Gene Literature Dashboard

Viewing September 2016 — 307 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← August 2016 October 2016 →
Also flagged:peptide hormoneRelaxinPeptidesnitric oxideprostanoidsVEGF
Journal Article 2016-09-30 No Snippets Leo CH, Jelinic M, Ng HH, Marshall SA, Novak J, Tare M, Conrad KP, Parry LJ.
Show Full Abstract

The peptide hormone relaxin regulates the essential maternal haemodynamic adaptations in early pregnancy through direct actions on the renal and systemic vasculature. These vascular actions of relaxin occur mainly through endothelium-derived NO-mediated vasodilator pathways and improvements in arterial compliance in small resistance-size arteries. This work catalysed a plethora of studies which revealed quite heterogeneous responses across the different regions of the vasculature, and also uncovered NO-independent mechanisms of relaxin action. In this review, we first describe the role of endogenous relaxin in maintaining normal vascular function, largely referring to work in pregnant and male relaxin-deficient animals. We then discuss the diversity of mechanisms mediating relaxin action in different vascular beds, including the involvement of prostanoids, VEGF, endothelium-derived hyperpolarisation and antioxidant activity in addition to the classic NO-mediated vasodilatory pathway. We conclude the review with current perspectives on the vascular remodelling capabilities of relaxin.<h4>Linked articles</h4>This article is part of a themed section on Recent Progress in the Understanding of Relaxin Family Peptides and their Receptors. To view the other articles in this section visit http://onlinelibrary.wiley.com/doi/10.1111/bph.v174.10/issuetoc.

Also flagged:reverse transcriptaselung interstitial fibrosisprogrammed cell death 4PDCD4LIN28Bconnective tissue growth factor
Journal Article 2016-09-30 No Snippets Yang H, Zhang Y, Li W, Lao C, Li M, Zheng Y.
Show Full Abstract

The objective of the present research is to explore miRNAs expression profiles in lung tissue of rat treated by nanosized SiO<sub>2</sub> in the light of normal at diverse dosages, time, predict their target genes, and probe the biological function and regulation of miRNA in the lung damage process caused by nanosized SiO<sub>2</sub>. Up-regulation of rno-miR-208, rno-miR-212 and rno-miR-18a in lung tissue mainly characterized by inflammation of SD rats caused by nanosized SiO<sub>2</sub> particles instilled intratracheally at 7<sup>th</sup>, 15<sup>th</sup> 30<sup>th</sup> d using Illumina HiSeq2000 sequencing technique and were further verified by quantitative reverse transcriptase polymerase chain reaction (qRT PCR) assay. Lung damage is mainly with characteristics of lung interstitial fibrosis, upregulation of rno-miR-212, rno-miR-144, rno-miR-702-3p, rno-miR-379 and rno-miR-127, down-regulation of rno-miR-541 at 60<sup>th</sup>, 90<sup>th</sup> d post-exposure. As target genes of rno-miR-208, rno-miR-212 and rno-miR-18a respectively, there was no statistical significance of programmed cell death 4 (PDCD4), LIN28B and connective tissue growth factor (CTGF) mRNA expression level (P > 0.05) compared to β-actin as internal controls detected by Real-time quantitative PCR. The differences in protein gray value ratio of PDCD4, LIN28B and CTGF detected by Western blotting test were statistically significant (P < 0.05). These results suggested that miR-208, miR-212 and miR-18a may take effects in rats' lung damage lead by nanosized SiO<sub>2</sub>. Their target genes of PDCD4, LIN28B and CTGF functioned in translation level of target genes in regulation of inflammatory signaling pathways and involved in the formation of tissue fibrosis.

Also flagged:Mtu1MitochondrialReversible infantile liver failureliver diseaseacute liver failurepathogenesis
Journal Article 2016-09-30 ✓ 2 Snippets Wu Y, Wei FY, Kawarada L, Suzuki T, Araki K, Komohara Y, Fujimura A, Kaitsuka T, Takeya M, Oike Y, Suzuki T, Tomizawa K.
In-Text Gene Mentions

…deficiency of murineDars2(mitochondrial aspartyl-tRNA s…

…the observation inDars2knockout mice, which…

Show Full Abstract

Reversible infantile liver failure (RILF) is a unique heritable liver disease characterized by acute liver failure followed by spontaneous recovery at an early stage of life. Genetic mutations in MTU1 have been identified in RILF patients. MTU1 is a mitochondrial enzyme that catalyzes the 2-thiolation of 5-taurinomethyl-2-thiouridine (τm5s2U) found in the anticodon of a subset of mitochondrial tRNAs (mt-tRNAs). Although the genetic basis of RILF is clear, the molecular mechanism that drives the pathogenesis remains elusive. We here generated liver-specific knockout of Mtu1 (Mtu1LKO) mice, which exhibited symptoms of liver injury characterized by hepatic inflammation and elevated levels of plasma lactate and AST. Mechanistically, Mtu1 deficiency resulted in a loss of 2-thiolation in mt-tRNAs, which led to a marked impairment of mitochondrial translation. Consequently, Mtu1LKO mice exhibited severe disruption of mitochondrial membrane integrity and a broad decrease in respiratory complex activities in the hepatocytes. Interestingly, mitochondrial dysfunction induced signaling pathways related to mitochondrial proliferation and the suppression of oxidative stress. The present study demonstrates that Mtu1-dependent 2-thiolation of mt-tRNA is indispensable for mitochondrial translation and that Mtu1 deficiency is a primary cause of RILF. In addition, Mtu1 deficiency is associated with multiple cytoprotective pathways that might prevent catastrophic liver failure and assist in the recovery from liver injury.

Also flagged:Chronic Liver Diseasecirrhosisliver fibrosisportal hypertensionhepatic fibrosisviral infection
Journal Article 2016-09-30 ✓ 1 Snippet Srinivasa Babu A, Wells ML, Teytelboym OM, Mackey JE, Miller FH, Yeh BM, Ehman RL, Venkatesh SK.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Chronic liver disease has multiple causes, many of which are increasing in prevalence. The final common pathway of chronic liver disease is tissue destruction and attempted regeneration, a pathway that triggers fibrosis and eventual cirrhosis. Assessment of fibrosis is important not only for diagnosis but also for management, prognostic evaluation, and follow-up of patients with chronic liver disease. Although liver biopsy has traditionally been considered the reference standard for assessment of liver fibrosis, noninvasive techniques are the emerging focus in this field. Ultrasound-based elastography and magnetic resonance (MR) elastography are gaining popularity as the modalities of choice for quantifying hepatic fibrosis. These techniques have been proven superior to conventional cross-sectional imaging for evaluation of fibrosis, especially in the precirrhotic stages. Moreover, elastography has added utility in the follow-up of previously diagnosed fibrosis, the assessment of treatment response, evaluation for the presence of portal hypertension (spleen elastography), and evaluation of patients with unexplained portal hypertension. In this article, a brief overview is provided of chronic liver disease and the tools used for its diagnosis. Ultrasound-based elastography and MR elastography are explored in depth, including a brief glimpse into the evolution of elastography. Elastography is based on the principle of measuring tissue response to a known mechanical stimulus. Specific elastographic techniques used to exploit this principle include MR elastography and ultrasonography-based static or quasistatic strain imaging, one-dimensional transient elastography, point shear-wave elastography, and supersonic shear-wave elastography. The advantages, limitations, and pitfalls of each modality are emphasized. <sup>©</sup>RSNA, 2016.

Also flagged:Tumorpaclitaxeldocosahexaenoic aciddisulfidecanceroleic acid
Journal Article 2016-09-30 No Snippets Luo C, Sun J, Sun B, Liu D, Miao L, Goodwin TJ, Huang L, He Z.
Show Full Abstract

The conjugate of paclitaxel (PTX) and docosahexaenoic acid has entered into clinical trials. However, the most recent clinical outcomes fell short of expectations, due to the extremely slow drug release from the hydrophobic conjugates. Herein, a novel prodrug-based nanoplatform self-assembled by the disulfide bond linked conjugates of PTX and oleic acid for rapid and differential release of PTX in tumor cells is reported. This redox-responsive prodrug-nanosystem demonstrates multiple therapeutic advantages, including one-step facile fabrication, high drug-loading efficiency (56%, w/w), on-demand drug release responding to redox stimuli, as well as favorable cellular uptake and biodistribution. These advantages result in significantly enhanced antitumor efficacy in vivo, with the tumor almost completely disappearing in mice. Such a uniquely engineered prodrug-nanosystem has great potential to be used as potent chemotherapeutic nanomedicine in clinical cancer therapy.

Also flagged:Heterochromatinchromosomenuclear laminadosage compensationdosage compensation complexchromosomes
Journal Article 2016-09-30 ✓ 5 Snippets Snyder MJ, Lau AC, Brouhard EA, Davis MB, Jiang J, Sifuentes MH, Csankovszki G.
In-Text Gene Mentions

…dosage compensation complex (DCC) binds both X…

…by mutations inDCCsubunits.…

…observable defects inDCClocalization and DCC-mediated…

…DCC localization andDCC-mediated changes in histone…

…cooperate with theDCCto compact and…

Show Full Abstract

Higher order chromosome structure and nuclear architecture can have profound effects on gene regulation. We analyzed how compartmentalizing the genome by tethering heterochromatic regions to the nuclear lamina affects dosage compensation in the nematode C. elegans. In this organism, the dosage compensation complex (DCC) binds both X chromosomes of hermaphrodites to repress transcription two-fold, thus balancing gene expression between XX hermaphrodites and XO males. X chromosome structure is disrupted by mutations in DCC subunits. Using X chromosome paint fluorescence microscopy, we found that X chromosome structure and subnuclear localization are also disrupted when the mechanisms that anchor heterochromatin to the nuclear lamina are defective. Strikingly, the heterochromatic left end of the X chromosome is less affected than the gene-rich middle region, which lacks heterochromatic anchors. These changes in X chromosome structure and subnuclear localization are accompanied by small, but significant levels of derepression of X-linked genes as measured by RNA-seq, without any observable defects in DCC localization and DCC-mediated changes in histone modifications. We propose a model in which heterochromatic tethers on the left arm of the X cooperate with the DCC to compact and peripherally relocate the X chromosomes, contributing to gene repression.

Also flagged:HSP90bindinghydrogenswaterorganizationMAP4K4
Journal Article 2016-09-30 No Snippets Gathiaka S, Liu S, Chiu M, Yang H, Stuckey JA, Kang YN, Delproposto J, Kubish G, Dunbar JB, Carlson HA, Burley SK, Walters WP, Amaro RE, Feher VA, Gilson MK.
Show Full Abstract

The Drug Design Data Resource (D3R) ran Grand Challenge 2015 between September 2015 and February 2016. Two targets served as the framework to test community docking and scoring methods: (1) HSP90, donated by AbbVie and the Community Structure Activity Resource (CSAR), and (2) MAP4K4, donated by Genentech. The challenges for both target datasets were conducted in two stages, with the first stage testing pose predictions and the capacity to rank compounds by affinity with minimal structural data; and the second stage testing methods for ranking compounds with knowledge of at least a subset of the ligand-protein poses. An additional sub-challenge provided small groups of chemically similar HSP90 compounds amenable to alchemical calculations of relative binding free energy. Unlike previous blinded Challenges, we did not provide cognate receptors or receptors prepared with hydrogens and likewise did not require a specified crystal structure to be used for pose or affinity prediction in Stage 1. Given the freedom to select from over 200 crystal structures of HSP90 in the PDB, participants employed workflows that tested not only core docking and scoring technologies, but also methods for addressing water-mediated ligand-protein interactions, binding pocket flexibility, and the optimal selection of protein structures for use in docking calculations. Nearly 40 participating groups submitted over 350 prediction sets for Grand Challenge 2015. This overview describes the datasets and the organization of the challenge components, summarizes the results across all submitted predictions, and considers broad conclusions that may be drawn from this collaborative community endeavor.

Also flagged:cytokinehematoxylinCell proliferationdeoxyuridineCD47transcription factors
Journal Article 2016-09-30 ✓ 1 Snippet Shatos MA, Hodges RR, Morinaga M, McNay DE, Islam R, Bhattacharya S, Li D, Turpie B, Makarenkova HP, Masli S, Utheim TP, Dartt DA.
In-Text Gene Mentions

Sox6

Show Full Abstract

The purpose of this study was to investigate the changes that occur in the lacrimal glands (LGs) in female thrombospondin 1 knockout (TSP1<sup>-/-</sup>) mice, a mouse model of the autoimmune disease Sjogren's syndrome. The LGs of 4, 12, and 24 week-old female TSP1<sup>-/-</sup> and C57BL/6J (wild type, WT) mice were used. qPCR was performed to measure cytokine expression. To study the architecture, LG sections were stained with hematoxylin and eosin. Cell proliferation was measured using bromo-deoxyuridine and immunohistochemistry. Amount of CD47 and stem cell markers was analyzed by western blot analysis and location by immunofluorescence microscopy. Expression of stem cell transcription factors was performed using Mouse Stem Cell Transcription Factors RT<sup>2</sup> Profiler PCR Array. Cytokine levels significantly increased in LGs of 24 week-old TSP1<sup>-/-</sup> mice while morphological changes were detected at 12 weeks. Proliferation was decreased in 12 week-old TSP1<sup>-/-</sup> mice. Three transcription factors were overexpressed and eleven underexpressed in TSP1<sup>-/-</sup> compared to WT LGs. The amount of CD47, Musashi1, and Sox2 was decreased while the amount of ABCG2 was increased in 12 week-old TSP1<sup>-/-</sup> mice. We conclude that TSP1 is necessary for maintaining normal LG homeostasis. Absence of TSP1 alters cytokine levels and stem cell transcription factors, LG cellular architecture, decreases cell proliferation, and alters amount of stem cell markers.

Also flagged:Netrin-1cerebral ischemianeural stem cells migration-gene transferfocal cerebral ischemia
Journal Article 2016-09-30 ✓ 5 Snippets Lu H, Song X, Wang F, Wang G, Wu Y, Wang Q, Wang Y, Yang GY, Zhang Z.
In-Text Gene Mentions

…As NT-1 receptors,DCCand UNC5H2 are…

…BothDCCand UNC5H2 are…

…NT-1 binding withDCCdisplays both attraction…

…NT-1/DCCsignaling was proved…

DCCcould regulate appropriate…

Show Full Abstract

Endogenous Netrin-1 (NT-1) protein was significantly increased after cerebral ischemia, which may participate in the repair after transient cerebral ischemic injury. In this work, we explored whether NT-1 can be steadily overexpressed by adeno-associated virus (AAV) and the exogenous NT-1 can promote neural stem cells migration from the subventricular zone (SVZ) region after cerebral ischemia. Adult CD-1 mice were injected stereotacticly with AAV carrying NT-1 gene (AAV-NT-1). Mice underwent 60 min of middle cerebral artery (MCA) occlusion 1 week after injection. We found that NT-1 mainly expressed in neuron and astrocyte, and the expression level of NT-1 significantly increased 1 week after AAV-NT-1 gene transfer and lasted for 28 days, even after transient middle cerebral artery occlusion (tMCAO) as well (<i>p</i> < 0.05). Immunohistochemistry results showed that the number of neural stem cells was greatly increased in the SVZ region of AAV-NT-1-transduced mice compared with control mice. Our study showed that overexpressed NT-1 promoted neural stem cells migration from SVZ. This result suggested that NT-1 is a promising factor for repairing and remodeling after focal cerebral ischemia.

Also flagged:SchizophreniaMethylationpathogenesispsychiatric disordersmental illnesscognitive impairment
Journal Article 2016-09-30 ✓ 2 Snippets Alelú-Paz R, Carmona FJ, Sanchez-Mut JV, Cariaga-Martínez A, González-Corpas A, Ashour N, Orea MJ, Escanilla A, Monje A, Guerrero Márquez C, Saiz-Ruiz J, Esteller M, Ropero S.
In-Text Gene Mentions

In the known and predicted protein–protein interactions we draw attention to the associations of HLA-DRB5 with HLA-A and HLA-B (Figure 3D), which are both involved in presenting foreign antigens to the immune system and are associated with schizophrenia (Chao et al., 2008; Childs et al., 2011; Gu et al., 2013), of HLA-B and LIF with IL6 and IL6R, respectively, which have both been implicated in schizophrenia, although controversially in the case of the latter (Sun et al., 2008; Liu et al., 2010; Singh et al., 2011), of HLB-B with HFE and CALR (Farokhashtiani et al., 2011; Buretic-Tomljanovic et al., 2012) and, finally, of LIF with LIFR, which participates in signal transduction by members of the interleukin (IL)-6 cytokine family and has recently been associated with persecutory delusion in the Korean population (Kang et al., 2012).

…of HLB-B withHFEand CALR (Farokhashtiani…

Show Full Abstract

Attempts to discover genes that are involved in the pathogenesis of major psychiatric disorders have been frustrating and often fruitless. Concern is building about the need to understand the complex ways in which nature and nurture interact to produce mental illness. We analyze the epigenome in several brain regions from schizophrenic patients with severe cognitive impairment using high-resolution (450K) DNA methylation array. We identified 139 differentially methylated CpG sites included in known and novel candidate genes sequences as well as in and intergenic sequences which functions remain unknown. We found that altered DNA methylation is not restricted to a particular region, but includes others such as CpG shelves and gene bodies, indicating the presence of different DNA methylation signatures depending on the brain area analyzed. Our findings suggest that epimutations are not relatables between different tissues or even between tissues' regions, highlighting the need to adequately study brain samples to obtain reliable data concerning the epigenetics of schizophrenia.

Also flagged:DNAJB6Myopathiesautosomal dominant limb girdle muscular dystrophy type 1DLGMD1DvacuolesHsp40
Journal Article 2016-09-30 No Snippets Ruggieri A, Saredi S, Zanotti S, Pasanisi MB, Maggi L, Mora M.
Show Full Abstract

Mutations in the <i>DNAJB6</i> gene have been associated with the autosomal dominant limb girdle muscular dystrophy type 1D (LGMD1D), a disorder characterized by abnormal protein aggregates and rimmed vacuoles in muscle fibers. DNAJB6 is a ubiquitously expressed Hsp40 co-chaperone characterized by a J domain that specifies Hsp70 functions in the cellular environment. DNAJB6 is also a potent inhibitor of expanded polyglutamine (polyQ) aggregation preventing aggregate toxicity in cells. In <i>DNAJB6</i>-mutated patients this anti-aggregation property is significantly reduced, albeit not completely lost. To elucidate the pathogenetic mechanisms underlying the DNAJB6-related myopathy, animal models have been created showing that, indeed, conditional muscular expression of a DNAJB6 mutant in the mouse causes a LGMD1D myofibrillary muscle tissue phenotype. Both mutations and phenotypes reported until recently were rather homogeneous, being exclusively missense mutations of a few amino acids of the protein G/F domain, and with a phenotype characterized by adult-onset slowly progressive muscular dystrophy predominantly affecting proximal muscles. Lately, several novel mutations and new phenotypes of DNAJB6 have been described. These mutations once more affect the G/F domain of DNAJB6 with missense changes and a splice site mutation; and the phenotypes include childhood onset and distal involvement of muscles, or childhood-onset LGMD1D with loss of ambulation in early adulthood and respiratory involvement. Thus, the spectrum of <i>DNAJB6</i>-related phenotypes is widening. Although our knowledge about the role of DNAJB6 in the pathogenesis of muscle diseases has made great progression, several questions remain unsolved, including why a ubiquitous protein affects only, or predominantly, skeletal muscle; why only the G/F domain is involved; and what is the possible role of the DNAJB6a isoform. Clarification of these issues will provide clues to implement possible therapeutic strategies for DNAJB6-related myopathies.

Also flagged:B cell lymphomasnodal marginal zone lymphomanuclear factor kappa BNF-kappaBnodal marginal zone lymphomasfollicular lymphomas
Journal Article 2016-09-30 ✓ 1 Snippet van Krieken JH.
In-Text Gene Mentions

SOCS1 mutations were exclusive to non-relapsing DLBCL, whereas primaries of relapsing DLBCL more commonly displayed gains of 10p15.3-p12.1 containing the potential oncogenes PRKCQ, GATA3, MLLT10, and ABI1.

Show Full Abstract

No abstract available.

Also flagged:Renal Cell carcinomaRCCcancercancersdeathcyclin D
Journal Article 2016-09-30 No Snippets Karim S, Al-Maghrabi JA, Farsi HM, Al-Sayyad AJ, Schulten HJ, Buhmeida A, Mirza Z, Al-Boogmi AA, Ashgan FT, Shabaad MM, NourEldin HF, Al-Ghamdi KB, Abuzenadah A, Chaudhary AG, Al-Qahtani MH.
Show Full Abstract

<h4>Background</h4>Renal cell carcinoma (RCC) is a seventh ranked malignancy with poor prognosis. RCC is lethal at metastatic stage as it does not respond to conventional systemic treatments, and there is an urgent need to find out promising novel biomarkers for effective treatment. The goal of this study was to evaluate the biomarkers that can be potential therapeutic target and predict effective inhibitors to treat the metastatic stage of RCC.<h4>Methods</h4>We conducted transcriptomic profiling to identify differentially expressed genes associated with RCC. Molecular pathway analysis was done to identify the canonical pathways and their role in RCC. Tissue microarrays (TMA) based immunohistochemical stains were used to validate the protein expression of cyclinD1 (CCND1) and were scored semi-quantitatively from 0 to 3+ on the basis of absence or presence of staining intensity in the tumor cell. Statistical analysis determined the association of CCND1 expression with RCC. Molecular docking analyses were performed to check the potential of two natural inhibitors, rutin and curcumin to bind CCND1.<h4>Results</h4>We detected 1490 significantly expressed genes (1034, upregulated and 456, downregulated) in RCC using cutoff fold change 2 and p value < 0.05. Hes-related family bHLH transcription factor with YRPW motif 1 (HEY1), neuropilin 2 (NRP2), lymphoid enhancer-binding factor 1 (LEF1), and histone cluster 1 H3h (HIST1H3H) were most upregulated while aldolase B, fructose-bisphosphate (ALDOB), solute carrier family 12 (SLC12A1), calbindin 1 (CALB1) were the most down regulated genes in our dataset. Functional analysis revealed Wnt/β-catenin signaling as the significantly activated canonical pathway (z score = 2.53) involving cyclin D1 (CCND1). CCND1 was overexpressed in transcriptomic studies (FC = 2.26, p value = 0.0047) and TMA results also showed the positive expression of CCND1 in 53 % (73/139) of RCC cases. The ligands - rutin and curcumin bounded with CCND1 with good affinity.<h4>Conclusion</h4>CCND1 was one of the important upregulated gene identified in microarray and validated by TMA. Docking study showed that CCND1 may act as a potential therapeutic target and its inhibition could focus on the migratory, invasive, and metastatic potential of RCC. Further in vivo and in vitro molecular studies are needed to investigate the therapeutic target potential of CCND1 for RCC treatment.

Also flagged:Prader-Willi syndromeimprinting disorderchromosomePrader-Will-Like syndromeSNRPNMKRN3
Journal Article 2016-09-30 ✓ 1 Snippet Cheon CK.
In-Text Gene Mentions

For example, mutations in SIM1, leptin receptor (LEPR), pro-opiomelanocortin (POMC), melanocortin 4 receptor (MC4R), and more recently, POU3F2 have all been related to severe obesity which suggests a convergence onto the leptin-melanocortin pathway in association with oxytocin87, 88).

Show Full Abstract

The Prader-Willi syndrome (PWS) is a human imprinting disorder resulting from genomic alterations that inactivate imprinted, paternally expressed genes in human chromosome region 15q11-q13. This genetic condition appears to be a contiguous gene syndrome caused by the loss of at least 2 of a number of genes expressed exclusively from the paternal allele, including <i>SNRPN</i>, <i>MKRN3</i>, <i>MAGEL2</i>, <i>NDN</i> and several <i>snoRNAs</i>, but it is not yet well known which specific genes in this region are associated with this syndrome. Prader-Will-Like syndrome (PWLS) share features of the PWS phenotype and the gene functions disrupted in PWLS are likely to lie in genetic pathways that are important for the development of PWS phenotype. However, the genetic basis of these rare disorders differs and the absence of a correct diagnosis may worsen the prognosis of these individuals due to the endocrine-metabolic malfunctioning associated with the PWS. Therefore, clinicians face a challenge in determining when to request the specific molecular test used to identify patients with classical PWS because the signs and symptoms of PWS are common to other syndromes such as PWLS. This review aims to provide an overview of current knowledge relating to the genetics of PWS and PWLS, with an emphasis on identification of patients that may benefit from further investigation and genetic screening.

Also flagged:synaptic transmissionepilepsiespathogenesisabsence epilepsyjuvenile myoclonic epilepsyneurological disorders
Journal Article 2016-09-30 No Snippets Wormuth C, Lundt A, Henseler C, Müller R, Broich K, Papazoglou A, Weiergräber M.
Show Full Abstract

<h4>Background</h4>Researchers have gained substantial insight into mechanisms of synaptic transmission, hyperexcitability, excitotoxicity and neurodegeneration within the last decades. Voltage-gated Ca<sup>2+</sup> channels are of central relevance in these processes. In particular, they are key elements in the etiopathogenesis of numerous seizure types and epilepsies. Earlier studies predominantly targeted on Ca<sub>v</sub>2.1 P/Q-type and Ca<sub>v</sub>3.2 T-type Ca<sup>2+</sup> channels relevant for absence epileptogenesis. Recent findings bring other channels entities more into focus such as the Ca<sub>v</sub>2.3 R-type Ca<sup>2+</sup> channel which exhibits an intriguing role in ictogenesis and seizure propagation. Ca<sub>v</sub>2.3 R-type voltage gated Ca<sup>2+</sup> channels (VGCC) emerged to be important factors in the pathogenesis of absence epilepsy, human juvenile myoclonic epilepsy (JME), and cellular epileptiform activity, <i>e.g</i>. in CA1 neurons. They also serve as potential target for various antiepileptic drugs, such as lamotrigine and topiramate.<h4>Objective</h4>This review provides a summary of structure, function and pharmacology of VGCCs and their fundamental role in cellular Ca<sup>2+</sup> homeostasis. We elaborate the unique modulatory properties of Ca<sub>v</sub>2.3 R-type Ca<sup>2+</sup> channels and point to recent findings in the proictogenic and proneuroapoptotic role of Ca<sub>v</sub>2.3 R-type VGCCs in generalized convulsive tonic-clonic and complex-partial hippocampal seizures and its role in non-convulsive absence like seizure activity.<h4>Conclusion</h4>Development of novel Ca<sub>v</sub>2.3 specific modulators can be effective in the pharmacological treatment of epilepsies and other neurological disorders.

Also flagged:degradationmagnesiumyttriumtissueendothelial dysfunctionbone formation
Journal Article 2016-09-30 No Snippets Turyanskaya A, Rauwolf M, Grünewald TA, Meischel M, Stanzl-Tschegg S, Löffler JF, Wobrauschek P, Weinberg AM, Lichtenegger HC, Streli C.
Show Full Abstract

This study investigated the distribution of the elemental constituents of Mg-based implants at various stages of the degradation process in surrounding bone tissue, with a focus on magnesium (Mg), as the main component of the alloy, and yttrium (Y), due to its potential adverse health effects. The measurements were performed on the implant-bearing thin sections of rat bone in a time series of implant degradation between one and 18 months. Micro X-ray fluorescence analysis (μXRF) with a special spectrometer meeting the requirements for the measurements of low-Z elements was used. It was found that the migration and accumulation behaviour of implant degradation products is element-specific. A sharp decrease in Mg was observed in the immediate vicinity of the interface and no specific accumulation or aggregation of Mg in the adjacent bone tissue was detected. By contrast, Y was found to migrate further into the bone over time and to remain in the tissue even after the complete degradation of the implant. Although the nature of Y accumulations must still be clarified, its potential health impact should be considered.

Also flagged:lipidphosphocholineα-hemolysinfluorocarbonwateramphiphiles
Journal Article 2016-09-29 No Snippets Walsh E, Feuerborn A, Cook PR.
Show Full Abstract

Droplet-interface bilayers (DIBs) have applications in disciplines ranging from biology to computing. We present a method for forming them manually using a Teflon tube attached to a syringe pump; this method is simple enough it should be accessible to those without expertise in microfluidics. It exploits the properties of interfaces between three immiscible liquids, and uses fluid flow through the tube to pack together drops coated with lipid monolayers to create bilayers at points of contact. It is used to create functional nanopores in DIBs composed of phosphocholine using the protein α-hemolysin (αHL), to demonstrate osmotically-driven mass transfer of fluid across surfactant-based DIBs, and to create arrays of DIBs. The approach is scalable, and thousands of DIBs can be prepared using a robot in one hour; therefore, it is feasible to use it for high throughput applications.

Also flagged:KininogenKininhereditary deficiency inC1Inhbradykinincatabolism
Journal Article 2016-09-29 ✓ 1 Snippet Baroso R, Sellier P, Defendi F, Charignon D, Ghannam A, Habib M, Drouet C, Favier B.
In-Text Gene Mentions

…hereditary deficiency inC1 InhibitorInhibitor (C1Inh), but…

Show Full Abstract

<h4>Background</h4>Angioedema without wheals (AE) is a symptom characterised by localised episodes of oedema presumably caused by kinin release from kininogen cleavage. It can result from a hereditary deficiency in C1 Inhibitor (C1Inh), but it can present with normal level of C1Inh. These forms are typically difficult to diagnose although enhanced kinin production is suspected or demonstrated in some cases.<h4>Objectives</h4>We wanted to investigate bradykinin overproduction in all AE condition with normal C1Inh, excluding cases with enhanced kinin catabolism, and to propose this parameter as a disease biomarker.<h4>Methods</h4>We retrospectively investigated high molecular weight kininogen (HK) cleavage pattern, using gel electrophoresis and immunorevelation. Plasma samples were drawn using the same standardised procedure from blood donors or AE patients with normal C1Inh conditions, normal kinin catabolism, and without prophylaxis.<h4>Results</h4>Circulating native HK plasma concentrations were similar in the healthy men (interquartile range: 98-175μg/mL, n = 51) and in healthy women (90-176μg/mL, n = 74), while HK cleavage was lower (p<0.001) in men (0-5%) than women (3-9%). Patients exhibited lower native HK concentration (p<10-4; 21-117μg/mL, n = 31 for men; 0-84μg/mL, n = 41 for women) and higher HK cleavage (p<10-4; 10-30% and 14-89%, respectively) than healthy donors. Pathological thresholds were set at: <72μg/mL native HK, >14.4% HK cleavage for men; <38μg/mL; native HK, >33.0% HK cleavage for women, with >98% specificity achieved for all parameters. In plasma from patients undergoing recovery two months after oestrogen/progestin combination withdrawal (n = 13) or two weeks after AE attack (n = 2), HK cleavage was not fully restored, suggesting its use as a post-attack assay.<h4>Conclusion</h4>As a diagnostic tool, HK cleavage can offer physicians supportive arguments for kinin production in suspected AE cases and improve patient follow-up in clinical trials or prophylactic management.

Also flagged:cancerhistone deacetylaseagingneurodegenerative diseasemetabolismmitochondrial
Journal Article 2016-09-29 No Snippets Ansari A, Rahman MS, Saha SK, Saikot FK, Deep A, Kim KH.
Show Full Abstract

In mammals, seven members of the sirtuin protein family known as class III histone deacetylase have been identified for their characteristic features. These distinguished characteristics include the tissues where they are distributed or located, enzymatic activities, molecular functions, and involvement in diseases. Among the sirtuin members, SIRT3 has received much attention for its role in cancer genetics, aging, neurodegenerative disease, and stress resistance. SIRT3 controls energy demand during stress conditions such as fasting and exercise as well as metabolism through the deacetylation and acetylation of mitochondrial enzymes. SIRT3 is well known for its ability to eliminate reactive oxygen species and to prevent the development of cancerous cells or apoptosis. This review article provides a comprehensive review on numerous (noteworthy) molecular functions of SIRT3 and its effect on cancer cells and various diseases including Huntington's disease, amyotrophic lateral sclerosis, and Alzheimer's disease.

Also flagged:dopamineoxygeninnervationL-DOPADOPA-decarboxylaseDDC
Journal Article 2016-09-29 ✓ 1 Snippet Blohberger J, Buck T, Berg D, Berg U, Kunz L, Mayerhofer A.
In-Text Gene Mentions

…the ovarian pathophysiology,DCCexpression in TCs…

Show Full Abstract

<h4>Background</h4>A previous study showed that dopamine (DA), which is contained in follicular fluid (FF) from IVF patients, strongly increased the production of reactive oxygen species (ROS) by cultured human granulosa cells (GCs). ROS, including H<sub>2</sub>O<sub>2</sub>, are assumed to play roles in ovarian physiology and pathology. Ovarian DA could be derived from the circulation, ovarian innervation and/or unknown ovarian sources. L-DOPA is the direct precursor of DA in its synthetic pathway. It was not yet described in FF. We examined L-DOPA levels in FF from IVF patients. As it may exert anti-oxidative and ROS-scavenging functions, we studied whether it exerts such actions in human GCs and whether DOPA-decarboxylase (DDC), the enzyme converting L-DOPA to DA, is expressed in the human ovary.<h4>Results</h4>ELISA measurements revealed that human IVF-derived FF contains L-DOPA. In cultured human GCs automated confluence analyses showed that L-DOPA enhanced their survival. This is in contrast to the actions of DA, which reduced cell survival. A dose-dependent mode of action of L-DOPA was identified using a fluorescent ROS indicator. The results showed that it antagonized intracellular ROS accumulation induced by exogenous H<sub>2</sub>O<sub>2</sub>. DDC was absent in follicular GCs, but immunohistochemistry identified it in theca cells (TCs) of large follicles in the human ovary. Laser micro-dissection followed by RT-PCR corroborated the expression. DDC was also identified in the steroidogenic cells of the corpus luteum.<h4>Conclusions</h4>L-DOPA in FF is an antioxidant factor and exerts positive influences on GCs. Ovarian DA is derived from L-DOPA and has opposite actions. Exogenous L-DOPA is a standard therapy for Parkinson's disease, and the results raise the possibility that it may be able to exert positive actions as an antioxidant in ovarian conditions, as well.

Also flagged:deathdepressionmajor depressive disordermood disordersbehavioralcognitive impairment
Journal Article 2016-09-29 ✓ 2 Snippets Zhang S, Chen JM, Kuang L, Cao J, Zhang H, Ai M, Wang W, Zhang SD, Wang SY, Liu SJ, Fang WD.
In-Text Gene Mentions

…lower serotonin transporter (5-HTT) binding potential (BP)…

…(BP) values, and5-HTTBP was significantly…

Show Full Abstract

<h4>Background</h4>Suicide is the second leading cause of death among 15- to 29-year-olds in China, and 60 % of suicidal patients have a history of depression. Previous brain imaging studies have shown that depression and suicide may be associated with abnormal activity in default mode network (DMN) regions. However, no study has specifically investigated the relationship between DMN functional activity and suicidal behavior in depressed individuals. Therefore, in the present study, we directly investigated features of DMN brain activity in adolescent patients with histories of depression and attempted suicide.<h4>Methods</h4>A total of 35 sex- and age-matched suicidal depressed patients were compared with 18 non-suicidal depressed patients and 47 healthy controls. We explored functional activity changes in DMN regions that could be associated with suicidal behavior by comparing resting-state functional magnetic resonance imaging (rs-fMRI) signals using independent component analysis (ICA). Scores on six clinical scales that measure depression severity (Hamilton Depression Scale (HDRS) and Beck Depression Inventory (BDI)) and suicidal traits (Barratt Impulsiveness Scale (BIS-11), Suicide Attitude Questionnaire (SAQ), Beck Hopelessness Scale (BHS), and Scale for Suicide Ideation (SSI)) were compared in the three groups.<h4>Results</h4>Compared with the healthy controls, all of the evaluated depressed patients showed increased functional connectivity in select DMN regions. The suicidal patients showed increased connectivity in the left cerebellum and decreased connectivity in the right posterior cingulate cortex (PCC), whereas the non-suicidal depressed patients showed increased connectivity in the left superior frontal gyrus, left lingual gyrus and right precuneus and decreased connectivity in the left cerebellum. Compared to the non-suicidal patients, the suicidal patients showed increased connectivity in the left cerebellum and the left lingual gyrus and decreased connectivity in the right precuneus. No differences in the scores of any clinical scales were found between the suicidal and non-suicidal depressed patients.<h4>Conclusions</h4>Collectively, our results highlight the importance of the DMN in the pathophysiology of depression and suggest that suicidal behavior in depressed adolescents may be related to abnormal functional connectivity in the DMN. In particular, abnormal connectivity in the PCC/precuneus and left cerebellum might be a predictor of suicidal behavior in depressed adolescent patients.

Also flagged:G-protein-Coupled Receptor GPR68AmelogenesisGPR68amelogenesis imperfectaG-protein-coupled receptorlocalization
Journal Article 2016-09-29 No Snippets Parry DA, Smith CE, El-Sayed W, Poulter JA, Shore RC, Logan CV, Mogi C, Sato K, Okajima F, Harada A, Zhang H, Koruyucu M, Seymen F, Hu JC, Simmer JP, Ahmed M, Jafri H, Johnson CA, Inglehearn CF, Mighell AJ.
Show Full Abstract

Amelogenesis is the process of dental enamel formation, leading to the deposition of the hardest tissue in the human body. This process requires the intricate regulation of ion transport and controlled changes to the pH of the developing enamel matrix. The means by which the enamel organ regulates pH during amelogenesis is largely unknown. We identified rare homozygous variants in GPR68 in three families with amelogenesis imperfecta, a genetically and phenotypically heterogeneous group of inherited conditions associated with abnormal enamel formation. Each of these homozygous variants (a large in-frame deletion, a frameshift deletion, and a missense variant) were predicted to result in loss of function. GPR68 encodes a proton-sensing G-protein-coupled receptor with sensitivity in the pH range that occurs in the developing enamel matrix during amelogenesis. Immunohistochemistry of rat mandibles confirmed localization of GPR68 in the enamel organ at all stages of amelogenesis. Our data identify a role for GPR68 as a proton sensor that is required for proper enamel formation.

Also flagged:PPM1Aacetyltransferasesnutlin-3Chromatin modificationlackcell death
Journal Article 2016-09-29 ✓ 5 Snippets Zimmermann T, Remmers F, Lutz B, Leschik J.
In-Text Gene Mentions

Numerous laboratories showed that in a large number of HD mouse models BDNF or BDNF/TRKB signaling is strongly reduced due to a mutant htt-mediated mechanism (Plotkin et al., 2014, Zuccato and Cattaneo, 2009).

HD is an autosomal dominant inheritable disease, caused by mutations in the huntingtin (HTT) gene, leading to an increased number of polyglutamine repeats in the encoded protein (McMurray, 2001).

…the huntingtin (HTT) gene, leading…

…How mutantHTTprotein causes neuronal…

…to a mutanthtt-mediated mechanism ( Plotkin…

Show Full Abstract

Huntington's disease (HD) is characterized by fatal motoric failures induced by loss of striatal medium spiny neurons. Neuronal cell death has been linked to impaired expression and axonal transport of the neurotrophin BDNF (brain-derived neurotrophic factor). By transplanting embryonic stem cell-derived neural progenitors overexpressing BDNF, we combined cell replacement and BDNF supply as a potential HD therapy approach. Transplantation of purified neural progenitors was analyzed in a quinolinic acid (QA) chemical and two genetic HD mouse models (R6/2 and N171-82Q) on the basis of distinct behavioral parameters, including CatWalk gait analysis. Explicit rescue of motor function by BDNF neural progenitors was found in QA-lesioned mice, whereas genetic mouse models displayed only minor improvements. Tumor formation was absent, and regeneration was attributed to enhanced neuronal and striatal differentiation. In addition, adult neurogenesis was preserved in a BDNF-dependent manner. Our findings provide significant insight for establishing therapeutic strategies for HD to ameliorate neurodegenerative symptoms.

Also flagged:gene expressionNordihydroguaiaretic acidmetabolic syndromeglucosefatty acidstriglyceride
Journal Article 2016-09-29 ✓ 2 Snippets Zhang H, Shen WJ, Li Y, Bittner A, Bittner S, Tabassum J, Cortez YF, Kraemer FB, Azhar S.
In-Text Gene Mentions

…including Cpt1a, Cpt1b,Eci2, Acsl2 and FATP1…

…Cpt1a, Cpt1b andEci2.…

Show Full Abstract

Nordihydroguaiaretic acid (NDGA), the main metabolite of Creosote Bush, has been shown to have profound effects on the core components of metabolic syndrome, including lowering of blood glucose, free fatty acids and triglyceride levels, attenuating elevated blood pressure in several rodent models of dyslipidemia, and improving body weight, insulin resistance, diabetes and hypertension. In the present study, a high-fructose diet fed rat model of hypertriglyceridemia, dyslipidemia, insulin resistance and hepatic steatosis was employed to investigate the global transcriptional changes in the lipid metabolizing pathways in three insulin sensitive tissues: liver, skeletal muscle and adipose tissue in response to chronic dietary administration of NDGA. Sprague-Dawley male rats (SD) were fed a chow (control) diet, high-fructose diet (HFrD) or HFrD supplemented with NDGA (2.5 g/kg diet) for eight weeks. Dietary administration of NDGA decreased plasma levels of TG, glucose, and insulin, and attenuated hepatic TG accumulation. DNA microarray expression profiling indicated that dietary administration of NDGA upregulated the expression of certain genes involved in fatty acid oxidation and their transcription regulator, PPARα, decreased the expression of a number of lipogenic genes and relevant transcription factors, and differentially impacted the genes of fatty acid transporters, acetyl CoA synthetases, elongases, fatty acid desaturases and lipid clearance proteins in liver, skeletal muscle and adipose tissues. These findings suggest that NDGA ameliorates hypertriglyceridemia and steatosis primarily by inhibiting lipogenesis and enhancing fatty acid catabolism in three major insulin responsive tissues by altering the expression of key enzyme genes and transcription factors involved in de novo lipogenesis and fatty acid oxidation.

Also flagged:peptideselectron transferpeptidelipopolysaccharidebiotinantibody
Journal Article 2016-09-28 No Snippets Chakrabarty JK, Naik AG, Fessler MB, Munske GR, Chowdhury SM.
Show Full Abstract

Chemical cross-linking and mass spectrometry are now widely used to analyze large-scale protein-protein interactions. The major challenge in cross-linking approaches is the complexity of the mass spectrometric data. New approaches are required that can identify cross-linked peptides with high-confidence and establish a user-friendly analysis protocol for the biomedical scientific community. Here, we introduce a novel cross-linker that can be selectively cleaved in the gas phase using two differential tandem mass-spectrometric fragmentation methods, such as collision-induced or electron transfer dissociation (CID and ETD). This technique produces two signature mass spectra of the same cross-linked peptide, thereby producing high confidence in identifying the sites of interaction. Further tandem mass spectrometry can also give additional confidence on the peptide sequences. We demonstrate a proof-of-concept for this method using standard peptides and proteins. Peptides and proteins were cross-linked and their fragmentation characteristics were analyzed using CID and ETD tandem mass spectrometry. Two sequential cleavages unambiguously identified cross-linked peptides. In addition, the labeling efficiency of the new cross-linker was evaluated in macrophage immune cells after stimulation with the microbial ligand lipopolysaccharide and subsequent pulldown experiments with biotin-avidin affinity chromatography. We believe this strategy will help advance insights into the structural biology and systems biology of cell signaling.

Also flagged:SUCLA2dystoniaLeigh-like syndromedeafnessmyopathyataxia
Journal Article 2016-09-28 ✓ 1 Snippet Garone C, Gurgel-Giannetti J, Sanna-Cherchi S, Krishna S, Naini A, Quinzii CM, Hirano M.
In-Text Gene Mentions

FBXL4

Show Full Abstract

SUCLA2 defects have been associated with mitochondrial DNA (mtDNA) depletion and the triad of hypotonia, dystonia/Leigh-like syndrome, and deafness. A 9-year-old Brazilian boy of consanguineous parents presented with psychomotor delay, deafness, myopathy, ataxia, and chorea. Despite the prominent movement disorder, brain magnetic resonance imaging (MRI) was normal while <sup>1</sup>H-magnetic resonance spectroscopy (MRS) showed lactate peaks in the cerebral cortex and lateral ventricles. Decreased biochemical activities of mitochondrial respiratory chain enzymes containing mtDNA-encoded subunits and mtDNA depletion were observed in muscle and fibroblasts. A novel homozygous mutation in SUCLA2, the first one in the ligase coenzyme A (CoA) domain of the protein, was identified. Escalating doses of CoQ<sub>10</sub> up to 2000 mg daily were associated with improvement of muscle weakness and stabilization of the disease course. The findings indicate the importance of screening for mitochondrial dysfunction in patients with complex movement disorders without brain MRI lesions and further investigation for potential secondary CoQ<sub>10</sub> deficiency in patients with SUCLA2 mutations.

Also flagged:WNT3AinfectionssecretionLGR5cancerShiga-toxin
Journal Article 2016-09-28 No Snippets In JG, Foulke-Abel J, Estes MK, Zachos NC, Kovbasnjuk O, Donowitz M.
Show Full Abstract

The development of indefinitely propagating human 'mini-guts' has led to a rapid advance in gastrointestinal research related to transport physiology, developmental biology, pharmacology, and pathophysiology. These mini-guts, also called enteroids or colonoids, are derived from LGR5<sup>+</sup> intestinal stem cells isolated from the small intestine or colon. Addition of WNT3A and other growth factors promotes stemness and results in viable, physiologically functional human intestinal or colonic cultures that develop a crypt-villus axis and can be differentiated into all intestinal epithelial cell types. The success of research using human enteroids has highlighted the limitations of using animals or in vitro, cancer-derived cell lines to model transport physiology and pathophysiology. For example, curative or preventive therapies for acute enteric infections have been limited, mostly due to the lack of a physiological human intestinal model. However, the human enteroid model enables specific functional studies of secretion and absorption in each intestinal segment as well as observations of the earliest molecular events that occur during enteric infections. This Review describes studies characterizing these human mini-guts as a physiological model to investigate intestinal transport and host-pathogen interactions.

Also flagged:RNA polymerase IIcell proliferationAPAmetabolismlocalizationRNA-binding proteins
Journal Article 2016-09-28 ✓ 1 Snippet Tian B, Manley JL.
In-Text Gene Mentions

STAU1

Show Full Abstract

Alternative polyadenylation (APA) is an RNA-processing mechanism that generates distinct 3' termini on mRNAs and other RNA polymerase II transcripts. It is widespread across all eukaryotic species and is recognized as a major mechanism of gene regulation. APA exhibits tissue specificity and is important for cell proliferation and differentiation. In this Review, we discuss the roles of APA in diverse cellular processes, including mRNA metabolism, protein diversification and protein localization, and more generally in gene regulation. We also discuss the molecular mechanisms underlying APA, such as variation in the concentration of core processing factors and RNA-binding proteins, as well as transcription-based regulation.

