were radiolabeled with (11)C or (18)F for in vivo evaluation.<h4>Methods</h4>Precursors were synthesized, and the four D(3) selective benzamide analogs were radiolabeled. The tissue distribution and brain uptake of the four compounds were evaluated in control rats and rats pretreated with cyclosporin A, a modulator of P-glycoprotein and an inhibitor of other ABC efflux transporters that contribute to the blood brain barrier. Micro-positron emission tomographic (PET) imaging was carried out for [(11)C]6 in a control and a cyclosporin A pretreated rat.<h4>Results</h4>All four compounds showed low brain uptake in control rats at 5 and 30 min post-injection; despite recently reported rat behavioral studies conducted on analogs 6 (WC-10) and 7 (WC-44). Following administration of cyclosporin A, increased brain uptake was observed with all four PET radiotracers at both 5 and 30 min post-intravenous injection. An increase in brain uptake following modulation/inhibition of the ABC transporters was also observed in the microPET study.<h4>Conclusions</h4>These data suggest that D3 selective conformationally-flexible benzamide analogs which contain a N-2-methoxyphenylpiperazine moiety are substrates for P-glycoprotein or other adenosine triphosphate (ATP)-binding cassette transporters expressed at the blood-brain barrier, and that PET radiotracers containing this pharmacophore may display low brain uptake in rodents due to the action of these efflux transporters.

Also flagged:joint infectioninfectionhip infectionobesityarterial hypertensiontype 2 diabetes mellitus
Journal Article 2011-03-02 ✓ 1 Snippet Aubin GG, Bémer P, Guillouzouic A, Crémet L, Touchais S, Fraquet N, Boutoille D, Reynaud A, Lepelletier D, Corvec S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

We describe the first case of hip prosthetic infection due to Lactococcus garvieae. The patient, a 71-year-old woman fishmonger, developed a hip infection 7 years after total hip arthroplasty. The origin of infection was possibly due to the manipulation or intake of seafood or fish contaminated with Lactococcus garvieae.

Also flagged:Movement disordersspinocerebellar ataxiasAutosomal dominant spinocerebellar ataxiascerebellar ataxiamovement disordercortical myoclonus
Journal Article 2011-03-02 ✓ 1 Snippet van Gaalen J, Giunti P, van de Warrenburg BP.
In-Text Gene Mentions

When confronted with a patient with an isolated movement disorder, that is, without ataxia, there is currently no reason to routinely screen for SCA gene mutations, the only exceptions being SCA2 in autosomal dominant parkinsonism (particularly in Asian patients) and SCA17 in the case of a Huntington's disease-like presentation without an HTT mutation.

Show Full Abstract

Autosomal dominant spinocerebellar ataxias (SCAs) can present with a large variety of noncerebellar symptoms, including movement disorders. In fact, movement disorders are frequent in many of the various SCA subtypes, and they can be the presenting, dominant, or even isolated disease feature. When combined with cerebellar ataxia, the occurrence of a specific movement disorder can provide a clue toward the underlying genotype. There are reasons to believe that for some coexisting movement disorders, the cerebellar pathology itself is the culprit, for example, in the case of cortical myoclonus and perhaps dystonia. However, movement disorders in SCAs are more likely related to extracerebellar pathology, and imaging and neuropathological data indeed show involvement of other parts of the motor system (substantia nigra, striatum, pallidum, motor cortex) in some SCA subtypes. When confronted with a patient with an isolated movement disorder, that is, without ataxia, there is currently no reason to routinely screen for SCA gene mutations, the only exceptions being SCA2 in autosomal dominant parkinsonism (particularly in Asian patients) and SCA17 in the case of a Huntington's disease-like presentation without an HTT mutation.

Also flagged:penicillin-binding proteinPBPmacrolidepenicillinerythromycinmefA
Journal Article 2011-03-02 No Snippets Hashida K, Shiomori T, Hohchi N, Ohkubo J, Ohbuchi T, Mori T, Suzuki H.
Show Full Abstract

<h4>Objectives</h4>We conducted a prospective bacteriological survey to investigate antibiotic resistance-related genetic characteristics and the turnover of nasopharyngeal Streptococcus pneumoniae carriage in healthy children in day-care centers (DCCs).<h4>Methods</h4>A total of 363 nasopharyngeal mucus samples were collected from children aged 0 to 6 years attending two DCCs in the summer of 2004 (n=181) and the following winter (n=182). We obtained 157 S. pneumoniae isolates and analyzed them by antibiotic susceptibility testing, PCR assay for the penicillin-binding protein (PBP) genes and macrolide-resistance gene, and pulsed-field gel electrophoresis (PFGE).<h4>Results</h4>The overall carriage rate was 43.3% (157/363). The percentages of penicillin-intermediately resistant S. pneumoniae (PISP) strains, penicillin-resistant S. pneumoniae (PRSP) strains, erythromycin-intermediately resistant S. pneumoniae strains and erythromycin-resistant S. pneumoniae strains were 35.7% (56/157), 0.6% (1/157), 1.9% (3/157), and 69.4% (109/157), respectively. The percentages of S. pneumoniae strains with the pbp mutation(s) and mefA and/or ermB gene(s) were 92.4% (145/157) and 71.3% (112/157), respectively. Fifty strains with different PFGE patterns were obtained from among the 157 isolates. Thirteen strains were observed in both seasons, but only one of these strains was isolated from the same carrier. Twenty-one strains (42.0%) were isolated from two or more children, and 17 of these were each isolated from children attending the same DCC.<h4>Conclusions</h4>These results indicate the spread of S. pneumoniae, particularly those with antibiotic-resistance genes, and the vigorous genetic turnover and substantial horizontal transmission of this pathogen in healthy children attending DCCs in Japan.

Also flagged:bindingenalaprilproteindegradationesterasedextran
Journal Article 2011-03-02 No Snippets Wenlock MC, Barton P, Austin RP.
Show Full Abstract

Traditional methods for the determination of plasma protein binding (PPB), such as equilibrium dialysis and ultrafiltration, normally operate on a timescale ranging from tens of minutes to several hours and are not suitable for measuring compounds that have significant chemical degradation on this timescale. One such compound is enalapril. Although stable in human plasma enalapril is subject to rapid esterase-catalyzed hydrolysis in rat plasma. A method has been developed which allows the extent of rat PPB of enalapril to be determined from initial rates kinetics of the adsorption of the unstable compound to dextran coated charcoal (DCC). The method has been applied to stable compounds, and the results are consistent with those from traditional equilibrium dialysis experiments. The experimental method is simple to run, requires no specialized equipment, and can potentially be applied to other compounds that show instability in plasma where traditional experimental techniques are unsuitable.

Also flagged:colon adenocarcinomaadenocarcinoma of the colontumorphosphatidylinositol 3-kinasephosphorylationAkt
Journal Article 2011-03-02 ✓ 1 Snippet Chen J, Shi Y, Li Z, Yu H, Han Y, Wang X, Sun K, Yang T, Lou K, Song Y, Zhang Y, Zhen Y, Zhang G, Hu Y, Ji J, Hui R.
In-Text Gene Mentions

DCC

Show Full Abstract

The IC53 gene was reported to be upregulated in the colon adenocarcinoma cell line SW480. Here, we show that the expression level of IC53 is positively correlated with the grade and depth of invasion in adenocarcinoma of the colon. Injection of IC53 stably transfected HCT-116 cells into athymic nude mice promoted tumor growth. Furthermore, overexpression of IC53 increased cell invasive growth, which could be dramatically prevented by knocking down IC53 with siRNA. The effects of IC53 on cell-invasive growth were mediated by upregulation of integrins, activation of phosphatidylinositol 3-kinase and phosphorylation of Akt. A single-nucleotide polymorphism rs2737 in the IC53 gene created a potential microRNA379 target site, and microRNA379 expression inhibited IC53 translation. Among 222 patients with colorectal cancer, the C/C rs2737 genotype was associated with late onset of colorectal cancer (median age 63.0 versus 55.3 years, P = 0.003). The frequency of the C/C rs2737 genotype was much lower in patients who developed colorectal cancer below the age of 45 years than in individuals over age 45 years (10.8% versus 26.6%, P = 0.039). These data indicated that IC53 is a positive mediator for colon cancer progression, and IC53-rs2737 may serve as protection from the onset of colorectal cancer.

Also flagged:chromosomal disorderscystic kidney diseasetrypsindeficiencyvon Willebrand diseasecystic fibrosis
Journal Article 2011-03-02 ✓ 2 Snippets Dye DE, Brameld KJ, Maxwell S, Goldblatt J, O'Leary P.
In-Text Gene Mentions

…α-1 anti-trypsin deficiency,hemochromatosis, von Willebrand disease,…

hemochromatosis

Show Full Abstract

Although the role of single gene and chromosomal disorders in pediatric illness has been recognized since the 1970s, there are few data describing the impact of these often severe disorders on the health of the adult population. In this study, we present population data describing the impact of single gene and chromosomal disorders on hospital admissions of patients aged 20 years and over in Western Australia between 2000 and 2006. The number, length, and cost of admissions were investigated and compared between disease categories and age groups and to hospital admissions for any reason. In total, 73,211 admissions and 8,032 patients were included in the study. The most costly disorders were cystic kidney disease, α-1 anti-trypsin deficiency, hemochromatosis, von Willebrand disease, and cystic fibrosis. Overall, patients with single gene and chromosomal disorders represented 0.5% of the patient population and were responsible for 1.9% of admissions and 1.5% of hospital costs. These data will enable informed provision of health care services for adults with single gene and chromosomal disorders in Australia.

