Hedonic substitution, where wheel running reduces voluntary ethanol consumption, has been observed in prior studies. Here, we replicate and expand on previous work showing that mice decrease voluntary ethanol consumption and preference when given access to a running wheel. While earlier work has been limited mainly to behavioral studies, here we assess the underlying molecular mechanisms that may account for this interaction. From four groups of female C57BL/6J mice (control, access to two-bottle choice ethanol, access to a running wheel, and access to both two-bottle choice ethanol and a running wheel), mRNA-sequencing of the striatum identified differential gene expression. Many genes in ethanol preference quantitative trait loci were differentially expressed due to running. Furthermore, we conducted Weighted Gene Co-expression Network Analysis and identified gene networks corresponding to each effect behavioral group. Candidate genes for mediating the behavioral interaction between ethanol consumption and wheel running include multiple potassium channel genes, Oprm1, Prkcg, Stxbp1, Crhr1, Gabra3, Slc6a13, Stx1b, Pomc, Rassf5 and Camta2. After observing an overlap of many genes and functional groups previously identified in studies of initial sensitivity to ethanol, we hypothesized that wheel running may induce a change in sensitivity, thereby affecting ethanol consumption. A behavioral study examining Loss of Righting Reflex to ethanol following exercise trended toward supporting this hypothesis. These data provide a rich resource for future studies that may better characterize the observed transcriptional changes in gene networks in response to ethanol consumption and wheel running.
Protocadherin 19 (Pcdh19) is an X-linked gene belonging to the protocadherin superfamily, whose members are predominantly expressed in the central nervous system and have been implicated in cell-cell adhesion, axon guidance and dendrite self-avoidance. Heterozygous loss-of-function mutations in humans result in the childhood epilepsy disorder PCDH19 Girls Clustering Epilepsy (PCDH19 GCE) indicating that PCDH19 is required for brain development. However, understanding PCDH19 function in vivo has proven challenging and has not been studied in mammalian models. Here, we validate a murine Pcdh19 null allele in which a β-Geo reporter cassette is expressed under the control of the endogenous promoter. Analysis of β-Geo reporter activity revealed widespread but restricted expression of PCDH19 in embryonic, postnatal and adult brains. No gross morphological defects were identified in Pcdh19(+/β-Geo) and Pcdh19(Y/β-Geo) brains and the location of Pcdh19 null cells was normal. However, in vitro migration assays revealed that the motility of Pcdh19 null neurons was significantly elevated, potentially contributing to pathogenesis in patients with PCDH19 mutations. Overall our initial characterization of Pcdh19(+/β-Geo), Pcdh19(β-Geo/β-Geo) and Pcdh19(Y/β-Geo)mice reveals that despite widespread expression of Pcdh19 in the CNS, and its role in human epilepsy, its function in mice is not essential for brain development.
Also flagged:gene expressionsnRNPspliceosomesnRNPsretrotranspositionhnRNP C
Journal Article2016-05-31No SnippetsSibley CR, Blazquez L, Ule J.
Show Full Abstract
Recent improvements in experimental and computational techniques that are used to study the transcriptome have enabled an unprecedented view of RNA processing, revealing many previously unknown non-canonical splicing events. This includes cryptic events located far from the currently annotated exons and unconventional splicing mechanisms that have important roles in regulating gene expression. These non-canonical splicing events are a major source of newly emerging transcripts during evolution, especially when they involve sequences derived from transposable elements. They are therefore under precise regulation and quality control, which minimizes their potential to disrupt gene expression. We explain how non-canonical splicing can lead to aberrant transcripts that cause many diseases, and also how it can be exploited for new therapeutic strategies.
Journal Article2016-05-31✓ 4 SnippetsPalaniappan A, Ramar K, Ramalingam S.
In-Text Gene Mentions
I A O 0000326)
…PCDH17…
I A O 0000326)
…LRRC7…
Results)
…Table 2 shows the central genes identified by centrality analysis for the stage II network. For progression to stage II, three hub driver genes were identified: DYNC1H1, GRIN2A, GRM1. Eight non-driver hub genes were identified: DLG4, SMC2, PLCG1, GRIN2B, RHOG, SMC1A, GRIN1, CAMK2A. Table 3 shows the modules in the network obtained by ModuLand analysis. Seven significant modules were obtained each centered at a different gene (Fig 3). Each module could function as a driver subnetwork for the progression of cancer to stage II. The most interesting module was that centered at DLG4, which also had the driver genes GRIN2A, GRM1, LRRC7 as its members. Of these, GRIN2A and GRM1 are also central genes. A gene ontology analysis for biological process yielded the key pathways in which these central driver genes played a role. The glutamate signaling pathway was identified as a key enriched biological process (q-value < 0.001). GRIN1, GRIN2A and GRIN2B emerged as key hub genes that could modulate this pathway. Among molecular functions, the glutamate receptor activity emerged significant (q-value < 0.001) in which GRM1 was implicated. The cellular component ontology was enriched in ionotropic glutamate receptor complex and the synapse (q-values < 0.001) (Table 4).…
Results)
…genes GRIN2A, GRM1,LRRC7as its members.…
Show Full Abstract
It is well-known that the conversion of normal colon epithelium to adenoma and then to carcinoma stems from acquired molecular changes in the genome. The genetic basis of colorectal cancer has been elucidated to a certain extent, and much remains to be known about the identity of specific cancer genes that are associated with the advancement of colorectal cancer from one stage to the next. Here in this study we attempted to identify novel cancer genes that could underlie the stage-specific progression and metastasis of colorectal cancer. We conducted a stage-based meta-analysis of the voluminous tumor genome-sequencing data and mined using multiple approaches for novel genes driving the progression to stage-II, stage-III and stage-IV colorectal cancer. The consensus of these driver genes seeded the construction of stage-specific networks, which were then analyzed for the centrality of genes, clustering of subnetworks, and enrichment of gene-ontology processes. Our study identified three novel driver genes as hubs for stage-II progression: DYNC1H1, GRIN2A, GRM1. Four novel driver genes were identified as hubs for stage-III progression: IGF1R, CPS1, SPTA1, DSP. Three novel driver genes were identified as hubs for stage-IV progression: GSK3B, GGT1, EIF2B5. We also identified several non-driver genes that appeared to underscore the progression of colorectal cancer. Our study yielded potential diagnostic biomarkers for colorectal cancer as well as novel stage-specific drug targets for rational intervention. Our methodology is extendable to the analysis of other types of cancer to fill the gaps in our knowledge.
Also flagged:trypsindigestionmitochondrialphosphorylationinsulin receptorinsulin like growth receptor 1
Journal Article2016-05-31✓ 1 SnippetKong BW, Lassiter K, Piekarski-Welsher A, Dridi S, Reverter-Gomez A, Hudson NJ, Bottje WG.
In-Text Gene Mentions
S I O 001029)
…The MA plot is consistent with a reduction in slow fiber subunits (TPM2, ACTC) in the high FE (HFE) and an increase in mitochondrial regulators of muscle energy supply in the form of ATP (SLC25A4) and creatine phosphate (VDAC2).…
Show Full Abstract
As feed represents 60 to 70% of the cost of raising an animal to market weight, feed efficiency (the amount of dry weight intake to amount of wet weight gain) remains an important genetic trait in animal agriculture. To gain greater understanding of cellular mechanisms of feed efficiency (FE), shotgun proteomics was conducted using in-gel trypsin digestion and tandem mass spectrometry on breast muscle samples obtained from pedigree male (PedM) broilers exhibiting high feed efficiency (FE) or low FE phenotypes (n = 4 per group). The high FE group had greater body weight gain (P = 0.004) but consumed the same amount of feed (P = 0.30) from 6 to 7 wk resulting in higher FE (P < 0.001). Over 1800 proteins were identified, of which 152 were different (P < 0.05) by at least 1.3 fold and ≤ 15 fold between the high and low FE phenotypes. Data were analyzed for a modified differential expression (DE) metric (Phenotypic Impact Factors or PIF) and interpretation of protein expression data facilitated using the Ingenuity Pathway Analysis (IPA) program. In the entire data set, 228 mitochondrial proteins were identified whose collective expression indicates a higher mitochondrial expression in the high FE phenotype (binomial probability P < 0.00001). Within the top up and down 5% PIF molecules in the dataset, there were 15 mitoproteome proteins up-regulated and only 5 down-regulated in the high FE phenotype. Pathway enrichment analysis also identified mitochondrial dysfunction and oxidative phosphorylation as the number 1 and 5 differentially expressed canonical pathways (up-regulated in high FE) in the proteomic dataset. Upstream analysis (based on DE of downstream molecules) predicted that insulin receptor, insulin like growth receptor 1, nuclear factor, erythroid 2-like 2, AMP activated protein kinase (α subunit), progesterone and triiodothyronine would be activated in the high FE phenotype whereas rapamycin independent companion of target of rapamycin, mitogen activated protein kinase 4, and serum response factor would be inhibited in the high FE phenotype. The results provide additional insight into the fundamental molecular landscape of feed efficiency in breast muscle of broilers as well as further support for a role of mitochondria in the phenotypic expression of FE. Funding provided by USDA-NIFA (#2013-01953), Arkansas Biosciences Institute (Little Rock, AR), McMaster Fellowship (AUS to WB) and the Agricultural Experiment Station (Univ. of Arkansas, Fayetteville).
Also flagged:ALSC9orf72ATXN2polyglutamineamyotrophic lateral sclerosis and frontotemporal dementiapathogenesis
Journal Article2016-05-31✓ 1 SnippetCiura S, Sellier C, Campanari ML, Charlet-Berguerand N, Kabashi E.
In-Text Gene Mentions
S I O 001029)
…This epistatic interaction appears specific for ATXN2 intermediate polyQ repeats, because C9orf72 loss of function does not accentuate toxicity of other proteins harboring polyQ repeats (ATXN3, HTT) or other ALS-related mutants (FUS and SOD1), at least in neuronal culture and in the time frame of our study.…
Show Full Abstract
The most common genetic cause for amyotrophic lateral sclerosis and frontotemporal dementia (ALS-FTD) is repeat expansion of a hexanucleotide sequence (GGGGCC) within the C9orf72 genomic sequence. To elucidate the functional role of C9orf72 in disease pathogenesis, we identified certain molecular interactors of this factor. We determined that C9orf72 exists in a complex with SMCR8 and WDR41 and that this complex acts as a GDP/GTP exchange factor for RAB8 and RAB39, 2 RAB GTPases involved in macroautophagy/autophagy. Consequently, C9orf72 depletion in neuronal cultures leads to accumulation of unresolved aggregates of SQSTM1/p62 and phosphorylated TARDBP/TDP-43. However, C9orf72 reduction does not lead to major neuronal toxicity, suggesting that a second stress may be required to induce neuronal cell death. An intermediate size of polyglutamine repeats within ATXN2 is an important genetic modifier of ALS-FTD. We found that coexpression of intermediate polyglutamine repeats (30Q) of ATXN2 combined with C9orf72 depletion increases the aggregation of ATXN2 and neuronal toxicity. These results were confirmed in zebrafish embryos where partial C9orf72 knockdown along with intermediate (but not normal) repeat expansions in ATXN2 causes locomotion deficits and abnormal axonal projections from spinal motor neurons. These results demonstrate that C9orf72 plays an important role in the autophagy pathway while genetically interacting with another major genetic risk factor, ATXN2, to contribute to ALS-FTD pathogenesis.
Also flagged:nucleusnaloxonedopaminepositronracloprideneurogenetics
Journal Article2016-05-31✓ 1 SnippetBlum K, Simpatico T, Febo M, Rodriquez C, Dushaj K, Li M, Braverman ER, Demetrovics Z, Oscar-Berman M, Badgaiyan RD.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
The goal of this review is to explore the clinical significance of music listening on neuroplasticity and dopaminergic activation by understanding the role of music therapy in addictive behavior treatment. fMRI data has shown that music listening intensely modifies mesolimbic structural changes responsible for reward processing (e.g., nucleus accumbens [NAc]) and may control the emotional stimuli's effect on autonomic and physiological responses (e.g., hypothalamus). Music listening has been proven to induce the endorphinergic response blocked by naloxone, a common opioid antagonist. NAc opioid transmission is linked to the ventral tegmental area (VTA) dopamine release. There are remarkable commonalities between listening to music and the effect of drugs on mesolimbic dopaminergic activation. It has been found that musical training before the age of 7 results in changes in white-matter connectivity, protecting carriers with low dopaminergic function (DRD2A1 allele, etc.) from poor decision-making, reward dependence, and impulsivity. In this article, we briefly review a few studies on the neurochemical effects of music and propose that these findings are relevant to the positive clinical findings observed in the literature. We hypothesize that music intervention enhances brain white matter plasticity through dopaminergic recruitment and that more research is needed to explore the efficacy of these therapies.
Optimal iron nutrition in utero is essential for development of the fetus and helps establish birth iron stores adequate to sustain growth in early infancy. In species with hemochorial placentas, such as humans and rodents, iron in the maternal circulation is transferred to the fetus by directly contacting placental syncytiotrophoblasts. Early kinetic studies provided valuable data on the initial uptake of maternal transferrin, an iron-binding protein, by the placenta. However, the remaining steps of iron trafficking across syncytiotrophoblasts and through the fetal endothelium into the fetal blood remain poorly characterized. Over the last 20 years, identification of transmembrane iron transporters and the iron regulatory hormone hepcidin has greatly expanded the knowledge of cellular iron transport and its regulation by systemic iron status. In addition, emerging human and animal data demonstrating comprised fetal iron stores in severe maternal iron deficiency challenge the classic dogma of exclusive fetal control over the transfer process and indicate that maternal and local signals may play a role in regulating this process. This review compiles current data on the kinetic, molecular, and regulatory aspects of placental iron transport and considers new questions and knowledge gaps raised by these advances.
Also flagged:infectioncrown rust diseasedefense responsesignal transductioncell-wallabscisic acid
Journal Article2016-05-31✓ 2 SnippetsLoarce Y, Navas E, Paniagua C, Fominaya A, Manjón JL, Ferrer E.
In-Text Gene Mentions
Discussion)
…NoHTTtranscripts were found in the present SSH library, suggesting that, in oat quantitative resistance, the phenylpropanoid pathway plays a greater role in cell wall lignification for preventing the invasion or expansion of pathogens than in the synthesis of secondary metabolites with antimicrobial activity (at least at the stages of infection studied here).…
Discussion)
…Hydroxycinnamoyl transferase (HTT) catalyzes the final…
Show Full Abstract
Cultivated oat (Avena sativa), an important crop in many countries, can suffer significant losses through infection by the fungus Puccinia coronata, the causal agent of crown rust disease. Understanding the molecular basis of existing partial resistance to this disease might provide targets of interest for crop improvement programs. A suppressive subtractive hybridization (SSH) library was constructed using cDNA from the partially resistant oat genotype MN841801-1 after inoculation with the pathogen. A total of 929 genes returned a BLASTx hit and were annotated under different GO terms, including 139 genes previously described as participants in mechanisms related to the defense response and signal transduction. Among these were genes involved in pathogen recognition, cell-wall modification, oxidative burst/ROS scavenging, and abscisic acid biosynthesis, as well genes related to inducible defense responses mediated by salicylic and jasmonic acid (although none of which had been previously reported involved in strong responses). These findings support the hypothesis that basal defense mechanisms are the main systems operating in oat partial resistance to P. coronata. When the expression profiles of 20 selected genes were examined at different times following inoculation with the pathogen, the partially resistant genotype was much quicker in mounting a response than a susceptible genotype. Additionally, a number of genes not previously described in oat transcriptomes were identified in this work, increasing our molecular knowledge of this crop.
Also flagged:nicotinehistone methyltransferaseAsh2lsynapseMef2cmethylation
Journal Article2016-05-30No SnippetsJung Y, Hsieh LS, Lee AM, Zhou Z, Coman D, Heath CJ, Hyder F, Mineur YS, Yuan Q, Goldman D, Bordey A, Picciotto MR.
Show Full Abstract
Developmental nicotine exposure causes persistent changes in cortical neuron morphology and in behavior. We used microarray screening to identify master transcriptional or epigenetic regulators mediating these effects of nicotine and discovered increases in Ash2l mRNA, encoding a component of a histone methyltransferase complex. We therefore examined genome-wide changes in trimethylation of histone H3 on Lys4 (H3K4me3), a mark induced by the Ash2l complex associated with increased gene transcription. A large proportion of regulated promoter sites were involved in synapse maintenance. We found that Mef2c interacts with Ash2l and mediates changes in H3K4me3. Knockdown of Ash2l or Mef2c abolished nicotine-mediated alterations of dendritic complexity in vitro and in vivo, and attenuated nicotine-dependent changes in passive avoidance behavior. In contrast, overexpression mimicked nicotine-mediated alterations of neuronal structure and passive avoidance behavior. These studies identify Ash2l as a target induced by nicotinic stimulation that couples developmental nicotine exposure to changes in brain epigenetic marks, neuronal structure and behavior.
Also flagged:pancreatic ductal adenocarcinomaPDACtumourgene expressionendoplasmic reticulummitochondrion
Journal Article2016-05-30✓ 1 SnippetGiulietti M, Occhipinti G, Principato G, Piva F.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
<h4>Purpose</h4>Pancreatic ductal adenocarcinoma (PDAC) is a highly aggressive malignancy. Up till now, the patient's prognosis remains poor which, among others, is due to the paucity of reliable early diagnostic biomarkers. In the past, candidate diagnostic biomarkers and therapeutic targets have been delineated from genes that were found to be differentially expressed in normal versus tumour samples. Recently, new systems biology approaches have been developed to analyse gene expression data, which may yield new biomarkers. As of yet, the weighted gene co-expression network analysis (WGCNA) tool has not been applied to PDAC microarray-based gene expression data.<h4>Methods</h4>PDAC microarray-based gene expression datasets, listed in the Gene Expression Omnibus (GEO) database, were analysed. After pre-processing of the data, we built two final datasets, Normal and PDAC, encompassing 104 and 129 patient samples, respectively. Next, we constructed a weighted gene co-expression network and identified modules of co-expressed genes distinguishing normal from disease conditions. Functional annotations of the genes in these modules were carried out to highlight PDAC-associated molecular pathways and common regulatory mechanisms. Finally, overall survival analyses were carried out to assess the suitability of the genes identified as prognostic biomarkers.<h4>Results</h4>Using WGCNA, we identified several key genes that may play important roles in PDAC. These genes are mainly related to either endoplasmic reticulum, mitochondrion or membrane functions, exhibit transferase or hydrolase activities and are involved in biological processes such as lipid metabolism or transmembrane transport. As a validation of the applied method, we found that some of the identified key genes (CEACAM1, MCU, VDAC1, CYCS, C15ORF52, TMEM51, LARP1 and ERLIN2) have previously been reported by others as potential PDAC biomarkers. Using overall survival analyses, we found that several of the newly identified genes may serve as biomarkers to stratify PDAC patients into low- and high-risk groups.<h4>Conclusions</h4>Using this new systems biology approach, we identified several genes that appear to be critical to PDAC development. As such, they may represent potential diagnostic biomarkers as well as therapeutic targets with clinical utility.
Also flagged:ArgatrobanthrombincytokinesecretionosteoarthritisOA
Journal Article2016-05-30✓ 2 SnippetsAsanuma K, Yoshikawa T, Yoshida K, Okamoto T, Asanuma Y, Hayashi T, Akita N, Oi T, Nishimura A, Hasegawa M, Sudo A.
In-Text Gene Mentions
Abstract)
…argatroban, antithrombin III (ATIII), or heparin cofactor…
Abstract)
…more effectively thanATIIIor HCII.…
Show Full Abstract
The purpose of this study was to clarify the precise effect of argatroban on the inhibition of cytokine secretion induced by thrombin on synovial cells. The efficiency of thrombin inactivation by thrombin inhibitors was evaluated in human synovial fluids (SFs). In SFs from 13 osteoarthritis (OA) and 11 rheumatoid arthritis (RA) patients, thrombin, Factor Xa (FXa), plasmin activity, IL-6, MMP-3, VEGF, and D-dimer concentrations were measured. Tissue factor (TF) activity or IL-6, MMP-3, and VEGF secretion of human synovial cells with or without thrombin and argatroban were measured. The efficiency of thrombin inactivation in SFs was compared for thrombin inhibitors: argatroban, antithrombin III (ATIII), or heparin cofactor II (HCII). In SFs, thrombin, FXa, plasmin, D-dimer, IL-6, and MMP-3 were significantly higher in RA than in OA. In synovial cell experiments, TNF-alpha and thrombin enhanced TF activity on the cell surface, and IL-6, MMP-3, and VEGF secretion were enhanced by thrombin. Increased TF activity, and IL-6, MMP-3, and VEGF secretion induced by thrombin were inhibited by argatroban. In SFs, argatroban inactivated thrombin more effectively than ATIII or HCII. Since thrombin plays an important role in the disease activity of OA and RA, it is a potential therapeutic molecular target. Argatroban was the most effective anticoagulant to inhibit thrombin activity in SF. Intra-articular injection is ideal administration because it can deliver high dose of argatroban without high risk of systematic complication.
Also flagged:Thrombophiliaarterial thromboembolismvenous thromboembolismfactor V Leidenproteins Cprothrombin
Journal Article2016-05-30✓ 2 SnippetsKim S, Song I, Kim HK, Huh S.
In-Text Gene Mentions
Introduction)
…protein S, andantithrombin-IIIare known to…
Results)
…patients (22%), anantithrombin-IIIdeficiency in 9…
Show Full Abstract
<h4>Purpose</h4>To determine the prevalence of thrombophilia in Korean patients with an arterial thromboembolism (ATE) or a venous thromboembolism (VTE), and to evaluate the characteristic of VTE in patients with thrombophilia.<h4>Methods</h4>Hospital records of 294 patients (228 with VTE, 66 with ATE) including two foreign ones (mean age, 51.4 years) who underwent thrombophilia testing between August 2006 and March 2015 were reviewed retrospectively. In general, such screening was performed according to the guidelines of the international consensus statement for VTE. Thrombophilia testing included evaluations of the factor V Leiden and prothrombin G20210A mutations, levels of proteins C and S and antithrombin, and antiphospholipid antibody syndrome (APLS).<h4>Results</h4>A factor V Leiden mutation was not found in the 292 Korean patients. A prothrombin G21210A mutation was investigated in 33 patients but none was found. Among 226 Korean patients with VTE, 130 demonstrated no thrombophilia and 55 patients did after exclusion of 41 patients without confirmatory test. The most common form was protein S deficiency (31 of 55, 56%) followed by protein C deficiency, antithrombin deficiency, and APLS. When comparing patients with a VTE or deep vein thrombosis (DVT) according to the presence of thrombophilia, thrombophilia was associated with younger age (P = 0.001 for VTE; P < 0.001 for DVT) and a family history (P < 0.001 for VTE and DVT).<h4>Conclusion</h4>We did not find any factor V Leiden mutation in Korean subjects at high risk for thrombophilia. Therefore, this testing is not warranted. Thrombophilia was associated with VTE in younger age and a family history.
…as diabetes orhemochromatosis, where oxidative stress…
Discussion)
…In patients withhemochromatosis[21] , RNA…
Show Full Abstract
Simvastatin reduces the blood concentration of cholesterol by inhibiting hydroxymethylglutaryl-coenzyme A reductase, the rate-limiting enzyme in cholesterol synthesis, and thereby reduces the risk of cardiovascular disease. In addition, simvastatin treatment leads to a reduction in fluxes in mitochondrial respiratory complexes I and II and might thereby reduce the formation of reactive oxygen species, which have been implicated in the pathogenesis of arteriosclerosis. Therefore, we hypothesized that simvastatin may reduce oxidative stress in humans in vivo. We conducted a randomized, double-blinded, placebo-controlled study in which subjects were treated with either 40mg of simvastatin or placebo for 14 days. The endpoints were six biomarkers for oxidative stress, which represent intracellular oxidative stress to nucleic acids, lipid peroxidation and plasma antioxidants, that were measured in urine and plasma samples. A total of 40 participants were included, of which 39 completed the trial. The observed differences between simvastatin and placebo groups in the primary outcomes, DNA and RNA oxidation, were small and nonsignificant (p=0.68), specifically, 3% in the simvastatin group compared to 7.1% in the placebo group for DNA oxidation and 7.3% in the simvastatin group compared to 3.4% in the placebo group. The differences in biomarkers related to plasma were not statistically significant between the treatments groups, with the exception of total vitamin E levels, which, as expected, were reduced in parallel with the reduction in plasma cholesterol. In healthy young male volunteers, short-term simvastatin treatment, which considerably reduces cholesterol, does not lead to a clinically relevant reduction in a panel of measures of oxidative stress. Whether simvastatin has effects on oxidative stress in diseased populations, such as diabetes or hemochromatosis, where oxidative stress is prominent, is unknown but seems unlikely.
Also flagged:pathogenesisFibrosisCDinflammatory diseaseinflammatory bowel diseasestrictures
Journal Article2016-05-30No SnippetsVerstockt B, Cleynen I.
Show Full Abstract
Fibrostenotic strictures are an important complication in patients with Crohn's disease (CD), very often necessitating surgery. This fibrotic process develops in a genetically susceptible individual and is influenced by an interplay with environmental, immunological, and disease-related factors. A deeper understanding of the genetic factors driving this fibrostenotic process might help to unravel the pathogenesis, and ultimately lead to development of new, anti-fibrotic therapy. Here, we review the genetic factors that have been associated with the development of fibrosis in patients with CD, as well as their potential pathophysiological mechanism(s). We also hypothesize on clinical implications, if any, and future research directions.
Also flagged:Lactate DehydrogenaseHepatocellular CarcinomacancersLactic dehydrogenaseLDHpyruvate
Journal Article2016-05-29✓ 1 SnippetFaloppi L, Bianconi M, Memeo R, Casadei Gardini A, Giampieri R, Bittoni A, Andrikou K, Del Prete M, Cascinu S, Scartozzi M.
In-Text Gene Mentions
Introduction)
…latoxin), metabolic (diabetes,hemochromatosis, and nonalcoholic fatty…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most common primary liver tumour (80-90%) and represents more than 5.7% of all cancers. Although in recent years the therapeutic options for these patients have increased, clinical results are yet unsatisfactory and the prognosis remains dismal. Clinical or molecular criteria allowing a more accurate selection of patients are in fact largely lacking. Lactic dehydrogenase (LDH) is a glycolytic key enzyme in the conversion of pyruvate to lactate under anaerobic conditions. In preclinical models, upregulation of LDH has been suggested to ensure both an efficient anaerobic/glycolytic metabolism and a reduced dependence on oxygen under hypoxic conditions in tumour cells. Data from several analyses on different tumour types seem to suggest that LDH levels may be a significant prognostic factor. The role of LDH in HCC has been investigated by different authors in heterogeneous populations of patients. It has been tested as a potential biomarker in retrospective, small, and nonfocused studies in patients undergoing surgery, transarterial chemoembolization (TACE), and systemic therapy. In the major part of these studies, high LDH serum levels seem to predict a poorer outcome. We have reviewed literature in this setting trying to resume basis for future studies validating the role of LDH in this disease.
Also flagged:ovarian cancergene expressiontumorstumorOvarian cancersSerous cancers
Journal Article2016-05-28✓ 1 SnippetHernandez L, Kim MK, Lyle LT, Bunch KP, House CD, Ning F, Noonan AM, Annunziata CM.
In-Text Gene Mentions
Text
…CCDC92…
Show Full Abstract
<h4>Objective</h4>The value of cell lines for pre-clinical work lies in choosing those with similar characteristics. Selection of cell lines is typically based on patient history, histological subtype at diagnosis, mutation patterns, or signaling pathways. Although recent studies established consensus regarding molecular characteristics of ovarian cancer cell lines, data on in vivo tumorigenicity remains only sporadically available, impeding translation of in vitro work to xenograft models.<h4>Methods</h4>We introduced 18 ovarian cancer cell lines into athymic nude mice through subcutaneous, intraperitoneal, and ovary intrabursal routes, and observed tumor development over 6weeks. We also profiled cell line gene expression and identified differentially expressed gene sets based on their ability to form tumors in the subcutaneous or intraperitoneal locations. Representative cell lines were further subjected to proteomic analyses.<h4>Results</h4>Ovarian cancer cell lines showed variable ability to grow in mice when implanted subcutaneous, intraperitoneal, or intrabursal. While some cell lines grew well in both SC and IP locations, others showed a strong propensity to grow in one location only. Gene expression profiles suggested that cell lines showing preference for IP growth had gene expression patterns more similar to primary tumors.<h4>Conclusions</h4>We report the tumorigenicity of 17 human ovarian cancer cell lines and one mouse cell line in three distinct anatomical locations, and associated gene networks. Growth patterns and histopathology, linked to molecular characteristics, provide a valuable resource to the research community, and better guide the choice of cell lines for in vitro studies to translate efficiently into xenograft testing.
Also flagged:Srccancerepithelial-to-mesenchymal transitionSrc-family kinasesreceptor tyrosine kinasestumor
Journal Article2016-05-28No SnippetsPatel A, Sabbineni H, Clarke A, Somanath PR.
Show Full Abstract
The Src-family kinases (SFKs), an intracellularly located group of non-receptor tyrosine kinases are involved in oncogenesis. The importance of SFKs has been implicated in the promotion of tumor cell motility, proliferation, inhibition of apoptosis, invasion and metastasis. Recent evidences indicate that specific effects of SFKs on epithelial-to-mesenchymal transition (EMT) as well as on endothelial and stromal cells in the tumor microenvironment can have profound effects on tumor microinvasion and metastasis. Although, having been studied extensively, these novel features of SFKs may contribute to greater understanding of benefits from Src inhibition in various types of cancers. Here we review the novel role of SFKs, particularly c-Src in mediating EMT, modulation of tumor endothelial-barrier, transendothelial migration (microinvasion) and metastasis of cancer cells, and discuss the utility of Src inhibitors in vascular normalization and cancer therapy.
Also flagged:cycloheximideamino acidHEKNESHoechst 33342STD
Journal Article2016-05-27No SnippetsMiyazaki Y, Mizumoto K, Dey G, Kudo T, Perrino J, Chen LC, Meyer T, Wandless TJ.
Show Full Abstract
The accumulation of protein aggregates is a common pathological hallmark of many neurodegenerative diseases. However, we do not fully understand how aggregates are formed or the complex network of chaperones, proteasomes and other regulatory factors involved in their clearance. Here, we report a chemically controllable fluorescent protein that enables us to rapidly produce small aggregates inside living cells on the order of seconds, as well as monitor the movement and coalescence of individual aggregates into larger structures. This method can be applied to diverse experimental systems, including live animals, and may prove valuable for understanding cellular responses and diseases associated with protein aggregates.
Also flagged:metabolismoxygenresponse to hypoxiaATPaseEGLN1PPARA
Journal Article2016-05-27✓ 1 SnippetWei C, Wang H, Liu G, Zhao F, Kijas JW, Ma Y, Lu J, Zhang L, Cao J, Wu M, Wang G, Liu R, Liu Z, Zhang S, Liu C, Du L.
In-Text Gene Mentions
S I O 001029)
…NGP4, ADAM9, PSMD2, LRRC7, MDH1B and LRRK1) a…
Show Full Abstract
Tibetan sheep have lived on the Tibetan Plateau for thousands of years; however, the process and consequences of adaptation to this extreme environment have not been elucidated for important livestock such as sheep. Here, seven sheep breeds, representing both highland and lowland breeds from different areas of China, were genotyped for a genome-wide collection of single-nucleotide polymorphisms (SNPs). The FST and XP-EHH approaches were used to identify regions harbouring local positive selection between these highland and lowland breeds, and 236 genes were identified. We detected selection events spanning genes involved in angiogenesis, energy production and erythropoiesis. In particular, several candidate genes were associated with high-altitude hypoxia, including EPAS1, CRYAA, LONP1, NF1, DPP4, SOD1, PPARG and SOCS2. EPAS1 plays a crucial role in hypoxia adaption; therefore, we investigated the exon sequences of EPAS1 and identified 12 mutations. Analysis of the relationship between blood-related phenotypes and EPAS1 genotypes in additional highland sheep revealed that a homozygous mutation at a relatively conserved site in the EPAS1 3' untranslated region was associated with increased mean corpuscular haemoglobin concentration and mean corpuscular volume. Taken together, our results provide evidence of the genetic diversity of highland sheep and indicate potential high-altitude hypoxia adaptation mechanisms, including the role of EPAS1 in adaptation.
Journal Article2016-05-27✓ 1 SnippetRolhion N, Furniss RC, Grabe G, Ryan A, Liu M, Matthews SA, Holden DW.
In-Text Gene Mentions
Methods)
…by the geneCSE1L, was amplified…
Show Full Abstract
Salmonella enterica replicates in macrophages through the action of effector proteins translocated across the vacuolar membrane by a type III secretion system (T3SS). Here we show that the SPI-2 T3SS effector SpvD suppresses proinflammatory immune responses. SpvD prevented activation of an NF-ĸB-dependent promoter and caused nuclear accumulation of importin-α, which is required for nuclear import of p65. SpvD interacted specifically with the exportin Xpo2, which mediates nuclear-cytoplasmic recycling of importins. We propose that interaction between SpvD and Xpo2 disrupts the normal recycling of importin-α from the nucleus, leading to a defect in nuclear translocation of p65 and inhibition of activation of NF-ĸB regulated promoters. SpvD down-regulated pro-inflammatory responses and contributed to systemic growth of bacteria in mice. This work shows that a bacterial pathogen can manipulate host cell immune responses by interfering with the nuclear transport machinery.
Also flagged:PCMSumatransickferritinIron Storage Diseaseiron
Journal Article2016-05-27✓ 5 SnippetsWatanabe M, Roth TL, Bauer SJ, Lane A, Romick-Rosendale LE.
In-Text Gene Mentions
Abstract)
…disease (ISD), orhemochromatosis, a disease resulting…
Abstract)
…reportedly die fromhemochromatosis.…
Abstract)
…in susceptibility tohemochromatosiswithin the taxon…
Abstract)
…value in diagnosinghemochromatosisin the Sumatran…
Abstract)
…the development ofhemochromatosisand possibly increase…
Show Full Abstract
A variety of wildlife species maintained in captivity are susceptible to iron storage disease (ISD), or hemochromatosis, a disease resulting from the deposition of excess iron into insoluble iron clusters in soft tissue. Sumatran rhinoceros (Dicerorhinus sumatrensis) is one of the rhinoceros species that has evolutionarily adapted to a low-iron diet and is susceptible to iron overload. Hemosiderosis is reported at necropsy in many African black and Sumatran rhinoceroses but only a small number of animals reportedly die from hemochromatosis. The underlying cause and reasons for differences in susceptibility to hemochromatosis within the taxon remains unclear. Although serum ferritin concentrations have been useful in monitoring the progression of ISD in many species, there is some question regarding their value in diagnosing hemochromatosis in the Sumatran rhino. To investigate the metabolic changes during the development of hemochromatosis and possibly increase our understanding of its progression and individual susceptibility differences, the serum metabolome from a Sumatran rhinoceros was investigated by nuclear magnetic resonance (NMR)-based metabolomics. The study involved samples from female rhinoceros at the Cincinnati Zoo (n = 3), including two animals that died from liver failure caused by ISD, and the Sungai Dusun Rhinoceros Conservation Centre in Peninsular Malaysia (n = 4). Principal component analysis was performed to visually and statistically compare the metabolic profiles of the healthy animals. The results indicated that significant differences were present between the animals at the zoo and the animals in the conservation center. A comparison of the 43 serum metabolomes of three zoo rhinoceros showed two distinct groupings, healthy (n = 30) and unhealthy (n = 13). A total of eighteen altered metabolites were identified in healthy versus unhealthy samples. Results strongly suggest that NMR-based metabolomics is a valuable tool for animal health monitoring and may provide insight into the progression of this and other insidious diseases.
Also flagged:AcetatebutyrateWatermetronidazoleSPFPropionate
Journal Article2016-05-27✓ 5 SnippetsPark JH, Kotani T, Konno T, Setiawan J, Kitamura Y, Imada S, Usui Y, Hatano N, Shinohara M, Saito Y, Murata Y, Matozaki T.
In-Text Gene Mentions
S I O 001029)
…(A) SPF mice (4-week-old) were provided with drinking water supplemented (or not) with an antibiotic cocktail (Abx: ampicillin, vancomycin, metronidazole, neomycin) for 4 weeks, after which paraffin-embedded sections of the ileum from mice (8-week-old) were prepared and subjected to in situ hybridization analysis of Olfm4 mRNA.…
Methods)
…of the olfactomedin4 (Olfm4) gene in the…
Methods)
…RNA probe forOlfm4mRNA (IMAGE clone…
Results)
…The number ofOlfm4mRNA–positive intestinal stem…
Discussion)
…the numbers ofOlfm4mRNA–positive stem cells…
Show Full Abstract
The life span of intestinal epithelial cells (IECs) is short (3-5 days), and its regulation is thought to be important for homeostasis of the intestinal epithelium. We have now investigated the role of commensal bacteria in regulation of IEC turnover in the small intestine. The proliferative activity of IECs in intestinal crypts as well as the migration of these cells along the crypt-villus axis were markedly attenuated both in germ-free mice and in specific pathogen-free (SPF) mice treated with a mixture of antibiotics, with antibiotics selective for Gram-positive bacteria being most effective in this regard. Oral administration of chloroform-treated feces of SPF mice to germ-free mice resulted in a marked increase in IEC turnover, suggesting that spore-forming Gram-positive bacteria contribute to this effect. Oral administration of short-chain fatty acids (SCFAs) as bacterial fermentation products also restored the turnover of IECs in antibiotic-treated SPF mice as well as promoted the development of intestinal organoids in vitro. Antibiotic treatment reduced the phosphorylation levels of ERK, ribosomal protein S6, and STAT3 in IECs of SPF mice. Our results thus suggest that Gram-positive commensal bacteria are a major determinant of IEC turnover, and that their stimulatory effect is mediated by SCFAs.
Sorghum vegetative tissues are becoming increasingly important for biofuel production. The composition of sorghum stem tissues is influenced by genotype, environment and photoperiod sensitivity, and varies widely between varieties and also between different stem tissues (outer rind vs inner pith). Here, the amount of cellulose, (1,3;1,4)-β-glucan, arabinose and xylose in the stems of twelve diverse sorghum varieties, including four photoperiod-sensitive varieties, was measured. At maturity, most photoperiod-insensitive lines had 1% w/w (1,3;1,4)-β-glucan in stem pith tissue whilst photoperiod-sensitive varieties remained in a vegetative stage and accumulated up to 6% w/w (1,3;1,4)-β-glucan in the same tissue. Three sorghum lines were chosen for further study: a cultivated grain variety (Sorghum bicolor BTx623), a sweet variety (S. bicolor Rio) and a photoperiod-sensitive wild line (S. bicolor ssp. verticilliflorum Arun). The Arun line accumulated 5.5% w/w (1,3;1,4)-β-glucan and had higher SbCslF6 and SbCslH3 transcript levels in pith tissues than did photoperiod-insensitive varieties Rio and BTx623 (<1% w/w pith (1,3;1,4)-β-glucan). To assess the digestibility of the three varieties, stem tissue was treated with either hydrolytic enzymes or dilute acid and the release of fermentable glucose was determined. Despite having the highest lignin content, Arun yielded significantly more glucose than the other varieties, and theoretical calculation of ethanol yields was 10 344 L ha-1 from this sorghum stem tissue. These data indicate that sorghum stem (1,3;1,4)-β-glucan content may have a significant effect on digestibility and bioethanol yields. This information opens new avenues of research to generate sorghum lines optimised for biofuel production.
<h4>Objective</h4>Adenomyosis is a clinical disorder defined by the presence of endometrial glands and stroma within the myometrium, the pathogenesis of which is poorly understood. We postulate that dysregulation of genes and pathways in eutopic endometrium may predispose to ectopic implantation. No study, to our knowledge, has examined the global transcriptome of isolated eutopic endometrium from women with clinically significant adenomyosis.<h4>Design</h4>Laboratory-based study with full institutional review board approval and consents.<h4>Material and methods</h4>Endometrial sampling was performed on hysterectomy specimens (proliferative phase) from symptomatic women with pathologically confirmed diffuse adenomyosis (n = 3). Controls (n = 5) were normo-ovulatory patients without adenomyosis. All patients were free from leiomyoma, endometriosis, and hormonal exposures. Isolated purified total RNA was subjected to microarray analysis using the Gene 1.0 ST Affymetrix platform. Data were analyzed with GeneSpring and Ingenuity Pathway analysis. Validation of several genes was undertaken by quantitative real-time reverse transcriptase polymerase chain reaction.<h4>Results</h4>Comparison of transcriptomes of proliferative endometrium from women with and without adenomyosis revealed 140 upregulated and 884 downregulated genes in samples from women with adenomyosis compared to controls. Highly differentially expressed genes include those involved in regulation of apoptosis, steroid hormone responsiveness, and proteins involved in extracellular matrix remodeling as well as microRNAs of unknown significance. Affected canonical pathways included eukaryotic initiation factor 2 signaling, oxidative phosphorylation, mitochondrial dysfunction, estrogen receptor signaling, and mammalian target of rapamycin signaling.<h4>Conclusion</h4>The eutopic endometrium in patients with adenomyosis has fundamental abnormalities that may predispose to invasion and survival beyond the myometrial interface.
Also flagged:DR3InfectionTNF-like cytokine 1Adeath receptor 3pathogenesisinflammatory bowel disease
Journal Article2016-05-27✓ 1 SnippetJia LG, Bamias G, Arseneau KO, Burkly LC, Wang EC, Gruszka D, Pizarro TT, Cominelli F.
In-Text Gene Mentions
Text
…TNFSF4…
Show Full Abstract
TNF-like cytokine 1A (TL1A) is expressed on APCs and provides costimulatory signals to activated lymphocytes that bear its functional receptor, death receptor 3 (DR3). TL1A/DR3 signaling is involved in the pathogenesis of human and experimental inflammatory bowel disease. In the current study, we investigated the role of this cytokine/receptor pair in acute intestinal injury/repair pathways. We demonstrate that intact DR3 signaling protected mice from acute dextran sodium sulfate colitis because DR3(-/-) mice showed more severe mucosal inflammation and increased mortality. DR3(-/-) mice were compromised in their ability to maintain adequate numbers of CD4(+)CD25(+)Foxp3(+) regulatory T cells in response to acute mucosal damage. This defect in immune regulation led to a nonspecific upregulation of effector proinflammatory pathways, which was most prominent for the Th17 immunophenotype. TL1A(-/-) mice were similarly more susceptible to dextran sodium sulfate colitis, although without mortality and with delayed kinetics compared with DR3(-/-) mice, and also displayed significantly reduced numbers of regulatory T cells. Infection of DR3(-/-) mice with Salmonella typhimurium was associated with defective microbial clearance and elevated bacterial load. Taken together, our findings indicate a novel protective role for the TL1A/DR3 axis in the regulation of mucosal homeostasis during acute intestinal injury/repair, which contrasts with its known pathogenic function during chronic intestinal inflammation.
Also flagged:Extracellular VesiclesIschemicMIMyocardial infarctioninflammatory responseextracellular
Journal Article2016-05-27✓ 1 SnippetCheow ES, Cheng WC, Lee CN, de Kleijn D, Sorokin V, Sze SK.
In-Text Gene Mentions
Text
…SERPINC1…
Show Full Abstract
Myocardial infarction (MI) triggers a potent inflammatory response via the release of circulatory mediators, including extracellular vesicles (EVs) by damaged cardiac cells, necessary for myocardial healing. Timely repression of inflammatory response are critical to prevent and minimize cardiac tissue injuries, nonetheless, progression in this aspect remains challenging. The ability of EVs to trigger a functional response upon delivery of carried bioactive cargos, have made them clinically attractive diagnostic biomarkers and vectors for therapeutic interventions. Using label-free quantitative proteomics approach, we compared the protein cargo of plasma EVs between patients with MI and from patients with stable angina (NMI). We report, for the first time, the proteomics profiling on 252 EV proteins that were modulated with >1.2-fold after MI. We identified six up-regulated biomarkers with potential for clinical applications; these reflected post-infarct pathways of complement activation (Complement C1q subcomponent subunit A (C1QA), 3.23-fold change, p = 0.012; Complement C5 (C5), 1.27-fold change, p = 0.087), lipoprotein metabolism (Apoliporotein D (APOD), 1.86-fold change, p = 0.033; Apolipoprotein C-III (APOCC3), 2.63-fold change, p = 0.029) and platelet activation (Platelet glycoprotein Ib alpha chain (GP1BA), 9.18-fold change, p < 0.0001; Platelet basic protein (PPBP), 4.72-fold change, p = 0.027). The data have been deposited to the ProteomeXchange with identifier PXD002950. This novel biomarker panel was validated in 43 patients using antibody-based assays (C1QA (p = 0.005); C5 (p = 0.0047), APOD (p = 0.0267); APOC3 (p = 0.0064); GP1BA (p = 0.0031); PPBP (p = 0.0465)). We further present that EV-derived fibrinogen components were paradoxically down-regulated in MI, suggesting that a compensatory mechanism may suppress post-infarct coagulation pathways, indicating potential for therapeutic targeting of this mechanism in MI. Taken together, these data demonstrated that plasma EVs contain novel diagnostic biomarkers and therapeutic targets that can be further developed for clinical use to benefit patients with coronary artery diseases (CADs).
Journal Article2016-05-27✓ 1 SnippetLi N, Nakauka-Ddamba A, Tobias J, Jensen ST, Lengner CJ.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
<h4>Background & aims</h4>Intestinal homeostasis and regeneration after injury are controlled by 2 different types of cells: slow cycling, injury-resistant reserve intestinal stem cells (ISCs) and actively proliferative ISCs. Putative reserve ISCs have been identified using a variety of methods, including CreER insertions at Hopx or Bmi1 loci in mice and DNA label retention. Label-retaining cells (LRCs) include dormant stem cells in several tissues; in the intestine, LRCs appear to share some properties with reserve ISCs, which can be marked by reporter alleles. We investigated the relationships between these populations.<h4>Methods</h4>Studies were performed in Lgr5-EGFP-IRESCreERT2, Bmi1-CreERT2, Hopx-CreERT2, and TRE-H2BGFP::Hopx-CreERT2::lox-stop-lox-tdTomato mice. Intestinal epithelial cell populations were purified; we compared reporter allele-marked reserve ISCs and several LRC populations (marked by H2B-GFP retention) using histologic flow cytometry and functional and single-cell gene expression assays.<h4>Results</h4>LRCs were dynamic and their cellular composition changed with time. Short-term LRCs had properties of secretory progenitor cells undergoing commitment to the Paneth or enteroendocrine lineages, while retaining some stem cell activity. Long-term LRCs lost stem cell activity and were a homogenous population of terminally differentiated Paneth cells. Reserve ISCs marked with HopxCreER were primarily quiescent (in G0), with inactive Wnt signaling and robust stem cell activity. In contrast, most LRCs were in G1 arrest and expressed genes that are regulated by the Wnt pathway or are in the secretory lineage.<h4>Conclusions</h4>LRCs are molecularly and functionally distinct from reporter-marked reserve ISCs. This information provides an important basis for future studies of relationships among ISC populations.
Also flagged:Nuclear specklesgenetic disorderspolyQ) diseasespathogenesismyotonic dystrophy type 1glutamine
Journal Article2016-05-27No SnippetsUrbanek MO, Jazurek M, Switonski PM, Figura G, Krzyzosiak WJ.
Show Full Abstract
The human genetic disorders caused by CAG repeat expansions in the translated sequences of various genes are called polyglutamine (polyQ) diseases because of the cellular "toxicity" of the mutant proteins. The contribution of mutant transcripts to the pathogenesis of these diseases is supported by several observations obtained from cellular models of these disorders. Here, we show that the common feature of cell lines modeling polyQ diseases is the formation of nuclear CAG RNA foci. We performed qualitative and quantitative analyses of these foci in numerous cellular models endogenously and exogenously expressing mutant transcripts by fluorescence in situ hybridization (FISH). We compared the CAG RNA foci of polyQ diseases with the CUG foci of myotonic dystrophy type 1 and found substantial differences in their number and morphology. Smaller differences within the polyQ disease group were also revealed and included a positive correlation between the foci number and the CAG repeat length. We show that expanded CAA repeats, also encoding glutamine, did not trigger RNA foci formation and foci formation is independent of the presence of mutant polyglutamine protein. Using FISH combined with immunofluorescence, we demonstrated partial co-localization of CAG repeat foci with MBNL1 alternative splicing factor, which explains the mild deregulation of MBNL1-dependent genes. We also showed that foci reside within nuclear speckles in diverse cell types: fibroblasts, lymphoblasts, iPS cells and neuronal progenitors and remain dependent on integrity of these nuclear structures.
Also flagged:mitochondrialcytochrome Bmitochondrial cytochrome bornithine decarboxylasephenolchloroform
Journal Article2016-05-27No SnippetsCard DC, Schield DR, Adams RH, Corbin AB, Perry BW, Andrew AL, Pasquesi GI, Smith EN, Jezkova T, Boback SM, Booth W, Castoe TA.
Show Full Abstract
Boa is a Neotropical genus of snakes historically recognized as monotypic despite its expansive distribution. The distinct morphological traits and color patterns exhibited by these snakes, together with the wide diversity of ecosystems they inhabit, collectively suggest that the genus may represent multiple species. Morphological variation within Boa also includes instances of dwarfism observed in multiple offshore island populations. Despite this substantial diversity, the systematics of the genus Boa has received little attention until very recently. In this study we examined the genetic structure and phylogenetic relationships of Boa populations using mitochondrial sequences and genome-wide SNP data obtained from RADseq. We analyzed these data at multiple geographic scales using a combination of phylogenetic inference (including coalescent-based species delimitation) and population genetic analyses. We identified extensive population structure across the range of the genus Boa and multiple lines of evidence for three widely-distributed clades roughly corresponding with the three primary land masses of the Western Hemisphere. We also find both mitochondrial and nuclear support for independent origins and parallel evolution of dwarfism on offshore island clusters in Belize and Cayos Cochinos Menor, Honduras.
Also flagged:behavioralcorticosteroneMPSmanganesegene expressionanxiety
Journal Article2016-05-27✓ 1 SnippetMcCreary JK, Truica LS, Friesen B, Yao Y, Olson DM, Kovalchuk I, Cross AR, Metz GA.
In-Text Gene Mentions
Abstract)
…neuronal growth regulator (Negr1) and synaptosomal-associated …
Show Full Abstract
Prenatal stress is a risk factor for abnormal neuroanatomical, cognitive, behavioral and mental health outcomes with potentially transgenerational consequences. Females in general seem more resilient to the effects of prenatal stress than males. Here, we examined if repeated stress across generations may diminish stress resiliency and cumulatively enhance the susceptibility for adverse health outcomes in females. Pregnant female rats of three successive generations were exposed to stress from gestational days 12-18 to generate multigenerational prenatal stress (MPS) in the maternal lineage. Stress response was measured by plasma corticosterone levels and open-field exploration in each generation. Neuromorphological consequences of MPS were investigated in the F3 generation using in vivo manganese-enhanced magnetic resonance imaging (MEMRI), T2-relaxometry, and cytoarchitectonics in relation to candidate gene expression involved in brain plasticity and mental health. Each additional generation of prenatal stress incrementally elevated hypothalamic-pituitary-adrenal axis activation, anxiety-like and aversive behaviors in adult female offspring. Elevated stress responses in the MPS F3 generation were accompanied by reduced neural density in prefrontal cortex, hippocampus and whole brain along with altered brain activation patterns in in vivo MEMRI. MPS increased ephrin receptor A5 (Epha5), neuronal growth regulator (Negr1) and synaptosomal-associated protein 25 (Snap25) gene expression and reduced fibroblast growth factor 12 (Fgf12) in prefrontal cortex. These genes regulate neuronal maturation, arborization and synaptic plasticity and may explain altered brain cytoarchitectonics and connectivity. These findings emphasize that recurrent stress across generations may cumulatively increase stress vulnerability and the risk of adverse health outcomes through perinatal programing in females.
Also flagged:AminoflavoneEGFRcancerTriple negative breast cancerbreast cancerAF
Journal Article2016-05-27No SnippetsBrinkman AM, Chen G, Wang Y, Hedman CJ, Sherer NM, Havighurst TC, Gong S, Xu W.
Show Full Abstract
Triple negative breast cancer (TNBC) is an aggressive subtype of breast cancer for which there is no available targeted therapy. TNBC cases contribute disproportionately to breast cancer-related mortality, thus the need for novel and effective therapeutic methods is urgent. We have previously shown that a National Cancer Institute (NCI) investigational drug aminoflavone (AF) exhibits strong growth inhibitory effects in TNBC cells. However, in vivo pulmonary toxicity resulted in withdrawal or termination of several human clinical trials for AF. Herein we report the in vivo efficacy of a nanoformulation of AF that enhances the therapeutic index of AF in TNBC. We engineered a unique unimolecular micelle nanoparticle (NP) loaded with AF and conjugated with GE11, a 12 amino acid peptide targeting epidermal growth factor receptor (EGFR), since EGFR amplification is frequently observed in TNBC tumors. These unimolecular micelles possessed excellent stability and preferentially released drug payload at endosomal pH levels rather than blood pH levels. Use of the GE11 targeting peptide resulted in enhanced cellular uptake and strong growth inhibitory effects in TNBC cells. Further, AF-loaded, GE11-conjugated (targeted) unimolecular micelle NPs significantly inhibit orthotopic TNBC tumor growth in a xenograft model, compared to treatment with AF-loaded, GE11-lacking (non-targeted) unimolecular micelle NPs or free AF. Interestingly, the animals treated with AF-loaded, targeted NPs had the highest plasma and tumor level of AF among different treatment groups yet exhibited no increase in plasma aspartate aminotransferase (AST) activity level or observable tissue damage at the time of sacrifice. Together, these results highlight AF-loaded, EGFR-targeted unimolecular micelle NPs as an effective therapeutic option for EGFR-overexpressing TNBC.
Also flagged:Huntington's diseaseneurodegenerative disordersHuntington DiseaseHDautosomal dominantly transmitted diseasesynthesis
Journal Article2016-05-26✓ 1 SnippetLuca G, Bellezza I, Arato I, Di Pardo A, Mancuso F, Calvitti M, Falabella G, Bartoli S, Maglione V, Amico E, Favellato M, Basta G, Bodo M, Minelli A, Calafiore R, Frati L, Squitieri F.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
<h4>Introduction</h4>Immune dysfunction, promoted by pro-inflammatory cytokines, plays a pivotal role in neurodegeneration associated with Huntington's disease.<h4>Aims</h4>The aim of this study was to investigate the emerging immunoregulatory and antiinflammatory properties of Sertoli cells in Huntington's disease.<h4>Methods</h4>The experimental R6/2 mouse model of Huntington's disease was treated by a single intraperitoneal injection of microencapsulated prepubertal porcine Sertoli cells and lifespan, motor performance and striatal inflammatory pattern have been evaluated.<h4>Results</h4>The results of this study demonstrated that a single intraperitoneal injection of microencapsulated prepubertal porcine Sertoli cells uniquely improved performances and extended the life expectancy of R6/2 Huntington's disease mice, by immune dysfunction modulation in brain.<h4>Conclusions</h4>This study highlights the immunomodulatory and trophic role of Sertoli cells that could be of help in the treatment of neurodegenerative disorders.
This study aimed to assess the features of intrahepatic cholangiocarcinoma (ICC) at computerized tomography (CT) and verify the risk of misdiagnosis of ICC as hepatocellular carcinoma (HCC) in cirrhosis. CT appearances of 98 histologically confirmed ICC nodules from 84 cirrhotic patients were retrospectively reviewed, taking into consideration the pattern and dynamic contrast uptake during the arterial, portal venous and delayed phases. During the arterial phase, 53 nodules (54.1%) showed peripheral rim-like enhancement, 35 (35.7%) hyperenhancement, 9 (9.2%) hypoenhancement and 1 (1.0%) isoenhancement. The ICC nodules showed heterogeneous dynamic contrast patterns, being progressive enhancement in 35 nodules (35.7%), stable enhancement in 28 nodules (28.6%), wash-in and wash-out pattern in 15 nodules (15.3%) and all other enhancement patterns in 20 nodules (20.4%). There were no significant differences in the dynamic vascular patterns of ICC according to nodule size (p > 0.05). ICC in cirrhosis has varied enhancement patterns at contrast-enhanced multiphase multidetector CT. Though the majority of ICC did not display typical radiological hallmarks of HCC, if dynamic CT scan was used as the sole modality for the non-invasive diagnosis of nodules in cirrhosis, the risk of misdiagnosis of ICC for HCC is not negligible.
Journal Article2016-05-26No SnippetsYang J, Guo B, Shikano T, Liu X, Merilä J.
Show Full Abstract
Heritable phenotypic differences between populations, caused by the selective effects of distinct environmental conditions, are of commonplace occurrence in nature. However, the actual genomic targets of this kind of selection are still poorly understood. We conducted a quantitative trait locus (QTL) mapping study to identify genomic regions responsible for morphometric differentiation between genetically and phenotypically divergent marine and freshwater nine-spined stickleback (Pungitius pungitius) populations. Using a dense panel of SNP-markers obtained by restriction site associated DNA sequencing of an F2 recombinant cross, we found 22 QTL that explained 3.5-12.9% of phenotypic variance in the traits under investigation. We detected one fairly large-effect (PVE = 9.6%) QTL for caudal peduncle length-a trait with a well-established adaptive function showing clear differentiation among marine and freshwater populations. We also identified two large-effect QTL for lateral plate numbers, which are different from the lateral plate QTL reported in earlier studies of this and related species. Hence, apart from identifying several large-effect QTL in shape traits showing adaptive differentiation in response to different environmental conditions, the results suggest intra- and interspecific heterogeneity in the genomic basis of lateral plate number variation.
Also flagged:lipidosteoporosiscardiovascular diseaseroyal jellyProtein CProtein S
Journal Article2016-05-26✓ 2 SnippetsLambrinoudaki I, Augoulea A, Rizos D, Politi M, Tsoltos N, Moros M, Chinou I, Graikou K, Kouskouni E, Kambani S, Panoulis K, Moutsatsou P.
In-Text Gene Mentions
Abstract)
…markers [lipid profile,antithrombin-III(ATIII), Protein C,…
Abstract)
…id profile, antithrombin-III (ATIII), Protein C, Protein…
Show Full Abstract
<h4>Aim</h4>Menopause transition is associated with chronic conditions such as osteoporosis and cardiovascular disease. Concerns about the long-term safety of menopausal hormone therapy make alternative natural methods an appealing approach to management. The aim of this study was to examine the effect of royal jelly (RJ) on cardiovascular and bone turnover markers in clinically healthy postmenopausal women.<h4>Methods</h4>A total of 36 postmenopausal healthy women were studied in a prospective follow-up study. Participants received 150 mg of RJ daily for three months. Circulating cardiovascular risk markers [lipid profile, antithrombin-III (ATIII), Protein C, Protein S, Plasminogen Activator Inhibitor-1 (PAI-1)] and bone turnover parameters [Total calcium, phosphate (P), parathormone (PTH), total type-1 Procollagen N-terminal (P1NP), Osteocalcin and serum collagen type 1 cross-linked C-telopeptide (CTX)] were compared between the baseline and the three-month visit.<h4>Results</h4>The RJ used in this study was particularly rich in medium chain fatty acids, compounds with hypolipidemic properties, which comprised 63% of the dry weight fatty content. RJ treatment resulted in a significant increase in high density lipoprotein - cholesterol (HDL-C 60.2 mg/dL ± 12.3 versus 64.7 mg/dL ± 13.9, 7.7% increase, p = 0.0003), as well as in a significant decrease in low density lipoprotein - cholesterol (LDL-C, 143.9 ± 37.5 versus 136.2 ± 32, 4.1% decrease, p = 0.011) and in total cholesterol (224.4 ± 38.6 to 216.1 ± 36.5, 3.09% decrease, p = 0.018). No statistical significant changes were found in the remaining cardiovascular or the bone turnover parameters.<h4>Conclusions</h4>The intake of RJ 150 mg for three months is associated with significant improvements of the lipid profile of postmenopausal women. RJ supplementation may offer an alternative method of controlling the menopause - associated dyslipidemia.
Also flagged:Cell ProliferationAromataseHormone Receptorbreast cancerestrogen receptorER
Journal Article2016-05-26No SnippetsHiguchi T, Endo M, Hanamura T, Gohno T, Niwa T, Yamaguchi Y, Horiguchi J, Hayashi S.
Show Full Abstract
Aromatase inhibitors (AIs) effectively treat hormone receptor-positive postmenopausal breast cancer, but some patients do not respond to treatment or experience recurrence. Mechanisms of AI resistance include ligand-independent activation of the estrogen receptor (ER) and signaling via other growth factor receptors; however, these do not account for all forms of resistance. Here we present an alternative mechanism of AI resistance. We ectopically expressed aromatase in MCF-7 cells expressing green fluorescent protein as an index of ER activity. Aromatase-overexpressing MCF-7 cells were cultured in estrogen-depleted medium supplemented with testosterone and the AI, letrozole, to establish letrozole-resistant (LR) cell lines. Compared with parental cells, LR cells had higher mRNA levels of steroid sulfatase (STS), which converts estrone sulfate (E1S) to estrone, and the organic anion transporter peptides (OATPs), which mediate the uptake of E1S into cells. LR cells proliferated more in E1S-supplemented medium than did parental cells, and LR proliferation was effectively inhibited by an STS inhibitor in combination with letrozole and by ER-targeting drugs. Analysis of ER-positive primary breast cancer tissues showed a significant correlation between the increases in the mRNA levels of STS and the OATPs in the LR cell lines, which supports the validity of this AI-resistant model. This is the first study to demonstrate the contribution of STS and OATPs in E1S metabolism to the proliferation of AI-resistant breast cancer cells. We suggest that E1S metabolism represents a new target in AI-resistant breast cancer treatment.
<h4>Background</h4>Indigenous populations of animals have developed unique adaptations to their local environments, which may include factors such as response to thermal stress, drought, pathogens and suboptimal nutrition. The survival and subsequent evolution within these local environments can be the result of both natural and artificial selection driving the acquisition of favorable traits, which over time leave genomic signatures in a population. This study's goals are to characterize genomic diversity and identify selection signatures in chickens from equatorial Africa to identify genomic regions that may confer adaptive advantages of these ecotypes to their environments.<h4>Results</h4>Indigenous chickens from Uganda (n = 72) and Rwanda (n = 100), plus Kuroilers (n = 24, an Indian breed imported to Africa), were genotyped using the Axiom® 600 k Chicken Genotyping Array. Indigenous ecotypes were defined based upon location of sampling within Africa. The results revealed the presence of admixture among the Ugandan, Rwandan, and Kuroiler populations. Genes within runs of homozygosity consensus regions are linked to gene ontology (GO) terms related to lipid metabolism, immune functions and stress-mediated responses (FDR < 0.15). The genes within regions of signatures of selection are enriched for GO terms related to health and oxidative stress processes. Key genes in these regions had anti-oxidant, apoptosis, and inflammation functions.<h4>Conclusions</h4>The study suggests that these populations have alleles under selective pressure from their environment, which may aid in adaptation to harsh environments. The correspondence in gene ontology terms connected to stress-mediated processes across the populations could be related to the similarity of environments or an artifact of the detected admixture.
Journal Article2016-05-26✓ 1 SnippetOhta S, Montaño-Gutierrez LF, de Lima Alves F, Ogawa H, Toramoto I, Sato N, Morrison CG, Takeda S, Hudson DF, Rappsilber J, Earnshaw WC.
In-Text Gene Mentions
Results)
…Condensinsubunits, with the…
Show Full Abstract
Packaging of DNA into condensed chromosomes during mitosis is essential for the faithful segregation of the genome into daughter nuclei. Although the structure and composition of mitotic chromosomes have been studied for over 30 years, these aspects are yet to be fully elucidated. Here, we used stable isotope labeling with amino acids in cell culture to compare the proteomes of mitotic chromosomes isolated from cell lines harboring conditional knockouts of members of the condensin (SMC2, CAP-H, CAP-D3), cohesin (Scc1/Rad21), and SMC5/6 (SMC5) complexes. Our analysis revealed that these complexes associate with chromosomes independently of each other, with the SMC5/6 complex showing no significant dependence on any other chromosomal proteins during mitosis. To identify subtle relationships between chromosomal proteins, we employed a nano Random Forest (nanoRF) approach to detect protein complexes and the relationships between them. Our nanoRF results suggested that as few as 113 of 5058 detected chromosomal proteins are functionally linked to chromosome structure and segregation. Furthermore, nanoRF data revealed 23 proteins that were not previously suspected to have functional interactions with complexes playing important roles in mitosis. Subsequent small-interfering-RNA-based validation and localization tracking by green fluorescent protein-tagging highlighted novel candidates that might play significant roles in mitotic progression.
Also flagged:γ-globingene silencingGATA-1FOG-1OGTOGA
Journal Article2016-05-26✓ 1 SnippetZhang Z, Costa FC, Tan EP, Bushue N, DiTacchio L, Costello CE, McComb ME, Whelan SA, Peterson KR, Slawson C.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
One mode of γ-globin gene silencing involves a GATA-1·FOG-1·Mi2β repressor complex that binds to the -566 GATA site relative to the (A)γ-globin gene cap site. However, the mechanism of how this repressor complex is assembled at the -566 GATA site is unknown. In this study, we demonstrate that the O-linked N-acetylglucosamine (O-GlcNAc) processing enzymes, O-GlcNAc-transferase (OGT) and O-GlcNAcase (OGA), interact with the (A)γ-globin promoter at the -566 GATA repressor site; however, mutation of the GATA site to GAGA significantly reduces OGT and OGA promoter interactions in β-globin locus yeast artificial chromosome (β-YAC) bone marrow cells. When WT β-YAC bone marrow cells are treated with the OGA inhibitor Thiamet-G, the occupancy of OGT, OGA, and Mi2β at the (A)γ-globin promoter is increased. In addition, OGT and Mi2β recruitment is increased at the (A)γ-globin promoter when γ-globin becomes repressed in postconception day E18 human β-YAC transgenic mouse fetal liver. Furthermore, we show that Mi2β is modified with O-GlcNAc, and both OGT and OGA interact with Mi2β, GATA-1, and FOG-1. Taken together, our data suggest that O-GlcNAcylation is a novel mechanism of γ-globin gene regulation mediated by modulating the assembly of the GATA-1·FOG-1·Mi2β repressor complex at the -566 GATA motif within the promoter.
Also flagged:arginineserinecholesterolsynthesisgene expressionPGC-1α 6
Journal Article2016-05-26✓ 1 SnippetMartínez-Redondo V, Jannig PR, Correia JC, Ferreira DM, Cervenka I, Lindvall JM, Sinha I, Izadi M, Pettersson-Klein AT, Agudelo LZ, Gimenez-Cassina A, Brum PC, Dahlman-Wright K, Ruas JL.
In-Text Gene Mentions
Text
…Ddx27…
Show Full Abstract
Endurance and resistance exercise training induces specific and profound changes in the skeletal muscle transcriptome. Peroxisome proliferator-activated receptor γ coactivator-1 α (PGC-1α) coactivators are not only among the genes differentially induced by distinct training methods, but they also participate in the ensuing signaling cascades that allow skeletal muscle to adapt to each type of exercise. Although endurance training preferentially induces PGC-1α1 expression, resistance exercise activates the expression of PGC-1α2, -α3, and -α4. These three alternative PGC-1α isoforms lack the arginine/serine-rich (RS) and RNA recognition motifs characteristic of PGC-1α1. Discrete functions for PGC-1α1 and -α4 have been described, but the biological role of PGC-1α2 and -α3 remains elusive. Here we show that different PGC-1α variants can affect target gene splicing through diverse mechanisms, including alternative promoter usage. By analyzing the exon structure of the target transcripts for each PGC-1α isoform, we were able to identify a large number of previously unknown PGC-1α2 and -α3 target genes and pathways in skeletal muscle. In particular, PGC-1α2 seems to mediate a decrease in the levels of cholesterol synthesis genes. Our results suggest that the conservation of the N-terminal activation and repression domains (and not the RS/RNA recognition motif) is what determines the gene programs and splicing options modulated by each PGC-1α isoform. By using skeletal muscle-specific transgenic mice for PGC-1α1 and -α4, we could validate, in vivo, splicing events observed in in vitro studies. These results show that alternative PGC-1α variants can affect target gene expression both quantitatively and qualitatively and identify novel biological pathways under the control of this system of coactivators.
Also flagged:progesteroneparturitiongene expressionhTERTchemokinecytokine
Journal Article2016-05-26No SnippetsGeorgiou EX, Lei K, Lai PF, Yulia A, Herbert BR, Castellanos M, May ST, Sooranna SR, Johnson MR.
Show Full Abstract
<h4>Study hypothesis</h4>Myometrial explants represent a superior model compared with cell culture models for the study of human myometrial progesterone (P4) signalling in parturition.<h4>Study finding</h4>Gene expression analysis showed myometrial explants closely resemble the in vivo condition and the anti-inflammatory action of P4 is not lost with labour onset.<h4>What is known already</h4>Circulating P4 levels decline before the onset of parturition in most animals, but not in humans. This has led to the suggestion that there is a functional withdrawal of P4 action at the myometrial level prior to labour onset. However, to date, no evidence of a loss of P4 function has been provided, with studies hampered by a lack of a physiologically relevant model.<h4>Study design, samples/materials, methods</h4>Myometrial biopsies obtained at Caesarean section were dissected into explants after a portion was immediately snap frozen (t = 0). Microarray analysis was used to compare gene expression of t = 0 with paired (i) explants, (ii) passage 4 myometrial cell cultures or (iii) the hTERT myometrial cell line. Western blotting and chemokine/cytokine assays were used to study P4 signalling in myometrial explants.<h4>Main results and the role of chance</h4>Gene expression comparison of t = 0 to the three models demonstrated that explants more closely resemble the in vivo status. At the protein level, explants maintain both P4 receptor (PR) and glucocorticoid receptor (GR) levels versus t = 0 whereas cells only maintain GR levels. Additionally, treatment with 1 µM P4 led to a reduction in interleukin-1 (IL-1) β-driven cyclooxygenase-2 in explants but not in cells. P4 signalling in explants was PR-mediated and associated with a repression of p65 and c-Jun phosphorylation. Furthermore, the anti-inflammatory action of P4 was maintained after labour onset.<h4>Limitations/reasons for caution</h4>There is evidence of basal inflammation in the myometrial explant model.<h4>Wider implications of the findings</h4>Myometrial explants constitute a novel model to study P4 signalling in the myometrium and can be used to further elucidate the mechanisms of P4 action in human labour.<h4>Large scale data</h4>Data deposited at http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?token=gvmpggkurbgxfqf&acc=GSE77830.<h4>Study funding and competing interest</h4>This work was supported by grants from the Joint Research Committee of the Westminster Medical School Research Trust, Borne (No. 1067412-7; a sub-charity of the Chelsea and Westminster Health Charity) and the Imperial NIHR Biomedical Research Centre. The views expressed are those of the author(s) and not necessarily those of the NHS or the Department of Health. The authors have no conflict of interest.
Also flagged:TrehaloseHDHuntington diseaseneuronaldisaccharidechaperone
Journal Article2016-05-26No SnippetsPerucho J, Gómez A, Muñoz MP, de Yébenes JG, Mena MÁ, Casarejos MJ.
Show Full Abstract
The pathological hallmark of Huntington disease (HD) is the intracellular aggregation of mutant huntingtin (mHTT) in striatal neurons and glia associated with the selective loss of striatal medium-sized spiny neurons. Up to the present, the role of glia in HD is poorly understood and has been classically considered secondary to neuronal disorder. Trehalose is a disaccharide known to possess many pharmacological properties, acting as an antioxidant, a chemical chaperone, and an inducer of autophagy. In this study, we analyzed at an early postnatal development stage the abnormalities observed in striatal glial cell cultures of postnatal R6/1 mice (HD glia), under baseline and stressing conditions and the protective effects of trehalose. Our data demonstrate that glial HD alterations already occur at early stages of postnatal development. After 20 postnatal days in vitro, striatal HD glia cultures showed more reactive astrocytes with increased expression of glial fibrillary acidic protein (GFAP) but with less replication capacity, less A2B5(+) glial progenitors and more microglia than wild-type (WT) cultures. HD glia had lower levels of intracellular glutathione (GSH) and was more susceptible to H2O2 and epoxomicin insults. The amount of expressed GDNF and secreted mature-BDNF by HD astrocytes were much lower than by WT astrocytes. In addition, HD glial cultures showed a deregulation of the major proteolytic systems, the ubiquitin-proteasomal system (UPS), and the autophagic pathway. This produces a defective protein quality control, indicated by the elevated levels of ubiquitination and p62 protein. Interestingly, we show that trehalose, through its capacity to induce autophagy, inhibited p62/SQSTM1 accumulation and facilitated the degradation of cytoplasmic aggregates from mHTT and α-synuclein proteins. Trehalose also reduced microglia activation and reversed the disrupted cytoskeleton of astrocytes accompanied with an increase in the replication capacity. In addition, trehalose up-regulated mature-BDNF neurotrophic factor expression and secretion, probably mediating cytoskeletal organization and helping in vesicular BDNF transport. Together, these findings indicate that glia suffers functional early changes in the disease process, changes that may contribute to HD neurodegeneration. Trehalose could be a very promising compound for treatment of HD and other diseases with abnormal protein aggregates. Furthermore our study identifies glial cells as a novel target for trehalose to induce neurotrophic and neuroprotective actions in HD.
Also flagged:FRRS1Lglutamateepilepsyhyperkinetic movement disordersmovement disordersepilepsies
Journal Article2016-05-26No SnippetsMadeo M, Stewart M, Sun Y, Sahir N, Wiethoff S, Chandrasekar I, Yarrow A, Rosenfeld JA, Yang Y, Cordeiro D, McCormick EM, Muraresku CC, Jepperson TN, McBeth LJ, Seidahmed MZ, El Khashab HY, Hamad M, Azzedine H, Clark K, Corrochano S, Wells S, Elting MW, Weiss MM, Burn S, Myers A, Landsverk M, Crotwell PL, Waisfisz Q, Wolf NI, Nolan PM, Padilla-Lopez S, Houlden H, Lifton R, Mane S, Singh BB, Falk MJ, Mercimek-Mahmutoglu S, Bilguvar K, Salih MA, Acevedo-Arozena A, Kruer MC.
Show Full Abstract
Glutamatergic neurotransmission governs excitatory signaling in the mammalian brain, and abnormalities of glutamate signaling have been shown to contribute to both epilepsy and hyperkinetic movement disorders. The etiology of many severe childhood movement disorders and epilepsies remains uncharacterized. We describe a neurological disorder with epilepsy and prominent choreoathetosis caused by biallelic pathogenic variants in FRRS1L, which encodes an AMPA receptor outer-core protein. Loss of FRRS1L function attenuates AMPA-mediated currents, implicating chronic abnormalities of glutamatergic neurotransmission in this monogenic neurological disease of childhood.
Also flagged:cell nuclear transferlinker histone H1fooSox2Klf4c-Mycgene expression
Journal Article2016-05-26✓ 3 SnippetsKunitomi A, Yuasa S, Sugiyama F, Saito Y, Seki T, Kusumoto D, Kashimura S, Takei M, Tohyama S, Hashimoto H, Egashira T, Tanimoto Y, Mizuno S, Tanaka S, Okuno H, Yamazawa K, Watanabe H, Oda M, Kaneda R, Matsuzaki Y, Nagai T, Okano H, Yagami KI, Tanaka M, Fukuda K.
In-Text Gene Mentions
Introduction)
…Xenopus SCNT, somaticlinker histoneshistones in transplanted…
Discussion)
…mouse egg, somaticlinker histoneshistones in sperm-derived…
Discussion)
…H1 and otherlinker histoneshistones, and may…
Show Full Abstract
Embryonic stem cells (ESCs) are a hallmark of ideal pluripotent stem cells. Epigenetic reprogramming of induced pluripotent stem cells (iPSCs) has not been fully accomplished. iPSC generation is similar to somatic cell nuclear transfer (SCNT) in oocytes, and this procedure can be used to generate ESCs (SCNT-ESCs), which suggests the contribution of oocyte-specific constituents. Here, we show that the mammalian oocyte-specific linker histone H1foo has beneficial effects on iPSC generation. Induction of H1foo with Oct4, Sox2, and Klf4 significantly enhanced the efficiency of iPSC generation. H1foo promoted in vitro differentiation characteristics with low heterogeneity in iPSCs. H1foo enhanced the generation of germline-competent chimeric mice from iPSCs in a manner similar to that for ESCs. These findings indicate that H1foo contributes to the generation of higher-quality iPSCs.