Also flagged:T-cell leukemiaDNA-binding protein HeliosIKZF2IkarosKrüppel-like zinc-finger proteinsT-cell differentiation
Journal Article 2016-09-28 ✓ 1 Snippet Zhao S, Liu W, Li Y, Liu P, Li S, Dou D, Wang Y, Yang R, Xiang R, Liu F.
In-Text Gene Mentions

…kinases (SYK, SKAP1,VRK2, RIPK4) and components…

Show Full Abstract

The molecular defects which lead to multistep incidences of human T-cell leukemia have yet to be identified. The DNA-binding protein Helios (known as IKZF2), a member of the Ikaros family of Krüppel-like zinc-finger proteins, functions pivotally in T-cell differentiation and activation. In this study, we identify three novel short Helios splice variants which are T-cell leukemic specific, and demonstrate their dominant-negative function. We then test the cellular localization of distinct Helios isoforms, as well as their capability to form heterodimer with Ikaros, and the association with complexes comprising histone deacetylase (HDAC). In addition, the ectopic expression of T-cell leukemic Helios isoforms interferes with T-cell proliferation and apoptosis. The gene expression profiling and pathway analysis indicated the enrichment of signaling pathways essential for gene expression, translation, cell cycle checkpoint, and response to DNA damage stimulus. These data indicate the molecular function of Helios to be involved in the leukemogenesis and phenotype of T-cell leukemia, and also reveal Helios deregulation as a novel marker for T-cell leukemia.

Also flagged:Netrin 1axon guidance factorchemokinemonocyte migrationrheumatoid arthritisIL-17
Journal Article 2016-09-28 ✓ 1 Snippet Maruyama K, Kawasaki T, Hamaguchi M, Hashimoto M, Furu M, Ito H, Fujii T, Takemura N, Karuppuchamy T, Kondo T, Kawasaki T, Fukasaka M, Misawa T, Saitoh T, Suzuki Y, Martino MM, Kumagai Y, Akira S.
In-Text Gene Mentions

DCC

Show Full Abstract

Netrin 1 was initially identified as an axon guidance factor, and recent studies indicate that it inhibits chemokine-directed monocyte migration. Despite its importance as a neuroimmune guidance cue, the role of netrin 1 in osteoclasts is largely unknown. Here we detected high netrin 1 levels in the synovial fluid of rheumatoid arthritis patients. Netrin 1 is potently expressed in osteoblasts and synovial fibroblasts, and IL-17 robustly enhances netrin 1 expression in these cells. The binding of netrin 1 to its receptor UNC5b on osteoclasts resulted in activation of SHP1, which inhibited VAV3 phosphorylation and RAC1 activation. This significantly impaired the actin polymerization and fusion, but not the differentiation of osteoclast. Strikingly, netrin 1 treatment prevented bone erosion in an autoimmune arthritis model and age-related bone destruction. Therefore, the netrin 1-UNC5b axis is a novel therapeutic target for bone-destructive diseases.

Also flagged:lactate dehydrogenasecell proliferationdeatholigonucleotideHSPA6HSPB8
Journal Article 2016-09-28 No Snippets Kapila N, Sharma A, Kishore A, Sodhi M, Tripathi PK, Mohanty AK, Mukesh M.
Show Full Abstract

The present study aims to identify the heat responsive genes and biological pathways in heat stressed buffalo mammary epithelial cells (MECs). The primary mammary epithelial cells of riverine buffalo were exposed to thermal stress at 42°C for one hour. The cells were subsequently allowed to recover at 37°C and harvested at different time intervals (30 min to 48 h) along with control samples (un-stressed). In order to assess the impact of heat stress in buffalo MECs, several in-vitro cellular parameters (lactate dehydrogenase activity, cell proliferation assay, cellular viability, cell death and apoptosis) and transcriptional studies were conducted. The heat stress resulted in overall decrease in cell viability and cell proliferation of MECs while induction of cellular apoptosis and necrosis. The transcriptomic profile of heat stressed MECs was generated using Agilent 44 K bovine oligonucleotide array and at cutoff criteria of ≥3-or ≤3 fold change, a total of 153 genes were observed to be upregulated while 8 genes were down regulated across all time points post heat stress. The genes that were specifically up-regulated or down-regulated were identified as heat responsive genes. The upregulated genes in heat stressed MECs belonged to heat shock family viz., HSPA6, HSPB8, DNAJB2, HSPA1A. Along with HSPs, genes like BOLA, MRPL55, PFKFB3, PSMC2, ENDODD1, ARID5A, and SENP3 were also upregulated. Microarray data revealed that the heat responsive genes belonged to different functional classes viz., chaperons; immune responsive; cell proliferation and metabolism related. Gene ontology analysis revealed enrichment of several biological processes like; cellular process, metabolic process, response to stimulus, biological regulation, immune system processes and signaling. The transcriptome analysis data was further validated by RT-qPCR studies. Several HSP (HSP40, HSP60, HSP70, HSP90, and HSPB1), apoptotic (Bax and Bcl2), immune (IL6, TNFα and NF-kβ) and oxidative stress (GPX1 and DUSP1) related genes showed differential expression profile at different time points post heat stress. The transcriptional data strongly indicated the induction of survival/apoptotic mechanism in heat stressed buffalo MECs. The overrepresented pathways across all time points were; electron transport chain, cytochrome P450, apoptosis, MAPK, FAS and stress induction of HSP regulation, delta Notch signaling, apoptosis modulation by HSP70, EGFR1 signaling, cytokines and inflammatory response, oxidative stress, TNF-alpha and NF- kB signaling pathway. The study thus identified several genes from different functional classes and biological pathways that could be termed as heat responsive in buffalo MEC. The responsiveness of buffalo MECs to heat stress in the present study clearly suggested its suitability as a model to understand the modulation of buffalo mammary gland expression signature in response to environmental heat load.

Also flagged:neurodegenerative diseasesaxonalendoplasmic reticulumnuclear factor of activated T cellsNFATdeath
Journal Article 2016-09-28 No Snippets Shah SZ, Shah SZ, Hussain T, Zhao D, Yang L.
Show Full Abstract

Accumulation of misfolded/unfolded aggregated proteins in the brain is a hallmark of many neurodegenerative diseases affecting humans and animals. Dysregulation of calcium (Ca<sup>2+</sup>) and disruption of fast axonal transport (FAT) are early pathological events that lead to loss of synaptic integrity and axonal degeneration in early stages of neurodegenerative diseases. Dysregulated Ca<sup>2+</sup> in the brain is triggered by accumulation of misfolded/unfolded aggregated proteins in the endoplasmic reticulum (ER), a major Ca<sup>2+</sup> storing organelle, ultimately leading to neuronal dysfunction and apoptosis. Calcineurin (CaN), a Ca<sup>2+</sup>/calmodulin-dependent serine/threonine phosphatase, has been implicated in T cells activation through the induction of nuclear factor of activated T cells (NFAT). In addition to the involvement of several other signaling cascades, CaN has been shown to play a role in early synaptic dysfunction and neuronal death. Therefore, inhibiting hyperactivated CaN in early stages of disease might be a promising therapeutic strategy for treating patients with protein misfolding diseases. In this review, we briefly summarize the structure of CaN, inhibition mechanisms by which immunosuppressants inhibit CaN, role of CaN in maintaining neuronal and synaptic integrity and homeostasis and the role played by CaN in protein unfolding/misfolding neurodegenerative diseases.

Also flagged:Neurotrophic Factor Receptor p75BDNFalcoholtropomyosin receptor kinase BTrkBp75 neurotrophin receptor
Journal Article 2016-09-28 No Snippets Darcq E, Morisot N, Phamluong K, Warnault V, Jeanblanc J, Longo FM, Massa SM, Ron D.
Show Full Abstract

<h4>Unlabelled</h4>Brain-derived neurotrophic factor (BDNF) signaling in the dorsolateral striatum (DLS) keeps alcohol intake in moderation. For example, activation of the BDNF receptor tropomyosin receptor kinase B (TrkB) in the DLS reduces intake in rats that consume moderate amounts of alcohol. Here, we tested whether long-term excessive consumption of alcohol produces neuroadaptations in BDNF signaling in the rat DLS. We found that BDNF was no longer able to gate alcohol self-administration after a history of repeated cycles of binge alcohol drinking and withdrawal. We then elucidated the possible neuroadaptations that could block the ability of BDNF to keep consumption of alcohol in moderation. We report that intermittent access to 20% alcohol in a two-bottle choice paradigm that models excessive alcohol drinking produces a mobilization of DLS p75 neurotrophin receptor (p75NTR), whose activities oppose those of the Trk receptors, including TrkB. These neuroadaptations were not observed in the DLS of rats exposed to continuous access to 10% alcohol or in rats consuming sucrose. Furthermore, short hairpin RNA (shRNA)-mediated knockdown of the p75NTR gene in the DLS, as well as intra-DLS infusion or systemic administration of the p75NTR modulator, LM11A-31, significantly reduced binge drinking of alcohol. Together, our results suggest that excessive alcohol consumption produces a change in BDNF signaling in the DLS, which is mediated by the recruitment of p75NTR. Our data also imply that modulators of p75NTR signaling could be developed as medications for alcohol abuse disorders.<h4>Significance statement</h4>Neuroadaptations gate or drive excessive, compulsive alcohol drinking. We previously showed that brain-derived neurotrophic factor and its receptor, TrkB, in the dorsolateral striatum (DLS), are part of an endogenous system that keeps alcohol drinking in moderation. Here, we show that a history of excessive alcohol intake produces neuroadaptations in the DLS that preclude BDNF's ability to gate alcohol self-administration in rats by the recruitment of the low-affinity neurotrophin receptor, p75NTR, whose activities opposes those of the Trk receptors. Finally, we show that the administration of the p75NTR modulator, LM11A-31, significantly reduces excessive alcohol intake suggesting that the drug may be developed as a new treatment for alcohol abuse disorders.

Also flagged:cysteinesulfenic acidamideglutathionesulfenyl amidessulfenic acids
Journal Article 2016-09-28 No Snippets Forman HJ, Davies MJ, Krämer AC, Miotto G, Zaccarin M, Zhang H, Ursini F.
Show Full Abstract

Oxidation of critical signaling protein cysteines regulated by H<sub>2</sub>O<sub>2</sub> has been considered to involve sulfenic acid (RSOH) formation. RSOH may subsequently form either a sulfenyl amide (RSNHR') with a neighboring amide, or a mixed disulfide (RSSR') with another protein cysteine or glutathione. Previous studies have claimed that RSOH can be detected as an adduct (e.g., with 5,5-dimethylcyclohexane-1,3-dione; dimedone). Here, kinetic data are discussed which indicate that few proteins can form RSOH under physiological signaling conditions. We also present experimental evidence that indicates that (1) dimedone reacts rapidly with sulfenyl amides, and more rapidly than with sulfenic acids, and (2) that disulfides can react reversibly with amides to form sulfenyl amides. As some proteins are more stable as the sulfenyl amide than as a glutathionylated species, the former may account for some of the species previously identified as the "sulfenome" - the cellular complement of reversibly-oxidized thiol proteins generated via sulfenic acids.

Also flagged:oxygenmetabolismcancertranscription factorNRF2nucleotide
Journal Article 2016-09-28 No Snippets Lacher SE, Slattery M.
Show Full Abstract

Reactive oxygen species (ROS), which are both a natural byproduct of oxidative metabolism and an undesirable byproduct of many environmental stressors, can damage all classes of cellular macromolecules and promote diseases from cancer to neurodegeneration. The actions of ROS are mitigated by the transcription factor NRF2, which regulates expression of antioxidant genes via its interaction with <i>cis</i>-regulatory antioxidant response elements (AREs). However, despite the seemingly straightforward relationship between the opposing forces of ROS and NRF2, regulatory precision in the NRF2 network is essential. Genetic variants that alter NRF2 stability or alter ARE sequences have been linked to a range of diseases. NRF2 hyperactivating mutations are associated with tumorigenesis. On the subtler end of the spectrum, single nucleotide variants (SNVs) that alter individual ARE sequences have been linked to neurodegenerative disorders including progressive supranuclear palsy and Parkinson's disease, as well as other diseases. Although the human health implications of NRF2 dysregulation have been recognized for some time, a systems level view of this regulatory network is beginning to highlight key NRF2-targeted AREs consistently associated with disease.

Also flagged:HGFc-METhepatocyte growth factorc-MET receptormalignant tumorsepithelial ovarian cancer
Journal Article 2016-09-27 No Snippets Kwon Y, Godwin AK.
Show Full Abstract

Binding of hepatocyte growth factor (HGF) to the c-MET receptor has mitogenic, motogenic, and morphogenic effects on cells. The versatile biological effects of HGF and c-MET interactions make them important contributors to the development of malignant tumors. We and others have demonstrated a therapeutic value in targeting the interaction of c-MET and HGF in epithelial ovarian cancer (EOC). However, both HGF and c-MET are expressed in the normal ovary as well. Therefore, it is important to understand the differences in mechanisms that control HGF signaling activation and its functional role in the normal ovary and EOC. In the normal ovary, HGF signaling may be under hormonal regulation. During ovulation, HGF-converting proteases are secreted and the subsequent activation of HGF signaling enhances the proliferation of ovarian surface epithelium in order to replenish the area damaged due to expulsion of the ovum. In contrast, EOC cells that exhibit epithelial characteristics constitutively express both c-MET and HGF-converting proteases such as urokinase-type plasminogen activator. In EOC, mechanisms to control the activation of HGF signaling are absent since HGF is provided locally from the tissue microenvironment as well as remotely throughout the body. Potential incessant HGF signaling in EOC may lead to an increase in proliferation, invasion through the stroma, and migration to other tissues of cancer cells. Therefore, targeting the interaction of c-MET and HGF would be beneficial in treating EOC.

Also flagged:bindingmembrane receptorsadenosine receptor A 2AA 2A RG protein-coupled receptorGPCR
Journal Article 2016-09-27 No Snippets McNeely PM, Naranjo AN, Forsten-Williams K, Robinson AS.
Show Full Abstract

Ligand binding plays a fundamental role in stimulating the downstream signaling of membrane receptors. Here, ligand-binding kinetics of the full-length human adenosine A<sub>2A</sub> receptor (A<sub>2A</sub>R) reconstituted in detergent micelles were measured using a fluorescently labeled ligand via fluorescence anisotropy. Importantly, to optimize the signal-to-noise ratio, these experiments were conducted in the ligand depletion regime. In the ligand depletion regime, the assumptions used to determine analytical solutions for one-site binding models for either one or two ligands in competition are no longer valid. We therefore implemented a numerical solution approach to analyze kinetic binding data as experimental conditions approach the ligand depletion regime. By comparing the results from the numerical and the analytical solutions, we highlight the ligand-receptor ratios at which the analytical solution begins to lose predictive accuracy. Using the numerical solution approach, we determined the kinetic rate constants of the fluorescent ligand, FITC-APEC, and those for three unlabeled ligands using competitive association experiments. The association and dissociation rate constants of the unlabeled ligands determined from the competitive association experiments were then independently validated using competitive dissociation data. Based on this study, a numerical solution is recommended to determine kinetic ligand-binding parameters for experiments conducted in the ligand-depletion regime.

Also flagged:silicapaclitaxelcancertumorcarbon dotswater
Journal Article 2016-09-27 No Snippets Wang H, Wang K, Tian B, Revia R, Mu Q, Jeon M, Chang FC, Zhang M.
Show Full Abstract

Applications of hydrophobic drug-based nanocarriers (NCs) remain largely limited because of their low loading capacity. Here, development of a multifunctional hybrid NC made of a magnetic Fe3O4 core and a mesoporous silica shell embedded with carbon dots (CDs) and paclitaxel (PTX), and covered by another layer of silica is reported. The NC is prepared via a one-pot process under mild condition. The PTX loading method introduced in this study simplifies drug loading process and demonstrates a high loading capacity due to mesoporous silica dual-shell structure, supramolecular π-stacking between conjugated rings of PTX molecules, and aromatic rings of the CDs in the hybrid NC. The CDs serve as both confocal and two-photon fluorescence imaging probes, while the Fe3O4 core serves as a magnetic resonance imaging contrast agent. Significantly, NC releases PTX in response to near infrared irradiation as a result of local heating of the embedded CDs and the heating of CDs also provides an additional therapeutic effect by thermally killing cancer cells in tumor in addition to the chemotherapeutic effect of released PTX. Both in vitro and in vivo results show that NC demonstrates high therapeutic efficacy through a synergistic effect from the combined chemo-photothermal treatments.

Also flagged:enterobactinSynthesiscatecholalkylzincbinding
Journal Article 2016-09-27 No Snippets Zhang Q, Jin B, Shi Z, Wang X, Liu Q, Lei S, Peng R.
Show Full Abstract

A series of novel hexadentate enterobactin analogues, which contain three catechol chelating moieties attached to different molecular scaffolds with flexible alkyl chain lengths, were prepared. The solution thermodynamic stabilities of the complexes with uranyl, ferric(III), and zinc(II) ions were then investigated. The hexadentate ligands demonstrate effective binding ability to uranyl ion, and the average uranyl affinities are two orders of magnitude higher than 2,3-dihydroxy-N<sup>1</sup>,N<sup>4</sup>-bis[(1,2-hydroxypyridinone-6-carboxamide)ethyl]terephthalamide [TMA(2Li-1,2-HOPO)<sub>2</sub>] ligand with similar denticity. The high affinity of hexadentate ligands could be due to the presence of the flexible scaffold, which favors the geometric agreement between the ligand and the uranyl coordination preference. The hexadentate ligands also exhibit higher antiradical efficiency than butylated hydroxyanisole (BHA). These results provide a basis for further studies on the potential applications of hexadentate ligands as therapeutic chelating agents.

Also flagged:FAT atypical cadherin 3heroin addictionFAT3kinectin 1KTN1DLG2
Journal Article 2016-09-27 ✓ 5 Snippets Li Y, Qiao X, Yin F, Guo H, Huang X, Lai J, Wei S.
In-Text Gene Mentions

DCC is involved in axon guidance pathways, and its genetic variants influence the structure of the human mesolimbic reward system [6], which plays a key role in drug addiction.

Sensitizing amphetamine pretreatment regimens result in selective upregulation of the expression of DCC in the ventral tegmental area of adult rodents [18], and DCC haploinsufficiency decreases sensitivity to the cocaine mediated enhancement of reward seeking behavior [19].

Because determining associations between functional polymorphisms and heroin addiction would be meaningful, we used HapMap (Han Chinese population) HCB data to systematically scan the promoter, 5’UTR, 3’UTR, exon, and intron-exon border regions of FAT3, KTN1, DLG2 and DCC, and 20 SNPs were selected to do association analysis with heroin addiction.

DCC may be an important candidate gene in heroin addiction, and rs16956878, rs12607853, and rs2292043 may be risk factors, thereby providing a basis for further genetic and biological research.

Recently, FAT atypical cadherin 3 (FAT3), kinectin 1 (KTN1), discs large homolog 2 (DLG2) and deleted in colorectal cancer (DCC) have been reported to be associated with the function of the human mesolimbic reward system [6], which is the neurobiological basis of drug addiction.

Show Full Abstract

Recent studies have shown that variants in FAT atypical cadherin 3 (FAT3), kinectin 1 (KTN1), discs large homolog2 (DLG2) and deleted in colorectal cancer (DCC) genes influence the structure of the human mesolimbic reward system. We conducted a systematic analysis of the potential functional single nucleotide polymorphisms (SNPs) in these genes associated with heroin addiction. We scanned the functional regions of these genes and identified 20 SNPs for genotyping by using the SNaPshot method. A total of 1080 samples, comprising 523 cases and 557 controls, were analyzed. We observed that DCC rs16956878, rs12607853, and rs2292043 were associated with heroin addiction. The T alleles of rs16956878 (p = 0.0004) and rs12607853 (p = 0.002) were significantly enriched in the case group compared with the controls. A lower incidence of the C allele of rs2292043 (p = 0.002) was observed in the case group. In block 2 of DCC (rs2292043-rs12607853-rs16956878), the frequency of the T-T-T haplotype was significantly higher in the case group than in the control group (p = 0.024), and fewer C-C-C haplotypes (p = 0.006) were detected in the case group. DCC may be an important candidate gene in heroin addiction, and rs16956878, rs12607853, and rs2292043 may be risk factors, thereby providing a basis for further genetic and biological research.

Also flagged:EthanolCholesterolSteatohepatitisALTsteatosisHMGB-1
Journal Article 2016-09-27 ✓ 1 Snippet Krishnasamy Y, Ramshesh VK, Gooz M, Schnellmann RG, Lemasters JJ, Zhong Z.
In-Text Gene Mentions

…hepatitis, HIV infection,hemochromatosis, genetic factors, obesity,…

Show Full Abstract

<h4>Background and aim</h4>Because ethanol consumption is commonly associated with a high cholesterol diet, we examined whether combined consumption of ethanol and high cholesterol increases liver injury and fibrosis.<h4>Methods</h4>Male C57BL/6J mice were fed diets containing: 1) 35% of calories from corn oil (CTR), 2) CTR plus 0.5% (w/v) cholesterol (Chol), 3) CTR plus ethanol (27% of calories) (EtOH), or 4) EtOH+Chol for 3 months.<h4>Results</h4>In mice fed Chol or EtOH alone, ALT increased to ~160 U/L, moderate hepatic steatosis occurred, and leukocyte infiltration, necrosis, and apoptosis increased modestly, but no observable fibrosis developed. By contrast in mice fed EtOH+Chol, ALT increased to ~270 U/L, steatosis was more extensive and mostly macrovesicular, and expression of proinflammatory molecules (HMGB-1, TLR4, TNFα, ICAM-1) and leukocyte infiltration increased substantially. Necrosis and apoptosis also increased. Trichrome staining and second harmonic generation microscopy revealed hepatic fibrosis. Fibrosis was mostly sinusoidal and/or perivenular, but in some mice bridging fibrosis occurred. Expression of smooth muscle α-actin and TGF-β1 increased slightly by Chol, moderately by EtOH, and markedly by EtOH+Chol. TGF-β pseudoreceptor BAMBI increased slightly by Chol, remained unchanged by EtOH and decreased by EtOH+Chol. MicroRNA-33a, which enhances TGF-β fibrotic effects, and phospho-Smad2/3, the down-stream signal of TGF-β, also increased more greatly by EtOH+Chol than Chol or EtOH. Metalloproteinase-2 and -9 were decreased only by EtOH+Chol.<h4>Conclusion</h4>High dietary cholesterol and chronic ethanol consumption synergistically increase liver injury, inflammation, and profibrotic responses and suppress antifibrotic responses, leading to severe steatohepatitis and early fibrosis in mice.

Also flagged:neurodegenerative diseasescytoplasmnucleusPolyglutamineHuntingtinHD
Journal Article 2016-09-27 ✓ 5 Snippets Zurawel AA, Kabeche R, DiGregorio SE, Deng L, Menon KM, Opalko H, Duennwald ML, Moseley JB, Supattapone S.
In-Text Gene Mentions

(D) Live GFP microscopy of S. cerevisiae after Htt induction and 1-h incubation in H2O2, l-azetidine-2-carboxylic acid, guanidine hydrochloride, or radicicol or after 42°C heat shock for 1 h.

For example, Huntington’s disease (HD) occurs when the polyQ region of the huntingtin protein (Htt) contains more than 36 glutamine residues (4, 5).

In humans, proteins such as huntingtin (Htt) with abnormally expanded polyQ regions cause neurodegenerative diseases such as Huntington’s disease (HD).

(A) Htt exon 1 with various lengths of CAG repeats (25, 46, 72, and 97 bp) was integrated into S. cerevisiae, and cells were serially diluted 5-fold and spotted onto repressing (glucose [−GAL]) or inducing (galactose [+GAL]) solid media, as well as onto solid rich media.

Heterologous Htt exon 1 expression in S. cerevisiae is an established model for HD, characterized by Htt aggregation and cellular toxicity that is dependent on the length of the Htt polyQ region (27).

Show Full Abstract

Proteins containing polyglutamine (polyQ) regions are found in almost all eukaryotes, albeit with various frequencies. In humans, proteins such as huntingtin (Htt) with abnormally expanded polyQ regions cause neurodegenerative diseases such as Huntington's disease (HD). To study how the presence of endogenous polyQ aggregation modulates polyQ aggregation and toxicity, we expressed polyQ expanded Htt fragments (polyQ Htt) in Schizosaccharomyces pombe In stark contrast to other unicellular fungi, such as Saccharomyces cerevisiae, S. pombe is uniquely devoid of proteins with more than 10 Q repeats. We found that polyQ Htt forms aggregates within S. pombe cells only with exceedingly long polyQ expansions. Surprisingly, despite the presence of polyQ Htt aggregates in both the cytoplasm and nucleus, no significant growth defect was observed in S. pombe cells. Further, PCR analysis showed that the repetitive polyQ-encoding DNA region remained constant following transformation and after multiple divisions in S. pombe, in contrast to the genetic instability of polyQ DNA sequences in other organisms. These results demonstrate that cells with a low content of polyQ or other aggregation-prone proteins can show a striking resilience with respect to polyQ toxicity and that genetic instability of repetitive DNA sequences may have played an important role in the evolutionary emergence and exclusion of polyQ expansion proteins in different organisms.<h4>Importance</h4>Polyglutamine (polyQ) proteins encoded by repetitive CAG DNA sequences serve a variety of normal biological functions. Yet some proteins with abnormally expanded polyQ regions cause neurodegeneration through unknown mechanisms. To study how distinct cellular environments modulate polyQ aggregation and toxicity, we expressed CAG-expanded huntingtin fragments in Schizosaccharomyces pombe In stark contrast to many other eukaryotes, S. pombe is uniquely devoid of proteins containing long polyQ tracts. Our results show that S. pombe cells, despite their low content of endogenous polyQ proteins, exhibit striking and unexpected resilience with respect to polyQ toxicity and that genetic instability of repetitive DNA sequences may have played an important role in the emergence and expansion of polyQ domains in eukaryotic evolution.

Also flagged:Gastrointestinal cancercancercolorectal cancertranslationaloligonucleotideGastrointestinal Cancers
Journal Article 2016-09-27 No Snippets Merhautova J, Demlova R, Slaby O.
Show Full Abstract

Gastrointestinal cancer accounts for the 20 most frequent cancer diseases worldwide and there is a constant urge to bring new therapeutics with new mechanism of action into the clinical practice. Quantity of <i>in vitro</i> and <i>in vivo</i> evidences indicate, that exogenous change in pathologically imbalanced microRNAs (miRNAs) is capable of transforming the cancer cell phenotype. This review analyzed preclinical miRNA-based therapy attempts in animal models of gastric, pancreatic, gallbladder, and colorectal cancer. From more than 400 original articles, 26 was found to assess the effect of miRNA mimics, precursors, expression vectors, or inhibitors administered locally or systemically being an approach with relatively high translational potential. We have focused on mapping available information on animal model used (animal strain, cell line, xenograft method), pharmacological aspects (oligonucleotide chemistry, delivery system, posology, route of administration) and toxicology assessments. We also summarize findings in the field pharmacokinetics and toxicity of miRNA-based therapy.

Also flagged:Gastric CancerHIF-1αHypoxia-inducible factorHIFcancerGastric Adenocarcinoma
Journal Article 2016-09-27 No Snippets Liu L, Zhao X, Zou H, Bai R, Yang K, Tian Z.
Show Full Abstract

Hypoxia-inducible factor (HIF) activates the transcription of genes involved in cancer progression. Recently, HIF was reported to regulate the transcription of non-coding RNAs. Here, we show that the transcription of a long non-coding RNA (lncRNA), Gastric Adenocarcinoma Associated, Positive CD44 Regulator, Long Intergenic Non-Coding RNA (GAPLINC), is directly activated by HIF-1α in gastric cancer (GC). GAPLINC was overexpressed in GC tissues and promoted tumor migration and invasive behavior. GAPLINC overexpression was associated with poor prognosis in GC patients. Luciferase reporter assays and chromatin immunoprecipitation assays confirmed that HIF-1α binds to the promoter region of GAPLINC and activates its transcription. GAPLINC knockdown inhibited hypoxia-induced tumor proliferation <i>in vivo</i>. Taken together, our results identified a novel role for HIF transcriptional pathways in GC tumorigenesis mediated by the regulation of the lncRNA GAPLINC, and suggest GAPLINC as a novel therapeutic target for reversing chemoradioresistance and prolonging survival.

Also flagged:heat strokewatersecretionsilicosissilicaimmune response
Journal Article 2016-09-27 No Snippets Schneider SM.
Show Full Abstract

The underground gold mines of South Africa offer a unique historical setting to study heat acclimation. The early heat stress research was conducted and described by a young medical officer, Dr. Aldo Dreosti. He developed practical and specific protocols to first assess the heat tolerance of thousands of new mining recruits, and then used the screening results as the basis for assigning a heat acclimation protocol. The mines provide an interesting paradigm where the prevention of heat stroke evolved from genetic selection, where only Black natives were recruited due to a false assumption of their intrinsic tolerance to heat, to our current appreciation of the epigenetic and other molecular adaptations that occur with exposure to heat.

Also flagged:Metabolite-Binding ProteinsRKIPERKbindingATP-binding proteinsraf kinase inhibitory protein
Journal Article 2016-09-26 No Snippets Huang WC, Lee DY, Chang GD.
Show Full Abstract

To elucidate the molecular mechanisms underlying the action of bioactive compounds such as metabolites, identification of their binding targets is essential. However, available techniques for enriching metabolite-binding proteins are practically restrained by special equipment requirements and laborious efforts. Here we have developed a novel method, affinity elution in tandem hydrophobic interaction chromatography (AETHIC), which enables enrichment of metabolite-binding proteins from a crude tissue extract. AETHIC constitutes two major steps, protein fractionation and affinity elution. The basic strategy of AETHIC uses a series of HIC matrices encompassing aliphatic chains of different length and thus provides a wide range of hydrophobicity for interactions with most proteins. Thereafter, target proteins are eluted selectively by a given ligand. As our first proof-of-principle, we demonstrated that AETHIC was able to enrich ATP-binding proteins from porcine brain extract. In addition, we have demonstrated that raf kinase inhibitory protein (RKIP) is an ATP-binding protein and ATP attenuates the interaction between RKIP and Raf-1. In parallel, short-term ATP depletion in cultured HEK293 cells augments interaction between RKIP and Raf-1, resulting in decreased activation of the downstream ERK signaling. Therefore, the ATP-binding function renders RKIP's inhibition on Raf-1 modulated by cellular ATP concentrations. These data shed light on how energy levels affect the propagation of cellular signaling. Taken together, the enclosed results advocate the potential of AETHIC in the study of metabolite-protein interactions.

Also flagged:Osteoblast DifferentiationOssificationmineralizationosteogenesis imperfectacalcific heart valve diseaseosteoporosis
Journal Article 2016-09-26 No Snippets Rutkovskiy A, Stensløkken KO, Vaage IJ.
Show Full Abstract

Ossification is a tightly regulated process, performed by specialized cells called osteoblasts. Dysregulation of this process may cause inadequate or excessive mineralization of bones or ectopic calcification, all of which have grave consequences for human health. Understanding osteoblast biology may help to treat diseases such as osteogenesis imperfecta, calcific heart valve disease, osteoporosis, and many others. Osteoblasts are bone-building cells of mesenchymal origin; they differentiate from mesenchymal progenitors, either directly or via an osteochondroprogenitor. The direct pathway is typical for intramembranous ossification of the skull and clavicles, while the latter is a hallmark of endochondral ossification of the axial skeleton and limbs. The pathways merge at the level of preosteoblasts, which progress through 3 stages: proliferation, matrix maturation, and mineralization. Osteoblasts can also differentiate into osteocytes, which are stellate cells populating narrow interconnecting passages within the bone matrix. The key molecular switch in the commitment of mesenchymal progenitors to osteoblast lineage is the transcription factor cbfa/runx2, which has multiple upstream regulators and a wide variety of targets. Upstream is the Wnt/Notch system, Sox9, Msx2, and hedgehog signaling. Cofactors of Runx2 include Osx, Atf4, and others. A few paracrine and endocrine factors serve as coactivators, in particular, bone morphogenetic proteins and parathyroid hormone. The process is further fine-tuned by vitamin D and histone deacetylases. Osteoblast differentiation is subject to regulation by physical stimuli to ensure the formation of bone adequate for structural and dynamic support of the body. Here, we provide a brief description of the various stimuli that influence osteogenesis: shear stress, compression, stretch, micro- and macrogravity, and ultrasound. A complex understanding of factors necessary for osteoblast differentiation paves a way to introduction of artificial bone matrices.

Also flagged:SynthesisCH2OximeSulfonatesesterspodophyllotoxin
Journal Article 2016-09-26 No Snippets Yu M, Liu G, Zhang Y, Feng T, Xu M, Xu H.
Show Full Abstract

A series of 2'(2',6')-(di)halogeno-isoxazolopodophyllic acids-based esters, and oxime sulfonates of 2'(2',6')-(di)halogenopodophyllones were prepared by structural modifications of podophyllotoxin as insecticidal agents against Mythimna separata Walker. It was found that when 2'(2',6')-(di)halogenopodophyllones or 2'(2',6')-(di)chloropicropodophyllones reacted with hydroxylamine hydrochloride, the desired products were related with the configuration of their lactones. Three key single-crystal structures of Ie, IIe and IIIb were determined by X-ray diffraction. Especially compounds IIc and Vc showed the highest insecticidal activity. Moreover, some interesting results of structure-insecticidal activity relationships of tested compounds were also observed.

Also flagged:methylationembryogenesisCD4CD8Glucosediabetes
Journal Article 2016-09-26 ✓ 1 Snippet Cardenas A, Allard C, Doyon M, Houseman EA, Bakulski KM, Perron P, Bouchard L, Hivert MF.
In-Text Gene Mentions

…of association betweenDCCand the adult…

Show Full Abstract

Cord blood is widely used as surrogate tissue in epigenome-wide association studies of prenatal conditions. Cell type composition variation across samples can be an important confounder of epigenome-wide association studies in blood that constitute a mixture of cells. We evaluated a newly developed cord blood reference panel to impute cell type composition from DNA methylation levels, including nucleated red blood cells (nRBCs). We estimated cell type composition from 154 unique cord blood samples with available DNA methylation data as well as direct measurements of nucleated cell types. We observed high correlations between the estimated and measured composition for nRBCs (r = 0.92, R<sup>2</sup> = 0.85), lymphocytes (r = 0.77, R<sup>2</sup> = 0.58), and granulocytes (r = 0.72, R<sup>2</sup> = 0.52), and a moderate correlation for monocytes (r = 0.51, R<sup>2</sup> = 0.25) as well as relatively low root mean square errors from the residuals ranging from 1.4 to 5.4%. These results validate the use of the cord blood reference panel and highlight its utility and limitations for epidemiological studies.

Also flagged:lipoproteincholesterolhematologic diseasesnucleotideautosomeschromosome
Journal Article 2016-09-26 ✓ 1 Snippet Iotchkova V, Huang J, Morris JA, Jain D, Barbieri C, Walter K, Min JL, Chen L, Astle W, Cocca M, Deelen P, Elding H, Farmaki AE, Franklin CS, Franberg M, Gaunt TR, Hofman A, Jiang T, Kleber ME, Lachance G, Luan J, Malerba G, Matchan A, Mead D, Memari Y, Ntalla I, Panoutsopoulou K, Pazoki R, Perry JRB, Rivadeneira F, Sabater-Lleal M, Sennblad B, Shin SY, Southam L, Traglia M, van Dijk F, van Leeuwen EM, Zaza G, Zhang W, UK10K Consortium, Amin N, Butterworth A, Chambers JC, Dedoussis G, Dehghan A, Franco OH, Franke L, Frontini M, Gambaro G, Gasparini P, Hamsten A, Issacs A, Kooner JS, Kooperberg C, Langenberg C, Marz W, Scott RA, Swertz MA, Toniolo D, Uitterlinden AG, van Duijn CM, Watkins H, Zeggini E, Maurano MT, Timpson NJ, Reiner AP, Auer PL, Soranzo N.
In-Text Gene Mentions

HFE

Show Full Abstract

Large-scale whole-genome sequence data sets offer novel opportunities to identify genetic variation underlying human traits. Here we apply genotype imputation based on whole-genome sequence data from the UK10K and 1000 Genomes Project into 35,981 study participants of European ancestry, followed by association analysis with 20 quantitative cardiometabolic and hematological traits. We describe 17 new associations, including 6 rare (minor allele frequency (MAF) < 1%) or low-frequency (1% < MAF < 5%) variants with platelet count (PLT), red blood cell indices (MCH and MCV) and HDL cholesterol. Applying fine-mapping analysis to 233 known and new loci associated with the 20 traits, we resolve the associations of 59 loci to credible sets of 20 or fewer variants and describe trait enrichments within regions of predicted regulatory function. These findings improve understanding of the allelic architecture of risk factors for cardiometabolic and hematological diseases and provide additional functional insights with the identification of potentially novel biological targets.

Also flagged:tuberculosisrifampicinDILIFAM65BchromosomeATP/GTP binding protein-like 4
Journal Article 2016-09-26 ✓ 1 Snippet Petros Z, Lee MM, Takahashi A, Zhang Y, Yimer G, Habtewold A, Amogne W, Aderaye G, Schuppe-Koistinen I, Mushiroda T, Makonnen E, Kubo M, Aklillu E.
In-Text Gene Mentions

…member 6 (SHISA6) in chromosome…

Show Full Abstract

<h4>Background</h4>Drug-induced liver injury (DILI) is a well-recognized adverse event of anti tuberculosis drugs (ATD) possibly associated with genetic variations. The objective of this study was to perform genome-wide association study (GWAS) to identify genetic variants associated with the risk for ATD induced liver toxicity in Ethiopian patients.<h4>Result</h4>Treatment-naïve newly diagnosed tuberculosis patients (n = 646) were enrolled prospectively and treated with rifampicin based short course anti-tuberculosis therapy. Whole genome genotyping was done using Illumina Omni Express Exome Bead Chip genotyping array with 951,117 single nucleotide polymorphisms (SNPs) on 48 DILI cases and 354 ATD tolerants. Replication study was carried out for 50 SNPs with the lowest P-values (top SNPs) using an independent cohort consisting of 27 DILI cases and 217 ATD tolerants. In the combined analysis, the top SNP identified was rs10946737 (P = 4.4 × 10<sup>-6</sup>, OR = 3.4, 95 % confidence interval = 2.2-5.3) in the intron of FAM65B in chromosome 6. In addition, we identified a cluster of SNPs with suggestive genome-wide significance in the intron of ATP/GTP binding protein-like 4 (AGBL4).<h4>Conclusion</h4>We identified genetic variants that are potentially associated with ATD induced liver toxicity. Further studies with larger sample sizes are essential to confirm the findings.

Also flagged:Astrocyte Differentiationbrain developmentcentral nervous system diseasesNeurological Disorderamyotrophic lateral sclerosisAlexander disease
Journal Article 2016-09-26 No Snippets Chandrasekaran A, Avci HX, Leist M, Kobolák J, Dinnyés A.
Show Full Abstract

Astrocytes have a central role in brain development and function, and so have gained increasing attention over the past two decades. Consequently, our knowledge about their origin, differentiation and function has increased significantly, with new research showing that astrocytes cultured alone or co-cultured with neurons have the potential to improve our understanding of various central nervous system diseases, such as amyotrophic lateral sclerosis, Alzheimer's disease, or Alexander disease. The generation of astrocytes derived from pluripotent stem cells (PSCs) opens up a new area for studying neurologic diseases <i>in vitro</i>; these models could be exploited to identify and validate potential drugs by detecting adverse effects in the early stages of drug development. However, as it is now known that a range of astrocyte populations exist in the brain, it will be important <i>in vitro</i> to develop standardized protocols for the <i>in vitro</i> generation of astrocyte subsets with defined maturity status and phenotypic properties. This will then open new possibilities for co-cultures with neurons and the generation of neural organoids for research purposes. The aim of this review article is to compare and summarize the currently available protocols and their strategies to generate human astrocytes from PSCs. Furthermore, we discuss the potential role of human-induced PSCs derived astrocytes in disease modeling.

Also flagged:cancernasopharyngeal carcinomaGene ExpressionTranscription factorPTGS2small cell lung cancer
Journal Article 2016-09-26 No Snippets Jiang X, Feng L, Dai B, Li L, Lu W.
Show Full Abstract

<h4>Introduction</h4>Nasopharyngeal carcinoma is the most common cancer originating from the nasopharynx.<h4>Objective</h4>To study the mechanisms of nasopharyngeal carcinoma, we analyzed GSE12452 microarray data.<h4>Methods</h4>GSE12452 was downloaded from the Gene Expression Omnibus database and included 31 nasopharyngeal carcinoma samples and 10 normal nasopharyngeal tissue samples. The differentially expressed genes were screened by ANOVA in the PGS package. Using the BiNGO plugin in Cytoscape and pathway enrichment analysis in the PGS package, functional and pathway enrichment analyses were performed separately to predict potential functions of the differentially expressed genes. Furthermore, Transcription factor-differentially expressed gene pairs were searched, and then the transcription factor-differentially expressed gene regulatory network was visualized using Cytoscape software.<h4>Results</h4>A total of 487 genes were screened as differentially expressed genes between the nasopharyngeal carcinoma samples and the normal nasopharyngeal tissue samples. Enrichment analysis indicated that PTGS2 was involved in the regulation of biological process and small cell lung cancer. ZIC2 and OVOL1 may function in nasopharyngeal carcinoma through targeting significantly up-regulated genes (such as PTGS2, FN1, CXCL9 and CXCL10) in the Transcription factor-differentially expressed gene regulatory network (e.g., ZIC2→PTGS2 and OVOL1→CXCL10).<h4>Conclusion</h4>PTGS2, FN1, CXCL9, CXCL10, ZIC2 and OVOL1 might play roles in nasopharyngeal carcinoma.

Also flagged:chronic kidney diseasepathogenesisgene expressiontransforming growth factor beta-1deathend stage renal disease
Journal Article 2016-09-26 No Snippets Rabieian R, Abedi M, Gheisari Y.
Show Full Abstract

<h4>Objective</h4>Despite the huge efforts, chronic kidney disease (CKD) remains as an unsolved problem in medicine. Many studies have shown a central role for transforming growth factor beta-1 (TGFβ-1) and its downstream signaling cascades in the pathogenesis of CKD. In this study, we have reanalyzed a microarray dataset to recognize critical signaling pathways controlled by TGFβ-1.<h4>Materials and methods</h4>This study is a bioinformatics reanalysis for a microarray data. The GSE23338 dataset was downloaded from the gene expression omnibus (GEO) database which assesses the mRNA expression profile of TGFβ-1 treated human kidney cells after 24 and 48 hours incubation. The protein interaction networks for differentially expressed (DE) genes in both time points were constructed and enriched. In addition, by network topology analysis, genes with high centrality were identified and then pathway enrichment analysis was performed with either the total network genes or with the central nodes.<h4>Results</h4>We found 110 and 170 genes differentially expressed in the time points 24 and 48 hours, respectively. As the genes in each time point had few interactions, the networks were enriched by adding previously known genes interacting with the differentially expressed ones. In terms of degree, betweenness, and closeness centrality parameters 62 and 60 nodes were considered to be central in the enriched networks of 24 hours and 48 hours treatment, respectively. Pathway enrichment analysis with the central nodes was more informative than those with all network nodes or even initial DE genes, revealing key signaling pathways.<h4>Conclusion</h4>We here introduced a method for the analysis of microarray data that integrates the expression pattern of genes with their topological properties in protein interaction networks. This holistic novel approach allows extracting knowledge from raw bulk <i>omics</i> data.

Also flagged:beta-beta-lactamaseextended-spectrum beta-lactamasesCTX-MabscessCTX-M-1
Journal Article 2016-09-26 No Snippets Moosavian M, Ahmadkhosravy N.
Show Full Abstract

<h4>Background</h4>A common mechanism of resistance to beta-lactam antibiotics is the production of beta-lactamase by Gram-negative bacteria. Recently, nonderivative extended-spectrum beta-lactamases (ESBLs) from the TEM and SHV enzymes, such as CTX-M, that were related to different geographical regions have been recognized.<h4>Objectives</h4>The aim of this study was to determine the frequency of the <i>CTX-M</i> gene in ESBL-producing <i>Enterobacteriaceae</i> isolates in hospitalized patients in the teaching hospitals of Ahvaz, Iran.<h4>Methods</h4><i>Enterobacteriaceae</i> isolates from clinical specimens (other than stool), such as wounds, blood, urine, trachea, discharge, and abscess, were collected and examined. All the isolates were identified using standard biochemical tests. The combination test was carried out based on CLSI criteria for the phenotypic detection of ESBL-producing isolates. After DNA extraction, the <i>CTX-M</i> and <i>CTX-M-1</i> genes were amplified using PCR among phenotypically positive ESBL isolates.<h4>Results</h4>Among 240 <i>Enterobacteriaceae</i> isolates, <i>Escherichia coli</i> and <i>Enterobacter</i> were the most common isolates with 171 (71.3%) and 65 (27.1%), respectively. The combination test results also showed that 108 (45%) <i>Enterobacteriaceae</i> isolates were phenotypic ESBL producers, but 104 (96%) isolates were positive for the <i>bla</i><sub>CTX-M</sub> gene and 99 (92%) were positive for the <i>bla</i><sub>CTX-M-1</sub> gene according to the PCR method.<h4>Conclusions</h4>The results of this study phenotypically and genotypically confirmed the high frequency of ESBL-producing strains, such as the <i>CTX-M</i> and <i>CTX-M-1</i> genes, among <i>Enterobacteriaceae</i> isolates in our region. Therefore, use of antibiotic susceptibility testing for the detection of ESBL isolates prior to the prescription of beta-lactam antibiotics is recommended. This could help prevent the spread of bacteria strains that are resistant to beta-lactam antibiotics.

Also flagged:Metabolismmethylationhistonemetabolic disordersdiabetesobesity
Journal Article 2016-09-25 No Snippets Xu W, Wang F, Yu Z, Xin F.
Show Full Abstract

Living eukaryotic systems evolve delicate cellular mechanisms for responding to various environmental signals. Among them, epigenetic machinery (DNA methylation, histone modifications, microRNAs, etc.) is the hub in transducing external stimuli into transcriptional response. Emerging evidence reveals the concept that epigenetic signatures are essential for the proper maintenance of cellular metabolism. On the other hand, the metabolite, a main environmental input, can also influence the processing of epigenetic memory. Here, we summarize the recent research progress in the epigenetic regulation of cellular metabolism and discuss how the dysfunction of epigenetic machineries influences the development of metabolic disorders such as diabetes and obesity; then, we focus on discussing the notion that manipulating metabolites, the fuel of cell metabolism, can function as a strategy for interfering epigenetic machinery and its related disease progression as well.