Also flagged:neurotrophic factorsbraincytokineHDglucosenucleus
Journal Article 2011-03-01 ✓ 2 Snippets Battaglia G, Cannella M, Riozzi B, Orobello S, Maat-Schieman ML, Aronica E, Busceti CL, Ciarmiello A, Alberti S, Amico E, Sassone J, Sipione S, Bruno V, Frati L, Nicoletti F, Nicoletti F, Squitieri F.
In-Text Gene Mentions

…DNA constructs were exon-1-Htt-25Q-EGFP which express 25…

…CAG triplets and exon-1-Htt-72Q-EGFP which express 72…

Show Full Abstract

A defective expression or activity of neurotrophic factors, such as brain- and glial-derived neurotrophic factors, contributes to neuronal damage in Huntington's disease (HD). Here, we focused on transforming growth factor-β (TGF-β(1) ), a pleiotropic cytokine with an established role in mechanisms of neuroprotection. Asymptomatic HD patients showed a reduction in TGF-β(1) levels in the peripheral blood, which was related to trinucleotide mutation length and glucose hypometabolism in the caudate nucleus. Immunohistochemical analysis in post-mortem brain tissues showed that TGF-β(1) was reduced in cortical neurons of asymptomatic and symptomatic HD patients. Both YAC128 and R6/2 HD mutant mice showed a reduced expression of TGF-β(1) in the cerebral cortex, localized in neurons, but not in astrocytes. We examined the pharmacological regulation of TGF-β(1) formation in asymptomatic R6/2 mice, where blood TGF-β(1) levels were also reduced. In these R6/2 mice, both the mGlu2/3 metabotropic glutamate receptor agonist, LY379268, and riluzole failed to increase TGF-β(1) formation in the cerebral cortex and corpus striatum, suggesting that a defect in the regulation of TGF-β(1) production is associated with HD. Accordingly, reduced TGF-β(1) mRNA and protein levels were found in cultured astrocytes transfected with mutated exon 1 of the human huntingtin gene, and in striatal knock-in cell lines expressing full-length huntingtin with an expanded glutamine repeat. Taken together, our data suggest that serum TGF-β(1) levels are potential biomarkers of HD development during the asymptomatic phase of the disease, and raise the possibility that strategies aimed at rescuing TGF-β(1) levels in the brain may influence the progression of HD.

Also flagged:connective tissue disorderschitosanosteogenesisFHL2ITGA5Fgf18
Journal Article 2011-03-01 No Snippets Charbord P, Livne E, Gross G, Häupl T, Neves NM, Marie P, Bianco P, Jorgensen C.
Show Full Abstract

Genostem (acronym for "Adult mesenchymal stem cells engineering for connective tissue disorders. From the bench to the bed side") has been an European consortium of 30 teams working together on human bone marrow Mesenchymal Stem Cell (MSC) biological properties and repair capacity. Part of Genostem activity has been dedicated to the study of basic issues on undifferentiated MSCs properties and on signalling pathways leading to the differentiation into 3 of the connective tissue lineages, osteoblastic, chondrocytic and tenocytic. We have evidenced that native bone marrow MSCs and stromal cells, forming the niche of hematopoietic stem cells, were the same cellular entity located abluminally from marrow sinus endothelial cells. We have also shown that culture-amplified, clonogenic and highly-proliferative MSCs were bona fide stem cells, sharing with other stem cell types the major attributes of self-renewal and of multipotential priming to the lineages to which they can differentiate (osteoblasts, chondrocytes, adipocytes and vascular smooth muscle cells/pericytes). Extensive transcription profiling and in vitro and in vivo assays were applied to identify genes involved in differentiation. Thus we have described novel factors implicated in osteogenesis (FHL2, ITGA5, Fgf18), chondrogenesis (FOXO1A) and tenogenesis (Smad8). Another part of Genostem activity has been devoted to studies of the repair capacity of MSCs in animal models, a prerequisite for future clinical trials. We have developed novel scaffolds (chitosan, pharmacologically active microcarriers) useful for the repair of both bone and cartilage. Finally and most importantly, we have shown that locally implanted MSCs effectively repair bone, cartilage and tendon.

Also flagged:Nasopharyngeal carcinomahead and neck carcinomastumorpathogenesismethylationtumors
Journal Article 2011-03-01 ✓ 4 Snippets Loyo M, Brait M, Kim MS, Ostrow KL, Jie CC, Chuang AY, Califano JA, Liégeois NJ, Begum S, Westra WH, Hoque MO, Tao Q, Sidransky D.
In-Text Gene Mentions

The methylation status of AIM1, APC, CALCA, deleted in colorectal carcinomas (DCC), DLEC, deleted in liver cancer 1 (DLC1), estrogen receptor alpha (ESR), FHIT, KIF1A and PGP9.5 was significantly associated with NPC compared to controls.

…Ectopic expression ofDCCand DLC1 lead…

…AIM1, APC, CALCA,DCC, DLEC, DLC1, ESR,…

DCC

Show Full Abstract

Nasopharyngeal carcinoma (NPC) is a rare malignancy with unique genetic, viral and environmental characteristic that distinguishes it from other head and neck carcinomas. The clinical management of NPC remains challenging largely due to the lack of early detection strategies for this tumor. In our study, we have sought to identify novel genes involved in the pathogenesis of NPC that might provide insight into this tumor's biology and could potentially be used as biomarkers. To identify these genes, we studied the epigenetics of NPC by characterizing a panel of methylation markers. Eighteen genes were evaluated by quantitative methylation-specific polymerase chain reaction (PCR) in cell lines as well as in tissue samples including 50 NPC tumors and 28 benign nasopharyngeal biopsies. Significance was evaluated using Fisher's exact test and quantitative values were optimized using cut off values derived from receiver-operator characteristic curves. The methylation status of AIM1, APC, CALCA, deleted in colorectal carcinomas (DCC), DLEC, deleted in liver cancer 1 (DLC1), estrogen receptor alpha (ESR), FHIT, KIF1A and PGP9.5 was significantly associated with NPC compared to controls. The sensitivity of the individual genes ranged from 26 to 66% and the specificity was above 92% for all genes except FHIT. The combination of PGP9.5, KIF1A and DLEC had a sensitivity of 84% and a specificity of 92%. Ectopic expression of DCC and DLC1 lead to decrease in colony formation and invasion properties. Our results indicate that methylation of novel biomarkers in NPC could be used to enhance early detection approaches. Additionally, our functional studies reveal previously unknown tumor suppressor roles in NPC.

Also flagged:serotonin-transportermild cognitive impairmentneuropsychiatric diseasesretrograde amnesiaApolipoprotein Edepression
Journal Article 2011-03-01 ✓ 3 Snippets Marini S, Bagnoli S, Bessi V, Tedde A, Bracco L, Sorbi S, Nacmias B.
In-Text Gene Mentions

…ion of serotonin-transporter (5-HTT) gene polymorphism in…

…role of the5-HTTS/L polymorphism and…

…distributions of the5-HTTgenetic variant and…

Show Full Abstract

Serotonin-transporter-linked polymorphism (5-HTTLPR) is involved in neuropsychiatric diseases and recently the S-isoform has been correlated with a higher risk of developing emotion-induced retrograde amnesia. In order to better clarify the possible role of the 5-HTT S/L polymorphism and its effects on cognitive ability, especially on memory skills, we report here the distributions of the 5-HTT genetic variant and the Apolipoprotein E (ApoE) ɛ-4 allele and their association with neuropsychological measures in older adults reporting problems with everyday memory. Moreover, we verified the presence of a possible association between the S-allele with depression and the personal trait of neuroticism. Our results indicate an association between the 5-HTTLPR S-allele and the risk of developing MCI. No association was found in the other three groups. We found a positive dose-dependent association between the S-allele and the Rey-Osterrieth complex figure test (recall) score. Finally, our data did not find an association between the same allele and depression or neuroticism. This data, in our opinion shows a slight, non-established influence of 5-HTTLPR on memory skills exhibited in challenging memory tests but no influence on other extra-mnesic cognitive abilities.

Also flagged:Ironmatrix metalloproteinase-1Oestrogen deficiencyageingmenopauseoestrogen
Journal Article 2011-03-01 ✓ 1 Snippet Jian J, Pelle E, Yang Q, Pernodet N, Maes D, Huang X.
In-Text Gene Mentions

HFE

Show Full Abstract

Oestrogen deficiency is regarded as the main causative factor in postmenopausal skin ageing and photoageing. While women after menopause experience low levels of oestrogen because of cease of ovarian function, they are also exposed to high levels of iron as a result of cessation of menstruation. In this study, we investigated whether this increase in iron presents a risk to the postmenopausal skin. Because of the lack of appropriate animal models to closely mimic the low oestrogen and high iron conditions, we tested the hypothesis in a high iron and low oestrogen culture model. Here, we showed that primary human dermal fibroblasts exposed to iron did not affect the baseline levels of matrix metalloproteinase-1 (MMP-1) activity. However, the iron-exposed fibroblasts were sensitized to UVA exposure, which resulted in a synergistic increase in MMP-1. UVA activated the three members of MAPK family: ERKs, p38, and JNKs. Additional activation of ERKs by iron contributed to the synergistic increases. Primary normal human epidermal keratinocytes (NHEK) did not respond to iron or UVA exposure as measured by MMP-1, but produced tumor necrosis factor-alpha (TNF-α) in the media, which then stimulated MMP-1 in fibroblasts. Our results indicate that iron and UVA increase MMP-1 activity in dermal fibroblasts not only directly through ERK activation but also by an indirect paracrine loop through TNF-α released by NHEK. We conclude that in addition to oestrogen deficiency, increased iron as a result of menopause could be a novel risk factor by sensitizing postmenopausal skin to solar irradiation.