Simple cell-cell interactions can give rise to complex cellular patterns. For example, neurons of the same type can interact to create a complex patchwork of non-overlapping dendrite arbors, a pattern known as dendrite tiling. Dendrite tiling often involves mutual repulsion between neighboring neurons. While dendrite tiling is found across nervous systems, the nematode Caenorhabditis elegans has a relatively simple nervous system with few opportunities for tiling. Here, we show that genetic duplication of a single neuron, PVD, is sufficient to create dendrite tiling among the resulting ectopic neurons. We use laser ablation to show that this tiling is mediated by mutual repulsion between neighbors. Furthermore, we find that tiling requires a repulsion signal (UNC-6/Netrin and its receptors UNC-40/DCC and UNC-5) that normally patterns the PVD dendrite arbor. These results demonstrate that an apparently complex cellular pattern can emerge in a simple nervous system merely by increasing neuron number.
Also flagged:AnxietyAggressionbehavioralpsychiatric disordersserotonin transportermating
Journal Article2016-05-26✓ 5 SnippetsMeyer N, Richter SH, Schreiber RS, Kloke V, Kaiser S, Lesch KP, Sachser N.
In-Text Gene Mentions
S I O 000419)
…Group means ± SEM of plasma corticosterone concentrations and tyrosine hydroxylase activities and medians with 25–75 % quartiles of plasma testosterone concentrations of male heterozygous (+∕−) and homozygous (−∕−) 5-HTT knockout mice and their wildtype counterparts (+∕+) that experienced either an adverse (AE) or beneficial (BE) environment during adolescence.…
Discussion)
…In our study however, this seems unlikely since high anxiety in homozygous 5-HTT knockout mice coincides with low aggressiveness, also supporting recent findings (Jansen et al., 2011).…
Discussion)
…It has been suggested that low levels of 5-HTT during development lead to modulations of brain systems involved in emotion and stress regulation which in turn might explain the increased levels of anxiety-like behavior in homozygous 5-HTT knockout mice (Ansorge et al., 2004).…
S I O 000419)
…Group means ± SEM of anxiety-like behavior and exploratory locomotion of male heterozygous (+∕−) and homozygous (−∕−) 5-HTT knockout mice and their wildtype counterparts (+∕+) that experienced either an adverse (AE) or beneficial (BE) environment during adolescence.…
Methods)
…The aim of the present study was to investigate how either a beneficial environment or escapable social adversity that male 5-HTT +∕+, 5-HTT +∕− and 5-HTT −∕− mice experience during adolescence affect their anxiety-like behavior and aggressiveness.…
Show Full Abstract
Anxiety and aggression are part of the behavioral repertoire of humans and animals. However, in their exaggerated form both can become maladaptive and result in psychiatric disorders. On the one hand, genetic predisposition has been shown to play a crucial modulatory role in anxiety and aggression. On the other hand, social experiences have been implicated in the modulation of these traits. However, so far, mainly experiences in early life phases have been considered crucial for shaping anxiety-like and aggressive behavior, while the phase of adolescence has largely been neglected. Therefore, the aim of the present study was to elucidate how levels of anxiety-like and aggressive behavior are shaped by social experiences during adolescence and serotonin transporter (5-HTT) genotype. For this purpose, male mice of a 5-HTT knockout mouse model including all three genotypes (wildtype, heterozygous and homozygous 5-HTT knockout mice) were either exposed to an adverse social situation or a beneficial social environment during adolescence. This was accomplished in a custom-made cage system where mice experiencing the adverse environment were repeatedly introduced to the territory of a dominant opponent but had the possibility to escape to a refuge cage. Mice encountering beneficial social conditions had free access to a female mating partner. Afterwards, anxiety-like and aggressive behavior was assessed in a battery of tests. Surprisingly, unfavorable conditions during adolescence led to a decrease in anxiety-like behavior and an increase in exploratory locomotion. Additionally, aggressive behavior was augmented in animals that experienced social adversity. Concerning genotype, homozygous 5-HTT knockout mice were more anxious and less aggressive than heterozygous 5-HTT knockout and wildtype mice. In summary, adolescence is clearly an important phase in which anxiety-like and aggressive behavior can be shaped. Furthermore, it seems that having to cope with challenge during adolescence instead of experiencing throughout beneficial social conditions leads to reduced levels of anxiety-like behavior.
Also flagged:MBD2methylationcancertranscriptional silencingmethylMBD
Journal Article2016-05-26✓ 1 SnippetWood KH, Zhou Z.
In-Text Gene Mentions
S I O 001029)
…However, further investigation showed that only the deleted in colon cancer (DCC) gene at this locus is likely to be directly linked to cancer progression.…
Show Full Abstract
DNA methylation is an epigenetic mark that is essential for many biological processes and is linked to diseases such as cancer. Methylation is usually associated with transcriptional silencing, but new research has challenged this model. Both transcriptional activation and repression have recently been found to be associated with DNA methylation in a context-specific manner. How DNA methylation patterns are interpreted into different functional output remains poorly understood. One mechanism involves the protein 'readers' of methylation, which includes the methyl-CpG binding domain (MBD) family of proteins. This review examines the molecular and biological functions of MBD2, which binds to CpG methylation and is an integral part of the nucleosome remodeling and histone deacetylation (NuRD) complex. MBD2 has been linked to immune system function and tumorigenesis, yet little is known about its functions in vivo. Recent studies have found the MBD2 protein is ubiquitously expressed, with relatively high levels in the lung, liver, and colon. Mbd2 null mice surprisingly show relatively mild phenotypes compared to mice with loss of function of other MBD proteins. This evidence has previously been interpreted as functional redundancy between the MBD proteins. Here, we examine and contextualize research that suggests MBD2 has unique properties and functions among the MBD proteins. These functions translate to recently described roles in the development and differentiation of multiple cell lineages, including pluripotent stem cells and various cell types of the immune system, as well as in tumorigenesis. We also consider possible models for the dynamic interactions between MBD2 and NuRD in different tissues in vivo. The functions of MBD2 may have direct therapeutic implications for several areas of human disease, including autoimmune conditions and cancer, in addition to providing insights into the actions of NuRD and chromatin regulation.
Also flagged:pancreatic cancerpathogenesisgene expressionpancreatic carcinomatransforming growth factor-βTGF-β
Journal Article2016-05-26No SnippetsLong J, Liu Z, Wu X, Xu Y, Ge C.
Show Full Abstract
In order to additionally understand the pathogenesis of pancreatic cancer (PC), the present study conducted pathway analysis based on genome-wide association study (GWAS) and gene expression data to predict genes that are associated with PC. GWAS data (accession no., pha002874.1) were downloaded from National Center for Biotechnology Information (NCBI) database of Genotypes and Phenotypes, which included data concerning 1,896 patients with PC and 1,939 control individuals. Gene expression data [accession no., GSE23952; human pancreatic carcinoma Panc-1 transforming growth factor-β (TGF-β) treatment assay] were downloaded from NCBI Gene Expression Omnibus. Gene set enrichment analysis was used to identify significant pathways in the GWAS or gene expression profiles. Meta-analysis was performed based on pathway analysis of the two data sources. In total, 58 and 280 pathways were identified to be significant in the GWAS and gene expression data, respectively, with 7 pathways significant in both the data profiles. Hsa 04350 TGF-β signaling pathway had the smallest meta P-value. Other significant pathways in the two data sources were negative regulation of DNA-dependent transcription, the nucleolus, negative regulation of RNA metabolic process, the cellular defense response, exocytosis and galactosyltransferase activity. By constructing the gene-pathway network, 5 pathways were closely associated, apart from exocytosis and galactosyltransferase activity pathways. Among the 7 pathways, 11 key genes (2.9% out of a total of 380 genes) from the GWAS data and 43 genes (10.5% out of a total of 409 genes) from the gene expression data were differentially expressed. Only Abelson murine leukemia viral oncogene homolog 1 from the nucleolus pathway was significantly expressed in by both data sources. Overall, the results of the present analysis provide possible factors for the occurrence of PC, and the identification of the pathways and genes associated with PC provides valuable data for investigating the pathogenesis of PC in future studies.
Also flagged:cancercell migrationgene expressioncell adhesioncell-matrix adhesiontumor
Journal Article2016-05-25✓ 1 SnippetZheng XH, Nie X, Liu HY, Fang YM, Zhao Y, Xia LX.
In-Text Gene Mentions
Methods)
…MUC5B orPCDH17was knocked down…
Show Full Abstract
TMPyP4 is widely considered as a potential photosensitizer in photodynamic therapy and a G-quadruplex stabilizer for telomerase-based cancer therapeutics. However, its biological effects including a possible adverse-effect are poorly understood. In this study, whole genome RNA-seq analysis was used to explore the alteration in gene expression induced by TMPyP4. Unexpectedly, we find that 27.67% of changed genes were functionally related to cell adhesion. Experimental evidences from cell adhesion assay, scratch-wound and transwell assay indicate that TMPyP4 at conventional doses (≤0.5 μM) increases cell-matrix adhesion and promotes the migration of tumor cells. In contrast, a high dose of TMPyP4 (≥2 μM) inhibits cell proliferation and induces cell death. The unintended "side-effect" of TMPyP4 on promoting cell migration suggests that a relative high dose of TMPyP4 is preferred for therapeutic purpose. These findings contribute to better understanding of biological effects induced by TMPyP4 and provide a new insight into the complexity and implication for TMPyP4 based cancer therapy.
…The quantitative analysis of all 27 Chr18-related miRNAs revealed no difference in expression between Chr18+/- and Chr18+/+ SI-NETs.<h4>Conclusion</h4>DCC seems to be the only Chr18-related tumor suppressor affected by the monoallelic loss of Chr18 resulting in a loss of DCC protein expression in one third of SI-NETs.…
Abstract)
…+ SI-NETs.<h4>Results</h4>OnlyDCC(deleted in colorectal…
Abstract)
…/+ SI-NETs.<h4>Conclusion</h4>DCCseems to be…
Abstract)
…a loss ofDCCprotein expression in…
Show Full Abstract
<h4>Background/aims</h4>Neuroendocrine tumors of the small intestine (SI-NETs) exhibit an increasing incidence and high mortality rate. Until now, no fundamental molecular event has been linked to the tumorigenesis and progression of these tumors. Only the loss of chromosome 18 (Chr18) has been shown in up to two thirds of SI-NETs, whereby the significance of this alteration is still not understood. We therefore performed the first comprehensive study to identify Chr18-related events at the genetic, epigenetic and gene/protein expression levels.<h4>Methods</h4>We did expression analysis of all seven putative Chr18-related tumor suppressors by quantitative real-time PCR (qRT-PCR), Western blot and immunohistochemistry. Next-generation exome sequencing and SNP array analysis were performed with five SI-NETs with (partial) loss of Chr18. Finally, we analyzed all microRNAs (miRNAs) located on Chr18 by qRT-PCR, comparing Chr18+/- and Chr18+/+ SI-NETs.<h4>Results</h4>Only DCC (deleted in colorectal cancer) revealed loss of/greatly reduced expression in 6/21 cases (29%). No relevant loss of SMAD2, SMAD4, elongin A3 and CABLES was detected. PMAIP1 and maspin were absent at the protein level. Next-generation sequencing did not reveal relevant recurrent somatic mutations on Chr18 either in an exploratory cohort of five SI-NETs, or in a validation cohort (n = 30). SNP array analysis showed no additional losses. The quantitative analysis of all 27 Chr18-related miRNAs revealed no difference in expression between Chr18+/- and Chr18+/+ SI-NETs.<h4>Conclusion</h4>DCC seems to be the only Chr18-related tumor suppressor affected by the monoallelic loss of Chr18 resulting in a loss of DCC protein expression in one third of SI-NETs. No additional genetic or epigenetic alterations were present on Chr18.
Also flagged:PHF13chromatincell divisionlocalizationPRC2RNA PolII
Journal Article2016-05-25✓ 1 SnippetChung HR, Xu C, Fuchs A, Mund A, Lange M, Lange M, Staege H, Schubert T, Bian C, Dunkel I, Eberharter A, Regnard C, Klinker H, Meierhofer D, Cozzuto L, Winterpacht A, Di Croce L, Min J, Will H, Kinkley S.
In-Text Gene Mentions
Discussion)
…H3K4me2/3 and otherchromatin affiliatedaffiliated proteins increases…
Show Full Abstract
PHF13 is a chromatin affiliated protein with a functional role in differentiation, cell division, DNA damage response and higher chromatin order. To gain insight into PHF13's ability to modulate these processes, we elucidate the mechanisms targeting PHF13 to chromatin, its genome wide localization and its molecular chromatin context. Size exclusion chromatography, mass spectrometry, X-ray crystallography and ChIP sequencing demonstrate that PHF13 binds chromatin in a multivalent fashion via direct interactions with H3K4me2/3 and DNA, and indirectly via interactions with PRC2 and RNA PolII. Furthermore, PHF13 depletion disrupted the interactions between PRC2, RNA PolII S5P, H3K4me3 and H3K27me3 and resulted in the up and down regulation of genes functionally enriched in transcriptional regulation, DNA binding, cell cycle, differentiation and chromatin organization. Together our findings argue that PHF13 is an H3K4me2/3 molecular reader and transcriptional co-regulator, affording it the ability to impact different chromatin processes.
Also flagged:NOVA2RNA-binding proteinsNOVA1NOVAaxon guidanceaxonal
Journal Article2016-05-25✓ 5 SnippetsSaito Y, Miranda-Rottmann S, Ruggiu M, Park CY, Fak JJ, Zhong R, Duncan JS, Fabella BA, Junge HJ, Chen Z, Araya R, Fritzsch B, Hudspeth AJ, Darnell RB.
In-Text Gene Mentions
Discussion)
…NEO1, another member of the Dcc family, shares ~50% amino acid identity with DCC (Vielmetter et al., 1994) and has four known alternative splicing sites.…
Introduction)
…In the present work, we find that NOVA2 uniquely regulates a series of alternative splicing events of axon guidance related genes, including deleted in colorectal carcinoma (Dcc), Roundabout, Axon Guidance Receptor, Homolog 2 (Robo2), Slit homolog 2 (Slit2), and EPH Receptor A5 (Epha5).…
Abstract)
…these genes, calledDcc.…
Introduction)
…colorectal carcinoma (Dcc), Roundabout, Axon…
Results)
…splicing events (Dccexon 17, Slit2…
Show Full Abstract
The neuron specific RNA-binding proteins NOVA1 and NOVA2 are highly homologous alternative splicing regulators. NOVA proteins regulate at least 700 alternative splicing events in vivo, yet relatively little is known about the biologic consequences of NOVA action and in particular about functional differences between NOVA1 and NOVA2. Transcriptome-wide searches for isoform-specific functions, using NOVA1 and NOVA2 specific HITS-CLIP and RNA-seq data from mouse cortex lacking either NOVA isoform, reveals that NOVA2 uniquely regulates alternative splicing events of a series of axon guidance related genes during cortical development. Corresponding axonal pathfinding defects were specific to NOVA2 deficiency: Nova2-/- but not Nova1-/- mice had agenesis of the corpus callosum, and axonal outgrowth defects specific to ventral motoneuron axons and efferent innervation of the cochlea. Thus we have discovered that NOVA2 uniquely regulates alternative splicing of a coordinate set of transcripts encoding key components in cortical, brainstem and spinal axon guidance/outgrowth pathways during neural differentiation, with severe functional consequences in vivo.
Also flagged:neuronal migrationRNA-binding proteinsmigrationaxonsplicing factorssplicing
Journal Article2016-05-25✓ 5 SnippetsLeggere JC, Saito Y, Darnell RB, Tessier-Lavigne M, Junge HJ, Chen Z.
In-Text Gene Mentions
Abstract)
…Together, our results demonstrate that the production of DCC splice variants controlled by NOVA has a crucial function during many stages of commissural neuron development.…
Results)
…Human Dcc undergoes additional alternative splicing in multiple regions in tumor cells (Reale et al., 1994; Huerta et al., 2001).…
Discussion)
…Thus, altered Dcc alternative splicing may also contribute to tumor development.…
Introduction)
…Netrin and Dcc (deleted in colorectal carcinoma) function during cell migration, neurite specification and growth, axon guidance, synaptogenesis, and tumorigenesis (Cooper et al., 1999; Killeen, 2009; Mehlen and Tauszig-Delamasure, 2014; Moore et al., 2007).…
Discussion)
…It remains to be seen if altered Dcc alternative splicing accounts for additional cases of colorectal cancers and other cancers.…
Show Full Abstract
RNA-binding proteins (RBPs) control multiple aspects of post-transcriptional gene regulation and function during various biological processes in the nervous system. To further reveal the functional significance of RBPs during neural development, we carried out an in vivo RNAi screen in the dorsal spinal cord interneurons, including the commissural neurons. We found that the NOVA family of RBPs play a key role in neuronal migration, axon outgrowth, and axon guidance. Interestingly, Nova mutants display similar defects as the knockout of the Dcc transmembrane receptor. We show here that Nova deficiency disrupts the alternative splicing of Dcc, and that restoring Dcc splicing in Nova knockouts is able to rescue the defects. Together, our results demonstrate that the production of DCC splice variants controlled by NOVA has a crucial function during many stages of commissural neuron development.
Also flagged:MetforminAMPKneurodegenerative diseaseHDmetabolismlactate dehydrogenase
Journal Article2016-05-25✓ 1 SnippetJin J, Gu H, Anders NM, Ren T, Jiang M, Tao M, Peng Q, Rudek MA, Duan W.
In-Text Gene Mentions
Abstract)
…In this study, we showed that metformin rescued cells from mutant huntingtin (HTT)-induced toxicity, as indicated by reduced lactate dehydrogenase (LDH) release from cells and preserved ATP levels in cells expressing mutant HTT.…
Show Full Abstract
Huntington's disease (HD) is a devastating neurodegenerative disease caused by the pathological elongation of the CAG repeats in the huntingtin gene. Caloric restriction (CR) has been the most reproducible environmental intervention to improve health and prolong life span. We have demonstrated that CR delayed onset and slowed disease progression in a mouse model of HD. Metformin, an antidiabetic drug, mimics CR by acting on cell metabolism at multiple levels. Long-term administration of metformin improved health and life span in mice. In this study, we showed that metformin rescued cells from mutant huntingtin (HTT)-induced toxicity, as indicated by reduced lactate dehydrogenase (LDH) release from cells and preserved ATP levels in cells expressing mutant HTT. Further mechanistic study indicated that metformin activated AMP-activated protein kinase (AMPK) and that inhibition of AMPK activation reduced its protective effects on mutant HTT toxicity, suggesting that AMPK mediates the protection of metformin in HD cells. Furthermore, metformin treatment prevented mitochondrial membrane depolarization and excess fission and modulated the disturbed mitochondrial dynamics in HD cells. We confirmed that metformin crossed the blood-brain barrier after oral administration and activated AMPK in the mouse brain. Our results urge further evaluation of the clinical potential for use of metformin in HD treatment.
Also flagged:prostanoidProstanoidscyclooxygenaseCOXneurogenic hypertensionANG II
Journal Article2016-05-25✓ 1 SnippetAsirvatham-Jeyaraj N, Fink GD.
In-Text Gene Mentions
Text
…Ptgis…
Show Full Abstract
Prostanoids generated by the cyclooxygenase (COX) pathway appear to contribute to the neurogenic hypertension (HTN) in rats. The first goal of this study was to establish the time frame during which prostanoids participate in ANG II-salt HTN. We induced HTN using ANG II (150 ng·kg(-1)·min(-1) sc) infusion for 14 days in rats on a high-salt (2% NaCl) diet. When ketoprofen pretreatment was combined with treatment during the first 7 days of ANG II infusion, development of HTN and increased neurogenic pressor activity (indexed by the depressor response to ganglion blockade) were significantly attenuated for the entire ANG II infusion period. This suggests that prostanoid generation caused by administration of ANG II and salt leads to an increase in neurogenic pressor activity and blood pressure (BP) via a mechanism that persists without the need for continuing prostanoid input. The second goal of this study was to determine whether prostanoid products specifically in the brain contribute to HTN development. Expression of prostanoid pathway genes was measured in brain regions known to affect neurogenic BP regulation. ANG II-treated rats exhibited changes in gene expression of phospholipase A2 (upregulated in organum vasculosum of the lamina terminalis, paraventricular nucleus, nucleus of the solitary tract, and middle cerebral artery) and lipocalin-type prostaglandin D synthase (upregulated in the organum vasculosum of the lamina terminalis). On the basis of our results, we propose that activation of the brain prostanoid synthesis pathway both upstream and downstream from COX at early stages plays an important role in the development of the neurogenic component of ANG II-salt HTN.
Also flagged:Growth hormoneGHacromegalycolon polypsadenomasGH receptor
Journal Article2016-05-25No SnippetsChesnokova V, Zonis S, Zhou C, Recouvreux MV, Ben-Shlomo A, Araki T, Barrett R, Workman M, Wawrowsky K, Ljubimov VA, Uhart M, Melmed S.
Show Full Abstract
Growth hormone (GH) excess in acromegaly is associated with increased precancerous colon polyps and soft tissue adenomas, whereas short-stature humans harboring an inactivating GH receptor mutation do not develop cancer. We show that locally expressed colon GH is abundant in conditions predisposing to colon cancer and in colon adenocarcinoma-associated stromal fibroblasts. Administration of a GH receptor (GHR) blocker in acromegaly patients induced colon p53 and adenomatous polyposis coli (APC), reversing progrowth GH signals. p53 was also induced in skin fibroblasts derived from short-statured humans with mutant GHR. GH-deficient prophet of pituitary-specific positive transcription factor 1 (Prop1)(-/-) mice exhibited induced colon p53 levels, and cross-breeding them with Apc(min+/-) mice that normally develop intestinal and colon tumors resulted in GH-deficient double mutants with markedly decreased tumor number and size. We also demonstrate that GH suppresses p53 and reduces apoptosis in human colon cell lines as well as in induced human pluripotent stem cell-derived intestinal organoids, and confirm in vivo that GH suppresses colon mucosal p53/p21. GH excess leads to decreased colon cell phosphatase and tensin homolog deleted on chromosome 10 (PTEN), increased cell survival with down-regulated APC, nuclear β-catenin accumulation, and increased epithelial-mesenchymal transition factors and colon cell motility. We propose that GH is a molecular component of the "field change" milieu permissive for neoplastic colon growth.
Also flagged:Pbx1TALE-homeodomain proteinsPREPMEIS2transcription factorPAX6
Journal Article2016-05-25✓ 1 SnippetGrebbin BM, Hau AC, Groß A, Anders-Maurer M, Schramm J, Koss M, Wille C, Mittelbronn M, Selleri L, Schulte D.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
TALE-homeodomain proteins function as components of heteromeric complexes that contain one member each of the PBC and MEIS/PREP subclasses. We recently showed that MEIS2 cooperates with the neurogenic transcription factor PAX6 in the control of adult subventricular zone (SVZ) neurogenesis in rodents. Expression of the PBC protein PBX1 in the SVZ has been reported, but its functional role(s) has not been investigated. Using a genetic loss-of-function mouse model, we now show that Pbx1 is an early regulator of SVZ neurogenesis. Targeted deletion of Pbx1 by retroviral transduction of Cre recombinase into Pbx2-deficient SVZ stem and progenitor cells carrying floxed alleles of Pbx1 significantly reduced the production of neurons and increased the generation of oligodendrocytes. Loss of Pbx1 expression in neuronally committed neuroblasts in the rostral migratory stream in a Pbx2 null background, by contrast, severely compromised cell survival. By chromatin immunoprecipitation from endogenous tissues or isolated cells, we further detected PBX1 binding to known regulatory regions of the neuron-specific genes Dcx and Th days or even weeks before the respective genes are expressed during the normal program of SVZ neurogenesis, suggesting that PBX1 might act as a priming factor to mark these genes for subsequent activation. Collectively, our results establish that PBX1 regulates adult neural cell fate determination in a manner beyond that of its heterodimerization partner MEIS2.
Also flagged:breast cancercancerCDK12PAK1PTK2RIPK2
Journal Article2016-05-25No SnippetsMertins P, Mani DR, Ruggles KV, Gillette MA, Clauser KR, Wang P, Wang X, Qiao JW, Cao S, Petralia F, Kawaler E, Mundt F, Krug K, Tu Z, Lei JT, Gatza ML, Wilkerson M, Perou CM, Yellapantula V, Huang KL, Lin C, McLellan MD, Yan P, Davies SR, Townsend RR, Skates SJ, Wang J, Zhang B, Kinsinger CR, Mesri M, Rodriguez H, Ding L, Paulovich AG, Fenyö D, Ellis MJ, Carr SA, NCI CPTAC.
Show Full Abstract
Somatic mutations have been extensively characterized in breast cancer, but the effects of these genetic alterations on the proteomic landscape remain poorly understood. Here we describe quantitative mass-spectrometry-based proteomic and phosphoproteomic analyses of 105 genomically annotated breast cancers, of which 77 provided high-quality data. Integrated analyses provided insights into the somatic cancer genome including the consequences of chromosomal loss, such as the 5q deletion characteristic of basal-like breast cancer. Interrogation of the 5q trans-effects against the Library of Integrated Network-based Cellular Signatures, connected loss of CETN3 and SKP1 to elevated expression of epidermal growth factor receptor (EGFR), and SKP1 loss also to increased SRC tyrosine kinase. Global proteomic data confirmed a stromal-enriched group of proteins in addition to basal and luminal clusters, and pathway analysis of the phosphoproteome identified a G-protein-coupled receptor cluster that was not readily identified at the mRNA level. In addition to ERBB2, other amplicon-associated highly phosphorylated kinases were identified, including CDK12, PAK1, PTK2, RIPK2 and TLK2. We demonstrate that proteogenomic analysis of breast cancer elucidates the functional consequences of somatic mutations, narrows candidate nominations for driver genes within large deletions and amplified regions, and identifies therapeutic targets.
Also flagged:gefitiniberlotinibafatinibnon-small cell lung cancerscysteineEGFR
Journal Article2016-05-25No SnippetsJia Y, Yun CH, Park E, Ercan D, Manuia M, Juarez J, Xu C, Rhee K, Chen T, Zhang H, Palakurthi S, Jang J, Lelais G, DiDonato M, Bursulaya B, Michellys PY, Epple R, Marsilje TH, McNeill M, Lu W, Harris J, Bender S, Wong KK, Jänne PA, Eck MJ.
Show Full Abstract
The epidermal growth factor receptor (EGFR)-directed tyrosine kinase inhibitors (TKIs) gefitinib, erlotinib and afatinib are approved treatments for non-small cell lung cancers harbouring activating mutations in the EGFR kinase, but resistance arises rapidly, most frequently owing to the secondary T790M mutation within the ATP site of the receptor. Recently developed mutant-selective irreversible inhibitors are highly active against the T790M mutant, but their efficacy can be compromised by acquired mutation of C797, the cysteine residue with which they form a key covalent bond. All current EGFR TKIs target the ATP-site of the kinase, highlighting the need for therapeutic agents with alternative mechanisms of action. Here we describe the rational discovery of EAI045, an allosteric inhibitor that targets selected drug-resistant EGFR mutants but spares the wild-type receptor. The crystal structure shows that the compound binds an allosteric site created by the displacement of the regulatory C-helix in an inactive conformation of the kinase. The compound inhibits L858R/T790M-mutant EGFR with low-nanomolar potency in biochemical assays. However, as a single agent it is not effective in blocking EGFR-driven proliferation in cells owing to differential potency on the two subunits of the dimeric receptor, which interact in an asymmetric manner in the active state. We observe marked synergy of EAI045 with cetuximab, an antibody therapeutic that blocks EGFR dimerization, rendering the kinase uniformly susceptible to the allosteric agent. EAI045 in combination with cetuximab is effective in mouse models of lung cancer driven by EGFR(L858R/T790M) and by EGFR(L858R/T790M/C797S), a mutant that is resistant to all currently available EGFR TKIs. More generally, our findings illustrate the utility of purposefully targeting allosteric sites to obtain mutant-selective inhibitors.
Acute myeloid leukemia (AML) is an aggressive and heterogeneous bone marrow malignancy, the only curative treatment being intensive chemotherapy eventually in combination with allogeneic stem cell transplantation. Both the AML and their neighboring stromal cells show constitutive chemokine release, but chemokines seem to function as regulators of AML cell proliferation only for a subset of patients. Chemokine targeting is therefore considered not only for immunosuppression in allotransplanted patients but also as a possible antileukemic strategy in combination with intensive chemotherapy or as part of disease-stabilizing treatment at least for the subset of patients with chemokine-responsive AML cells. In this study, we characterized more in detail the leukemia cell phenotype of the chemokine-responsive patients. We investigated primary AML cells derived from 79 unselected patients. Standardized in vitro suspension cultures were used to investigate AML cell proliferation, and global gene expression profiles were compared for chemokine responders and non-responders identified through the proliferation assays. CCL28-induced growth modulation was used as marker of chemokine responsiveness, and 38 patients were then classified as chemokine-responsive. The effects of exogenous CCL28 (growth inhibition/enhancement/no effect) thus differed among patients and was also dependent on the presence of exogenous hematopoietic growth factors as well as constitutive AML cell cytokine release. The effect of CCR1 inhibition in the presence of chemokine-secreting mesenchymal stem cells also differed among patients. Chemokine-responsive AML cells showed altered expression of genes important for (i) epigenetic transcriptional regulation, particularly lysine acetylation; (ii) helicase activity, especially DExD/H RNA helicases; and (iii) angioregulatory proteins important for integrin binding. Thus, chemokine responsiveness is part of a complex AML cell phenotype with regard to extracellular communication and transcriptional regulation. Chemokine targeting in chemokine-responsive patients may thereby alter AML cell trafficking and increase their susceptibility toward antileukemic treatment, e.g., conventional chemotherapy or targeting of other phenotypic characteristics of the chemokine-responsive cells.
Also flagged:lung cancerpaclitaxelTween 80copolymerllactide
Journal Article2016-05-25No SnippetsYuan X, Ji W, Chen S, Bao Y, Tan S, Lu S, Wu K, Chu Q.
Show Full Abstract
Drug resistance has become a main obstacle for the effective treatment of lung cancer. To address this problem, a novel biocompatible nanoscale package, poly(d,l-lactide-co-glycolide)-Tween 80, was designed and synthesized to overcome paclitaxel (PTX) resistance in a PTX-resistant human lung cancer cell line. The poly(d,l-lactide-co-glycolide) (PLGA)-Tween 80 nanoparticles (NPs) could efficiently load PTX and release the drug gradually. There was an increased level of uptake of PLGA-Tween 80 in PTX-resistant lung cancer cell line A549/T, which achieved a significantly higher level of cytotoxicity than both PLGA NP formulation and Taxol(®). The in vivo antitumor efficacy also showed that PLGA-Tween 80 NP was more effective than Taxol(®), indicating that PLGA-Tween 80 copolymer was a promising carrier for PTX in resistant lung cancer.
Also flagged:methylationbladder cancerUrothelial carcinomas of the urinary bladdergene silencingcancertumors
Journal Article2016-05-25✓ 3 SnippetsKim YJ, Kim WJ.
In-Text Gene Mentions
S I O 001029)
…Moreover, the methylation pattern of CDH13, PCDH10, and PCDH17 is significantly associated with aggressive tumor characteristics (tumor size, stage, and grade), and PCDH10 and PCDH17 are independent predictors of cancer-specific survival [76, 77, 78].…
S I O 001029)
…A recent study of PCDH17 promoter methylation in BC revealed an association between a significant reduction in survival and an independent predictor of overall survival [69].…
S I O 001029)
…Several serum methylation markers (CDH13, PCDH10, and PCDH17) are prognostic indicators for BC [76, 77, 78].…
Show Full Abstract
Urothelial carcinomas of the urinary bladder have diverse biological and functional characteristics, and numerous factors are likely to be involved in recurrence, progression, and patient survival. While several molecular markers used to evaluate the development and prognosis of bladder cancer have been studied, they are of limited value; therefore, new molecular parameters useful for predicting the prognosis of bladder cancer patients (particularly patients at high risk of progression and recurrence) are required. Recent progress in the understanding of epigenetic modification and gene silencing has provided new opportunities for the detection, treatment, and prevention of cancer. Methylation is an important molecular mechanism in bladder cancer and may have utility as a prognostic and/or diagnostic marker. This review discusses the epigenetic issues involved in the detection and prediction of bladder cancer.
Also flagged:carbon 11cholinepositronprostate cancerprostate-specific antigenPSA
Journal Article2016-05-24No SnippetsFodor A, Berardi G, Fiorino C, Picchio M, Busnardo E, Kirienko M, Incerti E, Dell'Oca I, Cozzarini C, Mangili P, Pasetti M, Calandrino R, Gianolli L, Di Muzio NG.
Show Full Abstract
<h4>Objective</h4>To report the 3-year toxicity and outcomes of carbon 11 (11C)-choline-positron emission tomography (PET)/computed tomography (CT)-guided radiotherapy (RT), delivered via helical tomotherapy (HTT; Tomotherapy<sup>®</sup> Hi-Art II<sup>®</sup> Treatment System, Accuray Inc., Sunnyvale, CA, USA) after lymph node (LN) relapses in patients with prostate cancer.<h4>Patients and methods</h4>From January 2005 to March 2013, 81 patients with biochemical recurrence after surgery, with or without adjuvant/salvage RT or radical RT, and with evidence of LN 11C-choline-PET/CT pathological uptake, underwent HTT (median [range] prostate-specific antigen level 2.59 [0.61-187] ng/mL). Of the 81 patients, 72 were treated at the pelvic and/or lumbar-aortic LN chain with HTT at 51.8 Gy/28 fr and with simultaneous integrated boost to a median dose of 65.5 Gy on the pathological uptake sites detected by 11C-choline-PET/CT. Nine patients were treated without simultaneous integrated boost (50-65.5 Gy, 25-30 fr).<h4>Results</h4>With a median (range) follow-up of 36 (9-116) months, 91.4% of the patients had a PSA reduction 3 months after HTT. The 3-year overall, local relapse-free and clinical relapse-free survival rates were 80.0, 89.8 and 61.8%, respectively. The 3-year actuarial incidences of ≥grade 2 rectal and ≥grade 2 genitourinary toxicity were 6.6% (±2.9%) and 26.3% (±5.5%), respectively. A PSA nadir of ≥0.26 ng/mL (hazard ratio [HR] 3.6, 95% confidence interval [CI] 1.7-7.7; P = 0.001), extrapelvic 11C-choline-PET/CT-positive LN location (HR 2.4, 95% CI 0.9-6.4; P = 0.07), RT previous to HTT (HR 2.7; 95% CI 1.07-6.9, P = 0.04) and number of positive LNs (HR 1.13, 95% CI 1.04-1.22; P = 0.003) were the main predictors of clinical relapse after HTT.<h4>Conclusions</h4>11C-choline-PET/CT-guided HTT is safe and effective in the treatment of LN relapses of prostate cancer in previously treated patients.
Also flagged:neoplasiaosteosarcomacarcinogenesistumorigenesiscancerresveratrol
Journal Article2016-05-24No SnippetsKondratyuk TP, Adrian JA, Wright B, Park EJ, van Breemen RB, Morris KR, Pezzuto JM.
Show Full Abstract
As with human beings, dogs suffer from the consequences of cancer. We investigated the potential of a formulation comprised of resveratrol, ellagic acid, genistein, curcumin and quercetin to modulate biomarkers indicative of disease prevention. Dog biscuits were evaluated for palatability and ability to deliver the chemopreventive agents. The extent of endogenous DNA damage in peripheral blood lymphocytes from dogs given the dietary supplement or placebo showed no change. However, H2O2-inducible DNA damage was significantly decreased after consumption of the supplement. The expression of 11 of 84 genes related to oxidative stress was altered. Hematological parameters remained in the reference range. The concept of chemoprevention for the explicit benefit of the canine is compelling since dogs are an important part of our culture. Our results establish a proof-of-principle and provide a framework for improving the health and well-being of "man's best friend".
Also flagged:mianseringene expressionmetabolismdegradationnicotinemelatonin
Journal Article2016-05-24✓ 1 SnippetRangaraju S, Levey DF, Nho K, Jain N, Andrews KD, Le-Niculescu H, Salomon DR, Saykin AJ, Petrascheck M, Niculescu AB.
In-Text Gene Mentions
Text
…PEBP1…
Show Full Abstract
Antidepressants have been shown to improve longevity in C. elegans. It is plausible that orthologs of genes involved in mood regulation and stress response are involved in such an effect. We sought to understand the underlying biology. First, we analyzed the transcriptome from worms treated with the antidepressant mianserin, previously identified in a large-scale unbiased drug screen as promoting increased lifespan in worms. We identified the most robust treatment-related changes in gene expression, and identified the corresponding human orthologs. Our analysis uncovered a series of genes and biological pathways that may be at the interface between antidepressant effects and longevity, notably pathways involved in drug metabolism/degradation (nicotine and melatonin). Second, we examined which of these genes overlap with genes which may be involved in depressive symptoms in an aging non-psychiatric human population (n=3577), discovered using a genome-wide association study (GWAS) approach in a design with extremes of distribution of phenotype. Third, we used a convergent functional genomics (CFG) approach to prioritize these genes for relevance to mood disorders and stress. The top gene identified was ANK3. To validate our findings, we conducted genetic and gene-expression studies, in C. elegans and in humans. We studied C. elegans inactivating mutants for ANK3/unc-44, and show that they survive longer than wild-type, particularly in older worms, independently of mianserin treatment. We also show that some ANK3/unc-44 expression is necessary for the effects of mianserin on prolonging lifespan and survival in the face of oxidative stress, particularly in younger worms. Wild-type ANK3/unc-44 increases in expression with age in C. elegans, and is maintained at lower youthful levels by mianserin treatment. These lower levels may be optimal in terms of longevity, offering a favorable balance between sufficient oxidative stress resistance in younger worms and survival effects in older worms. Thus, ANK3/unc-44 may represent an example of antagonistic pleiotropy, in which low-expression level in young animals are beneficial, but the age-associated increase becomes detrimental. Inactivating mutations in ANK3/unc-44 reverse this effect and cause detrimental effects in young animals (sensitivity to oxidative stress) and beneficial effect in old animals (increased survival). In humans, we studied if the most significant single nucleotide polymorphism (SNP) for depressive symptoms in ANK3 from our GWAS has a relationship to lifespan, and show a trend towards longer lifespan in individuals with the risk allele for depressive symptoms in men (odds ratio (OR) 1.41, P=0.031) but not in women (OR 1.08, P=0.33). We also examined whether ANK3, by itself or in a panel with other top CFG-prioritized genes, acts as a blood gene-expression biomarker for biological age, in two independent cohorts, one of live psychiatric patients (n=737), and one of suicide completers from the coroner's office (n=45). We show significantly lower levels of ANK3 expression in chronologically younger individuals than in middle age individuals, with a diminution of that effect in suicide completers, who presumably have been exposed to more severe and acute negative mood and stress. Of note, ANK3 was previously reported to be overexpressed in fibroblasts from patients with Hutchinson-Gilford progeria syndrome, a form of accelerated aging. Taken together, these studies uncover ANK3 and other genes in our dataset as biological links between mood, stress and longevity/aging, that may be biomarkers as well as targets for preventive or therapeutic interventions. Drug repurposing bioinformatics analyses identified the relatively innocuous omega-3 fatty acid DHA (docosahexaenoic acid), piracetam, quercetin, vitamin D and resveratrol as potential longevity promoting compounds, along with a series of existing drugs, such as estrogen-like compounds, antidiabetics and sirolimus/rapamycin. Intriguingly, some of our top candidate genes for mood and stress-modulated longevity were changed in expression in opposite direction in previous studies in the Alzheimer disease. Additionally, a whole series of others were changed in expression in opposite direction in our previous studies on suicide, suggesting the possibility of a "life switch" actively controlled by mood and stress.
Also flagged:Attention-deficit hyperactivity disorderattention-deficit/hyperactivity disordermethylphenidateattention-deficit hyperactive disorderADHDBAIAP2
Journal Article2016-05-24✓ 1 SnippetBonvicini C, Faraone SV, Scassellati C.
In-Text Gene Mentions
Results)
…transporter gene (SLC6A4,5-HTT) is a further…
Show Full Abstract
The adult form of attention-deficit/hyperactivity disorder has a prevalence of up to 5% and is the most severe long-term outcome of this common disorder. Family studies in clinical samples as well as twin studies suggest a familial liability and consequently different genes were investigated in association studies. Pharmacotherapy with methylphenidate (MPH) seems to be the first-line treatment of choice in adults with attention-deficit hyperactive disorder (ADHD) and some studies were conducted on the genes influencing the response to this drug. Finally some peripheral biomarkers were identified in ADHD adult patients. We believe this work is the first systematic review and meta-analysis of candidate gene association studies, pharmacogenetic and biochemical (metabolomics) studies performed in adults with ADHD to identify potential genetic, predictive and peripheral markers linked specifically to ADHD in adults. After screening 5129 records, we selected 87 studies of which 61 were available for candidate gene association studies, 5 for pharmacogenetics and 21 for biochemical studies. Of these, 15 genetic, 2 pharmacogenetic and 6 biochemical studies were included in the meta-analyses. We obtained an association between adult ADHD and the gene BAIAP2 (brain-specific angiogenesis inhibitor 1-associated protein 2), even after Bonferroni correction, with any heterogeneity in effect size and no publication bias. If we did not apply the Bonferroni correction, a trend was found for the carriers allele 9R of dopamine transporter SLC6A3 40 bp variable tandem repeat polymorphism (VNTR) and for 6/6 homozygotes of SLC6A3 30 bp VNTR. Negative results were obtained for the 9-6 haplotype, the dopamine receptor DRD4 48 bp VNTR, and the enzyme COMT SNP rs4680. Concerning pharmacogenetic studies, no association was found for the SLC6A3 40 bp and response to MPH with only two studies selected. For the metabolomics studies, no differences between ADHD adults and controls were found for salivary cortisol, whereas lower serum docosahexaenoic acid (DHA) levels were found in ADHD adults. This last association was significant even after Bonferroni correction and in absence of heterogeneity. Other polyunsaturated fatty acids (PUFAs) such as AA (arachidonic acid), EPA (eicosapentaenoic acid) and DyLA (dihomogammalinolenic acid) levels were not different between patients and controls. No publication biases were observed for these markers. Genes linked to dopaminergic, serotoninergic and noradrenergic signaling, metabolism (DBH, TPH1, TPH2, DDC, MAOA, MAOB, BCHE and TH), neurodevelopment (BDNF and others), the SNARE system and other forty genes/proteins related to different pathways were not meta-analyzed due to insufficient data. In conclusion, we found that there were not enough genetic, pharmacogenetic and biochemical studies of ADHD in adults and that more investigations are needed. Moreover we confirmed a significant role of BAIAP2 and DHA in the etiology of ADHD exclusively in adults. Future research should be focused on the replication of these findings and to assess their specificity for ADHD.
…We investigated the effects of functional variants in the 5-HTT, DAT1, and DRD4 genes, the social environment, and the interactions between genes and environment on brain volumes in a large sample of children, adolescents, and young adults with and without ADHD.…
Introduction)
…For example, the short allele of a functional promoter polymorphism in the serotonin transporter gene (SLC6A4/ 5-HTT)—HTTLPR—has been related to smaller anterior cingulate gyrus and amygdala volumes in healthy adults [9], smaller frontal cortex in adults with obsessive-compulsive disorder and healthy controls [9, 10], and to smaller caudate, and both smaller and larger hippocampal volumes in adults with major depression [11, 12] and healthy controls [13].…
Discussion)
…Neurotransmitters have an important role in synaptic and neural plasticity [83], and the age-dependent GxE effects may thus be related to differences in dopamine and serotonin availability associated with DRD4, DAT1 and 5-HTT variants.…
Abstract)
…between DAT1 ,5-HTT, and DRD4…
Show Full Abstract
Smaller total brain and subcortical volumes have been linked to psychopathology including attention-deficit/hyperactivity disorder (ADHD). Identifying mechanisms underlying these alterations, therefore, is of great importance. We investigated the role of gene-environment interactions (GxE) in interindividual variability of total gray matter (GM), caudate, and putamen volumes. Brain volumes were derived from structural magnetic resonance imaging scans in participants with (N = 312) and without ADHD (N = 437) from N = 402 families (age M = 17.00, SD = 3.60). GxE effects between DAT1, 5-HTT, and DRD4 and social environments (maternal expressed warmth and criticism; positive and deviant peer affiliation) as well as the possible moderating effect of age were examined using linear mixed modeling. We also tested whether findings depended on ADHD severity. Deviant peer affiliation was associated with lower caudate volume. Participants with low deviant peer affiliations had larger total GM volumes with increasing age. Likewise, developmentally sensitive GxE effects were found on total GM and putamen volume. For total GM, differential age effects were found for DAT1 9-repeat and HTTLPR L/L genotypes, depending on the amount of positive peer affiliation. For putamen volume, DRD4 7-repeat carriers and DAT1 10/10 homozygotes showed opposite age relations depending on positive peer affiliation and maternal criticism, respectively. All results were independent of ADHD severity. The presence of differential age-dependent GxE effects might explain the diverse and sometimes opposing results of environmental and genetic effects on brain volumes observed so far.
Several authors have investigated the malignant transformation of endometriosis, which supports the hypothesis of the pre-neoplastic state of endometriotic lesions, but there are few data about the pathways and molecular events related to this phenomenon. This review provides current data about deregulated genes that may function as key factors in the malignant transition of endometriotic lesions. In order to do so, we first searched for studies that have screened differential gene expression between endometriotic tissues and normal endometrial tissue of women without endometriosis, and found only two articles with 139 deregulated genes. Further, using the PubMed database, we crossed the symbol of each gene with the terms related to malignancies, such as cancer and tumor, and obtained 9,619 articles, among which 444 were studies about gene expression associated with specific types of tumor. This revealed that more than 68% of the analyzed genes are also deregulated in cancer. We have also found genes functioning as tumor suppressors and an oncogene. In this study, we present a list of 95 informative genes in order to understand the genetic components that may be responsible for endometriosis' malignant transformation. However, future studies should be conducted to confirm these findings.
…Interestingly, in the context of cholesterol effluxregulation, dynein-mediated microtubular transport has been reportedto regulate the dynamic structure of intracellular lipid droplets,24 and mutations in one of the dynein subunits,dynein axonemal heavy chain 10 (DNAH10), are reported to be associatedwith elevated HDL cholesterol levels in humans.25…
Results)
…heavy chain 10 (DNAH10), are reported to…
Show Full Abstract
Leoligin is a natural lignan found in Edelweiss (Leontopodium nivale ssp. alpinum). The aim of this study was to examine its influence on cholesterol efflux and to address the underlying mechanism of action. Leoligin increases apo A1- as well as 1% human plasma-mediated cholesterol efflux in THP-1 macrophages without affecting cell viability as determined by resazurin conversion. Western blot analysis revealed that the protein levels of the cholesterol efflux transporters ABCA1 and ABCG1 were upregulated, whereas the SR-B1 protein level remained unchanged upon treatment with leoligin (10 μM, 24 h). Quantitative reverse transcription PCR further uncovered that leoligin also increased ABCA1 and ABCG1 mRNA levels without affecting the half-life of the two mRNAs in the presence of actinomycin D, a transcription inhibitor. Proteome analysis revealed the modulation of protein expression fingerprint in the presence of leoligin. Taken together, these results suggest that leoligin induces cholesterol efflux in THP-1-derived macrophages by upregulating ABCA1 and ABCG1 expression. This novel activity suggests leoligin as a promising candidate for further studies addressing a possible preventive or therapeutic application in the context of atherosclerosis.
Also flagged:RNA-binding proteinsregulatorsinnate immunityRBPTTPZfp36
Journal Article2016-05-24✓ 1 SnippetTiedje C, Diaz-Muñoz MD, Trulley P, Ahlfors H, Laaß K, Blackshear PJ, Turner M, Gaestel M.
In-Text Gene Mentions
Discussion)
…regulated by Roquin (Rc3h1) through binding to…
Show Full Abstract
RNA-binding proteins (RBPs) facilitate post-transcriptional control of eukaryotic gene expression at multiple levels. The RBP tristetraprolin (TTP/Zfp36) is a signal-induced phosphorylated anti-inflammatory protein guiding unstable mRNAs of pro-inflammatory proteins for degradation and preventing translation. Using iCLIP, we have identified numerous mRNA targets bound by wild-type TTP and by a non-MK2-phosphorylatable TTP mutant (TTP-AA) in 1 h LPS-stimulated macrophages and correlated their interaction with TTP to changes at the level of mRNA abundance and translation in a transcriptome-wide manner. The close similarity of the transcriptomes of TTP-deficient and TTP-expressing macrophages upon short LPS stimulation suggested an effective inactivation of TTP by MK2, whereas retained RNA-binding capacity of TTP-AA to 3'UTRs caused profound changes in the transcriptome and translatome, altered NF-κB-activation and induced cell death. Increased TTP binding to the 3'UTR of feedback inhibitor mRNAs, such as Ier3, Dusp1 or Tnfaip3, in the absence of MK2-dependent TTP neutralization resulted in a strong reduction of their protein synthesis contributing to the deregulation of the NF-κB-signaling pathway. Taken together, our study uncovers a role of TTP as a suppressor of feedback inhibitors of inflammation and highlights the importance of fine-tuned TTP activity-regulation by MK2 in order to control the pro-inflammatory response.
Also flagged:prionHDcognitivebehaviouralneuroblastomaneurodegenerative diseases
Journal Article2016-05-24✓ 5 SnippetsJeon I, Cicchetti F, Cisbani G, Lee S, Li E, Bae J, Lee N, Li L, Im W, Kim M, Kim HS, Oh SH, Kim TA, Ko JJ, Aubé B, Oueslati A, Kim YJ, Song J.
In-Text Gene Mentions
Methods)
…Abbreviations: DAPI, 4’,6-diamidino-2-phenylindole; HD143F, fibroblasts derived from an HD patient with 143 CAG repeats; hEF, human embryonic fibroblasts; htt, huntingtin; UTR, untranslated region (TIFF 8678 kb)…
Results)
…We first evaluated the potential of HD patient-derived fibroblasts carrying the entire 170 kb genomic locus of the human Htt gene to generate an HD-associated phenotype in wild-type mice.…
Results)
…We further confirmed these results using the human neuroblastoma cell line SH-SY5Y overexpressing the exon 1 of Htt carrying 19 or 103 CAG fused to GFP or GFP alone (Supplemental Fig. 4a).…
Methods)
…(a) Schematic representation of the Htt locus present in HD and control fibroblasts.…
Methods)
…to amplify thehttgene.…
Show Full Abstract
Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder of the central nervous system (CNS) that is defined by a CAG expansion in exon 1 of the huntingtin gene leading to the production of mutant huntingtin (mHtt). To date, the disease pathophysiology has been thought to be primarily driven by cell-autonomous mechanisms, but, here, we demonstrate that fibroblasts derived from HD patients carrying either 72, 143 and 180 CAG repeats as well as induced pluripotent stem cells (iPSCs) also characterized by 143 CAG repeats can transmit protein aggregates to genetically unrelated and healthy host tissue following implantation into the cerebral ventricles of neonatal mice in a non-cell-autonomous fashion. Transmitted mHtt aggregates gave rise to both motor and cognitive impairments, loss of striatal medium spiny neurons, increased inflammation and gliosis in associated brain regions, thereby recapitulating the behavioural and pathological phenotypes which characterizes HD. In addition, both in vitro work using co-cultures of mouse neural stem cells with 143 CAG fibroblasts and the SH-SY5Y human neuroblastoma cell line as well as in vivo experiments conducted in newborn wild-type mice suggest that exosomes can cargo mHtt between cells triggering the manifestation of HD-related behaviour and pathology. This is the first evidence of human-to-mouse prion-like propagation of mHtt in the mammalian brain; a finding which will help unravel the molecular bases of HD pathology as well as to lead to the development of a whole new range of therapies for neurodegenerative diseases of the CNS.
Also flagged:Renal fibrosisrenal diseaseglomerulosclerosischemokinesinterstitial fibrosisunilateral ureteral obstruction
Journal Article2016-05-24✓ 1 SnippetZhao Q, Xue Y, Yang Y, Niu Z, Wang C, Hou Y, Chen H.
In-Text Gene Mentions
Discussion)
…expressed proteins, Prdx1,Prdx6, Park7, Dld and…
Show Full Abstract
Renal fibrosis, considered to be a common consequence of progressive renal disease, involves glomerulosclerosis and/or tubulointerstitial fibrosis. Currently, research is focused on investigating potential mechanisms to prevent or reverse the damage caused by fibrosis. Under the influence of cytokines, chemokines and other signaling molecules, the cellular interactions that regulate the development of interstitial fibrosis are complex. Epithelial‑mesenchymal transition (EMT) has emerged as an important pathway leading to the generation of matrix‑producing fibroblasts and myofibroblasts in diseased kidneys. The proteomics study compared the protein profiles between the time points of podocyte EMT and tubular cell EMT in a partial unilateral ureteral obstruction (PUUO) model in rats. Proteins isolated from the PUUO group and corresponding sham rat kidney tissues were subjected to 2‑D gel electrophoresis and were then identified by mass spectrometry. In total, 43 proteins with differential expression were identified, which were reported to be involved in the regulation of the cytoskeleton and actin, glucose metabolism, cell apoptosis, mitochondrial energy metabolism, oxidative stress and endoplasmic reticulum stress. Electron transfer flavoprotein, β polypeptide was detected by immunoblot analysis and its mRNA levels were determined in renal tissues. The results demonstrate protein alterations that reflect the pathology of the obstructed kidneys, and thus may aid in understanding the pathogenesis of obstructive nephropathy.
Also flagged:proteaseproteasesantithrombin IIIthrombincoagulationdisulfide
Journal Article2016-05-24✓ 5 SnippetsChandrasekhar K, Ke H, Wang N, Goodwin T, Gierasch LM, Gershenson A, Hebert DN.
In-Text Gene Mentions
Abstract)
…serpin antithrombin III (ATIII) targets thrombin and…
Abstract)
…blood coagulation, andATIIImisfolding can thus…
Abstract)
…ATIIIhas three disulfide…
Abstract)
…Our studies ofATIIIin-cell folding reveal…
Abstract)
…the predominantly β-sheetATIIIdomain in this…
Show Full Abstract
Although proteins generally fold to their thermodynamically most stable state, some metastable proteins populate higher free energy states. Conformational changes from metastable higher free energy states to lower free energy states with greater stability can then generate the work required to perform physiologically important functions. However, how metastable proteins fold to these higher free energy states in the cell and avoid more stable but inactive conformations is poorly understood. The serpin family of metastable protease inhibitors uses large conformational changes that are downhill in free energy to inhibit target proteases by pulling apart the protease active site. The serpin antithrombin III (ATIII) targets thrombin and other proteases involved in blood coagulation, and ATIII misfolding can thus lead to thrombosis and other diseases. ATIII has three disulfide bonds, two near the N terminus and one near the C terminus. Our studies of ATIII in-cell folding reveal a surprising, biased order of disulfide bond formation, with early formation of the C-terminal disulfide, before formation of the N-terminal disulfides, critical for folding to the active, metastable state. Early folding of the predominantly β-sheet ATIII domain in this two-domain protein constrains the reactive center loop (RCL), which contains the protease-binding site, ensuring that the RCL remains accessible. N-linked glycans and carbohydrate-binding molecular chaperones contribute to the efficient folding and secretion of functional ATIII. The inability of a number of disease-associated ATIII variants to navigate the folding reaction helps to explain their disease phenotypes.
Also flagged:cytotoxicbindinginflammatory responsesignaling transductionhydroxyapatitechitosan
Journal Article2016-05-24No SnippetsWang J, Wang L, Fan Y.
Show Full Abstract
The adverse biological effect of nanoparticles is an unavoidable scientific problem because of their small size and high surface activity. In this review, we focus on nano-hydroxyapatite and TiO₂ nanoparticles (NPs) to clarify the potential systemic toxicological effect and cytotoxic response of wear nanoparticles because they are attractive materials for bone implants and are widely investigated to promote the repair and reconstruction of bone. The wear nanoparticles would be prone to binding with proteins to form protein-particle complexes, to interacting with visible components in the blood including erythrocytes, leukocytes, and platelets, and to being phagocytosed by macrophages or fibroblasts to deposit in the local tissue, leading to the formation of fibrous local pseudocapsules. These particles would also be translocated to and disseminated into the main organs such as the lung, liver and spleen via blood circulation. The inflammatory response, oxidative stress, and signaling pathway are elaborated to analyze the potential toxicological mechanism. Inhibition of the oxidative stress response and signaling transduction may be a new therapeutic strategy for wear debris-mediated osteolysis. Developing biomimetic materials with better biocompatibility is our goal for orthopedic implants.
Also flagged:TRIM13TRIMRING domain-containingE3 ubiquitin ligasedeathcancer
Journal Article2016-05-24✓ 2 SnippetsHuang Y, Yang M, Yu Y, Yang Y, Zhou L, Huang X, Qin Q.
In-Text Gene Mentions
Discussion)
…TRIM5, TRIM56, TRIM22,TRIM38and TRIM68 were…
Discussion)
…contrast, overexpression ofTRIM38or TRIM11 in…
Show Full Abstract
The tripartite motif (TRIM)-containing proteins have attracted particular attention to their multiple functions in different biological processes. TRIM13, a member of the TRIM family, is a RING domain-containing E3 ubiquitin ligase which plays critical roles in diverse cellular processes including cell death, cancer and antiviral immunity. In this study, a TRIM13 homolog from orange spotted grouper, Epinephelus coioides (EcTRIM13) was cloned and characterized. The full-length of EcTRIM13 cDNA encoded a polypeptide of 399 amino acids which shared 81% identity with TRIM13 homolog from large yellow croaker (Larimichthys crocea). Amino acid alignment analysis showed that EcTRIM13 contained conserved RING finger and B-box domain. Expression patterns analysis indicated that EcTRIM13 was abundant in liver, spleen, kidney, intestine and gill. Moreover, the transcript of EcTRIM13 in grouper spleen was differently regulated after injection with Singapore grouper iridovirus (SGIV) or polyinosin-polycytidylic acid (poly I:C). Under fluorescence microscopy, we observed the tubular structure in wild type EcTRIM13 transfected cells, but the RING domain mutant resulted in the fluorescence distribution was changed and the bright punctate fluorescence was evenly situated throughout the cytoplasm, suggesting that the RING domain was essential for its accurate localization. Overexpression of EcTRIM13 in vitro obviously increased the replication of red spotted grouper nervous necrosis virus (RGNNV), and the enhancing effect of EcTRIM13 on virus replication was affected by the RING domain. Furthermore, the ectopic expression of EcTRIM13 not only negatively regulated the interferon promoter activity induced by interferon regulator factor (IRF) 3, IRF7, and melanoma differentiation-associated protein 5 (MDA5), but also decreased the expression of several interferon related factors. In addition, the overexpression of EcTRIM13 also differently regulated the transcription of pro-inflammatory factors. Together, our results firstly demonstrated that fish TRIM13 exerted negative regulation of antiviral response against nodavirus infection.
Also flagged:Alzheimer's DiseaseADdementiafamilial ADAPPPSEN1
Journal Article2016-05-24✓ 1 SnippetZhang W, Jiao B, Zhou M, Zhou T, Shen L.
In-Text Gene Mentions
S I O 001029)
…These disorders include, among others, Parkinson's disease (PD) with SNCA, PINK1, PARK2, GBA1, and LRRK2 mutations [68–70], amyotrophic lateral sclerosis (ALS) with TDP43 mutation [71], Huntington's disease (HD) with HTT mutation [72], and Spinal muscular atrophy (SMA) with SMN1 mutation [73].…
Show Full Abstract
Alzheimer's disease (AD) is the most prevalent type of dementia and its pathology is characterized by deposition of extracellular β-amyloid plaques, intracellular neurofibrillary tangles, and extensive neuron loss. While only a few familial AD cases are due to mutations in three causative genes (APP, PSEN1, and PSEN2), the ultimate cause behind the rest of the cases, called sporadic AD, remains unknown. Current animal and cellular models of human AD, which are based on the Aβ and tau hypotheses only, partially resemble the familial AD. As a result, there is a pressing need for the development of new models providing insights into the pathological mechanisms of AD and for the discovery of ways to treat or delay the onset of the disease. Recent preclinical research suggests that stem cells can be used to model AD. Indeed, human induced pluripotent stem cells can be differentiated into disease-relevant cell types that recapitulate the unique genome of a sporadic AD patient or family member. In this review, we will first summarize the current research findings on the genetic and pathological mechanisms of AD. We will then highlight the existing induced pluripotent stem cell models of AD and, lastly, discuss the potential clinical applications in this field.
Also flagged:Atopic DermatitisADskin lesionscytokineIL-4PKC
Journal Article2016-05-24No SnippetsCha HY, Ahn SH, Cheon JH, Park IS, Kim JT, Kim K.
Show Full Abstract
This study investigated the preventive therapeutic effects of Hataedock (HTD) treatment on inflammatory regulation and skin protection in AD-induced NC/Nga mice under high-fat diet conditions. Before inducing AD, the extract of Coptidis Rhizoma and Glycyrrhiza uralensis was administered orally to the 3-week-old mice. After that, AD-like skin lesions were induced by applying DNFB. All groups except the control group were fed a high-fat diet freely. We identified the effects of HTD on morphological changes, cytokine release and the induction of apoptosis through histochemistry, immunohistochemistry, and TUNEL assay. HTD downregulated the levels of IL-4 and PKC but increased the levels of LXR. HTD also suppressed the mast cell degranulation and release of MMP-9, Substance P. The levels of TNF-α, p-IκB, iNOS, and COX-2 were also decreased. The upregulation of inflammatory cell's apoptosis is confirmed by our results as increase of apoptotic body and cleaved caspase-3 and decrease of Bcl-2. HTD also reduced edema, angiogenesis, and skin lesion inflammation. Our results indicate HTD suppresses various inflammatory response on AD-induced mice with obesity through the regulation of Th2 differentiation and the protection of lipid barrier. Therefore, HTD could be used as an alternative and preventive therapeutic approach in the management of AD.
Also flagged:SynthesisPyrrolobenzodiazepineconjugationiminesvalinealanine
Journal Article2016-05-24No SnippetsTiberghien AC, Levy JN, Masterson LA, Patel NV, Adams LR, Corbett S, Williams DG, Hartley JA, Howard PW.
Show Full Abstract
Pyrrolobenzodiazepine dimers are an emerging class of warhead in the field of antibody-drug conjugates (ADCs). Tesirine (SG3249) was designed to combine potent antitumor activity with desirable physicochemical properties such as favorable hydrophobicity and improved conjugation characteristics. One of the reactive imines was capped with a cathepsin B-cleavable valine-alanine linker. A robust synthetic route was developed to allow the production of tesirine on clinical scale, employing a flexible, convergent strategy. Tesirine was evaluated <i>in vitro</i> both in stochastic and engineered ADC constructs and was confirmed as a potent and versatile payload. The conjugation of tesirine to anti-DLL3 rovalpituzumab has resulted in rovalpituzumab-tesirine (Rova-T), currently under evaluation for the treatment of small cell lung cancer.
…Some of these genes are known tumor-suppressor genes (EPB41L3, PRDX2), putative tumor-suppressor genes (PLCL1, TUSC1), regulators of cell proliferation (BCL11B, NDRG2, PID1) or regulators of drug metabolism (CYP1B1).21, 32, 33, 34, 35 A description of the downregulated genes is shown in Supplementary Tables S11 and S12.…
Results)
…tumor-suppressor genes (PLCL1, TUSC1 ),…
Show Full Abstract
Little is known about the impact of DNA methylation on the evolution/progression of Ph+ chronic myeloid leukemia (CML). We investigated the methylome of CML patients in chronic phase (CP-CML), accelerated phase (AP-CML) and blast crisis (BC-CML) as well as in controls by reduced representation bisulfite sequencing. Although only ~600 differentially methylated CpG sites were identified in samples obtained from CP-CML patients compared with controls, ~6500 differentially methylated CpG sites were found in samples from BC-CML patients. In the majority of affected CpG sites, methylation was increased. In CP-CML patients who progressed to AP-CML/BC-CML, we identified up to 897 genes that were methylated at the time of progression but not at the time of diagnosis. Using RNA-sequencing, we observed downregulated expression of many of these genes in BC-CML compared with CP-CML samples. Several of them are well-known tumor-suppressor genes or regulators of cell proliferation, and gene re-expression was observed by the use of epigenetic active drugs. Together, our results demonstrate that CpG site methylation clearly increases during CML progression and that it may provide a useful basis for revealing new targets of therapy in advanced CML.
Also flagged:Phosphono BisbenzguanidinesMatriptase-2II transmembrane serine proteaseironiron-overload diseasesβ-thalassemia
Journal Article2016-05-23✓ 1 SnippetHäußler D, Mangold M, Furtmann N, Braune A, Blaut M, Bajorath J, Stirnberg M, Gütschow M.
In-Text Gene Mentions
Abstract)
…diseases, such ashemochromatosisand β-thalassemia.…
Show Full Abstract
Matriptase-2, a type II transmembrane serine protease, plays a key role in human iron homeostasis. Inhibition of matriptase-2 is considered as an attractive strategy for the treatment of iron-overload diseases, such as hemochromatosis and β-thalassemia. In the present study, synthetic routes to nine dipeptidomimetic inactivators were developed. Five active compounds (41-45) were identified and characterized kinetically as irreversible inhibitors of matriptase-2. In addition to a phosphonate warhead, these dipeptides possess two benzguanidine moieties as arginine mimetics to provide affinity for matriptase-2 by binding to the S1 and S3/S4 subpockets, respectively. This binding mode was strongly supported by covalent docking analysis. Compounds 41-45 were obtained as mixtures of two diastereomers and were therefore separated into the single epimers. Compound 45 A, with S configuration at the N-terminal amino acid and R configuration at the phosphonate carbon atom, was the most potent matriptase-2 inactivator with a rate constant of inactivation of 2790 m(-1) s(-1) and abolished the activity of membrane-bound matriptase-2 on the surface of intact cells. Based on the chemotyp of phosphono bisbenzguanidines, the design and synthesis of a fluorescent probe (51 A) by insertion of a coumarin label is described. The in-gel fluorescence detection of matriptase-2 was demonstrated by applying 51 A as the first activity-based probe for this enzyme.
Also flagged:ovarian cancertumorovarian carcinomalipidSTAT3WNT
Journal Article2016-05-23✓ 2 SnippetsReinartz S, Finkernagel F, Adhikary T, Rohnalter V, Schumann T, Schober Y, Nockher WA, Nist A, Stiewe T, Jansen JM, Wagner U, Müller-Brüsselbach S, Müller R.
In-Text Gene Mentions
Results)
…, PTGES2/3 ,PTGIS; Fig. 5a,…
Discussion)
…expression of thePTGISand PTGER3 genes…
Show Full Abstract
<h4>Background</h4>Soluble protein and lipid mediators play essential roles in the tumor environment, but their cellular origins, targets, and clinical relevance are only partially known. We have addressed this question for the most abundant cell types in human ovarian carcinoma ascites, namely tumor cells and tumor-associated macrophages.<h4>Results</h4>Transcriptome-derived datasets were adjusted for errors caused by contaminating cell types by an algorithm using expression data derived from pure cell types as references. These data were utilized to construct a network of autocrine and paracrine signaling pathways comprising 358 common and 58 patient-specific signaling mediators and their receptors. RNA sequencing based predictions were confirmed for several proteins and lipid mediators. Published expression microarray results for 1018 patients were used to establish clinical correlations for a number of components with distinct cellular origins and target cells. Clear associations with early relapse were found for STAT3-inducing cytokines, specific components of WNT and fibroblast growth factor signaling, ephrin and semaphorin axon guidance molecules, and TGFβ/BMP-triggered pathways. An association with early relapse was also observed for secretory macrophage-derived phospholipase PLA2G7, its product arachidonic acid (AA) and signaling pathways controlled by the AA metabolites PGE2, PGI2, and LTB4. By contrast, the genes encoding norrin and its receptor frizzled 4, both selectively expressed by cancer cells and previously not linked to tumor suppression, show a striking association with a favorable clinical course.<h4>Conclusions</h4>We have established a signaling network operating in the ovarian cancer microenvironment with previously unidentified pathways and have defined clinically relevant components within this network.
Using Illumina sequencing, transcriptional changes occurring during silvering in swimbladder tissue of the European eel have been analyzed by comparison of yellow and silver eel tissue samples. Functional annotation analysis based on GO terms revealed significant expression changes in a number of genes related to the extracellular matrix, important for the control of gas permeability of the swimbladder, and to reactive oxygen species (ROS) defense, important to cope with ROS generated under hyperbaric oxygen partial pressures. Focusing on swimbladder tissue metabolism, levels of several mRNA species encoding glucose transport proteins were several-fold higher in silver eels, while enzymes of the glycolytic pathway were not affected. The significantly higher steady state level of a transcript encoding for membrane bound carbonic anhydrase, however, suggested that CO2 production in the pentose phosphate shunt and diffusion of CO2 was of particular importance in silver eel swimbladder. In addition, the mRNA level of a large number of genes related to immune response and to sexual maturation was significantly modified in the silver eel swimbladder. The modification of several processes related to protein metabolism and transport, cell cycle, and apoptosis suggested that these changes in swimbladder metabolism and permeability were achieved by increasing cell turn-over. The impact of an infection of the swimbladder with the nematode Anguillicola crassus has been assessed by comparing these expression changes with expression changes observed between uninfected yellow eel swimbladder tissue and infected silver eel swimbladder tissue. In contrast to uninfected silver eel swimbladder tissue, in infected tissue the mRNA level of several glycolytic enzymes was significantly elevated, and with respect to extracellular matrix, several mucin genes were many-fold higher in their mRNA level. Modification of many immune related genes and of the functional categories "response to DNA damage stimulus" and "cellular response to stress" illustrated the damaging effect of the nematode infection. This study has identified a range of cellular processes in the swimbladder of silver eels that appear to be altered by nematode infection. These altered cellular processes could contribute to detrimental changes in swimbladder function that, in turn, may lead to impairment of spawning migration.
Also flagged:cleft lipcleft palatePchromosomepolymeraseMYO5B
Journal Article2016-05-23No SnippetsMitra AK, Stessman HA, Schaefer RJ, Wang W, Myers CL, Van Ness BG, Beiraghi S.
Show Full Abstract
Nonsyndromic cleft lip with or without cleft palate (NSCL/P) is one of the most common congenital birth defects. NSCL/P is a complex multifactorial disease caused by interactions between multiple environmental and genetic factors. However, the causal single nucleotide polymorphism (SNP) signature profile underlying the risk of familial NSCL/P still remains unknown. We previously reported a 5.7-Mb genomic region on chromosome 18q21.1 locus that potentially contributes to autosomal dominant, low-penetrance inheritance of NSCL/P. In the current study, we performed exome sequencing on 12 familial genomes (six affected individuals, two obligate carriers, and four seemingly unaffected individuals) of a six-generation family to identify candidate SNPs associated with NSCL/P risk. Subsequently, targeted bidirectional DNA re-sequencing of polymerase chain reaction (PCR)-amplified high-risk regions of MYO5B gene and sequenom iPLEX genotpying of 29 candidate SNPs were performed on a larger set of 33 members of this NSCL/P family (10 affected + 4 obligate carriers + 19 unaffected relatives) to find SNPs significantly associated with NSCL/P trait. SNP vs. NSCL/P association analysis showed the MYO5B SNP rs183559995 GA genotype had an odds ratio of 18.09 (95% Confidence Interval = 1.86-176.34; gender-adjusted P = 0.0019) compared to the reference GG genotype. Additionally, the following SNPs were also found significantly associated with NSCL/P risk: rs1450425 (LOXHD1), rs6507992 (SKA1), rs78950893 (SMAD7), rs8097060, rs17713847 (SCARNA17), rs6507872 (CTIF), rs8091995 (CTIF), and rs17715416 (MYO5B). We could thus identify mutations in several genes as key candidate SNPs associated with the risk of NSCL/P in this large multi-generation family.
Also flagged:octreotidebufalinsomatostatin receptor 2breast canceresterasetumor
Journal Article2016-05-23No SnippetsLiu T, Jia T, Yuan X, Liu C, Sun J, Ni Z, Xu J, Wang X, Yuan Y.
Show Full Abstract
<h4>Background</h4>Development of polymeric prodrugs of small molecular anticancer drugs has become one of the most promising strategies to overcome the intrinsic shortcomings of small molecular anticancer drugs and improve their anticancer performance.<h4>Materials and methods</h4>In the current work, we fabricated a novel octreotide (Oct)-modified esterase-sensitive tumor-targeting polymeric prodrug of bufalin (BUF) and explored its anticancer performance against somatostatin receptor 2 overexpressing breast cancer.<h4>Results</h4>The obtained tumor-targeting polymeric prodrug of BUF, P(oligo[ethylene glycol] monomethyl ether methacrylate [OEGMA]-co-BUF-co-Oct), showed a nanosize dimension and controlled drug release features in the presence of esterase. It was demonstrated by in vitro experiment that P(OEGMA-co-BUF-co-Oct) showed enhanced cytotoxicity, cellular uptake, and apoptosis in comparison with those of free BUF. In vivo experiment further revealed the improved accumulation of drugs in tumor tissues and enhanced anticancer performance of P(OEGMA-co-BUF-co-Oct).<h4>Conclusion</h4>Taken together, this study indicated that polymeric prodrug of BUF holds promising potential toward the treatment of somatostatin receptor 2 overexpressing breast cancer.
Also flagged:Antiphospholipid antibodiesantiphospholipid syndromeinfectious diseasescardiolipinphosphatic acidphosphatidylcholine
Journal Article2016-05-21✓ 1 SnippetRoggenbuck D, Borghi MO, Somma V, Büttner T, Schierack P, Hanack K, Grossi C, Bodio C, Macor P, von Landenberg P, Boccellato F, Mahler M, Meroni PL.
In-Text Gene Mentions
Introduction)
…mutation, deficiency ofATIII, and protein C…
Show Full Abstract
<h4>Background</h4>Antiphospholipid antibodies (aPL) can be detected in asymptomatic carriers and infectious patients. The aim was to investigate whether a novel line immunoassay (LIA) differentiates between antiphospholipid syndrome (APS) and asymptomatic aPL+ carriers or patients with infectious diseases (infectious diseases controls (IDC)).<h4>Methods</h4>Sixty-one patients with APS (56 primary, 22/56 with obstetric events only, and 5 secondary), 146 controls including 24 aPL+ asymptomatic carriers and 73 IDC were tested on a novel hydrophobic solid phase coated with cardiolipin (CL), phosphatic acid, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, phosphatidylserine, beta2-glycoprotein I (β2GPI), prothrombin, and annexin V. Samples were also tested by anti-CL and anti-β2GPI ELISAs and for lupus anticoagulant activity. Human monoclonal antibodies (humoAbs) against human β2GPI or PL alone were tested on the same LIA substrates in the absence or presence of human serum, purified human β2GPI or after CL-micelle absorption.<h4>Results</h4>Comparison of LIA with the aPL-classification assays revealed good agreement for IgG/IgM aß2GPI and aCL. Anti-CL and anti-ß2GPI IgG/IgM reactivity assessed by LIA was significantly higher in patients with APS versus healthy controls and IDCs, as detected by ELISA. IgG binding to CL and ß2GPI in the LIA was significantly lower in aPL+ carriers and Venereal Disease Research Laboratory test (VDRL) + samples than in patients with APS. HumoAb against domain 1 recognized β2GPI bound to the LIA-matrix and in anionic phospholipid (PL) complexes. Absorption with CL micelles abolished the reactivity of a PL-specific humoAb but did not affect the binding of anti-β2GPI humoAbs.<h4>Conclusions</h4>The LIA and ELISA have good agreement in detecting aPL in APS, but the LIA differentiates patients with APS from infectious patients and asymptomatic carriers, likely through the exposure of domain 1.