Also flagged:Ascorbic AcidGanoderic Acid Atriterpenoidwaterbronchitisallergies
Journal Article 2016-09-25 ✓ 1 Snippet Tawasri P, Ampasavate C, Tharatha S, Chiranthanut N, Teekachunhatean S.
In-Text Gene Mentions

…iron overload orhemochromatosis.…

Show Full Abstract

The objective of this randomized, open-label, single-dose, two-phase crossover study was to determine the effect of ascorbic acid on pharmacokinetics of ganoderic acid A, an important biologically active triterpenoid compound with anticancer activities, following oral administration of water extract of fruiting bodies of Ling Zhi in 12 healthy male subjects. Each subject was randomized to receive either one of the two regimens: (1) a single dose of 3,000 mg of the Ling Zhi preparation or (2) a single dose of 3,000 mg of the Ling Zhi preparation in combination with 2,500 mg of ascorbic acid. After a washout period of at least two weeks, subjects were switched to receive the alternate regimen. Blood samples were collected in each phase immediately before dosing and at specific time points for 8 hours after dosing. Plasma ganoderic acid A concentrations were quantified using liquid chromatography-mass spectrometry (LC-MS). The pharmacokinetic parameters analyzed were maximal plasma concentration (<i>C</i><sub>max</sub>), time to reach peak concentration (<i>T</i><sub>max</sub>), area under the plasma concentration-time curve (<i>AUC</i>), and half-life (<i>t</i><sub>1/2</sub>). An oral coadministration of ascorbic acid with Ling Zhi preparation did not significantly alter the pharmacokinetic parameters of ganoderic acid A in healthy male subjects.

Also flagged:PneumoniaEPS8PDK2CCL21QRFPdeath
Journal Article 2016-09-24 ✓ 1 Snippet Huang S, Feng C, Chen L, Huang Z, Zhou X, Li B, Wang LL, Chen W, Lv FQ, Li TS.
In-Text Gene Mentions

…of CTD-2300H10.2 (e.g.,RC3H1, IHH, and…

Show Full Abstract

BACKGROUND This study aimed to identify the potential key long non-coding RNAs (lncRNAs) and target genes associated with pneumonia using lncRNA sequencing (lncRNA-seq). MATERIAL AND METHODS A total of 9 peripheral blood samples from patients with mild pneumonia (n=3) and severe pneumonia (n=3), as well as volunteers without pneumonia (n=3), were received for lncRNA-seq. Based on the sequencing data, differentially expressed lncRNAs (DE-lncRNAs) were identified by the limma package. After the functional enrichment analysis, target genes of DE-lncRNAs were predicted, and the regulatory network was constructed. RESULTS In total, 99 DE-lncRNAs (14 upregulated and 85 downregulated ones) were identified in the mild pneumonia group and 85 (72 upregulated and 13 downregulated ones) in the severe pneumonia group, compared with the control group. Among these DE-lncRNAs, 9 lncRNAs were upregulated in both the mild and severe pneumonia groups. A set of 868 genes were predicted to be targeted by these 9 DE-lncRNAs. In the network, RP11-248E9.5 and RP11-456D7.1 targeted the majority of genes. RP11-248E9.5 regulated several genes together with CTD-2300H10.2, such as QRFP and EPS8. Both upregulated RP11-456D7.1 and RP11-96C23.9 regulated several genes, such as PDK2. RP11-456D7.1 also positively regulated CCL21. CONCLUSIONS These novel lncRNAs and their target genes may be closely associated with the progression of pneumonia.

Also flagged:Glutamic acidCatalytic Activityethanolamino acid1,2,4-triazolidineHistidine
Journal Article 2016-09-24 No Snippets Gangu KK, Maddila S, Maddila SN, Jonnalagadda SB.
Show Full Abstract

An investigation was conducted into the influence of the amino acids as organic modifiers in the facile synthesis of metal incorporated fluorapatites (FAp) and their properties. The nanostructured Sm doped fluorapatites (Sm-FAp) were prepared by a co-precipitation method using four different amino acids, namely glutamic acid, aspartic acid, glycine and histidine. The materials were characterized by various techniques including X-ray diffraction (XRD), Fourier transform infra-red spectroscopy (FT-IR), field emission scanning electron microscopy (FE-SEM), energy-dispersive X-ray spectroscopy (EDX), high resolution transmission electron microscopy (HR-TEM), N₂-adsorption/desorption isotherm, temperature programmed desorption (TPD) and fluorescence spectrophotometry. Under similar conditions, Sm-FAp prepared using different amino acids exhibited distinctly different morphological structures, surface area and pore properties. Their activity as catalysts was assessed and Sm-FAp/Glycine displayed excellent efficiency in the synthesis of 1,2,4-triazole catalyzing the reaction between 2-nitrobenzaldehyde and thiosemicarbazide with exceptional selectivity and 98% yield in a short time interval (10 min). The study provides an insight into the role of organic modifiers as controllers of nucleation, growth and aggregation which significantly influence the nature and activity of the catalytic sites on Sm-FAp. Sm-FAp could also have potential as photoactive material.

Also flagged:Purkinje Cell Cytoplasmic Antibody
Journal Article 2016-09-24 No Snippets Gupta HV, Gervais C, Ross MA, Mehta SH.
Show Full Abstract

No abstract available.

Also flagged:AzolesFluoxetineserotoninreuptakegene expressionSAP
Journal Article 2016-09-23 No Snippets Gu W, Guo D, Zhang L, Xu D, Sun S.
Show Full Abstract

This study evaluated the synergistic effects of the selective serotonin reuptake inhibitor, fluoxetine, in combination with azoles against Candida albicans both in vitro and in vivo and explored the underlying mechanism. MICs, sessile MICs, and time-kill curves were determined for resistant C. albicans Galleria mellonella was used as a nonvertebrate model for determining the efficacy of the drug combinations against C. albicans in vivo For the mechanism study, gene expression levels of the SAP gene family were determined by reverse transcription (RT)-PCR, and extracellular phospholipase activities were detected in vitro by the egg yolk agar method. The combinations resulted in synergistic activity against C. albicans strains, but the same effect was not found for the non-albicans Candida strains. For the biofilms formed over 4, 8, and 12 h, synergism was seen for the combination of fluconazole and fluoxetine. In addition, the time-kill curves confirmed the synergism dynamically. The results of the G. mellonella studies agreed with the in vitro analysis. In the mechanism study, we observed that fluconazole plus fluoxetine caused downregulation of the gene expression levels of SAP1 to SAP4 and weakened the extracellular phospholipase activities of resistant C. albicans The combinations of azoles and fluoxetine showed synergistic effects against resistant C. albicans may diminish the virulence properties of C. albicans.

Also flagged:Immune Responseshand, foot, and mouth diseaseVP1VP3capsid subunit proteinsfoot, and mouth disease
Journal Article 2016-09-23 ✓ 4 Snippets Feng Q, He Y, Lu J.
In-Text Gene Mentions

It is worth noting that the anti-VLPs antisera exhibited no cross-reactivity against other HFMD-causing strains, including EV71, CA4, CA6, CA10, and ECHO 30, thereby suggesting the urgent need for bivalent (EV71/CA16) or multivalent vaccines for effective HFMD prevention [42,43].

CA16/JB141030026 (B1a genotype) and CA16/JB141030230 (B1b genotype), along with EV71 (C4genotype), CA4, CA6, CA10, and Echovirus 30 (ECHO 30) isolated from throat swabs or stool specimens during the HFMD epidemic in Shenzhen in 2010, were used as the challenge viruses, respectively.

…(C4genotype), CA4, CA6,CA10, and Echovirus 30…

…EV71, CA4, CA6,CA10, or ECHO 30…

Show Full Abstract

BACKGROUND Coxsackievirus A16 (CA16) is one of the main causative agents of hand, foot, and mouth disease (HFMD), and the development of a safe and effective vaccine has been a top priority among CA16 researchers. MATERIAL AND METHODS In this study, we developed a Pichia pastoris yeast system for secretory expression of the virus-like particles (VLPs) for CA16 by co-expression of the P1 and 3CD proteins of CA16. SDS-PAGE, Western blot, and transmission electron microscopy (TEM) were performed to identify the formation of VLPs. Immunogenicity and vaccine efficacy of the CA16 VLPs were assessed in BABL/c mouse models. RESULTS Biochemical and biophysical analysis showed that the yeast-expressed CA16 VLPs were composed of VP0, VP1, and VP3 capsid subunit proteins, and present spherical particles with a diameter of 30 nm, similar to the parental infectious CA16 virus. Furthermore, CA16 VLPs elicited potent humoral and cellular immune responses, and VLPs-immunized sera conferred efficient protection to neonatal mice against lethal CA16 challenge. CONCLUSIONS Our results demonstrate that VLPs produced in Pichia pastoris represent a safe and effective vaccine strategy for CA16.

Also flagged:Glyceronephosphate O-Acyltransferaseporphyria cutanea tardairon dependent diseasesirontype I hereditary hemochromatosisGNPAT
Journal Article 2016-09-23 ✓ 5 Snippets Farrell CP, Overbey JR, Naik H, Nance D, McLaren GD, McLaren CE, Zhou L, Desnick RJ, Parker CJ, Phillips JD.
In-Text Gene Mentions

Associations of GNPAT, HFE C282Y and H63D genotypes with PCT type (sporadic/familial) were assessed using Chi-square and Fisher’s exact tests as appropriate.

A recent study by McLaren et al. identified a sequence variant, D519G (rs11558492), of GNPAT that was associated with a high iron phenotype at presentation in men with hereditary hemochromatosis who were homozygous for HFE C282Y.[10] Further investigations suggested that GNPAT, like HFE, participates in the regulation of hepcidin expression.[10] These observations led us to the hypothesis that, analogous to HFE C282Y and H63D, GNPAT D519G is a risk factor for PCT.

PCT is an iron dependent disease, and a genetic variant of HFE (C282Y) that enhances iron absorption and recycling by reducing hepcidin expression is a risk factor for PCT.

Other factors including hepatitis C (HCV) infection, excess alcohol consumption, and therapeutic estrogens, in women,[4] increase the risk of developing PCT, but the importance of iron in the pathophysiology of the disease is underscored by the observation that symptoms resolve and plasma porphyrin levels return to normal when iron stores are depleted by therapeutic phlebotomy.[5, 6] Thus PCT is an iron-dependent disease and genetic variations of HFE (C282Y and H63D) that increase iron absorption by reducing expression of hepcidin are risk factors for developing PCT.[7–9]

Symptoms of PCT resolve when iron stores are depleted by phlebotomy, and a sequence variant of HFE (C282Y, c.843G>A, rs1800562) that enhances iron aborption by reducing hepcidin expression is a risk factor for PCT.

Show Full Abstract

Both familial and sporadic porphyria cutanea tarda (PCT) are iron dependent diseases. Symptoms of PCT resolve when iron stores are depleted by phlebotomy, and a sequence variant of HFE (C282Y, c.843G>A, rs1800562) that enhances iron aborption by reducing hepcidin expression is a risk factor for PCT. Recently, a polymorphic variant (D519G, c.1556A>G, rs11558492) of glyceronephosphate O-acyltransferase (GNPAT) was shown to be enriched in male patients with type I hereditary hemochromatosis (HFE C282Y homozygotes) who presented with a high iron phenotype, suggesting that GNPAT D519G, like HFE C282Y, is a modifier of iron homeostasis that favors iron absorption. To challenge this hypothesis, we investigated the frequency of GNPAT D519G in patients with both familial and sporadic PCT. Patients were screened for GNPAT D519G and allelic variants of HFE (both C282Y and H63D). Nucleotide sequencing of uroporphyrinogen decarboxylase (URO-D) identified mutant alleles. Patients with low erythrocyte URO-D activity or a damaging URO-D variant were classified as familial PCT (fPCT) and those with wild-type URO-D were classified as sporadic PCT (sPCT). GNPAT D519G was significantly enriched in the fPCT patient population (p = 0.0014) but not in the sPCT population (p = 0.4477). Both HFE C282Y and H63D (c.187C>G, rs1799945) were enriched in both PCT patient populations (p<0.0001) but showed no greater association with fPCT than with sPCT.<h4>Conclusion</h4>GNPAT D519G is a risk factor for fPCT, but not for sPCT.

Also flagged:Heparan SulfateFibroblast growth factorsFGFscellsurfaceheparan proteoglycans
Journal Article 2016-09-23 ✓ 1 Snippet Zhao Y, Singh A, Xu Y, Zong C, Zhang F, Boons GJ, Liu J, Linhardt RJ, Woods RJ, Amster IJ.
In-Text Gene Mentions

ATIII

Show Full Abstract

Fibroblast growth factors (FGFs) regulate several cellular developmental processes by interacting with cell surface heparan proteoglycans and transmembrane cell surface receptors (FGFR). The interaction of FGF with heparan sulfate (HS) is known to induce protein oligomerization, increase the affinity of FGF towards its receptor FGFR, promoting the formation of the HS-FGF-FGFR signaling complex. Although the role of HS in the signaling pathways is well recognized, the details of FGF oligomerization and formation of the ternary signaling complex are still not clear, with several conflicting models proposed in literature. Here, we examine the effect of size and sulfation pattern of HS upon FGF1 oligomerization, binding stoichiometry and conformational stability, through a combination of ion mobility (IM) and theoretical modeling approaches. Ion mobility-mass spectrometry (IMMS) of FGF1 in the presence of several HS fragments ranging from tetrasaccharide (dp4) to dodecasaccharide (dp12) in length was performed. A comparison of the binding stoichiometry of variably sulfated dp4 HS to FGF1 confirmed the significance of the previously known high-affinity binding motif in FGF1 dimerization, and demonstrated that certain tetrasaccharide-length fragments are also capable of inducing dimerization of FGF1. The degree of oligomerization was found to increase in the presence of dp12 HS, and a general lack of specificity for longer HS was observed. Additionally, collision cross-sections (CCSs) of several FGF1-HS complexes were calculated, and were found to be in close agreement with experimental results. Based on the (CCSs) a number of plausible binding modes of 2:1 and 3:1 FGF1-HS are proposed. Graphical Abstract ᅟ.

Also flagged:methylationchronic diseaseDNase-Iageingchronic diseasesdeath
Journal Article 2016-09-23 ✓ 1 Snippet Bell CG, Xia Y, Yuan W, Gao F, Ward K, Roos L, Mangino M, Hysi PG, Bell J, Wang J, Spector TD.
In-Text Gene Mentions

…, CDC14B ,HFE, BMI1 and…

Show Full Abstract

<h4>Background</h4>Advancing age progressively impacts on risk and severity of chronic disease. It also modifies the epigenome, with changes in DNA methylation, due to both random drift and variation within specific functional loci.<h4>Results</h4>In a discovery set of 2238 peripheral-blood genome-wide DNA methylomes aged 19-82 years, we identify 71 age-associated differentially methylated regions within the linkage disequilibrium blocks of the single nucleotide polymorphisms from the NIH genome-wide association study catalogue. This included 52 novel regions, 29 within loci not covered by 450 k or 27 k Illumina array, and with enrichment for DNase-I Hypersensitivity sites across the full range of tissues. These age-associated differentially methylated regions also show marked enrichment for enhancers and poised promoters across multiple cell types. In a replication set of 2084 DNA methylomes, 95.7 % of the age-associated differentially methylated regions showed the same direction of ageing effect, with 80.3 % and 53.5 % replicated to p < 0.05 and p < 1.85 × 10<sup>-8</sup>, respectively.<h4>Conclusion</h4>By analysing the functionally enriched disease and trait-associated regions of the human genome, we identify novel epigenetic ageing changes, which could be useful biomarkers or provide mechanistic insights into age-related common diseases.

Also flagged:glucose-transportertumorsextracellulariodinetranslation initiationcarcinomas
Journal Article 2016-09-23 ✓ 1 Snippet Ribback S, Sailer V, Böhning E, Günther J, Merz J, Steinmüller F, Utpatel K, Cigliano A, Peters K, Pilo MG, Evert M, Calvisi DF, Dombrowski F.
In-Text Gene Mentions

…antitrypsin deficiency andhemochromatosis[ 2 ].…

Show Full Abstract

Activation of the epidermal growth factor receptor (EGFR) signaling pathway promotes the development of hepatocellular adenoma (HCA) and carcinoma (HCC). The selective EGFR inhibitor Gefitinib was found to prevent hepatocarcinogenesis in rat cirrhotic livers. Thus, Gefitinib might reduce progression of pre-neoplastic liver lesions to HCC. In short- and long-term experiments, administration of N-Nitrosomorpholine (NNM) or intrahepatic transplantation of pancreatic islets in diabetic (PTx), thyroid follicles in thyroidectomized (TTx) and ovarian fragments in ovariectomized (OTx) rats was conducted for the induction of foci of altered hepatocytes (FAH). Gefitinib was administered for two weeks (20 mg/kg) or three and nine months (10 mg/kg). In NNM-treated rats, Gefitinib administration decreased the amount of FAH when compared to controls. The amount of HCA and HCC was decreased, but development was not prevented. Upon all transplantation models, proliferative activity of FAH was lower after administration of Gefitinib in short-term experiments. Nevertheless, the burden of HCA and HCC was not changed in later stages. Thus, EGFR inhibition by Gefitinib diminishes chemical and hormonal also induced hepatocarcinogenesis in the initiation stage in the non-cirrhotic liver. However, progression to malignant hepatocellular tumors was not prevented, indicating only a limited relevance of the EGFR signaling cascade in later stages of hepatocarcinogenesis.

Also flagged:CancerLiver CancerHepatocellular carcinomacell proliferationcalmodulin binding transcription activator 1chromatin
Journal Article 2016-09-23 ✓ 1 Snippet Ding LJ, Li Y, Wang SD, Wang XS, Fang F, Wang WY, Lv P, Zhao DH, Wei F, Qi L.
In-Text Gene Mentions

…with chromatin orchromatin modifiersmodifiers such as…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common subtype of liver malignancy, and it is characterized by poor prognosis because of cancer stem cell (CSC)-mediated high postsurgical recurrence rates. Thus, targeting CSCs, or HCC cells with CSC-like properties, is an effective strategy for HCC therapy. Here, using long noncoding RNA (lncRNA) microarray analysis, we identified a novel lncRNA termed lncCAMTA1 that is increased in both liver CSCs and HCC. High lncCAMTA1 expression in HCC indicates poor clinical outcome. In vitro and in vivo functional experiments showed that overexpression of lncCAMTA1 promotes HCC cell proliferation, CSC-like properties, and tumorigenesis. Conversely, depletion of lncCAMTA1 inhibits HCC cell proliferation, CSC-like properties, and tumorigenesis. Mechanistically, we demonstrated that lncCAMTA1 physically associates with the calmodulin binding transcription activator 1 (CAMTA1) promoter, induces a repressive chromatin structure, and inhibits CAMTA1 transcription. Furthermore, CAMTA1 is required for the effects of lncCAMTA1 on HCC cell proliferation and CSC-like properties, and the expression of lncCAMTA1 and CAMTA1 is significantly negatively correlated in HCC tissues. Collectively, our study revealed the important roles and underlying molecular mechanisms of lncCAMTA1 on HCC, and suggested that lncCAMTA1 could be an effective prognostic factor and a potential therapeutic target for HCC.

Also flagged:BANK1B-cell-scaffold proteinCD40AKTdopamine
Journal Article 2016-09-23 ✓ 1 Snippet Blokland GAM, Wallace AK, Hansell NK, Thompson PM, Hickie IB, Montgomery GW, Martin NG, McMahon KL, de Zubicaray GI, Wright MJ.
In-Text Gene Mentions

POU3F2

Show Full Abstract

In a population-based genome-wide association (GWA) study of n-back working memory task-related brain activation, we extracted the average percent BOLD signal change (2-back minus 0-back) from 46 regions-of-interest (ROIs) in functional MRI scans from 863 healthy twins and siblings. ROIs were obtained by creating spheres around group random effects analysis local maxima, and by thresholding a voxel-based heritability map of working memory brain activation at 50%. Quality control for test-retest reliability and heritability of ROI measures yielded 20 reliable (r>0.7) and heritable (h<sup>2</sup>>20%) ROIs. For GWA analysis, the cohort was divided into a discovery (n=679) and replication (n=97) sample. No variants survived the stringent multiple-testing-corrected genome-wide significance threshold (p<4.5×10<sup>-9</sup>), or were replicated (p<0.0016), but several genes were identified that are worthy of further investigation. A search of 529,379 genomic markers resulted in discovery of 31 independent single nucleotide polymorphisms (SNPs) associated with BOLD signal change at a discovery level of p<1×10<sup>-5</sup>. Two SNPs (rs7917410 and rs7672408) were associated at a significance level of p<1×10<sup>-7</sup>. Only one, most strongly affecting BOLD signal change in the left supramarginal gyrus (R<sup>2</sup>=5.5%), had multiple SNPs associated at p<1×10<sup>-5</sup> in linkage disequilibrium with it, all located in and around the BANK1 gene. BANK1 encodes a B-cell-specific scaffold protein and has been shown to negatively regulate CD40-mediated AKT activation. AKT is part of the dopamine-signaling pathway, suggesting a mechanism for the involvement of BANK1 in the BOLD response to working memory. Variants identified here may be relevant to (the susceptibility to) common disorders affecting brain function.

Also flagged:Neurodegenerative DiseasesMitochondriamitochondrialnuclear genomeimmune responsepathogenesis
Journal Article 2016-09-23 No Snippets Paine A, Jaiswal MK.
Show Full Abstract

No abstract available.

Also flagged:tryptophan hydroxylaseserotonin receptorstransportersbrain-derived neurotrophic factorsSBsserotonin transporter
Journal Article 2016-09-23 ✓ 2 Snippets Mirkovic B, Laurent C, Podlipski MA, Frebourg T, Cohen D, Gerardin P.
In-Text Gene Mentions

…serotonin transporter gene (5-HTTor SLC6A4) and…

…The serotonin transporter (5-HTT) plays an important…

Show Full Abstract

Suicidal behaviors (SBs), which range from suicidal ideation to suicide attempts and completed suicide, represent a fatal dimension of mental ill-health. The involvement of genetic risk factors in SB is supported by family, twin, and adoption studies. The aim of this paper is to review recent genetic association studies in SBs including (i) case-control studies, (ii) family-based association studies, and (iii) genome-wide association studies (GWAS). Various studies on genetic associations have tended to suggest that a number of genes [e.g., tryptophan hydroxylase, serotonin receptors and transporters, or brain-derived neurotrophic factors (BDNFs)] are linked to SBs, but these findings are not consistently supported by the results obtained. Although the candidate-gene approach is useful, it is hampered by the present state of knowledge concerning the pathophysiology of diseases. Interpretations of GWAS results are mostly hindered by a lack of annotation describing the functions of most variation throughout the genome. Association studies have addressed a wide range of single-nucleotide polymorphisms in numerous genes. We have included 104 such studies, of which 10 are family-based association studies and 11 are GWAS. Numerous meta-analyses of case-control studies have shown significant associations of SB with variants in the serotonin transporter gene (5-HTT or SLC6A4) and the tryptophan hydroxylase 1 gene (TPH1), but others report contradictory results. The gene encoding BDNF and its receptor (NTRK2) are also promising candidates. Only two of the GWAS showed any significant associations. Several pathways are mentioned in an attempt to understand the lack of reproducibility and the disappointing results. Consequently, we review and discuss here the following aspects: (i) sample characteristics and confounding factors; (ii) statistical limits; (iii) gene-gene interactions; (iv) gene, environment, and by time interactions; and (v) technological and theoretical limits.

Also flagged:breast cancerfulvestrantGene Expressiongreen fluorescent proteinpentose phosphateWnt
Journal Article 2016-09-23 No Snippets Liu P, Sun M, Jiang W, Zhao J, Liang C, Zhang H.
Show Full Abstract

The present study aimed to identify the differentially expressed genes (DEGs) regulated by microRNA (miRNA)-221 and miRNA-222 that are associated with the resistance of breast cancer to fulvestrant. The GSE19777 transcription profile was downloaded from the Gene Expression Omnibus database, and includes data from three samples of antisense miRNA-221-transfected fulvestrant-resistant MCF7-FR breast cancer cells, three samples of antisense miRNA-222-transfected fulvestrant-resistant MCF7-FR cells and three samples of control inhibitor (green fluorescent protein)-treated fulvestrant-resistant MCF7-FR cells. The linear models for microarray data package in R/Bioconductor was employed to screen for DEGs in the miRNA-transfected cells, and the pheatmap package in R was used to perform two-way clustering. Pathway enrichment was conducted using the Gene Set Enrichment Analysis tool. Furthermore, a miRNA-messenger (m) RNA regulatory network depicting interactions between miRNA-targeted upregulated DEGs was constructed and visualized using Cytoscape. In total, 492 and 404 DEGs were identified for the antisense miRNA-221-transfected MCF7-FR cells and the antisense miRNA-222-transfected MCF7-FR cells, respectively. Genes of the pentose phosphate pathway (PPP) were significantly enriched in the antisense miRNA-221-transfected MCF7-FR cells. In addition, components of the Wnt signaling pathway and cell adhesion molecules (CAMs) were significantly enriched in the antisense miRNA-222-transfected MCF7-FR cells. In the miRNA-mRNA regulatory network, miRNA-222 was demonstrated to target protocadherin 10 (<i>PCDH10</i>). The results of the present study suggested that the PPP and Wnt signaling pathways, as well as CAMs and <i>PCDH10</i>, may be associated with the resistance of breast cancer to fulvestrant.

Also flagged:histidineHDKu70repair proteinoligopeptidesAngiotensin III
Journal Article 2016-09-22 ✓ 5 Snippets Imamura T, Fujita K, Tagawa K, Ikura T, Chen X, Homma H, Tamura T, Mao Y, Taniguchi JB, Motoki K, Nakabayashi M, Ito N, Yamada K, Tomii K, Okano H, Kaye J, Finkbeiner S, Okazawa H.
In-Text Gene Mentions

We identified drug seeds for treating Huntington’s disease (HD) by combining in vitro single molecule fluorescence spectroscopy, in silico molecular docking simulations, and in vivo fly and mouse HD models to screen for inhibitors of abnormal interactions between mutant Htt and physiological Ku70, an essential DNA damage repair protein in neurons whose function is known to be impaired by mutant Htt.

Regarding the small size effects of Angiotensin III, LH-RH 4–10 peptide fragment and 7H on phenotypes of R6/2 mice, we suspected the small effect could be due to too severe phenotypes of R6/2 mice and asked whether the effect might become more visible in the other HD model expressing full-length Htt at a physiological level.

In this study, we screened candidate drug seeds for the treatment of HD via multi-step screenings targeting the prevention of the abnormal interaction between Ku70 and mutant Htt.

Despite the debate about whether overexpression of Htt exon 1 might produce some artifacts in the pathology or symptoms of HD, compared to other mutant Htt-KI, -YAC-Tg or -BAC-Tg mice, R6/2 is clearly the most efficient model for screening multiple chemicals in the shortest duration30.

For instance, the R6/2 transgenic mouse expressing Htt exon1-Q120 ± 523 has a long history of use in HD research, although whether overexpression of a partial fragment of the mutant protein completely reflects human pathology has been debated.

Show Full Abstract

We identified drug seeds for treating Huntington's disease (HD) by combining in vitro single molecule fluorescence spectroscopy, in silico molecular docking simulations, and in vivo fly and mouse HD models to screen for inhibitors of abnormal interactions between mutant Htt and physiological Ku70, an essential DNA damage repair protein in neurons whose function is known to be impaired by mutant Htt. From 19,468 and 3,010,321 chemicals in actual and virtual libraries, fifty-six chemicals were selected from combined in vitro-in silico screens; six of these were further confirmed to have an in vivo effect on lifespan in a fly HD model, and two chemicals exerted an in vivo effect on the lifespan, body weight and motor function in a mouse HD model. Two oligopeptides, hepta-histidine (7H) and Angiotensin III, rescued the morphological abnormalities of primary neurons differentiated from iPS cells of human HD patients. For these selected drug seeds, we proposed a possible common structure. Unexpectedly, the selected chemicals enhanced rather than inhibited Htt aggregation, as indicated by dynamic light scattering analysis. Taken together, these integrated screens revealed a new pathway for the molecular targeted therapy of HD.

Also flagged:oxygenHbgestationorganizationhyperbilirubinemianecrotizing enterocolitis
Journal Article 2016-09-22 ✓ 2 Snippets Katheria AC, Lakshminrusimha S, Rabe H, McAdams R, Mercer JS.
In-Text Gene Mentions

In fact, infants with PPHN tend to have lower Hb compared with infants with respiratory distress without PPHN suggesting that placental transfusion may be protective against pulmonary hypertension by promoting pulmonary blood flow and increasing oxygen carrying capacity.47 It has also been suggested that high pulmonary arterial pressure may be protective against fluctuating cerebral blood flow by reducing ductal shunt in extremely preterm infants.48 We speculate that improved cerebral blood flow, oxygen carrying capacity, increased pulmonary arterial pressure and reduced ductal shunt following placental transfusion may contribute to reduced IVH observed in preterm infants following DCC.19

In eight studies involving over 1000 neonates, there was no significant difference in risk of jaundice within 24–48 h.41 In the most recent meta-analysis of 1828 infants in five studies, there were no significant differences in clinical jaundice.49 Although a slight increase (2%) in the need for phototherapy with DCC was reported, this must be weighed against recent evidence that higher levels of bilirubin within normal limits may offer neuroprotection to the infant.50 Even using DCC in infants with alloimmunization requiring intrauterine transfusion, Garabedian et al.51 found no increase in jaundice.

Show Full Abstract

Recently there have been a number of studies and presentations on the importance of providing a placental transfusion to the newborn. Early cord clamping is an avoidable, unphysiologic intervention that prevents the natural process of placental transfusion. However, placental transfusion, although simple in concept, is affected by multiple factors, is not always straightforward to implement, and can be performed using different methods, making this basic procedure important to discuss. Here, we review three placental transfusion techniques: delayed cord clamping, intact umbilical cord milking and cut-umbilical cord milking, and the evidence in term and preterm newborns supporting this practice. We will also review several factors that influence placental transfusion, and discuss perceived risks versus benefits of this procedure. Finally, we will provide key straightforward concepts and implementation strategies to ensure that placental-to-newborn transfusion can become routine practice at any institution.

Also flagged:kininL-argininenitric oxideKLKB1amino acidsynthesis
Journal Article 2016-09-22 ✓ 1 Snippet Zhang W, Jernerén F, Lehne BC, Chen MH, Luben RN, Johnston C, Elshorbagy A, Eppinga RN, Scott WR, Adeyeye E, Scott J, Böger RH, Khaw KT, van der Harst P, Wareham NJ, Vasan RS, Chambers JC, Refsum H, Kooner JS.
In-Text Gene Mentions

SOX6

Show Full Abstract

L-arginine is the essential precursor of nitric oxide, and is involved in multiple key physiological processes, including vascular and immune function. The genetic regulation of blood L-arginine levels is largely unknown. We performed a genome-wide association study (GWAS) to identify genetic factors determining serum L-arginine levels, amongst 901 Europeans and 1,394 Indian Asians. We show that common genetic variations at the KLKB1 and F12 loci are strongly associated with serum L-arginine levels. The G allele of single nucleotide polymorphism (SNP) rs71640036 (T/G) in KLKB1 is associated with lower serum L-arginine concentrations (10 µmol/l per allele copy, p=1×10<sup>-24</sup>), while allele T of rs2545801 (T/C) near the F12 gene is associated with lower serum L-arginine levels (7 µmol/l per allele copy, p=7×10<sup>-12</sup>). Together these two loci explain 7 % of the total variance in serum L-arginine concentrations. The associations at both loci were replicated in independent cohorts with plasma L-arginine measurements (p<0.004). The two sentinel SNPs are in nearly complete LD with the nonsynonymous SNP rs3733402 at KLKB1 and the 5'-UTR SNP rs1801020 at F12, respectively. SNPs at both loci are associated with blood pressure. Our findings provide new insight into the genetic regulation of L-arginine and its potential relationship with cardiovascular risk.

Also flagged:16S rRNAV3–V4infectious diseasesbacterial vaginosiswound healinglactate
Journal Article 2016-09-22 ✓ 1 Snippet Zevin AS, Xie IY, Birse K, Arnold K, Romas L, Westmacott G, Novak RM, McCorrister S, McKinnon LR, Cohen CR, Mackelprang R, Lingappa J, Lauffenburger DA, Klatt NR, Burgener AD.
In-Text Gene Mentions

…IC1, GELS, CO3,PEBP1, PRDX1, PRDX2, CO4A,…

Show Full Abstract

The mechanism(s) by which bacterial communities impact susceptibility to infectious diseases, such as HIV, and maintain female genital tract (FGT) health are poorly understood. Evaluation of FGT bacteria has predominantly been limited to studies of species abundance, but not bacterial function. We therefore sought to examine the relationship of bacterial community composition and function with mucosal epithelial barrier health in the context of bacterial vaginosis (BV) using metaproteomic, metagenomic, and in vitro approaches. We found highly diverse bacterial communities dominated by Gardnerella vaginalis associated with host epithelial barrier disruption and enhanced immune activation, and low diversity communities dominated by Lactobacillus species that associated with lower Nugent scores, reduced pH, and expression of host mucosal proteins important for maintaining epithelial integrity. Importantly, proteomic signatures of disrupted epithelial integrity associated with G. vaginalis-dominated communities in the absence of clinical BV diagnosis. Because traditional clinical assessments did not capture this, it likely represents a larger underrepresented phenomenon in populations with high prevalence of G. vaginalis. We finally demonstrated that soluble products derived from G. vaginalis inhibited wound healing, while those derived from L. iners did not, providing insight into functional mechanisms by which FGT bacterial communities affect epithelial barrier integrity.

Mastering genomic terminology.

Also flagged:hemochromatosistranslationchromosomelearningBRCA1cancer
Journal Article 2016-09-22 No Snippets Jarvik GP, Evans JP.
Show Full Abstract

No abstract available.

Also flagged:DopamineHDcognitive disorderdegradationbehavioralCOMT
Journal Article 2016-09-22 ✓ 5 Snippets de Diego-Balaguer R, Schramm C, Rebeix I, Dupoux E, Durr A, Brice A, Charles P, Cleret de Langavant L, Youssov K, Verny C, Damotte V, Azulay JP, Goizet C, Simonin C, Tranchant C, Maison P, Rialland A, Schmitz D, Jacquemot C, Fontaine B, Bachoud-Lévi AC, French Speaking Huntington Group.
In-Text Gene Mentions

The size of the number of CAG repeats in the mutated Htt (mHtt) gene is inversely related to age at onset of HD patients, but accounts for only 40 to 70% of its variance [3].

Huntington’s disease (HD) is an autosomal dominant inherited neurodegenerative disease caused by increased number of CAG (cytosine adenine guanine) repeats in the Huntingtin (Htt) gene on chromosome 4 [1].

…the Huntingtin (Htt) gene on…

…in the mutatedHtt( mHtt )…

…in the normalHttallele remains uncertain,…

Show Full Abstract

Little is known about the genetic factors modulating the progression of Huntington's disease (HD). Dopamine levels are affected in HD and modulate executive functions, the main cognitive disorder of HD. We investigated whether the Val158Met polymorphism of the catechol-O-methyltransferase (COMT) gene, which influences dopamine (DA) degradation, affects clinical progression in HD. We carried out a prospective longitudinal multicenter study from 1994 to 2011, on 438 HD gene carriers at different stages of the disease (34 pre-manifest; 172 stage 1; 130 stage 2; 80 stage 3; 17 stage 4; and 5 stage 5), according to Total Functional Capacity (TFC) score. We used the Unified Huntington's Disease Rating Scale to evaluate motor, cognitive, behavioral and functional decline. We genotyped participants for COMT polymorphism (107 Met-homozygous, 114 Val-homozygous and 217 heterozygous). 367 controls of similar ancestry were also genotyped. We compared clinical progression, on each domain, between groups of COMT polymorphisms, using latent-class mixed models accounting for disease duration and number of CAG (cytosine adenine guanine) repeats. We show that HD gene carriers with fewer CAG repeats and with the Val allele in COMT polymorphism displayed slower cognitive decline. The rate of cognitive decline was greater for Met/Met homozygotes, which displayed a better maintenance of cognitive capacity in earlier stages of the disease, but had a worse performance than Val allele carriers later on. COMT polymorphism did not significantly impact functional and behavioral performance. Since COMT polymorphism influences progression in HD, it could be used for stratification in future clinical trials. Moreover, DA treatments based on the specific COMT polymorphism and adapted according to disease duration could potentially slow HD progression.

Also flagged:IL-8YKL-40chitotriosidasetauneurofilament light chainNFL
Journal Article 2016-09-22 ✓ 1 Snippet Rodrigues FB, Byrne LM, McColgan P, Robertson N, Tabrizi SJ, Zetterberg H, Wild EJ.
In-Text Gene Mentions

…exon of theHTTgene[ 1 ,…

Show Full Abstract

<h4>Introduction</h4>Immune system activation is involved in Huntington's disease (HD) pathogenesis and biomarkers for this process could be relevant to study the disease and characterise the therapeutic response to specific interventions. We aimed to study inflammatory cytokines and microglial markers in the CSF of HD patients.<h4>Methods</h4>CSF TNF-α, IL-1β, IL-6, IL-8, YKL-40, chitotriosidase, total tau and neurofilament light chain (NFL) from 23 mutation carriers and 14 healthy controls were assayed.<h4>Results</h4>CSF TNF-α and IL-1β were below the limit of detection. Mutation carriers had higher YKL-40 (p = 0.003), chitotriosidase (p = 0.015) and IL-6 (p = 0.041) than controls. YKL-40 significantly correlated with disease stage (p = 0.007), UHDRS total functional capacity score (r = -0.46, p = 0.016), and UHDRS total motor score (r = 0.59, p = 4.5*10-4) after adjustment for age.<h4>Conclusion</h4>YKL-40 levels in CSF may, after further study, come to have a role as biomarkers for some aspects of HD. Further investigation is needed to support our exploratory findings.

Also flagged:cytoskeletonimmune responseWinter syndromewaterbehavioralresponse to cold
Journal Article 2016-09-22 ✓ 5 Snippets Chang CH, Tang CH, Kang CK, Lo WY, Lee TH.
In-Text Gene Mentions

…roteins were peroxiredoxin-6 (Prdx6; 18-S3 in Fig…

Prdx6, Alb, and GRP78…

…), peroxiredoxin 6 (Prdx6; 16-S7 and 18-S3;…

…(apoptotic pathway) andPrdx6(anti-oxidative stress).…

…of GLTSCR2 andPrdx6increased 8.2- and…

Show Full Abstract

Milkfish is an important aquaculture species in Taiwan, and its high mortality during cold snaps in winter usually causes huge economic losses. To understand the effect of hypothermal stress and the corresponding compensatory stress response in milkfish, this study aimed to compare liver and gill protein levels between milkfish exposed to nonlethal (18°C), lethal (16°C), and control (28°C) temperatures. Using a proteomics approach based on two-dimensional electrophoresis and nano-LC-MS/MS analysis, this study identified thirty unique protein spots from milkfish livers and gills for which protein abundance was significantly different between nonlethal, lethal, and control temperature groups. Proteins identified in the liver were classified into three different categories according to their cellular function: (1) anti-oxidative stress, (2) apoptotic pathway, and (3) cytoskeleton. Similarly, proteins identified in the gill were sorted in five different functional categories: (1) cytoskeleton, (2) immune response, (3) protein quality control, (4) energy production, and (5) intracellular homeostasis. Based on functional information derived from the identified proteins, we assumed that different levels of hypothermal stress had a different effect and induced a different cellular response. Upon nonlethal hypothermal stress, the identified proteins were involved in anti-oxidative stress and anti-inflammation pathways, suggesting that milkfish had high levels of oxidative stress in the liver and exhibited inflammation response in the gill. Upon lethal hypothermal stress, however, identified proteins were associated with apoptosis in the liver and regulation of intracellular homeostasis in the gill. The present study provided evidence to illustrate different multi-physiological responses to nonlethal and lethal hypothermal stress in milkfish livers and gills.

Also flagged:Non-Alcoholic Fatty Liver DiseaseLiver CirrhosisHepatocellular Carcinomahereditary hemochromatosisliver diseasesNAFLD
Journal Article 2016-09-22 ✓ 5 Snippets Ye Q, Qian BX, Yin WL, Wang FM, Han T.
In-Text Gene Mentions

Accumulating evidence indicates that HFE mutations are associated with susceptibility to many clinical diseases, such as Parkinson's disease (PD) [20], primary varicose veins [21] and coronary heart disease (CHD) [22].

In 2007, Ellervik C and colleagues reported that the HFE C282Y mutation might be linked to an increased risk of NASH under a homozygote meta-analysis model [23].

An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC.

Pooled analysis for the association between HFE C282Y, H63D genotype frequencies and the risks of NAFLD, liver cirrhosis, HCC.

However, we found a positive association between the HD genotype of HFE H63D and increased susceptibility to overall NAFLD and specific NASH, particularly in the Asian population.

Show Full Abstract

<h4>Background</h4>Conflicting results have been obtained for the association between two common polymorphisms (C282Y, H63D) of human HFE (hereditary hemochromatosis) gene and the risks of the liver diseases, including non-alcoholic fatty liver disease (NAFLD), liver cirrhosis and hepatocellular carcinoma (HCC).<h4>Methods</h4>An updated systematic review and meta-analysis was conducted to evaluate the potential role of HFE polymorphisms in the susceptibility to NAFLD, liver cirrhosis and HCC. After retrieving articles from online databases, eligible studies were enrolled according to the selection criteria. Stata/SE 12.0 software was utilized to perform the statistical analysis.<h4>Results</h4>In total, 43 articles with 5,758 cases and 14,741 controls were selected. Compared with the control group, a significantly increased risk of NAFLD was observed for the C282Y polymorphism in the Caucasian population under all genetic models and for the H63D polymorphism under the allele, heterozygote and dominant models (all OR>1, Passociation<0.05). However, no significant difference between liver cirrhosis cases and the control group was observed for HFE C282Y and H63D (all Passociation>0.05). In addition, we found that HFE C282Y was statistically associated with increased HCC susceptibility in the overall population, while H63D increased the odds of developing non-cirrhotic HCC in the African population (all OR>1, Passociation<0.05). Moreover, a positive association between compound heterozygosity for C282Y/H63D and the risk of NAFLD and HCC, but not liver cirrhosis, was observed.<h4>Conclusion</h4>Our meta-analysis provides evidence that the HFE C282Y and H63D polymorphisms confer increased genetic susceptibility to NAFLD and HCC but not liver cirrhosis. Additional well-powered studies are required to confirm our conclusion.

Also flagged:Polyglutaminemovement disordercysteineS-nitrosylationAtaxin-1spinocerebellar ataxia type 1
Journal Article 2016-09-22 ✓ 5 Snippets Ni CL, Seth D, Fonseca FV, Wang L, Xiao TS, Gruber P, Sy MS, Stamler JS, Tartakoff AM.
In-Text Gene Mentions

To learn whether the relation between polyQ expansion and increased S-nitrosylation is specific to Htt, we conducted similar studies of Ataxin-1, which causes spinocerebellar ataxia type 1 (SCA1) when its N-terminal polyQ tract is expanded.

Expansion of the polyglutamine (polyQ) tract in the huntingtin (Htt) protein causes Huntington’s disease (HD), a fatal inherited movement disorder linked to neurodegeneration in the striatum and cortex.

Considering that cysteine residues are broadly distributed along the length of the protein (Fig 1), the observation that polyQ expansion has a major effect on the overall level of modification may best be attributed to global conformational features of Htt that alter reactivity of these residues as well as their interactomes, which may include NOSs and nitrosylases [48, 63, 64].

In human Htt, there are seventy cysteine residues.

To learn whether cysteine residues of Htt are S-nitrosylated or S-acylated, we expressed both full-length Htt and various Htt fragment constructs in cultured cell lines (Fig 1).

Show Full Abstract

Expansion of the polyglutamine (polyQ) tract in the huntingtin (Htt) protein causes Huntington's disease (HD), a fatal inherited movement disorder linked to neurodegeneration in the striatum and cortex. S-nitrosylation and S-acylation of cysteine residues regulate many functions of cytosolic proteins. We therefore used a resin-assisted capture approach to identify these modifications in Htt. In contrast to many proteins that have only a single S-nitrosylation or S-acylation site, we identified sites along much of the length of Htt. Moreover, analysis of cells expressing full-length Htt or a large N-terminal fragment of Htt shows that polyQ expansion strongly increases Htt S-nitrosylation. This effect appears to be general since it is also observed in Ataxin-1, which causes spinocerebellar ataxia type 1 (SCA1) when its polyQ tract is expanded. Overexpression of nitric oxide synthase increases the S-nitrosylation of normal Htt and the frequency of conspicuous juxtanuclear inclusions of Htt N-terminal fragments in transfected cells. Taken together with the evidence that S-nitrosylation of Htt is widespread and parallels polyQ expansion, these subcellular changes show that S-nitrosylation affects the biology of this protein in vivo.

Also flagged:deathantithrombin IIIprotein CprothrombincoagulationCoagulopathy
Journal Article 2016-09-22 ✓ 4 Snippets Zhang Y, Wu TB, Daigle BJ, Cohen M, Petzold L.
In-Text Gene Mentions

…as antithrombin III (ATIII), tissue factor pathway…

…VIII, IX, X,ATIIIand protein C,…

…X, antithrombin III (ATIII), protein C (PC),…

…and IX andATIII.…

Show Full Abstract

<h4>Background</h4>Trauma is the leading cause of death between the ages of 1 to 44 in the United States. Blood loss is the primary cause of these deaths. The discrimination of states through which patients transition would be helpful in understanding the disease process, and in identification of critical states and appropriate interventions. Even though these states are strongly associated with patients' blood composition data, there has not been a way to directly identify them. Statistical tools such as hidden Markov models can be used to infer the discrete latent states from the blood composition data.<h4>Methods</h4>We applied a hidden Markov model to time-series multivariate patient measurements from the UCSF/ San Francisco General Hospital and Trauma Center. Ten blood factor related measurements were used to identify the model: factors II, V, VII, VIII, IX, X, antithrombin III, protein C, prothrombin time and partial thromboplastin time. Missing data in the time-series dataset was considered in the hidden Markov model. The number of states was determined by minimizing the Bayesian information criterion across different numbers of states.<h4>Results</h4>After preprocessing, 1090 patients with a total number of 2176 time point measurements were included in the analysis. The hidden Markov model identified 6 disease states and 3 stages. We analyzed their relationships to the blood composition data and the coagulation cascade. The states are very indicative of the disease progression status of patients.<h4>Conclusions</h4>Six disease states and 3 stages associated with Coagulopathy in trauma were identified in our study. The hidden Markov model can be useful in identifying latent states by using patients' time-series multivariate data. The information obtained from the states and stages can be useful in the clinical setting.