Also flagged:metalsmanganese3-methylbenzoateexotoxin Atype III secretion systemsmono- and di-oxygenases
Journal Article 2011-03-01 ✓ 1 Snippet Wu X, Monchy S, Taghavi S, Zhu W, Ramos J, van der Lelie D.
In-Text Gene Mentions

The genome of W619 contains two mph operons for the degradation of 3-hydroxyphenylpropionate (Ferrandez et al., 1997): one complete mhpRABCDFET operon encoding enzymes for the conversion from 3-HTT to acetyl coenzyme A (CoA) and another incomplete cluster consisting of mhpEFD. The mhpEFD genes encode three enzymes that are conserved with part of the cym/cmt pathway: a 4-hydroxy-2-oxovalerate aldolase, an acetaldehyde dehydrogenase and a 2-hydroxypenta-2,4-dienoate hydratase (Table 4), which are respectively able to catalyze the conversion of 2-keto-4-pentenoate to 4-hydroxy-2-ketovalerate, to pyruvate and acetaldehyde and finally to acetyl CoA.

Show Full Abstract

Pseudomonas putida is a gram-negative rod-shaped gammaproteobacterium that is found throughout various environments. Members of the species P. putida show a diverse spectrum of metabolic activities, which is indicative of their adaptation to various niches, which includes the ability to live in soils and sediments contaminated with high concentrations of heavy metals and organic contaminants. Pseudomonas putida strains are also found as plant growth-promoting rhizospheric and endophytic bacteria. The genome sequences of several P. putida species have become available and provide a unique tool to study the specific niche adaptation of the various P. putida strains. In this review, we compare the genomes of four P. putida strains: the rhizospheric strain KT2440, the endophytic strain W619, the aromatic hydrocarbon-degrading strain F1 and the manganese-oxidizing strain GB-1. Comparative genomics provided a powerful tool to gain new insights into the adaptation of P. putida to specific lifestyles and environmental niches, and clearly demonstrated that horizontal gene transfer played a key role in this adaptation process, as many of the niche-specific functions were found to be encoded on clearly defined genomic islands.

Also flagged:cytoskeletonAxonfilamentousF)-actinmicrotubulesneuronal growth cone
Journal Article 2011-03-01 No Snippets Dent EW, Gupton SL, Gertler FB.
Show Full Abstract

Axon outgrowth and guidance to the proper target requires the coordination of filamentous (F)-actin and microtubules (MTs), the dynamic cytoskeletal polymers that promote shape change and locomotion. Over the past two decades, our knowledge of the many guidance cues, receptors, and downstream signaling cascades involved in neuronal outgrowth and guidance has increased dramatically. Less is known, however, about how those cascades of information converge and direct appropriate remodeling and interaction of cytoskeletal polymers, the ultimate effectors of movement and guidance. During development, much of the communication that occurs between environmental guidance cues and the cytoskeleton takes place at the growing tip of the axon, the neuronal growth cone. Several articles on this topic focus on the "input" to the growth cone, the myriad of receptor types, and their corresponding cognate ligands. Others investigate the signaling cascades initiated by receptors and propagated by second messenger pathways (i.e., kinases, phosphatases, GTPases). Ultimately, this plethora of information converges on proteins that associate directly with the actin and microtubule cytoskeletons. The role of these cytoskeletal-associated proteins, as well as the cytoskeleton itself in axon outgrowth and guidance, is the subject of this article.

Also flagged:response to drugsenzymesdrug transport proteinsmetabolismtransportersCYP2D6
Journal Article 2011-03-01 ✓ 1 Snippet Porcelli S, Drago A, Fabbri C, Gibiino S, Calati R, Serretti A.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Personalized medicine - the adaptation of therapies based on an individual's genetic and molecular profile - is one of the most promising aspects of modern medicine. The identification of the relation between genotype and drug response, including both the therapeutic effect and side effect profile, is expected to deeply affect medical practice. In this paper, we review the current knowledge about the genes related to antidepressant treatment response and provide methodologic proposals for future studies. We have mainly focused on genes associated with pharmacodynamics, for which a list of promising genes has been identified despite some inconsistency across studies. We have also synthesized the main results for pharmacokinetic genes, although so far they seem less relevant than those for pharmaco dynamic genes. We discuss possible reasons for these inconsistent findings and propose new study designs.

Non-clustered protocadherin.

Also flagged:cadherincadherinsprotocadherinsPCDH20PCDH19PCDH16
Journal Article 2011-03-01 ✓ 1 Snippet Kim SY, Yasuda S, Tanaka H, Yamagata K, Kim H.
In-Text Gene Mentions

PCDH17

Show Full Abstract

The cadherin family is classified into classical cadherins, desmosomal cadherins and protocadherins (PCDHs). Genomic structures distinguish between PCDHs and other cadherins, and between clustered and non-clustered PCDHs. The phylogenetic analysis with full sequences of non-clustered PCDHs enabled them to be further classified into three subgroups: δ1 (PCDH1, PCDH7, PCDH9, PCDH11 and PCDH20), δ2 (PCDH8, PCDH10, PCDH12, PCDH17, PCDH18 and PCDH19) and ε (PCDH15, PCDH16, PCDH21 and MUCDHL). ε-PCDH members except PCDH21 have either higher or lower numbers of cadherin repeats than those of other PCDHs. Non-clustered PCDHs are expressed predominantly in the nervous system and have spatiotemporally diverse expression patterns. Especially, the region-specific expressions of non-clustered PCDHs have been observed in cortical area of early postnatal stage and in caudate putaman and/or hippocampal formation of mature brains, suggesting that non-clustered PCDHs play roles in the circuit formation and maintenance. The non-clustered PCDHs appear to have homophilic/heterophilc cell-cell adhesion properties, and each member has diverse cell signaling partnership distinct from those of other members (PCDH7/TAF1; PCDH8/TAO2β; PCDH10/Nap1; PCDH11/β-catenin; PCDH18/mDab1). Furthermore, each PCDH has several isoforms with differential cytoplasmic sequences, suggesting that one PCDH isoform could activate intracellular signaling differential from other isoforms. These facts suggest that non-clustered PCDHs play roles as a mediator of a regulator of other molecules as well as cell-cell adhesion. Furthermore, some non-clustered PCDHs have been considered to be involved in neuronal diseases such as autism-spectrum disorders, schizophrenia, and female-limited epilepsy and cognitive impairment, suggesting that they play multiple, tightly regulated roles in normal brain function. In addition, some non-clustered PCDHs have been suggested as candidate tumor suppressor genes in several tissues. Although molecular adhesive and regulatory properties of some PCDHs began to be unveiled, the endeavor to understand the molecular mechanism of non-clustered PCDH is still in its infancy and requires future study.

Also flagged:venous thrombosispulmonary embolismCYP4V2KLKB1GP6RGS7
Journal Article 2011-03-01 ✓ 4 Snippets Austin H, De Staercke C, Lally C, Bezemer ID, Rosendaal FR, Hooper WC.
In-Text Gene Mentions

A meta-analysis of five case-control studies indicates that rs2227589 in the SERPINC1 gene, rs13146272 in the CYP4V2 gene and rs1613662 in the GP6 gene are risk factors for venous thrombosis among Whites.

…rs2227589 in theSERPINC1gene and for…

…rs2227589 in theSERPINC1gene, rs13146272 in…

SERPINC1

Show Full Abstract

<h4>Background</h4>We evaluated 10 single-nucleotide polymorphisms (SNPs) identified in three European case-control studies as risk factors for venous thrombosis.<h4>Objectives</h4>We sought to replicate the positive findings from this report among Whites and to evaluate the association of these SNPs with venous thrombosis for the first time among Blacks.<h4>Patient/methods</h4>These SNPs were evaluated in a case-control study of deep vein thrombosis and pulmonary embolism that included 1076 cases and 1239 controls. About 50% of subjects were African Americans. We measured plasma factor (F) XI on a subset of subjects.<h4>Results</h4>Among Whites, positive findings for rs13146272 in the CYP4V2 gene, for rs3087505 in the KLKB1 gene and for rs3756008 and rs2036914 in the F11 gene were found. We did not find significant associations for rs2227589 in the SERPINC1 gene and for rs1613662 in the GP6 gene. Among Blacks, rs2036914 in F11 and rs670659 in RGS7 were related to venous thrombosis, but the study had limited statistical power for many SNPs. Among Blacks, plasma FXI was related to two SNPs and the OR relating to the 90th percentile of the control distribution of plasma FXI was 2.6 (95% CI, 1.4, 5.0).<h4>Conclusions</h4>Our study supports the finding that genetic variants in the F11 gene are risk factors for venous thrombosis among both Whites and Blacks, although the findings in Blacks require confirmation. A meta-analysis of five case-control studies indicates that rs2227589 in the SERPINC1 gene, rs13146272 in the CYP4V2 gene and rs1613662 in the GP6 gene are risk factors for venous thrombosis among Whites.

Also flagged:AutophagyNrf2p62nuclear factor E2-related factor 2kelch-like ECH-associated proteingreen fluorescent protein
Journal Article 2011-03-01 No Snippets Riley BE, Kaiser SE, Kopito RR.
Show Full Abstract

No abstract available.

Also flagged:primary ciliary dyskinesiaTitaniumnucleotidesitus inversusneonatal respiratory distressrecurrent otitis media
Journal Article 2011-03-01 ✓ 1 Snippet Berg JS, Evans JP, Leigh MW, Omran H, Bizon C, Mane K, Knowles MR, Weck KE, Zariwala MA.
In-Text Gene Mentions

DNAH10

Show Full Abstract

<h4>Purpose</h4>Advances in genetic sequencing technology have the potential to enhance testing for genes associated with genetically heterogeneous clinical syndromes, such as primary ciliary dyskinesia. The objective of this study was to investigate the performance characteristics of exon-capture technology coupled with massively parallel sequencing for clinical diagnostic evaluation.<h4>Methods</h4>We performed a pilot study of four individuals with a variety of previously identified primary ciliary dyskinesia mutations. We designed a custom array (NimbleGen) to capture 2089 exons from 79 genes associated with primary ciliary dyskinesia or ciliary function and sequenced the enriched material using the GS FLX Titanium (Roche 454) platform. Bioinformatics analysis was performed in a blinded fashion in an attempt to detect the previously identified mutations and validate the process.<h4>Results</h4>Three of three substitution mutations and one of three small insertion/deletion mutations were readily identified using this methodology. One small insertion mutation was clearly observed after adjusting the bioinformatics handling of previously described SNPs. This process failed to detect two known mutations: one single-nucleotide insertion and a whole-exon deletion. Additional retrospective bioinformatics analysis revealed strong sequence-based evidence for the insertion but failed to detect the whole-exon deletion. Numerous other variants were also detected, which may represent potential genetic modifiers of the primary ciliary dyskinesia phenotype.<h4>Conclusions</h4>We conclude that massively parallel sequencing has considerable potential for both research and clinical diagnostics, but further development is required before widespread adoption in a clinical setting.