Also flagged:DeacetylationTFEBAβdegradationlysosomestranscription factor EB
Journal Article2016-05-21✓ 2 SnippetsBao J, Zheng L, Zhang Q, Li X, Zhang X, Li Z, Bai X, Zhang Z, Huo W, Zhao X, Shang S, Wang Q, Zhang C, Ji J.
In-Text Gene Mentions
Introduction)
…Researchers discovered that the neural toxicity from α-synuclein or htt-aggregates could be markedly ameliorated when TFEB is overexpressed or pharmacologically activated in PD or HD animal models, respectively (Decressac et al., 2013; Tsunemi et al., 2012).…
Introduction)
…from α-synuclein orhtt-aggregates could be markedly…
Show Full Abstract
Microglia play a pivotal role in clearance of Aβ by degrading them in lysosomes, countering amyloid plaque pathogenesis in Alzheimer's disease (AD). Recent evidence suggests that lysosomal dysfunction leads to insufficient elimination of toxic protein aggregates. We tested whether enhancing lysosomal function with transcription factor EB (TFEB), an essential regulator modulating lysosomal pathways, would promote Aβ clearance in microglia. Here we show that microglial expression of TFEB facilitates fibrillar Aβ (fAβ) degradation and reduces deposited amyloid plaques, which are further enhanced by deacetylation of TFEB. Using mass spectrometry analysis, we firstly confirmed acetylation as a previously unreported modification of TFEB and found that SIRT1 directly interacted with and deacetylated TFEB at lysine residue 116. Subsequently, SIRT1 overexpression enhanced lysosomal function and fAβ degradation by upregulating transcriptional levels of TFEB downstream targets, which could be inhibited when TFEB was knocked down. Furthermore, overexpression of deacetylated TFEB at K116R mutant in microglia accelerated intracellular fAβ degradation by stimulating lysosomal biogenesis and greatly reduced the deposited amyloid plaques in the brain slices of APP/PS1 transgenic mice. Our findings reveal that deacetylation of TFEB could regulate lysosomal biogenesis and fAβ degradation, making microglial activation of TFEB a possible strategy for attenuating amyloid plaque deposition in AD.
Conventional cancer treatment methods suffer from many limitations such as non-specificity and low efficacy in discrimination between healthy and cancer cells. Recent developments in nanotechnology have introduced novel and smart therapeutic nanomaterials that basically take advantage of various targeting approaches. Targeted nanomaterials selectively bind to the cancer cells and affect them with minor effects on healthy cells. Folic acid (folate) is an essential molecule in DNA synthesis pathway which is highly needed for cancer cell duplication. Some certain cancer cells overexpress folate receptors higher than normal cells, and this fact is the basis of folate targeting strategy. There are many publications reporting various folate conjugated nanomaterials among which folate-conjugated gold nanoparticles hold great promises in targeted cancer therapy. Gold nanoparticles have been identified as promising candidates for new cancer therapy modalities because of biocompatibility, easy synthesis and functionalization, chemo-physical stability, and optical tunable characteristics. In the last decade, there has been a significant explosion in gold nanoparticles research, with a rapid increase in publications related to the area of biomedicine. Although there are many reports published on "gold nanoparticles" and "folate targeting," there are a few reports on "folate-conjugated gold nanoparticles" in biomedical literature. This paper intends to review and illustrate the recent advances in biomedicine which have been designed on the basis of folate-conjugated gold nanoparticles.
Journal Article2016-05-21No SnippetsGao W, Wang Z, Lv L, Yin D, Chen D, Han Z, Ma Y, Zhang M, Yang M, Gu Y.
Show Full Abstract
Photodynamic therapy (PDT) has recently emerged as an approach to enhance intratumoral accumulation of nanoparticles. However, conventional PDT is greatly limited by the inability of the excitation light to sufficiently penetrate tissue, rendering PDT ineffective in the relatively deep tumors. To address this limitation, we developed a novel PDT platform and reported for the first time the effect of deep-tissue PDT on nanoparticle uptake in tumors. This platform employed c(RGDyK)-conjugated upconversion nanoparticles (UCNPs), which facilitate active targeting of the nanoconstruct to tumor vasculature and achieve the deep-tissue photosensitizer activation by NIR light irradiation. Results indicated that our PDT system efficiently enhanced intratumoral uptake of different nanoparticles in a deep-seated tumor model. The optimal light dose for deep-tissue PDT (34 mW/cm(2)) was determined and the most robust permeability enhancement was achieved by administering the nanoparticles within 15 minutes following PDT treatment. Further, a two-step treatment strategy was developed and validated featuring the capability of improving the therapeutic efficacy of Doxil while simultaneously reducing its cardiotoxicity. This two-step treatment resulted in a tumor inhibition rate of 79% compared with 56% after Doxil treatment alone. These findings provide evidence in support of the clinical application of deep-tissue PDT for enhanced nano-drug delivery.
Also flagged:Irondesferrioxamineextracellularmicrobial infectionphagocytosisdegranulation
Journal Article2016-05-20✓ 1 SnippetVöllger L, Akong-Moore K, Cox L, Goldmann O, Wang Y, Schäfer ST, Naim HY, Nizet V, von Köckritz-Blickwede M.
In-Text Gene Mentions
Discussion)
…iron overload (e.g.hemochromatosis) still remains to…
Show Full Abstract
Neutrophil extracellular trap (NET) formation is a significant innate immune defense mechanism against microbial infection that complements other neutrophil functions including phagocytosis and degranulation of antimicrobial peptides. NETs are decondensed chromatin structures in which antimicrobial components (histones, antimicrobial peptides and proteases) are deployed and mediate immobilization of microbes. Here we describe an effect of iron chelation on the phenotype of NET formation. Iron-chelating agent desferrioxamine (DFO) showed a modest but significant induction of NETs by freshly isolated human neutrophils as visualized and quantified by immunocytochemistry against histone-DNA complexes. Further analyses revealed that NET induction by iron chelation required NADPH-dependent production of reactive oxygen species (ROS) as well as protease and peptidyl-arginine-deiminase 4 (PAD4) activities, three key mechanistic pathways previously linked to NET formation. Our results demonstrate that iron chelation by DFO contributes to the formation of NETs and suggest a target for pharmacological manipulation of NET activity.
…SOCS1 mutations were exclusive to non-relapsing DLBCL, whereas primaries of relapsing DLBCL more commonly displayed gains of 10p15.3-p12.1 containing the potential oncogenes PRKCQ, GATA3, MLLT10 and ABI1.…
Abstract)
…oncogenes PRKCQ, GATA3,MLLT10and ABI1.…
Show Full Abstract
Recurrences of diffuse large B-cell lymphomas (DLBCL) result in significant morbidity and mortality, but their underlying genetic and biological mechanisms are unclear. Clonal relationship in DLBCL relapses so far is mostly addressed by the investigation of immunoglobulin (IG) rearrangements, therefore, lacking deeper insights into genome-wide lymphoma evolution. We studied mutations and copy number aberrations in 20 paired relapsing and 20 non-relapsing DLBCL cases aiming to test the clonal relationship between primaries and relapses to track tumors' genetic evolution and to investigate the genetic background of DLBCL recurrence. Three clonally unrelated DLBCL relapses were identified (15%). Also, two distinct patterns of genetic evolution in clonally related relapses were detected as follows: (1) early-divergent/branching evolution from a common progenitor in 6 patients (30%), and (2) late-divergent/linear progression of relapses in 11 patients (65%). Analysis of recurrent genetic events identified potential early drivers of lymphomagenesis (KMT2D, MYD88, CD79B and PIM1). The most frequent relapse-specific events were additional mutations in KMT2D and alterations of MEF2B. SOCS1 mutations were exclusive to non-relapsing DLBCL, whereas primaries of relapsing DLBCL more commonly displayed gains of 10p15.3-p12.1 containing the potential oncogenes PRKCQ, GATA3, MLLT10 and ABI1. Altogether, our study expands the knowledge on clonal relationship, genetic evolution and mutational basis of DLBCL relapses.
Also flagged:membraneTelhypoxiaChronic obstructive pulmonary diseasePPARβperoxisome proliferator-activated receptor β
Journal Article2016-05-20✓ 5 SnippetsHuang S, Jin L, Shen J, Shang P, Jiang X, Wang X.
In-Text Gene Mentions
I A O 0000326)
…Sox6…
Discussion)
…In summary, we find that LFES can induce mir-499/208b expression and inhibit Sox6 expression and was related to the increase of PPARβ/ERRγ expression and type-I fibres in GC.…
Abstract)
…high expression ofSox6in muscle could…
Abstract)
…ansformation and the microRNA/Sox6pathway.…
Abstract)
…followed by elevatedSox6expression.…
Show Full Abstract
Chronic obstructive pulmonary disease can cause muscle fibre transformation due to chronic intermittent hypoxia-hypercapnia (CIHH). Studies have shown that high expression of Sox6 in muscle could suppress type-I fibres through downregulating the PPARβ (peroxisome proliferator-activated receptor β)/ERRγ (oestrogen-related receptor γ)/microRNA pathway. However, whether this pathway is involved in CIHH-induced muscle fibre transformation is unknown. Electrical stimulation (ES) is an effective approach to ameliorate muscle dysfunction. Here, we explored the effects of ES on CIHH-induced muscle fibre transformation and the microRNA/Sox6 pathway. After CIHH exposure, both the soleus (SOL) and gastrocnemius (GC) muscles showed decreased type-I fibres. The PPARβ/ERRγ/mir-499&208b (PEM, for GC) and PPARβ/mir-499&208b (PM, for SOL) signalling cascades were suppressed, followed by elevated Sox6 expression. Low frequency electrical stimulation (LFES) activated the PEM/PM pathway and enhanced type-I fibre numbers through suppressing Sox6 in SOL and GC. High frequency electrical stimulation (HFES) promoted type-I fibre expression through activating the PEM pathway in GC. Although PPARβ expression and type-I fibres were suppressed in SOL after HFES, no significant change was found in mir-499&208b/Sox6 expression. These results suggest that the microRNA/Sox6 pathway is disturbed after CIHH. Both low and high frequency electrical stimulations induce muscle fibre transformation partly through regulating the microRNA/Sox6 pathway.
Also flagged:chronic lymphocytic leukaemiatyrosine kinaseBTKibrutinibPLCG2histiocytic sarcoma
Journal Article2016-05-20No SnippetsBurger JA, Landau DA, Taylor-Weiner A, Bozic I, Zhang H, Sarosiek K, Wang L, Stewart C, Fan J, Hoellenriegel J, Sivina M, Dubuc AM, Fraser C, Han Y, Li S, Livak KJ, Zou L, Wan Y, Konoplev S, Sougnez C, Brown JR, Abruzzo LV, Carter SL, Keating MJ, Davids MS, Wierda WG, Cibulskis K, Zenz T, Werner L, Dal Cin P, Kharchencko P, Neuberg D, Kantarjian H, Lander E, Gabriel S, O'Brien S, Letai A, Weitz DA, Nowak MA, Getz G, Wu CJ.
Show Full Abstract
Resistance to the Bruton's tyrosine kinase (BTK) inhibitor ibrutinib has been attributed solely to mutations in BTK and related pathway molecules. Using whole-exome and deep-targeted sequencing, we dissect evolution of ibrutinib resistance in serial samples from five chronic lymphocytic leukaemia patients. In two patients, we detect BTK-C481S mutation or multiple PLCG2 mutations. The other three patients exhibit an expansion of clones harbouring del(8p) with additional driver mutations (EP300, MLL2 and EIF2A), with one patient developing trans-differentiation into CD19-negative histiocytic sarcoma. Using droplet-microfluidic technology and growth kinetic analyses, we demonstrate the presence of ibrutinib-resistant subclones and estimate subclone size before treatment initiation. Haploinsufficiency of TRAIL-R, a consequence of del(8p), results in TRAIL insensitivity, which may contribute to ibrutinib resistance. These findings demonstrate that the ibrutinib therapy favours selection and expansion of rare subclones already present before ibrutinib treatment, and provide insight into the heterogeneity of genetic changes associated with ibrutinib resistance.
Also flagged:MAGhuntingtindeathscaffold proteinintracellularneomycin
Journal Article2016-05-20✓ 5 SnippetsLiu X, Wang CE, Hong Y, Zhao T, Wang G, Gaertig MA, Sun M, Li S, Li XJ.
In-Text Gene Mentions
Abstract)
…These findings imply a possible therapeutic benefit of removing the N-terminal region of HTT containing the polyQ repeat to treat the neurodegeneration in HD.…
Introduction)
…the N-terminal region of huntingtin (HTT). …
Introduction)
…in and body, mutant HTT causes selective ne…
Introduction)
…ge-dependent mutant HTT toxicity is a chara…
Introduction)
…Normal HTT consists of 3144 amino acids and…
Show Full Abstract
The Huntington's disease (HD) protein, huntingtin (HTT), is a large protein consisting of 3144 amino acids and has conserved N-terminal sequences that are followed by a polyglutamine (polyQ) repeat. Loss of Htt is known to cause embryonic lethality in mice, whereas polyQ expansion leads to adult neuronal degeneration. Whether N-terminal HTT is essential for neuronal development or contributes only to late-onset neurodegeneration remains unknown. We established HTT knock-in mice (N160Q-KI) expressing the first 208 amino acids of HTT with 160Q, and they show age-dependent HTT aggregates in the brain and neurological phenotypes. Importantly, the N-terminal mutant HTT also preferentially accumulates in the striatum, the brain region most affected in HD, indicating the importance of N-terminal HTT in selective neuropathology. That said, homozygous N160Q-KI mice are also embryonic lethal, suggesting that N-terminal HTT alone is unable to support embryonic development. Using Htt knockout neurons, we found that loss of Htt selectively affects the survival of developing neuronal cells, but not astrocytes, in culture. This neuronal degeneration could be rescued by a truncated HTT lacking the first 237 amino acids, but not by N-terminal HTT (1-208 amino acids). Also, the rescue effect depends on the region in HTT known to be involved in intracellular trafficking. Thus, the N-terminal HTT region may not be essential for the survival of developing neurons, but when carrying a large polyQ repeat, can cause selective neuropathology. These findings imply a possible therapeutic benefit of removing the N-terminal region of HTT containing the polyQ repeat to treat the neurodegeneration in HD.
Also flagged:polypeptideantibodiesantibodyGFPYFPDsRed
Journal Article2016-05-20No SnippetsTang JC, Drokhlyansky E, Etemad B, Rudolph S, Guo B, Wang S, Ellis EG, Li JZ, Cepko CL.
Show Full Abstract
The ability to detect and/or manipulate specific cell populations based upon the presence of intracellular protein epitopes would enable many types of studies and applications. Protein binders such as nanobodies (Nbs) can target untagged proteins (antigens) in the intracellular environment. However, genetically expressed protein binders are stable regardless of antigen expression, complicating their use for applications that require cell-specificity. Here, we created a conditional system in which the stability of an Nb depends upon an antigen of interest. We identified Nb framework mutations that can be used to rapidly create destabilized Nbs. Fusion of destabilized Nbs to various proteins enabled applications in living cells, such as optogenetic control of neural activity in specific cell types in the mouse brain, and detection of HIV-infected human cells by flow cytometry. These approaches are generalizable to other protein binders, and enable the rapid generation of single-polypeptide sensors and effectors active in cells expressing specific intracellular epitopes.
Also flagged:acute otitis mediasinusitispneumoniasepsismeningitispneumococcal infections
Journal Article2016-05-20No SnippetsStacevičienė I, Petraitienė S, Vaičiūnienė D, Alasevičius T, Kirslienė J, Usonis V.
Show Full Abstract
<h4>Background</h4>Increasing pneumococcal resistance to commonly used antibiotics and multidrug resistance is a serious public health concern. Data on distribution of resistant Streptococcus pneumoniae (SPn) strains among children in Lithuania are limited. We evaluated the circulation of SPn serotypes and antimicrobial susceptibility among preschool children in Lithuania before the introduction of universal infant pneumococcal vaccination.<h4>Methods</h4>A prospective study was carried out from February 2012 to March 2013 in five cities of Lithuania. A total of 900 children under six years of age who presented to primary care centre or a hospital emergency department with acute respiratory tract infection were enrolled in the study. Nasopharyngeal swabs were obtained and cultured for SPn. Positive samples (n = 367) were serotyped and tested for antimicrobial susceptibility. Associations of pneumococcal non-susceptibility with study site, season, age, sex, attendance of day care centre and treatment with antimicrobials (between one and six months prior the study) were evaluated.<h4>Results</h4>About a half (56.7 %) of SPn strains were susceptible to all the antibiotics tested. Pneumococcal non-susceptibility to penicillin, erythromycin, clindamycin and trimethoprim-sulphamethoxazole was 15.8, 21.3, 16.9 and 27.3 %, respectively. None of the tested isolates was resistant to norfloxacin or vancomycin. We found a geographical variation of pneumococcal resistance within the cities of the country. Age, sex, the attendance of day care centre and treatment with antimicrobials prior the study was not significantly associated with a carriage of non-susceptible SPn strains. Among non-susceptible SPn serotypes 67.9 %-82.4 % were present in currently available pneumococcal conjugate vaccines.<h4>Conclusions</h4>The rates of nasopharyngeal SPn susceptibility to penicillin and macrolides are still high among preschool children in Lithuania, however they are lower compared with previous studies. A strict policy with respect to antibiotic prescription together with widespread use of vaccination could potentially reduce the carriage rate of antibiotic-resistant pneumococci in our country.
Also flagged:gene expressionobesitydiabetesAutism spectrum disordersAMY2Bstarch
Journal Article2016-05-20✓ 3 SnippetsZhang X, Wang K, Wang L, Yang Y, Ni Z, Xie X, Shao X, Han J, Wan D, Qiu Q.
In-Text Gene Mentions
Results)
…oxia – MRP4 [78], DCC [79] and DEXI [80] …
Results)
…The DCC gene encodes the Netrin 1 receptor,…
I A O 0000615)
…es, including DEXI, DCC, and MRP4, were fou…
Show Full Abstract
<h4>Background</h4>Copy number variation (CNV) represents an important source of genetic divergence that can produce drastic phenotypic differences and may therefore be subject to selection during domestication and environmental adaptation. To investigate the evolutionary dynamics of CNV in the yak genome, we used a read depth approach to detect CNV based on genome resequencing data from 14 wild and 65 domestic yaks and determined CNV regions related to domestication and adaptations to high-altitude.<h4>Results</h4>We identified 2,634 CNV regions (CNVRs) comprising a total of 153 megabases (5.7 % of the yak genome) and 3,879 overlapping annotated genes. Comparison between domestic and wild yak populations identified 121 potentially selected CNVRs, harboring genes related to neuronal development, reproduction, nutrition and energy metabolism. In addition, we found 85 CNVRs that are significantly different between domestic yak living in high- and low-altitude areas, including three genes related to hypoxia response and six related to immune defense. This analysis shows that genic CNVs may play an important role in phenotypic changes during yak domestication and adaptation to life at high-altitude.<h4>Conclusions</h4>We present the first refined CNV map for yak along with comprehensive genomic analysis of yak CNV. Our results provide new insights into the genetic basis of yak domestication and adaptation to living in a high-altitude environment, as well as a valuable genetic resource that will facilitate future CNV association studies of important traits in yak and other bovid species.
Also flagged:KITc-KITcancerscanceramino acidskinase
Journal Article2016-05-20No SnippetsSanlorenzo M, Vujic I, Posch C, Ma J, Lin K, Lai K, Lee D, Vujic M, Oses-Prieto JA, Chand S, Rodriguez-Peralto JL, Burlingame A, Ortiz-Urda S.
Show Full Abstract
<h4>Unlabelled</h4>Mutations in the proto-oncogene c-KIT (KIT) are found in several cancers, and the site of these mutations differs markedly between cancer types. We used site directed mutagenesis to induce KIT(559), KIT(642) and KIT(816) mutations in primary human melanocytes (PHM) and we investigated the impact of each mutation on KIT function. We studied canonical KIT-signaling pathways by immunoblotting, and we used stable isotope labeling by amino acids in cell culture (SILAC) and kinase prediction models to identify kinases differently activated in respective mutants. We validated our results with the analysis of phosphorylation levels of selected substrates for each kinase. We concluded that CK1 ε and δ are more active in cell clones harboring KIT(559) and KIT(642) mutations, whereas PAK4 is more active in clones with KIT(816) mutation. Our findings might help to develop further therapeutic options for tumors with specific KIT mutations in different domains.<h4>Biological significance</h4>Different types of cancers harbor mutations in the oncogene KIT. The use of small molecules inhibitors directly targeting KIT had a limited success in the treatment of patients with KIT mutant cancers. Our study describes specific phospho-proteome changes due to different KIT mutations, and provides targets of further therapeutic options.
Also flagged:Huntington's diseaseHDpolymerasesynapse
Journal Article2016-05-20No SnippetsDu Z, Chazalon M, Bestaven E, Leste-Lasserre T, Baufreton J, Cazalets JR, Cho YH, Garret M.
Show Full Abstract
Huntington's disease (HD) is characterized by progressive motor symptoms preceded by cognitive deficits and is regarded as a disorder that primarily affects the basal ganglia. The external globus pallidus (GPe) has a central role in the basal ganglia, projects directly to the cortex, and is majorly modulated by GABA. To gain a better understanding of the time course of HD progression and gain insight into the underlying mechanisms, we analyzed GABAergic neurotransmission in the GPe of the R6/1 mouse model at purportedly asymptomatic and symptomatic stages (i.e., 2 and 6months). Western blot and quantitative polymerase chain reaction (PCR) analyses revealed alterations in the GPe of male R6/1 mice compared with wild-type littermates. Expression of proteins involved in pre- and post-synaptic GABAergic compartments as well as synapse number were severely decreased at 2 and 6months. At both ages, patch-clamp electrophysiological recordings showed a decrease of spontaneous and miniature inhibitory post-synaptic currents (IPSCs) suggesting that HD mutation has an early effect on the GABA signaling in the brain. Therefore, we performed continuous locomotor activity recordings from 2 to 4months of age. Actigraphy analyses revealed rest/activity fragmentation alterations that parallel GABAergic system impairment at 2months, while the locomotor deficit is evident only at 3months in R6/1 mice. Our results reveal early deficits in HD and support growing evidence for a critical role played by the GPe in physiological and pathophysiological states. We suggest that actimetry may be used as a non-invasive tool to monitor early disease progression.
Also flagged:Ironcytochromehememyoglobinoxygenbinding
Journal Article2016-05-20✓ 5 SnippetsKatsarou MS, Latsi R, Papasavva M, Demertzis N, Kalogridis T, Tsatsakis AM, Spandidos DA, Drakoulis N.
In-Text Gene Mentions
Abstract)
…In this study, we performed a population-based analysis of the distribution of three hemochromatosis-related polymorphisms in the HFE gene (rs1800562, rs1799945 and rs1800730).…
Introduction)
…The second most frequent HFE gene polymorphism consists of a histidine to aspartic acid replacement at position 63 of the HFE protein sequence (H63D), due to a cytosine (C) to guanine (G) replacement at position 187.…
Introduction)
…The C282Y polymorphism of the HFE gene is responsible, alone or in combination with H63D and/or S65C, for almost 90% of hemochromatosis cases among Northern European populations (11).…
Introduction)
…The most frequent polymorphism of the HFE gene is located in the short arm of chromosome 6 (6p), at position 845, where guanine (G) is replaced by adenine (A), resulting in the replacement of a cysteine by tyrosine at position 282 of the HFE protein sequence (C282Y), which leads to a non-functional protein (8).…
Introduction)
…A further association that seems to play a significant role in the development of hemochromatosis is the S65C polymorphism, where serine is replaced by a cysteine at position 65 of the HFE protein sequence (9).…
Show Full Abstract
Hereditary hemochromatosis (HH) is an autosomal recessive genetic disease, characterized by increased dietary iron absorption. Due to the absence of an effective excretory mechanism, the excess iron in the body may accumulate resulting in toxic effects. The HFE gene also affects the activity of hepcidin, a hormone which acts as a negative regulator of iron metabolism. In this study, we performed a population-based analysis of the distribution of three hemochromatosis-related polymorphisms in the HFE gene (rs1800562, rs1799945 and rs1800730). DNA from 1,446 non‑related individuals of Greek ethnicity was collected and analyzed, either from whole blood or buccal swabs. The frequency distribution of these HFE gene polymorphisms was then determined. The results revealed that in our Greek population cohort (gr) the frequencies of each polymorphism were as follows: rs1800562: GG (wild‑type)=97.0%, GA=1.5%, AA=1.5%; rs1799945: CC (wild‑type)=74.4%, CG=23.4%, GG=2.2%; rs1800730: AA (wild‑type)=98.1%, AT=1.5% and TT=0.4%. No association between the HFE polymorphisms rs1800562, rs1799945 and rs1800730 and gender could be established. As regards the rs1800562 polymorphism, the A allele (mutant) was ~1.8‑fold more frequent in the European population (eur) than in the Greek population [(gr)=2,3%<(eur)=4%]. As for the rs1799945 polymorphism, the G allele (mutant) was 1.2‑fold more frequent in the European population than in the Greek population [(gr)=13,9%<(eur)=17%]. As regards the rs1800730 polymorphism, the T allele (mutant) was ~1.7‑fold more frequent in the European population than in the Greek population [(gr)=1.2%<(eur)=2%]. However, these pathogenic mutations were found more frequently in the Greek population compared to the global population (gl) [rs1800562: (gl)=1%<(gr)=2,3%; rs1799945: (gl)=7%<(gr)=13,9%; rs1800730: (gl)=<1%<(gr)=1.2%]. This suggests that the Greek population may differ genetically from the northern European population, due to influences from neighboring Asian and African populations. These findings also suggest that there is no gender-associated inheritance of these polymorphisms, and gender-specific symptoms appear as a result of independent biological processes. Thus, the early detection of the tendency towards iron accumulation may be achieved by the genotypic analysis of the polymorphisms that may contribute to the development of the hemochromatosis.
Also flagged:synthesissaltcyclohexyltrifluoromethylbenzamidepotassium channel
Journal Article2016-05-20No SnippetsNatchimuthu V, Bandaru S, Nayarisseri A, Ravi S.
Show Full Abstract
The narrow therapeutic range and limited pharmacokinetics of available Antiepileptic drugs (AEDs) have raised serious concerns in the proper management of epilepsy. To overcome this, the present study attempts to identify a candidate molecule targeting voltage gated potassium channels anticipated to have superior pharmacological than existing potassium channel blockers. The compound was synthesized by reacting (S)-(+)-2,3-dihydro-1H-pyrrolo[2,1-c][1,4] benzodiazepine5,11(10H,11aH)-dione with 4-(Trifluoromethyl) benzoic acid (C<sub>8</sub>H<sub>5</sub>F<sub>3</sub>O<sub>2</sub>) in DMF and N,N'-dicyclohexylcarbodiimide (DCC) which lead to the formation of an intermediate salt of N-cyclohexyl-N-(cyclohexylcarbamoyl)-4-(trifluoromethyl)benzamide with a perfect crystalline structure. The structure of the compound was characterized by FTIR, <sup>1</sup>H NMR and <sup>13</sup>C NMR analysis. The crystal structure is confirmed by single crystal X-ray diffraction analysis. The Structure-Activity Relationship (SAR) studies revealed that substituent of fluoro or trifluoromethyl moiety into the compound had a great effect on the biological activity in comparison to clinically used drugs. Employing computational approaches the compound was further tested for its affinity against potassium protein structure by molecular docking in addition, bioactivity and ADMET properties were predicted through computer aided programs.
Also flagged:Microangiopathic hemolytic anemiametastatic breast cancerhemolytic anemiabreast cancercanceranemia
Journal Article2016-05-20✓ 1 SnippetTakabatake D, Oishi K.
In-Text Gene Mentions
Discussion)
…The possibility ofhemochromatosisconsequent to excessive…
Show Full Abstract
<h4>Introduction</h4>Microangiopathic hemolytic anemia (MAHA) is a mechanical hemolytic anemia characterized by the emergence of fragmented red cells in peripheral blood. Here, we report a case of breast cancer associated with cancer-related (CR)-MAHA along with a literature review.<h4>Case description</h4>The patient was a 54-year-old woman who made an emergency visit to our hospital because of low back pain, shoulder pain, visual impairment, and anemia. She was diagnosed with stage IV, ER-positive, PgR-positive, HER2-negative left breast cancer (invasive lobular carcinoma), with left axillary adenopathy, metastasis to the soft tissue of the orbital region, multiple bone metastases, pleural dissemination, and metastasis to the stomach and para-aortic lymph nodes. Chemotherapy was initiated successfully; tumor marker levels normalized and the visceral metastases almost disappeared. Hormone therapy was administered for maintenance. Two and a half years later, rapid elevation in tumor marker levels and severe anemia were noted, and fragmented red cells and poikilocytes emerged in the peripheral blood. Positron emission tomography-computed tomography and bone scintigraphy revealed multiple bone metastases, but no evidence of visceral metastasis. CR-MAHA associated with multiple bone metastases was diagnosed, and Paclitaxel chemotherapy was initiated with frequent blood transfusions. Her anemia gradually improved, with a decrease in tumor marker levels and the number of blood transfusions. Three months later, tumor marker levels increased again. Because the anemia was also exacerbated, chemotherapy was changed to eribulin. Tumor marker levels temporally decreased, and the anemia tended to improve, but 3 months later, the levels were elevated again and the anemia was exacerbated. A switch to another regimen was planned, but best supportive care was chosen instead because of rapid deterioration of liver function. The patient died a month later.<h4>Discussion and evaluation</h4>CR-MAHA is thought to have a different pathologic mechanism from TTP or HUS. Although CR-MAHA is a clinical condition associated with a very poor prognosis, we consider it controllable for long period by rapid introduction of chemotherapy in many cases.<h4>Conclusions</h4>CR-MAHA is a nearly oncologic emergency that medical oncologists need to be able to recognize even though it rarely occurs in breast cancer.
Also flagged:prostate cancermetastatic prostate cancerPCaGene Expressionmetastatic PCabenign prostate
Journal Article2016-05-20✓ 5 SnippetsZhang X, Yao X, Qin C, Luo P, Zhang J.
In-Text Gene Mentions
Discussion)
…PCDH17 methylation is a common tumor-specific event in PCa and has been associated with a shorter biochemical recurrence-free survival rate and a reduced overall survival rate of patients with PCa following a radical prostatectomy (47).…
Abstract)
…( CAMK2D andPCDH17) were observed…
Abstract)
…, SH3BP4 andPCDH17) were modulated…
Abstract)
…, SH3BP4 andPCDH17, that may…
Results)
…including CAMK2D ,PCDH17, EDNRB ,…
Show Full Abstract
The present study aimed to screen potential genes associated with metastatic prostate cancer (PCa), in order to improve the understanding of the mechanisms underlying PCa metastasis. The GSE3325 microarray dataset, which was downloaded from the Gene Expression Omnibus database, consists of seven clinically localized PCa samples, six hormone-refractory metastatic PCa samples and six benign prostate tissue samples. The Linear Models for Microarray Data package was used to identify differentially-expressed genes (DEGs) and a hierarchical cluster analysis for DEGs was performed with the pheatmap package. Furthermore, potential functions for the DEGs were predicted by a functional enrichment analysis. Subsequently, microRNAs (miRNAs) potentially involved in the regulation of PCa metastasis were identified by WebGestalt software, and the miRNA-DEG regulatory network was visualized using Cytoscape. In addition, a pathway enrichment analysis for DEGs in the regulatory network was performed. A total of 306 and 2,073 genes were differentially expressed in the clinically localized PCa and the metastatic PCa groups, respectively, as compared with the benign prostate group, of which 174 were differentially expressed in both groups. A number of the DEGs, including <i>CAMK2D</i> and <i>SH3BP4</i>, were significantly enriched in the cell cycle, and others, such as <i>MAF</i>, were associated with the regulation of cell proliferation. Furthermore, some DEGs (<i>CAMK2D</i> and <i>PCDH17</i>) were observed to be regulated by miR-30, whereas others (<i>ADCY2</i>, <i>MAF</i>, <i>SH3BP4</i> and <i>PCDH17</i>) were modulated by miR-182. Additionally, <i>ADCY2</i> and <i>CAMK2D</i> were distinctly enriched in the calcium signaling pathway. The present study identified novel DEGs, including <i>ADCY2</i>, <i>CAMK2D</i>, <i>MAF</i>, <i>SH3BP4</i> and <i>PCDH17</i>, that may be involved in the metastasis of PCa.
…We hypothesized that statins worsen phenotype in ALS mice, dependent on HFE genotype.<h4>Methods</h4>Mice harboring SOD1(G93A) heterozygous for H67D Hfe (homologous to human H63D HFE) were administered simvastatin and/or coenzyme Q10, and were allowed to reach end stage.…
Abstract)
…Statins did not alter mitochondrial protein levels.<h4>Conclusions</h4>Statins and Hfe genotype alter disease course in the ALS mouse model.…
Abstract)
…<h4>Introduction</h4>HMG-CoA reductase inhibitors (statins) and H63D HFE polymorphism may modify amyotrophic lateral sclerosis (ALS).…
Abstract)
…Because the H63DHFEpolymorphism is present…
Abstract)
…statins, stratified forHFEgenotype, may guide…
Show Full Abstract
<h4>Introduction</h4>HMG-CoA reductase inhibitors (statins) and H63D HFE polymorphism may modify amyotrophic lateral sclerosis (ALS). We hypothesized that statins worsen phenotype in ALS mice, dependent on HFE genotype.<h4>Methods</h4>Mice harboring SOD1(G93A) heterozygous for H67D Hfe (homologous to human H63D HFE) were administered simvastatin and/or coenzyme Q10, and were allowed to reach end stage. Disease progression was measured by grip strength. A separate group of animals was administered simvastatin and euthanized at the symptomatic 120-day time-point. Mitochondria from gastrocnemius muscle and lumbar spine were analyzed.<h4>Results</h4>Simvastatin and H67D Hfe accelerated disease progression. Simvastatin decreased survival. Coenzyme Q10 did not rescue statin-induced effects. Statins did not alter mitochondrial protein levels.<h4>Conclusions</h4>Statins and Hfe genotype alter disease course in the ALS mouse model. Because the H63D HFE polymorphism is present in 30% of patients with ALS, studying disease progression in patients who receive statins, stratified for HFE genotype, may guide therapy. Muscle Nerve, 2016 Muscle Nerve 54: 284-291, 2016.
Also flagged:Malachite greenbindingproteinFAPcyaninerhodamine
Journal Article2016-05-19No SnippetsNaganbabu M, Perkins LA, Wang Y, Kurish J, Schmidt BF, Bruchez MP.
Show Full Abstract
Malachite green (MG) is a fluorogenic dye that shows fluorescence enhancement upon binding to its engineered cognate protein, a fluorogen activating protein (FAP). Energy transfer donors such as cyanine and rhodamine dyes have been conjugated with MG to modify the spectral properties of the fluorescent complexes, where the donor dyes transfer energy through Förster resonance energy transfer to the MG complex resulting in binding-conditional fluorescence emission in the far-red region. In this article, we use a violet-excitable dye as a donor to sensitize the far-red emission of the MG-FAP complex. Two blue emitting fluorescent coumarin dyes were coupled to MG and evaluated for energy transfer to the MG-FAP complex via its secondary excitation band. 6,8-Difluoro-7-hydroxycoumarin-3-carboxylic acid (Pacific blue, PB) showed the most efficient energy transfer and maximum brightness in the far-red region upon violet (405 nm) excitation. These blue-red (BluR) tandem dyes are spectrally varied from other tandem dyes and are able to produce fluorescence images of the MG-FAP complex with a large Stokes shift (>250 nm). These dyes are cell-permeable and are used to label intracellular proteins. Used together with a cell-impermeable hexa-Cy3-MG (HCM) dye that labels extracellular proteins, we are able to visualize extracellular, intracellular, and total pools of cellular protein using one fluorogenic tag that combines with distinct dyes to effect different spectral characteristics.
Also flagged:apatiteBiomineralizationCalcium phosphatesilicacalciumcalcium carbonate
Journal Article2016-05-19No SnippetsEnsikat HJ, Geisler T, Weigend M.
Show Full Abstract
Biomineralization provides living organisms with various materials for the formation of resilient structures. Calcium phosphate is the main component of teeth and bones in vertebrates, whereas especially silica serves for the protection against herbivores on many plant surfaces. Functional calcium phosphate structures are well-known from the animal kingdom, but had not so far been reported from higher plants. Here, we document the occurrence of calcium phosphate biomineralization in the South-American plant group Loasaceae (rock nettle family), which have stinging trichomes similar to those of the well-known stinging nettles (Urtica). Stinging hairs and the smaller, glochidiate trichomes contained nanocrystalline hydroxylated apatite, especially in their distal portions, replacing the silica found in analogous structures of other flowering plants. This could be demonstrated by chemical, spectroscopic, and diffraction analyses. Some species of Loasaceae contained both calcium phosphate and silica in addition to calcium carbonate. The intriguing discovery of structural hydroxylated apatite in plants invites further studies, e.g., on its systematic distribution across the family, the genetic and cellular control of plant biomineralization, the properties and ultrastructure of calcium phosphate. It may prove the starting point for the development of biomimetic calcium phosphate composites based on a cellulose matrix.
Also flagged:ischemiasecretionmucositisleucine-rich repeat-containing G protein-coupled receptor 5Lgr5p53
Journal Article2016-05-19✓ 1 SnippetZhan Y, Xu C, Liu Z, Yang Y, Tan S, Yang Y, Jiang J, Liu H, Chen J, Wu B.
In-Text Gene Mentions
Discussion)
…ox9 ablation led to Olfm4+ CBC stem cell loss…
Show Full Abstract
The mechanism of chemotherapy-induced gastrointestinal (GI) syndrome (CIGIS) is still controversial, and it is unclear whether chemotherapy induces intestinal stem cell (ISC) apoptosis. β-Arrestins are regulators and mediators of G protein-coupled receptor signaling in cell apoptosis, division and growth. In this study, we aimed to investigate whether chemotherapy induces ISC apoptosis to contribute to mucositis in CIGIS and whether β-arrestin1 (β-arr1) is involved in this apoptosis. Different chemotherapeutic agents were used to generate a CIGIS model. Lgr5-EGFP-IRES-creERT2(+/-) knock-in mice were used as a CIGIS model to investigate ISC apoptosis. β-arr1 knockout mice were used to determine whether β-arr1 is involved in the apoptosis in CIGIS. Intestinal histology was performed, the ISC apoptosis was analyzed and the mucosal barrier was examined. The effects of β-arr1 in apoptosis were investigated in the samples from humans and mice as well as in cell lines. Here, we demonstrate that chemotherapy induced intestinal mucositis by promoting crypt cell apoptosis, especially in Lgr5+ stem cells and Paneth cells but not in goblet cells, epithelial cells or vascular endothelial cells. Furthermore, β-arr1 deficiency exacerbated the Lgr5+ stem cell apoptosis, but not Paneth cell apoptosis, in CIGIS. In addition, the data showed that β-arr1 reduced the chemotherapy-induced Lgr5+ stem cell apoptosis by inhibiting endoplasmic reticulum stress-mediated mitochondrial apoptotic signaling. Our study indicates that β-arr1 inhibits chemotherapy-induced ISC apoptosis to alleviate intestinal mucositis in CIGIS.
Also flagged:Hormone-ReceptorBreast Tumorshormone-receptor positive breast cancertumorsaromatase
Journal Article2016-05-19✓ 2 SnippetsManso L, Mourón S, Tress M, Gómez-López G, Morente M, Ciruelos E, Rubio-Camarillo M, Rodriguez-Peralto JL, Pujana MA, Pisano DG, Quintela-Fandino M.
In-Text Gene Mentions
Methods)
…Cell line clones resistant to estrogen deprivation were generated in an in vitro model analogous to acquisition of resistance to aromatase inhibitors, as described by Martin et al [28], Briefly, the method consisted of weekly passage and culture of cells in medium containing 10% dextran charcoal-stripped (DCC) fetal bovine serum (FBS) instead of full FBS, which removes steroids.…
Results)
…be cultured inDCC(CAMA1, HCC1500, and…
Show Full Abstract
We sought to identify genetic variants associated with disease relapse and failure to hormonal treatment in hormone-receptor positive breast cancer (HRPBC). We analyzed a series of HRPBC with distant relapse, by sequencing pairs (n = 11) of tumors (primary and metastases) at >800X. Comparative genomic hybridization was performed as well. Top hits, based on the frequency of alteration and severity of the changes, were tested in the TCGA series. Genes determining the most parsimonious prognostic signature were studied for their functional role in vitro, by performing cell growth assays in hormonal-deprivation conditions, a setting that mimics treatment with aromatase inhibitors. Severe alterations were recurrently found in 18 genes in the pairs. However, only MYC, DNAH5, CSFR1, EPHA7, ARID1B, and KMT2C preserved an independent prognosis impact and/or showed a significantly different incidence of alterations between relapsed and non-relapsed cases in the TCGA series. The signature composed of MYC, KMT2C, and EPHA7 best discriminated the clinical course, (overall survival 90,7 vs. 144,5 months; p = 0.0001). Having an alteration in any of the genes of the signature implied a hazard ratio of death of 3.25 (p<0.0001), and early relapse during the adjuvant hormonal treatment. The presence of the D348N mutation in KMT2C and/or the T666I mutation in the kinase domain of EPHA7 conferred hormonal resistance in vitro. Novel inactivating mutations in KMT2C and EPHA7, which confer hormonal resistance, are linked to adverse clinical course in HRPBC.
Also flagged:Central Obesitycardiometabolic diseaseObesityinsulin resistancetype-2 diabetescardiovascular disease
Journal Article2016-05-19No SnippetsScott WR, Zhang W, Loh M, Tan ST, Lehne B, Afzal U, Peralta J, Saxena R, Ralhan S, Wander GS, Bozaoglu K, Sanghera DK, Elliott P, Scott J, Chambers JC, Kooner JS.
Show Full Abstract
South Asians are 1/4 of the world's population and have increased susceptibility to central obesity and related cardiometabolic disease. Knowledge of genetic variants affecting risk of central obesity is largely based on genome-wide association studies of common SNPs in Europeans. To evaluate the contribution of DNA sequence variation to the higher levels of central obesity (defined as waist hip ratio adjusted for body mass index, WHR) among South Asians compared to Europeans we carried out: i) a genome-wide association analysis of >6M genetic variants in 10,318 South Asians with focused analysis of population-specific SNPs; ii) an exome-wide association analysis of ~250K SNPs in protein-coding regions in 2,637 South Asians; iii) a comparison of risk allele frequencies and effect sizes of 48 known WHR SNPs in 12,240 South Asians compared to Europeans. In genome-wide analyses, we found no novel associations between common genetic variants and WHR in South Asians at P<5x10-8; variants showing equivocal association with WHR (P<1x10-5) did not replicate at P<0.05 in an independent cohort of South Asians (N = 1,922) or in published, predominantly European meta-analysis data. In the targeted analyses of 122,391 population-specific SNPs we also found no associations with WHR in South Asians at P<0.05 after multiple testing correction. Exome-wide analyses showed no new associations between genetic variants and WHR in South Asians, either individually at P<1.5x10-6 or grouped by gene locus at P<2.5x10-6. At known WHR loci, risk allele frequencies were not higher in South Asians compared to Europeans (P = 0.77), while effect sizes were unexpectedly smaller in South Asians than Europeans (P<5.0x10-8). Our findings argue against an important contribution for population-specific or cosmopolitan genetic variants underlying the increased risk of central obesity in South Asians compared to Europeans.
Also flagged:NRXN1neurodevelopmental disordersdevelopmental delayintellectual disabilityNeurexinscell adhesion molecules
Journal Article2016-05-19No SnippetsLowther C, Speevak M, Armour CM, Goh ES, Graham GE, Li C, Zeesman S, Nowaczyk MJ, Schultz LA, Morra A, Nicolson R, Bikangaga P, Samdup D, Zaazou M, Boyd K, Jung JH, Siu V, Rajguru M, Goobie S, Tarnopolsky MA, Prasad C, Dick PT, Hussain AS, Walinga M, Reijenga RG, Gazzellone M, Lionel AC, Marshall CR, Scherer SW, Stavropoulos DJ, McCready E, Bassett AS.
Show Full Abstract
<h4>Purpose</h4>The purpose of the current study was to assess the penetrance of NRXN1 deletions.<h4>Methods</h4>We compared the prevalence and genomic extent of NRXN1 deletions identified among 19,263 clinically referred cases to that of 15,264 controls. The burden of additional clinically relevant copy-number variations (CNVs) was used as a proxy to estimate the relative penetrance of NRXN1 deletions.<h4>Results</h4>We identified 41 (0.21%) previously unreported exonic NRXN1 deletions ascertained for developmental delay/intellectual disability that were significantly greater than in controls (odds ratio (OR) = 8.14; 95% confidence interval (CI): 2.91-22.72; P < 0.0001). Ten (22.7%) of these had a second clinically relevant CNV. Subjects with a deletion near the 3' end of NRXN1 were significantly more likely to have a second rare CNV than subjects with a 5' NRXN1 deletion (OR = 7.47; 95% CI: 2.36-23.61; P = 0.0006). The prevalence of intronic NRXN1 deletions was not statistically different between cases and controls (P = 0.618). The majority (63.2%) of intronic NRXN1 deletion cases had a second rare CNV at a prevalence twice as high as that for exonic NRXN1 deletion cases (P = 0.0035).<h4>Conclusions</h4>The results support the importance of exons near the 5' end of NRXN1 in the expression of neurodevelopmental disorders. Intronic NRXN1 deletions do not appear to substantially increase the risk for clinical phenotypes.Genet Med 19 1, 53-61.
…Monogenic disorders, such as Huntington’s disease, are identified simply through the presence, or absence, of single gene mutations; in this case a mutation in the Huntingtin protein, HTT [2].…
Introduction)
…the Huntingtin protein,HTT[ 2 ].…
Show Full Abstract
Drug development is both increasing in cost whilst decreasing in productivity. There is a general acceptance that the current paradigm of R&D needs to change. One alternative approach is drug repositioning. With target-based approaches utilised heavily in the field of drug discovery, it becomes increasingly necessary to have a systematic method to rank gene-disease associations. Although methods already exist to collect, integrate and score these associations, they are often not a reliable reflection of expert knowledge. Furthermore, the amount of data available in all areas covered by bioinformatics is increasing dramatically year on year. It thus makes sense to move away from more generalised hypothesis driven approaches to research to one that allows data to generate their own hypothesis. We introduce an integrated, data driven approach to drug repositioning. We first apply a Bayesian statistics approach to rank 309,885 gene-disease associations using existing knowledge. Ranked associations are then integrated with other biological data to produce a semantically-rich drug discovery network. Using this network, we show how our approach identifies diseases of the central nervous system (CNS) to be an area of interest. CNS disorders are identified due to the low numbers of such disorders that currently have marketed treatments, in comparison to other therapeutic areas. We then systematically mine our network for semantic subgraphs that allow us to infer drug-disease relations that are not captured in the network. We identify and rank 275,934 drug-disease has_indication associations after filtering those that are more likely to be side effects, whilst commenting on the top ranked associations in more detail. The dataset has been created in Neo4j and is available for download at https://bitbucket.org/ncl-intbio/genediseaserepositioning along with a Java implementation of the searching algorithm.
…Huntington's disease (HD) is an inherited progressive neurodegenerative disorder caused by a CAG repeat expansion in the first exon of HTT. HTT encodes the huntingtin protein (HTT) and the CAG repeat tract gives rise to a polyglutamine tract in the protein [1].…
Introduction)
…HTTencodes the huntingtin…
Introduction)
…the huntingtin protein (HTT) and the CAG…
Show Full Abstract
Huntington's disease (HD) cellular pathology is characterised by the aggregation of mutant huntingtin (mHTT) protein into inclusion bodies. The present paper compared the sensitivity of five widely used mHTT antibodies (S830; MW8; EM48; 1C2; ubiquitin) against mice from five commonly used HD mouse models (R6/1; YAC128; HdhQ92; B6 HdhQ150; B6 x129/Ola HdhQ150) at two ages to determine: the most sensitive antibodies for each model; whether mHTT antibody binding differed depending on aggregation stage (diffuse versus frank inclusion); the role of ubiquitin during aggregation as the ubiquitin proteosome system has been implicated in disease development. The models demonstrated unique profiles of antibody binding even when the models varied only by background strain (HdhQ150). MW8 was highly sensitive for detecting frank inclusions in all lines whereas EM48, ubiquitin and 1C2 demonstrated consistent staining in all models irrespective of age or form of mHTT. MW8 and S830 were the most sensitive antibodies with 1C2 the least. Ubiquitin levels were stable for each model regardless of age. Ubiquitin was particularly sensitive in young YAC128 mice that demonstrate an absence of inclusions until ~12 months of age suggesting high affinity to mHTT in its diffuse form. The data indicate that generalisations across models regarding the quantification of aggregations may not be valid and that mHTT antibody binding is unique to the mouse model and sensitive to changes in inclusion development.
Also flagged:Presenilin 1PS1γ-secretaseamyloid precursor proteinAPPaxonal
Journal Article2016-05-19✓ 5 SnippetsDeyts C, Clutter M, Herrera S, Jovanovic N, Goddi A, Parent AT.
In-Text Gene Mentions
Results)
…We and others have previously reported that γ-secretase-dependent accumulation of Deleted Colorectal Cancer C-terminal fragment (DCC-CTF) promotes neurite outgrowth in neuroblastoma cells (Parent et al., 2005) and motor neuron explants (Bai et al., 2011).…
Introduction)
…Over 90 substrates have been identified so far including amyloid precursor protein (APP), Notch and Eph receptors and ligands, cadherins, and deleted in colorectal cancer (DCC) (Haapasalo and Kovacs, 2011; Kopan and Ilagan, 2004; McCarthy et al., 2009; Parks and Curtis, 2007).…
Introduction)
…in colorectal cancer (DCC) ( Haapasalo and…
Methods)
…targeted deletion ofDccalleles (DCC KO)…
Methods)
…of Dcc alleles (DCCKO) were generated…
Show Full Abstract
Presenilin 1 (PS1) is an essential γ-secretase component, the enzyme responsible for amyloid precursor protein (APP) intramembraneous cleavage. Mutations in PS1 lead to dominant-inheritance of early-onset familial Alzheimer's disease (FAD). Although expression of FAD-linked PS1 mutations enhances toxic Aβ production, the importance of other APP metabolites and γ-secretase substrates in the etiology of the disease has not been confirmed. We report that neurons expressing FAD-linked PS1 variants or functionally deficient PS1 exhibit enhanced axodendritic outgrowth due to increased levels of APP intracellular C-terminal fragment (APP-CTF). APP expression is required for exuberant neurite outgrowth and hippocampal axonal sprouting observed in knock-in mice expressing FAD-linked PS1 mutation. APP-CTF accumulation initiates CREB signaling cascade through an association of APP-CTF with Gαs protein. We demonstrate that pathological PS1 loss-of-function impinges on neurite formation through a selective APP gain-of-function that could impact on axodendritic connectivity and contribute to aberrant axonal sprouting observed in AD patients.
Also flagged:myosin heavy chainmuscle diseasesmuscular dystrophiessarcopeniaagingmuscle disease
Journal Article2016-05-19No SnippetsTalbot J, Maves L.
Show Full Abstract
Skeletal muscle fibers are classified into fiber types, in particular, slow twitch versus fast twitch. Muscle fiber types are generally defined by the particular myosin heavy chain isoforms that they express, but many other components contribute to a fiber's physiological characteristics. Skeletal muscle fiber type can have a profound impact on muscle diseases, including certain muscular dystrophies and sarcopenia, the aging-induced loss of muscle mass and strength. These findings suggest that some muscle diseases may be treated by shifting fiber type characteristics either from slow to fast, or fast to slow phenotypes, depending on the disease. Recent studies have begun to address which components of muscle fiber types mediate their susceptibility or resistance to muscle disease. However, for many diseases it remains largely unclear why certain fiber types are affected. A substantial body of work has revealed molecular pathways that regulate muscle fiber type plasticity and early developmental muscle fiber identity. For instance, recent studies have revealed many factors that regulate muscle fiber type through modulating the activity of the muscle regulatory transcription factor MYOD1. Future studies of muscle fiber type development in animal models will continue to enhance our understanding of factors and pathways that may provide therapeutic targets to treat muscle diseases. WIREs Dev Biol 2016, 5:518-534. doi: 10.1002/wdev.230 For further resources related to this article, please visit the WIREs website.
Also flagged:axonsDraxinaxon guidance proteintransmembraneaxonvesicles
Journal Article2016-05-19✓ 1 SnippetZhang S, Cui H, Wang L, Kang L, Huang G, Du J, Li S, Tanaka H, Su Y.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
The appropriate projection of axons within the nervous system is a crucial component of the establishment of neural circuitry. Draxin is a repulsive axon guidance protein. Draxin has important functions in the guidance of three commissures in the central nervous system and in the migration of neural crest cells and dI3 interneurons in the chick spinal cord. Here, we report that the distribution of the draxin protein and the location of 23C10-positive areas have a strong temporal and spatial correlation. The overexpression of draxin, especially transmembrane draxin, caused 23C10-positive axon bundles to misproject in the dorsal hindbrain. In addition, the overexpression of transmembrane draxin caused abnormal formation of the ganglion crest of the IX and X cranial nerves, misprojection of some anti-human natural killer-1 (HNK-1)-stained structures in the dorsal roof of the hindbrain, and a simultaneous reduction in the efferent nerves of some motoneuron axons inside the hindbrain. Our data reveal that draxin might be involved in the fascicular projection of cranial nerves in the hindbrain.
Also flagged:Huntingtinp53HDp53-induced gene 1bindingset 1
Journal Article2016-05-19✓ 5 SnippetsKim SH, Shahani N, Bae BI, Sbodio JI, Chung Y, Nakaso K, Paul BD, Sawa A.
In-Text Gene Mentions
Abstract)
…Together, we propose that Wig1, a key p53 downstream molecule in HD condition, play an important role in stabilizing mutant Htt mRNA and thereby accelerating HD pathology in the mHtt-p53-Wig1 positive feedback manner.…
Abstract)
…of mutant Huntingtin (Htt) compared with wild-type…
Abstract)
…compared with wild-typeHtt.…
Abstract)
…binding to mutantHtttranscripts than normal…
Abstract)
…gnificantly ameliorates mutantHtt-elicited cytotoxicity and agg…
Show Full Abstract
p53 has been implicated in the pathophysiology of Huntington's disease (HD). Nonetheless, the molecular mechanism of how p53 may play a unique role in the pathology remains elusive. To address this question at the molecular and cellular biology levels, we initially screened differentially expressed molecules specifically dependent on p53 in a HD animal model. Among the candidate molecules, wild-type p53-induced gene 1 (Wig1) is markedly upregulated in the cerebral cortex of HD patients. Wig1 preferentially upregulates the level of mutant Huntingtin (Htt) compared with wild-type Htt. This allele-specific characteristic of Wig1 is likely to be explained by higher affinity binding to mutant Htt transcripts than normal counterpart for the stabilization. Knockdown of Wig1 level significantly ameliorates mutant Htt-elicited cytotoxicity and aggregate formation. Together, we propose that Wig1, a key p53 downstream molecule in HD condition, play an important role in stabilizing mutant Htt mRNA and thereby accelerating HD pathology in the mHtt-p53-Wig1 positive feedback manner.
Also flagged:p62ubiquitinbindingautophagy receptorliver diseasesautophagy
Journal Article2016-05-19✓ 1 SnippetUmemura A, He F, Taniguchi K, Nakagawa H, Yamachika S, Font-Burgada J, Zhong Z, Subramaniam S, Raghunandan S, Duran A, Linares JF, Reina-Campos M, Umemura S, Valasek MA, Seki E, Yamaguchi K, Koike K, Itoh Y, Diaz-Meco MT, Moscat J, Karin M.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
p62 is a ubiquitin-binding autophagy receptor and signaling protein that accumulates in premalignant liver diseases and most hepatocellular carcinomas (HCCs). Although p62 was proposed to participate in the formation of benign adenomas in autophagy-deficient livers, its role in HCC initiation was not explored. Here we show that p62 is necessary and sufficient for HCC induction in mice and that its high expression in non-tumor human liver predicts rapid HCC recurrence after curative ablation. High p62 expression is needed for activation of NRF2 and mTORC1, induction of c-Myc, and protection of HCC-initiating cells from oxidative stress-induced death.
Also flagged:FOXL2forkhead box (FOXtranscription factorpropeptidescollagenscollagen
Journal Article2016-05-19✓ 1 SnippetMarongiu M, Deiana M, Marcia L, Sbardellati A, Asunis I, Meloni A, Angius A, Cusano R, Loi A, Crobu F, Fotia G, Cucca F, Schlessinger D, Crisponi L.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
FOXL2 belongs to the evolutionarily conserved forkhead box (FOX) superfamily and is a master transcription factor in a spectrum of developmental pathways, including ovarian and eyelid development and bone, cartilage and uterine maturation. To analyse its action, we searched for proteins that interact with FOXL2. We found that FOXL2 interacts with specific C-terminal propeptides of several fibrillary collagens. Because these propeptides can participate in feedback regulation of collagen biosynthesis, we inferred that FOXL2 could thereby affect the transcription of the cognate collagen genes. Focusing on COL1A2, we found that FOXL2 indeed affects collagen synthesis, by binding to a DNA response element located about 65Kb upstream of this gene. According to our hypothesis we found that in Foxl2(-/-) mouse ovaries, Col1a2 was elevated from birth to adulthood. The extracellular matrix (ECM) compartmentalizes the ovary during folliculogenesis, (with type I, type III and type IV collagens as primary components), and ECM composition changes during the reproductive lifespan. In Foxl2(-/-) mouse ovaries, in addition to up-regulation of Col1a2, Col3a1, Col4a1 and fibronectin were also upregulated, while laminin expression was reduced. Thus, by regulating levels of extracellular matrix components, FOXL2 may contribute to both ovarian histogenesis and the fibrosis attendant on depletion of the follicle reserve during reproductive aging and menopause.
Also flagged:Neurodegenerationsynthesiscellnerve terminalsaxonalamyotrophic lateral sclerosis
Journal Article2016-05-19✓ 2 SnippetsWhite JA, Banerjee R, Gunawardena S.
In-Text Gene Mentions
Introduction)
…HD protein huntingtin (HTT) is also proposed…
Introduction)
…Recently,HTThas been shown…
Show Full Abstract
Unlike virtually any other cells in the human body, neurons are tasked with the unique problem of transporting important factors from sites of synthesis at the cell bodies, across enormous distances, along narrow-caliber projections, to distally located nerve terminals in order to maintain cell viability. As a result, axonal transport is a highly regulated process whereby necessary cargoes of all types are packaged and shipped from one end of the neuron to the other. Interruptions in this finely tuned transport have been linked to many neurodegenerative disorders including Alzheimer's (AD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS) suggesting that this pathway is likely perturbed early in disease progression. Therefore, developing therapeutics targeted at modifying transport defects could potentially avert disease progression. In this review, we examine a variety of potential compounds identified from marine aquatic species that affect the axonal transport pathway. These compounds have been shown to function in microtubule (MT) assembly and maintenance, motor protein control, and in the regulation of protein degradation pathways, such as the autophagy-lysosome processes, which are defective in many degenerative diseases. Therefore, marine compounds have great potential in developing effective treatment strategies aimed at early defects which, over time, will restore transport and prevent cell death.
Combining virus-induced cytotoxic and immunotherapeutic effects, oncolytic virotherapy represents a promising therapeutic approach for high-grade glioma (HGG). A clinical trial has recently provided evidence for the clinical safety of the oncolytic parvovirus H-1 (H-1PV) in adult glioblastoma relapse patients. The present study assesses the efficacy of H-1PV in eliminating HGG initiating cells. H-1PV was able to enter and to transduce all HGG neurosphere culture models (n = 6), including cultures derived from adult glioblastoma, pediatric glioblastoma, and diffuse intrinsic pontine glioma. Cytotoxic effects induced by the virus have been observed in all HGG neurospheres at half maximal inhibitory concentration (IC50) doses of input virus between 1 and 10 plaque forming units per cell. H-1PV infection at this dose range was able to prevent tumorigenicity of NCH421k glioblastoma multiforme (GBM) "stem-like" cells in NOD/SCID mice. Interestingly NCH421R, an isogenic subclone with equal capacity of xenograft formation, but resistant to H-1PV infection could be isolated from the parental NCH421k culture. To reveal changes in gene expression associated with H-1PV resistance we performed a comparative gene expression analysis in these subclones. Several dysregulated genes encoding receptor proteins, endocytosis factors or regulators innate antiviral responses were identified and represent intriguing candidates for to further study molecular mechanisms of H-1PV resistance.
Also flagged:stem cell-associated antigenstranscription factorsCD31CD45stem cell antigen-1c-kit
Journal Article2016-05-19No SnippetsWu Q, Zhan J, Li Y, Wang X, Xu L, Yu J, Pu S, Zhou Z.
Show Full Abstract
Cardiac resident stem/progenitor cells (CSC/CPCs) are critical to the cellular and functional integrity of the heart because they maintain myocardial cell homeostasis. Several populations of CSC/CPCs have been identified based on expression of different stem cell-associated antigens. Sca-1(+) cells in the cardiac tissue may be the most common CSC/CPCs. However, they are a heterogeneous cell population and, in transplants, clinicians might transplant more endothelial cells, cardiomyocytes, or other cells than stem cells. The purposes of this study were to (1) isolate CSC/CPCs with Lin(-)CD45(-)Sca-1(+)CD31(-) and Lin(-)CD45(-)Sca-1(+)CD31(+) surface antigens using flow-activated cell sorting; (2) investigate their differentiation potential; and (3) determine the molecular basis for differences in stemness characteristics between cell subtypes. The results indicated that mouse heart-derived Sca-1(+)CD31(-) cells were multipotent and retained the ability to differentiate into different cardiac cell lineages, but Sca-1(+)CD31(+) cells did not. Integrated analysis of microRNA and mRNA expression indicated that 20 microRNAs and 49 mRNAs were inversely associated with Sca-1(+)CD31(-) and Sca-1(+)CD31(+) subtype stemness characteristics. In particular, mmu-miR-322-5p had more targeted and inversely associated genes and transcription factors and might have higher potential for CSC/CPCs differentiation.
Also flagged:MTORmammalian target of rapamycinsignal transductioncell growthmetabolismautophagy
Journal Article2016-05-18No SnippetsEvangelisti C, Cenni V, Lattanzi G.
Show Full Abstract
The mammalian target of rapamycin (mTOR) pathway is an highly conserved signal transduction axis involved in many cellular processes, such as cell growth, survival, transcription, translation, apoptosis, metabolism, motility and autophagy. Recently, this signalling pathway has come to the attention of the scientific community owing to the unexpected finding that inhibition of mTOR by rapamycin, an antibiotic with immunosuppressant and chemotherapeutic properties, extends lifespan in diverse animal models. Moreover, rapamycin has been reported to rescue the cellular phenotype in a progeroid syndrome [Hutchinson-Gilford Progeria syndrome (HGPS)] that recapitulates most of the traits of physiological ageing. The promising perspectives raised by these results warrant a better understanding of mTOR signalling and the potential applications of mTOR inhibitors to counteract ageing-associated diseases and increase longevity. This review is focused on these issues.
Also flagged:nanoclustersCXCR4primarytumorbreast cancerconjugation
Journal Article2016-05-18No SnippetsZhao Y, Detering L, Sultan D, Cooper ML, You M, Cho S, Meier SL, Luehmann H, Sun G, Rettig M, Dehdashti F, Wooley KL, DiPersio JF, Liu Y.
Show Full Abstract
As an emerging class of nanomaterial, nanoclusters hold great potential for biomedical applications due to their unique sizes and related properties. Herein, we prepared a (64)Cu doped gold nanocluster ((64)CuAuNC, hydrodynamic size: 4.2 ± 0.5 nm) functionalized with AMD3100 (or Plerixafor) for targeted positron emission tomography (PET) imaging of CXCR4, an up-regulated receptor on primary tumor and lung metastasis in a mouse 4T1 orthotopic breast cancer model. The preparation of targeted (64)CuAuNCs-AMD3100 (4.5 ± 0.4 nm) was done via one-step reaction with controlled conjugation of AMD3100 and specific activity, as well as improved colloid stability. In vivo pharmacokinetic evaluation showed favorable organ distribution and significant renal and fecal clearance within 48 h post injection. The expression of CXCR4 in tumors and metastasis was characterized by immunohistochemistry, Western blot, and reverse transcription polymerase chain reaction analysis. PET imaging with (64)CuAuNCs-AMD3100 demonstrated sensitive and accurate detection of CXCR4 in engineered tumors expressing various levels of the receptor, while competitive receptor blocking studies confirmed targeting specificity of the nanoclusters. In contrast to nontargeted (64)CuAuNCs and (64)Cu-AMD3100 alone, the targeted (64)CuAuNCs-AMD3100 detected up-regulated CXCR4 in early stage tumors and premetastatic niche of lung earlier and with greater sensitivity. Taken together, we believe that (64)CuAuNCs-AMD3100 could serve as a useful platform for early and accurate detection of breast cancer and metastasis providing an essential tool to guide the treatment.
Also flagged:Gene Expressioncancergene expressionsbreast cancerinvasive breast cancertumor
Journal Article2016-05-18No SnippetsZhang X, Cha IH, Kim KY.
Show Full Abstract
<h4>Purpose</h4>Chemotherapy targets all rapidly growing cells, not only cancer cells, and thus is often associated with unpleasant side effects. Therefore, examination of the chemosensitivity based on genotypes is needed in order to reduce the side effects.<h4>Materials and methods</h4>Various computational approaches have been proposed for predicting chemosensitivity based on gene expression profiles. A linear regression model can be used to predict the response of cancer cells to chemotherapeutic drugs, based on genomic features of the cells, and appropriate sample size for this method depends on the number of predictors. We used principal component analysis and identified a combined gene expression profile to reduce the number of predictors.<h4>Results</h4>The coefficients of determinanation (R<sup>2</sup>) of prediction models with combined gene expression and several independent gene expressions were similar. Corresponding F values, which represent model significances were improved by use of a combined gene expression profile, indicating that the use of a combined gene expression profile is helpful in predicting drug sensitivity. Even better, a prediction model can be used even with small samples because of the reduced number of predictors.<h4>Conclusion</h4>Combined gene expression analysis is expected to contribute to more personalized management of breast cancer cases by enabling more effective targeting of existing therapies. This procedure for identifying a cell-type-specific gene expression profile can be extended to other chemotherapeutic treatments and many other heterogeneous cancer types.
Also flagged:mitochondriacell growthelectron transport chainComplexes ICICIII
Journal Article2016-05-18✓ 1 SnippetLi D, Calderone R.
In-Text Gene Mentions
Text
…CI regulatory protein…
Show Full Abstract
Mitochondria are essential for cell growth and survival of most fungal pathogens. Energy (ATP) produced during oxidation/reduction reactions of the electron transport chain (ETC) Complexes I, III and IV (CI, CIII, CIV) fuel cell synthesis. The mitochondria of fungal pathogens are understudied even though more recent published data suggest critical functional assignments to fungal-specific proteins. Proteins of mammalian mitochondria are grouped into 16 functional categories. In this review, we focus upon 11 proteins from 5 of these categories in fungal pathogens, OXPHOS, protein import, stress response, carbon source metabolism, and fission/fusion morphology. As these proteins also are fungal-specific, we hypothesize that they may be exploited as targets in antifungal drug discovery. We also discuss published transcriptional profiling data of mitochondrial CI subunit protein mutants, in which we advance a novel concept those CI subunit proteins have both shared as well as specific responsibilities for providing ATP to cell processes.
Also flagged:OxygenHuntington diseasemitochondrialHDdinitrophenolisoflurane
Journal Article2016-05-18✓ 1 SnippetLou S, Lepak VC, Eberly LE, Roth B, Cui W, Zhu XH, Öz G, Dubinsky JM.
In-Text Gene Mentions
Text
…htt…
Show Full Abstract
In vivo evidence for brain mitochondrial dysfunction in animal models of Huntington disease (HD) is scarce. We applied the novel <sup>17</sup>O magnetic resonance spectroscopy (MRS) technique on R6/2 mice to directly determine rates of oxygen consumption (CMRO<sub>2</sub>) and assess mitochondrial function in vivo Basal respiration and maximal CMRO<sub>2</sub> in the presence of the mitochondrial uncoupler dinitrophenol (DNP) were compared using 16.4 T in isoflurane anesthetized wild type (WT) and HD mice at 9 weeks. At rest, striatal CMRO<sub>2</sub> of R6/2 mice was equivalent to that of WT, indicating comparable mitochondrial output despite onset of motor symptoms in R6/2. After DNP injection, the maximal CMRO<sub>2</sub> in both striatum and cortex of R6/2 mice was significantly lower than that of WT, indicating less spare energy generating capacity. In a separate set of mice, oligomycin injection to block ATP generation decreased CMRO<sub>2</sub> equally in brains of R6/2 and WT mice, suggesting oxidative phosphorylation capacity and respiratory coupling were equivalent at rest. Expression levels of representative mitochondrial proteins were compared from harvested tissue samples. Significant differences between R6/2 and WT included: in striatum, lower VDAC and the mitochondrially encoded cytochrome oxidase subunit I relative to actin; in cortex, lower tricarboxylic acid cycle enzyme aconitase and higher protein carbonyls; in both, lower glycolytic enzyme enolase. Therefore in R6/2 striatum, lowered CMRO<sub>2</sub> may be attributed to a decrease in mitochondria while the cortical CMRO<sub>2</sub> decrease may result from constraints upstream in energetic pathways, suggesting regionally specific changes and possibly rates of metabolic impairment.
Also flagged:Acetateetherdiethyl etherEthylbenzyl bromidesilica
Journal Article2016-05-18✓ 1 SnippetEl Alaoui M, Soulère L, Noiriel A, Popowycz F, Khatib A, Queneau Y, Abousalham A.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
A new spectrophotometric assay was developed to measure, continuously and specifically, phospholipase A1 (PLA1) or phospholipase A2 (PLA2) activities using synthetic glycerophosphatidylcholines (PCs) containing α-eleostearic acid, either at the sn-1 position [1-α-eleostearoyl-2-octadecyl-rac-glycero-3-phosphocholine (EOPC)] or at the sn-2 position [1-octadecyl-2-α-eleostearoyl-rac-glycero-3-phosphocholine (OEPC)]. The substrates were coated onto the wells of microtiter plates. A nonhydrolyzable ether bond, with a non-UV-absorbing alkyl chain, was introduced at the other sn position to prevent acyl chain migration during lipolysis. Upon enzyme action, α-eleostearic acid is liberated and then solubilized into the micellar phase. The PLA1 or PLA2 activity was measured by the increase in absorbance at 272 nm due to the transition of α-eleostearic acid from the adsorbed to the soluble state. EOPC and OEPC differentiate, with excellent accuracy, between PLA1 and PLA2 activity. Lecitase(®), guinea pig pancreatic lipase-related protein 2 (known to be a PLA1 enzyme), bee venom PLA2, and porcine pancreatic PLA2 were all used to validate the assay. Compared with current assays used for continuously measuring PLA1 or PLA2 activities and/or their inhibitors, the development of this sensitive enzymatic method, using coated PC substrate analogs to natural lipids and based on the UV spectroscopic properties of α-eleostearic acid, is a significant improvement.
Also flagged:naringinnucleusflavonoidgene expressionstumor necrosis factor-αTNF-α
Journal Article2016-05-18✓ 4 SnippetsLi N, Whitaker C, Xu Z, Heggeness M, Yang SY.
In-Text Gene Mentions
Abstract)
…Naringin also increased disc matrix gene activity including aggrecan and Sox6, and decreased the gene expression of MMP3.<h4>Conclusion</h4>Naringin effectively promotes the proliferation of degenerative human NP cells and improves the recuperation of the cells from degeneration by increasing expression of aggrecan, BMP-2, and Sox6 while inhibiting the expression of TNF-α and MMP3.…
Abstract)
…expression of aggrecan,Sox6, and MMP3 was…
Abstract)
…including aggrecan andSox6, and decreased the…
Abstract)
…aggrecan, BMP-2, andSox6while inhibiting the…
Show Full Abstract
<h4>Background</h4>Over half the population of the world will suffer from moderate or severe low back pain (LBP) during their life span. Studies have shown that naringin, a major flavonoid in grapefruit and an active compound extracted from a Chinese herbal medicine (Rhizoma Drynariae) possesses many pharmacological effects.<h4>Purpose</h4>The aim of this study was to evaluate the influence of naringin on the growth of degenerative human nucleus pulposus (NP) cells, and its repair effects on protein and gene expressions of the cells.<h4>Study design/setting</h4>This was an in vitro investigation of the human NP cells isolated from degenerated intervertebral discs that were interacted with various concentrated of naringin.<h4>Method</h4>This study was exempted by the institutional Human Subjects Committee-2, University of Kansas School of Medicine-Wichita. Degenerative human NP cells were isolated from intervertebral discs of patients with discogenic LBP and cultured at 37°C with 5% CO<sub>2</sub>. The proliferation of NP cells was determined following treatment with various concentrations of naringin. The protein expressions of tumor necrosis factor-α (TNF-α) and Bone morphogenetic protein 2 (BMP-2) were tested using enzyme-linked immunosorbent assay. Aggrecan and type II collagen levels were measured by immunohistological staining. Further examination of the gene expression of aggrecan, Sox6, and MMP3 was performed after intervention with naringin for 3 days.<h4>Results</h4>The human NP cells were successfully propagated in culture and stained positive with toluidine blue staining. Naringin effectively enhanced the cell proliferation at an optimal concentration of 20 µg/mL. Naringin treatment resulted in significant inhibition of TNF-α, but elevated protein expressions of BMP-2, collagen II, and aggrecan. Naringin also increased disc matrix gene activity including aggrecan and Sox6, and decreased the gene expression of MMP3.<h4>Conclusion</h4>Naringin effectively promotes the proliferation of degenerative human NP cells and improves the recuperation of the cells from degeneration by increasing expression of aggrecan, BMP-2, and Sox6 while inhibiting the expression of TNF-α and MMP3. This study suggests that naringin may represent an alternative therapeutic agent for disc degeneration.
Also flagged:serotonin transportersdevelopmental delayserotonin transporterneuropsychiatric disordersbehavioralfluoxetine
Journal Article2016-05-18✓ 5 SnippetsKroeze Y, Dirven B, Janssen S, Kröhnke M, Barte RM, Middelman A, van Bokhoven H, Zhou H, Homberg JR.
In-Text Gene Mentions
Abstract)
…We observed that both pharmacological and genetic inactivation of 5-HTT resulted in a developmental delay.…
Abstract)
…in serotonin transporter (5-HTT) function in early-life…
Abstract)
…effects of reduced5-HTTfunction on behavior…
Abstract)
…inactivation of the5-HTTaffects behavior across…
Abstract)
…vehicle and in5-HTT(-/-) versus 5-HTT(+/+) rats.…
Show Full Abstract
While there is strong evidence from rodent and human studies that a reduction in serotonin transporter (5-HTT) function in early-life can increase the risk for several neuropsychiatric disorders in adulthood, the effects of reduced 5-HTT function on behavior across developmental stages are underinvestigated. To elucidate how perinatal pharmacological and lifelong genetic inactivation of the 5-HTT affects behavior across development, we conducted a battery of behavioral tests in rats perinatally exposed to fluoxetine or vehicle and in 5-HTT(-/-) versus 5-HTT(+/+) rats. We measured motor-related behavior, olfactory function, grooming behavior, sensorimotor gating, object directed behavior and novel object recognition in the first three postnatal weeks and if possible the tests were repeated in adolescence and adulthood. We also measured developmental milestones such as eye opening, reflex development and body weight. We observed that both pharmacological and genetic inactivation of 5-HTT resulted in a developmental delay. Except for hypo-locomotion, most of the observed early-life effects were normalized later in life. In adolescence and adulthood we observed object directed behavior and decreased novel object recognition in the 5-HTT(-/-) rats, which might be related to the lifelong inactivation of 5-HTT. Together, these data provide an important contribution to the understanding of the effects of perinatal and lifelong 5-HTT inactivation on behavior across developmental stages.