Also flagged:procyanidineicosanoidlung cancerCOX-2prostaglandin Eprostacyclin
Journal Article 2016-09-22 ✓ 4 Snippets Mao JT, Smoake J, Park HK, Lu QY, Xue B.
In-Text Gene Mentions

…GSE also increasedPTGISand inhibition of…

…on prostacyclin synthase (PTGIS)/PGI 2 and 15-lipoxigenase-2…

…Transfections ofPTGISor 15-LOX-2 specific…

PTGIS

Show Full Abstract

Grape seed procyanidin extract (GSE) has been reported to exert antineoplastic properties via the inhibition of cyclooxygenase-2 (COX-2)/prostaglandin E<sub>2</sub> (PGE<sub>2</sub>) eicosanoid pathways. In addition, ample data link carcinogenesis to inflammatory events involving other major eicosanoid metabolic pathways, including prostacyclin (PGI<sub>2</sub>) and 15-hydroxyeicosatetraenoic acid (15-HETE). We therefore evaluated the effects of GSE on prostacyclin synthase (PTGIS)/PGI<sub>2</sub> and 15-lipoxigenase-2 (15-LOX-2)/15-HETE productions by human lung premalignant and malignant cells and correlated the findings with antiproliferative or proapoptotic effects of GSE. The effects of GSE on PGI<sub>2</sub> and 15-HETE productions by human bronchoalveolar lavage (BAL) cells ex vivo were also determined. We further evaluated the bioactivity of oral administration of leucoselect phytosome (a standardized GSE) in the lungs of subjects participating in a lung cancer chemoprevention trial, by comparing the antiproliferative effects of coculturing matched pre- versus posttreatment BAL fluids with lung premalignant and malignant cells. GSE significantly increased PGI<sub>2</sub> (as measured by 6-keto PGF1α) and 15-HETE productions by these cells. Transfections of PTGIS or 15-LOX-2-specific siRNA partially abrogated the antiproliferative or proapoptotic effects of GSE in lung premalignant and malignant cells, respectively. GSE also increased PTGIS and inhibition of caspase-3, and transfection of 15-LOX-2 siRNA abrogated the GSE-induced apoptosis in A549 cells. In addition, culture supernatants from ex vivo GSE-treated baseline BAL cells, as well as BAL fluids from subjects treated with leucoselect phytosome, significantly decreased proliferations of lung premalignant and malignant cells. Our findings support the continued investigation of GSE as an anti-neoplastic and chemopreventive agent against lung cancer. Cancer Prev Res; 9(12); 925-32. ©2016 AACR.

Also flagged:ILF2nucleotide-bindingILF3ribonucleoproteincarcinomaRPS7
Journal Article 2016-09-22 ✓ 3 Snippets Di Tomasso G, Miller Jenkins LM, Legault P.
In-Text Gene Mentions

STAU1

…the other three (STAU1, ILF2, and ILF3)…

…of our knowledge,STAU1, more commonly known…

Show Full Abstract

As part of their normal life cycle, most RNA molecules associate with several proteins that direct their fate and regulate their function. Here, we describe a novel method for identifying proteins that associate with a target RNA. The procedure is based on the ARiBo method for affinity purification of RNA, which was originally developed to quickly purify RNA with high yields and purity under native conditions. The ARiBo method was further optimized using in vitro transcribed RNA to capture RNA-associating proteins from cellular extracts with high yields and low background protein contamination. For these RNA pull-downs, stem-loops present in the immature forms of let-7 miRNAs (miRNA stem-loops) were used as the target RNAs. Label-free quantitative mass spectrometry analysis allowed for the reliable identification of proteins that are specific to the stem-loops present in the immature forms of two miRNAs, let-7a-1 and let-7g. Several proteins known to bind immature forms of these let-7 miRNAs were identified, but with an improved coverage compared to previous studies. In addition, several novel proteins were identified that better define the protein interactome of the let-7 miRNA stem-loops and further link let-7 biogenesis to important biological processes such as development and tumorigenesis. Thus, combining the ARiBo pull-down method with label-free quantitative mass spectrometry provides an effective proteomic approach for identification of proteins that associate with a target RNA.

Also flagged:mitochondrialoxygennitrogenwatersuperoxide anioncaspase 3
Journal Article 2016-09-22 No Snippets Rivera-Ingraham GA, Nommick A, Blondeau-Bidet E, Ladurner P, Lignot JH.
Show Full Abstract

In the context of global change, there is an urgent need for researchers in conservation physiology to understand the physiological mechanisms leading to the acquisition of stress acclimation phenotypes. Intertidal organisms continuously cope with drastic changes in their environmental conditions, making them outstanding models for the study of physiological acclimation. As the implementation of such processes usually comes at a high bioenergetic cost, a mitochondrial/oxidative stress approach emerges as the most relevant approach when seeking to analyze whole-animal responses. Here we use the intertidal flatworm Macrostomum lignano to analyze the bioenergetics of salinity acclimation and its consequences in terms of reactive oxygen/nitrogen species formation and physiological response to counteract redox imbalance. Measures of water fluxes and body volume suggest that M. lignano is a hyper-/iso-regulator. Higher salinities were revealed to be the most energetically expensive conditions, with an increase in mitochondrial density accompanied by increased respiration rates. Such modifications came at the price of enhanced superoxide anion production, likely associated with a high caspase 3 upregulation. These animals nevertheless managed to live at high levels of environmental salinity through the upregulation of several mitochondrial antioxidant enzymes such as superoxide dismutase. Contrarily, animals at low salinities decreased their respiration rates, reduced their activity and increased nitric oxide formation, suggesting a certain degree of metabolic arrest. A contradictory increase in dichlorofluorescein fluorescence and an upregulation of gluthathione-S-transferase pi 1 (GSTP1) expression were observed in these individuals. If animals at low salinity are indeed facing metabolic depression, the return to seawater may result in an oxidative burst. We hypothesize that this increase in GSTP1 could be a "preparation for oxidative stress", i.e. a mechanism to counteract the production of free radicals upon returning to seawater. The results of the present study shed new light on how tolerant organisms carry out subcellular adaptations to withstand environmental change.

Also flagged:polyglutamineneurodegenerative diseasesbindingHDneurodegenerative diseasedeath
Journal Article 2016-09-22 No Snippets Owens GE, New DM, Olvera AI, Manzella JA, Macon BL, Dunn JC, Cooper DA, Rouleau RL, Connor DS, Bjorkman PJ.
Show Full Abstract

Huntington's disease is one of nine neurodegenerative diseases caused by a polyglutamine (polyQ)-repeat expansion. An anti-polyQ antigen-binding fragment, MW1 Fab, was crystallized both on Earth and on the International Space Station, a microgravity environment where convection is limited. Once the crystals returned to Earth, the number, size and morphology of all crystals were recorded, and X-ray data were collected from representative crystals. The results generally agreed with previous microgravity crystallization studies. On average, microgravity-grown crystals were 20% larger than control crystals grown on Earth, and microgravity-grown crystals had a slightly improved mosaicity (decreased by 0.03°) and diffraction resolution (decreased by 0.2 Å) compared with control crystals grown on Earth. However, the highest resolution and lowest mosaicity crystals were formed on Earth, and the highest-quality crystal overall was formed on Earth after return from microgravity.

Also flagged:cannabinoidCB1CB2lipidendocannabinoidssynthesis
Journal Article 2016-09-22 No Snippets Ahamed M, Ahamed M, van Veghel D, Ullmer C, Van Laere K, Verbruggen A, Bormans GM.
Show Full Abstract

The type 2 cannabinoid receptor (CB2) is a member of the endocannabinoid system and is known for its important role in (neuro)inflammation. A PET-imaging agent that allows <i>in vivo</i> visualization of CB2 expression may thus allow quantification of neuroinflammation. In this paper, we report the synthesis, radiosynthesis, biodistribution and <i>in vitro</i> evaluation of a carbon-11 ([<sup>11</sup>C]MA2) and a fluorine-18 ([<sup>18</sup>F]MA3) labeled analog of a highly potent <i>N</i>-arylamide oxadiazole CB2 agonist (EC<sub>50</sub> = 0.015 nM). MA2 and MA3 behaved as potent CB2 agonist (EC<sub>50</sub>: 3 nM and 0.1 nM, respectively) and their <i>in vitro</i> binding affinity for <i>h</i>CB2 was found to be 87 nM and 0.8 nM, respectively. Also MA3 (substituted with a fluoro ethyl group) was found to have higher binding affinity and EC<sub>50</sub> values when compared to the originally reported trifluoromethyl analog <b>12</b>. [<sup>11</sup>C]MA2 and [<sup>18</sup>F]MA3 were successfully synthesized with good radiochemical yield, high radiochemical purity and high specific activity. In mice, both tracers were efficiently cleared from blood and all major organs by the hepatobiliary pathway and importantly these compounds showed high brain uptake. In conclusion, [<sup>11</sup>C]MA2 and [<sup>18</sup>F]MA3 are shown to be high potent CB2 agonists with good brain uptake, these favorable characteristics makes them potential PET probes for <i>in vivo</i> imaging of brain CB2 receptors. However, in view of its higher affinity and selectivity, further detailed evaluation of MA3 as a PET tracer for CB2 is warranted.

Also flagged:chronic diseasediabetes mellitusDiabetesObesitytype 2 diabetesinsulin resistance
Journal Article 2016-09-22 ✓ 1 Snippet Al-Saber F, Aldosari W, Alselaiti M, Khalfan H, Kaladari A, Khan G, Harb G, Rehani R, Kudo S, Koda A, Tanaka T, Nakajima M, Darwish A.
In-Text Gene Mentions

…hepatitis, porphyria, orhemochromatosis.…

Show Full Abstract

Type 2 diabetes mellitus is prevalent especially in Gulf countries and poses serious long-term risks to patients. A multifaceted treatment approach can include nutritional supplements with antioxidant properties such as 5-aminolevulinic acid (5-ALA) with sodium ferrous citrate (SFC). This prospective, randomized, single-blind, placebo-controlled, dose escalating pilot clinical trial assessed the safety of 5-ALA with SFC at doses up to 200 mg 5-ALA/229.42 mg SFC per day in patients living in Bahrain with type 2 diabetes mellitus that was uncontrolled despite the use of one or more antidiabetic drugs. Fifty-three patients (<i>n</i> = 53) from 3 sites at one center were enrolled by Dr. Feryal (Site #01), Dr. Hesham (Site #02), and Dr. Waleed (Site #03) (<i>n</i> = 35, 5-ALA-SFC; <i>n</i> = 18, placebo). There was no significant difference in incidence of adverse events reported, and the most frequent events reported were gastrointestinal in nature, consistent with the known safety profile of 5-ALA in patients with diabetes. No significant changes in laboratory values and no difference in hypoglycemia between patients receiving 5-ALA and placebo were noted. Overall, the current results support that use of 5-ALA-SFC up to 200 mg per day taken as 2 divided doses is safe in patients taking concomitant oral antidiabetic medications and may offer benefits in the diabetic population. This trial is registered with ClinicalTrials.gov NCT02481141.

Also flagged:immune responsecell proliferationchromatinmaintenanceof chromosomeCohesin
Journal Article 2016-09-22 ✓ 1 Snippet Rawlings JS.
In-Text Gene Mentions

…include Cohesin andCondensin, have long been…

Show Full Abstract

T lymphocytes (T cells) comprise a critical component of the immune system charged with diverse functions during an immune response. As a function of maturation in the thymus, T cells become quiescent and remain so until they participate in an immune response in the periphery. Recent work indicates that the control of T cell proliferation is mediated, at least in part, by chromatin architecture. Quiescent T cells possess a condensed chromatin, whereas proliferating T cells have a more open chromatin configuration. The structural maintenance of chromosome (SMC) complexes, which include Cohesin and Condensin, have long been known to play roles in modulating chromatin architecture during cell division; however, they are now known to have additional roles during interphase biology. These roles include the large-scale reorganization of chromatin as well as the regulation of specific gene loci. This review focuses on the roles that SMC complexes play in T cell development and function.

Also flagged:spinal cord injuryaxonsstem cell differentiationdeathSilverinnervation
Journal Article 2016-09-21 No Snippets Iyer NR, Wilems TS, Sakiyama-Elbert SE.
Show Full Abstract

The complex pathology of spinal cord injury (SCI), involving a cascade of secondary events and the formation of inhibitory barriers, hampers regeneration across the lesion site and often results in irreversible loss of motor function. The limited regenerative capacity of endogenous cells after SCI has led to a focus on the development of cell therapies that can confer both neuroprotective and neuroregenerative benefits. Stem cells have emerged as a candidate cell source because of their ability to self-renew and differentiate into a multitude of specialized cell types. While ethical and safety concerns impeded the use of stem cells in the past, advances in isolation and differentiation methods have largely mitigated these issues. A confluence of work in stem cell biology, genetics, and developmental neurobiology has informed the directed differentiation of specific spinal cell types. After transplantation, these stem cell-derived populations can replace lost cells, provide trophic support, remyelinate surviving axons, and form relay circuits that contribute to functional recovery. Further refinement of stem cell differentiation and transplantation methods, including combinatorial strategies that involve biomaterial scaffolds and drug delivery, is critical as stem cell-based treatments enter clinical trials. Biotechnol. Bioeng. 2017;114: 245-259. © 2016 Wiley Periodicals, Inc.

Also flagged:DNA MethyltransferasesHuntingtinNeurotoxicity
Journal Article 2016-09-21 ✓ 2 Snippets Pan Y, Daito T, Sasaki Y, Chung YH, Xing X, Pondugula S, Swamidass SJ, Wang T, Kim AH, Yano H.
In-Text Gene Mentions

“Following validation assays of possible screen “hits” using the MTS assay, we identified the cytosine nucleoside-analog DNA methyltransferase (DNMT) inhibitor decitabine, as the most effective drug in our mutant Htt neuroprotection screen (Fig. 1B and S1A,B).”

“Following validation assays of possible screen “hits” using the MTS assay, we identified the cytosine nucleoside-analog DNA methyltransferase (DNMT) inhibitor decitabine, as the most effective drug in our mutant Htt neuroprotection screen (Fig. 1B and S1A).”

Show Full Abstract

No abstract available.

Also flagged:Mdr1azoledrug efflux pumpsazolesefflux pumpfungal infection
Journal Article 2016-09-21 No Snippets Xie F, Chang W, Zhang M, Li Y, Li W, Shi H, Zheng S, Lou H.
Show Full Abstract

One of the main azole-resistance mechanisms in Candida pathogens is the upregulation of drug efflux pumps, which compromises the efficacy of azoles and results in treatment failure. The combination of azole-antifungal agents with efflux pump inhibitors represents a promising strategy to combat fungal infection. High-throughput screening of 150 extracts obtained from endolichenic fungal cultures led to the discovery that the extract of Phialocephala fortinii exhibits potent activity for the reversal of azole resistance. From P. fortinii cultures, a total of 15 quinone derivatives, comprising 11 new derivatives and 4 known compounds, were obtained. Among these compounds, palmarumycin P3 (3) and phialocephalarin B (8) specifically modulate the expression of MDR1 to inhibit the activity of drug efflux pumps and therefore reverse azole resistance. The present study revealed Mdr1 targeting as an alternative mechanism for the discovery of new agents to fight antifungal drug resistance.

Also flagged:ACIkeyyouorganizationclopidogrel
Journal Article 2016-09-21 ✓ 1 Snippet Rasmussen LV, Overby CL, Connolly J, Chute CG, Denny JC, Freimuth R, Hartzler AL, Holm IA, Manzi S, Pathak J, Peissig PL, Smith M, Williams MS, Shirts BH, Stoffel EM, Tarczy-Hornoch P, Rohrer Vitek CR, Wolf WA, Starren J.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>To understand opinions and perceptions on the state of information resources specifically targeted to genomics, and approaches to delivery in clinical practice.<h4>Methods</h4>We conducted a survey of genomic content use and its clinical delivery from representatives across eight institutions in the electronic Medical Records and Genomics (eMERGE) network and two institutions in the Clinical Sequencing Exploratory Research (CSER) consortium in 2014.<h4>Results</h4>Eleven responses representing distinct projects across ten sites showed heterogeneity in how content is being delivered, with provider-facing content primarily delivered via the electronic health record (EHR) (n=10), and paper/pamphlets as the leading mode for patient-facing content (n=9). There was general agreement (91%) that new content is needed for patients and providers specific to genomics, and that while aspects of this content could be shared across institutions there remain site-specific needs (73% in agreement).<h4>Conclusion</h4>This work identifies a need for the improved access to and expansion of information resources to support genomic medicine, and opportunities for content developers and EHR vendors to partner with institutions to develop needed resources, and streamline their use - such as a central content site in multiple modalities while implementing approaches to allow for site-specific customization.

Also flagged:cysteinep53transcription factorsdeathcell growthtumours
Journal Article 2016-09-21 No Snippets Ding C, Fan X, Wu G.
Show Full Abstract

Peroxiredoxins (PRDXs), a ubiquitous family of redox-regulating proteins, are reported of potential to eliminate various reactive oxygen species (ROS). As a major member of the antioxidant enzymes, PRDX1 can become easily over-oxidized on its catalytically active cysteine induced by a variety of stimuli in vitro and in vivo. In nucleus, oligomeric PRDX1 directly associates with p53 or transcription factors such as c-Myc, NF-κB and AR, and thus affects their bioactivities upon gene regulation, which in turn induces or suppresses cell death. Additionally, PRDX1 in cytoplasm has anti-apoptotic potential through direct or indirect interactions with several ROS-dependent (redox regulation) effectors, including ASK1, p66<sup>Shc</sup> , GSTpi/JNK and c-Abl kinase. PRDX1 is proven to be a versatile molecule regulating cell growth, differentiation and apoptosis. Recent studies have found that PRDX1 and/or PRDX1-regulated ROS-dependent signalling pathways play an important role in the progression and metastasis of human tumours, particularly in breast, oesophageal and lung cancers. In this paper, we review the structure, effector functions of PRDX1, its role in cancer and the pivotal role of ROS in anticancer treatment.

Also flagged:Pedal Osteomyelitisosteomyelitisgadoliniumdiabetic foot infectionsinfectionsgadolinium salts
Journal Article 2016-09-21 ✓ 1 Snippet Neuwelt A, Langsjoen J, Byrd T, Eberhardt S, Mlady G, Baca J, Bocklage T, Martinez C, Orner J, Rivera M, Sillerud LO.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

Also flagged:hepatocellular carcinomatumorliver-liver tumorslactate dehydrogenaseaspartate aminotransferase
Journal Article 2016-09-21 ✓ 1 Snippet Syha R, Gatidis S, Grözinger G, Grosse U, Maurer M, Zender L, Horger M, Nikolaou K, Ketelsen D.
In-Text Gene Mentions

…n = 3),hemochromatosis( n =…

Show Full Abstract

<h4>Background</h4>This study aims to evaluate immediate changes in perfusion parameters in hepatocellular carcinoma (HCC) to transarterial chemoembolization (TACE) in C-arm computed tomography (CT) and volume perfusion CT (VPCT) and prediction of midterm tumor response.<h4>Methods</h4>Twenty-five patients (median age 66, range 61 to 75 years) with 62 HCC lesions undergoing TACE received immediate pre- and post-interventional assessment by C-arm CT and VPCT. Cross-sectional imaging was analyzed at baseline and approximately 12 weeks after TACE according to modified RECIST criteria. Outcome was defined as objective response (OR, > 30 % reduction of viable tumor) or non-OR. Perfusion parameters were evaluated in C-arm CT [parenchymal blood volume (PBV)] and VPCT [blood volume (BV) and blood flow (BF)]. Ratios of perfusion parameters before and after TACE within the tumor and the non-affected liver parenchyma were calculated.<h4>Results</h4>Correlation between tumor PBV and BV revealed a moderate correlation (rho = 0.45, p = 0.005). In non-affected liver parenchyma, a significant decrease in PBV was seen, compared to a significant increase in BF and BV. Perfusion ratios in HCC lesions were significantly (p < 0.05) increased in OR group compared to non-OR patients in C-arm CT and VPCT: PBV ratio (0.95 (0.06) to 0.67 (0.38), BV ratio 0.63 (0.34) to 0.15 (0.6), and BF ratio 0.6 (0.32) to 0.22 (0.51). Logistic regression including PBV and BF allowed prediction of OR (sensitivity 88 %/specificity of 83 %).<h4>Conclusions</h4>Perfusion parameters acquired by C-arm CT and VPCT cannot simply be substituted by each other, but show similar capability in prediction of midterm tumor response.

Also flagged:axonWntShhaxonsNetrinaxon growth
Journal Article 2016-09-21 No Snippets Alavi M, Song M, King GL, Gillis T, Propst R, Lamanuzzi M, Bousum A, Miller A, Allen R, Kidd T.
Show Full Abstract

The Slit protein is a major midline repellent for central nervous system (CNS) axons. In vivo, Slit is proteolytically cleaved into N- and C-terminal fragments, but the biological significance of this is unknown. Analysis in the Drosophila ventral nerve cord of a slit allele (slit-UC) that cannot be cleaved revealed that midline repulsion is still present but longitudinal axon guidance is disrupted, particularly across segment boundaries. Double mutants for the Slit receptors Dscam1 and robo1 strongly resemble the slit-UC phenotype, suggesting they cooperate in longitudinal axon guidance, and through biochemical approaches, we found that Dscam1 and Robo1 form a complex dependent on Slit-N. In contrast, Robo1 binding alone shows a preference for full-length Slit, whereas Dscam1 only binds Slit-N. Using a variety of transgenes, we demonstrated that Dscam1 appears to modify the output of Robo/Slit complexes so that signaling is no longer repulsive. Our data suggest that the complex is promoting longitudinal axon growth across the segment boundary. The ability of Dscam1 to modify the output of other receptors in a ligand-dependent fashion may be a general principle for Dscam proteins.

Also flagged:AtaxiasEpisodic ataxiaEAtruncal ataxiaKCNA1CACNA1A
Journal Article 2016-09-21 ✓ 1 Snippet Choi KD, Choi JH.
In-Text Gene Mentions

Other genes associated with EA include ATP1A3 [27], NALCN [28], DARS2 [29], SLC2A1 [30], FGF14 [31], and PRRT2 [32], and they have been reported to cause epilepsy and paroxysmal dyskinesia.

Show Full Abstract

Episodic ataxia (EA) is a clinically heterogeneous group of disorders that are characterized by recurrent spells of truncal ataxia and incoordination lasting minutes to hours. Most have an autosomal dominant inheritance pattern. To date, 8 subtypes have been defined according to clinical and genetic characteristics, and five genes are known to be linked to EAs. Both EA1 and EA2, which are caused by mutations in KCNA1 and CACNA1A, account for the majority of EA, but many patients with no identified mutations still exhibit EA-like clinical features. Furthermore, genetically confirmed EAs have mostly been identified in Caucasian families. In this article, we review the current knowledge on the clinical and genetic characteristics of EAs. Additionally, we summarize the phenotypic features of the genetically confirmed EA2 families in Korea.

Also flagged:Cas9hereditary movement disordersnucleasesCRISPRendonucleasezinc-finger nucleases
Journal Article 2016-09-21 No Snippets Im W, Moon J, Kim M.
Show Full Abstract

Gene therapy is a potential therapeutic strategy for treating hereditary movement disorders, including hereditary ataxia, dystonia, Huntington's disease, and Parkinson's disease. Genome editing is a type of genetic engineering in which DNA is inserted, deleted or replaced in the genome using modified nucleases. Recently, clustered regularly interspaced short palindromic repeat/CRISPR associated protein 9 (CRISPR/Cas9) has been used as an essential tool in biotechnology. Cas9 is an RNA-guided DNA endonuclease enzyme that was originally associated with the adaptive immune system of Streptococcus pyogenes and is now being utilized as a genome editing tool to induce double strand breaks in DNA. CRISPR/Cas9 has advantages in terms of clinical applicability over other genome editing technologies such as zinc-finger nucleases and transcription activator-like effector nucleases because of easy in vivo delivery. Here, we review and discuss the applicability of CRISPR/Cas9 to preclinical studies or gene therapy in hereditary movement disorders.

Also flagged:Tourette SyndromeTScitalopramobsessive compulsive disorderHDCSLITRK1
Journal Article 2016-09-21 ✓ 1 Snippet Alexander J, Potamianou H, Xing J, Deng L, Karagiannidis I, Tsetsos F, Drineas P, Tarnok Z, Rizzo R, Wolanczyk T, Farkas L, Nagy P, Szymanska U, Androutsos C, Tsironi V, Koumoula A, Barta C, TSGeneSEE, Sandor P, Barr CL, Tischfield J, Paschou P, Heiman GA, Georgitsi M.
In-Text Gene Mentions

…( SERT ,5-HTT), coding for a…

Show Full Abstract

Although the genetic basis of Tourette Syndrome (TS) remains unclear, several candidate genes have been implicated. Using a set of 382 TS individuals of European ancestry we investigated four candidate genes for TS (<i>HDC, SLITRK1, BTBD9</i>, and <i>SLC6A4</i>) in an effort to identify possibly causal variants using a targeted re-sequencing approach by next generation sequencing technology. Identification of possible disease causing variants under different modes of inheritance was performed using the algorithms implemented in VAAST. We prioritized variants using Variant ranker and validated five rare variants via Sanger sequencing in <i>HDC</i> and <i>SLITRK1</i>, all of which are predicted to be deleterious. Intriguingly, one of the identified variants is in linkage disequilibrium with a variant that is included among the top hits of a genome-wide association study for response to citalopram treatment, an antidepressant drug with off-label use also in obsessive compulsive disorder. Our findings provide additional evidence for the implication of these two genes in TS susceptibility and the possible role of these proteins in the pathobiology of TS should be revisited.

Also flagged:Huntington diseaseHDdegradationcytosineadenineguanine
Journal Article 2016-09-21 ✓ 2 Snippets Ciarochi JA, Calhoun VD, Lourens S, Long JD, Johnson HJ, Bockholt HJ, Liu J, Plis SM, Paulsen JS, Turner JA, PREDICT-HD Investigators and Coordinators of the Huntington Study Group.
In-Text Gene Mentions

Huntington disease (HD) is caused by an abnormally expanded cytosine–adenine–guanine (CAG) trinucleotide repeat in the HTT gene.

…repeat in theHTTgene.…

Show Full Abstract

Huntington disease (HD) is caused by an abnormally expanded cytosine-adenine-guanine (CAG) trinucleotide repeat in the <i>HTT</i> gene. Age and CAG-expansion number are related to age at diagnosis and can be used to index disease progression. However, observed onset-age variability suggests that other factors also modulate progression. Indexing prodromal (pre-diagnosis) progression may highlight therapeutic targets by isolating the earliest-affected factors. We present the largest prodromal HD application of the univariate method voxel-based morphometry (VBM) and the first application of the multivariate method source-based morphometry (SBM) to, respectively, compare gray matter concentration (GMC) and capture co-occurring GMC patterns in control and prodromal participants. Using structural MRI data from 1050 (831 prodromal, 219 control) participants, we characterize control-prodromal, whole-brain GMC differences at various prodromal stages. Our results provide evidence for (1) regional co-occurrence and differential patterns of decline across the prodrome, with parietal and occipital differences commonly co-occurring, and frontal and temporal differences being relatively independent from one another, (2) fronto-striatal circuits being among the earliest and most consistently affected in the prodrome, (3) delayed degradation in some movement-related regions, with increasing subcortical and occipital differences with later progression, (4) an overall superior-to-inferior gradient of GMC reduction in frontal, parietal, and temporal lobes, and (5) the appropriateness of SBM for studying the prodromal HD population and its enhanced sensitivity to early prodromal and regionally concurrent differences.

Also flagged:Deathsudden infant death syndromeSIDSSudden Intrauterine Unexpected Death Syndromessudden intrauterine unexplained/unexpected death syndromestillbirth
Journal Article 2016-09-21 ✓ 2 Snippets Ottaviani G.
In-Text Gene Mentions

At least four categories of genes are involved in the pathogenesis of SIDS and SIUDS: genes for ion channel proteins involved in cardiac channelopathies, mainly the sodium channel gene (SCN5A/LQT3) and the potassium channel genes (KCNQ, KCNH12, KCNE2); genes regulating the brainstem functions, such as serotonin transporter (5-HTT), the regulator of the synaptic serotonergic receptor binding in the brainstem, PHOX2B, the major gene involved in congenital central hypoventilation syndrome (CCHS), and En-2, involved in the development of the autonomic nervous system; genes regulating inflammation and infections, such polymorphisms in complement C4 and interleukins IL-6 and IL-10; genes regulating energy production, hypoglycemia, and thermal regulation, such as the medium-chain acyl CoA dehydrogenase (MCAD) genes (2, 7, 8).

…serotonin transporter (5-HTT), the regulator…

Show Full Abstract

Crib death, or sudden infant death syndrome (SIDS), is the most frequent form of death in the first year of life, striking one baby in every 1,700-2,000. Yet, despite advances in maternal-infant care, sudden intrauterine unexplained/unexpected death syndrome (SIUDS) has a sixfold to eightfold greater incidence than that of SIDS. Frequent congenital abnormalities, likely morphological substrates for SIDS-SIUDS, were detected, mainly represented by alterations of the cardiac conduction system, such as accessory pathways and abnormal resorptive degeneration, and hypoplasia/agenesis of the vital brainstem structures. On the basis of these considerations, the new common definition of the SIDS-SIUDS complex is "The sudden death of a fetus after the 25th gestational week or infant under one year of age which is unexpected by history and remains unexplained after a thorough case investigation, including examination of the death scene, performance of a general autopsy and examination of the fetal adnexa". Therefore, given that the general autopsy does not disclose any cause of death, a more in-depth histopathological analysis of the cardiac conduction system and autonomic nervous system by specialized pathologists is necessary.

Also flagged:Colorectal Cancerascancernucleotidemethylationadenomas
Journal Article 2016-09-21 No Snippets Brim H, Ashktorab H.
Show Full Abstract

Genome-wide studies are increasingly becoming a must, especially for complex diseases such as cancer where multiple genes and diverse molecular mechanisms are known to be involved in genes' function alteration. In this review, we report our latest genomic and epigenomic findings in African-American colorectal cancer patients. This population suffers a higher burden of the disease and most investigators in this field are looking for the underlying genetic and epigenetic targets that might be responsible for this disparity. We here report genome-wide copy number variations, single nucleotide mutations and DNA methylation findings that might be specific to this population.

Also flagged:Vitamin DNAFLDpathogenesiscell differentiationgene expressionmetabolism
Journal Article 2016-09-20 ✓ 1 Snippet Patel YA, Henao R, Moylan CA, Guy CD, Piercy DL, Diehl AM, Abdelmalek MF.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objectives</h4>The pathogenesis of nonalcoholic fatty liver disease (NAFLD) is complex. Vitamin D (VitD) has been implicated in NAFLD pathogenesis because it has roles in immune modulation, cell differentiation and proliferation, and regulation of inflammation. We evaluated the association of VitD levels, hepatic gene expression for VitD metabolizing genes, and NAFLD histological severity.<h4>Methods</h4>Two adult cohorts, controls (n=39) and NAFLD (n=244), who underwent liver biopsy were compared. Two-sided t-tests or Wilcoxon's rank-sum tests for continuous predictors and chi-squared tests or Fisher's exact tests for categorical variables were used to analyze the association of VitD and NAFLD. Generalized linear models were used to analyze the association of VitD levels and VitD metabolizing genes with histological severity of NAFLD while adjusting for potential confounders and correcting for multiple comparisons.<h4>Results</h4>NAFLD patients were more likely than controls to have higher HbA1c (6.5±1.2 vs 5.9±1.0; P=0.009), a risk factor for VitD deficiency. However, no difference in VitD levels was observed between groups. VitD levels did not correlate with the severity of hepatic steatosis, lobular or portal inflammation, or ballooned hepatocytes after adjusting for confounding factors. Furthermore, no association was noted between VitD deficiency or differential expression of genes involved in VitD metabolism and severity of hepatic fibrosis or any other histologic feature of NAFLD.<h4>Conclusions</h4>Neither VitD deficiency, nor hepatic expression of VitD-related genes, associate with the presence or histologic severity of NAFLD in patients. Hence, despite preclinical evidence implicating VitD in NAFLD pathogenesis, VitD deficiency does not appear to be associated with NAFLD severity in humans.

Also flagged:Raf kinase inhibitory proteinserinenasopharyngeal carcinomaRKIPRaf kinase inhibitor proteinmetastasis suppressor gene
Journal Article 2016-09-20 No Snippets Li S, Liu T, Mo W, Hou Q, Zhou Y, Liu M, He Z, Liu Z, Chen Q, Wang H, Guo X, Xia W, Zeng M, Zhao H.
Show Full Abstract

<h4>Background</h4>Radiation is an effective treatment against nasopharyngeal carcinoma (NPC). However, radioresistance-induced locoregional recurrence remains as a major cause of treatment failure. Therefore, radiosensitivity indicators prior to treatment should be developed to screen radioresistant patients. Previous studies revealed that RKIP (Raf kinase inhibitor protein) is associated with NPC prognosis and radiosensitivity. However, the relationship of p-Ser153 RKIP (RKIP in a phosphorylated form at residue serine153) expression with the effect of radiation and prognosis of NPC patients is not elucidated. Thus, these clinical implication of the phosphorylated RKIP in NPC has yet to be described.<h4>Methods</h4>The effect of p-Ser153 RKIP on locoregional relapse-free survival (LRRFS) was first analyzed in a retrospective cohort of NPC patients without distant metastasis at initial diagnosis. They received radical intensity-modulated radiotherapy alone. Of 180 patients were enrolled in the ongoing matched pair study. The patients were re-classified into radioresistant group or radiosensitive group on the basis of the specified criteria. Patients in the two groups were matched in terms of radiosensitivity-related factors. p-Ser153 RKIP was examined by immunohistochemical staining on a NPC tissue microarray before radiotherapy. The relationship between the expression of p-Ser153 RKIP and the effect of radiotherapy was also analyzed.<h4>Results</h4>In this study, a retrospective cohort with 733 cases who received radical radiotherapy alone was established. Using the cohort, we validated that the p-Ser153 RKIP expression observed through immunohistochemical staining in a pretreatment NPC tissue microarray was an independent prognostic factor of LRRFS and OS; we also confirmed that endemic patients with a positive p-Ser153 RKIP expression benefited from irradiation alone in terms of locoregional relapse-free survival. A total of 180 patients were enrolled in a matched pair study. Both groups were well matched in terms of radiosensitivity-related factors. On the basis of the p-Ser153 RKIP expression, we predicted the following data: 80.0 % sensitivity, 73.3 % specificity, 76.7 % accuracy, 75.0 % positive predictive value, and 78.6 % negative predictive value.<h4>Conclusions</h4>Our results revealed for the first time that positive p-Ser153 RKIP expression was a favorable prognostic factor. It was also positively correlated with the radiosensitivity of NPC. p-Ser153 RKIP could also be used as a biomolecular marker with good availability and authenticity to preliminarily screen NPC-related clinical radiosensitivity.

Also flagged:AutophagyFYVEWDFY3protein degradationAutophagy linked FYVE proteinAlfy
Journal Article 2016-09-20 ✓ 4 Snippets Dragich JM, Kuwajima T, Hirose-Ikeda M, Yoon MS, Eenjes E, Bosco JR, Fox LM, Lystad AH, Oo TF, Yarygina O, Mita T, Waguri S, Ichimura Y, Komatsu M, Simonsen A, Burke RE, Mason CA, Yamamoto A.
In-Text Gene Mentions

The following antibodies were used for western blot, immunocytochemistry, immunohistochemistry, in situ hybridization and immunoprecipitation experiments: Anti-Alfy (rabbit polyclonal anti-COOH Alfy; generously provided by Dr. Anne Simonsen and used for western blots and immunoprecipitation), anti-Alfy-N1 (rabbit polyclonal anti-NH3 Alfy; generously provided by Dr. Masaaki Komatsu and used for western blots), anti-BrdU clone BU-33 (B2531, Sigma-Aldrich [St. Louis, MO]), anti-Caspase 3 active/cleaved form (AB3623, EMD Millipore [Germany]), anti-Class βIII-Tubulin (PRB-435P, Covance [Princeton, NJ]), anti-Human DCC (554222, BD Biosciences [San Jose, CA]), anti-Digoxigenin-AP, Fab fragments (Roche [Switzerland]), anti-Doublecortin (ab18723, Abcam [Cambridge, MA]), anti-GFAP, clone GA5 (MAB3402, EMD Millipore), anti-LC3 (for immunofluorescence, rabbit polyclonal; generously provided by Ron Kopito), anti-LC3B (for western blots, ab48394, Abcam), anti-Ki67 clone B56 (550609, BD Biosciences), anti-MAP-2 (ab11267, Abcam), anti-NCAML1, clone 324 (MAB5272, EMD Millipore), anti-Neurofilament clone2H3 (developed by TM Jessell and J Dodd and was obtained from the Developmental Studies Hybridoma Bank developed under the auspices of the NICHD and maintained by the University of Iowa), anti-Robo1 (H-200, Santa Cruz Biotechnology [Santa Cruz, CA]), anti-synaptophysin (101 002, Synaptic Systems [Germany]), anti-Tau-1, clone PC1C6 (MAB3420, EMD Millipore), anti-Tbr1 (AB2261, EMD Millipore), and anti-Ubiquitin, clone FK2 (Enzo Life Sciences [Farmingdale, NY]).

…[Princeton, NJ]), anti-HumanDCC(554222, BD Biosciences…

…in colorectal cancer (Dcc) KO (…

…guidance cue receptorDCC( Figure 7—figure…

Show Full Abstract

The regulation of protein degradation is essential for maintaining the appropriate environment to coordinate complex cell signaling events and to promote cellular remodeling. The Autophagy linked FYVE protein (Alfy), previously identified as a molecular scaffold between the ubiquitinated cargo and the autophagic machinery, is highly expressed in the developing central nervous system, indicating that this pathway may have yet unexplored roles in neurodevelopment. To examine this possibility, we used mouse genetics to eliminate Alfy expression. We report that this evolutionarily conserved protein is required for the formation of axonal tracts throughout the brain and spinal cord, including the formation of the major forebrain commissures. Consistent with a phenotype reflecting a failure in axon guidance, the loss of Alfy in mice disrupts localization of glial guidepost cells, and attenuates axon outgrowth in response to Netrin-1. These findings further support the growing indication that macroautophagy plays a key role in the developing CNS.

Also flagged:Keap1Nrf2hepatocellular carcinomacytoplasmiccancersorafenib
Journal Article 2016-09-20 ✓ 3 Snippets Chen J, Yu Y, Ji T, Ma R, Chen M, Li G, Li F, Ding Q, Kang Q, Huang D, Liang X, Lin H, Cai X.
In-Text Gene Mentions

investigated the correlation of Keap1 and Nrf2 expression and pathological features in oral squamous‐cell carcinoma (OSCC) and elucidated that the oxidative stress markers, Keap1, Nrf2, Prdx6, and CD147 were significantly correlated with each other and had prognostic value as potential therapeutic targets in OSCC 10.

elucidated that the oxidative stress markers, Keap1, Nrf2, Prdx6, and CD147 were significantly correlated with each other in OSCC 10.

…markers, Keap1, Nrf2,Prdx6, and CD147 were…

Show Full Abstract

In this paper, variation tendency of phosphorylated Nrf2, as the activated form of native Nrf2, was studied in 107 primary hepatocellular carcinoma (HCC) specimens treated by curative hepatectomy. Moreover, the coexpression of oxidative stress markers Keap1 and pNrf2, and their association with pathological features were also evaluated based on those specimens. The results showed that preserved cytoplasmic Keap1 expression of cancer cells was observed in 59 HCCs, while reduced Keap1 expression was determined in remaining 48 ones. With regarding to nuclear pNrf2 expression, 75 HCCs were defined as high and the other 32 ones as low. There was a significant association between Keap1 and pNrf2 expression in HCCs. Higher pNrf2 expression was observed, at a more substantial proportion, in those specimens with reduced Keap1 expression, compared to those with preserved Keap1 expression. The subset with higher pNrf2 and reduced Keap1 expression was defined as pNrf2<sup>+</sup> Keap1<sup>-</sup> . According to the analysis of prognosis, this subset was significantly associated with poor 5-year overall survival and worse disease-free survival in HCCs, indicating that pNrf2 and Keap1 were two-functional biomolecules, not only the oxidative stress markers but also biomarkers for prognosis of HCCs.

Also flagged:S15S12S18S16neurogenesiskey
Journal Article 2016-09-20 ✓ 5 Snippets Mendoza-Parra MA, Malysheva V, Mohamed Saleem MA, Lieb M, Godel A, Gronemeyer H.
In-Text Gene Mentions

Sox6

POU3F2

…Pbx1, Pbx2, Cdh2,Sox6, and Sox11…

…like NEUROD1, NEUROG2,POU3F2, or MYT1L, reconstitute…

…NEUROG1, NEUROG2, and/orPOU3F2( Fig. 6…

Show Full Abstract

Cell lineages, which shape the body architecture and specify cell functions, derive from the integration of a plethora of cell intrinsic and extrinsic signals. These signals trigger a multiplicity of decisions at several levels to modulate the activity of dynamic gene regulatory networks (GRNs), which ensure both general and cell-specific functions within a given lineage, thereby establishing cell fates. Significant knowledge about these events and the involved key drivers comes from homogeneous cell differentiation models. Even a single chemical trigger, such as the morphogen all-trans retinoic acid (RA), can induce the complex network of gene-regulatory decisions that matures a stem/precursor cell to a particular step within a given lineage. Here we have dissected the GRNs involved in the RA-induced neuronal or endodermal cell fate specification by integrating dynamic RXRA binding, chromatin accessibility, epigenetic promoter epigenetic status, and the transcriptional activity inferred from RNA polymerase II mapping and transcription profiling. Our data reveal how RA induces a network of transcription factors (TFs), which direct the temporal organization of cognate GRNs, thereby driving neuronal/endodermal cell fate specification. Modeling signal transduction propagation using the reconstructed GRNs indicated critical TFs for neuronal cell fate specification, which were confirmed by CRISPR/Cas9-mediated genome editing. Overall, this study demonstrates that a systems view of cell fate specification combined with computational signal transduction models provides the necessary insight in cellular plasticity for cell fate engineering. The present integrated approach can be used to monitor the in vitro capacity of (engineered) cells/tissues to establish cell lineages for regenerative medicine.

Also flagged:H3K4me3Mm9lncRNAsatrazinespermiogenesisSP
Journal Article 2016-09-20 ✓ 5 Snippets Hao C, Gely-Pernot A, Kervarrec C, Boudjema M, Becker E, Khil P, Tevosian S, Jégou B, Smagulova F.
In-Text Gene Mentions

…Cox18, Fdxr, Gcat,Htt, Mrpl55, Mtrf1, Ndufs2,…

…Zfpm2, Foxc2, Foxk1,Sox6, Sox14, Sp5, Asxl2…

…including Rfx8, Zfpm2,Sox6and Klf2 .…

…promoters of Pou5f1,Sox6, Klf1, Klf2, Foxh1,…

…Ezh2, Zhx2 andSox6among others (Supplementary…

Show Full Abstract

The epigenetic events imposed during germline reprogramming and affected by harmful exposure can be inherited and transferred to subsequent generations via gametes inheritance. In this study, we examine the transgenerational effects promoted by widely used herbicide atrazine (ATZ). We exposed pregnant outbred CD1 female mice and the male progeny was crossed for three generations with untreated females. We demonstrate here that exposure to ATZ affects meiosis, spermiogenesis and reduces the spermatozoa number in the third generation (F3) male mice. We suggest that changes in testis cell types originate from modified transcriptional network in undifferentiated spermatogonia. Importantly, exposure to ATZ dramatically increases the number of transcripts with novel transcription initiation sites, spliced variants and alternative polyadenylation sites. We found the global decrease in H3K4me3 occupancy in the third generation males. The regions with altered H3K4me3 occupancy in F3 ATZ-derived males correspond to altered H3K4me3 occupancy of F1 generation and 74% of changed peaks in F3 generation are associated with enhancers. The regions with altered H3K4me3 occupancy are enriched in SP family and WT1 transcription factor binding sites. Our data suggest that the embryonic exposure to ATZ affects the development and the changes induced by ATZ are transferred up to three generations.

Also flagged:phosphorylationkinasesphosphatasesprotein kinasesprotein phosphataseslocalization
Journal Article 2016-09-20 No Snippets Chiang DY, Heck AJ, Dobrev D, Wehrens XH.
Show Full Abstract

Reversible phosphorylation of proteins is a delicate yet dynamic balancing act between kinases and phosphatases, the disturbance of which underlies numerous disease processes. While our understanding of protein kinases has grown tremendously over the past decades, relatively little is known regarding protein phosphatases. This may be because protein kinases are great in number and relatively specific in function, and thereby amenable to be studied in isolation, whereas protein phosphatases are much less abundant and more nonspecific in their function. To achieve subcellular localization and substrate specificity, phosphatases depend on partnering with a large number of regulatory subunits, protein scaffolds and/or other interactors. This added layer of complexity presents a significant barrier to their study, but holds the key to unexplored opportunities for novel pharmacologic intervention. In this review we focus on serine/threonine protein phosphatase type-1 (PP1), which plays an important role in cardiac physiology and pathophysiology. Although much work has been done to investigate the role of PP1 in cardiac diseases including atrial fibrillation and heart failure, most of these studies were limited to examining and manipulating the catalytic subunit(s) of PP1 without adequately considering the PP1 interactors, which give specificity to PP1's functions. To complement these studies, three unbiased methods have been developed and applied to the mapping of the PP1 interactome: bioinformatics approaches, yeast two-hybrid screens, and affinity-purification mass spectrometry. The application of these complementary methods has the potential to generate a detailed cardiac PP1 interactome, which is an important step in identifying novel and targeted pharmacological interventions.

Also flagged:mitochondrial disordersMitochondrial Diseasesmitochondrial diseaseInborn Errors ofMetabolismmitochondrial
Journal Article 2016-09-20 No Snippets Camp KM, Krotoski D, Parisi MA, Gwinn KA, Cohen BH, Cox CS, Enns GM, Falk MJ, Goldstein AC, Gopal-Srivastava R, Gorman GS, Hersh SP, Hirano M, Hoffman FA, Karaa A, MacLeod EL, McFarland R, Mohan C, Mulberg AE, Odenkirchen JC, Parikh S, Rutherford PJ, Suggs-Anderson SK, Tang WH, Vockley J, Wolfe LA, Yannicelli S, Yeske PE, Coates PM.
Show Full Abstract

In December 2014, a workshop entitled "Nutritional Interventions in Primary Mitochondrial Disorders: Developing an Evidence Base" was convened at the NIH with the goals of exploring the use of nutritional interventions in primary mitochondrial disorders (PMD) and identifying knowledge gaps regarding their safety and efficacy; identifying research opportunities; and forging collaborations among researchers, clinicians, patient advocacy groups, and federal partners. Sponsors included the NIH, the Wellcome Trust, and the United Mitochondrial Diseases Foundation. Dietary supplements have historically been used in the management of PMD due to their potential benefits and perceived low risk, even though little evidence exists regarding their effectiveness. PMD are rare and clinically, phenotypically, and genetically heterogeneous. Thus patient recruitment for randomized controlled trials (RCTs) has proven to be challenging. Only a few RCTs examining dietary supplements, singly or in combination with other vitamins and cofactors, are reported in the literature. Regulatory issues pertaining to the use of dietary supplements as treatment modalities further complicate the research and patient access landscape. As a preface to exploring a research agenda, the workshop included presentations and discussions on what PMD are; how nutritional interventions are used in PMD; challenges and barriers to their use; new technologies and approaches to diagnosis and treatment; research opportunities and resources; and perspectives from patient advocacy, industry, and professional organizations. Seven key areas were identified during the workshop. These areas were: 1) defining the disease, 2) clinical trial design, 3) biomarker selection, 4) mechanistic approaches, 5) challenges in using dietary supplements, 6) standards of clinical care, and 7) collaboration issues. Short- and long-term goals within each of these areas were identified. An example of an overarching goal is the enrollment of all individuals with PMD in a natural history study and a patient registry to enhance research capability. The workshop demonstrates an effective model for fostering and enhancing collaborations among NIH and basic research, clinical, patient, pharmaceutical industry, and regulatory stakeholders in the mitochondrial disease community to address research challenges on the use of dietary supplements in PMD.

