Gene Literature Dashboard

Viewing October 2015 — 362 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← September 2015 November 2015 →
Also flagged:Breast cancer metastasis suppressor 1BRMS1TGF-β1breast cancerepithelial-to-mesenchymal transitionmetastasis suppressor
Journal Article 2015-10-31 ✓ 2 Snippets Cho KH, Yu SL, Cho DY, Park CG, Lee HY.
In-Text Gene Mentions

BRMS1 is a part of a family that includes suppressor of defective silencing 3 (SUDS3 or mSds3) and BRMS1-like (BRMS1L or p40) [6, 7] and has been shown to selectively suppress metastasis without any inhibition of tumorigenicity of multiple human cancer cells including melanoma [8], ovarian cancer [9] and non-small cell lung cancer [10].

…defective silencing 3 (SUDS3or mSds3) and…

Show Full Abstract

<h4>Background</h4>Cancer metastasis is a multi-step event including epithelial-to-mesenchymal transition (EMT). Breast cancer metastasis suppressor 1 (BRMS1) is a novel metastasis suppressor protein without anti-proliferating activity. However, a detailed underlying mechanism by which BRMS1 attenuates cancer cell EMT and invasion remained to be answered. In the present study, we report an additional mechanism by which BRMS1 attenuates Transforming growth factor-beta1 (TGF-β1)-induced breast cancer cell EMT and invasion.<h4>Methods</h4>Experimental analysis involving chromosome immunoprecipitation (ChIP) and luciferase reporter assays were used to validate hypoxia inducible factor-1alpha (HIF-1α) as a transcriptional regulator of TWIST1 and Snail. Quantitative RT-PCR was used to analyze transcript expression. Immunoblotting and immunofluorescence were used to analyze protein expression. Matrigel-coated in vitro invasion insert was used to analyze cancer cell invasion.<h4>Results</h4>BRMS1 strongly inhibited TGF-β1-induced breast cancer cell EMT and invasion. Unexpectedly, we observed that BRMS1 downregulates not only TWIST1 but also Snail expression, thereby inhibiting breast cancer cell invasion. In addition, we provide evidence that HIF-1α is required for Snail and TWIST1 expression. Further, BRMS1 reduced TGF-β1-induced HIF-1α transcript expression through inactivation of nuclear factor kappaB (NF-κB).<h4>Conclusion</h4>Collectively, the present study demonstrates a mechanical cascade of BRMS1 suppressing cancer cell invasion through downregulating HIF-1α transcript and consequently reducing Snail and TWIST1 expression.

Also flagged:chromatinp53bindingp21MDM2PIG3
Journal Article 2015-10-31 ✓ 1 Snippet Siska C, Bowler R, Kechris K.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Motivation</h4>Current differential correlation methods are designed to determine molecular feature pairs that have the largest magnitude of difference between correlation coefficients. These methods do not easily capture molecular feature pairs that experience no correlation in one group but correlation in another, which may reflect certain types of biological interactions. We have developed a tool, the Discordant method, which categorizes the correlation types for each group to make this possible.<h4>Results</h4>We compare the Discordant method to existing approaches using simulations and two biological datasets with different types of -omics data. In contrast to other methods, Discordant identifies phenotype-related features at a similar or higher rate while maintaining reasonable computational tractability and usability.<h4>Availability and implementation</h4>R code and sample data are available at https://github.com/siskac/discordant<h4>Contact</h4>katerina.kechris@ucdenver.edu<h4>Supplementary information</h4>Supplementary data are available at Bioinformatics online.

Also flagged:chronic myeloid leukemiaCMLleukemiatyrosine kinaseimatinibolfactomedin 4
Journal Article 2015-10-31 ✓ 5 Snippets Suknuntha K, Ishii Y, Tao L, Hu K, McIntosh BE, Yang D, Swanson S, Stewart R, Wang JYJ, Thomson J, Slukvin I.
In-Text Gene Mentions

To determine whether OLFM4 provides a survival advantage for cells more primitive than CFCs and whether it can affect the response of these cells to imatinib, we performed an LTC-IC assay using CML sCD34+ cells treated with siOLFM4, imatinib or both together.

These findings imply that OLFM4 is involved in regulation of imatinib resistance and survival of de novo generated primitive CML cells (Fig. 4g).

Consistent with prior observations in iCD34+ cells, CML cells in clonogenic cultures displayed a significant upregulation of OLFM4 expression when pretreated with imatinib (Fig. 6a and Supplementary Fig. S5).

We found that G-CSF stimulation indeed enhances OLFM4 production by sCD34+ cells and that this effect is potentiated by imatinib (Fig. 5d).

As shown in present studies, the use of pure population of induced lin−CD34+CD90+CD117+-CD45+CD38+/− BCR-ABL+ cells enabled identification of genes affected by imatinib treatment and eventually led to discovery of novel survival factor for primitive leukemia cells OLFM4.

Show Full Abstract

A definitive cure for chronic myeloid leukemia (CML) requires identifying novel therapeutic targets to eradicate leukemia stem cells (LSCs). However, the rarity of LSCs within the primitive hematopoietic cell compartment remains a major limiting factor for their study in humans. Here we show that primitive hematopoietic cells with typical LSC features, including adhesion defect, increased long-term survival and proliferation, and innate resistance to tyrosine kinase inhibitor (TKI) imatinib, can be generated de novo from reprogrammed primary CML cells. Using CML iPSC-derived primitive leukemia cells, we discovered olfactomedin 4 (OLFM4) as a novel factor that contributes to survival and growth of somatic lin(-)CD34(+) cells from bone marrow of patients with CML in chronic phase, but not primitive hematopoietic cells from normal bone marrow. Overall, this study shows the feasibility and advantages of using reprogramming technology to develop strategies for targeting primitive leukemia cells.

Also flagged:Coagulationcoagulation factorsantithrombin IIIprotein Cprotein Sfactor V Leiden
Journal Article 2015-10-31 ✓ 5 Snippets Besharat M, Tabandeh A, Keshtkar A, Mobasheri E, Besharat S, Joshaghani H.
In-Text Gene Mentions

…of antithrombin III (ATIII) using colorimetric assay,…

ATIIIwas abnormal in…

…anti-thrombin III (ATIII) was evaluated…

…C, protein S,ATIIIand factor V…

…( 8.5% ),ATIII( <80 )…

Show Full Abstract

<h4>Background</h4>It has been reported that 15-20% of parous female have experienced at least one miscarriage, while 3% of them have experienced two miscarriages. The goal of this study was to evaluate the plasma level of coagulation factors in women with a history of spontaneous abortions.<h4>Materials and methods</h4>In this case-control study, 82 women with a history of two or more abortions referred to the six private gynecologic clinics in Gorgan city without any structural abnormality were recruited during 2011-2012. Plasma levels of antithrombin III (ATIII) using colorimetric assay, protein C, protein S, factor V Leiden and lupus anticoagulant (LAC) using coagulation method were measured. The control group was women with a history of normal delivery and no abortions. Those under anti-coagulant therapy were excluded from the study. Data were entered into the computer using the Statistical Package for the Social Sciences (SPSS, SPSS Inc., Chicago, IL, USA) version 16 and analyzed by Chi-square, t test and non-parametric tests.<h4>Results</h4>At least one abnormality was reported in 35 cases (42.7%). Among them, protein C deficiency was the most prevalent (30.5%). ATIII was abnormal in 17.1% and lupus anti-coagulant was abnormal in 8.5%. Factor V Leiden was normal in all cases and protein S deficiency was only seen in one case.<h4>Conclusion</h4>We suggest to perform these tests in regards to the thrombophilia in cases with spontaneous abortions in order to find an early cure for this treatable disorder.

Also flagged:Monkeypox Virus InfectionMonkeypoxzoonosissmallpoxmonkeypox infectioninfection
Journal Article 2015-10-30 ✓ 1 Snippet Falendysz EA, Lopera JG, Lorenzsonn F, Salzer JS, Hutson CL, Doty J, Gallardo-Romero N, Carroll DS, Osorio JE, Rocke TE.
In-Text Gene Mentions

…Kidney fromGPR52was MPXV-positive by…

Show Full Abstract

Monkeypox is a zoonosis clinically similar to smallpox in humans. Recent evidence has shown a potential risk of increased incidence in central Africa. Despite attempts to isolate the virus from wild rodents and other small mammals, no reservoir host has been identified. In 2003, Monkeypox virus (MPXV) was accidentally introduced into the U.S. via the pet trade and was associated with the Gambian pouched rat (Cricetomys gambianus). Therefore, we investigated the potential reservoir competence of the Gambian pouched rat for MPXV by utilizing a combination of in vivo and in vitro methods. We inoculated three animals by the intradermal route and three animals by the intranasal route, with one mock-infected control for each route. Bioluminescent imaging (BLI) was used to track replicating virus in infected animals and virological assays (e.g. real time PCR, cell culture) were used to determine viral load in blood, urine, ocular, nasal, oral, and rectal swabs. Intradermal inoculation resulted in clinical signs of monkeypox infection in two of three animals. One severely ill animal was euthanized and the other affected animal recovered. In contrast, intranasal inoculation resulted in subclinical infection in all three animals. All animals, regardless of apparent or inapparent infection, shed virus in oral and nasal secretions. Additionally, BLI identified viral replication in the skin without grossly visible lesions. These results suggest that Gambian pouched rats may play an important role in transmission of the virus to humans, as they are hunted for consumption and it is possible for MPXV-infected pouched rats to shed infectious virus without displaying overt clinical signs.

Also flagged:Adult-onset autosomal dominant spastic paraplegiaGTPasemotor/sensory axonopathydynamin 2DNM2HSP
Journal Article 2015-10-30 No Snippets Sambuughin N, Goldfarb LG, Sivtseva TM, Davydova TK, Vladimirtsev VA, Osakovskiy VL, Danilova AP, Nikitina RS, Ylakhova AN, Diachkovskaya MP, Sundborger AC, Renwick NM, Platonov FA, Hinshaw JE, Toro C.
Show Full Abstract

<h4>Background</h4>Hereditary Spastic Paraplegia (HSP) represents a large group of clinically and genetically heterogeneous disorders linked to over 70 different loci and more than 60 recognized disease-causing genes. A heightened vulnerability to disruption of various cellular processes inherent to the unique function and morphology of corticospinal neurons may account, at least in part, for the genetic heterogeneity.<h4>Methods</h4>Whole exome sequencing was utilized to identify candidate genetic variants in a four-generation Siberian kindred that includes nine individuals showing clinical features of HSP. Segregation of candidate variants within the family yielded a disease-associated mutation. Functional as well as in-silico structural analyses confirmed the selected candidate variant to be causative.<h4>Results</h4>Nine known patients had young-adult onset of bilateral slowly progressive lower-limb spasticity, weakness and hyperreflexia progressing over two-to-three decades to wheel-chair dependency. In the advanced stage of the disease, some patients also had distal wasting of lower leg muscles, pes cavus, mildly decreased vibratory sense in the ankles, and urinary urgency along with electrophysiological evidence of a mild distal motor/sensory axonopathy. Molecular analyses uncovered a missense c.2155C > T, p.R719W mutation in the highly conserved GTP-effector domain of dynamin 2. The mutant DNM2 co-segregated with HSP and affected endocytosis when expressed in HeLa cells. In-silico modeling indicated that this HSP-associated dynamin 2 mutation is located in a highly conserved bundle-signaling element of the protein while dynamin 2 mutations associated with other disorders are located in the stalk and PH domains; p.R719W potentially disrupts dynamin 2 assembly.<h4>Conclusion</h4>This is the first report linking a mutation in dynamin 2 to a HSP phenotype. Dynamin 2 mutations have previously been associated with other phenotypes including two forms of Charcot-Marie-Tooth neuropathy and centronuclear myopathy. These strikingly different pathogenic effects may depend on structural relationships the mutations disrupt. Awareness of this distinct association between HSP and c.2155C > T, p.R719W mutation will facilitate ascertainment of additional DNM2 HSP families and will direct future research toward better understanding of cell biological processes involved in these partly overlapping clinical syndromes.

Also flagged:cholangiocarcinomadistal cholangiocarcinomatumorsinvasive tumorsmucosalcarcinoma
Journal Article 2015-10-30 ✓ 2 Snippets Miura F, Sano K, Amano H, Toyota N, Wada K, Tokairin T, Kondo F, Hayano K, Matsubara H, Takada T.
In-Text Gene Mentions

…Conclusions</h4>Defining earlyDCCas carcinoma confined…

…be inappropriate; earlyDCCshould be limited…

Show Full Abstract

<h4>Purpose</h4>The feasibility of defining early cholangiocarcinoma has not been adequately evaluated. The surgical outcomes of patients who had undergone pancreatoduodenectomy (PD) for pathological T1 (pT1) distal cholangiocarcinoma (DCC) were evaluated to determine whether it is possible to define early DCC.<h4>Methods</h4>The clinicopathological data of 18 patients with pT1 DCC who had undergone PD were reviewed retrospectively. Depth of fibromuscular (fm) layer invasion was divided into two categories: fm1 and fm2 (without adventitia fascia invasion and with adventitia fascia invasion). Comparative analyses were performed according to the depth of invasion.<h4>Results</h4>Disease-specific survival rates of patients with five mucosal tumors and 13 fm-invasive tumors were 80 and 61.9 % at 5 years and 80 and 41.2 % at 10 years, respectively. There was no significant difference in disease-specific survival rates between the two groups (P = 0.244). Disease-specific survival rates of patients with 7 fm1-invasive tumors and 6 fm2-invasive tumors were 85.7 and 40 % at 5 years and 85.7 and 0 % at 10 years. A significant difference in disease-specific survival rates was observed between mucosal tumors and fm2-invasive tumors (P = 0.043), and disease-specific survival rates of mucosal tumors and fm1-invasive tumors were similar (P = 0.968).<h4>Conclusions</h4>Defining early DCC as carcinoma confined to the fm of the bile duct might be inappropriate; early DCC should be limited to the mucosal carcinoma.

Also flagged:NDNCD1Amethylationhead and neck squamous carcinomastumorhypermethylation
Journal Article 2015-10-30 ✓ 5 Snippets Virani S, Bellile E, Bradford CR, Carey TE, Chepeha DB, Colacino JA, Helman JI, McHugh JB, Peterson LA, Sartor MA, Taylor JM, Walline HM, Wolf GT, Rozek LS.
In-Text Gene Mentions

Here, we test the hypothesis that specific candidate gene methylation markers (CCNA1, NDN, CD1A, DCC, p16, GADD45A) are associated with tumor recurrence and survival, in a well-characterized, prospective, cohort of 346 HNSCC patients.

Here we test the hypothesis that specific candidate gene methylation markers (CCNA1, NDN, CD1A, DCC, GADD45a, and p16) are associated with tumor recurrence and survival, in a well-characterized, prospective cohort of HNSCC patients with extensive epidemiologic, clinical and outcome information, who were treated by a single group of clinicians with a homogenous treatment approach.

DCC (deleted in colorectal carcinoma), GADD45 (growth arrest and DNA damage 45) and p16 (cyclin-dependent kinase inhibitor) were all previously found to be hypermethylated in HNSCC and were chosen for their role as tumor suppressors and potential involvement with HPV [9, 31–34].

In terms of RPFT, there were significant associations with CCNA1, DCC and NDN methylation in all HNSCC patients.

Stratification by HPV status across these epidemiologic and epigenetic characteristics revealed HPV (+) tumors were hypermethylated across CCNA1, NDN, CD1A, and DCC, but hypomethylated in p16 as compared to HPV(-) tumors, regardless of clinical epidemiological traits (data not shown).

Show Full Abstract

<h4>Background</h4>HPV-associated HNSCCs have a distinct etiologic mechanism and better prognosis than those with non-HPV associated HNSCCs. However, even within the each group, there is heterogeneity in survival time. Here, we test the hypothesis that specific candidate gene methylation markers (CCNA1, NDN, CD1A, DCC, p16, GADD45A) are associated with tumor recurrence and survival, in a well-characterized, prospective, cohort of 346 HNSCC patients.<h4>Methods</h4>Kaplan-Meier curves were used to estimate survival time distributions. Multivariable Cox Proportional Hazards models were used to test associations between each methylation marker and OST/RPFT after adjusting for known or identified prognostic factors. Stratified Cox models included an interaction term between HPV and methylation marker to test for differences in the associations of the biomarker with OST or RPFT across HPV status.<h4>Results</h4>Methylation markers were differentially associated with patient characteristics. DNA hypermethylation of NDN and CD1A was found to be significantly associated with overall survival time (OST) in all HNSCC patients (NDN hazard ratio (HR): 2.35, 95% CI: 1.40-3.94; CD1A HR: 1.31, 95% CI: 1.01-1.71). Stratification by HPV status revealed hypermethylation of CD1A was associated with better OST and recurrence/persistence-free time (RPFT) (OST HR: 3.34, 95% CI: 1.88-5.93; RPFT HR: 2.06, 95% CI: 1.21-3.49), while hypomethylation of CCNA1 was associated with increased RPFT in HPV (+) patients only (HR: 0.31, 95% CI: 0.13-0.74).<h4>Conclusions</h4>This study is the first to describe novel epigenetic alterations associated with survival in an unselected, prospectively collected, consecutive cohort of patients with HNSCC. DNA hypermethylation of NDN and CD1A was found to be significantly associated with increased overall survival time in all HNSCC patients. However, stratification by the important prognostic factor of HPV status revealed the immune marker, CD1A, and the cell cycle regulator, CCNA1 to be associated with prognosis in HPV (+) patients, specifically. Here, we identified novel methylation markers and specific, epigenetic molecular differences associated with HPV status, which warrant further investigation.

Also flagged:ureaHuntington's diseaseHDneurodegenerative disorderHuntingtonpolyglutamine
Journal Article 2015-10-30 ✓ 2 Snippets Patassini S, Begley P, Reid SJ, Xu J, Church SJ, Curtis M, Dragunow M, Waldvogel HJ, Unwin RD, Snell RG, Faull RL, Cooper GJ.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disorder wherein the aetiological defect is a mutation in the Huntington's gene (HTT), which alters the structure of the huntingtin protein through the lengthening of a polyglutamine tract and initiates a cascade that ultimately leads to dementia and premature death.

…the Huntington's gene (HTT), which alters the…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder wherein the aetiological defect is a mutation in the Huntington's gene (HTT), which alters the structure of the huntingtin protein through the lengthening of a polyglutamine tract and initiates a cascade that ultimately leads to dementia and premature death. However, neurodegeneration typically manifests in HD only in middle age, and processes linking the causative mutation to brain disease are poorly understood. Here, our objective was to elucidate further the processes that cause neurodegeneration in HD, by measuring levels of metabolites in brain regions known to undergo varying degrees of damage. We applied gas-chromatography/mass spectrometry-based metabolomics in a case-control study of eleven brain regions in short post-mortem-delay human tissue from nine well-characterized HD patients and nine controls. Unexpectedly, a single major abnormality was evident in all eleven brain regions studied across the forebrain, midbrain and hindbrain, namely marked elevation of urea, a metabolite formed in the urea cycle by arginase-mediated cleavage of arginine. Urea cycle activity localizes primarily in the liver, where it functions to incorporate protein-derived amine-nitrogen into urea for recycling or urinary excretion. It also occurs in other cell-types, but systemic over-production of urea is not known in HD. These findings are consistent with impaired local urea regulation in brain, by up-regulation of synthesis and/or defective clearance. We hypothesize that defective brain urea metabolism could play a substantive role in the pathogenesis of neurodegeneration, perhaps via defects in osmoregulation or nitrogen metabolism. Brain urea metabolism is therefore a target for generating novel monitoring/imaging strategies and/or therapeutic interventions aimed at ameliorating the impact of HD in patients.

Also flagged:chondrogenesisSox9Soxtranscription factorsFOXP2binding
Journal Article 2015-10-30 ✓ 1 Snippet Vivekanandan S, Moovarkumudalvan B, Lescar J, Kolatkar PR.
In-Text Gene Mentions

Sox6

Show Full Abstract

Sox9 is a fundamental sex-determining gene and the master regulator of chondrogenesis, and is involved in the development of various vital organs such as testes, kidney, heart and brain, and in skeletal development. Similar to other known Sox transcription factors, Sox9 recognizes and binds DNA with the consensus sequence C(T/A)TTG(T/A)(T/A) through the highly conserved HMG domain. Nonetheless, the molecular basis of the functional specificity of Sox9 in key developmental processes is still unclear. As an initial step towards a mechanistic understanding of Sox9 transcriptional regulation, the current work describes the details of the purification of the mouse Sox9 HMG domain (mSox9HMG), its crystallization in complex with a ChIP-Seq-identified FOXP2 promoter DNA element and the X-ray diffraction data analysis of this complex. The mSox9HMG-FOXP2 promoter DNA complex was crystallized by the hanging-drop vapour-diffusion method using 20% PEG 3350 in 200 mM sodium/potassium phosphate with 100 mM bis-tris propane at pH 8.5. The crystals diffracted to 2.7 Å resolution and the complex crystallized in the tetragonal space group P41212, with unit-cell parameters a = b = 99.49, c = 45.89 Å. Crystal-packing parameters revealed that asymmetric unit contained one mSox9HMG-FOXP2 promoter DNA complex with an estimated solvent content of 64%.

Also flagged:peptidesalkaloidsaminesbehavioralhyaluronidasephospholipase A 2
Journal Article 2015-10-30 ✓ 3 Snippets Danneels EL, Van Vaerenbergh M, Debyser G, Devreese B, de Graaf DC.
In-Text Gene Mentions

…proteinase stubble andantithrombin-III).…

…queen bees wasantithrombin-III.…

…proteinase stubble andantithrombin-III.…

Show Full Abstract

Venoms of invertebrates contain an enormous diversity of proteins, peptides, and other classes of substances. Insect venoms are characterized by a large interspecific variation resulting in extended lists of venom compounds. The venom composition of several hymenopterans also shows different intraspecific variation. For instance, venom from different honeybee castes, more specifically queens and workers, shows quantitative and qualitative variation, while the environment, like seasonal changes, also proves to be an important factor. The present study aimed at an in-depth analysis of the intraspecific variation in the honeybee venom proteome. In summer workers, the recent list of venom proteins resulted from merging combinatorial peptide ligand library sample pretreatment and targeted tandem mass spectrometry realized with a Fourier transform ion cyclotron resonance mass spectrometer (FT-ICR MS/MS). Now, the same technique was used to determine the venom proteome of queens and winter bees, enabling us to compare it with that of summer bees. In total, 34 putative venom toxins were found, of which two were never described in honeybee venoms before. Venom from winter workers did not contain toxins that were not present in queens or summer workers, while winter worker venom lacked the allergen Api m 12, also known as vitellogenin. Venom from queen bees, on the other hand, was lacking six of the 34 venom toxins compared to worker bees, while it contained two new venom toxins, in particularly serine proteinase stubble and antithrombin-III. Although people are hardly stung by honeybees during winter or by queen bees, these newly identified toxins should be taken into account in the characterization of a putative allergic response against Apis mellifera stings.

Also flagged:cancerchromosomeprotein bindingdegradationp21dosage compensation
Journal Article 2015-10-30 No Snippets Sanbonmatsu KY.
Show Full Abstract

While long non-coding RNAs play key roles in disease and development, few structural studies have been performed to date for this emerging class of RNAs. Previous structural studies are reviewed, and a pipeline is presented to determine secondary structures of long non-coding RNAs. Similar to riboswitches, experimentally determined secondary structures of long non-coding RNAs for one species, may be used to improve sequence/structure alignments for other species. As riboswitches have been classified according to their secondary structure, a similar scheme could be used to classify long non-coding RNAs. This article is part of a Special Issue titled: Clues to long noncoding RNA taxonomy1, edited by Dr. Tetsuro Hirose and Dr. Shinichi Nakagawa.

Also flagged:Obstructive sleep apneanon-alcoholic fatty liver diseaseobesityNAFLDvisceral obesityexcessive daytime sleepiness
Journal Article 2015-10-30 ✓ 1 Snippet Yu JH, Ahn JH, Yoo HJ, Seo JA, Kim SG, Choi KM, Baik SH, Choi DS, Shin C, Kim NH.
In-Text Gene Mentions

…no history ofhemochromatosis, autoimmune hepatitis, cirrho…

Show Full Abstract

<h4>Background/aims</h4>Obstructive sleep apnea (OSA) is associated with an increased risk of obesity and non-alcoholic fatty liver disease (NAFLD), but it remains unclear whether the risk of NAFLD is independently related to OSA regardless of visceral obesity. Thus, the aim of the present study was to examine whether OSA alone or in combination with excessive daytime sleepiness (EDS) or short sleep duration was associated with NAFLD independent of visceral fat in Korean adults.<h4>Methods</h4>A total of 621 participants were selected from the Korean Genome and Epidemiology Study (KoGES). The abdominal visceral fat area (VFA) and hepatic fat components of the participants were assessed using computed tomography scans and they were then categorized into four groups depending on the presence of OSA and EDS.<h4>Results</h4>The proportions of NAFLD were 21.1%, 18.5%, 32.4%, and 46.7% in participants without OSA/EDS, with only EDS, with only OSA, and with both OSA and EDS, respectively. A combination of OSA and EDS increased the odds ratio (OR) for developing NAFLD (OR, 2.75; 95% confidence interval [CI], 1.21 to 6.28) compared to those without OSA/EDS, and this association remained significant (OR, 2.38; 95% CI, 1.01 to 5.59) even after adjusting for VFA. In short sleepers (< 5 hours) with OSA, the adjusted OR for NAFLD was 2.50 (95% CI, 1.08 to 5.75) compared to those sleeping longer than 5 hours without OSA.<h4>Conclusions</h4>In the present study, OSA was closely associated with NAFLD in Korean adults. This association was particularly strong in those with EDS or short sleep duration regardless of VFA.

Also flagged:psychological disordersCOMTemotional disordersanxietydepressionserotonin-transporter
Journal Article 2015-10-30 ✓ 1 Snippet Jenness JL, Hankin BL, Young JF, Smolen A.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Attention bias to emotion may be an intermediate trait for stress-reactive psychopathology associated with biologically plausible candidate genes, yet the precise direction of effects within the youth literature remains unclear. The present study investigated whether stressful life events (SLEs) moderate the link between genetic risk (5-HTTLPR and <i>COMT</i>) and attention bias to emotion among youth (n= 467). Analyses revealed a differential effect of gene. Among youth who had experienced more recent SLEs, those homozygous for the low expressing allele of 5-HTTLPR (S/S) demonstrated preferential attention toward negative emotional expressions, whereas youth homozygous for the high expressing <i>COMT</i> genotype (Val/Val) showed attentional avoidance of positive facial expressions. No interaction between 5-HTTLPR and <i>COMT</i> was found. These findings highlight the importance of investigating stress as a moderator within the intermediate trait literature and suggest that biologically plausible candidate genes may have a differential effect in the pathway to psychological disorders.

Also flagged:Maternal DepressionAddictionmaternal addictiondepressionPostpartum depressiondrug use disorders
Journal Article 2015-10-30 ✓ 1 Snippet Nephew BC, Murgatroyd C, Pittet F, Febo M.
In-Text Gene Mentions

The s-allele results in a decreased transcription of the 5-HTT gene, leading to increased levels of serotonin in the synaptic cleft [56].

Show Full Abstract

Two research areas that could benefit from a greater focus on the role of the reward pathway are maternal depression and maternal addiction. Both depression and addiction in mothers are mediated by deficiencies in the reward pathway and represent substantial risks to the health of offspring and future generations. This targeted review discusses maternal reward deficits in depressed and addicted mothers, neural, genetic, and epigenetic mechanisms, and the transgenerational transmission of these deficits from mother to offspring. Postpartum depression and drug use disorders may entail alterations in the reward pathway, particularly in striatal and prefrontal areas, which may affect maternal attachment to offspring and heighten the risk of transgenerational effects on the oxytocin and dopamine systems. Alterations may involve neural circuitry changes, genetic factors that impact monoaminergic neurotransmission, as well as growth factors such as BDNF and stress-associated signaling in the brain. Improved maternal reward-based preventative measures and treatments may be specifically effective for mothers and their offspring suffering from depression and/or addiction.

Also flagged:ssaspradiodiamondfemoroacetabular impingement31.1
Journal Article 2015-10-30 No Snippets Clavier S, Illien F, Sagan S, Bolbach G, Sachon E.
Show Full Abstract

EWS-FLI1 expression in NIH-3T3 fibroblasts has a profound impact on the phenotype, resulting in the cytoskeleton and adhesive capacity disorganization (EF cells). Besides this, (R/W)<sub>9</sub>, a cell-penetrating peptide (CPP), has an intrinsic actin remodeling activity in EF cells. To evaluate the impact of the oncogenic protein EWS-FLI1 on proteins expression levels, a quantitative comparison of tumoral EF and non-tumoral 3T3 proteomes was performed. Then to see if we could link the EWS-FLI1 oncogenic transformation to the phenotype reversion induced by (R/W)<sub>9</sub>, (R/W)<sub>9</sub> influence on EF cells proteome was assessed. To our knowledge no such ⿿CPPomic⿿ study has been performed before.<h4>Biological significance</h4>Up to now very few global quantitative proteomic studies have been published to help understand the oncogenic transformation induced by EWS-FLI1 fusion protein and leading to Ewing sarcoma development and dissemination. The comparison we did in this study between a model tumoral cell line EF and its non-tumoral counterpart (3T3) allowed us to highlight several features either common to most tumor types or specific to Ewing sarcoma. Particularly, lack of actin cytoskeleton organization could very likely be explained by the down-regulation of many important actin binding proteins. These results are in accordance with the hypothesis of a passive/stochastic mode of dissemination conferring Ewing sarcoma tumoral cell a high metastatic potential.

Also flagged:intestinal cancertumourcancercolorectal cancerAPCTP53
Journal Article 2015-10-29 ✓ 1 Snippet Jackstadt R, Sansom OJ.
In-Text Gene Mentions

…colorectal cancer (DCC) is also…

Show Full Abstract

Murine models of intestinal cancer are powerful tools to recapitulate human intestinal cancer, understand its biology and test therapies. With recent developments identifying the importance of the tumour microenvironment and the potential for immunotherapy, autochthonous genetically engineered mouse models (GEMMs) will remain an important part of preclinical studies for the foreseeable future. This review will provide an overview of the current mouse models of intestinal cancer, from the Apc(Min/+) mouse, which has been used for over 25 years, to the latest 'state-of-the-art' organoid models. We discuss here how these models have been used to define fundamental processes involved in tumour initiation and the attempts to generate metastatic models, which is the ultimate cause of cancer mortality. Together these models will provide key insights to understand this complex disease and hopefully will lead to the discovery of new therapeutic strategies.

Also flagged:coagulation factorfibrinogentrauma-induced coagulopathyTICclottingthrombin
Journal Article 2015-10-29 No Snippets Ponschab M, Voelckel W, Pavelka M, Schlimp CJ, Schöchl H.
Show Full Abstract

<h4>Background</h4>Purified coagulation factor concentrates, such as fibrinogen concentrate (FC) and prothrombin complex concentrate (PCC) are increasingly used as haemostatic therapy for trauma-induced coagulopathy (TIC). The impact of FC and PCC administration on ROTEM parameters among patients with TIC has not been adequately investigated.<h4>Methods</h4>In this retrospective observational study, changes to ROTEM parameters, induced by three different therapeutic interventions, were investigated: patients receiving FC only (FC-group); patients treated with FC and PCC (FC + PCC-group) and patients treated with PCC only (PCC-group).<h4>Results</h4>The study population comprised 96 patients who were predominately male (69 [71.9 %]), median age was 45.0 (26.3-60.0) years, and the median injury severity score was 34.0 (25.0-44.5). Administration of FC resulted in a significant reduction of the clotting time (CT) in both the EXTEM and FIBTEM assays but had no effect on INTEM CT. Clot amplitude (CA) increased significantly in the FIBTEM assay but remained unchanged in the EXTEM and INTEM assays. The combined administration of FC and PCC increased FIBTEM maximum clot firmness (MCF) and normalized EXTEM CT but did not change either INTEM or FIBTEM CT. Following PCC therapy, EXTEM and FIBTEM CT normalized; CA at 10 min after CT measurements decreased significantly in EXTEM, INTEM and FIBTEM.<h4>Conclusions</h4>Administration of FC alone or in combination with PCC resulted in a significant improvement of fibrin polymerisation as measured by an increase in FIBTEM MCF. CT is dependent not only on thrombin generation but also on the availability of substrate (fibrinogen). Accelerated fibrin polymerisation rate results in earlier clot formation and consequently shorter CT. PCC administration normalised EXTEM CT below the upper threshold of 80 s. This study was performed at the AUVA Trauma Centre Salzburg, Salzburg, Austria.

Also flagged:IL-1βHepcidinBone Morphogenetic Proteinironmetabolismhypoferremia
Journal Article 2015-10-29 ✓ 2 Snippets Shanmugam NK, Chen K, Cherayil BJ.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

The liver hormone hepcidin is the central regulator of systemic iron metabolism. Its increased expression in inflammatory states leads to hypoferremia and anemia. Elucidation of the mechanisms that up-regulate hepcidin during inflammation is essential for developing rational therapies for this anemia. Using mouse models of inflammatory bowel disease, we have shown previously that colitis-associated hepcidin induction is influenced by intestinal microbiota composition. Here we investigate how two commensal bacteria, Bifidobacterium longum and Bacteroides fragilis, representative members of the gut microbiota, affect hepcidin expression. We found that supernatants of a human macrophage cell line infected with either of the bacteria up-regulated hepcidin when added to a human hepatocyte cell line. This activity was abrogated by neutralization of IL-1β. Moreover, purified IL-1β increased hepcidin expression when added to the hepatocyte line or primary human hepatocytes and when injected into mice. IL-1β activated the bone morphogenetic protein (BMP) signaling pathway in hepatocytes and in mouse liver, as indicated by increased phosphorylation of small mothers against decapentaplegic proteins. Activation of BMP signaling correlated with IL-1β-induced expression of BMP2 in human hepatocytes and activin B in mouse liver. Treatment of hepatocytes with two different chemical inhibitors of BMP signaling or with a neutralizing antibody to BMP2 prevented IL-1β-induced up-regulation of hepcidin. Our results clarify how commensal bacteria affect hepcidin expression and reveal a novel connection between IL-1β and activation of BMP signaling. They also suggest that there may be differences between mice and humans with respect to the mechanism by which IL-1β up-regulates hepcidin.

Also flagged:genetic diseasesataxiaHuntington diseasepolyQ disorderspathogenesisneurodegenerative diseases
Journal Article 2015-10-29 ✓ 2 Snippets Szlachcic WJ, Switonski PM, Kurkowiak M, Wiatr K, Figiel M.
In-Text Gene Mentions

For instance, in the R6/2 detailed mouse model page, the user can find that this is a transgenic HD model that contains the human HD promoter and expresses the N-terminal fragment of human huntingtin (HTT) protein with a 120 polyQ stretch.

…of human huntingtin (HTT) protein with a…

Show Full Abstract

<h4>Background</h4>The polyglutamine (polyQ) family of disorders comprises 9 genetic diseases, including several types of ataxia and Huntington disease. Approximately two decades of investigation and the creation of more than 130 mouse models of polyQ disorders have revealed many similarities between these diseases. The disorders share common mutation types, neurological characteristics and certain aspects of pathogenesis, including morphological and physiological neuronal alterations. All of the diseases still remain incurable.<h4>Description</h4>The large volume of information collected as a result of the investigation of polyQ models currently represents a great potential for searching, comparing and translating pathogenesis and therapeutic information between diseases. Therefore, we generated a public database comprising the polyQ mouse models, phenotypes and therapeutic interventions tested in vivo. The database is available at http://conyza.man.poznan.pl/ .<h4>Conclusion</h4>The use of the database in the field of polyQ diseases may accelerate research on these and other neurodegenerative diseases and provide new perspectives for future investigation.

Also flagged:nucleotidesregulation ofgene expressionchromatinRNA polymerase IIbrain development
Journal Article 2015-10-29 No Snippets Aprea J, Calegari F.
Show Full Abstract

Evidence on the role of long non-coding (lnc) RNAs has been accumulating over decades, but it has been only recently that advances in sequencing technologies have allowed the field to fully appreciate their abundance and diversity. Despite this, only a handful of lncRNAs have been phenotypically or mechanistically studied. Moreover, novel lncRNAs and new classes of RNAs are being discovered at growing pace, suggesting that this class of molecules may have functions as diverse as protein-coding genes. Interestingly, the brain is the organ where lncRNAs have the most peculiar features including the highest number of lncRNAs that are expressed, proportion of tissue-specific lncRNAs and highest signals of evolutionary conservation. In this work, we critically review the current knowledge about the steps that have led to the identification of the non-coding transcriptome including the general features of lncRNAs in different contexts in terms of both their genomic organisation, evolutionary origin, patterns of expression, and function in the developing and adult mammalian brain.

Also flagged:NeuroD1chromatintranscription factortranscription factorsheterochromatinneurogenesis
Journal Article 2015-10-29 ✓ 1 Snippet Pataskar A, Jung J, Smialowski P, Noack F, Calegari F, Straub T, Tiwari VK.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

Cell fate specification relies on the action of critical transcription factors that become available at distinct stages of embryonic development. One such factor is NeuroD1, which is essential for eliciting the neuronal development program and possesses the ability to reprogram other cell types into neurons. Given this capacity, it is important to understand its targets and the mechanism underlying neuronal specification. Here, we show that NeuroD1 directly binds regulatory elements of neuronal genes that are developmentally silenced by epigenetic mechanisms. This targeting is sufficient to initiate events that confer transcriptional competence, including reprogramming of transcription factor landscape, conversion of heterochromatin to euchromatin, and increased chromatin accessibility, indicating potential pioneer factor ability of NeuroD1. The transcriptional induction of neuronal fate genes is maintained via epigenetic memory despite a transient NeuroD1 induction during neurogenesis. NeuroD1 also induces genes involved in the epithelial-to-mesenchymal transition, thereby promoting neuronal migration. Our study not only reveals the NeuroD1-dependent gene regulatory program driving neurogenesis but also increases our understanding of how cell fate specification during development involves a concerted action of transcription factors and epigenetic mechanisms.

Also flagged:adaptive immunitygene expressionMHC class IIChlamydia muridarum infectionadaptiveinfection
Journal Article 2015-10-29 No Snippets Johnson RM, Kerr MS.
Show Full Abstract

Chlamydia trachomatis urogenital serovars are intracellular bacteria that parasitize human reproductive tract epithelium. As the principal cell type supporting bacterial replication, epithelial cells are central to Chlamydia immunobiology initially as sentries and innate defenders, and subsequently as collaborators in adaptive immunity-mediated bacterial clearance. In asymptomatic individuals who do not seek medical care a decisive struggle between C. trachomatis and host defenses occurs at the epithelial interface. For this study, we modeled the immunobiology of epithelial cells and macrophages lining healthy genital mucosa and inflamed/infected mucosa during the transition from innate to adaptive immunity. Upper reproductive tract epithelial cell line responses were compared to bone marrow-derived macrophages utilizing gene expression microarray technology. Those comparisons showed minor differences in the intrinsic innate defenses of macrophages and epithelial cells. Major lineage-specific differences in immunobiology relate to epithelial collaboration with adaptive immunity including an epithelial requirement for inflammatory cytokines to express MHC class II molecules, and a paucity and imbalance between costimulatory and coinhibitory ligands on epithelial cells that potentially limits sterilizing immunity (replication termination) to Chlamydia-specific T cells activated with limited or unconventional second signals.

Also flagged:ALSFUSRNA binding proteinsmembraneribonucleoproteinRNP
Journal Article 2015-10-29 ✓ 2 Snippets Murakami T, Qamar S, Lin JQ, Schierle GS, Rees E, Miyashita A, Costa AR, Dodd RB, Chan FT, Michel CH, Kronenberg-Versteeg D, Li Y, Yang SP, Wakutani Y, Meadows W, Ferry RR, Dong L, Tartaglia GG, Favrin G, Lin WL, Dickson DW, Zhen M, Ron D, Schmitt-Ulms G, Fraser PE, Shneider NA, Holt C, Vendruscolo M, Kaminski CF, Kaminski CF, St George-Hyslop P.
In-Text Gene Mentions

…μM GFP-SMN or GFP-Stau1protein was mixed…

…of GFP-SMN or GFP-Stau1.…

Show Full Abstract

The mechanisms by which mutations in FUS and other RNA binding proteins cause ALS and FTD remain controversial. We propose a model in which low-complexity (LC) domains of FUS drive its physiologically reversible assembly into membrane-free, liquid droplet and hydrogel-like structures. ALS/FTD mutations in LC or non-LC domains induce further phase transition into poorly soluble fibrillar hydrogels distinct from conventional amyloids. These assemblies are necessary and sufficient for neurotoxicity in a C. elegans model of FUS-dependent neurodegeneration. They trap other ribonucleoprotein (RNP) granule components and disrupt RNP granule function. One consequence is impairment of new protein synthesis by cytoplasmic RNP granules in axon terminals, where RNP granules regulate local RNA metabolism and translation. Nuclear FUS granules may be similarly affected. Inhibiting formation of these fibrillar hydrogel assemblies mitigates neurotoxicity and suggests a potential therapeutic strategy that may also be applicable to ALS/FTD associated with mutations in other RNA binding proteins.

Also flagged:Histone H3.1polypeptideschromatinH3.1bindinghistone
Journal Article 2015-10-29 ✓ 2 Snippets Campos EI, Smits AH, Kang YH, Landry S, Escobar TM, Nayak S, Ueberheide BM, Durocher D, Vermeulen M, Hurwitz J, Reinberg D.
In-Text Gene Mentions

…We also find TONSL-MMS22Lto function as…

MMS22L

Show Full Abstract

Despite minimal disparity at the sequence level, mammalian H3 variants bind to distinct sets of polypeptides. Although histone H3.1 predominates in cycling cells, our knowledge of the soluble complexes that it forms en route to deposition or following eviction from chromatin remains limited. Here, we provide a comprehensive analysis of the H3.1-binding proteome, with emphasis on its interactions with histone chaperones and components of the replication fork. Quantitative mass spectrometry revealed 170 protein interactions, whereas a large-scale biochemical fractionation of H3.1 and associated enzymatic activities uncovered over twenty stable protein complexes in dividing human cells. The sNASP and ASF1 chaperones play pivotal roles in the processing of soluble histones but do not associate with the active CDC45/MCM2-7/GINS (CMG) replicative helicase. We also find TONSL-MMS22L to function as a H3-H4 histone chaperone. It associates with the regulatory MCM5 subunit of the replicative helicase.

Also flagged:solid cancerscancercolorectal cancerbreast cancerliver cancerpancreatic cancer
Journal Article 2015-10-29 ✓ 5 Snippets Shen LL, Gu DY, Zhao TT, Tang CJ, Xu Y, Chen JF.
In-Text Gene Mentions

In summary, this analysis provided strong evidence that the HFE H63D polymorphism may play a critical role in the increased aggressiveness of hepatocellular carcinoma and pancreatic cancer.

PubMed and EMBASE databases were searched for articles associating the HFE H63D polymorphism with cancer risk.

A number of previous studies have demonstrated that the HFE H63D polymorphism is associated with increased risk of incidence multiple types of cancer, including colorectal cancer, breast cancer, liver cancer, pancreatic cancer, and gynecological malignant tumors.

…polymorphism in theHFEgene in increased…

…demonstrated that theHFEH63D polymorphism is…

Show Full Abstract

A number of previous studies have demonstrated that the HFE H63D polymorphism is associated with increased risk of incidence multiple types of cancer, including colorectal cancer, breast cancer, liver cancer, pancreatic cancer, and gynecological malignant tumors. However, the clinical outcomes were inconsistent. Therefore, this meta-analysis was conducted to summarize the effect of the H63D variant on the incidence of solid tumor. PubMed and EMBASE databases were searched for articles associating the HFE H63D polymorphism with cancer risk. The relationships were evaluated by calculating the pooled odds ratios (ORs) with 95% confidence intervals (CIs). A total of 28 studies, including 7728 cancer cases and 11,895 controls, were identified. Statistically significant associations were identified between the HFE H63D polymorphism and solid cancer risk (CG vs CC, OR = 1.14, 95%CI = 1.07-1.23, P < 0.001; GG vs CC, OR = 1.28, 95%CI = 1.06-1.55, P = 0.010; CG/GG vs CC, OR = 1.16, 95%CI = 1.08-1.24, P < 0.001; GG vs CC/CG, OR = 1.24, 95%CI = 1.02-1.49, P = 0.027). In the subgroup analysis, we illustrated the effect of the H63D polymorphism on hepatocellular carcinoma and pancreatic cancer risk, particularly in the Asian and African subgroups; however, this was not observed in gynecological malignant tumors. In summary, this analysis provided strong evidence that the HFE H63D polymorphism may play a critical role in the increased aggressiveness of hepatocellular carcinoma and pancreatic cancer.

Also flagged:mucopolysaccharidosis type IVAMorquio A syndromemucopolysaccharidosis IVAMPS IVAMPSautosomal recessive lysosomal storage disorder
Journal Article 2015-10-29 No Snippets Tomatsu S, Sawamoto K, Shimada T, Bober MB, Kubaski F, Yasuda E, Mason RW, Khan S, Alméciga-Díaz CJ, Barrera LA, Mackenzie WG, Orii T.
Show Full Abstract

<h4>Introduction</h4>Following a Phase III, randomized, double-blind, placebo (PBO)-controlled, multinational study in subjects with mucopolysaccharidosis IVA (MPS IVA), enzyme replacement therapy (ERT) of elosulfase alfa has been approved in several countries. The study was designed to evaluate safety and efficacy of elosulfase alfa in patients with MPS IVA aged 5 years and older.<h4>Areas covered</h4>Outcomes of clinical trials for MPS IVA have been described. Subjects received either 2.0 mg/kg/week, 2.0 mg/kg/every other week, or PBO, for 24 weeks. The primary endpoint was the change from baseline 6-min walk test (6MWT) distance compared to PBO. The 6MWT results improved in patients receiving 2 mg/kg weekly compared to PBO. The every other week regimen resulted in walk distances comparable to PBO. There was no change from baseline in the 3 Min Stair Climb Test in both treatment groups. Following completion of the initial study, patients, who continued to receive elosulfase alfa 2 mg/kg weekly (QW) for another 48 weeks (for a total of up to 72-week exposure), did not show additional improvement on 6MWT.<h4>Expert opinion</h4>We suggest that ERT is a therapeutic option for MPS IVA, providing a modest effect and the majority of the effects are seen in the soft tissues.

Also flagged:Sostprostate cancergene expressionmetabolismcancerMALAT1
Journal Article 2015-10-29 No Snippets Sebastian A, Hum NR, Hudson BD, Loots GG.
Show Full Abstract

Dynamic interaction between prostate cancer and the bone microenvironment is a major contributor to metastasis of prostate cancer to bone. In this study, we utilized an in vitro co-culture model of PC3 prostate cancer cells and osteoblasts followed by microarray based gene expression profiling to identify previously unrecognized prostate cancer-bone microenvironment interactions. Factors secreted by PC3 cells resulted in the up-regulation of many genes in osteoblasts associated with bone metabolism and cancer metastasis, including Mmp13, Il-6 and Tgfb2, and down-regulation of Wnt inhibitor Sost. To determine whether altered Sost expression in the bone microenvironment has an effect on prostate cancer metastasis, we co-cultured PC3 cells with Sost knockout (Sost(KO)) osteoblasts and wildtype (WT) osteoblasts and identified several genes differentially regulated between PC3-Sost(KO) osteoblast co-cultures and PC3-WT osteoblast co-cultures. Co-culturing PC3 cells with WT osteoblasts up-regulated cancer-associated long noncoding RNA (lncRNA) MALAT1 in PC3 cells. MALAT1 expression was further enhanced when PC3 cells were co-cultured with Sost(KO) osteoblasts and treatment with recombinant Sost down-regulated MALAT1 expression in these cells. Our results suggest that reduced Sost expression in the tumor microenvironment may promote bone metastasis by up-regulating MALAT1 in prostate cancer.

Also flagged:schizophreniaChildhood-onset schizophrenianeurodevelopmental disorderadult-onset schizophreniaautismpsychiatric disorders
Journal Article 2015-10-28 No Snippets Ambalavanan A, Girard SL, Ahn K, Zhou S, Dionne-Laporte A, Spiegelman D, Bourassa CV, Gauthier J, Hamdan FF, Xiong L, Dion PA, Joober R, Rapoport J, Rouleau GA.
Show Full Abstract

Childhood-onset schizophrenia (COS), defined by the onset of illness before age 13 years, is a rare severe neurodevelopmental disorder of unknown etiology. Recently, sequencing studies have identified rare, potentially causative de novo variants in sporadic cases of adult-onset schizophrenia and autism. In this study, we performed exome sequencing of 17 COS trios in order to test whether de novo variants could contribute to this disease. We identified 20 de novo variants in 17 COS probands, which is consistent with the de novo mutation rate reported in the adult form of the disease. Interestingly, the missense de novo variants in COS have a high likelihood for pathogenicity and were enriched for genes that are less tolerant to variants. Among the genes found disrupted in our study, SEZ6, RYR2, GPR153, GTF2IRD1, TTBK1 and ITGA6 have been previously linked to neuronal function or to psychiatric disorders, and thus may be considered as COS candidate genes.

Also flagged:metabolismchromosomeslactationslactationinseminationscalving
Journal Article 2015-10-28 ✓ 1 Snippet de Camargo GM, Aspilcueta-Borquis RR, Fortes MR, Porto-Neto R, Cardoso DF, Santos DJ, Lehnert SA, Reverter A, Moore SS, Tonhati H.
In-Text Gene Mentions

…In this context,CA10might be a…

Show Full Abstract

<h4>Background</h4>Asian buffaloes (Bubalus bubalis) have an important socio-economic role. The majority of the population is situated in developing countries. Due to the scarce resources in these countries, very few species-specific biotechnology tools exist and a lot of cattle-derived technologies are applied to buffaloes. However, the application of cattle genomic tools to buffaloes is not straightforward and, as results suggested, despite genome sequences similarity the genetic polymorphisms are different.<h4>Results</h4>The first SNP chip genotyping platform designed specifically for buffaloes has recently become available. Herein, a genome-wide association study (GWAS) and gene network analysis carried out in buffaloes is presented. Target phenotypes were six milk production and four reproductive traits. GWAS identified SNP with significant associations and suggested candidate genes that were specific to each trait and also genes with pleiotropic effect, associated to multiple traits.<h4>Conclusions</h4>Network predictions of interactions between these candidate genes may guide further molecular analyses in search of disruptive mutations, help select genes for functional experiments and evidence metabolism differences in comparison to cattle. The cattle SNP chip does not offer an optimal coverage of buffalo genome, thereafter the development of new buffalo-specific genetic technologies is warranted. An annotated reference genome would greatly facilitate genetic research, with potential impact to buffalo-based dairy production.

Also flagged:Breast CancerpigmentationCancertumorresponse totelangiectasia
Journal Article 2015-10-28 No Snippets Dorling L, Barnett GC, Michailidou K, Coles CE, Burnet NG, Yarnold J, Elliott RM, Dunning AM, Pharoah PD, West CM.
Show Full Abstract

<h4>Purpose</h4>It has been hypothesized that increased predisposition to breast cancer may correlate with radiosensitivity, and thus increased risk of toxicity following breast irradiation. This study investigated the relationship between common breast cancer risk variants and radiotherapy toxicity.<h4>Experimental design</h4>SNP genotypes were determined in female breast cancer patients from the RAPPER (Radiogenomics: Assessment of polymorphisms for predicting the effects of radiotherapy) study using the Illumina CytoSNP12 genome-wide array. A further 15,582,449 genotypes were imputed using the 1000 Genomes Project reference panel. Patient (n = 1,160) polygenic risk scores were generated by summing risk-allele dosages, both unweighted and weighted by published effect sizes for breast cancer risk. Regression models were used to test associations of individual variants and polygenic risk scores with acute and late toxicity phenotypes (telangiectasia, breast edema, photographically assessed shrinkage, induration, pigmentation, breast pain, breast sensitivity, and overall toxicity).<h4>Results</h4>Genotypes of 90 confirmed breast cancer risk variants were accurately determined and polygenic risk scores were approximately normally distributed. Variant rs6964587 was associated with increased breast edema 5 years following radiotherapy (Beta, 0.22; 95% confidence interval, 0.09-0.34; P = 7 × 10(-4)). No other associations were found between individual variants or the unweighted (P > 0.17) or weighted (P > 0.13) polygenic risk score and radiotherapy toxicity. This study had >87% power to detect an association between the polygenic risk score (relative risk > 1.1) and toxicity.<h4>Conclusions</h4>Cancer patients with a high polygenic predisposition to breast cancer do not have an increased risk of radiotherapy toxicity up to 5 years following radiotherapy but individual variants may increase risk.

Also flagged:calcium phosphatecalcium phosphatesmagnesium phosphatescalcium sulfate hemihydratecalcium ionshydroxyapatite
Journal Article 2015-10-28 No Snippets Olkowski R, Kaszczewski P, Czechowska J, Siek D, Pijocha D, Zima A, Ślósarczyk A, Lewandowska-Szumieł M.
Show Full Abstract

Calcium phosphate cements (CPC) are valuable bone fillers. Recently they have been also considered as the basis for drug-, growth factors- or cells-delivery systems. Broad possibilities to manipulate CPC composition provide a unique opportunity to obtain materials with a wide range of physicochemical properties. In this study we show that CPC composition significantly influences cell response. Human bone derived cells were exposed to the several well-characterized different cements based on calcium phosphates, magnesium phosphates and calcium sulfate hemihydrate (CSH). Cell viability assays, live/dead staining and real-time observation of cells in contact with the materials (time-laps) were performed. Although all the investigated materials have successfully passed a standard cytocompatibility assay, cell behavior in a direct contact with the materials varied depending on the material and the experimental system. The most recommended were the α-TCP-based materials which proved suitable as a support for cells in a direct contact. The materials which caused a decrease of calcium ions concentration in culture induced the negative cell response, however this effect might be expected efficiently compensated in vivo. All the materials consisting of CSH had negative impact on the cells. The obtained results strongly support running series of cytocompatibility studies for preclinical evaluation of bone cements.

Also flagged:Sp1SUMO2degradationubiquitinproteasomeRNF4
Journal Article 2015-10-28 No Snippets Wang M, Sang J, Ren Y, Liu K, Liu X, Zhang J, Wang H, Wang J, Orian A, Yang J, Yi J.
Show Full Abstract

SUMOylation is recently found to function as a targeting signal for the degradation of substrates through the ubiquitin-proteasome system. RNF4 is the most studied human SUMO-targeted ubiquitin E3 ligase. However, the relationship between SUMO proteases, SENPs, and RNF4 remains obscure. There are limited examples of the SENP regulation of SUMO2/3-targeted proteolysis mediated by RNF4. The present study investigated the role of SENP3 in the global protein turnover related to SUMO2/3-targeted ubiquitination and focused in particular on the SENP3 regulation of the stability of Sp1. Our data demonstrated that SENP3 impaired the global ubiquitination profile and promoted the accumulation of many proteins. Sp1, a cancer-associated transcription factor, was among these proteins. SENP3 increased the level of Sp1 protein via antagonizing the SUMO2/3-targeted ubiquitination and the consequent proteasome-dependent degradation that was mediated by RNF4. De-conjugation of SUMO2/3 by SENP3 attenuated the interaction of Sp1 with RNF4. In gastric cancer cell lines and specimens derived from patients and nude mice, the level of Sp1 was generally increased in parallel to the level of SENP3. These results provided a new explanation for the enrichment of the Sp1 protein in various cancers, and revealed a regulation of SUMO2/3 conjugated proteins whose levels may be tightly controlled by SENP3 and RNF4.

Also flagged:Meganucleasestranslationalmeganucleasetranscription activator-like effector nucleasessevere combined immunodeficiencyrecombination activating gene 2
Journal Article 2015-10-28 ✓ 1 Snippet Redel BK, Prather RS.
In-Text Gene Mentions

HTT

Show Full Abstract

Animal models of human diseases are critically necessary for developing an in-depth knowledge of disease development and progression. In addition, animal models are vital to the development of potential treatments or even cures for human diseases. Pigs are exceptional models as their size, physiology, and genetics are closer to that of humans than rodents. In this review, we discuss the use of pigs in human translational research and the evolving technology that has increased the efficiency of genetically engineering pigs. With the emergence of the clustered, regularly interspaced, short palindromic repeat (CRISPR)/CRISPR-associated (Cas) protein 9 system technology, the cost and time it takes to genetically engineer pigs has markedly decreased. We will also discuss the use of another meganuclease, the transcription activator-like effector nucleases , to produce pigs with severe combined immunodeficiency by developing targeted modifications of the recombination activating gene 2 (RAG2).RAG2mutant pigs may become excellent animals to facilitate the development of xenotransplantation, regenerative medicine, and tumor biology. The use of pig biomedical models is vital for furthering the knowledge of, and for treating human, diseases.

Also flagged:Heterogeneous nuclear ribonucleoprotein A1Drp1neuroblastomamitochondrialpathogenesisneurodegenerative diseases
Journal Article 2015-10-28 ✓ 4 Snippets Park SJ, Lee H, Jo DS, Jo YK, Shin JH, Kim HB, Seo HM, Rubinsztein DC, Koh JY, Lee EK, Cho DH.
In-Text Gene Mentions

HD is an autosomal dominant condition caused by abnormal expansions in a CAG repeat tract in the huntingtin gene (HTT), resulting in an abnormally long poly-glutamine stretch in the protein which renders it aggregate-prone [8].

HD is caused by mutations of the Huntingtin (HTT).

…the huntingtin gene (HTT), resulting in an…

…the Huntingtin (HTT).…

Show Full Abstract

Excessive mitochondrial fission is associated with the pathogenesis of neurodegenerative diseases. Dynamin-related protein 1 (Drp1) possesses specific fission activity in the mitochondria and peroxisomes. Various post-translational modifications of Drp1 are known to modulate complex mitochondrial dynamics. However, the post-transcriptional regulation of Drp1 remains poorly understood. Here, we show that the heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) regulates Drp1 expression at the post-transcriptional level. hnRNP A1 directly interacts with Drp1 mRNA at its 3'UTR region, and enhances translation potential without affecting mRNA stability. Down-regulation of hnRNP A1 induces mitochondrial elongation by reducing Drp1 expression. Moreover, depletion of hnRNP A1 suppresses 3-NP-mediated mitochondrial fission and dysfunction. In contrast, over-expression of hnRNP A1 promotes mitochondrial fragmentation by increasing Drp1 expression. Additionally, hnRNP A1 significantly exacerbates 3-NP-induced mitochondrial dysfunction and cell death in neuroblastoma cells. Interestingly, treatment with 3-NP induces subcellular translocation of hnRNP A1 from the nucleus to the cytoplasm, which accelerates the increase in Drp1 expression in hnRNP A1 over-expressing cells. Collectively, our findings suggest that hnRNP A1 controls mitochondrial dynamics by post-transcriptional regulation of Drp1.

Also flagged:immune responseresponse to woundingdefense responsechemotaxisinflammatory responsescytokine
Journal Article 2015-10-28 No Snippets Yang S, Cai Q, Vethanayagam RR, Wang J, Yang W, Hu BH.
Show Full Abstract

Our previous RNA-sequencing analysis of the rat cochlear genes identified multiple biological processes and molecular pathways in the cochlear response to acoustic overstimulation. However, the biological processes and molecular pathways that are common to other species have not been documented. The identification of these common stress processes is pivotal for a better understanding of the essential response of the cochlea to acoustic injury. Here, we compared the RNA-sequencing data collected from mice and rats that sustained a similar, but not identical, acoustic injury. The transcriptome analysis of cochlear genes identified the differentially expressed genes in the mouse and rat samples. Bioinformatics analysis revealed a marked similarity in the changes in the biological processes between the two species, although the differentially expressed genes did not overlap well. The common processes associated with the differentially expressed genes are primarily associated with immunity and inflammation, which include the immune response, response to wounding, the defense response, chemotaxis and inflammatory responses. Moreover, analysis of the molecular pathways showed considerable overlap between the two species. The common pathways include cytokine-cytokine receptor interactions, the chemokine signaling pathway, the Toll-like receptor signaling pathway, and the NOD-like receptor signaling pathway. Further analysis of the transcriptional regulators revealed common upstream regulators of the differentially expressed genes, and these upstream regulators are also functionally related to the immune and inflammatory responses. These results suggest that the immune and inflammatory responses are the essential responses to acoustic overstimulation in the cochlea.

Also flagged:schizophreniadendritic spinesmitochondrialdendritic spinegene expressionBehavior
Journal Article 2015-10-28 ✓ 2 Snippets Hjelm BE, Rollins B, Mamdani F, Lauterborn JC, Kirov G, Lynch G, Gall CM, Sequeira A, Vawter MP.
In-Text Gene Mentions

DARS2

MRPL39

Show Full Abstract

Genetic evidence has supported the hypothesis that schizophrenia (SZ) is a polygenic disorder caused by the disruption in function of several or many genes. The most common and reproducible cellular phenotype associated with SZ is a reduction in dendritic spines within the neocortex, suggesting alterations in dendritic architecture may cause aberrant cortical circuitry and SZ symptoms. Here, we review evidence supporting a multifactorial model of mitochondrial dysfunction in SZ etiology and discuss how these multiple paths to mitochondrial dysfunction may contribute to dendritic spine loss and/or underdevelopment in some SZ subjects. The pathophysiological role of mitochondrial dysfunction in SZ is based upon genomic analyses of both the mitochondrial genome and nuclear genes involved in mitochondrial function. Previous studies and preliminary data suggest SZ is associated with specific alleles and haplogroups of the mitochondrial genome, and also correlates with a reduction in mitochondrial copy number and an increase in synonymous and nonsynonymous substitutions of mitochondrial DNA. Mitochondrial dysfunction has also been widely implicated in SZ by genome-wide association, exome sequencing, altered gene expression, proteomics, microscopy analyses, and induced pluripotent stem cell studies. Together, these data support the hypothesis that SZ is a polygenic disorder with an enrichment of mitochondrial targets.

Also flagged:pridopidineHuntington diseaseHDneurodegenerative diseasechoreadystonia
Journal Article 2015-10-28 ✓ 5 Snippets Squitieri F, de Yebenes JG.
In-Text Gene Mentions

HD is caused by a CAG-repeat expanded mutation in the HTT gene, which encodes the huntingtin protein.

HD is associated with an expanded CAG-repeat mutation in the HTT gene that encodes the huntingtin protein (Htt).3,4 A CAG stretch expansion beyond 35 repeats is associated with the disease.4 Repeats in the range 36–39 are considered as low penetrance mutations (ie, the disease may start late or never during life), while full penetrance mutations (ie, all clinical manifestations are expected to present during life) are associated with ≥40 CAG repeats.4 The mutation is unstable during intergenerational transmission.

…functions of theHttprotein are not…

…the huntingtin protein (Htt).…

…stretch in theHttprotein, thus amplifying…

Show Full Abstract

Huntington disease (HD) is a chronic, genetic, neurodegenerative disease for which there is no cure. The main symptoms of HD are abnormal involuntary movements (chorea and dystonia), impaired voluntary movements (ie, incoordination and gait balance), progressive cognitive decline, and psychiatric disturbances. HD is caused by a CAG-repeat expanded mutation in the HTT gene, which encodes the huntingtin protein. The inherited mutation results in the production of an elongated polyQ mutant huntingtin protein (mHtt). The cellular functions of the Htt protein are not yet fully understood, but the functions of its mutant variant are thought to include alteration of gene transcription and energy production, and dysregulation of neurotransmitter metabolism, receptors, and growth factors. The phenylpiperidines pridopidine (4-[3-methanesulfonyl-phenyl]-1-propyl-piperidine; formerly known as ACR16) and OSU6162 ([S]-[-]-3-[3-methane [sulfonyl-phenyl]-1-propyl-piperidine) are members of a new class of pharmacologic agents known as "dopamine stabilizers". Recent clinical trials have highlighted the potential of pridopidine for symptomatic treatment of patients with HD. More recently, the analysis of HD models (ie, in vitro and in mice) highlighted previously unknown effects of pridopidine (increase in brain-derived neurotrophic factor, reduction in mHtt levels, and σ-1 receptor binding and modulation). These additional functions of pridopidine suggest it might be a neuroprotective and disease-modifying drug. Data from ongoing clinical trials of pridopidine will help define its place in the treatment of HD. This commentary examines the available preclinical and clinical evidence regarding the use of pridopidine in HD.

Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative disease3-nitropropionic acidbehavioraloxygen
Journal Article 2015-10-28 ✓ 4 Snippets Courtes AA, Arantes LP, Barcelos RP, da Silva IK, Boligon AA, Athayde ML, Puntel RL, Soares FA.
In-Text Gene Mentions

This neurodegenerative disorder is believed to be caused by an expanded trinucleotide CAG sequence in exon 1 of the Huntingtin gene (Htt), which encodes a stretch of glutamines in the Huntingtin protein [5].

Formation of Htt aggregates and alteration of overall gene expression profiles have also been reported in peripheral tissues of HD patients [6, 7].

…the Huntingtin gene (Htt), which encodes a…

…Formation ofHttaggregates and alteration…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease. Accordingly, 3-nitropropionic acid (3-NP) has been found to effectively produce HD-like symptoms. Luehea divaricata (L. divaricata), popularly known in Brazil as "açoita-cavalo," may act as a neuroprotective agent in vitro and in vivo. We evaluated the hypothesis that the aqueous extract of L. divaricata could prevent behavioral and oxidative alterations induced by 3-NP in rats. 25 adult Wistar male rats were divided into 5 groups: (1) control, (2) L. divaricata (1000 mg/kg), (3) 3-NP, (4) L. divaricata (500 mg/kg) + 3-NP, and (5) L. divaricata (1000 mg/kg) + 3-NP. Groups 2, 4, and 5 received L. divaricata via intragastric gavage daily for 10 days. Animals in groups 3, 4, and 5 received 20 mg/kg 3-NP daily from days 8-10. At day 10, parameters of locomotor activity and biochemical evaluations were performed. Indeed, rats treated with 3-NP showed decreased locomotor activity compared to controls. Additionally, 3-NP increased levels of reactive oxygen species and lipid peroxidation and decreased ratio of GSH/GSSG and acetylcholinesterase activity in cortex and/or striatum. Our results suggest that rats pretreated with L. divaricata prior to 3-NP treatment showed neuroprotective effects when compared to 3-NP treated controls, which may be due to its antioxidant properties.

Also flagged:response tohormonegrowth hormone deficiencygrowth hormonegene expressionNANOG
Journal Article 2015-10-27 ✓ 1 Snippet De Leonibus C, Chatelain P, Knight C, Clayton P, Stevens A.
In-Text Gene Mentions

…d transcriptional regulation (MLLT10and MSX1) (…

Show Full Abstract

The response to growth hormone in humans is dependent on phenotypic, genetic and environmental factors. The present study in children with growth hormone deficiency (GHD) collected worldwide characterised gene-environment interactions on growth response to recombinant human growth hormone (r-hGH). Growth responses in children are linked to latitude, and we found that a correlate of latitude, summer daylight exposure (SDE), was a key environmental factor related to growth response to r-hGH. In turn growth response was determined by an interaction between both SDE and genes known to affect growth response to r-hGH. In addition, analysis of associated networks of gene expression implicated a role for circadian clock pathways and specifically the developmental transcription factor NANOG. This work provides the first observation of gene-environment interactions in children treated with r-hGH.

Also flagged:chronic obstructive pulmonary diseaseCOPDCDH13KCNK1KCNJ2potassium channel
Journal Article 2015-10-27 No Snippets Hardin M, Cho MH, McDonald ML, Wan E, Lomas DA, Coxson HO, MacNee W, Vestbo J, Yates JC, Agusti A, Calverley PM, Celli B, Crim C, Rennard S, Wouters E, Bakke P, Bhatt SP, Kim V, Ramsdell J, Regan EA, Make BJ, Hokanson JE, Crapo JD, Beaty TH, Hersh CP, ECLIPSE and COPDGene Investigators, COPDGene Investigators—clinical centers.
Show Full Abstract

Short-acting β2-agonist bronchodilators are the most common medications used in treating chronic obstructive pulmonary disease (COPD). Genetic variants determining bronchodilator responsiveness (BDR) in COPD have not been identified. We performed a genome-wide association study (GWAS) of BDR in 5789 current or former smokers with COPD in one African-American and four white populations. BDR was defined as the quantitative spirometric response to inhaled β2-agonists. We combined results in a meta-analysis. In the meta-analysis, single-nucleotide polymorphisms (SNPs) in the genes KCNK1 (P=2.02 × 10(-7)) and KCNJ2 (P=1.79 × 10(-7)) were the top associations with BDR. Among African Americans, SNPs in CDH13 were significantly associated with BDR (P=5.1 × 10(-9)). A nominal association with CDH13 was identified in a gene-based analysis in all subjects. We identified suggestive association with BDR among COPD subjects for variants near two potassium channel genes (KCNK1 and KCNJ2). SNPs in CDH13 were significantly associated with BDR in African Americans.The Pharmacogenomics Journal advance online publication, 27 October 2015; doi:10.1038/tpj.2015.65.

Also flagged:nucleoside triphosphatesnucleosidereverse transcriptasephosphorylationnucleoside triphosphateacyl
Journal Article 2015-10-27 No Snippets Gollnest T, de Oliveira TD, Schols D, Balzarini J, Meier C.
Show Full Abstract

The antiviral activity of nucleoside reverse transcriptase inhibitors is often limited by ineffective phosphorylation. We report on a nucleoside triphosphate (NTP) prodrug approach in which the γ-phosphate of NTPs is bioreversibly modified. A series of TriPPPro-compounds bearing two lipophilic masking units at the γ-phosphate and d4T as a nucleoside analogue are synthesized. Successful delivery of d4TTP is demonstrated in human CD4(+) T-lymphocyte cell extracts by an enzyme-triggered mechanism with high selectivity. In antiviral assays, the compounds are potent inhibitors of HIV-1 and HIV-2 in CD4(+) T-cell (CEM) cultures. Highly lipophilic acyl residues lead to higher membrane permeability that results in intracellular delivery of phosphorylated metabolites in thymidine kinase-deficient CEM/TK(-) cells with higher antiviral activity than the parent nucleoside.

Also flagged:FXRFGF15bile acidreceptorfarnesoid X receptorsynthesis
Journal Article 2015-10-27 ✓ 1 Snippet Fu T, Kim YC, Byun S, Kim DH, Seok S, Suino-Powell K, Xu HE, Kemper B, Kemper JK.
In-Text Gene Mentions

histone modifying corepressor

Show Full Abstract

The bile acid (BA)-sensing nuclear receptor, farnesoid X receptor (FXR), regulates postprandial metabolic responses, including inhibition of BA synthesis, by inducing the intestinal hormone, fibroblast growth factor (FGF)15 (FGF19 in human). In this study, we tested a novel hypothesis that FXR not only induces intestinal FGF15 but also primes the liver for effectively responding to the signal by transcriptional induction of the obligate coreceptor for FGF15, β-Klotho (βKL). Activation of FXR by a synthetic agonist, GW4064, in mice increased occupancy of FXR and its DNA-binding partner, retinoid X receptor-α, at FGF15-signaling component genes, particularly βKL, and induced expression of these genes. Interestingly, mRNA levels of Fgfr4, the FGF15 receptor, were not increased by GW4064, but protein levels increased as a result of βKL-dependent increased protein stability. Both FGF receptor 4 and βKL protein levels were substantially decreased in FXR-knockout (KO) mice, and FGF19 signaling, monitored by phosphorylated ERK, was blunted in FXR-KO mice, FXR-KO mouse hepatocytes, and FXR-down-regulated human hepatocytes. Overexpression of βKL in FXR-lacking hepatocytes partially restored FGF19 signaling and inhibition by FGF19 of Cyp7a1, which encodes the rate-limiting BA biosynthetic enzyme. In mice, transient inductions of intestinal Fgf15 and hepatic βKL were temporally correlated after GW4064 treatment, and pretreatment of hepatocytes with GW4064 before FGF19 treatment enhanced FGF19 signaling, which was abolished by transcriptional inhibition or βKL down-regulation. This study identifies FXR as a gut-liver metabolic coordinator for FGF15/19 action that orchestrates transient induction of hepatic βKL and intestinal Fgf15/19 in a temporally correlated manner.

Also flagged:Sox11binding proteinsinhibitor of apoptosisIAPcaspase-6localization
Journal Article 2015-10-27 ✓ 2 Snippets Waldron-Roby E, Hoerauf J, Arbez N, Zhu S, Kulcsar K, Ross CA.
In-Text Gene Mentions

Proteins central to neurodegenerative diseases, such as Htt in HD, as well as amyloid precursor protein (APP), tau, and presenilin in Alzheimer’s disease (AD) are all caspase-6 substrates.

…diseases, such asHttin HD, as…

Show Full Abstract

The apoptotic cascade is an orchestrated event, whose final stages are mediated by effector caspases. Regulatory binding proteins have been identified for caspases such as caspase-3, -7, -8, and -9. Many of these proteins belong to the inhibitor of apoptosis (IAP) family. By contrast, caspase-6 is not believed to be influenced by IAPs, and little is known about its regulation. We therefore performed a yeast-two-hybrid screen using a constitutively inactive form of caspase-6 for bait in order to identify novel regulators of caspase-6 activity. Sox11 was identified as a potential caspase-6 interacting protein. Sox11 was capable of dramatically reducing caspase-6 activity, as well as preventing caspase-6 self- cleavage. Several regions, including amino acids 117-214 and 362-395 within sox11 as well as a nuclear localization signal (NLS) all contributed to the reduction in caspase-6 activity. Furthermore, sox11 was also capable of decreasing other effector caspase activity but not initiator caspases -8 and -9. The ability of sox11 to reduce effector caspase activity was also reflected in its capacity to reduce cell death following toxic insult. Interestingly, other sox proteins also had the ability to reduce caspase-6 activity but to a lesser extent than sox11.

Also flagged:Ion channelstranscription factorsNpas4transcription factoranion channelscyclic nucleotide
Journal Article 2015-10-27 ✓ 5 Snippets Akita T, Kumada T, Yoshihara S, Egea J, Yamagishi S.
In-Text Gene Mentions

…it interacts withDCC receptorsreceptors, and of…

…increase of theDCClevels on the…

…indicated that increasedDCClevels are required…

…basal levels ofDCC, Robo1 and Unc5…

…increase in surfaceDCClevels upon Slit…

Show Full Abstract

Our sophisticated thoughts and behaviors are based on the miraculous development of our complex nervous network system, in which many different types of proteins and signaling cascades are regulated in a temporally and spatially ordered manner. Here we review our recent attempts to grasp the principles of nervous system development in terms of general cellular phenomena and molecules, such as volume-regulated anion channels, intracellular Ca(2+) and cyclic nucleotide signaling, the Npas4 transcription factor and the FLRT family of axon guidance molecules. We also present an example illustrating that the same FLRT family may regulate the development of vascular networks as well. The aim of this review is to open up new vistas for understanding the intricacy of nervous and vascular system development.

Also flagged:NETserotoninnorepinephrinepanic disorderserotonin transporternorepinephrine transporter
Journal Article 2015-10-27 ✓ 2 Snippets Park HJ, Kim SK, Kang WS, Kim YJ, Cho AR, Park JK.
In-Text Gene Mentions

<h4>Background</h4>This is a pilot study assessing the impact of polymorphisms of serotonin transporter (5-HTT; 5-HTTLPR (S/L)) and norepinephrine transporter (NET; rs2242446 (T/C)) genes on selective serotonin reuptake inhibitors (SSRIs) and serotonin/norepinephrine reuptake inhibitors (SNRIs) response in Korean panic disorder (PD) patients.<h4>Methods</h4>PD patients were treated with SSRI (n = 18) or SNRI (n = 6) for 4 weeks.

…of serotonin transporter (5-HTT; 5-HTTLPR (S/L)) and…

Show Full Abstract

<h4>Background</h4>This is a pilot study assessing the impact of polymorphisms of serotonin transporter (5-HTT; 5-HTTLPR (S/L)) and norepinephrine transporter (NET; rs2242446 (T/C)) genes on selective serotonin reuptake inhibitors (SSRIs) and serotonin/norepinephrine reuptake inhibitors (SNRIs) response in Korean panic disorder (PD) patients.<h4>Methods</h4>PD patients were treated with SSRI (n = 18) or SNRI (n = 6) for 4 weeks. Panic Disorder Severity Scale (PDSS) was rated to evaluate the treatment response. Wilcoxon signed-rank test was used to compare PDSS scores before and after medication (SSRI or SNRI) as well as to compare those according to genotypes. Mann-Whitney U test was used to compare those between the two groups (SSRI or SNRI).<h4>Results</h4>Both SSRI and SNRI treatments for 4 weeks significantly reduced PDSS scores. We assessed the impact of rs2242446 on this effect of SSRI and SNRI. The scores were significantly decreased after 4 weeks in the SSRI-treated group regardless of genotypes of rs2242446, whereas they were significantly decreased in the SNRI-treated group with only non-C carrier (TT) of rs2242446. On 5-HTTLPR we could not analyse because 22 patients had SS genotype.<h4>Conclusions</h4>These results suggest that NET polymorphism may affect the SNRI response in Korean PD patients.