MicroRNAs (miRNAs) are non-coding RNAs that play essential roles in modulating the gene expression in almost all biological events. In the past decade, the involvement of miRNAs in various cardiovascular disorders has been explored in numerous in vitro and in vivo studies. In this paper, studies focused upon the discovery of miRNAs, their target genes, and functionality are reviewed. The selected miRNAs discussed herein have regulatory effects on target gene expression as demonstrated by miRNA/3' end untranslated region (3'UTR) interaction assay and/or gain/loss-of-function approaches. The listed miRNA entities are categorized according to the biological relevance of their target genes in relation to three cardiovascular pathologies, namely cardiac hypertrophy, fibrosis, and apoptosis. Furthermore, comparison across 86 studies identified several candidate miRNAs that might be of particular importance in the ontogenesis of cardiovascular diseases as they modulate the expression of clusters of target genes involved in the progression of multiple adverse cardiovascular events. This review illustrates the involvement of miRNAs in diverse biological signaling pathways and provides an overview of current understanding of, and progress of research into, of the roles of miRNAs in cardiovascular health and disease.
Also flagged:coronary heart diseaseidiopathic pulmonary arterial hypertensionIPAHpulmonary heart diseasecirculatory system diseasesGlycosphingolipid
Journal Article2016-05-18No SnippetsYuan Y, Zhang Y, Zhang X, Yu Y, Li B, Wang P, Li H, Zhao Y, Shen C, Wang Z.
Show Full Abstract
Coronary heart disease (CHD), idiopathic pulmonary arterial hypertension (IPAH) and pulmonary heart disease (PHD) are circulatory system diseases that may simultaneously emerge in a patient and they are often treated together in clinical practice. However, the molecular mechanisms connecting these three diseases remain unclear. In order to determine the multidimensional characteristic correlations between these three diseases based on genomic networks to aid in medical decision-making, genes from the Online Mendelian Inheritance in Man database were obtained, and applied network construction and modularized analysis were conducted. Functional enrichment analysis was conducted to explore the associations between overlapping genes, modules and pathways. A total of 29 overlapping genes and 3 common modules were identifed for the 3 diseases. Glycosphingolipid biosynthesis and the arachidonic acid metabolism are common pathways, and the biosynthetic process is suggested to be the major function involved in the three diseases. The current study reported, to the best of our knowledge for the first time, the role of glycosphingolipid biosynthesis in IPAH and PHD. The present study provided an improved understanding of the pathological mechanisms underlying CHD, IPAH and PHD. The overlapping genes, modules and pathways suggest novel areas for further research, and drug targets. The observations of the current study additionally suggest that drug indications can be broadened because of the presence of common targets.
Loss of functional retinal ganglion cells (RGC) is an element of retinal degeneration that is poorly understood. This is in part due to the lack of a reliable and validated protocol for the isolation of primary RGCs. Here we optimize a feasible, reproducible, standardized flow cytometry-based protocol for the isolation and enrichment of homogeneous RGC with the Thy1.2(hi)CD48(neg)CD15(neg)CD57(neg) surface phenotype. A three-step validation process was performed by: (1) genomic profiling of 25-genes associated with retinal cells; (2) intracellular labeling of homogeneous sorted cells for the intracellular RGC-markers SNCG, brain-specific homeobox/POU domain protein 3A (BRN3A), TUJ1, and RNA-binding protein with multiple splicing (RBPMS); and (3) by applying the methodology on RGC from a mouse model with elevated intraocular pressure (IOP) and optic nerve damage. Use of primary RGC cultures will allow for future careful assessment of important cell specific pathways in RGC to provide mechanistic insights into the declining of visual acuity in aged populations and those suffering from retinal neurodegenerative diseases.
…Relative quantities were normalized using the geometric mean of genes CMTM6 ,MRPL39, and ERC1 ( Naeem et al., 2012 ; Minuti et al., 2015 ).…
Show Full Abstract
Subacute ruminal acidosis (SARA) negatively impacts the dairy industry by decreasing dry matter intake, milk production, profitability, and increasing culling rate and death loss. Six ruminally cannulated, lactating Holstein cows were used in a replicated incomplete Latin square design to determine the effects of SARA induction on the ruminal microbiome and epithelium. Experimental periods were 10 days with days 1-3 for ad libitum intake of control diet, followed by 50% feed restriction on day 4, and ad libitum access on day 5 to the basal diet or the basal diet with an additional 10% of a 50:50 wheat/barley pellet. Based on subsequent ruminal pH, cows were grouped (SARA grouping; SG) as Non-SARA or SARA based on time <5.6 pH (0 and 3.4 h, respectively). Ruminal samples were collected on days 1 and 6 of each period prior to feeding and separated into liquid and solid fractions. Microbial DNA was extracted for bacterial analysis using 16S rRNA gene paired-end sequencing on the MiSeq Illumina platform and quantitative PCR (qPCR). Ruminal epithelium biopsies were taken on days 1 and 6 before feeding. Quantitative RT-PCR was used to determine gene expression in rumen epithelium. Bray-Curtis similarity indicated samples within the liquid fraction separated by day and coincided with an increased relative abundance of genera Prevotella, Ruminococcus, Streptococcus, and Lactobacillus on day 6 (P < 0.06). Although Firmicutes was the predominant phyla in the solid fraction, a SG × day interaction (P < 0.01) indicated a decrease on day 6 for SARA cows. In contrast, phylum Bacteroidetes increased on day 6 (P < 0.01) for SARA cows driven by greater genera Prevotella and YRC22 (P < 0.01). Streptococcus bovis and Succinivibrio dextrinosolvens populations tended to increase on day 6 but were not affected by SG. In ruminal epithelium, CLDN1 and CLDN4 expression increased on day 6 (P < 0.03) 24 h after SARA induction and a tendency for a SG × day interaction (P < 0.10) was observed for CLDN4. Overall, results indicate more rapid adaptation to an induced bout of SARA in the solid fraction ruminal microbiome compared with ruminal epithelium.
Autism spectrum disorders (ASD) is characterized by three core symptoms with impaired reciprocal social interaction and communication, a pattern of repetitive behavior and/or restricted interests in early childhood. The prevalence is higher in male children than in female children. As a complex neurodevelopmental disorder, the phenotype and severity of autism are extremely heterogeneous with differences from one patient to another. Genetics has a key role in the etiology of autism. Environmental factors are also interacting with the genetic profile and cause abnormal changes in neuronal development, brain growth, and functional connectivity. The term of exome represents less than 1% of the human genome, but contains 85% of known disease-causing variants. Whole-exome sequencing (WES) is an application of the next generation sequencing technology to determine the variations of all coding regions, or exons of known genes. For this reason, WES has been extensively used for clinical studies in the recent years. WES has achieved great success in the past years for identifying Mendelian disease genes. This review evaluates the potential of current findings in ASD for application in next generation sequencing technology, particularly WES. WES and whole-genome sequencing (WGS) approaches may lead to the discovery of underlying genetic factors for ASD and may thereby identify novel therapeutic targets for this disorder.
Also flagged:CDKAL1diabetic retinopathytype 2 diabetes mellitusdiabetesinsulinsecretion
Journal Article2016-05-18✓ 1 SnippetLiu NJ, Xiong Q, Wu HH, Li YL, Yang Z, Tao XM, Du YP, Lu B, Hu RM, Wang XC, Wen J.
In-Text Gene Mentions
Text
…CDK5RAP1…
Show Full Abstract
<h4>Aim</h4>To identify the contribution of CDKAL1 to the development of diabetic retinopathy (DR) in Chinese population.<h4>Methods</h4>A case-control study was performed to investigate the genetic association between DR and polymorphic variants of CDKAL1 in Chinese Han population with type 2 diabetes mellitus (T2DM). A well-defined population with T2DM, consisting of 475 controls and 105 DR patients, was recruited. All subjects were genotyped for the genetic variant (rs10946398) of CDKAL1. Genotyping was performed by iPLEX technology. The association between rs10946398 and T2DM was assessed by univariate and multivariate logistic regression (MLR) analysis.<h4>Results</h4>There were significant differences in C allele frequencies of rs10946398 (CDKAL1) between control and DR groups (45.06% versus 55.00%, P<0.05). The rs10946398 of CDKAL1 was found to be associated with the increased risk of DR among patients with diabetes.<h4>Conclusion</h4>Our findings suggest that rs10946398 of CDKAL1 is independently associated with DR in a Chinese Han population.
Also flagged:antibodyimmune responsestype 2 cytokineCytokineIL-1localization
Journal Article2016-05-18✓ 1 SnippetKobayashi T, Iijima K, Dent AL, Kita H.
In-Text Gene Mentions
Text
…Tnfsf4…
Show Full Abstract
<h4>Background</h4>T<sub>H</sub>2 cells have long been believed to play a pivotal role in allergic immune responses, including IgE antibody production and type 2 cytokine-mediated inflammation and pathology. A new T-cell subset, follicular helper T (T<sub>FH</sub>) cells, is specialized in supporting B-cell maturation and antibody production.<h4>Objective</h4>We sought to investigate the roles of T<sub>FH</sub> cells in allergic immune responses.<h4>Methods</h4>Naive mice were exposed to cytokines or natural allergens through the airways. Development of allergic immune responses was analyzed by collecting draining lymph nodes and sera and by challenging the animals. Cytokine reporter mice and gene-deficient mice were used to dissect the immunologic mechanisms.<h4>Results</h4>We observed the development of IL-4-producing T<sub>FH</sub> cells and T<sub>H</sub>2 cells in draining lymph nodes after airway exposure to IL-1 family cytokines or natural allergens. T<sub>FH</sub> and T<sub>H</sub>2 cells demonstrated unique phenotypes, tissue localization, and cytokine responses. T<sub>FH</sub> cells supported the sustained production of IgE antibody in vivo in the absence of other T-cell subsets or even when T<sub>H</sub>2 cell functions were severely compromised. Conversely, conditional deficiency of the master regulator Bcl6 in CD4<sup>+</sup> T cells resulted in a marked reduction in T<sub>FH</sub> cell numbers and IgE antibody levels, but type 2 cytokine responses and eosinophilic inflammation in the airways remained unaffected.<h4>Conclusion</h4>T<sub>FH</sub> cells play critical roles in the regulation of IgE antibody production. Allergic immune responses to airborne allergens likely involve 2 distinct subsets of IL-4-producing CD4<sup>+</sup> T cells, namely T<sub>FH</sub> and Th2 cells.
Also flagged:depressiondepressive disordersdepressive disordermineralchronic debilitating diseaseMajor depressive disorder
Journal Article2016-05-18No SnippetsSchweiger JU, Schweiger U, Hüppe M, Kahl KG, Greggersen W, Fassbinder E.
Show Full Abstract
<h4>Background</h4>The aim of this study was to evaluate the evidence of low bone mineral density (BMD) in depression. Low BMD is a major risk factor for osteoporotic fractures and frailty.<h4>Methods</h4>The searched database was Pubmed, Meta-analysis included human studies in men and women fulfilling the following criteria: (1) assessment of BMD in the lumbar spine, the femur or the total hip; (2) comparison of BMD between depressed individuals and the healthy control group; (3) measurement of BMD using dual-energy X-ray absorptiometry (DEXA); and (4) data on the mean, standard deviation, or standard error of BMD.<h4>Results</h4>Twenty-one studies were identified, encompassing 1842 depressed and 17,401 nondepressed individuals. Significant negative composite weighted mean effect sizes were identified for the lumbar spine (d = -0.15, 95%CL -0.22 to -0.08), femur (d = -0.34, 95%CL -0.64 to -0.05), and total hip (d = -0.14, 95%CL -0.23 to -0.05) indicating low BMD in depression. Examining men and women shows low bone density in the lumbar spine and femur in women and low bone density in the hip in men. The differences between men and women with MDD and the comparison group tended to be higher when examined by expert interviewers. Low bone density was found in all age groups.<h4>Conclusions</h4>Bone mineral density is reduced in patients with depressive disorders. The studies provide little evidence for potential relevant mediating factors.
Also flagged:cirrhosisliver cirrhosisBacterial PeritonitisSpontaneousalbuminliver fibrosis
Journal Article2016-05-17✓ 1 SnippetFernandes SR, Santos P, Fatela N, Baldaia C, Tato Marinho R, Proença H, Ramalho F, Velosa J.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>Spontaneous bacterial peritonitis (SBP) is a known complication of advanced cirrhosis and presents a high mortality rate. A polymorphonuclear (PMN) cell count >250/μl in the ascitic fluid is the current gold standard for diagnosing SBP.<h4>Aim</h4>We evaluated the accuracy of a point-of-care test (POCT) for ascitic calprotectin in diagnosing patients with SBP.<h4>Methods</h4>Eighty-eight patients admitted with decompensation of liver cirrhosis were studied including 41 patients (46.6%) with SBP. Ascitic calprotectin was measured using a quantitative POCT developed by Bühlmann<sup>®</sup> .<h4>Results</h4>Calprotectin levels correlated with PMN cell count and other inflammatory markers and were significantly higher in patients with SBP. An optimal cutoff of calprotectin above 1.57 μg/ml presented high sensitivity (87.8%), specificity (97.9%), and positive (97.3%) and negative (90.2%) predictive values for diagnosing SBP. Using calprotectin selectively in patients with a serum albumin-ascites gradient above 11 g/l further increased the sensitivity and negative predictive values of the test.<h4>Conclusion</h4>Ascitic calprotectin appears to be a reliable method for diagnosing SBP in patients with liver cirrhosis. It may present an alternative to other conventional diagnostic methods.
Also flagged:rheumatoid factorRFchemokinenuclear factor-kappa BNF-κBtumor necrosis factor
Journal Article2016-05-17No SnippetsShi H, Cao N, Pu Y, Xie L, Zheng L, Yu C.
Show Full Abstract
<h4>Background</h4>To examine the roles of long noncoding RNAs (lncRNAs) in the regulation of primary Sjögren's syndrome (pSS) and reveal the expression profile of lncRNAs in labial salivary glands (LSGs) in pSS patients.<h4>Method</h4>The expression of 63,431 lncRNAs and 39,887 mRNAs were determined in the LSG of four pSS patients and four healthy controls using microarray experiments. Validation was performed in 30 pSS patients and 16 controls using real-time PCR. LncRNA-mRNA co-expression and gene-pathway networks were constructed using bioinformatics software.<h4>Result</h4>A total of 1243 lncRNAs (upregulated: 890, downregulated: 353) and 1457 mRNAs (upregulated: 1141, downregulated: 316) were differentially expressed in the LSGs of pSS patients (fold change >2, P <0.05). Eight of these lncRNAs were validated using real-time PCR. ENST00000420219.1 (3.13-fold), ENST00000455309.1 (2.51-fold), n336161 (2.45-fold), NR_002712 (2.41-fold), ENST00000546086.1 (1.94-fold), Lnc-UTS2D-1:1 (1.79-fold), n340599 (1.69-fold), and TCONS_l2_00014794 (1.28-fold) were significantly upregulated in pSS. There were strong correlations between these lncRNAs and β2 microglobulin, disease course, erythrocyte sedimentation rate (ESR), rheumatoid factor (RF), IgA, IgM, visual analogue scale (VAS) of parotid swelling and VAS of dry eyes. Computational analyses revealed that 28 of the differentially expressed (DE) mRNAs were associated with eight DE lncRNAs involved in chemokine signaling pathways, the nuclear factor-kappa B (NF-κB) signaling pathway, and tumor necrosis factor (TNF) signaling pathway.<h4>Conclusions</h4>Our study revealed the expression profile of lncRNAs in LSGs of pSS patients. Many novel lncRNA transcripts that play important roles in the pathogenesis of pSS were dysregulated in pSS. Therefore, this study will aid in the development of new diagnostic biomarkers and drug therapies.
Also flagged:histone deacetylasevalproic acidthalidomidestem cell developmentHDACisreproduction
Journal Article2016-05-17✓ 3 SnippetsShinde V, Hoelting L, Srinivasan SP, Meisig J, Meganathan K, Jagtap S, Grinberg M, Liebing J, Bluethgen N, Rahnenführer J, Rempel E, Stoeber R, Schildknecht S, Förster S, Godoy P, van Thriel C, Gaspar JA, Hescheler J, Waldmann T, Hengstler JG, Leist M, Sachinidis A.
In-Text Gene Mentions
Discussion)
…mercurial consensus genesSOX6and THBS1 are…
Discussion)
…SOX6was found to…
Discussion)
…study, and aSOX6mouse knockout showed…
Show Full Abstract
Stem cell-based in vitro test systems can recapitulate specific phases of human development. In the UKK test system, human pluripotent stem cells (hPSCs) randomly differentiate into cells of the three germ layers and their derivatives. In the UKN1 test system, hPSCs differentiate into early neural precursor cells. During the normal differentiation period (14 days) of the UKK system, 570 genes [849 probe sets (PSs)] were regulated >fivefold; in the UKN1 system (6 days), 879 genes (1238 PSs) were regulated. We refer to these genes as 'developmental genes'. In the present study, we used genome-wide expression data of 12 test substances in the UKK and UKN1 test systems to understand the basic principles of how chemicals interfere with the spontaneous transcriptional development in both test systems. The set of test compounds included six histone deacetylase inhibitors (HDACis), six mercury-containing compounds ('mercurials') and thalidomide. All compounds were tested at the maximum non-cytotoxic concentration, while valproic acid and thalidomide were additionally tested over a wide range of concentrations. In total, 242 genes (252 PSs) in the UKK test system and 793 genes (1092 PSs) in the UKN1 test system were deregulated by the 12 test compounds. We identified sets of 'diagnostic genes' appropriate for the identification of the influence of HDACis or mercurials. Test compounds that interfered with the expression of developmental genes usually antagonized their spontaneous development, meaning that up-regulated developmental genes were suppressed and developmental genes whose expression normally decreases were induced. The fraction of compromised developmental genes varied widely between the test compounds, and it reached up to 60 %. To quantitatively describe disturbed development on a genome-wide basis, we recommend a concept of two indices, 'developmental potency' (D <sub>p</sub>) and 'developmental index' (D <sub>i</sub>), whereby D <sub>p</sub> is the fraction of all developmental genes that are up- or down-regulated by a test compound, and D <sub>i</sub> is the ratio of overrepresentation of developmental genes among all genes deregulated by a test compound. The use of D <sub>i</sub> makes hazard identification more sensitive because some compounds compromise the expression of only a relatively small number of genes but have a high propensity to deregulate developmental genes specifically, resulting in a low D <sub>p</sub> but a high D <sub>i</sub>. In conclusion, the concept based on the indices D <sub>p</sub> and D <sub>i</sub> offers the possibility to quantitatively express the propensity of test compounds to interfere with normal development.
Also flagged:aryl hydrocarbon receptor 2AHR1dioxinsaryl hydrocarbon receptorAHRluciferase
Journal Article2016-05-17No SnippetsBak SM, Iida M, Soshilov AA, Denison MS, Iwata H, Kim EY.
Show Full Abstract
The toxic effects of dioxins and related compounds (DRCs) are mediated by the aryl hydrocarbon receptor (AHR). Our previous study identified AHR1 and AHR2 genes from the red seabream (Pagrus major). Moreover, we found that AHR2 mRNA levels were notably elevated by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) exposure in the early life stage of red seabream embryos, while AHR1 mRNA level was not altered. In this study, to investigate the regulatory mechanism of these AHR transcripts, we cloned and characterized 5'-flanking regions of AHR1 and AHR2 genes. Both of the 5'-flanking regions in these AHR genes contained three potential xenobiotic-responsive elements (XREs). To assess whether the 5'-flanking region is transactivated by rsAHR1 and rsAHR2 proteins, we measured the transactivation potency of the luciferase reporter plasmids containing the 5'-flanking regions by AHR1 and AHR2 proteins that were transiently co-expressed in COS-7. Only reporter plasmid (pGL4-rsAHR2-3XREs) that contained three putative XRE sites in the 5'-flanking region of AHR2 gene showed a clear TCDD dose-dependent transactivation by AHR1 and AHR2 proteins. TCDD-EC<sub>50</sub> values for the rsAHR2-derived XRE transactivation were 1.3 and 1.4 nM for AHR1 and AHR2, respectively. These results suggest that the putative XREs of AHR2 gene have a function for AHR1- and AHR2-mediated transactivation, supporting our in ovo observation of an induction of AHR2 mRNA levels by TCDD exposure. Mutations in XREs of AHR2 gene led to a decrease in luciferase induction. Electrophoretic mobility shift assay showed that XRE1, the closest XRE from the start codon in AHR2 gene, is mainly responsible for the binding with TCDD-activated AHR. This suggests that TCDD-activated AHR1 and AHR2 up-regulate the AHR2 mRNA levels and this auto-induced AHR2 may amplify the signal transduction of its downstream targets including CYP1A in the red seabream.
Also flagged:Matrinealkaloidliver fibrosisradiation sicknessGene expressioncancer
Journal Article2016-05-17✓ 2 SnippetsLi J, Xu J, Lu Y, Qiu L, Xu W, Lu B, Hu Z, Chu Z, Chai Y, Zhang J.
In-Text Gene Mentions
Methods)
…Cacna1e( NM_019294 ):…
Results)
…alpha 1E subunit (Cacna1e), calcium channel, voltage-de…
Show Full Abstract
Matrine is an alkaloid extracted from Sophora flavescens Ait and has many biological activities, such as anti-inflammatory, antitumor, anti-fibrosis, and immunosuppressive properties. In our previous studies, the matrine derivative MASM was synthesized and exhibited potent inhibitory activity against liver fibrosis. In this study, we mainly investigated its protection against lethal total-body irradiation (TBI) in rats. Administration of MASM reduced the radiation sickness characteristics and increased the 30-day survival of rats before or after lethal TBI. Ultrastructural observation illustrated that pretreatment of rats with MASM significantly attenuated the TBI-induced morphological changes in the different organs of irradiated rats. Gene expression profiles revealed that pretreatment with MASM had a dramatic effect on gene expression changes caused by TBI. Pretreatment with MASM prevented differential expression of 53% (765 genes) of 1445 differentially expressed genes induced by TBI. Pathway enrichment analysis indicated that these genes were mainly involved in a total of 21 pathways, such as metabolic pathways, pathways in cancer, and mitogen-activated protein kinase (MAPK) pathways. Our data indicated that pretreatment of rats with MASM modulated these pathways induced by TBI, suggesting that the pretreatment with MASM might provide the protective effects on lethal TBI mainly or partially through the modulation of these pathways, such as multiple MAPK pathways. Therefore, MASM has the potential to be used as an effective therapeutic or radioprotective agent to minimize irradiation damages and in combination with radiotherapy to improve the efficacy of cancer therapy.
Also flagged:dimethylsulfatehydroxylamino acidribosomesprotein synthesis
Journal Article2016-05-17No SnippetsLi R, Zhu H, Luo Y.
Show Full Abstract
Although thousands of long non-coding RNAs (lncRNAs) have been discovered in eukaryotes, very few molecular mechanisms have been characterized due to an insufficient understanding of lncRNA structure. Therefore, investigations of lncRNA structure and subsequent elucidation of the regulatory mechanisms are urgently needed. However, since lncRNA are high molecular weight molecules, which makes their crystallization difficult, obtaining information about their structure is extremely challenging, and the structures of only several lncRNAs have been determined so far. Here, we review the structure-function relationships of the widely studied lncRNAs found in the animal and plant kingdoms, focusing on the principles and applications of both in vitro and in vivo technologies for the study of RNA structures, including dimethyl sulfate-sequencing (DMS-seq), selective 2'-hydroxyl acylation analyzed by primer extension-sequencing (SHAPE-seq), parallel analysis of RNA structure (PARS), and fragmentation sequencing (FragSeq). The aim of this review is to provide a better understanding of lncRNA biological functions by studying them at the structural level.
Also flagged:proteasomeamino aciddegradationpeptidesmajor histocompatibility complexMHC
Journal Article2016-05-17✓ 1 SnippetYu H, Singh Gautam AK, Wilmington SR, Wylie D, Martinez-Fonts K, Kago G, Warburton M, Chavali S, Inobe T, Finkelstein IJ, Babu MM, Matouschek A.
In-Text Gene Mentions
Discussion)
…For example, the protein linked to Huntington disease (HTT exon1) is rich in proline and glutamine residues.…
Show Full Abstract
The proteasome has pronounced preferences for the amino acid sequence of its substrates at the site where it initiates degradation. Here, we report that modulating these sequences can tune the steady-state abundance of proteins over 2 orders of magnitude in cells. This is the same dynamic range as seen for inducing ubiquitination through a classic N-end rule degron. The stability and abundance of His3 constructs dictated by the initiation site affect survival of yeast cells and show that variation in proteasomal initiation can affect fitness. The proteasome's sequence preferences are linked directly to the affinity of the initiation sites to their receptor on the proteasome and are conserved between Saccharomyces cerevisiae, Schizosaccharomyces pombe, and human cells. These findings establish that the sequence composition of unstructured initiation sites influences protein abundance in vivo in an evolutionarily conserved manner and can affect phenotype and fitness.
Also flagged:AgingCognitiongene expressioncognitive declinetranscription factorsimmediate-early
Journal Article2016-05-17No SnippetsIanov L, Rani A, Beas BS, Kumar A, Foster TC.
Show Full Abstract
Cognitive function depends on transcription; however, there is little information linking altered gene expression to impaired prefrontal cortex function during aging. Young and aged F344 rats were characterized on attentional set shift and spatial memory tasks. Transcriptional differences associated with age and cognition were examined using RNA sequencing to construct transcriptomic profiles for the medial prefrontal cortex (mPFC), white matter, and region CA1 of the hippocampus. The results indicate regional differences in vulnerability to aging. Age-related gene expression in the mPFC was similar to, though less robust than, changes in the dorsolateral PFC of aging humans suggesting that aging processes may be similar. Importantly, the pattern of transcription associated with aging did not predict cognitive decline. Rather, increased mPFC expression of genes involved in regulation of transcription, including transcription factors that regulate the strength of excitatory and inhibitory inputs, and neural activity-related immediate-early genes was observed in aged animals that exhibit delayed set shift behavior. The specificity of impairment on a mPFC-dependent task, associated with a particular mPFC transcriptional profile indicates that impaired executive function involves altered transcriptional regulation and neural activity/plasticity processes that are distinct from that described for impaired hippocampal function.
Also flagged:hypophosphatasiasystemic bone diseaseHPPodontohypophosphatasiaALPLtissue-nonspecific alkaline phosphatase
Journal Article2016-05-17✓ 1 SnippetOrimo H.
In-Text Gene Mentions
S I O 001029)
…Matrix vesicles are membrane-invested vesicles of 50–200 nm in diameter and are rich in annexins A2, A5, and A6, and in Ca2+-ATPase, TNAP, nucleotide pyrophosphate phosphodiesterase 1 (NPP1, formerly known as PC-1), Pit1 (a sodium–phosphate [Na/Pi] cotransporter), and PHOSPHO1.28 The first step of the mineralization process occurs within the matrix vesicles, in which hydroxyapatite (Ca10(PO4)6(OH)2) crystals are formed.28 Phosphate is derived from membrane phospholipids, which are hydrolyzed by phospholipase C to produce phosphocholine and phosphoethanolamine.29 These phosphocompounds are hydrolyzed by PHOSPHO1, a cytosolic phosphatase that is abundant in the matrix vesicles, to yield inorganic phosphate (Pi).30,31 Another source of Pi in the matrix vesicles is Pi that is transported through the Na/Pi cotransporter Pit1 that is also abundant on the matrix vesicle membrane.28 Calcium is incorporated into the matrix vesicles through annexin Ca2+ channels that consist of annexins A2, A5, and A6.28 Developing hydroxyapatite crystals then penetrate the matrix vesicle membrane, are elongated in the extracellular space, and eventually deposit in the spaces between collagen fibrils to complete extracellular matrix mineralization.28 The concentration ratio of Pi to inorganic pyrophosphate (PPi) in the extracellular matrix is crucial in the second step of mineralization because PPi is an inhibitor of hydroxyapatite formation.32 Two mechanisms are used for PPi formation.27,33 PPi is formed in the extracellular matrix from ATP by the matrix vesicle membrane enzyme NPP1.34 PPi is also provided through the PPi transporter ANKH (a homologue of the mouse progressive ankylosis gene product) from the cytoplasm, in which PPi is routinely formed by cellular metabolism.35 ANKH is distributed on the plasma membrane of hypertrophic chondrocytes and osteoblasts.35 TNAP on the membrane of the matrix vesicles hydrolyzes PPi and yields Pi, thereby reducing the levels of the PPi inhibitor and promoting hydroxyapatite formation.…
Show Full Abstract
Hypophosphatasia (HPP) is an inherited systemic bone disease that is characterized by bone hypomineralization. HPP is classified into six forms according to the age of onset and severity as perinatal (lethal), perinatal benign, infantile, childhood, adult, and odontohypophosphatasia. The causative gene of the disease is the ALPL gene that encodes tissue-nonspecific alkaline phosphatase (TNAP). TNAP is expressed ubiquitously, and its physiological role is apparent in bone mineralization. A defect in bone mineralization can manifest in several ways, including rickets or osteomalacia in HPP patients. Patients with severe forms suffer from respiratory failure because of hypoplastic chest, which is the main cause of death. They sometimes present with seizures due to a defect in vitamin B6 metabolism resulting from the lack of alkaline phosphatase activity in neuronal cells, which is also lethal. Patients with a mild form of the disease exhibit rickets or osteomalacia and a functional defect of exercise. Odontohypophosphatasia shows only dental manifestations. To date, 302 mutations in the ALPL gene have been reported, mainly single-nucleotide substitutions, and the relationships between phenotype and genotype have been partially elucidated. An established treatment for HPP was not available until the recent development of enzyme replacement therapy. The first successful enzyme replacement therapy in model mice using a modified human TNAP protein (asfotase alfa) was reported in 2008, and subsequently success in patients with severe form of the disease was reported in 2012. In 2015, asfotase alfa was approved in Japan in July, followed by in the EU and Canada in August, and then by the US Food and Drug Administration in the USA in October. It is expected that therapy with asfotase alfa will drastically change treatments and prognosis of HPP.
Also flagged:Parkinson's Diseaseironoxygeniron-sulfurcluster
Journal Article2016-05-17✓ 1 SnippetMuñoz Y, Carrasco CM, Campos JD, Aguirre P, Núñez MT.
In-Text Gene Mentions
Methods)
…syndromes such ashemochromatosis, β -thalassemia, myelodysplas…
Show Full Abstract
Mitochondrial dysfunction, iron accumulation, and oxidative damage are conditions often found in damaged brain areas of Parkinson's disease. We propose that a causal link exists between these three events. Mitochondrial dysfunction results not only in increased reactive oxygen species production but also in decreased iron-sulfur cluster synthesis and unorthodox activation of Iron Regulatory Protein 1 (IRP1), a key regulator of cell iron homeostasis. In turn, IRP1 activation results in iron accumulation and hydroxyl radical-mediated damage. These three occurrences-mitochondrial dysfunction, iron accumulation, and oxidative damage-generate a positive feedback loop of increased iron accumulation and oxidative stress. Here, we review the evidence that points to a link between mitochondrial dysfunction and iron accumulation as early events in the development of sporadic and genetic cases of Parkinson's disease. Finally, an attempt is done to contextualize the possible relationship between mitochondria dysfunction and iron dyshomeostasis. Based on published evidence, we propose that iron chelation-by decreasing iron-associated oxidative damage and by inducing cell survival and cell-rescue pathways-is a viable therapy for retarding this cycle.
Antithrombin (AT) is a glycoprotein that inactivates the several physiological target enzymes of coagulation system. The effect of purification strategies plays a crucial role in getting maximum recovery of yield, purity and biological activity of recombinant human antithrombin (rhAT). In the present work, the task of purifying rhAT from Saccharomyces cerevisiae BY4741 has been carried out using two different approaches such as cross flow filtration (CFF) system and chromatography methods. In the first approach, the protein was concentrated and partially purified through CFF to achieve maximum recovery yield and purity of 87 and 94 %, respectively. In the second approach, purification involved a single step chromatography with various types of ion exchange and size exclusion resins to analyze the maximum rhAT recovery yield and purity. From the experimental results, it has been observed that the size exclusion chromatography (SEC) technique with Superose 12 matrix was suitable for the purification of rhAT and achieved the maximum recovery yield and purity of 51 and 97 %, respectively. Further, to acquire a high recovery yield and purity of rhAT, the effect of various chromatographic conditions such as mobile phase, mobile phase pH, flow rate, sample volume and sample concentration were also investigated. Under the optimal chromatographic conditions, rhAT was significantly recovered and purified in a single step with maximum recovery yield, purity and biological activity of 67, 99 % and 410 IU/L, respectively. Based on these investigations, it was concluded that SEC with Superose 12 matrix was a more suitable and a potential method for the purification of rhAT.
Also flagged:CirculationHDnitric oxideendothelial dysfunctionvasodilationwater
Journal Article2016-05-16✓ 1 SnippetKane AD, Niu Y, Herrera EA, Morton AJ, Giussani DA.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease (HD) is a progressive, devastating and currently incurable neurodegenerative genetic disorder caused by a mutation in the HTT gene that codes for huntingtin1.…
Show Full Abstract
Recent evidence shows that the Huntington's disease (HD) extends beyond the nervous system to other sites, including the cardiovascular system. Further, the cardiovascular pathology pre-dates neurological decline, however the mechanisms involved remain unclear. We investigated in the R6/2 mouse model of HD nitric oxide (NO) dependent and independent endothelial mechanisms. Femoral artery reactivity was determined by wire myography in wild type (WT) and R6/2 mice at 12 and 16 weeks of adulthood. WT mice showed increased endothelial relaxation between 12 and 16 weeks (Rmax: 72 ± 7% vs. 97 ± 13%, P < 0.05). In contrast, R6/2 mice showed enhanced endothelial relaxation already by 12 weeks (Rmax at 12w: 72 ± 7% vs. 94 ± 5%, WT vs. R6/2, P < 0.05) that declined by 16 weeks compared with WT mice (Rmax at 16w: 97 ± 13% vs. 68 ± 7%, WT vs. R6/2, P < 0.05). In WT mice, the increase in femoral relaxation between 12 and 16 weeks was due to enhanced NO dependent mechanisms. By 16 weeks of adult age, the R6/2 mouse developed overt endothelial dysfunction due to an inability to increase NO dependent vasodilation. The data add to the growing literature of non-neural manifestations of HD and implicate NO depletion as a key mechanism underlying the HD pathophysiology in the peripheral vasculature.
Also flagged:pentachlorophenolfertilizationPCPmetabolismtransportersorganogenesis
Journal Article2016-05-16No SnippetsXu T, Zhao J, Xu Z, Pan R, Yin D.
Show Full Abstract
Pentachlorophenol (PCP) is a typical toxicant and prevailing pollutant whose toxicity has been broadly investigated. However, previous studies did not specifically investigate the underlying mechanisms of its developmental toxicity. Here, we chose zebrafish embryos as the model, exposed them to 2 different concentrations of PCP, and sequenced their entire transcriptomes at 10 and 24 hours post-fertilization (hpf). The sequencing analysis revealed that high concentrations of PCP elicited systematic responses at both time points. By combining the enrichment terms with single genes, the results were further analyzed using three categories: metabolism, transporters, and organogenesis. Hyperactive glycolysis was the most outstanding feature of the transcriptome at 10 hpf. The entire system seemed to be hypoxic, although hypoxia-inducible factor-1α (HIF1α) may have been suppressed by the upregulation of prolyl hydroxylase domain enzymes (PHDs). At 24 hpf, PCP primarily affected somitogenesis and lens formation probably resulting from the disruption of embryonic body plan at earlier stages. The proposed underlying toxicological mechanism of PCP was based on the crosstalk between each clue. Our study attempted to describe the developmental toxicity of environmental pollutants from a systematic view. Meanwhile, some features of gene expression profiling could serve as markers of human health or ecological risk.
Also flagged:Sick Sinus SyndromeDilated Cardiomyopathysinus node dysfunctionventricular arrhythmiacardiomyopathyheart failure
Journal Article2016-05-16No SnippetsZaragoza MV, Fung L, Jensen E, Oh F, Cung K, McCarthy LA, Tran CK, Hoang V, Hakim SA, Grosberg A.
Show Full Abstract
The goals are to understand the primary genetic mechanisms that cause Sick Sinus Syndrome and to identify potential modifiers that may result in intrafamilial variability within a multigenerational family. The proband is a 63-year-old male with a family history of individuals (>10) with sinus node dysfunction, ventricular arrhythmia, cardiomyopathy, heart failure, and sudden death. We used exome sequencing of a single individual to identify a novel LMNA mutation and demonstrated the importance of Sanger validation and family studies when evaluating candidates. After initial single-gene studies were negative, we conducted exome sequencing for the proband which produced 9 gigabases of sequencing data. Bioinformatics analysis showed 94% of the reads mapped to the reference and identified 128,563 unique variants with 108,795 (85%) located in 16,319 genes of 19,056 target genes. We discovered multiple variants in known arrhythmia, cardiomyopathy, or ion channel associated genes that may serve as potential modifiers in disease expression. To identify candidate mutations, we focused on ~2,000 variants located in 237 genes of 283 known arrhythmia, cardiomyopathy, or ion channel associated genes. We filtered the candidates to 41 variants in 33 genes using zygosity, protein impact, database searches, and clinical association. Only 21 of 41 (51%) variants were validated by Sanger sequencing. We selected nine confirmed variants with minor allele frequencies <1% for family studies. The results identified LMNA c.357-2A>G, a novel heterozygous splice-site mutation as the primary mutation with rare or novel variants in HCN4, MYBPC3, PKP4, TMPO, TTN, DMPK and KCNJ10 as potential modifiers and a mechanism consistent with haploinsufficiency.
Also flagged:H2BGFPDlx1Slc1a3tissue homeostasisα6-integrin
Journal Article2016-05-16✓ 1 SnippetSada A, Jacob F, Leung E, Wang S, White BS, Shalloway D, Tumbar T.
In-Text Gene Mentions
Methods)
…CTGGG and GCTGCCGCTTCATCTTTGC;Sox6GGTCATGTTTCCCACCCACAA and TTCA…
Show Full Abstract
The interfollicular epidermis regenerates from heterogeneous basal skin cell populations that divide at different rates. It has previously been presumed that infrequently dividing basal cells known as label-retaining cells (LRCs) are stem cells, whereas non-LRCs are short-lived progenitors. Here we employ the H2B-GFP pulse-chase system in adult mouse skin and find that epidermal LRCs and non-LRCs are molecularly distinct and can be differentiated by Dlx1(CreER) and Slc1a3(CreER) genetic marking, respectively. Long-term lineage tracing and mathematical modelling of H2B-GFP dilution data show that LRCs and non-LRCs constitute two distinct stem cell populations with different patterns of proliferation, differentiation and upward cellular transport. During homeostasis, these populations are enriched in spatially distinct skin territories and can preferentially produce unique differentiated lineages. On wounding or selective killing, they can temporarily replenish each other's territory. These two discrete interfollicular stem cell populations are functionally interchangeable and intrinsically well adapted to thrive in distinct skin environments.
Also flagged:mineralparathyroid hormonefibroblast growth factor 23bone diseasecardiovascular diseaseosteoporosis
Journal Article2016-05-16No SnippetsHill Gallant KM, Weaver CM, Towler DA, Thuppal SV, Bailey RL.
Show Full Abstract
Bone and heart health are linked through a variety of cellular, endocrine, and metabolic mechanisms, including the bidirectional effects of mineral-regulating hormones parathyroid hormone and fibroblast growth factor 23. Nutrition plays an important role in the development of both cardiovascular and bone disease. This review describes current knowledge on the relations between the cardiovascular system and bone and the influence of key nutrients involved in mineral metabolism-calcium, vitamin D, and phosphorus-on heart and bone health, as well as the racial/ethnic differences in cardiovascular disease and osteoporosis and the influence that nutrition has on these disparities.
Also flagged:Ironanemiaerythropoiesis-stimulatinghemeleft ventricular hypertrophycongestive heart failure
Journal Article2016-05-16✓ 1 SnippetLocatelli F, Mazzaferro S, Yee J.
In-Text Gene Mentions
Text
…HFE…
Show Full Abstract
The clinical consequences of untreated, severe anemia in patients with nondialysis CKD can be significant, but disparities exist in the anemia treatment guidelines and position papers issued from working groups and associations across the world. These differ in hemoglobin target and iron levels and their emphasis on various iron markers and other clinical outcomes. Not surprisingly, disparities are observed in anemia treatment strategies among patients with nondialysis CKD across different areas of the world. Over the past decade, the prescription and dosage of both iron therapies and erythropoiesis-stimulating agents have shifted, with notable regional differences observed. Moreover, there is ongoing debate regarding oral versus intravenous administration of iron. Compared with oral iron therapy, which often leads to gastrointestinal adverse events, low patient adherence, and low efficacy, intravenous iron administration has been associated with potential serious adverse events, such as anaphylaxis. New iron-based compounds and drugs currently under development are reviewed to describe their potential benefits in the treatment of anemia in patients with CKD. New oral compounds, including iron-based phosphate binders, heme iron polypeptide, and liposomal iron, show different rates of absorption with possibly different efficacy and improved tolerability. These new potential therapies offer health care providers additional anemia treatment options for their patients with CKD; however, the management of anemia in the CKD population continues to present challenges that require prospective studies to identify the optimal iron therapy for patients.
Also flagged:BMPR-2ALK-1transforming growth factor betaserotonin transporterpulmonary hypertensionPH
Journal Article2016-05-16✓ 4 SnippetsAli Z, Waseem M, Kumar R, Pandey P, Mohammad G, Qadar Pasha MA.
In-Text Gene Mentions
Abstract)
…The genetic-interactions among BMPR-2, ALK-1, and 5-HTT polymorphisms, elevated BMP-2 and 5-HT levels and differential gene expression substantiated the strong genetic contribution in HAPE pathophysiology.…
Abstract)
…The latter being a phenotype for high altitude pulmonary edema (HAPE), these genes are hypothesized to be crucial markers to investigate under the hypobaric hypoxic environment of high altitude.<h4>Aims</h4>We hence aimed to investigate bone-morphogenetic protein-2 (BMP2), bone morphogenetic protein receptor type-II (BMPR-2), activin receptor-like kinase-1 (ALK-1), serotonin transporter (5-HTT) and serotonin (5-HT) for their contribution, individually/epistatically, to clinical endpoints by altering downstream signaling molecules.<h4>Methods and materials</h4>In a case-control design, interactions between/among polymorphisms of BMPR-2, ALK-1 and 5-HTT were screened in 200 HAPE-patients (HAPE-p) and 200 HAPE-free sojourners (HAPE-f).…
Abstract)
…LK-1), serotonin transporter (5-HTT) and serotonin (5-HT)…
Abstract)
…BMPR-2, ALK-1 and5-HTTwere screened in…
Show Full Abstract
<h4>Context</h4>Few potential candidate genes coding for type I and II receptors of transforming growth factor beta signaling pathway and the serotonin transporter have been associated with pulmonary hypertension (PH). The latter being a phenotype for high altitude pulmonary edema (HAPE), these genes are hypothesized to be crucial markers to investigate under the hypobaric hypoxic environment of high altitude.<h4>Aims</h4>We hence aimed to investigate bone-morphogenetic protein-2 (BMP2), bone morphogenetic protein receptor type-II (BMPR-2), activin receptor-like kinase-1 (ALK-1), serotonin transporter (5-HTT) and serotonin (5-HT) for their contribution, individually/epistatically, to clinical endpoints by altering downstream signaling molecules.<h4>Methods and materials</h4>In a case-control design, interactions between/among polymorphisms of BMPR-2, ALK-1 and 5-HTT were screened in 200 HAPE-patients (HAPE-p) and 200 HAPE-free sojourners (HAPE-f). Plasma biomarker BMP-2 and 5-HT were estimated. The relative gene expression was also witnessed in 20 humans/10 rats followed by correlation analyses.<h4>Results</h4>The genotype/allele models revealed the prevalence of BMPR-2 rs6717924A-rs4303700A-rs1048829A; ALK-1 rs11169953T-rs3759178C-rs706816C and 5-HTT rs6354C in HAPE (P≤0.05). Multifactor dimensionality reduction for interactions among genes revealed a 4-locus model of BMPR-2 rs6717924G/A; ALK-1 rs11169953C/T-rs706816T/C and 5-HTT rs6354A/C as the best disease predicting (P≤0.001); whereas HapEvolution analysis confirmed the alleles rs6717924A, rs4303700A and rs6354C as the best interacting (P≤0.01). Plasma levels of BMP-2 and 5-HT were elevated in HAPE (P≤0.0001). The expression of BMP-2, ALK-1, 5-HT, 5-HTT was elevated and of BMPR-2 decreased in humans and rats (P≤0.05). The risk alleles BMPR-2 rs6717924A-rs4303700G-rs1048829A; ALK-1 rs11169953T-rs706816C and 5-HTT rs6354C correlated inversely with arterial oxygen saturation (SaO2) and positively with mean arterial pressure (MAP), BMP-2 and 5-HT in HAPE. Likewise, haplotypes BMPR-2 GGGCGAAAA, AAATAGGGA and ALK-1 CCTCAAAG, CCTTAAAG correlated with clinical markers and biomarkers (P≤0.01). BMP-2 and 5-HT correlated positively with MAP and negatively with SaO2 (P≤0.01).<h4>Conclusions</h4>The genetic-interactions among BMPR-2, ALK-1, and 5-HTT polymorphisms, elevated BMP-2 and 5-HT levels and differential gene expression substantiated the strong genetic contribution in HAPE pathophysiology.
Also flagged:polysaccharideAKTHuntington's diseaseHDneurodegenerative diseasephosphorylation
Journal Article2016-05-16✓ 3 SnippetsFang F, Peng T, Yang S, Wang W, Zhang Y, Li H.
In-Text Gene Mentions
Abstract)
…Huntington's disease (HD) is an inherited neurodegenerative disease that is caused by the abnormal expansion of CAG repeats in the gene encoding huntingtin (Htt).…
Abstract)
…gene encoding huntingtin (Htt).…
Abstract)
…involved in mutantHtt(mHtt)-induced cell death.…
Show Full Abstract
Huntington's disease (HD) is an inherited neurodegenerative disease that is caused by the abnormal expansion of CAG repeats in the gene encoding huntingtin (Htt). Reduced AKT phosphorylation and inhibited AKT activity have been shown to be involved in mutant Htt (mHtt)-induced cell death. Lycium barbarum polysaccharide (LBP), the main bioactive component of Lycium barbarum, reportedly has neuroprotective roles in neural injuries, including neurodegenerative diseases. Here, we report that treatment with LBP can increased the viability of HEK293 cells that stably expressed mHtt containing 160 glutamine repeats and significantly improved motor behavior and life span in HD-transgenic mice. Furthermore, we found that in LBP-treated HEK293 cells expressing mHtt, mHtt levels were reduced and the phosphorylation of AKT at Ser473 (p-AKT-Ser473) was significantly increased. We also found that treatment with LBP increased p-AKT-Ser473 and decreased mHtt in the cortex, hippocampus and striatum in HD-transgenic mice. The level of phosphorylation of p-GSK3β-Ser9 remained unchanged in both cultured cells and HD-transgenic mice. Our findings suggest that LBP alleviates the cytotoxicity of mHtt by activating AKT and reducing mHtt levels, indicating that LBP may be potentially useful for treating HD.
<h4>Background</h4>Reading and language skills have overlapping genetic bases, most of which are still unknown. Part of the missing heritability may be caused by copy number variants (CNVs).<h4>Methods</h4>In a dataset of children recruited for a history of reading disability (RD, also known as dyslexia) or attention deficit hyperactivity disorder (ADHD) and their siblings, we investigated the effects of CNVs on reading and language performance. First, we called CNVs with PennCNV using signal intensity data from Illumina OmniExpress arrays (~723,000 probes). Then, we computed the correlation between measures of CNV genomic burden and the first principal component (PC) score derived from several continuous reading and language traits, both before and after adjustment for performance IQ. Finally, we screened the genome, probe-by-probe, for association with the PC scores, through two complementary analyses: we tested a binary CNV state assigned for the location of each probe (i.e., CNV+ or CNV-), and we analyzed continuous probe intensity data using FamCNV.<h4>Results</h4>No significant correlation was found between measures of CNV burden and PC scores, and no genome-wide significant associations were detected in probe-by-probe screening. Nominally significant associations were detected (p~10(-2)-10(-3)) within CNTN4 (contactin 4) and CTNNA3 (catenin alpha 3). These genes encode cell adhesion molecules with a likely role in neuronal development, and they have been previously implicated in autism and other neurodevelopmental disorders. A further, targeted assessment of candidate CNV regions revealed associations with the PC score (p~0.026-0.045) within CHRNA7 (cholinergic nicotinic receptor alpha 7), which encodes a ligand-gated ion channel and has also been implicated in neurodevelopmental conditions and language impairment. FamCNV analysis detected a region of association (p~10(-2)-10(-4)) within a frequent deletion ~6 kb downstream of ZNF737 (zinc finger protein 737, uncharacterized protein), which was also observed in the association analysis using CNV calls.<h4>Conclusions</h4>These data suggest that CNVs do not underlie a substantial proportion of variance in reading and language skills. Analysis of additional, larger datasets is warranted to further assess the potential effects that we found and to increase the power to detect CNV effects on reading and language.
Also flagged:HMGB1bronchiolitis obliterans syndromeRAGENF-κBHPSEheparanase
Journal Article2016-05-15No SnippetsHe L, Sun F, Wang Y, Zhu J, Fang J, Zhang S, Yu Q, Gong Q, Ren B, Xiang X, Chen Z, Ning Q, Hu J, Yang P, Wang CY.
Show Full Abstract
Bronchiolitis obliterans syndrome (BOS), characterized by progressive airflow obstruction, is the main barrier to long-term graft survival after lung transplantation. Despite extensive studies, the mechanisms underlying BOS remain poorly understood, and targeted interventions have not yet been fully developed. In the present study, we employed a mouse model of tracheal transplantation and demonstrated that blockade of HMGB1 alone or combined with heparanase (HPSE) attenuates the development of BOS. It was noted that HMGB1 was first passively released from necrotic/damaged cells as a result of early unavoidable allograft injuries, leading to macrophage infiltration along with HMGB1 active secretion. Mechanistic studies revealed that extracellular HMGB1 acted through its receptor, RAGE, to activate NF-κB, which then bound to the HPSE promoter to transcribe its expression. The enhanced HPSE next released HS-bonded latent TGF-β from myofibroblast ECM by cleaving HS chains to promote the initiation and progression of BOS. Together, our data suggest that HMGB1 and HPSE could be viable targets for prevention and intervention of fibrotic diseases such BOS after lung transplantation.
Also flagged:Chronic Hepatitis C Virus Infection) infectionironHCV infectionChronicpolymerase
Journal Article2016-05-15✓ 5 SnippetsGerayli S, Pasdar A, Shakeri MT, Sepahi S, Hoseini SM, Ahadi M, Rostami S, Meshkat Z.
In-Text Gene Mentions
Introduction)
…Although HFE gene polymorphism carriers are frequently seen among hepatitis C patients, the effect of HFE gene polymorphisms on HCV infection remains unknown.…
Introduction)
…The His63Asp (H63D) polymorphism, in which a C is changed to a G at nucleotide position 187 of the HFE gene, results in a replacement of amino acid 63 at the alpha-3 domain, which removes a histidine residue and substitutes it with an aspartic acid (13, 14).…
Discussion)
…Two polymorphisms in the HFE gene result in a change of amino acid sites at codon 282 (Cys282Tyr) and codon 63 (His63Asp) (16).…
Discussion)
…However, it is not clear whether increased iron indices is a phenomenon resulting from viral hepatitis, hepatic inflammation, and virus proliferation, or whether simultaneous HFE gene polymorphisms can affect hepatitis-induced hepatic diseases (25).…
Discussion)
…The present data suggest that polymorphisms at the C282Y and H63D positions of the hemochromatosis gene are one of the risk factors for infection with hepatitis C. A larger number of HCV patients and healthy controls will be crucial in order to clearly illustrate the role of HFE gene polymorphisms.…
Show Full Abstract
<h4>Background</h4>Chronic hepatitis C virus (HCV) infection is frequently associated with elevated serum iron markers. Polymorphisms in the hemochromatosis (HFE) genes are responsible for iron accumulation in most cases of hemochromatosis, and may play a role in HCV infection.<h4>Objectives</h4>We aimed to assess the prevalence of HFE gene polymorphisms in a group of Iranian HCV-infected patients, and to explore the association of these polymorphisms with HCV infection.<h4>Patients and methods</h4>HFE gene polymorphisms were examined in a total of 69 HCV patients and 69 healthy controls using polymerase chain reaction and restriction fragment length polymorphism techniques. Haplotype and diplotype analyses were performed using PHASE software.<h4>Results</h4>In a recessive analysis model of the His63Asp (H63D) locus (HH vs. HD + DD), the HH genotype was more common in patients compared to controls (adjusted P = 0.012; OR = 6.42 [95% CI: 1.51 - 27.33]). Also, in a recessive analysis model of the Cys282Tyr (C282Y) locus (CC vs. CY + YY), the CC genotype was more frequent in patients compared to controls (adjusted P = 0.03; OR = 5.06 [95% CI: 1.13 - 22.06]). In addition, there was a significant association between the HC haplotype and the HCDC diplotype and HCV infection.<h4>Conclusions</h4>Polymorphism in the hemochromatosis gene may confer some degree of risk for HCV infection, and individuals carrying the H and C alleles may be susceptible to this disease; however, a larger sample of HCV patients and healthy individuals may be necessary to further illustrate the role of these polymorphisms in HCV.
Also flagged:gene expressionbehavioral disorderschromatinmethylationanxiety disordersanxiety
Journal Article2016-05-14No SnippetsNieto SJ, Patriquin MA, Nielsen DA, Kosten TA.
Show Full Abstract
Epigenetic processes regulate gene expression independent of the DNA sequence and are increasingly being investigated as contributors to the development of behavioral disorders. Environmental insults, such as stress, diet, or toxin exposure, can affect epigenetic mechanisms, including chromatin remodeling, DNA methylation, and non-coding RNAs that, in turn, alter the organism's phenotype. In this review, we examine the literature, derived at both the preclinical (animal) and clinical (human) levels, on epigenetic alterations associated with anxiety disorders. Using animal models of anxiety, researchers have identified epigenetic changes in several limbic and cortical brain regions known to be involved in stress and emotion responses. Environmental manipulations have been imposed prior to conception, during prenatal or early postnatal periods, and at juvenile and adult ages. Time of perturbation differentially affects the epigenome and many changes are brain region-specific. Although some sex-dependent effects are reported in animal studies, more research employing both sexes is needed particularly given that females exhibit a disproportionate number of anxiety disorders. The human literature is in its infancy but does reveal some epigenetic associations with anxiety behaviors and disorders. In particular, effects in monoaminergic systems are seen in line with evidence from etiological and treatment research. Further, there is evidence that epigenetic changes may be inherited to affect subsequent generations. We speculate on how epigenetic processes may interact with genetic contributions to inform prevention and treatment strategies for those who are at risk for or have anxiety disorders.
Also flagged:gene expressionofdecaynonsense‐mediated mRNA decaydegradationcycloheximide
Journal Article2016-05-13No SnippetsKarousis ED, Nasif S, Mühlemann O.
Show Full Abstract
Nonsense-mediated mRNA decay (NMD) was originally coined to define a quality control mechanism that targets mRNAs with truncated open reading frames due to the presence of a premature termination codon. Meanwhile, it became clear that NMD has a much broader impact on gene expression and additional biological functions beyond quality control are continuously being discovered. We review here the current views regarding the molecular mechanisms of NMD, according to which NMD ensues on mRNAs that fail to terminate translation properly, and point out the gaps in our understanding. We further summarize the recent literature on an ever-rising spectrum of biological processes in which NMD appears to be involved, including homeostatic control of gene expression, development and differentiation, as well as viral defense. WIREs RNA 2016, 7:661-682. doi: 10.1002/wrna.1357 For further resources related to this article, please visit the WIREs website.
Also flagged:refractive errorrefractiveCHRNGA2BP1RBFOX1refractive
error
Journal Article2016-05-13✓ 1 SnippetFan Q, Guo X, Tideman JW, Williams KM, Yazar S, Hosseini SM, Howe LD, Pourcain BS, Evans DM, Timpson NJ, McMahon G, Hysi PG, Krapohl E, Wang YX, Jonas JB, Baird PN, Wang JJ, Cheng CY, Teo YY, Wong TY, Ding X, Wojciechowski R, Young TL, Pärssinen O, Oexle K, Pfeiffer N, Bailey-Wilson JE, Paterson AD, Klaver CC, Plomin R, Hammond CJ, Mackey DA, He M, Saw SM, Williams C, Guggenheim JA, CREAM Consortium.
In-Text Gene Mentions
I A O 0000615)
…, ZIC2 andSHISA6showed early-onset effects…
Show Full Abstract
Myopia, currently at epidemic levels in East Asia, is a leading cause of untreatable visual impairment. Genome-wide association studies (GWAS) in adults have identified 39 loci associated with refractive error and myopia. Here, the age-of-onset of association between genetic variants at these 39 loci and refractive error was investigated in 5200 children assessed longitudinally across ages 7-15 years, along with gene-environment interactions involving the major environmental risk-factors, nearwork and time outdoors. Specific variants could be categorized as showing evidence of: (a) early-onset effects remaining stable through childhood, (b) early-onset effects that progressed further with increasing age, or (c) onset later in childhood (N = 10, 5 and 11 variants, respectively). A genetic risk score (GRS) for all 39 variants explained 0.6% (P = 6.6E-08) and 2.3% (P = 6.9E-21) of the variance in refractive error at ages 7 and 15, respectively, supporting increased effects from these genetic variants at older ages. Replication in multi-ancestry samples (combined N = 5599) yielded evidence of childhood onset for 6 of 12 variants present in both Asians and Europeans. There was no indication that variant or GRS effects altered depending on time outdoors, however 5 variants showed nominal evidence of interactions with nearwork (top variant, rs7829127 in ZMAT4; P = 6.3E-04).
Also flagged:gene expressionintrauterine infectionfibronectinprogesteroneLipidbiotin
Journal Article2016-05-13✓ 2 SnippetsSharp GC, Hutchinson JL, Hibbert N, Freeman TC, Saunders PT, Norman JE.
In-Text Gene Mentions
Results)
…, RAB11FIP2 ,PLCL1, SCARA3 and…
Discussion)
…, TMEM123 andPLCL1.…
Show Full Abstract
An incomplete understanding of the molecular mechanisms that initiate normal human labour at term seriously hampers the development of effective ways to predict, prevent and treat disorders such as preterm labour. Appropriate analysis of large microarray experiments that compare gene expression in non-labouring and labouring gestational tissues is necessary to help bridge these gaps in our knowledge. In this work, gene expression in 48 (22 labouring, 26 non-labouring) lower-segment myometrial samples collected at Caesarean section were analysed using Illumina HT-12 v4.0 BeadChips. Normalised data were compared between labouring and non-labouring groups using traditional statistical methods and a novel network graph approach. We sought technical validation with quantitative real-time PCR, and biological replication through inverse variance-weighted meta-analysis with published microarray data. We have extended the list of genes suggested to be associated with labour: Compared to non-labouring samples, labouring samples showed apparent higher expression at 960 probes (949 genes) and apparent lower expression at 801 probes (789 genes) (absolute fold change ≥1.2, rank product percentage of false positive value (RP-PFP) <0.05). Although half of the women in the labouring group had received pharmaceutical treatment to induce or augment labour, sensitivity analysis suggested that this did not confound our results. In agreement with previous studies, functional analysis suggested that labour was characterised by an increase in the expression of inflammatory genes and network analysis suggested a strong neutrophil signature. Our analysis also suggested that labour is characterised by a decrease in the expression of muscle-specific processes, which has not been explicitly discussed previously. We validated these findings through the first formal meta-analysis of raw data from previous experiments and we hypothesise that this represents a change in the composition of myometrial tissue at labour. Further work will be necessary to reveal whether these results are solely due to leukocyte infiltration into the myometrium as a mechanism initiating labour, or in addition whether they also represent gene changes in the myocytes themselves. We have made all our data available at www.ebi.ac.uk/arrayexpress/ (accession number E-MTAB-3136) to facilitate progression of this work.
…or lungs fromPrdx6-null or Prdx6-D140A-knock-in …
Abstract)
…from Prdx6-null orPrdx6-D140A-knock-in mice that lack…
Abstract)
…2 ) ofPrdx6; addition of either…
Abstract)
…by PMVECs requiredPrdx6-PLA 2 .…
Show Full Abstract
Peroxiredoxin 6 (Prdx6) is essential for activation of NADPH oxidase type 2 (NOX2) in pulmonary microvascular endothelial cells (PMVECs), alveolar macrophages (AMs), and polymorphonuclear leukocytes. Angiotensin II and phorbol ester increased superoxide/H2O2 generation in PMVECs, AMs, and isolated lungs from wild-type (WT) mice, but had much less effect on cells or lungs from Prdx6-null or Prdx6-D140A-knock-in mice that lack the phospholipase A2 activity (PLA2) of Prdx6; addition of either lysophosphatidylcholine (LPC) or lysophosphatidic acid (LPA) to cells restored their oxidant generation. The generation of LPC by PMVECs required Prdx6-PLA2 We propose that Prdx6-PLA2 modulates NOX2 activation by generation of LPC that is converted to LPA by the lysophospholipase D activity of autotaxin (ATX/lysoPLD). Inhibition of lysoPLD with HA130 (cells,10 μM; lungs, 20 μM; IC50, 29 nM) decreased agonist-induced oxidant generation. LPA stimulates pathways regulated by small GTPases through binding to G-protein-coupled LPA receptors (LPARs). The LPAR blocker Ki16425 (cells, 10 μM; lungs, 25 μM; Ki, 0.34 μM) or cellular knockdown of LPAR type 1 decreased oxidant generation and blocked translocation of rac1 to plasma membrane. Thus, Prdx6-PLA2 modulates NOX2 activation through generation of LPC for conversion to LPA; binding of LPA to LPAR1 signals rac activation.-Vázquez-Medina, J. P., Dodia, C., Weng, L., Mesaros, C., Blair, I. A., Feinstein, S. I., Chatterjee, S., Fisher, A. B. The phospholipase A2 activity of peroxiredoxin 6 modulates NADPH oxidase 2 activation via lysophosphatidic acid receptor signaling in the pulmonary endothelium and alveolar macrophages.
Also flagged:encephalomyopathic mitochondrial DNA depletion syndromeMitochondrial DNA depletion syndromesautosomaldisordersmitochondrialMTDPS13
Journal Article2016-05-13✓ 5 SnippetsBarøy T, Pedurupillay CR, Bliksrud YT, Rasmussen M, Holmgren A, Vigeland MD, Hughes T, Brink M, Rodenburg R, Nedregaard B, Strømme P, Frengen E, Misceo D.
In-Text Gene Mentions
Abstract)
…On clinical indication of mitochondrial encephalomyopathy, sequencing of FBXL4 should be performed, even when the activity levels of the MRC enzymes are normal.…
Title)
…A novel mutation in FBXL4 in a Norwegian child with encephalomyopathic mitochondrial DNA depletion syndrome 13.…
Mitochondrial DNA depletion syndromes (MTDPS) represent a clinically and genetically heterogeneous group of autosomal recessive disorders, caused by mutations in genes involved in maintenance of mitochondrial DNA (mtDNA). Biallelic mutations in FBXL4 were recently described to cause encephalomyopathic MTDPS13. The syndrome has infantile onset and presents with hypotonia, feeding difficulties, a pattern of mild facial dysmorphisms, global developmental delay and brain atrophy. Laboratory investigations reveal elevated blood lactate levels, unspecific mitochondrial respiratory chain (MRC) enzyme deficiencies and mtDNA depletion. We report a novel missense variant, c.1442T > C (p.Leu481Pro), in FBXL4 (NM_012160.4) in a Norwegian boy with clinical, biochemical and cerebral MRI characteristics consistent with MTDPS13. The FBXL4 c.1442T > C (p.Leu481Pro) variant was not present in public databases, 149 Norwegian controls nor an in-house database containing whole exome sequencing data from 440 individuals, and it was predicted in silico to be deleterious to the protein function. Activities of MRC enzymes were normal in muscle tissue (complexes I-IV) and cultured skin fibroblasts (complexes I-V) from the patient, but mtDNA depletion was confirmed in muscle, thus supporting the predicted pathogenicity of the FBXL4 c.1442T > C (p.Leu481Pro) variant. On clinical indication of mitochondrial encephalomyopathy, sequencing of FBXL4 should be performed, even when the activity levels of the MRC enzymes are normal.
Huntington disease (HD) is an autosomal dominantly inherited disease that exhibits genetic anticipation of affected progeny due to expansions of a trinucleotide repeat (TNR) region within the HTT gene. DNA repair machinery is a known effector of TNR instability; however, the specific defects in HD cells that lead to TNR expansion are unknown. We hypothesized that HD cells would be deficient in DNA repair gene expression. To test this hypothesis, we analyzed expression of select DNA repair genes involved in mismatch/loop-out repair (APEX1, BRCA1, RPA1, and RPA3) in patient-derived HD cells and found each was consistently down-regulated relative to wild-type samples taken from unaffected individuals in the same family. Rescue of DNA repair gene expression by 5-azacytidine treatment identified DNA methylation as a mediator of DNA repair gene expression deficiency. Bisulfite sequencing confirmed hypermethylation of the APEX1 promoter region in HD cells relative to control, as well as 5-azacytidine-induced hypomethylation. 5-Azacytidine treatments also resulted in stabilization of TNR expansion within the mutant HTT allele during long-term culture of HD cells. Our findings indicate that DNA methylation leads to DNA repair down-regulation and TNR instability in mitotically active HD cells and offer a proof of principle that epigenetic interventions can curb TNR expansions.
Also flagged:insulin-dependent diabetes mellitusIDDMinsulinnecrotizing enterocolitissepsisgestation
Journal Article2016-05-13No SnippetsBoghossian NS, Hansen NI, Bell EF, Brumbaugh JE, Stoll BJ, Laptook AR, Shankaran S, Wyckoff MH, Colaizy TT, Das A, Higgins RD, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract
<h4>Background and objective</h4>Little is known about in-hospital morbidities and neurodevelopmental outcomes among extremely preterm infants born to women with insulin-dependent diabetes mellitus (IDDM). We examined risks of mortality, in-hospital morbidities, and neurodevelopmental outcomes at 18 to 22 months' corrected age between extremely preterm infants of women with insulin use before pregnancy (IBP), with insulin use started during pregnancy (IDP), and without IDDM.<h4>Methods</h4>Infants 22 to 28 weeks' gestation born or cared for at a Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network center (2006-2011) were studied. Regression models compared the association between maternal IDDM and timing of insulin use and the outcomes of the 3 groups.<h4>Results</h4>Of 10 781 infants, 536 (5%) were born to women with IDDM; 58% had IBP, and 36% had IDP. Infants of mothers with IBP had higher risks of necrotizing enterocolitis (adjusted relative risk [RR] = 1.55 [95% confidence interval (CI) 1.17-2.05]) and late-onset sepsis (adjusted RR = 1.26 [95% CI 1.07-1.48]) than infants of mothers without IDDM. There was some indication of higher in-hospital mortality risk among infants of mothers with IBP compared with those with IDP (adjusted RR = 1.33 [95% CI 1.00-1.79]). Among survivors evaluated at 18 to 22 months' corrected age, average head circumference z score was lower for infants of mothers with IBP compared with those without IDDM, but there were no differences in risk of neurodevelopmental impairment.<h4>Conclusions</h4>In this cohort of extremely preterm infants, infants of mothers with IBP had higher risks of necrotizing enterocolitis, sepsis, and small head circumference.
Also flagged:lung canceradenocarcinomachromosomeCHRNA5TERTcancer
Journal Article2016-05-13✓ 1 SnippetZanetti KA, Wang Z, Aldrich M, Amos CI, Blot WJ, Bowman ED, Burdette L, Cai Q, Caporaso N, Chung CC, Gillanders EM, Haiman CA, Hansen HM, Henderson BE, Kolonel LN, Marchand LL, Li S, McNeill LH, Ryan BM, Schwartz AG, Sison JD, Spitz MR, Tucker M, Wenzlaff AS, Wiencke JK, Wilkens L, Wrensch MR, Wu X, Zheng W, Zheng W, Zhou W, Christiani D, Palmer JR, Penning TM, Rieber AG, Rosenberg L, Ruiz-Narvaez EA, Su L, Vachani A, Wei Y, Whitehead AS, Chanock SJ, Harris CC.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
<h4>Objectives</h4>Genome-wide association studies (GWAS) of lung cancer have identified regions of common genetic variation with lung cancer risk in Europeans who smoke and never-smoking Asian women. This study aimed to conduct a GWAS in African Americans, who have higher rates of lung cancer despite smoking fewer cigarettes per day when compared with Caucasians. This population provides a different genetic architecture based on underlying African ancestry allowing the identification of new regions and exploration of known regions for finer mapping.<h4>Materials and methods</h4>We genotyped 1,024,001 SNPs in 1737 cases and 3602 controls in stage 1, followed by a replication phase of 20 SNPs (p<1.51×10(-5)) in an independent set of 866 cases and 796 controls in stage 2.<h4>Results and conclusion</h4>In the combined analysis, we confirmed two loci to be associated with lung cancer that achieved the threshold of genome-wide significance: 15q25.1 marked by rs2036527 (p=1.3×10(-9); OR=1.32; 95% CI=1.20-1.44) near CHRNA5, and 5p15.33 marked by rs2853677 (p=2.8×10(-9); OR=1.28; 95% CI=1.18-1.39) near TERT. The association with rs2853677 is driven by the adenocarcinoma subtype of lung cancer (p=1.3×10(-8); OR=1.37; 95% CI=1.23-1.54). No SNPs reached genome-wide significance for either of the main effect models examining smoking - cigarettes per day and current or former smoker. Our study was powered to identify strong risk loci for lung cancer in African Americans; we confirmed results previously reported in African Americans and other populations for two loci near plausible candidate genes, CHRNA5 and TERT, on 15q25.1 and 5p15.33 respectively, are associated with lung cancer. Additional work is required to map and understand the biological underpinnings of the strong association of these loci with lung cancer risk in African Americans.
Also flagged:attention-deficit/hyperactivity disorderADHDinhibitionDAT1DRD4neuropsychiatric disorders
Journal Article2016-05-12✓ 3 SnippetsRichards JS, Arias Vásquez A, van Rooij D, van der Meer D, Franke B, Hoekstra PJ, Heslenfeld DJ, Oosterlaan J, Faraone SV, Hartman CA, Buitelaar JK.
In-Text Gene Mentions
Abstract)
…Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions.…
Abstract)
…genes ( DAT1,5-HTT, DRD4 ) and…
Text
…5-HTT…
Show Full Abstract
<h4>Objectives</h4>Impaired inhibitory control is a key feature of attention-deficit/hyperactivity disorder (ADHD). We investigated gene-environment interaction (GxE) as a possible contributing factor to response inhibition variation in context of the differential susceptibility theory. This states individuals carrying plasticity gene variants will be more disadvantaged in negative, but more advantaged in positive environments.<h4>Methods</h4>Behavioural and neural measures of response inhibition were assessed during a Stop-signal task in participants with (N = 197) and without (N = 295) ADHD, from N = 278 families (age M = 17.18, SD =3.65). We examined GxE between candidate plasticity genes (DAT1, 5-HTT, DRD4) and social environments (maternal expressed emotion, peer affiliation).<h4>Results</h4>A DRD4 × Positive peer affiliation interaction was found on the right fusiform gyrus (rFG) activation during successful inhibition. Further, 5-HTT short allele carriers showed increased rFG activation during failed inhibitions. Maternal warmth and positive peer affiliation were positively associated with right inferior frontal cortex activation during successful inhibition. Deviant peer affiliation was positively related to the error rate.<h4>Conclusions</h4>While a pattern of differential genetic susceptibility was found, more clarity on the role of the FG during response inhibition is warranted before firm conclusions can be made. Positive and negative social environments were related to inhibitory control. This extends previous research emphasizing adverse environments.
Porcine circovirus type 2 (PCV2), an economically important pathogen, causes postweaning multisystemic wasting syndrome (PMWS) and other syndrome diseases collectively known as porcine circovirus-associated disease (PCVAD). Previous studies revealed breed-dependent differences in porcine susceptibility to PCV2; however, the genetic mechanism underlying different resistance to PCV2 infection remains largely unknown. In this study, we found that Yorkshire × Landrace (YL) pigs exhibited serious clinical features typifying PCV2 disease, while the Laiwu (a Chinese indigenous pig breed, LW) pigs showed little clinical symptoms of the disease during PCV2 infection. At 35 days post infection (dpi), the PCV2 DNA copy in YL pigs was significantly higher than that in LW pigs (P < 0.05). The serum level of IL-4, IL-6, IL-8, IL-12 and TGF-β1 in LW pigs and TNF-α in YL pigs increased significantly at the early infected stages, respectively; while that of IL-10 and IFN-γ in YL pigs was greatly increased at 35 dpi. RNA-seq analysis revealed that, at 35 dpi, 83 genes were up-regulated and 86 genes were down-regulated in the lung tissues of LW pigs, while in YL pigs, the numbers were 187 and 18, respectively. In LW pigs, the differentially expressed genes (DEGs) were mainly involved in complement and coagulation cascades, metabolism of xenobiotics by cytochrome P450, RIG-I-like receptor signaling and B cell receptor signaling pathways. Four up-regulated genes (TFPI, SERPNC1, SERPNA1, and SERPNA5) that are enriched in complement and coagulation cascades pathway were identified in the PCV2-infected LW pigs, among which the mRNA expression of SERPNA1, as well as three genes including TGF-β1, TGF-β2 and VEGF that are regulated by SERPNA1 was significantly increased (P < 0.05). We speculate that higher expression of SERPNA1 may effectively suppress excessive inflammation reaction and reduce the pathological degree of lung tissue in PCV2-infected pigs. Collectively, our findings indicate that the susceptibility to PCV2 infection depends on a genetic difference between LW and YL pigs, and SERPNA1 likely plays an important role in the resistance of LW pigs to PCV2 infection.
Also flagged:replication forksheterochromatinchromatindevelopmental disordersATRXATRX) syndrome
Journal Article2016-05-12No SnippetsHuh MS, Ivanochko D, Hashem LE, Curtin M, Delorme M, Goodall E, Yan K, Picketts DJ.
Show Full Abstract
Expansive growth of neural progenitor cells (NPCs) is a prerequisite to the temporal waves of neuronal differentiation that generate the six-layered neocortex, while also placing a heavy burden on proteins that regulate chromatin packaging and genome integrity. This problem is further reflected by the growing number of developmental disorders caused by mutations in chromatin regulators. ATRX gene mutations cause a severe intellectual disability disorder (α-thalassemia mental retardation X-linked (ATRX) syndrome; OMIM no. 301040), characterized by microcephaly, urogenital abnormalities and α-thalassemia. Although the ATRX protein is required for the maintenance of repetitive DNA within heterochromatin, how this translates to disease pathogenesis remain poorly understood and was a focus of this study. We demonstrate that Atrx(FoxG1Cre) forebrain-specific conditional knockout mice display poly(ADP-ribose) polymerase-1 (Parp-1) hyperactivation during neurogenesis and generate fewer late-born Cux1- and Brn2-positive neurons that accounts for the reduced cortical size. Moreover, DNA damage, induced Parp-1 and Atm activation is elevated in progenitor cells and contributes to their increased level of cell death. ATRX-null HeLa cells are similarly sensitive to hydroxyurea-induced replication stress, accumulate DNA damage and proliferate poorly. Impaired BRCA1-RAD51 colocalization and PARP-1 hyperactivation indicated that stalled replication forks are not efficiently protected. DNA fiber assays confirmed that MRE11 degradation of stalled replication forks was rampant in the absence of ATRX or DAXX. Indeed, fork degradation in ATRX-null cells could be attenuated by treatment with the MRE11 inhibitor mirin, or exacerbated by inhibiting PARP-1 activity. Taken together, these results suggest that ATRX is required to limit replication stress during cellular proliferation, whereas upregulation of PARP-1 activity functions as a compensatory mechanism to protect stalled forks, limiting genomic damage, and facilitating late-born neuron production.