Also flagged:dotoxygenwaterperylenecancertriphenylphosphine
Journal Article 2016-09-20 No Snippets Shamirian A, Afsari HS, Hassan A, Miller LW, Snee PT.
Show Full Abstract

A quantum-dot based ratiometric fluorescent oxygen probe for the detection of hypoxia in live cells is reported. The system is comprised of a water-soluble near-infrared emissive quantum dot conjugated to perylene dye. The response to the oxygen concentration is investigated using enzymatic oxygen scavenging in water, while <i>in vitro</i> studies were performed with HeLa cells incubated under varying O<sub>2</sub> levels. In both cases a significant enhancement in dye/QD emission intensity ratio was observed in the deoxygenated environment, demonstrating the possible use of this probe for cancer research.

Also flagged:Colorectal CancerCancertranslationaltumortumorsimmune responses
Journal Article 2016-09-20 No Snippets Manne U, Jadhav T, Putcha BK, Samuel T, Soni S, Shanmugam C, Suswam EA.
Show Full Abstract

This review provides updates on the efforts for the development of prognostic and predictive markers in colorectal cancer based on the race/ethnicity of patients. Since the clinical consequences of genetic and molecular alterations differ with patient race and ethnicity, the usefulness of these molecular alterations as biomarkers needs to be evaluated in different racial/ethnic groups. To accomplish personalized patient care, a combined analysis of multiple molecular alterations in DNA, RNA, microRNAs (miRNAs), metabolites, and proteins in a single test is required to assess disease status in a precise way. Therefore, a special emphasis is placed on issues related to utility of recently identified genetic and molecular alterations in genes, miRNAs, and various "-omes" (e.g., proteomes, kinomes, metabolomes, exomes, methylomes) as candidate molecular markers to determine cancer progression (disease recurrence/relapse and metastasis) and to assess the efficacy of therapy in colorectal cancer in relation to patient race and ethnicity. This review will be useful for oncologists, pathologists, and basic and translational researchers.

Also flagged:SynthesisCellulosehydroxyapatitephosphorussodiumcreatine
Journal Article 2016-09-20 No Snippets Fu LH, Liu YJ, Ma MG, Zhang XM, Xue ZM, Zhu JF.
Show Full Abstract

In this paper, we report a facile, rapid, and green strategy for the synthesis of cellulose/hydroxyapatite (HA) nanocomposites using an inorganic phosphorus source (sodium dihydrogen phosphate dihydrate (NaH₂PO₄·2H₂O)), or organic phosphorus sources (adenosine 5'-triphosphate disodium salt (ATP), creatine phosphate disodium salt tetrahydrate (CP), or D-fructose 1,6-bisphosphate trisodium salt octahydrate (FBP)) through the microwave-assisted hydrothermal method. The effects of the phosphorus sources, heating time, and heating temperature on the phase, size, and morphology of the products were systematically investigated. The experimental results revealed that the phosphate sources played a critical role on the phase, size, and morphology of the minerals in the nanocomposites. For example, the pure HA was obtained by using NaH₂PO₄·2H₂O as phosphorus source, while all the ATP, CP, and FBP led to the byproduct, calcite. The HA nanostructures with various morphologies (including nanorods, pseudo-cubic, pseudo-spherical, and nano-spherical particles) were obtained by varying the phosphorus sources or adjusting the reaction parameters. In addition, this strategy is surfactant-free, avoiding the post-treatment procedure and cost for the surfactant removal from the product. We believe that this work can be a guidance for the green synthesis of cellulose/HA nanocomposites in the future.

Also flagged:graphene oxidecarbon nanotubeaxoncarbon nanotubesacrylateethylene glycol) acrylate
Journal Article 2016-09-20 No Snippets Liu X, Miller Ii AL, Park S, Waletzki BE, Terzic A, Yaszemski MJ, Lu L.
Show Full Abstract

Healing of nerve injuries is a critical medical issue. Biodegradable polymeric conduits are a promising therapeutic solution to provide guidance for axon growth in a given space, thus helping nerve heal. Extensive studies in the past decade reported that conductive materials could effectively increase neurite and axon extension in vitro and nerve regeneration in vivo. In this study, graphene oxide and carbon nanotubes were covalently functionalized with double bonds to obtain crosslinkable graphene oxide acrylate (GOa) sheets and carbon nanotube poly(ethylene glycol) acrylate (CNTpega). An electrically conductive reduced GOa-CNTpega-oligo(polyethylene glycol fumarate) (OPF) hydrogel (rGOa-CNTpega-OPF) was successfully fabricated by chemically crosslinking GOa sheets and CNTpega with OPF chains followed by in situ chemical reduction in l-ascorbic acid solution. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) imaging showed homogenous distribution of GOa/CNTpega carbon content in the rGOa-CNTpega-OPF composite hydrogel, resulting in a significant increase of electrical conductivity compared with neutral OPF without carbon content. Cell studies showed excellent biocompatibility and distinguished PC12 cell proliferation and spreading on the rGOa-CNTpega-OPF composite hydrogel. Fluorescent microscopy imaging demonstrated robustly stimulated neurite development in these cells on a conductive rGOa-CNTpega-OPF composite hydrogel compared with that on neutral OPF hydrogels. These results illustrated a promising potential for the rGOa-CNTpega-OPF composite hydrogel to serve as conduits for neural tissue engineering.

Also flagged:transcription factorbindingCTCFRNAPIIhistonemethylation
Journal Article 2016-09-19 No Snippets Glinsky GV.
Show Full Abstract

Thousands of candidate human-specific regulatory sequences (HSRS) have been identified, supporting the hypothesis that unique to human phenotypes result from human-specific alterations of genomic regulatory networks. Collectively, a compendium of multiple diverse families of HSRS that are functionally and structurally divergent from Great Apes could be defined as the backbone of human-specific genomic regulatory networks. Here, the conservation patterns analysis of 18,364 candidate HSRS was carried out requiring that 100% of bases must remap during the alignments of human, chimpanzee, and bonobo sequences. A total of 5,535 candidate HSRS were identified that are: (i) highly conserved in Great Apes; (ii) evolved by the exaptation of highly conserved ancestral DNA; (iii) defined by either the acceleration of mutation rates on the human lineage or the functional divergence from non-human primates. The exaptation of highly conserved ancestral DNA pathway seems mechanistically distinct from the evolution of regulatory DNA segments driven by the species-specific expansion of transposable elements. Genome-wide proximity placement analysis of HSRS revealed that a small fraction of topologically associating domains (TADs) contain more than half of HSRS from four distinct families. TADs that are enriched for HSRS and termed rapidly evolving in humans TADs (revTADs) comprise 0.8-10.3% of 3,127 TADs in the hESC genome. RevTADs manifest distinct correlation patterns between placements of human accelerated regions, human-specific transcription factor-binding sites, and recombination rates. There is a significant enrichment within revTAD boundaries of hESC-enhancers, primate-specific CTCF-binding sites, human-specific RNAPII-binding sites, hCONDELs, and H3K4me3 peaks with human-specific enrichment at TSS in prefrontal cortex neurons (P < 0.0001 in all instances). Present analysis supports the idea that phenotypic divergence of Homo sapiens is driven by the evolution of human-specific genomic regulatory networks via at least two mechanistically distinct pathways of creation of divergent sequences of regulatory DNA: (i) recombination-associated exaptation of the highly conserved ancestral regulatory DNA segments; (ii) human-specific insertions of transposable elements.

Also flagged:dinucleotidedinucleotidesbindingcytokinetumor
Journal Article 2016-09-19 No Snippets Liu B, Liu Y, Jin X, Wang X, Liu B.
Show Full Abstract

Meiotic recombination presents an uneven distribution across the genome. Genomic regions that exhibit at relatively high frequencies of recombination are called hotspots, whereas those with relatively low frequencies of recombination are called coldspots. Therefore, hotspots and coldspots would provide useful information for the study of the mechanism of recombination. In this study, we proposed a computational predictor called iRSpot-DACC to predict hot/cold spots across the yeast genome. It combined Support Vector Machines (SVMs) and a feature called dinucleotide-based auto-cross covariance (DACC), which is able to incorporate the global sequence-order information and fifteen local DNA properties into the predictor. Combined with Principal Component Analysis (PCA), its performance was further improved. Experimental results on a benchmark dataset showed that iRSpot-DACC can achieve an accuracy of 82.7%, outperforming some highly related methods.

Also flagged:methylationprotocadherin 17acute lymphoblastic leukemiaALLcadherin-
Journal Article 2016-09-19 ✓ 5 Snippets Uyen TN, Sakashita K, Al-Kzayer LF, Nakazawa Y, Kurata T, Koike K.
In-Text Gene Mentions

Aberrant methylation of protocadherin 17 and its prognostic value in pediatric acute lymphoblastic leukemia.

Univariate and multivariate analyses showed that only PCDH17 methylation was associated with an increased risk for relapse and mortality in patients with BCP ALL.<h4>Conclusion</h4>PCDH17 methylation at diagnosis was closely related to poor prognosis and thus could be used as a new biomarker to predict relapse in patients with BCP ALL.

…(PCDH) 8, andPCDH17were selected for…

…CDH1, PCDH8, andPCDH17were 62.5, 55,…

…On the contrary,PCDH17was unmethylated in…

Show Full Abstract

<h4>Background</h4>The outcome of approximately 20% of patients with acute lymphoblastic leukemia (ALL) remains poor because of disease recurrence. We examined whether DNA methylation of cadherin superfamily genes is a useful biomarker for ALL relapse.<h4>Procedure</h4>We used Infinium Methylation 450K Arrays to assess genome-wide DNA methylation status. The methylation status of each individual gene was then determined by a combination of bisulfite restriction analysis and genome bisulfite sequencing. mRNA expression was evaluated by reverse-transcriptase PCR (RT-PCR) and quantitative real-time PCR.<h4>Results</h4>Cadherin superfamily genes including cadherin (CDH) 1, protocadherin (PCDH) 8, and PCDH17 were selected for analysis of methylation status. In 40 patient samples with B-cell precursor (BCP) ALL at diagnosis, the methylation frequencies of CDH1, PCDH8, and PCDH17 were 62.5, 55, and 30%, respectively. CDH1 and PCDH8 methylation was also detected in 80 and 20% of control bone marrow (BM) samples, respectively. On the contrary, PCDH17 was unmethylated in all control BM samples. There was a significant correlation between the methylation status of PCDH17 (but not CDH1 and PCDH8) and event-free survival or overall survival. Univariate and multivariate analyses showed that only PCDH17 methylation was associated with an increased risk for relapse and mortality in patients with BCP ALL.<h4>Conclusion</h4>PCDH17 methylation at diagnosis was closely related to poor prognosis and thus could be used as a new biomarker to predict relapse in patients with BCP ALL.

Also flagged:melanomanon-melanoma skin cancerscancergene expressionskin cancercell proliferation
Journal Article 2016-09-19 No Snippets Shen Y, Kim AL, Du R, Liu L.
Show Full Abstract

Exposure to ultraviolet radiation (UVR) is a major risk factor for both melanoma and non-melanoma skin cancers. In addition to its mutagenic effect, UVR can also induce substantial transcriptional instability in skin cells affecting thousands of genes, including many cancer genes, suggesting that transcriptional instability may be another important etiological factor in skin photocarcinogenesis. In this study, we performed detailed transcriptomic profiling studies to characterize the kinetic changes in global gene expression in human keratinocytes exposed to different UVR conditions. We identified a subset of UV-responsive genes as UV signature genes (UVSGs) based on 1) conserved UV-responsiveness of this subset of genes among different keratinocyte lines; and 2) UV-induced persistent changes in their mRNA levels long after exposure. Interestingly, 11 of the UVSGs were shown to be critical to skin cancer cell proliferation and survival. Through computational Gene Set Enrichment Analysis, we demonstrated that a significant portion of the UVSGs were dysregulated in human skin squamous cell carcinomas, but not in other human malignancies. This highlights the potential and specificity of the UVSGs in clinical diagnosis of UV damage and stratification of skin cancer risk.

Also flagged:Sidekick (Sdk) 1immunoglobulincell adhesion proteinssynaptic connectionscell-cell adhesionSdk1
Journal Article 2016-09-19 ✓ 2 Snippets Goodman KM, Yamagata M, Jin X, Mannepalli S, Katsamba PS, Ahlsén G, Sergeeva AP, Honig B, Honig B, Sanes JR, Shapiro L.
In-Text Gene Mentions

…in colorectal cancer (DCC), CNTN, L1, Dscam,…

…Watkins, 2010 ),DCC( Chen et…

Show Full Abstract

Sidekick (Sdk) 1 and 2 are related immunoglobulin superfamily cell adhesion proteins required for appropriate synaptic connections between specific subtypes of retinal neurons. Sdks mediate cell-cell adhesion with homophilic specificity that underlies their neuronal targeting function. Here we report crystal structures of Sdk1 and Sdk2 ectodomain regions, revealing similar homodimers mediated by the four N-terminal immunoglobulin domains (Ig1-4), arranged in a horseshoe conformation. These Ig1-4 horseshoes interact in a novel back-to-back orientation in both homodimers through Ig1:Ig2, Ig1:Ig1 and Ig3:Ig4 interactions. Structure-guided mutagenesis results show that this canonical dimer is required for both Sdk-mediated cell aggregation (via <i>trans</i> interactions) and Sdk clustering in isolated cells (via <i>cis</i> interactions). Sdk1/Sdk2 recognition specificity is encoded across Ig1-4, with Ig1-2 conferring the majority of binding affinity and differential specificity. We suggest that competition between <i>cis</i> and <i>trans</i> interactions provides a novel mechanism to sharpen the specificity of cell-cell interactions.

Also flagged:translation initiationtranslationalribosomeamino acidGene ExpressionPVRIG
Journal Article 2016-09-19 ✓ 3 Snippets Jagannathan S, Bradley RK.
In-Text Gene Mentions

…NDUFV3 , andTRIM38all produced a…

…the NDUFV3 andTRIM38nonsense variants produced…

…in NDUFV3 andTRIM38were expressed in…

Show Full Abstract

Genetic variants that disrupt protein-coding DNA are ubiquitous in the human population, with about 100 such loss-of-function variants per individual. While most loss-of-function variants are rare, a subset have risen to high frequency and occur in a homozygous state in healthy individuals. It is unknown why these common variants are well tolerated, even though some affect essential genes implicated in Mendelian disease. Here, we combine genomic, proteomic, and biochemical data to demonstrate that many common nonsense variants do not ablate protein production from their host genes. We provide computational and experimental evidence for diverse mechanisms of gene rescue, including alternative splicing, stop codon readthrough, alternative translation initiation, and C-terminal truncation. Our results suggest a molecular explanation for the mild fitness costs of many common nonsense variants and indicate that translational plasticity plays a prominent role in shaping human genetic diversity.

Also flagged:Hyperferritinemiahyperuricemiahereditary hemochromatosisgouturic acidiron
Journal Article 2016-09-19 ✓ 5 Snippets Flais J, Bardou-Jacquet E, Deugnier Y, Coiffier G, Perdriger A, Chalès G, Ropert M, Loréal O, Guggenbuhl P.
In-Text Gene Mentions

Hyperferritinemia increases the risk of hyperuricemia in HFE-hereditary hemochromatosis.

…of hyperuricemia inHFE-hereditary hemochromatosis.…

…a cohort ofhemochromatosispatients who were…

…homozygous for theHFEp.Cys282Tyr mutation.<h4>Metho…

…patients with theHFEgene mutation Cys282Tyr…

Show Full Abstract

<h4>Objectives</h4>Hyperuricemia is becoming increasingly frequent in the population, and is known to be sometimes the cause of gout. The impact of uric acid is still not clearly understood, however. The iron metabolism may interact with the uric acid metabolism. The aim of this study was to examine the relationship between the serum uric acid and serum ferritin levels in a cohort of hemochromatosis patients who were homozygous for the HFE p.Cys282Tyr mutation.<h4>Methods</h4>738 patients with the HFE gene mutation Cys282Tyr in the homozygous state were included in the study. The variables measured during the initial evaluation were compared in univariate analysis by Student's t test. In multivariate analysis, linear stepwise regression was used.<h4>Results</h4>In the group of hyperuricemic patients, ferritinemia was significantly higher than in the group of non-hyperuricemic patients (1576.7±1387.4μg/l vs. 1095.63±1319.24μg/l, P<0.005). With multivariate analysis, only ferritin and BMI independently explained the uricemia (R<sup>2</sup>=0.258) after adjustment for age, glycemia and CRP. The correlation between uricemia and log(ferritin) with partial regression correlation coefficients was 0.307 (P<0.01).<h4>Conclusions</h4>The increase in uricemia is associated with the increase in ferritin in a population of patients who were homozygous for the HFE gene mutation p.Cys282Tyr and this independently of factors commonly associated with hyperuricemia. The increase in uric acid associated with hyperferritinemia, could be a response to the visceral toxicity of excess non-transferrin bound iron linked to oxidative stress via the antioxidant properties of uric acid.

Also flagged:nitrogenZymolyasenucleotidehexanucleotidewaterreproduction
Journal Article 2016-09-19 No Snippets Lutsak T, Fernández-Mendoza F, Greshake B, Dal Grande F, Ebersberger I, Ott S, Printzen C.
Show Full Abstract

<h4>Premise of the study</h4>Polymorphic microsatellite markers were developed for the lichen species Cetraria aculeata (Parmeliaceae) to study fine-scale population diversity and phylogeographic structure.<h4>Methods and results</h4>Using Illumina HiSeq and MiSeq, 15 fungus-specific microsatellite markers were developed and tested on 81 specimens from four populations from Spain. The number of alleles ranged from four to 13 alleles per locus with a mean of 7.9, and average gene diversities varied from 0.40 to 0.73 over four populations. The amplification rates of 10 markers (CA01-CA10) in populations of C. aculeata exceeded 85%. The markers also amplified across a range of closely related species, except for locus CA05, which did not amplify in C. australiensis and C. "panamericana," and locus CA10 which did not amplify in C. australiensis.<h4>Conclusions</h4>The identified microsatellite markers will be used to study the genetic diversity and phylogeographic structure in populations of C. aculeata in western Eurasia.

Also flagged:Biomineralizationnanocrystalsmineralmineralizationcalciumminerals
Journal Article 2016-09-19 No Snippets Abou Neel EA, Aljabo A, Strange A, Ibrahim S, Coathup M, Young AM, Bozec L, Mudera V.
Show Full Abstract

Biomineralization is a dynamic, complex, lifelong process by which living organisms control precipitations of inorganic nanocrystals within organic matrices to form unique hybrid biological tissues, for example, enamel, dentin, cementum, and bone. Understanding the process of mineral deposition is important for the development of treatments for mineralization-related diseases and also for the innovation and development of scaffolds. This review provides a thorough overview of the up-to-date information on the theories describing the possible mechanisms and the factors implicated as agonists and antagonists of mineralization. Then, the role of calcium and phosphate ions in the maintenance of teeth and bone health is described. Throughout the life, teeth and bone are at risk of demineralization, with particular emphasis on teeth, due to their anatomical arrangement and location. Teeth are exposed to food, drink, and the microbiota of the mouth; therefore, they have developed a high resistance to localized demineralization that is unmatched by bone. The mechanisms by which demineralization-remineralization process occurs in both teeth and bone and the new therapies/technologies that reverse demineralization or boost remineralization are also scrupulously discussed. Technologies discussed include composites with nano- and micron-sized inorganic minerals that can mimic mechanical properties of the tooth and bone in addition to promoting more natural repair of surrounding tissues. Turning these new technologies to products and practices would improve health care worldwide.

Also flagged:Budd-Chiari SyndromePortal venous thrombosisnodular regenerative hyperplasiaDeathcirrhosisBudd-Chiari-syndrome
Journal Article 2016-09-19 ✓ 1 Snippet Cansu DU, Temel T, Erturk A, Kasifoglu T, Acu B, Korkmaz C.
In-Text Gene Mentions

…and antithrombin III [ATIII] levels, and factor…

Show Full Abstract

<h4>Background</h4>Budd-Chiari syndrome, which is a rare complication of Behcet's disease, carries a high mortality rate.<h4>Objectives</h4>The aim of the study was to present our long-term follow up experience with patients suffering from Budd-Chiari syndrome due to Behcet's disease.<h4>Methods</h4>The records of 402 patients with Behcet's disease were evaluated retrospectively. To facilitate detection of the long-term complications caused by Budd-Chiari syndrome, the patients were evaluated via physical examinations, laboratory tests, imaging modalities, and endoscopy results.<h4>Results</h4>The data for 402 patients diagnosed with Behcet's disease, who were followed up at our hospital over 16 years, were analyzed retrospectively. Five of these 402 patients (1.2%) were diagnosed as having Budd-Chiari syndrome. The patients with Budd-Chiari syndrome were aged between 23 and 54, and all five were male. The interval between the onset of Behcet's disease and the development of Budd-Chiari syndrome ranged from 1 to 8 years. All the patients had combined venous occlusion (affecting the hepatic vein and inferior vena cava). Portal venous thrombosis was detected in only one patient (Case 1), who died 1 month after the diagnosis of Budd-Chiari syndrome. The survival time for the other four patients after the diagnosis of Budd-Chiari syndrome ranged from 4 to 16 years. During the long-term follow-up, hepatic masses were detected via radiological surveillance in Case 3 (in the form of large regenerative nodules) and Case 4 (nodular regenerative hyperplasia and cirrhosis).<h4>Conclusions</h4>In our study, portal venous thrombosis was detected in the patient who died during the acute period only. A study including large numbers of Budd-Chiari-syndrome patients with Behcet's disease and portal venous thrombosis would be helpful to determine the prognostic significance of portal venous thrombosis in Budd-Chiari-syndrome patients with Behcet's disease. In addition, patients should be monitored regularly for the development of hepatic masses via a long-term surveillance program.

Also flagged:transcription factorTFbindingRESTNRSFtranscriptional regulator
Journal Article 2016-09-19 ✓ 2 Snippets Wang P, Zhao D, Rockowitz S, Zheng D.
In-Text Gene Mentions

Surprisingly, several genes known to have critical roles in learning and memory, or brain disorders (e.g., <i>APP</i> and <i>HTT</i>) exhibit characteristics of human specific REST regulation.

…(e.g., APP andHTT) exhibit characteristics…

Show Full Abstract

Neural and brain development in human and other mammalian species are largely similar, but distinct features exist at the levels of macrostructure and underlying genetic control. Comparative studies of epigenetic regulation and transcription factor (TF) binding in humans, chimpanzees, rodents, and other species have found large differences in gene regulatory networks. A recent analysis of the cistromes of REST/NRSF, a critical transcriptional regulator for the nervous system, demonstrated that REST binding to syntenic genomic regions (i.e., conserved binding) represents only a small percentage of the total binding events in human and mouse embryonic stem cells. While conserved binding is significantly associated with functional features (e.g., co-factor recruitment) and enriched at genes important for neural development and function, >3000 genes, including many related to brain and neural functions, either contain extra REST-bound sites (e.g., <i>NRXN1</i>) or are targeted by REST only (e.g. <i>PSEN2</i>) in humans. Surprisingly, several genes known to have critical roles in learning and memory, or brain disorders (e.g., <i>APP</i> and <i>HTT</i>) exhibit characteristics of human specific REST regulation. These findings indicate that more systematic studies are needed to better understand the divergent wiring of regulatory networks in humans, mice, and other mammals and their functional implications.

Also flagged:calciumcollagen Identine phosphoproteinfluorideCOL IDPP
Journal Article 2016-09-19 No Snippets Wang M, Han T, Chen H, Wang J.
Show Full Abstract

This study aims to assess the roles of dietary protein (Pr) and calcium (Ca) levels associated with excessive fluoride (F) intake and the impact of Pr, Ca, and F on expression of collagen I (COL I) and dentine phosphoprotein (DPP) in rat incisors. Seventy-two rats were randomly allotted to six groups (NC, NC + F, LPrLCa, LPrLCa + F, HPrLCa + F and LPrHCa + F). F, Pr, and Ca were orally administrated to rats for 120 days. The genes and proteins expression levels were quantified. We found that levels of COL1A1 and DSPP gene were respectively decreased by 41.9% and 43.1% in the NC + F group compared with NC group, were respectively decreased by 47.9% and 40.8% in the LPrLCa + F group compared with LPrLCa group, were respectively increased by 71.8% and 39.5% in the HPrLCa + F group and increased by 26.5% and 21.1% in the LPrHCa + F group compared with LPrLCa + F group. Meanwhile, the proteins' expression display with the genes' expression changes were consistent. This study demonstrated that the gene and protein expressions of COL I and DPP were reduced by F both in normal nutrition and malnutrition, and it was reversed by Pr and Ca supplementation, with the effect of Pr being greater than that of Ca.

Also flagged:ribosomeStaufen 1RNA-binding proteinstress granuleendoplasmic reticulumPERK
Journal Article 2016-09-17 ✓ 5 Snippets Bonnet-Magnaval F, Philippe C, Van Den Berghe L, Prats H, Touriol C, Lacazette E.
In-Text Gene Mentions

These results suggest that Stau1 is a stress response gene that remains efficiently translated during hypoxia and ER stress despite the substantial global inhibition of cap-dependent protein translation, promoting cell recovery following stress.

Stau1 is a stress response gene that remains efficiently translated during hypoxia

…Staufen 1 (Stau1) is an RNA-binding…

…We hypothesized thatStau1mRNA could, like…

…the 5'UTR ofStau1mRNA, which is…

Show Full Abstract

Under physiological stress conditions the cell protects itself through a global blockade on cap-dependent translation of mRNA. This allows cap-independent mechanisms such as internal ribosome entry site (IRES)-mediated translation to take over and initiate the translation of a specific pool of mRNAs that encode proteins involved in protecting the cell from stress. Staufen 1 (Stau1) is an RNA-binding protein that has been previously implicated in the regulation of stress granule formation and therefore could play a key role in protecting the cell against stress stimuli such as oxidative and endoplasmic reticulum (ER) stress. We hypothesized that Stau1 mRNA could, like many stress response genes, contain an IRES in its 5'UTR. Here we describe that a bona fide IRES element is present in the 5'UTR of Stau1 mRNA, which is activated under hypoxic and ER stress conditions. Further, we show that the activity of PERK kinase, a major effector of the ER stress response, is required for Stau1 IRES-mediated translation during ER stress. These results suggest that Stau1 is a stress response gene that remains efficiently translated during hypoxia and ER stress despite the substantial global inhibition of cap-dependent protein translation, promoting cell recovery following stress.

Also flagged:RKIPbreast cancerHMGA2Raf-1 kinase inhibitor proteintumorcancer
Journal Article 2016-09-17 No Snippets Zou Q, Wu H, Fu F, Yi W, Pei L, Zhou M.
Show Full Abstract

Raf-1 kinase inhibitor protein (RKIP) is a tumor and metastasis suppressor in cancer cells. MicroRNAs (miRNAs) have been suggested to play a vital role in tumor initiation and progression by negatively regulating oncogenes and tumor suppressors. Quite recently, studies have identified some miRNAs operating to promote or suppress tumor invasion or metastasis via regulating metastasis-related genes, providing potential therapeutic targets on anti-metastasis strategy. In this study, we found the expression of RKIP and miR-185 in breast cancer tissues was significantly lower than that of in normal breast tissues. Over-expression of RKIP up-regulated miR-185 expression, inhibited breast cancer cell growth and invasion, and inhibited miR-185 target gene High-mobility group AT-hook 2 (HMGA2). HMGA2 is encoded by HMGA2 gene, which encodes a protein that belongs to the non-histone chromosomal high-mobility group (HMG) protein family. Moreover, RKIP knockdown attenuated the inhibition of breast cancer cell invasion and the expression of HMGA2 by miR-185. Forced HMGA2 overexpression could partly restore the inhibitory effect of miR-185 on breast cancer cell growth and invasion. Our findings newly described RKIP/miR-185 to HMGA2 link and provided a potential mechanism for breast cancer cell growth and invasion. It may illustrate the potential therapeutic utility of signaling pathway signatures.

Also flagged:peptidyl-prolyl isomeraseglutaminesgalactoseHsf1HAantibody
Journal Article 2016-09-16 ✓ 5 Snippets Bhadra AK, Bhadra AK, Das E, Roy I.
In-Text Gene Mentions

Enhanced aggregation of 103Q-htt in response to DR correlates with various deleterious phenotypes

Thus, when exposed singly to both types of stress conditions, either DR or aggregation of 103Q-htt, the level of glycerol increased.

The level of glycerol increased in response to aggregation of 103Q-htt and DR, when monitored individually, but showed a reverse trend when expression of 103Q-htt was monitored in DR cells (Fig. 2A).

Thus, yeast cells expressing 103Q-htt under DR showed enhanced aggregation of protein correlating with reduced glycerol, increased oxidative stress, impaired endocytosis, and decreased cell viability and longevity.

Yeast cells subjected to DR did not show any difference in growth pattern when compared with non-DR cells (Fig. S1E), indicating that galactose acted only as an inducer of 103Q-htt expression in both cases.

Show Full Abstract

Chronic stress and prolonged activation of defence pathways have deleterious consequences for the cell. Dietary restriction is believed to be beneficial as it induces the cellular stress response machinery. We report here that although the phenomenon is beneficial in a wild-type cell, dietary restriction leads to an inconsistent response in a cell that is already under proteotoxicity-induced stress. Using a yeast model of Huntington's disease, we show that contrary to expectation, aggregation of mutant huntingtin is exacerbated and activation of the unfolded protein response pathway is dampened under dietary restriction. Global proteomic analysis shows that when exposed to a single stress, either protein aggregation or dietary restriction, the expression of foldases like peptidyl-prolyl isomerase, is strongly upregulated. However, under combinatorial stress, this lead is lost, which results in enhanced protein aggregation and reduced cell survival. Successful designing of aggregation-targeted therapeutics will need to take additional stressors into account.

Also flagged:Nuclear Factor of Activated T CellNFATTranscription factorsactivationbindingAP1
Journal Article 2016-09-16 ✓ 1 Snippet Gabriel CH, Gross F, Karl M, Stephanowitz H, Hennig AF, Weber M, Gryzik S, Bachmann I, Hecklau K, Wienands J, Schuchhardt J, Herzel H, Radbruch A, Krause E, Baumgrass R.
In-Text Gene Mentions

VRK2

Show Full Abstract

Transcription factors of the nuclear factor of activated T cell (NFAT) family are essential for antigen-specific T cell activation and differentiation. Their cooperative DNA binding with other transcription factors, such as AP1 proteins (FOS, JUN, and JUNB), FOXP3, IRFs, and EGR1, dictates the gene regulatory action of NFATs. To identify as yet unknown interaction partners of NFAT, we purified biotin-tagged NFATc1/αA, NFATc1/βC, and NFATc2/C protein complexes and analyzed their components by stable isotope labeling by amino acids in cell culture-based mass spectrometry. We revealed more than 170 NFAT-associated proteins, half of which are involved in transcriptional regulation. Among them are many hitherto unknown interaction partners of NFATc1 and NFATc2 in T cells, such as Raptor, CHEK1, CREB1, RUNX1, SATB1, Ikaros, and Helios. The association of NFATc2 with several other transcription factors is DNA-dependent, indicating cooperative DNA binding. Moreover, our computational analysis discovered that binding motifs for RUNX and CREB1 are found preferentially in the direct vicinity of NFAT-binding motifs and in a distinct orientation to them. Furthermore, we provide evidence that mTOR and CHEK1 kinase activity influence NFAT's transcriptional potency. Finally, our dataset of NFAT-associated proteins provides a good basis to further study NFAT's diverse functions and how these are modulated due to the interplay of multiple interaction partners.

Also flagged:caspaseHuntington's diseaseHDautosomal dominant diseasepolyglutaminepathogenesis
Journal Article 2016-09-16 ✓ 4 Snippets Casaca-Carreira J, Toonen LJA, Evers MM, Jahanshahi A, van-Roon-Mom WMC, Temel Y.
In-Text Gene Mentions

Huntington's disease (HD) is a progressive autosomal dominant disease, caused by a CAG repeat expansion in the HTT gene, resulting in an expanded polyglutamine stretch at the N-terminal of the huntingtin protein.

…expansion in theHTTgene, resulting in…

…exon 12 ofHTT.…

…novel approach isHttprotein modification through…

Show Full Abstract

Huntington's disease (HD) is a progressive autosomal dominant disease, caused by a CAG repeat expansion in the HTT gene, resulting in an expanded polyglutamine stretch at the N-terminal of the huntingtin protein. An important event in HD pathogenesis appears to be the proteolysis of the mutant protein, which forms N-terminal huntingtin fragments. These fragments form insoluble aggregates and are found in nuclei and cytoplasm of affected neurons where they interfere with normal cell functioning. Important cleavage sites are encoded by exon 12 of HTT. A novel approach is Htt protein modification through exon skipping, which has recently been proven effective both in vitro and in vivo. Here we report proof-of-concept of AON 12.1 in vivo using the YAC128 mouse model of HD. Our results support and encourage future longitudinal studies exploring the therapeutic effects of sustained infusions in the YAC128 mouse model.

Also flagged:methamphetaminerhythmsHuntington's diseaseHDgeneticneurodegenerative disorder
Journal Article 2016-09-16 No Snippets Ouk K, Aungier J, Morton AJ.
Show Full Abstract

Huntington's disease (HD) is a progressive genetic neurodegenerative disorder characterised by motor and cognitive deficits, as well as sleep and circadian abnormalities. In the R6/2 mouse, a fragment model of HD, rest-activity rhythms controlled by the suprachiasmatic nucleus disintegrate completely by 4months of age. Rhythms driven by a second circadian oscillator, the methamphetamine-sensitive circadian oscillator (MASCO), are disrupted even earlier, and cannot be induced after 2months of age. Here, we studied the effect of the HD mutation on the expression of MASCO-driven rhythms in a more slowly developing, genetically relevant mouse model of HD, the Q175 'knock-in' mouse. We induced expression of MASCO output by administering low dose methamphetamine (0.005%) chronically via the drinking water. We measured locomotor activity in constant darkness in wild-type and Q175 mice at 2 (presymptomatic), 6 (early symptomatic), and 12 (symptomatic) months of age. At 2months, all mice expressed MASCO-driven rhythms, regardless of genotype. At older ages, however, there was a progressive gene dose-dependent deficit in MASCO output in Q175 mice. At 6months of age, these rhythms could be observed in only 45% of heterozygous and 15% of homozygous mice. By 1year of age, 90% of homozygous mice had an impaired MASCO output. There was also an age-dependent disruption of MASCO output seen in wild-type mice. The fact that the progressive deficit in MASCO-driven rhythms in Q175 mice is HD gene dose-dependent suggests that, whatever its role in humans, abnormalities in MASCO output may contribute to the HD circadian phenotype.

Also flagged:SodiumFerulateOxygenFerulic acidpolyphenolicsalt
Journal Article 2016-09-16 ✓ 2 Snippets Qiao Y, He H, Zhang Z, Liao Z, Yin D, Liu D, Yi B, He M.
In-Text Gene Mentions

…overload resulting fromhemochromatosisor hematologic disorders…

…condition, such ashemochromatosisor hematologic disorders.…

Show Full Abstract

Ferulic acid is a polyphenolic compound contained in various types of fruits and wheat bran. As a salt of the active ingredient, sodium ferulate (SF) has potent free radical scavenging activity and can effectively scavenge ROS. In this study, we examined the effect of SF on iron-overloaded mice in comparison to a standard antioxidant, taurine (TAU). We determined the protective role of SF against liver injury by examining liver-to-body ratio (%), transaminase and hepatocyte apoptosis in rats supplied with 10% dextrose intraperitoneal injection. In addition, antioxidative enzymes activities, ROS formation, mitochondrial swelling, and mitochondrial membrane potential (MMP) were all evaluated to clarify the mechanism of protective effect of SF associated with oxidative stress. After 15 weeks of SF treatment, we found a significant reduction in liver-to-body weight radio and elevation in both transaminase and hepatocyte apoptosis associated with iron-injected to levels comparable to those achieved with TAU. Both SF and TAU significantly attenuated the impaired liver function associated with iron-overloaded in mice, whereas neither showed any significant effect on the iron uptake. Furthermore, treatment with either SF or TAU in iron-overloaded mice attenuated oxidative stress, associated with elevated oxidant enzymes activities, decreased ROS production, prevented mitochondrial swelling and dissipation of MMP and then inhibited hepatic apoptosis. Taken together, the current study shows that, SF alleviated oxidative stress and liver damage associated with iron-overload conditions compared to the standard ROS scavenger (TAU), and potentially could encourage higher consumption and utilization as healthy and sustainable ingredients by the food and drink.

Also flagged:synthesishydroxyacylBiosynthesisnonribosomal peptide synthetasesNRPSamino acid
Journal Article 2016-09-16 No Snippets Davis TD, Mohandas P, Chiriac MI, Bythrow GV, Quadri LE, Tan DS.
Show Full Abstract

Biosynthesis of bacterial natural-product virulence factors is emerging as a promising antibiotic target. Many such natural products are produced by nonribosomal peptide synthetases (NRPS) from amino acid precursors. To develop selective inhibitors of these pathways, we have previously described aminoacyl-AMS (sulfamoyladenosine) macrocycles that inhibit NRPS amino acid adenylation domains but not mechanistically-related aminoacyl-tRNA synthetases. To improve the cell permeability of these inhibitors, we explore herein replacement of the α-amino group with an α-hydroxy group. In both macrocycles and corresponding linear congeners, this leads to decreased biochemical inhibition of the cysteine adenylation domain of the Yersina pestis siderophore synthetase HMWP2, which we attribute to loss of an electrostatic interaction with a conserved active-site aspartate. However, inhibitory activity can be regained by installing a cognate β-thiol moiety in the linear series. This provides a path forward to develop selective, cell-penetrant inhibitors of the biosynthesis of virulence factors to probe their biological functions and potential as therapeutic targets.

Also flagged:Nucleusmitochondrialagingmitochondriaage-related diseasesorganelle
Journal Article 2016-09-16 No Snippets Lionaki E, Gkikas I, Tavernarakis N.
Show Full Abstract

The coordination of nuclear and mitochondrial genomes plays a pivotal role in maintenance of mitochondrial biogenesis and functionality during stress and aging. Environmental and cellular inputs signal to nucleus and/or mitochondria to trigger interorganellar compensatory responses. Loss of this tightly orchestrated coordination results in loss of cellular homeostasis and underlies various pathologies and age-related diseases. Several signaling cascades that govern interorganellar communication have been revealed up to now, and have been classified as part of the anterograde (nucleus to mitochondria) or retrograde (mitochondrial to nucleus) response. Many of these molecular pathways rely on the dual distribution of nuclear or mitochondrial components under basal or stress conditions. These dually localized components usually engage in specific tasks in their primary organelle of function, whilst upon cellular stimuli, they appear in the other organelle where they engage in the same or a different task, triggering a compensatory stress response. In this review, we focus on protein factors distributed between the nucleus and mitochondria and activated to exert their functions upon basal or stress conditions. We further discuss implications of bi-organellar targeting in the context of aging.

Also flagged:Cas9Intestinal FailureIFShort bowel syndromeSBSnecrotizing enterocolitis
Journal Article 2016-09-16 No Snippets Hong SN, Dunn JC, Stelzner M, Martín MG.
Show Full Abstract

Intestinal failure is a rare life-threatening condition that results in the inability to maintain normal growth and hydration status by enteral nutrition alone. Although parenteral nutrition and whole organ allogeneic transplantation have improved the survival of these patients, current therapies are associated with a high risk for morbidity and mortality. Development of methods to propagate adult human intestinal stem cells (ISCs) and pluripotent stem cells raises the possibility of using stem cell-based therapy for patients with monogenic and polygenic forms of intestinal failure. Organoids have demonstrated the capacity to proliferate indefinitely and differentiate into the various cellular lineages of the gut. Genome-editing techniques, including the overexpression of the corrected form of the defective gene, or the use of CRISPR (clustered regularly interspaced short palindromic repeats)/Cas9 to selectively correct the monogenic disease-causing variant within the stem cell, make autologous ISC transplantation a feasible approach. However, numerous techniques still need to be further optimized, including more robust ex vivo ISC expansion, native ISC ablation, and engraftment protocols. Large-animal models can to be used to develop such techniques and protocols and to establish the safety of autologous ISC transplantation because outcomes in such models can be extrapolated more readily to humans. Stem Cells Translational Medicine 2017;6:666-676.

Also flagged:Peptidesstaphylococcal infectionsquorum sensingmultidrugAIP-1infections
Journal Article 2016-09-15 No Snippets Gordon CP, Olson SD, Lister JL, Kavanaugh JS, Horswill AR.
Show Full Abstract

Competitive quorum sensing (QS) antagonism offers a novel strategy for attenuating current multidrug resistant staphylococcal infections. To this end, a series of 10 truncated analogues based on the parent autoinducing peptides (AIPs) of Staphylococcus lugdunensis (groups I and II) and Staphylococcus epidermidis (groups I-III) were sequentially assessed against a newly developed Staphylococcus lugdunensis group I QS reporter strain. The truncated analogues based upon Staphylococcus lugdunensis AIP-1 (1) and AIP-2 (2) displayed respective IC<sub>50</sub> values of 0.2 ± 0.01 μM and 0.3 ± 0.01 μM, while the truncated analogue of the Staphylococcus epidermidis AIP-1 (3) elicited an IC<sub>50</sub> value of 2.7 ± 0.1 μM. These findings demonstrate the potential of cognate and "crosstalk" competitive quorum sensing inhibition using truncated AIPs as a means of attenuating staphylococcal infections in species beyond Staphylococcus aureus.

Also flagged:gene expressiontransposonsembryogenesisDnase Iproteinase Kdegradation
Journal Article 2016-09-15 No Snippets Basu S, Hadzhiev Y, Petrosino G, Nepal C, Gehrig J, Armant O, Ferg M, Strahle U, Sanges R, Müller F.
Show Full Abstract

Pufferfish such as fugu and tetraodon carry the smallest genomes among all vertebrates and are ideal for studying genome evolution. However, comparative genomics using these species is hindered by the poor annotation of their genomes. We performed RNA sequencing during key stages of maternal to zygotic transition of Tetraodon nigroviridis and report its first developmental transcriptome. We assembled 61,033 transcripts (23,837 loci) representing 80% of the annotated gene models and 3816 novel coding transcripts from 2667 loci. We demonstrate the similarities of gene expression profiles between pufferfish and zebrafish during maternal to zygotic transition and annotated 1120 long non-coding RNAs (lncRNAs) many of which differentially expressed during development. The promoters for 60% of the assembled transcripts result validated by CAGE-seq. Despite the extreme compaction of the tetraodon genome and the dramatic loss of transposons, the length of lncRNA exons remain comparable to that of other vertebrates and a small set of lncRNAs appears enriched for transposable elements suggesting a selective pressure acting on lncRNAs length and composition. Finally, a set of lncRNAs are microsyntenic between teleost and vertebrates, which indicates potential regulatory interactions between lncRNAs and their flanking coding genes. Our work provides a fundamental molecular resource for vertebrate comparative genomics and embryogenesis studies.

Also flagged:Pancreatic ductal adenocarcinomaPDACcancerAFAP1gene expressionpancreatic cancer
Journal Article 2016-09-15 No Snippets Fu XL, Liu DJ, Yan TT, Yang JY, Yang MW, Li J, Huo YM, Liu W, Zhang JF, Hong J, Hua R, Chen HY, Sun YW.
Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) remains one of the most aggressive and lethal malignancies. Long non-coding RNAs (lncRNAs) are a novel class of non-protein-coding transcripts that have been implicated in cancer biogenesis and prognosis. By repurposing microarray probes, we herein analysed the lncRNA expression profiles in two public PDAC microarray datasets and identified 34 dysregulated lncRNAs in PDAC. In addition, the expression of 6 selected lncRNAs was confirmed in Ren Ji cohort and pancreatic cell lines, and their association with 80 PDAC patients' clinicopathological features and prognosis was investigated. Results indicated that AFAP1-AS1, UCA1 and ENSG00000218510 might be involved in PDAC progression and significantly associated with overall survival of PDAC. UCA1 and ENSG00000218510 expression status may serve as independent prognostic biomarkers for overall survival of PDAC. Gene set enrichment analysis (GSEA) analysis suggested that high AFAP1-AS1, UCA1 and low ENSG00000218510 expression were correlated with several tumorigenesis related pathways. Functional experiments demonstrated that AFAP1-AS1 and UCA1 were required for efficient invasion and/or proliferation promotion in PDAC cell lines, while ENSG00000218510 acted the opposite. Our findings provide novel information on lncRNAs expression profiles which might be beneficial to the precise diagnosis, subcategorization and ultimately, the individualized therapy of PDAC.

Also flagged:cerebral palsyneurodevelopmentalpostnatalgrowth restrictiongestationhydrocephalus
Journal Article 2016-09-15 No Snippets Meyers JM, Bann CM, Stoll BJ, D'Angio CT, Bell EF, Duncan AF, Guillet R.
Show Full Abstract

<h4>Objective</h4>To compare neurodevelopmental outcomes in postnatal growth-restricted infants born <29 weeks with and without postnatal head-sparing (PHS).<h4>Study design</h4>We analyzed developmental outcomes at 2 years of age among postnatally growth-restricted infants with and without head-sparing. The primary outcome was Bayley III cognitive composite score; secondary outcomes included Bayley III motor composite score, moderate/severe cerebral palsy, gross motor functional classification scale level⩾2, and presence or absence of neurodevelopmental impairment (NDI).<h4>Results</h4>Of 1098 infants evaluated at 18 to 22 months, 658 were postnatally growth restricted, of whom 301 had head-sparing. In the multivariate model including independent risk factors for poor growth and poor developmental outcome, infants with head-sparing had higher adjusted motor composite scores (mean difference 4.65, P<0.01), but no differences in other neurodevelopmental outcomes.<h4>Conclusion</h4>PHS is associated with improved neurodevelopmental outcome in extremely preterm infants, specifically Bayley III motor scores, but whether beneficial effects of PHS persist later in life is unknown.

Also flagged:neurodegenerative disorderpolyglutaminepsychiatricHDCBPpathogenesis
Journal Article 2016-09-15 ✓ 5 Snippets Kunkanjanawan T, Carter RL, Prucha MS, Yang J, Parnpai R, Chan AW.
In-Text Gene Mentions

mHTT has a stronger binding affinity with dynamin-related protein 1 (Drp-1) than WT HTT which resulted in the increase of mitochondrial fission rate in HD patient lymphoblast [51].