Also flagged:Nonalcoholic fatty liver diseaseNAFLDhepatic steatosisdiabetessteatosisaminotransferases
Journal Article 2011-03-01 ✓ 1 Snippet Tabibian JH, Lazo M, Durazo FA, Yeh HC, Tong MJ, Clark JM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background and aim</h4>Nonalcoholic fatty liver disease (NAFLD) is increasingly common worldwide. We explored clinical, laboratory, and histological features of NAFLD as well as risk factors for histologically advanced disease among under-represented ethno-racial groups.<h4>Methods</h4>Patient records from one NAFLD clinic in California from 1998-2008 were reviewed. Biopsies were graded using Brunt criteria by a hepatopathologist blinded to clinical data. We used multivariate logistic regression to assess associations between ethno-racial group and histological severity of NAFLD, while controlling for other factors.<h4>Results</h4>We identified 90 biopsy-proven cases of NAFLD. Mean age was 49 years (standard deviation [SD]= 11.6), and half were female. 52% of patients were Caucasian, 20% Latino-American, 18% Asian-American, and 10% Middle Eastern-American. There were significant differences among groups with respect to age, weight, body mass index (BMI), and grade of hepatic steatosis (all P < 0.05). In multivariate analysis, older age was associated with severe (Brunt ≥ 2) inflammation (odds ratio [OR] 1.1, P = 0.002) and severe (Brunt ≥ 3) fibrosis (OR 1.2, P = 0.001), diabetes was associated with severe inflammation (OR 3.18, P = 0.07) and severe fibrosis (OR 8.81, P = 0.002), and increased BMI was associated with severe fibrosis (OR 2.43, P = 0.07). Additionally, compared to Caucasians, Asian-Americans showed a trend toward an association with severe (Brunt > 2) steatosis (OR 3.83, P = 0.08) and severe inflammation (OR 5.42, P = 0.06).<h4>Conclusions</h4>The findings from this ethno-racially diverse clinic-based cohort are consistent with prior studies and also suggest that Asian-Americans may be at risk for advanced NAFLD. This may have implications for the prevention, evaluation, and treatment of patients with NAFLD that merit further study.

The role of genetics in IBS.

Also flagged:IBSpsychiatric disordersIrritable Bowel Syndromechronic disorderinfectionanxiety
Journal Article 2011-03-01 No Snippets Saito YA.
Show Full Abstract

Irritable bowel syndrome (IBS) is a common disorder that has been shown to aggregate in families and to affect multiple generations, but not in a manner consistent with a major Mendelian effect. Relatives of an individual with IBS are 2 to 3 times as likely to have IBS, with both genders being affected. To date, more than 100 genetic variants in more than 60 genes from various pathways have been studied in a number of candidate gene studies, with several positive associations reported. These findings suggest that there may be distinct, as well as shared, molecular underpinnings for IBS and its subtypes.

Also flagged:gene expressioncancerneurodegenerative diseaseshereditary neurological disorderstrinucleotide repeat expansion diseasesspinocerebellar ataxias
Journal Article 2011-03-01 ✓ 1 Snippet Witkos TM, Koscianska E, Krzyzosiak WJ.
In-Text Gene Mentions

Several studies [92-94] proved that mutant huntingtin, a product of the HTT gene, is incapable of associating with Repressor element 1-silencing transcription factor (REST) which leads to repression of neural miRNAs and their lower levels in the brains of HD patients.

Show Full Abstract

microRNAs (miRNAs) are endogenous non-coding RNAs that control gene expression at the posttranscriptional level. These small regulatory molecules play a key role in the majority of biological processes and their expression is also tightly regulated. Both the deregulation of genes controlled by miRNAs and the altered miRNA expression have been linked to many disorders, including cancer, cardiovascular, metabolic and neurodegenerative diseases. Therefore, it is of particular interest to reliably predict potential miRNA targets which might be involved in these diseases. However, interactions between miRNAs and their targets are complex and very often there are numerous putative miRNA recognition sites in mRNAs. Many miRNA targets have been computationally predicted but only a limited number of these were experimentally validated. Although a variety of miRNA target prediction algorithms are available, results of their application are often inconsistent. Hence, finding a functional miRNA target is still a challenging task. In this review, currently available and frequently used computational tools for miRNA target prediction, i.e., PicTar, TargetScan, DIANA-microT, miRanda, rna22 and PITA are outlined and various practical aspects of miRNA target analysis are extensively discussed. Moreover, the performance of three algorithms (PicTar, TargetScan and DIANA-microT) is both demonstrated and evaluated by performing an in-depth analysis of miRNA interactions with mRNAs derived from genes triggering hereditary neurological disorders known as trinucleotide repeat expansion diseases (TREDs), such as Huntington's disease (HD), a number of spinocerebellar ataxias (SCAs), and myotonic dystrophy type 1 (DM1).

Also flagged:ironmetabolismtransporterbindingcell-surfacetransferrin receptor 1
Journal Article 2011-03-01 No Snippets Wang J, Pantopoulos K.
Show Full Abstract

Iron is an essential but potentially hazardous biometal. Mammalian cells require sufficient amounts of iron to satisfy metabolic needs or to accomplish specialized functions. Iron is delivered to tissues by circulating transferrin, a transporter that captures iron released into the plasma mainly from intestinal enterocytes or reticuloendothelial macrophages. The binding of iron-laden transferrin to the cell-surface transferrin receptor 1 results in endocytosis and uptake of the metal cargo. Internalized iron is transported to mitochondria for the synthesis of haem or iron-sulfur clusters, which are integral parts of several metalloproteins, and excess iron is stored and detoxified in cytosolic ferritin. Iron metabolism is controlled at different levels and by diverse mechanisms. The present review summarizes basic concepts of iron transport, use and storage and focuses on the IRE (iron-responsive element)/IRP (iron-regulatory protein) system, a well known post-transcriptional regulatory circuit that not only maintains iron homoeostasis in various cell types, but also contributes to systemic iron balance.

Also flagged:malignant pleural mesotheliomapleural diseasesmetastatic adenocarcinomasgene expressiontumorpleural effusions
Journal Article 2011-03-01 ✓ 1 Snippet Gueugnon F, Leclercq S, Blanquart C, Sagan C, Cellerin L, Padieu M, Perigaud C, Scherpereel A, Gregoire M.
In-Text Gene Mentions

PTGIS

Show Full Abstract

The diagnosis of malignant pleural mesothelioma is difficult, with the most common differential diagnoses being benign pleural diseases and metastatic adenocarcinomas (ADCA). To identify novel markers that would be able to improve diagnostic accuracy, we performed a genome-wide gene expression analysis on tumor cell lines established from pleural effusions (malignant pleural mesothelioma and lung ADCA). This analysis led to the identification of genes encoding novel and pertinent cellular and soluble markers, for which the expression was validated by real-time RT-PCR. Immunohistochemical staining of tumor biopsy specimens with anti-type III collagen antibodies showed positive labeling for mesothelioma cells but not for ADCA cells. Using enzyme-linked immunosorbent assay, we showed that the C-C motif chemokine 2 (CCL2) concentration was significantly higher in pleural effusions from patients with mesothelioma (n = 61) than in subjects with ADCA (n = 25) or with benign pleural effusions (n = 15): median (interquartile range) = 2.99 ng/ml (1.76 to 6.01) vs 0.99 ng/ml (0.51 to 1.83) and 1.47 ng/ml (0.80 to 1.56), respectively, P < 0.0001. Conversely, the galectin-3 concentration was lower in mesothelioma: 11.50 ng/ml (6.73 to 23.53) vs 24.74 ng/ml (20.42 to 70.35) and 17.64 ng/ml (14.81 to 24.68), respectively, P < 0.0001. The areas under the curve for CCL2 were 0.8030 and 0.7716 for the differentiation of mesothelioma from ADCA or benign pleural effusions, respectively. Similarly, the areas under the curve obtained for galectin-3 were 0.7980 and 0.6923, respectively. In conclusion, type III collagen, CCL2, and galectin-3 are promising new diagnostic markers for mesothelioma.

Also flagged:bindingpolyglutamineHuntington diseaseHuntingtin interacting proteinankyrincarbohydrates
Journal Article 2011-03-01 ✓ 5 Snippets Gupta S, Misra G, Pant MC, Seth PK.
In-Text Gene Mentions

htt results in neurodegenerative Huntington disease

…polyglutamine tracts in htt results in neurodegenerative Huntington disease. Huntingtin interacting protein…

…of huntingtin protein (htt).…

…polyglutamine tracts inhttresults in neurodegenerative…

…interacting partner ofhttand the altered…

Show Full Abstract

Protein-protein interactions play an important role in regulating the expression of huntingtin protein (htt). Expansion of polyglutamine tracts in htt results in neurodegenerative Huntington disease. Huntingtin interacting protein (HIP14) is an important interacting partner of htt and the altered interactions have been proposed to play an important role in disease progression. In the present study, an attempt has been made to explore the potential of several known Huntington inhibitors to inhibit HIP14. The docking studies have resulted in the identification of a novel binding site for these inhibitors distinct from the previously known ankyrin repeat domain. The results have been validated using geometry based docking transformations against the other binding pocket. The specificity of binding has been determined with high values of both accuracy and precision. Nine potential inhibitors obtained after screening belong to three distinct classes of compounds viz, carbohydrates (deoxy-glucose), alcohols (including phenolic scaffold) and tetracycline. The compounds form stable complex with protein exhibiting optimal intermolecular and Gibbs free energy. The hydrogen bonding and hydrophobic interactions predominantly contribute to the stability of these complexes. The present study identifies metoprolol, minocyclines and 18 F fluorodeoxyglucose as the best inhibitors that bind specifically to the new site. Therefore, these compounds can further be exploited for their potential to serve in the diagnosis and treatment of Huntington disease. The quantitative predictions provide a scope for experimental testing in future.