Also flagged:Gene ExpressionHematological Malignancieshematological cancersT-cell receptortumorimmune responses
Journal Article2016-05-12✓ 1 SnippetPont MJ, Honders MW, Kremer AN, van Kooten C, Out C, Hiemstra PS, de Boer HC, Jager MJ, Schmelzer E, Vries RG, Al Hinai AS, Kroes WG, Monajemi R, Goeman JJ, Böhringer S, Marijt WA, Falkenburg JH, Griffioen M.
In-Text Gene Mentions
I A O 0000326)
…is shown forOLFM4, RBP2 ,…
Show Full Abstract
Cellular immunotherapy has proven to be effective in the treatment of hematological cancers by donor lymphocyte infusion after allogeneic hematopoietic stem cell transplantation and more recently by targeted therapy with chimeric antigen or T-cell receptor-engineered T cells. However, dependent on the tissue distribution of the antigens that are targeted, anti-tumor responses can be accompanied by undesired side effects. Therefore, detailed tissue distribution analysis is essential to estimate potential efficacy and toxicity of candidate targets for immunotherapy of hematological malignancies. We performed microarray gene expression analysis of hematological malignancies of different origins, healthy hematopoietic cells and various non-hematopoietic cell types from organs that are often targeted in detrimental immune responses after allogeneic stem cell transplantation leading to graft-versus-host disease. Non-hematopoietic cells were also cultured in the presence of IFN-γ to analyze gene expression under inflammatory circumstances. Gene expression was investigated by Illumina HT12.0 microarrays and quality control analysis was performed to confirm the cell-type origin and exclude contamination of non-hematopoietic cell samples with peripheral blood cells. Microarray data were validated by quantitative RT-PCR showing strong correlations between both platforms. Detailed gene expression profiles were generated for various minor histocompatibility antigens and B-cell surface antigens to illustrate the value of the microarray dataset to estimate efficacy and toxicity of candidate targets for immunotherapy. In conclusion, our microarray database provides a relevant platform to analyze and select candidate antigens with hematopoietic (lineage)-restricted expression as potential targets for immunotherapy of hematological cancers.
Also flagged:Gene ExpressionLong-Chain Acyl-Coenzyme A Synthetaselipidmetabolismcancerlong-chain fatty acyl-Co A synthetase
Journal Article2016-05-12✓ 2 SnippetsChen WC, Wang CY, Hung YH, Weng TY, Yen MC, Lai MD.
In-Text Gene Mentions
Abstract)
…was coexpressed withSOX6and DARC.…
Results)
…region Y)-box 6 (SOX6), Duffy blood group,…
Show Full Abstract
Dysregulated lipid metabolism contributes to cancer progression. Our previous study indicates that long-chain fatty acyl-Co A synthetase (ACSL) 3 is essential for lipid upregulation induced by endoplasmic reticulum stress. In this report, we aimed to identify the role of ACSL family in cancer with systematic analysis and in vitro experiment. We explored the ACSL expression using Oncomine database to determine the gene alteration during carcinogenesis and identified the association between ACSL expression and the survival of cancer patient using PrognoScan database. ACSL1 may play a potential oncogenic role in colorectal and breast cancer and play a potential tumor suppressor role in lung cancer. Co-expression analysis revealed that ACSL1 was coexpressed with MYBPH, PTPRE, PFKFB3, SOCS3 in colon cancer and with LRRFIP1, TSC22D1 in lung cancer. In accordance with PrognoScan analysis, downregulation of ACSL1 in colon and breast cancer cell line inhibited proliferation, migration, and anchorage-independent growth. In contrast, increase of oncogenic property was observed in lung cancer cell line by attenuating ACSL1. High ACSL3 expression predicted a better prognosis in ovarian cancer; in contrast, high ACSL3 predicted a worse prognosis in melanoma. ACSL3 was coexpressed with SNUPN, TRIP13, and SEMA5A in melanoma. High expression of ACSL4 predicted a worse prognosis in colorectal cancer, but predicted better prognosis in breast, brain and lung cancer. ACSL4 was coexpressed with SERPIN2, HNRNPCL1, ITIH2, PROCR, LRRFIP1. High expression of ACSL5 predicted good prognosis in breast, ovarian, and lung cancers. ACSL5 was coexpressed with TMEM140, TAPBPL, BIRC3, PTPRE, and SERPINB1. Low ACSL6 predicted a worse prognosis in acute myeloid leukemia. ACSL6 was coexpressed with SOX6 and DARC. Altogether, different members of ACSLs are implicated in diverse types of cancer development. ACSL-coexpressed molecules may be used to further investigate the role of ACSL family in individual type of cancers.
<h4>Background</h4>Concerning the risk of antidepressant induced liver injury, it is not clear whether psychiatrists perform a liver function test (LFT) and whether an increase in aminotransferase levels should contraindicate antidepressant treatment.<h4>Aim</h4>To evaluate LFT availability, the prevalence of LFT abnormalities and the probable cause of an altered LFT in patients with a major depressive episode (MDE) requiring an antidepressant drug.<h4>Methods</h4>We studied LFT evaluation in a real world psychiatric setting, in a sample of 321 consecutive patients with a current major depressive episode (MDE) requiring an antidepressant drug treatment, but without current alcohol or drug dependence or unstable medical disease.<h4>Results</h4>An LFT is performed in 36.1% (116/321) of depressed patients. One fifth of antidepressant-treated patients who had an LFT evaluation had abnormal results. The most frequent causes of LFT abnormalities were: NAFLD (nonalcoholic fatty liver disease) (7/321; 2.1%), acute alcohol consumption (4/321; 1.2%), antidepressant-induced liver injury (3/321; 0.9%), hepatitis C virus infection (2/321; 0.6%) and heart failure (1/321; 0.3%). The cause of LFT abnormalities was unknown in 32% of patients (8/25) due to the absence of etiological investigations.<h4>Conclusion</h4>These results demonstrate that an LFT is infrequently performed by psychiatrists in depressed patients requiring an antidepressant drug. Baseline LFT assessment and observations during the first six months of antidepressant treatment may be useful for detection of patients with pre-existing liver disease such as NAFLD, and early identification of cases of antidepressant-induced liver injury. An increase in aminotransferase levels may be related to an underlying liver disease, but does not contraindicate antidepressant treatment.
Also flagged:curcuminTFEBAutophagyneurodegenerative disorderstranscription factor EBMTOR
Journal Article2016-05-12✓ 1 SnippetSong JX, Sun YR, Peluso I, Zeng Y, Yu X, Lu JH, Xu Z, Wang MZ, Liu LF, Huang YY, Chen LL, Durairajan SS, Zhang HJ, Zhou B, Zhang HQ, Lu A, Ballabio A, Medina DL, Guo Z, Li M.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Autophagy dysfunction is a common feature in neurodegenerative disorders characterized by accumulation of toxic protein aggregates. Increasing evidence has demonstrated that activation of TFEB (transcription factor EB), a master regulator of autophagy and lysosomal biogenesis, can ameliorate neurotoxicity and rescue neurodegeneration in animal models. Currently known TFEB activators are mainly inhibitors of MTOR (mechanistic target of rapamycin [serine/threonine kinase]), which, as a master regulator of cell growth and metabolism, is involved in a wide range of biological functions. Thus, the identification of TFEB modulators acting without inhibiting the MTOR pathway would be preferred and probably less deleterious to cells. In this study, a synthesized curcumin derivative termed C1 is identified as a novel MTOR-independent activator of TFEB. Compound C1 specifically binds to TFEB at the N terminus and promotes TFEB nuclear translocation without inhibiting MTOR activity. By activating TFEB, C1 enhances autophagy and lysosome biogenesis in vitro and in vivo. Collectively, compound C1 is an orally effective activator of TFEB and is a potential therapeutic agent for the treatment of neurodegenerative diseases.
Also flagged:basepairingchromosomeepigenetic silencing proteinSPENpsoralen
Journal Article2016-05-12✓ 1 SnippetLu Z, Zhang QC, Lee B, Flynn RA, Smith MA, Robinson JT, Davidovich C, Gooding AR, Goodrich KJ, Mattick JS, Mesirov JP, Cech TR, Chang HY.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
RNA has the intrinsic property to base pair, forming complex structures fundamental to its diverse functions. Here, we develop PARIS, a method based on reversible psoralen crosslinking for global mapping of RNA duplexes with near base-pair resolution in living cells. PARIS analysis in three human and mouse cell types reveals frequent long-range structures, higher-order architectures, and RNA-RNA interactions in trans across the transcriptome. PARIS determines base-pairing interactions on an individual-molecule level, revealing pervasive alternative conformations. We used PARIS-determined helices to guide phylogenetic analysis of RNA structures and discovered conserved long-range and alternative structures. XIST, a long noncoding RNA (lncRNA) essential for X chromosome inactivation, folds into evolutionarily conserved RNA structural domains that span many kilobases. XIST A-repeat forms complex inter-repeat duplexes that nucleate higher-order assembly of the key epigenetic silencing protein SPEN. PARIS is a generally applicable and versatile method that provides novel insights into the RNA structurome and interactome. VIDEO ABSTRACT.
Journal Article2016-05-12✓ 1 SnippetBoeing S, Williamson L, Encheva V, Gori I, Saunders RE, Instrell R, Aygün O, Rodriguez-Martinez M, Weems JC, Kelly GP, Conaway JW, Conaway RC, Stewart A, Howell M, Snijders AP, Svejstrup JQ.
In-Text Gene Mentions
Results)
…PNN, ALYREF, andSTAU1) that also scored…
Show Full Abstract
In order to facilitate the identification of factors and pathways in the cellular response to UV-induced DNA damage, several descriptive proteomic screens and a functional genomics screen were performed in parallel. Numerous factors could be identified with high confidence when the screen results were superimposed and interpreted together, incorporating biological knowledge. A searchable database, bioLOGIC, which provides access to relevant information about a protein or process of interest, was established to host the results and facilitate data mining. Besides uncovering roles in the DNA damage response for numerous proteins and complexes, including Integrator, Cohesin, PHF3, ASC-1, SCAF4, SCAF8, and SCAF11, we uncovered a role for the poorly studied, melanoma-associated serine/threonine kinase 19 (STK19). Besides effectively uncovering relevant factors, the multiomic approach also provides a systems-wide overview of the diverse cellular processes connected to the transcription-related DNA damage response.
Also flagged:conjugationpolyacrylamidenanostructuresnanofiberstriptycenezinc
Journal Article2016-05-12No SnippetsKumari R, Singh S, Monisha M, Bhowmick S, Roy A, Das N, Das P.
Show Full Abstract
Herein, we describe the successful construction of composite DNA nanostructures by the self-assembly of complementary symmetrical 2,6,14-triptycenetripropiolic acid (TPA)-DNA building blocks and zinc protoporphyrin IX (Zn PpIX). DNA-organic molecule scaffolds for the composite DNA nanostructure were constructed through covalent conjugation of TPA with 5'-C12-amine-terminated modified single strand DNA (ssDNA) and its complementary strand. The repeated covalent conjugation of TPA with DNA was confirmed by using denaturing polyacrylamide gel electrophoresis (PAGE), reverse-phase high-performance liquid chromatography (RP-HPLC) and matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF). The biologically relevant photosensitizer Zn PpIX was used to direct the hybridization-mediated self-assembly of DNA-TPA molecular building blocks as well as a model guest molecule within the DNA-TPA supramolecular self-assembly. The formation of fiber-like composite DNA nanostructures was observed. Native PAGE, circular dichroism (CD) and atomic force microscopy (AFM) have been utilized for analyzing the formation of DNA nanofibers after the coassembly. Computational methods were applied to discern the theoretical dimension of the DNA-TPA molecular building block of the nanofibers. A notable change in photocatalytic efficiency of Zn PpIX was observed when it was inside the TPA-DNA scaffold. The significant increase in ROS generation by Zn PpIX when trapped in this biocompatible DNA-TPA hybrid nanofiber may be an effective tool to explore photodynamic therapy (PDT) applications as well as photocatalytic reactions.
Also flagged:thalassemiahemoglobin Hthrombosesnucleotideprotein Cprotein S
Journal Article2016-05-12✓ 5 SnippetsSun NA, Cheng P, Deng DH, Liu RR, Lai YR.
In-Text Gene Mentions
I A O 0000613)
…Isolation of genomic DNA from whole blood was conducted using the QIAamp DNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol and was followed by polymerase chain reaction (PCR) sequencing analysis of the PC gene (PROC), PS gene (PROS1), antithrombin gene (SERPINC1), and several candidate single-nucleotide polymorphisms (SNPs) associated with deep-vein thrombosis (DVT) identified by genome-wide association studies.…
Discussion)
…PROC, PROS1 andSERPINC1, as well as…
Discussion)
…exon 5 ofSERPINC1.…
I A O 0000613)
…(PROS1), antithrombin gene (SERPINC1), and several candidate…
I A O 0000613)
…Finally,SERPINC1had a synonymous…
Show Full Abstract
Reports of recurrent thromboembolism in thalassemia, particularly in hemoglobin H (HbH) disease associated with congenital thrombophilic mutations, are scarce. However, several mutations were detected in a 22-year-old woman with HbH disease. The patient experienced the first thrombotic event at the age of 20 years and had four recurrent thromboses in a short time interval, despite receiving anticoagulant treatment. The present study reports a case with six nucleotide substitutions, including a missense 565C>T (Arg189Trp) mutation and two synonymous mutations, 66T>C (Pro22Pro) and 423G>T (Ser141Ser), identified in the protein C gene. The other three mutations, 947G>A (Arg316His), 981A>G (Val327Val), and 775C>A (rs13146272), were identified in the protein S, antithrombin and cytochrome P450, family 4, subfamily V, polypeptide 2 genes, respectively. These findings suggest that if thrombotic events repeatedly occur in a patient with thalassemia, not only the risk factors associated with a hypercoagulable state, but the acquired and congenital thrombophilia should be screened for.
Also flagged:Huntington's diseaseHDHuntingtonautosomal dominant neurodegenerative disordercognitive declinebehavioural
Journal Article2016-05-11✓ 1 SnippetBaig SS, Strong M, Rosser E, Taverner NV, Glew R, Miedzybrodzka Z, Clarke A, Craufurd D, UK Huntington’s Disease Prediction Consortium, Quarrell OW.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Huntington's disease (HD) is a progressive neurodegenerative condition. At-risk individuals have accessed predictive testing via direct mutation testing since 1993. The UK Huntington's Prediction Consortium has collected anonymised data on UK predictive tests, annually, from 1993 to 2014: 9407 predictive tests were performed across 23 UK centres. Where gender was recorded, 4077 participants were male (44.3%) and 5122 were female (55.7%). The median age of participants was 37 years. The most common reason for predictive testing was to reduce uncertainty (70.5%). Of the 8441 predictive tests on individuals at 50% prior risk, 4629 (54.8%) were reported as mutation negative and 3790 (44.9%) were mutation positive, with 22 (0.3%) in the database being uninterpretable. Using a prevalence figure of 12.3 × 10(-5), the cumulative uptake of predictive testing in the 50% at-risk UK population from 1994 to 2014 was estimated at 17.4% (95% CI: 16.9-18.0%). We present the largest study conducted on predictive testing in HD. Our findings indicate that the vast majority of individuals at risk of HD (>80%) have not undergone predictive testing. Future therapies in HD will likely target presymptomatic individuals; therefore, identifying the at-risk population whose gene status is unknown is of significant public health value.
Also flagged:pairingchromosomeorganizationnucleuscell nucleusorganelle
Journal Article2016-05-11✓ 1 SnippetSawyer IA, Shevtsov SP, Dundr M.
In-Text Gene Mentions
Text
…RABGAP1L…
Show Full Abstract
A concern in the field of genomics is the proper interpretation of large, high-throughput sequencing datasets. The use of DNA FISH followed by high-content microscopy is a valuable tool for validation and contextualization of frequently occurring gene pairing events at the single-cell level identified by deep sequencing. However, these techniques possess certain limitations. Firstly, they do not permit the study of colocalization of many gene loci simultaneously. Secondly, the direct assessment of the relative position of many clustered gene loci within their respective chromosome territories is impossible. Thus, methods are required to advance the study of higher-order nuclear and cellular organization. Here, we describe a multiplexed DNA FISH technique combined with indirect immunofluorescence to study the relative position of 6 distinct genomic or cellular structures. This can be achieved in a single hybridization step using spectral imaging during image acquisition and linear unmixing. Here, we detail the use of this method to quantify gene pairing between highly expressed spliceosomal genes and compare these data to randomly positioned in silico simulated gene clusters. This is a potentially universally applicable approach for the validation of 3C-based technologies, deep imaging of spatial organization within the nucleus and global cellular organization.
Also flagged:MitochondriaFatty acidmetabolismsteroidbiosynthesisperoxisomes
Journal Article2016-05-11✓ 5 SnippetsFan J, Li X, Issop L, Culty M, Papadopoulos V.
In-Text Gene Mentions
Abstract)
…Ectopic expression of the ACBD2/ECI2 isoform A in MA-10 cells led to increased basal and hormone-stimulated steroid formation, indicating that ACBD2/ECI2-mediated peroxisomes-mitochondria interactions favor in the exchange of metabolites and/or macromolecules between these 2 organelles in support of steroid biosynthesis.…
Abstract)
…tumor Leydig cells rapidly induces peroxisomes to approach mitochondria and form peroxisome-mitochondrial contact sites/fusion, revealed by the subcellular distribution of the endogenous acyl-coenzyme A-binding domain (ACBD)2/ECI2…
Title)
…ACBD2/ECI2-Mediated Peroxisome-Mitochond…
Abstract)
…zyme A-binding domain (ACBD)2/ECI2 isoform Aisoform A generated…
Abstract)
…expression of the ACBD2/ECI2isoform A in…
Show Full Abstract
Fatty acid metabolism and steroid biosynthesis are 2 major pathways shared by peroxisomes and mitochondria. Both organelles are in close apposition to the endoplasmic reticulum, with which they communicate via interorganelle membrane contact sites to promote cellular signaling and the exchange of ions and lipids. To date, no convincing evidence of the direct contact between peroxisomes and mitochondria was reported in mammalian cells. Hormone-induced, tightly controlled steroid hormone biosynthesis requires interorganelle interactions. Using immunofluorescent staining and live-cell imaging, we found that dibutyryl-cAMP treatment of MA-10 mouse tumor Leydig cells rapidly induces peroxisomes to approach mitochondria and form peroxisome-mitochondrial contact sites/fusion, revealed by the subcellular distribution of the endogenous acyl-coenzyme A-binding domain (ACBD)2/ECI2 isoform A generated by alternative splicing, and further validated using a proximity ligation assay. This event occurs likely via a peroxisome-like structure, which is mediated by peroxisomal and mitochondrial matrix protein import complexes: peroxisomal import receptor peroxisomal biogenesis factor 5 (PEX5), and the mitochondrial import receptor subunit translocase of outer mitochondrial membrane 20 homolog (yeast) protein. Similar results were obtained using the mLTC-1 mouse tumor Leydig cells. Ectopic expression of the ACBD2/ECI2 isoform A in MA-10 cells led to increased basal and hormone-stimulated steroid formation, indicating that ACBD2/ECI2-mediated peroxisomes-mitochondria interactions favor in the exchange of metabolites and/or macromolecules between these 2 organelles in support of steroid biosynthesis. Considering the widespread occurrence of the ACBD2/ECI2 protein, we propose that this protein might serve as a tool to assist in understanding the contact between peroxisomes and mitochondria.
Also flagged:ProgesteronePhospholipase C-Related Catalytically Inactive Protein 1miscarriagephosphoinositide 3-kinaseProtein kinase Btranscription factor
Journal Article2016-05-11✓ 1 SnippetMuter J, Brighton PJ, Lucas ES, Lacey L, Shmygol A, Quenby S, Blanks AM, Brosens JJ.
In-Text Gene Mentions
Abstract)
…we show thatPLCL1, coding phospholipase…
Show Full Abstract
Decidualization denotes the transformation of endometrial stromal cells into specialized decidual cells. In pregnancy, decidual cells form a protective matrix around the implanting embryo, enabling coordinated trophoblast invasion and formation of a functional placenta. Continuous progesterone (P4) signaling renders decidual cells resistant to various environmental stressors, whereas withdrawal inevitably triggers tissue breakdown and menstruation or miscarriage. Here, we show that PLCL1, coding phospholipase C (PLC)-related catalytically inactive protein 1 (PRIP-1), is highly induced in response to P4 signaling in decidualizing human endometrial stromal cells (HESCs). Knockdown experiments in undifferentiated HESCs revealed that PRIP-1 maintains basal phosphoinositide 3-kinase/Protein kinase B activity, which in turn prevents illicit nuclear translocation of the transcription factor forkhead box protein O1 and induction of the apoptotic activator BIM. By contrast, loss of this scaffold protein did not compromise survival of decidual cells. PRIP-1 knockdown did also not interfere with the responsiveness of HESCs to deciduogenic cues, although the overall expression of differentiation markers, such as PRL, IGFBP1, and WNT4, was blunted. Finally, we show that PRIP-1 in decidual cells uncouples PLC activation from intracellular Ca(2+) release by attenuating inositol 1,4,5-trisphosphate signaling. In summary, PRIP-1 is a multifaceted P4-inducible scaffold protein that gates the activity of major signal transduction pathways in the endometrium. It prevents apoptosis of proliferating stromal cells and contributes to the relative autonomy of decidual cells by silencing PLC signaling downstream of Gq protein-coupled receptors.
Also flagged:Ubiquilininclusion bodyvacuolelysosomeubiquitinproteasome
Journal Article2016-05-11✓ 5 SnippetsChuang KH, Liang F, Higgins R, Wang Y.
In-Text Gene Mentions
Introduction)
…The three lysine residues in the N-terminus of Htt are responsible for this modification, but the same residues are also subject to SUMOylation (Steffan et al., 2004).…
Introduction)
…Striatum from HD brains showed elevated levels of ubiquitinated Htt N-terminal fragments (Mende-Mueller et al., 2001).…
Introduction)
…Here we used Htt exon 1 with 103-polyQ expansion and the proline-rich region (Htt103QP) as a model substrate to study the function of yeast ubiquilin, Dsk2, in the clearance of misfolded proteins.…
Introduction)
…Expression of truncated Htt with polyQ expansion and a proline-rich domain is sufficient to induce protein aggregation in vitro (Muchowski et al., 2000).…
Results)
…This Htt fragment was tagged with Flag at the N-terminus and green fluorescent protein (GFP) at the C-terminus and is under control of a galactose promoter (PGALFlag-Htt103QP-GFP; hereafter Htt103QP).…
Show Full Abstract
Ubiquilin proteins contain a ubiquitin-like domain (UBL) and ubiquitin-associated domain(s) that interact with the proteasome and ubiquitinated substrates, respectively. Previous work established the link between ubiquilin mutations and neurodegenerative diseases, but the function of ubiquilin proteins remains elusive. Here we used a misfolded huntingtin exon I containing a 103-polyglutamine expansion (Htt103QP) as a model substrate for the functional study of ubiquilin proteins. We found that yeast ubiquilin mutant (dsk2Δ) is sensitive to Htt103QP overexpression and has a defect in the formation of Htt103QP inclusion bodies. Our evidence further suggests that the UBL domain of Dsk2 is critical for inclusion body formation. Of interest, Dsk2 is dispensable for Htt103QP degradation when Htt103QP is induced for a short time before noticeable inclusion body formation. However, when the inclusion body forms after a long Htt103QP induction, Dsk2 is required for efficient Htt103QP clearance, as well as for autophagy-dependent delivery of Htt103QP into vacuoles (lysosomes). Therefore our data indicate that Dsk2 facilitates vacuole-mediated clearance of misfolded proteins by promoting inclusion body formation. Of importance, the defect of inclusion body formation in dsk2 mutants can be rescued by human ubiquilin 1 or 2, suggesting functional conservation of ubiquilin proteins.
Whereas major histocompatibility class-1 (MH1) proteins present peptides to T cells displaying a large T-cell receptor (TR) repertoire, MH1Like proteins, such as CD1D and MR1, present glycolipids and microbial riboflavin precursor derivatives, respectively, to T cells expressing invariant TR-α (iTRA) chains. The groove of such MH1Like, as well as iTRA chains used by mucosal-associated invariant T (MAIT) and natural killer T (NKT) cells, respectively, may result from a coevolution under particular selection pressures. Herein, we investigated the evolutionary patterns of the iTRA of MAIT and NKT cells and restricting MH1Like proteins: MR1 appeared 170 Mya and is highly conserved across mammals, evolving more slowly than other MH1Like. It has been pseudogenized or independently lost three times in carnivores, the armadillo, and lagomorphs. The corresponding TRAV1 gene also evolved slowly and harbors highly conserved complementarity determining regions 1 and 2. TRAV1 is absent exclusively from species in which MR1 is lacking, suggesting that its loss released the purifying selection on MR1. In the rabbit, which has very few NKT and no MAIT cells, a previously unrecognized iTRA was identified by sequencing leukocyte RNA. This iTRA uses TRAV41, which is highly conserved across several groups of mammals. A rabbit MH1Like gene was found that appeared with mammals and is highly conserved. It was independently lost in a few groups in which MR1 is present, like primates and Muridae, illustrating compensatory emergences of new MH1Like/Invariant T-cell combinations during evolution. Deciphering their role is warranted to search similar effector functions in humans.
Journal Article2016-05-11No SnippetsPeng Y, Arighi C, Wu CH, Vijay-Shanker K.
Show Full Abstract
There has been a large growth in the number of biomedical publications that report experimental results. Many of these results concern detection of protein-protein interactions (PPI). In BioCreative V, we participated in the BioC task and developed a PPI system to detect text passages with PPIs in the full-text articles. By adopting the BioC format, the output of the system can be seamlessly added to the biocuration pipeline with little effort required for the system integration. A distinctive feature of our PPI system is that it utilizes extended dependency graph, an intermediate level of representation that attempts to abstract away syntactic variations in text. As a result, we are able to use only a limited set of rules to extract PPI pairs in the sentences, and additional rules to detect additional passages for PPI pairs. For evaluation, we used the 95 articles that were provided for the BioC annotation task. We retrieved the unique PPIs from the BioGRID database for these articles and show that our system achieves a recall of 83.5%. In order to evaluate the detection of passages with PPIs, we further annotated Abstract and Results sections of 20 documents from the dataset and show that an f-value of 80.5% was obtained. To evaluate the generalizability of the system, we also conducted experiments on AIMed, a well-known PPI corpus. We achieved an f-value of 76.1% for sentence detection and an f-value of 64.7% for unique PPI detection.Database URL: http://proteininformationresource.org/iprolink/corpora.
Also flagged:pathogenesisneurodegenerative disorderHDinflammatory responseIL6autosomal dominant neurodegenerative disorder
Journal Article2016-05-11✓ 3 SnippetsMiller JR, Lo KK, Andre R, Hensman Moss DJ, Träger U, Stone TC, Jones L, Holmans P, Plagnol V, Tabrizi SJ.
In-Text Gene Mentions
Introduction)
…Huntington’s disease (HD) is an incurable, autosomal dominant neurodegenerative disorder that is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene (1).…
Introduction)
…the huntingtin (HTT) gene (…
Discussion)
…MutantHTTexpression has been…
Show Full Abstract
Innate immune activation beyond the central nervous system is emerging as a vital component of the pathogenesis of neurodegeneration. Huntington's disease (HD) is a fatal neurodegenerative disorder caused by a CAG repeat expansion in the huntingtin gene. The systemic innate immune system is thought to act as a modifier of disease progression; however, the molecular mechanisms remain only partially understood. Here we use RNA-sequencing to perform whole transcriptome analysis of primary monocytes from thirty manifest HD patients and thirty-three control subjects, cultured with and without a proinflammatory stimulus. In contrast with previous studies that have required stimulation to elicit phenotypic abnormalities, we demonstrate significant transcriptional differences in HD monocytes in their basal, unstimulated state. This includes previously undetected increased resting expression of genes encoding numerous proinflammatory cytokines, such as IL6 Further pathway analysis revealed widespread resting enrichment of proinflammatory functional gene sets, while upstream regulator analysis coupled with Western blotting suggests that abnormal basal activation of the NFĸB pathway plays a key role in mediating these transcriptional changes. That HD myeloid cells have a proinflammatory phenotype in the absence of stimulation is consistent with a priming effect of mutant huntingtin, whereby basal dysfunction leads to an exaggerated inflammatory response once a stimulus is encountered. These data advance our understanding of mutant huntingtin pathogenesis, establish resting myeloid cells as a key source of HD immune dysfunction, and further demonstrate the importance of systemic immunity in the potential treatment of HD and the wider study of neurodegeneration.
Also flagged:chronic liver diseaseirongenetic diseasetransferrin receptor 2HAMPSLC40A1
Journal Article2016-05-11✓ 5 SnippetsZoller H, Henninger B.
In-Text Gene Mentions
Abstract)
…Molecular and clinical genetic studies have led to the identification of genes other than HFE in patients with inherited diseases associated with increased hepatic iron storage that can cause hemochromatosis, which adds complexity to a diagnostic approach to patients with suspected hemochromatosis.…
Abstract)
…Although associated with homozygosity for the C282Y polymorphism in the HFE gene in >80% of patients, hemochromatosis is a complex genetic disease with strong environmental disease modifiers.…
Title)
…and Treatment ofHemochromatosis.…
Abstract)
…Hemochromatosisis a common…
Abstract)
…liver disease andHFEgenotyping allows decisive…
Show Full Abstract
Hemochromatosis is a common cause of chronic liver disease and HFE genotyping allows decisive and non-invasive diagnosis. Molecular and clinical genetic studies have led to the identification of genes other than HFE in patients with inherited diseases associated with increased hepatic iron storage that can cause hemochromatosis, which adds complexity to a diagnostic approach to patients with suspected hemochromatosis. Despite major advances in genetics, hepatic iron quantification by non-invasive methods therefore remains the key to the diagnosis of hemochromatosis. Although associated with homozygosity for the C282Y polymorphism in the HFE gene in >80% of patients, hemochromatosis is a complex genetic disease with strong environmental disease modifiers. Testing for mutations in the non-HFE hemochromatosis genes transferrin receptor 2, hemojuvelin, HAMP and SLC40A1 is complex, costly and time-consuming. Demonstration of hepatic iron overload by liver biopsy or MRI is therefore required before such complex tests are carried out. The pathogenesis of chronic liver disease in hemochromatosis is mainly attributed to the redox potential of tissue iron, and only the more recent studies have focused on the toxic properties of circulating iron. Considering the fact that an increased saturation of transferrin and high iron in plasma are the hallmark of all hemochromatosis forms, an alternative view would be that toxic iron in the circulation is involved in the pathogenesis of hemochromatosis. Recent studies have shown an increased concentration of redox-active iron in plasma in patients with increased transferrin saturation. This finding supports the hypothesis that tissue iron may be the 'smoking gun' of iron-induced organ damage. Taken together, caring for patients with suspected or established hemochromatosis still remains a challenge, where understanding the genetics, biochemistry and cell biology of hemochromatosis will aid better diagnosis and treatment of affected individuals.
<h4>Background</h4>Campylobacter species are recognized as the most common cause of foodborne bacterial gastroenteritis in humans. In this study nine Campylobacter strains isolated from chicken meat and pork in Hanoi, Vietnam, were characterized using molecular methods and tested for antibiotic resistance.<h4>Results</h4>The nine isolates (eight C. jejuni and one C. coli) were identified by multiplex PCR, and tested for the presence or absence of 29 gene loci associated with virulence, lipooligosaccharide (LOS) biosynthesis and further functions. flaA typing, multilocus sequence typing and microarray assay investigation showed a high degree of genetic diversity among these isolates. In all isolates motility genes (flaA, flaB, flhA, fliM), colonization associated genes (cadF, docB), toxin production genes (cdtA, cdtB, secD, secF), and the LOS biosynthesis gene pglB were detected. Eight gene loci (fliY, virB11, Cje1278, Cj1434c, Cj1138, Cj1438c, Cj1440c, Cj1136) could not be detected by PCR. A differing presence of the gene loci ciaB (22.2 %), Cje1280 (77.8 %), docC (66.7 %), and cgtB (55.6 %) was found. iamA, cdtC, and the type 6 secretion system were present in all C. jejuni isolates but not in C. coli. flaA typing resulted in five different genotypes within C. jejuni, MLST classified the isolates into seven sequence types (ST-5155, ST-6736, ST-2837, ST-4395, ST-5799, ST-4099 and ST-860). The microarray assay analysis showed a high genetic diversity within Vietnamese Campylobacter isolates which resulted in eight different types for C. jejuni. Antibiotic susceptibility profiles showed that all isolates were sensitive to gentamicin and most isolates (88.8 %) were sensitive to chloramphenicol, erythromycin and streptomycin. Resistance rates to nalidixic acid, tetracycline and ciprofloxacin were 88.9, 77.8 and 66.7 %, respectively.<h4>Conclusions</h4>To the best of our knowledge, this study is the first report that shows high genetic diversity and remarkable antibiotic resistance of Campylobacter strains isolated from meat in Vietnam which can be considered of high public health significance. These preliminary data show that large scale screenings are justified to assess the relevance of Campylobacter infections on human health in Vietnam.
Also flagged:lumeninfertiledutasteride5α-reductaseβ-defensinsDefb2
Journal Article2016-05-11✓ 4 SnippetsXie SW, Li GT, Qu LJ, Cao Y, Wang Q, Zhou JY, Zhong RH, Guo XJ, Zhu Y.
In-Text Gene Mentions
Discussion)
…Our iTRAQ and ELISA results suggested that dutasteride could alter the expression of Gpx5 and Prdx6 in the fluids.…
Results)
…Gpx5 andPrdx6play an important…
Discussion)
…Gpx5 andPrdx6were secreted from…
Discussion)
…of Gpx5 andPrdx6in the fluids.…
Show Full Abstract
<h4>Background</h4>Spermatozoa become mature and acquire fertilizing capacity during their passage through the epididymal lumen. In this study, we identified new epididymal luminal fluid proteins involved in sperm maturation in infertile rats by dutasteride, a dual 5α-reductase inhibitor, in order to provide potential epididymal targets for new contraceptives and infertility treatment.<h4>Methods</h4>Male rats were treated with dutasteride for 28 consecutive days. We observed the protein expression profiles in the epididymal luminal fluids in infertile and normal rats using isobaric tags for relative and absolute quantitation (iTRAQ) technique. The confidence of proteome data was validated by enzyme-linked immunosorbent assays.<h4>Results</h4>1045 proteins were tested, and 23 of them presented different expression profiling in the infertile and normal rats. The seven proteins were down-regulated, and 16 proteins were up-regulated. Among the seven proteins which were significantly down-regulated by dutasteride in the epididymal luminal fluids, there were three β-defensins (Defb2, Defb18 and Defb39), which maybe the key proteins involved in epididymal sperm maturation and male fertility.<h4>Conclusions</h4>We report for the first time that dutasteride influences the protein expression profiling in the epididymal luminal fluids of rats, and this result provides some new epididymal targets for male contraception and infertility therapy.
Also flagged:Schizophreniapsychiatric disordercognitionpsychiatric diseasesgene expressionpsychiatric illness
Journal Article2016-05-11No SnippetsCariaga-Martinez A, Saiz-Ruiz J, Alelú-Paz R.
Show Full Abstract
Schizophrenia is a complex psychiatric disorder characterized by the presence of positive, negative, and cognitive symptoms that lacks a unifying neuropathology. In the present paper, we will review the current understanding of molecular dysregulation in schizophrenia, including genetic and epigenetic studies. In relation to the latter, basic research suggests that normal cognition is regulated by epigenetic mechanisms and its dysfunction occurs upon epigenetic misregulation, providing new insights into missing heritability of complex psychiatric diseases, referring to the discrepancy between epidemiological heritability and the proportion of phenotypic variation explained by DNA sequence difference. In schizophrenia the absence of consistently replicated genetic effects together with evidence for lasting changes in gene expression after environmental exposures suggest a role of epigenetic mechanisms. In this review we will focus on epigenetic modifications as a key mechanism through which environmental factors interact with individual's genetic constitution to affect risk of psychotic conditions throughout life.
Also flagged:gene expressiontranscription factorspenicillinstreptomycin
Journal Article2016-05-11No SnippetsZhang J, Xue X, Xu Y, Zhang Y, Li Z, Wang H.
Show Full Abstract
Hypothermia is widely used in neurosurgery and cardiac surgeries. However, little is known about the underlying molecular mechanisms. We previously reported that the transcriptome responses of cardiomyocyte exposed to hypothermia, "The transcriptome responses of cardiomyocyte exposed to hypothermia" [4]. Herein, we provide the hypothermia inhibited proliferation of cardiomyocyte cells in vitro and the details of transcription factors in regulation of differentially expressed genes.
Also flagged:infectionsmicrocephalyneurological diseasesdeathbrain malformationsconjunctivitis
Journal Article2016-05-11No SnippetsCugola FR, Fernandes IR, Russo FB, Freitas BC, Dias JL, Guimarães KP, Benazzato C, Almeida N, Pignatari GC, Romero S, Polonio CM, Cunha I, Freitas CL, Brandão WN, Rossato C, Andrade DG, Faria Dde P, Garcez AT, Buchpigel CA, Braconi CT, Mendes E, Sall AA, Zanotto PM, Peron JP, Muotri AR, Beltrão-Braga PC.
Show Full Abstract
Zika virus (ZIKV) is an arbovirus belonging to the genus Flavivirus (family Flaviviridae) and was first described in 1947 in Uganda following blood analyses of sentinel Rhesus monkeys. Until the twentieth century, the African and Asian lineages of the virus did not cause meaningful infections in humans. However, in 2007, vectored by Aedes aegypti mosquitoes, ZIKV caused the first noteworthy epidemic on the Yap Island in Micronesia. Patients experienced fever, skin rash, arthralgia and conjunctivitis. From 2013 to 2015, the Asian lineage of the virus caused further massive outbreaks in New Caledonia and French Polynesia. In 2013, ZIKV reached Brazil, later spreading to other countries in South and Central America. In Brazil, the virus has been linked to congenital malformations, including microcephaly and other severe neurological diseases, such as Guillain-Barré syndrome. Despite clinical evidence, direct experimental proof showing that the Brazilian ZIKV (ZIKV(BR)) strain causes birth defects remains absent. Here we demonstrate that ZIKV(BR) infects fetuses, causing intrauterine growth restriction, including signs of microcephaly, in mice. Moreover, the virus infects human cortical progenitor cells, leading to an increase in cell death. We also report that the infection of human brain organoids results in a reduction of proliferative zones and disrupted cortical layers. These results indicate that ZIKV(BR) crosses the placenta and causes microcephaly by targeting cortical progenitor cells, inducing cell death by apoptosis and autophagy, and impairing neurodevelopment. Our data reinforce the growing body of evidence linking the ZIKV(BR) outbreak to the alarming number of cases of congenital brain malformations. Our model can be used to determine the efficiency of therapeutic approaches to counteracting the harmful impact of ZIKV(BR) in human neurodevelopment.
Also flagged:Down Syndromegene expressionBDKRB1LTA4Hchromosomeinflammatory response
Journal Article2016-05-11No SnippetsSilva CR, Biselli-Périco JM, Zampieri BL, Silva WA, de Souza JE, Bürger MC, Goloni-Bertollo EM, Pavarino ÉC.
Show Full Abstract
<h4>Objective</h4>The aim of the study was to investigate the expression patterns of a specific set of genes involved in the inflammation process in children with Down Syndrome (DS) and children without the syndrome (control group) to identify differences that may be related to the immune abnormalities observed in DS individuals.<h4>Method</h4>RNA samples were obtained from peripheral blood, and gene expression was quantified using the TaqMan® Array Plate Human Inflammation Kit, which facilitated the investigation into 92 inflammation-related genes and four reference genes using real-time polymerase chain reaction (qPCR).<h4>Results</h4>Twenty genes showed differential expression in children with DS; 12 were overexpressed (PLA2G2D, CACNA1D, ALOX12, VCAM1, ICAM1, PLCD1, ADRB1, HTR3A, PDE4C, CASP1, PLA2G5, and PLCB4), and eight were underexpressed (LTA4H, BDKRB1, ADRB2, CD40LG, ITGAM, TNFRSF1B, ITGB1, and TBXAS1). After statistically correcting for the false discovery rate, only the genes BDKRB1 and LTA4H showed differential expression, and both were underexpressed within the DS group.<h4>Conclusion</h4>DS children showed differential expression of inflammation-related genes that were not located on chromosome 21 compared with children without DS. The BDKRB1 and LTA4H genes may differentiate the case and control groups based on the inflammatory response, which plays an important role in DS pathogenesis.
Background. Based on recent basic and clinical investigations, the extract of artichoke (Cynara scolymus) leaf has been revealed to be used for hepatoprotective and cholesterol reducing purposes. We aimed to assess the therapeutic effects of artichoke on biochemical and liver biomarkers in patients with nonalcoholic steatohepatitis (NASH). Methods. In a randomized double blind clinical trial, 60 consecutive patients suffering NASH were randomly assigned to receive Cynara scolymus extract (as 6 tablets per day consisting of 2700 mg extract of the herb) as the intervention group or placebo as the control group for two months. Results. Comparing changes in study markers following interventions showed improvement in liver enzymes. The levels of triglycerides and cholesterol were significantly reduced in the group treated with Cynara scolymus when compared to placebo group. To compare the role of Cynara scolymus use with placebo in changes in study parameters, multivariate linear regression models were employed indicating higher improvement in liver enzymes and also lipid profile particularly triglycerides and total cholesterol following administration of Cynara scolymus in comparison with placebo use. Conclusion. This study sheds light on the potential hepatoprotective activity and hypolipidemic effect of Cynara scolymus in management of NASH. This clinical trial is registered in the IRCT, Iranian Registry of Clinical Trials, by number IRCT2014070218321N1.
Also flagged:Temozolomideglioblastoma multiformeGBMastrocytomasMGMTimidazotetrazine
Journal Article2016-05-11✓ 1 SnippetLee SY.
In-Text Gene Mentions
S I O 001029)
…Interestingly, we observed that all but one (LN-18) of the TMZ resistant GBM cells we have studied have a mutation in the HFE gene22 which functions in iron homeostasis.…
Show Full Abstract
Temozolomide (TMZ) is an oral alkylating agent used to treat glioblastoma multiforme (GBM) and astrocytomas. However, at least 50% of TMZ treated patients do not respond to TMZ. This is due primarily to the over-expression of O<sup>6</sup>-methylguanine methyltransferase (MGMT) and/or lack of a DNA repair pathway in GBM cells. Multiple GBM cell lines are known to contain TMZ resistant cells and several acquired TMZ resistant GBM cell lines have been developed for use in experiments designed to define the mechanism of TMZ resistance and the testing of potential therapeutics. However, the characteristics of intrinsic and adaptive TMZ resistant GBM cells have not been systemically compared. This article reviews the characteristics and mechanisms of TMZ resistance in natural and adapted TMZ resistant GBM cell lines. It also summarizes potential treatment options for TMZ resistant GBMs.
Also flagged:methylprednisolonegene expressionACTC1fatty acid metabolismsarcomereactin
Journal Article2016-05-10No SnippetsLiu Y, Wang Y, Teng Z, Zhang X, Ding M, Zhang Z, Chen J, Xu Y.
Show Full Abstract
BACKGROUND Spinal cord injury (SCI) is the most critical complication of spinal injury. We aimed to identify differentially expressed genes (DEGs) and to find associated pathways that may function as targets for SCI prognosis and therapy. MATERIAL AND METHODS Seven gene microarray expression profiles, downloaded from the GEO database (ID: GSE33886), were used to screen the DEGs of leg tissue and to compare these between SCI patients and corresponding normal specimens. Then, GO enrichment analysis was performed on these selected DEGs. Afterwards, interactions among these DEGs were analyzed by String database and then a PPI network was constructed to obtain topology character and modules in the PPI network. Finally, roles of the critical proteins in the pathway were explained by comparing the enrichment results of the genes in sub-modules and all the DEGs. RESULTS A total of 113 DEGs were determined. We found that 21 up-regulated genes were enriched in 7 biological processes, while 9 down-regulated genes were significantly enriched in 4 KEGG pathways. The PPI network was constructed, including 40 interacting genes and 73 interactions. Three obvious function modules were identified by exploring the PPI network, and ACTC1 was identified as the critical protein in the 3 enriched signal pathways. However, no obvious difference was found in the signal pathway in which both the 11 genes in module 1 and all 113 DEGs participated. CONCLUSIONS Core proteins in the signal pathway associated with spinal cord injury may serve as potential prognostic and predictive markers for the diagnosis and treatment of spinal cord injury in clinical applications.
Journal Article2016-05-10No SnippetsUzun A, Schuster J, McGonnigal B, Schorl C, Dewan A, Padbury J.
Show Full Abstract
Understanding the genetic contribution(s) to the risk of preterm birth may lead to the development of interventions for treatment, prediction and prevention. Twin studies suggest heritability of preterm birth is 36-40%. Large epidemiological analyses support a primary maternal origin for recurrence of preterm birth, with little effect of paternal or fetal genetic factors. We exploited an "extreme phenotype" of preterm birth to leverage the likelihood of genetic discovery. We compared variants identified by targeted sequencing of women with 2-3 generations of preterm birth with term controls without history of preterm birth. We used a meta-genomic, bi-clustering algorithm to identify gene sets coordinately associated with preterm birth. We identified 33 genes including 217 variants from 5 modules that were significantly different between cases and controls. The most frequently identified and connected genes in the exome library were IGF1, ATM and IQGAP2. Likewise, SOS1, RAF1 and AKT3 were most frequent in the haplotype library. Additionally, SERPINB8, AZU1 and WASF3 showed significant differences in abundance of variants in the univariate comparison of cases and controls. The biological processes impacted by these gene sets included: cell motility, migration and locomotion; response to glucocorticoid stimulus; signal transduction; metabolic regulation and control of apoptosis.
Human factors/ergonomics recognises work as embedded in and shaped by levels of social, physical and organisational context. This study investigates the contextual or macroergonomic factors present in the health-related work performed by patients. We performed a secondary content analysis of findings from three studies of the work of chronically ill patients and their informal caregivers. Our resulting consolidated macroergonomic patient work system model identified 17 factors across physical, social and organisational domains and household and community levels. These factors are illustrated with examples from the three studies and discussed as having positive, negative or varying effects on health and health behaviour. We present three brief case studies to illustrate how macroergonomic factors combine across domains and levels to shape performance in expected and unexpected ways. Findings demonstrate not only the importance of context for patients' health-related activities but also specific factors to consider in future research, design and policy efforts. Practitioner Summary: Health-related activities of patients are embedded in and shaped by levels of social, physical and organisational context. This paper combined findings from three studies to specify 17 contextual or macroergonomic factors in home- and community-based work systems of chronically ill patients. These factors have research, design and policy implications.
Also flagged:Altered mental statusstrokeSubdural hemorrhageVolCerebral Venous Thrombosisdeath
Journal Article2016-05-10✓ 1 SnippetLee EJ, Noh SM, Kang DW, Kim JS, Kwon SU.
In-Text Gene Mentions
Methods)
…assays for D-dimer,antithrombin-III, proteins C and…
Show Full Abstract
<h4>Background and purpose</h4>Little is known about the relationships between provoking risk factors, prognosis, and optimal duration of anticoagulation in patients with cerebral venous thrombosis (CVT), especially in Asians. We aimed to investigate whether the prognosis and required duration of anticoagulation in CVT patients differ according to the provoking risk factors.<h4>Methods</h4>Prospectively recorded data from a tertiary medical center in South Korea were retrospectively reviewed. CVTs were categorized into three groups: unprovoked, those with possibly resolved provoking factors (PR), and those with persistent provoking factors (PP). The baseline characteristics, treatment, and prognosis of patients in these three groups were analyzed.<h4>Results</h4>From 2000 to 2015, 61 patients presented with CVT: 19 (31.1%) unprovoked, 11 (18.0%) with PR, and 31 (50.9%) with PP. The patients in our cohort had a slight female predominance and lower frequency of oral contraceptive use compared to Western cohorts. Median follow-up and duration of anticoagulation were 35 and 8 months, respectively. Despite the similarities in baseline characteristics, deaths (n=3; P=0.256) and recurrences (n=7; P=0.020) were observed only in the PP group. The median intervals to death and recurrence were 9 and 13 months, respectively. Death was associated with underlying disease activity, not with CVT progression. Recurrences in the PP group were associated with lack of anticoagulation (P=0.012).<h4>Conclusions</h4>Although the prognosis of CVT is generally benign in Koreans, recurrence and death were observed in patients with persistent risk factors, suggesting their need for long-term treatment with anticoagulants.
Also flagged:E2MMP-13IL-1βextracellular matrixmenopausal arthritisEstrogen
Journal Article2016-05-10✓ 1 SnippetLiang Y, Duan L, Xiong J, Zhu W, Liu Q, Wang D, Liu W, Li Z, Wang D.
In-Text Gene Mentions
Discussion)
…LSox5 andSox6can also control…
Show Full Abstract
<h4>Background</h4>Estrogen deficiency is closely related to the development of menopausal arthritis. Estrogen replacement therapy (ERT) shows a protective effect against the osteoarthritis. However, the underlying mechanism of this protective effect is unknown. This study aimed to determine the role of miR-140 in the estrogen-dependent regulation of MMP-13 in human chondrocytes.<h4>Methods</h4>Primary human articular chondrocytes were obtained from female OA patients undergoing knee replacement surgery. Normal articular chondrocytes were isolated from the knee joints of female donors after trauma and treated with interleukin-1 beta (IL-1β). Gene expression levels of miR-140, MMP-13, and ADAMTS-5 were detected by quantitative real-time PCR (qRT-PCR). miR-140 levels were upregulated or downregulated by transfecting cells with a miRNA mimic and inhibitor, respectively, prior to treatment with IL-1β. MMP-13 expression was then evaluated by Western blotting and immunofluorescence. Luciferase reporter assays were performed to verify the interaction between miR-140 and ER.<h4>Results</h4>17-β-estradiol (E2) suppressed MMP-13 expression in human articular chondrocytes. miR-140 expression was upregulated after estrogen treatment. Knockdown of miR-140 expression abolished the inhibitory effect of estrogen on MMP-13. In addition, the estrogen/ER/miR-140 pathway showed an inhibitory effect on IL-1β-induced cartilage matrix degradation.<h4>Conclusions</h4>This study suggests that estrogen acts via ER and miR-140 to inhibit the catabolic activity of proteases within the chondrocyte extracellular matrix. These findings provide new insight into the mechanism of menopausal arthritis and indicate that the ER/miR-140 signaling pathway may be a potential target for therapeutic interventions for menopausal arthritis.
Also flagged:MyosinMyosinsmyosin tail homology 4-band 4.1ezrinmoesinmembrane
Journal Article2016-05-10✓ 1 SnippetPlanelles-Herrero VJ, Blanc F, Sirigu S, Sirkia H, Clause J, Sourigues Y, Johnsrud DO, Amigues B, Cecchini M, Gilbert SP, Houdusse A, Titus MA.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
Myosins containing MyTH4-FERM (myosin tail homology 4-band 4.1, ezrin, radixin, moesin, or MF) domains in their tails are found in a wide range of phylogenetically divergent organisms, such as humans and the social amoeba Dictyostelium (Dd). Interestingly, evolutionarily distant MF myosins have similar roles in the extension of actin-filled membrane protrusions such as filopodia and bind to microtubules (MT), suggesting that the core functions of these MF myosins have been highly conserved over evolution. The structures of two DdMyo7 signature MF domains have been determined and comparison with mammalian MF structures reveals that characteristic features of MF domains are conserved. However, across millions of years of evolution conserved class-specific insertions are seen to alter the surfaces and the orientation of subdomains with respect to each other, likely resulting in new sites for binding partners. The MyTH4 domains of Myo10 and DdMyo7 bind to MT with micromolar affinity but, surprisingly, their MT binding sites are on opposite surfaces of the MyTH4 domain. The structural analysis in combination with comparison of diverse MF myosin sequences provides evidence that myosin tail domain features can be maintained without strict conservation of motifs. The results illustrate how tuning of existing features can give rise to new structures while preserving the general properties necessary for myosin tails. Thus, tinkering with the MF domain enables it to serve as a multifunctional platform for cooperative recruitment of various partners, allowing common properties such as autoinhibition of the motor and microtubule binding to arise through convergent evolution.
Also flagged:CNTN6ContactinCNTN5neuronal cell adhesion moleculesautism spectrum disordersattention-deficit/hyperactivity disorder
Journal Article2016-05-10No SnippetsMercati O, Huguet G, Danckaert A, André-Leroux G, Maruani A, Bellinzoni M, Rolland T, Gouder L, Mathieu A, Buratti J, Amsellem F, Benabou M, Van-Gils J, Beggiato A, Konyukh M, Bourgeois JP, Gazzellone MJ, Yuen RK, Walker S, Delépine M, Boland A, Régnault B, Francois M, Van Den Abbeele T, Mosca-Boidron AL, Faivre L, Shimoda Y, Watanabe K, Bonneau D, Rastam M, Leboyer M, Scherer SW, Gillberg C, Delorme R, Cloëz-Tayarani I, Bourgeron T.
Show Full Abstract
Contactin genes CNTN5 and CNTN6 code for neuronal cell adhesion molecules that promote neurite outgrowth in sensory-motor neuronal pathways. Mutations of CNTN5 and CNTN6 have previously been reported in individuals with autism spectrum disorders (ASDs), but very little is known on their prevalence and clinical impact. In this study, we identified CNTN5 and CNTN6 deleterious variants in individuals with ASD. Among the carriers, a girl with ASD and attention-deficit/hyperactivity disorder was carrying five copies of CNTN5. For CNTN6, both deletions (6/1534 ASD vs 1/8936 controls; P=0.00006) and private coding sequence variants (18/501 ASD vs 535/33480 controls; P=0.0005) were enriched in individuals with ASD. Among the rare CNTN6 variants, two deletions were transmitted by fathers diagnosed with ASD, one stop mutation CNTN6<sup>W923X</sup> was transmitted by a mother to her two sons with ASD and one variant CNTN6<sup>P770L</sup> was found de novo in a boy with ASD. Clinical investigations of the patients carrying CNTN5 or CNTN6 variants showed that they were hypersensitive to sounds (a condition called hyperacusis) and displayed changes in wave latency within the auditory pathway. These results reinforce the hypothesis of abnormal neuronal connectivity in the pathophysiology of ASD and shed new light on the genes that increase risk for abnormal sensory perception in ASD.
Also flagged:Vitamin Dmetabolismvitamin D deficiencycirrhosisaspartate aminotransferaseAST
Journal Article2016-05-10✓ 1 SnippetPilz S, Putz-Bankuti C, Gaksch M, Spindelboeck W, Haselberger M, Rainer F, Posch A, Kreuzer P, Stojakovic T, Stadlbauer V, Obermayer-Pietsch B, Stauber RE.
In-Text Gene Mentions
Results)
…5 patients, andhemochromatosisin 1 patient.…
Show Full Abstract
<h4>Background</h4>The liver is crucial for 25-hydroxyvitamin D (25(OH)D) metabolism, and vitamin D deficiency is highly prevalent in patients with cirrhosis and predicts adverse outcomes. We aimed to evaluate whether vitamin D supplementation in patients with cirrhosis is effective in increasing 25(OH)D serum concentrations. Secondary outcome measures included liver function tests (aspartate aminotransferase (AST), alanine aminotransferase (ALT), gamma glutamyltransferase (GGT), and alkaline phosphatase (AP)), albumin, International Normalized Ratio (INR), bilirubin, the liver fibrosis marker hyaluronic acid, and parameters of mineral metabolism including parathyroid hormone (PTH).<h4>Methods</h4>This is a double-center, double-blind, placebo-controlled study conducted from December 2013 to May 2014 at the Medical University of Graz, and the hospital Hoergas-Enzenbach, Austria. We enrolled 36 consecutive patients with cirrhosis and 25(OH)D concentrations below 30 ng/mL. Study participants were randomly allocated to receive either 2800 International Units of vitamin D3 per day as oily drops (n = 18) or placebo (n = 18) for 8 weeks.<h4>Results</h4>Thirty-three study participants (mean (SD) age: 60 (9) years; 21% females; 25(OH)D: 15.6 (7.4) ng/mL) completed the trial. The mean treatment effect (95% CI) for 25(OH)D was 15.2 (8.0 to 22.4) ng/mL (p < 0.001). There was no significant effect on any secondary outcome.<h4>Conclusions</h4>In this randomized controlled trial, vitamin D supplementation increases 25(OH)D serum concentrations, even in cirrhotic patients.
<h4>Background</h4>During the past two decades, external-beam radiation technology has substantially changed from traditional two-dimensional to conformal three-dimensional to intensity-modulated planning and stereotactic body radiotherapy (SBRT).<h4>Summary</h4>Modern techniques of radiotherapy (RT) are highly focused and capable of delivering an ablative dose to targeted hepatocellular carcinoma (HCC) tumors. SBRT is an option for selected patients with limited tumor volume and non-eligibility for other invasive treatments. Moreover, RT combined with a radiation sensitizer (RS) to increase the therapeutic ratio has shown promising results in select studies, prompting further investigation of this combination. With the undetermined role of RT in treatment guidelines and variation in patterns of treatment failure after RT in patient with HCC, useful biomarkers to guide RT decision-making and selection of patients are needed and emerging.<h4>Key message</h4>The objective of this review is to summarize the current RS with SBRT schemes and biomarkers for patient selection used to maximize the effect of RT on HCC.
Journal Article2016-05-09No SnippetsSreenilayam SP, Panarin YP, Vij JK, Panov VP, Lehmann A, Poppe M, Prehm M, Tschierske C.
Show Full Abstract
Liquid crystals (LCs) represent one of the foundations of modern communication and photonic technologies. Present display technologies are based mainly on nematic LCs, which suffer from limited response time for use in active colour sequential displays and limited image grey scale. Herein we report the first observation of a spontaneously formed helix in a polar tilted smectic LC phase (SmC phase) of achiral bent-core (BC) molecules with the axis of helix lying parallel to the layer normal and a pitch much shorter than the optical wavelength. This new phase shows fast (∼30 μs) grey-scale switching due to the deformation of the helix by the electric field. Even more importantly, defect-free alignment is easily achieved for the first time for a BC mesogen, thus providing potential use in large-scale devices with fast linear and thresholdless electro-optical response.
Also flagged:chromosomescell cycleanaphasemitosisChromosometissue development
Journal Article2016-05-09✓ 2 SnippetsStormo BM, Fox DT.
In-Text Gene Mentions
Introduction)
…be removed byCondensinII activity (…
Results)
…cells expressing theDCCcomplex protein MSL3…
Show Full Abstract
Duplicating chromosomes once each cell cycle produces sister chromatid pairs, which separate accurately at anaphase. In contrast, reduplicating chromosomes without separation frequently produces polytene chromosomes, a barrier to accurate mitosis. Chromosome reduplication occurs in many contexts, including: polytene tissue development, polytene tumors, and following treatment with mitosis-blocking chemotherapeutics. However, mechanisms responding to or resolving polyteny during mitosis are poorly understood. Here, using Drosophila, we uncover two distinct reduplicated chromosome responses. First, when reduplicated polytene chromosomes persist into metaphase, an anaphase delay prevents tissue malformation and apoptosis. Second, reduplicated polytene chromosomes can also separate prior to metaphase through a spindle-independent mechanism termed Separation-Into-Recent-Sisters (SIRS). Both reduplication responses require the spindle assembly checkpoint protein Mad2. While Mad2 delays anaphase separation of metaphase polytene chromosomes, Mad2's control of overall mitotic timing ensures efficient SIRS. Our results pinpoint mechanisms enabling continued proliferation after genome reduplication, a finding with implications for cancer progression and prevention.
Also flagged:Trbpheart failuremyogenesisMuscle Differentiationmyoblast differentiationlocomotion
Journal Article2016-05-09✓ 5 SnippetsDing J, Nie M, Liu J, Hu X, Ma L, Deng ZL, Wang DZ.
In-Text Gene Mentions
Introduction)
…the transcription factorSox6.…
Results)
…our previous study,Sox6is a key…
Results)
…We analyzedSox6mRNA level in…
Results)
…of Trbp onSox6and its downstream…
Results)
…Trbp affects neitherSox6expression nor the…
Show Full Abstract
Global inactivation of Trbp, a regulator of miRNA pathways, resulted in developmental defects and postnatal lethality in mice. Recently, we showed that cardiac-specific deletion of Trbp caused heart failure. However, its functional role(s) in skeletal muscle has not been characterized. Using a conditional knockout model, we generated mice lacking Trbp in the skeletal muscle. Unexpectedly, skeletal muscle specific Trbp mutant mice appear to be phenotypically normal under normal physiological conditions. However, these mice exhibited impaired muscle regeneration and increased fibrosis in response to cardiotoxin-induced muscle injury, suggesting that Trbp is required for muscle repair. Using cultured myoblast cells we further showed that inhibition of Trbp repressed myoblast differentiation in vitro. The impaired myogenesis is associated with reduced expression of muscle-specific miRNAs, miR-1a and miR-133a. Together, our study demonstrated that Trbp participates in the regulation of muscle differentiation and regeneration.
Also flagged:chondrogenesischondrocyte hypertrophycartilage developmentNotchtranscription factorsHES1
Journal Article2016-05-09✓ 1 SnippetRutkowski TP, Kohn A, Sharma D, Ren Y, Mirando AJ, Hilton MJ.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
RBPjκ-dependent Notch signaling regulates multiple processes during cartilage development, including chondrogenesis, chondrocyte hypertrophy and cartilage matrix catabolism. Select members of the HES- and HEY-families of transcription factors are recognized Notch signaling targets that mediate specific aspects of Notch function during development. However, whether particular HES and HEY factors play any role(s) in the processes during cartilage development is unknown. Here, for the first time, we have developed unique in vivo genetic models and in vitro approaches demonstrating that the RBPjκ-dependent Notch targets HES1 and HES5 suppress chondrogenesis and promote the onset of chondrocyte hypertrophy. HES1 and HES5 might have some overlapping function in these processes, although only HES5 directly regulates Sox9 transcription to coordinate cartilage development. HEY1 and HEYL play no discernable role in regulating chondrogenesis or chondrocyte hypertrophy, whereas none of the HES or HEY factors appear to mediate Notch regulation of cartilage matrix catabolism. This work identifies important candidates that might function as downstream mediators of Notch signaling both during normal skeletal development and in Notch-related skeletal disorders.
Also flagged:BIG1BIG2cell-cell adhesionWntbrefeldin Aguanine nucleotide-exchange factors 1
Journal Article2016-05-09No SnippetsLi CC, Le K, Kato J, Moss J, Vaughan M.
Show Full Abstract
Multifunctional β-catenin, with critical roles in both cell-cell adhesion and Wnt-signaling pathways, was among HeLa cell proteins coimmunoprecipitated by antibodies against brefeldin A-inhibited guanine nucleotide-exchange factors 1 and 2 (BIG1 or BIG2) that activate ADP-ribosylation factors (Arfs) by accelerating the replacement of bound GDP with GTP. BIG proteins also contain A-kinase anchoring protein (AKAP) sequences that can act as scaffolds for multimolecular assemblies that facilitate and limit cAMP signaling temporally and spatially. Direct interaction of BIG1 N-terminal sequence with β-catenin was confirmed using yeast two-hybrid assays and in vitro synthesized proteins. Depletion of BIG1 and/or BIG2 or overexpression of guanine nucleotide-exchange factor inactive mutant, but not wild-type, proteins interfered with β-catenin trafficking, leading to accumulation at perinuclear Golgi structures. Both phospholipase D activity and vesicular trafficking were required for effects of BIG1 and BIG2 on β-catenin activation. Levels of PKA-phosphorylated β-catenin S675 and β-catenin association with PKA, BIG1, and BIG2 were also diminished after BIG1/BIG2 depletion. Inferring a requirement for BIG1 and/or BIG2 AKAP sequence in PKA modification of β-catenin and its effect on transcription activation, we confirmed dependence of S675 phosphorylation and transcription coactivator function on BIG2 AKAP-C sequence.
Also flagged:Gene Expressionmalformations of the penishypospadiasmembranelumentubulogenesis
Journal Article2016-05-09No SnippetsArmfield BA, Seifert AW, Zheng Z, Merton EM, Rock JR, Lopez MC, Baker HV, Cohn MJ.
Show Full Abstract
<h4>Purpose</h4>Lower urinary tract malformations are among the most common congenital anomalies in humans. Molecular genetic studies of mouse external genital development have begun to identify mechanisms that pattern the genital tubercle and orchestrate urethral tubulogenesis. The urethral plate epithelium is an endodermal signaling region that has an essential role in external genital development. However, little is known about the molecular identity of this cell population or the genes that regulate its activity.<h4>Materials and methods</h4>We used microarray analysis to characterize differences in gene expression between urethral plate epithelium and surrounding tissue in mouse genital tubercles. In situ hybridizations were performed to map gene expression patterns and ToppCluster (https://toppcluster.cchmc.org/) was used to analyze gene associations.<h4>Results</h4>A total of 84 genes were enriched at least 20-fold in urethral plate epithelium relative to surrounding tissue. The majority of these genes were expressed throughout the urethral plate in males and females at embryonic day 12.5 when the urethral plate is known to signal. Functional analysis using ToppCluster revealed genetic pathways with known functions in other organ systems but unknown roles in external genital development. Additionally, a 3-dimensional molecular atlas of genes enriched in urethral plate epithelium was generated and deposited at the GUDMAP (GenitoUrinary Development Molecular Anatomy Project) website (http://gudmap.org/).<h4>Conclusions</h4>We identified dozens of genes previously unknown to be expressed in urethral plate epithelium at a crucial developmental period. It provides a novel panel of genes for analysis in animal models and in humans with external genital anomalies.
Also flagged:BDNFNPSR1anxietydepressionserotonin transporterbrain-derived neurotrophic factor
Journal Article2016-05-09✓ 5 SnippetsYang Y, Zhao M, Zhang Y, Shen X, Yuan Y.
In-Text Gene Mentions
S I O 001029)
…The interaction between 5-HTT (LL) and BDNF (A+) appeared to increase the risk of anxiety, whereas the interaction between BDNF (A+, GG) and NPSR1 (AA, T+) appeared to increase the risk of depression in asthmatic patients.…
Abstract)
…The interaction between 5-HTT (LL) and BDNF (A+) increased the risk of anxiety, and the interaction between BDNF (A+, GG) and NPSR1 (AA, T+) increased the risk of depression in asthmatic patients.…
Results)
…Scheirer-Ray-Hare analysis demonstrated that the anxiety score was significantly affected by the interactions between 5-HTT (LL, S+) and BDNF (A+, GG) (H=5.99, P=0.015), as shown in Table VII.…
Introduction)
…To the best of our knowledge, the association of NPSR1, BDNF and 5-HTT gene polymorphisms with anxiety or depression in asthmatic patients has not been previously examined.…
Abstract)
…In the present study, we aimed to explore the association of serotonin transporter (5-HTT), brain-derived neurotrophic factor (BDNF) and neuropeptide S receptor 1 (NPSR1) gene polymorphisms with anxiety and depression in asthmatic patients.…
Show Full Abstract
Asthmatic patients are known to have a higher risk of anxiety and depression. In the present study, we aimed to explore the association of serotonin transporter (5-HTT), brain-derived neurotrophic factor (BDNF) and neuropeptide S receptor 1 (NPSR1) gene polymorphisms with anxiety and depression in asthmatic patients. This was a cross-sectional study conducted on 143 asthmatic patients and 175 healthy volunteers. Of the asthmatic patients, 49 suffered from anxiety and 12 exhibited signs of depression. Patients with a lower level of education were more prone to depression. Both anxiety and depression were associated with poor asthma control as evaluated by the Asthma Control Test (ACT) score. The association of single nucleotide polymorphisms of BDNF, NPSR1 and 5-HTT with anxiety and depression in asthamtic patients was evaluated. The distribution of 5-HTT gene polymorphisms in the healthy group, the group with asthma but without anxiety, and the group with asthma and anxiety had significant differences. Females with asthma and anxiety were more prone to BDNF polymorphism. Also, BDNF gene distribution exhibited significant differences among those in the healthy group, the group with asthma but no depression, and the group with asthma and depression; however, NPSR1 gene distribution did not vary greatly between the groups. The anxiety score was significantly affected by the interaction between 5-HTT (LL, S+) and BDNF (A+, GG) (H=5.99, P=0.015). The depression score was significantly affected by the interaction between BDNF (A+, GG) and NPSR1 (AA, T+). We noted that both anxiety and depression led to poor asthma control. The interaction between 5-HTT (LL) and BDNF (A+) increased the risk of anxiety, and the interaction between BDNF (A+, GG) and NPSR1 (AA, T+) increased the risk of depression in asthmatic patients.
To measure the testicular toxicity of two fungicides (carbendazim and iprodione), alone or in a mixture, we used a rat ex vivo model of seminiferous tubules, greatly reducing the number of rodents used, in accordance with the 3R rule (Replacement, Reduction, and Refinement). This model allows the representation of puberty, a critical life period with regard to endocrine disruptors. The cellular modifications were followed for three weeks through transcriptomic and proteomic profiling analysis. A quantitative and comparative method was developed to estimate how known pathways were disturbed by each substance. This pathway-driven analysis revealed a strong alteration of steroidogenesis and an impairment of meiosis in all cases, albeit the initial molecular events were different for both substances. The ex vivo cytogenetic analysis confirmed that both fungicides alter the course of the first meiotic prophase. In addition, the mixture of both substances triggered effects greater than the sum of their cumulative effects and compromised future sperm motility after a shorter time of exposure compared with the fungicides tested separately. The alliance of an ex vivo culture with "omics" strategies complemented with a physiological examination is a powerful combination of tools for testing substances, separately or in a mixture, for their testicular toxicity. In particular, proteomics allowed the identification of systematically differentially expressed proteins in the secretomes of exposed cultures, such as FUCO and PEBP1, two proteins linked with the motility and fertilizing ability of spermatozoa, respectively. These proteins may be potential biomarkers of testicular dysfunction and infertility.
Also flagged:Transglutaminase type 2vesiclespathogenesiscancerneurodegenerative diseasesTissue transglutaminase
Journal Article2016-05-08No SnippetsDiaz-Hidalgo L, Altuntas S, Rossin F, D'Eletto M, Marsella C, Farrace MG, Falasca L, Antonioli M, Fimia GM, Piacentini M.
Show Full Abstract
Numerous studies are revealing a role of exosomes in intercellular communication, and growing evidence indicates an important function for these vesicles in the progression and pathogenesis of cancer and neurodegenerative diseases. However, the biogenesis process of exosomes is still unclear. Tissue transglutaminase (TG2) is a multifunctional enzyme with different subcellular localizations. Particularly, under stressful conditions, the enzyme has been also detected in the extracellular matrix, but the mechanism(s) by which TG2 is released outside the cells requires further investigation. Therefore, the goal of the present study was to determine whether exosomes might be a vehicle for TG2 to reach the extracellular space, and whether TG2 could be involved in exosomes biogenesis. To address this issue, we isolated and characterized exosomes derived from cells either expressing or not TG2, under stressful conditions (i.e. proteasome impairment or expressing a mutated form of huntingtin (mHtt) containing 84 polyglutamine repeats). Our results show that TG2 is present in the exosomes only upon proteasome blockade, a condition in which TG2 interacts with TSG101 and ALIX, two key proteins involved in exosome biogenesis. Interestingly, we found that TG2 favours the assembly of a protein complex including mHtt, ALIX, TSG101 and BAG3, a co-chaperone involved in the clearance of mHtt. The formation of this complex is paralleled by the selective recruitment of mHtt and BAG3 in the exosomes derived from TG2 proficient cells only. Overall, our data indicate that TG2 is an important player in the biogenesis of exosomes controlling the selectivity of their cargo under stressful cellular conditions. In addition, these vesicles represent the way by which cells can release TG2 into the extracellular space under proteostasis impairment.
Also flagged:PropolisGlucoseOxygengalactosesugarcataracts
Journal Article2016-05-08✓ 1 SnippetShibata T, Shibata S, Shibata N, Kiyokawa E, Sasaki H, Singh DP, Kubo E.
In-Text Gene Mentions
Discussion)
…therapeutic potential ofPrdx6as an antioxidant…
Show Full Abstract
Purpose. This study investigated the effects of oral propolis on the progression of galactose-induced sugar cataracts in rats and the in vitro effects of propolis on high-glucose-induced reactive oxygen species (ROS) and cell death in cultured rat lens cells (RLECs). Methods. Galactose-fed rats and RLECs cultured in high glucose (55 mM) medium were treated with propolis or vehicle control. Relative lens opacity was assessed by densitometry and changes in lens morphology by histochemical analysis. Intracellular ROS levels and cell viability were measured. Results. Oral administration of propolis significantly inhibited the onset and progression of cataract in 15% and 25% of galactose-fed rats, respectively. RLECs cultured with high glucose showed a significant increase in ROS expression with reduced cell viability. Treatment of these RLECs with 5 and 50 μg/mL propolis cultured significantly reduced ROS levels and increased cell viability, indicating that the antioxidant activity of propolis protected cells against ROS-induced damage. Conclusion. Propolis significantly inhibited the onset and progression of sugar cataract in rats and mitigated high-glucose-induced ROS production and cell death. These effects may be associated with the ability of propolis to inhibit hyperglycemia-evoked oxidative or osmotic stress-induced cellular insults.
Also flagged:lung cancerrespiratory diseasescardiovascular diseasesgastrointestinal diseasescardiovascular diseaseDSP
Journal Article2016-05-08✓ 3 SnippetsZhang Q, Zhang PW, Cai YD.
In-Text Gene Mentions
Results)
…Table 3 lists the maximum interaction scores and permutation FDRs of selected genes related to cardiovascular diseases, from which we can see that the total of 18 genes related to cardiovascular diseases were identified to be closely related to PM2.5 by our method. Here, some genes that are most relevant to PM2.5 would be discussed. For example, gene DSP (desmoplakin, a component of functional desmosomes) plays a crucial role in intercellular junctions between adjacent cells. DSP is significantly related to PM2.5 gene JUP. Research has found that mutations in DSP can cause arrhythmogenic right ventricular dysplasia/cardiomyopathy (ARVD/C) and increase risk of sudden death. More importantly, mutations of JUP itself have also been identified in patients with ARVD/C [36], which further explains that PM2.5 might increase risks of cardiovascular diseases. Another example is PTGS2. The abnormal expression of PTGS2 is found when cells are exposed to PM2.5, and the PM2.5 gene PTGS2 is related to PTGIS (a member of the cytochrome P450 superfamily of enzymes), which encodes monooxygenases that are involved in synthesis of lipids, such as cholesterol and steroids. Patients who are at high risks of developing stroke and myocardial infarction often have mutations in PTGS2 or abnormal expression of PTGIS [37].…
Results)
…is related toPTGIS(a member of…
Results)
…abnormal expression ofPTGIS[ 37 ].…
Show Full Abstract
Nowadays, pollution levels are rapidly increasing all over the world. One of the most important pollutants is PM2.5. It is known that the pollution environment may cause several problems, such as greenhouse effect and acid rain. Among them, the most important problem is that pollutants can induce a number of serious diseases. Some studies have reported that PM2.5 is an important etiologic factor for lung cancer. In this study, we extensively investigate the associations between PM2.5 and 22 disease classes recommended by Goh et al., such as respiratory diseases, cardiovascular diseases, and gastrointestinal diseases. The protein-protein interactions were used to measure the linkage between disease genes and genes that have been reported to be modulated by PM2.5. The results suggest that some diseases, such as diseases related to ear, nose, and throat and gastrointestinal, nutritional, renal, and cardiovascular diseases, are influenced by PM2.5 and some evidences were provided to confirm our results. For example, a total of 18 genes related to cardiovascular diseases are identified to be closely related to PM2.5, and cardiovascular disease relevant gene DSP is significantly related to PM2.5 gene JUP.