Also flagged:behavioralsynapsesHDM 4 muscarinic receptorsgenetic disorderM 4 muscarinic acetylcholine receptor
Journal Article 2015-10-27 ✓ 1 Snippet Pancani T, Foster DJ, Moehle MS, Bichell TJ, Bradley E, Bridges TM, Klar R, Poslusney M, Rook JM, Daniels JS, Niswender CM, Jones CK, Wood MR, Bowman AB, Lindsley CW, Xiang Z, Conn PJ.
In-Text Gene Mentions

Htt

Show Full Abstract

Mutations that lead to Huntington's disease (HD) result in increased transmission at glutamatergic corticostriatal synapses at early presymptomatic stages that have been postulated to set the stage for pathological changes and symptoms that are observed at later ages. Based on this, pharmacological interventions that reverse excessive corticostriatal transmission may provide a novel approach for reducing early physiological changes and motor symptoms observed in HD. We report that activation of the M4 subtype of muscarinic acetylcholine receptor reduces transmission at corticostriatal synapses and that this effect is dramatically enhanced in presymptomatic YAC128 HD and BACHD relative to wild-type mice. Furthermore, chronic administration of a novel highly selective M4 positive allosteric modulator (PAM) beginning at presymptomatic ages improves motor and synaptic deficits in 5-mo-old YAC128 mice. These data raise the exciting possibility that selective M4 PAMs could provide a therapeutic strategy for the treatment of HD.

Also flagged:cancernucleotidestumorgene expressionpeptidesRNA polymerase II
Journal Article 2015-10-27 ✓ 1 Snippet Silva A, Bullock M, Calin G, Calin G.
In-Text Gene Mentions

…their stability, triggeringSTAU1-mediated mRNA degradation […

Show Full Abstract

Non-coding RNAs have long been associated with cancer development and progression, and since their earliest discovery, their clinical potential in identifying and characterizing the disease has been pursued. Long non-coding (lncRNAs), a diverse class of RNA transcripts >200 nucleotides in length with limited protein coding potential, has been only modestly studied relative to other categories of non-coding RNAs. However, recent data suggests they too may be important players in cancer. In this article, we consider the value of lncRNAs in the clinical setting, and in particular their potential roles as diagnostic and prognostic markers in cancer. Furthermore, we summarize the most significant studies linking lncRNA expression in human biological samples to cancer outcomes. The diagnostic sensitivity, specificity and validity of these non-coding RNA transcripts is compared in the various biological compartments in which they have been detected including tumor tissue, whole body fluids and exosomes.

Also flagged:Transcription FactorsHb Fbeta-hemoglobinopathiesbindingHbHBG1
Journal Article 2015-10-27 ✓ 2 Snippets de Souza Carrocini GC, Venancio LP, Bonini-Domingos CR.
In-Text Gene Mentions

…including BCL11A andSOX6.…

…association with BCL11A,SOX6, FOG1, and NuRD…

Show Full Abstract

Fetal hemoglobin (Hb F) is an important genetic modulator of the beta-hemoglobinopathies. The regulation of Hb F levels is influenced by transcription factors. We used phylogenetic footprinting to screen transcription factors that have binding sites in HBG1 and HBG2 genes' noncoding regions in order to know the genetic determinants of the Hb F expression. Our analysis showed 354 conserved motifs in the noncoding regions of HBG1 gene and 231 motifs in the HBG2 gene between the analyzed species. Of these motifs, 13 showed relation to Hb F regulation: cell division cycle-5 (CDC5), myelo-blastosis viral oncogene homolog (c-MYB), transcription factor CP2 (TFCP2), GATA binding protein 1 (GATA-1), GATA binding protein 2 (GATA-2), nuclear factor erythroid 2 (NF-E2), nuclear transcription factor Y (NF-Y), runt-related transcription factor 1 (RUNX-1), T-cell acute lymphocytic leukemia 1 (TAL-1), YY1 transcription factor (YY1), beta protein 1 (BP1), chicken ovalbumin upstream promoter-transcription factor II (COUP-TFII), and paired box 1 (PAX-1). The last three motifs were conserved only in the noncoding regions of the HBG1 gene. The understanding of genetic elements involved in the maintenance of high Hb F levels may provide new efficient therapeutic strategies in the beta-hemoglobinopathies treatment, promoting reduction in clinical complications of these genetic disorders.

Also flagged:lung cancercisplatinlocal cancernanofiberLewis Lung carcinomacancer
Journal Article 2015-10-27 No Snippets Kaplan JA, Liu R, Freedman JD, Padera R, Schwartz J, Colson YL, Grinstaff MW.
Show Full Abstract

For early stage lung cancer patients, local cancer recurrence after surgical resection is a significant concern and stems from microscopic disease left behind after surgery. Here we apply a local drug delivery strategy to combat local lung cancer recurrence after resection using non-woven, biodegradable nanofiber meshes loaded with cisplatin. The meshes are fabricated using a scalable electrospinning process from two biocompatible polymers--polycaprolactone and poly(glycerol monostearate-co-caprolactone)--to afford favorable mechanical properties for use in a dynamic tissue such as the lung. Owing to their rough nanostructure and hydrophobic polymer composition, these meshes exhibit superhydrophobicity, and it is this non-wetting nature that sustains the release of cisplatin in a linear fashion over ∼90 days, with anti-cancer efficacy demonstrated using an in vitro Lewis Lung carcinoma (LLC) cell assay. The in vivo evaluation of cisplatin-loaded superhydrophobic meshes in the prevention of local cancer recurrence in a murine model of LLC surgical resection demonstrated a statistically significant increase (p = 0.0006) in median recurrence-free survival to >23 days, compared to standard intraperitoneal cisplatin therapy of equivalent dose. These results emphasize the importance of supplementing cytoreductive surgery with local drug delivery strategies to improve prognosis for lung cancer patients undergoing tumor resection.

Also flagged:OX40Interleukin-2IL-2Ewing sarcomatumortumor necrosis factor
Journal Article 2015-10-27 ✓ 1 Snippet Reuter D, Staege MS, Kühnöl CD, Föll J.
In-Text Gene Mentions

…ligand OX40L (CD252,TNFSF4) is expressed on…

Show Full Abstract

Interleukin-2 (IL-2) transgenic Ewing sarcoma cells can induce tumor specific T and NK cell responses and reduce tumor growth in vivo and in vitro. Nevertheless, the efficiency of this stimulation is not high enough to inhibit tumor growth completely. In addition to recognition of the cognate antigen, optimal T-cell stimulation requires signals from so-called co-stimulatory molecules. Several members of the tumor necrosis factor superfamily have been identified as co-stimulatory molecules that can augment antitumor immune responses. OX40 (CD134) and OX40 ligand (OX40L = CD252; also known as tumor necrosis factor ligand family member 4) is one example of such receptor/ligand pair with co-stimulatory function. In the present investigation, we generated OX40L transgenic Ewing sarcoma cells and tested their immunostimulatory activity in vitro. OX40L transgenic Ewing sarcoma cells showed preserved expression of Ewing sarcoma-associated (anti)gens including lipase member I, cyclin D1 (CCND1), cytochrome P450 family member 26B1 (CYP26B1), and the Ewing sarcoma breakpoint region 1-friend leukemia virus integration 1 (EWSR1-FLI1) oncogene. OX40L-expressing tumor cells showed a trend for enhanced immune stimulation against Ewing sarcoma cells in combination with IL-2 and stimulation of CD137. Our data suggest that inclusion of the OX40/OX40L pathway of co-stimulation might improve immunotherapy strategies for the treatment of Ewing sarcoma.

Also flagged:hemoglobinopathyγ-globinanemiahemoglobinopathiestranscriptional repressorsLSD1
Journal Article 2015-10-27 ✓ 1 Snippet Dai Y, Sangerman J, Luo HY, Fucharoen S, Chui DH, Faller DV, Perrine SP.
In-Text Gene Mentions

SOX6

Show Full Abstract

Pharmacologic augmentation of γ-globin expression sufficient to reduce anemia and clinical severity in patients with diverse hemoglobinopathies has been challenging. In studies here, representative molecules from four chemical classes, representing several distinct primary mechanisms of action, were investigated for effects on γ-globin transcriptional repressors, including components of the NuRD complex (LSD1 and HDACs 2-3), and the downstream repressor BCL11A, in erythroid progenitors from hemoglobinopathy patients. Two HDAC inhibitors (MS-275 and SB939), a short-chain fatty acid derivative (sodium dimethylbutyrate [SDMB]), and an agent identified in high-throughput screening, Benserazide, were studied. These therapeutics induced γ-globin mRNA in progenitors above same subject controls up to 20-fold, and increased F-reticulocytes up to 20%. Cellular protein levels of BCL11A, LSD-1, and KLF1 were suppressed by the compounds. Chromatin immunoprecipitation assays demonstrated a 3.6-fold reduction in LSD1 and HDAC3 occupancy in the γ-globin gene promoter with Benserazide exposure, 3-fold reduction in LSD-1 and HDAC2 occupancy in the γ-globin gene promoter with SDMB exposure, while markers of gene activation (histone H3K9 acetylation and H3K4 demethylation), were enriched 5.7-fold. These findings identify clinical-stage oral therapeutics which inhibit or displace major co-repressors of γ-globin gene transcription and may suggest a rationale for combination therapy to produce enhanced efficacy.

Also flagged:TumorColorectal Cancerepithelial-mesenchymal transitionmetastatic diseaseprimary tumorcancer
Journal Article 2015-10-27 No Snippets Hardingham JE, Grover P, Winter M, Hewett PJ, Price TJ, Thierry B.
Show Full Abstract

Circulating tumor cells (CTC) may be defined as tumor- or metastasis-derived cells that are present in the bloodstream. The CTC pool in colorectal cancer (CRC) patients may include not only epithelial tumor cells, but also tumor cells undergoing epithelial-mesenchymal transition (EMT) and tumor stem cells. A significant number of patients diagnosed with early stage CRC subsequently relapse with recurrent or metastatic disease despite undergoing "curative" resection of their primary tumor. This suggests that an occult metastatic disease process was already underway, with viable tumor cells being shed from the primary tumor site, at least some of which have proliferative and metastatic potential and the ability to survive in the bloodstream. Such tumor cells are considered to be responsible for disease relapse in these patients. Their detection in peripheral blood at the time of diagnosis or after resection of the primary tumor may identify those early-stage patients who are at risk of developing recurrent or metastatic disease and who would benefit from adjuvant therapy. CTC may also be a useful adjunct to radiological assessment of tumor response to therapy. Over the last 20 years many approaches have been developed for the isolation and characterization of CTC. However, none of these methods can be considered the gold standard for detection of the entire pool of CTC. Recently our group has developed novel unbiased inertial microfluidics to enrich for CTC, followed by identification of CTC by imaging flow cytometry. Here, we provide a review of progress on CTC detection and clinical significance over the last 20 years.

Also flagged:ThrombomodulinThrombinα-thrombinserine proteasefibrinogenprotein C
Journal Article 2015-10-26 ✓ 1 Snippet Handley LD, Treuheit NA, Venkatesh VJ, Komives EA.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

Human α-thrombin is a serine protease with dual functions. Thrombin acts as a procoagulant, cleaving fibrinogen to make the fibrin clot, but when bound to thrombomodulin (TM), it acts as an anticoagulant, cleaving protein C. A minimal TM fragment consisting of the fourth, fifth, and most of the sixth EGF-like domain (TM456m) that has been prepared has much improved solubility, thrombin binding capacity, and anticoagulant activity versus those of previous TM456 constructs. In this work, we compare backbone amide exchange of human α-thrombin in three states: apo, D-Phe-Pro-Arg-chloromethylketone (PPACK)-bound, and TM456m-bound. Beyond causing a decreased level of amide exchange at their binding sites, TM and PPACK both cause a decreased level of amide exchange in other regions including the γ-loop and the adjacent N-terminus of the heavy chain. The decreased level of amide exchange in the N-terminus of the heavy chain is consistent with the historic model of activation of serine proteases, which involves insertion of this region into the β-barrel promoting the correct conformation of the catalytic residues. Contrary to crystal structures of thrombin, hydrogen-deuterium exchange mass spectrometry results suggest that the conformation of apo-thrombin does not yet have the N-terminus of the heavy chain properly inserted for optimal catalytic activity, and that binding of TM allosterically promotes the catalytically active conformation.

Also flagged:Ironoverloadhereditary hemochromatosis type-IHHHLA -A class 1human leukocyte antigen
Journal Article 2015-10-26 ✓ 5 Snippets Branco CC, Gomes CT, De Fez L, Bulhões S, Brilhante MJ, Pereirinha T, Cabral R, Rego AC, Fraga C, Miguel AG, Brasil G, Macedo P, Mota-Vieira L.
In-Text Gene Mentions

In summary, we provide evidence that at least the complex allele HFE-c.[187C>G;340+4T>C] has a role, as a genetic predisposition factor, on iron overload in the São Miguel population (Azores, Portugal).

In summary, we provide evidence that the complex allele HFE-c.[187C&gt;G;340+4T&gt;C] has a role, as genetic predisposition factor, on iron overload in the São Miguel population.

Carriers of the Complex Allele HFE c.[187C>G;340+4T>C] Have Increased Risk of Iron Overload in São Miguel Island Population (Azores, Portugal).

Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier.

Other HFE single nucleotide polymorphisms and rare variants have been implicated in hemochromatosis [10,11], including intronic splicing mutations, such as c.340+4T>C [IVS2+4T>C] [12] and c.1008+1G>A [IVS5+1G>A] [13].

Show Full Abstract

Iron overload is associated with acquired and genetic conditions, the most common being hereditary hemochromatosis (HH) type-I, caused by HFE mutations. Here, we conducted a hospital-based case-control study of 41 patients from the São Miguel Island (Azores, Portugal), six belonging to a family with HH type-I pseudodominant inheritance, and 35 unrelated individuals fulfilling the biochemical criteria of iron overload compatible with HH type-I. For this purpose, we analyzed the most common HFE mutations- c.845G>A [p.Cys282Tyr], c.187C>G [p.His63Asp], and c.193A>T [p.Ser65Cys]. Results revealed that the family's HH pseudodominant pattern is due to consanguineous marriage of HFE-c.845G>A carriers, and to marriage with a genetically unrelated spouse that is a -c.187G carrier. Regarding unrelated patients, six were homozygous for c.845A, and three were c.845A/c.187G compound heterozygous. We then performed sequencing of HFE exons 2, 4, 5 and their intron-flanking regions. No other mutations were observed, but we identified the -c.340+4C [IVS2+4C] splice variant in 26 (74.3%) patients. Functionally, the c.340+4C may generate alternative splicing by HFE exon 2 skipping and consequently, a protein missing the α1-domain essential for HFE/ transferrin receptor-1 interactions. Finally, we investigated HFE mutations configuration with iron overload by determining haplotypes and genotypic profiles. Results evidenced that carriers of HFE-c.187G allele also carry -c.340+4C, suggesting in-cis configuration. This data is corroborated by the association analysis where carriers of the complex allele HFE-c.[187C>G;340+4T>C] have an increased iron overload risk (RR = 2.08, 95% CI = 1.40-2.94, p<0.001). Therefore, homozygous for this complex allele are at risk of having iron overload because they will produce two altered proteins--the p.63Asp [c.187G], and the protein lacking 88 amino acids encoded by exon 2. In summary, we provide evidence that the complex allele HFE-c.[187C>G;340+4T>C] has a role, as genetic predisposition factor, on iron overload in the São Miguel population. Independent replication studies in other populations are needed to confirm this association.

Also flagged:peroxiredoxinsPrdx4Prdx1Prdx2Prdx3Prdx5
Journal Article 2015-10-26 ✓ 5 Snippets Chidlow G, Wood JP, Knoops B, Casson RJ.
In-Text Gene Mentions

…hondrial immunolabeling, whilePrdx6was associated with…

…in axons, andPrdx6was restricted to…

…Rabbit anti-Prdx6was obtained from…

…By immunohistochemistry, thePrdx6antibody elicited high…

…using a differentPrdx6antibody (Goemaere and…

Show Full Abstract

Oxidative stress is implicated in various pathological conditions of the retina and optic nerve. Peroxiredoxins (Prdxs) comprise a recently characterized family of antioxidant enzymes. To date, little information exists regarding the distribution of Prdxs in the eye. Herein, we employed a combination of qRT-PCR, immunohistochemistry and Western blotting to determine the level of expression and distribution of the six Prdx isoforms in the retina and optic nerve of the rat. In addition, we performed some parallel analyses on the common marmoset (Callithrix Jacchus). In the rat, all of the Prdx transcripts were expressed in relatively high amounts in both retina and optic nerve, with abundances ranging from approximately 3-50 % of the level of the housekeeping gene cyclophilin. With regard to protein expression, each isoform was detected in the retina and optic nerve by either Western blotting and/or immunohistochemistry. Excepting Prdx4, there was a good correspondence between the rodent and primate results. In the retina, Prdx1 and Prdx2 were principally localized to neurons in the inner nuclear layer and cone photoreceptors, Prdx3 and Prdx5 displayed characteristic mitochondrial immunolabeling, while Prdx6 was associated with astrocytes and Müller cells. In the optic nerve, Prdx1 was robustly expressed by oligodendrocytes, Prdx3 and Prdx5 were observed in axons, and Prdx6 was restricted to astrocytes. The present findings augment our understanding of the distribution and expression of the Prdxs in the retina and optic nerve of rodents and primates and lay the foundation for subsequent analysis of their involvement in relevant blinding diseases.

Also flagged:gene expressionsiliconisopropanolsilaneCFPYFP
Journal Article 2015-10-26 No Snippets Hansen MM, Meijer LH, Spruijt E, Maas RJ, Rosquelles MV, Groen J, Heus HA, Huck WT.
Show Full Abstract

Understanding the dynamics of complex enzymatic reactions in highly crowded small volumes is crucial for the development of synthetic minimal cells. Compartmentalized biochemical reactions in cell-sized containers exhibit a degree of randomness due to the small number of molecules involved. However, it is unknown how the physical environment contributes to the stochastic nature of multistep enzymatic processes. Here, we present a robust method to quantify gene expression noise in vitro using droplet microfluidics. We study the changes in stochasticity in the cell-free gene expression of two genes compartmentalized within droplets as a function of DNA copy number and macromolecular crowding. We find that decreased diffusion caused by a crowded environment leads to the spontaneous formation of heterogeneous microenvironments of mRNA as local production rates exceed the diffusion rates of macromolecules. This heterogeneity leads to a higher probability of the molecular machinery staying in the same microenvironment, directly increasing the system's stochasticity.

Also flagged:Transcription factorschondrogenesispleomorphic adenoma of the salivary glandsalivary gland pleomorphic adenomaextracellulartumor
Journal Article 2015-10-26 ✓ 5 Snippets Matsumoto Y, Sato S, Maeda T, Kishino M, Toyosawa S, Usami Y, Iwai S, Nakazawa M, Yura Y, Ogawa Y.
In-Text Gene Mentions

The mRNAs of essential transcription factors for chondrogenesis-Sox9, Sox6, and Sox5-were detected in both tumor and salivary gland tissues.

Sox9 and Sox6 proteins were colocalized in many epithelial cells in tumors and salivary glands.

…ctors for chondrogenesis-Sox9,Sox6, and Sox5-were detected…

…Sox9 andSox6proteins were colocalized…

…cells expressed Sox9,Sox6, and Twist1, but…

Show Full Abstract

In salivary gland pleomorphic adenoma, expression of extracellular matrix (ECM) substances indicates that tumor epithelial cells are becoming chondrogenic and will produce cartilage-like mesenchymal tissues. Sox9, the master transcription factor of chondrogenesis, is expressed in mouse salivary gland cells. To clarify the mechanism behind chondrogenesis in tumor epithelial cells, we examined the expression of transcription factors related to chondrogenesis in tumors and salivary glands. Reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative real-time RT-PCR, and immunostaining were performed on pleomorphic adenoma tissues, salivary gland tissues, and human submandibular gland (HSG) cells. The mRNAs of essential transcription factors for chondrogenesis-Sox9, Sox6, and Sox5-were detected in both tumor and salivary gland tissues. The mRNAs of aggrecan and type II collagen-cartilage-specific ECM substances-were detected only in tumors. Sox9 and Sox6 proteins were colocalized in many epithelial cells in tumors and salivary glands. Tumor epithelial cells also possessed aggrecan protein and occasionally type II collagen protein. Moreover, mRNAs for transcription repressors of chondrogenesis δEF1 and AP-2α were detected in both tumors and salivary glands, whereas Twist1 mRNA was detected only in salivary glands and was at significantly low-to-undetectable levels in tumors. Twist1 protein was localized in the Sox9-expressing salivary gland cells. HSG cells expressed Sox9, Sox6, and Twist1, but not aggrecan or type II collagen, and thus were similar to salivary gland cells. Twist1 depletion by Twist1 siRNA led to the upregulation of aggrecan and type II collagen mRNA expression in HSG cells. In contrast, forced expression of Twist1, using Twist1 cDNA, resulted in the downregulation of both these genes. Taken together, these results indicate that salivary gland cells have a potential for chondrogenesis, and Twist1 depletion concomitant with neoplastic transformation, which would permit tumor epithelial cells to produce cartilage-like mesenchymal tissues in salivary gland pleomorphic adenoma.

Also flagged:adaptive immunitypathogenesisautoimmune diseasecell surface antigensSLEgene expression
Journal Article 2015-10-26 No Snippets Bentham J, Morris DL, Graham DSC, Pinder CL, Tombleson P, Behrens TW, Martín J, Fairfax BP, Knight JC, Chen L, Replogle J, Syvänen AC, Rönnblom L, Graham RR, Wither JE, Rioux JD, Alarcón-Riquelme ME, Vyse TJ.
Show Full Abstract

Systemic lupus erythematosus (SLE) is a genetically complex autoimmune disease characterized by loss of immune tolerance to nuclear and cell surface antigens. Previous genome-wide association studies (GWAS) had modest sample sizes, reducing their scope and reliability. Our study comprised 7,219 cases and 15,991 controls of European ancestry, constituting a new GWAS, a meta-analysis with a published GWAS and a replication study. We have mapped 43 susceptibility loci, including ten new associations. Assisted by dense genome coverage, imputation provided evidence for missense variants underpinning associations in eight genes. Other likely causal genes were established by examining associated alleles for cis-acting eQTL effects in a range of ex vivo immune cells. We found an over-representation (n = 16) of transcription factors among SLE susceptibility genes. This finding supports the view that aberrantly regulated gene expression networks in multiple cell types in both the innate and adaptive immune response contribute to the risk of developing SLE.

Also flagged:axonalorganizationaxonephrincell cycletranscription factors
Journal Article 2015-10-26 ✓ 1 Snippet Luxey M, Laussu J, Davy A.
In-Text Gene Mentions

…the Slit/Robo and Netrin/DCCpathways as repulsive…

Show Full Abstract

<h4>Background</h4>During sensori-motor circuit development, the somas of motoneurons (MN) are distributed in a topographic manner in the ventral horn of the neural tube. Indeed, their position within the lateral motor columns (LMC) correlates with axonal trajectories and identity of target limb muscles. The mechanisms by which this topographic distribution is established remains poorly understood. To address this issue, we assessed the role of ephrinB2 in MN topographic organization in the developing mouse spinal cord.<h4>Results</h4>First, we used a reporter mouse line to establish the spatio-temporal expression pattern of EfnB2 in the developing LMC. We show that early in LMC development, ephrinB2 is differentially expressed in MN of the lateral versus medial LMC, suggesting a possible role in MN sorting and/or migration. We demonstrate that while MN-specific excision of EfnB2 did not perturb specification or migration of MN, conditional loss of ephrinB2 led to the blurring of the LMC divisional boundary and to errors in the selection of LMC axon trajectory in the limb.<h4>Conclusions</h4>Altogether, our study uncovered a novel cell autonomous role for ephrinB2 in LMC MN thus emphasizing the prevalent role of this ephrin member in maintaining cell population boundaries.

Also flagged:mRNAcDNAgene expressioncell cycleimmune responseRTKN2
Journal Article 2015-10-26 No Snippets Steele MP, Luna LG, Coldren CD, Murphy E, Hennessy CE, Heinz D, Evans CM, Groshong S, Cool C, Cosgrove GP, Brown KK, Fingerlin TE, Schwarz MI, Schwartz DA, Yang IV.
Show Full Abstract

<h4>Background</h4>Idiopathic interstitial pneumonias (IIPs) are a group of heterogeneous, somewhat unpredictable diseases characterized by progressive scarring of the interstitium. Since lung function is a key determinant of survival, we reasoned that the transcriptional profile in IIP lung tissue would be associated with measures of lung function, and could enhance prognostic approaches to IIPs.<h4>Results</h4>Using gene expression profiling of 167 lung tissue specimens with IIP diagnosis and 50 control lungs, we identified genes whose expression is associated with changes in lung function (% predicted FVC and % predicted DLCO) modeled as categorical (severe vs mild disease) or continuous variables while adjusting for smoking status and IIP subtype; false discovery rate (FDR) approach was used to correct for multiple comparisons. This analysis identified 58 transcripts that are associated with mild vs severe disease (categorical analysis), including those with established role in fibrosis (ADAMTS4, ADAMTS9, AGER, HIF-1α, SERPINA3, SERPINE2, and SELE) as well as novel IIP candidate genes such as rhotekin 2 (RTKN2) and peptidase inhibitor 15 (PI15). Protein-protein interactome analysis of 553 genes whose expression is significantly associated with lung function when modeled as continuous variables demonstrates that more severe presentation of IIPs is characterized by an increase in cell cycle progression and apoptosis, increased hypoxia, and dampened innate immune response. Our findings were validated in an independent cohort of 131 IIPs and 40 controls at the mRNA level and for one gene (RTKN2) at the protein level by immunohistochemistry in a subset of samples.<h4>Conclusions</h4>We identified commonalities and differences in gene expression among different subtypes of IIPs. Disease progression, as characterized by lower measures of FVC and DLCO, results in marked changes in expression of novel and established genes and pathways involved in IIPs. These genes and pathways represent strong candidates for biomarker studies and potential therapeutic targets for IIP severity.

Also flagged:TRIM) 12cTRIM5Ubiquitin LigaseType I IFNNF-κBTNFR-Associated Factor 6
Journal Article 2015-10-26 ✓ 1 Snippet Chang TH, Yoshimi R, Ozato K.
In-Text Gene Mentions

TRIM38

Show Full Abstract

Tripartite motif (TRIM) protein TRIM5 of the primate species restricts replication of HIV and other retroviruses. Whereas primates have a single TRIM5 gene, the corresponding locus in the mouse has expanded during evolution, now containing more than eight related genes. Owing to the complexity of the genomic organization, a mouse homolog of TRIM5 has not been fully studied thus far. In the present study, we report that Trim12c (formerly Trim12-2) encodes a TRIM5-like protein with a ubiquitin ligase activity. Similar to the primate TRIM5, TRIM12c is expressed in the cytoplasm as a punctate structure and induced upon IFN and pathogen stimulation in macrophages and dendritic cells. We show that TRIM12c interacts with TRAF6, a key protein in the pathogen recognition receptor signaling, and reciprocally enhances their ubiquitination, leading to cooperative activation of IFN and NF-κB pathways. This study identifies TRIM12c as a mouse TRIM5 equivalent, critical for host innate immunity.

Also flagged:NEDD4HSF1α-synucleinheat-shock proteinsHSPsheat shock transcription factor 1
Journal Article 2015-10-26 ✓ 2 Snippets Kim E, Wang B, Sastry N, Masliah E, Nelson PT, Cai H, Liao FF.
In-Text Gene Mentions

…as mutant huntingtin (Htt), but not transactive…

…plasmids of α-synuclein,Httand TDP43 mutants,…

Show Full Abstract

Cellular protein homeostasis is achieved by a delicate network of molecular chaperones and various proteolytic processes such as ubiquitin-proteasome system (UPS) to avoid a build-up of misfolded protein aggregates. The latter is a common denominator of neurodegeneration. Neurons are found to be particularly vulnerable to toxic stress from aggregation-prone proteins such as α-synuclein. Induction of heat-shock proteins (HSPs), such as through activated heat shock transcription factor 1 (HSF1) via Hsp90 inhibition, is being investigated as a therapeutic option for proteinopathic diseases. HSF1 is a master stress-protective transcription factor which activates genes encoding protein chaperones (e.g. iHsp70) and anti-apoptotic proteins. However, whether and how HSF1 is dysregulated during neurodegeneration has not been studied. Here, we discover aberrant HSF1 degradation by aggregated α-synuclein (or α-synuclein-induced proteotoxic stress) in transfected neuroblastoma cells. HSF1 dysregulation via α-synuclein was confirmed by in vivo assessment of mouse and in situ studies of human specimens with α-synucleinopathy. We demonstrate that elevated NEDD4 is implicated as the responsible ubiquitin E3 ligase for HSF1 degradation through UPS. Furthermore, pharmacologically induced SIRT1-mediated deacetylation can attenuate aberrant NEDD4-mediated HSF1 degradation. Indeed, we define the acetylation status of the Lys 80 residue located in the DNA-binding domain of HSF1 as a critical factor in modulating HSF1 protein stability in addition to its previously identified role in the transcriptional activity. Together with the finding that preserving HSF1 can alleviate α-synuclein toxicity, this study strongly suggests that aberrant HSF1 degradation is a key neurodegenerative mechanism underlying α-synucleinopathy.

Also flagged:neurodegenerative diseasesHuntington's diseasePolyglutamine diseasesspinocerebellar ataxiasoligonucleotidesspinocerebellar ataxia
Journal Article 2015-10-26 ✓ 1 Snippet Keiser MS, Kordasiewicz HB, McBride JL.
In-Text Gene Mentions

HTT

Show Full Abstract

RNA-targeting approaches are emerging as viable therapeutics that offer an alternative method to modulate traditionally 'undrugable' targets. In the case of dominantly inherited neurodegenerative diseases, gene suppression strategies can target the underlying cause of these intractable disorders. Polyglutamine diseases are caused by CAG expansions in discrete genes, making them ideal candidates for gene suppression therapies. Here, we discuss the current state of gene suppression approaches for Huntington's disease and the spinocerebellar ataxias, including the use of antisense oligonucleotides, short-interfering RNAs, as well as viral vector-mediated delivery of short hairpin RNAs and artificial microRNAs. We focus on lessons learned from preclinical studies investigating gene suppression therapies for these disorders, particularly in rodent models of disease and in non-human primates. In animal models, recent advances in gene suppression technologies have not only prevented disease progression in a number of cases, but have also reversed existing disease, providing evidence that reducing the expression of disease-causing genes may be of benefit in symptomatic patients. Both allele- and non-allele-specific approaches to gene suppression have made great strides over the past decade, showing efficacy and safety in both small and large animal models. Advances in delivery techniques allow for broad and durable suppression of target genes, have been validated in non-human primates and in some cases, are currently being evaluated in human patients. Finally, we discuss the challenges of developing and delivering gene suppression constructs into the CNS and recent advances of potential therapeutics into the clinic.

Also flagged:restriction-modification enzymesnucleasehelicaseATPasemethyltransferasemotor activity
Journal Article 2015-10-26 No Snippets van Aelst K, Saikrishnan K, Szczelkun MD.
Show Full Abstract

The prokaryotic Type ISP restriction-modification enzymes are single-chain proteins comprising an Mrr-family nuclease, a superfamily 2 helicase-like ATPase, a coupler domain, a methyltransferase, and a DNA-recognition domain. Upon recognising an unmodified DNA target site, the helicase-like domain hydrolyzes ATP to cause site release (remodeling activity) and to then drive downstream translocation consuming 1-2 ATP per base pair (motor activity). On an invading foreign DNA, double-strand breaks are introduced at random wherever two translocating enzymes form a so-called collision complex following long-range communication between a pair of target sites in inverted (head-to-head) repeat. Paradoxically, structural models for collision suggest that the nuclease domains are too far apart (>30 bp) to dimerise and produce a double-strand DNA break using just two strand-cleavage events. Here, we examined the organisation of different collision complexes and how these lead to nuclease activation. We mapped DNA cleavage when a translocating enzyme collides with a static enzyme bound to its site. By following communication between sites in both head-to-head and head-to-tail orientations, we could show that motor activity leads to activation of the nuclease domains via distant interactions of the helicase or MTase-TRD. Direct nuclease dimerization is not required. To help explain the observed cleavage patterns, we also used exonuclease footprinting to demonstrate that individual Type ISP domains can swing off the DNA. This study lends further support to a model where DNA breaks are generated by multiple random nicks due to mobility of a collision complex with an overall DNA-binding footprint of ∼30 bp.

Also flagged:intraventricular hemorrhageangiogenesiscerebral palsymentaldevelopmental disordergestation
Journal Article 2015-10-26 ✓ 1 Snippet Ment LR, Ådén U, Bauer CR, Bada HS, Carlo WA, Kaiser JR, Lin A, Cotten CM, Murray J, Page G, Hallman M, Lifton RP, Zhang H, Gene Targets for IVH Study Group and the Neonatal Research Network.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Emerging data suggest intraventricular hemorrhage (IVH) of the preterm neonate is a complex disorder with contributions from both the environment and the genome. Environmental analyses suggest factors mediating both cerebral blood flow and angiogenesis contribute to IVH, while candidate gene studies report variants in angiogenesis, inflammation, and vascular pathways. Gene-by-environment interactions demonstrate the interaction between the environment and the genome, and a non-replicated genome-wide association study suggests that both environmental and genetic factors contribute to the risk for severe IVH in very low-birth weight preterm neonates.

Also flagged:Diabetes mellitusmetabolic disorderhyperglycemiainsulinsecretionaging
Journal Article 2015-10-26 ✓ 3 Snippets Khodaeian M, Enayati S, Tabatabaei-Malazy O, Amoli MM.
In-Text Gene Mentions

In contrast to above variants, CTLA4 (+49A/G polymorphism), HNF-1α (Ala98Val polymorphism), GLP-1R (glucagon-like peptid 1 receptor) (Thr149Met polymorohism), SLC30A8 (Arg325Trp polymorphism), GSTP1 (Ile105Val polymorphism), glucokinase (−30G/A polymorphism), SDF-1β (stromal derived factor -1 β) (G801A polymorphism), ApoE (apolipoprotein E), ENPP1 (ectoenzyme nucleotide pyrophosphate phosphodiesterase 1) (K121Q polymorphism), SUMO4 (small ubiquitin-like modifier 4) Met55Val polymorphism), MTHFR (C677T polymorphism), UCP2 (uncoupling protein 2) (−866G/A polymorphism), 5HTTLPR, IL-4 (−590C/T polymorphism), IFN-γ (interferon γ) (+874T/A polymorphism), CCR5 (C-C chemokine receptor type 5) (δ32mutation), HFE (hemochromatosis gene) (H63D, C282Y, PTPN1 (protein tyrosin Phosphatase 1B)/−51delA, −451A>G, −467T>C, −1023C>A, −1045G>A, −1286 3 bp del ACA, −1291 9 bp del CTAGACTAA polymorphisms) were not significantly associated with T2DM [22, 42, 46, 50–52, 54, 59–63, 66, 67, 71, 74].

…( δ 32mutation),HFE(hemochromatosis gene) (H63D,…

…δ 32mutation), HFE (hemochromatosisgene) (H63D, C282Y,…

Show Full Abstract

<h4>Introduction</h4>Diabetes mellitus as the most prevalent metabolic disease is a multifactorial disease which is influenced by environmental and genetic factors. In this systematic review, we assessed the association between genetic variants and diabetes/its complications in studies with Iranian populations.<h4>Methods</h4>Google Scholar, PubMed, Scopus, and Persian web databases were systematically searched up to January 2014. The search terms were "gene," "polymorphism," "diabetes," and "diabetic complications"; nephropathy, retinopathy, neuropathy, foot ulcer, and CAD (coronary artery diseases); and Persian equivalents. Animal studies, letters to editor, and in vitro studies were excluded.<h4>Results</h4>Out of overall 3029 eligible articles, 88 articles were included. We found significant association between CTLA-4, IL-18, VDR, TAP2, IL-12, and CD4 genes and T1DM, HNFα and MODY, haptoglobin, paraoxonase, leptin, TCF7L2, calreticulin, ERα, PPAR-γ2, CXCL5, calpain-10, IRS-1 and 2, GSTM1, KCNJ11, eNOS, VDR, INSR, ACE, apoA-I, apo E, adiponectin, PTPN1, CETP, AT1R, resistin, MMP-3, BChE K, AT2R, SUMO4, IL-10, VEGF, MTHFR, and GSTM1 with T2DM or its complications.<h4>Discussion</h4>We found some controversial results due to heterogeneity in ethnicity and genetic background. We thought genome wide association studies on large number of samples will be helpful in identifying diabetes susceptible genes as an alternative to studying individual candidate genes in Iranian populations.

Also flagged:irondeficiencyiron transporterproblemsiron transportersBMP6
Journal Article 2015-10-26 ✓ 1 Snippet Oh S, Shin PK, Chung J.
In-Text Gene Mentions

…proteins, such asHFEand TfR2, trigger…

Show Full Abstract

<h4>Background/objectives</h4>Iron deficiency in early life is associated with developmental problems, which may persist until later in life. The question of whether iron repletion after developmental iron deficiency could restore iron homeostasis is not well characterized. In the present study, we investigated the changes of iron transporters after iron depletion during the gestational-neonatal period and iron repletion during the post-weaning period.<h4>Materials/methods</h4>Pregnant rats were provided iron-deficient (< 6 ppm Fe) or control (36 ppm Fe) diets from gestational day 2. At weaning, pups from iron-deficient dams were fed either iron-deficient (ID group) or control (IDR group) diets for 4 week. Pups from control dams were continued to be fed with the control diet throughout the study period (CON).<h4>Results</h4>Compared to the CON, ID rats had significantly lower hemoglobin and hematocrits in the blood and significantly lower tissue iron in the liver and spleen. Hepatic hepcidin and BMP6 mRNA levels were also strongly down-regulated in the ID group. Developmental iron deficiency significantly increased iron transporters divalent metal transporter 1 (DMT1) and ferroportin (FPN) in the duodenum, but decreased DMT1 in the liver. Dietary iron repletion restored the levels of hemoglobin and hematocrit to a normal range, but the tissue iron levels and hepatic hepcidin mRNA levels were significantly lower than those in the CON group. Both FPN and DMT1 protein levels in the liver and in the duodenum were not different between the IDR and the CON. By contrast, DMT1 in the spleen was significantly lower in the IDR, compared to the CON. The splenic FPN was also decreased in the IDR more than in the CON, although the difference did not reach statistical significance.<h4>Conclusions</h4>Our findings demonstrate that iron transporter proteins in the duodenum, liver and spleen are differentially regulated during developmental iron deficiency. Also, post-weaning iron repletion efficiently restores iron transporters in the duodenum and the liver but not in the spleen, which suggests that early-life iron deficiency may cause long term abnormalities in iron recycling from the spleen.

Also flagged:Huntington's diseaseHuntington DiseaseHDneurodegenerative disorderpolyglutamineneurogenesis
Journal Article 2015-10-25 ✓ 3 Snippets Jamwal S, Kumar P.
In-Text Gene Mentions

Huntington Disease (HD), which is characterized by abnormal dance-like movements, is a neurodegenerative disorder caused by a genetic mutation that results in an expanded polyglutamine stretch in the NH2 terminus of huntingtin protein (HTT).

…of huntingtin protein (HTT).…

HTTis ubiquitously expressed…

Show Full Abstract

Huntington Disease (HD), which is characterized by abnormal dance-like movements, is a neurodegenerative disorder caused by a genetic mutation that results in an expanded polyglutamine stretch in the NH2 terminus of huntingtin protein (HTT). The principal neuropathological hallmarks of disease include loss of striatal and cortical projection neurons. HTT is ubiquitously expressed and is implicated in several cellular functions including neurogenesis, cell trafficking and brain-derived neurotrophic factor (BDNF) production. Major depression is the most common symptom among pre-symptomatic HD carriers and numerous pieces of preclinical evidence have suggested the use of antidepressants in HD not only elevates mood but also slows down the disease progression by activating different neuroprotective mechanism like BDNF/TrkB pathway, MAPK/ERK signalling, neurogenesis and Wnt signalling. HTT plays major role in neurogenesis, a physiological phenomenon that is implicated in some of the behavioral effects of antidepressants. Currently, there is no clinically available treatment that can halt or slow down the progression of HD except tetrabenazine (the only FDA approved drug); however, this drug also induces depression and sedation in patients. In this review, a brief discussion has been made about the mutant HTT that induced various cellular and molecular mechanisms underlying behavioral disorders in HD. Further, an attempt has been made to understand the various cellular mechanisms involved in mediating the neuroprotective effects of antidepressants in HD.

Also flagged:Chondroitindermatanheparansulfateglycosaminoglycanscore proteins
Journal Article 2015-10-25 ✓ 1 Snippet Mizumoto S, Yamada S, Sugahara K.
In-Text Gene Mentions

…yltransferases, XylT1, GalT-I,GalT-II, and GlcAT-I. These…

Show Full Abstract

Glycosaminoglycans, including chondroitin, dermatan, and heparan sulfate, have various roles in a wide range of biological events such as cell signaling, cell proliferation, tissue morphogenesis, and interactions with various growth factors. Their polysaccharides covalently attach to the serine residues on specific core proteins through the common linker region tetrasaccharide, -xylose-galactose-galactose-glucuronic acid, which is produced through the stepwise addition of respective monosaccharides by four distinct glycosyltransferases. Mutations in the human genes encoding the glycosyltransferases responsible for the biosynthesis of the linker region tetrasaccharide cause a number of genetic disorders, called glycosaminoglycan linkeropathies, including Desbuquois dysplasia type 2, spondyloepimetaphyseal dysplasia, Ehlers-Danlos syndrome, and Larsen syndrome. This review focused on recent studies on genetic diseases caused by defects in the biosynthesis of the common linker region tetrasaccharide.

Also flagged:ExtracellularMembranevesiclessynapsesynthesismyelin
Journal Article 2015-10-25 No Snippets Schiera G, Di Liegro CM, Di Liegro I.
Show Full Abstract

Extracellular vesicles are involved in a great variety of physiological events occurring in the nervous system, such as cross talk among neurons and glial cells in synapse development and function, integrated neuronal plasticity, neuronal-glial metabolic exchanges, and synthesis and dynamic renewal of myelin. Many of these EV-mediated processes depend on the exchange of proteins, mRNAs, and noncoding RNAs, including miRNAs, which occurs among glial and neuronal cells. In addition, production and exchange of EVs can be modified under pathological conditions, such as brain cancer and neurodegeneration. Like other cancer cells, brain tumours can use EVs to secrete factors, which allow escaping from immune surveillance, and to transfer molecules into the surrounding cells, thus transforming their phenotype. Moreover, EVs can function as a way to discard material dangerous to cancer cells, such as differentiation-inducing proteins, and even drugs. Intriguingly, EVs seem to be also involved in spreading through the brain of aggregated proteins, such as prions and aggregated tau protein. Finally, EVs can carry useful biomarkers for the early diagnosis of diseases. Herein we summarize possible roles of EVs in brain physiological functions and discuss their involvement in the horizontal spreading, from cell to cell, of both cancer and neurodegenerative pathologies.

Also flagged:gene expressionaortic valve regurgitationglucosefatty acidfenofibratemitochondrial
Journal Article 2015-10-25 No Snippets Roussel E, Drolet MC, Walsh-Wilkinson E, Dhahri W, Lachance D, Gascon S, Sarrhini O, Rousseau JA, Lecomte R, Couet J, Arsenault M.
Show Full Abstract

Patients with left ventricle (LV) volume overload (VO) remain in a compensated state for many years although severe dilation is present. The myocardial capacity to fulfill its energetic demand may delay decompensation. We performed a gene expression profile, a model of chronic VO in rat LV with severe aortic valve regurgitation (AR) for 9 months, and focused on the study of genes associated with myocardial energetics. Methods. LV gene expression profile was performed in rats after 9 months of AR and compared to sham-operated controls. LV glucose and fatty acid (FA) uptake was also evaluated in vivo by positron emission tomography in 8-week AR rats treated or not with fenofibrate, an activator of FA oxidation (FAO). Results. Many LV genes associated with mitochondrial function and metabolism were downregulated in AR rats. FA β-oxidation capacity was significantly impaired as early as two weeks after AR. Treatment with fenofibrate, a PPARα agonist, normalized both FA and glucose uptake while reducing LV dilation caused by AR. Conclusion. Myocardial energy substrate preference is affected early in the evolution of LV-VO cardiomyopathy. Maintaining a relatively normal FA utilization in the myocardium could translate into less glucose uptake and possibly lesser LV remodeling.

Also flagged:pilocytic astrocytomabrain tumortumorsgene expressiontumorbrainstem tumors
Journal Article 2015-10-24 ✓ 1 Snippet Zakrzewski K, Jarząb M, Pfeifer A, Oczko-Wojciechowska M, Jarząb B, Liberski PP, Zakrzewska M.
In-Text Gene Mentions

…of NR6A1 ,POU3F2, CUTL1 ,…

Show Full Abstract

<h4>Background</h4>Pilocytic astrocytoma is the most common type of brain tumor in the pediatric population, with a generally favorable prognosis, although recurrences or leptomeningeal dissemination are sometimes also observed. For tumors originating in the supra-or infratentorial location, a different molecular background was suggested, but plausible correlations between the transcriptional profile and radiological features and/or clinical course are still undefined. The purpose of this study was to identify gene expression profiles related to the most frequent locations of this tumor, subtypes based on various radiological features, and the clinical pattern of the disease.<h4>Methods</h4>Eighty six children (55 males and 31 females) with histologically verified pilocytic astrocytoma were included in this study. Their age at the time of diagnosis ranged from fourteen months to seventeen years, with a mean age of seven years. There were 40 cerebellar, 23 optic tract/hypothalamic, 21 cerebral hemispheric, and two brainstem tumors. According to the radiological features presented on MRI, all cases were divided into four subtypes: cystic tumor with a non-enhancing cyst wall; cystic tumor with an enhancing cyst wall; solid tumor with central necrosis; and solid or mainly solid tumor. In 81 cases primary surgical resection was the only and curative treatment, and in five cases progression of the disease was observed. In 47 cases the analysis was done by using high density oligonucleotide microarrays (Affymetrix HG-U133 Plus 2.0) with subsequent bioinformatic analyses and confirmation of the results by independent RT-qPCR (on 39 samples).<h4>Results</h4>Bioinformatic analyses showed that the gene expression profile of pilocytic astrocytoma is highly dependent on the tumor location. The most prominent differences were noted for IRX2, PAX3, CXCL14, LHX2, SIX6, CNTN1 and SIX1 genes expression even within different compartments of the supratentorial region. Analysis of the genes potentially associated with radiological features showed much weaker transcriptome differences. Single genes showed association with the tendency to progression.<h4>Conclusions</h4>Here we have shown that pilocytic astrocytomas of three different locations can be precisely differentiated on the basis of their gene expression level, but their transcriptional profiles does not strongly reflect the radiological appearance of the tumor or the course of the disease.

Also flagged:SMZLB-cell non-Hodgkin lymphomapathogenesistumorNOTCH2MYD88
Journal Article 2015-10-24 No Snippets Peveling-Oberhag J, Wolters F, Döring C, Walter D, Sellmann L, Scholtysik R, Lucioni M, Schubach M, Paulli M, Biskup S, Zeuzem S, Küppers R, Hansmann ML.
Show Full Abstract

<h4>Background</h4>Splenic marginal zone lymphoma (SMZL) is an indolent B-cell non-Hodgkin lymphoma and represents the most common primary malignancy of the spleen. Its precise molecular pathogenesis is still unknown and specific molecular markers for diagnosis or possible targets for causal therapies are lacking.<h4>Methods</h4>We performed whole exome sequencing (WES) and copy number analysis from laser-microdissected tumor cells of two primary SMZL discovery cases. Selected somatic single nucleotide variants (SNVs) were analyzed using pyrosequencing and Sanger sequencing in an independent validation cohort.<h4>Results</h4>Overall, 25 nonsynonymous somatic SNVs were identified, including known mutations in the NOTCH2 and MYD88 genes. Twenty-three of the mutations have not been associated with SMZL before. Many of these seem to be subclonal. Screening of 24 additional SMZL for mutations at the same positions found mutated in the WES approach revealed no recurrence of mutations for ZNF608 and PDE10A, whereas the MYD88 L265P missense mutation was identified in 15% of cases. An analysis of the NOTCH2 PEST domain and the whole coding region of the transcription factor SMYD1 in eight cases identified no additional case with a NOTCH2 mutation, but two additional cases with SMYD1 alterations.<h4>Conclusions</h4>In this first WES approach from microdissected SMZL tissue we confirmed known mutations and discovered new somatic variants. Recurrence of MYD88 mutations in SMZL was validated, but NOTCH2 PEST domain mutations were relatively rare (10 % of cases). Recurrent mutations in the transcription factor SMYD1 have not been described in SMZL before and warrant further investigation.

Also flagged:metabolismglucosecarbonpentosephosphatedetoxification
Journal Article 2015-10-24 No Snippets Bui-Nguyen TM, Baer CE, Lewis JA, Yang D, Lein PJ, Jackson DA.
Show Full Abstract

<h4>Background</h4>Exposure to dichlorvos (DDVP), an organophosphorus pesticide, is known to result in neurotoxicity as well as other metabolic perturbations. However, the molecular causes of DDVP toxicity are poorly understood, especially in cells other than neurons and muscle cells. To obtain a better understanding of the process of non-neuronal DDVP toxicity, we exposed zebrafish to different concentrations of DDVP, and investigated the resulting changes in liver histology and gene transcription.<h4>Results</h4>Functional enrichment analysis of genes affected by DDVP exposure identified a number of processes involved in energy utilization and stress response in the liver. The abundance of transcripts for proteins involved in glucose metabolism was profoundly affected, suggesting that carbon flux might be diverted toward the pentose phosphate pathway to compensate for an elevated demand for energy and reducing equivalents for detoxification. Strikingly, many transcripts for molecules involved in β-oxidation and fatty acid synthesis were down-regulated. We found increases in message levels for molecules involved in reactive oxygen species responses as well as ubiquitination, proteasomal degradation, and autophagy. To ensure that the effects of DDVP on energy metabolism were not simply a consequence of poor feeding because of neuromuscular impairment, we fasted fish for 29 or 50 h and analyzed liver gene expression in them. The patterns of gene expression for energy metabolism in fasted and DDVP-exposed fish were markedly different.<h4>Conclusion</h4>We observed coordinated changes in the expression of a large number of genes involved in energy metabolism and responses to oxidative stress. These results argue that an appreciable part of the effect of DDVP is on energy metabolism and is regulated at the message level. Although we observed some evidence of neuromuscular impairment in exposed fish that may have resulted in reduced feeding, the alterations in gene expression in exposed fish cannot readily be explained by nutrient deprivation.

Also flagged:curcumindiosgeninmethylenecarboncarbonylamyloid-β
Journal Article 2015-10-24 No Snippets Chojnacki JE, Liu K, Saathoff JM, Zhang S.
Show Full Abstract

In an effort to combat the multifaceted nature of Alzheimer's disease (AD) progression, a series of multifunctional, bivalent compounds containing curcumin and diosgenin were designed, synthesized, and biologically characterized. Screening results in MC65 neuroblastoma cells established that compound 38 with a spacer length of 17 atoms exhibited the highest protective potency with an EC50 of 111.7 ± 9.0 nM. A reduction in protective activity was observed as spacer length was increased up to 28 atoms and there is a clear structural preference for attachment to the methylene carbon between the two carbonyl moieties of curcumin. Further study suggested that antioxidative ability and inhibitory effects on amyloid-β oligomer (AβO) formation may contribute to the neuroprotective outcomes. Additionally, compound 38 was found to bind directly to Aβ, similar to curcumin, but did not form complexes with the common biometals Cu, Fe, and Zn. Altogether, these results give strong evidence to support the bivalent design strategy in developing novel compounds with multifunctional ability for the treatment of AD.

Also flagged:silver nanoclustersexonuclease IIIExo IIIcytosine
Journal Article 2015-10-24 ✓ 2 Snippets Yang W, Tian J, Ma Y, Wang L, Zhao Y, Zhao S.
In-Text Gene Mentions

…to monitor humanhemochromatosisgene (as a…

…to detect humanhemochromatosisgene in real…

Show Full Abstract

A number of specific nucleic acids are closely related with many serious diseases, in the current research, a platform taking advantage of exonuclease III (Exo III) to realize double recycling amplification and label-free fluorescent DNA-templated silver nanoclusters (DNA-AgNCs) for detecting of nucleic acid had been developed. In this method, a molecular beacon (MB) with 3'-protruding termini and a single-stranded cytosine-rich (C-rich) probe were designed that coexist stably with Exo III. Once the target DNA appeared, portion of the MB could hybridize with target DNA and was digested by Exo III, which allowed the release of target DNA and a residual sequence. Subsequently, the residual sequence could trigger the Exo III to digest C-rich probe, and the DNA-AgNCs was not able to be synthesized because of the C-rich probe was destroyed; finally the fluorescent of solution was quenched. This assay enables to monitor human hemochromatosis gene (as a model) with high sensitivity, the detection limit is as low as 120 pM compared with other fluorescence DNA-AgNCs methods, this assay also exhibits superior specificity even against single base mismatch. The strategy is applied to detect human hemochromatosis gene in real human serum samples successfully.

Also flagged:neurodegenerative diseasesHuntington diseasepolyglutaminepolyvalinepeptideglutamine
Journal Article 2015-10-23 ✓ 3 Snippets Gómez-Sicilia À, Sikora M, Cieplak M, Carrión-Vázquez M.
In-Text Gene Mentions

HD is caused by a protein in the human brain known as huntingtin (HTT)—of, as yet, not fully elucidated function.

…known as huntingtin (HTT)—of, as yet, not…

HTTis known to…

Show Full Abstract

Deposits of misfolded proteins in the human brain are associated with the development of many neurodegenerative diseases. Recent studies show that these proteins have common traits even at the monomer level. Among them, a polyglutamine region that is present in huntingtin is known to exhibit a correlation between the length of the chain and the severity as well as the earliness of the onset of Huntington disease. Here, we apply bias exchange molecular dynamics to generate structures of polyglutamine expansions of several lengths and characterize the resulting independent conformations. We compare the properties of these conformations to those of the standard proteins, as well as to other homopolymeric tracts. We find that, similar to the previously studied polyvaline chains, the set of possible transient folds is much broader than the set of known-to-date folds, although the conformations have different structures. We show that the mechanical stability is not related to any simple geometrical characteristics of the structures. We demonstrate that long polyglutamine expansions result in higher mechanical stability than the shorter ones. They also have a longer life span and are substantially more prone to form knotted structures. The knotted region has an average length of 35 residues, similar to the typical threshold for most polyglutamine-related diseases. Similarly, changes in shape and mechanical stability appear once the total length of the peptide exceeds this threshold of 35 glutamine residues. We suggest that knotted conformers may also harm the cellular machinery and thus lead to disease.

Also flagged:bone marrow failure syndromeglucocorticoidendocrine disorderadrenal insufficiencyhypogonadismhypothyroidism
Journal Article 2015-10-23 ✓ 1 Snippet Lahoti A, Harris YT, Speiser PW, Atsidaftos E, Lipton JM, Vlachos A.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Diamond-Blackfan anemia (DBA) is a rare inherited bone marrow failure syndrome. The mainstays of treatment involve chronic red cell transfusions, long-term glucocorticoid therapy, and stem cell transplantation. Systematic data concerning endocrine function in DBA are limited. We studied patients in the DBA Registry (DBAR) of North America to assess the prevalence of various endocrinopathies.<h4>Procedure</h4>In a pilot study, retrospective data were collected for 12 patients with DBA. Subsequently, patients with DBA aged 1-39 years were recruited prospectively. Combined, 57 patients were studied; 38 chronically transfused, 12 glucocorticoid-dependent, and seven in remission. Data were collected on anthropometric measurements, systematic screening of pituitary, thyroid, parathyroid, adrenal, pancreatic, and gonadal function, and ferritin levels. Descriptive statistics were tabulated and group differences were assessed.<h4>Results</h4>Fifty-three percent of patients had ≥ 1 endocrine disorder, including adrenal insufficiency (32%), hypogonadism (29%), hypothyroidism (14%), growth hormone dysfunction (7%), diabetes mellitus (2%), and/or diabetes insipidus (2%). Ten of the 33 patients with available heights had height standard deviation less than -2. Low 25-hydroxy vitamin D (25(OH)D) levels were present in 50%. A small proportion also had osteopenia, osteoporosis, or hypercalciuria. Most with adrenal insufficiency were glucocorticoid dependent; other endocrinopathies were more common in chronically transfused patients.<h4>Conclusions</h4>Endocrine dysfunction is common in DBA, as early as the teenage years. Although prevalence is highest in transfused patients, patients taking glucocorticoids or in remission also have endocrine dysfunction. Longitudinal studies are needed to better understand the etiology and true prevalence of these disorders.

Also flagged:HDpolyglutaminePDpathogenesiscyclin G-associated kinaseParkinson disease
Journal Article 2015-10-23 ✓ 5 Snippets Labadorf AT, Myers RH.
In-Text Gene Mentions

The goal of this study was to seek and evaluate evidence for previously reported alternative HTT splicing events in our unique mRNA-Seq datasets from human control and patient post-mortem brains.

In response to a recent report by Ruzo et al. of several novel splice forms of HTT in human embryonic stem cell lines, we have analyzed a set of mRNA sequencing datasets from post mortem human brain from Huntington's disease, Parkinson's disease, and neurologically normal control subjects to evaluate support for previously observed and to identify novel splice patterns.

In response to a recent report by Ruzo et al. of several novel splice forms of HTT in human embryonic stem cell lines, we have analyzed a set of mRNA sequencing datasets from post mortem human brain from Huntington’s disease, Parkinson’s disease, and neurologically normal control subjects to evaluate support for previously observed and to identify novel splice patterns.

Despite 20 years since its discovery, the gene responsible for Huntington’s Disease, HTT, has still not had its function or transcriptional profile completely characterized.

Our data support HTT as having potentially many alternative splice forms, in agreement with the observation of high levels of AS in humans in general [8], and further investigation into isoforms that may contain the AS events detected here may shed light into the function of this gene and whether these AS events contribute to the pathogenesis of HD.

Show Full Abstract

Despite 20 years since its discovery, the gene responsible for Huntington's Disease, HTT, has still not had its function or transcriptional profile completely characterized. In response to a recent report by Ruzo et al. of several novel splice forms of HTT in human embryonic stem cell lines, we have analyzed a set of mRNA sequencing datasets from post mortem human brain from Huntington's disease, Parkinson's disease, and neurologically normal control subjects to evaluate support for previously observed and to identify novel splice patterns. A custom analysis pipeline produced supporting evidence for some of the results reported by two previous studies of alternative isoforms as well as identifying previously unreported splice patterns. All of the alternative splice patterns were of relatively low abundance compared to the canonical splice form.

Also flagged:AMPKantibodyinfectiontranscriptional repressoradenosine monophosphate-activated protein kinasemetabolism
Journal Article 2015-10-23 ✓ 5 Snippets Ramiscal RR, Parish IA, Lee-Young RS, Babon JJ, Blagih J, Pratama A, Martin J, Hawley N, Cappello JY, Nieto PF, Ellyard JI, Kershaw NJ, Sweet RA, Goodnow CC, Jones RG, Febbraio MA, Vinuesa CG, Athanasopoulos V.
In-Text Gene Mentions

…ROQUIN1; encoded byRc3h1) acts to…

…sanroque mice, anRc3h1missense point mutation,…

…flanked or ‘floxed’Rc3h1exon 2, encoding…

…harboring the floxedRc3h1allele ( Rc3h1…

…Rc3h1 allele (Rc3h1lox/+ ) were…

Show Full Abstract

T follicular helper cells (Tfh) are critical for the longevity and quality of antibody-mediated protection against infection. Yet few signaling pathways have been identified to be unique solely to Tfh development. ROQUIN is a post-transcriptional repressor of T cells, acting through its ROQ domain to destabilize mRNA targets important for Th1, Th17, and Tfh biology. Here, we report that ROQUIN has a paradoxical function on Tfh differentiation mediated by its RING domain: mice with a T cell-specific deletion of the ROQUIN RING domain have unchanged Th1, Th2, Th17, and Tregs during a T-dependent response but show a profoundly defective antigen-specific Tfh compartment. ROQUIN RING signaling directly antagonized the catalytic α1 subunit of adenosine monophosphate-activated protein kinase (AMPK), a central stress-responsive regulator of cellular metabolism and mTOR signaling, which is known to facilitate T-dependent humoral immunity. We therefore unexpectedly uncover a ROQUIN-AMPK metabolic signaling nexus essential for selectively promoting Tfh responses.

Also flagged:SCP2ironchainfatty acidpristanic acidphytanic acid
Journal Article 2015-10-23 No Snippets Horvath R, Lewis-Smith D, Douroudis K, Duff J, Keogh M, Pyle A, Fletcher N, Chinnery PF.
Show Full Abstract

No abstract available.

Also flagged:dopamineneuropsychiatric disordersgene expressiontyrosine hydroxylaseTHdopa decarboxylase
Journal Article 2015-10-23 ✓ 2 Snippets Anderegg A, Poulin JF, Awatramani R.
In-Text Gene Mentions

SOX6

DCC

Show Full Abstract

Since their discovery, midbrain dopamine (DA) neurons have been researched extensively, in part because of their diverse functions and involvement in various neuropsychiatric disorders. Over the last few decades, reports have emerged that midbrain DA neurons were not a homogeneous group, but that DA neurons located in distinct anatomical locations within the midbrain had distinctive properties in terms of physiology, function, and vulnerability. Accordingly, several studies focused on identifying heterogeneous gene expression across DA neuron clusters. Here we review the importance of understanding DA neuron heterogeneity at the molecular level, previous studies detailing heterogeneous gene expression in DA neurons, and finally recent work which brings together previous heterogeneous gene expression profiles in a coordinated manner, at single cell resolution.

Also flagged:metabolic syndromemetabolic disorderstype 2 diabetescardiovascular diseasesCTNNA3RALYL
Journal Article 2015-10-23 ✓ 5 Snippets Tekola-Ayele F, Doumatey AP, Shriner D, Bentley AR, Chen G, Zhou J, Fasanmade O, Johnson T, Oli J, Okafor G, Eghan BA, Agyenim-Boateng K, Adebamowo C, Amoah A, Acheampong J, Adeyemo A, Rotimi CN.
In-Text Gene Mentions

We found two African-ancestry specific variants that were significantly associated with MetS: SNP rs73989312[A] near CA10 that conferred increased risk (P=3.86 × 10(-8), OR=6.80) and SNP rs77244975[C] in CTNNA3 that conferred protection against MetS (P=1.63 × 10(-8), OR=0.15).

We found two African-ancestry specific variants that were significantly associated with MetS: SNP rs73989312[A] near CA10 that conferred increased risk (P=3.86 × 10(-8), OR=6.80) and SNP rs77244975[C] in CTNNA3 that conferred protection against MetS (P=1.63 × 10(-8), OR=0.1

…exclusive expression ofCA10in the brain,…

…the brain, ourCA10finding strengthens previously…

CA10

Show Full Abstract

The metabolic syndrome (MetS) is a constellation of metabolic disorders that increase the risk of developing several diseases including type 2 diabetes and cardiovascular diseases. Although genome-wide association studies (GWAS) have successfully identified variants associated with individual traits comprising MetS, the genetic basis and pathophysiological mechanisms underlying the clustering of these traits remain unclear. We conducted GWAS of MetS in 1427 Africans from Ghana and Nigeria followed by replication testing and meta-analysis in another continental African sample from Kenya. Further replication testing was performed in an African American sample from the Atherosclerosis Risk in Communities (ARIC) study. We found two African-ancestry specific variants that were significantly associated with MetS: SNP rs73989312[A] near CA10 that conferred increased risk (P=3.86 × 10(-8), OR=6.80) and SNP rs77244975[C] in CTNNA3 that conferred protection against MetS (P=1.63 × 10(-8), OR=0.15). Given the exclusive expression of CA10 in the brain, our CA10 finding strengthens previously reported link between brain function and MetS. We also identified two variants that are not African specific: rs76822696[A] near RALYL associated with increased MetS risk (P=7.37 × 10(-9), OR=1.59) and rs7964157[T] near KSR2 associated with reduced MetS risk (P=4.52 × 10(-8), Pmeta=7.82 × 10(-9), OR=0.53). The KSR2 locus displayed pleiotropic associations with triglyceride and measures of blood pressure. Rare KSR2 mutations have been reported to be associated with early onset obesity and insulin resistance. Finally, we replicated the LPL and CETP loci previously found to be associated with MetS in Europeans. These findings provide novel insights into the genetics of MetS in Africans and demonstrate the utility of conducting trans-ethnic disease gene mapping studies for testing the cosmopolitan significance of GWAS signals of cardio-metabolic traits.

Also flagged:endometriosisbreast neoplasmsphthalatesContbisphenolBreast Cancer
Journal Article 2015-10-23 No Snippets Roy D, Morgan M, Yoo C, Deoraj A, Roy S, Yadav VK, Garoub M, Assaggaf H, Doke M.
Show Full Abstract

We present a combined environmental epidemiologic, genomic, and bioinformatics approach to identify: exposure of environmental chemicals with estrogenic activity; epidemiologic association between endocrine disrupting chemical (EDC) and health effects, such as, breast cancer or endometriosis; and gene-EDC interactions and disease associations. Human exposure measurement and modeling confirmed estrogenic activity of three selected class of environmental chemicals, polychlorinated biphenyls (PCBs), bisphenols (BPs), and phthalates. Meta-analysis showed that PCBs exposure, not Bisphenol A (BPA) and phthalates, increased the summary odds ratio for breast cancer and endometriosis. Bioinformatics analysis of gene-EDC interactions and disease associations identified several hundred genes that were altered by exposure to PCBs, phthalate or BPA. EDCs-modified genes in breast neoplasms and endometriosis are part of steroid hormone signaling and inflammation pathways. All three EDCs-PCB 153, phthalates, and BPA influenced five common genes-CYP19A1, EGFR, ESR2, FOS, and IGF1-in breast cancer as well as in endometriosis. These genes are environmentally and estrogen responsive, altered in human breast and uterine tumors and endometriosis lesions, and part of Mitogen Activated Protein Kinase (MAPK) signaling pathways in cancer. Our findings suggest that breast cancer and endometriosis share some common environmental and molecular risk factors.

Also flagged:dipeptidesl-tyrosinetyrosineargininesynthesisl-arginine methyl esters
Journal Article 2015-10-23 No Snippets Ferreira S, Carvalho J, Valente JFA, Corvo MC, Cabrita EJ, Sousa F, Queiroz JA, Cruz C.
Show Full Abstract

The developments in the use of plasmid DNA (pDNA) in gene therapy and vaccines have motivated the search and improvement of optimized purification processes. In this context, dipeptides l-tyrosine-l-tyrosine and l-tyrosine-l-arginine are synthetized to explore their application as affinity ligands for supercoiled (sc) plasmid DNA (pDNA) purification. The synthesis is based on the protection of N-Boc-l-tyrosine, followed by condensation with l-tyrosine or l-arginine methyl esters in the presence of dicyclohexylcarbodiimide (DCC), which after hydrolysis and acidification give the afforded dipeptides. The supports are then obtained by coupling l-tyrosine, l-tyrosine-l-tyrosine and l-tyrosine-l-arginine to epoxy-activated Sepharose and are characterized by high resolution magic angle spinning (HR-MAS) NMR and Fourier transform infrared spectroscopy (FTIR). Surface plasmon resonance (SPR) biosensor is used to establish the promising ligand to be used in the chromatographic experiments and ascertain experimental conditions. Sc isoform showed the highest affinity to the dipeptides, followed by linear (ln) pDNA, being the open circular (oc) the one that promoted the lowest affinity to l-tyrosine-l-arginine. Saturation transfer difference (STD)-NMR experiments show that the interaction is mainly hydrophobic with the majority of the 5'-mononucleotides, except for 5'-GMP with l-tyrosine-l-arginine Sepharose that is mainly electrostatic. The support l-tyrosine Sepharose used in chromatographic experiments promotes the separation of native pVAX1-LacZ and pcDNA3-FLAG-p53 samples (oc+sc) by decreasing the salt concentration. The results suggest that it is possible to purify different plasmids with the l-tyrosine Sepharose, with slight adjustments in the gradient conditions.

Also flagged:serotoninautismserotonin receptor 2AHTR2ASerotonin receptorbehavioral
Journal Article 2015-10-23 ✓ 5 Snippets Gong P, Liu J, Blue PR, Li S, Zhou X.
In-Text Gene Mentions

However, HTR2A and 5-HTT may have different mechanisms of regulating the serotonin availability, considering their differential distributions in pre- and post-synaptic membranes.

…transporter gene (5-HTT) on self-reported…

…However, HTR2A and5-HTTmay have different…

…st-synaptic membranes, whereas5-HTTproteins are mainly…

…the effect of5-HTTgene on empathy…

Show Full Abstract

Previous studies have indicated that empathic traits, such as perspective taking, are associated with the levels of serotonin in the brain and with autism spectrum conditions. Inspired by the finding that the serotonin receptor 2A gene (HTR2A) modulates the availability of serotonin, this study investigated to what extent HTR2A modulates individuals' perspective taking ability and autistic-like traits. To examine the associations of the functional HTR2A polymorphism T102C (rs6313) with individuals' perspective taking abilities and autistic-like traits, we differentiated individuals according to this polymorphism and measured empathic and autistic-like traits with Interpersonal Reactivity Index (IRI) and Autism-Spectrum Quotient (AQ) scale in 523 Chinese people. The results indicated that this polymorphism was significantly associated with the scores on Perspective Taking and Personal Distress subscales of IRI, and Communication subscale of AQ. Individuals with a greater number of the C alleles were less likely to spontaneously adopt the point of view of others, more likely to be anxious when observing the pain endured by others, and more likely to have communication problems. Moreover, the genotype effect on communication problems was mediated by individuals' perspective taking ability. These findings provide evidence that the HTR2A T102C polymorphism is a predictor of individual differences in empathic and autistic-like traits and highlight the role of the gene in the connection between perspective taking and autistic-like traits.

Also flagged:liver diseasesviral hepatitishepatitis B infectionautoimmune hepatitislymphomaportal hypertension
Journal Article 2015-10-23 ✓ 1 Snippet Amarapurkar D, Amarapurkar A.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Liver biopsy (LB) has been used as diagnostic modality in liver diseases (LD). Over last two decades, there has been remarkable improvement in understanding of natural history, molecular diagnostics of viral hepatitis, genetic of LD, and also limitations of LB. There is current trend in avoiding LB in the management of various LDs.<h4>Aim</h4>To determine utility of LB in clinical practice.<h4>Material and methods</h4>In a prospective study, 2413 patients of LD were followed up, 219 (9%) were acute, and remaining 2194 (90.9%) were chronic LD. Patients were evaluated by biochemical parameters, virological studies, and imaging endoscopy as and when required. LB was performed in 176 (7.2%) patients when no conclusion could be drawn from the noninvasive workup. Patients with platelet count <50,000/cm(2), ascites, and overt bleeding were excluded. Patients with international normalization ratio (INR) more than 1.5 were not excluded. No prophylactic use of fresh frozen plasma and platelet transfusion was done. There was no major complication related to the procedure. Indications for LB were as follows: cryptogenic LD 38 cases, hepatitis B infection 35, suspected autoimmune hepatitis 30, mass lesion in the liver and lymphoma 29, evaluation of portal hypertension 15, elevated liver enzymes 11, hepatitis C infection 9, and drug-induced LD 4, and miscellaneous 5 cases which were primary biliary cholangitis, primary sclerosing cholangitis, cholestatic LD, sarcoidosis, and amyloidosis.<h4>Results</h4>LB changed the diagnosis in 55 (31.2%). These were cryptogenic LD in 24 cases, portal hypertension 15, elevated liver enzymes 11, and 5 others. In remaining, LB confirmed clinical diagnosis and helped in making management decisions.<h4>Conclusion</h4>LB was required in 7.2% of patients with chronic LD. In 31.2% cases, LB changed the diagnosis. LB was a safe procedure even in presence of low platelet count and abnormal INR.

Also flagged:CCDC55cannabinoid receptorCNR1DISC1schizophreniacoiled coil domain-containing 55
Journal Article 2015-10-22 ✓ 2 Snippets Xie J, Gizatullin R, Vukojevic V, Leopardi R.
In-Text Gene Mentions

<h4>Purpose</h4>Our previous study suggested that the coiled coil domain-containing 55 gene (CCDC55), also named as NSRP1 (nuclear speckle splicing regulatory protein 1 (NSRP1)), was encompassed in a haplotype block spanning over the serotonin transporter (5-HTT) gene in patients with schizophrenia (SCZ).

…the serotonin transporter (5-HTT) gene in patients…

Show Full Abstract

<h4>Purpose</h4>Our previous study suggested that the coiled coil domain-containing 55 gene (CCDC55), also named as NSRP1 (nuclear speckle splicing regulatory protein 1 (NSRP1)), was encompassed in a haplotype block spanning over the serotonin transporter (5-HTT) gene in patients with schizophrenia (SCZ). However, the neurobiological function of CCDC55 gene remains unknown. This study aims to uncover the potential role of CCDC55 in SCZ-associated molecular pathways.<h4>Experimental design</h4>Using molecular cloning, sequencing and immune blotting to identify basic properties, yeast two-hybrid screening and glutathione S-transferase (GST) pull-down assay to test protein-protein interaction, and confocal laser scanning microscopy (CSLM) to show intracellular interaction of proteins.<h4>Principal findings</h4>(i) CCDC55 is expressed as a nuclear protein in human neuronal cells; (ii) Protein-protein interaction analyses showed CCDC55 physically interacted with Ran binding protein 9 (RanBP9) and disrupted in schizophrenia 1 (DISC1); (iii) CCDC55 and RanBP9 co-localized in the nucleus of human neuronal cells; (iv) CCDC55 also interacted with the cannabinoid receptor 1 (CNR1), and with the brain cannabinoid receptor-interacting protein 1a (CNRIP1a); (v) CNR1 activation in differentiated human neuronal cells resulted in an altered RanBP9 localization.<h4>Conclusion</h4>CCDC55 may be involved in a functional bridging between the CNR1 activation and the DISC1/RanBP9-associated pathways.

Also flagged:alkylluteolinNrf2Huntington's diseaseHDneurodegenerative disorder
Journal Article 2015-10-22 ✓ 3 Snippets Oliveira AM, Cardoso SM, Ribeiro M, Seixas RS, Silva AM, Rego AC.
In-Text Gene Mentions

Huntington's disease (HD) is a polyglutamine-expansion neurodegenerative disorder caused by increased number of CAG repeats in the HTT gene, encoding for the huntingtin protein.

…repeats in theHTTgene, encoding for…

…mice expressing mutantHtt(STHdh(Q111/Q111)) versus wild…

Show Full Abstract

Huntington's disease (HD) is a polyglutamine-expansion neurodegenerative disorder caused by increased number of CAG repeats in the HTT gene, encoding for the huntingtin protein. The mutation is linked to several intracellular mechanisms, including oxidative stress. Flavones are compounds with a protective role in neurodegenerative pathologies. In the present study we analyzed the protective effect of luteolin (Lut, 3',4',5,7-tetrahydroxyflavone) and four luteolin derivatives bearing 3-alkyl chains of 1, 4, 6 and 10 carbons (Lut-C1, Lut-C4, Lut-C6, Lut-C10) in striatal cells derived from HD knock-in mice expressing mutant Htt (STHdh(Q111/Q111)) versus wild-type striatal cells (STHdh(Q7/Q7)). HD cells showed increased caspase-3-like activity and intracellular reactive oxygen species (ROS), which were significantly decreased following treatment with Lut-C4 and Lut-C6 under concentrations that enhanced cell viability. Interestingly, Lut-C4 and Lut-C6 rose the nuclear levels of phospho(Ser40)-nuclear factor (erythroid-derived-2)-like 2 (Nrf2) and Nrf2/ARE transcriptional activity. Concordantly with increased Nrf2/ARE transcription, Lut-C6 enhanced superoxide dismutase 1 (SOD1) mRNA and SOD activity and glutamate-cysteine ligase catalytic subunit (GCLc) mRNA and protein levels, while Lut-C4 induced mRNA levels of GCLc only in mutant striatal cells. Data suggest that Lut-C6 luteolin derivative (in particular) might be relevant for the development of antioxidant strategies in HD.

Also flagged:E3 Ubiquitin LigaseRNA-binding proteinsRING-type E3 ubiquitin ligasebindingRoquinRC3H2
Journal Article 2015-10-22 ✓ 5 Snippets Zhang Q, Fan L, Hou F, Dong A, Wang YX, Tong Y.
In-Text Gene Mentions

Crystal structures, small-angle X-ray scattering, and E2 profiling revealed that while the two paralogs are highly homologous, RC3H2 and RC3H1 are different in their structures and functions.

A sanroque mutation (Met199Arg) in the mouse Roquin gene Rc3h1 leads to the production of high titre autoantibodies and a phenotype resembling human systemic lupus erythematosus (SLE)5.

In the RC3H1/Tnf23 structure, one of the central guanosine (G12) residue in the trinucleotide loop is not visible in the electron density map, while the purine ring of the other G12 forms a wobble-type base pairing with the U11 from the trinucleotide loop, creating a kink in the RNA duplex.

In the RC3H1/Tnf23 structure, the side chain of Arg131 forms hydrogen bonds with the purine base of an unpaired guanosine (G20 in one chain and G21 in the other) at the termini of the RNA duplex; while in the RC3H2/Ier3 structure, the side chain of the equivalent Arg128 interacts with the purine base of one central guanosine G8 (Fig. 3B) but not the guanosine in the other chain.

Given the similarity of the phenotype of sanroque mice with the symptoms of human SLE, it is tempting to postulate that the RC3H1-UBE2L3 axis may act in the pathogenesis of the disease.