Also flagged:HLATH2factor V LeidenprothrombinHemophilia Afactor VIII
Journal Article 2011-03-01 ✓ 1 Snippet Lozier JN, Rosenberg PS, Goedert JJ, Menashe I.
In-Text Gene Mentions

…and two inHFE) were also…

Show Full Abstract

Several genes that modify risk of factor VIII (FVIII) inhibitors in haemophilia A patients have been identified. Aside from the underlying mutations that cause haemophilia A, inhibitor risk appears to be modified by polymorphisms in various cytokines and immunomodulators including IL10, TNFα and CTLA4. HLA haplotypes have not been strong determinants of inhibitor risk. We sought to confirm previous observations on FVIII inhibitor risk-modifying genes and to test new candidate genes encoding various otherTH1/TH2 cytokines. We also sought to determine whether normal FVIII gene polymorphisms affect inhibitor risk in caucasians. We studied 915 caucasian, severe haemophilia A patients (282 inhibitor cases and 633 non-inhibitor controls). Genes were analysed using 368 tagging single nucleotide polymorphisms starting 20 kb 5' and ending 10 kb 3' of each gene's coding sequence; four other polymorphisms (factor V Leiden & prothrombin 20210 polymorphisms and two in HFE) were also evaluated. Haplotypes that increased inhibitor risk were found in IL10 (OR = 1.33, P = 0.04), IL12 (OR = 1.31, P = 0.04) and IL1α (OR = 2.16, P = 0.034). Protective haplotypes were seen in IL2 (OR =  .69, P = 0.008) and IL1β (OR = 0.75, P = 0.02). One rare haplotype in the FVIII gene increased the risk of inhibitor development by nearly fourfold (OR = 3.8, P = 0.004). We replicate previous findings for IL10; identify new associations with IL1, IL2 and IL12; and identify a rare FVIII haplotype in caucasians that is associated with increased inhibitor risk.

Also flagged:hepatitisacquired immunodeficiency syndromealcoholautoimmune diseasesaminotransferaseimmunodeficiency
Journal Article 2011-03-01 ✓ 1 Snippet Esposito A, Conti V, Cagliuso M, Pastori D, Fantauzzi A, Mezzaroma I.
In-Text Gene Mentions

…genetic test forhemochromatosisand the research…

Show Full Abstract

In HIV-1 infected patients, increase of liver enzymes may be mainly due to viral coinfections, alcohol intake, hepatotoxic drugs or autoimmune diseases. Three cases of aminotransferase elevation occurred during a phase of uncontrolled viral replication combined with a severe immunodeficiency and resolved by an effective HAART are described, focusing on the etio-pathogenetic role possibly played by HIV-1 infection.

Also flagged:MLLdosage compensationX chromosomesX-chromosomebindingDC complex
Journal Article 2011-03-01 ✓ 5 Snippets Pferdehirt RR, Kruesi WS, Meyer BJ.
In-Text Gene Mentions

DCC binding in which low-level DCC binding at dox sites is dictated by intrinsic

…the DC complex (DCC), a condensin complex,…

…to target theDCCto both X…

…TheDCCbinds to two…

…that recruit theDCCin an autonomous,…

Show Full Abstract

Here we analyze the essential process of X-chromosome dosage compensation (DC) to elucidate mechanisms that control the assembly, genome-wide binding, and function of gene regulatory complexes that act over large chromosomal territories. We demonstrate that a subunit of Caenorhabditis elegans MLL/COMPASS, a gene activation complex, acts within the DC complex (DCC), a condensin complex, to target the DCC to both X chromosomes of hermaphrodites for chromosome-wide reduction of gene expression. The DCC binds to two categories of sites on X: rex (recruitment element on X) sites that recruit the DCC in an autonomous, sequence-dependent manner, and dox (dependent on X) sites that reside primarily in promoters of expressed genes and bind the DCC robustly only when attached to X. We find that DC mutations that abolish rex site binding greatly reduce dox site binding but do not eliminate it. Instead, binding is diminished to the low level observed at autosomal sites in wild-type animals. Changes in DCC binding to these non-rex sites occur throughout development and correlate directly with transcriptional activity of adjacent genes. Moreover, autosomal DCC binding is enhanced by rex site binding in cis in X-autosome fusion chromosomes. Thus, dox and autosomal sites have similar binding potential but are distinguished by linkage to rex sites. We propose a model for DCC binding in which low-level DCC binding at dox sites is dictated by intrinsic properties correlated with high transcriptional activity. Sex-specific DCC recruitment to rex sites then enhances the magnitude of DCC binding to dox sites in cis, which lack high affinity for the DCC on their own. We also show that the DCC balances X-chromosome gene expression between sexes by controlling transcription.

Also flagged:meningiomatumoursmalignantbrain tumoursTinea Capitiscancers
Journal Article 2011-03-01 No Snippets Hosking FJ, Feldman D, Bruchim R, Olver B, Lloyd A, Vijayakrishnan J, Flint-Richter P, Broderick P, Houlston RS, Sadetzki S.
Show Full Abstract

<h4>Background</h4>Exposure to ionising radiation is a well-established risk factor for multiple types of tumours, including malignant brain tumours. In the 1950s, radiotherapy was used to treat Tinea Capitis (TC) in thousands of children, mostly of North-African and Middle Eastern origin, during the mass migration to Israel. The over-representation of radiation-associated meningioma (RAM) and other cancers in specific families provide support for inherited genetic susceptibility to radiation-induced cancer.<h4>Methods</h4>To test this hypothesis, we genotyped 15 families segregating RAM using high-density single-nucleotide polymorphism (SNP) arrays. Using the family-based association test (FBAT) programme, we tested each polymorphism and haplotype for an association with RAM.<h4>Results</h4>The strongest haplotype associations were attained at 18q21.1 (P=7.5 × 10(-5)), 18q21.31 (P=2.8 × 10(-5)) and 10q21.3 (P=1.6 × 10(-4)). Although associations were not formally statistically significant after adjustment for multiple testing, the 18q21.1 and 10q21.3 associations provide support for a variation in PIAS2, KATNAL2, TCEB3C, TCEB3CL and CTNNA3 genes as risk factors for RAM.<h4>Conclusion</h4>These findings suggest that any underlying genetic susceptibility to RAM is likely to be mediated through the co-inheritance of multiple risk alleles rather than a single major gene locus determining radiosensitivity.

Also flagged:Dicerdifferentiationinsulin
Journal Article 2011-03-01 No Snippets Tattikota SG, Poy MN.
Show Full Abstract

No abstract available.

Also flagged:neurogenesistranscription factorsFoxg1RNA-binding proteinElavl2Nr2e1
Journal Article 2011-03-01 ✓ 1 Snippet Shibata M, Nakao H, Kiyonari H, Abe T, Aizawa S.
In-Text Gene Mentions

Htt

Show Full Abstract

microRNA-9-2 and microRNA-9-3 double-mutant mice demonstrate that microRNA-9 (miR-9) controls neural progenitor proliferation and differentiation in the developing telencephalon by regulating the expression of multiple transcription factors. As suggested by our previous study, the Foxg1 expression was elevated, and the production of Cajal-Retzius cells and early-born neurons was suppressed in the miR-9-2/3 double-mutant pallium. At embryonic day 16.5 (E16.5), however, the Foxg1 expression was no longer elevated. The expression of an AU-rich RNA-binding protein Elavl2 increased at E16.5, Elav2 associated with Foxg1 3' untranslated region (UTR), and it countered the Foxg1 suppression by miR-9. Later, progenitor proliferation was reduced in the miR-9-2/3 double-mutant pallium with the decrease in Nr2e1 and Pax6 expression and the increase in Meis2 expression. The analyses suggest that microRNA-9 indirectly inhibits Pax6 expression by suppressing Meis2 expression. In contrast, together with Elavl1 and Msi1, microRNA-9 targets Nr2e1 mRNA 3' UTR to enhance the expression. Concomitantly, cortical layers were reduced, each cortical projection was malformed, and the tangential migration of interneurons into the pallium was impaired in the miR-9-2/3 double mutants. miR-9 also targets Gsh2 3' UTR, and Gsh2, as well as Foxg1, expression was elevated in the miR-9-2/3 double-mutant subpallium. The subpallium progenitor proliferation was enhanced, and the development of basal ganglia including striatum and globus pallidus was suppressed. Pallial/subpallial boundary shifted dorsally, and the ventral pallium was lost. Corridor was malformed, and thalamocortical and corticofugal axons were misrouted in the miR-9-2/3 double mutants.

Also flagged:cardiac voltage-dependent L-type calcium channelL-type cardiac calcium channelcardiac arrhythmia syndromesEarly Repolarization syndromesinherited disordersTransmembrane
Journal Article 2011-03-01 No Snippets Napolitano C, Antzelevitch C, Antzelevitch C.
Show Full Abstract

The L-type cardiac calcium channel (LTCC) plays a prominent role in the electric and mechanical function of the heart. Mutations in the LTCC have been associated with a number of inherited cardiac arrhythmia syndromes, including Timothy, Brugada, and early repolarization syndromes. Elucidation of the genetic defects associated with these syndromes has led to a better understanding of molecular and cellular mechanisms and the development of novel therapeutic approaches to dealing with the arrhythmic manifestations. This review provides an overview of the molecular structure and function of the LTCC, the genetic defects in these channels known to contribute to inherited disorders, and the underlying molecular and cellular mechanisms contributing to the development of life-threatening arrhythmias.