<h4>Background</h4>The high mortality rate of hepatocellular carcinoma (HCC) is partly due to a lack of good diagnostic markers and treatment strategies. Recently, several microRNA (miRNA) profiling studies were conducted with HCC; however, their inconsistency means that their diagnostic or therapeutic value is debatable.<h4>Aims</h4>This study aims to systematically evaluate the consistency of miRNAs from multiple independent studies.<h4>Methods</h4>A systematic analysis of miRNAs from eligible publications was conducted, followed by real-time PCRs. The targets of highly consistent miRNAs were collected using online programs, followed by enrichment analyses for gene ontology terms and Kyoto encyclopedia of genes and genomes pathways.<h4>Results</h4>In total, 241 differentially expressed miRNAs were reported in 13 HCC profiling studies, of which 137 were upregulated and 104 downregulated. Among consistently upregulated miRNAs (cutoff > fourfold), miRNA-222, miRNA-21, miRNA-221, miRNA-210, and miRNA-224 were found increased in 8, 6, 6, 5, and 5 different studies, respectively. Among 137 downregulated miRNAs, miRNA-195, miRNA-199a, miRNA-125b, and miRNA-99a were reported in 8, 8, 5, and 5 studies, respectively. These results were confirmed by real-time PCR. Enrichment analyses demonstrated that programmed cell death and proliferation play important roles during the interplay of miRNA with HCC.<h4>Conclusions</h4>miRNAs most consistently related to HCC are oncomirs miRNA-221/222 and tumor suppressors miRNA-199a/195.
Also flagged:Endoplasmic reticulummitochondrialneurodegenerative diseasescalciumunfoldedlumen
Journal Article2016-05-07No SnippetsJoshi AU, Kornfeld OS, Mochly-Rosen D.
Show Full Abstract
Endoplasmic reticulum (ER) and mitochondrial function have both been shown to be critical events in neurodegenerative diseases. The ER mediates protein folding, maturation, sorting as well acts as calcium storage. The unfolded protein response (UPR) is a stress response of the ER that is activated by the accumulation of misfolded proteins within the ER lumen. Although the molecular mechanisms underlying ER stress-induced apoptosis are not completely understood, increasing evidence suggests that ER and mitochondria cooperate to signal cell death. Similarly, calcium-mediated mitochondrial function and dynamics not only contribute to ATP generation and calcium buffering but are also a linchpin in mediating cell fate. Mitochondria and ER form structural and functional networks (mitochondria-associated ER membranes [MAMs]) essential to maintaining cellular homeostasis and determining cell fate under various pathophysiological conditions. Regulated Ca(2+) transfer from the ER to the mitochondria is important in maintaining control of pro-survival/pro-death pathways. In this review, we summarize the latest therapeutic strategies that target these essential organelles in the context of neurodegenerative diseases.
Also flagged:Huntington's diseaseHDmultiple spinocerebellar ataxiasneurodegenerative diseasesglutaminepolyglutamine diseases
Journal Article2016-05-06✓ 1 SnippetBettencourt C, Hensman-Moss D, Flower M, Wiethoff S, Brice A, Goizet C, Stevanin G, Koutsis G, Karadima G, Panas M, Yescas-Gómez P, García-Velázquez LE, Alonso-Vilatela ME, Lima M, Raposo M, Traynor B, Sweeney M, Wood N, Giunti P, SPATAX Network, Durr A, Holmans P, Houlden H, Tabrizi SJ, Jones L.
In-Text Gene Mentions
Discussion)
…A number of enzymes with the ability to nick DNA and therefore necessitate DNA repair are known to promote CAG expansion and both somatic expansion and HD‐related phenotypes are ameliorated in mouse models by manipulating genes associated with DNA repair.15, 29, 30, 31, 32 Critically, delay in phenotype onset in HD mice was recently demonstrated through suppressing somatic expansion by crossing HTT knock in mice with Ogg1–/– mice, lacking the DNA cleaving 7,8‐dihydro‐8‐oxo‐guanine (8‐oxo‐G) glycosylase.16 Notably, the single most significant SNP in the present study, rs3512, is in the 3′UTR of FAN1, which has DNA endo/exonuclease activity.…
Show Full Abstract
<h4>Objective</h4>The polyglutamine diseases, including Huntington's disease (HD) and multiple spinocerebellar ataxias (SCAs), are among the commonest hereditary neurodegenerative diseases. They are caused by expanded CAG tracts, encoding glutamine, in different genes. Longer CAG repeat tracts are associated with earlier ages at onset, but this does not account for all of the difference, and the existence of additional genetic modifying factors has been suggested in these diseases. A recent genome-wide association study (GWAS) in HD found association between age at onset and genetic variants in DNA repair pathways, and we therefore tested whether the modifying effects of variants in DNA repair genes have wider effects in the polyglutamine diseases.<h4>Methods</h4>We assembled an independent cohort of 1,462 subjects with HD and polyglutamine SCAs, and genotyped single-nucleotide polymorphisms (SNPs) selected from the most significant hits in the HD study.<h4>Results</h4>In the analysis of DNA repair genes as a group, we found the most significant association with age at onset when grouping all polyglutamine diseases (HD+SCAs; p = 1.43 × 10(-5) ). In individual SNP analysis, we found significant associations for rs3512 in FAN1 with HD+SCAs (p = 1.52 × 10(-5) ) and all SCAs (p = 2.22 × 10(-4) ) and rs1805323 in PMS2 with HD+SCAs (p = 3.14 × 10(-5) ), all in the same direction as in the HD GWAS.<h4>Interpretation</h4>We show that DNA repair genes significantly modify age at onset in HD and SCAs, suggesting a common pathogenic mechanism, which could operate through the observed somatic expansion of repeats that can be modulated by genetic manipulation of DNA repair in disease models. This offers novel therapeutic opportunities in multiple diseases. Ann Neurol 2016;79:983-990.
Journal Article2016-05-06✓ 1 SnippetMarei H, Carpy A, Macek B, Malliri A.
In-Text Gene Mentions
I A O 0000606)
…Reference Database IQGAP1Ras GTPase-activating-like protein 1GTPase-activating-like protein…
Show Full Abstract
The small GTPase Rac1 is implicated in various cellular processes that are essential for normal cell function. Deregulation of Rac1 signaling has also been linked to a number of diseases, including cancer. The diversity of Rac1 functioning in cells is mainly attributed to its ability to bind to a multitude of downstream effectors following activation by Guanine nucleotide Exchange Factors (GEFs). Despite the identification of a large number of Rac1 binding partners, factors influencing downstream specificity are poorly defined, thus hindering the detailed understanding of both Rac1's normal and pathological functions. In a recent study, we demonstrated a role for 2 Rac-specific GEFs, Tiam1 and P-Rex1, in mediating Rac1 anti- versus pro-migratory effects, respectively. Importantly, via conducting a quantitative proteomic screen, we identified distinct changes in the Rac1 interactome following activation by either GEF, indicating that these opposing effects are mediated through GEF modulation of the Rac1 interactome. Here, we present the full list of identified Rac1 interactors together with functional annotation of the differentially regulated Rac1 binding partners. In light of this data, we also provide additional insights into known and novel signaling cascades that might account for the GEF-mediated Rac1-driven cellular effects.
<h4>Background</h4>Failed hip prostheses can cause elevated circulating cobalt and chromium levels, with rare reports of fatal systemic organ deposition, including cobalt cardiomyopathy. Although blood cobalt and chromium levels are easily measured, organ deposition is difficult to detect without invasive biopsy. The T2* magnetic resonance (MR) method is used to quantify tissue iron deposition, and plays an important role in the management of iron-loading conditions. Cobalt and chromium, like iron, also affect magnetism and are proposed MR contrast agents.<h4>Case presentation</h4>We describe a case of a 44-year-old male with a failed hip implant and very elevated blood cobalt and chromium levels. Despite normal cardiac MR findings, liver T2* and R2 values were abnormal, triggering tissue biopsy. Liver tissue analysis, including X-ray fluorescence, demonstrated heavy elemental cobalt and chromium deposition in macrophages, and no detectable iron.<h4>Conclusions</h4>Our case demonstrates T2* and R2 quantification of liver metal deposition in a patient with a failed hip implant. Further work is needed to investigate the role of T2* and R2 MR in the detection of metal deposition from metal on metal hip prostheses.
Also flagged:peptidesβ-thalassemiapolycythemia veraerythropoiesisanemiairon
Journal Article2016-05-06✓ 2 SnippetsCasu C, Oikonomidou PR, Chen H, Nandi V, Ginzburg Y, Prasad P, Fleming RE, Shah YM, Valore EV, Nemeth E, Ganz T, MacDonald B, Rivella S.
In β-thalassemia and polycythemia vera (PV), disordered erythropoiesis triggers severe pathophysiological manifestations. β-Thalassemia is characterized by ineffective erythropoiesis, reduced production of erythrocytes, anemia, and iron overload and PV by erythrocytosis and thrombosis. Minihepcidins are hepcidin agonists that have been previously shown to prevent iron overload in murine models of hemochromatosis and induce iron-restricted erythropoiesis at higher doses. Here, we show that in young Hbb(th3/+) mice, which serve as a model of untransfused β-thalassemia, minihepcidin ameliorates ineffective erythropoiesis, anemia, and iron overload. In older mice with untransfused β-thalassemia, minihepcidin improves erythropoiesis and does not alter the beneficial effect of the iron chelator deferiprone on iron overload. In PV mice that express the orthologous JAK2 mutation causing human PV, administration of minihepcidin significantly reduces splenomegaly and normalizes hematocrit levels. These studies indicate that drug-like minihepcidins have a potential as future therapeutics for untransfused β-thalassemia and PV.
Also flagged:CLPPmitochondrial cardiomyopathymitochondrialsynthesismitochondrial diseasesmitochondrial matrix protease
Journal Article2016-05-06✓ 3 SnippetsSeiferling D, Szczepanowska K, Becker C, Senft K, Hermans S, Maiti P, König T, Kukat A, Trifunovic A.
In-Text Gene Mentions
Abstract)
…Surprisingly, we demonstrate that a strong mitochondrial cardiomyopathy and diminished respiration due to DARS2 deficiency can be alleviated by the loss of CLPP, leading to an increased de novo synthesis of individual OXPHOS subunits.…
I A O 0000326)
…Dars2…
Text
…DARS2…
Show Full Abstract
The mitochondrial matrix protease CLPP plays a central role in the activation of the mitochondrial unfolded protein response (UPR(mt)) in Caenorhabditis elegans Far less is known about mammalian UPR(mt) signaling, although similar roles were assumed for central players, including CLPP To better understand the mammalian UPR(mt) signaling, we deleted CLPP in hearts of DARS2-deficient animals that show robust induction of UPR(mt) due to strong dysregulation of mitochondrial translation. Remarkably, our results clearly show that mammalian CLPP is neither required for, nor it regulates the UPR(mt) in mammals. Surprisingly, we demonstrate that a strong mitochondrial cardiomyopathy and diminished respiration due to DARS2 deficiency can be alleviated by the loss of CLPP, leading to an increased de novo synthesis of individual OXPHOS subunits. These results question our current understanding of the UPR(mt) signaling in mammals, while introducing CLPP as a possible novel target for therapeutic intervention in mitochondrial diseases.
Also flagged:B-cell receptorBurkitt's lymphomaBLB-cell neoplasmB-cell antigen receptorsBCR
Journal Article2016-05-06✓ 2 SnippetsCorso J, Pan KT, Walter R, Doebele C, Mohr S, Bohnenberger H, Ströbel P, Lenz C, Slabicki M, Hüllein J, Comoglio F, Rieger MA, Zenz T, Wienands J, Engelke M, Serve H, Urlaub H, Oellerich T.
In-Text Gene Mentions
Abstract)
…that ACTN4 andARFGEF2, which have been…
Text
…ARFGEF2…
Show Full Abstract
Burkitt's lymphoma (BL) is a highly proliferative B-cell neoplasm and is treated with intensive chemotherapy that, because of its toxicity, is often not suitable for the elderly or for patients with endemic BL in developing countries. BL cell survival relies on signals transduced by B-cell antigen receptors (BCRs). However, tonic as well as activated BCR signaling networks and their relevance for targeted therapies in BL remain elusive. We have systematically characterized and compared tonic and activated BCR signaling in BL by quantitative phosphoproteomics to identify novel BCR effectors and potential drug targets. We identified and quantified ∼16,000 phospho-sites in BL cells. Among these sites, 909 were related to tonic BCR signaling, whereas 984 phospho-sites were regulated upon BCR engagement. The majority of the identified BCR signaling effectors have not been described in the context of B cells or lymphomas yet. Most of these newly identified BCR effectors are predicted to be involved in the regulation of kinases, transcription, and cytoskeleton dynamics. Although tonic and activated BCR signaling shared a considerable number of effector proteins, we identified distinct phosphorylation events in tonic BCR signaling. We investigated the functional relevance of some newly identified BCR effectors and show that ACTN4 and ARFGEF2, which have been described as regulators of membrane-trafficking and cytoskeleton-related processes, respectively, are crucial for BL cell survival. Thus, this study provides a comprehensive dataset for tonic and activated BCR signaling and identifies effector proteins that may be relevant for BL cell survival and thus may help to develop new BL treatments.
Over evolutionary time, the dynamic nature of a genome is driven, in part, by the activity of transposable elements (TE) such as retrotransposons. On a shorter time scale it has been established that new TE insertions can result in single-gene disease in an individual. In humans, the non-LTR retrotransposon Long INterspersed Element-1 (LINE-1 or L1) is the only active autonomous TE. In addition to mobilizing its own RNA to new genomic locations via a "copy-and-paste" mechanism, LINE-1 is able to retrotranspose other RNAs including Alu, SVA, and occasionally cellular RNAs. To date in humans, 124 LINE-1-mediated insertions which result in genetic diseases have been reported. Disease causing LINE-1 insertions have provided a wealth of insight and the foundation for valuable tools to study these genomic parasites. In this review, we provide an overview of LINE-1 biology followed by highlights from new reports of LINE-1-mediated genetic disease in humans.
Emerging evidence from the current outbreak of Zika virus (ZIKV) indicates a strong causal link between Zika and microcephaly. To investigate how ZIKV infection leads to microcephaly, we used human embryonic stem cell-derived cerebral organoids to recapitulate early stage, first trimester fetal brain development. Here we show that a prototype strain of ZIKV, MR766, efficiently infects organoids and causes a decrease in overall organoid size that correlates with the kinetics of viral copy number. The innate immune receptor Toll-like-Receptor 3 (TLR3) was upregulated after ZIKV infection of human organoids and mouse neurospheres and TLR3 inhibition reduced the phenotypic effects of ZIKV infection. Pathway analysis of gene expression changes during TLR3 activation highlighted 41 genes also related to neuronal development, suggesting a mechanistic connection to disrupted neurogenesis. Together, therefore, our findings identify a link between ZIKV-mediated TLR3 activation, perturbed cell fate, and a reduction in organoid volume reminiscent of microcephaly.
Also flagged:KMOHuntington's diseasekynurenineHD3-hydroxy kynureninequinolinic acid
Journal Article2016-05-06No SnippetsBeaumont V, Mrzljak L, Dijkman U, Freije R, Heins M, Rassoulpour A, Tombaugh G, Gelman S, Bradaia A, Steidl E, Gleyzes M, Heikkinen T, Lehtimäki K, Puoliväli J, Kontkanen O, Javier RM, Neagoe I, Deisemann H, Winkler D, Ebneth A, Khetarpal V, Toledo-Sherman L, Dominguez C, Park LC, Munoz-Sanjuan I.
Show Full Abstract
Dysregulation of the kynurenine (Kyn) pathway has been associated with the progression of Huntington's disease (HD). In particular, elevated levels of the kynurenine metabolites 3-hydroxy kynurenine (3-OH-Kyn) and quinolinic acid (Quin), have been reported in the brains of HD patients as well as in rodent models of HD. The production of these metabolites is controlled by the activity of kynurenine mono-oxygenase (KMO), an enzyme which catalyzes the synthesis of 3-OH-Kyn from Kyn. In order to determine the role of KMO in the phenotype of mouse models of HD, we have developed a potent and selective KMO inhibitor termed CHDI-340246. We show that this compound, when administered orally to transgenic mouse models of HD, potently and dose-dependently modulates the Kyn pathway in peripheral tissues and in the central nervous system. The administration of CHDI-340246 leads to an inhibition of the formation of 3-OH-Kyn and Quin, and to an elevation of Kyn and Kynurenic acid (KynA) levels in brain tissues. We show that administration of CHDI-340246 or of Kyn and of KynA can restore several electrophysiological alterations in mouse models of HD, both acutely and after chronic administration. However, using a comprehensive panel of behavioral tests, we demonstrate that the chronic dosing of a selective KMO inhibitor does not significantly modify behavioral phenotypes or natural progression in mouse models of HD.
Also flagged:gastrointestinal disordersgut disordersdinitrobenzene sulfonic acidcytokineclaudin-4IL-4
Journal Article2016-05-06✓ 1 SnippetMartín R, Laval L, Chain F, Miquel S, Natividad J, Cherbuy C, Sokol H, Verdu EF, van Hylckama Vlieg J, Bermudez-Humaran LG, Smokvina T, Langella P.
In-Text Gene Mentions
Methods)
…MaleC57BL/six micemice (6–8 weeks…
Show Full Abstract
Growing evidence supports the efficacy of many probiotic strains in the management of gastrointestinal disorders associated with deregulated intestinal barrier function and/or structure. In particular, bifidobacteria have been studied for their efficacy to both prevent and treat a broad spectrum of animal and/or human gut disorders. The aim of the current work was thus to evaluate effects on intestinal barrier function of Bifidobacterium animalis ssp. lactis CNCM-I2494, a strain used in fermented dairy products. A chronic dinitrobenzene sulfonic acid (DNBS)-induced low-grade inflammation model causing gut dysfunction in mice was used in order to study markers of inflammation, intestinal permeability, and immune function in the presence of the bacterial strain. In this chronic low-grade inflammation mice model several parameters pointed out the absence of an over active inflammation process. However, gut permeability, lymphocyte populations, and colonic cytokines were found to be altered. B. animalis ssp. lactis CNCM-I2494 was able to protect barrier functions by restoring intestinal permeability, colonic goblet cell populations, and cytokine levels. Furthermore, tight junction (TJ) proteins levels were also measured by qRT-PCR showing the ability of this strain to specifically normalize the level of several TJ proteins, in particular for claudin-4. Finally, B. lactis strain counterbalanced CD4(+) lymphocyte alterations in both spleen and mesenteric lymphoid nodes. It restores the Th1/Th2 ratio altered by the DNBS challenge (which locally augments CD4(+) Th1 cells) by increasing the Th2 response as measured by the increase in the production of major representative Th2 cytokines (IL-4, IL-5, and IL-10). Altogether, these data suggest that B. animalis ssp. lactis CNCM-I2494 may efficiently prevent disorders associated with increased barrier permeability.
Also flagged:Ethanophenanthridinealkaloidscrininecancertumorsglioma
Journal Article2016-05-06No SnippetsHenry S, Kidner R, Reisenauer MR, Magedov IV, Kiss R, Mathieu V, Lefranc F, Dasari R, Evidente A, Yu X, Ma X, Pertsemlidis A, Cencic R, Pelletier J, Cavazos DA, Brenner AJ, Aksenov AV, Rogelj S, Kornienko A, Frolova LV.
Show Full Abstract
Plants of the Amaryllidaceae family produce a large variety of alkaloids and non-basic secondary metabolites, many of which are investigated for their promising anticancer activities. Of these, crinine-type alkaloids based on the 5,10b-ethanophenanthridine ring system were recently shown to be effective at inhibiting proliferation of cancer cells resistant to various pro-apoptotic stimuli and representing tumors with dismal prognoses refractory to current chemotherapy, such as glioma, melanoma, non-small-cell lung, esophageal, head and neck cancers, among others. Using this discovery as a starting point and taking advantage of a concise biomimetic route to the crinine skeleton, a collection of crinine analogues were synthetically prepared and evaluated against cancer cells. The compounds exhibited single-digit micromolar activities and retained this activity in a variety of drug-resistant cancer cell cultures. This investigation resulted in the discovery of new bicyclic ring systems with significant potential in the development of effective clinical cancer drugs capable of overcoming cancer chemotherapy resistance.
Also flagged:neurological disordersmotor neuron disordersneurodegenerative disordersdementiabrain disorderstranslational
Journal Article2016-05-06✓ 1 SnippetAkinyemi RO, Owolabi MO, Oyeniyi T, Ovbiagele B, Arnett DK, Tiwari HK, Walker R, Ogunniyi A, Kalaria RN, SIREN group of H3Africa Consortium.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
The understanding of the genetic basis of neurological disorders has grown rapidly in the last two decades. Despite the genomic heterogeneity within African populations, large-scale candidate gene or linkage and exome studies are lacking. However, current knowledge on neurogenetics in African populations is limited and geographically very uneven. Isolated reports indicate the existence of autosomal dominant or recessive conditions incorporating cerebrovascular, movement, neuromuscular, seizure and motor neuron disorders in Africans. In addition, few African families with neurodegenerative disorders associated with dementia have been characterized in North, West and South Africa. The current insurgency in genomic research triggered by among others the Human Health and Heredity (H3) Africa Initiative indicates that there are unique opportunities to advance our knowledge and understanding of the influence of genomic variation on the pattern, presentations and prognosis of neurological disorders in Africa. These have enormous potential to unmask novel genes and molecular pathways germane to the neurobiology of brain disorders. It would facilitate the development of novel diagnostics, preventative and targeted treatments in the new paradigm of precision medicine. Nevertheless, it is crucial to strike a balance between effective traditional public health strategies and personalized genome based care. The translational barriers can be overcome through robust stakeholder engagement and sustainable multilevel, multigenerational and multidisciplinary capacity building and infrastructural development for genomic medicine in Africa.
Also flagged:serotonin transporteraggressionpsychiatric disorderstraumabehavioralAxis I disorders
Journal Article2016-05-05✓ 1 SnippetGorodetsky E, Carli V, Sarchiapone M, Roy A, Goldman D, Enoch MA.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
Suicidal behavior and self-mutilation can be regarded as the expression of self-directed aggression and both are common in prison populations. We investigated the influence of externalizing behaviors, depressive symptoms, childhood trauma, 5-HTTLPR variants on self-directed aggression (N = 145) in a group of 702 male Italian prisoners. Participants were comprehensively evaluated, including for psychiatric disorders, impulsive traits, lifetime aggressive behavior [Brown-Goodwin Lifetime History of Aggression (BGHA)], hostility, violent behavior during incarceration, depressive symptomatology [Hamilton Depression Rating Scale (HDRS)], childhood trauma [Childhood Trauma Questionnaire (CTQ)]. Logistic regression analysis showed false discovery rate corrected independent main effects of externalizing behaviors: BGHA (P = 0.001), violent behavior in jail (P = 0.007), extraversion (P = 0.015); HDRS (P = 0.0004), Axis I disorders (P = 0.015), CTQ (P = 0.004) and 5-HTTLPR genotype (P = 0.02). Carriers of 5-HTTLPR high (LA LA ), intermediate (LA LG , SLA ) activity variants were more likely to have exhibited self-directed aggression relative to the low activity (LG LG , SLG , SS) variant: high/low: odds ratio (OR) = 2.3, 95% confidence interval (CI) 1.27-4.68, P = 0.007; intermediate/low: OR = 1.96, 95% CI 1.09-3.68, P = 0.025. The CTQ main effect was driven by physical abuse. There was no interactive effect of 5-HTTLPR and CTQ. Secondary logistic regression analyses in (1) all suicide attempters (N = 88) and (2) all self-mutilators (N = 104), compared with controls showed that in both groups, childhood trauma (P = 0.008-0.01), depression (P = 0.0004-0.001) were strong predictors. BGHA, violent behavior in jail predicted self-mutilation (P = 0.002) but not suicide attempts (P = 0.1). This study was able to distinguish differing influences on self-directed aggression between groups of closely related predictor variables within the externalizing behavioral domain. 5-HTTLPR had an independent, variant dosage effect.
Journal Article2016-05-05No SnippetsMerwin A, Phillips WC, Williamson MA, Willit JL, Motsegood PN, Chidambaram D.
Show Full Abstract
Molten mixtures of lithium chloride and metallic lithium are of significant interest in various metal oxide reduction processes. These solutions have been reported to exhibit seemingly anomalous physical characteristics that lack a comprehensive explanation. In the current work, the physical chemistry of molten solutions of lithium chloride and metallic lithium, with and without lithium oxide, was investigated using in situ Raman spectroscopy. The Raman spectra obtained from these solutions were in agreement with the previously reported spectrum of the lithium cluster, Li8. This observation is indicative of a nanofluid type colloidal suspension of Li8 in a molten salt matrix. It is suggested that the formation and suspension of lithium clusters in lithium chloride is the cause of various phenomena exhibited by these solutions that were previously unexplainable.
Journal Article2016-05-05No SnippetsThuy le TT, Van Thuy TT, Matsumoto Y, Hai H, Ikura Y, Yoshizato K, Kawada N.
Show Full Abstract
Cytoglobin (Cygb) was identified in hepatic stellate cells (HSCs) and pericytes of all organs; however, the effects of Cygb on cellular functions remain unclear. Here, we report spontaneous and age-dependent malformations in multiple organs of Cygb(-/-) mice. Twenty-six percent of young Cygb(-/-) mice (<1 year old) showed heart hypertrophy, cystic disease in the kidney or ovary, loss of balance, liver fibrosis and lymphoma. Furthermore, 71.3% (82/115) of aged Cygb(-/-) mice (1-2 years old) exhibited abnormalities, such as heart hypertrophy and cancer development in multiple organs; by contrast, 5.8% (4/68) of aged wild-type (WT) mice had abnormalities (p < 0.0001). Interestingly, serum and urine analysis demonstrated that the concentration of nitric oxide metabolites increased significantly in Cygb(-/-) mice, resulting in an imbalance in the oxidative stress and antioxidant defence system that was reversed by N(G)-monomethyl-L-arginine treatment. A senescent phenotype and evidence of DNA damage were found in primary HSCs and the liver of aged Cygb(-/-) mice. Moreover, compared with HSC(+/+), HSC(-/-) showed high expression of Il-6 and chemokine mRNA when cocultured with mouse Hepa 1-6 cells. Thus, the absence of Cygb in pericytes provokes organ abnormalities, possibly via derangement of the nitric oxide and antioxidant defence system and through accelerated cellular senescence.
The Hippo pathway is a signalling cascade conserved from Drosophila melanogaster to mammals. The mammalian core kinase components comprise MST1 and MST2, SAV1, LATS1 and LATS2 and MOB1A and MOB1B. The transcriptional co-activators YAP1 and TAZ are the downstream effectors of the Hippo pathway and regulate target gene expression. Hippo signalling has crucial roles in the control of organ size, tissue homeostasis and regeneration, and dysregulation of the Hippo pathway can lead to uncontrolled cell growth and malignant transformation. Mammalian intestine consists of a stem cell compartment as well as differentiated cells, and its ability to regenerate rapidly after injury makes it an excellent model system to study tissue homeostasis, regeneration and tumorigenesis. Several studies have established the important role of the Hippo pathway in these processes. In addition, crosstalk between Hippo and other signalling pathways provides tight, yet versatile, regulation of tissue homeostasis. In this Review, we summarize studies on the role of the Hippo pathway in the intestine on these physiological processes and the underlying mechanisms responsible, and discuss future research directions and potential therapeutic strategies targeting Hippo signalling in intestinal disease.
…V-miRNAs converging onto BRN2/POU3F2and two onto…
Show Full Abstract
The conversion of melanocytes into cutaneous melanoma is largely dictated by the effects of solar ultraviolet radiation (UVR). Yet to be described, however, is exactly how these cells are affected by intense solar UVR while residing in their natural microenvironment, and whether their response differs in persons with a history of melanoma when compared to that of healthy individuals. By using laser capture microdissection (LCM) to isolate a pure population of melanocytes from a small area of skin that had been intermittingly exposed or un-exposed to physiological doses of solar UVR, we can now report for the first time that the majority of UV-responsive microRNAs (miRNAs) in the melanocytes of a group of women with a history of melanoma are down-regulated when compared to those in the melanocytes of healthy controls. Among the miRNAs that were commonly and significantly down-regulated in each of these women were miR-193b (P<0.003), miR-342-3p (P<0.003), miR186 (P<0.007), miR-130a (P<0.007), and miR-146a (P<0.007). To identify genes potentially released from inhibition by these repressed UV-miRNAs, we analyzed databases (e.g., DIANA-TarBase) containing experimentally validated microRNA-gene interactions. In the end, this enabled us to construct UV-miRNA-gene regulatory networks consisting of individual genes with a probable gain-of-function being intersected not by one, but by several down-regulated UV-miRNAs. Most striking, however, was that these networks typified well-known regulatory modules involved in controlling the epithelial-to-mesenchymal transition and processes associated with the regulation of immune-evasion. We speculate that these pathways become activated by UVR resulting in miRNA down regulation only in melanocytes susceptible to melanoma, and that these changes could be partially responsible for empowering these cells toward tumor progression.
Also flagged:Bipolar Disorderlithiumpsychiatric disorderbipolar I disorderBipolar Illnessvalproic acid
Journal Article2016-05-05✓ 1 SnippetOedegaard KJ, Alda M, Anand A, Andreassen OA, Balaraman Y, Berrettini WH, Bhattacharjee A, Brennand KJ, Burdick KE, Calabrese JR, Calkin CV, Claasen A, Coryell WH, Craig D, DeModena A, Frye M, Gage FH, Gao K, Garnham J, Gershon E, Jakobsen P, Leckband SG, McCarthy MJ, McInnis MG, Maihofer AX, Mertens J, Morken G, Nievergelt CM, Nurnberger J, Pham S, Schoeyen H, Shekhtman T, Shilling PD, Szelinger S, Tarwater B, Yao J, Zandi PP, Kelsoe JR.
In-Text Gene Mentions
Introduction)
…serotonin transporter gene (5-HTT), the presence of…
Show Full Abstract
<h4>Background</h4>Bipolar disorder is a serious and common psychiatric disorder characterized by manic and depressive mood switches and a relapsing and remitting course. The cornerstone of clinical management is stabilization and prophylaxis using mood-stabilizing medications to reduce both manic and depressive symptoms. Lithium remains the gold standard of treatment with the strongest data for both efficacy and suicide prevention. However, many patients do not respond to this medication, and clinically there is a great need for tools to aid the clinician in selecting the correct treatment. Large genome wide association studies (GWAS) investigating retrospectively the effect of lithium response are in the pipeline; however, few large prospective studies on genetic predictors to of lithium response have yet been conducted. The purpose of this project is to identify genes that are associated with lithium response in a large prospective cohort of bipolar patients and to better understand the mechanism of action of lithium and the variation in the genome that influences clinical response.<h4>Methods/design</h4>This study is an 11-site prospective non-randomized open trial of lithium designed to ascertain a cohort of 700 subjects with bipolar I disorder who experience protocol-defined relapse prevention as a result of treatment with lithium monotherapy. All patients will be diagnosed using the Diagnostic Interview for Genetic Studies (DIGS) and will then enter a 2-year follow-up period on lithium monotherapy if and when they exhibit a score of 1 (normal, not ill), 2 (minimally ill) or 3 (mildly ill) on the Clinical Global Impressions of Severity Scale for Bipolar Disorder (CGI-S-BP Overall Bipolar Illness) for 4 of the 5 preceding weeks. Lithium will be titrated as clinically appropriate, not to exceed serum levels of 1.2 mEq/L. The sample will be evaluated longitudinally using a wide range of clinical scales, cognitive assessments and laboratory tests. On relapse, patients will be discontinued or crossed-over to treatment with valproic acid (VPA) or treatment as usual (TAU). Relapse is defined as a DSM-IV manic, major depressive or mixed episode or if the treating physician decides a change in medication is clinically necessary. The sample will be genotyped for GWAS. The outcome for lithium response will be analyzed as a time to event, where the event is defined as clinical relapse, using a Cox Proportional Hazards model. Positive single nucleotide polymorphisms (SNPs) from past genetic retrospective studies of lithium response, the Consortium on Lithium Genetics (ConLiGen), will be tested in this prospective study sample; a meta-analysis of these samples will then be performed. Finally, neurons will be derived from pluripotent stem cells from lithium responders and non-responders and tested in vivo for response to lithium by gene expression studies. SNPs in genes identified in these cellular studies will also be tested for association to response.<h4>Discussion</h4>Lithium is an extraordinarily important therapeutic drug in the clinical management of patients suffering from bipolar disorder. However, a significant proportion of patients, 30-40 %, fail to respond, and there is currently no method to identify the good lithium responders before initiation of treatment. Converging evidence suggests that genetic factors play a strong role in the variation of response to lithium, but only a few genes have been tested and the samples have largely been retrospective or quite small. The current study will collect an entirely unique sample of 700 patients with bipolar disorder to be stabilized on lithium monotherapy and followed for up to 2 years. This study will produce useful information to improve the understanding of the mechanism of action of lithium and will add to the development of a method to predict individual response to lithium, thereby accelerating recovery and reducing suffering and cost.<h4>Trial registration</h4>ClinicalTrials.gov Identifier: NCT01272531 Registered: January 6, 2011.
Also flagged:gene expressioncancernucleusHDHuntingtin
Journal Article2016-05-05✓ 2 SnippetsList M, Alcaraz N, Dissing-Hansen M, Ditzel HJ, Mollenhauer J, Baumbach J.
In-Text Gene Mentions
S I O 001029)
…Note that HD is a Mendelian disease, i.e. a certain mutation in the Huntingtin (HTT) gene triggers the disease.…
I A O 0000613)
…in the Huntingtin (HTT) gene triggers the…
Show Full Abstract
We present KeyPathwayMinerWeb, the first online platform for de novo pathway enrichment analysis directly in the browser. Given a biological interaction network (e.g. protein-protein interactions) and a series of molecular profiles derived from one or multiple OMICS studies (gene expression, for instance), KeyPathwayMiner extracts connected sub-networks containing a high number of active or differentially regulated genes (proteins, metabolites) in the molecular profiles. The web interface at (http://keypathwayminer.compbio.sdu.dk) implements all core functionalities of the KeyPathwayMiner tool set such as data integration, input of background knowledge, batch runs for parameter optimization and visualization of extracted pathways. In addition to an intuitive web interface, we also implemented a RESTful API that now enables other online developers to integrate network enrichment as a web service into their own platforms.
Also flagged:Cas9FOXA2tumorpancreatic cancerPancreatic ductal adenocarcinomaPDAC
Journal Article2016-05-05No SnippetsVorvis C, Hatziapostolou M, Mahurkar-Joshi S, Koutsioumpa M, Williams J, Donahue TR, Poultsides GA, Eibl G, Iliopoulos D.
Show Full Abstract
Pancreatic ductal adenocarcinoma (PDAC) is an aggressive cancer with low survival rates and limited therapeutic options. Thus elucidation of signaling pathways involved in PDAC pathogenesis is essential for identifying novel potential therapeutic gene targets. Here, we used a systems approach to elucidate those pathways by integrating gene and microRNA profiling analyses together with CRISPR/Cas9 technology to identify novel transcription factors involved in PDAC pathogenesis. FOXA2 transcription factor was found to be significantly downregulated in PDAC relative to control pancreatic tissues. Functional experiments revealed that FOXA2 has a tumor suppressor function through inhibition of pancreatic cancer cell growth, migration, invasion, and colony formation. In situ hybridization analysis revealed miR-199a to be significantly upregulated in pancreatic cancer. Bioinformatics and luciferase analyses showed that miR-199a negatively but directly regulates FOXA2 expression through binding in its 3'-untranslated region (UTR). Evaluation of the functional importance of miR-199a on pancreatic cancer revealed that miR-199a acts as an inhibitor of FOXA2 expression, inducing an increase in pancreatic cancer cell proliferation, migration, and invasion. Additionally, gene ontology and network analyses in PANC-1 cells treated with a small interfering RNA (siRNA) against FOXA2 revealed an enrichment for cell invasion mechanisms through PLAUR and ERK activation. FOXA2 deletion (FOXA2Δ) by using two CRISPR/Cas9 vectors in PANC-1 cells induced tumor growth in vivo resulting in upregulation of PLAUR and ERK pathways in FOXA2Δ xenograft tumors. We have identified FOXA2 as a novel tumor suppressor in pancreatic cancer and it is regulated directly by miR-199a, thereby enhancing our understanding of how microRNAs interplay with the transcription factors to affect pancreatic oncogenesis.
Also flagged:butyrateretinoic acidHDACvitamin Aretinolaldehyde dehydrogenases
Journal Article2016-05-05No SnippetsSchilderink R, Verseijden C, Seppen J, Muncan V, van den Brink GR, Lambers TT, van Tol EA, de Jonge WJ.
Show Full Abstract
In the intestinal mucosa, retinoic acid (RA) is a critical signaling molecule. RA is derived from dietary vitamin A (retinol) through conversion by aldehyde dehydrogenases (aldh). Reduced levels of short-chain fatty acids (SCFAs) are associated with pathological microbial dysbiosis, inflammatory disease, and allergy. We hypothesized that SCFAs contribute to mucosal homeostasis by enhancing RA production in intestinal epithelia. With the use of human and mouse epithelial cell lines and primary enteroids, we studied the effect of SCFAs on the production of RA. Functional RA conversion was analyzed by Adlefluor activity assays. Butyrate (0-20 mM), in contrast to other SCFAs, dose dependently induced aldh1a1 or aldh1a3 transcript expression and increased RA conversion in human and mouse epithelial cells. Epithelial cell line data were replicated in intestinal organoids. In these organoids, butyrate (2-5 mM) upregulated aldh1a3 expression (36-fold over control), whereas aldh1a1 was not significantly affected. Butyrate enhanced maturation markers (Mucin-2 and villin) but did not consistently affect stemness markers or other Wnt target genes (lgr5, olfm4, ascl2, cdkn1). In enteroids, the stimulation of RA production by SCFA was mimicked by inhibitors of histone deacetylase 3 (HDAC3) but not by HDAC1/2 inhibitors nor by agonists of butyrate receptors G-protein-coupled receptor (GPR)43 or GPR109A, indicating that butyrate stimulates RA production via HDAC3 inhibition. We conclude that the SCFA butyrate inhibits HDAC3 and thereby supports epithelial RA production.
Also flagged:chromosomeT-T-cell acute lymphoblastic leukemiaacute lymphoblastic leukemialeukemiaTCF7
Journal Article2016-05-05✓ 1 SnippetLa Starza R, Barba G, Demeyer S, Pierini V, Di Giacomo D, Gianfelici V, Schwab C, Matteucci C, Vicente C, Cools J, Messina M, Crescenzi B, Chiaretti S, Foà R, Basso G, Harrison CJ, Mecucci C.
In-Text Gene Mentions
Text
…MLLT10…
Show Full Abstract
Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia.
Also flagged:T-cellacute lymphoblastic leukemiaT-cell acute lymphoblastic leukemiagene expressiononcogenestumor
Journal Article2016-05-05✓ 1 SnippetGianfelici V, Chiaretti S, Demeyer S, Di Giacomo F, Messina M, La Starza R, Peragine N, Paoloni F, Geerdens E, Pierini V, Elia L, Mancini M, De Propris MS, Apicella V, Gaidano G, Testi AM, Vitale A, Vignetti M, Mecucci C, Guarini A, Cools J, Foà R.
In-Text Gene Mentions
Text
…MLLT10…
Show Full Abstract
Despite therapeutic improvements, a sizable number of patients with T-cell acute lymphoblastic leukemia still have a poor outcome. To unravel the genomic background associated with refractoriness, we evaluated the transcriptome of 19 cases of refractory/early relapsed T-cell acute lymphoblastic leukemia (discovery cohort) by performing RNA-sequencing on diagnostic material. The incidence and prognostic impact of the most frequently mutated pathways were validated by Sanger sequencing on genomic DNA from diagnostic samples of an independent cohort of 49 cases (validation cohort), including refractory, relapsed and responsive cases. Combined gene expression and fusion transcript analyses in the discovery cohort revealed the presence of known oncogenes and identified novel rearrangements inducing overexpression, as well as inactivation of tumor suppressor genes. Mutation analysis identified JAK/STAT and RAS/PTEN as the most commonly disrupted pathways in patients with chemorefractory disease or early relapse, frequently in association with NOTCH1/FBXW7 mutations. The analysis on the validation cohort documented a significantly higher risk of relapse, inferior overall survival, disease-free survival and event-free survival in patients with JAK/STAT or RAS/PTEN alterations. Conversely, a significantly better survival was observed in patients harboring only NOTCH1/FBXW7 mutations: this favorable prognostic effect was abrogated by the presence of concomitant mutations. Preliminary in vitro assays on primary cells demonstrated sensitivity to specific inhibitors. These data document the negative prognostic impact of JAK/STAT and RAS/PTEN mutations in T-cell acute lymphoblastic leukemia and suggest the potential clinical application of JAK and PI3K/mTOR inhibitors in patients harboring mutations in these pathways.
Also flagged:infectionidiopathic pneumonia syndromerespiratory failureCell movementLung Injuryinfectious
Journal Article2016-05-05No SnippetsBhargava M, Viken KJ, Dey S, Steinbach MS, Wu B, Jagtap PD, Higgins L, Panoskaltsis-Mortari A, Weisdorf DJ, Kumar V, Arora M, Bitterman PB, Ingbar DH, Wendt CH.
Show Full Abstract
Pulmonary complications due to infection and idiopathic pneumonia syndrome (IPS), a noninfectious lung injury in hematopoietic stem cell transplant (HSCT) recipients, are frequent causes of transplantation-related mortality and morbidity. Our objective was to characterize the global bronchoalveolar lavage fluid (BALF) protein expression of IPS to identify proteins and pathways that differentiate IPS from infectious lung injury after HSCT. We studied 30 BALF samples from patients who developed lung injury within 180 days of HSCT or cellular therapy transfusion (natural killer cell transfusion). Adult subjects were classified as having IPS or infectious lung injury by the criteria outlined in the 2011 American Thoracic Society statement. BALF was depleted of hemoglobin and 14 high-abundance proteins, treated with trypsin, and labeled with isobaric tagging for relative and absolute quantification (iTRAQ) 8-plex reagent for two-dimensional capillary liquid chromatography (LC) and data dependent peptide tandem mass spectrometry (MS) on an Orbitrap Velos system in higher-energy collision-induced dissociation activation mode. Protein identification employed a target-decoy strategy using ProteinPilot within Galaxy P. The relative protein abundance was determined with reference to a global internal standard consisting of pooled BALF from patients with respiratory failure and no history of HSCT. A variance weighted t-test controlling for a false discovery rate of ≤5% was used to identify proteins that showed differential expression between IPS and infectious lung injury. The biological relevance of these proteins was determined by using gene ontology enrichment analysis and Ingenuity Pathway Analysis. We characterized 12 IPS and 18 infectious lung injury BALF samples. In the 5 iTRAQ LC-MS/MS experiments 845, 735, 532, 615, and 594 proteins were identified for a total of 1125 unique proteins and 368 common proteins across all 5 LC-MS/MS experiments. When comparing IPS to infectious lung injury, 96 proteins were differentially expressed. Gene ontology enrichment analysis showed that these proteins participate in biological processes involved in the development of lung injury after HSCT. These include acute phase response signaling, complement system, coagulation system, liver X receptor (LXR)/retinoid X receptor (RXR), and farsenoid X receptor (FXR)/RXR modulation. We identified 2 canonical pathways modulated by TNF-α, FXR/RXR activation, and IL2 signaling in macrophages. The proteins also mapped to blood coagulation, fibrinolysis, and wound healing-processes that participate in organ repair. Cell movement was identified as significantly over-represented by proteins with differential expression between IPS and infection. In conclusion, the BALF protein expression in IPS differed significantly from infectious lung injury in HSCT recipients. These differences provide insights into mechanisms that are activated in lung injury in HSCT recipients and suggest potential therapeutic targets to augment lung repair.
Also flagged:gene expressioncell surface receptorssensorytransductionaxonsshort-term
Journal Article2016-05-05No SnippetsCrocker A, Guan XJ, Murphy CT, Murthy M.
Show Full Abstract
Learning and memory formation in Drosophila rely on a network of neurons in the mushroom bodies (MBs). Whereas numerous studies have delineated roles for individual cell types within this network in aspects of learning or memory, whether or not these cells can also be distinguished by the genes they express remains unresolved. In addition, the changes in gene expression that accompany long-term memory formation within the MBs have not yet been studied by neuron type. Here, we address both issues by performing RNA sequencing on single cell types (harvested via patch pipets) within the MB. We discover that the expression of genes that encode cell surface receptors is sufficient to identify cell types and that a subset of these genes, required for sensory transduction in peripheral sensory neurons, is not only expressed within individual neurons of the MB in the central brain, but is also critical for memory formation.
…dosage compensation complex (DCC), which acetylates X…
Abstract)
…formation of theDCCin infected females,…
Abstract)
…expression of theDCC-specific gene msl-2 ,…
Text
…DCC…
Show Full Abstract
Numerous arthropods harbor maternally transmitted bacteria that induce the preferential death of males [1-7]. This sex-specific lethality benefits the bacteria because males are "dead ends" regarding bacterial transmission, and their absence may result in additional resources for their viable female siblings who can thereby more successfully transmit the bacteria [5]. Although these symbionts disrupt a range of developmental processes [8-10], the underlying cellular mechanisms are largely unknown. It was previously shown that mutations in genes of the dosage compensation pathway of Drosophila melanogaster suppressed male killing caused by the bacterium, Spiroplasma [10]. This result suggested that dosage compensation is a target of Spiroplasma. However, it remains unclear how this pathway is affected, and whether the underlying interactions require the male-specific cellular environment. Here, we investigated the cellular basis of male embryonic lethality in D. melanogaster induced by Spiroplasma. We found that the dosage compensation complex (DCC), which acetylates X chromatin in males [11], becomes mis-localized to ectopic regions of the nucleus immediately prior to the killing phase. This effect was accompanied by inappropriate histone acetylation and genome-wide mis-regulation of gene expression. Artificially induced formation of the DCC in infected females, through transgenic expression of the DCC-specific gene msl-2, resulted in mis-localization of this complex to non-X regions and early Spiroplasma-induced death, mirroring the killing effects in males. These findings strongly suggest that Spiroplasma initiates male killing by targeting the dosage compensation machinery directly and independently of other cellular features characteristic of the male sex.
…6. HFE Gene Mutations in NAFLD and Atherosclerosis…
S I O 001029)
…This suggests that heterozygosis for the HFE mutation (responsible for mild iron overload) may trigger the clinical NAFLD manifestation [29].…
S I O 001029)
…Several studies analyzed the role of HFE mutations in patients with NAFLD and iron overload.…
S I O 001029)
…This protein has been found strongly associated not only with parameters influencing iron stores, such as sex, age, alcohol, and genetic factors (i.e., HFE mutations), but also with metabolic alterations defining the metabolic syndrome.…
Show Full Abstract
Non Alcoholic Fatty Liver Disease (NAFLD) is the most common chronic liver disease in Western countries. Recent data indicated that NAFLD is a risk factor by itself contributing to the development of cardiovascular disease independently of classical known risk factors. Hyperferritinemia and mild increased iron stores are frequently observed in patients with NAFLD and several mechanisms have been proposed to explain the role of iron, through oxidative stress and interaction with insulin metabolism, in the development of vascular damage. Moreover, iron depletion has been shown to decrease atherogenesis in experimental models and in humans. This review presents the recent evidence on epidemiology, pathogenesis, and the possible explanation of the role of iron and ferritin in the development of cardiovascular damage in patients with NAFLD, and discusses the possible interplay between metabolic disorders associated with NAFLD and iron in the development of cardiovascular disease.
Fluorescence assays are the most common readouts used in droplet microfluidics due to their bright signals and fast time response. Applications such as multiplex assays, enzyme evolution, and molecular biology enhanced cell sorting require the detection of two or more colors of fluorescence. Standard multicolor detection systems that couple free space lasers to epifluorescence microscopes are bulky, expensive, and difficult to maintain. In this paper, we describe a scheme to perform multicolor detection by exciting discrete regions of a microfluidic channel with lasers coupled to optical fibers. Emitted light is collected by an optical fiber coupled to a single photodetector. Because the excitation occurs at different spatial locations, the identity of emitted light can be encoded as a temporal shift, eliminating the need for more complicated light filtering schemes. The system has been used to detect droplet populations containing four unique combinations of dyes and to detect sub-nanomolar concentrations of fluorescein.
Also flagged:bipolar disordermood disorderMYO5BTSPAN8EGFRSORCS2
Journal Article2016-05-05No SnippetsJiang Y, He Y, Zhang H.
Show Full Abstract
LASSO is a popular statistical tool often used in conjunction with generalized linear models that can simultaneously select variables and estimate parameters. When there are many variables of interest, as in current biological and biomedical studies, the power of LASSO can be limited. Fortunately, so much biological and biomedical data have been collected and they may contain useful information about the importance of certain variables. This paper proposes an extension of LASSO, namely, prior LASSO (pLASSO), to incorporate that prior information into penalized generalized linear models. The goal is achieved by adding in the LASSO criterion function an additional measure of the discrepancy between the prior information and the model. For linear regression, the whole solution path of the pLASSO estimator can be found with a procedure similar to the Least Angle Regression (LARS). Asymptotic theories and simulation results show that pLASSO provides significant improvement over LASSO when the prior information is relatively accurate. When the prior information is less reliable, pLASSO shows great robustness to the misspecification. We illustrate the application of pLASSO using a real data set from a genome-wide association study.
Also flagged:Gene expressionNucleosteminNStumorp53leukemia
Journal Article2016-05-05No SnippetsSun X, Jia Y, Wei Y, Liu S, Yue B.
Show Full Abstract
Nucleostemin (NS) is mainly expressed in stem and tumor cells, and is necessary for the maintenance of their self-renewal and proliferation. Originally, NS was thought to exert its effects through inhibiting p53, while recent studies have revealed that NS is also able to function independently of p53. The present study performed a gene expression profiling analysis of p53‑mutant NB4 leukeima cells following knockdown of NS in order to elucidate the p53‑independent NS pathway. NS expression was silenced using lentivirus‑mediated RNA interference technology, and gene expression profiling of NB4 cells was performed by DNA microarray analysis. A total of 1,953 genes were identified to be differentially expressed (fold change ≥2 or ≤0.5) following knockdown of NS expression. Furthermore, reverse‑transcription quantitative polymerase chain reaction analysis was used to detect the expression of certain candidate genes, and the results were in agreement with the micaroarray data. Pathway analysis indicated that aberrant genes were enhanced in endoplasmic, c‑Jun N‑terminal kinase and mineral absorption pathways. The present study shed light on the mechanisms of the p54‑independent NS pathway in NB4 cells and provided a foundation for the discovery of promising targets for the treatment of p53-mutant leukemia.
<h4>Background</h4>In oviparous species accidental variation of incubation temperatures may occur under natural conditions and mechanisms may have evolved by natural selection that facilitate coping with these stressors. However, under controlled artificial incubation modification of egg incubation temperature has been shown to have a wide-ranging impact on post-hatch development in several poultry species. Because developmental changes initiated in-ovo can affect poultry production, understanding the molecular routes and epigenetic alterations induced by incubation temperature differences may allow targeted modification of phenotypes.<h4>Results</h4>In order to identify molecular pathways responsive to variable incubation temperature, broiler eggs were incubated at a lower or higher temperature (36.8 °C, 38.8 °C) relative to control (37.8 °C) over two developmental intervals, embryonic days (E) 7-10 and 10-13. Global gene expression of M. gastrocnemius was assayed at E10, E13, and slaughter age [post-hatch day (D) 35] (6 groups; 3 time points; 8 animals each) by microarray analysis and treated samples were compared to controls within each time point. Transcript abundance differed for between 113 and 738 genes, depending on treatment group, compared to the respective control. In particular, higher incubation temperature during E7-10 immediately affected pathways involved in energy and lipid metabolism, cell signaling, and muscle development more so than did other conditions. But lower incubation temperature during E10-13 affected pathways related to cellular function and growth, and development of organ, tissue, and muscle as well as nutrient metabolism pathways at D35.<h4>Conclusion</h4>Shifts in incubation temperature provoke specific immediate and long-term transcriptional responses. Further, the transcriptional response to lower incubation temperature, which did not affect the phenotypes, mediates compensatory effects reflecting adaptability. In contrast, higher incubation temperature triggers gene expression and has long-term effects on the phenotype, reflecting considerable phenotypic plasticity.
Also flagged:hydrogenperoxidewatercobaltcarbondioxygen
Journal Article2016-05-04No SnippetsMase K, Yoneda M, Yamada Y, Fukuzumi S.
Show Full Abstract
Hydrogen peroxide (H2O2) in water has been proposed as a promising solar fuel instead of gaseous hydrogen because of advantages on easy storage and high energy density, being used as a fuel of a one-compartment H2O2 fuel cell for producing electricity on demand with emitting only dioxygen (O2) and water. It is highly desired to utilize the most earth-abundant seawater instead of precious pure water for the practical use of H2O2 as a solar fuel. Here we have achieved efficient photocatalytic production of H2O2 from the most earth-abundant seawater instead of precious pure water and O2 in a two-compartment photoelectrochemical cell using WO3 as a photocatalyst for water oxidation and a cobalt complex supported on a glassy-carbon substrate for the selective two-electron reduction of O2. The concentration of H2O2 produced in seawater reached 48 mM, which was high enough to operate an H2O2 fuel cell.
Also flagged:gene expressioncancerTissueadenoid cystic carcinomaACCpheochromocytoma and paraganglioma
Journal Article2016-05-04No SnippetsKosti I, Jain N, Aran D, Butte AJ, Sirota M.
Show Full Abstract
The central dogma of molecular biology describes the translation of genetic information from mRNA to protein, but does not specify the quantitation or timing of this process across the genome. We have analyzed protein and gene expression in a diverse set of human tissues. To study concordance and discordance of gene and protein expression, we integrated mass spectrometry data from the Human Proteome Map project and RNA-Seq measurements from the Genotype-Tissue Expression project. We analyzed 16,561 genes and the corresponding proteins in 14 tissue types across nearly 200 samples. A comprehensive tissue- and gene-specific analysis revealed that across the 14 tissues, correlation between mRNA and protein expression was positive and ranged from 0.36 to 0.5. We also identified 1,012 genes whose RNA and protein expression was correlated across all the tissues and examined genes and proteins that were concordantly and discordantly expressed for each tissue of interest. We extended our analysis to look for genes and proteins that were differentially correlated in cancer compared to normal tissues, showing higher levels of correlation in normal tissues. Finally, we explored the implications of these findings in the context of biomarker and drug target discovery.
Also flagged:PSMAprostate cancertumorstumorsynthesisbinding
Journal Article2016-05-04No SnippetsBouvet V, Wuest M, Jans HS, Janzen N, Genady AR, Valliant JF, Benard F, Wuest F.
Show Full Abstract
<h4>Background</h4>Prostate-specific membrane antigen (PSMA) is frequently overexpressed and upregulated in prostate cancer. To date, various (18)F- and (68)Ga-labeled urea-based radiotracers for PET imaging of PSMA have been developed and entered clinical trials. Here, we describe an automated synthesis of [(18)F]DCFPyL via direct radiofluorination and validation in preclinical models of prostate cancer.<h4>Methods</h4>[(18)F]DCFPyL was synthesized via direct nucleophilic heteroaromatic substitution reaction in a single reactor TRACERlab FXFN automated synthesis unit. Radiopharmacological evaluation of [(18)F]DCFPyL involved internalization experiments, dynamic PET imaging in LNCaP (PSMA+) and PC3 (PSMA-) tumor-bearing BALB/c nude mice, biodistribution studies, and metabolic profiling. In addition, reversible two-tissue compartmental model analysis was used to quantify pharmacokinetics of [(18)F]DCFPyL in LNCaP and PC3 tumor models.<h4>Results</h4>Automated radiosynthesis afforded radiotracer [(18)F]DCFPyL in decay-corrected radiochemical yields of 23 ± 5 % (n = 10) within 55 min, including HPLC purification. Dynamic PET analysis revealed rapid and high uptake of radioactivity (SUV5min 0.95) in LNCaP tumors which increased over time (SUV60min 1.1). Radioactivity uptake in LNCaP tumors was blocked in the presence of nonradioactive DCFPyL (SUV60min 0.22). The muscle as reference tissue showed rapid and continuous clearance over time (SUV60min 0.06). Fast blood clearance of radioactivity resulted in tumor-blood ratios of 1.0 after 10 min and 8.3 after 60 min. PC3 tumors also showed continuous clearance of radioactivity over time (SUV60min 0.11). Kinetic analysis of PET data revealed the two-tissue compartmental model as best fit with K 1 = 0.12, k 2 = 0.18, k 3 = 0.08, and k 4 = 0.004 min(-1), confirming molecular trapping of [(18)F]DCFPyL in PSMA+ LNCaP cells.<h4>Conclusions</h4>[(18)F]DCFPyL can be prepared for clinical applications simply and in good radiochemical yields via a direct radiofluorination synthesis route in a single reactor automated synthesis unit. Radiopharmacological evaluation of [(18)F]DCFPyL confirmed high PSMA-mediated tumor uptake combined with superior clearance parameters. Compartmental model analysis points to a two-step molecular trapping mechanism based on PSMA binding and subsequent internalization leading to retention of radioactivity in PSMA+ LNCaP tumors.
Also flagged:polymeraseDNA polymerasenitrogenwaterchromosomes
Journal Article2016-05-04No SnippetsRhee M, Light YK, Meagher RJ, Singh AK.
Show Full Abstract
Multiple displacement amplification (MDA) is a widely used technique for amplification of DNA from samples containing limited amounts of DNA (e.g., uncultivable microbes or clinical samples) before whole genome sequencing. Despite its advantages of high yield and fidelity, it suffers from high amplification bias and non-specific amplification when amplifying sub-nanogram of template DNA. Here, we present a microfluidic digital droplet MDA (ddMDA) technique where partitioning of the template DNA into thousands of sub-nanoliter droplets, each containing a small number of DNA fragments, greatly reduces the competition among DNA fragments for primers and polymerase thereby greatly reducing amplification bias. Consequently, the ddMDA approach enabled a more uniform coverage of amplification over the entire length of the genome, with significantly lower bias and non-specific amplification than conventional MDA. For a sample containing 0.1 pg/μL of E. coli DNA (equivalent of ~3/1000 of an E. coli genome per droplet), ddMDA achieves a 65-fold increase in coverage in de novo assembly, and more than 20-fold increase in specificity (percentage of reads mapping to E. coli) compared to the conventional tube MDA. ddMDA offers a powerful method useful for many applications including medical diagnostics, forensics, and environmental microbiology.
Also flagged:Triclosanendocrinegene expressiongestationTCScell cycle
Journal Article2016-05-04No SnippetsRabaglino MB, Chang EI, Richards EM, James MO, Keller-Wood M, Wood CE.
Show Full Abstract
Triclosan (TCS), an antibacterial compound commonly added to personal care products, could be an endocrine disruptor at low doses. Although TCS has been shown to alter fetal physiology, its effects in the developing fetal brain are unknown. We hypothesize that exposure to TCS during fetal life could affect fetal hypothalamic gene expression. The objective of this study was to use transcriptomics and systems analysis to identify significantly altered biological processes in the late gestation ovine fetal hypothalamus after direct or indirect exposure to low doses of TCS. For direct TCS exposure, chronically catheterized late gestation fetal sheep were infused with vehicle (n = 4) or TCS (250 μg/d; n = 4) iv. For indirect TCS exposure, TCS (100 μg/kg · d; n = 3) or vehicle (n = 3) was infused into the maternal circulation. Fetal hypothalami were collected after 2 days of infusion, and gene expression was measured through microarray. Hierarchical clustering of all samples according to gene expression profiles showed that samples from the TCS-treated animals clustered apart from the controls. Gene set enrichment analysis revealed that fetal hypothalamic genes stimulated by maternal and fetal TCS infusion were significantly enriching for cell cycle, reproductive process, and feeding behavior, whereas the inhibited genes were significantly enriching for chromatin modification and metabolism of steroids, lipoproteins, fatty acids, and glucose (P < .05). In conclusion, short-term infusion of TCS induces vigorous changes in the fetal hypothalamic transcriptomics, which are mainly related to food intake pathways and metabolism. If these changes persist to postnatal life, they could result in adverse consequences in adulthood.
Also flagged:acute myeloid leukemiaAMLbreast cancerlung cancercancertumor
Journal Article2016-05-04✓ 1 SnippetGrechkin M, Logsdon BA, Gentles AJ, Lee SI.
In-Text Gene Mentions
Results)
…targets of thepolycomb repressiverepressive complex gene…
Show Full Abstract
We present a computational framework, called DISCERN (DIfferential SparsE Regulatory Network), to identify informative topological changes in gene-regulator dependence networks inferred on the basis of mRNA expression datasets within distinct biological states. DISCERN takes two expression datasets as input: an expression dataset of diseased tissues from patients with a disease of interest and another expression dataset from matching normal tissues. DISCERN estimates the extent to which each gene is perturbed-having distinct regulator connectivity in the inferred gene-regulator dependencies between the disease and normal conditions. This approach has distinct advantages over existing methods. First, DISCERN infers conditional dependencies between candidate regulators and genes, where conditional dependence relationships discriminate the evidence for direct interactions from indirect interactions more precisely than pairwise correlation. Second, DISCERN uses a new likelihood-based scoring function to alleviate concerns about accuracy of the specific edges inferred in a particular network. DISCERN identifies perturbed genes more accurately in synthetic data than existing methods to identify perturbed genes between distinct states. In expression datasets from patients with acute myeloid leukemia (AML), breast cancer and lung cancer, genes with high DISCERN scores in each cancer are enriched for known tumor drivers, genes associated with the biological processes known to be important in the disease, and genes associated with patient prognosis, in the respective cancer. Finally, we show that DISCERN can uncover potential mechanisms underlying network perturbation by explaining observed epigenomic activity patterns in cancer and normal tissue types more accurately than alternative methods, based on the available epigenomic data from the ENCODE project.
Also flagged:traumaanxietyserotonin transporteraffective disorderscognitionssocial anxiety
Journal Article2016-05-04✓ 2 SnippetsSchiele MA, Ziegler C, Holitschke K, Schartner C, Schmidt B, Weber H, Reif A, Romanos M, Pauli P, Zwanzger P, Deckert J, Domschke K.
In-Text Gene Mentions
Title)
…Influence of5-HTTvariation, childhood trauma…
Abstract)
…teractive relationship between5-HTTgenotype and adverse…
Show Full Abstract
Environmental vulnerability factors such as adverse childhood experiences in interaction with genetic risk variants, e.g., the serotonin transporter gene linked polymorphic region (5-HTTLPR), are assumed to play a role in the development of anxiety and affective disorders. However, positive influences such as general self-efficacy (GSE) may exert a compensatory effect on genetic disposition, environmental adversity, and anxiety traits. We, thus, assessed childhood trauma (Childhood Trauma Questionnaire, CTQ) and GSE in 678 adults genotyped for 5-HTTLPR/rs25531 and their interaction on agoraphobic cognitions (Agoraphobic Cognitions Questionnaire, ACQ), social anxiety (Liebowitz Social Anxiety Scale, LSAS), and trait anxiety (State-Trait Anxiety Inventory, STAI-T). The relationship between anxiety traits and childhood trauma was moderated by self-efficacy in 5-HTTLPR/rs25531 LALA genotype carriers: LALA probands maltreated as children showed high anxiety scores when self-efficacy was low, but low anxiety scores in the presence of high self-efficacy despite childhood maltreatment. Our results extend previous findings regarding anxiety-related traits showing an interactive relationship between 5-HTT genotype and adverse childhood experiences by suggesting coping-related measures to function as an additional dimension buffering the effects of a gene-environment risk constellation. Given that anxiety disorders manifest already early in childhood, this insight could contribute to the improvement of psychotherapeutic interventions by including measures strengthening self-efficacy and inform early targeted preventive interventions in at-risk populations, particularly within the crucial time window of childhood and adolescence.
Radical S-adenosylmethionine (SAM) enzymes catalyze an astonishing array of complex and chemically challenging reactions across all domains of life. Of approximately 114,000 of these enzymes, 8 are known to be present in humans: MOCS1, molybdenum cofactor biosynthesis; LIAS, lipoic acid biosynthesis; CDK5RAP1, 2-methylthio-N(6)-isopentenyladenosine biosynthesis; CDKAL1, methylthio-N(6)-threonylcarbamoyladenosine biosynthesis; TYW1, wybutosine biosynthesis; ELP3, 5-methoxycarbonylmethyl uridine; and RSAD1 and viperin, both of unknown function. Aberrations in the genes encoding these proteins result in a variety of diseases. In this review, we summarize the biochemical characterization of these 8 radical S-adenosylmethionine enzymes and, in the context of human health, describe the deleterious effects that result from such genetic mutations.
<h4>Background</h4>Despite the fundamental biological importance and clinical relevance of characterizing the effects of chronic hypoxia exposure on central nervous system (CNS) development, the changes in gene expression from hypoxia are unknown. It is not known if there are unifying principles, properties, or logic in the response of the developing CNS to hypoxic exposure. Here, we use the small vertebrate zebrafish (Danio rerio) to study the effects of hypoxia on connectivity gene expression across development. We perform transcriptional profiling at high temporal resolution to systematically determine and then experimentally validate the response of CNS connectivity genes to hypoxia exposure.<h4>Results</h4>We characterized mRNA changes during development, comparing the effects of chronic hypoxia exposure at different time-points. We focused on changes in expression levels of a subset of 1270 genes selected for their roles in development of CNS connectivity, including axon pathfinding and synapse formation. We found that the majority of CNS connectivity genes were unaffected by hypoxia. However, for a small subset of genes hypoxia significantly affected their gene expression profiles. In particular, hypoxia appeared to affect both the timing and levels of expression, including altering expression of interacting gene pairs in a fashion that would potentially disrupt normal function.<h4>Conclusions</h4>Overall, our study identifies the response of CNS connectivity genes to hypoxia exposure during development. While for most genes hypoxia did not significantly affect expression, for a subset of genes hypoxia changed both levels and timing of expression. Importantly, we identified that some genes with interacting proteins, for example receptor/ligand pairs, had dissimilar responses to hypoxia that would be expected to interfere with their function. The observed dysynchrony of gene expression could impair the development of normal CNS connectivity maps.
Beginning in the early 2000s, the accumulation of biospecimens linked to electronic health records (EHRs) made possible genome-phenome studies (i.e., comparative analyses of genetic variants and phenotypes) using only data collected as a by-product of typical health care. In addition to disease and trait genetics, EHRs proved a valuable resource for analyzing pharmacogenetic traits and developing reverse genetics approaches such as phenome-wide association studies (PheWASs). PheWASs are designed to survey which of many phenotypes may be associated with a given genetic variant. PheWAS methods have been validated through replication of hundreds of known genotype-phenotype associations, and their use has differentiated between true pleiotropy and clinical comorbidity, added context to genetic discoveries, and helped define disease subtypes, and may also help repurpose medications. PheWAS methods have also proven to be useful with research-collected data. Future efforts that integrate broad, robust collection of phenotype data (e.g., EHR data) with purpose-collected research data in combination with a greater understanding of EHR data will create a rich resource for increasingly more efficient and detailed genome-phenome analysis to usher in new discoveries in precision medicine.
Also flagged:Huntington's diseaseHDneurodegenerative diseasegene expressionorganizationmetabolism
Journal Article2016-05-04✓ 1 SnippetDíez-Planelles C, Sánchez-Lozano P, Crespo MC, Gil-Zamorano J, Ribacoba R, González N, Suárez E, Martínez-Descals A, Martínez-Camblor P, Álvarez V, Martín-Hernández R, Huerta-Ruíz I, González-García I, Cosgaya JM, Visioli F, Dávalos A, Iglesias-Gutiérrez E, Tomás-Zapico C.
In-Text Gene Mentions
Abstract)
…repeats in theHTTgene, and seven…
Show Full Abstract
Huntington's disease (HD) is a hereditary neurodegenerative disease, with peripheral consequences that negatively contribute to quality of life. Circulating microRNAs (cmiRNAs) are being explored for their roles in intercellular communication and gene expression regulation, which allows gaining insight into the regulation of crosstalk between neuronal and peripheral tissues. Here, we explore the cmiRNA profile of plasma samples from fifteen symptomatic patients, with 40-45 CAG repeats in the HTT gene, and seven healthy matched controls. Isolated miRNAs from plasma samples were run against human miRNome panels, which have sequences for 752 human mature miRNAs. We found that 168 cmiRNAs are altered in symptomatic patients. Considering Bonferroni's correction, miR-877-5p, miR-223-3p, miR-223-5p, miR-30d-5p, miR-128, miR-22-5p, miR-222-3p, miR-338-3p, miR-130b-3p, miR-425-5p, miR-628-3p, miR-361-5p, miR-942 are significantly increased in HD patients as compared with controls. Moreover, after patient's organization according to approved HD scales, miR-122-5p is significantly decreased in HD patients with Unified Huntington's Disease Rating Scale >24, whereas an increase in miR-100-5p levels and a decrease in miR-641 and miR-330-3p levels were recorded when patients were rearranged by Total Functional Capacity. These results suggest that cmiRNA profile could be further modified by disease progression, making cmiRNAs useful as monitoring biomarkers. Analysis of target genes indicated a general overexpression of cmiRNAs implicated in metabolism regulation. Profiling cmiRNA of HD subjects opens the possibility of personalized therapies for different groups of HD patients, based on disease modifiers: regulation of altered pathways might contribute to not only alleviate disease symptoms, but also influence HD progression.
Also flagged:NS1immune responsescytoskeletoninnate immunityinfluenza infectionpathogenesis
Journal Article2016-05-04✓ 2 SnippetsThulasi Raman SN, Zhou Y.
In-Text Gene Mentions
Results)
…interact with hStaufen (STAU1) ( Falcon et…
Results)
…observations, PABP1 andSTAU1were identified in…
Show Full Abstract
Pigs are an important host of influenza A viruses due to their ability to generate reassortant viruses with pandemic potential. NS1 protein of influenza A viruses is a key virulence factor and a major antagonist of innate immune responses. It is also involved in enhancing viral mRNA translation and regulation of virus replication. Being a protein with pleiotropic functions, NS1 has a variety of cellular interaction partners. Hence, studies on swine influenza viruses (SIV) and identification of swine influenza NS1-interacting host proteins is of great interest. Here, we constructed a recombinant SIV carrying a Strep-tag in the NS1 protein and infected primary swine respiratory epithelial cells (SRECs) with this virus. The Strep-tag sequence in the NS1 protein enabled us to purify intact, the NS1 protein and its interacting protein complex specifically. We identified cellular proteins present in the purified complex by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and generated a dataset of these proteins. 445 proteins were identified by LC-MS/MS and among them 192 proteins were selected by setting up a threshold based on MS parameters. The selected proteins were analyzed by bioinformatics and were categorized as belonging to different functional groups including translation, RNA processing, cytoskeleton, innate immunity, and apoptosis. Protein interaction networks were derived using these data and the NS1 interactions with some of the specific host factors were verified by immunoprecipitation. The novel proteins and the networks revealed in our study will be the potential candidates for targeted study of the molecular interaction of NS1 with host proteins, which will provide insights into the identification of new therapeutic targets to control influenza infection and disease pathogenesis.
Also flagged:lipidsugarmetabolismdetoxificationliver cancercancer
Journal Article2016-05-04✓ 1 SnippetKarin M, Dhar D.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
The liver is a key metabolic organ that is essential for production of blood proteins, lipid and sugar metabolism and detoxification of naturally occurring and foreign harmful chemicals. To maintain its mass and many essential functions, the liver possesses remarkable regenerative capacity, but the latter also renders it highly susceptible to carcinogenesis. In fact, liver cancer often develops in the context of chronic liver injury. Currently, primary liver cancer is the second leading cause of cancer-related deaths, and as the rates of other cancers have been declining, the incidence of liver cancer continues to rise with an alarming rate. Although much remains to be accomplished in regards to liver cancer therapy, we have learned a great deal about the molecular etiology of the most common form of primary liver cancer, hepatocellular carcinoma (HCC). Much of this knowledge has been obtained from studies of mouse models, using either toxic chemicals, a combination of fatty foods and endoplasmic reticulum stress or chronic activation of specific metabolic pathways. Surprisingly, NRF2, a transcription factor that was initially thought to protect the liver from oxidative stress, was found to play a key role in promoting HCC pathogenesis.
…The combined analysis of distinct datasets from BEAS-2B cells infected with RSV retrieved intriguing results, whereby using powerful statistical methods and assumptions this study identified a new set of biomarkers of early infection with RSV composed by seventeen genes: ABCC4, ARMC8, BCLAF1, EZH1, FAM118A, FAM208B, FUS, HSPH1, KAZN, MAP3K2, N6AMT1, PRMT2, S100PBP, SERPINA1, TLK2, ZNF322, and ZNF337.…
Abstract)
…, TLK2 ,ZNF322, and ZNF337…
Results)
…whereas MAP3K2 andZNF322are clearly involved…
Show Full Abstract
Respiratory syncytial virus (RSV) is a major cause of lower respiratory tract infections in children, elderly, and immunocompromised individuals. Despite of advances in diagnosis and treatment, biomarkers of RSV infection are still unclear. To understand the host response and propose signatures of RSV infection, previous studies evaluated the transcriptional profile of the human bronchial epithelial cell line-BEAS-2B-infected with different strains of this virus. However, the evolution of statistical methods and functional analysis together with the large amount of expression data provide opportunities to uncover novel biomarkers of inflammation and infections. In view of those facts publicly available microarray datasets from RSV-infected BEAS-2B cells were analyzed with linear model-based statistics and the platform for functional analysis InnateDB. The results from those analyses argue for the reevaluation of previously reported transcription patterns and biological pathways in BEAS-2B cell lines infected with RSV. Importantly, this study revealed a biosignature constituted by genes such as ABCC4, ARMC8, BCLAF1, EZH1, FAM118A, FAM208B, FUS, HSPH1, KAZN, MAP3K2, N6AMT1, PRMT2, S100PBP, SERPINA1, TLK2, ZNF322, and ZNF337 which should be considered in the development of new molecular diagnosis tools.
Also flagged:HypopituitarismAdrenal InsufficiencyHypothyroidismWilson's Diseasedepressionanorexia
Journal Article2016-05-04✓ 3 SnippetsLee HW, Kang JD, Yeo CW, Yoon SW, Lee KJ, Choi MK.
In-Text Gene Mentions
Discussion)
…as sarcoidosis orhemochromatosiswhich are relatively…
Discussion)
…Among infiltrative diseases,hemochromatosisis known to…
Discussion)
…some cases ofhemochromatosis.…
Show Full Abstract
Wilson's disease typically presents symptoms associated with liver damage or neuropsychiatric disturbances, while endocrinologic abnormalities are rare. We report an unprecedented case of hypopituitarism in a patient with Wilson's disease. A 40-year-old woman presented with depression, general weakness and anorexia. Laboratory tests and imaging studies were compatible with liver cirrhosis due to Wilson's disease. Basal hormone levels and pituitary function tests indicated secondary hypothyroidism and adrenal insufficiency due to hypopituitarism. Brain MRI showed T2 hyperintense signals in both basal ganglia and midbrain but the pituitary imaging was normal. She is currently receiving chelation therapy along with thyroid hormone and steroid replacement. There may be a relationship between Wilson's disease and hypopituitarism. Copper deposition or secondary neuronal damage in the pituitary may be a possible explanation for this theory.
…In these studies, when administered prior to the onset of clinical features, the agent offered striatal neuroprotection with reduced Htt-inclusion formation and reduced transglutaminase activity.94,95 In the more slowly progressing R6/1 mouse model of HD, cysteamine was also shown to be neuroprotective, but the authors postulated that in this case it also worked by increasing BDNF.96 This drug has previously been shown to be well tolerated in patients with HD,97,98 and recently a new 36-month, delayed-onset trial of cysteamine reported its preliminary findings via a press release.…
S I O 001029)
…Isis 443139 is an antisense oligonucleotide that has been designed to do exactly that, by targeting Htt messenger RNA to reduce its synthesis, and by so doing lead to a reversal of the clinical signs and symptoms of HD.…
S I O 001029)
…Nevertheless, any therapy that directly inhibits the expression of Htt would theoretically attack the primary disease mechanism and thus modify the pathological course of HD.…
Show Full Abstract
Huntington's disease (HD) is an incurable, inherited, progressive, neurodegenerative disorder that is characterized by a triad of motor, cognitive, and psychiatric problems. Despite the noticeable increase in therapeutic trials in HD in the last 20 years, there have, to date, been very few significant advances. The main hope for new and emerging therapeutics for HD is to develop a neuroprotective compound capable of slowing down or even stopping the progression of the disease and ultimately prevent the subtle early signs from developing into manifest disease. Recently, there has been a noticeable shift away from symptomatic therapies in favor of more mechanistic-based interventions, a change driven by a better understanding of the pathogenesis of this disorder. In this review, we discuss the status of, and supporting evidence for, potential novel treatments of HD that are currently under development or have reached the level of early Phase I/II clinical trials.