Show Full Abstract

Roquins are a family of highly conserved RNA-binding proteins that also contain a RING-type E3 ubiquitin ligase domain. They repress constitutive decay elements containing mRNAs and play a critical role in RNA homeostasis and immunological self-tolerance. Here we present the crystal structures of the RNA-binding region of Roquin paralog RC3H2 in both apo- and RNA-bound forms. The RNA-binding region has a bipartite architecture composed of ROQ and HEPN domains, and can bind to stem-loop and double-stranded RNAs simultaneously. The two domains undergo a large orientation change to accommodate RNA duplex binding. We profiled E2 ubiquitin-conjugating enzymes that pair with Roquins and found that RC3H1 and RC3H2 interact with two sets of overlapping but not identical E2 enzymes to drive the assembly of polyubiquitin chains of different linkages. Crystal structures, small-angle X-ray scattering, and E2 profiling revealed that while the two paralogs are highly homologous, RC3H2 and RC3H1 are different in their structures and functions. We also demonstrated that RNA duplex binding to RC3H2 cross-talks with its E3 ubiquitin ligase function using an in vitro auto-ubiquitination assay.

Also flagged:CD45ROHDACProteaseprovirusesglycolic acidpolyethylene glycol
Journal Article 2015-10-22 No Snippets Tang X, Liang Y, Liu X, Zhou S, Liu L, Zhang F, Xie C, Cai S, Wei J, Zhu Y, Hou W.
Show Full Abstract

Activating HIV-1 proviruses in latent reservoirs combined with inhibiting viral spread might be an effective anti-HIV therapeutic strategy. Active specific delivery of therapeutic drugs into cells harboring latent HIV, without the use of viral vectors, is a critical challenge to this objective. In this study, nanoparticles of poly(lactic-co-glycolic acid)-polyethylene glycol diblock copolymers conjugated with anti-CD45RO antibody and loaded with the histone deacetylase inhibitor suberoylanilide hydroxamic acid (SAHA) and/or protease inhibitor nelfinavir (Nel) were tested for activity against latent virus in vitro. Nanoparticles loaded with SAHA, Nel, and SAHA + Nel were characterized in terms of size, surface morphology, zeta potential, entrapment efficiency, drug release, and toxicity to ACH-2 cells. We show that SAHA- and SAHA + Nel-loaded nanoparticles can target latently infected CD4(+) T-cells and stimulate virus production. Moreover, nanoparticles loaded with SAHA + NEL were capable of both activating latent virus and inhibiting viral spread. Taken together, these data demonstrate the potential of this novel reagent for targeting and eliminating latent HIV reservoirs.

Also flagged:chromosomal disordersugarmetabolismtype 2 diabetesextreme obesitycongenital heart disease
Journal Article 2015-10-22 No Snippets Fakhro KA, Yousri NA, Rodriguez-Flores JL, Robay A, Staudt MR, Agosto-Perez F, Salit J, Malek JA, Suhre K, Jayyousi A, Zirie M, Stadler D, Mezey JG, Crystal RG.
Show Full Abstract

<h4>Background</h4>The populations of the Arabian Peninsula remain the least represented in public genetic databases, both in terms of single nucleotide variants and of larger genomic mutations. We present the first high-resolution copy number variation (CNV) map for a Gulf Arab population, using a hybrid approach that integrates array genotyping intensity data and next-generation sequencing reads to call CNVs in the Qatari population.<h4>Methods</h4>CNVs were detected in 97 unrelated Qatari individuals by running two calling algorithms on each of two primary datasets: high-resolution genotyping (Illumina Omni 2.5M) and high depth whole-genome sequencing (Illumina PE 100bp). The four call-sets were integrated to identify high confidence CNV regions, which were subsequently annotated for putative functional effect and compared to public databases of CNVs in other populations. The availability of genome sequence was leveraged to identify tagging SNPs in high LD with common deletions in this population, enabling their imputation from genotyping experiments in the future.<h4>Results</h4>Genotyping intensities and genome sequencing data from 97 Qataris were analyzed with four different algorithms and integrated to discover 16,660 high confidence CNV regions (CNVRs) in the total population, affecting ~28 Mb in the median Qatari genome. Up to 40% of all CNVs affected genes, including novel CNVs affecting Mendelian disease genes, segregating at different frequencies in the 3 major Qatari subpopulations, including those with Bedouin, Persian/South Asian, and African ancestry. Consistent with high consanguinity levels in the Bedouin subpopulation, we found an increased burden for homozygous deletions in this group. In comparison to known CNVs in the comprehensive Database of Genomic Variants, we found that 5% of all CNVRs in Qataris were completely novel, with an enrichment of CNVs affecting several known chromosomal disorder loci and genes known to regulate sugar metabolism and type 2 diabetes in the Qatari cohort. Finally, we leveraged the availability of genome sequence to find suitable tagging SNPs for common deletions in this population.<h4>Conclusion</h4>We combine four independently generated datasets from 97 individuals to study CNVs for the first time at high-resolution in a Gulf Arab population.

Also flagged:Glucosesilversilver nanoparticlescancerneutral redmitochondria
Journal Article 2015-10-22 ✓ 1 Snippet Zuberek M, Wojciechowska D, Krzyzanowski D, Meczynska-Wielgosz S, Kruszewski M, Grzelak A.
In-Text Gene Mentions

…PRDX2, PEDX4, PRDX5,PRDX6, PTGS1, RNF7, SEPP1,…

Show Full Abstract

<h4>Background</h4>The increasing body of evidence suggest that nanomaterials toxicity is associated with generation of oxidative stress. In this paper we investigated the role of respiration in silver nanoparticles (AgNPs) generated oxidative stress and toxicity. Since cancer cells rely on glucose as the main source of energy supply, glucose availability might be an important determinant of NPs toxicity.<h4>Methods</h4>AgNPs of 20 nm nominal diameter were used as a model NPs. HepG2 cells were cultured in the media with high (25 mM) or low (5.5 mM) glucose content and treated with 20 nm AgNPs. AgNPs-induced toxicity was tested by neutral red assay. Generation of H2O2 in mitochondria was evaluated by use of mitochondria specific protein indicator HyPer-Mito. Expression of a 77 oxidative stress related genes was assessed by qPCR. The activity of antioxidant enzymes was estimated colorimetrically by dedicated methods in cell homogenates.<h4>Results</h4>AgNPs-induced dose-dependent generation of H2O2 and toxicity was observed. Toxicity of AgNPs towards cells maintained in the low glucose medium was significantly lower than the toxicity towards cells growing in the high glucose concentration. Scarceness of glucose supply resulted in upregulation of the endogenous antioxidant defence mechanisms that in turn alleviated AgNPs dependent ROS generation and toxicity.<h4>Conclusion</h4>Glucose availability can modify toxicity of AgNPs via elevation of antioxidant defence triggered by oxidative stress resulted from enhanced oxidative phosphorylation in mitochondria and associated generation of ROS. Presented results strengthen the idea of strong linkage between NPs toxicity and intracellular respiration and possibly other mitochondria dependent processes.

Also flagged:Amyotrophic Lateral SclerosisIronpathogenesisALSnucleuscaudate nucleus
Journal Article 2015-10-22 ✓ 1 Snippet Sheelakumari R, Madhusoodanan M, Radhakrishnan A, Ranjith G, Thomas B.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background and purpose</h4>Iron-mediated oxidative stress plays a pivotal role in the pathogenesis of amyotrophic lateral sclerosis. This study aimed to assess iron deposition qualitatively and quantitatively by using SWI and microstructural changes in the corticospinal tract by using DTI in patients with amyotrophic lateral sclerosis.<h4>Materials and methods</h4>Seventeen patients with amyotrophic lateral sclerosis and 15 age- and sex-matched controls underwent brain MR imaging with SWI and DTI. SWI was analyzed for both signal-intensity scoring and quantitative estimation of iron deposition in the anterior and posterior banks of the motor and sensory cortices and deep gray nuclei. The diffusion measurements along the corticospinal tract at the level of pons and medulla were obtained by ROI analysis.<h4>Results</h4>Patients with amyotrophic lateral sclerosis showed reduced signal-intensity grades in the posterior bank of the motor cortex bilaterally. Quantitative analysis confirmed significantly higher iron content in the posterior bank of the motor cortex in patients with amyotrophic lateral sclerosis. In contrast, no significant differences were noted for the anterior bank of the motor cortex, anterior and posterior banks of the sensory cortex, and deep nuclei. Receiver operating characteristic comparison showed a cutoff of 35μg Fe/g of tissue with an area under the curve of 0.78 (P = .008) for the posterior bank of the motor cortex in discriminating patients with amyotrophic lateral sclerosis from controls. Fractional anisotropy was lower in the pyramidal tracts of patients with amyotrophic lateral sclerosis at the pons and medulla on either side, along with higher directionally averaged mean diffusivity values. The combination of SWI and DTI revealed an area under the curve of 0.784 for differentiating patients with amyotrophic lateral sclerosis from controls.<h4>Conclusions</h4>Measurements of motor cortex iron deposition and diffusion tensor parameters of the corticospinal tract may be useful biomarkers for the diagnosis of clinically suspected amyotrophic lateral sclerosis.

Also flagged:cancermetabolic disordersgenetic diseaseNucleic acidsoligonucleotidespairing
Journal Article 2015-10-22 ✓ 1 Snippet Childs-Disney JL, Disney MD.
In-Text Gene Mentions

HTT

Show Full Abstract

RNA has become an increasingly important target for therapeutic interventions and for chemical probes that dissect and manipulate its cellular function. Emerging targets include human RNAs that have been shown to directly cause cancer, metabolic disorders, and genetic disease. In this review, we describe various routes to obtain bioactive compounds that target RNA, with a particular emphasis on the development of small molecules. We use these cases to describe approaches that are being developed for target validation, which include target-directed cleavage, classic pull-down experiments, and covalent cross-linking. Thus, tools are available to design small molecules to target RNA and to identify the cellular RNAs that are their targets.

Also flagged:Appl1Appl2HGFAktphosphatidylinositol-3 kinasereproduction
Journal Article 2015-10-21 No Snippets Tan Y, Xin X, Coffey FJ, Wiest DL, Dong LQ, Testa JR.
Show Full Abstract

Although Appl1 and Appl2 have been implicated in multiple cellular activities, we and others have found that Appl1 is dispensable for mouse embryonic development, suggesting that Appl2 can substitute for Appl1 during development. To address this possibility, we generated conditionally targeted Appl2 mice. We found that ubiquitous Appl2 knockout (Appl2-/-) mice, much like Appl1-/- mice, are viable and grow normally to adulthood. Intriguingly, when Appl1-/- mice were crossed with Appl2-/- mice, we found that homozygous Appl1;Appl2 double knockout (DKO) animals are also viable and grossly normal with regard to reproductive potential and postnatal growth. Appl2-null and DKO mice were found to exhibit altered red blood cell physiology, with erythrocytes from these mice generally being larger and having a more irregular shape than erythrocytes from wild type mice. Although Appl1/2 proteins have been previously shown to have a very strong interaction with phosphatidylinositol-3 kinase (Pi3k) in thymic T cells, Pi3k-Akt signaling and cellular differentiation was unaltered in thymocytes from Appl1;Appl2 (DKO) mice. However, Appl1/2-null mouse embryonic fibroblasts exhibited defects in HGF-induced Akt activation, migration, and invasion. Taken together, these data suggest that Appl1 and Appl2 are required for robust HGF cell signaling but are dispensable for embryonic development and reproduction.

Also flagged:cancerprimarytumorMStissue morphogenesiscell proliferation
Journal Article 2015-10-21 ✓ 2 Snippets Zhao M, Li Z, Qu H.
In-Text Gene Mentions

…(NME1, BRMS1, CD82,PEBP1, KISS1, NME2, CDH1,…

…including “Role ofDCCin regulating apoptosis,”…

Show Full Abstract

Metastasis suppressor genes (MS genes) are genes that play important roles in inhibiting the process of cancer metastasis without preventing growth of the primary tumor. Identification of these genes and understanding their functions are critical for investigation of cancer metastasis. Recent studies on cancer metastasis have identified many new susceptibility MS genes. However, the comprehensive illustration of diverse cellular processes regulated by metastasis suppressors during the metastasis cascade is lacking. Thus, the relationship between MS genes and cancer risk is still unclear. To unveil the cellular complexity of MS genes, we have constructed MSGene (http://MSGene.bioinfo-minzhao.org/), the first literature-based gene resource for exploring human MS genes. In total, we manually curated 194 experimentally verified MS genes and mapped to 1448 homologous genes from 17 model species. Follow-up functional analyses associated 194 human MS genes with epithelium/tissue morphogenesis and epithelia cell proliferation. In addition, pathway analysis highlights the prominent role of MS genes in activation of platelets and coagulation system in tumor metastatic cascade. Moreover, global mutation pattern of MS genes across multiple cancers may reveal common cancer metastasis mechanisms. All these results illustrate the importance of MSGene to our understanding on cell development and cancer metastasis.

Also flagged:Calebbehaviouralmatingwaterreproduction
Journal Article 2015-10-21 No Snippets Briceño F, Linnane AJ, Quiroz JC, Gardner C, Pecl GT.
Show Full Abstract

Depredation of southern rock lobster (Jasus edwardsii) within fishing gear by the Maori octopus (Pinnoctopus cordiformis) has economic and ecological impacts on valuable fisheries in South Australia. In addition, depredation rates can be highly variable resulting in uncertainties for the fishery. We examined how in-pot lobster predation was influenced by factors such as lobster size and sex, season, fishing zone, and catch rate. Using mixed modelling techniques, we found that in-pot predation risk increased with lobster size and was higher for male lobsters. In addition, the effect of catch rate of lobsters on predation risk by octopus differed among fishing zones. There was both a seasonal and a spatial component to octopus predation, with an increased risk within discrete fishing grounds in South Australia at certain times of the year. Information about predation within lobster gear can assist fishery management decision-making, potentially leading to significant reduction in economic losses to the fishery.

Also flagged:HLA-DRautoimmune hepatitisHLA-DR4IgGprothrombinalbumin
Journal Article 2015-10-21 ✓ 1 Snippet Furumoto Y, Asano T, Sugita T, Abe H, Chuganji Y, Fujiki K, Sakata A, Aizawa Y.
In-Text Gene Mentions

…drug-induced liver disease,hemochromatosis, primary sclerosing cholangit…

Show Full Abstract

<h4>Background</h4>The role of HLA-DR antigens in the clinicopathological features of autoimmune hepatitis (AIH) is not clearly understood. We examined the implications of HLA-DR antigens in Japanese AIH, including the effect of HLA-DR4 on the age and pattern of AIH onset, clinicopathological features, and treatment efficacy.<h4>Methods</h4>A total of 132 AIH patients consecutively diagnosed and treated in 2000-2014 at 2 major hepatology centers of eastern Tokyo district were the subjects of this study. The frequency of HLA-DR phenotypes was compared with that in the healthy Japanese population. AIH patients were divided into HLA-DR4-positive or HLA-DR4-negative groups and further sub-classified into elderly and young-to-middle-aged groups, and differences in clinical and histological features were examined. Clinical features associated with the response to immunosuppressive therapy were also determined.<h4>Results</h4>The frequency of the HLA-DR4 phenotype was significantly higher in AIH than in control subjects (59.7 % vs. 41.8 %, P < 0.001), and the relative risk was 2.14 (95 % CI; 1.51-3.04). HLA-DR4-positive AIH patients were younger than HLA-DR4-negative patients (P = 0.034). Serum IgG and IgM levels were higher (P < 0.001 and P = 0.007, respectively) in HLA-DR4-positive patients. These differences were more prominent in elderly AIH patients. However, there was no difference in IgG and IgM levels between HLA-DR4-positive and HLA-DR4-negative patients of the young-to-middle-aged group. There were no differences in the histological features. In patients with refractory to immunosuppressive therapy, higher total bilirubin, longer prothrombin time, lower serum albumin, and lower platelet count were found. Imaging revealed splenomegaly to be more frequent in refractory patients than in non-refractory patients (60.0 % vs. 30.8 %, P = 0.038). HLA-DR phenotype distribution was similar regardless of response to immunosuppressive therapy.<h4>Conclusions</h4>HLA-DR4 was the only DR antigen significantly associated with Japanese AIH. The clinical features of HLA-DR4-positive AIH differed between elderly patients and young-to-middle-aged patients. Treatment response depended on the severity of liver dysfunction but not on HLA-DR antigens.

Also flagged:Huntington's diseaseneurodegenerative disorderpathogenesisproteasesmitochondrialcalcium
Journal Article 2015-10-21 ✓ 2 Snippets Clemens LE, Clemens LE, Weber JJ, Wlodkowski TT, Yu-Taeger L, Michaud M, Calaminus C, Eckert SH, Gaca J, Weiss A, Magg JC, Jansson EK, Eckert GP, Pichler BJ, Bordet T, Pruss RM, Riess O, Nguyen HP.
In-Text Gene Mentions

Huntington's disease is a fatal human neurodegenerative disorder caused by a CAG repeat expansion in the HTT gene, which translates into a mutant huntingtin protein.

…expansion in theHTTgene, which translates…

Show Full Abstract

Huntington's disease is a fatal human neurodegenerative disorder caused by a CAG repeat expansion in the HTT gene, which translates into a mutant huntingtin protein. A key event in the molecular pathogenesis of Huntington's disease is the proteolytic cleavage of mutant huntingtin, leading to the accumulation of toxic protein fragments. Mutant huntingtin cleavage has been linked to the overactivation of proteases due to mitochondrial dysfunction and calcium derangements. Here, we investigated the therapeutic potential of olesoxime, a mitochondria-targeting, neuroprotective compound, in the BACHD rat model of Huntington's disease. BACHD rats were treated with olesoxime via the food for 12 months. In vivo analysis covered motor impairments, cognitive deficits, mood disturbances and brain atrophy. Ex vivo analyses addressed olesoxime's effect on mutant huntingtin aggregation and cleavage, as well as brain mitochondria function. Olesoxime improved cognitive and psychiatric phenotypes, and ameliorated cortical thinning in the BACHD rat. The treatment reduced cerebral mutant huntingtin aggregates and nuclear accumulation. Further analysis revealed a cortex-specific overactivation of calpain in untreated BACHD rats. Treated BACHD rats instead showed significantly reduced levels of mutant huntingtin fragments due to the suppression of calpain-mediated cleavage. In addition, olesoxime reduced the amount of mutant huntingtin fragments associated with mitochondria, restored a respiration deficit, and enhanced the expression of fusion and outer-membrane transport proteins. In conclusion, we discovered the calpain proteolytic system, a key player in Huntington's disease and other neurodegenerative disorders, as a target of olesoxime. Our findings suggest that olesoxime exerts its beneficial effects by improving mitochondrial function, which results in reduced calpain activation. The observed alleviation of behavioural and neuropathological phenotypes encourages further investigations on the use of olesoxime as a therapeutic for Huntington's disease.

Also flagged:retinoblastoma-binding protein 4RBBP4nuclearbindingnuclear importnuclear transport
Journal Article 2015-10-21 ✓ 2 Snippets Tsujii A, Miyamoto Y, Moriyama T, Tsuchiya Y, Obuse C, Mizuguchi K, Oka M, Yoneda Y.
In-Text Gene Mentions

CSE1L

chromatin modifiers

Show Full Abstract

Nucleocytoplasmic trafficking is a fundamental cellular process in eukaryotic cells. Here, we demonstrated that retinoblastoma-binding protein 4 (RBBP4) functions as a novel regulatory factor to increase the efficiency of importin α/β-mediated nuclear import. RBBP4 accelerates the release of importin β1 from importin α via competitive binding to the importin β-binding domain of importin α in the presence of RanGTP. Therefore, it facilitates importin α/β-mediated nuclear import. We showed that the importin α/β pathway is down-regulated in replicative senescent cells, concomitant with a decrease in RBBP4 level. Knockdown of RBBP4 caused both suppression of nuclear transport and induction of cellular senescence. This is the first report to identify a factor that competes with importin β1 to bind to importin α, and it demonstrates that the loss of this factor can trigger cellular senescence.

Also flagged:triglyceridetriglyceridesgene expressioncardiovascular diseaseCVDAPOE
Journal Article 2015-10-21 No Snippets Sarzynski MA, Davidsen PK, Sung YJ, Hesselink MK, Schrauwen P, Rice TK, Rao DC, Falciani F, Bouchard C.
Show Full Abstract

<h4>Aim</h4>We performed genome-wide and transcriptome-wide profiling to identify genes and single nucleotide polymorphisms (SNPs) associated with the response of triglycerides (TG) to exercise training.<h4>Methods</h4>Plasma TG levels were measured before and after a 20-week endurance training programme in 478 white participants from the HERITAGE Family Study. Illumina HumanCNV370-Quad v3.0 BeadChips were genotyped using the Illumina BeadStation 500GX platform. Affymetrix HG-U133+2 arrays were used to quantitate gene expression levels from baseline muscle biopsies of a subset of participants (N=52). Genome-wide association study (GWAS) analysis was performed using MERLIN, while transcriptomic predictor models were developed using the R-package GALGO.<h4>Results</h4>The GWAS results showed that eight SNPs were associated with TG training-response (ΔTG) at p<9.9×10(-6), while another 31 SNPs showed p values <1×10(-4). In multivariate regression models, the top 10 SNPs explained 32.0% of the variance in ΔTG, while conditional heritability analysis showed that four SNPs statistically accounted for all of the heritability of ΔTG. A molecular signature based on the baseline expression of 11 genes predicted 27% of ΔTG in HERITAGE, which was validated in an independent study. A composite SNP score based on the top four SNPs, each from the genomic and transcriptomic analyses, was the strongest predictor of ΔTG (R(2)=0.14, p=3.0×10(-68)).<h4>Conclusions</h4>Our results indicate that skeletal muscle transcript abundance at 11 genes and SNPs at a number of loci contribute to TG response to exercise training. Combining data from genomics and transcriptomics analyses identified a SNP-based gene signature that should be further tested in independent samples.

Also flagged:lung diseaseNitric Oxidebronchopulmonary dysplasiaoxygenSP-Bphospholipid
Journal Article 2015-10-21 No Snippets Ballard RA, Keller RL, Black DM, Ballard PL, Merrill JD, Eichenwald EC, Truog WE, Mammel MC, Steinhorn RH, Rogers EE, Ryan RM, Durand DJ, Asselin JM, Bendel CM, Bendel-Stenzel EM, Courtney SE, Dhanireddy R, Hudak ML, Koch FR, Mayock DE, McKay VJ, O'Shea TM, Porta NF, Wadhawan R, Palermo L, TOLSURF Study Group.
Show Full Abstract

<h4>Objective</h4>To assess whether late surfactant treatment in extremely low gestational age (GA) newborn infants requiring ventilation at 7-14 days, who often have surfactant deficiency and dysfunction, safely improves survival without bronchopulmonary dysplasia (BPD).<h4>Study design</h4>Extremely low GA newborn infants (GA ≤28 0/7 weeks) who required mechanical ventilation at 7-14 days were enrolled in a randomized, masked controlled trial at 25 US centers. All infants received inhaled nitric oxide and either surfactant (calfactant/Infasurf) or sham instillation every 1-3 days to a maximum of 5 doses while intubated. The primary outcome was survival at 36 weeks postmenstrual age (PMA) without BPD, as evaluated by physiological oxygen/flow reduction.<h4>Results</h4>A total of 511 infants were enrolled between January 2010 and September 2013. There were no differences between the treated and control groups in mean birth weight (701 ± 164 g), GA (25.2 ± 1.2 weeks), percentage born at GA <26 weeks (70.6%), race, sex, severity of lung disease at enrollment, or comorbidities of prematurity. Survival without BPD did not differ between the treated and control groups at 36 weeks PMA (31.3% vs 31.7%; relative benefit, 0.98; 95% CI, 0.75-1.28; P = .89) or 40 weeks PMA (58.7% vs 54.1%; relative benefit, 1.08; 95% CI, 0.92-1.27; P = .33). There were no between-group differences in serious adverse events, comorbidities of prematurity, or severity of lung disease to 36 weeks.<h4>Conclusion</h4>Late treatment with up to 5 doses of surfactant in ventilated premature infants receiving inhaled nitric oxide was well tolerated, but did not improve survival without BPD at 36 or 40 weeks. Pulmonary and neurodevelopmental assessments are ongoing.<h4>Trial registration</h4>ClinicalTrials.gov: NCT01022580.

Also flagged:CMT2D neuropathybindinghereditary peripheral neuropathiesGlyRSprotein biosynthesisneuropilin 1
Journal Article 2015-10-21 ✓ 3 Snippets He W, Bai G, Zhou H, Wei N, White NM, Lauer J, Liu H, Shi Y, Dumitru CD, Lettieri K, Shubayev V, Jordanova A, Guergueltcheva V, Griffin PR, Burgess RW, Pfaff SL, Yang XL.
In-Text Gene Mentions

…mutant 34 ,DCCmutant 35 ,…

…mouse TrkB-Fc, mouseDCC-Fc, rat Robo1-Fc and…

…ignaling; 1:1000), mouse anti-DCC(AF5, Abcam; 1:100),…

Show Full Abstract

Selective neuronal loss is a hallmark of neurodegenerative diseases, which, counterintuitively, are often caused by mutations in widely expressed genes. Charcot-Marie-Tooth (CMT) diseases are the most common hereditary peripheral neuropathies, for which there are no effective therapies. A subtype of these diseases--CMT type 2D (CMT2D)--is caused by dominant mutations in GARS, encoding the ubiquitously expressed enzyme glycyl-transfer RNA (tRNA) synthetase (GlyRS). Despite the broad requirement of GlyRS for protein biosynthesis in all cells, mutations in this gene cause a selective degeneration of peripheral axons, leading to deficits in distal motor function. How mutations in GlyRS (GlyRS(CMT2D)) are linked to motor neuron vulnerability has remained elusive. Here we report that GlyRS(CMT2D) acquires a neomorphic binding activity that directly antagonizes an essential signalling pathway for motor neuron survival. We find that CMT2D mutations alter the conformation of GlyRS, enabling GlyRS(CMT2D) to bind the neuropilin 1 (Nrp1) receptor. This aberrant interaction competitively interferes with the binding of the cognate ligand vascular endothelial growth factor (VEGF) to Nrp1. Genetic reduction of Nrp1 in mice worsens CMT2D symptoms, whereas enhanced expression of VEGF improves motor function. These findings link the selective pathology of CMT2D to the neomorphic binding activity of GlyRS(CMT2D) that antagonizes the VEGF-Nrp1 interaction, and indicate that the VEGF-Nrp1 signalling axis is an actionable target for treating CMT2D.

Also flagged:Synthesisbenzenesulfonylsaltscarboxylic acidscancerN -Acylbenzenesulfonamides
Journal Article 2015-10-21 No Snippets Żołnowska B, Sławiński J, Belka M, Bączek T, Kawiak A, Chojnacki J, Pogorzelska A, Szafrański K.
Show Full Abstract

A series of novel N-acyl-4-chloro-5-methyl-2-(R¹-methylthio)benzenesulfonamides 18-47 have been synthesized by the reaction of N-[4-chloro-5-methyl-2-(R¹-methylthio) benzenesulfonyl]cyanamide potassium salts with appropriate carboxylic acids. Some of them showed anticancer activity toward the human cancer cell lines MCF-7, HCT-116 and HeLa, with the growth percentages (GPs) in the range from 7% to 46%. Quantitative structure-activity relationship (QSAR) studies on the cytotoxic activity of N-acylsulfonamides toward MCF-7, HCT-116 and HeLa were performed by using topological, ring and charge descriptors based on the stepwise multiple linear regression technique (MLR). The QSAR studies revealed three predictive and statistically significant models for the investigated compounds. The results obtained with these models indicated that the anticancer activity of N-acylsulfonamides depends on topological distances, number of ring system, maximum positive charge and number of atom-centered fragments. The metabolic stability of the selected compounds had been evaluated on pooled human liver microsomes and NADPH, both R¹ and R² substituents of the N-acylsulfonamides simultaneously affected them.

Also flagged:epirubicindocetaxellocally advanced breast cancerbreast cancerTumorfebrile neutropenia
Journal Article 2015-10-21 ✓ 3 Snippets Trudeau ME, Chapman JA, Guo B, Clemons MJ, Dent RA, Jong RA, Kahn HJ, Pritchard KI, Han L, O'Brien P, Shepherd LE, Parissenti AM.
In-Text Gene Mentions

Two other genes whose expression pre-treatment was significantly elevated in chemoresponsive tumors (BTN2A2 and ONECUT2) would be expected to improve clinical response to chemotherapy, since the enhanced expression of the former gene inhibits AKT-dependent survival pathways and is associated with improved patient prognosis (Ammann et al. 2013), while the latter gene is a known tumor suppressor gene (Rauch et al. 2006).

…ONECUT2 , and/orBTN2A2(Fig. 3 a).…

…chemoresponsive tumors (BTN2A2and ONECUT2 )…

Show Full Abstract

This phase I/II neoadjuvant trial (ClinicalTrials.gov identifier NCT00066443) determined maximally-tolerated doses (MTD), dose-limiting toxicities, response-to-therapy, and explored the role of novel response biomarkers. MA.22 accrued T3N0, any N2 or N3, and T4 breast cancer patients. Treatment was 6 cycles of 3-weekly (Schedule A; N = 47) or 8 cycles of 2-weekly (Schedule B; N = 46) epirubicin/docetaxel chemotherapy in sequential phase I/II studies, with growth factor support. In phase I of each schedule, MTDs were based on DLT. In phase II, clinical responses (CR/PR) and pathologic complete responses (pCR) were assessed. Tumor biopsy cores were obtained pre-, mid-, and post-treatment: 3 for pathologic assessment; 3 for microarray studies. DLT for Schedule A was febrile neutropenia at 105 mg/m(2) epirubicin and 75 mg/m(2) docetaxel; for schedule B, it was fatigue at 75 mg/m(2) for both agents. Phase II doses were 90 mg/m(2) epirubicin/75 mg/m(2) docetaxel for Schedule A and 60 mg/m(2) (both agents) for Schedule B. Schedule A CR/PR and pCR rates were 90 and 10 %, with large reductions in tumor RNA content and integrity following treatment; Schedule B results were 93 and 0 %, with smaller reductions in RNA quality. Pre-treatment expression of several genes was associated with clinical response, including those within a likely amplicon at 17q12 (ERBB2, TCAP, GSDMB, and PNMT). The combination regimens had acceptable toxicity, good clinical response, induction of changes in tumor RNA content and integrity. Pre-treatment expression of particular genes was associated with clinical responses, including several near 17q12, which with ERBB2, may better identify chemoresponsiveness.

Also flagged:schizophreniacardiovascular diseaseimmune-mediated diseasespsychiatric disordersbrain developmentdelusions
Journal Article 2015-10-21 ✓ 1 Snippet Srinivasan S, Bettella F, Mattingsdal M, Wang Y, Witoelar A, Schork AJ, Thompson WK, Zuber V, Schizophrenia Working Group of the Psychiatric Genomics Consortium, The International Headache Genetics Consortium, Winsvold BS, Zwart JA, Collier DA, Desikan RS, Melle I, Werge T, Dale AM, Djurovic S, Andreassen OA.
In-Text Gene Mentions

VRK2

Show Full Abstract

<h4>Background</h4>Why schizophrenia has accompanied humans throughout our history despite its negative effect on fitness remains an evolutionary enigma. It is proposed that schizophrenia is a by-product of the complex evolution of the human brain and a compromise for humans' language, creative thinking, and cognitive abilities.<h4>Methods</h4>We analyzed recent large genome-wide association studies of schizophrenia and a range of other human phenotypes (anthropometric measures, cardiovascular disease risk factors, immune-mediated diseases) using a statistical framework that draws on polygenic architecture and ancillary information on genetic variants. We used information from the evolutionary proxy measure called the Neanderthal selective sweep (NSS) score.<h4>Results</h4>Gene loci associated with schizophrenia are significantly (p = 7.30 × 10(-9)) more prevalent in genomic regions that are likely to have undergone recent positive selection in humans (i.e., with a low NSS score). Variants in brain-related genes with a low NSS score confer significantly higher susceptibility than variants in other brain-related genes. The enrichment is strongest for schizophrenia, but we cannot rule out enrichment for other phenotypes. The false discovery rate conditional on the evolutionary proxy points to 27 candidate schizophrenia susceptibility loci, 12 of which are associated with schizophrenia and other psychiatric disorders or linked to brain development.<h4>Conclusions</h4>Our results suggest that there is a polygenic overlap between schizophrenia and NSS score, a marker of human evolution, which is in line with the hypothesis that the persistence of schizophrenia is related to the evolutionary process of becoming human.

Also flagged:curcumininflammatory diseasesSMADERGTLRTLR9
Journal Article 2015-10-21 No Snippets Gan Y, Zheng S, Baak JP, Zhao S, Zheng Y, Luo N, Liao W, Fu C.
Show Full Abstract

Curcumin, the medically active component from Curcuma longa (Turmeric), is widely used to treat inflammatory diseases. Protein interaction network (PIN) analysis was used to predict its mechanisms of molecular action. Targets of curcumin were obtained based on ChEMBL and STITCH databases. Protein-protein interactions (PPIs) were extracted from the String database. The PIN of curcumin was constructed by Cytoscape and the function modules identified by gene ontology (GO) enrichment analysis based on molecular complex detection (MCODE). A PIN of curcumin with 482 nodes and 1688 interactions was constructed, which has scale-free, small world and modular properties. Based on analysis of these function modules, the mechanism of curcumin is proposed. Two modules were found to be intimately associated with inflammation. With function modules analysis, the anti-inflammatory effects of curcumin were related to SMAD, ERG and mediation by the TLR family. TLR9 may be a potential target of curcumin to treat inflammation.

Also flagged:IronCalciumIron overload cardiomyopathyhemoglobinopathiesthalassemiasickle cell anemia
Journal Article 2015-10-21 ✓ 1 Snippet Khamseekaew J, Kumfu S, Chattipakorn SC, Chattipakorn N.
In-Text Gene Mentions

…primary form (ie,hemochromatosis) and a very…

Show Full Abstract

Iron overload cardiomyopathy occurs in a rare primary form (ie, hemochromatosis) and a very common secondary form in a host of hemoglobinopathies (eg, thalassemia, sickle cell anemia) of substantial and growing global prevalence, which have transformed iron overload cardiomyopathy into a worldwide epidemic. Intracellular calcium ([Ca(2+)]i) is known to be a critical regulator of myocardial function, in which it plays a key role in maintaining cardiac excitation-contraction coupling. It has been proposed that a disturbance in cardiac calcium regulation is a major contributor to left ventricular dysfunction in iron overload cardiomyopathy. This review comprehensively summarizes reports concerned with the effects of iron overload on cardiac calcium regulation, including alteration in the intracellular calcium level, voltage-gated calcium channel function, and calcium cycling protein activity. Consistent reports, as well as inconsistent findings, from both in vitro and in vivo studies, are presented and discussed. The understanding of these mechanisms has provided important new pathophysiological insights and has led to the development of novel therapeutic and preventive strategies for patients with iron overload cardiomyopathy that are currently in clinical trials.

Also flagged:Methylationtranscription factorbindinggene expressioncell differentiationorganization
Journal Article 2015-10-20 No Snippets Huang CZ, Yu T, Chen QK.
Show Full Abstract

DNA methylation, an epigenetic control mechanism in mammals, is widely present in the intestinal tract during the differentiation and proliferation of epithelial cells. Cells in stem cell pools or villi have different patterns of DNA methylation. The process of DNA methylation is dynamic and occurs at many relevant regulatory elements during the rapid transition of stem cells into fully mature, differentiated epithelial cells. Changes in DNA methylation patterns most often take place in enhancer and promoter regions and are associated with transcription factor binding. During differentiation, enhancer regions associated with genes important to enterocyte differentiation are demethylated, activating gene expression. Abnormal patterns of DNA methylation during differentiation and proliferation in the intestinal tract can lead to the formation of aberrant crypt foci and destroy the barrier and absorptive functions of the intestinal epithelium. Accumulation of these epigenetic changes may even result in tumorigenesis. In the current review, we discuss recent findings on the association between DNA methylation and cell differentiation and proliferation in the small intestine and highlight the possible links between dysregulation of this process and tumorigenesis.

Also flagged:chromosomeBBS9EBLN1THNSL2obesityADCY8
Journal Article 2015-10-20 ✓ 5 Snippets Sung YJ, Pérusse L, Sarzynski MA, Fornage M, Sidney S, Sternfeld B, Rice T, Terry JG, Jacobs DR, Katzmarzyk P, Curran JE, Jeffrey Carr J, Blangero J, Ghosh S, Després JP, Rankinen T, Rao DC, Bouchard C.
In-Text Gene Mentions
⭐ same-sentence co-mention

Our results provide evidence for new loci influencing abdominal visceral (BBS9, ADCY8, KCNK9) and subcutaneous (MLLT10/DNAJC1/EBLN1) fat, and confirmed a locus (THNSL2) previously reported to be associated with abdominal fat in women.

⭐ same-sentence co-mention

The strongest evidence of association, and the only one reaching genome-wide significant level (p < 5.0 × 10−8), was found for SAT in women with 11 SNPs encompassing three different loci on chromosome 10p12.31: MLLT10, DNAJC1 and EBLN1. No evidence of association with obesity-related traits has been reported with these loci, but a SNP located in that region of chromosome 10 (rs16923476 at OTUD1/KIAA1217 locus; p = 3.69 × 10−8) was previously found to be associated with severe early-onset obesity (71).

⭐ same-sentence co-mention

…SNPs encompassing theMLLT10, DNAJC1 and EBLN1…

⭐ same-sentence co-mention

…encompassing the MLLT10,DNAJC1and EBLN1 genes…

⭐ same-sentence co-mention

…KCNK9) and subcutaneous (MLLT10/DNAJC1/EBLN1) fat, and confir…

Show Full Abstract

<h4>Background</h4>To identify loci associated with abdominal fat and replicate prior findings, we performed genome-wide association (GWA) studies of abdominal fat traits: subcutaneous adipose tissue (SAT); visceral adipose tissue (VAT); total adipose tissue (TAT) and visceral to subcutaneous adipose tissue ratio (VSR).<h4>Subjects and methods</h4>Sex-combined and sex-stratified analyses were performed on each trait with (TRAIT-BMI) or without (TRAIT) adjustment for body mass index (BMI), and cohort-specific results were combined via a fixed effects meta-analysis. A total of 2513 subjects of European descent were available for the discovery phase. For replication, 2171 European Americans and 772 African Americans were available.<h4>Results</h4>A total of 52 single-nucleotide polymorphisms (SNPs) encompassing 7 loci showed suggestive evidence of association (P<1.0 × 10(-6)) with abdominal fat in the sex-combined analyses. The strongest evidence was found on chromosome 7p14.3 between a SNP near BBS9 gene and VAT (rs12374818; P=1.10 × 10(-7)), an association that was replicated (P=0.02). For the BMI-adjusted trait, the strongest evidence of association was found between a SNP near CYCSP30 and VAT-BMI (rs10506943; P=2.42 × 10(-7)). Our sex-specific analyses identified one genome-wide significant (P<5.0 × 10(-8)) locus for SAT in women with 11 SNPs encompassing the MLLT10, DNAJC1 and EBLN1 genes on chromosome 10p12.31 (P=3.97 × 10(-8) to 1.13 × 10(-8)). The THNSL2 gene previously associated with VAT in women was also replicated (P=0.006). The six gene/loci showing the strongest evidence of association with VAT or VAT-BMI were interrogated for their functional links with obesity and inflammation using the Biograph knowledge-mining software. Genes showing the closest functional links with obesity and inflammation were ADCY8 and KCNK9, respectively.<h4>Conclusions</h4>Our results provide evidence for new loci influencing abdominal visceral (BBS9, ADCY8, KCNK9) and subcutaneous (MLLT10/DNAJC1/EBLN1) fat, and confirmed a locus (THNSL2) previously reported to be associated with abdominal fat in women.

Also flagged:biosynthesisPhenylpropanoidtranscription factorssynthesisDSnitrogen
Journal Article 2015-10-20 ✓ 2 Snippets Singh H, Rai KM, Upadhyay SK, Upadhyay SK, Pant P, Verma PC, Singh AP, Singh PK.
In-Text Gene Mentions

…7.7, followed byPRDX6; peroxiredoxin 6, 1-Cys…

PRDX6; peroxiredoxin 6, 1-Cys…

Show Full Abstract

Bryophytes are the first land plants but are scarcely studied at the molecular level. Here, we report transcriptome sequencing and functional annotation of Dumortiera hirsuta, as a representative bryophyte. Approximately 0.5 million reads with ~195 Mb data were generated by sequencing of mRNA using 454 pyrosequencer. De novo assembly of reads yielded 85,240 unigenes (12,439 contigs and 72,801 singletons). BlastX search at NCBI-NR database showed similarity of 33,662 unigenes with 10-(10) e-value. A total of 23,685 unigenes were annotated at TAIR10 protein database. The annotated unigenes were further classified using the Gene Ontology. Analysis at Kyoto Encyclopedia of Genes and Genomes pathway database identified 95 pathways with significant scores, among which metabolic and biosynthesis of secondary metabolite were the major ones. Phenylpropanoid pathway was elucidated and selected genes were characterized by real time qPCR. We identified 447 transcription factors belonging to 41 families and 1594 eSSRs in 1479 unigenes. D. hirsuta unigenes showed homology across the taxa from algae to angiosperm indicating their role as the connecting link between aquatic and terrestrial plants. This could be a valuable genomic resource for molecular and evolutionary studies. Further, it sheds light for the isolation and characterization of new genes with unique functions.

Also flagged:Methamphetamineaddictiondrug addictionsynaptosomescytoskeletonsynaptic vesicles
Journal Article 2015-10-20 ✓ 5 Snippets Bosch PJ, Peng L, Kivell BM.
In-Text Gene Mentions

Interestingly, our results vary from a recent publication which found reduced Pebp1 following methamphetamine self-administration and extinction training [16].

Our results correlate well with a previous cocaine self-administration and abstinence study with 4 of the 12 proteins (Pebp1, ATP synthase beta subunit, Malate dehydrogenase and dynamin-1) corresponding [15].

…hanolamine binding protein-1 (Pebp1, 1/750 dilution, ab76582,…

…hanolamine binding protein-1 (Pebp1), detected by LC-MS/MS…

…= 5) andPebp1(p<0.05, 1-tailed t-test,…

Show Full Abstract

Methamphetamine is a widely abused, highly addictive drug. Regulation of synaptic proteins within the brain's reward pathway modulates addiction behaviours, the progression of drug addiction and long-term changes in brain structure and function that result from drug use. Therefore, using large scale proteomics studies we aim to identify global protein expression changes within the dorsal striatum, a key brain region involved in the modulation of addiction. We performed LC-MS/MS analyses on rat striatal synaptosomes following 30 days of methamphetamine self-administration (2 hours/day) and 14 days abstinence. We identified a total of 84 differentially-expressed proteins with known roles in neuroprotection, neuroplasticity, cell cytoskeleton, energy regulation and synaptic vesicles. We identify significant expression changes in stress-induced phosphoprotein and tubulin polymerisation-promoting protein, which have not previously been associated with addiction. In addition, we confirm the role of amphiphysin and phosphatidylethanolamine binding protein in addiction. This approach has provided new insight into the effects of methamphetamine self-administration on synaptic protein expression in a key brain region associated with addiction, showing a large set of differentially-expressed proteins that persist into abstinence. The mass spectrometry proteomics data are available via ProteomeXchange with identifier PXD001443.

Also flagged:parturitionLUSCell contractionprostacyclin synthasePOSTNcell-
Journal Article 2015-10-20 ✓ 3 Snippets Liu L, Li H, Dargahi D, Shynlova O, Slater D, Jones SJ, Lye SJ, Dong X.
In-Text Gene Mentions

…xA13), prostacyclin synthase (PTGIS), and periostin (POSTN)…

…up-regulates transcription ofPTGISand POSTN genes.…

…levels of HoxA13,PTGIS, and POSTN, and…

Show Full Abstract

<h4>Context</h4>Bipedalism separates humans from most other animal species, but results in significant physiologic challenges, particularly with respect to the maintenance of pregnancy and induction of parturition. A contracted lower uterine segment (LUS) and a relaxed uterine fundal myometrium (FUN) during pregnancy are required to prevent pressure on the cervix from the fetal head due to gravity. With the onset of labor, this regionalization of myometrial function must be reversed, allowing descent of the fetus, dilation of the cervix, and expulsion of the fetus through the birth canal. However, the molecular mechanisms remain unclear.<h4>Objective and design</h4>This study sought to identify phenotypic regionalization of LUS and FUN during pregnancy, RNA sequencing was performed to analyze the human myometrial transcriptome. Real-time PCR and immunoblotting were applied to validate sequencing results. Cell contraction/adhesion assays and gene microarrays were used to study the cellular functions of the identified genes.<h4>Results</h4>Homeobox A13 (HoxA13), prostacyclin synthase (PTGIS), and periostin (POSTN) genes are more highly expressed in LUS than FUN of nonlaboring, but not laboring, myometrial cells at term. HoxA13 up-regulates transcription of PTGIS and POSTN genes. Elevated HoxA13 expression enhances myometrial cell contractility and cell-cell adhesion. Gene microarray studies show that HoxA13-regulated genes are associated with immune response, gap junction/cell adhesion, and pregnancy.<h4>Conclusion</h4>The LUS expresses higher levels of HoxA13, PTGIS, and POSTN, and is more contractile than the FUN at term prior to labor. This pregnancy-maintaining regionalization of myometrial function may be mediated by HoxA13.

Also flagged:RIG-I-like receptorRLRtype I interferonsIFNαantiviral responsetranscription factors
Journal Article 2015-10-20 No Snippets van der Lee R, Feng Q, Langereis MA, Ter Horst R, Szklarczyk R, Netea MG, Andeweg AC, van Kuppeveld FJ, Huynen MA.
Show Full Abstract

The RIG-I-like receptor (RLR) pathway is essential for detecting cytosolic viral RNA to trigger the production of type I interferons (IFNα/β) that initiate an innate antiviral response. Through systematic assessment of a wide variety of genomics data, we discovered 10 molecular signatures of known RLR pathway components that collectively predict novel members. We demonstrate that RLR pathway genes, among others, tend to evolve rapidly, interact with viral proteins, contain a limited set of protein domains, are regulated by specific transcription factors, and form a tightly connected interaction network. Using a Bayesian approach to integrate these signatures, we propose likely novel RLR regulators. RNAi knockdown experiments revealed a high prediction accuracy, identifying 94 genes among 187 candidates tested (~50%) that affected viral RNA-induced production of IFNβ. The discovered antiviral regulators may participate in a wide range of processes that highlight the complexity of antiviral defense (e.g. MAP3K11, CDK11B, PSMA3, TRIM14, HSPA9B, CDC37, NUP98, G3BP1), and include uncharacterized factors (DDX17, C6orf58, C16orf57, PKN2, SNW1). Our validated RLR pathway list (http://rlr.cmbi.umcn.nl/), obtained using a combination of integrative genomics and experiments, is a new resource for innate antiviral immunity research.

Also flagged:CD8parasitic infectionsinfectioncytokinemitochondrialdeath
Journal Article 2015-10-20 No Snippets Martin MD, Kim MT, Shan Q, Sompallae R, Xue HH, Harty JT, Badovinac VP.
Show Full Abstract

Memory CD8 T cells confer increased protection to immune hosts upon secondary viral, bacterial, and parasitic infections. The level of protection provided depends on the numbers, quality (functional ability), and location of memory CD8 T cells present at the time of infection. While primary memory CD8 T cells can be maintained for the life of the host, the full extent of phenotypic and functional changes that occur over time after initial antigen encounter remains poorly characterized. Here we show that critical properties of circulating primary memory CD8 T cells, including location, phenotype, cytokine production, maintenance, secondary proliferation, secondary memory generation potential, and mitochondrial function change with time after infection. Interestingly, phenotypic and functional alterations in the memory population are not due solely to shifts in the ratio of effector (CD62Llo) and central memory (CD62Lhi) cells, but also occur within defined CD62Lhi memory CD8 T cell subsets. CD62Lhi memory cells retain the ability to efficiently produce cytokines with time after infection. However, while it is was not formally tested whether changes in CD62Lhi memory CD8 T cells over time occur in a cell intrinsic manner or are due to selective death and/or survival, the gene expression profiles of CD62Lhi memory CD8 T cells change, phenotypic heterogeneity decreases, and mitochondrial function and proliferative capacity in either a lymphopenic environment or in response to antigen re-encounter increase with time. Importantly, and in accordance with their enhanced proliferative and metabolic capabilities, protection provided against chronic LCMV clone-13 infection increases over time for both circulating memory CD8 T cell populations and for CD62Lhi memory cells. Taken together, the data in this study reveal that memory CD8 T cells continue to change with time after infection and suggest that the outcome of vaccination strategies designed to elicit protective memory CD8 T cells using single or prime-boost immunizations depends upon the timing between antigen encounters.

Also flagged:Glutathioneneurodegenerative diseasesglutamylglycineoxygennitrogen
Journal Article 2015-10-20 No Snippets Pehar M, Ball LE, Sharma DR, Harlan BA, Comte-Walters S, Neely BA, Vargas MR.
Show Full Abstract

Astrocytes and neurons form a highly specialized functional unit, and the loss or gain of astrocytic functions can influence the initiation and progression of different neurodegenerative diseases. Neurons depend on the antioxidant protection provided by neighboring astrocytes. Glutathione (γ-l-glutamyl-l-cysteinyl-glycine) is a major component of the antioxidant system that defends cells against the toxic effects of reactive oxygen/nitrogen species. A decline in glutathione levels has been observed in aging and neurodegenerative diseases, and it aggravates the pathology in an amyotrophic lateral sclerosis-mouse model. Using a SILAC-based quantitative proteomic approach, we analyzed changes in global protein expression and lysine acetylation in primary astrocyte cultures obtained from wild-type mice or those deficient in the glutamate-cysteine ligase modifier subunit (GCLM). GCLM knockout astrocytes display an ∼80% reduction in total glutathione levels. We identified potential molecular targets and novel sites of acetylation that are affected by the chronic decrease in glutathione levels and observed a response mediated by Nrf2 activation. In addition, sequence analysis of peptides displaying increased acetylation in GCLM knockout astrocytes revealed an enrichment of cysteine residues in the vicinity of the acetylation site, which suggests potential crosstalk between lysine-acetylation and cysteine modification. Regulation of several metabolic and antioxidant pathways was observed at the level of protein expression and lysine acetylation, revealing a coordinated response involving transcriptional and posttranslational regulation.

Also flagged:Coronary Artery Diseasecardiovascular diseaseCVDlipoproteincholesteroltriglycerides
Journal Article 2015-10-20 No Snippets LeBlanc M, Zuber V, Andreassen BK, Witoelar A, Zeng L, Bettella F, Wang Y, McEvoy LK, Thompson WK, Schork AJ, Reppe S, Barrett-Connor E, Ligthart S, Dehghan A, Gautvik KM, Nelson CP, Schunkert H, Samani NJ, CARDIoGRAM Consortium, Ridker PM, Chasman DI, Aukrust P, Djurovic S, Frigessi A, Desikan RS, Dale AM, Andreassen OA.
Show Full Abstract

<h4>Rationale</h4>Coronary artery disease (CAD) is a critical determinant of morbidity and mortality. Previous studies have identified several cardiovascular disease risk factors, which may partly arise from a shared genetic basis with CAD, and thus be useful for discovery of CAD genes.<h4>Objective</h4>We aimed to improve discovery of CAD genes and inform the pathogenic relationship between CAD and several cardiovascular disease risk factors using a shared polygenic signal-informed statistical framework.<h4>Methods and results</h4>Using genome-wide association studies summary statistics and shared polygenic pleiotropy-informed conditional and conjunctional false discovery rate methodology, we systematically investigated genetic overlap between CAD and 8 traits related to cardiovascular disease risk factors: low-density lipoprotein cholesterol, high-density lipoprotein cholesterol, triglycerides, type 2 diabetes mellitus, C-reactive protein, body mass index, systolic blood pressure, and type 1 diabetes mellitus. We found significant enrichment of single-nucleotide polymorphisms associated with CAD as a function of their association with low-density lipoprotein, high-density lipoprotein, triglycerides, type 2 diabetes mellitus, C-reactive protein, body mass index, systolic blood pressure, and type 1 diabetes mellitus. Applying the conditional false discovery rate method to the enriched phenotypes, we identified 67 novel loci associated with CAD (overall conditional false discovery rate <0.01). Furthermore, we identified 53 loci with significant effects in both CAD and at least 1 of low-density lipoprotein, high-density lipoprotein, triglycerides, type 2 diabetes mellitus, C-reactive protein, systolic blood pressure, and type 1 diabetes mellitus.<h4>Conclusions</h4>The observed polygenic overlap between CAD and cardiometabolic risk factors indicates a pathogenic relation that warrants further investigation. The new gene loci identified implicate novel genetic mechanisms related to CAD.

Also flagged:structural maintenance of chromosomecohesincondensinschromosomecell cyclehydrogen
Journal Article 2015-10-20 ✓ 2 Snippets Uchiyama S, Kawahara K, Hosokawa Y, Fukakusa S, Oki H, Nakamura S, Kojima Y, Noda M, Takino R, Miyahara Y, Maruno T, Kobayashi Y, Ohkubo T, Fukui K.
In-Text Gene Mentions

…Formation of HumanCondensinStructural Maintenance of…

Condensin

Show Full Abstract

Eukaryotic structural maintenance of chromosome proteins (SMC) are major components of cohesin and condensins that regulate chromosome structure and dynamics during cell cycle. We here determine the crystal structure of human condensin SMC hinge heterodimer with ~30 residues of coiled coils. The structure, in conjunction with the hydrogen exchange mass spectrometry analyses, revealed the structural basis for the specific heterodimer formation of eukaryotic SMC and that the coiled coils from two different hinges protrude in the same direction, providing a unique binding surface conducive for binding to single-stranded DNA. The characteristic hydrogen exchange profiles of peptides constituted regions especially across the hinge-hinge dimerization interface, further suggesting the structural alterations upon single-stranded DNA binding and the presence of a half-opened state of hinge heterodimer. This structural change potentially relates to the DNA loading mechanism of SMC, in which the hinge domain functions as an entrance gate as previously proposed for cohesin. Our results, however, indicated that this is not the case for condensins based on the fact that the coiled coils are still interacting with each other, even when DNA binding induces structural changes in the hinge region, suggesting the functional differences of SMC hinge domain between condensins and cohesin in DNA recognition.

Also flagged:ZearalenonebiotinHRPantibodyMNPhyperestrogenism
Journal Article 2015-10-20 No Snippets Zhang X, Wang X, Sun M, Zhang X, Song H, Yan Y, Sun J, Li X, Fang W.
Show Full Abstract

A novel enzyme-linked immunosorbent assay based on magnetic nanoparticles and biotin/streptavidin-HRP (MNP-bsELISA) was developed for rapid and sensitive detection of zearalenone (ZEN). The detection signal was enhanced and the sensitivity of the assay was improved by combined use of antibody-conjugated magnetic nanoparticles and biotin-streptavidin system. Under the optimized conditions, the regression equation for quantification of ZEN was y = -0.4287x + 0.3132 (R² = 0.9904). The working range was 0.07-2.41 ng/mL. The detection limit was 0.04 ng/mL and IC50 was 0.37 ng/mL. The recovery rates of intra-assay and inter-assay ranged from 92.8%-111.9% and 91.7%-114.5%, respectively, in spiked corn samples. Coefficients of variation were less than 10% in both cases. Parallel analysis of cereal and feed samples showed good correlation between MNP-bsELISA and liquid chromatograph-tandem mass spectrometry (R² = 0.9283). We conclude that this method is suitable for rapid detection of zearalenone in cereal and feed samples in relevant laboratories.

Also flagged:methylationdepressionserotonin transporterserotonin5anxiety
Journal Article 2015-10-20 ✓ 3 Snippets Lei MK, Beach SR, Simons RL, Philibert RA.
In-Text Gene Mentions

Allele variants of the serotonin transporter gene (5-HTT) interact with neighborhood crime to predict depressive symptoms in a manner consonant with the differential susceptibility perspective.

…transporter gene (5-HTT) interact with…

5-HTT

Show Full Abstract

<h4>Introduction</h4>Social scientists have long recognized the important role that neighborhood crime can play in stress-related disease, but very little is known about potential biosocial mechanisms that may link the experience of living in high-crime neighborhoods with depression.<h4>Objective</h4>The current study introduces an integrated model that combines neighborhood, genetic, and epigenetic factors.<h4>Methods</h4>Hypotheses were tested with a sample of 99 African American women from the Family and Community Health Study (FACHS).<h4>Results</h4>Allele variants of the serotonin transporter gene (5-HTT) interact with neighborhood crime to predict depressive symptoms in a manner consonant with the differential susceptibility perspective. Furthermore, this association is mediated by DNA methylation of the promoter region of the serotonin transporter gene.<h4>Conclusion</h4>The findings provide support for an integrated model in which changes in DNA methylation, resulting from neighborhood crime, can result in an increase or decrease in gene activity which, in turn, influences depressive symptoms.

Also flagged:cell proliferationcancercancerscolorectal cancercell growthtumor
Journal Article 2015-10-20 ✓ 5 Snippets Li YC, Li CF, Chen LB, Li DD, Yang L, Jin JP, Zhang B.
In-Text Gene Mentions

SOX6, a member of the Sox transcription-factor family, plays critical roles in cell differentiation and proliferation.16,17 SOX6 is reported to have a tumor-suppressive function in cancers.18,19 Qin et al indicated that SOX6 inhibited cell proliferation by upregulating expressions of p53 and p21 and downregulating expressions of cyclin D1/CDK4, cyclin A, and β-catenin in esophageal cancer.20 Cyclin D1 and p21 are crucial in the regulation of cell proliferation, differentiation, apoptosis, and other cellular functions.21–23 In line with these reports, in our study, ectopic expression of miR-766 led to downregulation of SOX6, which resulted in the downregulation of p21, upregulation of cyclin D1, and thus the promotion of CRC cell proliferation.

Bioinformatic analysis predicted SOX6, a potential target of miR-766, acting as a tumor suppressor.

…targeting regulation ofSOX6expression promoted cell…

…oinformatic analysis predictedSOX6, a potential target…

…of miR-766 suppressedSOX6expression, resulting in…

Show Full Abstract

MicroRNAs (miRNAs) have emerged as important regulators of cancer-cell biological processes. Previous studies have shown that miR-766 plays an important role in a variety of biological processes in various human cancers. However, the underlying mechanism of miR-766 in colorectal cancer (CRC) cells remains unclear. In this study, we investigated miR-766's role in CRC cell proliferation. Polymerase chain reaction results showed that miR-766 expression was significantly upregulated in CRC tissues and cells. Ectopic expression of miR-766 promoted cell growth and anchorage-independent growth in CRC cells. Bioinformatic analysis predicted SOX6, a potential target of miR-766, acting as a tumor suppressor. Luciferase reporter assay results demonstrated that miR-766 directly bound to the 3'-untranslated region of SOX6. Overexpression of miR-766 suppressed SOX6 expression, resulting in the downregulation of p21 and upregulation of cyclin D1. In a further experiment, SOX6-silenced SW480 cells transfected with miR-766 promoted cell growth, suggesting that downregulation of SOX6 was required for miR-766-induced CRC cell proliferation. Taken together, these results suggested that miR-766 represents an onco-miRNA and participates in the development of CRC by modulating SOX6 expression.

Also flagged:SiliconCalcium phosphatedicalcium phosphate-tricalciumreceptor activator of nuclear factor κβ ligandRANKL
Journal Article 2015-10-20 No Snippets Vahabzadeh S, Roy M, Bose S.
Show Full Abstract

Calcium phosphate cements (CPCs) are being widely used for treating small scale bone defects. Among the various CPCs, brushite (dicalcium phosphate dihydrate, DCPD) cement is widely used due to its superior solubility and ability to form new bone. In the present study, we have studied the physical, mechanical, osteoclast-like-cells differentiation and <i>in vivo</i> osteogenic and vasculogenic properties of silicon (Si) doped brushite cements. Addition of Si did not alter the phase composition of final product and regardless of Si level, all samples included β-tricalcium phosphate (β-TCP) and DCPD. 1.1 wt. % Si addition increased the compressive strength of undoped brushite cement from 4.78±0.21 MPa to 5.53±0.53 MPa, significantly. Cellular activity was studied using receptor activator of nuclear factor κβ ligand (RANKL) supplemented osteoclast-like-cells precursor RAW 264.7 cell. Phenotypic expressions of the cells confirmed successful differentiation of RAW264.7 monocytes to osteoclast-like-cells on undoped and doped brushite cements. An increased activity of osteoclast-like cells was noticed due to Si doping in the brushite cement. An excellent new bone formation was found in all cement compositions, with significant increase in Si doped brushite samples as early as 4 weeks post implantation in rat femoral model. After 4 weeks of implantation, no significant difference was found in blood vessel formation between the undoped and doped cements, however, a significant increase in vasculgenesis was found in 0.8 and 1.1 wt. % Si doped brushite cements after 8 weeks. These results show the influence of Si dopant on physical, mechanical, <i>in vitro</i> osteoclastogenesis and <i>in vivo</i> osteogenic and vasculogenic properties of brushite cements.

Also flagged:serotonin transporterpositronbindingtransportersdepressionbipolar depression
Journal Article 2015-10-19 ✓ 5 Snippets Miller JM, Everett BA, Oquendo MA, Ogden RT, Mann JJ, Parsey RV.
In-Text Gene Mentions

…the serotonin transporter (5-HTT), but specific in…

5-HTTbinding was unrelated…

…evidence of abnormal5-HTTbinding in bipolar…

…C]DASB, we compared5-HTTbinding between unmedicated…

…did observe lower5-HTTbinding in BD…

Show Full Abstract

<h4>Objectives</h4>Bipolar disorder (BD) is associated with abnormalities in the serotonin transporter (5-HTT), but specific in vivo findings have been discrepant. Using positron emission tomography (PET) and [(11)C]DASB, we compared 5-HTT binding between unmedicated depressed BD subjects and healthy volunteers (HVs).<h4>Experimental design</h4>5-HTT binding in six brain regions was compared between 17 depressed, unmedicated BD subjects and 31 HVs, using the outcome measure of VT/fP (proportional to the total number of available transporters). Alternative outcome measures were examined as well. 47% of BD were BP I; and 65% reported a prior suicide attempt.<h4>Principal observations</h4>5-HTT binding (VT/fP ) did not differ between BD and HV groups considering six brain regions of interest simultaneously (P = 0.24). In contrast, alternative outcome measures (BPF*, BPP*, and BPND*) indicated lower binding in BD compared with HV across these six regions of interest (BPF*: P = 0.047; BPP*: P = 0.032; BPND*: P = 0.031). 5-HTT binding was unrelated to suicide attempt history, depression severity, bipolar subtype, or history of past substance use disorder.<h4>Conclusions</h4>Choice of outcome measure strongly affects comparisons of serotonin transporter binding using PET with [(11)C]DASB. We do not find evidence of abnormal 5-HTT binding in bipolar depression using our primary outcome measure, VT /fP . However, we did observe lower 5-HTT binding in BD with alternative outcome measures that are frequently used with [(11)C]DASB. Relative merits and assumptions of different outcome measures are discussed. Evaluation in larger samples and during different mood states, including remission, is warranted.

Also flagged:p53Trp53cancerstranscription factormetabolismcell cycle
Journal Article 2015-10-19 ✓ 2 Snippets D'Abramo M, Bešker N, Desideri A, Levine AJ, Melino G, Chillemi G.
In-Text Gene Mentions

…TheDCCMap for the…

…analysis of theDCCMap clearly highlights…

Show Full Abstract

The Trp53 gene is the most frequently mutated gene in all human cancers. Its protein product p53 is a very powerful transcription factor that can activate different biochemical pathways and affect the regulation of metabolism, senescence, DNA damage response, cell cycle and cell death. The understanding of its function at the molecular level could be of pivotal relevance for therapy. Investigation of long-range intra- and interdomain communications in the p53 tetramer-DNA complex was performed by means of an atomistic model that included the tetramerization helices in the C-terminal domain, the DNA-binding domains and a consensus DNA-binding site of 18 base pairs. Nonsymmetric dynamics are illustrated in the four DNA-binding domains, with loop L1 switching from inward to outward conformations with respect to the DNA major groove. Direct intra- and intermonomeric long-range communications between the tetramerization and DNA-binding domains are noted. These long-distance conformational changes link the C terminus with the DNA-binding domain and provide a biophysical rationale for the reported functional regulation of the p53 C-terminal region. A fine characterization of the DNA deformation caused by p53 binding is obtained, with 'static' deformations always present and measured by the slide parameter in the central thymine-adenine base pairs; we also detect 'dynamic' deformations switched on and off by particular p53 tetrameric conformations and measured by the roll and twist parameters in the same base pairs. These different conformations can indeed modulate the electrostatic potential isosurfaces of the whole p53-DNA complex. These results provide a molecular/biophysical understanding of the evident role of the C terminus in post-translational modification that regulates the transcriptional function of p53. Furthermore, the unstructured C terminus is able to facilitate contacts between the core DNA-binding domains of the tetramer.

Also flagged:Estrogenestrogen receptorSOCS3tissue remodelingchronic inflammatory diseasesmenopause
Journal Article 2015-10-19 No Snippets Villa A, Rizzi N, Vegeto E, Ciana P, Maggi A.
Show Full Abstract

Although 17β-estradiol (E2) anti-inflammatory activity has been well described, very little is known about the effects of this hormone on the resolution phase of the inflammatory process. Here, we identified a previously unreported ERα-mediated effect of E2 on the inflammatory machinery. The study showed that the activation of the intracellular estrogen receptor shortens the LPS-induced pro-inflammatory phase and, by influencing the intrinsic and extrinsic programs, triggers the resolution of inflammation in RAW 264.7 cells. Through the regulation of the SOCS3 and STAT3 signaling pathways, E2 facilitates the progression of the inflammatory process toward the IL10-dependent "acquired deactivation" phenotype, which is responsible for tissue remodeling and the restoration of homeostatic conditions. The present study may provide an explanation for increased susceptibility to chronic inflammatory diseases in women after menopause, and it suggests novel anti-inflammatory treatments for such disorders.

Also flagged:Integrin receptormembraneILKPINCHFAKpaxillin
Journal Article 2015-10-19 No Snippets Horton ER, Byron A, Askari JA, Ng DHJ, Millon-Frémillon A, Robertson J, Koper EJ, Paul NR, Warwood S, Knight D, Humphries JD, Humphries MJ.
Show Full Abstract

Integrin receptor activation initiates the formation of integrin adhesion complexes (IACs) at the cell membrane that transduce adhesion-dependent signals to control a multitude of cellular functions. Proteomic analyses of isolated IACs have revealed an unanticipated molecular complexity; however, a global view of the consensus composition and dynamics of IACs is lacking. Here, we have integrated several IAC proteomes and generated a 2,412-protein integrin adhesome. Analysis of this data set reveals the functional diversity of proteins in IACs and establishes a consensus adhesome of 60 proteins. The consensus adhesome is likely to represent a core cell adhesion machinery, centred around four axes comprising ILK-PINCH-kindlin, FAK-paxillin, talin-vinculin and α-actinin-zyxin-VASP, and includes underappreciated IAC components such as Rsu-1 and caldesmon. Proteomic quantification of IAC assembly and disassembly detailed the compositional dynamics of the core cell adhesion machinery. The definition of this consensus view of integrin adhesome components provides a resource for the research community.

Also flagged:cancerintracerebral hemorrhageproteasomelactacystinepoxomicindimethyl
Journal Article 2015-10-19 ✓ 1 Snippet Wójcik S, Spodnik JH, Dziewiątkowski J, Spodnik E, Moryś J.
In-Text Gene Mentions

…enzyme peroxiredoxin 6 (PRDX6) [ 32 ].…

Show Full Abstract

The broad variety of substances that inhibit the action of the ubiquitin-proteasome system (UPS)-known as proteasome inhibitors-have been used extensively in previous studies, and they are currently frequently proposed as a novel form of cancer treatment and as a protective factor in intracerebral hemorrhage treatment. The experimental data on the safest route of proteasome inhibitor administration, their associated side effects, and the possible ways of minimizing these effects have recently become a very important topic. The aim of our present study was to determine the effects of administering of MG-132, lactacystin and epoxomicin, compounds belonging to three different classes of proteasome inhibitors, on the ependymal walls of the lateral ventricle. Observations were made 2 and 8 weeks after the intraventricular administration of the studied substances dissolved in dimethyl sulfoxide (DMSO) into the lateral ventricle of adult Wistar rats. Qualitative and quantitative analysis of brain sections stained with histochemical and inmmunofluorescence techniques showed that the administration of proteasome inhibitors caused a partial occlusion of the injected ventricle in all of the studied animals. The occlusion was due to ependymal cells damage and subsequent ependymal discontinuity, which caused direct contact between the striatum and the lateral nuclei of the septum, mononuclear cell infiltration and the formation of a glial scar between these structures (with the activation of astroglia, microglia and oligodendroglia). Morphologically, the ubiquitin-positive aggregates corresponded to aggresomes, indicating impaired activity of the UPS and the accumulation and aggregation of ubiquitinated proteins that coincided with the occurrence of glial scars. The most significant changes were observed in the wall covering the striatum in animals that were administered epoxomicin, and milder changes were observed in animals administered lactacystin and MG-132. Interestingly, DMSO administration also caused damage to some of the ependymal cells, but the aggresome-like structures were not formed. Our results indicate that all of the studied classes of proteasome inhibitors are detrimental to ependymal cells to some extent, and may cause severe changes in the ventricular system. The safety implications of their usage in therapeutic strategies to attenuate intracerebral hemorrhagic injury and in brain cancer treatment will require further studies.

Also flagged:RKIPβ-adrenoceptorheart failureRaf kinaseβ1-adrenoceptorcardiac failure
Journal Article 2015-10-19 ✓ 4 Snippets Schmid E, Neef S, Berlin C, Tomasovic A, Kahlert K, Nordbeck P, Deiss K, Denzinger S, Herrmann S, Wettwer E, Weidendorfer M, Becker D, Schäfer F, Wagner N, Ergün S, Schmitt JP, Katus HA, Weidemann F, Ravens U, Maack C, Hein L, Ertl G, Müller OJ, Maier LS, Lohse MJ, Lorenz K.
In-Text Gene Mentions

Pebp1 gene transfer in a mouse model of heart failure has beneficial effects, suggesting a new therapeutic strategy for heart failure therapy.

Pebp1 gene transfer in a mouse model of heart failure

…(RKIP), encoded byPebp1in mice, produces…

Pebp1gene transfer in…

Show Full Abstract

In heart failure therapy, it is generally assumed that attempts to produce a long-term increase in cardiac contractile force are almost always accompanied by structural and functional damage. Here we show that modest overexpression of the Raf kinase inhibitor protein (RKIP), encoded by Pebp1 in mice, produces a well-tolerated, persistent increase in cardiac contractility that is mediated by the β1-adrenoceptor (β1AR). This result is unexpected, as β1AR activation, a major driver of cardiac contractility, usually has long-term adverse effects. RKIP overexpression achieves this tolerance via simultaneous activation of the β2AR subtype. Analogously, RKIP deficiency exaggerates pressure overload-induced cardiac failure. We find that RKIP expression is upregulated in mouse and human heart failure, indicative of an adaptive role for RKIP. Pebp1 gene transfer in a mouse model of heart failure has beneficial effects, suggesting a new therapeutic strategy for heart failure therapy.

Also flagged:MAPKMEKSelumetinibestrogen receptorERovarian cancer
Journal Article 2015-10-19 ✓ 1 Snippet Hew KE, Miller PC, El-Ashry D, Sun J, Besser AH, Ince TA, Gu M, Wei Z, Zhang G, Brafford P, Gao W, Lu Y, Mills GB, Slingerland JM, Simpkins F.
In-Text Gene Mentions

PTGIS

Show Full Abstract

<h4>Purpose</h4>Although 67% of high-grade serous ovarian cancers (HGSOC) express the estrogen receptor (ER), most fail antiestrogen therapy. Because MAPK activation is frequent in ovarian cancer, we investigated if estrogen regulates MAPK and if MEK inhibition (MEKi) reverses antiestrogen resistance.<h4>Experimental design</h4>Effects of MEKi (selumetinib), antiestrogen (fulvestrant), or both were assayed in ER-positive HGSOC in vitro and in xenografts. Response biomarkers were investigated by gene expression microarray and reverse phase protein array (RPPA). Genes differentially expressed in two independent primary HGSOC datasets with high versus low pMAPK by RPPA were used to generate a "MAPK-activated gene signature." Gene signature components that were reversed by MEKi were then identified.<h4>Results</h4>High intratumor pMAPK independently predicts decreased survival (HR, 1.7; CI > 95%,1.3-2.2; P = 0.0009) in 408 HGSOC from The Cancer Genome Atlas. A differentially expressed "MAPK-activated" gene subset was also prognostic. "MAPK-activated genes" in HGSOC differ from those in breast cancer. Combined MEK and ER blockade showed greater antitumor effects in xenografts than monotherapy. Gene set enrichment analysis and RPPA showed that dual therapy downregulated DNA replication and cell-cycle drivers, and upregulated lysosomal gene sets. Selumetinib reversed expression of a subset of "MAPK-activated genes" in vitro and/or in xenografts. Three of these genes were prognostic for poor survival (P = 0.000265) and warrant testing as a signature predictive of MEKi response.<h4>Conclusions</h4>High pMAPK is independently prognostic and may underlie antiestrogen failure. Data support further evaluation of fulvestrant and selumetinib in ER-positive HGSOC. The MAPK-activated HGSOC signature may help identify MEK inhibitor responsive tumors.

Also flagged:Netrin-1in colorectal cancersignal transductionaxonmechanical allodyniapostherpetic neuralgia
Journal Article 2015-10-19 ✓ 3 Snippets Wu CH, Yuan XC, Gao F, Li HP, Cao J, Liu YS, Yu W, Tian B, Meng XF, Shi J, Pan HL, Li M.
In-Text Gene Mentions

…in colorectal cancer (DCC) (attractive receptor of…

…gradually decreased, whereasDCCexpression was significantly…

…environment by increasingDCCexpression, thus enhancing…

Show Full Abstract

Netrin-1 is a neuronal guidance molecule implicated in the development of spinal cord neurons and cortical neurons. In the adult spinal cord, UNC5H (repulsive receptor of netrin-1), but not deleted in colorectal cancer (DCC) (attractive receptor of netrin-1), constitutes a major mode of netrin-1 signal transduction, which may be involved in axon repulsion and inhibits neurite outgrowth. Abnormal sprouting of myelinated afferent fibers in the spinal dorsal horn can cause mechanical allodynia associated with postherpetic neuralgia (PHN, Shingles) and other neuropathic pains. However, whether netrin-1 participates in sprouting of myelinated afferent fibers and mechanical allodynia remains unknown. In an ultropotent TRPV1 agonist resiniferatoxin (RTX)-induced PHN-like model, RTX treatment for 6 weeks increased netrin-1 expression in dorsal horn neurons, including NK-1-positive projection neurons. In human neuroblastoma SH-SY5Y cells, we found that TRPV1 antagonist capsazepine antagonized RTX-induced upregulation of netrin-1. After RTX treatment, UNC5H2 expression was gradually decreased, whereas DCC expression was significantly increased. Silencing netrin-1 in the spinal dorsal horn significantly attenuated RTX-induced mechanical allodynia and sprouting of myelinated fibers into the spinal lamina II. Our results suggest that RTX treatment upregulates netrin-1 expression through activation of TRPV1 receptors and change UNC5H2-rich spinal dorsal horn into a growth-permissive environment by increasing DCC expression, thus enhancing the sprouting of myelinated afferent nerves. Netrin-1 may be targeted for reducing primary afferent sprouting and mechanical allodynia in PHN and other neuropathic pain conditions.

Also flagged:non-small cell lung cancerbevacizumaberlotinibSFTPBcell adhesionSTAB2
Journal Article 2015-10-19 ✓ 2 Snippets Baty F, Klingbiel D, Zappa F, Brutsche M.
In-Text Gene Mentions

Splicing candidates reveal a series of genes related to carcinogenesis (SFTPB), cell adhesion (STAB2, PCDH15, HABP2), tumor aggressiveness (ARNTL2), apoptosis, proliferation and differentiation (PDE4D, FLT3, IL1R2), cell invasion (ETV1), as well as tumor growth (OLFM4, FGF14), tumor necrosis (AFF3) or tumor suppression (TUSC3, CSMD1, RHOBTB2, SERPINB5), with indication of known alternative splicing in a majority of genes.

…as tumor growth (OLFM4, FGF14), tumor necrosis…

Show Full Abstract

Alternative splicing is an important component of tumorigenesis. Recent advent of exon array technology enables the detection of alternative splicing at a genome-wide scale. The analysis of high-throughput alternative splicing is not yet standard and methodological developments are still needed. We propose a novel statistical approach-Dually Constrained Correspondence Analysis-for the detection of splicing changes in exon array data. Using this methodology, we investigated the genome-wide alteration of alternative splicing in patients with non-small cell lung cancer treated by bevacizumab/erlotinib. Splicing candidates reveal a series of genes related to carcinogenesis (SFTPB), cell adhesion (STAB2, PCDH15, HABP2), tumor aggressiveness (ARNTL2), apoptosis, proliferation and differentiation (PDE4D, FLT3, IL1R2), cell invasion (ETV1), as well as tumor growth (OLFM4, FGF14), tumor necrosis (AFF3) or tumor suppression (TUSC3, CSMD1, RHOBTB2, SERPINB5), with indication of known alternative splicing in a majority of genes. DCCA facilitates the identification of putative biologically relevant alternative splicing events in high-throughput exon array data.