Also flagged:agingNeurodegenerative disordersAlzheimer's diseaseischemic strokeneurotrophic factorsbrain-derived neurotrophic factor
Journal Article 2011-03-01 ✓ 2 Snippets Hutchison E, Mattson MP.
In-Text Gene Mentions

…onally, huntingtin (Htt) is a predicted tar…

…ergy restriction in Htt mutant mice, a mode…

Show Full Abstract

No abstract available.

Also flagged:brain tumorglioblastoma multiformeGBMantibodiestumorsglioma
Journal Article 2011-03-01 No Snippets Chow KH, Gottschalk S.
Show Full Abstract

The outcome for patients with the most common primary brain tumor, glioblastoma multiforme (GBM), remains poor. Several immunotherapeutic approaches are actively being pursued including antibodies and cell-based therapies. While the blood-brain barrier protects brain tumor cells from therapeutic antibodies, immune cells have the ability to traverse the blood-brain barrier and migrate into GBM tumors to exert their therapeutic function. Results of Phase I clinical studies with vaccines to induce GBM-specific T cells are encouraging and Phase II clinical trials are in progress. Nonvaccine-based cell therapy for GBM has been actively explored over the last four decades. Here we will review past clinical experience with adoptive cell therapies for GBM and summarize current strategies on how to improve these approaches.

Also flagged:pathogenesisglioblastomastumorastrocytomasglioblastomaPI3K
Journal Article 2011-03-01 ✓ 1 Snippet Chow LM, Endersby R, Zhu X, Rankin S, Qu C, Zhang J, Broniscer A, Ellison DW, Baker SJ.
In-Text Gene Mentions

Dcc

Show Full Abstract

Mutations in the PTEN, TP53, and RB1 pathways are obligate events in the pathogenesis of human glioblastomas. We induced various combinations of deletions in these tumor suppressors in astrocytes and neural precursors in mature mice, resulting in astrocytomas ranging from grade III to grade IV (glioblastoma). There was selection for mutation of multiple genes within a pathway, shown by somatic amplifications of genes in the PI3K or Rb pathway in tumors in which Pten or Rb deletion was an initiating event. Despite multiple mutations within PI3K and Rb pathways, elevated Mapk activation was not consistent. Gene expression profiling revealed striking similarities to subclasses of human diffuse astrocytoma. Astrocytomas were found within and outside of proliferative niches in the adult brain.

Also flagged:coronary heart diseaseatherosclerosis
Journal Article 2011-03-01 ✓ 5 Snippets Chen MZ, Cheng GH, Ma L, Wang H, Qiu RF, Xue FZ, Liu QJ.
In-Text Gene Mentions

In order to explore the relationship between this gene and coronary heart disease (CHD) in Chinese Han population, we collected 498 cases and 509 controls from Qilu hospital of Shandong University and analyzed the association between five single-nucleotide polymorphisms (SNPs) (rs1234314, rs45454293, rs3850641, rs1234313, and rs3861950) of TNFSF4 and CHD.

[Association study between TNFSF4 and coronary heart disease].

Previous studies suggest that TNFSF4 is a susceptibility gene of atherosclerosis.

These results indicate that TNFSF4 is a susceptibility gene of CHD in Chinese Han population.

…[Association study betweenTNFSF4and coronary heart…

Show Full Abstract

Previous studies suggest that TNFSF4 is a susceptibility gene of atherosclerosis. But case-control association analysis in Swedish population and German population provided inconsistent, even opposite results. In order to explore the relationship between this gene and coronary heart disease (CHD) in Chinese Han population, we collected 498 cases and 509 controls from Qilu hospital of Shandong University and analyzed the association between five single-nucleotide polymorphisms (SNPs) (rs1234314, rs45454293, rs3850641, rs1234313, and rs3861950) of TNFSF4 and CHD. On the basis of using traditional statistical analysis methods based on single SNP and haplotypes, we introduced principal component score-based logistic regression analysis to deal with the data. The results suggested that in Armitage trend test, only rs3861950 was significant, when used the Bonferroni correction, and all of the five SNPs were not statistically significant. In the logistic regression analysis which adjusts the confounding factors, all of the five SNPs were not statistically significant. In haplotype analysis, the frequencies of six haplotypes were significantly different in cases and controls (CTAGT (P=0.0006), CTAAC (P=0.0123), CCAGT (P=0.0004), GTGGT (P=0.0329), GCGAC (P<0.0001), and GCAAC (P=0.0173)). In principal component score-based logistic regression analysis, the first principal component has statistical significance (P=0.0236). These results indicate that TNFSF4 is a susceptibility gene of CHD in Chinese Han population.

Also flagged:sodium-phosphate cotransporterPiT-1elastindegradationVascular calcificationcalcium
Journal Article 2011-03-01 No Snippets Lau WL, Pai A, Moe SM, Giachelli CM.
Show Full Abstract

Elevated serum phosphate has clinically been associated with vascular stiffness and cardiovascular mortality. Mechanistic studies over the past decade regarding local effects of phosphate on the vessel wall have provided insight into various pathways that culminate in vascular calcification. Smooth muscle cell phenotype change and apoptosis play prominent roles. The sodium-phosphate cotransporter PiT-1 is required for the osteochondrogenic differentiation of smooth muscle cells in vitro. Less is known about phosphate-driven valve interstitial cell calcification and elastin degradation. In this article, we review the current knowledge about phosphate-induced changes in the vascular wall.

Also flagged:cancertranslationalgene expressionNucleotideoncogenestumor suppressor genes
Journal Article 2011-03-01 No Snippets Chin L, Hahn WC, Getz G, Meyerson M.
Show Full Abstract

High-throughput tools for nucleic acid characterization now provide the means to conduct comprehensive analyses of all somatic alterations in the cancer genomes. Both large-scale and focused efforts have identified new targets of translational potential. The deluge of information that emerges from these genome-scale investigations has stimulated a parallel development of new analytical frameworks and tools. The complexity of somatic genomic alterations in cancer genomes also requires the development of robust methods for the interrogation of the function of genes identified by these genomics efforts. Here we provide an overview of the current state of cancer genomics, appraise the current portals and tools for accessing and analyzing cancer genomic data, and discuss emerging approaches to exploring the functions of somatically altered genes in cancer.

Also flagged:response to air pollutioncardiovascular diseaseAgingAtherosclerosiscardiovascular diseasesinflammatory responses
Journal Article 2011-03-01 ✓ 1 Snippet Zanobetti A, Baccarelli A, Schwartz J.
In-Text Gene Mentions

HFE

Show Full Abstract

Genetic susceptibility is likely to play a role in response to air pollution. Hence, gene-environment interaction studies can be a tool for exploring the mechanisms and the importance of the pathway in the association between air pollution and a cardiovascular outcome. In this article, we present a systematic review of the studies that have examined gene-environment interactions in relation to the cardiovascular health effects of air pollutants. We identified 16 articles meeting our search criteria. Of these studies, most have focused on individual functional polymorphisms or individual candidate genes. Moreover, they were all based on 3 study populations that have been extensively investigated in relation to air pollution effects: the Normative Aging Study, Air Pollution and Inflammatory Response in Myocardial Infarction Survivors: Gene-Environment Interaction in a High Risk Group, and Multiethnic Study of Atherosclerosis. In conclusions, the studies differed substantially in both the cardiovascular outcomes examined and the polymorphisms examined, so there is little confirmation of results across cohorts. Gene-environment interaction studies can help explore the mechanisms and the potential pathway in the association between air pollution and a cardiovascular outcome; replication of findings and studies involving multiple cohorts would be needed to draw stronger conclusions.

Also flagged:RKIPlung squamous cell carcinomaphosphatidylethanolamine binding proteinPEBPRaf-1MEK1
Journal Article 2011-03-01 No Snippets Xu H, Wang X, Shen W, Wang L, Shen G, Chen M, Zhou L.
Show Full Abstract

<h4>Background and objective</h4>Raf kinase inhibitory protein (RKIP) belongs to the phosphatidylethanolamine binding protein (PEBP) family. RKIP is an endogenous inhibitor of the Raf-1-MEK1/2-ERK1/2 signaling pathway, NFkappaB signaling pathway and G protein coupled receptors signaling pathway. The aim of this study is to explore the expression of RKIP in lung squamous cell carcinoma, and the relationship between RKIP expression and clinical pathology of lung squamous cell carcinoma.<h4>Methods</h4>The expression of RKIP mRNA was detected in 56 lung squamous cell carcinoma tissues and adjacent cancer tissues by RT-PCR. The expression level of RKIP protein was detected by Western blot. The positive rates of RKIP expression in cancer tissues and adjacent cancer tissues were analyzed.<h4>Results</h4>RKIP mRNA positive expression rate in cancer tissues was significantly lower than that in adjacent cancer tissues (P < 0.05). The positive rate of RKIP mRNA expression in the cancer tissues with lymph node metastasis was significantly lower than that without lymph node metastasis (P < 0.05). RKIP mRNA expression has no remarkable correlation with age, sex, tumor differentiation and size (P > 0.05). RKIP protein expression in the cancer tissues was significantly lower than that in adjacent cancer tissues (P < 0.05).<h4>Conclusions</h4>The deficiency of RKIP expression is positively correlated with carcinogenesis and invasion metastasis of lung squamous cell carcinoma.

Also flagged:NMDA ReceptorExcitotoxicityPhosphatasePhosphorylationHuntingtin
Journal Article 2011-03-01 No Snippets Jablonski MR, Cooper L, Jacob DA.
Show Full Abstract

No abstract available.