Also flagged:polypeptidegene expression regulationpolypeptidespeptidetranslationalsteroid receptor RNA activator
Journal Article2016-05-03No SnippetsNam JW, Choi SW, You BH.
Show Full Abstract
Since the RNA world hypothesis was proposed, a large number of regulatory noncoding RNAs (ncRNAs) have been identified in many species, ranging from microorganisms to mammals. During the characterization of these newly discovered RNAs, RNAs having both coding and noncoding functions were discovered, and these were considered bifunctional RNAs. The recent use of computational and high-throughput experimental approaches has revealed increasing evidence of various sources of bifunctional RNAs, such as protein-coding mRNAs with a noncoding isoform and long ncRNAs bearing a small open reading frame. Therefore, the genomic diversity of Janus-faced RNA molecules that have dual characteristics of coding and noncoding indicates that the functional roles of RNAs have to be revisited in cells on a genome-wide scale. Such studies would allow us to further understand the complex gene-regulatory network in cells. In this review, we discuss three major genomic sources of bifunctional RNAs and present a handful of examples of bifunctional RNA along with their functional roles.
Also flagged:synthesiscell cyclemetabolismcancertissue remodelingaging
Journal Article2016-05-03✓ 1 SnippetMarthandan S, Baumgart M, Priebe S, Groth M, Schaer J, Kaether C, Guthke R, Cellerino A, Platzer M, Diekmann S, Hemmerich P.
In-Text Gene Mentions
I A O 0000606)
…Kinesin Family Member C1Family Member C1…
Show Full Abstract
Cellular senescence correlates with changes in the transcriptome. To obtain a complete view on senescence-associated transcription networks and pathways, we assessed by deep RNA sequencing the transcriptomes of five of the most commonly used laboratory strains of human fibroblasts during their transition into senescence. In a number of cases, we verified the RNA-seq data by real-time PCR. By determining cellular protein levels we observed that the age-related expression of most but not all genes is regulated at the transcriptional level. We found that 78% of the age-affected differentially expressed genes were commonly regulated in the same direction (either up- or down-regulated) in all five fibroblast strains, indicating a strong conservation of age-associated changes in the transcriptome. KEGG pathway analyses confirmed up-regulation of the senescence-associated secretory phenotype and down-regulation of DNA synthesis/repair and most cell cycle pathways common in all five cell strains. Newly identified senescence-induced pathways include up-regulation of endocytotic/phagocytic pathways and down-regulation of the mRNA metabolism and the mRNA splicing pathways. Our results provide an unprecedented comprehensive and deep view into the individual and common transcriptome and pathway changes during the transition into of senescence of five human fibroblast cell strains.
Also flagged:choreabehavioralHDHuntington diseaseHuntington's diseaseautosomal dominant neurodegenerative disease
Journal Article2016-05-03✓ 1 SnippetCarlozzi NE, Downing NR, Schilling SG, Lai JS, Goodnight SM, Miner JA, A Frank S.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
<h4>Purpose</h4>Huntington's disease (HD) is an autosomal dominant neurodegenerative disease associated with motor, behavioral, and cognitive deficits. The hallmark symptom of HD, chorea, is often the focus of HD clinical trials. Unfortunately, there are no self-reported measures of chorea. To address this shortcoming, we developed a new measure of chorea for use in HD, HDQLIFE Chorea.<h4>Methods</h4>Qualitative data and literature reviews were conducted to develop an initial item pool of 141 chorea items. An iterative process, including cognitive interviews, expert review, translatability review, and literacy review, was used to refine this item pool to 64 items. These 64 items were field tested in 507 individuals with prodromal and/or manifest HD. Exploratory and confirmatory factor analyses (EFA and CFA, respectively) were conducted to identify a unidimensional set of items. Then, an item response theory graded response model (GRM) and differential item functioning analyses were conducted to select the final items for inclusion in this measure.<h4>Results</h4>EFA and CFA supported the retention of 34 chorea items. GRM and DIF supported the retention of all of these items in the final measure. GRM calibration data were used to inform the selection of a 6-item, static short form and to program the HDQLIFE Chorea computer adaptive test (CAT). CAT simulation analyses indicated a 0.99 correlation between the CAT scores and the full item bank.<h4>Conclusions</h4>The new HDQLIFE Chorea CAT and corresponding 6-item short form were developed using established rigorous measurement development standards; this is the first self-reported measure developed to evaluate the impact of chorea on HRQOL in HD. This development work indicates that these measures have strong psychometric properties; future work is needed to establish test-retest reliability and responsiveness to change.
Also flagged:mineralbone resorptionosteoclast differentiationosteoclastogenesisosteoporosisITGA2B
Journal Article2016-05-03No SnippetsZeng Y, Zhang L, Zhu W, Xu C, He H, Zhou Y, Liu YZ, Tian Q, Zhang JG, Deng FY, Hu HG, Zhang LS, Deng HW.
Show Full Abstract
<h4>Unlabelled</h4>Osteoporosis is mainly characterized by low bone mineral density (BMD), and can be attributed to excessive bone resorption by osteoclasts. Migration of circulating monocytes from blood to bone is important for subsequent osteoclast differentiation and bone resorption. Identification of those genes and pathways related to osteoclastogenesis and BMD will contribute to a better understanding of the pathophysiological mechanisms of osteoporosis. In this study, we applied the LC-nano-ESI-MS(E) (Liquid Chromatograph-nano-Electrospray Ionization-Mass Spectrometry) for quantitative proteomic profiling in 33 female Caucasians with discordant BMD levels, with 16 high vs. 17 low BMD subjects. Protein quantitation was accomplished by label-free measurement of total ion currents collected from MS(E) data. Comparison of protein expression in high vs. low BMD subjects showed that ITGA2B (p=0.0063) and GSN (p=0.019) were up-regulated in the high BMD group. Additionally, our protein-RNA integrative analysis showed that RHOA (p=0.00062) differentially expressed between high vs. low BMD groups. Network analysis based on multiple tools revealed two pathways: "regulation of actin cytoskeleton" (p=1.13E-5, FDR=3.34E-4) and "leukocyte transendothelial migration" (p=2.76E-4, FDR=4.71E-3) that are functionally relevant to osteoporosis. Consistently, ITGA2B, GSN and RHOA played crucial roles in these two pathways respectively. All together, our study strongly supported the contribution of the genes ITGA2B, GSN and RHOA and the two pathways to osteoporosis risk.<h4>Biological significance</h4>Mass spectrometry based quantitative proteomics study integrated with network analysis identified novel genes and pathways related to osteoporosis. The results were further verified in multiple level studies including protein-RNA integrative analysis and genome wide association studies.
Also flagged:perfluorooctanoic acidperfluorooctanesulfonic acidliver cancerhepatocyte nuclear factor 4-alphaHNF4αdeath
Journal Article2016-05-03No SnippetsBeggs KM, McGreal SR, McCarthy A, Gunewardena S, Lampe JN, Lau C, Apte U.
Show Full Abstract
Perfluorooctanoic acid (PFOA) and perfluorooctanesulfonic acid (PFOS), chemicals present in a multitude of consumer products, are persistent organic pollutants. Both compounds induce hepatotoxic effects in rodents, including steatosis, hepatomegaly and liver cancer. The mechanisms of PFOA- and PFOS-induced hepatic dysfunction are not completely understood. We present evidence that PFOA and PFOS induce their hepatic effects via targeting hepatocyte nuclear factor 4-alpha (HNF4α). Human hepatocytes treated with PFOA and PFOS at a concentration relevant to occupational exposure caused a decrease in HNF4α protein without affecting HNF4α mRNA or causing cell death. RNA sequencing analysis combined with Ingenuity Pathway Analysis of global gene expression changes in human hepatocytes treated with PFOA or PFOS indicated alterations in the expression of genes involved in lipid metabolism and tumorigenesis, several of which are regulated by HNF4α. Further investigation of specific HNF4α target gene expression revealed that PFOA and PFOS could promote cellular dedifferentiation and increase cell proliferation by down regulating positive targets (differentiation genes such as CYP7A1) and inducing negative targets of HNF4α (pro-mitogenic genes such as CCND1). Furthermore, in silico docking simulations indicated that PFOA and PFOS could directly interact with HNF4α in a similar manner to endogenous fatty acids. Collectively, these results highlight HNF4α degradation as novel mechanism of PFOA and PFOS-mediated steatosis and tumorigenesis in human livers.
Also flagged:Erectile dysfunctiondepressiontestosteronehypogonadismnitric oxideguanosine monophosphate
Journal Article2016-05-03✓ 5 SnippetsLi R, Meng X, Zhang Y, Wang T, Yang J, Niu Y, Cui K, Wang S, Liu J, Rao K.
In-Text Gene Mentions
Introduction)
…glandin I2 by prostacyclin synthase (PTGIS). …
Introduction)
…e role of the COX-2/PTGIS/cAMP signaling path…
Methods)
… Hong Kong, China), PTGIS (1:1000; Abcam, Hon…
Results)
…cavernous COX-2 and PTGIS protein expression …
Results)
…t showing COX-2 and PTGIS protein expression …
Show Full Abstract
Testosterone is overwhelmingly important in regulating erectile physiology. However, the associated molecular mechanisms are poorly understood. The purpose of this study was to explore the effects and mechanisms of testosterone in erectile dysfunction (ED) in castrated rats. Forty male Sprague-Dawley rats were randomized to four groups (control, sham-operated, castration and castration-with-testosterone-replacement). Reactive oxygen species (ROS) production was measured by dihydroethidium (DHE) staining. Erectile function was assessed by the recording of intracavernous pressure (ICP) and mean arterial blood pressure (MAP). Protein expression levels were examined by western blotting. We found that castration reduced erectile function and that testosterone restored it. Nitric oxide synthase (NOS) activity was decrease in the castrated rats, and testosterone administration attenuated this decrease (each p < 0.05). The testosterone, dihydrotestosterone, cyclic guanosine monophosphate (cGMP) and cyclic adenosine monophosphate (cAMP) concentrations were lower in the castrated rats, and testosterone restored these levels (each p < 0.05). Furthermore, the cyclooxygenase-2 (COX-2) and prostacyclin synthase (PTGIS) expression levels and phospho-endothelial nitric oxide synthase (p-eNOS, Ser1177)/endothelial nitric oxide synthase (eNOS) ratio were reduced in the castrated rats compared with the controls (each p < 0.05). In addition, the p40(phox) and p67(phox) expression levels were increased in the castrated rats, and testosterone reversed these changes (each p < 0.05). Overall, our results demonstrate that testosterone ameliorates ED after castration by reducing ROS production and increasing the activity of the eNOS/cGMP and COX-2/PTGIS/cAMP signaling pathways.
…hepatitis, Wilson’s disease,hemochromatosis, and α-1-antitrypsin deficien…
Show Full Abstract
<h4>Background</h4>Hepatitis B virus (HBV) is among the leading causes of liver cirrhosis worldwide. Predictors of cirrhosis in Iranian chronic hepatitis B (CHB) patients are yet to be clearly identified.<h4>Objectives</h4>Evaluating the predictive factors of liver cirrhosis in CHB.<h4>Patients and methods</h4>A longitudinal study was conducted during 1995 - 2014 on all CHB patients who were referred to Tehran hepatitis center, Tehran, Iran. The patients were assessed during periodic visits through medical history and laboratory data. Logistic regression analyses were used to determine predictors of cirrhosis.<h4>Results</h4>Two hundred thirty-seven CHB patients were followed for an average duration of 10.6 years, and 41 of these patients developed cirrhosis. The incidence rate of cirrhosis was 2.82/100 person-years. Univariate analyses determined 9 out of 17 factors as significant predictors of outcome in CHB patients. Age of ≥ 45 years, positive hepatitis D virus (HDV), negative HBeAg, platelet count of < 150 (× 10(9))/L, and HBV DNA level of ≥ 2,000 IU/mL were identified as significant independent predictors of liver cirrhosis in multiple logistic analyses.<h4>Conclusions</h4>Five predictive factors that are simple and easy to measure may be used as parameters for the prediction of liver cirrhosis in CHB patients.
…Physiologically, miR‐486 functions as a tumor suppressor and inhibits the anti‐apoptotic protein OLFM4.…
Show Full Abstract
Cancer is a disease of the genome caused by oncogene activation and tumor suppressor gene inhibition. Deep sequencing studies including large consortia such as TCGA and ICGC identified numerous tumor-specific mutations not only in protein-coding sequences but also in non-coding sequences. Although 98% of the genome is not translated into proteins, most studies have neglected the information hidden in this "dark matter" of the genome. Malignancy-driving mutations can occur in all genetic elements outside the coding region, namely in enhancer, silencer, insulator, and promoter as well as in 5'-UTR and 3'-UTR Intron or splice site mutations can alter the splicing pattern. Moreover, cancer genomes contain mutations within non-coding RNA, such as microRNA, lncRNA, and lincRNA A synonymous mutation changes the coding region in the DNA and RNA but not the protein sequence. Importantly, oncogenes such as TERT or miR-21 as well as tumor suppressor genes such as TP53/p53, APC, BRCA1, or RB1 can be affected by these alterations. In summary, coding-independent mutations can affect gene regulation from transcription, splicing, mRNA stability to translation, and hence, this largely neglected area needs functional studies to elucidate the mechanisms underlying tumorigenesis. This review will focus on the important role and novel mechanisms of these non-coding or allegedly silent mutations in tumorigenesis.
Journal Article2016-05-02✓ 5 SnippetsSalloum-Asfar S, Arroyo AB, Teruel-Montoya R, García-Barberá N, Roldán V, Vicente V, Martínez C, González-Conejero R.
In-Text Gene Mentions
I A O 0000326)
…SERPINC1…
Abstract)
…, F12 ,SERPINC1, PROS1 ,…
Abstract)
…, F12 ,SERPINC1, PROC ,…
Results)
…F9 (14–400%) andSERPINC1(6–640%) whereas PROC…
Results)
…, PROS1 andSERPINC1( Fig 4C…
Show Full Abstract
MiRNAs have been reported as CIS-acting elements of several hemostatic factors, however, their mechanism as TRANS-acting elements mediated by a transcription factor is little known and could have important effects. HNF4α has a direct and important role in the regulation of multiple hepatic coagulation genes. Previous in vitro studies have demonstrated that miR-24-3p and miR-34a-5p regulate HNF4A expression. Here we aimed to investigate the molecular mechanisms of miR-24 and miR-34a on coagulation through HNF4A. Transfections with miR-24 and miR-34a in HepG2 cells decreased not only HNF4A but also F10, F12, SERPINC1, PROS1, PROC, and PROZ transcripts levels. Positive and significant correlations were observed between levels of HNF4A and several hemostatic factors (F5, F8, F9, F11, F12, SERPINC1, PROC, and PROS1) in human liver samples (N = 104). However, miR-24 and miR-34a levels of the low (10th) and high (90th) percentiles of those liver samples were inversely correlated with HNF4A and almost all hemostatic factors expression levels. These outcomes suggest that miR-24 and miR-34a might be two indirect elements of regulation of several hemostatic factors. Additionally, variations in miRNA expression profiles could justify, at least in part, changes in HNF4A expression levels and its downstream targets of coagulation.
Also flagged:FLSrnoProtein kinase CInterleukin 1 receptor accessory proteinIRSIRAK
Journal Article2016-05-02No SnippetsOkamoto K, Koda M, Okamoto T, Onoyama T, Miyoshi K, Kishina M, Kato J, Tokunaga S, Sugihara TA, Hara Y, Hino K, Murawaki Y.
Show Full Abstract
<h4>Background & aims</h4>Simple steatosis (SS) and non-alcoholic steatohepatitis (NASH) are subtypes of non-alcoholic fatty liver disease (NAFLD), and the pathogenic differences between SS and NASH remain unclear. MicroRNAs (miRNAs) are endogenous, non-coding, short RNAs that regulate gene expression. The aim of this study was to use animal models and human samples to examine the relationship between miRNA expression profiles and each type of NAFLD (SS and NASH).<h4>Methods</h4>DD Shionogi, Fatty Liver Shionogi (FLS) and FLS ob/ob mice were used as models for normal control, SS and NASH, respectively. Microarray analysis and real-time PCR were used to identify candidate NAFLD-related miRNAs. Human serum samples were used to examine the expression profiles of these candidate miRNAs in control subjects and patients with SS or NASH.<h4>Results</h4>Fourteen miRNAs showed clear expression differences among liver tissues from SS, NASH, and control mice with good reproducibility. Among these NAFLD candidate miRNAs, seven showed similar expression patterns and were upregulated in both SS and NASH tissues; these seven candidate miRNAs mapped to an miRNA cluster in the 14q32.2 maternally imprinted region delineated by delta-like homolog 1 and type III iodothyronine deiodinase (Dlk1-Dio3 mat). Software-based predictions indicated that the transforming growth factor-β pathway, insulin like growth factor-1 and 5' adenosine monophosphate activated protein kinase were potential targets of theses Dlk1-Dio3 mat NAFLD candidate miRNAs. In addition, serum samples from patients with SS or NASH differed markedly with regard to expression of the putative Dlk1-Dio3 mat miRNAs, and these differences accurately corresponded with NAFLD diagnosis.<h4>Conclusion</h4>The expression profiles of seven miRNAs in 14q32.2 mat have high potential as biomarkers for NAFLD and for improving future research on the pathogenesis and treatment of NASH.
Also flagged:extracellularhistonesinfectionpeptidyl arginine deiminase 4PAD4autoantibodies
Journal Article2016-05-02No SnippetsSørensen OE, Borregaard N.
Show Full Abstract
Neutrophil extracellular traps (NETs) were discovered as extracellular strands of decondensed DNA in complex with histones and granule proteins, which were expelled from dying neutrophils to ensnare and kill microbes. NETs are formed during infection in vivo by mechanisms different from those originally described in vitro. Citrullination of histones by peptidyl arginine deiminase 4 (PAD4) is central for NET formation in vivo. NETs may spur formation of autoantibodies and may also serve as scaffolds for thrombosis, thereby providing a link among infection, autoimmunity, and thrombosis. In this review, we present the mechanisms by which NETs are formed and discuss the physiological and pathophysiological consequences of NET formation. We conclude that NETs may be of more importance in autoimmunity and thrombosis than in innate immune defense.
Also flagged:EGFTGF-αepidermal growth factor receptorRAB7phosphorylationRCP
Journal Article2016-05-02No SnippetsFrancavilla C, Papetti M, Rigbolt KT, Pedersen AK, Sigurdsson JO, Cazzamali G, Karemore G, Blagoev B, Olsen JV.
Show Full Abstract
A fascinating conundrum in cell signaling is how stimulation of the same receptor tyrosine kinase with distinct ligands generates specific outcomes. To decipher the functional selectivity of EGF and TGF-α, which induce epidermal growth factor receptor (EGFR) degradation and recycling, respectively, we devised an integrated multilayered proteomics approach (IMPA). We analyzed dynamic changes in the receptor interactome, ubiquitinome, phosphoproteome, and late proteome in response to both ligands in human cells by quantitative MS and identified 67 proteins regulated at multiple levels. We identified RAB7 phosphorylation and RCP recruitment to EGFR as switches for EGF and TGF-α outputs, controlling receptor trafficking, signaling duration, proliferation, and migration. By manipulating RCP levels or phosphorylation of RAB7 in EGFR-positive cancer cells, we were able to switch a TGF-α-mediated response to an EGF-like response or vice versa as EGFR trafficking was rerouted. We propose IMPA as an approach to uncover fine-tuned regulatory mechanisms in cell signaling.
…Selective expression of mutant huntingtin during development recapitulates characteristic features of Huntington's disease.…
Abstract)
…mutant huntingtin (mHtt) modified to…
Abstract)
…the floxed mHtt-exon1 was removed…
Abstract)
…removed and mHttexpression was terminated…
Abstract)
…mice expressing mHttthroughout life: (…
Show Full Abstract
Recent studies have identified impairments in neural induction and in striatal and cortical neurogenesis in Huntington's disease (HD) knock-in mouse models and associated embryonic stem cell lines. However, the potential role of these developmental alterations for HD pathogenesis and progression is currently unknown. To address this issue, we used BACHD:CAG-Cre(ERT2) mice, which carry mutant huntingtin (mHtt) modified to harbor a floxed exon 1 containing the pathogenic polyglutamine expansion (Q97). Upon tamoxifen administration at postnatal day 21, the floxed mHtt-exon1 was removed and mHtt expression was terminated (Q97(CRE)). These conditional mice displayed similar profiles of impairments to those mice expressing mHtt throughout life: (i) striatal neurodegeneration, (ii) early vulnerability to NMDA-mediated excitotoxicity, (iii) impairments in motor coordination, (iv) temporally distinct abnormalities in striatal electrophysiological activity, and (v) altered corticostriatal functional connectivity and plasticity. These findings strongly suggest that developmental aberrations may play important roles in HD pathogenesis and progression.
Also flagged:HIV-2 InfectionpathogenesisHIV-2 infectionsregulation ofgene expressioninfection
Journal Article2016-05-02No SnippetsDevadas K, Biswas S, Haleyurgirisetty M, Ragupathy V, Wang X, Lee S, Hewlett I.
Show Full Abstract
While human immunodeficiency virus type 1 and 2 (HIV-1 and HIV-2) share many similar traits, major differences in pathogenesis and clinical outcomes exist between the two viruses. The differential expression of host factors like microRNAs (miRNAs) in response to HIV-1 and HIV-2 infections are thought to influence the clinical outcomes presented by the two viruses. MicroRNAs are small non-coding RNA molecules which function in transcriptional and post-transcriptional regulation of gene expression. MiRNAs play a critical role in many key biological processes and could serve as putative biomarker(s) for infection. Identification of miRNAs that modulate viral life cycle, disease progression, and cellular responses to infection with HIV-1 and HIV-2 could reveal important insights into viral pathogenesis and provide new tools that could serve as prognostic markers and targets for therapeutic intervention. The aim of this study was to elucidate the differential expression profiles of host miRNAs in cells infected with HIV-1 and HIV-2 in order to identify potential differences in virus-host interactions between HIV-1 and HIV-2. Differential expression of host miRNA expression profiles was analyzed using the miRNA profiling polymerase chain reaction (PCR) arrays. Differentially expressed miRNAs were identified and their putative functional targets identified. The results indicate that hsa-miR 541-3p, hsa-miR 518f-3p, and hsa-miR 195-3p were consistently up-regulated only in HIV-1 infected cells. The expression of hsa-miR 1225-5p, hsa-miR 18a* and hsa-miR 335 were down modulated in HIV-1 and HIV-2 infected cells. Putative functional targets of these miRNAs include genes involved in signal transduction, metabolism, development and cell death.
Also flagged:TRIM8RING domainE3 ubiquitin ligasecancerpolypeptideamino acids
Journal Article2016-05-02✓ 1 SnippetHuang Y, Yu Y, Yang Y, Yang M, Zhou L, Huang X, Qin Q.
In-Text Gene Mentions
Discussion)
…and knockdown ofTRIM38expression resulted in…
Show Full Abstract
The tripartite motif (TRIM)-containing proteins usually exert important regulatory roles during multiple biological processes. TRIM8 has been demonstrated to be a RING domain-containing E3 ubiquitin ligase which plays critical roles in inflammation and cancer. In this study, a TRIM8 homolog from grouper, Epinephelus coioides (EcTRIM8) was cloned, and its effects on fish virus replication were investigated. The full-length EcTRIM8 cDNA encoded a polypeptide of 568 amino acids with 92% identity to TRIM8 homolog from large yellow croaker (Larimichthys crocea). Sequence alignment analysis indicated that EcTRIM8 contained conserved RING finger, B-box and coiled-coil domain. Expression patterns analysis showed that EcTRIM8 was predominant in kidney, gill, fin, liver, spleen and brain. After challenging with Singapore grouper iridovirus (SGIV) or polyinosin-polycytidylic acid (poly I:C), the EcTRIM8 transcript was significantly increased at the early stage of injection. Under fluorescence microscopy, we observed different distribution patterns of EcTRIM8 in grouper spleen (GS) cells, including punctate fluorescence evenly situated throughout the cytoplasm and bright aggregates. The ectopic expression of EcTRIM8 in vitro significantly inhibited the replication of SGIV and red spotted grouper nervous necrosis virus (RGNNV), evidenced by the obvious reduction in the severity of cytopathic effect (CPE) and the significant decrease in viral gene transcription and protein synthesis. Moreover, the transcription of the proinflammatory factors and interferon related immune factors were differently regulated by EcTRIM8 during SGIV or RGNNV infection. In addition, overexpression of EcTRIM8 significantly increased the transcription of interferon regulator factor 3 (IRF3) and IRF7, and enhanced IRF3 or IRF7 induced interferon-stimulated response element (ISRE) promoter activity. Together, our results firstly demonstrated that fish TRIM8 could exert antiviral function through the regulation of the expression of proinflammatory cytokines and interferon related transcription factors in response to fish viruses.
<h4>Background & aims</h4>Uncontrolled studies show sitagliptin, an oral DPP-4 inhibitor, may improve alanine aminotransferase and liver histology in non-alcoholic fatty liver disease (NAFLD) patients. We aimed to compare sitagliptin vs. the efficacy of a placebo in reducing liver fat measured by MRI-derived proton density-fat fraction (MRI-PDFF).<h4>Methods</h4>This randomized, double-blind, allocation-concealed, placebo-controlled trial included 50 NAFLD patients with prediabetes or early diabetes randomized to sitagliptin orally 100mg/day or placebo for 24weeks. Primary outcome was liver fat change measured by MRI-PDFF in colocalized regions of interest within each of nine liver segments. Additional advanced assessments included MR spectroscopy (MRS) for internal validation of MRI-PDFF's accuracy, and magnetic resonance elastography (MRE) and FIBROSpect® II to assess liver fibrosis.<h4>Results</h4>Sitagliptin was not significantly better than placebo in reducing liver fat measured by MRI-PDFF (mean difference between sitagliptin and placebo arms: -1.3%, p=0.4). Compared to baseline, there were no significant differences in end-of-treatment MRI-PDFF for sitagliptin (18.1% to 16.9%, p=0.27) or placebo (16.6% to 14.0%, p=0.07). The groups had no significant differences for changes in alanine aminotransferase, aspartate aminotransferase, low-density lipoprotein, homeostatic model assessment insulin resistance, and MRE-derived liver stiffness. In both groups at baseline and post-treatment, MRI-PDFF and MRS showed robust correlation coefficients ranging from r(2)=0.96 to r(2)=0.99 (p<0.0001), demonstrating the strong internal validity of the findings. FIBROSpect® II showed no changes in the sitagliptin group but was significantly increased in the placebo group (p=0.03).<h4>Conclusions</h4>Sitagliptin was safe but not better than placebo in reducing liver fat in prediabetic or diabetic patients with NAFLD.<h4>Lay summary</h4>In a randomized, double-blind, placebo-controlled study, the anti-diabetic drug sitagliptin was no more effective than placebo for improving liver fat and liver fibrosis in patients with non-alcoholic fatty liver disease. This study demonstrates that non-invasive magnetic resonance imaging techniques, including magnetic resonance imaging-proton density-fat fraction and magnetic resonance elastography, can be used to assess treatment response in non-alcoholic fatty liver disease clinical trials.
Also flagged:Voltage-gated calcium channelsSOD1ALSAmyotrophic lateral sclerosisneurodegenerative diseasepathogenesis
Journal Article2016-05-02No SnippetsChang Q, Martin LJ.
Show Full Abstract
Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterized by progressive loss of motoneurons. Hyperexcitability and excitotoxicity have been implicated in the early pathogenesis of ALS. Studies addressing excitotoxic motoneuron death and intracellular Ca(2+) overload have mostly focused on Ca(2+) influx through AMPA glutamate receptors. However, intrinsic excitability of motoneurons through voltage-gated ion channels may also have a role in the neurodegeneration. In this study we examined the function and localization of voltage-gated Ca(2+) channels in cultured spinal cord motoneurons from mice expressing a mutant form of human superoxide dismutase-1 with a Gly93→Ala substitution (G93A-SOD1). Using whole-cell patch-clamp recordings, we showed that high voltage activated (HVA) Ca(2+) currents are increased in G93A-SOD1 motoneurons, but low voltage activated Ca(2+) currents are not affected. G93A-SOD1 motoneurons also have altered persistent Ca(2+) current mediated by L-type Ca(2+) channels. Quantitative single-cell RT-PCR revealed higher levels of Ca1a, Ca1b, Ca1c, and Ca1e subunit mRNA expression in G93A-SOD1 motoneurons, indicating that the increase of HVA Ca(2+) currents may result from upregulation of Ca(2+) channel mRNA expression in motoneurons. The localizations of the Ca1B N-type and Ca1D L-type Ca(2+) channels in motoneurons were examined by immunocytochemistry and confocal microscopy. G93A-SOD1 motoneurons had increased Ca1B channels on the plasma membrane of soma and dendrites. Ca1D channels are similar on the plasma membrane of soma and lower on the plasma membrane of dendrites of G93A-SOD1 motoneurons. Our study demonstrates that voltage-gated Ca(2+) channels have aberrant functions and localizations in ALS mouse motoneurons. The increased HVA Ca(2+) currents and PCCa current could contribute to early pathogenesis of ALS.
Also flagged:retrotransposonschromosomespolymerasematingorganelleRetroelements
Journal Article2016-05-02No SnippetsLin X, Faridi N, Casola C.
Show Full Abstract
Comparative genomics analyses empowered by the wealth of sequenced genomes have revealed numerous instances of horizontal DNA transfers between distantly related species. In eukaryotes, repetitive DNA sequences known as transposable elements (TEs) are especially prone to move across species boundaries. Such horizontal transposon transfers, or HTTs, are relatively common within major eukaryotic kingdoms, including animals, plants, and fungi, while rarely occurring across these kingdoms. Here, we describe the first case of HTT from animals to plants, involving TEs known as Penelope-like elements, or PLEs, a group of retrotransposons closely related to eukaryotic telomerases. Using a combination of in situ hybridization on chromosomes, polymerase chain reaction experiments, and computational analyses we show that the predominant PLE lineage, EN(+)PLEs, is highly diversified in loblolly pine and other conifers, but appears to be absent in other gymnosperms. Phylogenetic analyses of both protein and DNA sequences reveal that conifers EN(+)PLEs, or Dryads, form a monophyletic group clustering within a clade of primarily arthropod elements. Additionally, no EN(+)PLEs were detected in 1,928 genome assemblies from 1,029 nonmetazoan and nonconifer genomes from 14 major eukaryotic lineages. These findings indicate that Dryads emerged following an ancient horizontal transfer of EN(+)PLEs from arthropods to a common ancestor of conifers approximately 340 Ma. This represents one of the oldest known interspecific transmissions of TEs, and the most conspicuous case of DNA transfer between animals and plants.
Hereditary angioedema (HAE) is a rare autosomal dominant disease that commonly manifests with episodes of cutaneous or submucosal angioedema and intense abdominal pain. The condition usually presents due to a deficiency of C1 esterase inhibitor (C1-INH) that leads to the overproduction of bradykinin, causing an abrupt increase in vascular permeability. A less-understood and less-common form of the disease presents with normal C1-INH levels. Symptoms of angioedema may be confused initially with mast cell-mediated angioedema, such as allergic reactions, and may perplex physicians when epinephrine, antihistamine, or glucocorticoid therapies do not provide relief. Similarly, abdominal attacks may lead to unnecessary surgeries or opiate dependence. All affected individuals are at risk for a life-threatening episode of laryngeal angioedema, which continues to be a source of fatalities due to asphyxiation. Unfortunately, the diagnosis is delayed on average by almost a decade due to a misunderstanding of symptoms and general lack of awareness of the disease. Once physicians suspect HAE, however, diagnostic methods are reliable and available at most laboratories, and include testing for C4, C1-INH protein, and C1-INH functional levels. In patients with HAE, management consists of acute treatment of an attack as well as possible short- or long-term prophylaxis. Plasma-derived C1-INH, ecallantide, icatibant, and recombinant human C1-INH are new treatments that have been shown to be safe and effective in the treatment of HAE attacks. The current understanding of HAE has greatly improved in recent decades, leading to growing awareness, new treatments, improved management strategies, and better outcomes for patients.
Also flagged:neurodegenerative disorderprolyl isomerasePin1p53HDaging
Journal Article2016-05-02✓ 5 SnippetsAgostoni E, Michelazzi S, Maurutto M, Carnemolla A, Ciani Y, Vatta P, Roncaglia P, Zucchelli S, Leanza G, Mantovani F, Gustincich S, Santoro C, Piazza S, Del Sal G, Persichetti F.
In-Text Gene Mentions
Abstract)
…region of theHTTgene.…
Results)
…in a wild-typeHttbackground was altering…
Results)
…in a wild-typeHttbackground was involving…
Results)
…in a wild-typeHttbackground.…
Results)
…were wild-type forHtt(Figure 2C ).…
Show Full Abstract
Huntington's disease (HD) is a fatal, dominantly inherited, neurodegenerative disorder due to a pathological expansion of the CAG repeat in the coding region of the HTT gene. In the quest for understanding the molecular basis of neurodegeneration, we have previously demonstrated that the prolyl isomerase Pin1 plays a crucial role in mediating p53-dependent apoptosis triggered by mutant huntingtin (mHtt) in vitro. To assess the effects of the lack of Pin1 in vivo, we have bred Pin1 knock-out mice with Hdh(Q111) knock-in mice, a genetically precise model of HD. We show that Pin1 genetic ablation modifies a portion of Hdh(Q111) phenotypes in a time-dependent fashion. As an early event, Pin1 activity reduces the DNA damage response (DDR). In midlife mice, by taking advantage of next-generation sequencing technology, we show that Pin1 activity modulates a portion of the alterations triggered by mHtt, extending the role of Pin1 to two additional Hdh(Q111) phenotypes: the unbalance in the "synthesis/concentration of hormones", as well as the alteration of "Wnt/β-catenin signaling". In aging animals, Pin1 significantly increases the number of mHtt-positive nuclear inclusions while it reduces gliosis. In summary, this work provides further support for a role of Pin1 in HD pathogenesis.
…In particular, we will focus on three Cul3 substrate adaptors, kelch-like ECH-associated protein (Keap1), kelch-like family member 20 (KLHL20), and speckle type BTB/POZ protein (SPOP), with the intent to highlight novel targets in cancer therapy.…
S I O 001029)
…(Middle) The Cul3–KLHL20 ubiquitin ligase mediates the degradation of tumor-suppressor proteins PML and DAPK, thereby promoting tumor progression and therapy resistance.…
I A O 0000615)
…In particular, Keap1, KLHL20, and SPOP are the most reported Cul3 substrate adaptors for their impacts on various cancer types.…
S I O 001029)
…KLHL20 in Tumor Hypoxia Responses…
S I O 001029)
…In line with this notion, KLHL20 expression is elevated in prostate cancers compared to its expression in benign prostatic hyperplasia.…
Show Full Abstract
Cullin-RING ubiquitin ligases are the largest E3 ligase family in eukaryotes and are multiprotein complexes. In these complexes, the Cullin protein serves as a scaffold to connect two functional modules of the ligases, the catalytic subunit and substrate-binding subunit. To date, eight members of the Cullin family proteins have been identified. In the Cul3 ubiquitin ligases, Bric-a-brac/Tramtrack/Broad complex (BTB) domain-containing proteins function as a bridge to connect Cul3 and substrates. While the BTB domain is responsible for Cul3 binding, these proteins usually contain an additional domain for substrate interaction, such as MATH, kelch, Zn finger, and PAM, Highwire, and RPM-1 (PHR domain). With the existence of a large number of BTB proteins in human, the Cul3 ubiquitin ligases ubiquitinate a wide range of substrates involving in diverse cellular functions. In this review, we will discuss recent advances on the functions of Cul3 ubiquitin ligases in cancer development, progression, and therapeutic response and the dysregulation of Cul3-mediated ubiquitination events in human malignancies. In particular, we will focus on three Cul3 substrate adaptors, kelch-like ECH-associated protein (Keap1), kelch-like family member 20 (KLHL20), and speckle type BTB/POZ protein (SPOP), with the intent to highlight novel targets in cancer therapy.
Also flagged:major depressive disordermood disordersABCA transporterslipidUNC5DSIAH2
Journal Article2016-05-02✓ 5 SnippetsZeng Y, Navarro P, Fernandez-Pujals AM, Hall LS, Clarke TK, Thomson PA, Smith BH, Hocking LJ, Padmanabhan S, Hayward C, MacIntyre DJ, Wray NR, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Deary IJ, Porteous DJ, Haley CS, McIntosh AM.
In-Text Gene Mentions
Discussion)
…These results imply a potentially functional contribution of variants in DCC and UNC5D to MDD.…
Results)
…three genes (DCC, UNC5D ,…
Results)
…proteins encoded byDCCand UNC5D share…
Results)
…Block 6 inDCCand Block 1…
Results)
…in LRT (Block6DCC: p lrt_bonf…
Show Full Abstract
<h4>Background</h4>Genome-wide association studies (GWASs) of major depressive disorder (MDD) have identified few significant associations. Testing the aggregation of genetic variants, in particular biological pathways, may be more powerful. Regional heritability analysis can be used to detect genomic regions that contribute to disease risk.<h4>Methods</h4>We integrated pathway analysis and multilevel regional heritability analyses in a pipeline designed to identify MDD-associated pathways. The pipeline was applied to two independent GWAS samples [Generation Scotland: The Scottish Family Health Study (GS:SFHS, N = 6455) and Psychiatric Genomics Consortium (PGC:MDD) (N = 18,759)]. A polygenic risk score (PRS) composed of single nucleotide polymorphisms from the pathway most consistently associated with MDD was created, and its accuracy to predict MDD, using area under the curve, logistic regression, and linear mixed model analyses, was tested.<h4>Results</h4>In GS:SFHS, four pathways were significantly associated with MDD, and two of these explained a significant amount of pathway-level regional heritability. In PGC:MDD, one pathway was significantly associated with MDD. Pathway-level regional heritability was significant in this pathway in one subset of PGC:MDD. For both samples the regional heritabilities were further localized to the gene and subregion levels. The NETRIN1 signaling pathway showed the most consistent association with MDD across the two samples. PRSs from this pathway showed competitive predictive accuracy compared with the whole-genome PRSs when using area under the curve statistics, logistic regression, and linear mixed model.<h4>Conclusions</h4>These post-GWAS analyses highlight the value of combining multiple methods on multiple GWAS data for the identification of risk pathways for MDD. The NETRIN1 signaling pathway is identified as a candidate pathway for MDD and should be explored in further large population studies.
<h4>Background</h4>Red blood cell transfusions are critical in burn management. The subsequent iron overload that can occur from this treatment can lead to secondary hemochromatosis with multi-organ damage.<h4>Case presentation</h4>While well recognized in patients receiving chronic transfusions, we present a case outlining the acute development of hemochromatosis secondary to multiple transfusions in a burn patient.<h4>Conclusions</h4>Simple screening laboratory measures and treatment options exist which may significantly reduce morbidity; thus, we believe awareness of secondary hemochromatosis in those treating burn patients is critical.
Also flagged:Nonalcoholic fatty liver diseaseNAFLDliver diseasenonalcoholic fatty livernonalcoholic steatohepatitisNASH
Journal Article2016-05-01✓ 1 SnippetAkuta N, Kawamura Y, Arase Y, Suzuki F, Sezaki H, Hosaka T, Kobayashi M, Kobayashi M, Saitoh S, Suzuki Y, Ikeda K, Kumada H.
<h4>Background/aims</h4>It is important to determine the noninvasive parameters of histological features in nonalcoholic fatty liver disease (NAFLD). The aim of this study was to investigate the value of genetic variations as surrogate markers of histological features.<h4>Methods</h4>The parameters that affected the histological features of NAFLD were investigated in 211 Japanese patients with biopsy-proven NAFLD. The relationships between genetic variations in PNPLA3 rs738409 or TM6SF2 rs58542926 and histological features were analyzed. Furthermore, the impact of genetic variations that affected the pathological criteria for the diagnosis of nonalcoholic steatohepatitis (NASH) (Matteoni classification and NAFLD activity score) was evaluated.<h4>Results</h4>The fibrosis stage of PNPLA3 GG was significantly more progressive than that of CG by multiple comparisons. Multivariate analysis identified PNPLA3 genotypes as predictors of fibrosis of stage 2 or more, but the impact tended to decrease at stage 3 or greater. There were no significant differences among the histological features of the three genotypes of TM6SF2. PNPLA3 genotypes partly affected the definition of NASH by the NAFLD activity score, but TM6SF2 genotypes did not affect the definition of NASH.<h4>Conclusions</h4>In Japanese patients with biopsy-proven NAFLD, PNPLA3 genotypes may partly affect histological features, including stage of fibrosis, but the TM6SF2 genotype does not affect histological features.
Also flagged:Systemic Lupus ErythematosusSLEchronic autoimmune disorderIKZF1HIP1IRF5
Journal Article2016-05-01✓ 5 SnippetsLessard CJ, Sajuthi S, Zhao J, Kim K, Ice JA, Li H, Ainsworth H, Rasmussen A, Kelly JA, Marion M, Bang SY, Joo YB, Choi J, Lee HS, Kang YM, Suh CH, Chung WT, Lee SK, Choe JY, Shim SC, Oh JH, Kim YJ, Han BG, Shen N, Howe HS, Wakeland EK, Li QZ, Song YW, Gaffney PM, Alarcón-Riquelme ME, Criswell LA, Jacob CO, Kimberly RP, Vyse TJ, Harley JB, Sivils KL, Bae SC, Langefeld CD, Tsao BP.
In-Text Gene Mentions
Abstract)
…Of these loci, previously unreported, independent second risk effects of SNPs in TNFAIP3 and TNFSF4, as well as differences in the association with a putative causal variant in the WDFY4 region, were identified.<h4>Conclusion</h4>Further studies are needed to identify true SLE risk effects in other loci suggestive of a significant association, and to identify the causal variants in the regions of ATG16L2, FCHSD2, and P2RY2.…
Abstract)
…Ten previously established SLE risk loci were replicated: STAT1-STAT4, TNFSF4, TNFAIP3, IKZF1, HIP1, IRF5, BLK, WDFY4, ETS1, and IRAK1-MECP2.…
<h4>Objective</h4>Systemic lupus erythematosus (SLE) is a chronic autoimmune disorder whose etiology is incompletely understood, but likely involves environmental triggers in genetically susceptible individuals. Using an unbiased genome-wide association (GWA) scan and replication analysis, we sought to identify the genetic loci associated with SLE in a Korean population.<h4>Methods</h4>A total of 1,174 SLE cases and 4,246 population controls from Korea were genotyped and analyzed with a GWA scan to identify single-nucleotide polymorphisms (SNPs) significantly associated with SLE, after strict quality control measures were applied. For select variants, replication of SLE risk loci was tested in an independent data set of 1,416 SLE cases and 1,145 population controls from Korea and China.<h4>Results</h4>Eleven regions outside the HLA exceeded the genome-wide significance level (P = 5 × 10(-8) ). A novel SNP-SLE association was identified between FCHSD2 and P2RY2, peaking at rs11235667 (P = 1.03 × 10(-8) , odds ratio [OR] 0.59) on a 33-kb haplotype upstream of ATG16L2. In the independent replication data set, the SNP rs11235667 continued to show a significant association with SLE (replication meta-analysis P = 0.001, overall meta-analysis P = 6.67 × 10(-11) ; OR 0.63). Within the HLA region, the SNP-SLE association peaked in the class II region at rs116727542, with multiple independent effects observed in this region. Classic HLA allele imputation analysis identified HLA-DRB1*1501 and HLA-DQB1*0602, each highly correlated with one another, as most strongly associated with SLE. Ten previously established SLE risk loci were replicated: STAT1-STAT4, TNFSF4, TNFAIP3, IKZF1, HIP1, IRF5, BLK, WDFY4, ETS1, and IRAK1-MECP2. Of these loci, previously unreported, independent second risk effects of SNPs in TNFAIP3 and TNFSF4, as well as differences in the association with a putative causal variant in the WDFY4 region, were identified.<h4>Conclusion</h4>Further studies are needed to identify true SLE risk effects in other loci suggestive of a significant association, and to identify the causal variants in the regions of ATG16L2, FCHSD2, and P2RY2.
Also flagged:proteaseshemorrhagic shockproteolysispeptidesshockpathogenesis
Journal Article2016-05-01No SnippetsAletti F, Maffioli E, Negri A, Santamaria MH, DeLano FA, Kistler EB, Schmid-Schönbein GW, Tedeschi G.
Show Full Abstract
It has been previously shown that intestinal proteases translocate into the circulation during hemorrhagic shock and contribute to proteolysis in distal organs. However, consequences of this phenomenon have not previously been investigated using high-throughput approaches. Here, a shotgun label-free quantitative proteomic approach was utilized to compare the peptidome of plasma samples from healthy and hemorrhagic shock rats to verify the possible role of uncontrolled proteolytic activity in shock. Plasma was collected from rats after hemorrhagic shock (HS) consisting of 2-h hypovolemia followed by 2-h reperfusion, and from healthy control (CTRL) rats. A new two-step enrichment method was applied to selectively extract peptides and low molecular weight proteins from plasma, and directly analyze these samples by tandem mass spectrometry. One hundred twenty-six circulating peptides were identified in CTRL and 295 in HS animals. Ninety-six peptides were present in both conditions; of these, 57 increased and 30 decreased in shock. In total, 256 peptides were increased or present only in HS confirming a general increase in proteolytic activity in shock. Analysis of the proteases that potentially generated the identified peptides suggests that the larger relative contribution to the proteolytic activity in shock is due to chymotryptic-like proteases. These results provide quantitative confirmation that extensive, system-wide proteolysis is part of the complex pathologic phenomena occurring in hemorrhagic shock.
<h4>Purpose of review</h4>Anemia is prevalent in patients with infections and other inflammatory conditions. Induction of the iron regulatory hormone hepcidin has been implicated in the pathogenesis of anemia of inflammation. This review outlines recent discoveries in understanding how hepcidin and its receptor ferroportin are regulated, how they contribute to anemia of inflammation, and how this knowledge may help guide new diagnostic and therapeutic strategies for this disease.<h4>Recent findings</h4>IL-6 is a primary driver for hepcidin induction in many models of anemia of inflammation, but the SMAD1/5/8 pathway also contributes, likely via Activin B and SMAD-STAT3 interactions at the hepcidin promoter. Hepcidin has an important functional role in many, but not all forms of anemia of inflammation, although hepcidin-independent mechanisms also contribute. In certain populations, hepcidin assays may help target therapy with iron or erythropoiesis-stimulating agents to patients who may benefit most. New therapies targeting the hepcidin-ferroportin axis have shown efficacy in preclinical and early clinical studies.<h4>Summary</h4>Recent studies confirm an important role for the hepcidin-ferroportin axis in the development of anemia of inflammation, but also highlight the diverse and complex pathogenesis of this disorder depending on the underlying disease. Hepcidin-based diagnostic and therapeutic strategies offer promise to improve anemia treatment, but more work is needed in this area.
Chronic infections with hepatitis B (HBV) and hepatitis C viruses (HCV) are the leading cause of cirrhosis and hepatocellular carcinoma (HCC) worldwide. Both viruses encode multifunctional regulatory proteins activating several oncogenic pathways, which induce accumulation of multiple genetic alterations in the infected hepatocytes. Gene mutations in HBV- and HCV-induced HCCs frequently impair the TP53, Wnt/b-catenin, RAS/RAF/MAPK kinase and AKT/mTOR pathways, which represent important anti-cancer targets. In this review, we highlight the molecular mechanisms underlying the pathogenesis of primary liver cancer, with particular emphasis on the host genetic variations identified by high-throughput technologies. In addition, we discuss the importance of genetic alterations, such as mutations in the telomerase reverse transcriptase (TERT) promoter, for the diagnosis, prognosis, and tumor stratification for development of more effective treatment approaches.
Also flagged:kinaseCancerTyrosine kinasestyrosine kinasetumorssolid tumors
Journal Article2016-05-01✓ 1 SnippetTabbò F, Pizzi M, Kyriakides PW, Ruggeri B, Inghirami G.
In-Text Gene Mentions
S I O 001029)
…The most promising therapeutic agents are the conventional TKi, Ponatinib, and the BCR-ABL1 switch control inhibitor, DCC-2036 [96].…
Show Full Abstract
Cancer biology relies on intrinsic and extrinsic deregulated pathways, involving a plethora of intra-cellular and extra-cellular components. Tyrosine kinases are frequently deregulated genes, whose aberrant expression is often caused by major cytogenetic events (e.g. chromosomal translocations). The resulting tyrosine kinase fusions (TKFs) prompt the activation of oncogenic pathways, determining the biological and clinical features of the associated tumors. First reported half a century ago, oncogenic TKFs are now found in a large series of hematologic and solid tumors. The molecular basis of TKFs has been thoroughly investigated and tailored therapies against recurrent TKFs have recently been developed. This review illustrates the biology of oncogenic TKFs and their role in solid as well as hematological malignancies. We also address the therapeutic implications of TKFs and the many open issues concerning their clinical impact.
Also flagged:reproductionfibroblast growth factorFGFWntbeta-cateninbone morphogenic protein
Journal Article2016-05-01No SnippetsChung JW.
Show Full Abstract
All living things share some common life processes, such as growth and reproduction, and have the ability to respond to their environment. However, each type of organism has its own specialized way of managing biological events. Genetic sequences determine phenotypic and physiological traits. Based on genetic information, comparative genomics has been used to delineate the differences and similarities between various genomes, and significant progress has been made in understanding regenerative biology by comparing the genomes of a variety of lower animal models of regeneration, such as planaria, zebra fish, and newts. However, the genome of lizards has been relatively ignored until recently, even though lizards have been studied as an excellent amniote model of tissue regeneration. Very recently, whole genome sequences of lizards have been uncovered, and several attempts have been made to find regeneration factors based on genetic information. In this article, recent advances in comparative analysis of the lizard genome are introduced, and their biological implications and putative applications for regenerative medicine and stem cell biology are discussed. [BMB Reports 2016; 49(5): 249-254].
Also flagged:gene expressioncorticosteronemineralocorticoid receptorglucocorticoidsbrain‐derived neurotrophic factorcorticotrophin‐releasing hormone
Journal Article2016-05-01No SnippetsMarasco V, Herzyk P, Robinson J, Spencer KA.
Show Full Abstract
Exposure to stress during early development can permanently influence an individual's physiology and behaviour, and affect its subsequent health. The extent to which elevated glucocorticoids cause such long-term 'programming' remains largely untested. In the present study, using the Japanese quail as our study species, we independently manipulated exposure to corticosterone during pre- and/or post-natal development and investigated the subsequent effects on global gene expression profiles within the hippocampus and hypothalamus upon achieving adulthood. Our results showed that the changes in transcriptome profiles in response to corticosterone exposure clearly differed between the hippocampus and the hypothalamus. We also showed that these effects depended on the developmental timing of exposure and identified brain-region specific gene expression patterns that were either: (i) similarly altered by corticosterone regardless of the developmental stage in which hormonal exposure occurred or (ii) specifically and uniquely altered by either pre-natal or post-natal exposure to corticosterone. Corticosterone-treated birds showed alterations in networks of genes that included known markers of the programming actions of early-life adversity (e.g. brain-derived neurotrophic factor and mineralocorticoid receptor within the hippocampus; corticotrophin-releasing hormone and serotonin receptors in the hypothalamus). Altogether, for the first time, these findings provide experimental support for the hypothesis that exposure to elevated glucocorticoids during development may be a key hormonal signalling pathway through which the long-term phenotypic effects associated with early-life adversity emerge and potentially persist throughout the lifespan. These data also highlight that stressors might have different long-lasting impacts on the brain transcriptome depending on the developmental stage in which they are experienced; more work is now required to relate these mechanisms to organismal phenotypic differences.
Also flagged:Ferritinophagyhost cellsinfectionsurinary tract infectionsautophagosomesIron
Journal Article2016-05-01✓ 1 SnippetBauckman KA, Mysorekar IU.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Autophagy is a cellular recycling pathway, which in many cases, protects host cells from infections by degrading pathogens. However, uropathogenic Escherichia coli (UPEC), the predominant cause of urinary tract infections (UTIs), persist within the urinary tract epithelium (urothelium) by forming reservoirs within autophagosomes. Iron is a critical nutrient for both host and pathogen, and regulation of iron availability is a key host defense against pathogens. Iron homeostasis depends on the shuttling of iron-bound ferritin to the lysosome for recycling, a process termed ferritinophagy (a form of selective autophagy). Here, we demonstrate for the first time that UPEC shuttles with ferritin-bound iron into the autophagosomal and lysosomal compartments within the urothelium. Iron overload in urothelial cells induces ferritinophagy in an NCOA4-dependent manner causing increased iron availability for UPEC, triggering bacterial overproliferation and host cell death. Addition of even moderate levels of iron is sufficient to increase and prolong bacterial burden. Furthermore, we show that lysosomal damage due to iron overload is the specific mechanism causing host cell death. Significantly, we demonstrate that host cell death and bacterial burden can be reversed by inhibition of autophagy or inhibition of iron-regulatory proteins, or chelation of iron. Together, our findings suggest that UPEC persist in host cells by taking advantage of ferritinophagy. Thus, modulation of iron levels in the bladder may provide a therapeutic avenue to controlling UPEC persistence, epithelial cell death, and recurrent UTIs.
Journal Article2016-05-01✓ 5 SnippetsFu Y, Huang W, Jin D, Geng D.
In-Text Gene Mentions
Abstract)
…This meta-analysis reveals that TNFSF4 (rs3850641) polymorphisms is not associated with CHD risk.…
Abstract)
…On the other hand, in the subgroup analysis by ethnicity, source of controls, genotyping methods, or matching criteria, there was still no statistically significant association between TNFSF4 (rs3850641) polymorphisms and CHD risk.<h4>Conclusions</h4>This meta-analysis reveals that TNFSF4 (rs3850641) polymorphisms is not associated with CHD risk.…
Abstract)
…<h4>Objective</h4>To clarify the effects of TNFSF4 (rs3850641) polymorphisms on coronary heart disease (CHD) risk.<h4>Method</h4>Published literature from Pubmed, Embase, ISI Wed of Knowledge, Cochrane Library, and Chinese databases were retrieved.…
Abstract)
…All studies evaluating the association between TNFSF4 (rs3850641) polymorphisms and CHD risk were included.…
Title)
…Association of TNFSF4 (rs3850641) gene polymorphisms and coronary heart disease: an evidence-based meta-analysis.…
Show Full Abstract
<h4>Objective</h4>To clarify the effects of TNFSF4 (rs3850641) polymorphisms on coronary heart disease (CHD) risk.<h4>Method</h4>Published literature from Pubmed, Embase, ISI Wed of Knowledge, Cochrane Library, and Chinese databases were retrieved. All studies evaluating the association between TNFSF4 (rs3850641) polymorphisms and CHD risk were included. Summary odds ratios (ORs) and 95% confidence intervals (CI) were calculated employing random-effects models irrespective of between-study heterogeneity.<h4>Results</h4>A total of 9 eligible studies was included in this meta-analysis. Overall analysis showed that the rs3850641 G allele was not associated with CHD, compared with the A allele, with OR of 1.10 (95% CI, 0.96-1.27; p = 0.174). Genotypic analysis showed that there was no significant association between the GG, GA, GG + GA, and CHD, compared with participants with AA, with ORs of 1.23 (95% CI, 0.75-2.03; p = 0.409), 1.04 (95% CI, 0.84-1.29; p = 0.705), and 1.07 (95% CI, 0.85-1.34; p = 0.589), respectively. On the other hand, in the subgroup analysis by ethnicity, source of controls, genotyping methods, or matching criteria, there was still no statistically significant association between TNFSF4 (rs3850641) polymorphisms and CHD risk.<h4>Conclusions</h4>This meta-analysis reveals that TNFSF4 (rs3850641) polymorphisms is not associated with CHD risk.
Also flagged:CDK6SPCCell cyclenon-small-cell lung cancerGAPDHLSD1
Journal Article2016-05-01✓ 1 SnippetShi X, Ma C, Zhu Q, Yuan D, Sun M, Gu X, Wu G, Lv T, Song Y.
In-Text Gene Mentions
Results)
…such as PRC2,STAU1, and LSD1 […
Show Full Abstract
Despite improvements in diagnostics and treatment of non-small cell lung cancer (NSCLC), it remains the leading causes of cancer-related mortality worldwide. In more recent years, mutiple lines of evidence have highlighted long noncoding RNAs (lncRNAs) serve as novel class of regulators of cancer biological processes, including proliferation, apoptosis and metastasis. LncRNAs serve as a novel class of regulators of cancer biological processes in cancer, but little is known of their expression and potential functions in NSCLC. We identified an oncogene, linc00673, whose expression level was upregulated by bioinformatics analyses and qRT-PCR analyses in NSCLC. The effects of linc00673 on tumor progression were investigated in vitro and in vivo. Linc00673 knockdown significantly inhibited cell proliferation and colony-forming ability, and suppressed S-phase entry in vitro and shRNA linc00673 mediated knockdown significantly inhibit tumor growth in vivo, meanwhile, linc00673 overexpression increased tumor cell growth. Analysis of RNAseq data revealed linc00673 could modulate the transcription of a large amount of genes including oncogene and tumor suppressor gene, so we investigated the role and regulatory mechanism of linc00673 in NSCLC proliferation. Further mechanistic analyses indicated that the oncogenic activity of linc00673 is partially attributable to its repression of NCALD through association with the epigenetic repressor LSD1. Taken together, these findings suggested that linc00673 could play crucial role in NSCLC progression and might be a potential therapeutic target for patients with NSCLC.
Also flagged:H-cadherinmethylationMGMTE-cadherinSSTp16
Journal Article2016-05-01✓ 5 SnippetsMisawa K, Mochizuki D, Imai A, Endo S, Mima M, Misawa Y, Kanazawa T, Carey TE, Mineta H.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Introduction)
…We prospectively analyzed 11 genes involved in cell cycle control (p16, galanin receptor 1; GALR1), DNA damage repair (O6-alkylguanine DNA alkyltransferase; MGMT), apoptosis (death-associated protein kinase; DAPK, Ras association domain-containing protein 1; RASSF1A), inflammatory reactions (tachykinin, precursor 1; TAC1), antitumor and antisecretory activity (somatostatin; SST), and tumor cell invasion (E-cadherin, H-cadherin, deleted in colorectal carcinoma [DCC], and collagen alpha-2(I) chain [COL1A2]) in a cohort of clinically well-characterized HNSCC samples.…
Abstract)
…We detected frequent methylation of p16 (44%), RASSF1A (18%), E-cadherin (53%), H-cadherin (35%), MGMT (35%), DAPK (53%), DCC (42%), COL1A2 (44%), TAC1 (61%), SST (64%), and GALR1 (44%) in HNSCC.…
Abstract)
…The methylation statuses of the promoters of 11 tumor-related genes (p16, RASSF1A, E-cadherin, H-cadherin, MGMT, DAPK, DCC, COL1A2, TAC1, SST, and GALR1) were analyzed in 133 HNSCC cases using quantitative methylation-specific PCR.…
Results)
…In particular, we detected frequent methylation of p16 (44.4%), RASSF1A (18.0%), E-cadherin (53.6%), H-cadherin (35.3%), MGMT (35.3%), DAPK (53.4%), DCC (42.1%), COL1A2 (44.4%), TAC1 (61.0%), SST (64.0%), and GALR1 (44.4%) in HNSCC (Figure 1B).…
Show Full Abstract
Staging and pathological grading are useful, but imperfect predictors of recurrence in head and neck squamous cell carcinoma (HNSCC). Accordingly, molecular biomarkers that predict the risk of recurrence are necessary to improve clinical outcomes. The methylation statuses of the promoters of 11 tumor-related genes (p16, RASSF1A, E-cadherin, H-cadherin, MGMT, DAPK, DCC, COL1A2, TAC1, SST, and GALR1) were analyzed in 133 HNSCC cases using quantitative methylation-specific PCR. We detected frequent methylation of p16 (44%), RASSF1A (18%), E-cadherin (53%), H-cadherin (35%), MGMT (35%), DAPK (53%), DCC (42%), COL1A2 (44%), TAC1 (61%), SST (64%), and GALR1 (44%) in HNSCC. Disease-free survival was lower in patients with 6-11 methylated genes than in those with 0-5 methylated genes (log-rank test, P = 0.001). In a multivariate Cox proportional hazards analysis, the methylation of E-cadherin, COL1A2, TAC1, and GALR1 was associated with poor survival, with hazard ratios of 4.474 (95% CI, 1.241-16.124). In a joint analysis of these four genes, patients with 2-4 methylated genes had a significantly lower survival rate than those with 0-1 methylated genes in early-stage HNSCC. Importantly, the methylation of some genes was closely related to poor prognosis in early-stage HNSCC, providing strong evidence that these hypermethylated genes are valuable biomarkers for prognostic evaluation.
Journal Article2016-05-01No SnippetsBharadwaj U, Eckols TK, Xu X, Kasembeli MM, Chen Y, Adachi M, Song Y, Mo Q, Lai SY, Tweardy DJ.
Show Full Abstract
While STAT3 has been validated as a target for treatment of many cancers, including head and neck squamous cell carcinoma (HNSCC), a STAT3 inhibitor is yet to enter the clinic. We used the scaffold of C188, a small-molecule STAT3 inhibitor previously identified by us, in a hit-to-lead program to identify C188-9. C188-9 binds to STAT3 with high affinity and represents a substantial improvement over C188 in its ability to inhibit STAT3 binding to its pY-peptide ligand, to inhibit cytokine-stimulated pSTAT3, to reduce constitutive pSTAT3 activity in multiple HNSCC cell lines, and to inhibit anchorage dependent and independent growth of these cells. In addition, treatment of nude mice bearing xenografts of UM-SCC-17B, a radioresistant HNSCC line, with C188-9, but not C188, prevented tumor xenograft growth. C188-9 treatment modulated many STAT3-regulated genes involved in oncogenesis and radioresistance, as well as radioresistance genes regulated by STAT1, due to its potent activity against STAT1, in addition to STAT3. C188-9 was well tolerated in mice, showed good oral bioavailability, and was concentrated in tumors. Thus, C188-9, either alone or in combination with radiotherapy, has potential for use in treating HNSCC tumors that demonstrate increased STAT3 and/or STAT1 activation.
Also flagged:ANKCalcium Pyrophosphateankylosisamino acidtransmembrane proteinpyrophosphate
Journal Article2016-05-01✓ 1 SnippetMitton-Fitzgerald E, Gohr CM, Bettendorf B, Rosenthal AK.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
The protein product of the progressive ankylosis gene, known as ANK, is a 492-amino acid multi-pass transmembrane protein. This protein is critical for the regulation of pyrophosphate, and gain of function ANK mutations is associated with calcium pyrophosphate deposition disease. Much about the structure, function, and regulation of ANK remain unstudied. This review of the current literature examines recent contributions to our understanding of ANK. We focus on new work on the function, binding partners, and regulators of ANK. A more complete understanding of this important protein may help to identify future therapeutic targets for the treatment of calcium pyrophosphate deposition disease.
Also flagged:methylationgene expressioncolorectal cancerIGDCC3colorectal cancerscancer
Journal Article2016-05-01✓ 1 SnippetChong A, Teo JX, Ban KH.
In-Text Gene Mentions
Results)
…Colorectal Cancer geneDCC, with 41,…
Show Full Abstract
Epigenetic changes, like DNA methylation, affect gene expression and in colorectal cancer (CRC), a distinct phenotype called the CpG island methylator phenotype ("CIMP") has significantly higher levels of DNA methylation at so-called "Type C loci" within the genome. We postulate that enhancer-gene pairs are coordinately controlled through DNA methylation in order to regulate the expression of key genes/biomarkers for a particular phenotype.Firstly, we found 24 experimentally-validated enhancers (VISTA enhancer browser) that contained statistically significant (FDR-adjusted q-value of <0.01) differentially methylated regions (DMRs) (1000bp) in a study of CIMP versus non-CIMP CRCs. Of these, the methylation of 2 enhancers, 1702 and 1944, were found to be very well correlated with the methylation of the genes Wnt3A and IGDCC3, respectively, in two separate and independent datasets.We show for the first time that there are indeed distinct and dynamic changes in the methylation pattern of specific enhancer-gene pairs in CRCs. Such a coordinated epigenetic event could be indicative of an interaction between (1) enhancer 1702 and Wnt3A and (2) enhancer 1944 and IGDCC3. Moreover, our study shows that the methylation patterns of these 2 enhancer-gene pairs can potentially be used as biomarkers to delineate CIMP from non-CIMP CRCs.
Also flagged:PCDH7Bladder cancerprotocadherinstumorcancerschromosome
Journal Article2016-05-01No SnippetsLin YL, Wang YL, Fu XL, Li WP, Wang YH, Ma JG.
Show Full Abstract
Bladder cancer is a heterogeneous disease with outcome difficult to predict, and novel predictive biomarkers are needed. PCDH7, a member of protocadherins family, functions as tumor suppressor in several human cancers. The human PCDH7 gene is localized in chromosome 4p15, which is often inactivated in human cancers, including bladder cancer. The aim of this study was to investigate the clinical significance of PCDH7 expression in non-muscle invasive bladder cancer (NMIBC). PCDH7 expression was examined using immunohistochemical staining in 199 primary NMIBC tissues and 25 normal bladder epithelial tissues. Then the relationship between PCDH7 expression and clinicopathologic features was evaluated. Kaplan-Meier survival analysis and Cox analysis was used to evaluate the correlation between PCDH7 expression and prognosis. PCDH7 expression in NMIBC tissues was significantly lower than that in normal bladder epithelial tissues (P < 0.001). Low PCDH7 expression correlated with advanced grade (P = 0.021) and larger tumor size (P = 0.044). Moreover, patients with low PCDH7 expression have shorter recurrence-free survival (P < 0.001), progression-free survival (P = 0.007) and overall survival (P = 0.011) than patients with high PCDH7 expression. Low PCDH7 expression is an independent predictor of recurrence-free survival (multivariate Cox analysis: P = 0.007), progression-free survival (multivariate Cox analysis: P = 0.014) and overall survival (multivariate Cox analysis: P = 0.004). The findings indicate that low PCDH7 expression is a potential prognostic biomarker for primary NMIBC.
Also flagged:alkaloidtranslationalStress granulescytoplasmic ribonucleoproteincancermetabolism
Journal Article2016-05-01✓ 2 SnippetsSzaflarski W, Fay MM, Kedersha N, Zabel M, Anderson P, Ivanov P.
In-Text Gene Mentions
Methods)
…Anti-Stau1(cat.…
Results)
…associated RNA-binding proteinSTAU1( Figure S4…
Show Full Abstract
Resistance to chemotherapy drugs is a serious therapeutic problem and its underlying molecular mechanisms are complex. Stress granules (SGs), cytoplasmic ribonucleoprotein complexes assembled in cells exposed to stress, are implicated in various aspects of cancer cell metabolism and survival. SGs promote the survival of stressed cells by reprogramming gene expression and inhibiting pro-apoptotic signaling cascades. We show that the vinca alkaloid (VA) class of anti-neoplastic agents potently activates a SG-mediated stress response program. VAs inhibit translation initiation by simultaneous activation of eIF4E-BP1 and phosphorylation of eIF2α, causing polysome disassembly and SG assembly. VA-induced SGs contain canonical SG components but lack specific signaling molecules. Blocking VA-induced SG assembly by inactivating eIF4EBP1 or inhibiting eIF2α phosphorylation decreases cancer cell viability and promotes apoptosis. Our data describe previously unappreciated effects of VAs on cellular RNA metabolism and illuminate the roles of SGs in cancer cell survival.
Also flagged:Di(2-ethylhexyl) phthalatediethyl-hexyl phthalatepolyvinylestrogenBisphenol Apolycarbonate
Journal Article2016-05-01✓ 2 SnippetsWang T, Han J, Duan X, Xiong B, Cui XS, Kim NH, Liu HL, Sun SC.
In-Text Gene Mentions
Results)
…SOD1, SOD2, Prdx2,Prdx6) were examined…
Results)
…SOD2, Prdx2 andPrdx6had no significantly…
Show Full Abstract
Bisphenol A (BPA) and Di-(2-ethylhexyl) phthalate (DEHP) are widely used in the plastic industry such as water bottles, containers, packaging and toys. BPA and DEHP are shown to be the endocrine disruptors which disturb the endocrine system and are linked to several diseases including infertility. In this study, we investigated the effects of BPA exposure on porcine oocyte maturation and its possible reasons. Our results showed that: (i) the rates of oocyte maturation significantly decreased with 250 μM BPA treatment in vitro, but not DEHP. This might be due to the delayed cell cycle progression of oocyte maturation. (ii) BPA treatment resulted in abnormal cytoskeletons on porcine oocytes, showing with aberrant actin distribution, spindle morphology and chromosome alignment, which was further confirmed by the reduced p-MAPK level. (iii) The fluorescence intensity of histone methylation (H3K4me2) and DNA methylation (5 mC) levels were altered after BPA treatment, indicating that epigenetic modification was disturbed. (iv) BPA-exposed oocytes had higher rates of early stage apoptosis/autophagy, and this may be resulted from the increased level of oxidative stress. Collectively, our results indicated that porcine oocytes maturation was disrupted after BPA treatment through disrupting cytoskeletal dynamics, epigenetic modifications and inducing apoptosis/autophagy.
Also flagged:IronDialysisgenetic hemochromatosisanemiadeatherythropoiesis-stimulating
Journal Article2016-05-01✓ 2 SnippetsRostoker G, Vaziri ND, Fishbane S.
In-Text Gene Mentions
S I O 001029)
…No link was found between the LIC of hemodialysis patients with excessive alcohol consumption [Alcohol Use Disorders Test (AUDIT) score] and the major HFE mutation C282Y [8].…
Introduction)
…hemosideroses and genetichemochromatosis[ 10 ].…
Show Full Abstract
Iron overload used to be considered rare in hemodialysis patients but its clinical frequency is now increasingly realized. The liver is the main site of iron storage and the liver iron concentration (LIC) is closely correlated with total iron stores in patients with secondary hemosideroses and genetic hemochromatosis. Magnetic resonance imaging is now the gold standard method for LIC estimation and monitoring in non-renal patients. Studies of LIC in hemodialysis patients by quantitative magnetic resonance imaging and magnetic susceptometry have demonstrated a strong relation between the risk of iron overload and the use of intravenous (IV) iron products prescribed at doses determined by the iron biomarker cutoffs contained in current anemia management guidelines. These findings have challenged the validity of both iron biomarker cutoffs and current clinical guidelines, especially with respect to recommended IV iron doses. Three long-term observational studies have recently suggested that excessive IV iron doses may be associated with an increased risk of cardiovascular events and death in hemodialysis patients. We postulate that iatrogenic iron overload in the era of erythropoiesis-stimulating agents may silently increase complications in dialysis patients without creating frank clinical signs and symptoms. High hepcidin-25 levels were recently linked to fatal and nonfatal cardiovascular events in dialysis patients. It is therefore tempting to postulate that the main pathophysiological pathway leading to these events may involve the pleiotropic master hormone hepcidin (synergized by fibroblast growth factor 23), which regulates iron metabolism. Oxidative stress as a result of IV iron infusions and iron overload, by releasing labile non-transferrin-bound iron, might represent a 'second hit' on the vascular bed. Finally, iron deposition in the myocardium of patients with severe iron overload might also play a role in the pathogenesis of sudden death in some patients.
Also flagged:B4GALT1clear cell renal cell carcinomabeta-1, 4-galactosyltransferaseccRCCtumorkidney cancer
Journal Article2016-05-01✓ 5 SnippetsXie H, Zhu Y, An H, Wang H, Zhu Y, Fu H, Wang Z, Fu Q, Xu J, Ye D.
In-Text Gene Mentions
Discussion)
…Exogenous reagents like etoposide could regulate B4GALT5 in glioma by influencing the level of related transcription factors [17].…
Discussion)
…B4GALT5and B4GALT6 also…
Discussion)
…reported, B4GALT1 andB4GALT5gene are both…
Discussion)
…etoposide could regulateB4GALT5in glioma by…
Discussion)
…B4GALT1 andB4GALT5have been shown…
Show Full Abstract
B4GALT1 is one of seven beta-1, 4-galactosyltransferase (B4GALT) genes, which has distinct functions in various malignances. Here, we evaluate the association of B4GALT1 expression with oncologic outcome in patients with non-metastatic clear cell renal cell carcinoma (ccRCC). A retrospective analysis of 438 patients with non-metastatic ccRCC at two academic medical centers between 2005 and 2009 was performed. The first cohort with 207 patients was treated as training cohort and the other as validation cohort. Tissue microarrays (TMAs) were created in triplicate from formalin-fixed, paraffin embedded specimens. Immunohistochemistry (IHC) was performed and the association of B4GALT1 expression with standard pathologic features and prognosis were evaluated. B4GALT1 expression was significantly associated with tumor T stage (P<0.001 and P<0.001, respectively), Fuhrman grade (P<0.001 and P<0.001, respectively) and necrosis (P=0.021 and P=0.002, respectively) in both training and validation cohorts. And high B4GALT1 expression indicated poor overall survival (OS) (P<0.001 and P<0.001, respectively) in the two cohorts. Furthermore, B4GALT1 expression was identified as an independent adverse prognostic factor for survival (P=0.007 and P=0.002, respectively). Moreover, the accuracy of established prognostic models was improved when B4GALT1 expression was added. Therefore, a predictive nomogram was generated with identified independent prognosticators to assess patients' OS at 5 and 10 years. Increased B4GALT1 expression is a potential independent adverse prognostic factor for OS in patients with non-metastatic ccRCC.
Stroke is one of the most fatal diseases in the world, which is seriously threatening human life. Raf kinase inhibitory protein (RKIP) is involved in the regulation of several signaling pathways and is important for cell growth, proliferation, differentiation and apoptosis. In the present study, the protective effect of RKIP on stroke was investigated by the metabonomics method based on the UHPLC-Q-TOF-MS technique. TTC staining of brain tissues showed that RKIP overexpression by the lentivirus markedly reduced the necrotic area after ischemic stroke. Subsequent metabolomic profiling revealed that the protective effect of RKIP overexpression on ischemic stroke is mainly reflected in the metabolism of energy, amino acids and lipids. Several metabolites involved in purine, pyrimidine and fatty acid metabolism were identified. It was also shown that the protective effect of RKIP on ischemic stroke might be mediated by inhibiting the inflammatory response. The current study provided insight into the molecular mechanism of ischemic stroke and a reliable basis for the development of novel therapeutic targets for the treatment of ischemic stroke.
Also flagged:colorectal carcinomabreast cancerDeleted in colorectal carcinomacancersnetrin-1 dependence receptortumors
Journal Article2016-05-01✓ 5 SnippetsLiu X, Wang X, Fu SW, Wang M, Kang H, Guan H, Zhang S, Ma X, Lin S, Liu K, Feng Y, Dai C, Dai Z.