Also flagged:lung cancerbreast cancerprostate cancercancerscancerBad
Journal Article 2015-10-19 No Snippets Qian DC, Byun J, Han Y, Greene CS, Field JK, Hung RJ, Brhane Y, Mclaughlin JR, Fehringer G, Landi MT, Rosenberger A, Bickeböller H, Malhotra J, Risch A, Heinrich J, Hunter DJ, Henderson BE, Haiman CA, Schumacher FR, Eeles RA, Easton DF, Seminara D, Amos CI.
Show Full Abstract

Results from genome-wide association studies (GWAS) have indicated that strong single-gene effects are the exception, not the rule, for most diseases. We assessed the joint effects of germline genetic variations through a pathway-based approach that considers the tissue-specific contexts of GWAS findings. From GWAS meta-analyses of lung cancer (12 160 cases/16 838 controls), breast cancer (15 748 cases/18 084 controls) and prostate cancer (14 160 cases/12 724 controls) in individuals of European ancestry, we determined the tissue-specific interaction networks of proteins expressed from genes that are likely to be affected by disease-associated variants. Reactome pathways exhibiting enrichment of proteins from each network were compared across the cancers. Our results show that pathways associated with all three cancers tend to be broad cellular processes required for growth and survival. Significant examples include the nerve growth factor (P = 7.86 × 10(-33)), epidermal growth factor (P = 1.18 × 10(-31)) and fibroblast growth factor (P = 2.47 × 10(-31)) signaling pathways. However, within these shared pathways, the genes that influence risk largely differ by cancer. Pathways found to be unique for a single cancer focus on more specific cellular functions, such as interleukin signaling in lung cancer (P = 1.69 × 10(-15)), apoptosis initiation by Bad in breast cancer (P = 3.14 × 10(-9)) and cellular responses to hypoxia in prostate cancer (P = 2.14 × 10(-9)). We present the largest comparative cross-cancer pathway analysis of GWAS to date. Our approach can also be applied to the study of inherited mechanisms underlying risk across multiple diseases in general.

Also flagged:Cas9autismCHD8autism spectrum disordersWntextracellular
Journal Article 2015-10-19 No Snippets Wang P, Lin M, Pedrosa E, Hrabovsky A, Zhang Z, Guo W, Lachman HM, Zheng D.
Show Full Abstract

<h4>Background</h4>Disruptive mutation in the CHD8 gene is one of the top genetic risk factors in autism spectrum disorders (ASDs). Previous analyses of genome-wide CHD8 occupancy and reduced expression of CHD8 by shRNA knockdown in committed neural cells showed that CHD8 regulates multiple cell processes critical for neural functions, and its targets are enriched with ASD-associated genes.<h4>Methods</h4>To further understand the molecular links between CHD8 functions and ASD, we have applied the CRISPR/Cas9 technology to knockout one copy of CHD8 in induced pluripotent stem cells (iPSCs) to better mimic the loss-of-function status that would exist in the developing human embryo prior to neuronal differentiation. We then carried out transcriptomic and bioinformatic analyses of neural progenitors and neurons derived from the CHD8 mutant iPSCs.<h4>Results</h4>Transcriptome profiling revealed that CHD8 hemizygosity (CHD8 (+/-)) affected the expression of several thousands of genes in neural progenitors and early differentiating neurons. The differentially expressed genes were enriched for functions of neural development, β-catenin/Wnt signaling, extracellular matrix, and skeletal system development. They also exhibited significant overlap with genes previously associated with autism and schizophrenia, as well as the downstream transcriptional targets of multiple genes implicated in autism. Providing important insight into how CHD8 mutations might give rise to macrocephaly, we found that seven of the twelve genes associated with human brain volume or head size by genome-wide association studies (e.g., HGMA2) were dysregulated in CHD8 (+/-) neural progenitors or neurons.<h4>Conclusions</h4>We have established a renewable source of CHD8 (+/-) iPSC lines that would be valuable for investigating the molecular and cellular functions of CHD8. Transcriptomic profiling showed that CHD8 regulates multiple genes implicated in ASD pathogenesis and genes associated with brain volume.

Also flagged:fatty acidspectinbutyratetumorcellulosePDE4B
Journal Article 2015-10-19 ✓ 1 Snippet Shah MS, Kim E, Davidson LA, Knight JM, Zoh RS, Goldsby JS, Callaway ES, Zhou B, Ivanov I, Chapkin RS.
In-Text Gene Mentions

Olfm4

Show Full Abstract

There is mounting evidence that noncoding microRNAs (miRNA) are modulated by select chemoprotective dietary agents. For example, recently we demonstrated that the unique combination of dietary fish oil (containing n-3 fatty acids) plus pectin (fermented to butyrate in the colon) (FPA) up-regulates a subset of putative tumor suppressor miRNAs in intestinal mucosa, and down-regulates their predicted target genes following carcinogen exposure as compared to control (corn oil plus cellulose (CCA)) diet. To further elucidate the biological effects of diet and carcinogen modulated miR's in the colon, we verified that miR-26b and miR-203 directly target PDE4B and TCF4, respectively. Since perturbations in adult stem cell dynamics are generally believed to represent an early step in colon tumorigenesis and to better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we additionally determined the effects of the chemoprotective FPA diet on miRNAs and mRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creER(T2) knock-in mice. Following global miRNA profiling, 26 miRNAs (P<0.05) were differentially expressed in Lgr5(high) stem cells as compared to Lgr5(negative) differentiated cells. FPA treatment up-regulated miR-19b, miR-26b and miR-203 expression as compared to CCA specifically in Lgr5(high) cells. In contrast, in Lgr5(negative) cells, only miR-19b and its indirect target PTK2B were modulated by the FPA diet. These data indicate for the first time that select dietary cues can impact stem cell regulatory networks, in part, by modulating the steady-state levels of miRNAs. To our knowledge, this is the first study to utilize Lgr5(+) reporter mice to determine the impact of diet and carcinogen on miRNA expression in colonic stem cells and their progeny.

Also flagged:Gene Expressionimmune responsesautoimmune diseasestranscriptional regulatorsCD141presentation
Journal Article 2015-10-19 No Snippets Schinnerling K, García-González P, Aguillón JC.
Show Full Abstract

The ability of dendritic cells (DCs) to initiate and modulate antigen-specific immune responses has made them attractive targets for immunotherapy. Since DC research in humans is limited by the scarcity of DC populations in the blood circulation, most of our knowledge about DC biology and function has been obtained in vitro from monocyte-derived DCs (moDCs), which can be readily generated in sufficient numbers and are able to differentiate into distinct functional subsets depending on the nature of stimulus. In particular, moDCs with tolerogenic properties (tolDCs) possess great therapeutic potential for the treatment of autoimmune diseases. Several protocols have been developed to generate tolDCs in vitro, able to reinstruct auto-reactive T cells and to promote regulatory cells. While ligands and soluble mediators, by which DCs shape immune responses, have been vastly studied, the intracellular pathways and transcriptional regulators that govern tolDC differentiation and function are poorly understood. Whole-genome microarrays and proteomics provide useful strategies to dissect the complex molecular processes that promote tolerogenicity. Only few attempts have been made to understand tolDC biology through a global view on "omics" profiles. So far, the identification of a common regulator of tolerogenicity has been hampered by the fact that each protocol, used for tolDC generation, targets distinct signaling pathways. Here, we review the progress in understanding the transcriptional regulation of moDC differentiation, with a special focus on tolDCs, and highlight candidate molecules that might be associated with DC tolerogenicity.

Also flagged:acetylhydrolase IBgene expressionlocalizationpolyacrylamideapolipoprotein A1apolipoprotein A4
Journal Article 2015-10-19 ✓ 5 Snippets Ji Q, Zhu F, Liu X, Li Q, Su SB.
In-Text Gene Mentions

…In colorectal adenocarcinoma, Huang et al. [33] found that Baicalein inhibited colorectal cancer DLD1 cell proliferation and reduced reactive oxygen species (ROS) by upregulating the levels of peroxiredoxin-6 (PRDX6).…

…In a rat model of myocardial infarction, Zhou et al. [51] established that Buyang Huanwu decoction (BYHWD) alleviated ventricular remodeling, which increased Bcl-2/Bax ratio and decreased caspase 3 activity via downregulating atrial natriuretic factor (ANF) while upregulating heat shock protein beta-6 (HSPB6) and peroxiredoxin-6 (PRDX6).…

…levels of peroxiredoxin-6 (PRDX6).…

…(HSPB6) and peroxiredoxin-6 (PRDX6).…

…by upregulation ofPRDX6and the subsequent…

Show Full Abstract

Proteomics technology, a major component of system biology, has gained comprehensive attention in the area of medical diagnosis, drug development, and mechanism research. On the holistic and systemic theory, proteomics has a convergence with traditional Chinese medicine (TCM). In this review, we discussed the applications of proteomic technologies in diseases-TCM syndrome combination researches. We also introduced the proteomic studies on the in vivo and in vitro effects and underlying mechanisms of TCM treatments using Chinese herbal medicine (CHM), Chinese herbal formula (CHF), and acupuncture. Furthermore, the combined studies of proteomics with other "-omics" technologies in TCM were also discussed. In summary, this report presents an overview of the recent advances in the application of proteomic technologies in TCM studies and sheds a light on the future global and further research on TCM.

Also flagged:terpenoidsflavonoidsglycosidescancerstumormitochondria
Journal Article 2015-10-19 ✓ 1 Snippet Wang Y, Yu RY, He QY.
In-Text Gene Mentions

Peroxiredoxin-6 (PRDX6), an upregulated protein after baicalein treatment, was found to decrease the generation of ROS and inhibit the growth of colorectal cancer cells.

Show Full Abstract

Traditional Chinese medicine (TCM) is a rich resource of anticancer drugs. Increasing bioactive natural compounds extracted from TCMs are known to exert significant antitumor effects, but the action mechanisms of TCMs are far from clear. Proteomics, a powerful platform to comprehensively profile drug-regulated proteins, has been widely applied to the mechanistic investigation of TCMs and the identification of drug targets. In this paper, we discuss several bioactive TCM products including terpenoids, flavonoids, and glycosides that were extensively investigated by proteomics to illustrate their antitumor mechanisms in various cancers. Interestingly, many of these natural compounds isolated from TCMs mostly exert their tumor-suppressing functions by specifically targeting mitochondria in cancer cells. These TCM components induce the loss of mitochondrial membrane potential, the release of cytochrome c, and the accumulation of ROS, initiating apoptosis cascade signaling. Proteomics provides systematic views that help to understand the molecular mechanisms of the TCM in tumor cells; it bears the inherent limitations in uncovering the drug-protein interactions, however. Subcellular fractionation may be coupled with proteomics to capture and identify target proteins in mitochondria-enriched lysates. Furthermore, translating mRNA analysis, a new technology profiling the drug-regulated genes in translatome level, may be integrated into the systematic investigation, revealing global information valuable for understanding the action mechanism of TCMs.

Also flagged:transient receptor potential (TRP) ion channelsbehavioralthermoregulationwaternucleuslocomotion
Journal Article 2015-10-19 No Snippets Almeida MC, Vizin RC, Carrettiero DC.
Show Full Abstract

Temperature influence on the physiology and biochemistry of living organisms has long been recognized, which propels research in the field of thermoregulation. With the cloning and characterization of the transient receptor potential (TRP) ion channels as the principal temperature sensors of the mammalian somatosensory neurons, the understanding, at a molecular level, of thermosensory and thermoregulatory mechanisms became promising. Because thermal environment can be extremely hostile (temperature range on earth's surface is from ∼ -69°C to 58°C), living organisms developed an array of thermoregulatory strategies to guarantee survival, which include both autonomic mechanisms, which aim at increasing or decreasing heat exchange between body, and ambient and behavioral strategies. The knowledge regarding neural mechanisms involved in autonomic thermoregulatory strategies has progressed immensely compared to the knowledge on behavioral thermoregulation. This review aims at collecting the up-to-date knowledge on the neural basis for behavioral thermoregulation in mammals in order to point out perspectives and deployment of this research field.

Also flagged:Alzheimer's diseaseADdementiacognitive impairmentTaumicrotubules
Journal Article 2015-10-19 No Snippets Carrettiero DC, Santiago FE, Motzko-Soares AC, Almeida MC.
Show Full Abstract

Alzheimer's disease (AD), the most common dementia in the elderly, is characterized by cognitive impairment and severe autonomic symptoms such as disturbance in core body temperature (Tc), which may be predictors or early events in AD onset. Inclusions of phosphorylated Tau (p-Tau) are a hallmark of AD and other neurodegenerative disorders called "Tauopathies." Animal and human studies show that anesthesia augments p-Tau levels through reduction of Tc, with implications for AD. Additionally, hypothermia impairs memory and cognitive function. The molecular networks related to Tc that are associated with AD remain poorly characterized. Under physiological conditions, Tau binds microtubules, promoting their assembly and stability. The dynamically regulated Tau-microtubule interaction plays an important role in structural remodeling of the cytoskeleton, having important functions in neuronal plasticity and memory in the hippocampus. Hypothermia-induced increases in p-Tau levels are significant, with an 80% increase for each degree Celsius below normothermic conditions. Although the effects of temperature on Tau phosphorylation are evident, its effects on p-Tau degradation remain poorly understoodWe review information concerning the mechanisms of Tau regulation of neuron plasticity via its effects on microtubule dynamics, with focus on pathways regulating the abundance of phosphorylated Tau species.  We highlight the effects of temperature on molecular mechanisms influencing the development of Tau-related diseases. Specifically, we argue that cold might preferentially affects central nervous system structures that are highly reliant upon plasticity, such as the hippocampus, and that the effect of cold on Tau phosphorylation may constitute a pathology-initiating trigger leading to neurodegeneration.

Also flagged:MOFdosage compensationhistone acetyltransferaseacetylhistonegene expression
Journal Article 2015-10-19 No Snippets Chen QY, Chen QY, Costa M, Sun H.
Show Full Abstract

MOF was first identified in <i>Drosophila melanogaster</i> as an important component of the dosage compensation complex. As a member of MYST family of histone acetyltransferase, MOF specifically deposits the acetyl groups to histone H4 lysine 16. Throughout evolution, MOF and its mammalian ortholog have retained highly conserved substrate specificity and similar enzymatic activities. MOF plays important roles in dosage compensation, ESC self-renewal, DNA damage and repair, cell survival, and gene expression regulation. Dysregulation of MOF has been implicated in tumor formation and progression of many types of human cancers. This review will discuss the structure and activity of mammalian hMOF as well as its function in H4K16 acetylation, DNA damage response, stem cell pluripotency, and carcinogenesis.

Also flagged:ethylene glycolhyaluronic acidesterhydroxysuccinimidecell migrationconjugation
Journal Article 2015-10-19 No Snippets Boere KWM, Blokzijl MM, Visser J, Linssen JEA, Malda J, Hennink WE, Vermonden T.
Show Full Abstract

Progress in biofabrication technologies is mainly hampered by the limited number of suitable hydrogels that can act as bioinks. Here, we present a new bioink for 3D-printing, capable of forming large, highly defined constructs. Hydrogel formulations consisted of a thermoresponsive polymer mixed with a poly(ethylene glycol) (PEG) or a hyaluronic acid (HA) cross-linker with a total polymer concentration of 11.3 and 9.1 wt% respectively. These polymer solutions were partially cross-linked before plotting by a chemoselective reaction called oxo-ester mediated native chemical ligation, yielding printable formulations. Deposition on a heated plate of 37 °C resulted in the stabilization of the construct due to the thermosensitive nature of the hydrogel. Subsequently, further chemical cross-linking of the hydrogel precursors proceeded after extrusion to form mechanically stable hydrogels that exhibited a storage modulus of 9 kPa after 3 hours. Flow and elastic properties of the polymer solutions and hydrogels were analyzed under similar conditions to those used during the 3D-printing process. These experiments showed the ability to extrude the hydrogels, as well as their rapid recovery after applied shear forces. Hydrogels were printed in grid-like structures, hollow cones and a model representing a femoral condyle, with a porosity of 48 ± 2%. Furthermore, an N-hydroxysuccinimide functionalized thermoplastic poly-ε-caprolactone (PCL) derivative was successfully synthesized and 3D-printed. We demonstrated that covalent grafting of the developed hydrogel to the thermoplastic reinforced network resulted in improved mechanical properties and yielded high construct integrity. Reinforced constructs also containing hyaluronic acid showed high cell viability of chondrocytes, underlining their potential for further use in regenerative medicine applications.

Also flagged:Acute Lymphocytic Leukemiapolyynessignal transductiondetoxificationmetabolismthioredoxin-like proteins
Journal Article 2015-10-18 ✓ 1 Snippet Shiau JY, Yin SY, Chang SL, Hsu YJ, Chen KW, Kuo TF, Feng CS, Yang NS, Shyur LF, Yang WC, Wen TN.
In-Text Gene Mentions

…Nine proteins,mitochondrial 39S ribosomal protein L3939S ribosomal protein…

Show Full Abstract

Bidens pilosa, a medicinal herb worldwide, is rich in bioactive polyynes. In this study, by using high resolution 2-dimensional gel electrophoresis coupled with mass spectrometry analysis, as many as 2000 protein spots could be detected and those whose expression was specifically up- or downregulated in Jurkat T cells responsive to the treatment with 2-β-D-glucopyranosyloxy-1-hydroxytrideca-5,7,9,11-tetrayne (GHTT) can be identified. GHTT treatment can upregulate thirteen proteins involved in signal transduction, detoxification, metabolism, energy pathways, and channel transport in Jurkat cells. Nine proteins, that is, thioredoxin-like proteins, BH3 interacting domain death agonist (BID protein involving apoptosis), methylcrotonoyl-CoA carboxylase beta chain, and NADH-ubiquinone oxidoreductase, were downregulated in GHTT-treated Jurkat cells. Further, bioinformatics tool, Ingenuity software, was used to predict signaling pathways based on the data obtained from the differential proteomics approach. Two matched pathways, relevant to mitochondrial dysfunction and apoptosis, in Jurkat cells were inferred from the proteomics data. Biochemical analysis further verified both pathways involving GHTT in Jurkat cells. These findings do not merely prove the feasibility of combining proteomics and bioinformatics methods to identify cellular proteins as key players in response to the phytocompound in Jurkat cells but also establish the pathways of the proteins as the potential therapeutic targets of leukemia.

Also flagged:BKM120Non-Hodgkin lymphomastumorsPI3Khematologicsolid tumors
Journal Article 2015-10-18 No Snippets Civallero M, Cosenza M, Pozzi S, Bari A, Ferri P, Sacchi S.
Show Full Abstract

Non-Hodgkin lymphomas encompass a heterogeneous group of cancers, with 85-90% arising from B lymphocytes and the remainder deriving from T lymphocytes or NK lymphocytes. These tumors are molecularly and clinically heterogeneous, showing dramatically different responses and outcomes with standard therapies. Deregulated PI3K signaling is linked to oncogenesis and disease progression in hematologic malignancies and in a variety of solid tumors and apparently enhances resistance to antineoplastic therapy, resulting in a poor prognosis. Here, we have evaluated and compared the effects of the pan-PI3K inhibitor BKM120 and the dual PI3K/mTOR inhibitor BEZ235 on mantle, follicular, and T-cell lymphomas. Our results suggest that BKM120 and BEZ235 can effectively inhibit lymphoma cell proliferation by causing cell cycle arrest and can lead to cell death by inducing apoptosis and autophagy mediated by ROS accumulation. Despite great advances in lymphoma therapy after the introduction of monoclonal antibodies, many patients still die from disease progression. Therefore, novel treatment approaches are needed. BKM120 and BEZ235 alone and in combination are very effective against lymphoma cells in vitro. If further studies confirm their effectiveness in animal models, they may be promising candidates for development as new drugs.

Also flagged:tumorcryptogenic hepatocellular carcinomanon-alcoholic hepatocellular carcinomaNASHLiver Cancerhepatocellular carcinoma
Journal Article 2015-10-17 ✓ 1 Snippet Ohkura Y, Sasaki K, Matsuda M, Hashimoto M, Watanabe G.
In-Text Gene Mentions

…cirrhosis, severe steatosis,hemochromatosis, Wilson’s disease, and…

Show Full Abstract

<h4>Background</h4>We investigated the patterns and predictors of recurrence and survival in cryptogenic non-B, non-C, non-alcoholic hepatocellular carcinoma (CR-HCC). We compared the findings with those hepatitis virus B (B) and hepatitis virus C (C)-HCC. CR-HCC does not include HCC developed on NASH.<h4>Methods</h4>From 1990 to 2011, of 676 patients who underwent primary curative liver resection as initial therapy for HCC at our institution, 167 had B-HCC, 401 had C-HCC, and 62 had CR-HCC. Differences between three groups were analyzed using the Chi-squared test. Cumulative overall survival (OS) and disease-free survival (DFS) were determined by the Kaplan-Meier method, prognostic factors involved in OS/DFS were evaluated by univariate analysis using the log-rank test, and stepwise Cox regression analysis.<h4>Results</h4>Liver function was better in CR-HCC than in B/C-HCC, and mean tumor size was larger in CR-HCC than in B/C-HCC. In CR-HCC, OS was equivalent to that of B/C-HCC, and DFS was equivalent to that of B-HCC. Both tumor-related factors and background liver function appeared to be prognostic factors for three groups.<h4>Conclusion</h4>Our findings indicate that the probability of survival of advanced CR-HCC was not longer than that of B/C-HCC. Given our findings, a postoperative follow-up protocol for CR-HCC should be established alongside that for B/C-HCC.

Also flagged:Heat Shock ProteinDNAJB6deathDNAJB6acytoplasmicnucleus
Journal Article 2015-10-17 ✓ 5 Snippets Smith C, D'Mello SR.
In-Text Gene Mentions

DNAJB6 protects against mut-Htt neurotoxicity

…of mutant huntingtin (mut-Htt) via direct interaction…

…direct interaction with mut-Htt.…

…primary neurons with mut-Htt, DNAJB6 protects against…

…DNAJB6 protects against mut-Httneurotoxicity.…

Show Full Abstract

Previous studies performed in cell lines have shown that the heat shock protein, DNAJB6, protects against the proteotoxic effects of mutant huntingtin (mut-Htt) via direct interaction with mut-Htt. However, these studies were performed primarily using in vitro models and cell lines. We report that when expressed in primary neurons, DNAJB6 induces cell death. Neurotoxicity is observed with both the DNAJB6a isoform, which is strictly nuclear, and the DNAJB6b isoform, which is predominantly cytoplasmic, suggesting that neurotoxicity is mediated in the nucleus. However, when co-expressed in primary neurons with mut-Htt, DNAJB6 protects against mut-Htt neurotoxicity. This suggests that the contrasting effect of DNAJB6 on neuronal viability depends on the presence or absence of proteotoxic stress. Neurotoxicity of DNAJB6 cannot be prevented by inhibition of glycogen synthase kinase 3 beta (GSK3β) or c-Jun N-terminal kinase (JNK) but is prevented by pharmacological inhibition of cyclin-dependent kinases (CDKs). Expression of dominant-negative forms of CDK2 or CDK4, or of p21(CIP1), the physiological inhibitor of CDKs, also inhibits DNAJB6 neurotoxicity. DNAJB6 neurotoxicity can also be inhibited by histone deacetylase-4 (HDAC4), which interacts with DNAJB6 and which has previously been described to inhibit cell cycle progression. These results conclude that neurotoxicity resulting from elevated DNAJB6 is cell cycle dependent.

Also flagged:neurodegenerative diseaseHDpolyglutaminebehavioralglucosegene expression
Journal Article 2015-10-17 ✓ 3 Snippets Moreno CL, Ehrlich ME, Mobbs CV.
In-Text Gene Mentions

…the complete humanHTTgene and for…

…histone acetylation andHTT

HTT

Show Full Abstract

Huntington's disease (HD) is a fatal neurodegenerative disease characterized by metabolic, cognitive, and motor deficits. HD is caused by an expanded CAG repeat in the first exon of the HTT gene, resulting in an expanded polyglutamine section. Dietary restriction (DR) increases lifespan and ameliorates age-related pathologies, including in a model of HD, but the mechanisms mediating these protective effects are unknown. We report metabolic and behavioral effects of DR in the full-length YAC128 HD mouse model, and associated transcriptional changes in hypothalamus and striatum. DR corrected many effects of the transgene including increased body weight, decreased blood glucose, and impaired motor function. These changes were associated with reduced striatal human (but not mouse) HTT expression, as well as alteration in gene expression regulating histone acetylation modifications, particularly Hdac2. Other mRNAs related to Huntington's pathology in striatal tissue showed significant modulation by the transgene, dietary restriction or both. These results establish a protective role of DR in a transgenic model that contains the complete human HTT gene and for the first time suggest a role for DR in lowering HTT level, which correlates with severity of symptoms.

Also flagged:CDX2transcription factorTFChromatinbindinggene expression
Journal Article 2015-10-17 ✓ 1 Snippet San Roman AK, Tovaglieri A, Breault DT, Shivdasani RA.
In-Text Gene Mentions

…Myc , andOlfm4were enriched in…

Show Full Abstract

Lgr5-expressing intestinal stem cells (ISCs) renew the adult gut epithelium by producing mature villus cells (VCs); the transcriptional basis for ISC functions remains unclear. RNA sequencing analysis identified transcripts modulated during differentiation of Lgr5(+) ISCs into VCs, with high expression of the intestine-restricted transcription factor (TF) gene Cdx2 in both populations. Cdx2-deleted mouse ISCs showed impaired proliferation and long-term inability to produce mature lineages, revealing essential ISC functions. Chromatin immunoprecipitation sequencing analysis of CDX2 in Lgr5(+) ISCs, coupled with mRNA profiling of control and Cdx2(-/-) ISCs, identified features of CDX2 regulation distinct from VCs. Most CDX2 binding in ISCs occurs in anticipation of future gene expression, but whereas CDX2 primarily activates VC genes, direct ISC targets are activated and repressed. Diverse CDX2 requirements in stem and differentiated cells may reflect the versatility of TFs that specify a tissue in development and control the same tissue in adults.

Also flagged:Chromatinstem cell differentiationorganizationnucleasedigestionheterochromatin
Journal Article 2015-10-17 ✓ 1 Snippet Ugarte F, Sousae R, Cinquin B, Martin EW, Krietsch J, Sanchez G, Inman M, Tsang H, Warr M, Passegué E, Larabell CA, Forsberg EC.
In-Text Gene Mentions

…function, such asSox6, Itga2b ,…

Show Full Abstract

Epigenetic regulation serves as the basis for stem cell differentiation into distinct cell types, but it is unclear how global epigenetic changes are regulated during this process. Here, we tested the hypothesis that global chromatin organization affects the lineage potential of stem cells and that manipulation of chromatin dynamics influences stem cell function. Using nuclease sensitivity assays, we found a progressive decrease in chromatin digestion among pluripotent embryonic stem cells (ESCs), multipotent hematopoietic stem cells (HSCs), and mature hematopoietic cells. Quantitative high-resolution microscopy revealed that ESCs contain significantly more euchromatin than HSCs, with a further reduction in mature cells. Increased cellular maturation also led to heterochromatin localization to the nuclear periphery. Functionally, prevention of heterochromatin formation by inhibition of the histone methyltransferase G9A resulted in delayed HSC differentiation. Our results demonstrate global chromatin rearrangements during stem cell differentiation and that heterochromatin formation by H3K9 methylation regulates HSC differentiation.

Also flagged:scrapietransmissible spongiform encephalopathyneurodegenerative diseasesPrPPRNPinfection
Journal Article 2015-10-17 No Snippets Gossner AG, Hopkins J.
Show Full Abstract

Accumulation of the misfolded prion protein, PrP(Sc) in the central nervous system (CNS) is strongly linked to progressive neurodegenerative disease. For many transmissible spongiform encephalopathies (TSEs), peripheral lymphoid tissue is an important site of PrP(Sc) amplification but without gross immunological consequence. Susceptible VRQ homozygous New Zealand Cheviot sheep were infected with SSBP/1 scrapie by inoculation in the drainage area of the prescapular lymph nodes. The earliest time that PrP(Sc) was consistently detected by immunohistology in these nodes was D50 post infection. This transcriptomic study of lymph node taken before (D10) and after (D50) the detection of PrP(Sc), aimed to identify the genes and physiological pathways affected by disease progression within the nodes as assessed by PrP(Sc) detection. Affymetrix Ovine Gene arrays identified 75 and 80 genes as differentially-expressed at D10 and D50, respectively, in comparison with control sheep inoculated with uninfected brain homogenate. Approximately 70% of these were repressed at each time point. RT-qPCR analysis of seven genes showed statistically significant correlation with the array data, although the results for IL1RN and TGIF were different between the two technologies. The ingenuity pathway analysis (IPA) and general low level of repression of gene expression in lymphoid tissue, including many inflammatory genes, contrasts with the pro-inflammatory and pro-apoptotic events that occur within the CNS at equivalent stages of disease progression as assessed by PrP(Sc) accumulation.

Also flagged:Head and Neck Cancerhead and neck tumorhead and neck squamous cell carcinomaHNSCCtumorscancer
Journal Article 2015-10-17 ✓ 1 Snippet Puram SV, Rocco JW.
In-Text Gene Mentions

DCC

Show Full Abstract

In spite of a rapidly expanding understanding of head and neck tumor biology and optimization of radiation, chemotherapy, and surgical treatment modalities, head and neck squamous cell carcinoma (HNSCC) remains a major cause of cancer-related morbidity and mortality. Although our biologic understanding of these tumors had largely been limited to pathways driving proliferation, survival, and differentiation, the identification of HPV as a major driver of HNSCC and genomic sequencing analyses has dramatically influenced our understanding of tumor biology and approach to therapy. Here, we summarize molecular aspects of HNSCC biology and identify promising areas for potential diagnostic and therapeutic agents.

Also flagged:AMLgene expressioncytarabineleukemiaanthracyclinesinfections
Journal Article 2015-10-16 No Snippets Lamba JK, Pounds S, Cao X, Crews KR, Cogle CR, Bhise N, Raimondi SC, Downing JR, Baker SD, Ribeiro RC, Rubnitz JE.
Show Full Abstract

Despite initial remission, ∼60-70% of adult and 30% of pediatric patients experience relapse or refractory AML. Studies so far have identified base line gene expression profiles of pathogenic and prognostic significance in AML; however, the extent of change in gene expression post-initiation of treatment has not been investigated. Exposure of leukemic cells to chemotherapeutic agents such as cytarabine, a mainstay of AML chemotherapy, can trigger adaptive response by influencing leukemic cell transcriptome and, hence, development of resistance or refractory disease. It is, however, challenging to perform such a study due to lack of availability of specimens post-drug treatment. The primary objective of this study was to identify in vivo cytarabine-induced changes in leukemia cell transcriptome and to evaluate their impact on clinical outcome. The results highlight genes relevant to cytarabine resistance and support the concept of targeting cytarabine-induced genes as a means of improving response.

Also flagged:Se-AllylselenocysteineautophagyAMPKmTORcolorectal adenocarcinomaSelenium
Journal Article 2015-10-16 ✓ 5 Snippets Wu JC, Wang FZ, Tsai ML, Lo CY, Badmaev V, Ho CT, Wang YJ, Pan MH.
In-Text Gene Mentions

Se-Allylselenocysteine induces autophagy by modulating the AMPK/mTOR signaling pathway and epigenetic regulation of PCDH17 in human colorectal adenocarcinoma cells.

In this study, we investigated the underlying molecular mechanisms of Se-allylselenocysteine (ASC)-induced PCD and protocadherin 17 (PCDH17) expression in HT-29 cells.<h4>Methods and results</h4>Cell viability analysis indicated that the ability of ASC to induce cancer cell death was greater than that of Se-methylselenocysteine in colorectal cancer cells.

…epigenetic regulation ofPCDH17in human colorectal…

…and protocadherin 17 (PCDH17) expression in HT-29…

…level, ASC inducedPCDH17expression through decreased…

Show Full Abstract

<h4>Scope</h4>Selenium (Se)-conjugated compounds have been established as anti-carcinogenic compounds. The use of chemicals as cancer chemotherapeutic agents to induce programmed cell death (PCD) involves genetic and epigenetic modifications. In this study, we investigated the underlying molecular mechanisms of Se-allylselenocysteine (ASC)-induced PCD and protocadherin 17 (PCDH17) expression in HT-29 cells.<h4>Methods and results</h4>Cell viability analysis indicated that the ability of ASC to induce cancer cell death was greater than that of Se-methylselenocysteine in colorectal cancer cells. ASC also decreased global DNA methylation levels via downregulation of DNA methyltransferase 1 expression. The autophagic cell death is the cause in ASC-induced cytotoxicity that was inhibited by pretreatment with autophagy inhibitor. At the molecular level, ASC induced PCDH17 expression through decreased PCDH17 promoter hypermethylation. PCDH17 is also an important role in ASC-induced autophagy by HT-29 transfected with PCDH17 shRNA or expression plasmid. Our western blot analysis showed that ASC significantly induced autophagy via the AMPK/mTOR pathway that was also regulated PCDH17 expression. Additionally, we used the HT-29 tumor xenograft models to confirm the ability of ASC inhibited tumor growth.<h4>Conclusion</h4>These results reveal that ASC is an effective inducer of autophagy through regulating the AMPK/mTOR and PCDH17 expression via epigenetic modification.

Also flagged:chromatinnon-Hodgkin's lymphomasdiffuse large B-cell lymphomaDLBCLfollicular lymphomaFL
Journal Article 2015-10-16 ✓ 1 Snippet Lunning MA, Green MR.
In-Text Gene Mentions

…H1 family oflinker histoneshistones that are…

Show Full Abstract

Subtypes of non-Hodgkin's lymphomas align with different stages of B-cell development. Germinal center B-cell (GCB)-like diffuse large B-cell lymphoma (DLBCL), follicular lymphoma (FL) and Burkitt's lymphoma (BL) each share molecular similarities with normal GCB cells. Recent next-generation sequencing studies have gained insight into the genetic etiology of these malignancies and revealed a high frequency of mutations within genes encoding proteins that modifying chromatin. These include activating and inactivating mutations of genes that perform post-translational modification of histones and organize chromatin structure. Here, we discuss the function of histone acetyltransferases (CREBBP, EP300), histone methyltransferases (KDM2C/D, EZH2) and regulators of higher order chromatin structure (HIST1H1C/D/E, ARID1A and SMARCA4) that have been reported to be mutated in ⩾5% of DLBCL, FL or BL. Mutations of these genes are an emerging hallmark of lymphomas with GCB-cell origins, and likely represent the next generation of therapeutic targets for these malignancies.

Also flagged:Chronic Fatigue SyndromeSLC6A4serotonin transporterserotonincognitive impairmentsorthostatic intolerance
Journal Article 2015-10-16 ✓ 5 Snippets Meyer B, Nguyen CB, Moen A, Fagermoen E, Sulheim D, Nilsen H, Wyller VB, Gjerstad J.
In-Text Gene Mentions

The present study suggests that the 5-HTT genotype may be a factor that contributes to maintenance of CFS.

Thus, CFS patients with the 5-HTT SS or SLG genotype had worse 30 weeks outcome than CFS patients with the 5-HTT LALG, SLA or LALA genotype.

In addition, variation in the 5-HTT gene SLC6A4 may modulate attention to threat [26], anxiety, negative affect and fear [10–12].

Moreover, variation in the 5-HTT gene SLC6A4, indicating decreased transcription, may modulate anxiety and negative affect [11,12].

Earlier studies have shown that genetic variability in the SLC6A4 gene encoding the serotonin transporter (5-HTT) may be important for the re-uptake of serotonin (5-HT) in the central nervous system.

Show Full Abstract

Earlier studies have shown that genetic variability in the SLC6A4 gene encoding the serotonin transporter (5-HTT) may be important for the re-uptake of serotonin (5-HT) in the central nervous system. In the present study we investigated how the 5-HTT genotype i.e. the short (S) versus long (L) 5-HTTLPR allele and the SNP rs25531 A > G affect the physical and psychosocial functioning in patients with chronic fatigue syndrome (CFS). All 120 patients were recruited from The Department of Paediatrics at Oslo University Hospital, Norway, a national referral center for young CFS patients (12-18 years). Main outcomes were number of steps per day obtained by an accelerometer and disability scored by the Functional Disability Inventory (FDI). Patients with the 5-HTT SS or SLG genotype had a significantly lower number of steps per day than patients with the 5-HTT LALG, SLA or LALA genotype. Patients with the 5-HTT SS or SLG genotype also had a significantly higher FDI score than patients with the 5-HTT LALG, SLA or LALA genotype. Thus, CFS patients with the 5-HTT SS or SLG genotype had worse 30 weeks outcome than CFS patients with the 5-HTT LALG, SLA or LALA genotype. The present study suggests that the 5-HTT genotype may be a factor that contributes to maintenance of CFS.

Also flagged:infectious diseasesironmetabolisminfectionbehavioralmetals
Journal Article 2015-10-16 No Snippets Soares MP, Weiss G.
Show Full Abstract

Microbes exert a major impact on human health and disease by either promoting or disrupting homeostasis, in the latter instance leading to the development of infectious diseases. Such disparate outcomes are driven by the ever-evolving genetic diversity of microbes and the countervailing host responses that minimize their pathogenic impact. Host defense strategies that limit microbial pathogenicity include resistance mechanisms that exert a negative impact on microbes, and disease tolerance mechanisms that sustain host homeostasis without interfering directly with microbes. While genetically distinct, these host defense strategies are functionally integrated, via mechanisms that remain incompletely defined. Here, we explore the general principles via which host adaptive responses regulating iron (Fe) metabolism impact on resistance and disease tolerance to infection.

Also flagged:Matrix MetalloproteinaseMatrix metalloproteinasesMMPspathogenesisskin cancerextracellular
Journal Article 2015-10-16 ✓ 1 Snippet Schlage P, Kockmann T, Sabino F, Kizhakkedathu JN, Auf dem Keller U.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Matrix metalloproteinases (MMPs) are important players in skin homeostasis, wound repair, and in the pathogenesis of skin cancer. It is now well established that most of their functions are related to processing of bioactive proteins rather than components of the extracellular matrix (ECM). MMP10 is highly expressed in keratinocytes at the wound edge and at the invasive front of tumors, but hardly any non-ECM substrates have been identified and its function in tissue repair and carcinogenesis is unclear. To better understand the role of MMP10 in the epidermis, we employed multiplexed iTRAQ-based Terminal Amine Isotopic Labeling of Substrates (TAILS) and monitored MMP10-dependent proteolysis over time in secretomes from keratinocytes. Time-resolved abundance clustering of neo-N termini classified MMP10-dependent cleavage events by efficiency and refined the MMP10 cleavage site specificity by revealing a so far unknown preference for glutamate in the P1 position. Moreover, we identified and validated the integrin alpha 6 subunit, cysteine-rich angiogenic inducer 61 and dermokine as novel direct MMP10 substrates and provide evidence for MMP10-dependent but indirect processing of phosphatidylethanolamine-binding protein 1. Finally, we sampled the epidermal proteome and degradome in unprecedented depth and confirmed MMP10-dependent processing of dermokine in vivo by TAILS analysis of epidermis from transgenic mice that overexpress a constitutively active mutant of MMP10 in basal keratinocytes. The newly identified substrates are involved in cell adhesion, migration, proliferation, and/or differentiation, indicating a contribution of MMP10 to local modulation of these processes during wound healing and cancer development. Data are available via ProteomeXchange with identifier PXD002474.

Also flagged:Butyrophilin 3A1PrenylPyrophosphatecancerisoprenoidisopentenyl
Journal Article 2015-10-16 ✓ 1 Snippet Wang H, Morita CT.
In-Text Gene Mentions

BTN3A3

Show Full Abstract

Vγ2Vδ2 T cells play important roles in human immunity to pathogens and in cancer immunotherapy by responding to isoprenoid metabolites, such as (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate and isopentenyl pyrophosphate. The Ig superfamily protein butyrophilin (BTN)3A1 was shown to be required for prenyl pyrophosphate stimulation. We proposed that the intracellular B30.2 domain of BTN3A1 binds prenyl pyrophosphates, resulting in a change in the extracellular BTN3A1 dimer that is detected by Vγ2Vδ2 TCRs. Such B30.2 binding was demonstrated recently. However, other investigators reported that the extracellular BTN3A1 IgV domain binds prenyl pyrophosphates, leading to the proposal that the Vγ2Vδ2 TCR recognizes the complex. To distinguish between these mechanisms, we mutagenized residues in the two binding sites and tested the mutant BTN3A1 proteins for their ability to mediate prenyl pyrophosphate stimulation of Vγ2Vδ2 T cells to proliferate and secrete TNF-α. Mutagenesis of residues in the IgV site had no effect on Vγ2Vδ2 T cell proliferation or secretion of TNF-α. In contrast, mutagenesis of residues within the basic pocket and surrounding V regions of the B30.2 domain abrogated prenyl pyrophosphate-induced proliferation. Mutations of residues making hydrogen bonds to the pyrophosphate moiety also abrogated TNF-α secretion, as did mutation of aromatic residues making contact with the alkenyl chain. Some mutations further from the B30.2 binding site also diminished stimulation, suggesting that the B30.2 domain may interact with a second protein. These findings support intracellular sensing of prenyl pyrophosphates by BTN3A1 rather than extracellular presentation.

Also flagged:SynthesisPhosphorusdideoxynucleosidetriphosphatespronucleotidedideoxynucleosides
Journal Article 2015-10-16 No Snippets Xu Z, Ramsay Shaw B.
Show Full Abstract

Phosphorus-modified prodrugs of dideoxynucleoside triphosphates (ddNTPs) have shown promise as pronucleotide strategies for improving antiviral activity compared to their parent dideoxynucleosides. Borane modified NTPs offer a promising choice as nucleoside/nucleotide reverse transcriptase inhibitors (NRTIs). However, the availability of α-P-borano-γ-P-substituted NTP analogs remains limited due to challenges with synthesis and purification. Here, we report the chemical synthesis and stability of a new potential class of NRTI prodrugs: stavudine (d4T) 5'-α-P-borano-γ-P-N-L-tryptophanyltriphosphates. One-pot synthesis of these compounds was achieved via a modified cyclic trimetaphosphate approach. Pure Rp and Sp diastereomers were obtained after HPLC separation. Based on LC-MS analysis, we report degradation pathways, half-lives (5-36 days) and mechanisms arising from structural differences to generate the corresponding borano tri- and di-phosphates, and H-phosphonate, via several parallel routes in buffer at physiologically relevant pH and temperature. Here, the major hydrolysis products, d4T α-P-boranotriphosphate Rp and Sp isomers, were isolated by HPLC and identified with spectral data. We first propose that one of the major degradation products, d4T H-phosphonate, was generated from the d4T pronucleotides via a protonation-promoted intramolecular reduction followed by a second step nucleophilic attack. This report could provide valuable information for pronucleotide-based drug design in terms of selective release of target nucleotides.

Also flagged:macropinocytosisagingneurodegenerative diseasesAlzheimer's diseaseCreutzfeldt-Jakob diseaseCJD
Journal Article 2015-10-16 ✓ 1 Snippet Zeineddine R, Yerbury JJ.
In-Text Gene Mentions

…huntingtin exon 1 (Httexon 1 Q44…

Show Full Abstract

With the onset of the rapidly aging population, the impact of age related neurodegenerative diseases is becoming a predominant health and economic concern. Neurodegenerative diseases such as Alzheimer's disease, Creutzfeldt-Jakob disease (CJD), Parkinson's disease, Huntington's disease, frontotemporal dementia (FTD), and amyotrophic lateral sclerosis (ALS) result from the loss of a specific subsets of neurons, which is closely associated with accumulation and deposition of specific protein aggregates. Protein aggregation, or fibril formation, is a well-studied phenomenon that occurs in a nucleation-dependent growth reaction. Recently, there has been a swell of literature implicating protein aggregation and its ability to propagate cell-to-cell in the rapid progression of these diseases. In order for protein aggregation to be kindled in recipient cells it is a requisite that aggregates must be able to be released from one cell and then taken up by others. In this article we will explore the relationship between protein aggregates, their propagation and the role of macropinocytosis in their uptake. We highlight the ability of neurons to undergo stimulated macropinocytosis and identify potential therapeutic targets.

Also flagged:OX40OX40Lglycyrrhizic acidasthmaovalbuminOVA
Journal Article 2015-10-15 No Snippets Wu Q, Tang Y, Hu X, Wang Q, Lei W, Zhou L, Huang J.
Show Full Abstract

<h4>Background and objective</h4>Glycyrrhizic acid (GA) has been reported to have attenuating airway inflammation effects in asthma mouse model. However, the potential molecular mechanisms by which GA exerts anti-inflammatory effects on ovalbumin (OVA)-induced allergic asthma have not been well elaborated.<h4>Methods</h4>The effect of GA on OVA-sensitized and challenged mice was investigated. The effect of GA on anti-OX40 mAb stimulated splenocytes from asthma mice model was also examined.<h4>Results</h4>In OVA-induced asthmatic mice, GA treatment prevented the decrease of T helper1 cytokine (interferon (IFN)-γ) and the increase of T helper2 cytokines (interleukin (IL)-4, IL-5, IL-13) in bronchoalveolar lavage fluid (BALF), reduced serum immunoglobulin (Ig)E and OVA-specific IgE levels, prohibited the protein and mRNA expression of OX40 and OX40 Ligand (OX40L) in lung tissues, and the expression of OX40 in CD4(+) T cells and OX40L in CD11b(+) monocytes and CD19(+) B cells in spleens in a dose-dependent manner compared with the vehicle treatment (all P < 0.05). Moreover, OVA significantly increased the activation of p38 mitogen-activated protein kinase (MAPK) in lung tissues, whereas GA and anti-OX40L mAb markedly reduced phosphorylation of p38 MAPK. In addition, GA could inhibit the T cell proliferation and modulate the balance of Th1/Th2 in anti-OX40 mAb stimulated CD4(+) T cells from asthmatic spleens (all P < 0.05).<h4>Conclusions</h4>GA may exert a therapeutic effect on OVA-induced experimental asthma partly by regulating the Th1/Th2 balance through suppressing OX40-OX40L signalling and p38 MAPK activity. GA may be a promising treatment for asthma.

Also flagged:Myeloproliferative neoplasmschronic myeloid cancersCD34essential thrombocythemiaETpolycythemia vera
Journal Article 2015-10-15 ✓ 1 Snippet Guglielmelli P, Bisognin A, Saccoman C, Mannarelli C, Coppe A, Vannucchi AM, Bortoluzzi S.
In-Text Gene Mentions

…FGR, LCN2, andOLFM4.…

Show Full Abstract

Myeloproliferative neoplasms (MPN) are chronic myeloid cancers thought to arise at the level of CD34+ hematopoietic stem/progenitor cells. They include essential thrombocythemia (ET), polycythemia vera (PV) and primary myelofibrosis (PMF). All can progress to acute leukemia, but PMF carries the worst prognosis. Increasing evidences indicate that deregulation of microRNAs (miRNAs) might plays an important role in hematologic malignancies, including MPN. To attain deeper knowledge of short RNAs (sRNAs) expression pattern in CD34+ cells and of their possible role in mediating post-transcriptional regulation in PMF, we sequenced with Illumina HiSeq2000 technology CD34+ cells from healthy subjects and PMF patients. We detected the expression of 784 known miRNAs, with a prevalence of miRNA up-regulation in PMF samples, and discovered 34 new miRNAs and 99 new miRNA-offset RNAs (moRNAs), in CD34+ cells. Thirty-seven small RNAs were differentially expressed in PMF patients compared with healthy subjects, according to microRNA sequencing data. Five miRNAs (miR-10b-5p, miR-19b-3p, miR-29a-3p, miR-379-5p, and miR-543) were deregulated also in PMF granulocytes. Moreover, 3'-moR-128-2 resulted consistently downregulated in PMF according to RNA-seq and qRT-PCR data both in CD34+ cells and granulocytes. Target predictions of these validated small RNAs de-regulated in PMF and functional enrichment analyses highlighted many interesting pathways involved in tumor development and progression, such as signaling by FGFR and DAP12 and Oncogene Induced Senescence. As a whole, data obtained in this study deepened the knowledge of miRNAs and moRNAs altered expression in PMF CD34+ cells and allowed to identify and validate a specific small RNA profile that distinguishes PMF granulocytes from those of normal subjects. We thus provided new information regarding the possible role of miRNAs and, specifically, of new moRNAs in this disease.

Also flagged:EPOPLAphenolHCTRNaseVEGFA
Journal Article 2015-10-15 ✓ 1 Snippet Yan Y, Shi Y, Wang C, Guo P, Wang J, Zhang CY, Zhang C.
In-Text Gene Mentions

…SMAD5 31 andSOX632 , and…

Show Full Abstract

Circulating microRNAs (miRNAs) are promising disease biomarkers. However, the influence of high-altitude hypoxic environments on plasma miRNA profiles remains unknown. This study included a total of 509 plasma samples from 278 native Tibetans and 80 newly arrived migrant Han Chinese (Tibet Han) residing at 3560 m and 151 Han Chinese residing at 8.9 m (Nanjing Han). The levels of 754 miRNAs were initially determined using a TaqMan Low Density Array (TLDA) in two pooled samples from 50 Tibet Han and 50 Nanjing Han individuals. Some markedly altered miRNAs in Tibet Han were subsequently measured in all 509 plasma samples by individual qRT-PCR. Compared with the Nanjing Han, 172 miRNAs were differentially expressed in the Tibet Han (105 upregulated and 67 downregulated). The correlation coefficient for the two groups was 0.72. Several upregulated miRNAs were randomly selected for analysis by qRT-PCR, and the results were consistent with those identified by TLDA. These miRNAs were also significantly increased in the Tibetans compared with the Nanjing Han. Furthermore, these altered miRNAs showed strong positive correlations with red blood cell counts and hemoglobin values. These data are the first to provide clear evidence that a high-altitude hypoxic environment significantly affects human plasma miRNA profiles.

Also flagged:EphB3 receptorsdeathdependenceEph receptorSpinal cord injurymyelin basic protein
Journal Article 2015-10-15 ✓ 2 Snippets Tsenkina Y, Ricard J, Runko E, Quiala-Acosta MM, Mier J, Liebl DJ.
In-Text Gene Mentions

…in Colorectal Cancer (DCC) and uncoordinated-5 homolog…

…exhibited apoptosis ofDCC- and UNC5-expressing cells…

Show Full Abstract

We demonstrate that EphB3 receptors mediate oligodendrocyte (OL) cell death in the injured spinal cord through dependence receptor mechanism. OLs in the adult spinal cord express EphB3 as well as other members of the Eph receptor family. Spinal cord injury (SCI) is associated with tissue damage, cellular loss and disturbances in EphB3-ephrinB3 protein balance acutely (days) after the initial impact creating an environment for a dependence receptor-mediated cell death to occur. Genetic ablation of EphB3 promotes OL survival associated with increased expression of myelin basic protein and improved locomotor function in mice after SCI. Moreover, administration of its ephrinB3 ligand to the spinal cord after injury also promotes OL survival. Our in vivo findings are supported by in vitro studies showing that ephrinB3 administration promotes the survival of both oligodendroglial progenitor cells and mature OLs cultured under pro-apoptotic conditions. In conclusion, the present study demonstrates a novel dependence receptor role of EphB3 in OL cell death after SCI, and supports further development of ephrinB3-based therapies to promote recovery.

Also flagged:osteogenesis imperfectaCOL1A2developmental delayinfectionschromosomeintellectual disability
Journal Article 2015-10-15 ✓ 1 Snippet Balasubramanian M, Cartwright A, Smith K, Arundel P, Bishop NJ.
In-Text Gene Mentions

…in association withtype 1 collagenopathy1 collagenopathy: Atypical…

Show Full Abstract

We report a sibling-pair and a 4-year old child from two families with an atypical presentation in Osteogenesis imperfecta (OI). In the sib-pair, the older sibling initially came to medical attention due to a fracture history (Patient 1) and she was shown to have a COL1A2 mutation. In addition, she also had developmental delay, facial dysmorphism, and a history of frequent infections which led to a search for an alternate diagnosis. ArrayCGH revealed a 4.3 Mb duplication on chromosome 19q13.42q13.43, which was confirmed by FISH analysis. On further familial analysis, the younger sibling who had no previous fracture history was also found to have the COL1A2 mutation and tested positive for the 19q13.42q13.43 duplication (Patient 2). The 19q13 duplication appears to be the cause of intellectual disability in these siblings but given that this is a chromosomal duplication, it is still possible that there is an as yet unidentified cause that may account for the combined phenotype in this family. Patient 3 was a 4-year old child presenting with a femoral fracture, blue sclerae, developmental delay, and joint hypermobility. Genetic analyses confirmed a COL1A2 mutation but also revealed an 8.8 Mb deletion of 11q24.2q25, confirmed by G-band chromosome analysis. We discuss the differing phenotypes in patients presenting with atypical OI and stress the need to consider ancillary investigations in individuals presenting with heterogeneous phenotypic symptoms, not entirely attributable to OI.

Also flagged:ironHuntingtincadmiummanganesemetalsTF
Journal Article 2015-10-15 ✓ 5 Snippets Szeliga M, Różycka A, Jędrak P, Barańska S, Janik P, Jamrozik Z, Albrecht J.
In-Text Gene Mentions

HD is an autosomal-dominant disorder caused by mutation of the IT15 gene (also known as HTT) encoding huntingtin (Htt).

Wild-type human Htt contains the polyQ domain composed of 11–34 glutamine (CAG) residues.

…(also known asHTT) encoding huntingtin…

…) encoding huntingtin (Htt).…

…role of wild-typeHttis unclear, although…

Show Full Abstract

Recent studies have demonstrated elevated levels of iron (Fe) in brains of patients with Huntington's disease (HD). Striatal cells carrying mutated Huntingtin presented increased sensitivity to cadmium (Cd) toxicity, decreased sensitivity to manganese (Mn) toxicity and deficits in Mn uptake. The hypothesis arose that the observed alterations result from the altered expression and/or activity of proteins engaged in the transport of these metals, that is: transferrin (TF), transferrin receptor (TFR), divalent metal transporter 1 (DMT1) and ZIP8 protein. Here we examined the expression levels of genes encoding these proteins in blood of HD patients and control subjects. A decreasing tendency in the level of TF transcript and increasing tendency of SLC11A2 mRNA encoding DMT1 was observed in the blood of HD patients compared to the control subjects, but neither attained statistical significance. No changes were found in the levels of TFRC coding for TFR and SLC39A8 coding for ZIP8 between HD patients and controls. The results indicate that HD-associated changes in metal homeostasis occur are not related to mechanisms other than the expression level of the here analyzed metal transporters.

Also flagged:Filamin Aneuronal periventricular nodular heterotopiacognitionpatent ductus arteriosuscardiac valve diseaseaortic dissection
Journal Article 2015-10-15 ✓ 2 Snippets Lange M, Kasper B, Bohring A, Rutsch F, Kluger G, Hoffjan S, Spranger S, Behnecke A, Ferbert A, Hahn A, Oehl-Jaschkowitz B, Graul-Neumann L, Diepold K, Schreyer I, Bernhard MK, Mueller F, Siebers-Renelt U, Beleza-Meireles A, Uyanik G, Janssens S, Boltshauser E, Winkler J, Schuierer G, Hehr U.
In-Text Gene Mentions

…mutations within theARFGEF2gene resulting in…

ARFGEF2encodes the brefeldin-inhibite…

Show Full Abstract

<h4>Background</h4>Heterozygous loss of function mutations within the Filamin A gene in Xq28 are the most frequent cause of bilateral neuronal periventricular nodular heterotopia (PVNH). Most affected females are reported to initially present with difficult to treat seizures at variable age of onset. Psychomotor development and cognition may be normal or mildly to moderately impaired. Distinct associated extracerebral findings have been observed and may help to establish the diagnosis including patent ductus arteriosus Botalli, progressive dystrophic cardiac valve disease and aortic dissection, chronic obstructive lung disease or chronic constipation. Genotype-phenotype correlations could not yet be established.<h4>Methods</h4>Sanger sequencing and MLPA was performed for a large cohort of 47 patients with Filamin A associated PVNH (age range 1 to 65 years). For 34 patients more detailed clinical information was available from a structured questionnaire and medical charts on family history, development, epileptologic findings, neurological examination, cognition and associated clinical findings. Available detailed cerebral MR imaging was assessed for 20 patients.<h4>Results</h4>Thirty-nine different FLNA mutations were observed, they are mainly truncating (37/39) and distributed throughout the entire coding region. No obvious correlation between the number and extend of PVNH and the severity of the individual clinical manifestation was observed. 10 of the mutation carriers so far are without seizures at a median age of 19.7 years. 22 of 24 patients with available educational data were able to attend regular school and obtain professional education according to age.<h4>Conclusions</h4>We report the clinical and mutation spectrum as well as MR imaging for a large cohort of 47 patients with Filamin A associated PVNH including two adult males. Our data are reassuring in regard to psychomotor and cognitive development, which is within normal range for the majority of patients. However, a concerning median diagnostic latency of 17 to 20 years was noted between seizure onset and the genetic diagnosis, intensely delaying appropriate medical surveillance for potentially life threatening cardiovascular complications as well as genetic risk assessment and counseling prior to family planning for this X-linked dominant inherited disorder with high perinatal lethality in hemizygous males.

Also flagged:histoneslinker histone H1chromatinnucleosomeposttranslational modificationsheterochromatin
Journal Article 2015-10-15 ✓ 1 Snippet Hergeth SP, Schneider R.
In-Text Gene Mentions

linker histones

Show Full Abstract

The linker histone H1 family members are a key component of chromatin and bind to the nucleosomal core particle around the DNA entry and exit sites. H1 can stabilize both nucleosome structure and higher-order chromatin architecture. In general, H1 molecules consist of a central globular domain with more flexible tail regions at both their N- and C-terminal ends. The existence of multiple H1 subtypes and a large variety of posttranslational modifications brings about a considerable degree of complexity and makes studying this protein family challenging. Here, we review recent progress in understanding the function of linker histones and their subtypes beyond their role as merely structural chromatin components. We summarize current findings on the role of H1 in heterochromatin formation, transcriptional regulation and embryogenesis with a focus on H1 subtypes and their specific modifications.

Also flagged:ObesitysleepingFTOpotassium channel tetramerization domain containingKCTD15melanocortin receptor4
Journal Article 2015-10-15 ✓ 5 Snippets Lee H, Ash GI, Angelopoulos TJ, Gordon PM, Moyna NM, Visich PS, Zoeller RF, Gordish-Dressman H, Deshpande V, Chen MH, Thompson PD, Hoffman EP, Devaney JM, Pescatello LS.
In-Text Gene Mentions

Due to the pleiotropic effects of related phenotypes, we tested six of these obesity-related genetic variants for their association with physical activity: fat mass and obesity-associated (FTO)(rs9939609)T>A, potassium channel tetramerization domain containing (KCTD15) (rs11084753)G>A, melanocortin receptor4 (MC4R)(rs17782313)T>C, neuronal growth regulator 1 (NEGR1)(rs2815752)A>G, SH2B adapter protein 1 (SH2B1)(rs7498665)A>G, and transmembrane protein18 (TMEM18)(rs6548238)C>T.

These single nucleotide polymorphisms (SNPs) were fat mass and obesity-associated (FTO) (rs9939609) T>A, glucosamine-6 phosphate deaminase 2 (GNPDA) (rs10938397) A>G, potassium channel tetramerization domain containing (KCTD15) (rs11084753) G>A, melanocortin receptor 4 (MC4R) (rs17782313) T>C, mitochondrial carrier homolog 2 (MTCH2) (rs10838738) A>G, neuronal growth regulator 1 (NEGR1) (rs2815752) A>G, SH2B adapter protein 1 (SH2B1) (rs7498665) A>G, and transmembrane protein 18 (TMEM18) (rs6548238) C>T.

…( MC4R )(rs17782313)T>C,neuronal growth regulator 1growth regulator 1…

…regulator 1 (NEGR1)(rs2815752)A>G, SH2B adapter…

…) (rs10838738) A>G,neuronal growth regulator 1growth regulator 1…

Show Full Abstract

<h4>Background</h4>Meta-analysis of genome-wide association studies identified obesity-related genetic variants. Due to the pleiotropic effects of related phenotypes, we tested six of these obesity-related genetic variants for their association with physical activity: fat mass and obesity-associated (<i>FTO</i>)(rs9939609)T>A, potassium channel tetramerization domain containing (<i>KCTD15</i>) (rs11084753)G>A, melanocortin receptor4 (<i>MC4R</i>)(rs17782313)T>C, neuronal growth regulator 1 (<i>NEGR1</i>)(rs2815752)A>G, SH2B adapter protein 1 (<i>SH2B1</i>)(rs7498665)A>G, and transmembrane protein18 (<i>TMEM18</i>)(rs6548238)C>T.<h4>Method</h4>European-American women (<i>n</i> = 263) and men (<i>n</i> = 229) (23.5 ± 0.3 years, 24.6 ± 0.2 kg/m<sup>2</sup>) were genotyped and completed the Paffenbarger physical activity Questionnaire. Physical activity volume in metabolic energy equivalents [MET]-hour/week was derived from the summed time spent (hour/week) times the given MET value for vigorous, moderate, and light intensity physical activity, and sitting and sleeping, respectively. Multivariable adjusted [(age, sex, and body mass index (BMI)] linear regression tested associations among genotype (dominant/recessive model) and the log of physical activity volume.<h4>Result</h4><i>MC4R</i> (rs17782313)T>C explained 1.1 % (<i>p</i> = 0.02), <i>TMEM18</i>(rs6548238)C>T 1.2 % (<i>p</i> = 0.01), and <i>SH2B1</i> (rs7498665)A>G 0.6 % (<i>p</i> = 0.08) of the variability in physical activity volume. Subjects with the <i>MC4R</i> C allele spent 3.5 % less MET-hour/week than those with the TT genotype (<i>p</i> = 0.02). Subjects with the <i>TMEM18</i> T allele spent 4.1 % less MET-hour/week than those with the CC genotype (<i>p</i> = 0.01). Finally, subjects with the <i>SH2B1</i> GG genotype spent 3.6 % less MET-hour/week than A allele carriers (<i>p</i> = 0.08).<h4>Conclusion</h4>Our findings suggest a shared genetic influence among some obesity-related gene loci and physical activity phenotypes that should be explored further. Physical activity volume differences by genotype have public health importance equating to 11-13 lb weight difference annually.

Also flagged:Salvianolic AcidsFlavonoidsSulfur mustardthiolsglutathionewater
Journal Article 2015-10-15 No Snippets Li J, Chen L, Wu H, Lu Y, Hu Z, Lu B, Zhang L, Chai Y, Zhang J.
Show Full Abstract

Sulfur mustard (SM) is a vesicating chemical warfare agent used in numerous military conflicts and remains a potential chemical threat to the present day. Exposure to SM causes the depletion of cellular antioxidant thiols, mainly glutathione (GSH), which may lead to a series of SM-associated toxic responses. MSTF is the mixture of salvianolic acids (SA) of Salvia miltiorrhiza and total flavonoids (TFA) of Anemarrhena asphodeloides. SA is the main water-soluble phenolic compound in Salvia miltiorrhiza. TFA mainly includes mangiferin, isomangiferin and neomangiferin. SA and TFA possess diverse activities, including antioxidant and anti-inflammation activities. In this study, we mainly investigated the therapeutic effects of MSTF on SM toxicity in Sprague Dawley rats. Treatment with MSTF 1 h after subcutaneous injection with 3.5 mg/kg (equivalent to 0.7 LD50) SM significantly increased the survival levels of rats and attenuated the SM-induced morphological changes in the testis, small intestine and liver tissues. Treatment with MSTF at doses of 60 and 120 mg/kg caused a significant (p<0.05) reversal in SM-induced GSH depletion. Gene expression profiles revealed that treatment with MSTF had a dramatic effect on gene expression changes caused by SM. Treatment with MSTF prevented SM-induced differential expression of 93.8% (973 genes) of 1037 genes. Pathway enrichment analysis indicated that these genes were mainly involved in a total of 36 pathways, such as the MAPK signaling pathway, pathways in cancer, antigen processing and presentation. These data suggest that MSTF attenuates SM-induced injury by increasing GSH and targeting multiple pathways, including the MAPK signaling pathway, as well as antigen processing and presentation. These results suggest that MSTF has the potential to be used as a potential therapeutic agent against SM injuries.

Alcohol and the Intestine.

Also flagged:Alcohol abusealcoholendotoxemiacircadian rhythmspathogenesisalcoholic liver disease
Journal Article 2015-10-15 ✓ 1 Snippet Patel S, Behara R, Swanson GR, Forsyth CB, Voigt RM, Keshavarzian A.
In-Text Gene Mentions

…infection (HCV) andhemochromatosis[ 5 ,…

Show Full Abstract

Alcohol abuse is a significant contributor to the global burden of disease and can lead to tissue damage and organ dysfunction in a subset of alcoholics. However, a subset of alcoholics without any of these predisposing factors can develop alcohol-mediated organ injury. The gastrointestinal tract (GI) could be an important source of inflammation in alcohol-mediated organ damage. The purpose of review was to evaluate mechanisms of alcohol-induced endotoxemia (including dysbiosis and gut leakiness), and highlight the predisposing factors for alcohol-induced dysbiosis and gut leakiness to endotoxins. Barriers, including immunologic, physical, and biochemical can regulate the passage of toxins into the portal and systemic circulation. In addition, a host of environmental interactions including those influenced by circadian rhythms can impact alcohol-induced organ pathology. There appears to be a role for therapeutic measures to mitigate alcohol-induced organ damage by normalizing intestinal dysbiosis and/or improving intestinal barrier integrity. Ultimately, the inflammatory process that drives progression into organ damage from alcohol appears to be multifactorial. Understanding the role of the intestine in the pathogenesis of alcoholic liver disease can pose further avenues for pathogenic and treatment approaches.

Also flagged:Sjögren's Syndromepathogenesislymphomamajor histocompatibility complexMHCtype I interferon
Journal Article 2015-10-15 No Snippets Nezos A, Mavragani CP.
Show Full Abstract

We aimed to summarize the current evidence related to the contributory role of genetic factors in the pathogenesis of Sjögren's syndrome (SS) and SS-related lymphoma. Genes within the major histocompatibility complex (MHC) locus previously considered conferring increased susceptibility to SS development have been also revealed as important contributors in recent genome wide association studies. Moreover, genetic variations outside the MHC locus involving genes in type I interferon pathway, NF-κB signaling, B- and T-cell function and methylation processes have been shown to be associated with both SS and SS-related lymphoma development. Appreciating the functional implications of SS-related genetic variants could provide further insights into our understanding of SS heterogeneity, allowing the design of tailored therapeutic interventions.

Also flagged:hepatocellular carcinomaliver cancercell proliferationluciferasebindingtumor
Journal Article 2015-10-15 ✓ 5 Snippets Xiong G, Wang Y, Ding Q, Yang L.
In-Text Gene Mentions

In conclusion, our results support that SNP rs73239138 in miR-1269 is a protective factor which prevents binding to 3'UTR of SOX6 and there by suppresses tumor growth in HCC.

Hsa-mir-1269 genetic variant contributes to hepatocellular carcinoma susceptibility through affecting SOX6.

SOX6was predicted as…

…positively correlated withSOX6expression.…

…decreased level ofSOX6.…

Show Full Abstract

MiR-1269 is an essential oncogene that plays crucial roles in regulating the development of hepatocellular carcinoma (HCC). In this study, we mainly focused on the polymorphisms (rs73239138) in miR-1069 to explore its potential role in regulation of target genes in liver cancer. We detected increased level of miR-1269 in 80 HCC patients. SOX6 was predicted as a potential target gene of miR-as. Notably, Pearson correlation analysis indicated that patients harbored with miR-1269 wild type (rs73239138, GG genotype), positively correlated with SOX6 expression. Over-expression of miR-1269 with GG genotype promoted cell proliferation comparing with AA genotype, which is acompanied by a decreased level of SOX6. Further dual luciferase reporter assay showed that miR-1269 with GG genotype have a stronger binding ability with SOX6. SNP rs73239138 in miR-1269 was very likey to be involved in the development of HCC by acting as a protective factor, as the carriers of GA and GG genotype resulted in a smaller tumor size. In conclusion, our results support that SNP rs73239138 in miR-1269 is a protective factor which prevents binding to 3'UTR of SOX6 and there by suppresses tumor growth in HCC.

Also flagged:Gliomacancerdeathtranscription factorsGene Expressiontranscription factor
Journal Article 2015-10-15 No Snippets Jiang CM, Wang XH, Shu J, Yang WX, Fu P, Zhuang LL, Zhou GP.
Show Full Abstract

Glioma represents one of the main causes of cancer-related death worldwide. Unfortunately, its exact molecular mechanisms remain poorly understood, which limits the prognosis and therapy. This study aimed to identify the critical genes, transcription factors and the possible biochemical pathways that may affect glioma progression at transcription level. After downloading micro-array data from Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between glioma and normal samples were screened. We predicted novel glioma-related genes and carried on online software DAVID to conduct GO enrichment and transcription factor analysis of these selected genes. String software was applied to construct a PPI protein interaction network, as well as to find the key genes and transcription factors in the regulation of glioma. A total of 97 DEGs were identified associated with cancer, the GO enrichment analysis indicated these DEGs were mainly relevant to immune responses as well as regulation of cell growth. In addition, the transcription factor analysis showed these DEGs were regulated by the binding sites of transcription factors GLI2, SP1, SMAD7, SMAD3, RELA, STAT5B, CTNNB1, STAT5A, TFAP2A and SP3. PPI protein interaction network analysis demonstrated the hub nodes in the interaction network were EGFR, TGFB1, FN1 and MYC. The hub DEGs may be the most critical in glioma and could be considered as drug targets for glioma therapy after further exploration. Besides, with the identification of regulating transcription factors, the pathogenesis of glioma at transcription level might be brought to light.

Also flagged:endometriosissex determining region Y-box 6p21cyclin D1pRbcell proliferation
Journal Article 2015-10-15 ✓ 5 Snippets Zhang D, Li Y, Tian J, Zhang H, Wang S.
In-Text Gene Mentions

And, miR-202 could complementary bind to SOX6 3'UTR to regulate the expression of SOX6.<h4>Conclusion</h4>MiR-202 was up-regulated in the endometriosis.

Through targeting SOX6 and its downstream proteins (p21, cyclin D1 and pRb), miR-202 can promote the progression of endometriosis.

MiR-202 promotes endometriosis by regulating SOX6 expression.

…protein expressions ofSOX6(sex determining region…

…The expression ofSOX6protein was lower…

Show Full Abstract

<h4>Objectives</h4>This study is to investigate the role and mechanism of microRNA-202 (miR-202) in endometriosis.<h4>Methods</h4>Forty-five cases of ectopic endometrial tissues, 25 cases of eutopic endometrial tissues and 26 cases of normal endometrial tissues were collected. MiR-202 expression was detected by quantitative RT-PCR. The protein expressions of SOX6 (sex determining region Y-box 6) and its downstream proteins (p21, cyclin D1 and pRb (retinoblastoma protein)) were detected by immunochemistry and western blot. MTT and transwell assays were used to examine cell proliferation and cell migration. The dual luciferase assay was applied to validate whether miR-202 can directly target SOX6 gene.<h4>Results</h4>MiR-202 was highly expressed in eutopic and ectopic endometrial tissues than normal endometrial tissues (P < 0.05), and the expression was higher in tissues with III/IV stages than I/II stages (P < 0.05). The expression of SOX6 protein was lower in ectopic endometrial tissues than in normal endometrial tissues. In ectopic endometrial tissues, the expression of p21 was decreased while cyclin D1 and pRb was up-regulated than in normal endometrial tissues (P < 0.05). In cultured endometrial cells, miR-202 down-regulation induced up-regulation of SOX6 and p21 whereas down-regulation of cyclin D1 and pRb. MiR-202 promoted the proliferation and metastasis of endometrial cells. And, miR-202 could complementary bind to SOX6 3'UTR to regulate the expression of SOX6.<h4>Conclusion</h4>MiR-202 was up-regulated in the endometriosis. Through targeting SOX6 and its downstream proteins (p21, cyclin D1 and pRb), miR-202 can promote the progression of endometriosis.

Also flagged:FBN1Marfan syndromechromosomecysteineaortic aneurysmdissections
Journal Article 2015-10-15 ✓ 1 Snippet Jaradat SA, Abujamous LA, Al-Hawamdeh AA, Alawneh KM, Rawashdeh TA, Jaradat ZM.
In-Text Gene Mentions

type 1 fibrillinopathies

Show Full Abstract

Marfan syndrome is an autosomal dominant inheritance disorder with a 1/5000-live-birth prevalence. More than 3000 mutations have been characterized thus far in the FBN1 gene. The goal of this study is to facilitate Marfan syndrome diagnosis in Jordanian patients using a molecular genetic testing. All of the 65 coding exons and flanking intronic sequences of the FBN1 gene were amplified using polymerase chain reaction and were subjected to sequencing in five unrelated Jordanian patients suspected of having Marfan syndrome. Four different mutations were identified, including two novel mutations: the c.1553dupG frame-shift (p.Tyr519Ilefs*14) and the c.6650G>A (p.Cys2217Tyr) missense mutations. Two other missense mutations, c.2243G>A (p.Cys748Tyr) and c.2432G>A (p.Cys811Tyr), have been previously detected. Patient number five was heterozygous for the synonymous substitution variant c.1875T>C (p.Asn625Asn; rs#25458). Additionally, eight variants in the intronic sequence of the FBN1 gene were identified, of which the c.2168-46A>G mutation was a new variant. The data provide molecular-based evidence linking Marfan syndrome to pathogenic mutations in the FBN1 gene among Jordanians for the first time. Thus, our results will contribute to the better management of the disease using molecular tools and will help in genetic counseling of the patients' families.

Also flagged:OxygenCarbonhydrogenperoxidecarbon nanotubesosmium
Journal Article 2015-10-14 No Snippets Rawson FJ, Hicks J, Dodd N, Abate W, Garrett DJ, Yip N, Fejer G, Downard AJ, Baronian KH, Jackson SK, Mendes PM.
Show Full Abstract

Herein, we report a highly sensitive electrocatalytic sensor-cell construct that can electrochemically communicate with the internal environment of immune cells (e.g., macrophages) via the selective monitoring of a particular reactive oxygen species (ROS), hydrogen peroxide. The sensor, which is based on vertically aligned single-walled carbon nanotubes functionalized with an osmium electrocatalyst, enabled the unprecedented detection of a local intracellular "pulse" of ROS on a short second time scale in response to bacterial endotoxin (lipopolysaccharide-LPS) stimulation. Our studies have shown that this initial pulse of ROS is dependent on NADPH oxidase (NOX) and toll like receptor 4 (TLR4). The results suggest that bacteria can induce a rapid intracellular pulse of ROS in macrophages that initiates the classical innate immune response of these cells to infection.

Also flagged:BMP12bone morphogenetic proteinBMPglycosaminoglycanscollagendegradation
Journal Article 2015-10-14 ✓ 2 Snippets Gelberman RH, Shen H, Kormpakis I, Rothrauff B, Yang G, Tuan RS, Xia Y, Sakiyama-Elbert S, Silva MJ, Thomopoulos S.
In-Text Gene Mentions

ATIII

PEBP1

Show Full Abstract

The outcomes of flexor tendon repair are highly variable. As recent efforts to improve healing have demonstrated promise for growth factor- and cell-based therapies, the objective of the current study was to enhance repair via application of autologous adipose derived stromal cells (ASCs) and the tenogenic growth factor bone morphogenetic protein (BMP) 12. Controlled delivery of cells and growth factor was achieved in a clinically relevant canine model using a nanofiber/fibrin-based scaffold. Control groups consisted of repair-only (no scaffold) and acellular scaffold. Repairs were evaluated after 28 days of healing using biomechanical, biochemical, and proteomics analyses. Range of motion was reduced in the groups that received scaffolds compared to normal. There was no effect of ASC + BMP12 treatment for range of motion or tensile properties outcomes versus repair-only. Biochemical assays demonstrated increased DNA, glycosaminoglycans, and crosslink concentration in all repair groups compared to normal, but no effect of ASC + BMP12. Total collagen was significantly decreased in the acellular scaffold group compared to normal and significantly increased in the ASC + BMP12 group compared to the acellular scaffold group. Proteomics analysis comparing healing tendons to uninjured tendons revealed significant increases in proteins associated with inflammation, stress response, and matrix degradation. Treatment with ASC + BMP12 amplified these unfavorable changes. In summary, the treatment approach used in this study induced a negative inflammatory reaction at the repair site leading to poor healing. Future approaches should consider cell and growth factor delivery methods that do not incite negative local reactions.

Also flagged:pathogenesispsychosismethylationschizophreniabipolar disorderGene expression
Journal Article 2015-10-14 No Snippets Zhao H, Xu J, Pang L, Zhang Y, Fan H, Liu L, Liu T, Yu F, Zhang G, Lan Y, Bai J, Li X, Xiao Y.
Show Full Abstract

<h4>Background</h4>DNA methylation is thought to be extensively involved in the pathogenesis of many diseases, including major psychosis. However, most studies focus on DNA methylation alteration at promoters of protein-coding genes, despite the poor correlation between DNA methylation and gene expression.<h4>Methods</h4>We analyzed differentially methylated regions and differentially expressed genes in patients with schizophrenia and bipolar disorder and normal subjects. Gene expression and DNA methylation were analyzed with RNA-seq and MeDIP-seq of post-mortem brain tissue (brain region BA9) cohort in five schizophrenia, seven bipolar disorder cases and six controls, respectively.<h4>Results</h4>Here, we performed a large-scale integrative analysis using MeDIP-seq, coupled with RNA-seq, on brain samples from major psychotic and normal subjects and observed obvious discrepancy between DNA methylation and gene expression. We found that differentially methylated regions (DMRs) were distributed across different types of genomic elements, especially introns. These intronic DMRs were significantly enriched for diverse regulatory elements, such as enhancers and binding sites of certain transcriptional factors (e.g., Pol3). Notably, we found that parts of intronic DMRs overlapped with some intragenic miRNAs, such as hsa-mir-7-3. These intronic DMR-related miRNAs were found to target many differentially expressed genes. Moreover, functional analysis demonstrated that differential target genes of intronic DMR-related miRNAs were sufficient to capture many important biological processes in major psychosis, such as neurogenesis, suggesting that miRNAs may function as important linkers mediating the relationships between DNA methylation alteration and gene expression changes.<h4>Conclusions</h4>Collectively, our study indicated that DNA methylation alteration could induce expression changes indirectly by affecting miRNAs and the exploration of DMR-related miRNAs and their targets enhanced understanding of the molecular mechanisms underlying major psychosis.