Also flagged:COUP-TFIvasoactive intestinal peptidecalretininparvalbuminEpilepsyPV
Journal Article 2011-03-01 ✓ 1 Snippet Lodato S, Tomassy GS, De Leonibus E, Uzcategui YG, Andolfi G, Armentano M, Touzot A, Gaztelu JM, Arlotta P, Menendez de la Prida L, Studer M.
In-Text Gene Mentions

Sox6

Show Full Abstract

In rodents, cortical interneurons originate from the medial ganglionic eminence (MGE) and caudal ganglionic eminence (CGE) according to precise temporal schedules. The mechanisms controlling the specification of CGE-derived interneurons and their role in cortical circuitry are still unknown. Here, we show that COUP-TFI expression becomes restricted to the dorsal MGE and CGE at embryonic day 13.5 in the basal telencephalon. Conditional loss of function of COUP-TFI in subventricular precursors and postmitotic cells leads to a decrease of late-born, CGE-derived, VIP (vasoactive intestinal peptide)- and CR (calretinin)-expressing bipolar cortical neurons, compensated by the concurrent increase of early-born MGE-derived, PV (parvalbumin)-expressing interneurons. Strikingly, COUP-TFI mutants are more resistant to pharmacologically induced seizures, a phenotype that is dependent on GABAergic signaling. Together, our data indicate that COUP-TFI controls the delicate balance between MGE- and CGE-derived cortical interneurons by regulating intermediate progenitor divisions and ultimately affecting the activity of the cortical inhibitory circuitry.

Also flagged:TDRD7regulation of gene expressiongene expressionorganogenesiscataractcataracts
Journal Article 2011-03-01 ✓ 1 Snippet Lachke SA, Alkuraya FS, Kneeland SC, Ohn T, Aboukhalil A, Howell GR, Saadi I, Cavallesco R, Yue Y, Tsai AC, Nair KS, Cosma MI, Smith RS, Hodges E, Alfadhli SM, Al-Hajeri A, Shamseldin HE, Behbehani A, Hannon GJ, Bulyk ML, Drack AV, Anderson PJ, John SW, Maas RL.
In-Text Gene Mentions

…that interact withSTAU1-ribonucleoproteins (RNPs).…

Show Full Abstract

The precise transcriptional regulation of gene expression is essential for vertebrate development, but the role of posttranscriptional regulatory mechanisms is less clear. Cytoplasmic RNA granules (RGs) function in the posttranscriptional control of gene expression, but the extent of RG involvement in organogenesis is unknown. We describe two human cases of pediatric cataract with loss-of-function mutations in TDRD7 and demonstrate that Tdrd7 nullizygosity in mouse causes cataracts, as well as glaucoma and an arrest in spermatogenesis. TDRD7 is a Tudor domain RNA binding protein that is expressed in lens fiber cells in distinct TDRD7-RGs that interact with STAU1-ribonucleoproteins (RNPs). TDRD7 coimmunoprecipitates with specific lens messenger RNAs (mRNAs) and is required for the posttranscriptional control of mRNAs that are critical to normal lens development and to RG function. These findings demonstrate a role for RGs in vertebrate organogenesis.

Troubleshooting adult ECMO.

Also flagged:membraneepinephrineleft ventricular failurelower limb ischemiaischemiaAcute Pulmonary Edema
Journal Article 2011-03-01 ✓ 1 Snippet Sidebotham D.
In-Text Gene Mentions

ATIII

Show Full Abstract

The following scenarios explore some of the common problems encountered during extracorporeal membrane oxygenation (ECMO) in adults. In each scenario, the circuit is comprised of a centrifugal pump and a polymethylpentene oxygenator.

Also flagged:melanomatumorsF-actintumorRho kinasegene expression
Journal Article 2011-03-01 No Snippets Spencer C, Montalvo J, McLaughlin SR, Bryan BA.
Show Full Abstract

<h4>Background</h4>Rho kinase signaling plays an important role in the oncogenic process largely through its regulation of F-actin dynamics, and inhibition of this pathway results in reduction in tumor volume and metastasis across a number of tumor types. While the cytoskeletal-regulatory role of Rho kinase has been a topic of in-depth study, the mechanisms linking Rho kinase to altered gene expression are largely unknown.<h4>Materials and methods</h4>Global gene expression analysis was performed on melanoma tumors treated with sham or the small molecule inhibitor Y27632.<h4>Results</h4>Inhibition of Rho kinase activity in melanoma tumors results in a statistically significant change in gene transcription of 94 genes, many of which are critically involved in tumor initiation and progression.<h4>Conclusion</h4>In addition to regulating tumorigenesis through modulation of the phosphoproteome, Rho kinase signaling also contributes to the regulation of the tumor transcriptome.

Also flagged:capsulegastrointestinal obstructiondiabetes mellitusironsucralfaterenal impairment
Journal Article 2011-03-01 ✓ 1 Snippet Triantafyllou K, Papanikolaou IS, Papaxoinis K, Ladas SD.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Aim</h4>To explore the feasibility of dual camera capsule (DCC) small-bowel (SB) imaging and to examine if two cameras complement each other to detect more SB lesions.<h4>Methods</h4>Forty-one eligible, consecutive patients underwent DCC SB imaging. Two experienced investigators examined the videos and compared the total number of detected lesions to the number of lesions detected by each camera separately. Examination tolerability was assessed using a questionnaire.<h4>Results</h4>One patient was excluded. DCC cameras detected 68 positive findings (POS) in 20 (50%) cases. Fifty of them were detected by the "yellow" camera, 48 by the "green" and 28 by both cameras; 44% (n = 22) of the "yellow" camera's POS were not detected by the "green" camera and 42% (n = 20) of the "green" camera's POS were not detected by the "yellow" camera. In two cases, only one camera detected significant findings. All participants had 216 findings of unknown significance (FUS). The "yellow", "green" and both cameras detected 171, 161, and 116 FUS, respectively; 32% (n = 55) of the "yellow" camera's FUS were not detected by the "green" camera and 28% (n = 45) of the "green" camera's FUS were not detected by the "yellow" camera. There were no complications related to the examination, and 97.6% of the patients would repeat the examination, if necessary.<h4>Conclusion</h4>DCC SB examination is feasible and well tolerated. The two cameras complement each other to detect more SB lesions.

Also flagged:alanine aminotransferaseγ-glutamyltransferasemetabolic syndromeNAFLDMSchronic liver disease
Journal Article 2011-03-01 ✓ 1 Snippet Oh HJ, Kim TH, Sohn YW, Kim YS, Oh YR, Cho EY, Shim SY, Shin SR, Han AL, Yoon SJ, Kim HC.
In-Text Gene Mentions

…as autoimmune hepatitis,hemochromatosis, or Wilson's disease,…

Show Full Abstract

<h4>Background/aims</h4>Nonalcoholic fatty liver disease (NAFLD) has recently been found to be a novel component of metabolic syndrome (MS), which is one of the leading causes of chronic liver disease. The serum alanine aminotransferase (ALT) and ⟨-glutamyltransferase (GGT) levels are suggested to affect liver fat accumulation and insulin resistance. We assessed the associations of serum ALT and GGT concentrations within the reference ranges with MS and NAFLD.<h4>Methods</h4>In total, 1,069 subjects enrolled at the health promotion center of Wonkwang University Hospital were divided into 4 groups according to serum ALT and GGT concentrations levels within the reference ranges. We performed biochemical tests, including liver function tests and lipid profiles, and diagnosed fatty liver by ultrasonography. Associations of ALT and GGT concentrationgrading within the reference range with fatty liver and/or MS were investigated.<h4>Results</h4>The presence of MS, its components, and the number of metabolic abnormalities [except for high-density lipoprotein-cholesterol (HDL-C) and fasting blood glucose] increased with the ALT level, while the presence of MS, its components, and the number of metabolic abnormalities (except for HDL-C) increased with the GGT level. The odds ratios for fatty liver and MS increased with the ALT level (P⟨0.001 and P=0.049, respectively) and the GGT level (P=0.044 and P=0.039, respectively).<h4>Conclusions</h4>Serum ALT and GGT concentrations within the reference ranges correlated with the incidence of NAFLD and MS in a dose-dependent manner. There associations need to be confirmed in large, prospective studies.

Also flagged:SynthesisCopolymersalkyneazidegemcitabinesolid tumor
Journal Article 2011-03-01 No Snippets Yang J, Luo K, Pan H, Kopečková P, Kopeček J.
Show Full Abstract

A new strategy for the synthesis of biodegradable high molecular weight N-(2-hydroxypropyl)methacrylamide (HPMA)-based polymeric carriers has been designed. An enzyme-sensitive, alkyne-functionalized, chain transfer agent (CTA-GFLG-alkyne; N(α)-(4-pentynoyl)-N(δ)-(4-cyano-4-(phenylcarbonothioylthio)pentanoyl-glycylphenylalanylleucylglycyl)-lysine) was synthesized and used to mediate the reversible addition-fragmentation chain-transfer (RAFT) polymerization and copolymerization of HPMA. Post-polymerization modification with 4,4'-azobis(azidopropyl 4-cyanopentanoate)resulted in the formation of heterotelechelic HPMA copolymers containing terminal alkyne and azide groups. Chain extension via click reaction resulted in high molecular weight multiblock copolymers. Upon exposure to papain, these copolymers degraded into the initial blocks. Similar results were obtained for copolymers of HPMA with N-methacryloylglycylphenylalanylleucylglycyl thiazolidine-2-thione and N-methacryloylglycylphenylalanylleucylglycyl-gemcitabine. The new synthetic method presented permits the synthesis of biocompatible, biodegradable high molecular weight HPMA copolymer-anticancer drug conjugates that possess long-circulation times and augmented accumulation in solid tumor tissue due to the enhanced permeability and retention effect.