In-Text Gene Mentions
Abstract)
…These findings affirmed that rs2229080 and rs7504990 polymorphisms in DCC might be related with breast cancer susceptibility in Chinese women.…
Discussion)
…As this is the first report of genetic BC susceptibility related to DCC polymorphism, similar studies with larger sample sizes will be needed for further verification.…
Discussion)
…Significant differences were observed between cases without metastasis or local recurrences versus those with metastasis or local recurrences, suggesting that a decrease in DCC expression might influence the prognosis of patients with breast cancer [22].…
Abstract)
…Evidence indicated that DCC was frequently down-regulated in many cancers.…
Discussion)
…According to our study, the DCC rs2229080 polymorphism was associated with the lymph node metastasis status.…
Show Full Abstract
Deleted in colorectal carcinoma (DCC), a netrin-1 dependence receptor, is correlated with cell progression, migration, and adhesion. Evidence indicated that DCC was frequently down-regulated in many cancers. However, the association of DCC with breast cancer remains uncertain. We conducted a case-control study to investigate the impact of three DCC gene variants (rs2229080, rs7504990, and rs4078288) on breast cancer susceptibility in Chinese women. This study included 560 breast cancer patients and 583 age-matched healthy controls from Northwest China. The three gene variants were genotyped via Sequenom MassARRAY. Odds ratios (ORs) and 95% confidence intervals (CIs) were utilized to evaluate the associations. We found that individuals with the rs2229080 C/G, C/C, and C/G-CC genotypes had a higher breast cancer risk, and the minor allele C was associated with increased breast cancer risk in an allele model. We observed a significantly decreased breast cancer risk with the rs7504990 C/T, T/T, and C/T-T/T genotypes, and the minor allele T was protective against breast cancer in an allele model. In addition, rs2229080 was associated with the axillary lymph node (LN) metastasis status. An age-stratified analysis revealed an association between rs2229080 and reduced breast cancer risk among older patients (≥ 49 years). Furthermore, the haplotype analysis showed that the Crs2229080Crs7504990Ars4078288 haplotype was associated with a decreased breast cancer risk. However, the results indicated a lack of association between rs4078288 and breast cancer risk. These findings affirmed that rs2229080 and rs7504990 polymorphisms in DCC might be related with breast cancer susceptibility in Chinese women.
…The serotonin transporter (5-HTT, SERT) removes serotonin from the synaptic cleft back into the presynaptic terminal and has a general role in the termination and recycling of serotonin during neurotransmission.…
S I O 001029)
…In preclinical studies, the 5-HTT knockout mice showed decreased exploratory behavior, increased anxiety-like behaviors (Holmes et al., 2003), elevated sensitivity to stress (Jiang et al., 2009) and reduced social interactions (Kalueff et al., 2007).…
Show Full Abstract
Autism spectrum disorder (ASD) is a neurodevelopmental disorder characterized by social and communication impairments, as well as repetitive and restrictive behaviors. The phenotypic heterogeneity of ASD has made it overwhelmingly difficult to determine the exact etiology and pathophysiology underlying the core symptoms, which are often accompanied by comorbidities such as hyperactivity, seizures, and sensorimotor abnormalities. To our benefit, the advent of animal models has allowed us to assess and test diverse risk factors of ASD, both genetic and environmental, and measure their contribution to the manifestation of autistic symptoms. At a broader scale, rodent models have helped consolidate molecular pathways and unify the neurophysiological mechanisms underlying each one of the various etiologies. This approach will potentially enable the stratification of ASD into clinical, molecular, and neurophenotypic subgroups, further proving their translational utility. It is henceforth paramount to establish a common ground of mechanistic theories from complementing results in preclinical research. In this review, we cluster the ASD animal models into lesion and genetic models and further classify them based on the corresponding environmental, epigenetic and genetic factors. Finally, we summarize the symptoms and neuropathological highlights for each model and make critical comparisons that elucidate their clinical and neurobiological relevance.
The molecular biology of metazoan eye development is an area of intense investigation. These efforts have led to the surprising recognition that although insect and vertebrate eyes have dramatically different structures, the orthologs or family members of several conserved transcription and signaling regulators such as Pax6, Six3, Prox1, and Bmp4 are commonly required for their development. In contrast, our understanding of posttranscriptional regulation in eye development and disease, particularly regarding the function of RNA-binding proteins (RBPs), is limited. We examine the present knowledge of RBPs in eye development in the insect model Drosophila as well as several vertebrate models such as fish, frog, chicken, and mouse. Interestingly, of the 42 RBPs that have been investigated for their expression or function in vertebrate eye development, 24 (~60%) are recognized in eukaryotic cells as components of RNA granules such as processing bodies, stress granules, or other specialized ribonucleoprotein (RNP) complexes. We discuss the distinct developmental and cellular events that may necessitate potential RBP/RNA granule-associated RNA regulon models to facilitate posttranscriptional control of gene expression in eye morphogenesis. In support of these hypotheses, three RBPs and RNP/RNA granule components Tdrd7, Caprin2, and Stau2 are linked to ocular developmental defects such as congenital cataract, Peters anomaly, and microphthalmia in human patients or animal models. We conclude by discussing the utility of interdisciplinary approaches such as the bioinformatics tool iSyTE (integrated Systems Tool for Eye gene discovery) to prioritize RBPs for deriving posttranscriptional regulatory networks in eye development and disease. WIREs RNA 2016, 7:527-557. doi: 10.1002/wrna.1355 For further resources related to this article, please visit the WIREs website.
Also flagged:capacitationfertilizationejaculationcyclic-AMPphosphorylationprotein kinase A
Journal Article2016-05-01✓ 1 SnippetNixon B, Anderson AL, Smith ND, McLeod R, Johnston SD.
In-Text Gene Mentions
I A O 0000326)
…PEBP1…
Show Full Abstract
Although mammalian spermatozoa only acquire functional maturity as they are conveyed through the male (epididymal maturation) and female (capacitation) reproductive tracts, the degree of post-testicular development necessary to achieve fertilization in other vertebrate species remains far less clear. Indeed, despite reports that the epididymis of birds and reptiles is capable of secreting proteins that bind and modify the sperm surface characteristics, it remains unclear whether capacitation is a pre-requisite for fertilization in these species. Using the ancient reptilian Australian saltwater crocodile as a model, this study was undertaken to explore whether reptile sperm do undergo capacitation-like changes following ejaculation. Our studies revealed that crocodile spermatozoa experienced a rapid and sustained, cyclic-AMP mediated increase in progressive motility following incubation under conditions optimized for the induction of capacitation in mammalian species such as the mouse and human. This response was coupled with elevated levels of phosphorylation associated with both protein kinase A and tyrosine kinase substrates, the latter of which were predominantly localized within the sperm flagellum. In findings that also accord with mammalian spermatozoa, we confirmed a homologue of outer dense fibre 2 as one of the principal substrates for tyrosine phosphorylation. Overall, our findings support the concept that crocodile spermatozoa do undergo a process that is homologous to capacitation in preparation for fertilization of an ovum.
Also flagged:Trim9MorphogenesisaxonsE3 ubiquitin ligaselocalizationcell bodies
Journal Article2016-05-01✓ 1 SnippetWinkle CC, Olsen RH, Kim H, Moy SS, Song J, Gupton SL.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
<h4>Unlabelled</h4>During hippocampal development, newly born neurons migrate to appropriate destinations, extend axons, and ramify dendritic arbors to establish functional circuitry. These developmental stages are recapitulated in the dentate gyrus of the adult hippocampus, where neurons are continuously generated and subsequently incorporate into existing, local circuitry. Here we demonstrate that the E3 ubiquitin ligase TRIM9 regulates these developmental stages in embryonic and adult-born mouse hippocampal neurons in vitro and in vivo Embryonic hippocampal and adult-born dentate granule neurons lacking Trim9 exhibit several morphological defects, including excessive dendritic arborization. Although gross anatomy of the hippocampus was not detectably altered by Trim9 deletion, a significant number of Trim9(-/-) adult-born dentate neurons localized inappropriately. These morphological and localization defects of hippocampal neurons in Trim9(-/-) mice were associated with extreme deficits in spatial learning and memory, suggesting that TRIM9-directed neuronal morphogenesis may be involved in hippocampal-dependent behaviors.<h4>Significance statement</h4>Appropriate generation and incorporation of adult-born neurons in the dentate gyrus are critical for spatial learning and memory and other hippocampal functions. Here we identify the brain-enriched E3 ubiquitin ligase TRIM9 as a novel regulator of embryonic and adult hippocampal neuron shape acquisition and hippocampal-dependent behaviors. Genetic deletion of Trim9 elevated dendritic arborization of hippocampal neurons in vitro and in vivo Adult-born dentate granule cells lacking Trim9 similarly exhibited excessive dendritic arborization and mislocalization of cell bodies in vivo These cellular defects were associated with severe deficits in spatial learning and memory.
…<h4>Unlabelled</h4>Huntington's disease (HD) is a heritable neurodegenerative disorder caused by expansion of CAG (glutamine) repeats in the HTT gene.…
Abstract)
…repeats in theHTTgene.…
Text
…Htt…
Show Full Abstract
<h4>Unlabelled</h4>Huntington's disease (HD) is a heritable neurodegenerative disorder caused by expansion of CAG (glutamine) repeats in the HTT gene. A prodromal stage characterized by psychiatric disturbances normally precedes primary motor symptoms and suppressed motivation represents one of the earliest and most common psychiatric symptoms. Although dopamine in the nucleus accumbens (NAc) critically regulates motivation and altered dopamine signaling is implicated in HD, the nature of dopaminergic deficits and contribution to symptoms in HD is poorly understood. We therefore tested whether altered NAc dopamine release accompanies motivational deficits in the Q175 knock-in HD mouse model. Q175 mice express a CAG expansion of the human mutant huntingtin allele in the native mouse genome and gradually manifest symptoms late in life, closely mimicking the genotypic context and disease progression in human HD. Sub-second extracellular dopamine release dynamics were monitored using fast-scan cyclic voltammetry, whereas motivation was assessed using a progressive ratio reinforcement schedule. As the response ratio (lever presses per reward) escalated, Q175 mice exerted less effort to earn fewer rewards versus wild-type (WT). Moreover, dopamine released at reward delivery dynamically encoded increasing reward cost in WT but not Q175 mice. Deficits were specific to situations of high effortful demand as no difference was observed in locomotion, free feeding, hedonic processing, or reward seeking when the response requirement was low. This compromised dopaminergic encoding of reward delivery coincident with suppressed motivation to work for reward in Q175 mice provides novel, neurobiological insight into an established and clinically relevant endophenotype of prodromal HD.<h4>Significance statement</h4>Psychiatric impairments in Huntington's disease (HD) typically manifest early in disease progression, before motor deficits. However, the neurobiological factors contributing to psychiatric symptoms are poorly understood. We used a mouse HD model and assessed whether impaired dopamine release in the nucleus accumbens (NAc), a brain region critical to goal-directed behaviors, accompanies motivational deficits, one of the most common early HD symptoms. HD mice exhibited blunted motivation to work for food reward coincident with diminished dopamine release to reward receipt. Motivational and NAc dopaminergic deficits were not associated with gross motor deficits or impaired food seeking when effortful demands were low. This work identifies a specific prodromal HD phenotype associated with a prominent and previously unidentified neurobiological impairment.
Also flagged:Viral infectionsalanineinfectionsinfectionlow-density lipoprotein cholesterolhepatitis
Journal Article2016-05-01✓ 1 SnippetHu JH, Chen MY, Yeh CT, Lin HS, Lin MS, Huang TJ, Chang ML.
In-Text Gene Mentions
Methods)
…of acute infection,hemochromatosis, Wilson disease, autoimmune…
Show Full Abstract
The impact of sex on metabolic alterations in individuals with hepatitis B virus (HBV) or hepatitis C virus (HCV) infection remains elusive.A community-based study was performed to assess sex, age, body mass index, the lipid profile, blood pressure, glucose, alanine aminotransferase, HBV surface antigen (HBsAg), and HCV antibody levels, smoking and alcohol drinking habits, and cardiometabolic diseases, including diabetes, hypertension, cardiovascular events, and renal diseases. The HCV-RNA level and genotype were further assessed in HCV antibody-positive subjects, and the hepatitis B e antigen and HBV-DNA levels were further examined in HBsAg-positive subjects.Among the 10,959 adults enrolled, 1949 (17.8%) and 1536 (14.0%) were HBV and HCV-infected, respectively. Univariate and multivariate analyses showed that the lipid profile and hypertension were independently associated with HCV infection (95% confidence intervals of odds ratios [OR 95% CI]: total cholesterol [TC] = 0.508-0.677; triglycerides = 0.496-0.728; hypertension = 0.669-0.937), but not with HBV infection. Consistently, HCV, but not HBV infection, was negatively associated with the TC and triglyceride levels (OR 95% CI for TC: 0.450-0.601; triglycerides: 0.443-0.671). Generalized linear models revealed that HCV infection, sex, and age interactively affected the lipid profile (OR 95% CI TC = 1.189-1.385; triglycerides = 1.172-5.289). Age-stratification analysis showed that the lipid levels were lower in both the HCV-positive females aged ≥49 years (TC, P < 0.001; triglycerides, P = 0.001) and males of all ages (TC, P < 0.001; triglycerides, P < 0.001) compared with their sex and age-matched HCV-negative counterparts. HCV infection was associated with a higher body mass index (≥49 years, β = 0.405, P = 0.002) and increased rates of cardiovascular events (<49 years, OR 95% CI 1.23-9.566), diabetes (≥49 years, OR 95% CI 1.114-1.932), and renal diseases (≥49 years, OR 95% CI 1.23-9.55), and with a lower rate of hypertension (≥49 years, OR 95% CI 0.616-0.964) in the females, but not in the males, as determined by multivariate analyses.Only HCV infection was associated with metabolic alterations in this HBV/HCV-hyperendemic area. Females aged ≥49 years and males of all ages exhibited HCV-associated hypolipidemia. HCV-associated cardiometabolic diseases were evident only in the females. Sex dimorphism in HCV-associated metabolic complications warrants personalized follow-up of HCV-positive patients.
Sequencing tests assaying panels of genes or whole exomes are widely available for cancer risk evaluation. However, methods for classification of variants resulting from this testing are not well studied. We evaluated the ability of a variant-classification methodology based on American College of Medical Genetics and Genomics (ACMG) guidelines to define the rate of mutations and variants of uncertain significance (VUS) in 180 medically relevant genes, including all ACMG-designated reportable cancer and non-cancer-associated genes, in individuals who met guidelines for hereditary cancer risk evaluation. We performed whole-exome sequencing in 404 individuals in 253 families and classified 1,640 variants. Potentially clinically actionable (likely pathogenic [LP] or pathogenic [P]) versus nonactionable (VUS, likely benign, or benign) calls were 95% concordant with locus-specific databases and Clinvar. LP or P mutations were identified in 12 of 25 breast cancer susceptibility genes in 26 families without identified BRCA1/2 mutations (11%). Evaluation of 84 additional genes associated with autosomal-dominant cancer susceptibility identified LP or P mutations in only two additional families (0.8%). However, individuals from 10 of 253 families (3.9%) had incidental LP or P mutations in 32 non-cancer-associated genes, and 9% of individuals were monoallelic carriers of a rare LP or P mutation in 39 genes associated with autosomal-recessive cancer susceptibility. Furthermore, 95% of individuals had at least one VUS. In summary, these data support the clinical utility of ACMG variant-classification guidelines. Additionally, evaluation of extended panels of cancer-associated genes in breast/ovarian cancer families leads to only an incremental clinical benefit but substantially increases the complexity of the results.
Also flagged:Arachidonic acid metabolismPPARagingTLRToll-like receptor signaling pathway-related diseases
Journal Article2016-05-01✓ 3 SnippetsPark D, Kim BC, Kim CH, Choi YJ, Jeong HO, Kim ME, Lee JS, Park MH, Chung KW, Kim DH, Lee J, Im DS, Yoon S, Lee S, Yu BP, Bhak J, Chung HY.
In-Text Gene Mentions
S I O 001029)
…Among up-regulated genes, arachidonic acid metabolism (ALOX5, ALOX15B, GPX2, and PTGIS), cell adhesion (SIGLEC10), chemokine (CCL21, CXCL2, and CXCL5), interleukin (IL19 and IL1R2), T-cell signaling (FYB), Toll-like receptor (TLR7), and tumor necrosis factor (TNFSF8 and TNFSF11) genes were tested for expression levels during aging.…
Results)
…Among up-regulated genes, the expression of arachidonic acid metabolism (ALOX5, ALOX15B, GPX2, and PTGIS), cell adhesion (SIGLEC10), chemokine (CCL21, CXCL2, and CXCL5), interleukin (IL19 and IL1R2), T-cell signaling (FYB), Toll-like receptor (TLR7), and tumor necrosis factor (TNFSF8 and TNFSF11) were evaluated in young and old animals.…
Results)
…GPX2 , andPTGIS), cell adhesion…
Show Full Abstract
Age-related dysregulated inflammation plays an essential role as a major risk factor underlying the pathophysiological aging process. To better understand how inflammatory processes are related to aging at the molecular level, we sequenced the transcriptome of young and aged rat kidney using RNA-Seq to detect known genes, novel genes, and alternative splicing events that are differentially expressed. By comparing young (6 months of age) and old (25 months of age) rats, we detected 722 up-regulated genes and 111 down-regulated genes. In the aged rats, we found 32 novel genes and 107 alternatively spliced genes. Notably, 6.6% of the up-regulated genes were related to inflammation (P < 2.2 × 10-16, Fisher exact t-test); 15.6% were novel genes with functional protein domains (P = 1.4 × 10-5); and 6.5% were genes showing alternative splicing events (P = 3.3 × 10-4). Based on the results of pathway analysis, we detected the involvement of inflammation-related pathways such as cytokines (P = 4.4 × 10-16), which were found up-regulated in the aged rats. Furthermore, an up-regulated inflammatory gene analysis identified the involvement of transcription factors, such as STAT4, EGR1, and FOSL1, which regulate cancer as well as inflammation in aging processes. Thus, RNA changes in these pathways support their involvement in the pro-inflammatory status during aging. We propose that whole RNA-Seq is a useful tool to identify novel genes and alternative splicing events by documenting broadly implicated inflammation-related genes involved in aging processes.
Also flagged:Autophagy Enhancer-67Huntington's DiseaseAutophagylysosomedegradationHD
Journal Article2016-05-01No SnippetsBilles V, Kovács T, Hotzi B, Manzéger A, Tagscherer K, Komlós M, Tarnóci A, Pádár Z, Erdős A, Bjelik A, Legradi A, Gulya K, Gulyás B, Vellai T.
Show Full Abstract
<h4>Background</h4>Autophagy, a lysosome-mediated self-degradation process of eukaryotic cells, serves as a main route for the elimination of cellular damage [1-3]. Such damages include aggregated, oxidized or misfolded proteins whose accumulation can cause various neurodegenerative pathologies, including Huntington's disease (HD).<h4>Objective</h4>Here we examined whether enhanced autophagic activity can alleviate neurophatological features in a Drosophila model of HD (the transgenic animals express a human mutant Huntingtin protein with a long polyglutamine repeat, 128Q).<h4>Methods</h4>We have recently identified an autophagy-enhancing small molecule, AUTEN-67 (autophagy enhancer 67), with potent neuroprotective effects [4]. AUTEN-67 was applied to induce autophagic activity in the HD model used in this study.<h4>Results</h4>We showed that AUTEN-67 treatment interferes with the progressive accumulation of ubiquitinated proteins in the brain of Drosophila transgenic for the pathological 128Q form of human Huntingtin protein. The compound significantly improved the climbing ability and moderately extended the mean life span of these flies. Furthermore, brain tissue samples from human patients diagnosed for HD displayed increased levels of the autophagy substrate SQSTM1/p62 protein, as compared with controls.<h4>Conclusions</h4>These results imply that AUTEN-67 impedes the progression of neurodegenerative symptoms characterizing HD, and that autophagy is a promising therapeutic target for treating this pathology. In humans, AUTEN-67 may have the potential to delay the onset and decrease the severity of HD.
Also flagged:Olig2PDGFEGF ReceptorTumorgliomastumors
Journal Article2016-05-01✓ 1 SnippetLu F, Chen Y, Zhao C, Wang H, He D, Xu L, Wang J, He X, Deng Y, Lu EE, Liu X, Verma R, Bu H, Drissi R, Fouladi M, Stemmer-Rachamimov AO, Burns D, Xin M, Rubin JB, Bahassi EM, Canoll P, Holland EC, Lu QR.
In-Text Gene Mentions
Text
…POU3F2…
Show Full Abstract
Malignant gliomas exhibit extensive heterogeneity and poor prognosis. Here we identify mitotic Olig2-expressing cells as tumor-propagating cells in proneural gliomas, elimination of which blocks tumor initiation and progression. Intriguingly, deletion of Olig2 resulted in tumors that grow, albeit at a decelerated rate. Genome occupancy and expression profiling analyses reveal that Olig2 directly activates cell-proliferation machinery to promote tumorigenesis. Olig2 deletion causes a tumor phenotypic shift from an oligodendrocyte precursor-correlated proneural toward an astroglia-associated gene expression pattern, manifest in downregulation of platelet-derived growth factor receptor-α and reciprocal upregulation of epidermal growth factor receptor (EGFR). Olig2 deletion further sensitizes glioma cells to EGFR inhibitors and extends the lifespan of animals. Thus, Olig2-orchestrated receptor signaling drives mitotic growth and regulates glioma phenotypic plasticity. Targeting Olig2 may circumvent resistance to EGFR-targeted drugs.
Also flagged:Hepatocellular carcinomaliver canceralcoholismnonalcoholic steatohepatitisobesitytype 2 diabetes
Journal Article2016-05-01✓ 1 SnippetRapisarda V, Loreto C, Malaguarnera M, Ardiri A, Proiti M, Rigano G, Frazzetto E, Ruggeri MI, Malaguarnera G, Bertino N, Malaguarnera M, Catania VE, Di Carlo I, Toro A, Bertino E, Mangano D, Bertino G.
Hepatocellular carcinoma (HCC) is the most common type of liver cancer. The main risk factors for HCC are alcoholism, hepatitis B virus, hepatitis C virus, nonalcoholic steatohepatitis, obesity, type 2 diabetes, cirrhosis, aflatoxin, hemochromatosis, Wilson's disease and hemophilia. Occupational exposure to chemicals is another risk factor for HCC. Often the relationship between occupational risk and HCC is unclear and the reports are fragmented and inconsistent. This review aims to summarize the current knowledge regarding the association of infective and non-infective occupational risk exposure and HCC in order to encourage further research and draw attention to this global occupational public health problem.
Also flagged:pediatric cancershistone H3nucleosomesH3K36 methyltransferasesmethylationpolycomb repressive complex 1
Journal Article2016-05-01No SnippetsLu C, Jain SU, Hoelper D, Bechet D, Molden RC, Ran L, Murphy D, Venneti S, Hameed M, Pawel BR, Wunder JS, Dickson BC, Lundgren SM, Jani KS, De Jay N, Papillon-Cavanagh S, Andrulis IL, Sawyer SL, Grynspan D, Turcotte RE, Nadaf J, Fahiminiyah S, Muir TW, Majewski J, Thompson CB, Chi P, Garcia BA, Allis CD, Jabado N, Lewis PW.
Show Full Abstract
Several types of pediatric cancers reportedly contain high-frequency missense mutations in histone H3, yet the underlying oncogenic mechanism remains poorly characterized. Here we report that the H3 lysine 36-to-methionine (H3K36M) mutation impairs the differentiation of mesenchymal progenitor cells and generates undifferentiated sarcoma in vivo. H3K36M mutant nucleosomes inhibit the enzymatic activities of several H3K36 methyltransferases. Depleting H3K36 methyltransferases, or expressing an H3K36I mutant that similarly inhibits H3K36 methylation, is sufficient to phenocopy the H3K36M mutation. After the loss of H3K36 methylation, a genome-wide gain in H3K27 methylation leads to a redistribution of polycomb repressive complex 1 and de-repression of its target genes known to block mesenchymal differentiation. Our findings are mirrored in human undifferentiated sarcomas in which novel K36M/I mutations in H3.1 are identified.
Also flagged:adenomacarcinoma in situDMBT1S100A9Galectin-10S100A8
Journal Article2016-05-01No SnippetsPeng F, Huang Y, Li MY, Li GQ, Huang HC, Guan R, Chen ZC, Liang SP, Chen YH.
Show Full Abstract
<h4>Aim</h4>To discover novel biomarkers for early diagnosis, prognosis or treatment of human colorectal cancer.<h4>Methods</h4>iTRAQ 2D LC-MS/MS analysis was used to identify differentially expressed proteins (DEPs) in the human colonic epithelial carcinogenic process using laser capture microdissection-purified colonic epithelial cells from normal colon, adenoma, carcinoma in situ and invasive carcinoma tissues.<h4>Results</h4>A total of 326 DEPs were identified, and four DEPs (DMBT1, S100A9, Galectin-10, and S100A8) with progressive alteration in the carcinogenic process were further validated by immunohistochemistry. The DEPs were involved in multiple biological processes including cell cycle, cell adhesion, translation, mRNA processing, and protein synthesis. Some of the DEPs involved in cellular process such as "translation" and "mRNA splicing" were progressively up-regulated, while some DEPs involved in other processes such as "metabolism" and "cell response to stress" was progressively down-regulated. Other proteins with up- or down-regulation at certain stages of carcinogenesis may play various roles at different stages of the colorectal carcinogenic process.<h4>Conclusion</h4>These findings give insights into our understanding of the mechanisms of colorectal carcinogenesis and provide clues for further investigation of carcinogenesis and identification of biomarkers.
Also flagged:interferon alfaentecavirhepatitis DIFNαhepatitis B surface antigenhepatitis B
Journal Article2016-05-01✓ 1 SnippetAbbas Z, Memon MS, Umer MA, Abbas M, Shazi L.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Aim</h4>To investigate the efficacy of pegylated interferon alfa (PEG-IFNα) therapy with and without entecavir in patients with chronic hepatitis D.<h4>Methods</h4>Forty hepatitis D virus (HDV) RNA positive patients were randomized to receive either PEG-IFNα-2a 180 μg weekly in combination with entecavir 0.5 mg daily (n = 21) or PEG-IFNα alone (n =19). Patients who failed to show 2 log reduction in HDV RNA level at 24 wk of treatment, or had detectable HDV RNA at 48 wk of therapy were considered as treatment failure. Treatment was continued for 72 wk in the rest of the patients. All the patients were followed for 24 wk post treatment. Intention to treat analysis was performed.<h4>Results</h4>The mean age of the patients was 26.7 ± 6.8 years, 31 were male. Two log reduction in HDV RNA levels at 24 wk of therapy was achieved in 9 (43%) patients receiving combination therapy and 12 (63%) patients receiving PEG-IFNα alone (P = 0.199). Decline in hepatitis B surface antigen (HBsAg) levels was insignificant. At the end of treatment, HDV RNA was negative in 8 patients (38%) receiving combination therapy and 10 patients (53%) receiving PEG-IFNα-2a alone. Virological response persisted in 7 (33%) and 8 (42%) patients, respectively at the end of the 24 wk follow-up period. One responder patient in the combination arm lost HBsAg and became hepatitis B surface antibody positive. Six out of 14 baseline hepatitis B e antigen reactive patients seroconverted and four of these seroconverted patients had persistent HDV RNA clearance.<h4>Conclusion</h4>Administration of PEG-IFNα-2a with or without entecavir, resulted in persistent HDV RNA clearance in 37% of patients. The addition of entecavir did not improve the overall response.
Also flagged:TNF ReceptorTNFTNF superfamily receptorsimmune responsesautoimmune diseasestumors
Journal Article2016-05-01No SnippetsWard-Kavanagh LK, Lin WW, Šedý JR, Ware CF.
Show Full Abstract
Cytokines related to tumor necrosis factor (TNF) provide a communication network essential for coordinating multiple cell types into an effective host defense system against pathogens and malignant cells. The pathways controlled by the TNF superfamily differentiate both innate and adaptive immune cells and modulate stromal cells into microenvironments conducive to host defenses. Members of the TNF receptor superfamily activate diverse cellular functions from the production of type 1 interferons to the modulation of survival of antigen-activated T cells. Here, we focus attention on the subset of TNF superfamily receptors encoded in the immune response locus in chromosomal region 1p36. Recent studies have revealed that these receptors use diverse mechanisms to either co-stimulate or restrict immune responses. Translation of the fundamental mechanisms of TNF superfamily is leading to the design of therapeutics that can alter pathogenic processes in several autoimmune diseases or promote immunity to tumors.
Also flagged:antigen receptorsystemic lupus erythematosusrheumatoid arthritismultiple sclerosisautoimmune diseasesMS
Journal Article2016-05-01No SnippetsZhang Q, Vignali DA.
Show Full Abstract
The immune system is guided by a series of checks and balances, a major component of which is a large array of co-stimulatory and co-inhibitory pathways that modulate the host response. Although co-stimulation is essential for boosting and shaping the initial response following signaling through the antigen receptor, inhibitory pathways are also critical for modulating the immune response. Excessive co-stimulation and/or insufficient co-inhibition can lead to a breakdown of self-tolerance and thus to autoimmunity. In this review, we will focus on the role of co-stimulatory and co-inhibitory pathways in two systemic (systemic lupus erythematosus and rheumatoid arthritis) and two organ-specific (multiple sclerosis and type 1 diabetes) emblematic autoimmune diseases. We will also discuss how mechanistic analysis of these pathways has led to the identification of potential therapeutic targets and initiation of clinical trials for autoimmune diseases, as well as outline some of the challenges that lie ahead.
Targeted RNA sequencing (CaptureSeq) uses oligonucleotide probes to capture RNAs for sequencing, providing enriched read coverage, accurate measurement of gene expression, and quantitative expression data. We applied CaptureSeq to refine transcript annotations in the current murine GRCm38 assembly. More than 23,000 regions corresponding to putative or annotated long noncoding RNAs (lncRNAs) and 154,281 known splicing junction sites were selected for targeted sequencing across five mouse tissues and three brain subregions. The results illustrate that the mouse transcriptome is considerably more complex than previously thought. We assemble more complete transcript isoforms than GENCODE, expand transcript boundaries, and connect interspersed islands of mapped reads. We describe a novel filtering pipeline that identifies previously unannotated but high-quality transcript isoforms. In this set, 911 GENCODE neighboring genes are condensed into 400 expanded gene models. Additionally, 594 GENCODE lncRNAs acquire an open reading frame (ORF) when their structure is extended with CaptureSeq. Finally, we validate our observations using current FANTOM and Mouse ENCODE resources.
…Recently, we showed that in yeast non-toxic amyloids of Q-rich proteins can induce aggregation and toxicity of wild type huntingtin (Htt) with a short non-pathogenic polyglutamine tract.…
Abstract)
…wild type huntingtin (Htt) with a short…
Abstract)
…Similarly to mutantHttwith an elongated…
Abstract)
…of wild typeHttacted as intermediaries…
Text
…Htt…
Show Full Abstract
Proteins with expanded polyglutamine (polyQ) regions are prone to form amyloids, which can cause diseases in humans and toxicity in yeast. Recently, we showed that in yeast non-toxic amyloids of Q-rich proteins can induce aggregation and toxicity of wild type huntingtin (Htt) with a short non-pathogenic polyglutamine tract. Similarly to mutant Htt with an elongated N-terminal polyQ sequence, toxicity of its wild type counterpart was mediated by induced aggregation of the essential Sup35 protein, which contains a Q-rich region. Notably, polymerization of Sup35 was not caused by the initial benign amyloids and, therefore, aggregates of wild type Htt acted as intermediaries in seeding Sup35 polymerization. This exemplifies a protein polymerization cascade which can generate a network of interdependent polymers. Here we discuss cross-seeded protein polymerization as a possible mechanism underlying known interrelations between different polyQ diseases. We hypothesize that similar mechanisms may enable proteins, which possess expanded Q-rich tracts but are not associated with diseases, to promote the development of polyQ diseases.
Also flagged:densinschromosome segregationMetaphasemitotic chromosome condensationlocalizationcal
Journal Article2016-05-01✓ 1 SnippetGoloborodko A, Marko JF, Mirny LA.
In-Text Gene Mentions
Introduction)
…Condensincomplexes, which play…
Show Full Abstract
During cell division, chromosomes are compacted in length by more than a 100-fold. A wide range of experiments demonstrated that in their compacted state, mammalian chromosomes form arrays of closely stacked consecutive ∼100 kb loops. The mechanism underlying the active process of chromosome compaction into a stack of loops is unknown. Here we test the hypothesis that chromosomes are compacted by enzymatic machines that actively extrude chromatin loops. When such loop-extruding factors (LEF) bind to chromosomes, they progressively bridge sites that are further away along the chromosome, thus extruding a loop. We demonstrate that collective action of LEFs leads to formation of a dynamic array of consecutive loops. Simulations and an analytically solved model identify two distinct steady states: a sparse state, where loops are highly dynamic but provide little compaction; and a dense state, where there are more stable loops and dramatic chromosome compaction. We find that human chromosomes operate at the border of the dense steady state. Our analysis also shows how the macroscopic characteristics of the loop array are determined by the microscopic properties of LEFs and their abundance. When the number of LEFs are used that match experimentally based estimates, the model can quantitatively reproduce the average loop length, the degree of compaction, and the general loop-array morphology of compact human chromosomes. Our study demonstrates that efficient chromosome compaction can be achieved solely by an active loop-extrusion process.
Also flagged:NeogeninBMP2Smad1yapastrogliogenesissynaptic transmission
Journal Article2016-05-01✓ 5 SnippetsHuang Z, Sun D, Hu JX, Tang FL, Lee DH, Wang Y, Hu G, Zhu XJ, Zhou J, Mei L, Xiong WC.
In-Text Gene Mentions
Abstract)
…DCC (deleted in colorectal cancer…
Abstract)
…Neogenin, a DCC (deleted in colorectal cancer…
Abstract)
…Neogenin, aDCC(deleted in colorectal…
Text
…DCC…
Text
…DCC receptor…
Show Full Abstract
<h4>Unlabelled</h4>Neogenin, a DCC (deleted in colorectal cancer) family receptor, is highly expressed in neural stem cells (NSCs). However, its function in NSCs remains to be explored. Here we provide in vitro and in vivo evidence for neogenin's function in NSCs to promote neocortical astrogliogenesis, but not self-renewal or neural differentiation. Mechanistically, neogenin in neocortical NSCs was required for BMP2 activation of YAP (yes associated protein). The active/nuclear YAP stabilized phospho-Smad1/5/8 and was necessary for BMP2 induction of astrocytic differentiation. Deletion of yap in mouse neocortical NSCs caused a similar deficit in neocortical astrogliogenesis as that in neogenin mutant mice. Expression of YAP in neogenin mutant NSCs diminished the astrocytic differentiation deficit in response to BMP2. Together, these results reveal an unrecognized function of neogenin in increasing neocortical astrogliogenesis, and identify a pathway of BMP2-neogenin-YAP-Smad1 for astrocytic differentiation in developing mouse neocortex.<h4>Significance statement</h4>Astrocytes, a major type of glial cells in the brain, play important roles in modulating synaptic transmission and information processing, and maintaining CNS homeostasis. The abnormal astrocytic differentiation during development contributes to dysfunctions of synaptic plasticity and neuropsychological disorders. Here we provide evidence for neogenin's function in regulation of the neocortical astrocyte differentiation during mouse brain development. We also provide evidence for the necessity of neogenin in BMP2/Smad1-induced astrocyte differentiation through YAP. Thus, our findings identify an unrecognized function of neogenin in mouse neocortical astrocyte differentiation, and suggest a signaling pathway, BMP2-neogenin-YAP-Smad1, underlying astrogliogenesis in developing mouse neocortex.
<h4>Aim</h4>To identify therapeutic agents for the prophylaxis of gastrointestinal anastomotic leakage (AL) under complicated conditions.<h4>Methods</h4>The PubMed and EMBASE databases were searched for English articles published between January 1975 and September 2014. Studies with the primary purpose of improving anastomotic healing in the colon or rectum under complicated preoperative and/or intraoperative conditions were included. We excluded studies investigating the adverse effects or risk assessment of an active intervention. Furthermore, investigations of biophysical materials, sealants, electrical stimulation and nutrients were excluded. The primary study outcome was biomechanical anastomotic strength or AL. The meta-analysis focused on therapeutic agents that were investigated in one animal model using the same outcome by at least three independent research groups.<h4>Results</h4>The 65 studies included were divided into 7 different complicated animal models: Bowel ischemia, ischemia/reperfusion, bowel obstruction, obstructive jaundice, peritonitis, chemotherapy and radiotherapy. In total, 48 different therapeutic compounds were examined. The majority of investigated agents (65%) were reported as beneficial for anastomotic healing. Twelve of the agents (25%) were tested more than once in the same model, whereas 13 (27%) of the agents were tested in two or more models of complicated healing. Two therapeutic agents met our inclusion criteria for the meta-analysis. Postoperative hyperbaric oxygen therapy significantly increased anastomotic bursting pressure in ischemic colon anastomoses by a mean of 28 mmHg (95%CI: 17 to 39 mmHg, P < 0.00001). Granulocyte macrophage-colony stimulating factor failed to show a significant increase in anastomotic bursting pressure (95%CI: -20 to 21 mmHg, P = 0.97) vs controls in experimental chemotherapeutic models.<h4>Conclusion</h4>This systematic review identified potential therapeutic agents, but more studies are needed before concluding that any of these are useful for AL prophylaxis.
Also flagged:Inflammatory bowel diseasecancerpathogenesiscolitissporadic colorectal carcinomainflammatory response
Journal Article2016-05-01No SnippetsAxelrad JE, Lichtiger S, Yajnik V.
Show Full Abstract
In patients with inflammatory bowel disease (IBD), chronic inflammation is a major risk factor for the development of gastrointestinal malignancies. The pathogenesis of colitis-associated cancer is distinct from sporadic colorectal carcinoma and the critical molecular mechanisms underlying this process have yet to be elucidated. Patients with IBD have also been shown to be at increased risk of developing extra-intestinal malignancies. Medical therapies that diminish the mucosal inflammatory response represent the foundation of treatment in IBD, and recent evidence supports their introduction earlier in the disease course. However, therapies that alter the immune system, often used for long durations, may also promote carcinogenesis. As the population of patients with IBD grows older, with longer duration of chronic inflammation and longer exposure to immunosuppression, there is an increasing risk of cancer development. Many of these patients will require cancer treatment, including chemotherapy, radiation, hormonal therapy, and surgery. Many patients will require further treatment for their IBD. This review seeks to explore the characteristics and risks of cancer in patients with IBD, and to evaluate the limited data on patients with IBD and cancer, including management of IBD after a diagnosis of cancer, the effects of cancer treatment on IBD, and the effect of IBD and medications for IBD on cancer outcomes.
Non-alcoholic fatty liver disease (NAFLD) is a recognized problem in patients after orthotopic liver transplantation and may lead to recurrent graft injury. As the increased demand for liver allografts fail to match the available supply of donor organs, split liver transplantation (SLT) has emerged as an important technique to increase the supply of liver grafts. SLT allows two transplants to occur from one donor organ, and provides a unique model for observing the pathogenesis of NAFLD with respect to the role of recipient environmental and genetic factors. Here we report on two recipients of a SLT from the same deceased donor where only one developed non-alcoholic steatohepatitis (NASH), suggesting that host factors are critical for the development of NASH.
Dilated cardiomyopathy (DCM) is defined by progressive functional and structural changes. We performed RNA-seq at different stages of disease to define molecular signaling in the progression from pre-DCM hearts to DCM and overt heart failure (HF) using a genetic model of DCM (phospholamban missense mutation, PLN<sup>R9C/+</sup>). Pre-DCM hearts were phenotypically normal yet displayed proliferation of nonmyocytes (59% relative increase vs. WT, <i>P</i> = 8 × 10<sup>-4</sup>) and activation of proinflammatory signaling with notable cardiomyocyte-specific induction of a subset of profibrotic cytokines including TGFβ2 and TGFβ3. These changes progressed through DCM and HF, resulting in substantial fibrosis (17.6% of left ventricle [LV] vs. WT, <i>P</i> = 6 × 10<sup>-33</sup>). Cardiomyocytes displayed a marked shift in metabolic gene transcription: downregulation of aerobic respiration and subsequent upregulation of glucose utilization, changes coincident with attenuated expression of PPARα and PPARγ coactivators -1α (PGC1α) and -1β, and increased expression of the metabolic regulator T-box transcription factor 15 (<i>Tbx15</i>). Comparing DCM transcriptional profiles with those in hypertrophic cardiomyopathy (HCM) revealed similar and distinct molecular mechanisms. Our data suggest that cardiomyocyte-specific cytokine expression, early fibroblast activation, and the shift in metabolic gene expression are hallmarks of cardiomyopathy progression. Notably, key components of these profibrotic and metabolic networks were disease specific and distinguish DCM from HCM.
Amyloids are protein aggregates consisting of fibrils rich in β-sheets. Growth of amyloid fibrils occurs by the addition of protein molecules to the tip of an aggregate with a concurrent change of a conformation. Thus, amyloids are self-propagating protein conformations. In certain cases these conformations are transmissible / infectious; they are known as prions. Initially, amyloids were discovered as pathological extracellular deposits occurring in different tissues and organs. To date, amyloids and prions have been associated with over 30 incurable diseases in humans and animals. However, a number of recent studies demonstrate that amyloids are also functionally involved in a variety of biological processes, from biofilm formation by bacteria, to long-term memory in animals. Interestingly, amyloid-forming proteins are highly overrepresented among cellular factors engaged in all stages of mRNA life cycle: from transcription and translation, to storage and degradation. Here we review rapidly accumulating data on functional and pathogenic amyloids associated with mRNA processing, and discuss possible significance of prion and amyloid networks in the modulation of key cellular functions.
Also flagged:SIRT6endothelial dysfunctionagingatherosclerosisdysfunctioncytokine
Journal Article2016-05-01✓ 5 SnippetsXu S, Yin M, Koroleva M, Mastrangelo MA, Zhang W, Bai P, Little PJ, Jin ZG.
In-Text Gene Mentions
Results)
…Our results indicate that SIRT6 binds to promoter region of TNFSF4 under basal conditions (Figure 8A), which was increased upon infection with SIRT6 adenovirus.…
Abstract)
…RNA-sequencing profiling revealed that SIRT6 overexpression decreased the expression of multiple atherosclerosis-related genes, including proatherogenic gene TNFSF4 (tumor necrosis factor superfamily member 4).…
Results)
…Detailed analysis of RNA-seq data indicated that SIRT6 overexpression decreased the expression of multiple genes involved in vascular inflammation and atherosclerosis, including PTX3 (Pentraxin 3) [35], GJA1 (gap junction A1, also known as Connexin 43) [36], and TNFSF4 (tumor necrosis factor superfamily member 4, also known as OX40 ligand) [37] (Figure 7D and Table S4).…
SIRT6 is an important member of sirtuin family that represses inflammation, aging and DNA damage, three of which are causing factors for endothelial dysfunction. SIRT6 expression is decreased in atherosclerotic lesions from ApoE(-/-) mice and human patients. However, the role of SIRT6 in regulating vascular endothelial function and atherosclerosis is not well understood. Here we show that SIRT6 protects against endothelial dysfunction and atherosclerosis. Global and endothelium-specific SIRT6 knockout mice exhibited impaired endothelium-dependent vasorelaxation. Moreover, SIRT6(+/-) haploinsufficient mice fed a high-fat diet (HFD) also displayed impaired endothelium-dependent vasorelaxation. Importantly, SIRT6(+/-); ApoE(-/-) mice after HFD feeding exhibited exacerbated atherosclerotic lesion development, concurrent with increased expression of the proinflammatory cytokine VCAM-1. Loss- and gain-of-SIRT6 function studies in cultured human endothelial cells (ECs) showed that SIRT6 attenuated monocyte adhesion to ECs. RNA-sequencing profiling revealed that SIRT6 overexpression decreased the expression of multiple atherosclerosis-related genes, including proatherogenic gene TNFSF4 (tumor necrosis factor superfamily member 4). Chromatin immunoprecipitation assays showed that SIRT6 decreased TNFSF4 gene expression by binding to and deacetylating H3K9 at TNFSF4 gene promoter. Collectively, these findings demonstrate that SIRT6 play a pivotal role in maintaining endothelial function and increased SIRT6 activity could be a new therapeutic strategy to combat atherosclerotic disease.
Also flagged:acute pancreatitiscystGI obstructionDuplication Cystsduodenal duplication cystscysts
Journal Article2016-05-01No SnippetsGjeorgjievski M, Manickam P, Ghaith G, Cappell MS.
Show Full Abstract
Analyze efficacy, safety of endoscopic therapy for duodenal duplication cysts (DDC) by comprehensively reviewing case reports.Tandem, independent, systematic, computerized, literature searches were performed via PubMed using medical subject headings or Keywords "cyst" and "duodenal" and "duplication"; or "cyst", and "endoscopy" or "endoscopic", and "therapy" or "decompression"; with reconciliation of generated references by two experts. Case report followed CARE guidelines.Literature review revealed 28 cases (mean = 1.3 ± 1.2 cases/report). Endoscopic therapy is increasingly reported recently (1984-1999: 3 cases, 2000-2015: 25 cases, P = 0.003, OR = 8.33, 95%-CI: 1.77-44.5). Fourteen (54%) of 26 patients were men (unknown-sex = 2). Mean age = 32.2 ± 18.3 years old. Procedure indications: acute pancreatitis-16, abdominal pain-8, jaundice-2, gastrointestinal (GI) obstruction-1, asymptomatic cyst-1. Mean maximal DDC dimension = 3.20 ± 1.53 cm (range, 1-6.5 cm). Endoscopic techniques included cyst puncture via needle knife papillotomy (NKP)/papillotome-18, snare resection of cyst-7, cystotome-2, and cyst needle aspiration/ligation-1. Endoscopic therapy was successful in all cases. Among 24 initially symptomatic patients, all remained asymptomatic post-therapy without relapses (mean follow-up = 36.5 ± 48.6 months, 3 others reported asymptomatic at follow-up of unknown duration; 1 initially asymptomatic patient remained asymptomatic 3 years post-therapy). Two complications occurred: mild intraprocedural duodenal bleeding related to NKP and treated locally endoscopically.A patient is reported who presented with vomiting, 15-kg-weight-loss, and profound dehydration for 1 month from extrinsic compression of duodenum by 14 × 6 cm DDC, underwent successful endosonographic cyst decompression with large fenestration of cyst and endoscopic aspiration of 1 L of fluid from cyst with rapid relief of symptoms. At endoscopy the DDC was intubated and visualized and random endoscopic mucosal biopsies were obtained to help exclude malignant or dysplastic DDC.Study limitations include retrospective literature review, potential reporting bias, limited patient number, variable follow-up.In conclusion, endoscopic therapy for DDC was efficacious in all 29 reported patients including current case, including patients presenting acutely with acute pancreatitis, or GI obstruction. Complications were rare and minor, suggesting that endoscopic therapy may be a useful alternative to surgery for nonmalignant DDC when performed by expert endoscopists.
Also flagged:neurodegenerative disorderHDHdhbehaviouralcircadian rhythmssleep
Journal Article2016-05-01No SnippetsYhnell E, Dunnett SB, Brooks SP.
Show Full Abstract
<h4>Background</h4>Huntington's disease (HD) is a rare, incurable neurodegenerative disorder caused by a CAG trinucleotide expansion with the first exon of the huntingtin gene. Numerous knock-in mouse models are currently available for modelling HD. However, before their use in scientific research, these models must be characterised to determine their face and predictive validity as models of the disease and their reliability in recapitulating HD symptoms.<h4>Objective</h4>Manifest HD is currently diagnosed upon the onset of motor symptoms, thus we sought to longitudinally characterise the progression and severity of motor signs in the HdhQ111 knock-in mouse model of HD, in heterozygous mice.<h4>Methods</h4>An extensive battery of motor tests including: rotarod, inverted lid test, balance beam, spontaneous locomotor activity and gait analysis were applied longitudinally to a cohort of HdhQ111 heterozygous mice in order to progressively assess motor function.<h4>Results</h4>A progressive failure to gain body weight was demonstrated from 11 months of age and motor problems in all measures of balance beam performance were shown in HdhQ111 heterozygous animals in comparison to wild type control animals from 9 months of age. A decreased latency to fall from the rotarod was demonstrated in HdhQ111 heterozygous animals in comparison to wild type animals, although this was not progressive with time. No genotype specific differences were demonstrated in any of the other motor tests included in the test battery.<h4>Conclusions</h4>The HdhQ111 heterozygous mouse demonstrates a subtle and progressive motor phenotype that begins at 9 months of age. This mouse model represents an early disease stage and would be ideal for testing therapeutic strategies that require elongated lead-in times, such as viral gene therapies or striatal transplantation.
Also flagged:peroxiredoxinsulfiredoxin-1SRXN1sulfur mustardgene expressioncarbonyls
Journal Article2016-05-01✓ 2 SnippetsTahmasbpour Marzony E, Ghanei M, Panahi Y.
In-Text Gene Mentions
Abstract)
…order PRDX1> PRDX3>PRDX6> SRXN1> PRDX2> PRDX4>…
Abstract)
…(p = 0.000134),PRDX63.4964 (p =…
Show Full Abstract
<h4>Background</h4>Sulfur mustard (SM) is a potent and mutagenic agent that targets human lung tissue.<h4>Purpose of the study</h4>The purpose of this investigation is to characterize the expression of sulfiredoxin-1 (SRXN1) and peroxiredoxin (PRDXs) genes and oxidative stress (OS) status in human lung after exposure to SM.<h4>Materials and methods</h4>Lung biopsy specimens bronchoalveolar lavage (BAL) fluids were provided from SM-exposed patients (n = 6) and controls (n = 5). Changes in gene expression were measured using RT(2) Profiler PCR Array. OS was considered by measuring BAL fluid levels of malondialdehyde (MDA) and protein carbonyls (PC).<h4>Results</h4>Mean of MDA and PC values in BAL fluid of patients (0.6467 ± 0.05922 nmol/l and 1.391 ± 0.421 nmol/mg, respectively) was higher than in controls (0.486 ± 0.04615 nmol/l and 0.949 ± 0.149 nmol/mg, respectively). Expression of all examined genes was in the order PRDX1> PRDX3> PRDX6> SRXN1> PRDX2> PRDX4> PRDX5. Among the most upregulated genes was the PRDX1, which was overexpressed by 10.1029-fold (p = 0.000634). SM-exposed individuals demonstrated expression of PRDX3 4.6231 (p = 0.000134), PRDX6 3.4964 (p = 0.001102), SRXN1 3.3719 (p < 0.0001) and PRDX2 2.7725-folds (p = 0.000383) higher than those of controls that reveal.<h4>Conclusions</h4>Upregulation of PRDXs and SRXN1 genes may be because of reactive oxygen species (ROS) production and OS in lung tissue of patients after SM exposure. Expression of SRXN1 and PRDXNs genes, especially I, II, III, and VI is increased in SM-injured lungs, suggesting the induction of cellular responses to increased production of ROS and OS in lung of the patients. Therefore, sulfiredoxin and peroxiredoxins can be targeted as biomarkers of OS in these patients.
Also flagged:serotonin transporterserotoninanxietyRecurrent aphthous stomatitisRASoral mucosal disease
Journal Article2016-05-01✓ 5 SnippetsManchanda A, Iyengar AR, Patil S.
In-Text Gene Mentions
Discussion)
…The human serotonin transporter (5-HTT) plays a key role in mediating regulation of the availability of serotonin to the receptors of serotonergic system by terminating the action of serotonin and recycling it in the synaptic clefts.…
Introduction)
…the serotonin transporter (5-HTT).…
Introduction)
…polymorphism of the5-HTTgene in subjects…
Methods)
…insertion/deletion in the 5-HTTgene-linked polymorphic region…
Discussion)
…human serotonin transporter (5-HTT) plays a key…
Show Full Abstract
<h4>Background</h4>Anxiety-related traits have been attributed to sequence variability in the genes coding for serotonin transmission in the brain. Two alleles, termed long (L) and short (S) differing by 44 base pairs, are found in a polymorphism identified in the promoter region of serotonin transporter gene. The presence of the short allele and SS and LS genotypes is found to be associated with the reduced expression of this gene decreasing the uptake of serotonin in the brain leading to various anxiety-related traits. Recurrent aphthous stomatitis (RAS) is an oral mucosal disease with varied etiology including the presence of stress, anxiety, and genetic influences. The present study aimed to determine this serotonin transporter gene polymorphism in patients with RAS and compare it with normal individuals.<h4>Materials and methods</h4>This study included 20 subjects with various forms of RAS and 20 normal healthy age- and gender-matched individuals. Desquamated oral mucosal cells were collected for DNA extraction and subjected to polymerase chain reaction for studying insertion/deletion in the 5-HTT gene-linked polymorphic region. Cross tabulations followed by Chi-square tests were performed to compare the significance of findings, P < 0.05 was considered statistically significant.<h4>Results</h4>The LS genotype was the most common genotype found in the subjects with aphthous stomatitis (60%) and controls (40%). The total percentage of LS and SS genotypes and the frequency of S allele were found to be higher in the subjects with aphthous stomatitis as compared to the control group although a statistically significant correlation could not be established, P = 0.144 and 0.371, respectively.<h4>Conclusion</h4>Within the limitations of this study, occurrence of RAS was not found to be associated with polymorphic promoter region in serotonin transporter gene.
…and HCV infection,hemochromatosis, and autoimmune hepatitis).…
Show Full Abstract
<h4>Objective</h4>The majority of cases of hepatocellular carcinoma have been reported in individuals with cirrhosis due to chronic viral hepatitis and alcoholism, but recently, the prevalence has become increasingly related to nonalcoholic steatohepatitis around the world. The study aimed to evaluate the clinical and histophatological characteristics of hepatocellular carcinoma in Brazilians' patients with nonalcoholic steatohepatitis at the present time.<h4>Methods</h4>Members of the Brazilian Society of Hepatology were invited to complete a survey regarding patients with hepatocellular carcinoma related to nonalcoholic steatohepatitis. Patients with a history of alcohol intake (>20 g/day) and other liver diseases were excluded. Hepatocellular carcinoma diagnosis was performed by liver biopsy or imaging methods according to the American Association for the Study of Liver Diseases' 2011 guidelines.<h4>Results</h4>The survey included 110 patients with a diagnosis of hepatocellular carcinoma and nonalcoholic fatty liver disease from nine hepatology units in six Brazilian states (Bahia, Minas Gerais, Rio de Janeiro, São Paulo, Paraná and Rio Grande do Sul). The mean age was 67±11 years old, and 65.5% were male. Obesity was observed in 52.7% of the cases; diabetes, in 73.6%; dyslipidemia, in 41.0%; arterial hypertension, in 60%; and metabolic syndrome, in 57.2%. Steatohepatitis without fibrosis was observed in 3.8% of cases; steatohepatitis with fibrosis (grades 1-3), in 27%; and cirrhosis, in 61.5%. Histological diagnosis of hepatocellular carcinoma was performed in 47.2% of the patients, with hepatocellular carcinoma without cirrhosis accounting for 7.7%. In total, 58 patients with cirrhosis had their diagnosis by ultrasound confirmed by computed tomography or magnetic resonance imaging. Of these, 55% had 1 nodule; 17%, 2 nodules; and 28%, ≥3 nodules.<h4>Conclusions</h4>Nonalcoholic steatohepatitis is a relevant risk factor associated with hepatocellular carcinoma in patients with and without cirrhosis in Brazil. In this survey, hepatocellular carcinoma was observed in elevated numbers of patients with steatohepatitis without cirrhosis.
Also flagged:Transcription factor EBlysosomeautophagymembranemTORmetabolism
Journal Article2016-05-01No SnippetsSardiello M.
Show Full Abstract
The lysosome is the main catabolic hub of the cell. Owing to its role in fundamental processes such as autophagy, plasma membrane repair, mTOR signaling, and maintenance of cellular homeostasis, the lysosome has a profound influence on cellular metabolism and human health. Indeed, inefficient or impaired lysosomal function has been implicated in the pathogenesis of a number of degenerative diseases affecting various organs and tissues, most notably the brain, liver, and muscle. The discovery of the coordinated lysosomal expression and regulation (CLEAR) genetic program and its master controller, transcription factor EB (TFEB), has provided an unprecedented tool to study and manipulate lysosomal function. Most lysosome-based processes-including macromolecule degradation, autophagy, lysosomal exocytosis, and proteostasis-are under the transcriptional control of TFEB. Interestingly, impaired TFEB signaling has been suggested to be a contributing factor in the pathogenesis of several degenerative storage diseases. Preclinical studies based on TFEB exogenous expression to reinstate TFEB activity or promote CLEAR network-based lysosomal enhancement have highlighted TFEB as a candidate therapeutic target for the treatment of various degenerative storage diseases.
Advances in gene sequencing techniques have led to a dramatic increase in the number of signaling cascade and cytoskeletal assembly mutations associated with malformations of cortical development and epilepsy. At the forefront of this research are novel mutations found in regulators of the PI3K/AKT/mTOR cascade and tubulin-associated malformations of cortical development. However, there is limited understanding of the consequences of these newly discovered germline and somatic mutations on cellular function or how these changes in cell biology may lead to areas-large or small-of malformed cortex and recurrent spontaneous seizures. We summarize and discuss what is currently known in this field in an effort to shine light on vast gaps in our knowledge of relatively common causes of cortical malformations.
…HD occurs when the gene that encodes huntingtin (Htt), located on the short arm of chromosome 4, shows an expanded CAG repeat region following exon 1 (The Huntington's Collaborative Research Group, 1993).…
Introduction)
…that encodes huntingtin (Htt), located on the…
Show Full Abstract
Progress to date from our group and others indicate that using genetically-engineered mesenchymal stem cells (MSC) to secrete brain-derived neurotrophic factor (BDNF) supports our plan to submit an Investigational New Drug application to the Food and Drug Administration for the future planned Phase 1 safety and tolerability trial of MSC/BDNF in patients with Huntington's disease (HD). There are also potential applications of this approach beyond HD. Our biological delivery system for BDNF sets the precedent for adult stem cell therapy in the brain and could potentially be modified for other neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS), spinocerebellar ataxia (SCA), Alzheimer's disease, and some forms of Parkinson's disease. The MSC/BDNF product could also be considered for studies of regeneration in traumatic brain injury, spinal cord and peripheral nerve injury. This work also provides a platform for our future gene editing studies, since we will again use MSCs to deliver the needed molecules into the central nervous system.
Also flagged:water-reductionDisks large homolog 4Calcium-activated potassium channel subunit alpha-1fluoridedental fluorosis
Journal Article2016-05-01No SnippetsKhan ZN, Leite Ade L, Charone S, Sabino IT, Martini T, Pereira HA, Oliveira RC, Buzalaf MA.
Show Full Abstract
<h4>Objective</h4>In this study, we investigated the differential pattern of protein expression in the liver of these mice to provide insights on why they have different responses to F.<h4>Material and methods</h4>Weanling male A/J and 129P3/J mice (n=10 from each strain) were pared and housed in metabolic cages with ad libitum access to low-F food and deionized water for 42 days. Liver proteome profiles were examined using nLC-MS/MS. Protein function was classified by GO biological process (Cluego v2.0.7 + Clupedia v1.0.8) and protein-protein interaction network was constructed (PSICQUIC, Cytoscape).<h4>Results</h4>Most proteins with fold change were increased in A/J mice. The functional category with the highest percentage of altered genes was oxidation-reduction process (20%). Subnetwork analysis revealed that proteins with fold change interacted with Disks large homolog 4 and Calcium-activated potassium channel subunit alpha-1. A/J mice had an increase in proteins related to energy flux and oxidative stress.<h4>Conclusion</h4>This could be a possible explanation for the high susceptibility of these mice to the effects of F, since the exposure also induces oxidative stress.
Also flagged:DopaminepsychopathologiesShhShh receptorCdontyrosine hydroxylase
Journal Article2016-05-01✓ 4 SnippetsVerwey M, Grant A, Meti N, Adye-White L, Torres-Berrío A, Rioux V, Lévesque M, Charron F, Flores C.
In-Text Gene Mentions
Discussion)
…For example, mice that are haploinsufficient for the Netrin-1 receptor Dcc exhibit increased baseline concentrations of dopamine and dopamine metabolites in mPFC, which in turn causes blunted amphetamine-induced dopamine release in the NAcc (Flores et al., 2005; Pokinko et al., 2015).…
Discussion)
…Interestingly, adult Dcc haploinsufficient mice also fail to show sensitization to the locomotor effects of amphetamine upon repeated exposure (Flores et al., 2005; Grant et al., 2007; Yetnikoff et al., 2010).…
Motivated behaviors and many psychopathologies typically involve changes in dopamine release from the projections of the ventral tegmental area (VTA) and/or the substantia nigra pars compacta (SNc). The morphogen Sonic Hedgehog (Shh) specifies fates of midbrain dopamine neurons, but VTA-specific effects of Shh signaling are also being uncovered. In this study, we assessed the role of the Shh receptor Cdon in the development of VTA and SNc dopamine neurons. We find that Cdon is expressed in the proliferating progenitor zone of the embryonic ventral midbrain and that the number of proliferating cells in this region is increased in mouse Cdon(-/-) embryos. Consistent with a role of Shh in the regulation of neuronal proliferation in this region, we find that the number of tyrosine hydroxylase (TH)-positive neurons is increased in the VTA of Cdon(-/-) mice at birth and that this effect endures into adulthood. In contrast, the number of TH-positive neurons in the SNc is not altered in Cdon(-/-) mice at either age. Moreover, adult Cdon(-/-) mice have a greater number of medial prefrontal cortex (mPFC) dopamine presynaptic sites, and increased baseline concentrations of dopamine and dopamine metabolites selectively in this region. Finally, consistent with increased dopamine function in the mPFC, we find that adult Cdon(-/-) mice fail to exhibit behavioral plasticity upon repeated amphetamine treatment. Based on these data, we suggest that Cdon plays an important role encoding the diversity of dopamine neurons in the midbrain, influencing both the development of the mesocortical dopamine pathway and behavioral outputs that involve this neural circuitry.
Also flagged:Transcription Factorstranscription factorSox5Sox13Soxbinding
Journal Article2016-05-01✓ 5 SnippetsJi EH, Kim J.
In-Text Gene Mentions
S I O 001029)
…Sox5 or Sox6 induces premature appearance of cells positive for Sox10 which is a definitive oligodendrocytic lineage marker in the central nervous…
Abstract)
…three members, Sox5,Sox6, and Sox13.…
Introduction)
…Sox5,Sox6, and Sox13 comprise…
Introduction)
…Like Sox 5,Sox6is expressed in…
Introduction)
…Sox5 andSox6are particularly well…
Show Full Abstract
SoxD transcription factor subfamily includes three members, Sox5, Sox6, and Sox13. Like other Sox genes, they contain the High-Mobility-Group (HMG) box as the DNA binding domain but in addition feature the subgroup-specific leucine zipper motif. SoxD genes are expressed in diverse cell types in multiple organs during embryogenesis and in adulthood. Among the cells expressing them are those present in the developing nervous system including neural stem (or progenitor) cells as well as differentiating neurons and oligodendrocytes. SoxD transcription factors do not contain distinct activator or repressor domain, and they are believed to function in modulation of other transcription factors in promoter-specific manners. This brief review article will attempt to summarize the latest studies on the function of SoxD genes in embryogenesis with a particular emphasis on the regulation of neural development.
Also flagged:Liver Fibrosisliverbile obstructionGVHDascitesvenoocclusive disease
Journal Article2016-05-01✓ 1 SnippetHosoi H, Warigaya K, Murata S, Mushino T, Kuriyama K, Nishikawa A, Tamura S, Hatanaka K, Hanaoka N, Muragaki Y, Murata S, Nakakuma H, Sonoki T.
In-Text Gene Mentions
I A O 0000613)
…liver fibrosis andhemochromatosis( Figure 2D,G…
Show Full Abstract
We report cases of three patients of refractory ascites without other fluid retention that occurred around five months after allogeneic hematopoietic stem cell transplantation (allo-HSCT). All three patients expired and postmortem examinations revealed unexpected liver fibrosis lacking histological evidences of graft-versus-host-disease (GVHD). The three patients showed normal hepatic function and size before transplantation. During their clinical courses, serum biochemistry test showed no elevation of hepatic enzymes and bilirubin; however, imaging studies demonstrated hepatic atrophy at the onset of ascites. One of the liver specimens showed bile obstruction, which could be seen in hepatic damage by GVHD. Although ascites resulting from venoocclusive disease in early phase allo-HSCT is well documented, ascites associated with hepatic fibrosis in late phase allo-HCST has not been reported. Further clinico-pathological studies on similar patients should be required to ascertain refractory ascites associated with liver fibrosis after allo-HSCT.
Also flagged:ExtrahepaticPortal Vein ObstructionPortal HypertensionExtrahepatic portal vein obstructionhyperesplenismcholangyopathy
Journal Article2016-05-01✓ 1 SnippetKhodayar-Pardo P, Peña Aldea A, Ramírez González A, Meseguer Carrascosa A, Calabuig Bayo C.
In-Text Gene Mentions
I A O 0000613)
…VI and IX,hemochromatosisand Wilson disease)…
Show Full Abstract
Extrahepatic portal vein obstruction, although rare in children, is a significant cause of portal hypertension (PHT) leading to life-threatening gastrointestinal bleeding in the pediatric age group. PHT may also lead to other complications such as hyperesplenism, cholangyopathy, ascites, and even hepatopulmonary syndrome and portopulmonary hypertension that may require organ transplantation. Herein we report the case of an asymptomatic 11-month-old infant wherein a hepatomegaly and cavernous transformation of the portal vein was detected by liver ultrasound. Neither signs of thrombosis in arteriovenous system, nor affectation of biliary tract were identified in the magnetic resonance imaging study. A significant enlargement of the caudate lobe of the liver was reported. No risk factors were detected. The differential diagnosis performed was extensive. Inherited thrombophilia and storage disorders were especially considered. Liver biopsy was normal. Upper gastrointestinal esophagogastroduodenoscopy detected two small varicose cords on the distal third of the esophagus. Finding a cavernous transformation of the portal vein with evidence of collateral circulation in such an early age is a challenging condition for professionals, since PHT may lead to severe complications during childhood and can compromise growth and development. Evidence-based guidelines for the management of PHT in adults have been published. However, follow-up and treatment of pediatric patients have not yet been standardized. Moreover, management of PHT in infants faces particular difficulties such as technical restrictions that could hinder their treatment.
…Interestingly, the ICGC study also identified five genes (USP9X, MLL4, ARID2, UNC13C and TRPM3) and three pathways (Wnt signaling, dorso-ventral axis formation and axon guidance) previously not associated with HNSCC in TCGA.…
Introduction)
…USP9X, MLL4, ARID2,UNC13Cand TRPM3 )…
Show Full Abstract
While sequencing studies have provided an improved understanding of the genetic landscape of head and neck squamous cell carcinomas (HNSCC), there remains a significant lack of genetic data derived from non-Caucasian cohorts. Additionally, there is wide variation in HNSCC incidence and mortality worldwide both between and within various geographic regions. These epidemiologic differences are in part accounted for by varying exposure to environmental risk factors such as tobacco, alcohol, high risk human papilloma viruses and betel quid. However, inherent genetic factors may also play an important role in this variability. As limited sequencing data is available for many populations, the involvement of unique genetic factors in HNSCC pathogenesis from epidemiologically diverse groups is unknown. Here, we review current knowledge about the epidemiologic, environmental, and genetic variation in HNSCC cohorts globally and discuss future studies necessary to further our understanding of these differences. Long-term, a more complete understanding of the genetic drivers found in diverse HNSCC cohorts may help the development of personalized medicine protocols for patients with rare or complex genetic events.
Also flagged:glutamate receptordendritesynaptogenesisDEXNEMOMCM
Journal Article2016-05-01✓ 1 SnippetYulan XU, Yadan X, Lijun K.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
There are three types of glial cells in Caenorhabditis elegans (C. elegans for short): sheath glia, socket glia and glutamate receptor glia. They are mainly located in four sensory organs including the amphid, the cephalic organ, the outer labial sensilla and the inner labial sensilla. C. elegans glial cells play key roles in dendrite extension, neurite guidance and extension, and are essential for synaptogenesis and maintain the normal morphology and the function of sensory nerve endings as well. A recent study shown that some nematode neurons are derived from the glial cells. Moreover, nematodes glial cells can directly modulate the function of sensory neurons. Some glial cells can also respond to certain external stimuli, such as mechanical stimulation, and adjust the accompanying neuronal activities.The article summarizes the progress on effects of nematodes glial cells on the nervous system development and function.
Also flagged:Hepatic Angiosarcomaangiosarcomacancergastric cancerHAhepatic neoplasm
Journal Article2016-05-01✓ 1 SnippetIto Z, Kajihara M, Kobayashi Y, Kanai T, Matsumoto Y, Takakura K, Yukawa T, Ohkusa T, Koyama S, Imazu H, Arakawa H, Ohata M, Koido S.
In-Text Gene Mentions
Introduction)
…of androgenic steroids,hemochromatosis, von Recklinghausen's disease…
Show Full Abstract
Primary hepatic angiosarcoma is a very rare malignancy with a poor prognosis. Because patients present with no specific symptoms, the cancer can grow undetected and most cases are diagnosed too late for resection. We present the case of a 78-year-old Japanese man admitted to our hospital with massive hematemesis and melena. A total gastrectomy had previously been performed on the patient to treat gastric cancer. Endoscopic injection sclerotherapy was performed to control the bleeding from varices over the anastomosis. Computed tomography revealed the presence of multiple atypical liver nodules in the enhanced image. Histological diagnosis of hepatic angiosarcoma was obtained by percutaneous ultrasound-guided liver biopsy. To our knowledge, this is the first report of a patient with hepatic angiosarcoma and acute variceal hemorrhage.
Also flagged:IronHemoglobinHereditary hemochromatosisgenetic disorderadult hemochromatosisextracellular space
Journal Article2016-05-01✓ 5 SnippetsWrobel N, Pottgiesser T, Birkner P, Deibert P, Ahlgrim C.
In-Text Gene Mentions
Introduction)
…HFE (High Iron Fe) gene with autosomal recessive inheritance termed ‘classic’ adult hemochromatosis…
Introduction)
…HFE hemochromatosis…
Introduction)
…hemochromatosis is made by elevated ferritin levels (above ≈250 μg/l), elevated transferrin saturation (>45%), HFE…
I A O 0000613)
…hemochromatosis was made by an elevated transferrin saturation (58%, table 1) and HFE…
Title)
…Mass in aHemochromatosisPatient…
Show Full Abstract
<h4>Introduction</h4>Hereditary hemochromatosis features a dysregulated iron absorption leading to iron overload and organ damage. The regulation of total hemoglobin mass during depletion of iron deposits by therapeutic phlebotomy has not been studied.<h4>Case presentation</h4>The initial ferritin level of the 52-year-old male subject was 1,276 μg/l. Despite successful depletion of iron stores (ferritin<Sub>min</Sub>: 53 μg/l) through phlebotomies, total hemoglobin mass stabilized at the pretherapy level. However, regeneration of total hemoglobin mass was accelerated (up to 10.8 g/day).<h4>Conclusion</h4>In this hemochromatosis patient, the total hemoglobin mass was not altered in the long term, but regeneration was accelerated, possibly due to elevated body iron content.
Also flagged:oesophageal cancertumourPUR-aplhaPURApathogenesistumours
Journal Article2016-05-01✓ 1 SnippetSharma P, Saraya A, Sharma R.
In-Text Gene Mentions
Results)
…kcal/mol) and FBXL3 (F-box and leucine-rich repeat protein 3and leucine-rich repeat…
Show Full Abstract
<h4>Background & objectives</h4>Insidious symptomatology, late clinical presentation and poor prognosis of oesophageal cancer (EC) highlight the pressing need for novel non-invasive biomarkers for early tumour diagnosis and better prognosis. The present study was carried out to evaluate the clinical significance of circulating and tissue miR-144 expression in oesophageal cancer.<h4>Methods</h4>Clinical significance of miR-144 expression was evaluated in preneoplastic (12) and neoplastic (35) oesophageal cancer tissues as well as matched distant non-malignant tissues using real-time PCR (qPCR). Circulating levels of miR-144 were also analyzed in serum samples of EC patients as well as normal individuals to determine the diagnostic potential of miR-144. Further, targets of miR-144 were predicted using bioinformatic tools and their gene ontology (GO) terms were assigned.<h4>Results</h4>Real-time PCR analysis revealed significant upregulation of miR-144 in 29 of 35 (83%) EC tissues as compared to matched distant non-malignant tissues (P=0.010). a0 ll the dysplastic tissues showed upregulation of miR-144 as compared to their matched distant non-malignant tissues. Relative levels of circulating miR-144 in serum significantly distinguished EC patients from normal controls (P=0.015; AUC = 0.731) with high sensitivity of 94.7 per cent. Bioinformatically predicted target, PUR-aplha (PURA) was found to be significantly (P=0.018) downregulated in 81 per cent (26/32) EC patients and its expression was found to be significantly and negatively correlated with miR-144 expression at mRNA level.<h4>Interpretation & conclusions</h4>Our findings showed significant upregulation of miR-144 in serum samples of EC patients indicating its potential as minimally invasive marker. Further studies need to be done to understand the role of miR-144 in the pathogenesis of EC.
Journal Article2016-05-01No SnippetsMcDonald JU, Kaforou M, Clare S, Hale C, Ivanova M, Huntley D, Dorner M, Wright VJ, Levin M, Martinon-Torres F, Herberg JA, Tregoning JS.
Show Full Abstract
Greater understanding of the functions of host gene products in response to infection is required. While many of these genes enable pathogen clearance, some enhance pathogen growth or contribute to disease symptoms. Many studies have profiled transcriptomic and proteomic responses to infection, generating large data sets, but selecting targets for further study is challenging. Here we propose a novel data-mining approach combining multiple heterogeneous data sets to prioritize genes for further study by using respiratory syncytial virus (RSV) infection as a model pathogen with a significant health care impact. The assumption was that the more frequently a gene is detected across multiple studies, the more important its role is. A literature search was performed to find data sets of genes and proteins that change after RSV infection. The data sets were standardized, collated into a single database, and then panned to determine which genes occurred in multiple data sets, generating a candidate gene list. This candidate gene list was validated by using both a clinical cohort and <i>in vitro</i> screening. We identified several genes that were frequently expressed following RSV infection with no assigned function in RSV control, including <i>IFI27</i>, <i>IFIT3</i>, <i>IFI44L</i>, <i>GBP1</i>, <i>OAS3</i>, <i>IFI44</i>, and <i>IRF7</i>. Drilling down into the function of these genes, we demonstrate a role in disease for the gene for interferon regulatory factor 7, which was highly ranked on the list, but not for <i>IRF1</i>, which was not. Thus, we have developed and validated an approach for collating published data sets into a manageable list of candidates, identifying novel targets for future analysis. <b>IMPORTANCE</b> Making the most of "big data" is one of the core challenges of current biology. There is a large array of heterogeneous data sets of host gene responses to infection, but these data sets do not inform us about gene function and require specialized skill sets and training for their utilization. Here we describe an approach that combines and simplifies these data sets, distilling this information into a single list of genes commonly upregulated in response to infection with RSV as a model pathogen. Many of the genes on the list have unknown functions in RSV disease. We validated the gene list with new clinical, <i>in vitro</i>, and <i>in vivo</i> data. This approach allows the rapid selection of genes of interest for further, more-detailed studies, thus reducing time and costs. Furthermore, the approach is simple to use and widely applicable to a range of diseases.
Also flagged:Ironexcretionhereditary haemochromatosisanaemiairon regulatory hormoneHepcidin
Journal Article2016-05-01No SnippetsWallace DF.
Show Full Abstract
Iron is an essential element in biology, required for numerous cellular processes. Either too much or too little iron can be detrimental, and organisms have developed mechanisms for balancing iron within safe limits. In mammals there are no controlled mechanisms for the excretion of excess iron, hence body iron homeostasis is regulated at the sites of absorption, utilisation and recycling. This review will discuss the discoveries that have been made in the past 20 years into advancing our understanding of iron homeostasis and its regulation. The study of iron-associated disorders, such as the iron overload condition hereditary haemochromatosis and various forms of anaemia have been instrumental in increasing our knowledge in this area, as have cellular and animal model studies. The liver has emerged as the major site of systemic iron regulation, being the location where the iron regulatory hormone hepcidin is produced. Hepcidin is a negative regulator of iron absorption and recycling, achieving this by binding to the only known cellular iron exporter ferroportin and causing its internalisation and degradation, thereby reducing iron efflux from target cells and reducing serum iron levels. Much of the research in the iron metabolism field has focussed on the regulation of hepcidin and its interaction with ferroportin. The advances in this area have greatly increased our knowledge of iron metabolism and its regulation and have led to the development of novel diagnostics and therapeutics for iron-associated disorders.