Also flagged:Huntington DiseaseHDneurodegenerative disorder
Journal Article 2015-10-14 ✓ 1 Snippet Adjeroud N, Yagüe S, Yu-Taeger L, Bozon B, Leblanc-Veyrac P, Riess O, Allain P, Nguyen HP, Doyère V, El Massioui N.
In-Text Gene Mentions

…repeats in theHTTgene.…

Show Full Abstract

Executive dysfunction and psychiatric symptoms are hallmarks of Huntington disease (HD), a neurodegenerative disorder genetically characterized by expanded CAG repeats in the HTT gene. Using the BACHD rat model of HD (97 CAG-CAA repeats), the present research seeks to characterize the progressive emergence of decision-making impairments in a rat version of the Iowa Gambling Task (RGT) and the impact of emotional modulation, whether positive or negative, on choice behavior. The choice efficiency shown both by WT rats (independent of their age) and the youngest BACHD rats (2 and 8months old) evidenced that they are able to integrate outcomes of past decisions to determine expected reward values for each option. However, 18months old BACHD rats made fewer choices during the RGT session and were less efficient in choosing advantageous options than younger animals. Presenting either chocolate pellets or electrical footshocks half-way through a second RGT session reduced exploratory activity (inefficient nose-poking) and choices with a weaker effect on BACHD animals than on WT. Choice efficiency was left intact in transgenic rats. Our results bring new knowledge on executive impairments and impact of emotional state on decision-making at different stages of the disease, increasing the face-validity of the BACHD rat model.

Also flagged:azoleACT1ARE2GFPHIS1lox
Journal Article 2015-10-14 ✓ 1 Snippet Chang W, Zhang M, Zheng S, Li Y, Li X, Li W, Li G, Lin Z, Xie Z, Zhao Z, Lou H.
In-Text Gene Mentions

CA10

Show Full Abstract

Lipid droplets (LDs) act as intracellular storage organelles in most types of cells and are principally involved in energy homeostasis and lipid metabolism. However, the role of LDs in resistance to toxins in fungi remains largely unknown. Here, we show that the trapping of endogenous toxins by LDs is a self-resistance mechanism in the toxin producer, while absorbing external lipophilic toxins is a resistance mechanism in the toxin recipient that acts to quench the production of reactive oxygen species. We found that an endolichenic fungus that generates phototoxic perylenequinones (PQs) trapped the PQs inside LDs. Using a model that incorporates the fungicidal action of hypocrellin A (HA), a PQ derivative, we showed that yeast cells escaped killing by trapping toxins inside LDs. Furthermore, LD-deficient mutants were hypersusceptible to HA-mediated phototoxins and other fungicides. Our study identified a previously unrecognised function of LDs in fungi that has implications for our understanding of environmental adaptation strategies for fungi and antifungal drug discovery.

Also flagged:asleepsimple snoringobstructive sleep apnoea syndromeOSASDown syndromemucopolysaccharidosis
Journal Article 2015-10-14 No Snippets Venekamp RP, Hearne BJ, Chandrasekharan D, Blackshaw H, Lim J, Schilder AG.
Show Full Abstract

<h4>Background</h4>Obstructive sleep-disordered breathing (oSDB) is a condition that encompasses breathing problems when asleep, due to an obstruction of the upper airways, ranging in severity from simple snoring to obstructive sleep apnoea syndrome (OSAS). It affects both children and adults. In children, hypertrophy of the tonsils and adenoid tissue is thought to be the commonest cause of oSDB. As such, tonsillectomy - with or without adenoidectomy - is considered an appropriate first-line treatment for most cases of paediatric oSDB.<h4>Objectives</h4>To assess the benefits and harms of tonsillectomy with or without adenoidectomy compared with non-surgical management of children with oSDB.<h4>Search methods</h4>We searched the Cochrane Register of Studies Online, PubMed, EMBASE, CINAHL, Web of Science, Clinicaltrials.gov, ICTRP and additional sources for published and unpublished trials. The date of the search was 5 March 2015.<h4>Selection criteria</h4>Randomised controlled trials comparing the effectiveness and safety of (adeno)tonsillectomy with non-surgical management in children with oSDB aged 2 to 16 years.<h4>Data collection and analysis</h4>We used the standard methodological procedures expected by The Cochrane Collaboration.<h4>Main results</h4>Three trials (562 children) met our inclusion criteria. Two were at moderate to high risk of bias and one at low risk of bias. We did not pool the results because of substantial clinical heterogeneity. They evaluated three different groups of children: those diagnosed with mild to moderate OSAS by polysomnography (PSG) (453 children aged five to nine years; low risk of bias; CHAT trial), those with a clinical diagnosis of oSDB but with negative PSG recordings (29 children aged two to 14 years; moderate to high risk of bias; Goldstein) and children with Down syndrome or mucopolysaccharidosis (MPS) diagnosed with mild to moderate OSAS by PSG (80 children aged six to 12 years; moderate to high risk of bias; Sudarsan). Moreover, the trials included two different comparisons: adenotonsillectomy versus no surgery (CHAT trial and Goldstein) or versus continuous positive airway pressure (CPAP) (Sudarsan). Disease-specific quality of life and/or symptom score (using a validated instrument): first primary outcomeIn the largest trial with lowest risk of bias (CHAT trial), at seven months, mean scores for those instruments measuring disease-specific quality of life and/or symptoms were lower (that is, better quality of life or fewer symptoms) in children receiving adenotonsillectomy than in those managed by watchful waiting:- OSA-18 questionnaire (scale 18 to 126): 31.8 versus 49.5 (mean difference (MD) -17.7, 95% confidence interval (CI) -21.2 to -14.2);- PSQ-SRBD questionnaire (scale 0 to 1): 0.2 versus 0.5 (MD -0.3, 95% CI -0.31 to -0.26);- Modified Epworth Sleepiness Scale (scale 0 to 24): 5.1 versus 7.1 (MD -2.0, 95% CI -2.9 to -1.1).No data on this primary outcome were reported in the Goldstein trial.In the Sudarsan trial, the mean OSA-18 score at 12 months did not significantly differ between the adenotonsillectomy and CPAP groups. The mean modified Epworth Sleepiness Scale scores did not differ at six months, but were lower in the surgery group at 12 months: 5.5 versus 7.9 (MD -2.4, 95% CI -3.1 to -1.7). Adverse events: second primary outcomeIn the CHAT trial, 15 children experienced a serious adverse event: 6/194 (3%) in the adenotonsillectomy group and 9/203 (4%) in the control group (RD -1%, 95% CI -5% to 2%).No major complications were reported in the Goldstein trial.In the Sudarsan trial, 2/37 (5%) developed a secondary haemorrhage after adenotonsillectomy, while 1/36 (3%) developed a rash on the nasal dorsum secondary to the CPAP mask (RD -3%, 95% CI -6% to 12%). Secondary outcomesIn the CHAT trial, at seven months, mean scores for generic caregiver-rated quality of life were higher in children receiving adenotonsillectomy than in those managed by watchful waiting. No data on this outcome were reported by Sudarsan and Goldstein.In the CHAT trial, at seven months, more children in the surgery group had normalisation of respiratory events during sleep as measured by PSG than those allocated to watchful waiting: 153/194 (79%) versus 93/203 (46%) (RD 33%, 95% CI 24% to 42%). In the Goldstein trial, at six months, PSG recordings were similar between groups and in the Sudarsan trial resolution of OSAS (Apnoea/Hypopnoea Index score below 1) did not significantly differ between the adenotonsillectomy and CPAP groups.In the CHAT trial, at seven months, neurocognitive performance and attention and executive function had not improved with surgery: scores were similar in both groups. In the CHAT trial, at seven months, mean scores for caregiver-reported ratings of behaviour were lower (that is, better behaviour) in children receiving adenotonsillectomy than in those managed by watchful waiting, however, teacher-reported ratings of behaviour did not significantly differ.No data on these outcomes were reported by Goldstein and Sudarsan.<h4>Authors' conclusions</h4>In otherwise healthy children, without a syndrome, of older age (five to nine years), and diagnosed with mild to moderate OSAS by PSG, there is moderate quality evidence that adenotonsillectomy provides benefit in terms of quality of life, symptoms and behaviour as rated by caregivers and high quality evidence that this procedure is beneficial in terms of PSG parameters. At the same time, high quality evidence indicates no benefit in terms of objective measures of attention and neurocognitive performance compared with watchful waiting. Furthermore, PSG recordings of almost half of the children managed non-surgically had normalised by seven months, indicating that physicians and parents should carefully weigh the benefits and risks of adenotonsillectomy against watchful waiting in these children. This is a condition that may recover spontaneously over time.For non-syndromic children classified as having oSDB on purely clinical grounds but with negative PSG recordings, the evidence on the effects of adenotonsillectomy is of very low quality and is inconclusive.Low-quality evidence suggests that adenotonsillectomy and CPAP may be equally effective in children with Down syndrome or MPS diagnosed with mild to moderate OSAS by PSG.We are unable to present data on the benefits of adenotonsillectomy in children with oSDB aged under five, despite this being a population in whom this procedure is often performed for this purpose.

Also flagged:InsulinAkt2Insulin resistanceType 2 diabetesphosphoinositide-dependent serine/threonine kinaseglucose
Journal Article 2015-10-14 No Snippets Caruso M, Zhang X, Ma D, Yang Z, Qi Y, Yi Z.
Show Full Abstract

Insulin resistance and Type 2 diabetes are marked by an aberrant response in the insulin signaling network. The phosphoinositide-dependent serine/threonine kinase, Akt2, plays a key role in insulin signaling and glucose uptake, most notably within skeletal muscle. Protein-protein interaction regulates the functional consequence of Akt2 and in turn, Akt2's role in glucose uptake. However, only few insulin-responsive Akt2 interaction partners have been identified in skeletal muscle cells. In the present work, rat L6 myoblasts, a widely used insulin sensitive skeletal muscle cell line, were used to examine endogenous, insulin-stimulated Akt2 protein interaction partners. Akt2 co-immunoprecipitation was coupled with 1D-SDS-PAGE and fractions were analyzed by HPLC-ESI-MS/MS to reveal Akt2 protein-protein interactions. The pull-down assay displayed specificity for the Akt2 isoform; Akt1 and Akt3 unique peptides were not detected. A total of 49 were detected with a significantly increased (47) or decreased (2) association with Akt2 following insulin administration (n = 4; p<0.05). Multiple pathways were identified for the novel Akt2 interaction partners, such as the EIF2 and ubiquitination pathways. These data suggest that multiple new endogenous proteins may associate with Akt2 under basal as well as insulin-stimulated conditions, providing further insight into the insulin signaling network. Data are available via ProteomeXchange with identifier PXD002557.

Also flagged:methylationbehavioralcancerprotein restrictionfolic acidgene expression
Journal Article 2015-10-14 ✓ 1 Snippet Mitchell C, Schneper LM, Notterman DA.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Epigenetics, and especially DNA methylation, have recently become provocative biological explanations for early-life environmental effects on later health. Despite the large increase in papers on the topic over the last few years, many questions remain with regards to the biological feasibility of this mechanism and the strength of the evidence to date. In this review, we examine the literature on early-life effects on epigenetic patterns, with special emphasis on social environmental influences. First, we review the basic biology of epigenetic modification of DNA and debate the role of early-life stressful, protective, and positive environments on gene-specific, system-specific, and whole-genome epigenetic patterns later in life. Second, we compare the epigenetic literatures of both humans and other animals and review the research linking epigenetic patterns to health in order to complete the mechanistic pathway. Third, we discuss physical environmental and social environmental effects, which have to date, generally not been jointly considered. Finally, we close with a discussion of the current state of the area's research, its future direction, and its potential use in pediatric health.

Also flagged:cancermelanomastumoursMelanomafolatemethotrexate
Journal Article 2015-10-14 No Snippets Piskounova E, Agathocleous M, Murphy MM, Hu Z, Huddlestun SE, Zhao Z, Leitch AM, Johnson TM, DeBerardinis RJ, Morrison SJ.
Show Full Abstract

Solid cancer cells commonly enter the blood and disseminate systemically, but are highly inefficient at forming distant metastases for poorly understood reasons. Here we studied human melanomas that differed in their metastasis histories in patients and in their capacity to metastasize in NOD-SCID-Il2rg(-/-) (NSG) mice. We show that melanomas had high frequencies of cells that formed subcutaneous tumours, but much lower percentages of cells that formed tumours after intravenous or intrasplenic transplantation, particularly among inefficiently metastasizing melanomas. Melanoma cells in the blood and visceral organs experienced oxidative stress not observed in established subcutaneous tumours. Successfully metastasizing melanomas underwent reversible metabolic changes during metastasis that increased their capacity to withstand oxidative stress, including increased dependence on NADPH-generating enzymes in the folate pathway. Antioxidants promoted distant metastasis in NSG mice. Folate pathway inhibition using low-dose methotrexate, ALDH1L2 knockdown, or MTHFD1 knockdown inhibited distant metastasis without significantly affecting the growth of subcutaneous tumours in the same mice. Oxidative stress thus limits distant metastasis by melanoma cells in vivo.

Also flagged:OzoneEthidium BromideMultiple sclerosisautoimmune inflammatory disease of the central nervousbromidecorticosteroids
Journal Article 2015-10-14 ✓ 1 Snippet Salem NA, Assaf N, Ismail MF, Khadrawy YA, Samy M.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Multiple sclerosis, an autoimmune inflammatory disease of the central nervous system, is characterized by excessive demyelination. The study aimed to investigate the possible protective effect of ozone (O3) therapy in ethidium bromide (EB)-induced demyelination in rats either alone or in combination with corticosteroids in order to decrease the dose of steroid therapy. Rats were divided into Group (1) normal control rats received saline, Group (2) Sham-operated rats received saline, Group (3) Sham-operated rats received vehicle (oxygen), Group (4) EB-treated rats received EB, Group (5) EB-treated rats received O3, Group (6) EB-treated rats received methylprednisolone (MP), and Group (7) EB-treated rats received half the dose of MP concomitant with O3. EB-treated rats showed a significant increase in the number of footfalls in the grid walk test, decreased brain GSH, and paraoxonase-1 enzyme activity, whereas brain MDA, TNF-α, IL-1β, INF-γ, Cox-2 immunoreactivity, and p53 protein levels were increased. A significant decline in brain serotonin, dopamine, norepinephrine, and MBP immunoreactivity was also reported. Significant improvement of the above-mentioned parameters was demonstrated with the administration of either MP or O3, whereas best amelioration was achieved by combining half the dose of MP with ozone.

Also flagged:Serotonin transporteranxietyAnxiety disordersmental disordersSerotonin5-hydroxytryptamine
Journal Article 2015-10-14 ✓ 3 Snippets Ming Q, Zhang Y, Yi J, Wang X, Zhu X, Yao S.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) gene has captured…

…particular attention because5-HTTis involved in…

…The5-HTTgene has several…

Show Full Abstract

<h4>Background</h4>Previous studies of the interaction between a functional polymorphism in the serotonin transporter gene-linked promoter region (5-HTTLPR) and stress in anxiety-related phenotypes have produced inconsistent results. The aim of the current study was to examine the effect of the 5-HTTLPR × stress interaction on anxiety symptoms in Chinese adolescents.<h4>Methods</h4>A total of 651 healthy adolescents [323 females and 328 males; age 14-17 (mean = 16.27, standard deviation = 0.77)] participated in this study. At the initial assessment, participants completed self-report measures assessing anxiety symptoms, depressive symptoms and stressful life events. Additionally, anxiety symptoms and stressful life events were assessed once every 3 months for the subsequent 9 months. A hierarchical linear model (HLM) was used to investigate the 5-HTTLPR × stress interaction.<h4>Results</h4>The HLM indicated no main effect of 5-HTTLPR on anxiety symptoms. Significant 5-HTTLPR × stress interaction effect in predicting anxiety symptoms was found. Specifically, individuals with the 5-HTTLPR L allele exhibited more anxiety symptoms related to stressful life events.<h4>Conclusions</h4>The association between stress and anxiety symptoms is moderated by 5-HTTLPR. The 5-HTTLPR L allele increases individuals' vulnerability to anxiety under stress situations.

Also flagged:OxygenMetaphasemicrotubulegap junction proteintrypan bluehydrogen
Journal Article 2015-10-14 ✓ 1 Snippet Shaeib F, Khan SN, Ali I, Thakur M, Saed MG, Dai J, Awonuga AO, Banerjee J, Abu-Soud HM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

We investigated the ability of reactive oxygen species (ROS), such as hydrogen peroxide (H(2)O(2)), hydroxyl radical ((·)OH), and hypochlorous acid (HOCl), to overcome the defensive capacity of cumulus cells and elucidate the mechanism through which ROS differentially deteriorate oocyte quality. Metaphase II mouse oocytes with (n = 1634) and without cumulus cells (n = 1633) were treated with increasing concentration of ROS, and the deterioration in oocyte quality was assessed by the changes in the microtubule morphology and chromosomal alignment. Oocyte and cumulus cell viability and cumulus cell number were assessed by indirect immunofluorescence, staining of gap junction protein, and trypan blue staining. The treated oocytes showed decreased quality as a function of increasing concentrations of ROS when compared to controls. Cumulus cells show protection against H(2)O(2) and (·)OH insult at lower concentrations, but this protection was lost at higher concentrations (>50 μmol/L). At higher H(2)O(2) concentrations, treatment dramatically influenced the cumulus cell number and viability with resulting reduction in the antioxidant capacity making the oocyte more susceptible to oxidative damage. However, cumulus cells offered no significant protection against HOCl at any concentration used. In all circumstances in which cumulus cells did not offer protection to the oocyte, both cumulus cell number and viability were decreased. Therefore, the deterioration in oocyte quality may be caused by one or more of the following: a decrease in the antioxidant machinery by the loss of cumulus cells, the lack of scavengers for specific ROS, and/or the ability of the ROS to overcome these defenses.

Also flagged:Endoplasmic ReticulumEthanolfetal alcohol spectrum disordersFASDbehavioralneurotrophic factors
Journal Article 2015-10-14 ✓ 1 Snippet Yang F, Luo J.
In-Text Gene Mentions

Increased mutant Huntington protein (HTT) in Huntington’s disease and accumulation of superoxide dismutase (SOD1) in ALS have been shown positively correlated with ER stress [20].

Show Full Abstract

Ethanol abuse affects virtually all organ systems and the central nervous system (CNS) is particularly vulnerable to excessive ethanol exposure. Ethanol exposure causes profound damages to both the adult and developing brain. Prenatal ethanol exposure induces fetal alcohol spectrum disorders (FASD) which is associated with mental retardation and other behavioral deficits. A number of potential mechanisms have been proposed for ethanol-induced brain damage; these include the promotion of neuroinflammation, interference with signaling by neurotrophic factors, induction of oxidative stress, modulation of retinoid acid signaling, and thiamine deficiency. The endoplasmic reticulum (ER) regulates posttranslational protein processing and transport. The accumulation of unfolded or misfolded proteins in the ER lumen triggers ER stress and induces unfolded protein response (UPR) which are mediated by three transmembrane ER signaling proteins: pancreatic endoplasmic reticulum kinase (PERK), inositol-requiring enzyme 1 (IRE1), and activating transcription factor 6 (ATF6). UPR is initiated to protect cells from overwhelming ER protein loading. However, sustained ER stress may result in cell death. ER stress has been implied in various CNS injuries, including brain ischemia, traumatic brain injury, and aging-associated neurodegeneration, such as Alzheimer's disease (AD), Huntington's disease (HD), Amyotrophic lateral sclerosis (ALS), and Parkinson's disease (PD). However, effects of ethanol on ER stress in the CNS receive less attention. In this review, we discuss recent progress in the study of ER stress in ethanol-induced neurotoxicity. We also examine the potential mechanisms underlying ethanol-mediated ER stress and the interaction among ER stress, oxidative stress and autophagy in the context of ethanol neurotoxicity.

Also flagged:host cellpeptidestransmembranelocalizationcell growthprotein degradation
Journal Article 2015-10-13 ✓ 2 Snippets Kumar A, Baycin-Hizal D, Wolozny D, Pedersen LE, Lewis NE, Heffner K, Chaerkady R, Cole RN, Shiloach J, Zhang H, Bowen MA, Betenbaugh MJ.
In-Text Gene Mentions

SERPINC1

antithrombin-III

Show Full Abstract

Chinese hamster ovary (CHO) cells are the preferred host cell line for manufacturing a variety of complex biotherapeutic drugs including monoclonal antibodies. We performed a proteomics and bioinformatics analysis on the spent medium from adherent CHO cells. Supernatant from CHO-K1 culture was collected and subjected to in-solution digestion followed by LC/LC-MS/MS analysis, which allowed the identification of 3281 different host cell proteins (HCPs). To functionally categorize them, we applied multiple bioinformatics tools to the proteins identified in our study including SignalP, TargetP, SecretomeP, TMHMM, WoLF PSORT, and Phobius. This analysis provided information on the presence of signal peptides, transmembrane domains, and cellular localization and showed that both secreted and intracellular proteins were constituents of the supernatant. Identified proteins were shown to be localized to the secretory pathway including ones playing roles in cell growth, proliferation, and folding as well as those involved in protein degradation and removal. After combining proteins predicted to be secreted or having a signal peptide, we identified 1015 proteins, which we termed as CHO supernatant-ome (CHO-SO), or superome. As a part of this effort, we created a publically accessible web-based tool called GO-CHO to functionally categorize proteins found in CHO-SO and identify enriched molecular functions, biological processes, and cellular components. We also used a tool to evaluate the immunogenicity potential of high-abundance HCPs. Among enriched functions were catalytic activity and structural constituents of the cytoskeleton. Various transport related biological processes, such as vesicle mediated transport, were found to be highly enriched. Extracellular space and vesicular exosome associated proteins were found to be the most enriched cellular components. The superome also contained proteins secreted from both classical and nonclassical secretory pathways. The work and database described in our study will enable the CHO community to rapidly identify high-abundance HCPs in their cultures and therefore help assess process and purification methods used in the production of biologic drugs.

Also flagged:HDneurodegenerative disorderHuntingtinadult-onset disease
Journal Article 2015-10-13 ✓ 2 Snippets Mattis VB, Svendsen CN.
In-Text Gene Mentions

Huntington׳s Disease (HD) is a fatal neurodegenerative disorder caused by expanded polyglutamine repeats in the Huntingtin (HTT) gene.

…in the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington׳s Disease (HD) is a fatal neurodegenerative disorder caused by expanded polyglutamine repeats in the Huntingtin (HTT) gene. While the gene was identified over two decades ago, it remains poorly understood why mutant HTT (mtHTT) is initially toxic to striatal medium spiny neurons (MSNs). Models of HD using non-neuronal human patient cells and rodents exhibit some characteristic HD phenotypes. While these current models have contributed to the field, they are limited in disease manifestation and may vary in their response to treatments. As such, human HD patient MSNs for disease modeling could greatly expand the current understanding of HD and facilitate the search for a successful treatment. It is now possible to use pluripotent stem cells, which can generate any tissue type in the body, to study and potentially treat HD. This review covers disease modeling in vitro and, via chimeric animal generation, in vivo using human HD patient MSNs differentiated from embryonic stem cells or induced pluripotent stem cells. This includes an overview of the differentiation of pluripotent cells into MSNs, the established phenotypes found in cell-based models and transplantation studies using these cells. This review not only outlines the advancements in the rapidly progressing field of HD modeling using neurons derived from human pluripotent cells, but also it highlights several remaining controversial issues such as the 'ideal' series of pluripotent lines, the optimal cell types to use and the study of a primarily adult-onset disease in a developmental model. This article is part of a Special Issue entitled SI: Exploiting human neurons.

Also flagged:psychosisN-methyl-D-aspartate (NMDA)-type glutamate receptorschizophreniaNMDA receptorneurodevelopmental disordersGene expression
Journal Article 2015-10-13 ✓ 1 Snippet Ingason A, Giegling I, Hartmann AM, Genius J, Konte B, Friedl M, Schizophrenia Working Group of the Psychiatric Genomics Consortium (PGC), Ripke S, Sullivan PF, St Clair D, Collier DA, O'Donovan MC, Mirnics K, Rujescu D.
In-Text Gene Mentions

…23 TCF4, 23VRK2(ref.…

Show Full Abstract

Antagonists of the N-methyl-D-aspartate (NMDA)-type glutamate receptor induce psychosis in healthy individuals and exacerbate schizophrenia symptoms in patients. In this study we have produced an animal model of NMDA receptor hypofunction by chronically treating rats with low doses of the NMDA receptor antagonist MK-801. Subsequently, we performed an expression study and identified 20 genes showing altered expression in the brain of these rats compared with untreated animals. We then explored whether the human orthologs of these genes are associated with schizophrenia in the largest schizophrenia genome-wide association study published to date, and found evidence for association for 4 out of the 20 genes: SF3B1, FOXP1, DLG2 and VGLL4. Interestingly, three of these genes, FOXP1, SF3B1 and DLG2, have previously been implicated in neurodevelopmental disorders.

Also flagged:Zinc Oxidecell growthZinc Oxide NanoparticlesNanoparticlesmetaloxide
Journal Article 2015-10-13 No Snippets Zhao Y, Li L, Zhang PF, Shen W, Liu J, Yang FF, Liu HB, Hao ZH.
Show Full Abstract

Annually, tons and tons of zinc oxide nanoparticles (ZnO NPs) are produced in the world. And they are applied in almost all aspects of our life. Their release from the products into environment may pose issue for human health. Although many studies have reported the adverse effects of ZnO NPs on organisms, little is known about the effects on female reproductive systems or the related mechanisms. Quantitative proteomics have not been applied although quantitative transcriptomics have been used in zinc oxide nanoparticles (ZnO NPs) research. Genes are very important players however proteins are the real actors in the biological systems. By using hen's ovarian granulosa cells, it was found that ZnO-NP-5μg/ml and ZnSO4-10μg/ml treatments produced the same amount of intracellular Zn and resulted in similar cell growth inhibition. And NPs were found in the treated cells. However, ZnO-NP-5μg/ml specifically regulated the expression of genes and proteins compared with that in ZnSO4-10μg/ml treatment. For the first time, this investigation reports that intact NPs produce different impacts on the expression of genes and proteins involved in specific pathways compared to that by Zn2+. The findings enrich our knowledge for the molecular insights of zinc oxide nanoparticles effects on the female reproductive systems. This also may raise the health concern that ZnO NPs may adversely affect the female reproductive systems through regulation of specific signaling pathways.

Also flagged:CollagenLiver Fibrosispicrosirius redChronic Hepatitis Cliver diseasehepatocellular carcinoma
Journal Article 2015-10-13 ✓ 1 Snippet Chen SH, Peng CY, Lai HC, Chang IP, Lee CJ, Su WP, Lin CH, Kao JT, Chuang PH.
In-Text Gene Mentions

…disease, autoimmune hepatitis,hemochromatosis, extrahepatic cholestasis, my…

Show Full Abstract

<h4>Background</h4>The aim of this study was to compare the diagnostic performances of the collagen proportionate area (CPA) and liver stiffness measurement (LSM) for liver fibrosis quantification in chronic hepatitis C (CHC).<h4>Methods</h4>A total of 137 eligible consecutive Taiwanese patients (74 women and 63 men; age 21-80 years; median age 54 years), with CHC underwent LSM by using acoustic radiation force impulse (ARFI) elastography and an immediate percutaneous liver biopsy for METAVIR scoring. Liver tissue sections were stained using picrosirius red. Areas of the stained collagen and the tissue parenchyma were calculated in pixels. The ratio between the two areas was expressed as a CPA percentage. The result of LSM was presented as shear wave velocity (SWV).<h4>Results</h4>METAVIR fibrosis (F) stages were dichotomized using the CPA (%) and SWV (m/s), and the optimal cut-off values were 7.47 and 1.59 for F1 versus F2-4; 12.56 and 1.73 for F1, 2 versus F3, 4; 15.32 and 1.96 for F1-3 versus F4. To dichotomize F1 versus F2-4, the areas under receiver operating characteristic curves for the CPA was 0.9349 (95% confidence interval: 0.8943-0.9755) and for SWV was 0.8434 (0.7762-0.9105) (CPA versus SWV, P = 0.0063). For F1, 2 versus F3, 4, the CPA was 0.9436 (0.9091-0.9781); SWV was 0.8997 (0.8444-0.9551) (P = 0.1587). For F1-3 versus F4, the CPA was 0.8647 (0.7944-0.9349); SWV was 0.9036 (0.8499-0.9573) (P = 0.2585). The CPA could be predicted in a linear regression formula by using SWV and platelet count (R2 = 0.524).<h4>Conclusions</h4>The CPA and ARFI elastography are promising tools for liver fibrosis evaluation. The CPA was superior to ARFI elastography in the diagnosis of significant fibrosis (≥ F2). The CPA may be independent of severe necroinflammation, which may augment liver stiffness.

Also flagged:BMPBone morphogenetic proteinsBMPsatherosclerosispulmonary arterial hypertensionBMP receptors
Journal Article 2015-10-13 No Snippets Morrell NW, Bloch DB, ten Dijke P, Goumans MJ, Hata A, Smith J, Yu PB, Bloch KD.
Show Full Abstract

Bone morphogenetic proteins (BMPs) and their receptors, known to be essential regulators of embryonic patterning and organogenesis, are also critical for the regulation of cardiovascular structure and function. In addition to their contributions to syndromic disorders including heart and vascular development, BMP signalling is increasingly recognized for its influence on endocrine-like functions in postnatal cardiovascular and metabolic homeostasis. In this Review, we discuss several critical and novel aspects of BMP signalling in cardiovascular health and disease, which highlight the cell-specific and context-specific nature of BMP signalling. Based on advancing knowledge of the physiological roles and regulation of BMP signalling, we indicate opportunities for therapeutic intervention in a range of cardiovascular conditions including atherosclerosis and pulmonary arterial hypertension, as well as for anaemia of inflammation. Depending on the context and the repertoire of ligands and receptors involved in specific disease processes, the selective inhibition or enhancement of signalling via particular BMP ligands (such as in atherosclerosis and pulmonary arterial hypertension, respectively) might be beneficial. The development of selective small molecule antagonists of BMP receptors, and the identification of ligands selective for BMP receptor complexes expressed in the vasculature provide the most immediate opportunities for new therapies.

Also flagged:schizophreniapsychotic disorderschromosomeion channelsdopamineglutamate
Journal Article 2015-10-13 No Snippets Butler MG, McGuire AB, Masoud H, Manzardo AM.
Show Full Abstract

A large body of genetic data from schizophrenia-related research has identified an assortment of genes and disturbed pathways supporting involvement of complex genetic components for schizophrenia spectrum and other psychotic disorders. Advances in genetic technology and expanding studies with searchable genomic databases have led to multiple published reports, allowing us to compile a master list of known, clinically relevant, or susceptibility genes contributing to schizophrenia. We searched key words related to schizophrenia and genetics from peer-reviewed medical literature sources, authoritative public access psychiatric websites and genomic databases dedicated to gene discovery and characterization of schizophrenia. Our list of 560 genes were arranged in alphabetical order in tabular form with gene symbols placed on high-resolution human chromosome ideograms. Genome wide pathway analysis using GeneAnalytics was carried out on the resulting list of genes to assess the underlying genetic architecture for schizophrenia. Recognized genes of clinical relevance, susceptibility or causation impact a broad range of biological pathways and mechanisms including ion channels (e.g., CACNA1B, CACNA1C, CACNA1H), metabolism (e.g., CYP1A2, CYP2C19, CYP2D6), multiple targets of neurotransmitter pathways impacting dopamine, GABA, glutamate, and serotonin function, brain development (e.g., NRG1, RELN), signaling peptides (e.g., PIK3CA, PIK4CA) and immune function (e.g., HLA-DRB1, HLA-DQA1) and interleukins (e.g., IL1A, IL10, IL6). This summary will enable clinical and laboratory geneticists, genetic counselors, and other clinicians to access convenient pictorial images of the distribution and location of contributing genes to inform diagnosis and gene-based treatment as well as provide risk estimates for genetic counseling of families with affected relatives.

Also flagged:methylationgene expressioncolorectal cancertumorcancercancers
Journal Article 2015-10-13 No Snippets Moarii M, Reyal F, Vert JP.
Show Full Abstract

<h4>Background</h4>The CpG island methylator phenotype (CIMP) was first characterized in colorectal cancer but since has been extensively studied in several other tumor types such as breast, bladder, lung, and gastric. CIMP is of clinical importance as it has been reported to be associated with prognosis or response to treatment. However, the identification of a universal molecular basis to define CIMP across tumors has remained elusive.<h4>Results</h4>We perform a genome-wide methylation analysis of over 2000 tumor samples from 5 cancer sites to assess the existence of a CIMP with common molecular basis across cancers. We then show that the CIMP phenotype is associated with specific gene expression variations. However, we do not find a common genetic signature in all tissues associated with CIMP.<h4>Conclusion</h4>Our results suggest the existence of a universal epigenetic and transcriptomic signature that defines the CIMP across several tumor types but does not indicate the existence of a common genetic signature of CIMP.

Also flagged:DIAPH1microcephalyepilepsyvisionbronchiectasisrespiratory infections
Journal Article 2015-10-13 No Snippets Al-Maawali A, Barry BJ, Rajab A, El-Quessny M, Seman A, Coury SN, Barkovich AJ, Yang E, Walsh CA, Mochida GH, Stoler JM.
Show Full Abstract

Exome sequencing identified homozygous loss-of-function variants in DIAPH1 (c.2769delT; p.F923fs and c.3145C>T; p.R1049X) in four affected individuals from two unrelated consanguineous families. The affected individuals in our report were diagnosed with postnatal microcephaly, early-onset epilepsy, severe vision impairment, and pulmonary symptoms including bronchiectasis and recurrent respiratory infections. A heterozygous DIAPH1 mutation was originally reported in one family with autosomal dominant deafness. Recently, however, a homozygous nonsense DIAPH1 mutation (c.2332C4T; p.Q778X) was reported in five siblings in a single family affected by microcephaly, blindness, early onset seizures, developmental delay, and bronchiectasis. The role of DIAPH1 was supported using parametric linkage analysis, RNA and protein studies in their patients' cell lines and further studies in human neural progenitors cells and a diap1 knockout mouse. In this report, the proband was initially brought to medical attention for profound metopic synostosis. Additional concerns arose when his head circumference did not increase after surgical release at 5 months of age and he was diagnosed with microcephaly and epilepsy at 6 months of age. Clinical exome analysis identified a homozygous DIAPH1 mutation. Another homozygous DIAPH1 mutation was identified in the research exome analysis of a second family with three siblings presenting with a similar phenotype. Importantly, no hearing impairment is reported in the homozygous affected individuals or in the heterozygous carrier parents in any of the families demonstrating the autosomal recessive microcephaly phenotype. These additional families provide further evidence of the likely causal relationship between DIAPH1 mutations and a neurodevelopmental disorder.

Also flagged:Serotonin TransporterGene Expressionserotonin (5-hydroxytriptamine (5-HT)) transporterSLC6A45serotonin
Journal Article 2015-10-13 ✓ 2 Snippets Iurescia S, Seripa D, Rinaldi M.
In-Text Gene Mentions

…iptamine (5-HT)) transporter (5-HTT) gene-linked polymorphic regi…

…of the human5-HTT-encoding gene SLC6A4.…

Show Full Abstract

The serotonin (5-hydroxytriptamine (5-HT)) transporter (5-HTT) gene-linked polymorphic region (5-HTTLPR) is a variable number tandem repeats (VNTR) located in the promoter region of the human 5-HTT-encoding gene SLC6A4. This length polymorphism gives rise to different promoter variants, variously influencing SLC6A4 expression. Over the years, an extensive literature has investigated the relationships between these promoter variants and SLC6A4 gene expression, since these variants have been variously associated to complex neuropsychiatric conditions and traits. In this review, we detail the genetic architecture of the 5-HTTLPR allelic variants reported so far, with a closer look at the two single nucleotide polymorphisms (SNPs) rs25531 and rs25532 that lies in the VNTR and thus increase genetic variability of the SLC6A4 promoter. We summarize the hypothesized molecular mechanisms underlying this variation. We also provide an update on common and uncommon 5-HTTLPR allelic variants reviewing the available data on functional in vitro analysis of their regulatory effect on SLC6A4 gene transcription. Controversial findings are highlighted and critically discussed. A deeper knowledge of the "5-HTTLPR universe" will be useful to better understand the molecular basis of serotonin homeostasis and the pathological basis underlying serotonin-related neuropsychiatric conditions and traits.

Also flagged:psychiatric disorderscardiovascular diseasesanxietyPD5-hydroxytryptamine (5-HT) 1A receptorpanic disorder
Journal Article 2015-10-13 ✓ 5 Snippets Kokacya MH, Copoglu US, Kivrak Y, Ari M, Sahpolat M, Ulutas KT.
In-Text Gene Mentions

Although a relationship between increased platelet activity and anxiety, depression, and post-MI depression has been reported on earlier, the relationship between anxiety and platelet functions has not been precisely proven.29 In a recent study, it was reported that patients with anxiety disorder showed multiple changes in platelet parameters.30 These changes originated from a decrease of the serotonin transporter in [3H]imipramine-binding sites of platelets and an increase in 5-HT 2A receptor-binding sites on the surface of platelets.31 Abnormalities in 5-HT 1A receptor functions and alterations in 5-HTT levels and activity are described in platelets from patients affected by anxiety disorders.32,33 Moreover, several reports have pointed toward decreased platelet activity after treatment with SSRIs in patients with major depression.11,34 It has been suggested that some mechanisms that lead to platelet abnormalities in major depression are altered intraplatelet concentrations of monoamines and catecholamines, altered platelet function by increased plasma concentrations of 5-HT and epinephrine, and altered platelet function by increased intraplatelet calcium mobilization.35

These effects are modulated by selective serotonin reuptake inhibitors (SSRIs), which are commonly used in the treatment of PD.9,10 Furthermore, several studies have reported decreased platelet activity after treatment for depression, especially with SSRIs.11,12 Several serotonin transporter (5-HTT) abnormalities have been detected in panic disorder (PD), although results concerning the synaptic serotonin state are still inconsistent.13,14 It has been reported that a hyperserotonergic state resulting from impaired 5-HTT function can cause an anxiety or fear response by stimulating the amygdala.15 Conversely, serotonergic agents are known to relieve panic symptoms.16

Serotonin not only has a pivotal role in the pathophysiology of depression and PD, but also participates in hemostasis by affecting platelet aggregation.6 Serotonin 5-HT2A receptors and serotonin transporter receptors in platelets and the brain are encoded by the same gene.40 It has been reported that patients with anxiety disorder have increased platelet reactivation related to serotonin.40 Dysregulation of serotonin and increased adrenaline, which are crucial in the etiology of PD, induce platelet activation.30 In one study, platelet 5-HT uptake maximal velocity (Vmax) and its associated affinity constant (Km) were found to be lower in PD patients than in normal control subjects.41 In this study, Kang et al reported that patients with PD showed abnormalities in platelet 5-HTT function; furthermore, they found that after 12 weeks of paroxetine treatment, the Km values of platelet serotonin transporters increased in parallel to clinical improvement.

Peripheral platelet models are widely used as indicators of central serotonin (5-HT) metabolism, as they reflect central serotonergic function.1 Serotonin is an important factor in the pathophysiology of anxiety disorders and plays pivotal roles in the vascular system in the regulation of vascular tone and platelet aggregation.6 Platelets contain serotonin (5-HT) receptors such as 5-HT 2A, 5-HT 3, and a 5-HT transporter (5-HTT) in their membranes.7,8 Experimental studies have shown that 5-HT-potentiated procoagulant responses of platelets enhance thrombogenesis on damaged vascular surfaces.

…a 5-HT transporter (5-HTT) in their membranes.…

Show Full Abstract

<h4>Objective</h4>The relationship between platelet activation and psychiatric disorders has been shown in previous work. Mean platelet volume (MPV) is a measure of platelet size and a good indicator of platelet activity, which increases in cardiovascular diseases (CVDs). It is known that anxiety is a considerable factor in the etiology of mortality in CVDs. The aim of the present study was to investigate any probable difference in the MPV of patients with panic disorder (PD).<h4>Methods</h4>Sixty-one drug-free patients, aged 18-65 years and diagnosed with PD according to the Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition, were included in the study, along with 63 healthy age- and sex-matched volunteers. The body mass index (BMI) was calculated and MPV measured for each subject.<h4>Results</h4>The MPV was found to be higher in the PD group compared to the control group (P=0.004). There were no significant differences between the two groups in terms of platelet count or BMI.<h4>Conclusion</h4>Alterations in platelet activity may be a reflection of abnormal 5-hydroxytryptamine (5-HT) 1A receptor function in the central nervous system of subjects with a diagnosis of PD. These findings may elucidate the relationship between CVDs and PD. The findings of the present study suggest that MPV is increased in PD patients.

Also flagged:embryogenesistranscription factorofgene expressionRNA-binding proteinsmethylation
Journal Article 2015-10-13 No Snippets Hutchins AP, Pei D.
Show Full Abstract

Transposable elements (TEs) are mobile genomic sequences of DNA capable of autonomous and non-autonomous duplication. TEs have been highly successful, and nearly half of the human genome now consists of various families of TEs. Originally thought to be non-functional, these elements have been co-opted by animal genomes to perform a variety of physiological functions ranging from TE-derived proteins acting directly in normal biological functions, to innovations in transcription factor logic and influence on epigenetic control of gene expression. During embryonic development, when the genome is epigenetically reprogrammed and DNA-demethylated, TEs are released from repression and show embryonic stage-specific expression, and in human and mouse embryos, intact TE-derived endogenous viral particles can even be detected. A similar process occurs during the reprogramming of somatic cells to pluripotent cells: When the somatic DNA is demethylated, TEs are released from repression. In embryonic stem cells (ESCs), where DNA is hypomethylated, an elaborate system of epigenetic control is employed to suppress TEs, a system that often overlaps with normal epigenetic control of ESC gene expression. Finally, many long non-coding RNAs (lncRNAs) involved in normal ESC function and those assisting or impairing reprogramming contain multiple TEs in their RNA. These TEs may act as regulatory units to recruit RNA-binding proteins and epigenetic modifiers. This review covers how TEs are interlinked with the epigenetic machinery and lncRNAs, and how these links influence each other to modulate aspects of ESCs, embryogenesis, and somatic cell reprogramming.

Also flagged:P-glycoproteinneurodegenerative diseaseefflux transporterHDNF-κBextracellular
Journal Article 2015-10-13 ✓ 5 Snippets Kao YH, Chern Y, Yang HT, Chen HM, Lin CJ.
In-Text Gene Mentions

Treatment with the IKK inhibitor, BMS-345541, decreased P-glycoprotein mRNA level in cells transfected with mHTT-109Q or normal HTT-25Q In conclusion, mutant HTT altered the expression of P-glycoprotein through the NF-κB pathway in brain capillaries in HD and markedly affected the availability of P-glycoprotein substrates in the brain.

Huntington's disease (HD) is a neurodegenerative disease marked by an expanded polyglutamine (polyQ) tract on the huntingtin (HTT) protein that may cause transcriptional dysfunction.

The results showed that, compared with the littermate controls, R6/2 HD transgenic mice with the human mutant HTT gene had higher levels of P-glycoprotein mRNA and protein and enhanced NF-κB activity in their brain capillaries.

…on the huntingtin (HTT) protein that may…

…of human mutantHTTprotein with expanded…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disease marked by an expanded polyglutamine (polyQ) tract on the huntingtin (HTT) protein that may cause transcriptional dysfunction. This study aimed to investigate the regulation and function of P-glycoprotein, an important efflux transporter, in brain capillaries in HD. The results showed that, compared with the littermate controls, R6/2 HD transgenic mice with the human mutant HTT gene had higher levels of P-glycoprotein mRNA and protein and enhanced NF-κB activity in their brain capillaries. Higher P-glycoprotein expression was also observed in the brain capillaries of human HD patients. Consistent with this enhanced P-glycoprotein expression, brain extracellular levels and brain-to-plasma ratios of the antipsychotic agents risperidone and paliperidone were significantly lower in R6/2 mice than in their littermate controls. Exogenous expression of human mutant HTT protein with expanded polyQ (mHTT-109Q) in HEK293T cells enhanced the levels of P-glycoprotein transcripts and NF-κB activity compared with cells expressing normal HTT-25Q. Treatment with the IKK inhibitor, BMS-345541, decreased P-glycoprotein mRNA level in cells transfected with mHTT-109Q or normal HTT-25Q In conclusion, mutant HTT altered the expression of P-glycoprotein through the NF-κB pathway in brain capillaries in HD and markedly affected the availability of P-glycoprotein substrates in the brain.

Also flagged:Chromatingene expressionorganizationpost-translationalhistonenucleosomes
Journal Article 2015-10-12 No Snippets Rotem A, Ram O, Shoresh N, Sperling RA, Goren A, Weitz DA, Bernstein BE.
Show Full Abstract

Chromatin profiling provides a versatile means to investigate functional genomic elements and their regulation. However, current methods yield ensemble profiles that are insensitive to cell-to-cell variation. Here we combine microfluidics, DNA barcoding and sequencing to collect chromatin data at single-cell resolution. We demonstrate the utility of the technology by assaying thousands of individual cells and using the data to deconvolute a mixture of ES cells, fibroblasts and hematopoietic progenitors into high-quality chromatin state maps for each cell type. The data from each single cell are sparse, comprising on the order of 1,000 unique reads. However, by assaying thousands of ES cells, we identify a spectrum of subpopulations defined by differences in chromatin signatures of pluripotency and differentiation priming. We corroborate these findings by comparison to orthogonal single-cell gene expression data. Our method for single-cell analysis reveals aspects of epigenetic heterogeneity not captured by transcriptional analysis alone.

Also flagged:zinc finger proteinoligodendrocyte migrationmyelinationaxonszinc finger protein 16-likeznf16l
Journal Article 2015-10-12 No Snippets Sidik H, Talbot WS.
Show Full Abstract

Precise control of oligodendrocyte migration and development is crucial for myelination of axons in the central nervous system (CNS), but important questions remain unanswered about the mechanisms controlling these processes. In a zebrafish screen for myelination mutants, we identified a mutation in zinc finger protein 16-like (znf16l). znf16l mutant larvae have reduced myelin basic protein (mbp) expression and reduced CNS myelin. Marker, time-lapse and ultrastructural studies indicated that oligodendrocyte specification, migration and myelination are disrupted in znf16l mutants. Transgenic studies indicated that znf16l acts autonomously in oligodendrocytes. Expression of Zfp488 from mouse rescued mbp expression in znf16l mutants, indicating that these homologs have overlapping functions. Our results defined the function of a new zinc finger protein with specific function in oligodendrocyte specification, migration and myelination in the developing CNS.

Also flagged:Short bowel syndromeSBSpolyglycolicpoly L lactic acidnecrotizing enterocolitishyperglycemia
Journal Article 2015-10-12 ✓ 1 Snippet Finkbeiner SR, Freeman JJ, Wieck MM, El-Nachef W, Altheim CH, Tsai YH, Huang S, Dyal R, White ES, Grikscheit TC, Teitelbaum DH, Spence JR.
In-Text Gene Mentions

…cells marked byOLFM4( Fig. 5…

Show Full Abstract

Short bowel syndrome (SBS) is characterized by poor nutrient absorption due to a deficit of healthy intestine. Current treatment practices rely on providing supportive medical therapy with parenteral nutrition; while life saving, such interventions are not curative and are still associated with significant co-morbidities. As approaches to lengthen remaining intestinal tissue have been met with only limited success and intestinal transplants have poor survival outcomes, new approaches to treating SBS are necessary. Human intestine derived from embryonic stem cells (hESCs) or induced pluripotent stem cells (iPSCs), called human intestinal organoids (HIOs), have the potential to offer a personalized and scalable source of intestine for regenerative therapies. However, given that HIOs are small three-dimensional structures grown in vitro, methods to generate usable HIO-derived constructs are needed. We investigated the ability of hESCs or HIOs to populate acellular porcine intestinal matrices and artificial polyglycolic/poly L lactic acid (PGA/PLLA) scaffolds, and examined the ability of matrix/scaffolds to thrive when transplanted in vivo. Our results demonstrate that the acellular matrix alone is not sufficient to instruct hESC differentiation towards an endodermal or intestinal fate. We observed that while HIOs reseed acellular porcine matrices in vitro, the HIO-reseeded matrices do not thrive when transplanted in vivo. In contrast, HIO-seeded PGA/PLLA scaffolds thrive in vivo and develop into tissue that looks nearly identical to adult human intestinal tissue. Our results suggest that HIO-seeded PGA/PLLA scaffolds are a promising avenue for developing the mucosal component of tissue engineered human small intestine, which need to be explored further to develop them into fully functional tissue.

Also flagged:LithiumBipolar I Disorderbipolar disorderthyrotropinManiaschizophrenia
Journal Article 2015-10-12 No Snippets Findling RL, Robb A, McNamara NK, Pavuluri MN, Kafantaris V, Scheffer R, Frazier JA, Rynn M, DelBello M, Kowatch RA, Rowles BM, Lingler J, Martz K, Anand R, Clemons TE, Taylor-Zapata P.
Show Full Abstract

<h4>Background</h4>Lithium is a benchmark treatment for bipolar disorder in adults. Definitive studies of lithium in pediatric bipolar I disorder (BP-I) are lacking.<h4>Methods</h4>This multicenter, randomized, double-blind, placebo-controlled study of pediatric participants (ages 7-17 years) with BP-I/manic or mixed episodes compared lithium (n = 53) versus placebo (n = 28) for up to 8 weeks. The a priori primary efficacy measure was change from baseline to the end of study (week 8/ET) in the Young Mania Rating Scale (YMRS) score, based on last-observation-carried-forward analysis.<h4>Results</h4>The change in YMRS score was significantly larger in lithium-treated participants (5.51 [95% confidence interval: 0.51 to 10.50]) after adjustment for baseline YMRS score, age group, weight group, gender, and study site (P = .03). Overall Clinical Global Impression-Improvement scores favored lithium (n = 25; 47% very much/much improved) compared with placebo (n = 6; 21% very much/much improved) at week 8/ET (P = .03). A statistically significant increase in thyrotropin concentration was seen with lithium (3.0 ± 3.1 mIU/L) compared with placebo (-0.1 ± 0.9 mIU/L; P < .001). There was no statistically significant between-group difference with respect to weight gain.<h4>Conclusions</h4>Lithium was superior to placebo in reducing manic symptoms in pediatric patients treated for BP-I in this clinical trial. Lithium was generally well tolerated in this patient population and was not associated with weight gain, distinguishing it from other agents commonly used to treat youth with bipolar disorder.

Also flagged:Autism-Associated ChromatinBrg1SynapseMyocyte Enhancer Factor 2synapse-relatedneurological diseases
Journal Article 2015-10-12 ✓ 1 Snippet Zhang Z, Cao M, Chang CW, Wang C, Shi X, Zhan X, Birnbaum SG, Bezprozvanny I, Huber KM, Wu JI.
In-Text Gene Mentions

PCDH17

Show Full Abstract

Synapse development requires normal neuronal activities and the precise expression of synapse-related genes. Dysregulation of synaptic genes results in neurological diseases such as autism spectrum disorders (ASD). Mutations in genes encoding chromatin-remodeling factor Brg1/SmarcA4 and its associated proteins are the genetic causes of several developmental diseases with neurological defects and autistic symptoms. Recent large-scale genomic studies predicted Brg1/SmarcA4 as one of the key nodes of the ASD gene network. We report that Brg1 deletion in early postnatal hippocampal neurons led to reduced dendritic spine density and maturation and impaired synapse activities. In developing mice, neuronal Brg1 deletion caused severe neurological defects. Gene expression analyses indicated that Brg1 regulates a significant number of genes known to be involved in synapse function and implicated in ASD. We found that Brg1 is required for dendritic spine/synapse elimination mediated by the ASD-associated transcription factor myocyte enhancer factor 2 (MEF2) and that Brg1 regulates the activity-induced expression of a specific subset of genes that overlap significantly with the targets of MEF2. Our analyses showed that Brg1 interacts with MEF2 and that MEF2 is required for Brg1 recruitment to target genes in response to neuron activation. Thus, Brg1 plays important roles in both synapse development/maturation and MEF2-mediated synapse remodeling. Our study reveals specific functions of the epigenetic regulator Brg1 in synapse development and provides insights into its role in neurological diseases such as ASD.

Also flagged:Spinal cord injuryaxonalneurotrophin-3NT3chitosannerve
Journal Article 2015-10-12 ✓ 1 Snippet Duan H, Ge W, Zhang A, Xi Y, Chen Z, Luo D, Cheng Y, Fan KS, Horvath S, Sofroniew MV, Cheng L, Yang Z, Sun YE, Li X.
In-Text Gene Mentions

Tnfsf4

Show Full Abstract

Spinal cord injury (SCI) is considered incurable because axonal regeneration in the central nervous system (CNS) is extremely challenging, due to harsh CNS injury environment and weak intrinsic regeneration capability of CNS neurons. We discovered that neurotrophin-3 (NT3)-loaded chitosan provided an excellent microenvironment to facilitate nerve growth, new neurogenesis, and functional recovery of completely transected spinal cord in rats. To acquire mechanistic insight, we conducted a series of comprehensive transcriptome analyses of spinal cord segments at the lesion site, as well as regions immediately rostral and caudal to the lesion, over a period of 90 days after SCI. Using weighted gene coexpression network analysis (WGCNA), we established gene modules/programs corresponding to various pathological events at different times after SCI. These objective measures of gene module expression also revealed that enhanced new neurogenesis and angiogenesis, and reduced inflammatory responses were keys to conferring the effect of NT3-chitosan on regeneration.

Also flagged:EGFPI3KcancerPTENtranscription factorbinding
Journal Article 2015-10-12 No Snippets Kiselev VY, Juvin V, Malek M, Luscombe N, Hawkins P, Le Novère N, Stephens L.
Show Full Abstract

PIP3 is synthesized by the Class I PI3Ks and regulates complex cell responses, such as growth and migration. Signals that drive long-term reshaping of cell phenotypes are difficult to resolve because of complex feedback networks that operate over extended times. PIP3-dependent modulation of mRNA accumulation is clearly important in this process but is poorly understood. We have quantified the genome-wide mRNA-landscape of non-transformed, breast epithelium-derived MCF10a cells and its response to acute regulation by EGF, in the presence or absence of a PI3Kα inhibitor, compare it to chronic activation of PI3K signalling by cancer-relevant mutations (isogenic cells expressing an oncomutant PI3Kα allele or lacking the PIP3-phosphatase/tumour-suppressor, PTEN). Our results show that whilst many mRNAs are changed by long-term genetic perturbation of PIP3 signalling ('butterfly effect'), a much smaller number do so in a coherent fashion with the different PIP3 perturbations. This suggests a subset of more directly regulated mRNAs. We show that mRNAs respond differently to given aspects of PIP3 regulation. Some PIP3-sensitive mRNAs encode PI3K pathway components, thus suggesting a transcriptional feedback loop. We identify the transcription factor binding motifs SRF and PRDM1 as important regulators of PIP3-sensitive mRNAs involved in cell movement.

Also flagged:Mitochondrial division inhibitor 1mitochondrialgene expressionmitochondriaHDHuntington's disease
Journal Article 2015-10-12 ✓ 5 Snippets Manczak M, Reddy PH.
In-Text Gene Mentions

Taken together, these findings suggest that Mdivi1 is protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons and that Mdivi1 may be a promising molecule for the treatment of HD patients.

…stably express mutantHtt(STHDhQ111/Q111) and wild-type…

…and wild-type (WT)Htt(STHDhQ7/Q7).…

…changes in mutantHttneurons relative to…

…relative to WTHttneurons.…

Show Full Abstract

The objective of this study was to determine the protective effects of the mitochondrial division inhibitor 1 (Mdivi1) in striatal neurons that stably express mutant Htt (STHDhQ111/Q111) and wild-type (WT) Htt (STHDhQ7/Q7). Using gene expression analysis, biochemical methods, transmission electron microscopy (TEM) and confocal microscopy methods, we studied (i) mitochondrial and synaptic activities by measuring mRNA and the protein levels of mitochondrial and synaptic genes, (ii) mitochondrial function and (iii) ultra-structural changes in mutant Htt neurons relative to WT Htt neurons. We also studied these parameters in Mdivil-treated and untreated WT and mutant Htt neurons. Increased expressions of mitochondrial fission genes, decreased expression of fusion genes and synaptic genes were found in the mutant Htt neurons relative to the WT Htt neurons. Electron microscopy of the mutant Htt neurons revealed a significantly increased number of mitochondria, indicating that mutant Htt fragments mitochondria. Biochemical analysis revealed defective mitochondrial functioning. In the Mdivil-treated mutant Htt neurons, fission genes were down-regulated, and fusion genes were up-regulated, suggesting that Mdivil decreases fission activity. Synaptic genes were up-regulated, and mitochondrial function was normal in the Mdivi1-treated mutant Htt neurons. Immunoblotting findings of mitochondrial and synaptic proteins agreed with mRNA findings. The TEM studies revealed that increased numbers of structurally intact mitochondria were present in Mdivi1-treated mutant Htt neurons. Increased synaptic and mitochondrial fusion genes and decreased fission genes were found in the Mdivi1-treated WT Htt neurons, indicating that Mdivi1 beneficially affects healthy neurons. Taken together, these findings suggest that Mdivi1 is protective against mutant Htt-induced mitochondrial and synaptic damage in HD neurons and that Mdivi1 may be a promising molecule for the treatment of HD patients.

Also flagged:PeptideChlorinNeuropilin-1cancerdioxygenoxygen
Journal Article 2015-10-12 No Snippets Kamarulzaman EE, Gazzali AM, Acherar S, Frochot C, Barberi-Heyob M, Boura C, Chaimbault P, Sibille E, Wahab HA, Vanderesse R.
Show Full Abstract

Photodynamic therapy (PDT) is a cancer treatment modality that requires three components, namely light, dioxygen and a photosensitizing agent. After light excitation, the photosensitizer (PS) in its excited state transfers its energy to oxygen, which leads to photooxidation reactions. In order to improve the selectivity of the treatment, research has focused on the design of PS covalently attached to a tumor-targeting moiety. In this paper, we describe the synthesis and the physico-chemical and photophysical properties of six new peptide-conjugated photosensitizers designed for targeting the neuropilin-1 (NRP-1) receptor. We chose a TPC (5-(4-carboxyphenyl)-10,15, 20-triphenyl chlorine as photosensitizer, coupled via three different spacers (aminohexanoic acid, 1-amino-3,6-dioxaoctanoic acid, and 1-amino-9-aza-3,6,12,15-tetraoxa-10-on-heptadecanoic acid) to two different peptides (DKPPR and TKPRR). The affinity towards the NRP-1 receptor of the conjugated chlorins was evaluated along with in vitro and in vivo stability levels. The tissue concentration of the TPC-conjugates in animal model shows good distribution, especially for the DKPPR conjugates. The novel peptide-PS conjugates proposed in this study were proven to have potential to be further developed as future NRP-1 targeting photodynamic therapy agent.

Also flagged:CMTneuropathyNeuropathiesNeuromuscular DiseaseDCTN2dynein
Journal Article 2015-10-12 ✓ 5 Snippets Braathen GJ, Høyer H, Busk ØL, Tveten K, Skjelbred CF, Russell MB.
In-Text Gene Mentions

This is the first time a haplotype on chromosome 12 containing sequence variants in the genes DCTN2, DNAH10, LRIG3, and MYO1A has been linked to an inherited neuropathy in humans.

Variants in the genes DCTN2, DNAH10, LRIG3, and MYO1A are associated with intermediate Charcot-Marie-Tooth disease in a Norwegian family.

This is the first time a haplotype on chromosome 12 containing sequence variants in the genes DCTN2, DNAH10, LRIG3, and MYO1A has been linked to an inherited

This is the first time a haplotype on chromosome 12 containing sequence variants in the genes DCTN2,DNAH10,LRIG3, and MYO1A has been linked to an inherited neuropathy in humans.

…C>T (p.His113Tyr), NM_207437.3DNAH10:c.9510C>G (p.Ile3170Met), NM_…

Show Full Abstract

<h4>Introduction</h4>Charcot-Marie-Tooth disease (CMT) is a heterogeneous inherited neuropathy. The number of known CMT genes is rapidly increasing mainly due to next-generation sequencing technology, at present more than 70 CMT-associated genes are known. We investigated whether variants in the DCTN2 could cause CMT.<h4>Material and methods</h4>Fifty-nine Norwegian CMT families from the general population with unknown genotype were tested by targeted next-generation sequencing (NGS) for variants in DCTN2 along with 32 CMT genes and 19 other genes causing other inherited neuropathies or neuronopathies, due to phenotypic overlap. In the family with the DCTN2 variant, exome sequencing was then carried out on all available eight family members to rule out the presence of more potential variants.<h4>Results</h4>Targeted NGS identified in one family a variant of DCTN2, c.337C>T, segregating with the phenotype in five affected members, while it was not present in the three unaffected members. The DCTN2 variant c.337C>T; p.(His113Tyr) was neither found in in-house controls nor in SNP databases. Exome sequencing revealed a singular heterozygous shared haplotype containing four genes, DCTN2, DNAH10, LRIG3, and MYO1A, with novel sequence variants. The haplotype was shared by all the affected members, while the unaffected members did not have it.<h4>Conclusions</h4>This is the first time a haplotype on chromosome 12 containing sequence variants in the genes DCTN2, DNAH10, LRIG3, and MYO1A has been linked to an inherited neuropathy in humans.

Also flagged:alien hand syndromestrokestoAnterior Cerebral Artery Strokegaitapraxia
Journal Article 2015-10-12 ✓ 2 Snippets Brugger F, Galovic M, Weder BJ, Kägi G.
In-Text Gene Mentions

Mirror movements are usually seen in early childhood due to mutations in the DCC and RAD51 genes (41), although they may sometimes also occur in patients with basal ganglia disorders and strokes, mainly of the corona radiata.

…mutations in theDCCand RAD51 genes…

Show Full Abstract

<h4>Background</h4>Both the supplementary motor complex (SMC), consisting of the supplementary motor area (SMA) proper, the pre-SMA, and the supplementary eye field, and the rostral cingulate cortex are supplied by the anterior cerebral artery (ACA) and are involved in higher motor control. The Bereitschaftspotential (BP) originates from the SMC and reflects cognitive preparation processes before volitional movements. ACA strokes may lead to impaired motor control in the absence of limb weakness and evoke an alien hand syndrome (AHS) in its extreme form.<h4>Aim</h4>To characterize the clinical spectrum of disturbed motor control after ACA strokes, including signs attributable to AHS and to identify the underlying neuroanatomical correlates.<h4>Methods</h4>A clinical assessment focusing on signs of disturbed motor control including intermanual conflict (i.e., bilateral hand movements directed at opposite purposes), lack of self-initiated movements, exaggerated grasping, motor perseverations, mirror movements, and gait apraxia was performed. Symptoms were grouped into (A) AHS-specific and (B) non-AHS-specific signs of upper limbs, and (C) gait apraxia. Lesion summation mapping was applied to the patients' MRI or CT scans to reveal associated lesion patterns. The BP was recorded in two patients.<h4>Results</h4>Ten patients with ACA strokes (nine unilateral, one bilateral; mean age: 74.2 years; median NIH-SS at admission: 13.0) were included in this case series. In the acute stage, all cases had marked difficulties to perform volitional hand movements, while movements in response to external stimuli were preserved. In the chronic stage (median follow-up: 83.5 days) initiation of voluntary movements improved, although all patients showed persistent signs of disturbed motor control. Impaired motor control is predominantly associated with damaged voxels within the SMC and the anterior and medial cingulate cortex, while lesions within the pre-SMA are specifically related to AHS. No BP was detected over the damaged hemisphere.<h4>Conclusion</h4>ACA strokes involving the premotor cortices, particularly the pre-SMA, are associated with AHS-specific signs. In the acute phase, motor behavior is characterized by the inability to carry out self-initiated movements. Motor control deficits may persist to a variable degree beyond the acute phase. Alterations of the BP point to an underlying SMC dysfunction in AHS.

Also flagged:Matrix Metalloproteinasesneurodegenerative diseasesMMPszinc-containing endopeptidasesMMPAlzheimer's disease
Journal Article 2015-10-11 ✓ 1 Snippet Brkic M, Balusu S, Libert C, Vandenbroucke RE.
In-Text Gene Mentions

Htt:…

Show Full Abstract

Neurodegeneration is a chronic progressive loss of neuronal cells leading to deterioration of central nervous system (CNS) functionality. It has been shown that neuroinflammation precedes neurodegeneration in various neurodegenerative diseases. Matrix metalloproteinases (MMPs), a protein family of zinc-containing endopeptidases, are essential in (neuro)inflammation and might be involved in neurodegeneration. Although MMPs are indispensable for physiological development and functioning of the organism, they are often referred to as double-edged swords due to their ability to also inflict substantial damage in various pathological conditions. MMP activity is strictly controlled, and its dysregulation leads to a variety of pathologies. Investigation of their potential use as therapeutic targets requires a better understanding of their contributions to the development of neurodegenerative diseases. Here, we review MMPs and their roles in neurodegenerative diseases: Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and multiple sclerosis (MS). We also discuss MMP inhibition as a possible therapeutic strategy to treat neurodegenerative diseases.

Also flagged:G72schizophreniapolypeptideamino acidsD-amino acid oxidaseDAOA
Journal Article 2015-10-11 No Snippets Wang M, Chen HJ, Zhang J, Li W, Xie X, Chang HT.
Show Full Abstract

G72 is a schizophrenia-susceptible gene encoding a polypeptide with 153 amino acids. In 2002, it was originally proposed as an activator of D-amino acid oxidase (DAOA) that could enhance the activity of DAAO and subsequently reduce the neurotransmission of N-methyl-D-aspartate receptors. However, several controversial findings have been reported recently. Due to a number of inconsistent descriptions of pLG72's biofunctions, this study aims to identify the cellular effects induced by pLG72 in U87 cells using systems biology approaches. The analyses of transcriptomics and biological networks showed that pLG72 might be involved in the induction of oxidative stress. To confirm the in silico prediction, we tested and discovered that overexpression of pLG72 effectively enhanced reactive oxygen species (ROS) in U87 cells and, furthermore, this induction can be quenched by Tempol, a general ROS scavenger. Therefore, G72-transgenic mice presenting some psychiatric symptoms, along with the pLG72 level being significantly increased in the serum of patients with schizophrenia, have led us to propose that the ROS enhancement in mental diseases may be from the overexpression of pLG72 in brain cells.

Also flagged:polycystic liver diseasesPC2cystgene expressiondegradationautophagy
Journal Article 2015-10-10 ✓ 1 Snippet Spirli C, Villani A, Mariotti V, Fabris L, Fiorotto R, Strazzabosco M.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Unlabelled</h4>Polycystin-2 (PC2 or TRPPC2), a member of the transient receptor potential channel family, is a nonselective calcium channel. Mutations in PC2 are associated with polycystic liver diseases. PC2-defective cholangiocytes show increased production of cyclic adenosine monophosphate, protein kinase A-dependent activation of the extracellular signal-regulated kinase 1/2 (ERK1/2) pathway, hypoxia-inducible factor 1α (HIF-1α)-mediated vascular endothelial growth factor (VEGF) production, and stimulation of cyst growth and progression. Activation of the ERK/HIF-1α/VEGF pathway in cholangiocytes plays a key role during repair from biliary damage. We hypothesized that PC2 levels are modulated during biliary damage/repair, resulting in activation of the ERK/HIF-1α/VEGF pathway. PC2 protein expression, but not its gene expression, was significantly reduced in mouse livers with biliary damage (Mdr2(-/-) knockout, bile duct ligation, 3,5-diethoxycarbonyl-1,4-dihydrocollidine treatment). Treatment of cholangiocytes with proinflammatory cytokines, nitric oxide donors, and endoplasmic reticulum stressors increased ERK1/2 phosphorylation, HIF-1α transcriptional activity, secretion of VEGF, and VEGF receptor type 2 phosphorylation and down-regulated PC2 protein expression without affecting PC2 gene expression. Expression of homocysteine-responsive endoplasmic reticulum-resident ubiquitin-like domain member 1 protein and NEK, ubiquitin-like proteins that promote proteosomal PC2 degradation, was increased. Pretreatment with the proteasome inhibitor MG-132 restored the expression of PC2 in cells treated with cytokines but not in cells treated with nitric oxide donors or with endoplasmic reticulum stressors. In these conditions, PC2 degradation was instead inhibited by interfering with the autophagy pathway. Treatment of 3,5-diethoxycarbonyl-1,4-dihydrocollidine mice and of Mdr2(-/-) mice with the proteasome inhibitor bortezomib restored PC2 expression and significantly reduced the ductular reaction, fibrosis, and phosphorylated ERK1/2.<h4>Conclusion</h4>In response to biliary damage, PC2 expression is modulated posttranslationally by the proteasome or the autophagy pathway, and PC2 down-regulation is associated with activation of ERK1/2 and an increase of HIF-1α-mediated VEGF secretion; treatments able to restore PC2 expression and to reduce ductular reaction and fibrosis may represent a new therapeutic approach in biliary diseases.

Also flagged:Colorectal cancertumorcancercolon cancertumors5-Fluoruracil
Journal Article 2015-10-10 ✓ 1 Snippet Paschall AV, Liu K.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Colorectal cancer stem cells (CSCs) were initially considered to be a subset of undifferentiated tumor cells with well-defined phenotypic and molecular markers. However, emerging evidence indicates instead that colorectal CSCs are heterogeneous subsets of tumor cells that are continuously reshaped by the dynamic interactions between genetic, epigenetic, and immune factors in the tumor microenvironment. Thus, the colorectal CSC phenotypes and responsiveness to therapy may not only be a tumor cell-intrinsic feature, but also depend on tumor-extrinsic microenvironmental factors. Furthermore, emerging evidence also implicates colorectal CSCs in potential immune evasion. Therefore, understanding how colorectal CSC-intrinsic mechanisms cooperate with the extrinsic microenvironmental factors to dynamically shape colorectal CSC resistance to chemotherapy and immunotherapy holds great promise for development of targeted CSC therapies of advanced human CRC.

Also flagged:Infectionbrain disordersneuropsychiatric disorderschildhood-onset schizophreniaParasite infectioncysts
Journal Article 2015-10-09 ✓ 1 Snippet Passeri E, Jones-Brando L, Bordón C, Sengupta S, Wilson AM, Primerano A, Rapoport JL, Ishizuka K, Kano S, Yolken RH, Sawa A.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Toxoplasma gondii is a protozoan parasite capable of establishing persistent infection within the brain. Serological studies in humans have linked exposure to Toxoplasma to neuropsychiatric disorders. However, serological studies have not elucidated the related molecular mechanisms within neuronal cells. To address this question, we used human induced neuronal cells derived from peripheral fibroblasts of healthy individuals and patients with genetically-defined brain disorders (i.e. childhood-onset schizophrenia with disease-associated copy number variations). Parasite infection was characterized by differential detection of tachyzoites and tissue cysts in induced neuronal cells. This approach may aid study of molecular mechanisms underlying individual predisposition to Toxoplasma infection linked to neuropathology of brain disorders.

Also flagged:Metabolisminborn errors of metabolismbone dysplasiasphenylketonuriamitochondrial disorderslysosomal storage disorders
Journal Article 2015-10-09 ✓ 1 Snippet Sirrs S, Hollak C, Merkel M, Sechi A, Glamuzina E, Janssen MC, Lachmann R, Langendonk J, Scarpelli M, Ben Omran T, Mochel F, SFEIM-A Study Group, Tchan MC.
In-Text Gene Mentions

…(e.g. bone dysplasias,hemochromatosis) or for age…

Show Full Abstract

<h4>Background</h4>There are few centres which specialise in the care of adults with inborn errors of metabolism (IEM). To anticipate facilities and staffing needed at these centres, it is of interest to know the distribution of the different disorders.<h4>Methods</h4>A survey was distributed through the list-serve of the SSIEM Adult Metabolic Physicians group asking clinicians for number of patients with confirmed diagnoses, types of diagnoses and age at diagnosis.<h4>Results</h4>Twenty-four adult centres responded to our survey with information on 6,692 patients. Of those 6,692 patients, 510 were excluded for diagnoses not within the IEM spectrum (e.g. bone dysplasias, hemochromatosis) or for age less than 16 years, leaving 6,182 patients for final analysis. The most common diseases followed by the adult centres were phenylketonuria (20.6%), mitochondrial disorders (14%) and lysosomal storage disorders (Fabry disease (8.8%), Gaucher disease (4.2%)). Amongst the disorders that can present with acute metabolic decompensation, the urea cycle disorders, specifically ornithine transcarbamylase deficiency, were most common (2.2%), followed by glycogen storage disease type I (1.5%) and maple syrup urine disease (1.1%). Patients were frequently diagnosed as adults, particularly those with mitochondrial disease and lysosomal storage disorders.<h4>Conclusions</h4>A wide spectrum of IEM are followed at adult centres. Specific knowledge of these disorders is needed to provide optimal care including up-to-date knowledge of treatments and ability to manage acute decompensation.

Also flagged:polyglutamineinclusion bodiesFKBP12isomeraseHDpeptides
Journal Article 2015-10-09 ✓ 5 Snippets Sun CS, Lee CC, Li YN, Yao-Chen Yang S, Lin CH, Chang YC, Liu PF, He RY, Wang CH, Chen W, Chern Y, Jen-Tse Huang J.
In-Text Gene Mentions

To investigate the biological impact of FKBP12 in polyQ-expanded HTT-expressing cells, we proceeded to subject cells co-expressing FKBP12 and Htt(Q)25-eYFP or Htt(Q)109-eYFP to retinoic acid (RA)-induced neurite outgrowth assays.

The filamentous deposits of Htt(Q)109-eYFP inclusions isolated by cell sorter (Fig. 2e) resemble the in vivo ultrastructure of fibrillar aggregates found in the tissue section of HD-post mortem brains and HD mouse models30.

Moreover, the suppressed ThT intensity can still be observed when either FK506 or Rapamycin, the PPIase inhibitor, was added into the GST-Htt(Q)43 protein co-incubated with FKBP12 (referred as GST-Htt(Q)43/FKBP12/FK506 or GST-Htt(Q)43/FKBP12/Rapamycin) (Supplementary Fig. 8a).

…utathione S-transferase (GST)-Htt(Q) 25 and GST-Htt(Q)…

…(GST)-Htt(Q) 25 and GST-Htt(Q) 43 were prepared…

Show Full Abstract

The abundant accumulation of inclusion bodies containing polyglutamine-expanded mutant huntingtin (mHTT) aggregates is considered as the key pathological event in Huntington's disease (HD). Here, we demonstrate that FKBP12, an isomerase that exhibits reduced expression in HD, decreases the amyloidogenicity of mHTT, interrupts its oligomerization process, and structurally promotes the formation of amorphous deposits. By combining fluorescence-activated cell sorting with multiple biophysical techniques, we confirm that FKBP12 reduces the amyloid property of these ultrastructural-distinct mHTT aggregates within cells. Moreover, the neuroprotective effect of FKBP12 is demonstrated in both cellular and nematode models. Finally, we show that FKBP12 also inhibit the fibrillization process of other disease-related and aggregation-prone peptides. Our results suggest a novel function of FKBP12 in ameliorating the proteotoxicity in mHTT, which may shed light on unraveling the roles of FKBP12 in different neurodegenerative diseases and developing possible therapeutic strategies.

Also flagged:Netrin-1osteoclast differentiationUnc5bantibodiesalkaline phosphatasepolyethylene
Journal Article 2015-10-09 ✓ 5 Snippets Mediero A, Ramkhelawon B, Wilder T, Purdue PE, Goldring SR, Dewan MZ, Loomis C, Moore KJ, Cronstein BN.
In-Text Gene Mentions

colon cancer (DCC

…receptors, Unc5b andDCCinjected IP on…

…spectively, p<0.001) but anti-DCC-antibody did not affect…

…anti-Unc5b, but not anti-DCC, antibody-treatment markedly …

DCC

Show Full Abstract

<h4>Objective</h4>Netrin-1 is a chemorepulsant and matrix protein expressed during and required for osteoclast differentiation, which also plays a role in inflammation by preventing macrophage egress. Because wear particle-induced osteolysis requires osteoclast-mediated destruction of bone, we hypothesised that blockade of Netrin-1 or Unc5b, a receptor for Netrin-1, may diminish this pathological condition.<h4>Methods</h4>C57BL/6 mice, 6-8 weeks old, had 3 mg of ultrahigh-molecular-weight polyethylene particles implanted over the calvaria and then received 10 µg of monoclonal antibodies for Netrin-1 or its receptors, Unc5b and deleted in colon cancer (DCC), injected intraperitoneally on a weekly basis. After 2 weeks, micro-computed tomography and histology analysis were performed. Netrin-1 expression was analysed in human tissue obtained following primary prosthesis implantation or after prosthesis revision for peri-implant osteolysis and aseptic implant loosening.<h4>Results</h4>Weekly injection of anti-Netrin-1 or anti-Unc5b-antibodies significantly reduced particle-induced bone pitting in calvaria exposed to wear particles (46±4% and 49±3% of control bone pitting, respectively, p<0.001) but anti-DCC antibody did not affect inflammatory osteolysis (80±7% of control bone pitting, p=ns). Anti-Netrin-1 or anti-Unc5b, but not anti-DCC, antibody treatment markedly reduced the inflammatory infiltrate and the number of tartrate resistance acid phosphatase (TRAP)-positive osteoclasts (7±1, 4±1 and 14±1 cells/high power field (hpf), respectively, vs 12±1 cells/hpf for control, p<0.001), with no significant changes in alkaline phosphatase-positive osteoblasts on bone-forming surfaces in any antibody-treated group. Netrin-1 immunostaining colocalised with CD68 staining for macrophages. The peri-implant tissues of patients undergoing prosthesis revision surgery showed an increase in Netrin-1 expression, whereas there was little Netrin-1 expression in soft tissues removed at the time of primary joint replacement.<h4>Conclusions</h4>These results demonstrate a unique role for Netrin-1 in osteoclast biology and inflammation and may be a novel target for prevention/treatment of inflammatory osteolysis.