Also flagged:Osteoporosisdiabetes mellitusestrogen deficiencytype 1 DMmetabolisminsulin
Journal Article 2011-03-01 No Snippets Wongdee K, Charoenphandhu N.
Show Full Abstract

Osteoporosis, a global age-related health problem in both male and female elderly, insidiously deteriorates the microstructure of bone, particularly at trabecular sites, such as vertebrae, ribs and hips, culminating in fragility fractures, pain and disability. Although osteoporosis is normally associated with senescence and estrogen deficiency, diabetes mellitus (DM), especially type 1 DM, also contributes to and/or aggravates bone loss in osteoporotic patients. This topic highlight article focuses on DM-induced osteoporosis and DM/osteoporosis comorbidity, covering alterations in bone metabolism as well as factors regulating bone growth under diabetic conditions including, insulin, insulin-like growth factor-1 and angiogenesis. Cellular and molecular mechanisms of DM-related bone loss are also discussed. This information provides a foundation for the better understanding of diabetic complications and for development of early screening and prevention of osteoporosis in diabetic patients.

Also flagged:Down's syndromechromosomesuperoxide dismutase 1SOD1peroxiredoxin 6heat shock protein 27
Journal Article 2011-03-01 ✓ 4 Snippets Yan LY, Sun CJ, Wang X, Chen Y, Zhang WY.
In-Text Gene Mentions

Four kinds [superoxide dismutase 1 (SOD1), peroxiredoxin 6 (PRDX6), heat shock protein 27 (HSP27), endoplasmic reticulum protein 29 (ERP29)] of them were validated by western blot analysis, the group of fetal Down's syndrome were 0.74 ± 0.12, 0.29 ± 0.10, 0.53 ± 0.16, 0.20 ± 0.09, the group of normal pregnancies were 0.51 ± 0.08, 0.34 ± 0.16, 0.18 ± 0.07, 0.35 ± 0.09, the results confirmed the observed changes in proteomics.<h4>Conclusions</h4>Compared with normal pregnancies, there were differential proteins expressed in placenta of Down's syndrome.

This approach might provide new screening markers in use for prediction of Down's syndrome, however, further study should be done to make these 4 proteins (SOD1, HSP27, ERP29, PRDX6) be new screening markers.

…(SOD1), peroxiredoxin 6 (PRDX6), heat shock protein…

…(SOD1, HSP27, ERP29,PRDX6) be new screening…

Show Full Abstract

<h4>Objective</h4>To discuss protein marks expressed differentially in placenta of Down's syndrome by means of proteomics.<h4>Methods</h4>We collected placenta of 18 patients (from March 2009 to December 2009 at Beijing Obstetrics and Gynecology Hospital), and divided them into two groups, one was 10 patients with fetal Down's syndrome, the other was normal pregnancies (normal chromosome) with other diseases. We separated proteins expressed in placentas of two groups by two-dimensional difference gel electrophoresis (2D-DIGE), and then analyzed the differential protein spots by software Decyder 6.5, then, spots differentially expressed by 1.5 fold or more were analyzed by matrix assisted laser desorption ionization-time of flight-mass spectrometry (MALDI-TOF-MS). In the end, the differential expressional levels of partially identified proteins were validated by western blot analysis.<h4>Results</h4>(1) Differential proteins of two groups protein spots of placentas separated by 2D-DIGE were analyzed by software Decyder 6.5 (these colored lights scattered in the image were protein spots), a total of 56 spots out of 352 were differentially expressed (P < 0.05) in two groups. We analyzed 17 protein spots (12 protein spots were over-expressed and 5 protein spots were down-expressed) differentially expressed by 1.5 fold or more by MALDI-TOF-MS. (2) Protein matching after searching protein database, 17 protein spots turn out to be 10 proteins. Four kinds [superoxide dismutase 1 (SOD1), peroxiredoxin 6 (PRDX6), heat shock protein 27 (HSP27), endoplasmic reticulum protein 29 (ERP29)] of them were validated by western blot analysis, the group of fetal Down's syndrome were 0.74 ± 0.12, 0.29 ± 0.10, 0.53 ± 0.16, 0.20 ± 0.09, the group of normal pregnancies were 0.51 ± 0.08, 0.34 ± 0.16, 0.18 ± 0.07, 0.35 ± 0.09, the results confirmed the observed changes in proteomics.<h4>Conclusions</h4>Compared with normal pregnancies, there were differential proteins expressed in placenta of Down's syndrome. This approach might provide new screening markers in use for prediction of Down's syndrome, however, further study should be done to make these 4 proteins (SOD1, HSP27, ERP29, PRDX6) be new screening markers.

Also flagged:Methylationcell cycleoncogenesARHGEF1tumor-suppressorsAPC2
Journal Article 2011-03-01 ✓ 5 Snippets Kashevarova AA, Tolmacheva EN, Sazhenova EA, Sikhanova NN, Lebedev IN.
In-Text Gene Mentions

tumor-suppressors (APC2, BRACA2, DCC, GRLF1, RB1, TP73, TSPYL2, VHL) as well as genes, participating in chromosome segregation regulation (CNTROB, GMNN, PROCR, TACC1

tumor-suppressors (APC2, BRACA2, DCC, GRLF1, RB1, TP73, TSPYL2, VHL) as well as genes, participating in chromosome segregation regulation (CNTROB, GMNN, PROCR

tumor-suppressors (APC2, BRACA2, DCC

tumor-suppressors (APC2, BRACA2, DCC, GRLF1, RB1, TP73, TSPYL2, VHL

tumor-suppressors (APC2, BRACA2, DCC, GRLF1, RB1, TP73, TSPYL2, VHL) as well as genes, participating in chromosome segregation regulation (CNTROB, GMNN

Show Full Abstract

To date the investigation of epigenetic mechanisms of cell cycle regulation, ensuring genomic stability maintaining and accurate transfer of hereditary information to daughter cells, is of a considerable interest. Development of the up-to-date molecular technologies allows determining methylation pattern of the whole genome at a single round of analysis. In this work for the first time the epigenetic status of placental tissues of human embryos with mosaic karyotype was studied using the genome-wide Illumina Infinium HumanMethylation27 BeadChip Array (Illumina, USA). The groups of genes, related to the cell cycle and its regulation and containing differentially methylated CpG-sites in their promoter regions, are determined. The methylation level of oncogenes (ARHGEF1, RGF5), tumor-suppressors (APC2, BRACA2, DCC, GRLF1, RB1, TP73, TSPYL2, VHL) as well as genes, participating in chromosome segregation regulation (CNTROB, GMNN, PROCR, TACC1), was changed most frequently.

Also flagged:gene expressionnucleusDrug addictionoxygenfatty acidmetabolism
Journal Article 2011-03-01 ✓ 2 Snippets Higuera-Matas A, Montoya GL, Coria SM, Miguéns M, García-Lecumberri C, Ambrosio E.
In-Text Gene Mentions

…t, secretion/exocytosis: Sv2c,Unc13cand Sytl5 respectively)…

…Interestingly, theUnc13cgene was inhibited…

Show Full Abstract

Drug addiction results from the interplay between social and biological factors. Among these, genetic variables play a major role. The use of genetically related inbred rat strains that differ in their preference for drugs of abuse is one approach of great importance to explore genetic determinants. Lewis and Fischer 344 rats have been extensively studied and it has been shown that the Lewis strain is especially vulnerable to the addictive properties of several drugs when compared with the Fischer 344 strain. Here, we have used microarrays to analyze gene expression profiles in the frontal cortex and nucleus accumbens of Lewis and Fischer 344 rats. Our results show that only a very limited group of genes were differentially expressed in Lewis rats when compared with the Fischer 344 strain. The genes that were induced in the Lewis strain were related to oxygen transport, neurotransmitter processing and fatty acid metabolism. On the contrary genes that were repressed in Lewis rats were involved in physiological functions such as drug and proton transport, oligodendrocyte survival and lipid catabolism.These data might be useful for the identification of genes which could be potential markers of the vulnerability to the addictive properties of drugs of abuse.

Also flagged:Myalgic Encephalomyelitischronic fatigue syndromeMEhypersensitivityinfectious illnessbrain trauma
Journal Article 2011-03-01 No Snippets Jason LA, Sorenson M, Porter N, Belkairous N.
Show Full Abstract

Kindling might represent a heuristic model for understanding the etiology of Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS). Kindling occurs when an organism is exposed repeatedly to an initially sub-threshold stimulus resulting in hypersensitivity and spontaneous seizure-like activity. Among patients with ME/CFS, chronically repeated low-intensity stimulation due to an infectious illness might cause kindling of the limbic-hypothalamic-pituitary axis. Kindling might also occur by high-intensity stimulation (e.g., brain trauma) of the limbic-hypothalamic-pituitary axis. Once this system is charged or kindled, it can sustain a high level of arousal with little or no external stimulus and eventually this could lead to hypocortisolism. Seizure activity may spread to adjacent structures of the limbic-hypothalamic-pituitary axis in the brain, which might be responsible for the varied symptoms that occur among patients with ME/CFS. In addition, kindling may also be responsible for high levels of oxidative stress, which has been found in patients with ME/CFS.

Also flagged:EGFEMR2mucin-like hormone receptor-2G-protein coupled receptorpolycystic kidney diseasetransporter
Journal Article 2011-03-01 No Snippets Rani M, Dikhit MR, Sahoo GC, Das P.
Show Full Abstract

EMR2 is an EGF-like module containing mucin-like hormone receptor-2 precursor, a G-protein coupled receptor (G-PCR). Mutation in EMR2 causes complicated disorders like polycystic kidney disease (PKD). The structure of EMR2 shows that the fifth domain is comprised of EGF-TM7 helices. Functional assignment of EMR2 by support vector machine (SVM) revealed that along with transporter activity, several novel functions are predicted. A twenty amino acid sequence "MGGRVFLVFLAFCVWLTLPG" acts as the signal peptide responsible for posttranslational transport. Eight amino acids are involved in N-glycosylation sites and two cleavage sites are Leu517 and Ser518 in EMR2. The residue Arg241 is responsible for interaction with glycosaminoglycan and chondroitin sulfate. On the basis of structure, function and ligand binding sites, competitive EMR2 inhibitors designed may decrease the rate of human diseases like Usher's syndrome, bilateral frontoparietal polymicrogyria and PKD.