…exon of theHTTgene [ 1…

…Although theHTTgene is not…

…exon 1 ofHTTgene (both mHTT…

…mHTT and endogenousHTT) to exon…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder caused by the expansion of polyglutamine (polyQ) tract that leads to motor, cognitive and psychiatric impairment. Currently there is no cure for HD. A transgenic HD nonhuman primate (HD-NHP) model was developed with progressive development of clinical and pathological features similar to human HD, which suggested the potential preclinical application of the HD-NHP model. Elevated expression of miR-196a was observed in both HD-NHP and human HD brains. Cytotoxicity and apoptosis were ameliorated by the overexpression of miR-196a in HD-NHP neural progenitor cells (HD-NPCs) and differentiated neural cells (HD-NCs). The expression of apoptosis related gene was also down regulated. Mitochondrial morphology and activity were improved as indicated by mitotracker staining and the upregulation of CBP and PGC-1α in HD-NPCs overexpressing miR-196a. Here we demonstrated the amelioration of HD cellular phenotypes in HD-NPCs and HD-NCs overexpressing miR-196a. Our results also suggested the regulatory role of miR-196a in HD pathogenesis that may hold the key for understanding molecular regulation in HD and developing novel therapeutics.

Also flagged:nucleolarofgene expressionbreast cancerCCpiwi
Journal Article 2016-09-15 No Snippets Krishnan P, Ghosh S, Wang B, Heyns M, Graham K, Mackey JR, Kovalchuk O, Damaraju S.
Show Full Abstract

One of the most abundant, yet least explored, classes of RNA is the small nucleolar RNAs (snoRNAs), which are well known for their involvement in post-transcriptional modifications of other RNAs. Although snoRNAs were only considered to perform housekeeping functions for a long time, recent studies have highlighted their importance as regulators of gene expression and as diagnostic/prognostic markers. However, the prognostic potential of these RNAs has not been interrogated for breast cancer (BC). The objective of the current study was to identify snoRNAs as prognostic markers for BC. Small RNA sequencing (Illumina Genome Analyzer IIx) was performed for 104 BC cases and 11 normal breast tissues. Partek Genomics Suite was used for analyzing the sequencing files. Two independent and proven approaches were used to identify prognostic markers: case-control (CC) and case-only (CO). For both approaches, snoRNAs significant in the permutation test, following univariate Cox proportional hazards regression model were used for constructing risk scores. Risk scores were subsequently adjusted for potential confounders in a multivariate Cox model. For both approaches, thirteen snoRNAs were associated with overall survival and/or recurrence free survival. Patients belonging to the high-risk group were associated with poor outcomes, and the risk score was significant after adjusting for confounders. Validation of representative snoRNAs (SNORD46 and SNORD89) using qRT-PCR confirmed the observations from sequencing experiments. We also observed 64 snoRNAs harboring piwi-interacting RNAs and/or microRNAs that were predicted to target genes (mRNAs) involved in tumorigenesis. Our results demonstrate the potential of snoRNAs to serve (i) as novel prognostic markers for BC and (ii) as indirect regulators of gene expression.

Also flagged:Progesteroneprogesterone receptorPGRprotein kinaseestrogen receptor alphaER
Journal Article 2016-09-15 ✓ 1 Snippet Diep CH, Ahrendt H, Lange CA.
In-Text Gene Mentions

DCC

Show Full Abstract

Progesterone Receptors (PRs) are critical effectors of estrogen receptor (ER) signaling required for mammary gland development and reproductive proficiency. In breast and reproductive tract malignancies, PR expression is a clinical prognostic marker of ER action. While estrogens primarily regulate PR expression, other factors likely contribute to a dynamic range of receptor expression across diverse tissues. In this study, we identified estrogen-independent but progestin (R5020)-dependent regulation of ER target genes including PGR in ER+/PR+ cancer cell lines. R5020 (10nM-10μM range) induced dose-dependent PR mRNA and protein expression in the absence of estrogen but required both PR and ERα. Antagonists of either PR (RU486, onapristone) or ERα (ICI 182,780) attenuated R5020 induction of TFF1, CTSD, and PGR. Chromatin immunoprecipitation (ChIP) assays performed on ER+/PR+ cells demonstrated that both ERα and PR were recruited to the same ERE/Sp1 site-containing region of the PGR proximal promoter in response to high dose progestin (10μM). Recruitment of ERα and PR to chromatin and subsequent PR mRNA induction were dependent upon rapid activation of MAPK/ERK and AKT; inhibition of these kinase pathways via U0126 or LY294002 blocked these events. Overall, we have identified a novel mechanism of ERα activation initiated by rapid PR-dependent kinase pathway activation and associated with phosphorylation of ERα Ser118 for estrogen-independent but progestin-dependent ER/PR cross talk. These studies may provide insight into mechanisms of persistent ER-target gene expression during periods of hormone (i.e. estrogen) ablation and suggest caution following prolonged treatment with aromatase or CYP17 inhibitors (i.e. contexts when progesterone levels may be abnormally elevated).

Also flagged:GRIM-19cytokinetumorCytokinescell proliferationsolid tumors
Journal Article 2016-09-15 No Snippets Nallar SC, Kalvakolanu DV.
Show Full Abstract

Cytokines induce cell proliferation or growth suppression depending on the context. It is increasingly becoming clear that success of standard radiotherapy and/or chemotherapeutics to eradicate solid tumors is dependent on IFN signaling. In this review we discuss the molecular mechanisms of tumor growth suppression by a gene product isolated in our laboratory using a genome-wide expression knock-down strategy. Gene associated with retinoid-IFN-induced mortality -19 (GRIM-19) functions as non-canonical tumor suppressor by antagonizing oncoproteins. As a component of mitochondrial respiratory chain, GRIM-19 influences the degree of "Warburg effect" in cancer cells as many advanced and/or aggressive tumors show severely down-regulated GRIM-19 levels. In addition, GRIM-19 appears to regulate innate and acquired immune responses in mouse models. Thus, GRIM-19 is positioned at nodes that favor cell protection and/or prevent aberrant cell growth.

Also flagged:rheumatoid arthritisepilepsybipolar disorderobesityCCL3L1IRGM
Journal Article 2016-09-15 ✓ 5 Snippets Nguyen HT, Boocock J, Merriman TR, Black MA.
In-Text Gene Mentions

For example, a common 20-kb deletion upstream of the IRGM gene has been associated with Crohn’s disease (McCarroll et al., 2008), a common 40-kb deletion upstream of the NEGR1 gene has been associated with body mass index (Willer et al., 2009), and a 32-kb deletion around the LCE3C and LCE3B genes has been associated with psoriasis (de Cid et al., 2009).

…upstream of theNEGR1gene has been…

…CNV were used (NEGR1, LCE3, IRGM).…

…upstream of theNEGR1gene (NEGR1 locus),…

…the NEGR1 gene (NEGR1locus), a region…

Show Full Abstract

Copy-number variation (CNV) has been associated with increased risk of complex diseases. High-throughput sequencing (HTS) technologies facilitate the detection of copy-number variable regions (CNVRs) and their breakpoints. This helps in understanding genome structure as well as their evolution process. Various approaches have been proposed for detecting CNV breakpoints, but currently it is still challenging for tools based on a single analysis method to identify breakpoints of CNVs. It has been shown, however, that pipelines which integrate multiple approaches are able to report more reliable breakpoints. Here, based on HTS data, we have developed a pipeline to identify approximate breakpoints (±10 bp) relating to different ancestral events within a specific CNVR. The pipeline combines read-depth and split-read information to infer breakpoints, using information from multiple samples to allow an imputation approach to be taken. The main steps involve using a normal mixture model to cluster samples into different groups, followed by simple kernel-based approaches to maximize information obtained from read-depth and split-read approaches, after which common breakpoints of groups are inferred. The pipeline uses split-read information directly from CIGAR strings of BAM files, without using a re-alignment step. On simulated data sets, it was able to report breakpoints for very low-coverage samples including those for which only single-end reads were available. When applied to three loci from existing human resequencing data sets (NEGR1, LCE3, IRGM) the pipeline obtained good concordance with results from the 1000 Genomes Project (92, 100, and 82%, respectively). The package is available at https://github.com/hoangtn/SRBreak, and also as a docker-based application at https://registry.hub.docker.com/u/hoangtn/srbreak/.

Also flagged:Endometriosisgynecological diseasepathogenesisinflammatory disordergynecological diseasesretrograde
Journal Article 2016-09-15 No Snippets Zhao L, Gu C, Huang K, Han W, Fu M, Meng Y.
Show Full Abstract

Endometriosis is a common gynecological disease with high prevalence, while its etiology and pathophysiology have remained to be fully elucidated. Previous evidence suggested that this disorder may be in part or completely of somatic origin. However, traditional endometrial samples may not be ideal for investigation, as target cells, including epithelial and stromal cells, in endometriotic lesions are too sparse to be analyzed. Recently, capture microdissection techniques have been used to overcome these limitations and eliminate tissue heterogeneity in endometriosis research. Therefore, the present review summarized the alterations in epithelial and stromal cells in endometriosis tissues isolated through capture microdissection, outlined recent progress and provided directions for future investigation of the pathogenesis of endometriosis.

Also flagged:synthesisdendrimersdendrimermembranesethanolwater
Journal Article 2016-09-14 No Snippets Xiao Q, Rubien JD, Wang Z, Reed EH, Hammer DA, Sahoo D, Heiney PA, Yadavalli SS, Goulian M, Wilner SE, Baumgart T, Vinogradov SA, Klein ML, Percec V.
Show Full Abstract

The modular synthesis of a library containing seven self-assembling amphiphilic Janus dendrimers is reported. Three of these molecules contain environmentally friendly chiral-racemic fluorinated dendrons in their hydrophobic part (RF), one contains achiral hydrogenated dendrons (RH), while one denoted hybrid Janus dendrimer, contains a combination of chiral-racemic fluorinated and achiral hydrogenated dendrons (RHF) in its hydrophobic part. Two Janus dendrimers contain either chiral-racemic fluorinated dendrons and a green fluorescent dye conjugated to its hydrophilic part (RF-NBD) or achiral hydrogenated and a red fluorescent dye in its hydrophilic part (RH-RhB). These RF, RH, and RHF Janus dendrimers self-assembled into unilamellar or onion-like soft vesicular dendrimersomes (DSs), with similar thicknesses to biological membranes by simple injection from ethanol solution into water or buffer. Since RF and RH dendrons are not miscible, RF-NBD and RH-RhB were employed to investigate by fluorescence microscopy the self-sorting and coassembly of RF and RH as well as of phospholipids into hybrid DSs mediated by the hybrid hydrogenated-fluorinated RHF Janus dendrimer. The hybrid RHF Janus dendrimer coassembled with both RF and RH. Three-component hybrid DSs containing RH, RF, and RHF were formed when the proportion of RHF was higher than 40%. With low concentration of RHF and in its absence, RH and RF self-sorted into individual RH or RF DSs. Phospholipids were also coassembled with hybrid RHF Janus dendrimers. The simple synthesis and self-assembly of DSs and hybrid DSs, their similar thickness with biological membranes and their imaging by fluorescence and (19)F-MRI make them important tools for synthetic biology.

Also flagged:Rheumatoid Arthritisdinucleotidechemokine receptorCCR6transcription activator-like effector nucleasetranscription factor
Journal Article 2016-09-14 ✓ 1 Snippet Li G, Cunin P, Wu D, Diogo D, Yang Y, Okada Y, Plenge RM, Nigrovic PA.
In-Text Gene Mentions

…human genes includingHFE, CXCL1 ,…

Show Full Abstract

Understanding the implications of genome-wide association studies (GWAS) for disease biology requires both identification of causal variants and definition of how these variants alter gene function. The non-coding triallelic dinucleotide polymorphism CCR6DNP is associated with risk for rheumatoid arthritis, and is considered likely causal because allelic variation correlates with expression of the chemokine receptor CCR6. Using transcription activator-like effector nuclease (TALEN) gene editing, we confirmed that CCR6DNP regulates CCR6. To identify the associated transcription factor, we applied a novel assay, Flanking Restriction Enhanced Pulldown (FREP), to identify specific association of poly (ADP-ribose) polymerase 1 (PARP-1) with CCR6DNP consistent with the established allelic risk hierarchy. Correspondingly, manipulation of PARP-1 expression or activity impaired CCR6 expression in several lineages. These findings show that CCR6DNP is a causal variant through which PARP-1 regulates CCR6, and introduce a highly efficient approach to interrogate non-coding genetic polymorphisms associated with human disease.

Also flagged:NickelphosphorylationJNKcytotoxicgluconeogenesisprotein degradation
Journal Article 2016-09-14 No Snippets Ge Y, Bruno M, Haykal-Coates N, Wallace K, Andrews D, Swank A, Winnik W, Ross JA.
Show Full Abstract

Understanding the mechanisms underlying toxicity initiated by nickel, a ubiquitous environmental contaminant and known human carcinogen is necessary for proper assessment of its risks to human and environment. Among a variety of toxic mechanisms, disruption of protein responses and protein response-based biochemical pathways represents a key mechanism through which nickel induces cytotoxicity and carcinogenesis. To identify protein responses and biochemical pathways that are critical to nickel-induced toxicity responses, we measured cytotoxicity and changes in expression and phosphorylation status of 14 critical biochemical pathway regulators in human BEAS-2B cells exposed to four concentrations of nickel using an integrated proteomic approach. A subset of the pathway regulators, including interleukin-6, and JNK, were found to be linearly correlated with cell viability, and may function as molecular determinants of cytotoxic responses of BEAS-2B cells to nickel exposures. In addition, 128 differentially expressed proteins were identified by two dimensional electrophoresis (2-DE) and mass spectrometry. Principal component analysis, hierarchical cluster analyses, and ingenuity signaling pathway analysis (IPA) identified putative nickel toxicity pathways. Some of the proteins and pathways identified have not previously been linked to nickel toxicity. Based on the consistent results obtained from both ELISA and 2-DE proteomic analysis, we propose a core signaling pathway regulating cytotoxic responses of human BEAS-2B cells to nickel exposures, which integrates a small set of proteins involved in glycolysis and gluconeogenesis pathways, apoptosis, protein degradation, and stress responses including inflammation and oxidative stress.

Also flagged:Insulin-Like Growth Factor-1Insulinneurodegenerative disordersInsulin Growth Factor 1IGF-1cognitive decline
Journal Article 2016-09-14 ✓ 1 Snippet Salem L, Saleh N, Désaméricq G, Youssov K, Dolbeau G, Cleret L, Bourhis ML, Azulay JP, Krystkowiak P, Verny C, Morin F, Moutereau S, French Huntington Study Group, Bachoud-Lévi AC, Maison P.
In-Text Gene Mentions

…heterozygous for theHttgene (> 36…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is one of several neurodegenerative disorders that have been associated with metabolic alterations. Changes in Insulin Growth Factor 1 (IGF-1) and/or insulin input to the brain may underlie or contribute to the progress of neurodegenerative processes. Here, we investigated the association over time between changes in plasma levels of IGF-1 and insulin and the cognitive decline in HD patients.<h4>Methods</h4>We conducted a multicentric cohort study in 156 patients with genetically documented HD aged from 22 to 80 years. Among them, 146 patients were assessed at least twice with a follow-up of 3.5 ± 1.8 years. We assessed their cognitive decline using the Unified Huntington's Disease Rating Scale, and their IGF-1 and insulin plasmatic levels, at baseline and once a year during the follow-up. Associations were evaluated using a mixed-effect linear model.<h4>Results</h4>In the cross-sectional analysis at baseline, higher levels of IGF-1 and insulin were associated with lower cognitive scores and thus with a higher degree of cognitive impairment. In the longitudinal analysis, the decrease of all cognitive scores, except the Stroop interference, was associated with the IGF-1 level over time but not of insulin.<h4>Conclusions</h4>IGF-1 levels, unlike insulin, predict the decline of cognitive function in HD.

Also flagged:Na/K pumpcytoplasmiccalciumNa/K pumpsextracellularprotein
Journal Article 2016-09-14 ✓ 1 Snippet Lu FM, Deisl C, Hilgemann DW.
In-Text Gene Mentions

…myocytes from Peroxiredoxin6 (PRDX6)-/- mice ( Nagy…

Show Full Abstract

Small changes of Na/K pump activity regulate internal Ca release in cardiac myocytes via Na/Ca exchange. We now show conversely that transient elevations of cytoplasmic Ca strongly regulate cardiac Na/K pumps. When cytoplasmic Na is submaximal, Na/K pump currents decay rapidly during extracellular K application and multiple results suggest that an inactivation mechanism is involved. Brief activation of Ca influx by reverse Na/Ca exchange enhances pump currents and attenuates current decay, while repeated Ca elevations suppress pump currents. Pump current enhancement reverses over 3 min, and results are similar in myocytes lacking the regulatory protein, phospholemman. Classical signaling mechanisms, including Ca-activated protein kinases and reactive oxygen, are evidently not involved. Electrogenic signals mediated by intramembrane movement of hydrophobic ions, such as hexyltriphenylphosphonium (C6TPP), increase and decrease in parallel with pump currents. Thus, transient Ca elevation and Na/K pump inactivation cause opposing sarcolemma changes that may affect diverse membrane processes.

Also flagged:telomerestelomerecolorectal cancerTERTgene expressioncarcinoma
Journal Article 2016-09-14 No Snippets Slattery ML, Herrick JS, Pellatt AJ, Wolff RK, Mullany LE.
Show Full Abstract

It has been proposed that miRNAs are involved in the control of telomeres. We test that hypothesis by examining the association between miRNAs and telomere length (TL). Additionally, we evaluate if genetic variation in telomerase reverse transcriptase (TERT) is associated with miRNA expression levels. We use data from a population-based study of colorectal cancer (CRC), where we have previously shown associations between TL and TERT and CRC, to test associations between TL and miRNA expression and TERT and miRNA expression. To gain insight into functions of miRNAs associated with TERT we tested linear associations between miRNAs and their targeted gene mRNAs. An Agilent platform that contained information on over 2000 miRNAs was used. TL was measured using a multiplexed quantitative PCR (qPCR). RNAseq was used to assess gene expression. Our sample consisted of 1152 individuals with SNP data and miRNA expression data; 363 individuals with both TL and miRNA; and 148 individuals with miRNA and mRNA data. Thirty-three miRNAs were directly associated with TL after adjusting for age and sex (false discovery rate (FDR) of 0.05). TERT rs2736118 was associated with differences in miRNA expression between carcinoma and normal colonic mucosa for 75 miRNAs (FDR <0.05). Genes regulated by these miRNAs, as indicated by mRNA/miRNA associations, were associated with major signaling pathways beyond their TL-related functions, including PTEN, and PI3K/AKT signaling. Our data support a direct association between miRNAs and TL; differences in miRNA expression levels by TERT genotype were observed. Based on miRNA and targeted mRNA associations our data suggest that TERT is involved in non-TL-related functions by acting through altered miRNA expression.

Also flagged:Metabolismglutamateion homeostasision pumpsvoltage/ligand-gated channelsNa + /K + ATPase
Journal Article 2016-09-14 No Snippets DiNuzzo M, Giove F, Maraviglia B, Mangia S.
Show Full Abstract

Brain activity involves essential functional and metabolic interactions between neurons and astrocytes. The importance of astrocytic functions to neuronal signaling is supported by many experiments reporting high rates of energy consumption and oxidative metabolism in these glial cells. In the brain, almost all energy is consumed by the Na<sup>+</sup>/K<sup>+</sup> ATPase, which hydrolyzes 1 ATP to move 3 Na<sup>+</sup> outside and 2 K<sup>+</sup> inside the cells. Astrocytes are commonly thought to be primarily involved in transmitter glutamate cycling, a mechanism that however only accounts for few % of brain energy utilization. In order to examine the participation of astrocytic energy metabolism in brain ion homeostasis, here we attempted to devise a simple stoichiometric relation linking glutamatergic neurotransmission to Na<sup>+</sup> and K<sup>+</sup> ionic currents. To this end, we took into account ion pumps and voltage/ligand-gated channels using the stoichiometry derived from available energy budget for neocortical signaling and incorporated this stoichiometric relation into a computational metabolic model of neuron-astrocyte interactions. We aimed at reproducing the experimental observations about rates of metabolic pathways obtained by <sup>13</sup>C-NMR spectroscopy in rodent brain. When simulated data matched experiments as well as biophysical calculations, the stoichiometry for voltage/ligand-gated Na<sup>+</sup> and K<sup>+</sup> fluxes generated by neuronal activity was close to a 1:1 relationship, and specifically 63/58 Na<sup>+</sup>/K<sup>+</sup> ions per glutamate released. We found that astrocytes are stimulated by the extracellular K<sup>+</sup> exiting neurons in excess of the 3/2 Na<sup>+</sup>/K<sup>+</sup> ratio underlying Na<sup>+</sup>/K<sup>+</sup> ATPase-catalyzed reaction. Analysis of correlations between neuronal and astrocytic processes indicated that astrocytic K<sup>+</sup> uptake, but not astrocytic Na<sup>+</sup>-coupled glutamate uptake, is instrumental for the establishment of neuron-astrocytic metabolic partnership. Our results emphasize the importance of K<sup>+</sup> in stimulating the activation of astrocytes, which is relevant to the understanding of brain activity and energy metabolism at the cellular level.

Also flagged:ADpathogenesisneurodegenerative disorderdementiaagingcognition
Journal Article 2016-09-14 No Snippets Iatrou A, Kenis G, Rutten BP, Lunnon K, van den Hove DL.
Show Full Abstract

Even though the etiology of Alzheimer's disease (AD) remains unknown, it is suggested that an interplay among genetic, epigenetic and environmental factors is involved. An increasing body of evidence pinpoints that dysregulation in the epigenetic machinery plays a role in AD. Recent developments in genomic technologies have allowed for high throughput interrogation of the epigenome, and epigenome-wide association studies have already identified unique epigenetic signatures for AD in the cortex. Considerable evidence suggests that early dysregulation in the brainstem, more specifically in the raphe nuclei and the locus coeruleus, accounts for the most incipient, non-cognitive symptomatology, indicating a potential causal relationship with the pathogenesis of AD. Here we review the advancements in epigenomic technologies and their application to the AD research field, particularly with relevance to the brainstem. In this respect, we propose the assessment of epigenetic signatures in the brainstem as the cornerstone of interrogating causality in AD. Understanding how epigenetic dysregulation in the brainstem contributes to AD susceptibility could be of pivotal importance for understanding the etiology of the disease and for the development of novel diagnostic and therapeutic strategies.

Also flagged:Prostate cancermalignanciessequelaeproscancermalignancy
Journal Article 2016-09-14 No Snippets Höcht S, Aebersold DM, Albrecht C, Böhmer D, Flentje M, Ganswindt U, Hölscher T, Martin T, Sedlmayer F, Wenz F, Zips D, Wiegel T.
Show Full Abstract

<h4>Aim</h4>This article gives an overview on the current status of hypofractionated radiotherapy in the treatment of prostate cancer with a special focus on the applicability in routine use.<h4>Methods</h4>Based on a recently published systematic review the German Society of Radiation Oncology (DEGRO) expert panel added additional information that has become available since then and assessed the validity of the information on outcome parameters especially with respect to long-term toxicity and long-term disease control.<h4>Results</h4>Several large-scale trials on moderate hypofractionation with single doses from 2.4-3.4 Gy have recently finished recruiting or have published first results suggestive of equivalent outcomes although there might be a trend for increased short-term and possibly even long-term toxicity. Large phase 3 trials on extreme hypofractionation with single doses above 4.0 Gy are lacking and only very few prospective trials have follow-up periods covering more than just 2-3 years.<h4>Conclusion</h4>Until the results on long-term follow-up of several well-designed phase 3 trials become available, moderate hypofractionation should not be used in routine practice without special precautions and without adherence to the highest quality standards and evidence-based dose fractionation regimens. Extreme hypofractionation should be restricted to prospective clinical trials.

Also flagged:Huntington's diseaseHDneurodegenerative disordercachexiaglutaminemetabolism
Journal Article 2016-09-14 ✓ 2 Snippets Liot G, Valette J, Pépin J, Flament J, Brouillet E.
In-Text Gene Mentions

…the huntingtin protein (Htt).…

…functions of mutantHtt(mHtt).…

Show Full Abstract

Huntington's disease (HD) is an inherited progressive neurodegenerative disorder associated with involuntary abnormal movements (chorea), cognitive deficits and psychiatric disturbances. The most striking neuropathological change in HD is the early atrophy of the striatum. While the disease progresses, other brain structures also degenerate, including the cerebral cortex. Changes are also seen outside the brain, in particular weight loss/cachexia despite high dietary intake. The disease is caused by an abnormal expansion of a CAG repeat in the gene encoding the huntingtin protein (Htt). This mutation leads to the expression of a poly-glutamine stretch that changes the biological functions of mutant Htt (mHtt). The mechanisms underlying neurodegeneration in HD are not totally elucidated. Here, we discuss recent results obtained in patients, animal and cellular models suggesting that early disturbance in energy metabolism at least in part associated with mitochondrial defects may play a central role, even though all data are not congruent, possibly because most findings were obtained in cell culture systems or using biochemical analyses of post mortem tissues from rodent models. Thus, we put a particular focus on brain imaging studies that could identify biomarkers of energy defects in vivo and would be of prime interest in preclinical and clinical trials testing the efficacy of new therapies targeting energy metabolism in HD.

Also flagged:triazolepolyglutamineneuronal disordersautophagyneuroblastomaBeclin-1
Journal Article 2016-09-14 ✓ 3 Snippets Hsieh CH, Lee LC, Leong WY, Yang TC, Yao CF, Fang K.
In-Text Gene Mentions

The aberrant protein with expanded glutamine repeats formed aggregates in neurons.33 While the induced nuclear Q79 aggregations remained intact under DMSO control, OC-13 activated JNK that phosphorylated Bcl-2 and dissociated from Beclin-1 and helped autophagy development.28 Strategies to ease mutant aggregates confer protection against toxicity in cell and animal models and interrupt the disease pathogenesis.34 The approach was applied in a number of pathologies that include cancer and neurodegeneration.28 Several pharmacological inducers to upregulate autophagy in mammals are activated by mTOR-dependent or mTOR-independent pathways.35 Rapamycin or its analog rapalogs removes expanded repeats of Htt through mTOR pathway.11,36,37 Phosphorylated Akt activated mTOR complexes, which in turn downregulated autophagy.22,38,39 On the other hand, calpastatin and rilmenidine removed polyQ aggregation such as mutant Htt and α-synuclein by activating JNK.

…expanded repeats ofHttthrough mTOR pathway.…

…such as mutantHttand α-synuclein by…

Show Full Abstract

Trinucleotide CAG repeat expansion in the coding region of genes has a propensity to form polyglutamine (polyQ) aggregates that contribute to neuronal disorders. Strategies in elevating autophagy to disintegrate the insoluble aggregates without injuring cells have become a major goal for therapy. In this work, a triazole derivative, OC-13, was found accelerating autophagic clearance of polyQ aggregation in human neuroblastoma cells following induction of the enhanced green fluorescence-conjugated chimeric protein that enclosed 79 polyQ repeats (Q79-EGFP). OC-13 accelerated autophagy development and removed nuclear Q79-EGFP aggregates. The increase of Beclin-1, turnover of LC3-I to LC3-II and degradation of p62 supported autophagy activation. Pretreatment of autophagy inhibitor, bafilomycin A1, not only suppressed autophagolysome fusion, but also impeded aggregate eradication. The study also showed that c-Jun N-terminal kinase/Beclin-1 pathway was activated during OC-13 treatment and c-Jun N-terminal kinase inhibitor impaired autophagy and final breakdown. Autophagic clearance of the insoluble aggregates demonstrated the feasibility of OC-13 in alleviating neuronal disorders because of expanded glutamine stretches.

Also flagged:keto-enaminewaterSchiff basehydroxyaldehydeketo
Journal Article 2016-09-14 No Snippets Thote J, Barike Aiyappa H, Rahul Kumar R, Kandambeth S, Biswal BP, Balaji Shinde D, Chaki Roy N, Banerjee R.
Show Full Abstract

The formation of keto-enamine based crystalline, porous polymers in water is investigated for the first time. Facile access to the Schiff base reaction in water has been exploited to synthesize stable porous structures using the principles of Dynamic Covalent Chemistry (DCC). Most credibly, the water-based Covalent Organic Frameworks (COFs) possess chemical as well as physical properties such as crystallinity, surface area and porosity, which is comparable to their solvothermal counterparts. The formation of COFs in water is further investigated by understanding the nature of the monomers formed using hydroxy and non-hydroxy analogues of the aldehyde. This synthetic route paves a new way to synthesize COFs using a viable, greener route by utilization of the DCC principles in conjunction with the keto-enol tautomerism to synthesize useful, stable and porous COFs in water.

Also flagged:HuntingtonHDneurodegenerative disordercytosineadenineguanine
Journal Article 2016-09-13 ✓ 1 Snippet Harrington DL, Long JD, Durgerian S, Mourany L, Koenig K, Bonner-Jackson A, Paulsen JS, PREDICT-HD Investigators of the Huntington Study Group, Rao SM.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Objectives</h4>Diffusivity in white-matter tracts is abnormal throughout the brain in cross-sectional studies of prodromal Huntington's disease. To date, longitudinal changes have not been observed. The present study investigated cross-sectional and longitudinal changes in white-matter diffusivity in relationship to the phase of prodromal Huntington's progression, and compared them with changes in brain volumes and clinical variables that track disease progression.<h4>Methods</h4>Diffusion MRI profiles were studied for 2 years in 37 gene-negative controls and 64 prodromal Huntington's disease participants in varied phases of disease progression. To estimate the relative importance of diffusivity metrics in the prodromal phase, group effects were rank ordered relative to those obtained from analyses of brain volumes, motor, cognitive, and sensory variables.<h4>Results</h4>First, at baseline diffusivity was abnormal throughout all tracts, especially as individuals approached a manifest Huntington's disease diagnosis. Baseline diffusivity metrics in 6 tracts and basal ganglia volumes best distinguished among the groups. Second, group differences in longitudinal change in diffusivity were localized to the superior fronto-occipital fasciculus, most prominently in individuals closer to a diagnosis. Group differences were also observed in longitudinal changes of most brain volumes, but not clinical variables. Last, increases in motor symptoms across time were associated with greater changes in the superior fronto-occipital fasciculus diffusivity and corpus callosum, cerebrospinal fluid, and lateral ventricle volumes.<h4>Conclusions</h4>These novel findings provide new insights into changes within 2 years in different facets of brain structure and their clinical relevance to changes in symptomatology that is decisive for a manifest Huntington's diagnosis. © 2016 International Parkinson and Movement Disorder Society.

Also flagged:Type 1 Diabetessignal transducer activitypathogenesisinsulinglucagonsomatostatin
Journal Article 2016-09-13 No Snippets Zhang L, Lanzoni G, Battarra M, Inverardi L, Zhang Q.
Show Full Abstract

The etiology of Type 1 Diabetes (T1D) remains elusive. Enzymatically isolated and cultured (EIC) islets cannot fully reflect the natural protein composition and disease process of in vivo islets, because of the stress from isolation procedures. In order to study islet protein composition in conditions close to the natural environment, we performed proteomic analysis of EIC islets, and laser capture microdissected (LCM) human islets and acinar tissue from fresh-frozen pancreas sections of three cadaveric donors. 1104 and 706 proteins were identified from 6 islets equivalents (IEQ) of LCM islets and acinar tissue, respectively. The proteomic profiles of LCM islets were reproducible within and among cadaveric donors. The endocrine hormones were only detected in LCM islets, whereas catalytic enzymes were significantly enriched in acinar tissue. Furthermore, high overlap (984 proteins) and similar function distribution were found between LCM and EIC islets proteomes, except that EIC islets had more acinar contaminants and stress-related signal transducer activity proteins. The comparison among LCM islets, LCM acinar tissue and EIC islets proteomes indicates that LCM combined with proteomic methods enables accurate and unbiased profiling of islet proteome from frozen pancreata. This paves the way for proteomic studies on human islets during the progression of T1D.<h4>Significance</h4>The etiological agent triggering autoimmunity against beta cells in Type 1 diabetes (T1D) remains obscure. The in vitro models available (enzymatically isolated and cultured islets, EIC islets) do not accurately reflect what happens in vivo due to lack of the natural environment where islets exist and the preparation-induced changes in cell physiology. The importance of this study is that we investigated the feasibility of laser capture microdissection (LCM) for the isolation of intact islets from frozen cadaveric pancreatic tissue sections. We compared the protein profile of LCM islets (9 replicates from 3 cadaveric donors) with that of both LCM acinar tissues (6 replicates from the same 3 cadaveric donor as LCM islets) and EIC islets (at least 4 replicates for each sample with the same islets equivalents) by using proteomics techniques with advanced instrumentation, nanoLC-Q Exactive HF Orbitrap mass spectrometry (nano LC-MS/MS). The results demonstrate that the LCM method is reliable in isolating islets with an intact environment. LCM-based islet proteomics is a feasible approach to obtain good proteome coverage for assessing the pathology of T1D using cadaveric pancreatic samples, even from very small sample amounts. Future applications of this LCM-based proteomic method may help us understand the pathogenesis of T1D and identify potential biomarkers for T1D diagnosis at an early stage.

Also flagged:gene expressiondegradationmetabolismneuropsychiatric disorderscancermental illnesses
Journal Article 2016-09-13 ✓ 1 Snippet Mahmoudi E, Cairns MJ.
In-Text Gene Mentions

For instance, in glioblastoma multiforme, which is the most frequent and malignant of primary brain tumors, a cohort of microRNAs, including miR-137, were identified to be significantly downregulated.32 By contrast its overexpression led to inhibition of cell proliferation and invasion in glioma cell lines, perhaps as a result of inverse regulation of Cox-2.93, 94 Li et al. further established that this miR-137 negatively regulated cell viability, anchorage-independent growth and invasion through modulation of CSE1L expression.94 Functional studies in several melanoma cell lines also revealed that miR-137 was able to inhibit melanoma cell invasion, migration, proliferation and induced apoptosis via downregulation of multiple target genes including transcription factor MITF and the oncogenes c-Met, YB1, EZH2 and PAK2, suggesting miR-137 involvement in several significant pathways in melanoma development and progression.95, 96 Lower miR-137 expression contributed to poor survival in stage IV melanoma patients.95 MiR-137 appears to also act as a tumor suppressor in colon cancer.97 MSI1, a stem cell regulator with high expression in colorectal cancer was downregulated by miR-137 in colon tumors leading to reduction in cell growth, colony formation and tumorsphere growth in vitro as well as inhibition of tumor growth in vivo.

Show Full Abstract

MicroRNAs (miRNAs) represent an important class of small regulatory RNAs that control gene expression posttranscriptionally by targeting mRNAs for degradation or translation inhibition. Early studies have revealed a complex role for miRNAs in major biological processes such as development, differentiation, growth and metabolism. MiR-137 in particular, has been of great interest due to its critical role in brain function and putative involvement in the etiology of both neuropsychiatric disorders and cancer. Several lines of evidence suggest that development, differentiation and maturation of the nervous system is strongly linked to the expression of miR-137 and its regulation of a large number of downstream target genes in various pathways. Dysregulation of this molecule has also been implicated in major mental illnesses through its position in a variant allele highly associated with schizophrenia in the largest mega genome-wide association studies. Interestingly, miR-137 has also been shown to act as a tumor suppressor, with numerous studies finding reduced expression in neoplasia including brain tumor. Restoration of miR-137 expression has also been shown to inhibit cell proliferation, migration and metastasis, and induce cell cycle arrest, differentiation and apoptosis. These properties of miR-137 propose its potential for prognosis, diagnosis and as a therapeutic target for treatment of several human neurological and neoplastic disorders. In this review, we provide details on the discovery, targets, function, regulation and disease involvement of miR-137 with a broad look at recent discovery in this area.

Also flagged:gene expressioncell differentiationgene expressionsMyoblast differentiationcell divisionnuclear division
Journal Article 2016-09-13 ✓ 1 Snippet duVerle DA, Yotsukura S, Nomura S, Aburatani H, Tsuda K.
In-Text Gene Mentions

STAU1transports and localizes…

Show Full Abstract

<h4>Background</h4>Single-cell RNA sequencing is fast becoming one the standard method for gene expression measurement, providing unique insights into cellular processes. A number of methods, based on general dimensionality reduction techniques, have been suggested to help infer and visualise the underlying structure of cell populations from single-cell expression levels, yet their models generally lack proper biological grounding and struggle at identifying complex differentiation paths.<h4>Results</h4>Here we introduce cellTree: an R/Bioconductor package that uses a novel statistical approach, based on document analysis techniques, to produce tree structures outlining the hierarchical relationship between single-cell samples, while identifying latent groups of genes that can provide biological insights.<h4>Conclusions</h4>With cellTree, we provide experimentalists with an easy-to-use tool, based on statistically and biologically-sound algorithms, to efficiently explore and visualise single-cell RNA data. The cellTree package is publicly available in the online Bionconductor repository at: http://bioconductor.org/packages/cellTree/ .

Also flagged:Gene ExpressionSF3B4acrofacial dysostosesRodriguez syndromeNager syndromesmall nuclear ribonucleoprotein
Journal Article 2016-09-13 ✓ 5 Snippets Marques F, Tenney J, Duran I, Martin J, Nevarez L, Pogue R, Krakow D, Cohn DH, Li B.
In-Text Gene Mentions

…SOX9 , andSOX6transcription factor genes,…

…including DLX5 andSOX6, that are…

…upstream regulator ofSOX6and plays a…

…secondary reduction ofSOX6transcript levels observed…

…in DLX5 ,SOX6, and SOX9…

Show Full Abstract

The acrofacial dysostoses (AFD) are a genetically heterogeneous group of inherited disorders with craniofacial and limb abnormalities. Rodriguez syndrome is a severe, usually perinatal lethal AFD, characterized by severe retrognathia, oligodactyly and lower limb abnormalities. Rodriguez syndrome has been proposed to be a severe form of Nager syndrome, a non-lethal AFD that results from mutations in SF3B4, a component of the U2 small nuclear ribonucleoprotein particle (U2 snRNP). Furthermore, a case with a phenotype intermediate between Rodriguez and Nager syndromes has been shown to have an SF3B4 mutation. We identified heterozygosity for SF3B4 mutations in Rodriguez syndrome, confirming that the phenotype is a dominant disorder that is allelic with Nager syndrome. The mutations led to reduced SF3B4 synthesis and defects in mRNA splicing, primarily exon skipping. The mutations also led to reduced expression in growth plate chondrocytes of target genes, including the DLX5, DLX6, SOX9, and SOX6 transcription factor genes, which are known to be important for skeletal development. These data provide mechanistic insight toward understanding how SF3B4 mutations lead to the skeletal abnormalities observed in the acrofacial dysostoses.

Also flagged:Hand, foot, and mouth diseaseinfectious illnessCA2-8immune responseviral infectionsimmune responses
Journal Article 2016-09-13 ✓ 1 Snippet Ding Y, Wang Z, Zhang X, Teng Z, Gao C, Qian B, Wang L, Feng J, Wang J, Zhao C, Guo C, Pan W.
In-Text Gene Mentions

…EV71, CA6 andCA10(i.e., a non-specific…

Show Full Abstract

Coxsackievirus A16 (CA16) is one of the major causative agents of hand, foot, and mouth disease worldwide. The non-neutralizing antibody response that targets CA16 VP1 remains poorly elucidated. In the present study, antibody responses against CA16 VP1 in Shanghai blood donors and Shanxi individuals were analyzed by ELISA and inhibitory ELISA using five CA16 VP1 antigens: VP11-297, VP141-297, VP11-60, VP145-58 and VP161-297. The correlation coefficients for most of the reactions against each of the five antigens and the inhibition of the anti-CA16 VP1 antibody response produced by the various antigens were higher in Shanghai blood donors compared to those in Shanxi individuals. VP11-297 and VP141-297 strongly inhibited the anti-CA16 VP1 response in serum samples from both populations, while VP145-58 and VP161-297 intermediately and weakly inhibited the anti-CA16 VP1 response, respectively, in only Shanghai group. A specific type of inhibition (anti-CA16 VP1 was completely inhibited by both VP11-60 and VP141-297) characterized by high neutralizing antibody titers was identified and accounted for 71.4% of the strongly reactive samples from the Shanghai group. These results indicate that the Shanghai blood donors exhibited a consistent and specific antibody response, while the Shanxi individuals showed an inconsistent and non-specific antibody response. These findings may improve the understanding of host humoral immunity against CA16 and help to identify an effective approach for seroepidemiological surveillance and specific diagnosis of CA16 infection based on normal and competitive ELISA.

Also flagged:myopiagene expressionvision disordervisual impairmentocular disorderscataract
Journal Article 2016-09-13 No Snippets Tkatchenko AV, Luo X, Tkatchenko TV, Vaz C, Tanavde VM, Maurer-Stroh S, Zauscher S, Gonzalez P, Young TL.
Show Full Abstract

Development of myopia is associated with large-scale changes in ocular tissue gene expression. Although differential expression of coding genes underlying development of myopia has been a subject of intense investigation, the role of non-coding genes such as microRNAs in the development of myopia is largely unknown. In this study, we explored myopia-associated miRNA expression profiles in the retina and sclera of C57Bl/6J mice with experimentally induced myopia using microarray technology. We found a total of 53 differentially expressed miRNAs in the retina and no differences in miRNA expression in the sclera of C57BL/6J mice after 10 days of visual form deprivation, which induced -6.93 ± 2.44 D (p < 0.000001, n = 12) of myopia. We also identified their putative mRNA targets among mRNAs found to be differentially expressed in myopic retina and potential signaling pathways involved in the development of form-deprivation myopia using miRNA-mRNA interaction network analysis. Analysis of myopia-associated signaling pathways revealed that myopic response to visual form deprivation in the retina is regulated by a small number of highly integrated signaling pathways. Our findings highlighted that changes in microRNA expression are involved in the regulation of refractive eye development and predicted how they may be involved in the development of myopia by regulating retinal gene expression.

Also flagged:deathdexamethasonedeliberate self-harmself-mutilationselfinjury
Journal Article 2016-09-13 No Snippets Chang BP, Franklin JC, Ribeiro JD, Fox KR, Bentley KH, Kleiman EM, Nock MK.
Show Full Abstract

Prior studies have proposed a wide range of potential biological risk factors for future suicidal behaviors. Although strong evidence exists for biological correlates of suicidal behaviors, it remains unclear if these correlates are also risk factors for suicidal behaviors. We performed a meta-analysis to integrate the existing literature on biological risk factors for suicidal behaviors and to determine their statistical significance. We conducted a systematic search of PubMed, PsycInfo and Google Scholar for studies that used a biological factor to predict either suicide attempt or death by suicide. Inclusion criteria included studies with at least one longitudinal analysis using a biological factor to predict either of these outcomes in any population through 2015. From an initial screen of 2541 studies we identified 94 cases. Random effects models were used for both meta-analyses and meta-regression. The combined effect of biological factors produced statistically significant but relatively weak prediction of suicide attempts (weighted mean odds ratio (wOR)=1.41; CI: 1.09-1.81) and suicide death (wOR=1.28; CI: 1.13-1.45). After accounting for publication bias, prediction was nonsignificant for both suicide attempts and suicide death. Only two factors remained significant after accounting for publication bias-cytokines (wOR=2.87; CI: 1.40-5.93) and low levels of fish oil nutrients (wOR=1.09; CI: 1.01-1.19). Our meta-analysis revealed that currently known biological factors are weak predictors of future suicidal behaviors. This conclusion should be interpreted within the context of the limitations of the existing literature, including long follow-up intervals and a lack of tests of interactions with other risk factors. Future studies addressing these limitations may more effectively test for potential biological risk factors.

Also flagged:major depressive disorderDepressionescitalopramnortriptylinecitalopramserotonin
Journal Article 2016-09-13 No Snippets Li QS, Tian C, Seabrook GR, Drevets WC, Narayan VA.
Show Full Abstract

Genetic predisposition may contribute to the differences in drug-specific, class-specific or antidepressant-wide treatment resistance. Clinical studies with the genetic data are often limited in sample sizes. Drug response obtained from self-reports may offer an alternative approach to conduct a study with much larger sample size. Using the phenotype data collected from 23andMe 'Antidepressant Efficacy and Side Effects' survey and genotype data from 23andMe's research participants, we conducted genome-wide association study (GWAS) on subjects of European ancestry using four groups of phenotypes (a) non-treatment-resistant depression (n=7795) vs treatment-resistant depression (TRD, n=1311), (b) selective serotonin reuptake inhibitors (SSRI) responders (n=6348) vs non-responders (n=3340), (c) citalopram/escitalopram responders (n=2963) vs non-responders (n=2005), and (d) norepinephrine-dopamine reuptake inhibitor (NDRI, bupropion) responders (n=2675) vs non-responders (n=1861). Each of these subgroups was also compared with controls (n ~ 190 000). The most significant association was from bupropion responders vs non-responders analysis. Variant rs1908557 (P=2.6 × 10(-8), OR=1.35) passed the conventional genome-wide significance threshold (P=5 × 10(-8)) and was located within the intron of human spliced expressed sequence tags in chromosome 4. Gene sets associated with long-term depression, circadian rhythm and vascular endothelial growth factor (VEGF) pathway were enriched in the bupropion analysis. No single-nucleotide polymorphism passed genome-wide significance threshold in other analyses. The heritability estimates for each response group compared with controls were between 0.15 and 0.25, consistent with the known heritability for major depressive disorder.

Also flagged:intraventricular hemorrhagenecrotizing enterocolitisanemiagestationcardiac arrestpolyethylene
Journal Article 2016-09-13 ✓ 5 Snippets Bolstridge J, Bell T, Dean B, Mackley A, Moore G, Swift C, Viscount D, Paul DA, Pearlman SA.
In-Text Gene Mentions

DCC, we evaluated two cohorts of very low birth weight

DCC has proven benefit, it has also been associated with an increased incidence of jaundice requiring phototherapy and delivery room hypothermia

DCC to be associated with less admission hypothermia

DCC as it may be faster and hence reduce the risk of hypothermia

DCChas also been…

Show Full Abstract

<h4>Background</h4>Due to clinical benefits, delayed cord clamping (DCC) is recommended in infants born before 37 weeks gestational age. The objective was to institute a delayed cord clamping program and to evaluate clinical outcomes one year after initiation.<h4>Methods</h4>This study occured at Christiana Care Health System, a tertiary care facility with a 52 bed level 3 Neonatal Intensive Care Unit (NICU). A multidisciplinary team created a departmental policy, a DCC protocol and educational programs to support the development of a DCC program. A year after initiation of DCC, we evaluated two cohorts of very low birth weight (VLBW) infants (<1500 g) prior to (Cohort 1) and after initiation (Cohort 2) of DCC (n = 136 and n = 142 respectively). Chart review was conducted to evaluate demographic data and clinical outcomes. Analysis was completed with a retrospective, cohort analysis on an intention-to-treat basis.<h4>Results</h4>There were no differences in demographic factors between the two cohorts. We demonstrated a 73 % compliance rate with the delayed cord clamping protocol and a decrease in the percentage of VLBW infants requiring red blood cell transfusion from 53.7 to 35.9 % (p = 0.003). We also found a decreased need for respiratory support in the second cohort with no increases in the balancing measures of admission hypothermia and jaundice requiring phototherapy. During the Control Phase ongoing monitoring and education has led to a 93.7 % compliance rate.<h4>Conclusions</h4>A multidisciplinary team including key leadership from the obstetric and pediatric departments allowed for the rapid and safe implementation of DCC.