Also flagged:TRAF5Retinoid-related orphan nuclear receptor γttranscription factortumor necrosis factor receptor-associated factor 5E3 ubiquitin protein ligaseIL-17A
Journal Article 2015-10-09 ✓ 1 Snippet Wang X, Yang J, Han L, Zhao K, Wu Q, Bao L, Li Z, Lv L, Li B.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Retinoid-related orphan nuclear receptor γt (RORγt) is a key transcription factor for the development and function of Th17 cells. In this study, we show that tumor necrosis factor receptor-associated factor 5 (TRAF5), known as an E3 ubiquitin protein ligase and signal transducer, interacts with and ubiquitinates RORγt via Lys-63-linked polyubiquitination. TRAF5 stabilizes the RORγt protein level depending on its RING finger domain. Depletion of TRAF5 in Th17 cells destabilizes RORγt protein and down-regulates Th17-related genes, including IL-17A, an inflammatory cytokine involved in pathogenic mechanisms of several autoimmune diseases such as systemic lupus erythematosus. Moreover, up-regulation of the TRAF5 mRNA level was found in systemic lupus erythematosus patient CD4(+) T cells. Our findings reveal a direct link between TRAF5-mediated ubiquitination and RORγt protein regulation, which may aggravate inflammatory progress and provide new therapeutic drug targets for autoimmune diseases.

Also flagged:methylationOAhip OAorgan morphogenesisosteoarthritisosteoarthrits
Journal Article 2015-10-09 No Snippets Aref-Eshghi E, Zhang Y, Liu M, Harper PE, Martin G, Furey A, Green R, Sun G, Rahman P, Zhai G.
Show Full Abstract

<h4>Background</h4>Evidence suggests that epigenetics plays a role in osteoarthrits (OA). The aim of the study was to describe the genome wide DNA methylation changes in hip and knee OA and identify novel genes and pathways involved in OA by comparing the DNA methylome of the hip and knee osteoarthritic cartilage tissues with those of OA-free individuals.<h4>Methods</h4>Cartilage samples were collected from hip or knee joint replacement patients either due to primary OA or hip fractures as controls. DNA was extracted from the collected cartilage and assayed by Illumina Infinium HumanMethylation450 BeadChip array, which allows for the analysis of >480,000 CpG sites. Student T-test was conducted for each CpG site and those sites with at least 10 % methylation difference and a p value <0.0005 were defined as differentially methylated regions (DMRs) for OA. A sub-analysis was also done for hip and knee OA separately. DAVID v6.7 was used for the functional annotation clustering of the DMR genes. Clustering analysis was done using multiple dimensional scaling and hierarchical clustering methods.<h4>Results</h4>The study included 5 patients with hip OA, 6 patients with knee OA and 7 hip cartilage samples from OA-free individuals. The comparisons of hip, knee and combined hip/knee OA patients with controls resulted in 26, 72, and 103 DMRs, respectively. The comparison between hip and knee OA revealed 67 DMRs. The overall number of the sites after considering the overlaps was 239, among which 151 sites were annotated to 145 genes. One-fifth of these genes were reported in previous studies. The functional annotation clustering of the identified genes revealed clusters significantly enriched in skeletal system morphogenesis and development. The analysis revealed significant difference among OA and OA-free cartilage, but less different between hip OA and knee OA.<h4>Conclusions</h4>We found that a number of CpG sites and genes across the genome were differentially methylated in OA patients, a remarkable portion of which seem to be involved in potential etiologic mechanisms of OA. Genes involved in skeletal developmental pathways and embryonic organ morphogenesis may be a potential area for further OA studies.

Also flagged:glutathionecysteinecataractsdisulfidedisulfidesβ-crystallins
Journal Article 2015-10-09 ✓ 1 Snippet Fan X, Zhou S, Wang B, Hom G, Guo M, Li B, Yang J, Vaysburg D, Monnier VM.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Low glutathione levels are associated with crystallin oxidation in age-related nuclear cataract. To understand the role of cysteine residue oxidation, we used the novel approach of comparing human cataracts with glutathione-depleted LEGSKO mouse lenses for intra- versus intermolecular disulfide crosslinks using 2D-PAGE and proteomics, and then systematically identified in vivo and in vitro all disulfide forming sites using ICAT labeling method coupled with proteomics. Crystallins rich in intramolecular disulfides were abundant at young age in human and WT mouse lens but shifted to multimeric intermolecular disulfides at older age. The shift was ∼4x accelerated in LEGSKO lens. Most cysteine disulfides in β-crystallins (except βA4 in human) were highly conserved in mouse and human and could be generated by oxidation with H(2)O(2), whereas γ-crystallin oxidation selectively affected γC23/42/79/80/154, γD42/33, and γS83/115/130 in human cataracts, and γB79/80/110, γD19/109, γF19/79, γE19, γS83/130, and γN26/128 in mouse. Analysis based on available crystal structure suggests that conformational changes are needed to expose Cys42, Cys79/80, Cys154 in γC; Cys42, Cys33 in γD, and Cys83, Cys115, and Cys130 in γS. In conclusion, the β-crystallin disulfidome is highly conserved in age-related nuclear cataract and LEGSKO mouse, and reproducible by in vitro oxidation, whereas some of the disulfide formation sites in γ-crystallins necessitate prior conformational changes. Overall, the LEGSKO mouse model is closely reminiscent of age-related nuclear cataract.

Also flagged:GLUT3metabolismAscorbic acidglucoselactateHD
Journal Article 2015-10-09 ✓ 1 Snippet Covarrubias-Pinto A, Moll P, Solís-Maldonado M, Acuña AI, Riveros A, Miró MP, Papic E, Beltrán FA, Cepeda C, Concha II, Brauchi S, Castro MA.
In-Text Gene Mentions

HTT

Show Full Abstract

Failure in energy metabolism and oxidative damage are associated with Huntington's disease (HD). Ascorbic acid released during synaptic activity inhibits use of neuronal glucose, favouring lactate uptake to sustain brain activity. Here, we observe a decreased expression of GLUT3 in STHdhQ111 cells (HD cells) and R6/2 mice (HD mice). Localisation of GLUT3 is decreased at the plasma membrane in HD cells affecting the modulation of glucose uptake by ascorbic acid. An ascorbic acid analogue without antioxidant activity is able to inhibit glucose uptake in HD cells. The impaired modulation of glucose uptake by ascorbic acid is directly related to ROS levels indicating that oxidative stress sequesters the ability of ascorbic acid to modulate glucose utilisation. Therefore, in HD, a decrease in GLUT3 localisation at the plasma membrane would contribute to an altered neuronal glucose uptake during resting periods while redox imbalance should contribute to metabolic failure during synaptic activity.

Also flagged:major histocompatibility complexMHCchromosomeMHC class I-likebeta-2 microglobuliniron
Journal Article 2015-10-09 ✓ 5 Snippets Barton JC, Edwards CQ, Acton RT.
In-Text Gene Mentions

We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload.

Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent.

HFEgene: Structure, function,…

…Thehemochromatosisgene HFE was…

…The hemochromatosis geneHFEwas discovered in…

Show Full Abstract

The hemochromatosis gene HFE was discovered in 1996, more than a century after clinical and pathologic manifestations of hemochromatosis were reported. Linked to the major histocompatibility complex (MHC) on chromosome 6p, HFE encodes the MHC class I-like protein HFE that binds beta-2 microglobulin. HFE influences iron absorption by modulating the expression of hepcidin, the main controller of iron metabolism. Common HFE mutations account for ~90% of hemochromatosis phenotypes in whites of western European descent. We review HFE mapping and cloning, structure, promoters and controllers, and coding region mutations, HFE protein structure, cell and tissue expression and function, mouse Hfe knockouts and knockins, and HFE mutations in other mammals with iron overload. We describe the pertinence of HFE and HFE to mechanisms of iron homeostasis, the origin and fixation of HFE polymorphisms in European and other populations, and the genetic and biochemical basis of HFE hemochromatosis and iron overload.

Also flagged:nervePeripheral nerve injurythioredoxin-fold proteinsredoxinshydrogenperoxide
Journal Article 2015-10-09 ✓ 2 Snippets Valek L, Kanngießer M, Häussler A, Agarwal N, Lillig CH, Tegeder I.
In-Text Gene Mentions

nerve injury but peroxiredoxins were upregulated in the DRGs, Prdx1 and Prdx6 mainly in non-neuronal cells and Prdx4

…DRGs, Prdx1 andPrdx6mainly in non-neuronal…

Show Full Abstract

Peripheral nerve injury causes redox stress in injured neurons by upregulations of pro-oxidative enzymes, but most neurons survive suggesting an activation of endogenous defense against the imbalance. As potential candidates we assessed thioredoxin-fold proteins, called redoxins, which maintain redox homeostasis by reduction of hydrogen peroxide or protein dithiol-disulfide exchange. Using a histologic approach, we show that the peroxiredoxins (Prdx1-6), the glutaredoxins (Glrx1, 2, 3 and 5), thioredoxin (Txn1 and 2) and their reductases (Txnrd1 and 2) are expressed in neurons, glial and/or vascular cells of the dorsal root ganglia (DRGs) and in the spinal cord. They show distinct cellular and subcellular locations in agreement with the GO terms for "cellular component". The expression and localization of Glrx, Txn and Txnrd proteins was not affected by sciatic nerve injury but peroxiredoxins were upregulated in the DRGs, Prdx1 and Prdx6 mainly in non-neuronal cells and Prdx4 and Prdx5 in DRG neurons, the latter associated with an increase of respective mRNAs and protein accumulation in peripheral and/or central fibers. The upregulation of Prdx4 and Prdx5 in DRG neurons was reduced in mice with a cre-loxP mediated deficiency of hypoxia inducible factor 1 alpha (HIF1α) in these neurons. The results identify Prdx4 and Prdx5 as endogenous HIF1α-dependent, transcriptionally regulated defenders of nerve injury evoked redox stress that may be important for neuronal survival and regeneration.

Also flagged:psychiatric disordersserotonindepressionbipolar disorderborderline personality disorderpersonality disorder
Journal Article 2015-10-09 ✓ 2 Snippets Li J, Chen C, Wu K, Zhang M, Zhu B, Chen C, Moyzis RK, Dong Q.
In-Text Gene Mentions

Genes in the following four serotonin subsystems were selected: (1) the serotonin synthesis subsystem, which converts hydroxylation (by TPH) to 5-HT: TPH1, TPH2; (2) the degradation subsystem, which directly breaks down released 5-HT at the synapse into inactive metabolites (MAOA, MAOB); (3) the transportation subsystem, which pumps serotonin from synaptic spaces into presynaptic neurons [SLC6A4(also known as 5-HTT)] or integrates the membrane of intracellular vesicles of presynaptic neurons and transported monoamines into the synaptic vesicles [SLC18A1(also known as VMAT1), SLC18A2(also known as VMAT2)]; (4) the serotonin receptor subsystem (HTR1A, HTR1B, HTR1D, HTR1F, HTR2A, HTR2B, HTR2C, HTR3A, HTR3B, HTR3C, HTR3D, HTR3E, HTR4, HTR5A, HTR5B, HTR6, HTR7).

…(also known as5-HTT)] or integrates…

Show Full Abstract

The amygdala plays a critical role in emotion processing and psychiatric disorders associated with emotion dysfunction. Accumulating evidence suggests that amygdala structure is modulated by serotonin-related genes. However, there is a gap between the small contributions of single loci (less than 1%) and the reported 63-65% heritability of amygdala structure. To understand the "missing heritability," we systematically explored the contribution of serotonin genes on amygdala structure at the gene set level. The present study of 417 healthy Chinese volunteers examined 129 representative polymorphisms in genes from multiple biological mechanisms in the regulation of serotonin neurotransmission. A system-level approach using multiple regression analyses identified that nine SNPs collectively accounted for approximately 8% of the variance in amygdala volume. Permutation analyses showed that the probability of obtaining these findings by chance was low (p = 0.043, permuted for 1000 times). Findings showed that serotonin genes contribute moderately to individual differences in amygdala volume in a healthy Chinese sample. These results indicate that the system-level approach can help us to understand the genetic basis of a complex trait such as amygdala structure.

Also flagged:venous thromboembolismcoagulationbindingclottingfibrinolysisThrombophilia
Journal Article 2015-10-09 ✓ 1 Snippet Zhou X, Huntjens D, Gilissen R.
In-Text Gene Mentions

…K cycle andATIII‐heparin complex for simulatin…

Show Full Abstract

Factor Xa (FXa) emerged as a promising target for effective anticoagulation and several FXa inhibitors are now available for the prevention of venous thromboembolism. However, in previously reported pharmacokinetic/pharmacodynamic (PK/PD) models, the complex coagulation processes and detailed information of drug action are usually unclear, which makes it difficult to predict clinical outcome at the drug discovery stage. In this study, a large-scale systems pharmacology model was developed based on several published models and clinical data. It takes into account all pathways of the coagulation network, and captures drug-specific features: plasma pharmacokinetics and drug-target binding kinetics (BKs). We aimed to predict the anticoagulation effects of FXa inhibitors in healthy subjects, and to use this model to compare the effects of compounds with different binding properties. Our model predicts the clotting time and anti-FXa effects and could thus serve as a predictive tool for the anticoagulant potential of a new compound.

Also flagged:cancerbreast cancerGene ExpressionERtumordeath
Journal Article 2015-10-08 No Snippets Galatenko VV, Shkurnikov MY, Samatov TR, Galatenko AV, Mityakina IA, Kaprin AD, Schumacher U, Tonevitsky AG.
Show Full Abstract

Genes with significant differential expression are traditionally used to reveal the genetic background underlying phenotypic differences between cancer cells. We hypothesized that informative marker sets can be obtained by combining genes with a relatively low degree of individual differential expression. We developed a method for construction of highly informative gene combinations aimed at the maximization of the cumulative informative power and identified sets of 2-5 genes efficiently predicting recurrence for ER-positive breast cancer patients. The gene combinations constructed on the basis of microarray data were successfully applied to data acquired by RNA-seq. The developed method provides the basis for the generation of highly efficient prognostic and predictive gene signatures for cancer and other diseases. The identified gene sets can potentially reveal novel essential segments of gene interaction networks and pathways implied in cancer progression.

Also flagged:Dopamine Beta HydroxylaseAtomoxetineattention-deficit/hyperactivity disorderADHDnorepinephrineDBH
Journal Article 2015-10-08 ✓ 1 Snippet Fang Y, Ji N, Cao Q, Su Y, Chen M, Wang Y, Yang L.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Objective</h4>Atomoxetine is the most widely used nonstimulant for the treatment of attention-deficit/hyperactivity disorder (ADHD). It selectively acts on the norepinephrine (NE) system. Dopamine beta hydroxylase (DBH) regulates the synthesis of NE. This study aimed to investigate whether variants in the DBH gene have an effect on the differential response to atomoxetine.<h4>Methods</h4>Children and adolescents with ADHD were enrolled in a prospective, open-label study of atomoxetine for 8-12 weeks. The dose was titrated to 1.2-1.4 mg/kg per day and maintained for at least 4 weeks. The primary efficacy measure was the investigator-rated ADHD Rating Scale-IV (ADHD-RS-IV). Three categorical evaluations of treatment effects (defined as response, robust response, and remission) were used. We used a candidate gene approach. Eight single nucleotide polymorphisms (SNPs) in DBH were selected and genotyped based on the functional annotation in literature. Their association with response or remission status was analyzed.<h4>Results</h4>Four SNPs were found nominally associated with response status (rs1076150, p = 0.0484; rs2873804, p = 0.0348; rs1548364, p = 0.0383; and rs2519154, p = 0.0097), two were associated with robust response (rs1076150, p = 0.0349; and rs2519154, p = 0.0047), and one was associated with remission (rs2519154, p = 0.0479). The association between rs2519154 and robust response was significant after correction of multiple comparison (p = 0.0384). Two haplotypes of linkage disequilibrium (LD) block1 (constituted by rs1108580, rs2873804, rs1548364, and rs2519154) were nominally associated with response and robust response status (CTAC: p = 0.0301 for response, p = 0.0374 for robust response; TCGT: p = 0.0317 for response, p = 0.021 for robust response), whereas one haplotype (GC) of LD block2 (constituted by rs2073837 and rs129882) was associated with robust response and remission status (p = 0.0377 for robust response; p = 0.0321 for remission), although none achieved significant threshold after multiple comparison.<h4>Conclusions</h4>Variants in DBH genes were associated with atomoxetine response in the treatment of ADHD. Further replication in larger samples would be warranted.

Also flagged:peptidedigestioninflammatory responsesimmune responsesmetabolismcellular growth
Journal Article 2015-10-08 No Snippets Ha M, Sabherwal M, Duncan E, Stevens S, Stockwell P, McConnell M, Bekhit Ael-D, Carne A.
Show Full Abstract

An in-depth proteomic study of sheep milk whey is reported and compared to the data available in the literature for the cow whey proteome. A combinatorial peptide ligand library kit (ProteoMiner) was used to normalize protein abundance in the sheep whey proteome followed by an in-gel digest of a 1D-PAGE display and an in-solution digestion followed by OFFGEL isoelectric focusing fractionation. The peptide fractions obtained were then analyzed by LC-MS/MS. This enabled identification of 669 proteins in sheep whey that, to our knowledge, is the largest inventory of sheep whey proteins identified to date. A comprehensive list of cow whey proteins currently available in the literature (783 proteins from unique genes) was assembled and compared to the sheep whey proteome data obtained in this study (606 proteins from unique genes). This comparison revealed that while the 233 proteins shared by the two species were significantly enriched for immune and inflammatory responses in gene ontology analysis, proteins only found in sheep whey in this study were identified that take part in both cellular development and immune responses, whereas proteins only found in cow whey in this study were identified to be associated with metabolism and cellular growth.

Also flagged:Insulin-Like Growth Factor 1Gene Expressionprimarymuscle disordersTNF-αcell differentiation
Journal Article 2015-10-08 ✓ 3 Snippets Meyer SU, Krebs S, Thirion C, Blum H, Krause S, Pfaffl MW.
In-Text Gene Mentions

…Sepp1, Ndst4, Tecrl,Unc13c, Spats2l, Lix1, Csdc2,…

…Ndst4, Tecrl, Cmbl,Unc13c, Spats2l, Lix1, and…

…expression regulation forUnc13c/Munc13-3 in myoblast differen…

Show Full Abstract

<h4>Introduction</h4>TNF-α levels are increased during muscle wasting and chronic muscle degeneration and regeneration processes, which are characteristic for primary muscle disorders. Pathologically increased TNF-α levels have a negative effect on muscle cell differentiation efficiency, while IGF1 can have a positive effect; therefore, we intended to elucidate the impact of TNF-α and IGF1 on gene expression during the early stages of skeletal muscle cell differentiation.<h4>Methodology/principal findings</h4>This study presents gene expression data of the murine skeletal muscle cells PMI28 during myogenic differentiation or differentiation with TNF-α or IGF1 exposure at 0 h, 4 h, 12 h, 24 h, and 72 h after induction. Our study detected significant coregulation of gene sets involved in myoblast differentiation or in the response to TNF-α. Gene expression data revealed a time- and treatment-dependent regulation of signaling pathways, which are prominent in myogenic differentiation. We identified enrichment of pathways, which have not been specifically linked to myoblast differentiation such as doublecortin-like kinase pathway associations as well as enrichment of specific semaphorin isoforms. Moreover to the best of our knowledge, this is the first description of a specific inverse regulation of the following genes in myoblast differentiation and response to TNF-α: Aknad1, Cmbl, Sepp1, Ndst4, Tecrl, Unc13c, Spats2l, Lix1, Csdc2, Cpa1, Parm1, Serpinb2, Aspn, Fibin, Slc40a1, Nrk, and Mybpc1. We identified a gene subset (Nfkbia, Nfkb2, Mmp9, Mef2c, Gpx, and Pgam2), which is robustly regulated by TNF-α across independent myogenic differentiation studies.<h4>Conclusions</h4>This is the largest dataset revealing the impact of TNF-α or IGF1 treatment on gene expression kinetics of early in vitro skeletal myoblast differentiation. We identified novel mRNAs, which have not yet been associated with skeletal muscle differentiation or response to TNF-α. Results of this study may facilitate the understanding of transcriptomic networks underlying inhibited muscle differentiation in inflammatory diseases.

Also flagged:HuntingtinaxonalHuntington's diseaseHDdyneinvesicle
Journal Article 2015-10-08 ✓ 4 Snippets White JA, Anderson E, Zimmerman K, Zheng KH, Rouhani R, Gunawardena S.
In-Text Gene Mentions

huntingtin (HTT), the Huntington's disease

…Loss of huntingtin (HTT), the Huntington's disease…

…the complex roleHTTplays within neurons…

HTT

Show Full Abstract

Loss of huntingtin (HTT), the Huntington's disease (HD) protein, was previously shown to cause axonal transport defects. Within axons, HTT can associate with kinesin-1 and dynein motors either directly or via accessory proteins for bi-directional movement. However, the composition of the vesicle-motor complex that contains HTT during axonal transport is unknown. Here we analyze the in vivo movement of 16 Rab GTPases within Drosophila larval axons and show that HTT differentially influences the movement of a particular sub-set of these Rab-containing vesicles. While reduction of HTT perturbed the bi-directional motility of Rab3 and Rab19-containing vesicles, only the retrograde motility of Rab7-containing vesicles was disrupted with reduction of HTT. Interestingly, reduction of HTT stimulated the anterograde motility of Rab2-containing vesicles. Simultaneous dual-view imaging revealed that HTT and Rab2, 7 or 19 move together during axonal transport. Collectively, our findings indicate that HTT likely influences the motility of different Rab-containing vesicles and Rab-mediated functions. These findings have important implications for our understanding of the complex role HTT plays within neurons normally, which when disrupted may lead to neuronal death and disease.

Also flagged:hepatocellular carcinomaliver cancerorganophosphateorganochlorinecarbamateliver disease
Journal Article 2015-10-08 ✓ 1 Snippet VoPham T, Brooks MM, Yuan JM, Talbott EO, Ruddell D, Hart JE, Chang CC, Weissfeld JL.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Hepatocellular carcinoma (HCC), the most common type of primary liver cancer, is associated with low survival. U.S. studies examining self-reported pesticide exposure in relation to HCC have demonstrated inconclusive results. We aimed to clarify the association between pesticide exposure and HCC by implementing a novel data linkage between Surveillance, Epidemiology, and End Results (SEER)-Medicare and California Pesticide Use Report (PUR) data using a geographic information system (GIS).<h4>Methods</h4>Controls were frequency-matched to HCC cases diagnosed between 2000 and 2009 in California by year, age, race, sex, and duration of residence in California. Potential confounders were extracted from Medicare claims. From 1974 to 2008, pounds (1 pound represents 0.45 kg) of applied organophosphate, organochlorine, and carbamate pesticides provided in PURs were aggregated to the ZIP Code level using area weighting in a GIS. ZIP Code exposure estimates were linked to subjects using Medicare-provided ZIP Codes to calculate pesticide exposure. Agricultural residents were defined as living in ZIP Codes with a majority area intersecting agricultural land cover according to the 1992, 2001, and 2006 National Land Cover Database (NLCD) rasters. Multivariable conditional logistic regression was used to estimate the association between pesticide exposure and HCC.<h4>Results</h4>Among California residents of agriculturally intensive areas, previous annual ZIP Code-level exposure to over 14.53 kg/km(2) of organochlorine pesticides (75(th) percentile among controls) was associated with an increased risk of HCC after adjusting for liver disease and diabetes (adjusted odds ratio [OR] 1.87, 95% confidence interval [CI] 1.17, 2.99; p=0.0085). ZIP Code-level organochlorines were significantly associated with an increased risk of HCC among males (adjusted OR 2.76, 95% CI 1.58, 4.82; p=0.0004), but not associated with HCC among females (adjusted OR 0.83, 95% CI 0.35, 1.93; p=0.6600) (interaction p=0.0075).<h4>Conclusions</h4>This is the first epidemiologic study to use GIS-based exposure estimates to study pesticide exposure and HCC. Our results suggest that organochlorine pesticides are associated with an increase in HCC risk among males but not females.

Also flagged:ironretinal degenerationTfcirculationactivationphotoreceptors
Journal Article 2015-10-08 ✓ 1 Snippet Picard E, Le Rouzic Q, Oudar A, Berdugo M, El Sanharawi M, Andrieu-Soler C, Naud MC, Jonet L, Latour C, Klein C, Galiacy S, Malecaze F, Coppin H, Roth MP, Jeanny JC, Courtois Y, Behar-Cohen F.
In-Text Gene Mentions

…mouse model ofhemochromatosis, Tf had the…

Show Full Abstract

Iron is essential for retinal function but contributes to oxidative stress-mediated degeneration. Iron retinal homeostasis is highly regulated and transferrin (Tf), a potent iron chelator, is endogenously secreted by retinal cells. In this study, therapeutic potential of a local Tf delivery was evaluated in animal models of retinal degeneration. After intravitreal injection, Tf spread rapidly within the retina and accumulated in photoreceptors and retinal pigment epithelium, before reaching the blood circulation. Tf injected in the vitreous prior and, to a lesser extent, after light-induced retinal degeneration, efficiently protected the retina histology and function. We found an association between Tf treatment and the modulation of iron homeostasis resulting in a decrease of iron content and oxidative stress marker. The immunomodulation function of Tf could be seen through a reduction in macrophage/microglial activation as well as modulated inflammation responses. In a mouse model of hemochromatosis, Tf had the capacity to clear abnormal iron accumulation from retinas. And in the slow P23H rat model of retinal degeneration, a sustained release of Tf in the vitreous via non-viral gene therapy efficently slowed-down the photoreceptors death and preserved their function. These results clearly demonstrate the synergistic neuroprotective roles of Tf against retinal degeneration and allow identify Tf as an innovative and not toxic therapy for retinal diseases associated with oxidative stress.

Also flagged:histone H1Linker histones H1chromatinnucleosomechromosomehistone
Journal Article 2015-10-08 ✓ 1 Snippet Kalashnikova AA, Rogge RA, Hansen JC.
In-Text Gene Mentions

…processes regulated bylinker histoneshistones and the…

Show Full Abstract

Linker histones H1 are ubiquitous chromatin proteins that play important roles in chromatin compaction, transcription regulation, nucleosome spacing and chromosome spacing. H1 function in DNA and chromatin structure stabilization is well studied and established. The current paradigm of linker histone mode of function considers all other cellular roles of linker histones to be a consequence from H1 chromatin compaction and repression. Here we review the multiple processes regulated by linker histones and the emerging importance of protein interactions in H1 functioning. We propose a new paradigm which explains the multi functionality of linker histones through linker histones protein interactions as a way to directly regulate recruitment of proteins to chromatin.

Also flagged:StatlackCT26poreVIFfit
Journal Article 2015-10-08 No Snippets Mukhopadhyay AG, Dey CS.
Show Full Abstract

Dyneins are high molecular weight microtubule based motor proteins responsible for beating of the flagellum. The flagellum is important for the viability of trypanosomes like <i>Leishmania</i>. However, very little is known about dynein and its role in flagellar motility in such trypanosomatid species. Here, we have identified genes in five species of <i>Leishmania</i> that code for outer-arm dynein (OAD) heavy chains α and β, and inner-arm dynein (IAD) heavy chains 1α and 1β using BLAST and MSA. Our sequence analysis indicates that unlike the three-headed outer-arm dyneins of <i>Chlamydomonas</i> and <i>Tetrahymena</i>, the outer-arm dyneins of the genus <i>Leishmania</i> are two-headed, lacking the γ chain like that of metazoans. N-terminal sequence analysis revealed a conserved IQ-like calmodulin binding motif in the outer-arm α and inner-arm 1α dynein heavy chain in the five species of <i>Leishmania</i> similar to <i>Chlamydomonas reinhardtii</i> outer-arm γ. It was predicted that both motifs were incapable of binding calmodulin. Phosphorylation site prediction revealed conserved serine and threonine residues in outer-arm dynein α and inner-arm 1α as putative phosphorylation sites exclusive to <i>Leishmania</i> but not in <i>Trypanosoma brucei</i> suggesting that regulation of dynein activity might be via phosphorylation of these IQ-like motifs in <i>Leishmania sp.</i>

Also flagged:GlioblastomaGBMbrain tumorForkhead box M1transcription factorcancers
Journal Article 2015-10-07 ✓ 2 Snippets Lee Y, Kim KH, Kim DG, Cho HJ, Kim Y, Rheey J, Shin K, Seo YJ, Choi YS, Lee JI, Lee J, Joo KM, Nam DH.
In-Text Gene Mentions

In addition, a recent report showed that overexpression of Sox2, along with other transcriptional factors POU3F2, SALL2, and OLIG2, was sufficient to acquire GSC-like properties.[42] Given the prominent roles of Sox2 in GBM malignancy, it is conceivable that FoxM1-Sox2 signaling axis may be a critical regulator of stem cell maintenance.

…other transcriptional factorsPOU3F2, SALL2, and OLIG2,…

Show Full Abstract

Glioblastoma (GBM) is the most aggressive and most lethal brain tumor. As current standard therapy consisting of surgery and chemo-irradiation provides limited benefit for GBM patients, novel therapeutic options are urgently required. Forkhead box M1 (FoxM1) transcription factor is an oncogenic regulator that promotes the proliferation, survival, and treatment resistance of various human cancers. The roles of FoxM1 in GBM remain incompletely understood, due in part to pleotropic nature of the FoxM1 pathway. Here, we show the roles of FoxM1 in GBM stem cell maintenance and radioresistance. ShRNA-mediated FoxM1 inhibition significantly impeded clonogenic growth and survival of patient-derived primary GBM cells with marked downregulation of Sox2, a master regulator of stem cell phenotype. Ectopic expression of Sox2 partially rescued FoxM1 inhibition-mediated effects. Conversely, FoxM1 overexpression upregulated Sox2 expression and promoted clonogenic growth of GBM cells. These data, with a direct binding of FoxM1 in the Sox2 promoter region in GBM cells, suggest that FoxM1 regulates stemness of primary GBM cells via Sox2. We also found significant increases in FoxM1 and Sox2 expression in GBM cells after irradiation both in vitro and in vivo orthotopic tumor models. Notably, genetic or a small-molecule FoxM1 inhibitor-mediated FoxM1 targeting significantly sensitized GBM cells to irradiation, accompanying with Sox2 downregulation. Finally, FoxM1 inhibition combined with irradiation in a patient GBM-derived orthotopic model significantly impeded tumor growth and prolonged the survival of tumor bearing mice. Taken together, these results indicate that the FoxM1-Sox2 signaling axis promotes clonogenic growth and radiation resistance of GBM, and suggest that FoxM1 targeting combined with irradiation is a potentially effective therapeutic approach for GBM.

Also flagged:carbonSynthesisCyclohexylAlkenePin1naphthyl
Journal Article 2015-10-07 No Snippets Chen XR, Fan SA, Ware RI, Etzkorn FA.
Show Full Abstract

Three stereoisomeric inhibitors of Pin1: (2R,5S)-, (2S,5R)- and (2S,5S)-Ac-pSer-Ψ[(Z)CH = C]-pipecolyl(Pip)-2-(2-naphthyl)ethylamine 1, that mimic L-pSer-D-Pro, D-pSer-L-Pro, and D-pSer-D-Pro amides respectively, were synthesized by a 13-step route. The newly formed stereogenic centers in the pipecolyl ring were introduced by Luche reduction, followed by stereospecific [2,3]-Still-Wittig rearrangement. The (Z)- to (E)-alkene ratio in the rearrangements were consistently 5.5 to 1. The stereochemistry at the original Ser α-carbon controlled the stereochemistry of the Luche reduction, but it did not affect the stereochemical outcome of the rearrangement, which consistently gave the (Z)-alkene. The epimerized by-product, (2S,5S)-10, resulting from the work-up after Na/NH3 debenzylation of (2S,5R)-9, was carried on to the (2S,5S)-1 isomer. Compound (2S,5S)-10 was resynthesized from the Luche reduction by-product, (2R,3R)-3, and the stereochemistry was confirmed by comparison of the optical rotations. The IC50 values for (2R,5S)-1, (2S,5R)-1 and (2S,5S)-1 Pin1 inhibition were: 52, 85, and 140 μM, respectively.

Also flagged:metabolismhyperglycemiainsulinobesitymetabolic disordersmetabolic diseases
Journal Article 2015-10-07 ✓ 3 Snippets Resnyk CW, Chen C, Huang H, Wu CH, Simon J, Le Bihan-Duval E, Duclos MJ, Cogburn LA.
In-Text Gene Mentions

Birds suffering from this myopathy exhibit down-regulation of eight hemostatic genes (A2M, FGA, FGB, FGG, KNG1, SERPINC1 and VWF) and up-regulation of four other coagulation genes (F5, F10, PROS1 and F2R).

…peroxiredoxin 6 (PRDX6), solute carrier…

…, KNG1 ,SERPINC1and VWF )…

Show Full Abstract

Genetic selection for enhanced growth rate in meat-type chickens (Gallus domesticus) is usually accompanied by excessive adiposity, which has negative impacts on both feed efficiency and carcass quality. Enhanced visceral fatness and several unique features of avian metabolism (i.e., fasting hyperglycemia and insulin insensitivity) mimic overt symptoms of obesity and related metabolic disorders in humans. Elucidation of the genetic and endocrine factors that contribute to excessive visceral fatness in chickens could also advance our understanding of human metabolic diseases. Here, RNA sequencing was used to examine differential gene expression in abdominal fat of genetically fat and lean chickens, which exhibit a 2.8-fold divergence in visceral fatness at 7 wk. Ingenuity Pathway Analysis revealed that many of 1687 differentially expressed genes are associated with hemostasis, endocrine function and metabolic syndrome in mammals. Among the highest expressed genes in abdominal fat, across both genotypes, were 25 differentially expressed genes associated with de novo synthesis and metabolism of lipids. Over-expression of numerous adipogenic and lipogenic genes in the FL chickens suggests that in situ lipogenesis in chickens could make a more substantial contribution to expansion of visceral fat mass than previously recognized. Distinguishing features of the abdominal fat transcriptome in lean chickens were high abundance of multiple hemostatic and vasoactive factors, transporters, and ectopic expression of several hormones/receptors, which could control local vasomotor tone and proteolytic processing of adipokines, hemostatic factors and novel endocrine factors. Over-expression of several thrombogenic genes in abdominal fat of lean chickens is quite opposite to the pro-thrombotic state found in obese humans. Clearly, divergent genetic selection for an extreme (2.5-2.8-fold) difference in visceral fatness provokes a number of novel regulatory responses that govern growth and metabolism of visceral fat in this unique avian model of juvenile-onset obesity and glucose-insulin imbalance.

Also flagged:calcium-binding proteinnitric oxidemalariaparasitic diseasemacrophage proliferationmacrophage
Journal Article 2015-10-07 No Snippets Liu J, Pan T, You X, Xu Y, Liang J, Limpanont Y, Sun X, Okanurak K, Zheng H, Wu Z, Lv Z.
Show Full Abstract

<h4>Background</h4>Schistosomiasis is considered second only to malaria as the most devastating parasitic disease in tropical countries. Schistosome cercariae invade the host by penetrating the skin and migrate though the lungs and portal circulation to their final destination in the hepatic portal system and eventually the mesenteric veins. Previous studies have shown that the cytotoxic pathways that target schistosomulum in the lung-stage involve nitric oxide (NO) produced by macrophages. By contrast, skin-stage schistosomulas can evade clearance, indicating that they might be freed from macrophage NO-mediated cytotoxicity to achieve immune evasion; however, the critical molecules and mechanisms involved remain unknown.<h4>Methods</h4>Recombinant SjCa8 (rSjCa8), an 8-kDa calcium-binding protein that is stage-specifically expressed in cercaria and early skin-stage schistosomulas of Schistosoma japonicum, was incubated with mouse RAW264.7 macrophages. Effects on macrophage proliferation were determined using Cell Counting Kit-8. Next, transwell assay was carried out to further investigate the role of rSjCa8 in macrophage migration. The effects of rSjCa8 on macrophage apoptosis were evaluated using confocal microscopy and flow cytometry. Additional impacts of rSjCa8 on NO release by lipopolysaccharide (LPS)-stimulated macrophages as well as the underlying mechanisms were explored using fluorescent probe, nitric oxide signaling pathway microarray, quantitative real-time PCR, mutagenesis, and neutralizing antibody approaches.<h4>Results</h4>rSjCa8 exhibited a striking inhibitory effect on macrophage migration, but did not markedly increase cell proliferation or apoptosis. Additionally, rSjCa8 potently inhibited NO release by LPS-stimulated macrophages in a dose- and time-dependent manner, and the inhibitory mechanism was closely associated with intracellular Ca(2+) levels, the up-regulation of catalase expression, and the down-regulation of the expression of 47 genes, including Myc, Gadd45a, Txnip, Fas, Sod2, Nos2, and Hmgb1. Vaccination with rSjCa8 increased NO concentration in the challenging skin area of infected mice and reduced the number of migrated schistosomula after skin penetration by cercariae.<h4>Conclusions</h4>Our findings indicate that SjCa8 might be a novel molecule that plays a critical role in immune evasion by S. japonicum cercaria during the process of skin penetration. The inhibitory impacts of rSjCa8 on macrophage migration and [Ca(2+)]i-dependent NO release suggest it might represent a novel vaccine candidate and chemotherapeutic target for the prevention and treatment of schistosomiasis.

Also flagged:type 2 diabetesGlucoseInsulinpro-B-type natriuretic peptidedimethylglycinediabetes
Journal Article 2015-10-07 No Snippets Abbasi A.
Show Full Abstract

Many biomarkers are associated with type 2 diabetes (T2D) risk in epidemiological observations. The aim of this study was to identify and summarize current evidence for causal effects of biomarkers on T2D. A systematic literature search in PubMed and EMBASE (until April 2015) was done to identify Mendelian randomization studies that examined potential causal effects of biomarkers on T2D. To replicate the findings of identified studies, data from two large-scale, genome-wide association studies (GWAS) were used: DIAbetes Genetics Replication And Meta-analysis (DIAGRAMv3) for T2D and the Meta-Analyses of Glucose and Insulin-related traits Consortium (MAGIC) for glycaemic traits. GWAS summary statistics were extracted for the same genetic variants (or proxy variants), which were used in the original Mendelian randomization studies. Of the 21 biomarkers (from 28 studies), ten have been reported to be causally associated with T2D in Mendelian randomization. Most biomarkers were investigated in a single cohort study or population. Of the ten biomarkers that were identified, nominally significant associations with T2D or glycaemic traits were reached for those genetic variants related to bilirubin, pro-B-type natriuretic peptide, delta-6 desaturase and dimethylglycine based on the summary data from DIAGRAMv3 or MAGIC. Several Mendelian randomization studies investigated the nature of associations of biomarkers with T2D. However, there were only a few biomarkers that may have causal effects on T2D. Further research is needed to broadly evaluate the causal effects of multiple biomarkers on T2D and glycaemic traits using data from large-scale cohorts or GWAS including many different genetic variants.

Also flagged:ImmunitylipoproteinLppacyltransferasepneumonic plagueantibody
Journal Article 2015-10-07 ✓ 1 Snippet Tiner BL, Sha J, Ponnusamy D, Baze WB, Fitts EC, Popov VL, van Lier CJ, Erova TE, Chopra AK.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Earlier, we showed that the Δlpp ΔmsbB Δail triple mutant of Yersinia pestis CO92 with deleted genes encoding Braun lipoprotein (Lpp), an acyltransferase (MsbB), and the attachment invasion locus (Ail), respectively, was avirulent in a mouse model of pneumonic plague. In this study, we further evaluated the immunogenic potential of the Δlpp ΔmsbB Δail triple mutant and its derivative by different routes of vaccination. Mice were immunized via the subcutaneous (s.c.) or the intramuscular (i.m.) route with two doses (2 × 10(6) CFU/dose) of the above-mentioned triple mutant with 100% survivability of the animals. Upon subsequent pneumonic challenge with 70 to 92 50% lethal doses (LD(50)) of wild-type (WT) strain CO92, all of the mice survived when immunization occurred by the i.m. route. Since Ail has virulence and immunogenic potential, a mutated version of Ail devoid of its virulence properties was created, and the genetically modified ail replaced the native ail gene on the chromosome of the Δlpp ΔmsbB double mutant, creating a Δlpp ΔmsbB::ailL2 vaccine strain. This newly generated mutant was attenuated similarly to the Δlpp ΔmsbB Δail triple mutant when administered by the i.m. route and provided 100% protection to animals against subsequent pneumonic challenge. Not only were the two above-mentioned mutants cleared rapidly from the initial i.m. site of injection in animals with no histopathological lesions, the immunized mice did not exhibit any disease symptoms during immunization or after subsequent exposure to WT CO92. These two mutants triggered balanced Th1- and Th2-based antibody responses and cell-mediated immunity. A substantial increase in interleukin-17 (IL-17) from the T cells of vaccinated mice, a cytokine of the Th17 cells, further augmented their vaccine potential. Thus, the Δlpp ΔmsbB Δail and Δlpp ΔmsbB::ailL2 mutants represent excellent vaccine candidates for plague, with the latter mutant still retaining Ail immunogenicity but with a much diminished virulence potential.

Also flagged:Vitamin Eα-tocopheroltocopherolvitamin E deficiencytrypsinlipid
Journal Article 2015-10-07 No Snippets West KP, Cole RN, Shrestha S, Schulze KJ, Lee SE, Betz J, Nonyane BA, Wu LS, Yager JD, Groopman JD, Christian P.
Show Full Abstract

<h4>Background</h4>The term vitamin E describes a family of 8 vitamers, 1 of which is α-tocopherol, that is essential for human health. Vitamin E status remains largely unknown in low-income countries because of the complexity and cost of measurement. Quantitative proteomics may offer an approach for identifying plasma proteins for assessing vitamin E status in these populations.<h4>Objective</h4>To improve options for vitamin E status assessment, we sought to detect and quantify a set of plasma proteins associated with α- and γ-tocopherol concentrations in a cohort of 500 rural Nepalese children aged 6-8 y and, based on nutrient-protein associations, to predict the prevalence of vitamin E deficiency (α-tocopherol <12 μmol/L).<h4>Methods</h4>Study children were born to mothers enrolled in an earlier antenatal micronutrient trial in Sarlahi District, Nepal. Plasma α- and γ-tocopherol concentrations were measured by high-performance liquid chromatography. Plasma aliquots were depleted of 6 high-abundance proteins, digested with trypsin, labeled with isobaric mass tags, and assessed for relative protein abundance by tandem mass spectrometry. Linear mixed-effects models were used to evaluate the association between α-tocopherol status and relative protein abundance and to predict deficiency.<h4>Results</h4>We quantified 982 plasma proteins in >10% of all child samples, of which 119 correlated with α-tocopherol (false discovery rate, q < 0.10). Proteins were primarily involved in lipid transport, coagulation, repair, innate host defenses, neural function, and homeostasis. Six proteins [apolipoprotein (apo)C-III; apoB; pyruvate kinase, muscle; forkhead box 04; unc5 homolog C; and regulator of G-protein signaling 8] explained 71% of the variability in plasma α-tocopherol, predicting an in-sample population prevalence of vitamin E deficiency of 51.4% (95% CI: 46.4%, 56.3%) compared with a measured prevalence of 54.8%. Plasma γ-tocopherol was associated with 12 proteins (q < 0.10), 2 of which (apoC-III and Misato 1) explained 20% of its variability.<h4>Conclusions</h4>In this undernourished population of children in South Asia, quantitative proteomics identified a large plasma α-tocopherome from which 6 proteins predicted the prevalence of vitamin E deficiency. The findings illustrate that protein biomarkers, once absolutely quantified, can potentially predict micronutrient deficiencies in populations. The maternal micronutrient supplementation trial from which data were derived as a follow-up activity was registered with clinicaltrials.gov as NCT00115271.

Also flagged:Gene ExpressionTyrosine-Protein Kinase Srcinfectious laryngotracheitisproto-oncogene tyrosine-protein kinase SrcSrcILTV infection
Journal Article 2015-10-07 ✓ 2 Snippets Li H, Wang F, Han Z, Gao Q, Li H, Shao Y, Sun N, Liu S.
In-Text Gene Mentions

…(antithrombin), member 1 (SERPINC1), indicating that these…

…PLG andSERPINC1were downregulated by…

Show Full Abstract

<h4>Unlabelled</h4>Given the side effects of vaccination against infectious laryngotracheitis (ILT), novel strategies for ILT control and therapy are urgently needed. The modulation of host-virus interactions is a promising strategy to combat the virus; however, the interactions between the host and avian ILT herpesvirus (ILTV) are unclear. Using genome-wide transcriptome studies in combination with a bioinformatic analysis, we identified proto-oncogene tyrosine-protein kinase Src (Src) to be an important modulator of ILTV infection. Src controls the virulence of ILTV and is phosphorylated upon ILTV infection. Functional studies revealed that Src prolongs the survival of host cells by increasing the threshold of virus-induced cell death. Therefore, Src is essential for viral replication in vitro and in ovo but is not required for ILTV-induced cell death. Furthermore, our results identify a positive-feedback loop between Src and the tyrosine kinase focal adhesion kinase (FAK), which is necessary for the phosphorylation of either Src or FAK and is required for Src to modulate ILTV infection. To the best of our knowledge, we are the first to identify a key host regulator controlling host-ILTV interactions. We believe that our findings have revealed a new potential therapeutic target for ILT control and therapy.<h4>Importance</h4>Despite the extensive administration of live attenuated vaccines starting from the mid-20th century and the administration of recombinant vaccines in recent years, infectious laryngotracheitis (ILT) outbreaks due to avian ILT herpesvirus (ILTV) occur worldwide annually. Presently, there are no drugs or control strategies that effectively treat ILT. Targeting of host-virus interactions is considered to be a promising strategy for controlling ILTV infections. However, little is known about the mechanisms governing host-ILTV interactions. The results from our study advance our understanding of host-ILTV interactions on a molecular level and provide experimental evidence that it is possible to control ILT via the manipulation of host-virus interactions.

Also flagged:EGFRTumorNSCLCEpidermal Growth Factor Receptornon-small cell lung cancerstyrosine kinase
Journal Article 2015-10-07 No Snippets Sundaresan TK, Sequist LV, Heymach JV, Riely GJ, Jänne PA, Koch WH, Sullivan JP, Fox DB, Maher R, Muzikansky A, Webb A, Tran HT, Giri U, Fleisher M, Yu HA, Wei W, Johnson BE, Barber TA, Walsh JR, Engelman JA, Stott SL, Kapur R, Maheswaran S, Toner M, Haber DA.
Show Full Abstract

<h4>Purpose</h4>The T790M gatekeeper mutation in the EGFR is acquired by some EGFR-mutant non-small cell lung cancers (NSCLC) as they become resistant to selective tyrosine kinase inhibitors (TKI). As third-generation EGFR TKIs that overcome T790M-associated resistance become available, noninvasive approaches to T790M detection will become critical to guide management.<h4>Experimental design</h4>As part of a multi-institutional Stand-Up-To-Cancer collaboration, we performed an exploratory analysis of 40 patients with EGFR-mutant tumors progressing on EGFR TKI therapy. We compared the T790M genotype from tumor biopsies with analysis of simultaneously collected circulating tumor cells (CTC) and circulating tumor DNA (ctDNA).<h4>Results</h4>T790M genotypes were successfully obtained in 30 (75%) tumor biopsies, 28 (70%) CTC samples, and 32 (80%) ctDNA samples. The resistance-associated mutation was detected in 47% to 50% of patients using each of the genotyping assays, with concordance among them ranging from 57% to 74%. Although CTC- and ctDNA-based genotyping were each unsuccessful in 20% to 30% of cases, the two assays together enabled genotyping in all patients with an available blood sample, and they identified the T790M mutation in 14 (35%) patients in whom the concurrent biopsy was negative or indeterminate.<h4>Conclusions</h4>Discordant genotypes between tumor biopsy and blood-based analyses may result from technological differences, as well as sampling different tumor cell populations. The use of complementary approaches may provide the most complete assessment of each patient's cancer, which should be validated in predicting response to T790M-targeted inhibitors.

Also flagged:protein transductionagingPeroxiredoxin (Prdx) 6GSH peroxidasecalciumphospholipase A2
Journal Article 2015-10-07 ✓ 5 Snippets Singh SP, Chhunchha B, Fatma N, Kubo E, Singh SP, Singh DP.
In-Text Gene Mentions

Delivery of a protein transduction domain-mediated Prdx6 protein ameliorates oxidative stress-induced injury in human and mouse neuronal cells.

…n transduction domain-mediatedPrdx6protein ameliorates oxidative…

…reduced expression ofPrdx6protein and mRNA…

…UsingPrdx6fused to TAT…

…showed evidence thatPrdx6was internalized in…

Show Full Abstract

Oxidative stress or reduced expression of naturally occurring antioxidants during aging has been identified as a major culprit in neuronal cell/tissue degeneration. Peroxiredoxin (Prdx) 6, a protective protein with GSH peroxidase and acidic calcium-independent phospholipase A2 activities, acts as a rheostat in regulating cellular physiology by clearing reactive oxygen species (ROS) and thereby optimizing gene regulation. We found that under stress, the neuronal cells displayed reduced expression of Prdx6 protein and mRNA with increased levels of ROS, and the cells subsequently underwent apoptosis. Using Prdx6 fused to TAT transduction domain, we showed evidence that Prdx6 was internalized in human brain cortical neuronal cells, HCN-2, and mouse hippocampal cells, HT22. The cells transduced with Prdx6 conferred resistance against the oxidative stress inducers paraquat, H2O2, and glutamate. Furthermore, Prdx6 delivery ameliorated damage to neuronal cells by optimizing ROS levels and overstimulation of NF-κB. Intriguingly, transduction of Prdx6 increased the expression of endogenous Prdx6, suggesting that protection against oxidative stress was mediated by both extrinsic and intrinsic Prdx6. The results demonstrate that Prdx6 expression is critical to protecting oxidative stress-evoked neuronal cell death. We propose that local or systemic application of Prdx6 can be an effective means of delaying/postponing neuronal degeneration.

Also flagged:SynthesisThrombosiscardiovascular diseasesbenzofuroxanadenosinediphosphate
Journal Article 2015-10-07 No Snippets Rosseto LA, Pires ME, Melchior AC, Bosquesi PL, Pavan AR, Marcondes S, Chung MC, Santos JL.
Show Full Abstract

Thrombosis is the main outcome of many cardiovascular diseases. Current treatments to prevent thrombotic events involve the long-term use of antiplatelet drugs. However, this therapy has several limitations, thereby justifying the development of new drugs. A series of N-oxide derivatives (furoxan and benzofuroxan) were synthesized and characterized as potential antiplatelet/antithrombotic compounds. All compounds (3a,b, 4a,b, 8a,b, 9a,b, 13a,b and 14a,b) inhibited platelet aggregation induced by adenosine-5-diphosphate, collagen, and arachidonic acid. All compounds protected mice from pulmonary thromboembolism induced by a mixture of collagen and epinephrine; however, benzofuroxan derivatives (13a,b and 14a,b) were the most active compounds, reducing thromboembolic events by up to 80%. N-oxide derivative 14a did not induce genotoxicity in vivo. In conclusion, 14a has emerged as a new antiplatelet/antithrombotic prototype useful for the prevention of atherothrombotic events.

Also flagged:N-glycosylationlinked protein glycosylation-glycosylationglycosylationCELSR1ST3GAL5
Journal Article 2015-10-07 ✓ 1 Snippet Kim DS, Choi D, Hahn Y.
In-Text Gene Mentions

…CELSR1, ST3GAL5 andVSIG10, lost an ancestrally…

Show Full Abstract

N-linked protein glycosylation is involved in various biological processes, such as protein quality control and adhesion or signaling among cells. The loss of ancestrally conserved N-glycosylation sites may result in the evolution of protein structure and function. In the present study, a mouse glycoproteome dataset and mammalian proteome data were assessed to identify 40 ancestral N-glycosylation sites in 37 proteins that disappeared during human evolution since the last common ancestor of the Euarchonta (primates and treeshrews). The results showed that each of the human proteins, CELSR1, ST3GAL5 and VSIG10, lost an ancestrally conserved N-glycosylation site following human-chimpanzee divergence. Notably, CELSR1 and ST3GAL5 are crucial for normal development and function of the mammalian nervous system, suggesting an association with the evolution of human cognitive function. Thus, the lost ancestrally conserved N-glycosylation sites identified in the present study may be useful targets for functional analyses to identify molecular changes linked with the evolution of human phenotypes.

Also flagged:locomotionN-cadherinmicrotubuleorganizationcyclin-dependent kinase 5cell adhesion
Journal Article 2015-10-07 No Snippets Kawauchi T.
Show Full Abstract

The mammalian brain consists of numerous compartments that are closely connected with each other via neural networks, comprising the basis of higher order brain functions. The highly specialized structure originates from simple pseudostratified neuroepithelium-derived neural progenitors located near the ventricle. A long journey by neurons from the ventricular side is essential for the formation of a sophisticated brain structure, including a mammalian-specific six-layered cerebral cortex. Neuronal migration consists of several contiguous steps, but the locomotion mode comprises a large part of the migration. The locomoting neurons exhibit unique features; a radial glial fiber-dependent migration requiring the endocytic recycling of N-cadherin and a neuron-specific migration mode with dilation/swelling formation that requires the actin and microtubule organization possibly regulated by cyclin-dependent kinase 5 (Cdk5), Dcx, p27(kip1), Rac1, and POSH. Here I will introduce the roles of various cellular events, such as cytoskeletal organization, cell adhesion, and membrane trafficking, in the regulation of the neuronal migration, with particular focus on the locomotion mode.

Also flagged:Acute Lymphoblastic LeukemiaALLMLLT3MLLT1BCRABL1
Journal Article 2015-10-07 ✓ 1 Snippet Coccé MC, Alonso CN, Rossi JG, Bernasconi AR, Rampazzi MA, Felice MS, Rubio PL, Eandi Eberle S, Medina A, Gallego MS.
In-Text Gene Mentions

MLLT10

Show Full Abstract

The purpose of the current study was to evaluate the cytogenetic findings in 1,057 children with acute lymphoblastic leukemia (ALL) referred to the cytogenetics laboratory at the Hospital de Pediatría Dr. Juan P. Garrahan, between 1991 and 2014. Chromosomal abnormalities were evaluated by G-banding and FISH. Since December 2002, RT-PCR determinations were systematically carried out for BCR-ABL1, KMT2A-AFF1, ETV6-RUNX1, and TCF3-PBX1 rearrangements in children, adding KMT2A-MLLT3 and KMT2A-MLLT1 in infants. The percentage of abnormalities detected by cytogenetics was 70.1%. Four novel abnormalities, t(2;8)(p11.2;p22), inv(4)(p16q25), t(1;7)(q25;q32), and t(5;6)(q21;q21), were found in this cohort. We compared cytogenetic and RT-PCR results for BCR-ABL1, KMT2A-AFF1 and TCF3-PBX1 rearrangements in 497 children evaluated by both methods. The results were highly concordant (p < 0.7), and interestingly, FISH was relevant to confirm G-banding findings that were discordant with RT-PCR studies. This study showed the importance of performing G-banding, FISH and RT-PCR simultaneously to improve the detection of chromosomal abnormalities considering their important value in the diagnosis and prognosis of childhood ALL patients. Finally, to the best of our knowledge, this is the first series of cytogenetic findings in children with ALL reported in Argentina.

Also flagged:copperCytokinechemokineGene expressionchemokinesIL-12
Journal Article 2015-10-06 ✓ 1 Snippet Adamcakova-Dodd A, Monick MM, Powers LS, Gibson-Corley KN, Thorne PS.
In-Text Gene Mentions

…< 0.03) andTnfsf4(Tnf (ligand) superfamily,…

Show Full Abstract

<h4>Background</h4>Increasing numbers of individuals may be exposed to nanomaterials during pregnancy. The overarching goal of this investigation was to determine if prenatal inhalation exposure to copper nanoparticles (Cu NPs) has an effect on dams and offspring, including an analysis of inflammatory markers (Th1/Th2 cytokine profiles).<h4>Methods</h4>Physicochemical characterization of Cu NPs was performed. Pregnant and non-pregnant mice (C57Bl/6 J) were exposed to Cu NPs or laboratory air in the whole-body chamber for 4 hrs/day on gestation days (GD) 3-19 (3.5 mg/m(3)). Animals were euthanized on GD 19 (0 week) or 7 weeks later. Bronchoalveolar lavage (BAL) fluid was analyzed for total and differential cells. Cytokine/chemokine concentrations were determined in the BAL fluid and the plasma of dams/non-pregnant mice and pups. Cu content was determined in the lungs and the blood of dams/non-pregnant mice and pups, in the placentas as well as in the whole bodies of pups immediately after delivery. Lungs and placentas were evaluated for histopathological changes. Gene expression of the Th1/Th2 profiles were analyzed in spleens of pups.<h4>Results</h4>The survival rate of 7 week old pups exposed to Cu NPs was significantly lower than control pups (73 vs. 97 %). The average litter size, male/female ratio, body weight and lenght at birth were not different between Cu NP-exposed and control mice. Both pregnant and non-pregnant mice exposed to Cu NPs had significant pulmonary inflammation with increased number of neutrophils in the BAL fluid compared to controls. Perivascular lymphoplasmacytic cuffing was found in the lungs of exposed mice and was more pronounced in the non-pregnant group. Similarly, levels of inflammatory cytokines/chemokines IL-12(p40), G-CSF, GM-CSF, KC, MCP-1, MIP-1α, MIP-1β, RANTES and TNF-α in BAL fluid were significantly higher in non-pregnant than pregnant exposed mice. Histopathology evaluation of placentas did not identify any pathological changes. No translocation of Cu into the placenta or the fetus was found by inductively coupled plasma-mass spectroscopy. Expression of several Th1/Th2 or other immune response genes in pups' spleens were found to be significantly up- or down-regulated.<h4>Conclusions</h4>Prenatal exposure to Cu NPs caused a profound pulmonary inflammation in dams and strong immunomodulatory effects in offspring. There was no clear polarization of genes expressed in pups' spleens towards Th1 or Th2 type of response.

Also flagged:Huntington DiseaseHDHuntingtinpolymerase
Journal Article 2015-10-06 ✓ 2 Snippets Bastepe M, Xin W.
In-Text Gene Mentions

Huntington disease (HD) is caused by expansion of a CAG trinucleotide repeat in the first exon of the Huntingtin (HTT) gene.

…of the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington disease (HD) is caused by expansion of a CAG trinucleotide repeat in the first exon of the Huntingtin (HTT) gene. Molecular testing of Huntington disease for diagnostic confirmation and disease prediction requires detection of the CAG repeat expansion. There are three main types of HD genetic testing: (1) diagnostic testing to confirm or rule out disease, (2) presymptomatic testing to determine whether an at-risk individual inherited the expanded allele, and (3) prenatal testing to determine whether the fetus has inherited the expanded allele. This unit includes protocols that describe the complementary use of polymerase chain reactions (PCR) and Southern blot hybridization to accurately measure the CAG trinucleotide repeat size and interpret the test results. In addition, an indirect linkage analysis that does not reveal the unwanted parental HD status in a prenatal testing will also be discussed.

Also flagged:gonadotropin-regulated testicular RNA helicasedefectsteratomasprotein 2Spermatogenesiscarcinoma
Journal Article 2015-10-06 ✓ 1 Snippet Saito S, Lin YC, Murayama Y, Nakamura Y, Eckner R, Niemann H, Yokoyama KK.
In-Text Gene Mentions

…] miR181c Sox5,Sox6, Rsbn1 Up-regulation in…

Show Full Abstract

Pluripotent stem cells (PSCs) are a unique type of cells because they exhibit the characteristics of self-renewal and pluripotency. PSCs may be induced to differentiate into any cell type, even male and female germ cells, suggesting their potential as novel cell-based therapeutic treatment for infertility problems. Spermatogenesis is an intricate biological process that starts from self-renewal of spermatogonial stem cells (SSCs) and leads to differentiated haploid spermatozoa. Errors at any stage in spermatogenesis may result in male infertility. During the past decade, much progress has been made in the derivation of male germ cells from various types of progenitor stem cells. Currently, there are two main approaches for the derivation of functional germ cells from PSCs, either the induction of in vitro differentiation to produce haploid cell products, or combination of in vitro differentiation and in vivo transplantation. The production of mature and fertile spermatozoa from stem cells might provide an unlimited source of autologous gametes for treatment of male infertility. Here, we discuss the current state of the art regarding the differentiation potential of SSCs, embryonic stem cells, and induced pluripotent stem cells to produce functional male germ cells. We also discuss the possible use of livestock-derived PSCs as a novel option for animal reproduction and infertility treatment.

Also flagged:Saponinpancreatic lipaseLXR-βlipidobesitydyslipidemia
Journal Article 2015-10-06 ✓ 1 Snippet Guo L, Gao Z, Zhang L, Guo F, Chen Y, Li Y, Huang C.
In-Text Gene Mentions

…of the obeseC57BL/six micemice on a…

Show Full Abstract

<h4>Context</h4>Sea cucumbers have been consumed as tonic, food, and nutrition supplements for many years.<h4>Objective</h4>The objective of this study is to investigate the antiobesity and lipid-lowering effects of sea cucumber extracts in in vitro and in vivo models and elucidate the mechanism of action of the extracts on obesity and dyslipidemia.<h4>Materials and methods</h4>The 60% ethanol extracts from the body walls of 10 different sea cucumbers were investigated for the inhibition of pancreatic lipase (PL) activity in vitro. The optimal active extract (SC-3) was further chemically analyzed by LC-MS and UV. And 0.1% and 0.2% of SC-3 was mixed with a high-fat diet to treat C57/BL6 mice for 6 weeks or 2 weeks as preventive and therapeutic study. The body weight, serum, and liver lipid profile in the mice were investigated.<h4>Results</h4>The crude extract of Pearsonothuria graeffei Semper (Holothuriidae) inhibited the PL activity by 36.44% of control at 0.5 μg/mL. SC-3 and echinoside A inhibited PL with an IC50 value at 2.86 μg/mL and 0.76 μM. 0.1% of SC-3 reduced the body weight (23.0 ± 0.62 versus 26.3 ± 0.76 g), the serum TC (2.46 ± 0.04 versus 2.83 ± 0.12 mmol/L), TG (0.19 ± 0.08 versus 0.40 ± 0.03 mmo/L), and LDL-c (0.48 ± 0.02 versus 0.51 ± 0.02 mmol/L), and liver TC (1.19 ± 0.17 versus 1.85 ± 0.13 mmol/mg) and TG (6.18 ± 0.92 versus 10.87 ± 0.97 mmol/mg) contents of the obese C57BL/six mice on a high-fat diet.<h4>Discussion and conclusion</h4>Sea cucumber may be used for developing antiobesity and antihyperlipidemia drugs.

Also flagged:Hyperuricemianon-alcoholic steatohepatitisNASHmetabolic disordermetabolic syndromediabetes
Journal Article 2015-10-06 ✓ 1 Snippet Huang JF, Yeh ML, Yu ML, Huang CF, Dai CY, Hsieh MY, Hsieh MH, Huang CI, Lin ZY, Chen SC, Hsiao PJ, Shin SJ, Chuang WL.
In-Text Gene Mentions

…diseases such ashemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

<h4>Background & aims</h4>Asians are more susceptible to non-alcoholic steatohepatitis (NASH) as well as metabolic disorder than other ethnicities. We aimed to assess the interaction between metabolic factors and fibrosis in Taiwanese NASH patients.<h4>Methods</h4>A total of 130 biopsy-proven Taiwanese NASH patients (94 males, age = 43.0 ± 13.0 years) were consecutively enrolled. Their demographic, metabolic profiles and histopathological manifestations were analyzed.<h4>Results</h4>Twenty-four (18.5%) NASH patients were non-obese. Thirty-three (25.4%) patients had significant fibrosis (F2) or more: 22 (16.9%) patients were of F2, whilst 11 (8.5%) patients were of advanced fibrosis (F3-4). The prevalence of metabolic syndrome, diabetes and hypertension were 60.8%, 39.4%, and 61.5%, respectively. There was a significant inverse correlation between hyperuricemia and fibrosis stages, ranging from 48.4% of F0-1, 33.3% of F2, and 9.1% of F3-4, respectively (P = 0.01, linear trend). Multivariate logistic regression analysis showed that a decreased serum albumin level (OR = 40.0, 95% CI = 4.5-300, P = 0.001) and normal uric acid level (OR = 5.6, 95% CI = 1.5-21.7, P = 0.01) were the significant factors associated with significant fibrosis.<h4>Conclusions</h4>Hyperuricemia inversely predicts fibrosis stages. Females might carry a more disease severity than males in Taiwanese NASH patients.

Also flagged:anxietydepressionanxiety disordersPTSDserotonin transporterbrain-derived neurotropic factor
Journal Article 2015-10-06 ✓ 1 Snippet Sharma S, Powers A, Bradley B, Ressler KJ.
In-Text Gene Mentions

…the 5-HTTLPR (5-HTTgene-linked polymorphic region…

Show Full Abstract

The burgeoning field of gene-by-environment (G×E) interactions has revealed fascinating biological insights, particularly in the realm of stress-, anxiety-, and depression-related disorders. In this review we present an integrated view of the study of G×E interactions in stress and anxiety disorders, including the evolution of genetic association studies from genetic epidemiology to contemporary large-scale genome-wide association studies and G×E studies. We convey the importance of consortia efforts and collaboration to gain the large sample sizes needed to move the field forward. Finally, we discuss several robust and well-reproduced G×E interactions and demonstrate how epidemiological identification of G×E interactions has naturally led to a plethora of basic research elucidating the mechanisms of high-impact genetic variants.

Also flagged:IGF-ISOX9synthesistype II collagenCol-IIglycosaminoglycans
Journal Article 2015-10-06 ✓ 1 Snippet Simental-Mendía M, Lara-Arias J, Álvarez-Lozano E, Said-Fernández S, Soto-Domínguez A, Padilla-Rivas GR, Martínez-Rodríguez HG.
In-Text Gene Mentions

…SOX5 , andSOX6( 23 ).…

Show Full Abstract

Damage to cartilage causes a loss of type II collagen (Col-II) and glycosaminoglycans (GAG). To restore the original cartilage architecture, cell factors that stimulate Col-II and GAG production are needed. Insulin-like growth factor I (IGF-I) and transcription factor SOX9are essential for the synthesis of cartilage matrix, chondrocyte proliferation, and phenotype maintenance. We evaluated the combined effect of IGF-I and SOX9 transgene expression on Col-II and GAG production by cultured human articular chondrocytes. Transient transfection and cotransfection were performed using two mammalian expression plasmids (pCMV-SPORT6), one for each transgene. At day 9 post-transfection, the chondrocytes that were over-expressing IGF-I/SOX9 showed 2-fold increased mRNA expression of the Col-II gene, as well as a 57% increase in Col-II protein, whereas type I collagen expression (Col-I) was decreased by 59.3% compared with controls. The production of GAG by these cells increased significantly compared with the controls at day 9 (3.3- vs 1.8-times, an increase of almost 83%). Thus, IGF-I/SOX9 cotransfected chondrocytes may be useful for cell-based articular cartilage therapies.

Also flagged:serotonin transporter5-HTTLPRattachmentSLC6A4serotoninsynapses
Journal Article 2015-10-06 ✓ 1 Snippet Brumariu LE, Bureau JF, Nemoda Z, Sasvari-Szekely M, Lyons-Ruth K.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Objective</h4>This study's aim was to evaluate whether infant disorganized attachment and infant proneness to distress exhibited differential relations to infant genetic factors as indexed by the serotonin transporter polymorphism.<h4>Background</h4>The role of the short allele of the serotonin transporter polymorphism (5-HTTLPR) in enhancing sensitivity to fearful and negative affect has been well-established (Canli & Lesch, 2007). In the current study, we used this known property of the short allele to provide a test of an important postulate of attachment theory, namely that infant attachment security or disorganization is not a function of the infant's proneness to distress.<h4>Methods</h4>Participants were 39 parents and infants assessed between 12 and 18 months in the Strange Situation procedure. Genotype categories for the 5-HTTLPR (and rs25531) were created by both the original and the reclassified grouping system; infant proneness to distress was assessed directly in the Strange Situation Procedure. We also assessed maternal behavior at 18 months to evaluate whether any observed genetic effect indicated a passive effect through the mother.<h4>Results</h4>Consistent with previous findings, the 5-HTTLPR short allele was significantly related to the infant's wariness and distress, but was not related to attachment security or attachment disorganization. In addition, maternal disrupted interaction with the infant was not related to infant genotype or infant distress.<h4>Conclusion</h4>Results support the concept that infant proneness to distress is associated with serotonergic factors while infant attachment security or disorganization is not a function of either 5-HTTLPR or behaviorally rated proneness to distress.

Also flagged:gene expressionmethylationdemethylationMethylated cytosinesten-eleven-translocation (TET) proteins5-hydroxymethylcytosines
Journal Article 2015-10-05 ✓ 1 Snippet Taylor SE, Li YH, Smeriglio P, Rath M, Wong WH, Bhutani N.
In-Text Gene Mentions

Sox6

Show Full Abstract

Regulation of gene expression changes during chondrogenic differentiation by DNA methylation and demethylation is little understood. Methylated cytosines (5mC) are oxidized by the ten-eleven-translocation (TET) proteins to 5-hydroxymethylcytosines (5hmC), 5-formylcytosines (5fC), and 5-carboxylcytosines (5caC), eventually leading to a replacement by unmethylated cytosines (C), ie, DNA demethylation. Additionally, 5hmC is stable and acts as an epigenetic mark by itself. Here, we report that global changes in 5hmC mark chondrogenic differentiation in vivo and in vitro. Tibia anlagen and growth plate analyses during limb development at mouse embryonic days E 11.5, 13.5, and 17.5 showed dynamic changes in 5hmC levels in the differentiating chondrocytes. A similar increase in 5hmC levels was observed in the ATDC5 chondroprogenitor cell line accompanied by increased expression of the TET proteins during in vitro differentiation. Loss of TET1 in ATDC5 decreased 5hmC levels and impaired differentiation, demonstrating a functional role for TET1-mediated 5hmC dynamics in chondrogenic differentiation. Global analyses of the 5hmC-enriched sequences during early and late chondrogenic differentiation identified 5hmC distribution to be enriched in the regulatory regions of genes preceding the transcription start site (TSS), as well as in the gene bodies. Stable gains in 5hmC were observed in specific subsets of genes, including genes associated with cartilage development and in chondrogenic lineage-specific genes. 5hmC gains in regulatory promoter and enhancer regions as well as in gene bodies were strongly associated with activated but not repressed genes, indicating a potential regulatory role for DNA hydroxymethylation in chondrogenic gene expression.

Also flagged:cDNAcoronary artery aneurysmKawasaki diseaseself-limited vasculitiscardiovascular diseaseimmunoglobulin
Journal Article 2015-10-05 ✓ 5 Snippets Lin YJ, Chang JS, Liu X, Tsang H, Chien WK, Chen JH, Hsieh HY, Hsueh KC, Shiao YT, Li JP, Lin CW, Lai CH, Wu JY, Chen CH, Lin JG, Lin TH, Liao CC, Huang SM, Lan YC, Ho TJ, Liang WM, Yeh YC, Lin JC, Tsai FJ.
In-Text Gene Mentions

…PLCB4 , andPLCL1inhibited the effect…

…PLCB4 , andPLCL1(5′–3′; siKCNQ5: duplex…

…5′- CCCAGCAGTCAAGTTCAACA -3′;PLCL1, forward: 5′-…

…PLCB4 , andPLCL1, for further…

…PLCB4 , andPLCL1knockdown on IL-1…

Show Full Abstract

Kawasaki disease (KD) is an acute, inflammatory, and self-limited vasculitis affecting infants and young children. Coronary artery aneurysm (CAA) formation is the major complication of KD and the leading cause of acquired cardiovascular disease among children. To identify susceptible loci that might predispose patients with KD to CAA formation, a genome-wide association screen was performed in a Taiwanese KD cohort. Patients with both KD and CAA had longer fever duration and delayed intravenous immunoglobulin treatment time. After adjusting for these factors, 100 susceptibility loci were identified. Four genes were identified from a single cluster of 35 using the Ingenuity Pathway Analysis (IPA) Knowledge Base. Silencing KCNQ5, PLCB1, PLCB4, and PLCL1 inhibited the effect of lipopolysaccharide-induced endothelial cell inflammation with varying degrees of proinflammatory cytokine expression. PLCB1 showed the most significant inhibition. Endothelial cell inflammation was also inhibited by using a phospholipase C (PLC) inhibitor. The single nucleotide polymorphism rs6140791 was identified between PLCB4 and PLCB1. Plasma PLC levels were higher in patients with KD and CC+CG rs6140791genotypes, and these genotypes were more prevalent in patients with KD who also had CAA. Our results suggest that polymorphism of the PLCB4/B1 genes might be involved in the CAA pathogenesis of KD.

Also flagged:signal transductionmitochondrialoxygenphosphatasescysteinemitochondrial respiratory chain
Journal Article 2015-10-05 No Snippets Patterson HC, Gerbeth C, Thiru P, Vögtle NF, Knoll M, Shahsafaei A, Samocha KE, Huang CX, Harden MM, Song R, Chen C, Kao J, Shi J, Salmon W, Shaul YD, Stokes MP, Silva JC, Bell GW, MacArthur DG, Ruland J, Meisinger C, Lodish HF.
Show Full Abstract

Reactive oxygen species (ROS) such as hydrogen peroxide (H2O2) govern cellular homeostasis by inducing signaling. H2O2 modulates the activity of phosphatases and many other signaling molecules through oxidation of critical cysteine residues, which led to the notion that initiation of ROS signaling is broad and nonspecific, and thus fundamentally distinct from other signaling pathways. Here, we report that H2O2 signaling bears hallmarks of a regular signal transduction cascade. It is controlled by hierarchical signaling events resulting in a focused response as the results place the mitochondrial respiratory chain upstream of tyrosine-protein kinase Lyn, Lyn upstream of tyrosine-protein kinase SYK (Syk), and Syk upstream of numerous targets involved in signaling, transcription, translation, metabolism, and cell cycle regulation. The active mediators of H2O2 signaling colocalize as H2O2 induces mitochondria-associated Lyn and Syk phosphorylation, and a pool of Lyn and Syk reside in the mitochondrial intermembrane space. Finally, the same intermediaries control the signaling response in tissues and species responsive to H2O2 as the respiratory chain, Lyn, and Syk were similarly required for H2O2 signaling in mouse B cells, fibroblasts, and chicken DT40 B cells. Consistent with a broad role, the Syk pathway is coexpressed across tissues, is of early metazoan origin, and displays evidence of evolutionary constraint in the human. These results suggest that H2O2 signaling is under control of a signal transduction pathway that links the respiratory chain to the mitochondrial intermembrane space-localized, ubiquitous, and ancient Syk pathway in hematopoietic and nonhematopoietic cells.

Also flagged:prostaglandinperoxisome proliferator activated receptorsPPARsperoxisome proliferator activated receptor-γPPARγPPARG
Journal Article 2015-10-05 No Snippets Puhl AC, Milton FA, Cvoro A, Sieglaff DH, Campos JC, Bernardes A, Filgueira CS, Lindemann JL, Deng T, Neves FA, Polikarpov I, Webb P.
Show Full Abstract

Non-steroidal anti-inflammatory drugs (NSAIDs) display anti-inflammatory, antipyretic and analgesic properties by inhibiting cyclooxygenases and blocking prostaglandin production. Previous studies, however, suggested that some NSAIDs also modulate peroxisome proliferator activated receptors (PPARs), raising the possibility that such off target effects contribute to the spectrum of clinically relevant NSAID actions. In this study, we set out to understand how peroxisome proliferator activated receptor-γ (PPARγ/PPARG) interacts with NSAIDs using X-ray crystallography and to relate ligand binding modes to effects on receptor activity. We find that several NSAIDs (sulindac sulfide, diclofenac, indomethacin and ibuprofen) bind PPARγ and modulate PPARγ activity at pharmacologically relevant concentrations. Diclofenac acts as a partial agonist and binds to the PPARγ ligand binding pocket (LBP) in typical partial agonist mode, near the β-sheets and helix 3. By contrast, two copies of indomethacin and sulindac sulfide bind the LBP and, in aggregate, these ligands engage in LBP contacts that resemble agonists. Accordingly, both compounds, and ibuprofen, act as strong partial agonists. Assessment of NSAID activities in PPARγ-dependent 3T3-L1 cells reveals that NSAIDs display adipogenic activities and exclusively regulate PPARγ-dependent target genes in a manner that is consistent with their observed binding modes. Further, PPARγ knockdown eliminates indomethacin activities at selected endogenous genes, confirming receptor-dependence of observed effects. We propose that it is important to consider how individual NSAIDs interact with PPARγ to understand their activities, and that it will be interesting to determine whether high dose NSAID therapies result in PPAR activation.

Also flagged:epithelial to mesenchymal transitionNrf2tongue squamous cell carcinomaoral and maxillofacial tumorsPlumbaginhydroxy
Journal Article 2015-10-05 No Snippets Pan ST, Qin Y, Zhou ZW, He ZX, Zhang X, Yang T, Yang YX, Wang D, Zhou SF, Qiu JX.
Show Full Abstract

Tongue squamous cell carcinoma (TSCC) is the most common malignancy in oral and maxillofacial tumors with highly metastatic characteristics. Plumbagin (5-hydroxy-2-methyl-1, 4-naphthoquinone; PLB), a natural naphthoquinone derived from the roots of Plumbaginaceae plants, exhibits various bioactivities, including anticancer effects. However, the potential molecular targets and underlying mechanisms of PLB in the treatment of TSCC remain elusive. This study employed stable isotope labeling by amino acids in cell culture (SILAC)-based quantitative proteomic approach to investigate the molecular interactome of PLB in human TSCC cell line SCC25 and elucidate the molecular mechanisms. The proteomic data indicated that PLB inhibited cell proliferation, activated death receptor-mediated apoptotic pathway, remodeled epithelial adherens junctions pathway, and manipulated nuclear factor erythroid 2-related factor 2 (Nrf2)-mediated oxidative stress response signaling pathway in SCC25 cells with the involvement of a number of key functional proteins. Furthermore, we verified these protein targets using Western blotting assay. The verification results showed that PLB markedly induced cell cycle arrest at G2/M phase and extrinsic apoptosis, and inhibited epithelial to mesenchymal transition (EMT) and stemness in SCC25 cells. Of note, N-acetyl-l-cysteine (NAC) and l-glutathione (GSH) abolished the effects of PLB on cell cycle arrest, apoptosis induction, EMT inhibition, and stemness attenuation in SCC25 cells. Importantly, PLB suppressed the translocation of Nrf2 from cytosol to nucleus, resulting in an inhibition in the expression of downstream targets. Taken together, these results suggest that PLB may act as a promising anticancer compound via inhibiting Nrf2-mediated oxidative stress signaling pathway in SCC25 cells. This study provides a clue to fully identify the molecular targets and decipher the underlying mechanisms of PLB in the treatment of TSCC.

Also flagged:multiple myelomadexamethasonebortezomibM proteinpathogenesiscancer
Journal Article 2015-10-05 No Snippets Ikeda H, Ishiguro K, Igarashi T, Aoki Y, Hayashi T, Ishida T, Sasaki Y, Tokino T, Shinomura Y.
Show Full Abstract

A 69-year-old man was diagnosed with IgG λ-type multiple myeloma (MM), Stage II in October 2010. He was treated with one cycle of high-dose dexamethasone. After three cycles of bortezomib, the patient exhibited slow elevations in the free light-chain levels and developed a significant new increase of serum M protein. Bone marrow cytogenetic analysis revealed a complex karyotype characteristic of malignant plasma cells. To better understand the molecular pathogenesis of this patient, we sequenced for mutations in the entire coding regions of 409 cancer-related genes using a semiconductor-based sequencing platform. Sequencing analysis revealed eight nonsynonymous somatic mutations in addition to several copy number variants, including CCND1 and RB1. These alterations may play roles in the pathobiology of this disease. This targeted next-generation sequencing can allow for the prediction of drug resistance and facilitate improvements in the treatment of MM patients.

Also flagged:localizationautosomeschromosomeschromosomeDiacylglycerol O-Acyltransferase 1DGAT1
Journal Article 2015-10-05 ✓ 3 Snippets Shin D, Lee C, Park KD, Kim H, Cho KH.
In-Text Gene Mentions

PLCL1and ACADM (acyl-coenzyme…

PLCL1encodes a protein…

…095–87004473 region containingPLCL1genes and three…

Show Full Abstract

<h4>Objective</h4>Holsteins are known as the world's highest-milk producing dairy cattle. The purpose of this study was to identify genetic regions strongly associated with milk traits (milk production, fat, and protein) using Korean Holstein data.<h4>Methods</h4>This study was performed using single nucleotide polymorphism (SNP) chip data (Illumina BovineSNP50 Beadchip) of 911 Korean Holstein individuals. We inferred each genomic estimated breeding values based on best linear unbiased prediction (BLUP) and ridge regression using BLUPF90 and R. We then performed a genome-wide association study and identified genetic regions related to milk traits.<h4>Results</h4>We identified 9, 6, and 17 significant genetic regions related to milk production, fat and protein, respectively. These genes are newly reported in the genetic association with milk traits of Holstein.<h4>Conclusion</h4>This study complements a recent Holstein genome-wide association studies that identified other SNPs and genes as the most significant variants. These results will help to expand the knowledge of the polygenic nature of milk production in Holsteins.

Also flagged:Heart Failureoxygenpulmonary edemaacute heart failurecoronary ischemiavalvular disease
Journal Article 2015-10-04 ✓ 1 Snippet Szema A, McLarty A, Skopicki H, Bloom M, Jermyn R.
In-Text Gene Mentions

…other diseases likehemochromatosiswarrant phlebotomy and…

Show Full Abstract

No abstract available.

Also flagged:CarbonateApatitegypsumHydroxyapatitebone remodelingosteogenesis
Journal Article 2015-10-04 No Snippets Ayukawa Y, Suzuki Y, Tsuru K, Koyano K, Ishikawa K.
Show Full Abstract

Carbonate apatite (CO3Ap), the form of apatite found in bone, has recently attracted attention. The purpose of the present study was to histologically evaluate the tissue/cellular response toward the low-crystalline CO3Ap fabricated using a dissolution-precipitation reaction with set gypsum as a precursor. When set gypsum was immersed in a 100°C 1 mol/L Na3PO4 aqueous solution for 24 h, the set gypsum transformed into CO3Ap. Both CO3Ap and sintered hydroxyapatite (s-HAp), which was used as a control, were implanted into surgically created tibial bone defects of rats for histological evaluation. Two and 4 weeks after the implantation, histological sections were created and observed using light microscopy. The CO3Ap granules revealed both direct apposition of the bone matrix by osteoblasts and osteoclastic resorption. In contrast, the s-HAp granules maintained their contour even after 4 weeks following implantation which implied that there was a lack of replacement into the bone. The s-HAp granules were sometimes encapsulated with fibrous tissue, and macrophage polykaryon was occasionally observed directly apposed to the implanted granules. From the viewpoint of bone remodeling, the CO3Ap granules mimicked the bone matrix, suggesting that CO3Ap may be an appropriate bone substitute.

Also flagged:rectal cancerrectal adenocarcinomacancerColorectal cancerdeathrectosigmoid tumours
Journal Article 2015-10-04 ✓ 1 Snippet Conde-Muíño R, Cuadros M, Zambudio N, Segura-Jiménez I, Cano C, Palma P.
In-Text Gene Mentions

…4-gene set includingLRRIQ3, FRMD3, SAMD5, and…

Show Full Abstract

There has been a high local recurrence rate in rectal cancer. Besides improvements in surgical techniques, both neoadjuvant short-course radiotherapy and long-course chemoradiation improve oncological results. Approximately 40-60% of rectal cancer patients treated with neoadjuvant chemoradiation achieve some degree of pathologic response. However, there is no effective method of predicting which patients will respond to neoadjuvant treatment. Recent studies have evaluated the potential of genetic biomarkers to predict outcome in locally advanced rectal adenocarcinoma treated with neoadjuvant chemoradiation. The articles produced by the PubMed search were reviewed for those specifically addressing a genetic profile's ability to predict response to neoadjuvant treatment in rectal cancer. Although tissue gene microarray profiling has led to promising data in cancer, to date, none of the identified signatures or molecular markers in locally advanced rectal cancer has been successfully validated as a diagnostic or prognostic tool applicable to routine clinical practice.

Also flagged:Autoimmune ConditionsFHdiabetesethanolALTAST
Journal Article 2015-10-04 ✓ 5 Snippets Barton JC, Barton JC.
In-Text Gene Mentions

Autoimmune Conditions in 235 Hemochromatosis Probands with HFE C282Y Homozygosity and Their First-Degree Relatives.

In the Hemochromatosis and Iron Overload Screening Study of adult primary care participants in North America, 8.5% of 176 HFE C282Y homozygotes and 10.9% of 312 HFE wt/wt controls reported taking thyroid supplements (p = 0.4019) [52].

To study this further, we performed a retrospective analysis of ACs at diagnosis of hemochromatosis in 235 nonscreening probands with HFE C282Y homozygosity who had also undergone HLA-A and -B typing.

…Conditions in 235HemochromatosisProbands with HFE…

…Hemochromatosis Probands withHFEC282Y Homozygosity and…

Show Full Abstract

We performed a retrospective study of autoimmune conditions (ACs) in 235 hemochromatosis probands at diagnosis by analyzing age, sex, ACs, history of first-degree family members with ACs (FH), diabetes, heavy ethanol consumption, elevated serum ALT/AST, nonalcoholic fatty liver disease, viral hepatitis, cirrhosis, iron removed to achieve iron depletion (QFe), and positivity for human leukocyte antigen (HLA) haplotypes A (∗) 01, B (∗) 08; A (∗) 02, B (∗) 44; A (∗) 03, B (∗) 07; A (∗) 03, B (∗) 14; and A (∗) 29, B (∗) 44. There were 138 men (58.7%). Median followup was 19.6 y. One or more of 19 ACs were diagnosed in each of 35 probands (14.9%). Prevalences of Hashimoto's thyroiditis, rheumatoid arthritis, and ankylosing spondylitis were 8.1% (95% CI: [5.1, 12.5]), 1.7% [0.6, 4.6], and 0.0085 [0.0015, 0.0337], respectively. Eighteen probands (7.7%) had a FH. Eight probands with ACs had 9 family members with ACs. In a logistic regression, ACs were less likely in men (odds ratio (OR) 0.3 [0.1, 0.6]) and more likely in probands with a FH (OR 4.1 [1.4, 11.8]). Overall ACs risk was not significantly associated with QFe or HLA haplotypes. Estimated survival of probands with and without ACs did not differ significantly. We conclude that ACs are common in hemochromatosis probands, especially women and probands with a FH.

Also flagged:Transferrin receptorironmetabolismdeficiencyfatty acidgluconeogenesis
Journal Article 2015-10-04 No Snippets Barrientos T, Laothamatas I, Koves TR, Soderblom EJ, Bryan M, Moseley MA, Muoio DM, Andrews NC.
Show Full Abstract

Transferrin receptor (Tfr1) is ubiquitously expressed, but its roles in non-hematopoietic cells are incompletely understood. We used a tissue-specific conditional knockout strategy to ask whether skeletal muscle required Tfr1 for iron uptake. We found that iron assimilation via Tfr1 was critical for skeletal muscle metabolism, and that iron deficiency in muscle led to dramatic changes, not only in muscle, but also in adipose tissue and liver. Inactivation of Tfr1 incapacitated normal energy production in muscle, leading to growth arrest and a muted attempt to switch to fatty acid β oxidation, using up fat stores. Starvation signals stimulated gluconeogenesis in the liver, but amino acid substrates became limiting and hypoglycemia ensued. Surprisingly, the liver was also iron deficient, and production of the iron regulatory hormone hepcidin was depressed. Our observations reveal a complex interaction between iron homeostasis and metabolism that has implications for metabolic and iron disorders.

Also flagged:Peroxiredoxin 6toperoxiredoxinsamino acidperoxidasephospholipase
Journal Article 2015-10-03 ✓ 2 Snippets Tolomeo AM, Carraro A, Bakiu R, Toppo S, Place SP, Ferro D, Santovito G.
In-Text Gene Mentions

…were compared withPrdx6orthologs from other…

…temporal expression ofPrdx6mRNA in response…

Show Full Abstract

In the present study, we describe the purification and molecular characterization of two peroxiredoxins (Prdxs), referred to as Prdx6A and Prdx6B, from Trematomus bernacchii, a teleost widely distributed in many areas of Antarctica, that plays a pivotal role in the Antarctic food chain. The two putative amino acid sequences were compared with Prdx6 orthologs from other fish, highlighting a high percentage of identity and similarity with the respective variant, in particular for the residues that are essential for the characteristic peroxidase and phospholipase activities of these enzymes. Phylogenetic analyses suggest the appearance of the two prdx6 genes through a duplication event before the speciation that led to the differentiation of fish families and that the evolution of the two gene variants seems to proceed together with the evolution of fish orders and families. The temporal expression of Prdx6 mRNA in response to short-term thermal stress showed a general upregulation of prdx6b and inhibition of prdx6a, suggesting that the latter is the variant most affected by temperature increase. The variations of mRNA accumulation are more conspicuous in heart than the liver, probably related to behavioral changes of the specimens in response to elevated temperature. These data, together with the peculiar differences between the molecular structures of the two Prdx6s in T. bernacchii as well as in the tropical species Stegastes partitus, suggest an adaptation that allowed these poikilothermic aquatic vertebrates to colonize very different environments, characterized by different temperature ranges.

Also flagged:envelopeaxonsmyelinmyelin formationmyelinationmyelin sheath
Journal Article 2015-10-03 No Snippets Tomassy GS, Dershowitz LB, Arlotta P.
Show Full Abstract

The evolutionary success of the vertebrate nervous system is largely due to a unique structural feature--the myelin sheath, a fatty envelope that surrounds the axons of neurons. By increasing the speed by which electrical signals travel along axons, myelin facilitates neuronal communication between distant regions of the nervous system. We review the cellular and molecular mechanisms that regulate the development of myelin as well as its homeostasis in adulthood. We discuss how finely tuned neuron-oligodendrocyte interactions are central to myelin formation during development and in the adult, and how these interactions can have profound implications for the plasticity of the adult brain. We also speculate how the functional diversity of both neurons and oligodendrocytes may impact on the myelination process in both health and disease.

Also flagged:diabetic neuropathydiabetic peripheral neuropathygene expressionhyperglycemiahyperinsulinemiatriglycerides
Journal Article 2015-10-03 No Snippets O'Brien PD, Hur J, Robell NJ, Hayes JM, Sakowski SA, Feldman EL.
Show Full Abstract

<h4>Aims</h4>To identify a female mouse model of diabetic peripheral neuropathy (DPN), we characterized DPN in female BTBR ob/ob mice and compared their phenotype to non-diabetic and gender-matched controls. We also identified dysregulated genes and pathways in sciatic nerve (SCN) and dorsal root ganglia (DRG) of female BTBR ob/ob mice to determine potential DPN mechanisms.<h4>Methods</h4>Terminal neuropathy phenotyping consisted of examining latency to heat stimuli, sciatic motor and sural sensory nerve conduction velocities (NCV), and intraepidermal nerve fiber (IENF) density. For gene expression profiling, DRG and SCN were dissected, RNA was isolated and processed using microarray technology and differentially expressed genes were identified.<h4>Results</h4>Similar motor and sensory NCV deficits were observed in male and female BTBR ob/ob mice at study termination; however, IENF density was greater in female ob/ob mice than their male counterparts. Male and female ob/ob mice exhibited similar weight gain, hyperglycemia, and hyperinsulinemia compared to non-diabetic controls, although triglycerides were elevated more so in males than in females. Transcriptional profiling of nerve tissue from female mice identified dysregulation of pathways related to inflammation.<h4>Conclusions</h4>Similar to males, female BTBR ob/ob mice display robust DPN, and pathways related to inflammation are dysregulated in peripheral nerve.

Also flagged:fucosylationtrypsindigestionpeptidesAgglutininLCA
Journal Article 2015-10-02 ✓ 2 Snippets Yin H, Tan Z, Wu J, Zhu J, Shedden KA, Marrero J, Lubman DM.
In-Text Gene Mentions

antithrombin-III

SERPINC1

Show Full Abstract

A mass spectrometry-based methodology has been developed to screen for changes in site-specific core-fucosylation (CF) of serum proteins in early stage HCC with different etiologies. The methods involve depletion of high-abundance proteins, trypsin digestion of medium-to-low-abundance proteins into peptides, iTRAQ labeling, and Lens culinaris Agglutinin (LCA) enrichment of CF peptides, followed by endoglycosidase F3 digestion before mass spectrometry analysis. 1300 CF peptides from 613 CF proteins were identified from patients sera, where 20 CF peptides were differentially expressed in alcohol (ALC)-related HCC samples compared with ALC-related cirrhosis samples and 26 CF peptides changed in hepatitis C virus (HCV)-related HCC samples compared with HCV-related cirrhosis samples. Among these, we found three CF peptides from fibronectin upregulated in ALC-related HCC samples compared with ALC-related cirrhosis samples with an AUC (area under the curve) value of 0.89 at site 1007 with a specificity of 85.7% at a sensitivity of 92.9% (generated with 10-fold cross-validation). When combined with the AFP index, the AUC value reached to 0.92 with a specificity of 92.9% at a sensitivity of 100%, significantly improved compared to that with AFP alone (LR test p < 0.001). In HCV-related samples, the CF level of cadherin-5 at site 61 showed the best AUC value of 0.75 but was not as promising as that of fibronectin site 1007 for ALC-related samples. The CF peptides of fibronectin may serve as potential biomarkers for early stage HCC screening in ALC-related cirrhosis patients.

Also flagged:neurograninEFNA3DDNGantsodiumRGS14
Journal Article 2015-10-02 ✓ 5 Snippets Smalley JL, Breda C, Mason RP, Kooner G, Luthi-Carter R, Gant TW, Giorgini F.
In-Text Gene Mentions

Huntington's disease (HD) is a genetic disease caused by a CAG trinucleotide repeat expansion encoding a polyglutamine tract in the huntingtin (HTT) protein, ultimately leading to neuronal loss and consequent cognitive decline and death.

HTT

Oxidative stress has been implicated in mutant HTT-induced toxicity, with lipid peroxidation products such as malondialdehyde observed in HD-affected regions of the brain [50].

Huntington’s disease (HD) is a genetic disease caused by a CAG trinucleotide repeat expansion encoding a polyglutamine tract in the huntingtin (HTT) protein, ultimately leading to neuronal loss and consequent cognitive decline and death.

However, both the loss of normal HTT function and the toxic gain of function of the mutant HTT protein are thought to be important in HD progression [3, 4].

Show Full Abstract

<h4>Unlabelled</h4>Huntington's disease (HD) is a genetic disease caused by a CAG trinucleotide repeat expansion encoding a polyglutamine tract in the huntingtin (HTT) protein, ultimately leading to neuronal loss and consequent cognitive decline and death. As no treatments for HD currently exist, several chemical screens have been performed using cell-based models of mutant HTT toxicity. These screens measured single disease-related endpoints, such as cell death, but had low 'hit rates' and limited dimensionality for therapeutic detection. Here, we have employed gene expression microarray analysis of HD samples--a snapshot of the expression of 25,000 genes--to define a gene expression signature for HD from publically available data. We used this information to mine a database for chemicals positively and negatively correlated to the HD gene expression signature using the Connectivity Map, a tool for comparing large sets of gene expression patterns. Chemicals with negatively correlated expression profiles were highly enriched for protective characteristics against mutant HTT fragment toxicity in in vitro and in vivo models. This study demonstrates the potential of using gene expression to mine chemical activity, guide chemical screening, and detect potential novel therapeutic compounds.<h4>Key messages</h4>Single-endpoint chemical screens have low therapeutic discovery hit-rates. In the context of HD, we guided a chemical screen using gene expression data. The resulting chemicals were highly enriched for suppressors of mutant HTT fragment toxicity. This study provides a proof of concept for wider usage in all chemical screening.

Also flagged:CUL4DDB1CDT2E3 LigaseDegradationcell proliferation
Journal Article 2015-10-02 ✓ 1 Snippet Tong X, Zhang D, Guha A, Arthurs B, Cazares V, Gupta N, Yin L.
In-Text Gene Mentions

…CRY1 protein degradation,F-box leucine-rich repeat protein 3leucine-rich repeat protein…

Show Full Abstract

The CUL4-DDB1 E3 ligase complex serves as a critical regulator in various cellular processes, including cell proliferation, DNA damage repair, and cell cycle progression. However, whether this E3 ligase complex regulates clock protein turnover and the molecular clock activity in mammalian cells is unknown. Here we show that CUL4-DDB1-CDT2 E3 ligase ubiquitinates CRY1 and promotes its degradation both in vitro and in vivo. Depletion of the major components of this E3 ligase complex, including Ddb1, Cdt2, and Cdt2-cofactor Pcna, leads to CRY1 stabilization in cultured cells or in the mouse liver. CUL4A-DDB1-CDT2 E3 ligase targets lysine 585 within the C-terminal region of CRY1 protein, shown by the CRY1 585KA mutant's resistance to ubiquitination and degradation mediated by the CUL4A-DDB1 complex. Surprisingly, both depletion of Ddb1 and over-expression of Cry1-585KA mutant enhance the oscillatory amplitude of the Bmal1 promoter activity without altering its period length, suggesting that CUL4A-DDB1-CDT2 E3 targets CRY1 for degradation and reduces the circadian amplitude. All together, we uncovered a novel biological role for CUL4A-DDB1-CDT2 E3 ligase that regulates molecular circadian behaviors via promoting ubiquitination-dependent degradation of CRY1.

Also flagged:Gene ExpressionProtein Kinase Ctumorcanceracetatep53
Journal Article 2015-10-02 ✓ 5 Snippets Glover KP, Chen Z, Markell LK, Han X.
In-Text Gene Mentions

…, TNC andTNFSF4.…

…, CCDC70 ,DNAH10, IL29 ,…

…, CCDC70 ,DNAH10, FOS ,…

…, SERPINE1 ,TNFSF4and ZSCAN4 (…

…, TNC ,TNFSF4and IL29 were…

Show Full Abstract

Activation of stress response pathways in the tumor microenvironment can promote the development of cancer. However, little is known about the synergistic tumor promoting effects of stress response pathways simultaneously induced in the tumor microenvironment. Therefore, the purpose of this study was to establish gene expression signatures representing the interaction of pathways deregulated by tumor promoting agents and pathways induced by DNA damage. Human lymphoblastoid TK6 cells were pretreated with the protein kinase C activating tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA) and exposed to UVC-irradiation. The time and dose-responsive effects of the co-treatment were captured with RNA-sequencing (RNA-seq) in two separate experiments. TK6 cells exposed to both TPA and UVC had significantly more genes differentially regulated than the theoretical sum of genes induced by either stress alone, thus indicating a synergistic effect on global gene expression patterns. Further analysis revealed that TPA+UVC co-exposure caused synergistic perturbation of specific genes associated with p53, AP-1 and inflammatory pathways important in carcinogenesis. The 17 gene signature derived from this model was confirmed with other PKC-activating tumor promoters including phorbol-12,13-dibutyrate, sapintoxin D, mezerein, (-)-Indolactam V and resiniferonol 9,13,14-ortho-phenylacetate (ROPA) with quantitative real-time PCR (QPCR). Here we show a novel gene signature that may represent a synergistic interaction in the tumor microenvironment that is relevant to the mechanisms of chemical induced tumor promotion.

Also flagged:bovine pleuropneumoniarespiratory diseaseMmm infectionTNFαTLR2IL-12B
Journal Article 2015-10-02 No Snippets Rodrigues V, Holzmuller P, Puech C, Wesonga H, Thiaucourt F, Manso-Silván L.
Show Full Abstract

Contagious bovine pleuropneumonia (CBPP), caused by Mycoplasma mycoides subsp. mycoides (Mmm), is a severe respiratory disease of cattle responsible for major economic losses in sub-Saharan Africa. Disease control relies mainly on the use of empirically attenuated vaccines that provide limited protection. Thus, understanding the virulence mechanisms used by Mmm as well as the role of the host immune system in disease development, persistence, and control is a prerequisite for the development of new, rationally designed control strategies. The aim of this study was to assess the use of whole blood transcriptome analysis to study cattle-Mmm interactions, starting by the characterization of the bovine response to Mmm infection during the acute form of the disease. For that purpose, we compared the transcriptome profile of whole blood from six cattle, before challenge by contact with Mmm-infected animals and at the appearance of first clinical signs, using a bovine microarray. Functional analysis revealed that 680 annotated genes were differentially expressed, with an overwhelming majority of down-regulated genes characterizing an immunosuppression. The main bio-functions affected were "organismal survival", "cellular development, morphology and functions" and "cell-to cell signaling and interactions". These affected functions were consistent with the results of previous in vitro immunological studies. However, microarray and qPCR validation results did not highlight pro-inflammatory molecules (such as TNFα, TLR2, IL-12B and IL-6), whereas inflammation is one of the most characteristic traits of acute CBPP. This global gene expression pattern may be considered as the result, in blood, of the local pulmonary response and the systemic events occurring during acute CBPP. Nevertheless, to understand the immune events occurring during disease, detailed analyses on the different immune cell subpopulations, either in vivo, at the local site, or in vitro, will be required. Whole blood transcriptome analysis remains an interesting approach for the identification of bio-signatures correlating to recovery and protection, which should facilitate the evaluation and validation of novel vaccine formulations.

Also flagged:HedgehogCell MigrationtumorcancerHhcancers
Journal Article 2015-10-02 ✓ 2 Snippets Araújo SJ.
In-Text Gene Mentions

Fra (DCC

Fra)/DCC

Show Full Abstract

Cell migration and guidance are complex processes required for morphogenesis, the formation of tumor metastases, and the progression of human cancer. During migration, guidance molecules induce cell directionality and movement through complex intracellular mechanisms. Expression of these molecules has to be tightly regulated and their signals properly interpreted by the receiving cells so as to ensure correct navigation. This molecular control is fundamental for both normal morphogenesis and human disease. The Hedgehog (Hh) signaling pathway is evolutionarily conserved and known to be crucial for normal cellular growth and differentiation throughout the animal kingdom. The relevance of Hh signaling for human disease is emphasized by its activation in many cancers. Here, I review the current knowledge regarding the involvement of the Hh pathway in cell migration and guidance during Drosophila development and discuss its implications for human cancer origin and progression.

Also flagged:panic disorderPDanxietyneurotransmitter receptorscatecholamineserotonin receptors
Journal Article 2015-10-01 ✓ 5 Snippets Bilodeau C, Bradwejn J, Koszycki D.
In-Text Gene Mentions

…serotonin transporter gene (5-HTT) may play a…

…allele of the5-HTTgene have been…

…carriers of the5-HTTgene were more…

…impact of the5-HTTgene on recognizing…

…variation of the5-HTTgene confers heightened…

Show Full Abstract

Recent studies suggest that impaired processing of facial affect has a familial component and may reflect a marker of liability to psychopathology. This study investigated whether facial affect processing is impaired in offspring with parental panic disorder (PD). Psychiatrically healthy children with parental PD (n = 51) and age and sex matched control children with no parental psychopathology (n = 51) completed a standard facial recognition task. High-risk children made more errors recognizing fearful faces than controls and misattributed fear and angry facial affect as surprised. High-risk females also made more errors recognizing sad faces compared to low risk females and misattributed sadness as fear. No difference emerged for self-rated anxiety while viewing facial expressions. However, self-rated anxiety correlated moderately with misrecognition of fearful facial affect in high-risk children. Overall, our data suggest that the ability to correctly recognize negative facial emotions is impaired in children with parental PD. Further research is needed to confirm if these deficits represent a trait marker of liability for PD and elucidate the contribution of genetic and family environmental influences.

Also flagged:pediatric depressionDepressioncardiovascular diseaseCVDplatelet aggregationmajor depression
Journal Article 2015-10-01 ✓ 1 Snippet Can MM, Guler G, Guler E, Ozveren O, Turan B, DiNicolantinio JJ, Kipshidze N, Serebruany V.
In-Text Gene Mentions

…platelet volume, andantithrombin-IIIlevels were almost…

Show Full Abstract

Depression is associated with poor prognosis for cardiovascular disease (CVD) including mortality. Among multiple mechanisms linking depression and CVD, changes in platelet reactivity are known to be one of the major confounders of such adverse association. However, there are very limited data in children. Thus, we evaluated some conventional hemostatic indices including whole blood platelet aggregation in patients with documented pediatric depression and compared these data with those obtained from healthy children. The pediatric patients fulfilled criteria for major depression with a minimum score of 19 on the 21-item Beck Depression Inventory Scale. Plasma fibrinogen, D-dimer, platelet count, mean platelet volume, and platelet aggregation induced by ADP and collagen were measured in 67 pediatric patients with depression and matched by age and sex with 78 healthy controls. As expected, the depressed children had significantly higher BECK scales (P = 0.001) compared with the normal subjects. Platelet aggregation induced by ADP and collagen (P = 0.0001 for both) was significantly higher in depressed children. BECK scale scores correlated significantly with platelet aggregation induced by ADP (r = 0.3, P = 0.001) and collagen (r = 0.4, P = 0.01). In contrast, platelet counts, fibrinogen, D-dimer, mean platelet volume, and antithrombin-III levels were almost identical between both groups. Children with depression exhibit mostly intact hemostatic parameters, with the exception of significantly higher platelet activity when compared with healthy controls. These data match well with prior evidence from depressed adults supporting the hypothesis that platelets participate in the pathogenesis of depression. However, beyond pure assessment of platelet activity, other elements including serotonin content and cell receptor changes in pediatric depression should be elucidated before randomized trial(s) can be justified.

Also flagged:chronic tuberculosisTBinfectionpositronSodiumFluoride
Journal Article 2015-10-01 No Snippets Ordonez AA, DeMarco VP, Klunk MH, Pokkali S, Jain SK.
Show Full Abstract

<h4>Purpose</h4>Calcification is a hallmark of chronic tuberculosis (TB) in humans, often noted years to decades (after the initial infection) on chest radiography, but not visualized well with traditional positron emission tomography (PET). We hypothesized that sodium [(18)F]fluoride (Na[(18)F]F) PET could be used to detect microcalcifications in a chronically Mycobacterium tuberculosis-infected murine model.<h4>Procedures</h4>C3HeB/FeJ mice, which develop necrotic and hypoxic TB lesions, were aerosol-infected with M. tuberculosis and imaged with Na[(18)F]F PET.<h4>Results</h4>Pulmonary TB lesions from chronically infected mice demonstrated significantly higher Na[(18)F]F uptake compared with acutely infected or uninfected animals (P < 0.01), while no differences were noted in the blood or bone compartments (P > 0.08). Ex vivo biodistribution studies confirmed the imaging findings, and tissue histology demonstrated microcalcifications in TB lesions from chronically infected mice, which has not been demonstrated previously in a murine model.<h4>Conclusion</h4>Na[(18)F]F PET can be used for the detection of chronic TB lesions and could prove to be a useful noninvasive biomarker for TB studies.

Also flagged:platelet dysfunctionanemiaironmembraneplatelet receptorsphospholipase C
Journal Article 2015-10-01 ✓ 1 Snippet Popov VM, Vladareanu AM, Bumbea H, Kovacs E, Savopol T, Iordache MM, Moisescu MG.
In-Text Gene Mentions

…Patients withhemochromatosishave low platelet…

Show Full Abstract

Platelet function is influenced by changes in membrane fluidity that has an important role in the expression of platelet receptors and in modulating the activity of proteins like phospholipase C or proteinkinase C. In freshly prepared platelets, membrane fluidity modifies the aggregation/agglutination function. Reactive oxygen species (ROS) represent another important parameter involved in platelet receptor activation. There is a certain association of high levels of ROS and iron overload. Patients with hemochromatosis have low platelet aggregation induced by thrombin; little is known about the anemia and effects of iron overload on platelet activation in myelodysplastic syndromes (MDS) patients. Study of platelet membrane fluidity and ROS production changes in patients with MDS and possible correlations with altered platelet function as reflected in aggregation curves and platelet receptor expression. To find out possible correlations of fluidity of platelet membrane and ROS level with hematologic parameters and iron levels. The prospective study included 34 patients with myelodysplastic syndromes classified according to French-American-British cooperative group proposals and 29 healthy volunteers. Platelet membrane fluidity was quantified by fluorescence anisotropy measurements using the marker 1-(4-trimethylammoniumphenyl)-6-phenyl-1,3,5-hexatriene p-toluenesulfonate. ROS production was evaluated by fluorescence measurements using 2',7'-dichlorodihydrofluorescein diacetate. Platelet function was analyzed by optical aggregometry using the agonists adenosine diphosphate, collagen, ristocetin and epinephrine. The expression of platelet receptors CD41/CD61, CD42a/CD42b and CD62P/CD63 was evaluated by flow cytometry. Platelet membrane fluidity in patients with MDS was similar to that of healthy volunteers and did not vary according to the risk category. Patients with MDS had increased platelet ROS production compared with the control group without statistical correlation with membrane fluidity. We found a negative correlation of ROS levels with the severity of anemia (R =  -0.587, P = 0.017). Platelet response was reduced in patients with MDS compared with volunteers, for all reagents. The response was different according to the risk category only in case of ristocetin or collagen. Patients with anemia presented a decreased platelet aggregation induced by collagen or ristocetin (collagen: R = 0.395, P = 0.003; ristocetin: R = 0.420, P = 0.002). The membrane fluidity of platelets from MDS patients appeared unmodified, but the ROS production was increased in all risk categories of MDS. The levels of ROS were correlated with the degree of anemia, which, in turn, had a negative impact on the platelet aggregation function induced by collagen or ristocetin.

Also flagged:SepsisextracellularproteinsGlycopeptidescathepsin-L1vascular cell adhesion molecule
Journal Article 2015-10-01 ✓ 1 Snippet DeCoux A, Tian Y, DeLeon-Pennell KY, Nguyen NT, de Castro Brás LE, Flynn ER, Cannon PL, Griswold ME, Jin YF, Puskarich MA, Jones AE, Lindsey ML.
In-Text Gene Mentions

thrombin-III

Show Full Abstract

<h4>Objective</h4>Sepsis remains a predominant cause of mortality in the ICU, yet strategies to increase survival have proved largely unsuccessful. This study aimed to identify proteins linked to sepsis outcomes using a glycoproteomic approach to target extracellular proteins that trigger downstream pathways and direct patient outcomes.<h4>Design</h4>Plasma was obtained from the Lactate Assessment in the Treatment of Early Sepsis cohort. N-linked plasma glycopeptides were quantified by solid-phase extraction coupled with mass spectrometry. Glycopeptides were assigned to proteins using RefSeq (National Center of Biotechnology Information, Bethesda, MD) and visualized in a heat map. Protein differences were validated by immunoblotting, and proteins were mapped for biological processes using Database for Annotation, Visualization and Integrated Discovery (National Institute of Allergy and Infectious Diseases, National Institutes of Health; Bethesda, MD) and for functional pathways using Kyoto Encyclopedia of Genes and Genomes (Kanehisa Laboratories, Kyoto, Japan) databases.<h4>Setting</h4>Hospitalized care.<h4>Patients</h4>Patients admitted to the emergency department were enrolled in the study when the diagnosis of sepsis was made, within 6 hours of presentation.<h4>Interventions</h4>None.<h4>Measurements and main results</h4>A total of 501 glycopeptides corresponding to 234 proteins were identified. Of these, 66 glycopeptides were unique to the survivor group and corresponded to 54 proteins, 60 were unique to the nonsurvivor group and corresponded to 43 proteins, and 375 were common responses between groups and corresponded to 137 proteins. Immunoblotting showed that nonsurvivors had increased total kininogen; decreased total cathepsin-L1, vascular cell adhesion molecule, periostin, and neutrophil gelatinase-associated lipocalin; and a two-fold decrease in glycosylated clusterin (all p < 0.05). Kyoto Encyclopedia of Genes and Genomes analysis identified six enriched pathways. Interestingly, survivors relied on the extrinsic pathway of the complement and coagulation cascade, whereas nonsurvivors relied on the intrinsic pathway.<h4>Conclusion</h4>This study identifies proteins linked to patient outcomes and provides insight into unexplored mechanisms that can be investigated for the identification of novel therapeutic targets.

Also flagged:Antithrombin IIIbindingglycosaminoglycanheparinHpserine protease
Journal Article 2015-10-01 ✓ 5 Snippets Zhao Y, Singh A, Li L, Linhardt RJ, Xu Y, Liu J, Woods RJ, Amster IJ.
In-Text Gene Mentions

…of Antithrombin III (ATIII) and Arixtra, a…

…its interaction withATIII, a serine protease…

…conformational changes withinATIIIthat dramatically enhance…

…dramatically enhance theATIII-mediated inhibition rate.…

…to bind withATIII.…

Show Full Abstract

We validate the utility of ion mobility to measure protein conformational changes induced by the binding of glycosaminoglycan ligands, using the well characterized system of Antithrombin III (ATIII) and Arixtra, a pharmaceutical agent with heparin (Hp) activity. Heparin has been used as a therapeutic anticoagulant drug for several decades through its interaction with ATIII, a serine protease inhibitor that plays a central role in the blood coagulation cascade. This interaction induces conformational changes within ATIII that dramatically enhance the ATIII-mediated inhibition rate. Arixtra is the smallest synthetic Hp containing the specific pentasaccharide sequence required to bind with ATIII. Here we report the first travelling wave ion mobility mass spectrometry (TWIMS) investigation of the conformational changes in ATIII induced by its interaction with Arixtra. Native electrospray ionization mass spectrometry allowed the gentle transfer of the native topology of ATIII and ATIII-Arixtra complex. IM measurements of ATIII and ATIII-Arixtra complex showed a single structure, with well-defined collisional cross section (CCS) values. An average 3.6% increase in CCS of ATIII occurred as a result of its interaction with Arixtra, which agrees closely with the theoretical estimation of the change in CCS based on protein crystal structures. A comparison of the binding behavior of ATIII under both denaturing and non-denaturing conditions confirmed the significance of a folded tertiary structure of ATIII for its biological activity. A Hp oligosaccharide whose structure is similar to Arixtra but missing the 3-O sulfo group on the central glucosamine residue showed a dramatic decrease in binding affinity towards ATIII, but no change in the mobility behavior of the complex, consistent with prior studies that suggested that 3-O sulfation affects the equilibrium constant for binding to ATIII, but not the mode of interaction. In contrast, nonspecific binding by a Hp tetrasaccharide showed more complex mobility behavior, suggesting more promiscuous interactions with ATIII. The effect of collisional activation of ATIII and ATIII-Arixtra complex were also assessed, revealing that the binding of Arixtra provided ATIII with additional stability against unfolding. Overall, our results validate the capability of TWIMS to retain the significant features of the solution structure of a protein-carbohydrate complex so that it can be used to study protein conformational changes induced by the binding of glycosaminoglycan ligands.

Also flagged:GAPDHmitophagyneurodegenerative diseasesmitochondriaglyceraldehyde-3-phosphate dehydrogenasepolyglutamine
Journal Article 2015-10-01 No Snippets Hwang S, Disatnik MH, Mochly-Rosen D.
Show Full Abstract

Mitochondrial dysfunction is implicated in multiple neurodegenerative diseases. In order to maintain a healthy population of functional mitochondria in cells, defective mitochondria must be properly eliminated by lysosomal machinery in a process referred to as mitophagy. Here, we uncover a new molecular mechanism underlying mitophagy driven by glyceraldehyde-3-phosphate dehydrogenase (GAPDH) under the pathological condition of Huntington's disease (HD) caused by expansion of polyglutamine repeats. Expression of expanded polyglutamine tracts catalytically inactivates GAPDH (iGAPDH), which triggers its selective association with damaged mitochondria in several cell culture models of HD. Through this mechanism, iGAPDH serves as a signaling molecule to induce direct engulfment of damaged mitochondria into lysosomes (micro-mitophagy). However, abnormal interaction of mitochondrial GAPDH with long polyglutamine tracts stalled GAPDH-mediated mitophagy, leading to accumulation of damaged mitochondria, and increased cell death. We further demonstrated that overexpression of inactive GAPDH rescues this blunted process and enhances mitochondrial function and cell survival, indicating a role for GAPDH-driven mitophagy in the pathology of HD.

Also flagged:ProliferationCardiovascular diseasedeathmyocardial infarctionMIheart failure
Journal Article 2015-10-01 No Snippets Sharma A, Zhang Y, Wu SM.
Show Full Abstract

<h4>Opinion statement</h4>Adult human cardiomyocytes are terminally differentiated and have limited capacity for cell division. Hence, they are not naturally replaced following ischemic injury to the heart. As such, cardiac function is often permanently compromised after an event such as myocardial infarction. In recent years, investigators have focused intensively on ways to reactivate cardiomyocyte mitotic activity in both in vitro cell culture systems and in vivo animal models. In parallel, advances in stem cell biology have allowed for the mass production of patient-specific human cardiomyocytes from human-induced pluripotent stem cells. These cells can be produced via chemically defined differentiation of human pluripotent stem cells in a matter of weeks and could theoretically be utilized directly for therapeutic purposes to replace damaged myocardium. However, stem cell-derived cardiomyocytes, like their adult counterparts, are post-mitotic and incapable of large-scale expansion after reaching a certain stage of in vitro differentiation. Due to this shared characteristic, these stem cell-derived cardiomyocytes may provide a platform for studying genes, pathways, and small molecules that induce cell cycle reentry and proliferation of human cardiomyocytes. Ultimately, the discovery of novel mechanisms or pathways to induce human cardiomyocyte proliferation should improve our ability to regenerate adult cardiomyocytes and help restore cardiac function following injury.

Also flagged:Epithelial ovarian cancercancerdeathgynecologic tumorstumorstumor
Journal Article 2015-10-01 No Snippets Rea K, Pinciroli P, Sensi M, Alciato F, Bisaro B, Lozneanu L, Raspagliesi F, Centritto F, Cabodi S, Defilippi P, Avanzi GC, Canevari S, Tomassetti A.
Show Full Abstract

High-grade epithelial ovarian cancer (HGEOC) is a clinically diverse and molecularly heterogeneous disease comprising subtypes with distinct biological features and outcomes. The receptor tyrosine kinases, expressed by EOC cells, and their ligands, present in the microenvironment, activate signaling pathways, which promote EOC cells dissemination. Herein, we established a molecular link between the presence of Gas6 ligand in the ascites of HGEOCs, the expression and activation of its receptor Axl in ovarian cancer cell lines and biopsies, and the progression of these tumors. We demonstrated that Gas6/Axl signalling converges on the integrin β3 pathway in the presence of the adaptor protein p130Cas, thus inducing tumor cell adhesion to the extracellular matrix and invasion. Accordingly, Axl and p130Cas were significantly co-expressed in HGEOC samples. Clinically, we identified an Axl-associated signature of 62 genes able to portray the HGEOCs with the shortest overall survival. These data biologically characterize a group of HGEOCs and could help guide a more effective therapeutic approach to be taken for these patients.

Also flagged:Voltage-gated calcium channelscalcium channel1,4-dihydropyridineshypertensionethosuximideabsence epilepsy
Journal Article 2015-10-01 No Snippets Zamponi GW, Striessnig J, Koschak A, Dolphin AC.
Show Full Abstract

Voltage-gated calcium channels are required for many key functions in the body. In this review, the different subtypes of voltage-gated calcium channels are described and their physiologic roles and pharmacology are outlined. We describe the current uses of drugs interacting with the different calcium channel subtypes and subunits, as well as specific areas in which there is strong potential for future drug development. Current therapeutic agents include drugs targeting L-type Ca(V)1.2 calcium channels, particularly 1,4-dihydropyridines, which are widely used in the treatment of hypertension. T-type (Ca(V)3) channels are a target of ethosuximide, widely used in absence epilepsy. The auxiliary subunit α2δ-1 is the therapeutic target of the gabapentinoid drugs, which are of value in certain epilepsies and chronic neuropathic pain. The limited use of intrathecal ziconotide, a peptide blocker of N-type (Ca(V)2.2) calcium channels, as a treatment of intractable pain, gives an indication that these channels represent excellent drug targets for various pain conditions. We describe how selectivity for different subtypes of calcium channels (e.g., Ca(V)1.2 and Ca(V)1.3 L-type channels) may be achieved in the future by exploiting differences between channel isoforms in terms of sequence and biophysical properties, variation in splicing in different target tissues, and differences in the properties of the target tissues themselves in terms of membrane potential or firing frequency. Thus, use-dependent blockers of the different isoforms could selectively block calcium channels in particular pathologies, such as nociceptive neurons in pain states or in epileptic brain circuits. Of important future potential are selective Ca(V)1.3 blockers for neuropsychiatric diseases, neuroprotection in Parkinson's disease, and resistant hypertension. In addition, selective or nonselective T-type channel blockers are considered potential therapeutic targets in epilepsy, pain, obesity, sleep, and anxiety. Use-dependent N-type calcium channel blockers are likely to be of therapeutic use in chronic pain conditions. Thus, more selective calcium channel blockers hold promise for therapeutic intervention.

Also flagged:ironmetabolismmyelinationiron deficiency anemiaIDAanemia
Journal Article 2015-10-01 No Snippets Lönnerdal B, Georgieff MK, Hernell O.
Show Full Abstract

No abstract available.

Also flagged:BCAT1ovarian cancerbranched chain amino-acid transaminase 1serous epithelial ovarian tumorsepithelial ovarian cancercell proliferation
Journal Article 2015-10-01 No Snippets Wang ZQ, Faddaoui A, Bachvarova M, Plante M, Gregoire J, Renaud MC, Sebastianelli A, Guillemette C, Gobeil S, Macdonald E, Vanderhyden B, Bachvarov D.
Show Full Abstract

Previously, we have identified the branched chain amino-acid transaminase 1 (BCAT1) gene as notably hypomethylated in low-malignant potential (LMP) and high-grade (HG) serous epithelial ovarian tumors, compared to normal ovarian tissues. Here we show that BCAT1 is strongly overexpressed in both LMP and HG serous epithelial ovarian tumors, which probably correlates with its hypomethylated status. Knockdown of the BCAT1 expression in epithelial ovarian cancer (EOC) cells led to sharp decrease of cell proliferation, migration and invasion and inhibited cell cycle progression. BCAT1 silencing was associated with the suppression of numerous genes and pathways known previously to be implicated in ovarian tumorigenesis, and the induction of some tumor suppressor genes (TSGs). Moreover, BCAT1 suppression resulted in downregulation of numerous genes implicated in lipid production and protein synthesis, suggesting its important role in controlling EOC metabolism. Further metabolomic analyses were indicative for significant depletion of most amino acids and different phospho- and sphingolipids following BCAT1 knockdown. Finally, BCAT1 suppression led to significantly prolonged survival time in xenograft model of advanced peritoneal EOC. Taken together, our findings provide new insights about the functional role of BCAT1 in ovarian carcinogenesis and identify this transaminase as a novel EOC biomarker and putative EOC therapeutic target.

Also flagged:Breast cancercancerdeathBRCA1BRCA2breast carcinomas
Journal Article 2015-10-01 No Snippets Vos S, Vesuna F, Raman V, van Diest PJ, van der Groep P.
Show Full Abstract

miRNA deregulation has been found to promote carcinogenesis. Little is known about miRNA deregulation in hereditary breast tumors as no miRNA expression profiling studies have been performed in normal breast tissue of BRCA1 and BRCA2 mutation carriers. miRNA profiles of 17 BRCA1- and 9 BRCA2-associated breast carcinomas were analyzed using microarrays. Normal breast tissues from BRCA1 and BRCA2 mutation carriers (both n = 5) and non-mutation carriers (n = 10) were also included. Candidate miRNAs were validated by qRT-PCR. Breast carcinomas showed extensive miRNA alteration compared to normal breast tissues in BRCA1 and BRCA2 mutation carriers. Moreover, normal breast tissue from BRCA1 mutation carriers already showed miRNA alterations compared to non-mutation carriers. Chromosomal distribution analysis showed several hotspots containing down- or up-regulated miRNAs. Pathway analysis yielded many similarities between the BRCA1 and BRCA2 axes with miRNAs involved in cell cycle regulation, proliferation and apoptosis. Lesser known pathways were also affected, including cellular movement and protein trafficking. This study provides a comprehensive insight into the potential role of miRNA deregulation in BRCA1/2-associated breast carcinogenesis. The observed extensive miRNA deregulation is likely the result of genome-wide effects of chromosomal instability caused by impaired BRCA1 or BRCA2 function. This study's results also suggest the existence of common pathways driving breast carcinogenesis in both BRCA1 and BRCA2 germ-line mutation carriers.

Also flagged:Histone Deacetylasesacetyllysinehistonesmitochondrialaging
Journal Article 2015-10-01 No Snippets Bradley EW, Carpio LR, van Wijnen AJ, McGee-Lawrence ME, Westendorf JJ.
Show Full Abstract

Histone deacetylases (Hdacs) are conserved enzymes that remove acetyl groups from lysine side chains in histones and other proteins. Eleven of the 18 Hdacs encoded by the human and mouse genomes depend on Zn(2+) for enzymatic activity, while the other 7, the sirtuins (Sirts), require NAD2(+). Collectively, Hdacs and Sirts regulate numerous cellular and mitochondrial processes including gene transcription, DNA repair, protein stability, cytoskeletal dynamics, and signaling pathways to affect both development and aging. Of clinical relevance, Hdacs inhibitors are United States Food and Drug Administration-approved cancer therapeutics and are candidate therapies for other common diseases including arthritis, diabetes, epilepsy, heart disease, HIV infection, neurodegeneration, and numerous aging-related disorders. Hdacs and Sirts influence skeletal development, maintenance of mineral density and bone strength by affecting intramembranous and endochondral ossification, as well as bone resorption. With few exceptions, inhibition of Hdac or Sirt activity though either loss-of-function mutations or prolonged chemical inhibition has negative and/or toxic effects on skeletal development and bone mineral density. Specifically, Hdac/Sirt suppression causes abnormalities in physiological development such as craniofacial dimorphisms, short stature, and bone fragility that are associated with several human syndromes or diseases. In contrast, activation of Sirts may protect the skeleton from aging and immobilization-related bone loss. This knowledge may prolong healthspan and prevent adverse events caused by epigenetic therapies that are entering the clinical realm at an unprecedented rate. In this review, we summarize the general properties of Hdacs/Sirts and the research that has revealed their essential functions in bone forming cells (e.g., osteoblasts and chondrocytes) and bone resorbing osteoclasts. Finally, we offer predictions on future research in this area and the utility of this knowledge for orthopedic applications and bone tissue engineering.

Also flagged:fibrinogenplatelet deficiencyfactor XIII
Journal Article 2015-10-01 No Snippets Solomon C, Ranucci M, Hochleitner G, Schöchl H, Schlimp CJ.
Show Full Abstract

The viscoelastic properties of blood clot have been studied most commonly using thrombelastography (TEG) and thromboelastometry (ROTEM). ROTEM-based bleeding treatment algorithms recommend administering platelets to patients with low EXTEM clot strength (e.g., clot amplitude at 10 minutes [A10] <40 mm) once clot strength of the ROTEM® fibrin-based test (FIBTEM) is corrected. Algorithms based on TEG typically use a low value of maximum amplitude (e.g., <50 mm) as a trigger for administering platelets. However, this parameter reflects the contributions of various blood components to the clot, including platelets and fibrin/fibrinogen. The platelet component of clot strength may provide a more sensitive indication of platelet deficiency than clot amplitude from a whole blood TEG or ROTEM® assay. The platelet component of the formed clot is derived from the results of TEG/ROTEM® tests performed with and without platelet inhibition. In this article, we review the basis for why this calculation should be based on clot elasticity (e.g., the E parameter with TEG and the CE parameter with ROTEM®) as opposed to clot amplitude (e.g., the A parameter with TEG or ROTEM®). This is because clot elasticity, unlike clot amplitude, reflects the force with which the blood clot resists rotation within the device, and the relationship between clot amplitude (variable X) and clot elasticity (variable Y) is nonlinear. A specific increment of X (ΔX) will be associated with different increments of Y (ΔY), depending on the initial value of X. When calculated correctly, using clot elasticity data, the platelet component of the clot can provide a valuable insight into platelet deficiency in emergency bleeding.

Also flagged:tumorcyaninecyclohexenylconjugationalbuminHSA
Journal Article 2015-10-01 No Snippets Rong P, Huang P, Liu Z, Lin J, Jin A, Ma Y, Niu G, Yu L, Zeng W, Wang W, Chen X.
Show Full Abstract

The development of imageable photothermal theranostics has attracted considerable attention for imaging guided photothermal therapy (PTT) with high tumor ablation accuracy. In this study, we strategically constructed a near-infrared (NIR) cyanine dye by introducing a rigid cyclohexenyl ring to the heptamethine chain to obtain a heptamethine dye CySCOOH with high fluorescence intensity and good stability. By covalent conjugation of CySCOOH onto human serum albumin (HSA), the as-prepared HSA@CySCOOH nanoplatform is highly efficient for NIR fluorescence/photoacoustic/thermal multimodality imaging and photothermal tumor ablation. The theranostic capability of HSA@CySCOOH was systematically evaluated both in vitro and in vivo. Most intriguingly, complete tumor elimination was achieved by intravenous injection of HSA@CySCOOH (CySCOOH, 1 mg kg(-1); 808 nm, 1.0 W cm(-2) for 5 min) into 4T1 tumor-bearing mice, with no weight loss, noticeable toxicity, or tumor recurrence being observed. This as-prepared protein-based nanotheranostics exhibits high water dispersibility, no off target cytotoxicity, and good biodegradability and biocompatibility, thus facilitating its clinical translation to cancer photothermal theranostics.

Also flagged:Gene expressioninfectionimmune responseRNA-binding proteinstranscriptional regulatorsimmune responses
Journal Article 2015-10-01 No Snippets Schwerk J, Savan R.
Show Full Abstract

Gene expression programs undergo constant regulation to quickly adjust to environmental stimuli that alter the physiological status of the cell, like cellular stress or infection. Gene expression is tightly regulated by multilayered regulatory elements acting in both cis and trans. Posttranscriptional regulation of the 3' untranslated region (UTR) is a powerful regulatory process that determines the rate of protein translation from mRNA. Regulatory elements targeting the 3' UTR include microRNAs, RNA-binding proteins, and long noncoding RNAs, which dramatically alter the immune response. We provide an overview of our current understanding of posttranscriptional regulation of immune gene expression. The focus of this review is on regulatory elements that target the 3' UTR. We delineate how the synergistic or antagonistic interactions of posttranscriptional regulators determine gene expression levels and how dysregulation of 3' UTR-mediated posttranscriptional control associates with human diseases.

Also flagged:Nitric Oxidesiliconepolycarbonatedisulfidewaterhydrogen
Journal Article 2015-10-01 ✓ 1 Snippet Wo Y, Li Z, Brisbois EJ, Colletta A, Wu J, Major TC, Xi C, Bartlett RH, Matzger AJ, Meyerhoff ME.
In-Text Gene Mentions

…binds to antithrombin (ATIII), preventing fibrin formation…

Show Full Abstract

The prolonged and localized delivery of nitric oxide (NO), a potent antithrombotic and antimicrobial agent, has many potential biomedical applications. In this work, the origin of the long-term storage stability and sustained NO release mechanism of S-nitroso-N-acetyl-D-penicillamine (SNAP)-doped CarboSil 20 80A polymer, a biomedical thermoplastic silicone-polycarbonate-urethane, is explored. Long-term (22 days) localized NO release is achieved by utilizing a cross-linked silicone rubber as topcoats, which can greatly reduce the amount of SNAP, NAP, and NAP disulfide leaching from the SNAP-doped CarboSil films, as measured by LC-MS. Raman spectroscopy and powder X-ray diffraction characterization of SNAP-doped CarboSil films demonstrate that a polymer-crystal composite is formed during the solvent evaporation process when SNAP exceeds its solubility in CarboSil (ca. 3.4-4.0 wt %). Further, when exceeding this solubility threshold, SNAP exists in an orthorhombic crystal form within the bulk of the polymer. The proposed mechanism of sustained NO release in SNAP-doped CarboSil is that the solubilized SNAP in the polymer matrix decomposes and releases NO, primarily in the water-rich regions near the polymer/solution interface, and the dissolved SNAP in the bulk polymeric phase becomes unsaturated, resulting in the dissolution of crystalline SNAP within the bulk of the polymer. This is a very slow process that ultimately leads to NO release at the physiological flux levels for >3 weeks. The increased stability of SNAP within CarboSil is attributed to the intermolecular hydrogen bonds between the SNAP molecules that crystallize. This crystallization also plays a key role in maintaining RSNO stability within the CarboSil polymer for >8 months at 37 °C (88.5% remains). Further, intravascular catheters fabricated with this new material are demonstrated to significantly decrease the formation of Staphylococcus aureus biofilm (a leading cause of nosocomial bloodstream infections) (in vitro) over a 7 day period, with 5 log units reduction of viable cell count on catheter surfaces. It is also shown that the NO release catheters can greatly reduce thrombus formation on the catheter surfaces during 7 h implantation in rabbit veins, when compared to the control catheters fabricated without SNAP. These results suggest that the SNAP-doped CarboSil system is a very attractive new composite material for creating long-term NO release medical devices with increased stability and biocompatibility.

Also flagged:NKD2hypermethylationgastric cancerSOX18chromosomegastric cancers
Journal Article 2015-10-01 ✓ 1 Snippet Jia Y, Cao B, Yang Y, Linghu E, Zhan Q, Lu Y, Yu Y, Herman JG, Guo M.
In-Text Gene Mentions

…RARβ, MGMT, CHFR,DCC, RUNX3, TSLC1, BCL2L10,…

Show Full Abstract

Naked cuticle homolog2 (NKD2) is located in chromosome 5p15.3, which is frequently loss of heterozygosity in human colorectal and gastric cancers. In order to understand the mechanism of NKD2 in gastric cancer development, 6 gastric cancer cell lines and 196 cases of human primary gastric cancer samples were involved. Methylation specific PCR (MSP), gene expression array, flow cytometry, transwell assay and xenograft mice model were employed in this study. The expression of NKD1 and NKD2 was silenced by promoter region hypermethylation. NKD1 and NKD2 were methylated in 11.7% (23/196) and 53.1% (104/196) in human primary gastric cancer samples. NKD2 methylation is associated with cell differentiation, TNM stage and distant metastasis significantly (all P < 0.05), and the overall survival time is longer in NKD2 unmethylated group compared to NKD2 methylated group (P < 0.05). Restoration of NKD2 expression suppressed cell proliferation, colony formation, cell invasion and migration, induced G2/M phase arrest, and sensitized cancer cells to docetaxel. NKD2 inhibits SOX18 and MMP-2,7,9 expression and suppresses BGC823 cell xenograft growth. In conclusion, NKD2 methylation may serve as a poor prognostic and chemo-sensitive marker in human gastric cancer. NKD2 impedes gastric cancer metastasis by inhibiting SOX18.

Also flagged:Synthesisindole diterpenoidpaspalineIndole Diterpenepaspalicineindole diterpene alkaloid
Journal Article 2015-10-01 No Snippets Sharpe RJ, Johnson JS.
Show Full Abstract

An enantioselective synthesis of the indole diterpenoid natural product paspaline is disclosed. Critical to this approach was the implementation of stereoselective desymmetrization reactions to assemble key stereocenters of the molecule. The design and execution of these tactics are described in detail, and a thorough analysis of observed outcomes is presented, ultimately providing the title compound in high stereopurity. This synthesis provides a novel template for preparing key stereocenters in this family of molecules, and the reactions developed en route to paspaline present a series of new synthetic disconnections in preparing steroidal natural products.

Also flagged:gene expressiontranslationaldegradationlocalizationscytoplasmendomembranes
Journal Article 2015-10-01 No Snippets Leung AKL.
Show Full Abstract

MicroRNAs (miRNAs) are a conserved class of approximately 22 nucleotide (nt) short noncoding RNAs that normally silence gene expression via translational repression and/or degradation of targeted mRNAs in plants and animals. Identifying the whereabouts of miRNAs potentially informs miRNA functions, some of which are perhaps specialized to specific cellular compartments. In this review, the significance of miRNA localizations in the cytoplasm, including those at RNA granules and endomembranes, and the export of miRNAs to extracellular space will be discussed. How miRNA localizations and functions are regulated by protein modifications on the core miRNA-binding protein Argonaute (AGO) during normal and stress conditions will be explored, and in conclusion new AGO partners, non-AGO miRNA-binding proteins, and the emergent understanding of miRNAs found in the nucleoplasm, nucleoli, and mitochondria will be discussed.

Also flagged:carbonnitrogencollagenlipidacidificationbioapatite
Journal Article 2015-10-01 No Snippets Tomaszewicz CN, Seminoff JA, Ramirez MD, Kurle CM.
Show Full Abstract

<h4>Rationale</h4>The sampling of sequential, annually formed bone growth layers for stable carbon (δ(13)C values) and nitrogen (δ(15)N values) isotope analysis (SIA) can provide a time series of foraging ecology data. To date, no standard protocol exists for the pre-SIA treatment of cortical samples taken from fresh, modern, bones.<h4>Methods</h4>Based on the SIA of historical bone, it is assumed that fresh bone samples must be pre-treated with acid prior to SIA. Using an elemental analyzer coupled to an isotope ratio mass spectrometer to measure stable carbon and nitrogen ratios, we tested the need to acidify cortical bone powder with 0.25 M HCl prior to SIA to isolate bone collagen for the determination of δ(13)C and δ(15)N values. We also examined the need for lipid extraction to remove potential biases related to δ(13)C analysis, based on a C:N ratio threshold of 3.5.<h4>Results</h4>It was found that acidification of micromilled cortical bone samples from marine turtles does not affect their δ(15)N values, and the small effect acidification has on δ(13)C values can be mathematically corrected for, thus eliminating the need for pre-SIA acidification of cortical bone. The lipid content of the cortical bone samples was low, as measured by their C:N ratios, indicating that lipid extracting cortical bone samples from modern marine turtles is unnecessary.<h4>Conclusions</h4>We present a standard protocol for testing fresh, modern cortical bone samples prior to SIA, facilitating direct comparison of future studies. Based on the results obtained from marine turtle bones, pre-acidification and lipid removal of cortical bone are not recommended. This is especially useful as there is frequently not enough bone material removed via micromilling of sequential growth layers to accommodate both acid treatment and SIA.

Also flagged:IronInsulin ReceptorGlut4glucoseenzyme activityC-reactive protein
Journal Article 2015-10-01 ✓ 1 Snippet Mehdad A, Campos NA, Arruda SF, Siqueira EM.
In-Text Gene Mentions

…for the C282YHFEmutation that are…

Show Full Abstract

<h4>Objectives</h4>Considering that phenotype related to iron overload associated with pathological conditions differs from that caused by dietary iron excess, our study set out to evaluate the impact of dietary iron restriction and dietary iron supplementation on oxidative stress and functional outcome in adult, healthy rats.<h4>Methods</h4>adult rats were divided into the three groups and fed diets containing 10, 35 or 350 mg/kg iron (restricted-diet, control-diet and supplemented- diet groups, respectively) for 78 days. Hematological variables, fasting blood glucose, hepatic enzyme activity and C-reactive protein levels were analyzed. Iron and glycogen concentrations in liver and skeletal muscle were determined. The extent of tissue damage caused by either dietary iron restriction or iron supplementation was accessed by measuring malondialdehyde, carbonyl, NADPH oxidase, glutathione peroxidase, glutathione reductase and glutathione-s-transferase in various tissues. The mRNA expression levels of insulin receptor, glucose transporter 4 and p53 were also determined.<h4>Results</h4>Fasting blood glucose values trended toward a decrease by dietary iron restriction, moreover, hepatic glycogen content decreased with concomitant increases in skeletal muscle. In addition, dietary iron restriction resulted in a twofold increase in mRNA expression of Insr and fourfold increase in Glut4 expression in skeletal muscle. Although the dietary iron restriction did not affect body iron status, it caused hepatic low oxidative damages. However, high liver NADPH oxidase activity and increased levels of protein oxidation in muscle were observed. Chronic feeding of high iron diet induces iron overload and resulted in elevated levels of stress markers in tissues.<h4>Conclusion</h4>Dietary iron deprivation may improve insulin receptor and glucose transporter transcription in muscle; however, our results show that dietary iron restriction can prevent and/or promote oxidative damage in a tissue-specific manner, emphasizing the importance of maintaining optimal iron intake.

Also flagged:renal cell carcinomaRCCcancerkidney and renal pelvis cancerskidney cancerclear cell RCC
Journal Article 2015-10-01 No Snippets Gu L, Li H, Chen L, Ma X, Gao Y, Li X, Zhang Y, Fan Y, Zhang X.
Show Full Abstract

This is a systematic review of studies investigating the prognostic value of different microRNAs (miRs) in renal cell carcinoma (RCC). Twenty-seven relevant studies were identified, with a total of 2578 subjects. We found that elevated expression of miR-21, miR-1260b, miR-210, miR-100, miR-125b, miR-221, miR-630, and miR-497 was associated with a poor prognosis in RCC patients. Conversely, decreased expression of miR-106b, miR-99a, miR-1826, miR-215, miR-217, miR-187, miR-129-3p, miR-23b, miR-27b, and miR-126 was associated with a worse prognosis. We performed meta-analyses on studies to address the prognostic value of miR-21, miR-126, miR-210, and miR-221. This revealed that elevated miR-21 expression was associated with shorter overall survival (OS; hazard ratio [HR], 2.29; 95% confidence interval [CI], 1.28-4.08), cancer specific survival (CSS; HR, 4.16; 95% CI, 2.49-6.95), and disease free survival (DFS; HR, 2.15; 95% CI, 1.16-3.98). The decreased expression of miR-126 was associated with shorter CSS (HR, 0.35; 95% CI, 0.15-0.85), OS (HR, 0.45; 95% CI, 0.30-0.69), and DFS (HR 0.30; 95% CI, 0.18-0.50). Our comprehensive systematic review reveals that miRs, especially miR-21 and miR-126, could be promising prognostic markers and useful therapeutic targets in RCC.

Also flagged:localizationStaubindingbrain tumourscaffold proteinRNA binding protein
Journal Article 2015-10-01 ✓ 5 Snippets Jia M, Shan Z, Yang Y, Liu C, Li J, Li J, Luo ZG, Zhang M, Cai Y, Wen W, Wang W.
In-Text Gene Mentions

…that of humanSTAU1dsRBD5 (ref.…

…well as humanSTAU1dsRBD5 (ref.…

…in dsRBD5s of Stau/STAU1homologues.…

…dsRBD5s in other Stau/STAU1homologues can also…

…dsRBD5 and humanSTAU1dsRBD5 locate at…

Show Full Abstract

During the asymmetric division of Drosophila neuroblasts (NBs), the scaffold Miranda (Mira) coordinates the subcellular distribution of cell-fate determinants including Staufen (Stau) and segregates them into the ganglion mother cells (GMCs). Here we show the fifth double-stranded RNA (dsRNA)-binding domain (dsRBD5) of Stau is necessary and sufficient for binding to a coiled-coil region of Mira cargo-binding domain (CBD). The crystal structure of Mira514-595/Stau dsRBD5 complex illustrates that Mira forms an elongated parallel coiled-coil dimer, and two dsRBD5 symmetrically bind to the Mira dimer through their exposed β-sheet faces, revealing a previously unrecognized protein interaction mode for dsRBDs. We further demonstrate that the Mira-Stau dsRBD5 interaction is responsible for the asymmetric localization of Stau during Drosophila NB asymmetric divisions. Finally, we find the CBD-mediated dimer assembly is likely a common requirement for Mira to recognize and translocate other cargos including brain tumour (Brat).

Also flagged:RepAnucleoidbindingamyloidprion diseasesantibody
Journal Article 2015-10-01 ✓ 1 Snippet Moreno-Del Álamo M, de la Espina SM, Fernández-Tresguerres ME, Giraldo R.
In-Text Gene Mentions

…xpansions, such as Huntington’s HttHtt or the…

Show Full Abstract

Upon binding to short specific dsDNA sequences in vitro, the N-terminal WH1 domain of the plasmid DNA replication initiator RepA assembles as amyloid fibres. These are bundles of single or double twisted tubular filaments in which distorted RepA-WH1 monomers are the building blocks. When expressed in Escherichia coli, RepA-WH1 triggers the first synthetic amyloid proteinopathy in bacteria, recapitulating some of the features of mammalian prion diseases: it is vertically transmissible, albeit non-infectious, showing up in at least two phenotypically distinct and interconvertible strains. Here we report B3h7, a monoclonal antibody specific for oligomers of RepA-WH1, but which does not recognize the mature amyloid fibres. Unlike a control polyclonal antibody generated against the soluble protein, B3h7 interferes in vitro with DNA-promoted or amyloid-seeded assembly of RepA-WH1 fibres, thus the targeted oligomers are on-pathway amyloidogenic intermediates. Immuno-electron microscopy with B3h7 on thin sections of E. coli cells expressing RepA-WH1 consistently labels the bacterial nucleoid, but not the large cytoplasmic aggregates of the protein. This observation points to the nucleoid as the place where oligomeric amyloid precursors of RepA-WH1 are generated, and suggests that, once nucleated by DNA, further growth must continue in the cytoplasm due to entropic exclusion.

Also flagged:linezolidlactic acidosissickle cell diseasevancomycinenterococcal bacteremiatricuspid valve endocarditis
Journal Article 2015-10-01 ✓ 1 Snippet Johnson PC, Vaduganathan M, Phillips KM, O'Donnell WJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

We present a case of suspected linezolid toxicity in a 34-year-old man with sickle cell disease and line-related vancomycin-resistant enterococcal bacteremia and tricuspid valve endocarditis. The patient developed sudden-onset hypoglycemia, lactic acidosis, and acute pancreatitis 11 days after initiation of linezolid. All adverse effects quickly resolved with drug cessation. The pathophysiology underlying this triad of linezolid toxicity is unclear, but may be related to mitochondrial dysfunction.

Also flagged:steroidsteroid hormonesmenopausechromosometype 2 diabetescoronary artery disease
Journal Article 2015-10-01 ✓ 2 Snippets Winkler TW, Justice AE, Graff M, Barata L, Feitosa MF, Chu S, Czajkowski J, Esko T, Fall T, Kilpeläinen TO, Lu Y, Mägi R, Mihailov E, Pers TH, Rüeger S, Teumer A, Ehret GB, Ferreira T, Heard-Costa NL, Karjalainen J, Lagou V, Mahajan A, Neinast MD, Prokopenko I, Simino J, Teslovich TM, Jansen R, Westra HJ, White CC, Absher D, Ahluwalia TS, Ahmad S, Albrecht E, Alves AC, Bragg-Gresham JL, de Craen AJ, Bis JC, Bonnefond A, Boucher G, Cadby G, Cheng YC, Chiang CW, Delgado G, Demirkan A, Dueker N, Eklund N, Eiriksdottir G, Eriksson J, Feenstra B, Fischer K, Frau F, Galesloot TE, Geller F, Goel A, Gorski M, Grammer TB, Gustafsson S, Haitjema S, Hottenga JJ, Huffman JE, Jackson AU, Jacobs KB, Johansson Å, Kaakinen M, Kleber ME, Lahti J, Mateo Leach I, Lehne B, Liu Y, Lo KS, Lorentzon M, Luan J, Madden PA, Mangino M, McKnight B, Medina-Gomez C, Monda KL, Montasser ME, Müller G, Müller-Nurasyid M, Nolte IM, Panoutsopoulou K, Pascoe L, Paternoster L, Rayner NW, Renström F, Rizzi F, Rose LM, Ryan KA, Salo P, Sanna S, Scharnagl H, Shi J, Smith AV, Southam L, Stančáková A, Steinthorsdottir V, Strawbridge RJ, Sung YJ, Tachmazidou I, Tanaka T, Thorleifsson G, Trompet S, Pervjakova N, Tyrer JP, Vandenput L, van der Laan SW, van der Velde N, van Setten J, van Vliet-Ostaptchouk JV, Verweij N, Vlachopoulou E, Waite LL, Wang SR, Wang Z, Wild SH, Willenborg C, Wilson JF, Wong A, Yang J, Yengo L, Yerges-Armstrong LM, Yu L, Zhang W, Zhao JH, Andersson EA, Bakker SJ, Baldassarre D, Banasik K, Barcella M, Barlassina C, Bellis C, Benaglio P, Blangero J, Blüher M, Bonnet F, Bonnycastle LL, Boyd HA, Bruinenberg M, Buchman AS, Campbell H, Chen YD, Chines PS, Claudi-Boehm S, Cole J, Collins FS, de Geus EJ, de Groot LC, Dimitriou M, Duan J, Enroth S, Eury E, Farmaki AE, Forouhi NG, Friedrich N, Gejman PV, Gigante B, Glorioso N, Go AS, Gottesman O, Gräßler J, Grallert H, Grarup N, Gu YM, Broer L, Ham AC, Hansen T, Harris TB, Hartman CA, Hassinen M, Hastie N, Hattersley AT, Heath AC, Henders AK, Hernandez D, Hillege H, Holmen O, Hovingh KG, Hui J, Husemoen LL, Hutri-Kähönen N, Hysi PG, Illig T, De Jager PL, Jalilzadeh S, Jørgensen T, Jukema JW, Juonala M, Kanoni S, Karaleftheri M, Khaw KT, Kinnunen L, Kittner SJ, Koenig W, Kolcic I, Kovacs P, Krarup NT, Kratzer W, Krüger J, Kuh D, Kumari M, Kyriakou T, Langenberg C, Lannfelt L, Lanzani C, Lotay V, Launer LJ, Leander K, Lindström J, Linneberg A, Liu YP, Lobbens S, Luben R, Lyssenko V, Männistö S, Magnusson PK, McArdle WL, Menni C, Merger S, Milani L, Montgomery GW, Morris AP, Narisu N, Nelis M, Ong KK, Palotie A, Pérusse L, Pichler I, Pilia MG, Pouta A, Rheinberger M, Ribel-Madsen R, Richards M, Rice KM, Rice TK, Rivolta C, Salomaa V, Sanders AR, Sarzynski MA, Scholtens S, Scott RA, Scott WR, Sebert S, Sengupta S, Sennblad B, Seufferlein T, Silveira A, Slagboom PE, Smit JH, Sparsø TH, Stirrups K, Stolk RP, Stringham HM, Swertz MA, Swift AJ, Syvänen AC, Tan ST, Thorand B, Tönjes A, Tremblay A, Tsafantakis E, van der Most PJ, Völker U, Vohl MC, Vonk JM, Waldenberger M, Walker RW, Wennauer R, Widén E, Willemsen G, Wilsgaard T, Wright AF, Zillikens MC, van Dijk SC, van Schoor NM, Asselbergs FW, de Bakker PI, Beckmann JS, Beilby J, Bennett DA, Bergman RN, Bergmann S, Böger CA, Boehm BO, Boerwinkle E, Boomsma DI, Bornstein SR, Bottinger EP, Bouchard C, Chambers JC, Chanock SJ, Chasman DI, Cucca F, Cusi D, Dedoussis G, Erdmann J, Eriksson JG, Evans DA, de Faire U, Farrall M, Ferrucci L, Ford I, Franke L, Franks PW, Froguel P, Gansevoort RT, Gieger C, Grönberg H, Gudnason V, Gyllensten U, Hall P, Hamsten A, van der Harst P, Hayward C, Heliövaara M, Hengstenberg C, Hicks AA, Hingorani A, Hofman A, Hu F, Huikuri HV, Hveem K, James AL, Jordan JM, Jula A, Kähönen M, Kajantie E, Kathiresan S, Kiemeney LA, Kivimaki M, Knekt PB, Koistinen HA, Kooner JS, Koskinen S, Kuusisto J, Maerz W, Martin NG, Laakso M, Lakka TA, Lehtimäki T, Lettre G, Levinson DF, Lind L, Lokki ML, Mäntyselkä P, Melbye M, Metspalu A, Mitchell BD, Moll FL, Murray JC, Musk AW, Nieminen MS, Njølstad I, Ohlsson C, Oldehinkel AJ, Oostra BA, Palmer LJ, Pankow JS, Pasterkamp G, Pedersen NL, Pedersen O, Penninx BW, Perola M, Peters A, Polašek O, Pramstaller PP, Psaty BM, Qi L, Quertermous T, Raitakari OT, Rankinen T, Rauramaa R, Ridker PM, Rioux JD, Rivadeneira F, Rotter JI, Rudan I, den Ruijter HM, Saltevo J, Sattar N, Schunkert H, Schwarz PE, Shuldiner AR, Sinisalo J, Snieder H, Sørensen TI, Spector TD, Staessen JA, Stefania B, Thorsteinsdottir U, Stumvoll M, Tardif JC, Tremoli E, Tuomilehto J, Uitterlinden AG, Uusitupa M, Verbeek AL, Vermeulen SH, Viikari JS, Vitart V, Völzke H, Vollenweider P, Waeber G, Walker M, Wallaschofski H, Wareham NJ, Watkins H, Zeggini E, CHARGE Consortium, DIAGRAM Consortium, GLGC Consortium, Global-BPGen Consortium, ICBP Consortium, MAGIC Consortium, Chakravarti A, Clegg DJ, Cupples LA, Gordon-Larsen P, Jaquish CE, Rao DC, Abecasis GR, Assimes TL, Barroso I, Berndt SI, Boehnke M, Deloukas P, Fox CS, Groop LC, Hunter DJ, Ingelsson E, Kaplan RC, McCarthy MI, Mohlke KL, O'Connell JR, Schlessinger D, Strachan DP, Stefansson K, van Duijn CM, Hirschhorn JN, Lindgren CM, Heid IM, North KE, Borecki IB, Kutalik Z, Loos RJ.
In-Text Gene Mentions

…GWA meta-analyses (nearNEGR1, TNNI3K ,…

…, EYA1 ,CCDC92, NSD1 ).…

Show Full Abstract

Genome-wide association studies (GWAS) have identified more than 100 genetic variants contributing to BMI, a measure of body size, or waist-to-hip ratio (adjusted for BMI, WHRadjBMI), a measure of body shape. Body size and shape change as people grow older and these changes differ substantially between men and women. To systematically screen for age- and/or sex-specific effects of genetic variants on BMI and WHRadjBMI, we performed meta-analyses of 114 studies (up to 320,485 individuals of European descent) with genome-wide chip and/or Metabochip data by the Genetic Investigation of Anthropometric Traits (GIANT) Consortium. Each study tested the association of up to ~2.8M SNPs with BMI and WHRadjBMI in four strata (men ≤50y, men >50y, women ≤50y, women >50y) and summary statistics were combined in stratum-specific meta-analyses. We then screened for variants that showed age-specific effects (G x AGE), sex-specific effects (G x SEX) or age-specific effects that differed between men and women (G x AGE x SEX). For BMI, we identified 15 loci (11 previously established for main effects, four novel) that showed significant (FDR<5%) age-specific effects, of which 11 had larger effects in younger (<50y) than in older adults (≥50y). No sex-dependent effects were identified for BMI. For WHRadjBMI, we identified 44 loci (27 previously established for main effects, 17 novel) with sex-specific effects, of which 28 showed larger effects in women than in men, five showed larger effects in men than in women, and 11 showed opposite effects between sexes. No age-dependent effects were identified for WHRadjBMI. This is the first genome-wide interaction meta-analysis to report convincing evidence of age-dependent genetic effects on BMI. In addition, we confirm the sex-specificity of genetic effects on WHRadjBMI. These results may provide further insights into the biology that underlies weight change with age or the sexually dimorphism of body shape.