Also flagged:InsulinSecretionHuntingtin-associated protein 1Hap1Huntington diseasemicrotubule-dependent transporters
Journal Article 2016-09-13 ✓ 1 Snippet Pan JY, Yuan S, Yu T, Su CL, Liu XL, He J, Li H.
In-Text Gene Mentions

Htt

Show Full Abstract

Huntingtin-associated protein 1 (Hap1) was originally identified as a protein that binds to the Huntington disease protein, huntingtin. Growing evidence has shown that Hap1 participates in intracellular trafficking via its association with various microtubule-dependent transporters and organelles. Recent studies also revealed that Hap1 is involved in exocytosis such as insulin release from pancreatic β-cells. However, the mechanism underlying the action of Hap1 on insulin release remains to be investigated. We found that Hap1 knock-out mice had a lower plasma basal insulin level than control mice. Using cultured pancreatic β-cell lines, INS-1 cells, we confirmed that decreasing Hap1 reduces the number of secreted vesicles and inhibits vesicle exocytosis. Electrophysiology and imaging of intracellular Ca<sup>2+</sup> measurements demonstrated that Hap1 depletion significantly reduces the influx of Ca<sup>2+</sup> mediated by L-type Ca<sup>2+</sup> channels (Cav). This decrease is not due to reduced expression of Cav1.2 channel mRNA but results from the decreased distribution of Cav1.2 on the plasma membrane of INS-1 cells. Fluorescence recovery after photobleaching showed a defective movement of Cav1.2 in Hap1 silencing INS-1 cells. Our findings suggest that Hap1 is important for insulin secretion of pancreatic β-cells via regulating the intracellular trafficking and plasma membrane localization of Cav1.2, providing new insight into the mechanisms that regulate insulin release from pancreatic β-cells.

Also flagged:esophageal variceshepatic cirrhosisarteriovenous fistulasynthesissepsistype II diabetes
Journal Article 2016-09-13 No Snippets Van der Cruyssen F, Manzelli A.
Show Full Abstract

<h4>Background</h4>The spleen is the second most commonly injured organ in cases of abdominal trauma. Management of splenic injury depends on the clinical status of the patient and can include nonoperative management (NOM), splenic artery embolization (SAE), surgery (operative splenic salvage or splenectomy), or a combination of these treatments. In nonoperatively managed cases, SAE is sometimes used to control haemorrhage. However, the indications for SAE have not been clearly defined and, in some cases, the potential complications of the procedure may outweigh its benefits.<h4>Review of the literature</h4>Through review of the literature we address the question of when SAE is indicated in combination with NOM of splenic injury, and whether SAE may delay needed surgical treatment in some cases. This systematic review highlighted the use of imperfect and inconsistent scoring systems in the diagnosis of splenic injury, the lack of consensus regarding indications for SAE, and the potential for severe morbidities associated with this procedure. Based on current literature and evidence we provide a new, non-verified, decision algorithm.<h4>Conclusions</h4>NOM+ SAE involves potential risks and operative management may be preferable to SAE for certain patients. To clarify current literature, we propose a new algorithm for blunt abdominal trauma that should be validated prospectively. New evidence-based protocols should be developed to guide diagnosis and management of patients with splenic trauma.

Also flagged:cGASSTINGviral infectioncyclic GMP-AMP synthaseadaptor proteinresponse
Journal Article 2016-09-13 ✓ 5 Snippets Hu MM, Yang Q, Xie XQ, Liao CY, Lin H, Liu TT, Yin L, Shu HB.
In-Text Gene Mentions

Trim38 also sumoylated Sting during the early phase of viral infection, promoting both Sting activation and protein stability.

Here we found that the ubiquitin ligase Trim38 targets cGas for sumoylation in uninfected cells and during the early phase of viral infection.

…the ubiquitin ligaseTrim38targets cGas for…

Trim38also sumoylated Sting…

…essential role forTrim38in the innate…

Show Full Abstract

During viral infection, sensing of cytosolic DNA by the cyclic GMP-AMP synthase (cGAS) activates the adaptor protein STING and triggers an antiviral response. Little is known about the mechanisms that determine the kinetics of activation and deactivation of the cGAS-STING pathway, ensuring effective but controlled innate antiviral responses. Here we found that the ubiquitin ligase Trim38 targets cGas for sumoylation in uninfected cells and during the early phase of viral infection. Sumoylation of cGas prevented its polyubiquitination and degradation. Trim38 also sumoylated Sting during the early phase of viral infection, promoting both Sting activation and protein stability. In the late phase of infection, cGas and Sting were desumoylated by Senp2 and subsequently degraded via proteasomal and chaperone-mediated autophagy pathways, respectively. Our findings reveal an essential role for Trim38 in the innate immune response to DNA virus and provide insight into the mechanisms that ensure optimal activation and deactivation of the cGAS-STING pathway.

Also flagged:mitochondrialtransition porepathogenesisHuntington diseaseHDneurological disorder
Journal Article 2016-09-13 ✓ 4 Snippets Quintanilla RA, Tapia C, Pérez MJ.
In-Text Gene Mentions

HD is caused by a pathological expansion of CAG repeats in the huntingtin gene that codifies for a protein called huntingtin (Htt), which principal function is not completely understood.

Accumulative evidence shows that this pathological expansion modifies Htt function affecting different neuronal targets, including mitochondrial function which is an important factor that contributes to HD.

…protein called huntingtin (Htt), which principal function…

…athological expansion modifiesHttfunction affecting different…

Show Full Abstract

Huntington disease (HD) is a devastating neurological disorder that affects the striatum and cortex of patients. HD patients develop progressive motor dysfunction and psychiatric disturbances with gradual dementia. HD is caused by a pathological expansion of CAG repeats in the huntingtin gene that codifies for a protein called huntingtin (Htt), which principal function is not completely understood. Accumulative evidence shows that this pathological expansion modifies Htt function affecting different neuronal targets, including mitochondrial function which is an important factor that contributes to HD. Interestingly, several groups have shown mitochondrial disturbances including calcium handling defects, depolarization, decrease of mitochondrial transport, ATP reduction, and increase of reactive oxygen species (ROS) in cellular and murine HD models. Systematic analysis of this evidence indicates that a mitochondrial structure, the mitochondrial permeability transition pore (mPTP), could be responsible for these changes that affect mitochondria. The mPTP plays an important role in apoptosis and neurodegeneration. It has also been reported to have some physiological functions in heart development and synaptic communication. In HD, the presence of mutant huntingtin (mHtt) activates this mechanism producing a significant compromise of mitochondrial metabolism and bioenergetics. Considering these findings this review explores the evidence that suggests the important role of mPTP in the mitochondrial impairment induced by mHtt, which leads to calcium derangement and contributes to neuronal dysfunction in HD.

Also flagged:Copolymerscopolymercamptothecin-caprolactonephenyl isocyaniderhodamine B
Journal Article 2016-09-13 No Snippets Shi S, Liu Y, Chen Y, Zhang Z, Ding Y, Wu Z, Yin J, Nie L.
Show Full Abstract

With high optical absorption efficiency, near infrared (NIR) dyes have been proposed as theranostic agents for fluorescence imaging, photoacoustic imaging (PAI), and photothermal therapy (PTT). However, inherent hydrophobicity and short circulation time of small molecule hinder the further biomedical application. Herein smart amphiphilic copolymer was synthesized containing IR780/camptothecin@poly(ε-caprolactone) (IR780/CPT@PCL) as core, helical poly(phenyl isocyanide) (PPI) blocks as shell with the pH-responsive rhodamine B (RhB) moieties in the core-shell interface. With hydrophilic helical PPI coronas, these micelles present significantly enhanced cell-penetrating capacity that plays a key role in facilitating intracellular delivery of various cargos. By encapsulating CPT and IR780 molecules, the multifunctional self-assemble probe has huge potential to realize functional cooperativity and adaptability for cancer diagnosis and therapy. The <i>in vitro</i> and <i>in vivo</i> experimental results demonstrate that the pH-triggered fluorescent responsiveness and strong acoustic generation permit them efficient fluorescent and PA signal sensing for cancer diagnosis. Moreover, with 808 nm laser irradiation, the generated heat significantly improves the drug release from PCL core, leading to synergetic chemo-photothermal therapy and decreases tumor recurrence rates in mice. Overall, the biocompatible multifunctional micelles with these combined advantages can potentially be utilized for PAI guided disease diagnosis and tumor ablation.

Also flagged:GFAPS100BHdhOLIG2IBA1nuclei
Journal Article 2016-09-12 ✓ 5 Snippets Jansen AH, van Hal M, Op den Kelder IC, Meier RT, de Ruiter AA, Schut MH, Smith DL, Grit C, Brouwer N, Kamphuis W, Boddeke HW, den Dunnen WF, van Roon WM, Bates GP, Hol EM, Reits EA.
In-Text Gene Mentions

Htt

HTT

HD is caused by a CAG expansion in the Huntingtin (HTT) gene resulting in a polyglutamine‐expansion in the mutant HTT protein (mHTT), and the formation of mHTT inclusions in the nucleus and the cytoplasm of cells.

Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder that is caused by a CAG expansion in the Huntingtin (HTT) gene, leading to HTT inclusion formation in the brain.

…gene, leading toHTTinclusion formation in…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder that is caused by a CAG expansion in the Huntingtin (HTT) gene, leading to HTT inclusion formation in the brain. The mutant huntingtin protein (mHTT) is ubiquitously expressed and therefore nuclear inclusions could be present in all brain cells. The effects of nuclear inclusion formation have been mainly studied in neurons, while the effect on glia has been comparatively disregarded. Astrocytes, microglia, and oligodendrocytes are glial cells that are essential for normal brain function and are implicated in several neurological diseases. Here we examined the number of nuclear mHTT inclusions in both neurons and various types of glia in the two brain areas that are the most affected in HD, frontal cortex, and striatum. We compared nuclear mHTT inclusion body formation in three HD mouse models that express either full-length HTT or an N-terminal exon1 fragment of mHTT, and we observed nuclear inclusions in neurons, astrocytes, oligodendrocytes, and microglia. When studying the frequency of cells with nuclear inclusions in mice, we found that half of the population of neurons contained nuclear inclusions at the disease end stage, whereas the proportion of GFAP-positive astrocytes and oligodendrocytes having a nuclear inclusion was much lower, while microglia hardly showed any nuclear inclusions. Nuclear inclusions were also present in neurons and all studied glial cell types in human patient material. This is the first report to compare nuclear mHTT inclusions in glia and neurons in different HD mouse models and HD patient brains. GLIA 2016;65:50-61.

Also flagged:hematological malignanciesHLAtumorpeptidesminor histocompatibility antigensHLA class I
Journal Article 2016-09-12 No Snippets van der Lee DI, Pont MJ, Falkenburg JH, Griffioen M.
Show Full Abstract

Allogeneic stem cell transplantation can be a curative treatment for hematological malignancies. After HLA-matched allogeneic stem cell transplantation, beneficial anti-tumor immunity as well as detrimental side-effects can develop due to donor-derived T-cells recognizing polymorphic peptides that are presented by HLA on patient cells. Polymorphic peptides on patient cells that are recognized by specific T-cells are called minor histocompatibility antigens (MiHA), while the respective peptides in donor cells are allelic variants. MiHA can be identified by reverse strategies in which large sets of peptides are screened for T-cell recognition. In these strategies, selection of peptides by prediction algorithms may be relevant to increase the efficiency of MiHA discovery. We investigated the value of online prediction algorithms for MiHA discovery and determined the in silico characteristics of 68 autosomal HLA class I-restricted MiHA that have been identified as natural ligands by forward strategies in which T-cells from in vivo immune responses after allogeneic stem cell transplantation are used to identify the antigen. Our analysis showed that HLA class I binding was accurately predicted for 87% of MiHA of which a relatively large proportion of peptides had strong binding affinity (56%). Weak binding affinity was also predicted for a considerable number of antigens (31%) and the remaining 13% of MiHA were not predicted as HLA class I binding peptides. Besides prediction for HLA class I binding, none of the other online algorithms significantly contributed to MiHA characterization. Furthermore, we demonstrated that the majority of MiHA do not differ from their allelic variants in in silico characteristics, suggesting that allelic variants can potentially be processed and presented on the cell surface. In conclusion, our analyses revealed the in silico characteristics of 68 HLA class I-restricted MiHA and explored the value of online algorithms to predict T-cell ligands that are created by genetic variants.

Also flagged:High blood pressurecardiovascular diseasedeathENPEPhypertensionRBM47
Journal Article 2016-09-12 ✓ 3 Snippets Surendran P, Drenos F, Young R, Warren H, Cook JP, Manning AK, Grarup N, Sim X, Barnes DR, Witkowska K, Staley JR, Tragante V, Tukiainen T, Yaghootkar H, Masca N, Freitag DF, Ferreira T, Giannakopoulou O, Tinker A, Harakalova M, Mihailov E, Liu C, Kraja AT, Fallgaard Nielsen S, Rasheed A, Samuel M, Zhao W, Bonnycastle LL, Jackson AU, Narisu N, Swift AJ, Southam L, Marten J, Huyghe JR, Stančáková A, Fava C, Ohlsson T, Matchan A, Stirrups KE, Bork-Jensen J, Gjesing AP, Kontto J, Perola M, Shaw-Hawkins S, Havulinna AS, Zhang H, Donnelly LA, Groves CJ, Rayner NW, Neville MJ, Robertson NR, Yiorkas AM, Herzig KH, Kajantie E, Zhang W, Willems SM, Lannfelt L, Malerba G, Soranzo N, Trabetti E, Verweij N, Evangelou E, Moayyeri A, Vergnaud AC, Nelson CP, Poveda A, Varga TV, Caslake M, de Craen AJ, Trompet S, Luan J, Scott RA, Harris SE, Liewald DC, Marioni R, Menni C, Farmaki AE, Hallmans G, Renström F, Huffman JE, Hassinen M, Burgess S, Vasan RS, Felix JF, CHARGE-Heart Failure Consortium, Uria-Nickelsen M, Malarstig A, Reily DF, Hoek M, Vogt T, Lin H, Lieb W, EchoGen Consortium, Traylor M, Markus HF, METASTROKE Consortium, Highland HM, Justice AE, Marouli E, GIANT Consortium, Lindström J, Uusitupa M, Komulainen P, Lakka TA, Rauramaa R, Polasek O, Rudan I, Rolandsson O, Franks PW, Dedoussis G, Spector TD, EPIC-InterAct Consortium, Jousilahti P, Männistö S, Deary IJ, Starr JM, Langenberg C, Wareham NJ, Brown MJ, Dominiczak AF, Connell JM, Jukema JW, Sattar N, Ford I, Packard CJ, Esko T, Mägi R, Metspalu A, de Boer RA, van der Meer P, van der Harst P, Lifelines Cohort Study, Gambaro G, Ingelsson E, Lind L, de Bakker PI, Numans ME, Brandslund I, Christensen C, Petersen ER, Korpi-Hyövälti E, Oksa H, Chambers JC, Kooner JS, Blakemore AI, Franks S, Jarvelin MR, Husemoen LL, Linneberg A, Skaaby T, Thuesen B, Karpe F, Tuomilehto J, Doney AS, Morris AD, Palmer CN, Holmen OL, Hveem K, Willer CJ, Tuomi T, Groop L, Käräjämäki A, Palotie A, Ripatti S, Salomaa V, Alam DS, Shafi Majumder AA, Di Angelantonio E, Chowdhury R, McCarthy MI, Poulter N, Stanton AV, Sever P, Amouyel P, Arveiler D, Blankenberg S, Ferrières J, Kee F, Kuulasmaa K, Müller-Nurasyid M, Veronesi G, Virtamo J, Deloukas P, Wellcome Trust Case Control Consortium, Elliott P, Understanding Society Scientific Group, Zeggini E, Kathiresan S, Melander O, Kuusisto J, Laakso M, Padmanabhan S, Porteous D, Hayward C, Scotland G, Collins FS, Mohlke KL, Hansen T, Pedersen O, Boehnke M, Stringham HM, EPIC-CVD Consortium, Frossard P, Newton-Cheh C, CHARGE+ Exome Chip Blood Pressure Consortium, Tobin MD, Nordestgaard BG, T2D-GENES Consortium, GoT2DGenes Consortium, ExomeBP Consortium, CHD Exome+ Consortium, Caulfield MJ, Mahajan A, Morris AP, Tomaszewski M, Samani NJ, Saleheen D, Asselbergs FW, Lindgren CM, Danesh J, Wain LV, Butterworth AS, Howson JM, Munroe PB.
In-Text Gene Mentions

Focusing on SNVs that were GWS for any BP trait from our transformed discovery data for either ancestry, there were 25 coding variants, of which 6 were predicted to be damaging at loci labelled CDC25A, SLC39A8, HFE, ULK4, ST7L-CAPZA1-MOV10 and CYP1A1-ULK3.

…labelled CDC25A, SLC39A8,HFE, ULK4, ST7L-CAPZA1-MOV10 and…

…loci labelled SLC39A8,HFEand ST7-CAPZA1-MOV10.…

Show Full Abstract

High blood pressure is a major risk factor for cardiovascular disease and premature death. However, there is limited knowledge on specific causal genes and pathways. To better understand the genetics of blood pressure, we genotyped 242,296 rare, low-frequency and common genetic variants in up to 192,763 individuals and used ∼155,063 samples for independent replication. We identified 30 new blood pressure- or hypertension-associated genetic regions in the general population, including 3 rare missense variants in RBM47, COL21A1 and RRAS with larger effects (>1.5 mm Hg/allele) than common variants. Multiple rare nonsense and missense variant associations were found in A2ML1, and a low-frequency nonsense variant in ENPEP was identified. Our data extend the spectrum of allelic variation underlying blood pressure traits and hypertension, provide new insights into the pathophysiology of hypertension and indicate new targets for clinical intervention.

Also flagged:BPhypertensiontype 2 diabetesNPPAnatriuretic peptide Achromosomes
Journal Article 2016-09-12 ✓ 2 Snippets Ehret GB, Ferreira T, Chasman DI, Jackson AU, Schmidt EM, Johnson T, Thorleifsson G, Luan J, Donnelly LA, Kanoni S, Petersen AK, Pihur V, Strawbridge RJ, Shungin D, Hughes MF, Meirelles O, Kaakinen M, Bouatia-Naji N, Kristiansson K, Shah S, Kleber ME, Guo X, Lyytikäinen LP, Fava C, Eriksson N, Nolte IM, Magnusson PK, Salfati EL, Rallidis LS, Theusch E, Smith AJP, Folkersen L, Witkowska K, Pers TH, Joehanes R, Kim SK, Lataniotis L, Jansen R, Johnson AD, Warren H, Kim YJ, Zhao W, Wu Y, Tayo BO, Bochud M, CHARGE-EchoGen consortium, CHARGE-HF consortium, Wellcome Trust Case Control Consortium, Absher D, Adair LS, Amin N, Arking DE, Axelsson T, Baldassarre D, Balkau B, Bandinelli S, Barnes MR, Barroso I, Bevan S, Bis JC, Bjornsdottir G, Boehnke M, Boerwinkle E, Bonnycastle LL, Boomsma DI, Bornstein SR, Brown MJ, Burnier M, Cabrera CP, Chambers JC, Chang IS, Cheng CY, Chines PS, Chung RH, Collins FS, Connell JM, Döring A, Dallongeville J, Danesh J, de Faire U, Delgado G, Dominiczak AF, Doney ASF, Drenos F, Edkins S, Eicher JD, Elosua R, Enroth S, Erdmann J, Eriksson P, Esko T, Evangelou E, Evans A, Fall T, Farrall M, Felix JF, Ferrières J, Ferrucci L, Fornage M, Forrester T, Franceschini N, Duran OHF, Franco-Cereceda A, Fraser RM, Ganesh SK, Gao H, Gertow K, Gianfagna F, Gigante B, Giulianini F, Goel A, Goodall AH, Goodarzi MO, Gorski M, Gräßler J, Groves C, Gudnason V, Gyllensten U, Hallmans G, Hartikainen AL, Hassinen M, Havulinna AS, Hayward C, Hercberg S, Herzig KH, Hicks AA, Hingorani AD, Hirschhorn JN, Hofman A, Holmen J, Holmen OL, Hottenga JJ, Howard P, Hsiung CA, Hunt SC, Ikram MA, Illig T, Iribarren C, Jensen RA, Kähönen M, Kang H, Kathiresan S, Keating BJ, Khaw KT, Kim YK, Kim E, Kivimaki M, Klopp N, Kolovou G, Komulainen P, Kooner JS, Kosova G, Krauss RM, Kuh D, Kutalik Z, Kuusisto J, Kvaløy K, Lakka TA, Lee NR, Lee IT, Lee WJ, Levy D, Li X, Liang KW, Lin H, Lin L, Lindström J, Lobbens S, Männistö S, Müller G, Müller-Nurasyid M, Mach F, Markus HS, Marouli E, McCarthy MI, McKenzie CA, Meneton P, Menni C, Metspalu A, Mijatovic V, Moilanen L, Montasser ME, Morris AD, Morrison AC, Mulas A, Nagaraja R, Narisu N, Nikus K, O'Donnell CJ, O'Reilly PF, Ong KK, Paccaud F, Palmer CD, Parsa A, Pedersen NL, Penninx BW, Perola M, Peters A, Poulter N, Pramstaller PP, Psaty BM, Quertermous T, Rao DC, Rasheed A, Rayner NWNWR, Renström F, Rettig R, Rice KM, Roberts R, Rose LM, Rossouw J, Samani NJ, Sanna S, Saramies J, Schunkert H, Sebert S, Sheu WH, Shin YA, Sim X, Smit JH, Smith AV, Sosa MX, Spector TD, Stančáková A, Stanton A, Stirrups KE, Stringham HM, Sundstrom J, Swift AJ, Syvänen AC, Tai ES, Tanaka T, Tarasov KV, Teumer A, Thorsteinsdottir U, Tobin MD, Tremoli E, Uitterlinden AG, Uusitupa M, Vaez A, Vaidya D, van Duijn CM, van Iperen EPA, Vasan RS, Verwoert GC, Virtamo J, Vitart V, Voight BF, Vollenweider P, Wagner A, Wain LV, Wareham NJ, Watkins H, Weder AB, Westra HJ, Wilks R, Wilsgaard T, Wilson JF, Wong TY, Yang TP, Yao J, Yengo L, Zhang W, Zhao JH, Zhu X, Bovet P, Cooper RS, Mohlke KL, Saleheen D, Lee JY, Elliott P, Gierman HJ, Willer CJ, Franke L, Hovingh GK, Taylor KD, Dedoussis G, Sever P, Wong A, Lind L, Assimes TL, Njølstad I, Schwarz PE, Langenberg C, Snieder H, Caulfield MJ, Melander O, Laakso M, Saltevo J, Rauramaa R, Tuomilehto J, Ingelsson E, Lehtimäki T, Hveem K, Palmas W, März W, Kumari M, Salomaa V, Chen YI, Rotter JI, Froguel P, Jarvelin MR, Lakatta EG, Kuulasmaa K, Franks PW, Hamsten A, Wichmann HE, Palmer CNA, Stefansson K, Ridker PM, Loos RJF, Chakravarti A, Deloukas P, Morris AP, Newton-Cheh C, Munroe PB.
In-Text Gene Mentions

Therefore there are no results for three lower frequency BP loci (SLC39A8, CYP17A1-NT5C2 and GNAS-EDN3) and for the second signal at the following loci: MTHFR-NPPB (rs2272803), MECOM (rs2242338) and HFE rs1800562).

…MECOM (rs2242338) andHFErs1800562).…

Show Full Abstract

To dissect the genetic architecture of blood pressure and assess effects on target organ damage, we analyzed 128,272 SNPs from targeted and genome-wide arrays in 201,529 individuals of European ancestry, and genotypes from an additional 140,886 individuals were used for validation. We identified 66 blood pressure-associated loci, of which 17 were new; 15 harbored multiple distinct association signals. The 66 index SNPs were enriched for cis-regulatory elements, particularly in vascular endothelial cells, consistent with a primary role in blood pressure control through modulation of vascular tone across multiple tissues. The 66 index SNPs combined in a risk score showed comparable effects in 64,421 individuals of non-European descent. The 66-SNP blood pressure risk score was significantly associated with target organ damage in multiple tissues but with minor effects in the kidney. Our findings expand current knowledge of blood pressure-related pathways and highlight tissues beyond the classical renal system in blood pressure regulation.

Also flagged:IL-27Potentiates LupusCD20CD38CD27CD95
Journal Article 2016-09-12 No Snippets Vijayan D, Mohd Redzwan N, Avery DT, Wirasinha RC, Brink R, Walters G, Adelstein S, Kobayashi M, Gray P, Elliott M, Wong M, King C, Vinuesa CG, Ghilardi N, Ma CS, Tangye SG, Batten M.
Show Full Abstract

Germinal centers (GC) give rise to high-affinity and long-lived Abs and are critical in immunity and autoimmunity. IL-27 supports GCs by promoting survival and function of T follicular helper cells. We demonstrate that IL-27 also directly enhances GC B cell function. Exposure of naive human B cells to rIL-27 during in vitro activation enhanced their differentiation into CD20<sup>+</sup>CD38<sup>+</sup>CD27<sup>low</sup>CD95<sup>+</sup>CD10<sup>+</sup> cells, consistent with the surface marker phenotype of GC B cells. This effect was inhibited by loss-of-function mutations in STAT1 but not STAT3 To extend these findings, we studied the in vivo effects of IL-27 signals to B cells in the GC-driven Roquin<sup>san/san</sup> lupus mouse model. Il27ra<sup>-/-</sup>Roquin<sup>san/san</sup> mice exhibited significantly reduced GCs, IgG2a(c)<sup>+</sup> autoantibodies, and nephritis. Mixed bone marrow chimeras confirmed that IL-27 acts through B cell- and CD4<sup>+</sup> T cell-intrinsic mechanisms to support GCs and alter the production of pathogenic Ig isotypes. To our knowledge, our data provide the first evidence that IL-27 signals directly to B cells promote GCs and support the role of IL-27 in lupus.

Also flagged:transcriptional factorsgene expressioncancerhepatocellular carcinomareverse transcriptionliver cancer
Journal Article 2016-09-12 ✓ 1 Snippet Toraih EA, Fawzy MS, El-Falouji AI, Hamed EO, Nemr NA, Hussein MH, Abd El Fadeal NM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Stem cell transcriptional signature activation is an essential event in the development of cancer. This study aimed to investigate the differential expression profile of three pluripotency-associated genes (<i>OCT4</i>, <i>NANOG</i>, and <i>SOX2</i>), G-protein-coupled chemokine receptor 4 (<i>CXCR4</i>) and the ligand (<i>CXCL2</i>), and alpha feto-protein (<i>AFP</i>) in hepatogenic differentiated stem cells and in sera of hepatitis C virus (HCV) and HCV-induced hepatocellular carcinoma (HCC) patients. Mesenchymal stem cells derived from umbilical cord blood were differentiated using hepatogenic differentiation media. Serum specimens were collected from 96 patients (32 cirrhotic HCV, 32 early HCC, and 32 late HCC) and 96 controls. Real-time quantitative reverse transcription polymerase chain reaction was performed for relative quantification of the 6 target genes using LIVAC method. <i>In silico</i> network analysis was also executed to explore the pluripotency and tumorigenic regulatory circuits in liver cancer. The expression levels of all genes declined gradually during the stages of stem cell differentiation. On univariate and multivariate analyses, <i>NANOG</i>, <i>CXCR4</i> and <i>AFP</i> were significantly up-regulated in HCC patients with late clinical stage. In contrast, <i>SOX2</i> and <i>CXCL2</i> were markedly over-expressed in cirrhotic patients and could be used for clear demarcation between cirrhotic and HCC patients in our cases. In conclusion, our data highlight the potential role of <i>SOX2</i> stem cell marker and <i>CXCL2</i> chemokine in liver cell degeneration and fibrogenesis in HCV-induced hepatic cirrhosis in our sample of the Egyptian population. In addition, the significant association of <i>NANOG</i> and <i>CXCR4</i> high-expression with late HCC, could contribute to the acquisition of stem cell-like properties in hepatic cancer and dissemination in late stages, respectively. Taken together, our results could have a potential application in HCC prognosis and treatment.

Also flagged:elavETR3Streptavidinribonucleoproteincarcinomamethionine
Journal Article 2016-09-12 ✓ 1 Snippet Jazurek M, Ciesiolka A, Starega-Roslan J, Bilinska K, Krzyzosiak WJ.
In-Text Gene Mentions

HTT

Show Full Abstract

RNA-protein complexes play a central role in the regulation of fundamental cellular processes, such as mRNA splicing, localization, translation and degradation. The misregulation of these interactions can cause a variety of human diseases, including cancer and neurodegenerative disorders. Recently, many strategies have been developed to comprehensively analyze these complex and highly dynamic RNA-protein networks. Extensive efforts have been made to purify in vivo-assembled RNA-protein complexes. In this review, we focused on commonly used RNA-centric approaches that involve mass spectrometry, which are powerful tools for identifying proteins bound to a given RNA. We present various RNA capture strategies that primarily depend on whether the RNA of interest is modified. Moreover, we briefly discuss the advantages and limitations of in vitro and in vivo approaches. Furthermore, we describe recent advances in quantitative proteomics as well as the methods that are most commonly used to validate robust mass spectrometry data. Finally, we present approaches that have successfully identified expanded repeat-binding proteins, which present abnormal RNA-protein interactions that result in the development of many neurological diseases.

Also flagged:mitochondriaOxygenmitochondrialParkinson diseaseDeathneurodegenerative diseases
Journal Article 2016-09-12 ✓ 1 Snippet Polyzos AA, McMurray CT.
In-Text Gene Mentions

Htt

Show Full Abstract

Mitochondrial dysfunction and ensuing oxidative damage is typically thought to be a primary cause of Huntington's disease, Alzheimer's disease, and Parkinson disease. There is little doubt that mitochondria (MT) become defective as neurons die, yet whether MT defects are the primary cause or a detrimental consequence of toxicity remains unanswered. Oxygen consumption rate (OCR) and glycolysis provide sensitive and informative measures of the functional status MT and the cells metabolic regulation, yet these measures differ depending on the sample source; species, tissue type, age at measurement, and whether MT are measured in purified form or in a cell. The effects of these various parameters are difficult to quantify and not fully understood, but clearly have an impact on interpreting the bioenergetics of MT or their failure in disease states. A major goal of the review is to discuss issues and coalesce detailed information into a reference table to help in assessing mitochondrial dysfunction as a cause or consequence of Huntington's disease.

Also flagged:Colorectal cancercancerpathogenesistumorGene Expressionextracellular
Journal Article 2016-09-12 ✓ 2 Snippets Shen X, Yue M, Meng F, Zhu J, Zhu X, Jiang Y.
In-Text Gene Mentions

…colorectal carcinoma (DCC), SMAD family…

DCChas been shown…

Show Full Abstract

Colorectal cancer (CRC) is one of the most prevalent malignancies worldwide and remains the third leading cause of cancer-associated mortality. The present study aimed to fully elucidate the pathogenesis of CRC and identify associated genes in tumor development. Microarray GSE44076, GSE41328 and GSE44861 datasets were downloaded from the Gene Expression Omnibus database and integrated with meta-analysis. Differentially-expressed genes (DEGs) were identified from CRC samples compared with adjacent non-cancerous controls using the Limma package in R, followed by functional analysis using the Database for Annotation, Visualization, and Integrated Discovery online tool. A protein-protein interaction (PPI) network of DEGs and linker genes was constructed using NetBox software and modules were also mined. Functional annotation was performed for modules with a maximum number of nodes. Subsequent to meta-analysis to pool the data, one dataset that included 327 samples involved in 11,081 genes was obtained. A total of 697 DEGs were identified between CRC samples and adjacent non-cancerous controls. In the PPI network, modules 1 and 5 contained the maximum number of nodes. Collagen, type I, α1 (<i>COL1A1</i>), <i>COL1A2</i> and matrix metallopeptidase 9 (<i>MMP9</i>) in module 1 and UDP-glucose 6-dehydrogenase (<i>UGDH</i>), aldehyde dehydrogenase 1 family, member A1 (<i>ALDH1A1</i>), fatty acid binding protein 4 (<i>FABP4</i>) and monoglyceride lipase (<i>MGLL</i>) in module 5 exhibited a high degree of connectivity. Functional analysis indicated that the genes in module 1 were involved in extracellular matrix (ECM)-associated functions and that the genes in module 5 were involved in metabolism-related functions. Overall, significant DEGs and linker genes, namely <i>COL1A1</i>, <i>COL1A2</i>, <i>MMP9</i>, <i>UGDH</i>, <i>ALDH1A1</i>, <i>FABP4</i> and <i>MGLL</i>, play a crucial role in the development of CRC via regulating the ECM and cell metabolism.

Also flagged:ReproductiveAgingmenopausemenstrual cycleMüllerian hormoneAMH
Journal Article 2016-09-10 ✓ 5 Snippets Jurczak A, Szkup M, Grzywacz A, Safranow K, Grochans E.
In-Text Gene Mentions

In the study, anxiety and mood were not related to the 5-HTT and MAO-A gene polymorphisms in healthy, late-reproductive-stage women.

The study did not demonstrate the relationship between the 5-HTT and MAO-A gene polymorphisms, and the severity of anxiety and mood disorders in healthy late-reproductive-stage women.

The most frequently analysed molecules engaged in the regulation of the level of serotonin in the brain are serotonin transporter (5-HTT), responsible for the transport of this hormone from the extracellular space, and monoamine oxidase A (MAO-A), a key enzyme taking part in the degradation of serotonin.

The aim of this study was to investigate how mood and anxiety of late-reproductive-stage women are related to the 5-HTT and MAO-A gene polymorphisms.

Analysis of the data did not demonstrate statistically significant differences in the levels of state anxiety (STAI X1) and trait anxiety (STAI X2) according to STAI depending on the distribution of genotypes of the 44-bp VNTR polymorphism in the 5-HTT (SLC 6A4) promoter region and the 30-bp VNTR polymorphism in the MAO-A promoter region (p > 0.05).

Show Full Abstract

The purpose of this study was to determine whether anxiety and mood disorders in late-reproductive-stage women are related to the serotonin transporter and monoamine oxidase A gene polymorphisms. Research instrument used in this study were the State-Trait Anxiety Inventory and the UWIST Mood Adjective Checklist. The 44-bp VNTR polymorphism in the 5-HTT (SLC 6A4) promoter region and the 30-bp VNTR polymorphism in the MAO-A promoter region were analyzed. The study included 345 healthy Polish women in the late reproductive stage. The mean age of the participants was 42.3 ± 4.5 years. State anxiety was observed in 16.8 % of the women and trait anxiety in 14.5 %. There were no statistically significant differences in the mood and the mean levels of anxiety depending on the presence of the polymorphisms analyzed in this study. Depressed mood is frequent among healthy women in the late reproductive stage. Anxiety is definitely less common. The study did not demonstrate the relationship between the 5-HTT and MAO-A gene polymorphisms, and the severity of anxiety and mood disorders in healthy late-reproductive-stage women.

Also flagged:HDpathogenesisdeathaxonalHdhneurogenesis
Journal Article 2016-09-10 ✓ 5 Snippets Arteaga-Bracho EE, Arteaga-Bracho EE, Gulinello M, Winchester ML, Pichamoorthy N, Petronglo JR, Zambrano AD, Inocencio J, De Jesus CD, Louie JO, Gokhan S, Mehler MF, Molero AE, Molero AE.
In-Text Gene Mentions

These results indicate that developmental deficits associated with Htt functions render cells present at discrete neural foci increasingly susceptible to cell death, thus implying the potential existence of a loss-of-function developmental component to HD pathogenesis.

…loss of huntingtin (Htt) function during development…

…low levels ofHttthroughout embryonic life…

…deficits associated withHttfunctions render cells…

Htt

Show Full Abstract

The mutation in huntingtin (mHtt) leads to a spectrum of impairments in the developing forebrain of Huntington's disease (HD) mouse models. Whether these developmental alterations are due to loss- or gain-of-function mechanisms and contribute to HD pathogenesis is unknown. We examined the role of selective loss of huntingtin (Htt) function during development on postnatal vulnerability to cell death. We employed mice expressing very low levels of Htt throughout embryonic life to postnatal day 21 (Hdh<sup>d•hyp</sup>). We demonstrated that Hdh<sup>d•hyp</sup> mice exhibit: (1) late-life striatal and cortical neuronal degeneration; (2) neurological and skeletal muscle alterations; and (3) white matter tract impairments and axonal degeneration. Hdh<sup>d•hyp</sup> embryos also exhibited subpallial heterotopias, aberrant striatal maturation and deregulation of gliogenesis. These results indicate that developmental deficits associated with Htt functions render cells present at discrete neural foci increasingly susceptible to cell death, thus implying the potential existence of a loss-of-function developmental component to HD pathogenesis.

Also flagged:TrehaloseSynthesispolystyrenespindlemembranesphospholipids
Journal Article 2016-09-10 No Snippets Yano S, Teramoto N, Shimasaki T, Shibata M.
Show Full Abstract

A photocrosslinkable trehalose derivative carrying mesogenic groups was synthesized by esterification reactions. The derivative (TC-HBPHA) was synthesized by the reaction of partially cinnamoyl-modified trehalose (TC4) with 4-(4-hexyloxybenzoyloxy)phenoxy-6-oxohexanoic acid (HBPHA) as a mesogenic unit. TC-HBPHA showed a nematic liquid crystalline mesophase at a temperature range from 150 °C to 175 °C in the heating process under observation with a polarized optical microscope. The dimerization of the cinnamoyl groups of TC-HBPHA by ultraviolet (UV) light irradiation was monitored by ultraviolet-visible (UV-Vis) spectroscopy and Fourier transform infrared (FT-IR) spectroscopy. The photocrosslinked film was obtained after the UV irradiation of TC-HBPHA, and it kept the liquid crystalline mesophase at almost the same temperature range. Fibroblast cells cultured on the photocrosslinked TC-HBPHA proliferated as well as on the polystyrene culture plate, indicating that the film has no toxicity. Interestingly, some cells on photocrosslinked TC-HBPHA had a spindle shape and aligned characteristically.

Also flagged:gene expressionpregnancy disorderendothelial dysfunctionserine proteasePEangiogenesis
Journal Article 2016-09-10 ✓ 2 Snippets Wang Y, Nie G.
In-Text Gene Mentions

…( EDN1 andPTGIS) and two…

…2 B), butPTGISmRNA was not…

Show Full Abstract

<h4>Introduction</h4>Preeclampsia (PE) is a life-threatening pregnancy disorder characterized by wide-spread endothelial dysfunction. Placental factors circulating in the maternal blood are believed to cause endothelial dysfunction. Our previous study identified HtrA4 as a placenta-specific serine protease that is released into the maternal circulation and significantly increased in early-onset PE. In this study, we examined the impact of HtrA4 on expression of endothelial genes related to vessel biology, using human umbilical vein endothelial cells (HUVECs) as a model.<h4>Methods</h4>HUVECs were treated with 0 or 3 μg/ml HtrA4 (highest concentration seen in PE circulation) for 24 h and analysed by an endothelial cell biology PCR array containing 84 genes. HtrA4-induced changes were then validated by real-time RT-PCR and ELISA for time and dose dependency.<h4>Results</h4>High levels of HtrA4 significantly altered the expression of a range of genes related to inflammation, vaso-activity, angiogenesis, cell adhesion, platelet activation and coagulation. In particular, pro-inflammatory genes IL6, PTGS2 (COX2) and IL1B were significantly increased by HtrA4. IL6 protein in HUVEC media was also drastically increased. THBD, an anticoagulant factor reported to be increased in PE, was significantly up-regulated by HtrA4. In contrast, THBS1, which is involved in many regulatory processes of endothelial cell biology, was severely down-regulated by HtrA4.<h4>Discussion</h4>HtrA4 significantly increased the inflammatory responses of HUVECs, and altered their expression of a number of genes important for vessel biology. These data suggest that placenta-derived HtrA4 that is increased in PE circulation is a potential causal factor of endothelial dysfunction.

Also flagged:mechanosensationmembranecalciumsilanepolyetherspolyethyleneglycol
Journal Article 2016-09-09 No Snippets Ho KK, Lee LM, Liu AP.
Show Full Abstract

All living organisms sense mechanical forces. Engineering mechanosensitive artificial cell through bottom-up in vitro reconstitution offers a way to understand how mixtures of macromolecules assemble and organize into a complex system that responds to forces. We use stable double emulsion droplets (aqueous/oil/aqueous) to prototype mechanosensitive artificial cells. In order to demonstrate mechanosensation in artificial cells, we develop a novel microfluidic device that is capable of trapping double emulsions into designated chambers, followed by compression and aspiration in a parallel manner. The microfluidic device is fabricated using multilayer soft lithography technology, and consists of a control layer and a deformable flow channel. Deflections of the PDMS membrane above the main microfluidic flow channels and trapping chamber array are independently regulated pneumatically by two sets of integrated microfluidic valves. We successfully compress and aspirate the double emulsions, which result in transient increase and permanent decrease in oil thickness, respectively. Finally, we demonstrate the influx of calcium ions as a response of our mechanically activated artificial cell through thinning of oil. The development of a microfluidic device to mechanically activate artificial cells creates new opportunities in force-activated synthetic biology.

Also flagged:Tricarboxylic AcidCycleelectron transportenzyme activitiesHDpyruvate dehydrogenase complex
Journal Article 2016-09-09 ✓ 3 Snippets Naseri NN, Bonica J, Xu H, Park LC, Arjomand J, Chen Z, Gibson GE.
In-Text Gene Mentions

HD is an autosomal dominant inherited disease that is caused by an excessive number of polyglutamine (CAG) repeats in the huntingtin gene (HTT) [1].

…the huntingtin gene (HTT) [ 1 ].…

…MutantHtt(mHtt) forms aggregates…

Show Full Abstract

Metabolic dysfunction is well-documented in Huntington's disease (HD). However, the link between the mutant huntingtin (mHTT) gene and the pathology is unknown. The tricarboxylic acid (TCA) cycle is the main metabolic pathway for the production of NADH for conversion to ATP via the electron transport chain (ETC). The objective of this study was to test for differences in enzyme activities, mRNAs and protein levels related to the TCA cycle between lymphoblasts from healthy subjects and from patients with HD. The experiments utilize the advantages of lymphoblasts to reveal new insights about HD. The large quantity of homogeneous cell populations permits multiple dynamic measures to be made on exactly comparable tissues. The activities of nine enzymes related to the TCA cycle and the expression of twenty-nine mRNAs encoding for these enzymes and enzyme complexes were measured. Cells were studied under baseline conditions and during metabolic stress. The results support our recent findings that the activities of the pyruvate dehydrogenase complex (PDHC) and succinate dehydrogenase (SDH) are elevated in HD. The data also show a large unexpected depression in MDH activities. Furthermore, message levels for isocitrate dehydrogenase 1 (IDH1) were markedly increased in in HD lymphoblasts and were responsive to treatments. The use of lymphoblasts allowed us to clarify that the reported decrease in aconitase activity in HD autopsy brains is likely due to secondary hypoxic effects. These results demonstrate the mRNA and enzymes of the TCA cycle are critical therapeutic targets that have been understudied in HD.

Also flagged:failurehepatic encephalopathymicrocystinacute serum hepatitisTheiler's diseasepyrrolizidine alkaloids
Journal Article 2016-09-09 ✓ 2 Snippets Mittelman NS, Engiles JB, Murphy L, Vudathala D, Johnson AL.
In-Text Gene Mentions

…chronic active hepatitis,hemochromatosis, Fall Panicum (…

…histologic findings (eg,hemochromatosisor characteristic biliary…

Show Full Abstract

An 8-year-old Holsteiner gelding was presented for evaluation of anorexia, obtundation, icterus, and mild colic signs of 48 hours duration. History, physical examination, and initial diagnostics were suggestive of hepatic disease and encephalopathy. Microcystin toxicosis was suspected based on historical administration of a cyanobacteria supplement, associated serum biochemistry abnormalities, and characteristic histopathological changes. Microcystin contamination was confirmed in both supplement containers fed to the horse. Fulminant hepatic failure and encephalopathy progressed resulting in euthanasia. Necropsy findings were consistent with microcystin induced liver failure.

Also flagged:Huntingtons DiseaseKynurenineCD8Huntington's diseaseHDneurodegenerative disorder
Journal Article 2016-09-09 ✓ 3 Snippets Donley DW, Olson AR, Raisbeck MF, Fox JH, Gigley JP.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disorder caused by a CAG-repeat expansion in exon-1 of the huntingtin gene (HTT) that results in expression of a polyglutamine-expanded huntingtin protein [1].

…huntingtin gene (HTT) that results…

…MutantHTTgene-positive individuals demo…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder caused by a polyglutamine-repeat expansion in the huntingtin protein. Activation of the kynurenine pathway of tryptophan degradation is implicated in the pathogenesis of HD. Indoleamine-2,3-dioxygenase (IDO) catalyzes the oxidation of tryptophan to kynurenine, the first step in this pathway. The prevalent, neuroinvasive protozoal pathogen Toxoplasma gondii (T. gondii) results in clinically silent life-long infection in immune-competent individuals. T. gondii infection results in activation of IDO which provides some protection against the parasite by depleting tryptophan which the parasite cannot synthesize. The kynurenine pathway may therefore represent a point of synergism between HD and T. gondii infection. We show here that IDO activity is elevated at least four-fold in frontal cortex and striata of non-infected N171-82Q HD mice at 14-weeks corresponding to early-advanced HD. T. gondii infection at 5 weeks resulted in elevation of cortical IDO activity in HD mice. HD-infected mice died significantly earlier than wild-type infected and HD control mice. Prior to death, infected HD mice demonstrated decreased CD8+ T-lymphocyte proliferation in brain and spleen compared to wild-type infected mice. We demonstrate for the first time that HD mice have an altered response to an infectious agent that is characterized by premature mortality, altered immune responses and early activation of IDO. Findings are relevant to understanding how T. gondii infection may interact with pathways mediating neurodegeneration in HD.

Also flagged:Obsessive-compulsive disorderchronic psychiatric illnessserotoninfluoxetinefluvoxamineparoxetine
Journal Article 2016-09-09 ✓ 4 Snippets Chu CS, Chou PH, Lin CH, Cheng C, Tsai CJ, Lan TH, Huang MW, Nestadt G.
In-Text Gene Mentions

Serotonin concentration in platelets is crucial in maintaining the homeostatic function of platelets and the serotonin transporter (5-HTT) carrier protein functions to maintain the homeostasis of platelet serotonin concentration and serotonin level in blood [40].

Several weeks of treatment with a SSRI has been shown to inhibit 5-HTT and to block the reuptake of serotonin, leading to depletion of serotonin storage in platelets [41,42].