Also flagged:SarcomaTP53MDM2soft-tissue sarcomasnutlincancer
Journal Article 2015-10-01 No Snippets Laroche A, Tran-Cong K, Chaire V, Lagarde P, Hostein I, Coindre JM, Chibon F, Neuville A, Lesluyes T, Lucchesi C, Italiano A.
Show Full Abstract

Nutlin inhibits TP53-MDM2 interaction and is under investigation in soft-tissue sarcomas (STS) and other malignancies. Molecular mechanisms of secondary resistance to nutlin in STS are unknown. We performed whole-transcriptome sequencing (RNA-seq) on three pretreatment and secondary resistant STS cell lines selected based on their high primary sensitivity to nutlin. Our data identified a subset of cancer gene mutations and ploidy variations that were positively selected following treatment, including TP53 mutations in 2 out of 3 resistant cell lines. Further, secondary resistance to nutlin was associated with deregulation of apoptosis-related genes and marked productive autophagy, the inhibition of which resulted in significant restoration of nutlin-induced cell death. Collectively, our findings argue that secondary resistance to nutlin in STS involved heterogeneous mechanisms resulting from clonal evolution and several biological pathways. Alternative dosing regimens and combination with other targeted agents are needed to achieve successful development of nutlin in the clinical setting.

Also flagged:serotoninADHDinhibitionattention-deficit/hyperactivity disorderHTR1B5HTT
Journal Article 2015-10-01 ✓ 2 Snippets van Rooij D, Hartman CA, van Donkelaar MM, Bralten J, von Rhein D, Hakobjan M, Franke B, Heslenfeld DJ, Oosterlaan J, Rommelse N, Buitelaar JK, Hoekstra PJ.
In-Text Gene Mentions

Given the role of serotonin in ADHD and impulsivity, we postulated that genetic variants within the serotonin pathway might influence response inhibition.<h4>Methods</h4>We measured neural activation during stop-signal task performance in adolescents with ADHD (N = 185), their unaffected siblings (N = 111), and healthy controls (N = 124), and investigated the relationship of two serotonin gene polymorphisms (the rs6296 SNP of the HTR1B gene and HTTLPR variants of the 5-HTT gene) with the neural correlates of response inhibition.<h4>Results</h4>The whole-brain analyses demonstrated large scale neural activation differences in the inferior and medial frontal and temporal/parietal regions of the response inhibition network between the different variants of both the HTR1B and 5HTT genes.

…variants of the5-HTTgene) with the…

Show Full Abstract

<h4>Objectives</h4>Deficits in response inhibition have been associated with attention-deficit/hyperactivity disorder (ADHD). Given the role of serotonin in ADHD and impulsivity, we postulated that genetic variants within the serotonin pathway might influence response inhibition.<h4>Methods</h4>We measured neural activation during stop-signal task performance in adolescents with ADHD (N = 185), their unaffected siblings (N = 111), and healthy controls (N = 124), and investigated the relationship of two serotonin gene polymorphisms (the rs6296 SNP of the HTR1B gene and HTTLPR variants of the 5-HTT gene) with the neural correlates of response inhibition.<h4>Results</h4>The whole-brain analyses demonstrated large scale neural activation differences in the inferior and medial frontal and temporal/parietal regions of the response inhibition network between the different variants of both the HTR1B and 5HTT genes. Activation in these regions was significantly associated with stop-task performance, but not with ADHD diagnosis or severity. No associations were found between HTR1B and 5HTT variants and ADHD or ADHD-related neural activation.<h4>Conclusions</h4>These results provide novel evidence that serotonin may play an important role in the neurobiology of response inhibition. Although response inhibition is strongly linked to ADHD, serotonin linked genetic variants associated with response inhibition and its neural correlates do not explain variance of the ADHD phenotype.

Also flagged:Schizophreniagene expressionpathogenesisneurogenesissynaptogenesismelanoma
Journal Article 2015-10-01 No Snippets Warburton A, Breen G, Bubb VJ, Quinn JP.
Show Full Abstract

Single nucleotide polymorphisms (SNPs) within the MIR137 gene locus have been shown to confer risk for schizophrenia through genome-wide association studies (GWAS). The expression levels of microRNA-137 (miR-137) and its validated gene targets have also been shown to be disrupted in several neuropsychiatric conditions, including schizophrenia. Regulation of miR-137 expression is thus imperative for normal neuronal functioning. We previously characterized an internal promoter domain within the MIR137 gene that contained a variable number tandem repeat (VNTR) polymorphism and could alter the in vitro levels of miR-137 in a stimulus-induced and allele-specific manner. We now demonstrate that haplotype tagging-SNP analysis linked the rs1625579 GWAS SNP for schizophrenia to this internal MIR137 promoter through a proxy SNP rs2660304 located at this domain. We postulated that the rs2660304 promoter SNP may act as predisposing factor for schizophrenia through altering the levels of miR-137 expression in a genotype-dependent manner. Reporter gene analysis of the internal MIR137 promoter containing the common VNTR variant demonstrated genotype-dependent differences in promoter activity with respect to rs2660304. In line with previous reports, the major allele of the rs2660304 proxy SNP, which has previously been linked with schizophrenia risk through genetic association, resulted in downregulation of reporter gene expression in a tissue culture model. The genetic influence of the rs2660304 proxy SNP on the transcriptional activity of the internal MIR137 promoter, and thus the levels of miR-137 expression, therefore offers a distinct regulatory mechanism to explain the functional significance of the rs1625579 GWAS SNP for schizophrenia risk.

Also flagged:endometrial stromal sarcomaJAZF1JJAZ1uterine sarcomasSUZ12PHF1
Journal Article 2015-10-01 ✓ 3 Snippets Choi YJ, Jung SH, Kim MS, Baek IP, Rhee JK, Lee SH, Hur SY, Kim TM, Chung YJ, Lee SH.
In-Text Gene Mentions

Also, by analyzing the CHASM to distinguish driver and passenger mutations, we identified ten putative cancer-related mutations (THSD7A, TBC1D14, TTK, SLC38A1, CTNNA2, SUPT6H, DCC, MDGA2, CNNM1 and MYO19) [18].

…SLC38A1, CTNNA2, SUPT6H,DCC, MDGA2, CNNM1 and…

…( SRGAP3, PPARG,DCCand ZFP36L2 )…

Show Full Abstract

Although recurrent gene fusions such as JAZF1-JJAZ1 are considered driver events for endometrial stromal sarcoma (ESS) development, other genomic alterations remain largely unknown. In this study, we performed whole-exome sequencing, transcriptome sequencing and copy number profiling for five ESSs (three low-grade ESS (LG-ESS) and two undifferentiated uterine sarcomas (UUSs)). All three LG-ESSs exhibited either one of JAZF1-SUZ12, JAZF1-PHF1 and MEAF6-PHF1 fusions, whereas the two UUSs did not. All ESSs except one LG-ESS exhibited copy number alterations (CNAs), many of which encompassed cancer-related genes. In UUSs, five CNAs encompassing cancer-related genes (EZR, CDH1, RB1, TP53 and PRKAR1A) accompanied their expressional changes, suggesting that they might stimulate UUS development. We found 81 non-silent mutations (35 from LG-ESSs and 46 from UUSs) that included 15 putative cancer genes catalogued in cancer-related databases, including PPARG and IRF4 mutations. However, they were non-recurrent and did not include any well-known mutations, indicating that point mutations may not be a major driver for ESS development. Our data show that gene fusions and CNAs are the principal drivers for LG-ESS and USS, respectively, but both may require additional genomic alterations including point mutations. These differences may explain the different biologic behaviors between LG-ESS and UUS. Our findings suggest that ESS development requires point mutations and CNAs as well as the gene fusions.

Also flagged:fibromyalgiasickle cell diseasesickle cellchronic pain syndromejuvenile fibromyalgiasickle
Journal Article 2015-10-01 ✓ 1 Snippet Ramprakash S, Fishman D.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Juvenile fibromyalgia in children with sickle cell disease has not been reported in the literature. We report an adolescent patient with sickle cell whose pain symptoms progressed from having recurrent acute sickle cell pain crisis episodes to a chronic pain syndrome over several years. He was eventually diagnosed with juvenile fibromyalgia based on the clinical history and myofascial tender points and his pain symptoms responded better to multidisciplinary strategies for chronic fibromyalgia pain. Chronic pain in sickle cell disease is an area of poor research, and in addition there is inconsistency in the definition of chronic pain in sickle cell disease. Central sensitisation to pain is shown to occur after recurrent painful stimuli in a genetically vulnerable individual. In a chronic pain condition such as fibromyalgia central sensitisation is thought to play a key role. Fibromyalgia should be considered as one of the main differential diagnosis in any sickle cell patient with chronic pain.

Also flagged:p53MDM2Bcl-2chronic myeloid leukemiaBcr-Abltyrosine kinase
Journal Article 2015-10-01 No Snippets Carter BZ, Mak PY, Mak DH, Ruvolo VR, Schober W, McQueen T, Cortes J, Kantarjian HM, Champlin RE, Konopleva M, Andreeff M.
Show Full Abstract

The Bcr-Abl tyrosine kinase regulates several Bcl-2 family proteins that confer resistance to apoptosis in chronic myeloid leukemia (CML) cells. Given p53's ability to modulate the expression and activity of Bcl-2 family members, we hypothesized that targeting Bcr-Abl, Bcl-2, and p53 concomitantly could have therapeutic benefits in blast crisis (BC) CML and in quiescent CML CD34+ cells that are insensitive to tyrosine kinase inhibitors (TKI). We examined the effects of the MDM2 inhibitor nutlin3a and its combination with the dual Bcl-2 and Bcl-xL inhibitor ABT-737, and the Bcr-Abl inhibitor nilotinib on BC CML patient samples. We found that in quiescent CD34+ progenitors, p53 expression is significantly lower, and MDM2 is higher, compared to their proliferating counterparts. Treatment with nutlin3a induced apoptosis in bulk and CD34+CD38- cells, and in both proliferating and quiescent CD34+ progenitor CML cells. Nutlin3a synergized with ABT-737 and nilotinib, in part by inducing pro-apoptotic, and suppressing anti-apoptotic, Bcl-2 proteins. Nilotinib inhibited the expression of Bcl-xL and Mcl-1 in BC CML cells. These results demonstrate that p53 activation by MDM2 blockade can sensitize BC CML cells, including quiescent CD34+ cells, to Bcl-2 inhibitor- and TKI-induced apoptosis. This novel strategy could be useful in the therapy of BC CML.

Also flagged:UBA1UbiquitinNeurodegenerative diseasesdeathUbiquitin-like modifier activating enzyme 1E1 ubiquitin-activating enzyme
Journal Article 2015-10-01 ✓ 4 Snippets Groen EJN, Gillingwater TH.
In-Text Gene Mentions

a neurodegenerative disease characterized by the degeneration of striatal neurons and caused by a polyglutamine (polyQ) repeat expansion in the gene encoding huntingtin (HTT).

Pathologically, HD is characterized by intraneuronal and intranuclear inclusion bodies that are positive for mutant HTT protein and, often, ubiquitin.

…encoding huntingtin (HTT).…

…positive for mutantHTTprotein and, often,…

Show Full Abstract

Neurodegenerative diseases are a leading cause of disability and early death. A common feature of these conditions is disruption of protein homeostasis. Ubiquitin-like modifier activating enzyme 1 (UBA1), the E1 ubiquitin-activating enzyme, sits at the apex of the ubiquitin cascade and represents an important regulator of cellular protein homeostasis. Critical contributions of UBA1-dependent pathways to the regulation of homeostasis and degeneration in the nervous system are emerging, including specific disruption of UBA1 in spinal muscular atrophy (SMA) and Huntington's disease (HD). In this review we discuss recent findings that put UBA1 at the centre of cellular homeostasis and neurodegeneration, highlighting the potential for UBA1 to act as a promising therapeutic target for a range of neurodegenerative diseases.

Ironing out Ferroportin.

Also flagged:ironmetabolismerythropoiesismembraneiron-regulatory hormonetranslational
Journal Article 2015-10-01 No Snippets Drakesmith H, Nemeth E, Ganz T.
Show Full Abstract

Maintaining physiologic iron concentrations in tissues is critical for metabolism and host defense. Iron absorption in the duodenum, recycling of iron from senescent erythrocytes, and iron mobilization from storage in macrophages and hepatocytes constitute the major iron flows into plasma for distribution to tissues, predominantly for erythropoiesis. All iron transfer to plasma occurs through the iron exporter ferroportin. The concentration of functional membrane-associated ferroportin is controlled by its ligand, the iron-regulatory hormone hepcidin, and fine-tuned by regulatory mechanisms serving iron homeostasis, oxygen utilization, host defense, and erythropoiesis. Fundamental questions about the structure and biology of ferroportin remain to be answered.

Also flagged:PZPAF10DOT1Lmethylationamino acidsbinding
Journal Article 2015-10-01 ✓ 1 Snippet Chen S, Yang Z, Wilkinson AW, Deshpande AJ, Sidoli S, Krajewski K, Strahl BD, Garcia BA, Armstrong SA, Patel DJ, Gozani O.
In-Text Gene Mentions

AF10, a DOT1L cofactor, is required for H3K79 methylation and cooperates with DOT1L in leukemogenesis.

Show Full Abstract

AF10, a DOT1L cofactor, is required for H3K79 methylation and cooperates with DOT1L in leukemogenesis. However, the molecular mechanism by which AF10 regulates DOT1L-mediated H3K79 methylation is not clear. Here we report that AF10 contains a "reader" domain that couples unmodified H3K27 recognition to H3K79 methylation. An AF10 region consisting of a PHD finger-Zn knuckle-PHD finger (PZP) folds into a single module that recognizes amino acids 22-27 of H3, and this interaction is abrogated by H3K27 modification. Structural studies reveal that H3 binding triggers rearrangement of the PZP module to form an H3(22-27)-accommodating channel and that the unmodified H3K27 side chain is encased in a compact hydrogen-bond acceptor-lined cage. In cells, PZP recognition of H3 is required for H3K79 dimethylation, expression of DOT1L-target genes, and proliferation of DOT1L-addicted leukemic cells. Together, our results uncover a pivotal role for H3K27-via readout by the AF10 PZP domain-in regulating the cancer-associated enzyme DOT1L.

Also flagged:vesiclestranslationalHydrogensulfidecysteinethiols
Journal Article 2015-10-01 No Snippets Paul BD, Snyder SH.
Show Full Abstract

Hydrogen sulfide (H2S) is a member of the growing family of gasotransmitters. Once regarded as a noxious molecule predominantly present in the atmosphere, H2S is now known to be synthesized endogenously in mammals. H2S participates in a myriad of physiological processes ranging from regulation of blood pressure to neuroprotection. Its chemical nature precludes H2S from being stored in vesicles and acting on receptor proteins in the fashion of other chemical messengers. Thus, novel cellular mechanisms have evolved to mediate its effects. This review focuses on sulfhydration (or persulfidation), which appears to be the principal post-translational modification elicited by H2S.

Also flagged:Obesitychildhood obesityPediatric ObesityNAMPTdevelopmental delaymethylation
Journal Article 2015-10-01 No Snippets Chesi A, Grant SFA.
Show Full Abstract

Obesity among children and adults has notably escalated over recent decades and represents a global major health problem. We now know that both genetic and environmental factors contribute to its complex etiology. Genome-wide association studies (GWAS) have revealed compelling genetic signals influencing obesity risk in adults. Recent reports for childhood obesity revealed that many adult loci also play a role in the pediatric setting. Childhood GWAS have uncovered novel loci below the detection range in adult studies, suggesting that obesity genes may be more easily uncovered in the pediatric setting. Shedding light on the genetic architecture of childhood obesity will facilitate the prevention and treatment of pediatric cases, and will have fundamental implications for diseases that present later in life.

Also flagged:anemiahemoglobingastrointestinal bleeding
Journal Article 2015-10-01 No Snippets Rodrigues ES, Ramakrishna H.
Show Full Abstract

No abstract available.

Also flagged:Neurodegenerative Diseaseageingneurodegenerative diseasesamyotrophic lateral sclerosistranslationalHD
Journal Article 2015-10-01 ✓ 1 Snippet McGurk L, Berson A, Bonini NM.
In-Text Gene Mentions

HTT

Show Full Abstract

With the increase in the ageing population, neurodegenerative disease is devastating to families and poses a huge burden on society. The brain and spinal cord are extraordinarily complex: they consist of a highly organized network of neuronal and support cells that communicate in a highly specialized manner. One approach to tackling problems of such complexity is to address the scientific questions in simpler, yet analogous, systems. The fruit fly, Drosophila melanogaster, has been proven tremendously valuable as a model organism, enabling many major discoveries in neuroscientific disease research. The plethora of genetic tools available in Drosophila allows for exquisite targeted manipulation of the genome. Due to its relatively short lifespan, complex questions of brain function can be addressed more rapidly than in other model organisms, such as the mouse. Here we discuss features of the fly as a model for human neurodegenerative disease. There are many distinct fly models for a range of neurodegenerative diseases; we focus on select studies from models of polyglutamine disease and amyotrophic lateral sclerosis that illustrate the type and range of insights that can be gleaned. In discussion of these models, we underscore strengths of the fly in providing understanding into mechanisms and pathways, as a foundation for translational and therapeutic research.

Also flagged:biosynthesisquantum dotsextracellularHe2synthesisnanocrystals
Journal Article 2015-10-01 ✓ 2 Snippets Unknown Authors
In-Text Gene Mentions

…), peroxiredoxin 6 (Prdx6), phosphatidylethan…

…�binding protein 1 (Pebp1/Rkip), and histone …

Show Full Abstract

No abstract available.

Also flagged:HLAimmune responseshuman leukocyte antigencell surfacemajor histocompatibility complexchromosome
Journal Article 2015-10-01 ✓ 1 Snippet Ichinohe T.
In-Text Gene Mentions

…molecules (MICA, MICB,HFE, MR1, CD1, FcRn)…

Show Full Abstract

Human immune responses are principally characterized by the human leukocyte antigen (HLA) system, a diverse set of cell surface molecules encoded by the major histocompatibility complex gene cluster on the short arm of chromosome 6. Among various members of the HLA family, the best characterized are the classic highly polymorphic class I and class II molecules that are responsible for antigen presentation to T cells and regulation of NK cell functions. In allogeneic hematopoietic cell transplantation, sophisticated approaches to donor-recipient allele-level matching at 3 class I (HLA-A/B/C) and 3 class II (HLA-DRB1/DQB1/DPB1) loci have been proven to lower the risk of immunologic complications such as graft failure and graft-versus-host disease, and possibly to confer effective graft-versus-malignancy effects. Future areas of research include clarifying the role of relatively non-polymorphic non-classical HLA molecules (HLA-E/F/G, HLA-DM/DO) and polymorphic/non-polymorphic class I-related molecules (MICA, MICB, HFE, MR1, CD1, FcRn) in the immune regulation that follows hematopoietic cell transplantation.

Also flagged:Gastric cancercancerRF1KATO IIItumorpathogenesis
Journal Article 2015-10-01 No Snippets Zhang X, Peng Y, Jin Z, Huang W, Cheng Y, Liu Y, Feng X, Yang M, Huang Y, Zhao Z, Wang L, Wei Y, Fan X, Zheng D, Meltzer SJ.
Show Full Abstract

Gastric cancer (GC) is one of the leading causes of cancer-related deaths throughout China and worldwide. The discovery of microRNAs (miRNAs) has provided a new opportunity for developing diagnostic biomarkers and effective therapeutic targets in GC. By performing microarray analyses of benign and malignant gastric epithelial cell lines (HFE145, NCI-N87, MKN28, RF1, KATO III and RF48), 16 significantly dysregulated miRNAs were found. 11 of these were validated by real-time qRT-PCR. Based on miRWalk online database scans, 703 potential mRNA targets of the 16 miRNAs were identified. Bioinformatic analyses suggested that these dysregulated miRNAs and their predicted targets were principally involved in tumor pathogenesis, MAPK signaling, and apoptosis. Finally, miRNA-gene network analyses identified miRNA-125b as a crucial miRNA in GC development. Taken together, these results develop a comprehensive expression and functional profile of differentially expressed miRNAs related to gastric oncogenesis. This profile may serve as a potential tool for biomarker and therapeutic target identification in GC patients.

Also flagged:Cdx2transcription factorBarrett's esophagusBEIL-1βK14
Journal Article 2015-10-01 No Snippets Kong J, Sai H, Crissey MA, Jhala N, Falk GW, Ginsberg GG, Abrams JA, Nakagawa H, Wang K, Rustgi AK, Wang TC, Lynch JP.
Show Full Abstract

Cdx2, an intestine specific transcription factor, is expressed in Barrett's esophagus (BE). We sought to determine if esophageal Cdx2 expression would accelerate the onset of metaplasia in the L2-IL-1β transgenic mouse model for Barrett's-like metaplasia. The K14-Cdx2::L2-IL-1β double transgenic mice had half as many metaplastic nodules as control L2-IL-1β mice. This effect was not due to a reduction in esophageal IL-1β mRNA levels nor diminished systemic inflammation. The diminished metaplasia was due to an increase in apoptosis in the K14-Cdx2::L2-IL-1β mice. Fluorescence activated cell sorting of immune cells infiltrating the metaplasia identified a population of CD11b+Gr-1+ cells that are significantly reduced in K14-Cdx2::L2-IL-1β mice. These cells have features of immature granulocytes and have immune-suppressing capacity. We demonstrate that the apoptosis in K14-Cdx2::L2-IL-1β mice is CD8+ T cell dependent, which CD11b+Gr-1+ cells are known to inhibit. Lastly, we show that key regulators of CD11b+Gr-1+ cell development, IL-17 and S100A9, are significantly diminished in the esophagus of K14-Cdx2::L2-IL-1β double transgenic mice. We conclude that metaplasia development in this mouse model for Barrett's-like metaplasia requires suppression of CD8+ cell dependent apoptosis, likely mediated by immune-suppressing CD11b+Gr-1+ immature myeloid cells.

Also flagged:Parkinson's diseasePDpathogenesisSTK39BST1HLA-DQB1
Journal Article 2015-10-01 No Snippets Chang KH, Wu YR, Chen YC, Fung HC, Lee-Chen GJ, Chen CM.
Show Full Abstract

Neuroinflammation is emerging as an important pathway involved in Parkinson's disease (PD) pathogenesis. Herein, we investigated the effect of 4 top PD-associated genetic variants in Caucasians listed on the top risk loci identified by meta-analysis of genome wide-association studies in PDGene database (http://www.pdgene.org/top_results), including serine threonine kinase 39 (STK39) rs1955337, bone marrow stromal cell antigen 1 (BST1) rs11724635, major histocompatibility complex, class II, DQ beta 1 (HLA-DQB1) rs9275326, and signal peptide peptidase-like 2B (SPPL2B) rs62120679, by genotyping 596 Han-Chinese patients with PD and 597 age-matched control subjects. Compared with subjects with STK39 rs1955337 GG genotype, those with TT genotype had a 1.64-fold increased risk of PD (95% confidence interval: 1.13-2.39, P = 0.010). The recessive model also demonstrated an increased PD risk in TT genotype (odds ratio: 1.59, 95% confidence interval: 1.12-2.27) compared with the other genotypes (GT + GG). PD patients demonstrate a similar genotypic and allelic frequency in BST1 rs11724635, HLA-DQB1 rs9275326, and SPPL2B rs62120679 compared with controls. These findings suggested that the STK39 rs1955337 TT genotype is a risk factor for Han-Chinese patients with PD in Taiwan. The ethnic discrepancies of the other 3 genetic variants may indicate a distinct genetic background of neuroinflammation between PD patients in Han-Chinese and Caucasians.

Also flagged:integrin-linked kinasegene expressionILKmechanotransductionenergy homeostasisjunction
Journal Article 2015-10-01 No Snippets Sontam DM, Firth EC, Tsai P, Vickers MH, O'Sullivan JM.
Show Full Abstract

Mechanical loading is essential to maintain optimal skeletal health. Despite the fact that early-life exercise has positive, long-lasting effects on the musculo-skeletal system, the response of the musculo-skeletal system to spontaneous low-impact exercise has been poorly studied. Previously, we identified subtle morphological changes in the femoral diaphysis of exercised animals compared to nonexercised controls. We hypothesized that significant changes in gene expression of cells should precede significant measurable phenotypic changes in the tissues of which they are part. Here, we employed RNA-Seq to analyse the transcriptome of the cortical bone from the femoral mid-diaphysis of prepubertal male Sprague-Dawley rats that were assigned to control (CON); bipedal stance (BPS); or wheel exercise (WEX) groups for 15 days. We identified 808 and 324 differentially expressed transcripts in the BPS and WEX animals respectively. While a number of transcripts change their levels in an exercise-specific manner, we identified 191 transcripts that were differentially expressed in both BPS and WEX. Importantly, we observed that the exercise mode had diametrically opposite effects on transcripts for multiple genes within the integrin-linked kinase (ILK) and Ca(2+) signaling pathways such that they were up-regulated in BPS and down-regulated in WEX. The findings are important for our understanding of possible ways in which different exercise regimens might affect bone when normal activities apply mechanical stimuli during postnatal growth and development.

Also flagged:peroxiredoxin 1PRDX1liver cancertranslationaltumorcytosol
Journal Article 2015-10-01 ✓ 1 Snippet Sun YL, Cai JQ, Liu F, Bi XY, Zhou LP, Zhao XH.
In-Text Gene Mentions

PRDX6

Show Full Abstract

<h4>Aim</h4>To investigate the expression characteristics of peroxiredoxin 1 (PRDX1) mRNA and protein in liver cancer cell lines and tissues.<h4>Methods</h4>The RNA sequencing data from 374 patients with liver cancer were obtained from The Cancer Genome Atlas. The expression and clinical characteristics of PRDX1 mRNA were analyzed in this dataset. The Kaplan-Meier and Cox regression survival analysis was performed to determine the relationship between PRDX1 levels and patient survival. Subcellular fractionation and Western blotting were used to demonstrate the expression of PRDX1 protein in six liver cancer cell lines and 29 paired fresh tissue specimens. After bioinformatics prediction, a putative post-translational modification form of PRDX1 was observed using immunofluorescence under confocal microscopy and immunoprecipitation analysis in liver cancer cells.<h4>Results</h4>The mRNA of PRDX1 gene was upregulated about 1.3-fold in tumor tissue compared with the adjacent non-tumor control (P = 0.005). Its abundance was significantly higher in men than women (P < 0.001). High levels of PRDX1 mRNA were associated with a shorter overall survival time (P = 0.04) but not with recurrence-free survival. The Cox regression analysis demonstrated that patients with high PRDX1 mRNA showed about 1.9-fold increase of risk for death (P = 0.03). In liver cancer cells, PRDX1 protein was strongly expressed with multiple different bands. PRDX1 in the cytosol fraction existed near the theoretical molecular weight, whereas two higher molecular weight bands were present in the membrane/organelle and nuclear fractions. Importantly, the theoretical PRDX1 band was increased, whereas the high molecular weight form was decreased in tumor tissues. Subsequent experiments revealed that the high molecular weight bands of PRDX1 might result from the post-translational modification by small ubiquitin-like modifier-1 (SUMO1).<h4>Conclusion</h4>PRDX1 was overexpressed in the tumor tissues of liver cancer and served as an independent poor prognostic factor for overall survival. PRDX1 can be modified by SUMO to play specific roles in hepatocarcinogenesis.

Also flagged:oxygenphotoreceptorglutaminehydrogensalt
Journal Article 2015-10-01 No Snippets Bocola M, Schwaneberg U, Jaeger KE, Krauss U.
Show Full Abstract

The modularity of light, oxygen, voltage (LOV) blue-light photoreceptors has recently been exploited for the design of LOV-based optogenetic tools, which allow the light-dependent control of biological functions. For the understanding of LOV sensory function and hence the optimal design of LOV-based optogentic tools it is essential to gain an in depth atomic-level understanding of the underlying photoactivation and intramolecular signal-relay mechanisms. To address this question we performed molecular dynamics simulations on both the dark- and light-adapted state of PpSB1-LOV, a short dimeric bacterial LOV-photoreceptor protein, recently crystallized under constant illumination. While LOV dimers remained globally stable during the light-state simulation with regard to the Jα coiled-coil, distinct conformational changes for a glutamine in the vicinity of the FMN chromophore are observed. In contrast, multiple Jα-helix conformations are sampled in the dark-state. These changes coincide with a displacement of the Iβ and Hβ strands relative to the light-state structure and result in a correlated rotation of both LOV core domains in the dimer. These global changes are most likely initiated by the reorientation of the conserved glutamine Q116, whose side chain flips between the Aβ (dark state) and Hβ strand (light state), while maintaining two potential hydrogen bonds to FMN-N5 and FMN-O4, respectively. This local Q116-FMN reorientation impacts on an inter-subunit salt-bridge (K117-E96), which is stabilized in the light state, hence accounting for the observed decreased mobility. Based on these findings we propose an alternative mechanism for dimeric LOV photoactivation and intramolecular signal-relay, assigning a distinct structural role for the conserved "flipping" glutamine. The proposed mechanism is discussed in light of universal applicability and its implications for the understanding of LOV-based optogenetic tools.

Also flagged:Triacylglycerol SynthesisLactationfatty acidstriacylglycerolsynthesissecretion
Journal Article 2015-10-01 ✓ 1 Snippet Lv Y, Guan W, Qiao H, Wang C, Chen F, Zhang Y, Liao Z.
In-Text Gene Mentions

…lipid droplet formation (BTN2A1, XDH, PLIN2), and…

Show Full Abstract

Mammalian milk is a key source of lipids, providing not only important calories but also essential fatty acids. Veterinary medicine and omics systems sciences intersection, termed as "veterinomics" here, has received little attention to date but stands to offer much promise for building bridges between human and animal health. We determined the changes in porcine mammary genes and proteomics expression associated with milk triacylglycerol (TAG) synthesis and secretion from late pregnancy to lactation. TAG content and fatty acid (FA) composition were determined in porcine colostrum (the 1st day of lactation) and milk (the 17th day of lactation). The mammary transcriptome for 70 genes and 13 proteins involved in TAG synthesis and secretion from six sows, each at d -17(late pregnancy), d 1(early lactation), and d 17 (peak lactation) relative to parturition were analyzed using quantitative real-time PCR and Western blot analyses. The TAG content and the concentrations of de novo synthesized FAs, saturated FAs, and monounsaturated FAs were higher in milk than in colostrum (p<0.05). Robust upregulation with high relative mRNA abundance was evident during lactation for genes associated with FA uptake (VLDLR, LPL, CD36), FA activation (ACSS2, ACSL3), and intracellar transport (FABP3), de novo FA synthesis (ACACA, FASN), FA elongation (ELOVL1), FA desaturation (SCD, FADS1), TAG synthesis (GPAM, AGPAT1, LPIN1, DGAT1), lipid droplet formation (BTN2A1, XDH, PLIN2), and transcription factors and nuclear receptors (SREBP1, SCAP, INSIG1/2). In conclusion, a wide variety of lipogenic genes and proteins regulate the channeling of FAs towards milk TAG synthesis and secretion in porcine mammary gland tissue. These findings inform future omics strategies to increase milk fat production and lipid profile and attest to the rise of both veterinomics and lipidomics in postgenomics life sciences.

Also flagged:HSPGsglycosaminoglycanheparan sulfateSdcglypicanscore protein
Journal Article 2015-10-01 No Snippets Poulain FE, Yost HJ.
Show Full Abstract

Heparan sulfate proteoglycans (HSPGs) have long been implicated in a wide range of cell-cell signaling and cell-matrix interactions, both in vitro and in vivo in invertebrate models. Although many of the genes that encode HSPG core proteins and the biosynthetic enzymes that generate and modify HSPG sugar chains have not yet been analyzed by genetics in vertebrates, recent studies have shown that HSPGs do indeed mediate a wide range of functions in early vertebrate development, for example during left-right patterning and in cardiovascular and neural development. Here, we provide a comprehensive overview of the various roles of HSPGs in these systems and explore the concept of an instructive heparan sulfate sugar code for modulating vertebrate development.

Also flagged:paclitaxelhydroxyapatitefolic acidpolyethylene glycoltitanium dioxidealkaline phosphatase
Journal Article 2015-10-01 No Snippets Venkatasubbu GD, Ramasamy S, Gaddam PR, Kumar J.
Show Full Abstract

Nanoparticles are widely used for targeted drug delivery applications. Surface modification with appropriate polymer and ligands is carried out to target the drug to the affected area. Toxicity analysis is carried out to evaluate the safety of the surface modified nanoparticles. In this study, paclitaxel attached, folic acid functionalized, polyethylene glycol modified hydroxyapatite and titanium dioxide nanoparticles were used for targeted drug delivery system. The toxicological behavior of the system was studied in vivo in rats and mice. Acute and subchronic studies were carried out. Biochemical, hematological, and histopathological analysis was also done. There were no significant alterations in the biochemical parameters at a low dosage. There was a small change in alkaline phosphatase (ALP) level at a high dosage. The results indicate a safe toxicological profile.

Also flagged:Gastric cancercancerscancercell cycleAKTepithelial-mesenchymal transition
Journal Article 2015-10-01 No Snippets Yang Q, Zhang RW, Sui PC, He HT, Ding L.
Show Full Abstract

Gastric cancer (GC) is one of the most common cancers in the world and a significant threat to the health of patients, especially those from China and Japan. The prognosis for patients with late stage GC receiving the standard of care treatment, including surgery, chemotherapy and radiotherapy, remains poor. Developing novel treatment strategies, identifying new molecules for targeted therapy, and devising screening techniques to detect this cancer in its early stages are needed for GC patients. The discovery of non-coding RNAs (ncRNAs), primarily microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), helped to elucidate the mechanisms of tumorigenesis, diagnosis and treatment of GC. Recently, significant research has been conducted on non-coding RNAs and how the regulatory dysfunction of these RNAs impacts the tumorigenesis of GC. In this study, we review papers published in the last five years concerning the dysregulation of non-coding RNAs, especially miRNAs and lncRNAs, in GC. We summarize instances of aberrant expression of the ncRNAs in GC and their effect on survival-related events, including cell cycle regulation, AKT signaling, apoptosis and drug resistance. Additionally, we evaluate how ncRNA dysregulation affects the metastatic process, including the epithelial-mesenchymal transition, stem cells, transcription factor activity, and oncogene and tumor suppressor expression. Lastly, we determine how ncRNAs affect angiogenesis in the microenvironment of GC. We further discuss the use of ncRNAs as potential biomarkers for use in clinical screening, early diagnosis and prognosis of GC. At present, no ideal ncRNAs have been identified as targets for the treatment of GC.

Also flagged:nonalcoholic fatty liver diseaseNAFLDliver diseasesmetabolismwound healingPatatin-like phosholipase domain-containing 3
Journal Article 2015-10-01 No Snippets Macaluso FS, Maida M, Petta S.
Show Full Abstract

In the Western world, nonalcoholic fatty liver disease (NAFLD) is considered as one of the most significant liver diseases of the twenty-first century. Its development is certainly driven by environmental factors, but it is also regulated by genetic background. The role of heritability has been widely demonstrated by several epidemiological, familial, and twin studies and case series, and likely reflects the wide inter-individual and inter-ethnic genetic variability in systemic metabolism and wound healing response processes. Consistent with this idea, genome-wide association studies have clearly identified Patatin-like phosholipase domain-containing 3 gene variant I148M as a major player in the development and progression of NAFLD. More recently, the transmembrane 6 superfamily member 2 E167K variant emerged as a relevant contributor in both NAFLD pathogenesis and cardiovascular outcomes. Furthermore, numerous case-control studies have been performed to elucidate the potential role of candidate genes in the pathogenesis and progression of fatty liver, although findings are sometimes contradictory. Accordingly, we performed a comprehensive literature search and review on the role of genetics in NAFLD. We emphasize the strengths and weaknesses of the available literature and outline the putative role of each genetic variant in influencing susceptibility and/or progression of the disease.

Also flagged:BMI1tumorspT1chronic inflammationdysplasiaBMI-1
Journal Article 2015-10-01 No Snippets De Faveri LE, Hurst CD, Roulson JA, Wood H, Sanchez-Carbayo M, Knowles MA, Chapman EJ.
Show Full Abstract

Urothelial carcinoma (UC) causes significant morbidity and remains the most expensive cancer to treat because of the need for repeated resections and lifelong monitoring for patients with non-muscle-invasive bladder cancer (NMIBC). Novel therapeutics and stratification approaches are needed to improve the outlook for both NMIBC and muscle-invasive bladder cancer. We investigated the expression and effects of B Lymphoma Mo-MLV Insertion Region 1 (BMI1) in UC. BMI1 was found to be overexpressed in most UC cell lines and primary tumors by quantitative real-time polymerase chain reaction and immunohistochemistry. In contrast to some previous reports, no association with tumor stage or grade was observed in two independent tumor panels. Furthermore, upregulation of BMI1 was detected in premalignant bladder lesions, suggesting a role early in tumorigenesis. BMI1 is not located within a common region of genomic amplification in UC. The CDKN2A locus (which encodes the p16 tumor suppressor gene) is a transcriptional target of BMI1 in some cellular contexts. In UC cell lines and primary tissues, no correlation between BMI1 and p16 expression was observed. Retroviral-mediated overexpression of BMI1 immortalized normal human urothelial cells (NHUC) in vitro and was associated with induction of telomerase activity, bypass of senescence, and repression of differentiation. The effects of BMI1 on gene expression were identified by expression microarray analysis of NHUC-BMI1. Metacore analysis of the gene expression profile implicated downstream effects of BMI1 on α4/β1 integrin-mediated adhesion, cytoskeleton remodeling, and CREB1-mediated transcription.

Also flagged:Myotonic Dystrophy 1genetic diseasenucleotidemuscleblind-like 1MBNL1binding
Journal Article 2015-10-01 ✓ 2 Snippets Yildirim I, Chakraborty D, Disney MD, Wales DJ, Schatz GC.
In-Text Gene Mentions

One hypothesis is that formationof non-B-form conformations by the repetitive DNA sequences, suchas hairpins, is the reason for the expansion during DNA replicationand repair.3−5 In the expansions of CAG repeats, which are typicallyfound in the coding regions of mRNAs such as Huntingtin (HTT), androgenreceptor (AR), spinocerebellar ataxia (SCA), and atrophin-1 (ATN1)genes, the transcripts are translated into toxic polyglutamine (polyQ)6 proteins, resulting in Huntington’s disease(HD), Spinal and Bulbar Muscular Atrophy (SBMA), Spinocerebellar AtaxiaType 1 (SCA1), and Dentatorubral-pallidoluysian atrophy (DRPLA), respectively.7−12 Furthermore, it has been shown recently that RNA CAG repeat expansions can sequester proteins and contribute to neurodegeneration.13−15 Another genetic disorder, Friedreich’s ataxia (FRDA), iscaused by expansion of GAA repeats.9,16 A common heritableform of mental retardation, Fragile X-associated tremor ataxia syndrome(FXTAS), is caused by expansion of the CGG segment from 50 to 200repeats in the 5′-untranslated region (UTR) of the fragileX mental retardation 1 (FMR1) gene.7,16−23 Once the FMR1 gene is transcribed into mRNA, the expanded CGG repeats fold into a hairpin structure with repeating1×1 GG internal loops that sequester and inactivate Sam68 protein.

…such as Huntingtin (HTT), androgen receptor (AR),…

Show Full Abstract

Despite the importance of the knowledge of molecular hydration entropy (ΔShyd) in chemical and biological processes, the exact calculation of ΔShyd is very difficult, because of the complexity in solute–water interactions. Although free-energy perturbation (FEP) methods have been employed quite widely in the literature, the poor convergent behavior of the van der Waals interaction term in the potential function limited the accuracy and robustness. In this study, we propose a new method for estimating ΔShyd by means of combining the FEP approach and the scaled particle theory (or information theory) to separately calculate the electrostatic solute–water interaction term (ΔSelec) and the hydrophobic contribution approximated by the cavity formation entropy (ΔScav), respectively. Decomposition of ΔShyd into ΔScav and ΔSelec terms is found to be very effective with a substantial accuracy enhancement in ΔShyd estimation, when compared to the conventional full FEP calculations. ΔScav appears to dominate over ΔSelec in magnitude, even in the case of polar solutes, implying that the major contribution to the entropic cost for hydration comes from the formation of a solvent-excluded volume. Our hybrid scaled particle theory and FEP method is thus found to enhance the accuracy of ΔShyd prediction by effectively complementing the conventional full FEP method.

Also flagged:type 2 diabetesdiabetesdiabetic nephropathydiabetic retinopathycancercardiovascular diseases
Journal Article 2015-10-01 No Snippets Li L, Cheng WY, Glicksberg BS, Gottesman O, Tamler R, Chen R, Bottinger EP, Dudley JT.
Show Full Abstract

Type 2 diabetes (T2D) is a heterogeneous complex disease affecting more than 29 million Americans alone with a rising prevalence trending toward steady increases in the coming decades. Thus, there is a pressing clinical need to improve early prevention and clinical management of T2D and its complications. Clinicians have understood that patients who carry the T2D diagnosis have a variety of phenotypes and susceptibilities to diabetes-related complications. We used a precision medicine approach to characterize the complexity of T2D patient populations based on high-dimensional electronic medical records (EMRs) and genotype data from 11,210 individuals. We successfully identified three distinct subgroups of T2D from topology-based patient-patient networks. Subtype 1 was characterized by T2D complications diabetic nephropathy and diabetic retinopathy; subtype 2 was enriched for cancer malignancy and cardiovascular diseases; and subtype 3 was associated most strongly with cardiovascular diseases, neurological diseases, allergies, and HIV infections. We performed a genetic association analysis of the emergent T2D subtypes to identify subtype-specific genetic markers and identified 1279, 1227, and 1338 single-nucleotide polymorphisms (SNPs) that mapped to 425, 322, and 437 unique genes specific to subtypes 1, 2, and 3, respectively. By assessing the human disease-SNP association for each subtype, the enriched phenotypes and biological functions at the gene level for each subtype matched with the disease comorbidities and clinical differences that we identified through EMRs. Our approach demonstrates the utility of applying the precision medicine paradigm in T2D and the promise of extending the approach to the study of other complex, multifactorial diseases.

Also flagged:chronic infectiongastric cancertight junctionclaudininfectionpathogenesis
Journal Article 2015-10-01 No Snippets Caron TJ, Scott KE, Fox JG, Hagen SJ.
Show Full Abstract

Long-term chronic infection with Helicobacter pylori (H. pylori) is a risk factor for gastric cancer development. In the multi-step process that leads to gastric cancer, tight junction dysfunction is thought to occur and serve as a risk factor by permitting the permeation of luminal contents across an otherwise tight mucosa. Mechanisms that regulate tight junction function and structure in the normal stomach, or dysfunction in the infected stomach, however, are largely unknown. Although conventional tight junction components are expressed in gastric epithelial cells, claudins regulate paracellular permeability and are likely the target of inflammation or H. pylori itself. There are 27 different claudin molecules, each with unique properties that render the mucosa an intact barrier that is permselective in a way that is consistent with cell physiology. Understanding the architecture of tight junctions in the normal stomach and then changes that occur during infection is important but challenging, because most of the reports that catalog claudin expression in gastric cancer pathogenesis are contradictory. Furthermore, the role of H. pylori virulence factors, such as cytotoxin-associated gene A and vacoulating cytotoxin, in regulating tight junction dysfunction during infection is inconsistent in different gastric cell lines and in vivo, likely because non-gastric epithelial cell cultures were initially used to unravel the details of their effects on the stomach. Hampering further study, as well, is the relative lack of cultured cell models that have tight junction claudins that are consistent with native tissues. This summary will review the current state of knowledge about gastric tight junctions, normally and in H. pylori infection, and make predictions about the consequences of claudin reorganization during H. pylori infection.

Also flagged:tumourCancercatabolismautophagyazathioprinevesicle
Journal Article 2015-10-01 No Snippets Peiris-Pagès M, Smith DL, Győrffy B, Sotgia F, Lisanti MP.
Show Full Abstract

Cancer cells grow in highly complex stromal microenvironments, which through metabolic remodelling, catabolism, autophagy and inflammation nurture them and are able to facilitate metastasis and resistance to therapy. However, these changes in the metabolic profile of stromal cancer-associated fibroblasts and their impact on cancer initiation, progression and metastasis are not well-known. This is the first study to provide a comprehensive proteomic portrait of the azathioprine and taxol-induced catabolic state on human stromal fibroblasts, which comprises changes in the expression of metabolic enzymes, myofibroblastic differentiation markers, antioxidants, proteins involved in autophagy, senescence, vesicle trafficking and protein degradation, and inducers of inflammation. Interestingly, many of these features are major contributors to the aging process. A catabolic stroma signature, generated with proteins found differentially up-regulated in taxol-treated fibroblasts, strikingly correlates with recurrence, metastasis and poor patient survival in several solid malignancies. We therefore suggest the inhibition of the catabolic state in healthy cells as a novel approach to improve current chemotherapy efficacies and possibly avoid future carcinogenic processes.

Also flagged:HDAC4MAP1SautophagyLC3Huntington's diseasebinding
Journal Article 2015-10-01 ✓ 5 Snippets Yue F, Li W, Zou J, Chen Q, Xu G, Huang H, Xu Z, Zhang S, Gallinari P, Wang F, McKeehan WL, Liu L.
In-Text Gene Mentions

Recently, HDAC4 was found to be associated with aggregate-prone mutant Huntington's disease–associated products of the huntingtin gene (HTT) that have long polyglutamine stretches [3].

…the huntingtin (HTT) gene that…

…that encodes huntingtin (HTT) protein [ 2…

…the huntingtin gene (HTT) that have long…

…Wild-typeHTTprotein normally is…

Show Full Abstract

Autophagy controls and executes the turnover of abnormally aggregated proteins. MAP1S interacts with the autophagy marker LC3 and positively regulates autophagy flux. HDAC4 associates with the aggregation-prone mutant huntingtin protein (mHTT) that causes Huntington's disease, and colocalizes with it in cytosolic inclusions. It was suggested HDAC4 interacts with MAP1S in a yeast two-hybrid screening. Here, we found that MAP1S interacts with HDAC4 via a HDAC4-binding domain (HBD). HDAC4 destabilizes MAP1S, suppresses autophagy flux and promotes the accumulation of mHTT aggregates. This occurs by an increase in the deacetylation of the acetylated MAP1S. Either suppression of HDAC4 with siRNA or overexpression of the MAP1S HBD leads to stabilization of MAP1S, activation of autophagy flux and clearance of mHTT aggregates. Therefore, specific interruption of the HDAC4-MAP1S interaction with short peptides or small molecules to enhance autophagy flux may relieve the toxicity of mHTT associated with Huntington's disease and improve symptoms of HD patients.

Also flagged:enzyme activitiesgene expressionlipidsuperoxide dismutasecatalaseglutathione peroxidase
Journal Article 2015-10-01 ✓ 5 Snippets Razali N, Abdul Aziz A, Lim CY, Mat Junit S.
In-Text Gene Mentions

Figure 5A shows a graphical representation of the predicted molecular relationships between the genes listed under the top networks, which linked them to the top five predicted canonical pathways that are listed in Table 2. IPA identified “Lipid Metabolism, Small Molecule Biochemistry and Hematological Disease” as the top network that linked the genes of altered expression namely KNG1, SERPINC1, SERPIND1, SERPINE1, FGG and FGA, to the two top canonical pathways, “Coagulation System” (P < 2.80 × 10−6) and “Intrinsic Prothrombin Activation Pathway” (P < 2.92 × 10−4). This network also linked MVK, DHCR24, LSS and TM7SF2 to the second top canonical pathway, “Superpathway of Cholesterol Biosynthesis” (P < 2.17 × 10−4). On the other hand, both top networks, “Ophthalmic Disease, Connective Tissue Disorders, Inflammatory Disease” and “Digestive System Development and Function, Organ Morphology, Developmental Disorder” linked LEAP2, IFNGR1, ANXA3 and MX1 to the fourth top canonical pathway “Immune Protection/Antimicrobial Response” (P < 2.28 × 10−3). The next top network, “Carbohydrate Metabolism, Small Molecule Biochemistry, Free Radical Scavenging” connected ALDH6A1, ALDH9A1, EPHX1, CYP24A1, ADH6 and GSTM4 to the fifth top canonical pathway, “Xenobiotic Metabolism Signaling” (P < 2.41 × 10−3).

…expression of KNG1,SERPINC1, SERPIND1, SERPINE1, FGG,…

…include KNG1 ,SERPINC1, SERPIND1 ,…

…namely KNG1 ,SERPINC1, SERPIND1 ,…

…the interaction betweenSERPINC1, SERPIND1 ,…

Show Full Abstract

The leaf extract of Tamarindus indica L. (T. indica) had been reported to possess high phenolic content and showed high antioxidant activities. In this study, the effects of the antioxidant-rich leaf extract of the T. indica on lipid peroxidation, antioxidant enzyme activities, H2O2-induced ROS production and gene expression patterns were investigated in liver HepG2 cells. Lipid peroxidation and ROS production were inhibited and the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase was enhanced when the cells were treated with the antioxidant-rich leaf extract. cDNA microarray analysis revealed that 207 genes were significantly regulated by at least 1.5-fold (p < 0.05) in cells treated with the antioxidant-rich leaf extract. The expression of KNG1, SERPINC1, SERPIND1, SERPINE1, FGG, FGA, MVK, DHCR24, CYP24A1, ALDH6A1, EPHX1 and LEAP2 were amongst the highly regulated. When the significantly regulated genes were analyzed using Ingenuity Pathway Analysis software, "Lipid Metabolism, Small Molecule Biochemistry, Hematological Disease" was the top biological network affected by the leaf extract, with a score of 36. The top predicted canonical pathway affected by the leaf extract was the coagulation system (P < 2.80 × 10(-6)) followed by the superpathway of cholesterol biosynthesis (P < 2.17 × 10(-4)), intrinsic prothrombin pathway (P < 2.92 × 10(-4)), Immune Protection/Antimicrobial Response (P < 2.28 × 10(-3)) and xenobiotic metabolism signaling (P < 2.41 × 10(-3)). The antioxidant-rich leaf extract of T. indica also altered the expression of proteins that are involved in the Coagulation System and the Intrinsic Prothrombin Activation Pathway (KNG1, SERPINE1, FGG), Superpathway of Cholesterol Biosynthesis (MVK), Immune protection/antimicrobial response (IFNGR1, LEAP2, ANXA3 and MX1) and Xenobiotic Metabolism Signaling (ALDH6A1, ADH6). In conclusion, the antioxidant-rich leaf extract of T. indica inhibited lipid peroxidation and ROS production, enhanced antioxidant enzyme activities and significantly regulated the expression of genes and proteins involved with consequential impact on the coagulation system, cholesterol biosynthesis, xenobiotic metabolism signaling and antimicrobial response.

Also flagged:non-muscle invasive bladder cancerbladder cancerUrothelial carcinoma of the bladdercancercarcinoma in situaromatic amines
Journal Article 2015-10-01 ✓ 1 Snippet Darwiche F, Parekh DJ, Gonzalgo ML.
In-Text Gene Mentions

Chung et al. identified a panel of eight genes (A2BP1, NPTX2, SOX11, PENK, NKX6-2, DBC1, MYO3A and CA10) that were highly methylated in bladder cancer, with methylation frequencies ranging from 62% to 92%.[88] Reinert et al. found that POU4F2 and HOXA9 genes had a high frequency of methylation (92%) in bladder cancer tissues and were unmethylated in the normal urothelium.[89]

Show Full Abstract

The search continues for optimal markers that can be utilized to improve bladder cancer detection and to predict disease recurrence. Although no single marker has yet replaced the need to perform cystoscopy and urine cytology, many tests have been evaluated and are being developed. In the future, these promising markers may be incorporated into standard practice to address the challenge of screening in addition to long-term surveillance of patients who have or are at risk for developing bladder cancer.

Also flagged:calcium phosphatepolyethylene glycolcrospovidoneAceclofenacmannitolcellulose
Journal Article 2015-10-01 No Snippets Garg N, Pandey P, Kaushik D, Dureja H.
Show Full Abstract

<h4>Introduction</h4>The objective of the present investigation was to develop a novel multifunctional directly compressible co-processed excipient consisting of dibasic calcium phosphate anhydrous, polyethylene glycol 4000 (PEG 4000) and crospovidone using Box-Behnken design.<h4>Materials and methods</h4>The technique of melt granulation was adopted for the preparation of the co-processed excipient. The percentage of crospovidone (5-10% w/w), percentage of PEG 4000 (5-15% w/w) and the heating time (4-12 min) were selected as independent variables. The co-processed granules were evaluated for bulk density, tapped density, Hausner's ratio and Carr's index. Placebo tablets of co-processed granules were prepared and evaluated for hardness, friability and disintegration time. Multiple linear regression was applied to develop mathematical models for hardness, Carr' index and disintegrating time. ANOVA was applied to study the fitting and significance of the model. The optimized batches (BB) were selected for further studies. The selected batches were characterized for particle size distribution, granular friability index, moisture uptake study, differential scanning calorimetry, Fourier transform infrared spectroscopy and scanning electron microscopy. Aceclofenac was selected as model drug for the preparation of tablets.<h4>Results</h4>Aceclofenac tablets prepared using co-processed excipients showed better hardness, disintegration time and in vitro drug release as compared to aceclofenac tablets prepared using conventional wet granulation method.<h4>Conclusion</h4>The developed co-processed excipient can serve as a novel co-processed excipient for improvement of tableting characteristics.

Also flagged:BECLIN 1VPS34Autophagydegradationorganellesautophagy-related
Journal Article 2015-10-01 ✓ 1 Snippet Morris DH, Yip CK, Shi Y, Chait BT, Wang QJ.
In-Text Gene Mentions

Htt

Show Full Abstract

Autophagy is an important lysosomal degradation pathway that aids in the maintenance of cellular homeostasis by breaking down and recycling intracellular contents. Dysregulation of autophagy is linked to a growing number of human diseases. The Beclin 1-Vps34 protein-protein interaction network is critical for autophagy regulation and is therefore essential to cellular integrity. Manipulation of autophagy, in particular via modulation of the action of the Beclin 1-Vps34 complexes, is considered a promising route to combat autophagy-related diseases. Here we summarize recent findings on the core components and structural architecture of the Beclin 1-Vps34 complexes, and how these findings provide valuable insights into the molecular mechanisms that underlie the multiple functions of these complexes and for devising therapeutic strategies.

Also flagged:Periodontitisgreen enhanced fluorescence proteingreen fluorescence proteinGFPto injurybone morphogenetic protein-2
Journal Article 2015-10-01 No Snippets Wang Y, Zhou L, Li C, Xie H, Lu Y, Wu Y, Liu H.
Show Full Abstract

Periodontitis, a disease leads to the formation of periodontal defect, can result in tooth loss if left untreated. The therapies to repair/regenerate periodontal tissues have attracted lots of attention these years. Bone marrow-derived cells (BMDCs), a group of cells containing heterogeneous stem/progenitor cells, are capable of homing to injured tissues and participating in tissue repair/regeneration. The amplification of autologous BMDCs' potential in homing for self-repair/regeneration, therefore, might be considered as an alternative therapy except for traditional cell transplantation. However, the knowledge of the BMDCs' homing and participation in periodontal repair/regeneration is still known little. For the purpose of directly observing BMDCs' involvement in periodontal repair, chimeric mouse models were established to make their bone marrow cells reconstituted with cells expressing green enhanced fluorescence protein (EGFP) in this study. One month after bone marrow transplantation, periodontal defects were made on the mesial side of bilateral maxillary first molars in chimeric mice. The green fluorescence protein-positive (GFP+) BMDCS in periodontal defect regions were examined by bioluminescent imaging and immunofluorescence staining. GFP+ BMDCs were found to aggregate in the periodontal defect regions and emerge in newly-formed bones or fibers. Some of them also co-expressed markers of fibroblasts, osteoblasts or vascular endothelial cells. These results indicated that BMDCs might contribute to the formation of new fibers, bones and blood vessels during periodontal repair. In conclusion, we speculated that autologous BMDCs were capable of negotiating into the surgical sites created by periodontal operation and participating in tissue repair.

Also flagged:translationalneurogenetic diseasesHDXMyotonic Dystrophy Type 1Parkinson’s disease
Journal Article 2015-10-01 ✓ 1 Snippet Mazzetti P, Inca-Martínez M, Tirado-Hurtado I, Milla-Neyra K, Silva-Paredes G, Vishnevetsky A, Cornejo-Olivas M.
In-Text Gene Mentions

…genotyping of theHTTgene, to the…

Show Full Abstract

Neurogenetics is an emerging discipline in Peru that links basic research with clinical practice. The Neurogenetics Research Center located in Lima, Peru is the only unit dedicated to the specialized care of neurogenetic diseases in the country. From the beginning, neurogenetics research has been closely linked to the study of Huntington’s Disease (HD), from the PCR genotyping of the HTT gene, to the current haplogroup studies in HD. Research in other monogenic diseases led to the implementation of alternative methodologies for the genotyping of Fragile X and Myotonic Dystrophy Type 1. Both, national and international collaborative efforts have facilitated the discovery of new genetic variants in complex multigenic diseases such as Parkinson’s disease and Alzheimer’s disease. Additionally, multidisciplinary education and mentoring have allowed for the training of new neurogenetics specialists, supporting the sustained growth of the discipline in the country. The promotion of research in Peru has spurred the growth of neurogenetics research, although limitations in infrastructure, technology, and education remain a challenge for the further growth of research in this field.

Also flagged:antithrombin IIIprotein Cactivated protein CthrombophiliamiscarriagePC
Journal Article 2015-10-01 ✓ 5 Snippets Mekaj Y, Lulaj S, Daci F, Rafuna N, Miftari E, Hoxha H, Sllamniku X, Mekaj A.
In-Text Gene Mentions

…of antithrombin III (ATIII) and protein C…

…group, deficiencies ofATIII, PC, and PS…

…the control group,ATIII(0%) deficiencies were…

…ditionally, antithrombin III (ATIII), protein C (PC),…

…major natural anticoagulant (ATIII, PC, and PS)…

Show Full Abstract

<h4>Context</h4>Several studies have reported that thrombophilia is responsible for recurrent pregnancy loss (RPL).<h4>Aims</h4>The aim of this study was to evaluate the prevalence and role of inherited thrombophilia in early pregnancy loss, specifically in the first trimester.<h4>Materials and methods</h4>A total of 104 women (patients) with a history of two or more miscarriages during the first trimester of pregnancy and 110 women (controls) who had experienced two or more births without a miscarriage were included in this study. In both groups, we determined the biological activities of antithrombin III (ATIII) and protein C (PC) using the chromogenic method and the biological activity of protein S (PS) and the activated protein C resistance (APCR) were examined using a clotting method.<h4>Results</h4>In the patient group, deficiencies of ATIII, PC, and PS were detected in 3 (2.88%), 4 (3.85%), and 6 (5.77%) cases, respectively. In the control group, ATIII (0%) deficiencies were not detected, and deficiencies for PC (0.9%) and PS (0.9%) were each detected in 1 patient. APCR was detected in 9 patients (8.65%) and 4 control subjects (3.63%).<h4>Conclusion</h4>Based on our results, we can conclude that thrombophilia is a causal factor for miscarriages in the first trimester of pregnancy, although there are the conflicting data in the literature.

Also flagged:Antithrombin IIIATIII) deficiencythrombophilia
Journal Article 2015-10-01 ✓ 5 Snippets Osunkalu VO, Kanu OO, Ngwuli F.
In-Text Gene Mentions

…reference intervals forATIIIamong Nigerians.<h4>Subjects a…

…PercentageATIIIactivity was determined…

…The mean percentageATIIIactivity was 91.2…

ATIIIactivity was lower…

…However,ATIIIactivity tended to…

Show Full Abstract

<h4>Background</h4>Diagnosis of antithrombin III (ATIII) deficiency as a common cause of thrombophilia is primarily based on the determination of antithrombin levels in plasma using a functional activity assay or an immunological assay, but local reference interval is lacking.<h4>Aims</h4>The aim of the present study was to determine pattern of antithrombin activity and local reference intervals for ATIII among Nigerians.<h4>Subjects and methods</h4>A cross-sectional study was carried out among healthy blood donors at the Lagos University Teaching Hospital in Nigeria between the age range 18 and 65 years. Structured questionnaires were applied to obtain demographic and clinical history. Percentage ATIII activity was determined using immunoassay technique. Data were analysed using SPSS version 20.0.<h4>Results</h4>One hundred and fifty-five healthy blood donors who participated in this study consisted of 84 males and 71 females. The mean age of participants was 35 ± 6.7 years with a modal age range at 25-49 years. The mean percentage ATIII activity was 91.2 ± 14.2% (confidence interval: 69.2-113.2). Reference interval estimated for all the subjects was 62.8-119.6%. ATIII activity was lower in females compared to males (91.1 vs. 94.2; P = 0.03). However, ATIII activity tended to decrease with increasing age (P = 0.001).<h4>Conclusion</h4>Mean percentage ATIII activity for our study population was 91.2% with a reference interval of 62.8-119.6%. Reference interval for ATIII activity in African population is lower than documented Caucasian values.

Also flagged:Liver tumorsHepatic neoplasiametabolic diseasesneoplasiametabolic disordershepatocellular neoplasms
Journal Article 2015-10-01 No Snippets Schady DA, Roy A, Finegold MJ.
Show Full Abstract

Hepatic neoplasia is a rare but serious complication of metabolic diseases in children. The risk of developing neoplasia, the age at onset, and the measures to prevent it differ in the various diseases. We review the most common metabolic disorders that are associated with a heightened risk of developing hepatocellular neoplasms, with a special emphasis on reviewing recent advances in the molecular pathogenesis of the disorders and pre-clinical therapeutic options. The cellular and genetic pathways driving carcinogenesis are poorly understood, but best understood in tyrosinemia.

Also flagged:carbonateapatitecollagencarbonate apatitebone formationwater
Journal Article 2015-10-01 ✓ 1 Snippet Salim S, Ariani MD.
In-Text Gene Mentions

Current attempts are focused on bioceramics such as calcium phosphate which is found in the body, demonstrated excellent cellular and tissue responses in vitro and in vivo, and shows promises of biocompatibility, osteoconductivity, and biodegradability.[6, 7] The types of calcium phosphate materials which have developed and investigated as bone graft material are hydroxyapatite (HA, Ca10(PO4) 6(OH)2), β-tricalcium phosphate (β-TCP, Ca3(PO4)2), biphasic calcium phosphate, and multiphasic bio-glasses.[7, 8] However, some problems arise such as difficulties to control absorbance time period of HA and it has been reported that HA produced from coral has the inability to control the pore size and chemical composition, thereby resulting in unpredictable outcomes.[9, 10, 11] In addition, resorption time of β-TCP is faster 10–20 times than HA, the macroscopic mechanical properties of β-TCP are inadequate for load bearing surface due to the inherent brittleness.[12] Therefore, to overcome these problems, we focused on carbonate apatite (CA) as a biodegradable material.

Show Full Abstract

<h4>Background</h4>Collagen is regarded as one of the most useful biomaterials. We tried to combine collagen and carbonate apatite (CA) with some cytokines in order to enhance bone formation ability. In this study, we found that CA-collagen sponge (CA-CS) was a possible candidate of newly graft material for bone formation.<h4>Materials and methods</h4>CA-CS was fabricated by the following procedure. One wt% of pig hide collagen solution (Nippon Meat Packers. Inc., Tokyo, Japan) was neutralized with 0.1 N NaOH, and then mixed immediately 243 mg apatite powder with 0.06 M carbonate contents. After centrifugation at 1500 rpm for 10 min, excess water was removed, and the mixture was packed into Teflon molds (5.0 mm × 2.0 mm). Each 10 µg of basic fibroblast growth factor (bFGF) and recombinant human bone morphogenetic protein-2 (rh-BMP2) were involved in these sponges. Then these scaffolds frozen at -80°C for 2 h and dried in a freeze dry machine for 24 h. CA-CS without cytokines were also prepared as a control. Mouse osteoblast-like cell (MC3T3-E1) proliferations in these scaffolds were investigated by 3-day in vitro cell culture using MTT assay examination. Ten New Zealand rabbits (weight: 3-3.5 kg) were used in this in vivo study. After 3 weeks of placement, the scaffolds, rabbits were sacrificed, and bone formation in the sockets was evaluated histologically and histomorphometrically.<h4>Results and conclusion</h4>By histological observation and measurement of bone area ratio, CA-CS with cytokines showed higher bone formation ability (bFGF/CA-CS: 50.7 ± 7.3%, rh-BMP2/CA-CS: 54.2 ± 5.0%) than other groups. From the limited results of this study, it is suggested that CA collagen scaffolds with some cytokines may become an attractive scaffold for bone regeneration.

Also flagged:Depressionamino acidfluoxetinebehavioral depressionanxietysucrose
Journal Article 2015-10-01 ✓ 2 Snippets Kalshetti PB, Alluri R, Mohan V, Thakurdesai PA.
In-Text Gene Mentions

Recently, down-regulation of hippocampal serotonin transporter (5-HTT) protein expression is reported as signature change associated with anhedonia.[42] Taken together, our results from sucrose intake test provided strong support to our results from other parameters (FST and serotoninergic system measurements) and suggested 4-HI as a potential antidepressant agent.

…campal serotonin transporter (5-HTT) protein expression is…

Show Full Abstract

<h4>Context</h4>Antidepressant-like effects of (2S, 3R, 4S)-4-hydroxyisoleucine (4-HI), a major amino acid from fenugreek seeds, has been reported in the animal model of acute depression.<h4>Aims</h4>To evaluate effects of subacute administration of 4-HI in animal model of stress-induced depression namely socially isolated olfactory bulbectomized rats.<h4>Materials and methods</h4>Bilateral olfactory bulbectomy (OBX) were induced in 30 Sprague-Dawley rats. After recovery period of 14 days, rats were randomized into five groups of 6 rats each and stressed with social isolation (individual housing). The rats were orally treated with either vehicle (OBX-Iso), positive control, fluoxetine (30 mg/kg) or 4-HI (10, 30, 100 mg/kg) once a day from day 14 onward. Separate group of rats with social isolation but without OBX (Sham-Iso) was also maintained. The behavioral depression and anxiety related parameters using open field test (OFT), sucrose intake test, novelty suppressed feeding (NSF) and forced swim test (FST), and neurochemical estimation (brain monoamines viz., serotonin and nor-adrenaline, serotonin turnover, and serum cortisol) were performed.<h4>Statistical analysis used</h4>Data was analyzed by either two-way ANOVA (OFT and FST) or one-way ANOVA (sucrose intake test, NSF, and neurochemical estimation) followed by Dunnett's multiple comparisons test. Differences were considered significant at P < 0.05.<h4>Results</h4>The significant and dose-dependent protection from behavioral and neurochemical changes were observed in 4-HI co-administrated OBX-Iso rats.<h4>Conclusion</h4>4-HI demonstrated the antidepressant and antianxiety effects in socially isolated stress-induced OBX rats with possible involvement of multiple stress relieving mechanisms.<h4>Highlights of paper</h4>In this study, the subacute pretreatment of 4-HI showed strong and dose-dependent prevention of isolation stress related behavioral and neurochemical responses in olfactory bulbectomized rats. The prevention of hyperactive HPA axis in OBX-Iso stress-induced rats can be envisaged as probable mechanism of antidepressant and antianxiety effects of 4-HI.<h4>Summary</h4>Effect of 4-hydroxyisoleucine (4-HI) in olfactory bulbectomized and socially isolated (Iso) rats was evaluated4-HI showed significant and dose-dependent antidepressant effects during novelty suppressed feeding (NSF) and forced swim test (FST)4-HI showed significant and dose-dependent antianxiety effects during OFT (open field test) and sucrose intake test4-HI showed protection from OBX-Iso stress-induced brain monoamines, serotonin turnover, and serum cortisol level elevation. Abbreviations used: SSRI: Selective Serotonin Reuptake Inhibitor; 4-HI: (2S, 3R, 4S)-4-hydroxyisoleucine; OBX: Olfactory bulbectomy; CPCSEA: Committee for the Purpose of Control and Supervision of Experiments on Animals; OFT: Open Field Test; NSF: Novelty Suppressed Feeding; FST: Forced Swimming Test; 5HT: 5-Hydroxytryptamine; 5-HIAA: 5-Hydroxyindoleacetic Acid; NA: Nor-adrenaline; and HPA: Hypothalamic-Pituitary Adrenal.

Also flagged:Antithrombinvenous thromboembolismantithrombin IIIdeficiencyright atrial thrombosisheparin
Journal Article 2015-10-01 ✓ 2 Snippets Sabzi F, Khosravi D, Faraji R.
In-Text Gene Mentions

…intravenous infusions ofATIIIconcentrate and surgical…

…protein C orATIIIand hepatocellular carcinoma…

Show Full Abstract

<h4>Background</h4>One of the rare causes of venous thromboembolism in pregnancy is antithrombin III deficiency. Antithrombin III deficiency is estimated to carry a 30% risk of venous thrombotic complication during each pregnancy and postpartum.<h4>Case details</h4>We present thea case of a A 21-year-old pregnant woman (Para 1+) with a history of large atrial septal defect repair at our hospital (Imam Ali Hospital, 2 May 2014). The patient, with unknown history of antithrombin III deficiency, was admitted at our emergency center with dyspnea and chest pain for the rule out of tamponade. She presented with a right atrial thrombosis in the second trimester of pregnancy despite the use of therapeutic doses of heparin and warfarin in the postoperative period as thromboembolic prophylaxis. The risk of warfarin emberyopaty led to termination of pregnancy, and successful redo-cardiac surgery outcome was achieved with the combined use of therapeutic anticoagulation and regular plasma-derived antithrombin concentrate infusions to normalize her antithrombin levels.<h4>Conclusion</h4>She recovered from the operation uneventfully, and wad discharged in the 12(th) postoperative day. In the 6(th) month of follow-up, antithrombin III increased to 70% in more stable level and transethoracic echocardiography showed no recurrence of right atrial thrombus formation. This case leads to further debate regarding whether full anticoagulation should be a worthy preventive measure for venous thromboembolic prophylaxis after an open heart surgery complicated by pregnancy in a women with inherited antithrombin III deficiency. This point may become more relevant as further experience is gained with the use of recombinant human antithrombin in known cases during open cardiac surgery.

Also flagged:arachnoid cystArachnoid cystsataxiacranial nerve palsymembranetumor
Journal Article 2015-10-01 ✓ 1 Snippet Gurkas E, Altan BY, Gücüyener K, Kolsal E.
In-Text Gene Mentions

…heterozygous mutations ofDCCgene were shown.[…

Show Full Abstract

Arachnoid cysts are benign developmental collections of cerebrospinal fluid (CSF). They constitute approximately 1% of intracranial masses. The cerebellopontine angle (CPA) arachnoid cysts are rare and often asymptomatic. The onset of symptoms and signs is usually due to the compression of the brain, cranial nerves and obstruction of CSF circulation. The major clinical symptoms for CPA arachnoid cysts were reported as headache, ataxia and 8(th) cranial nerve palsy. We report a patient with a CPA arachnoid cyst. He presented with cranial nerve palsies and mirror movements found in upper extremities. We postulated that CPA arachnoid cyst compressing the brain stem and the pyramidal decussation may lead to mirror movements. We conclude that mirror movements can be associated with CPA arachnoid cyst.

Also flagged:gene expressionlocalizationcytoplasmicnuclearcytoplasmmitochondrial
Journal Article 2015-10-01 ✓ 1 Snippet Chen L, Huang C, Wang X, Shan G.
In-Text Gene Mentions

…tumor suppressor geneDCC, in which exons…

Show Full Abstract

Circular RNAs (circRNAs) are now recognized as large species of transcripts in eukaryotic cells. From model organisms such as C. elegans, Drosophila, mice to human beings, thousands of circRNAs formed from back-splicing of exons have been identified. The known complexity of transcriptome has been greatly expanded upon the discovery of these RNAs. Studies about the biogenesis and physiological functions have yielded substantial knowledge for the circRNAs, and they are now more likely to be viewed as regulatory elements coded by the genome rather than unavoidable noise of gene expression. Certain human diseases may also relate to circRNAs. These circRNAs show diversifications in features such as sequence composition and cellular localization, and thus we propose that they may be divided into subtypes such as cytoplasmic circRNAs, nuclear circRNAs, and exon-intron circRNAs (EIciRNAs). Here we summarize and discuss knowns and unknowns for these RNAs, and we need to keep in mind that the whole field is still at the beginning of exciting explorations.

Also flagged:regulation ofNATcancerpiwiMALAT1HOTAIR
Journal Article 2015-10-01 No Snippets Han Li C, Chen Y.
Show Full Abstract

Non-coding RNA refers to a large group of endogenous RNA molecules that have no protein coding capacity, while having specialized cellular and molecular functions. They possess wide range of functions such as the regulation of gene transcription and translation, post-transcriptional modification, epigenetic landscape establishment, protein scaffolding and cofactors recruitments. They are further divided into small non-coding RNAs with size < 200nt (e.g. miRNA, piRNA) and long non-coding RNAs with size >= 200nt (e.g. lincRNA, NAT). Increasing evidences suggest that both non-coding RNAs groups play important roles in cancer development, progression and pathology. Clinically, non-coding RNAs aberrations show high diagnostic and prognostic values. With improved understanding of the nature and roles of non-coding RNAs, it is believed that we can develop therapeutic treatment against cancer via the modulation of these RNA molecules. Advances in nucleic acid drug technology and computational simulation prompt the development of agents to intervene the malignant effects of non-coding RNAs. In this review, we will discuss the role of non-coding RNAs in cancer, and evaluate the potential of non-coding RNA-based cancer therapies.

Also flagged:deathepilepsySUDEPNervegeneralized tonic-clonicSudden unexpected
Journal Article 2015-10-01 ✓ 1 Snippet Papacostas SS.
In-Text Gene Mentions

5-HTT

Show Full Abstract

<h4>Background</h4>Sudden unexpected death in epilepsy (SUDEP) affects 0.09-9.3 per 1,000 person-years depending on the population studied and constitutes the most common cause of death in people with epilepsy. The purpose of this study was to analyze epidemiological data of patients with SUDEP, identify possible risk factors in the population of a tertiary referral center and provide a review of the literature aiming to raise awareness of this phenomenon.<h4>Methods</h4>Data for this study originate from the records of the Cyprus Institute of Neurology and Genetics in Nicosia Cyprus. We performed a systematic review of patients with epilepsy who had died between 1997 and 2012 and identified those whose death circumstances met the definition of SUDEP. Information was collected regarding sex, age, type of seizures, anti-epileptic therapies, and circumstances of death. Ethical approval was obtained from the institutional medical ethics committee.<h4>Results</h4>Four hundred and forty four new patients were diagnosed with epilepsy among referrals to the epilepsy clinic and were followed to the end of the study period. Seven patients, six males, were identified who met criteria for SUDEP. The average age was 30 years. All patients had had either primary or secondary tonic-clonic seizures. Most were on polypharmacy, and two had Vagus Nerve Stimulation implanted. Most deaths were unwitnessed and nocturnal. The overall incidence rate for SUDEP in this population was 2.13 deaths/1000 person-years. Overall Cumulative Incidence (or lifetime risk) was calculated at 15.76 SUDEP deaths/1,000 patients.<h4>Conclusions</h4>In our series, SUDEP was primarily a nocturnal and unwitnessed event that affected primarily young males. Among both males and females patients, 36.8% of all deaths were due to SUDEP. The major risk factor identified was the occurrence of generalized tonic-clonic seizures signifying that every effort should be made to control this type of seizures. Hippokratia 2015; 19 (4): 338-343.

ISSUE HIGHLIGHTS

Also flagged:chromosomespolytene chromosomesintercalary heterochromatinchromosome breakagemitosismethylation
Journal Article 2015-10-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

HFE

Show Full Abstract

No abstract available.

Also flagged:LVII
Journal Article 2015-10-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:TpCpWCDH116S rRNAV2V3V4
Journal Article 2015-10-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:bile duct stonesduct stonespancreatitisbile ductstonecystic lesions
Journal Article 2015-10-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…hepatitis, Wilson disease,hemochromatosisand auto-immune hepatitis…

Show Full Abstract

No abstract available.