…the serotonin transporter (5-HTT) carrier protein functions…

…shown to inhibit5-HTTand to block…

Show Full Abstract

<h4>Background</h4>Previous research has suggested a link between antidepressants use and the development of cerebrovascular events, but there has never been any study investigating the risk of stroke in obsessive-compulsive disorder (OCD) patients treated with a selective serotonin reuptake inhibitor (SSRI).<h4>Methods</h4>A retrospective observational cohort study was conducted using data from the National Health Insurance Database of Taiwan between the year of 2001 and 2009. A total of 527 OCD patients with 412 subjects in the SSRI use group and 115 in the non SSRI use group were included. Multivariable Cox proportional-hazards models were used to explore the associations between SSRI use and the occurrence of stroke, controlling for age, gender, concomitant medications, and comorbid medical illnesses.<h4>Results</h4>A total of nineteen OCD patients were diagnosed with new onset of stroke during the follow-up period including six cases in the SSRI group and thirteen in the non SSRI use group. SSRI use was demonstrated to be associated with a decreased risk of stroke (hazard ratio [HR] = 0.30; 95% confidence interval [CI] = 0.10-0.86, P = 0.02). The increase in age-related risk of strokes was 2.55 per decade (HR = 2.55; 95% CI = 1.74-3.75, P<0.001). Alternatively, sex, concomitant use of aspirin and non-steroidal anti-inflammatory drugs, and comorbidities with angina pectoris, diabetes mellitus, hypertension, and hyperlipidemia were not found to be associated with an increased risk for stroke in OCD patients.<h4>Conclusions</h4>Our study showed that SSRI use was associated with decreased risk of stroke in OCD patients. Further investigation into the possible biological mechanisms underlying the relationship between stroke and SSRI use in OCD patients is warranted.

Also flagged:mineralCOL11A1diabetesglucoseinsulinOsteoporosis
Journal Article 2016-09-09 No Snippets Hoppmann AS, Schlosser P, Backofen R, Lausch E, Köttgen A.
Show Full Abstract

Genome-wide association studies (GWAS) evaluate associations between genetic variants and a trait or disease of interest free of prior biological hypotheses. GWAS require stringent correction for multiple testing, with genome-wide significance typically defined as association p-value <5*10-8. This study presents a new tool that uses external information about genes to prioritize SNP associations (GenToS). For a given list of candidate genes, GenToS calculates an appropriate statistical significance threshold and then searches for trait-associated variants in summary statistics from human GWAS. It thereby allows for identifying trait-associated genetic variants that do not meet genome-wide significance. The program additionally tests for enrichment of significant candidate gene associations in the human GWAS data compared to the number expected by chance. As proof of principle, this report used external information from a comprehensive resource of genetically manipulated and systematically phenotyped mice. Based on selected murine phenotypes for which human GWAS data for corresponding traits were publicly available, several candidate gene input lists were derived. Using GenToS for the investigation of candidate genes underlying murine skeletal phenotypes in data from a large human discovery GWAS meta-analysis of bone mineral density resulted in the identification of significantly associated variants in 29 genes. Index variants in 28 of these loci were subsequently replicated in an independent GWAS replication step, highlighting that they are true positive associations. One signal, COL11A1, has not been discovered through GWAS so far and represents a novel human candidate gene for altered bone mineral density. The number of observed genes that contained significant SNP associations in human GWAS based on murine candidate gene input lists was much greater than the number expected by chance across several complex human traits (enrichment p-value as low as 10-10). GenToS can be used with any candidate gene list, any GWAS summary file, runs on a desktop computer and is freely available.

Also flagged:gene expressionstrokewaterneurological diseasebrain injuryorganization
Journal Article 2016-09-09 ✓ 1 Snippet Roberts-Galbraith RH, Brubacher JL, Newmark PA.
In-Text Gene Mentions

…like Slit/Robo and Netrin/DCCas well as…

Show Full Abstract

Planarians regenerate all body parts after injury, including the central nervous system (CNS). We capitalized on this distinctive trait and completed a gene expression-guided functional screen to identify factors that regulate diverse aspects of neural regeneration in <i>Schmidtea mediterranea</i>. Our screen revealed molecules that influence neural cell fates, support the formation of a major connective hub, and promote reestablishment of chemosensory behavior. We also identified genes that encode signaling molecules with roles in head regeneration, including some that are produced in a previously uncharacterized parenchymal population of cells. Finally, we explored genes downregulated during planarian regeneration and characterized, for the first time, glial cells in the planarian CNS that respond to injury by repressing several transcripts. Collectively, our studies revealed diverse molecules and cell types that underlie an animal's ability to regenerate its brain.

Also flagged:aggRstx1stx2stx1 stx1_FTGATGATTGATAGTGGCACAGG299ThiswzxO104fliCH4
Journal Article 2016-09-09 No Snippets Trung NV, Nhung HN, Carrique-Mas JJ, Mai HH, Tuyen HT, Campbell J, Nhung NT, Van Minh P, Wagenaar JA, Mai NT, Hieu TQ, Schultsz C, Hoa NT.
Show Full Abstract

<h4>Background</h4>Enteroaggregative (EAEC) and Shiga-toxin producing Escherichia coli (STEC) are a major cause of diarrhea worldwide. E. coli carrying both virulence factors characteristic for EAEC and STEC and producing extended-spectrum beta-lactamase caused severe and protracted disease during an outbreak of E. coli O104:H4 in Europe in 2011. We assessed the opportunities for E. coli carrying the aggR and stx genes to emerge in 'backyard' farms in south-east Asia.<h4>Results</h4>Faecal samples collected from 204 chicken farms; 204 farmers and 306 age- and gender-matched individuals not exposed to poultry farming were plated on MacConkey agar plates with and without antimicrobials being supplemented. Sweep samples obtained from MacConkey agar plates without supplemented antimicrobials were screened by multiplex PCR for the detection of the stx1, stx2 and aggR genes. One chicken farm sample each (0.5 %) contained the stx1 and the aggR gene. Eleven (2.4 %) human faecal samples contained the stx1 gene, 2 samples (0.4 %) contained stx2 gene, and 31 (6.8 %) contained the aggR gene. From 46 PCR-positive samples, 205 E. coli isolates were tested for the presence of stx1, stx2, aggR, wzx O104 and fliC H4 genes. None of the isolates simultaneously contained the four genetic markers associated with E. coli O104:H4 epidemic strain (aggR, stx2, wzx O104 and fliC H4 ). Of 34 EAEC, 64.7 % were resistant to 3(rd)-generation cephalosporins.<h4>Conclusion</h4>These results indicate that in southern Vietnam, the human population is a more likely reservoir of aggR and stx gene carrying E. coli than the chicken population. However, conditions for transmission of isolates and/or genes between human and animal reservoirs resulting in the emergence of highly virulent E. coli strains are still favorable, given the nature of'backyard' farms in Vietnam.

Also flagged:synthesisdegradationprotein synthesisglutamate receptorprotein degradationubiquitin
Journal Article 2016-09-09 ✓ 1 Snippet Hakim V, Cohen LD, Zuchman R, Ziv T, Ziv NE.
In-Text Gene Mentions

…such as Huntingtin (htt; t ½ ≈…

Show Full Abstract

Synaptic function crucially depends on uninterrupted synthesis and degradation of synaptic proteins. While much has been learned on synaptic protein synthesis, little is known on the routes by which synaptic proteins are degraded. Here we systematically studied how inhibition of the ubiquitin-proteasome system (UPS) affects the degradation rates of thousands of neuronal and synaptic proteins. We identified a group of proteins, including several proteins related to glutamate receptor trafficking, whose degradation rates were significantly slowed by UPS inhibition. Unexpectedly, however, degradation rates of most synaptic proteins were not significantly affected. Interestingly, many of the differential effects of UPS inhibition were readily explained by a quantitative framework that considered known metabolic turnover rates for the same proteins. In contrast to the limited effects on protein degradation, UPS inhibition profoundly and preferentially suppressed the synthesis of a large number of synaptic proteins. Our findings point to the importance of the UPS in the degradation of certain synaptic proteins, yet indicate that under basal conditions most synaptic proteins might be degraded through alternative pathways.

Also flagged:5serotonin-transporteraging
Journal Article 2016-09-09 ✓ 2 Snippets Volf NV, Belousova LV, Knyazev GG, Kulikov AV.
In-Text Gene Mentions

These results may have implications for understanding 5-HTT-dependent variation in the effect of aging on brain activity.

…implications for understanding5-HTT-dependent variation in the…

Show Full Abstract

This study was aimed to localize the effects of 5-HTTLPR (serotonin-transporter-linked polymorphic region) on the age differences of spontaneous EEG activity in women using neuroimaging analysis sLORETA (Standardized Low Resolution brain Electromagnetic Tomography). DNA samples extracted from cheek swabs and resting-state EEG recorded at 60 standard leads were collected from young (YW, N=86, 18-35years) and older (OW, N=45; 55-80years) healthy women. We have shown that advanced age was associated with increased posterior EEG desynchronization in S'/S'. S' (LG allele was grouped with S alleles owing to its functional equivalence and this group was labeled as S') genotype carriers denoted by decrease of delta - beta1 current source density, and to a lesser extent in L/L homozygotes denoted by decrease in delta activity. In heterozygotes OW, as compared with heterozygotes YW, higher source density estimates of beta1 in frontal and temporal cortex were observed. Age differences were more pronounced in the right hemisphere in S'/S' and L/L carriers and in the left hemisphere in heterozygotes. We also found that in OW, current source density estimates of theta, alpha1, alpha2, alpha3 and beta1 sources in the right occipital lobe were higher in S'/L than in S'/S' carriers. These results may have implications for understanding 5-HTT-dependent variation in the effect of aging on brain activity.

Also flagged:SerotoninchemoreceptionLmx1bPet1serotonin transporter5-HT
Journal Article 2016-09-09 ✓ 1 Snippet Cerpa VJ, Wu Y, Bravo E, Teran FA, Flynn RS, Richerson GB.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Serotonin (5-HT) neurons contribute to respiratory chemoreception in adult mice, but it is unclear whether they play a similar role in neonatal mice. We studied breathing during development in Lmx1b<sup>f/f/p</sup> mice, which lack 5-HT neurons. From postnatal days 1-7 (P1-P7), ventilation of Lmx1b<sup>f/f/p</sup> mice breathing room air was 50% of WT mice (p<0.001). By P12, baseline ventilation increased to a level equal to WT mice. In contrast, the hypercapnic ventilatory response (HCVR) of neonatal Lmx1b<sup>f/f/p</sup> and WT mice was equal to each other, but were both much less than adult WT mice. By P21 the HCVR of WT mice increased to near adult levels, but the HCVR of Lmx1b<sup>f/f/p</sup> mice had not changed, and was 42% less than WT mice. Primary cell cultures were prepared from the ventromedial medulla of neonatal mice, and patch-clamp recordings were made from neurons identified as serotonergic by expression of a reporter gene. In parallel with developmental changes of the HCVR in vivo, 5-HT neurons had little chemosensitivity to acidosis until 12days in vitro (DIV), after which their response increased to reach a plateau around 25 DIV. Neonatal Lmx1b<sup>f/f/p</sup> mice displayed high mortality and decreased growth rate, and this worsened in hypoxia. Mortality was decreased in hyperoxia. These results indicate that maturation of 5-HT neurons contributes to development of respiratory CO<sub>2</sub>/pH chemoreception during the first few weeks of life in mice in vivo. A defect in the 5-HT system in early postnatal life decreases survival due in part to hypoxia.

Also flagged:Interleukin 2 Receptor Alpha-related disordersemotion dysregulationcognitionPTSDDepression
Journal Article 2016-09-09 No Snippets Powers A, Almli L, Smith A, Lori A, Leveille J, Ressler KJ, Jovanovic T, Bradley B.
Show Full Abstract

Emotion dysregulation has been implicated as a risk factor for many psychiatric conditions. Therefore, examining genetic risk associated with emotion dysregulation could help inform cross-disorder risk more generally. A genome-wide association study (GWAS) of emotion dysregulation using single nucleotide polymorphism (SNP) array technology was conducted in a highly traumatized, minority, urban sample (N = 2600, males = 774). Post-hoc analyses examined associations between SNPs identified in the GWAS and current depression, posttraumatic stress disorder (PTSD), and history of suicide attempt. Methylation quantitative trait loci were identified and gene set enrichment analyses were used to broadly determine biological processes involved with these SNPs. Among males, SNP rs6602398, located within the interleukin receptor 2A gene, IL2RA, was significantly associated with emotion dysregulation (p = 1.1 × 10<sup>-8</sup>). Logistic regression analyses revealed this SNP was significantly associated with depression (Exp(B) = 2.67, p < 0.001) and PTSD (Exp(B) = 2.07, p < 0.01). This SNP was associated with differential DNA methylation (p < 0.05) suggesting it may be functionally active. Finally, through gene set enrichment analyses, ten psychiatric disease pathways (adjusted p < 0.01) and the calcium signaling pathway (adjusted p = 0.008) were significantly associated with emotion dysregulation. We found initial evidence for an association between emotion dysregulation and genetic risk loci that have already been implicated in medical disorders that have high comorbidity with psychiatric disorders. Our results provide further evidence that emotion dysregulation can be understood as a potential psychiatric cross-disorder risk factor, and that sex differences across these phenotypes may be critical. Continued research into genetic and biological risk associated with emotion dysregulation is needed.

Also flagged:hereditary angioedemaC1 inhibitordeficiencyHAEC1ecallantide
Journal Article 2016-09-08 ✓ 1 Snippet Farkas H, Martinez-Saguer I, Bork K, Bowen T, Craig T, Frank M, Germenis AE, Grumach AS, Luczay A, Varga L, Zanichelli A, HAWK.
In-Text Gene Mentions

…during the 9thC1 InhibitorInhibitor Deficiency Workshop…

Show Full Abstract

<h4>Background</h4>The consensus documents published to date on hereditary angioedema with C1 inhibitor deficiency (C1-INH-HAE) have focused on adult patients. Many of the previous recommendations have not been adapted to pediatric patients. We intended to produce consensus recommendations for the diagnosis and management of pediatric patients with C1-INH-HAE.<h4>Methods</h4>During an expert panel meeting that took place during the 9th C1 Inhibitor Deficiency Workshop in Budapest, 2015 (www.haenet.hu), pediatric data were presented and discussed and a consensus was developed by voting.<h4>Results</h4>The symptoms of C1-INH-HAE often present in childhood. Differential diagnosis can be difficult as abdominal pain is common in pediatric C1-INH-HAE, but also commonly occurs in the general pediatric population. The early onset of symptoms may predict a more severe subsequent course of the disease. Before the age of 1 year, C1-INH levels may be lower than in adults; therefore, it is advisable to confirm the diagnosis after the age of one year. All neonates/infants with an affected C1-INH-HAE family member should be screened for C1-INH deficiency. Pediatric patients should always carry a C1-INH-HAE information card and medicine for emergency use. The regulatory approval status of the drugs for prophylaxis and for acute treatment is different in each country. Plasma-derived C1-INH, recombinant C1-INH, and ecallantide are the only agents licensed for the acute treatment of pediatric patients. Clinical trials are underway with additional drugs. It is recommended to follow up patients in an HAE comprehensive care center.<h4>Conclusions</h4>The pediatric-focused international consensus for the diagnosis and management of C1-INH-HAE patients was created.

Also flagged:hydroxyapatiteageingoctacalciumdegradationcalcium phosphatephosphate
Journal Article 2016-09-08 No Snippets Bannerman A, Williams RL, Cox SC, Grover LM.
Show Full Abstract

The resorption of brushite-based bone cements has been shown to be highly unpredictable, with strong dependence on a number of conditions. One of the major factors is phase transformation, with change to more stable phases such as hydroxyapatite affecting the rate of resorption. Despite its importance, the analysis of phase transformation has been largely undertaken using methods that only detect crystalline composition and give no information on the spatial distribution of the phases. In this study confocal Raman microscopy was used to map cross-sections of brushite cylinders aged in Phosphate Buffered Saline, Foetal Bovine Serum, Dulbecco's - Minimum Essential Medium (with and without serum). Image maps showed the importance of ageing medium on the phase composition throughout the ceramic structure. When aged without serum, there was dissolution of the brushite phase concomitant to the deposition of octacalcium phosphate (OCP) around the periphery of the sample. The deposition of OCP was detectable within five days and reduced the rate of brushite dissolution from the material. The use of serum, even at a concentration of 10vol% prevented phase transformation. This paper demonstrates the value of confocal Raman microscopy in monitoring phase change in biocements; it also demonstrates the problems with assessing material degradation in non-serum containing media.

Also flagged:Refractive errorpathogenesisCD55CNDP2RDH5myopia
Journal Article 2016-09-08 ✓ 4 Snippets Liao X, Lan C, Liao D, Tian J, Huang X.
In-Text Gene Mentions

Included among these were the 21 SNPs in CREAM study and 22 SNPs in 23andMe study from 35 risk loci of RE and AAO of myopia, which contains overlapping genes (PRSS56, BMP3, LAMA2, RDH5, TOX, ZIC2, GJD2, RASGRF1) and non-overlapping genes (CD55, CHRNG, CACNA1D, CHD7, ZMAT4, RORB, CYP26A1, BICC1, GRIA4, PCCA, MYO1D, KCNJ2, CNDP2, LRRC4C, RBFOX1, KCNQ5, SFRP1, SHISA6, TJP2, RGR, DLG2, ZBTB38, PDE11A, DLX1, KCNMA1, BMP4 and PABPCP2 pseudogene) in both studies.

…, SFRP1 ,SHISA6, TJP2 ,…

…changes the motifs (POU3F2, Foxa, Pbx3, Pou1f1,…

…Foxa, Pbx3, Pou1f1,Pou3f2and STAT), as…

Show Full Abstract

Refractive error (RE) is a complex multifactorial disease. Genome-wide association studies (GWAS) have provided significant insight into the genetic architecture and identified plenty of robust genetic variations or single nucleotide polymorphisms (SNPs) associated with complex disease. A major current challenge is to convert those resources into causal variants and target genes. We used RegulomeDB and HaploReg to annotate regulatory information onto associated SNPs derived from the two largest RE GWAS, and additional SNPs in linkage disequilibrium (LD) with GWAS significant SNPs. Overall 868 SNPs were investigated, out of which 662 returned RegulomeDB scores of 1 to 6. It was observed that 36 out of those SNPs show strong evidence of regulatory effects with a RegulomeDB score of 1, while only four of them were GWAS significant SNPs (CD55/rs1652333, CNDP2/rs12971120, RDH5/rs3138142 and rs3138144). The results encourage us to explore those putative pathogenic variants, both GWAS significant SNPs as well as the SNPs in LD, for future discernment of functional consequence. This study offers the attractive approach for prioritizing potential functional variants by combining ENCODE data and GWAS information, and provide further insights into the pathogenesis and mechanism and ultimately therapeutics.

Also flagged:chromosomeTurner syndromeTSdevelopmental disorderBicuspidcongenital heart lesions
Journal Article 2016-09-08 ✓ 5 Snippets Prakash SK, Bondy CA, Maslen CL, Silberbach M, Lin AE, Perrone L, Limongelli G, Michelena HI, Bossone E, Citro R, BAVCon Investigators, GenTAC Registry Investigators, Lemaire SA, Body SC, Milewicz DM.
In-Text Gene Mentions

SLC2A3, SLC2A14, and NANOGP1) and was previously implicated in congenital heart defects in the 22q11 deletion syndrome

SLC2A3, SLC2A14, and NANOGP1) and was previously implicated in congenital heart defects

SLC2A14, and NANOGP1) and was previously implicated in congenital heart defects in the 22q11 deletion syndrome

SLC2A14, and NANOGP1) and was previously implicated in congenital heart defects

…( SLC2A3 ,SLC2A14and NANOGP1 )…

Show Full Abstract

Turner Syndrome (TS) is a developmental disorder caused by partial or complete loss of one sex chromosome. Bicuspid aortic valve and other left-sided congenital heart lesions (LSL), including thoracic aortic aneurysms and acute aortic dissections, are 30-50 times more frequent in TS than in the general population. In 454 TS subjects, we found that LSL are significantly associated with reduced dosage of Xp genes and increased dosage of Xq genes. We also showed that genome-wide copy number variation is increased in TS and identify a common copy number variant (CNV) in chromosome 12p13.31 that is associated with LSL with an odds ratio of 3.7. This CNV contains three protein-coding genes (SLC2A3, SLC2A14, and NANOGP1) and was previously implicated in congenital heart defects in the 22q11 deletion syndrome. In addition, we identified a subset of rare and recurrent CNVs that are also enriched in non-syndromic BAV cases. These observations support our hypothesis that X chromosome and autosomal variants affecting cardiac developmental genes may interact to cause the increased prevalence of LSL in TS. © 2016 Wiley Periodicals, Inc.

Also flagged:hibernationantimicrobial defense proteinscoagulationproteaselipidmetabolism
Journal Article 2016-09-08 ✓ 1 Snippet Welinder KG, Hansen R, Overgaard MT, Brohus M, Sønderkær M, von Bergen M, Rolle-Kampczyk U, Otto W, Lindahl TL, Arinell K, Evans AL, Swenson JE, Revsbech IG, Frøbert O.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

Brown bears (Ursus arctos) hibernate for 5-7 months without eating, drinking, urinating, and defecating at a metabolic rate of only 25% of the summer activity rate. Nonetheless, they emerge healthy and alert in spring. We quantified the biochemical adaptations for hibernation by comparing the proteome, metabolome, and hematological features of blood from hibernating and active free-ranging subadult brown bears with a focus on conservation of health and energy. We found that total plasma protein concentration increased during hibernation, even though the concentrations of most individual plasma proteins decreased, as did the white blood cell types. Strikingly, antimicrobial defense proteins increased in concentration. Central functions in hibernation involving the coagulation response and protease inhibition, as well as lipid transport and metabolism, were upheld by increased levels of very few key or broad specificity proteins. The changes in coagulation factor levels matched the changes in activity measurements. A dramatic 45-fold increase in sex hormone-binding globulin levels during hibernation draws, for the first time, attention to its significant but unknown role in maintaining hibernation physiology. We propose that energy for the costly protein synthesis is reduced by three mechanisms as follows: (i) dehydration, which increases protein concentration without de novo synthesis; (ii) reduced protein degradation rates due to a 6 °C reduction in body temperature and decreased protease activity; and (iii) a marked redistribution of energy resources only increasing de novo synthesis of a few key proteins. The comprehensive global data identified novel biochemical strategies for bear adaptations to the extreme condition of hibernation and have implications for our understanding of physiology in general.

Also flagged:neuroticismMAO - Apolymerasemental disordersdepressionmetabolism
Journal Article 2016-09-08 ✓ 5 Snippets Schneider-Matyka D, Jurczak A, Samochowiec A, Karakiewicz B, Szkup M, Grzywacz A, Grochans E.
In-Text Gene Mentions

The presence of the ‘s’ allele of the 5-HTT gene is presumably associated with a lower gene expression and worse functioning of the serotonin transporter, which in turn disturbs neurotransmission and results in a higher tendency to anxiety and avoidant behaviours [7, 8].

…The serotonin transporter (5-HTT) gene ( SLC…

…allele of the5-HTTgene is presumably…

…allele of the5-HTTgene may be…

…polymorphism in the5-HTT(SLC 6A4) promoter…

Show Full Abstract

<h4>Background</h4>Quality of life can be perceived as a subjective assessment of different aspects of human functioning. Personality is a factor which determines actions taken by individuals and their tendency to perceive reality in a particular way. Therefore, the assumption that personality may influence the QoL assessment seems reasonable. Our purpose was to assess the relationships between personality traits and the presence of the 44-bp VNTR polymorphism in the 5-HTT (SLC 6A4) promoter region and the 30-bp VNTR polymorphism in the MAO-A promoter region. We also wanted to determine the influence of personality on the quality of life of postmenopausal women.<h4>Methods</h4>The study involved 214 postmenopausal women from northwest Poland. It was conducted using the NEO-FFI and the SF-36 questionnaires. DNA polymorphisms were identified using the polymerase chain reaction (PCR).<h4>Results</h4>The average age of the women was 56.8 ± 4.08 years. Half of the respondents had completed second-level education, 69.2 % had life partners, and 53.3 % were professionally active. Women with the 3/3 genotype were characterized by significantly lower openness to experience than respondents with other MAO-A genotypes (p < 0.05). There was a significant correlation between the quality of life and the levels of neuroticism and extroversion, as well as between selected quality of life domains and the levels of agreeableness and conscientiousness.<h4>Conclusions</h4>(1)Women with the 3/3 genotype of the 30-bp VNTR polymorphism in the MAO-A promoter region are characterized by lower levels of openness to experience than women with other MAO-A genotypes in our study (2) Personality traits may contribute to the assessment of the quality of life.

Also flagged:Down SyndromechromosomeRUNX1regulatorneuron migrationneural
Journal Article 2016-09-08 ✓ 2 Snippets Halevy T, Biancotti JC, Yanuka O, Golan-Lev T, Benvenisty N.
In-Text Gene Mentions

…genes such asPOU3F2(also known as…

…genes in DS-NPCs,POU3F2and ASCL1 ,…

Show Full Abstract

Down syndrome (DS) is the leading genetic cause of mental retardation and is caused by a third copy of human chromosome 21. The different pathologies of DS involve many tissues with a distinct array of neural phenotypes. Here we characterize embryonic stem cell lines with DS (DS-ESCs), and focus on the neural aspects of the disease. Our results show that neural progenitor cells (NPCs) differentiated from five independent DS-ESC lines display increased apoptosis and downregulation of forehead developmental genes. Analysis of differentially expressed genes suggested RUNX1 as a key transcription regulator in DS-NPCs. Using genome editing we were able to disrupt all three copies of RUNX1 in DS-ESCs, leading to downregulation of several RUNX1 target developmental genes accompanied by reduced apoptosis and neuron migration. Our work sheds light on the role of RUNX1 and the importance of dosage balance in the development of neural phenotypes in DS.

Also flagged:amelogeninhydroxyapatiteextracellular matrixmineralphosphorylationbinding
Journal Article 2016-09-08 No Snippets Connelly C, Cicuto T, Leavitt J, Petty A, Litman A, Margolis HC, Gerdon AE.
Show Full Abstract

Amelogenin, the predominant extracellular matrix protein secreted by ameloblasts, has been shown to be essential for proper tooth enamel formation. In this study, amelogenin adsorption to hydroxyapatite (HAP) surfaces, a prototype for enamel mineral, has been studied using a quartz crystal microbalance (QCM) to interrogate effects of protein phosphorylation and solution pH. Dynamic flow-based experiments were conducted at pH 7.4 and 8.0 using native phosphorylated porcine amelogenin (P173) and recombinant non-phosphorylated porcine amelogenin (rP172). Loading capacities (μmol/m<sup>2</sup>) on HAP surfaces were calculated under all conditions and adsorption affinities (K<sub>ad</sub>) were calculated when Langmuir isotherm conditions appeared to be met. At pH 8.0, binding characteristics were remarkably similar for the two proteins. However, at pH 7.4 a higher affinity and lower surface loading for the phosphorylated P173 was found compared to any other set of conditions. This suggests that phosphorylated P173 adopts a more extended conformation than non-phosphorylated full-length amelogenin, occupying a larger footprint on the HAP surface. This surface-induced structural difference may help explain why P173 is a more effective inhibitor of spontaneous HAP formation in vitro than rP172. Differences in the viscoelastic properties of P173 and rP172 in the adsorbed state were also observed, consistent with noted differences in HAP binding. These collective findings provide new insight into the important role of amelogenin phosphorylation in the mechanism by which amelogenin regulates enamel crystal formation.

Also flagged:cognitionbrain-related disordersneurological disordersepilepsyneurological disorderepilepsy syndromes
Journal Article 2016-09-08 ✓ 1 Snippet Alhusaini S, Whelan CD, Sisodiya SM, Thompson PM.
In-Text Gene Mentions

…risk locus (atVRK2or FANCL )…

Show Full Abstract

Over the last decade, the field of <i>imaging genomics</i> has combined high-throughput genotype data with quantitative magnetic resonance imaging (QMRI) measures to identify genes associated with brain structure, cognition, and several brain-related disorders. Despite its successful application in different psychiatric and neurological disorders, the field has yet to be advanced in epilepsy. In this article we examine the relevance of imaging genomics for future genetic studies in epilepsy from three perspectives. First, we discuss prior genome-wide genetic mapping efforts in epilepsy, considering the possibility that some studies may have been constrained by inherent theoretical and methodological limitations of the genome-wide association study (GWAS) method. Second, we offer a brief overview of the imaging genomics paradigm, from its original inception, to its role in the discovery of important risk genes in a number of brain-related disorders, and its successful application in large-scale multinational research networks. Third, we provide a comprehensive review of past studies that have explored the eligibility of brain QMRI traits as <i>endophenotypes</i> for epilepsy. While the breadth of studies exploring QMRI-derived endophenotypes in epilepsy remains narrow, robust syndrome-specific neuroanatomical QMRI traits have the potential to serve as accessible and relevant intermediate phenotypes for future genetic mapping efforts in epilepsy.

Also flagged:prostaglandin synthasessteroidsoxytocin receptorsoxytocinprostaglandin endoperoxide synthase 2PTGS2
Journal Article 2016-09-08 ✓ 4 Snippets Rebordão MR, Galvão A, Pinto-Bravo P, Pinheiro J, Gamboa S, Silva E, Mateus L, Ferreira-Dias G.
In-Text Gene Mentions

…(AKR1C3, PTGES, andPTGIS), oxytocin receptor (OXTR),…

…< 0.05), PTGES,PTGIS, PGR, and ESR2…

…whereas AKR1C3, PTGES,PTGIS, and PGR were…

…immunolabeling for PTGES,PTGIS, PGR, and OXTR…

Show Full Abstract

Oxytocin (OXT) has been used to prolong the luteal phase in mares, but its mechanism of action is unknown. The aim of this study was to evaluate the effect of chronic exogenous OXT administration to mid-luteal phase mares on luteal maintenance. Also, endometrial expression of prostaglandin endoperoxide synthase 2 (PTGS2), prostaglandin F<sub>2</sub>α, E<sub>2</sub> and I<sub>2</sub> synthases (AKR1C3, PTGES, and PTGIS), oxytocin receptor (OXTR), progesterone receptor (PGR), and estrogen receptors 1 (ESR1) and 2 (ESR2) were assessed in mares experiencing luteal maintenance 2 weeks after chronic exogenous OXT administration. Control mares (n = 5; C group) received 6 mL of saline im, whereas OXT (60 units/mare) was administered im (n = 6; OXT group), every 12 hours, on days 7 to 14 postovulation. After endometrial biopsy in groups C (Day 10) and OXT (Day 24), luteolysis occurred within 3 or 6 days, respectively. Luteal maintenance took place in 4 of 6 (67%) of OXT-treated mares. Progesterone in C group was the highest on biopsy day (P < 0.05). In OXT mares, PTGS2, ESR1 (P < 0.05), PTGES, PTGIS, PGR, and ESR2 (P < 0.01) gene transcription decreased, whereas OXTR increased (P < 0.05) in comparison with the C group. In OXT-treated mares, endometrial ESR2 protein expression decreased (P < 0.05), but OXTR increased (P < 0.05) compared with control animals. In both experimental groups, PTGS2 was mainly immunolocalized in surface epithelium, whereas AKR1C3, PTGES, PTGIS, and PGR were in surface and glandular epithelia. ESR1 and ESR2 were found in glandular epithelium and OXTR in stromal cells. High immunolabeling for PTGES, PTGIS, PGR, and OXTR and low for ESR2 was detected in endometrium of OXT-group mares with extended diestrus. Prolonged luteal function associated with chronic OXT treatment may be related to different spatial expression of OXTR and PGR in the endometrium. The observed reduction of endometrial ESR2 may be responsible for the maintenance of PGR in luminal and glandular epithelium. Also, ESR2 may attenuate the transcriptional activity of ESR1 in mare endometrium. This study offers new knowledge on the endometrial expression of ovarian steroids and OXT receptors in OXT pharmacologically induced luteal maintenance in the mare.

Also flagged:infectious diseasesERN1FOXO1COMTRAF1TSC1
Journal Article 2016-09-07 No Snippets Ling Q, Xie H, Li J, Liu J, Cao J, Yang F, Wang C, Hu Q, Xu X, Zheng S.
Show Full Abstract

New-onset diabetes after liver transplantation (NODALT) is a frequent complication with an unfavorable outcome. We previously demonstrated a crucial link between donor graft genetics and the risk of NODALT. We selected 15 matched pairs of NODALT and non-NODALT liver recipients using propensity score matching analysis. The donor liver tissues were tested for the expression of 10 microRNAs (miRNAs) regulating human hepatic glucose homeostasis. The biological functions of potential target genes were predicted using gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Both miR-103 and miR-181a were significantly highly expressed in the NODALT group as compared to the non-NODALT group. The predicted target genes (e.g. Irs2, Pik3r1, Akt2, and Gsk3b) were involved in glucose import and the insulin signaling pathway. We also observed dysregulation of miRNAs (e.g. let-7, miR-26b, miR-145, and miR-183) in cultured human hepatocytes treated with tacrolimus or high glucose, the two independent risk factors of NODALT identified in this cohort. The hepatic miRNA profiles altered by tacrolimus or hyperglycemia were associated with insulin resistance and glucose homeostatic imbalance as revealed by enrichment analysis. The disease susceptibility miRNA expressive pattern could be imported directly from the donor and consolidated by the transplant factors.

Also flagged:renal interstitial fibrosisRIFchronic kidney diseasesrenal impairmentsrenal fibrosisepithelial to mesenchymal transition
Journal Article 2016-09-07 No Snippets Xiao Y, Liu J, Peng Y, Xiong X, Huang L, Yang H, Zhang J, Tao L.
Show Full Abstract

Tubular epithelial-mesenchymal transition (EMT) has been widely accepted as the underlying mechanisms of renal interstitial fibrosis (RIF). The production of reactive oxygen species (ROS) plays a vital role in tubular EMT process. The purpose of this study was to investigate the involved molecular mechanisms in TGF-beta-induced EMT and identify the potential role of glutathione S-transferase alpha 3 (GSTA3) in this process. The iTRAQ screening was performed to identify protein alterations of the rats underwent unilateral-ureteral obstruction (UUO). Protein expression of GSTA3 in patients with obstructive nephropathy and UUO rats was detected by immunohistochemistry. Protein and mRNA expression of GSTA3 in UUO rats and NRK-52E cells were determined by Western blot and RT-PCR. siRNA and overexpression plasmid were transfected specifically to assess the role of GSTA3 in RIF. The generation of ROS was measured by dichlorofluorescein fluorescence analysis. GSTA3 protein and mRNA expression was significantly reduced in UUO rats. Immunohistochemical analysis revealed that GSTA3 expression was reduced in renal cortex in UUO rats and patients with obstructive nephropathy. Treating with TGF-β1 down-regulated GSTA3 expression in NRK-52E cells, which have been found to be correlated with the decreased expression in E-cadherin and megalin and increased expression in α-smooth muscle actin. Furthermore, knocking down GSTA3 in NRK-52 cells led to increased production of ROS and tubular EMT, whereas overexpressing GSTA3 ameliorated ROS production and prevented the occurrence of tubular EMT. GSTA3 plays a protective role against tubular EMT in renal fibrosis, suggesting GSTA3 is a potential therapeutic target for RIF.

Also flagged:aspartic proteaseEndothiapepsintriazolealkynes
Journal Article 2016-09-07 No Snippets Mondal M, Unver MY, Pal A, Bakker M, Berrier SP, Hirsch AK.
Show Full Abstract

There is an urgent need for the development of efficient methodologies that accelerate drug discovery. We demonstrate that the strategic combination of fragment linking/optimization and protein-templated click chemistry is an efficient and powerful method that accelerates the hit-identification process for the aspartic protease endothiapepsin. The best binder, which inhibits endothiapepsin with an IC<sub>50</sub> value of 43 μm, represents the first example of triazole-based inhibitors of endothiapepsin. Our strategy could find application on a whole range of drug targets.

Also flagged:gastric carcinomatumorgastric cancerlymphsolid cancerstranscription factors
Journal Article 2016-09-07 ✓ 1 Snippet Ren C, Chen H, Han C, Fu D, Wang D, Shen M.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Purpose</h4>To investigate the expression pattern of miR-16 and miR-451 and evaluate their prognostic value in 180 GC patients undergoing surgery.<h4>Methods</h4>In our previous study, a panel of five circulating miRNAs (miR-16, miR-25, miR-92a, miR-451 and miR-486-5p) can be used as a potential biomarker for detecting of early-stage gastric carcinoma (GC). Tissue microarrays were constructed from 180 patients with GC after surgery. MiR-16 and miR-451 expression was detected by miRNA-locked nucleic acid in situ hybridization, and their relationship with clinicopathological parameters and overall survival was analyzed.<h4>Results</h4>MiR-16 expression was decreased in 30.6 % (55/180) of GC, increased in 54.4 % (98/180) and unchanged in 15.0 % (27/180), compared with paracancerous normal tissue (P < 0.001). MiR-451 expression was decreased in 17.8 % (32/180), increased in 62.8 % (113/180) and unchanged in 19.4 % (35/180) of GC, compared with paracancerous normal tissue (P < 0.001).Univariate analysis indicated that low miR-16 and miR-451 expression, tumor stage, tumor status, node status and tumor size were significant negative prognostic predictors for overall survival in patients with GC (P < 0.001, P < 0.001, P = 0.002, P < 0.001 and P = 0.001, respectively). Multivariate regression analysis demonstrated that stage [hazard ratio (HR) 1.80; 95 % confidence interval (CI) 1.0-3.26; P = 0.05], low expression of miR-16 (HR 2.26; 95 % CI 1.51-3.40; P < 0.001) and miR-451 (HR 2.01; 95 % CI 1.36-2.96; P < 0.001) predicted shorter OS, while tumor status (HR 1.59; 95 % CI 0.73-3.48 P = 0.242), lymph node metastasis (HR 1.41; 95 % CI 0.71-2.82; P = 0.326) and tumor size (HR 1.53; 95 % CI 0.92-2.55; P = 0.099) were not. Moreover, patients with both miR-16 and miR-451 high expression have better OS than those with two miRNAs unchanged or low expression in GC tissues. Patients with both miR-16 and miR-451 high have better OS than patients with single miR-451 high expression.<h4>Conclusions</h4>High expression of miR-16 and miR-451 was associated with longer OS in GC patients. Especially patients with miR-16 and miR-451 double high expression will predict better OS. MiR-16 and miR-451 may be used as novel makers to evaluate prognosis and provide a new treatment target in GC.

Also flagged:calcium phosphatechewinghydroxyapatitenanowiresamelogenesisenamel formation
Journal Article 2016-09-07 No Snippets La Fontaine A, Zavgorodniy A, Liu H, Zheng R, Swain M, Cairney J.
Show Full Abstract

Human dental enamel, the hardest tissue in the body, plays a vital role in protecting teeth from wear as a result of daily grinding and chewing as well as from chemical attack. It is well established that the mechanical strength and fatigue resistance of dental enamel are derived from its hierarchical structure, which consists of periodically arranged bundles of hydroxyapatite (HAP) nanowires. However, we do not yet have a full understanding of the in vivo HAP crystallization process that leads to this structure. Mg(2+) ions, which are present in many biological systems, regulate HAP crystallization by stabilizing its precursor, amorphous calcium phosphate (ACP), but their atomic-scale distribution within HAP is unknown. We use atom probe tomography to provide the first direct observations of an intergranular Mg-rich ACP phase between the HAP nanowires in mature human dental enamel. We also observe Mg-rich elongated precipitates and pockets of organic material among the HAP nanowires. These observations support the postclassical theory of amelogenesis (that is, enamel formation) and suggest that decay occurs via dissolution of the intergranular phase. This information is also useful for the development of more accurate models to describe the mechanical behavior of teeth.

Also flagged:chlorambucildendrimerwaterconjugationpolyethylene-glycolester
Journal Article 2016-09-07 No Snippets Assadi A, Najafabadi VS, Shandiz SA, Boroujeni AS, Ashrafi S, Vaziri AZ, Ghoreishi SM, Aghasadeghi MR, Ebrahimi SE, Pirali-Hamedani M, Ardestani MS.
Show Full Abstract

Evaluating the efficacy of anticancer drugs is an evolving and research-oriented issue. The objective of this study was to reduce the insolubility of chlorambucil (CBL) in water and improve the anticancer activity of CBL in vitro and in vivo through the conjugation of CBL with anionic linear-globular dendrimer (second generation, G2). In the current study, the anticancer activity among three groups that include CBL, CBL-G2 dendrimer, and control was measured in vitro and in vivo. In vitro studies showed that G2 anionic linear-globular polyethylene-glycol-based dendrimer, which conjugated to the CBL exterior through an ester linkage, was able to significantly improve the treatment efficacy over clinical CBL alone with respect to proliferation assay, 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide; half maximal inhibitory concentration (IC50) was calculated to be 141 µg/mL for CBL alone and 27.7 µg/mL for CBL-G2 dendrimer; P<0.05. In addition, CBL-G2 dendrimer conjugate forestalled the growth of MCF-7 cancerous cells in addition to enhancing the number of apoptotic and necrotic cells as demonstrated by an annexin V-fluorescein isothiocyanate assay. CBL-G2 dendrimer conjugate was able to checkmate antiapoptotic Bcl-2 expression and Bcl-2/Bax ratio in a large scale compared with the control group and CBL alone (P<0.005). In vivo studies showed that tumor treatment by CBL-G2 dendrimer conjugate outstrips the efficacy of treatment compared with CBL alone. The evaluation was based on reduction in tumor volume and tumor growth inhibition of murine 4T1 mammary tumor cells. Tumor volume of 140%±8% was measured in the treatment with CBL-G2 dendrimer, whereas 152%±13.5% was calculated in the treatment with free CBL (P<0.05). However, there were no significant differences in histological assay among the three groups. In conclusion, tumor growth suppression potential of CBL-G2 dendrimer, which was assessed in both in vitro and in vivo experiments, has provided empirical evidence to buttress the fact that this compound could be considered for functional cancer treatment with low side effects.

Also flagged:invasive cutaneous malignant melanomaphosphoinositide 3-kinaseAktmelanomamelanoma in situinvasive melanoma
Journal Article 2016-09-07 No Snippets Dowling P, Moran B, McAuley E, Meleady P, Henry M, Clynes M, McMenamin M, Leonard N, Monks M, Wynne B, Ormond P, Larkin A.
Show Full Abstract

Understanding the events at a protein level that govern the progression from melanoma <i>in situ</i> to invasive melanoma are important areas of current research to be developed. Recent advances in the analysis of formalin-fixed, paraffin-embedded tissue by proteomics, particularly using the filter-aided sample preparation protocol, has opened up the possibility of studying vast archives of clinical material and associated medical records. In the present study, quantitative protein profiling was performed using tandem mass spectrometry, and the proteome differences between melanoma <i>in situ</i> and invasive melanoma were compared. Biological pathway analyses revealed several signalling pathways differing between melanoma <i>in situ</i> and invasive melanoma, including metabolic pathways and the phosphoinositide 3-kinase-Akt signalling pathway. Selected proteins of interest (14-3-3ε and fatty acid synthase) were subsequently investigated using immunohistochemical analysis of tissue microarrays. Identifying the key proteins that play significant roles in the establishment of a more invasive phenotype in melanoma may ultimately aid diagnosis and treatment decisions.

Also flagged:Polymerscell nucleusviral capsidsbiopolymerspolymersilver
Journal Article 2016-09-07 No Snippets Regan K, Ricketts S, Robertson-Anderson RM.
Show Full Abstract

Double-stranded DNA offers a robust platform for investigating fundamental questions regarding the dynamics of entangled polymer solutions. The exceptional monodispersity and multiple naturally occurring topologies of DNA, as well as a wide range of tunable lengths and concentrations that encompass the entanglement regime, enable direct testing of molecular-level entanglement theories and corresponding scaling laws. DNA is also amenable to a wide range of techniques from passive to nonlinear measurements and from single-molecule to bulk macroscopic experiments. Over the past two decades, researchers have developed methods to directly visualize and manipulate single entangled DNA molecules in steady-state and stressed conditions using fluorescence microscopy, particle tracking and optical tweezers. Developments in microfluidics, microrheology and bulk rheology have also enabled characterization of the viscoelastic response of entangled DNA from molecular levels to macroscopic scales and over timescales that span from linear to nonlinear regimes. Experiments using DNA have uniquely elucidated the debated entanglement properties of circular polymers and blends of linear and circular polymers. Experiments have also revealed important lengthscale and timescale dependent entanglement dynamics not predicted by classical tube models, both validating and refuting new proposed extensions and alternatives to tube theory and motivating further theoretical work to describe the rich dynamics exhibited in entangled polymer systems.

Also flagged:mineralWNT4TNFSF11SLC1A3glutamateto
Journal Article 2016-09-06 ✓ 1 Snippet Nielson CM, Liu CT, Smith AV, Ackert-Bicknell CL, Reppe S, Jakobsdottir J, Wassel C, Register TC, Oei L, Alonso N, Oei EH, Parimi N, Samelson EJ, Nalls MA, Zmuda J, Lang T, Bouxsein M, Latourelle J, Claussnitzer M, Siggeirsdottir K, Srikanth P, Lorentzen E, Vandenput L, Langefeld C, Raffield L, Terry G, Cox AJ, Allison MA, Criqui MH, Bowden D, Ikram MA, Mellström D, Karlsson MK, Carr J, Budoff M, Phillips C, Cupples LA, Chou WC, Myers RH, Ralston SH, Gautvik KM, Cawthon PM, Cummings S, Karasik D, Rivadeneira F, Gudnason V, Orwoll ES, Harris TB, Ohlsson C, Kiel DP, Hsu YH.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Genome-wide association studies (GWASs) have revealed numerous loci for areal bone mineral density (aBMD). We completed the first GWAS meta-analysis (n = 15,275) of lumbar spine volumetric BMD (vBMD) measured by quantitative computed tomography (QCT), allowing for examination of the trabecular bone compartment. SNPs that were significantly associated with vBMD were also examined in two GWAS meta-analyses to determine associations with morphometric vertebral fracture (n = 21,701) and clinical vertebral fracture (n = 5893). Expression quantitative trait locus (eQTL) analyses of iliac crest biopsies were performed in 84 postmenopausal women, and murine osteoblast expression of genes implicated by eQTL or by proximity to vBMD-associated SNPs was examined. We identified significant vBMD associations with five loci, including: 1p36.12, containing WNT4 and ZBTB40; 8q24, containing TNFRSF11B; and 13q14, containing AKAP11 and TNFSF11. Two loci (5p13 and 1p36.12) also contained associations with radiographic and clinical vertebral fracture, respectively. In 5p13, rs2468531 (minor allele frequency [MAF] = 3%) was associated with higher vBMD (β = 0.22, p = 1.9 × 10<sup>-8</sup> ) and decreased risk of radiographic vertebral fracture (odds ratio [OR] = 0.75; false discovery rate [FDR] p = 0.01). In 1p36.12, rs12742784 (MAF = 21%) was associated with higher vBMD (β = 0.09, p = 1.2 × 10<sup>-10</sup> ) and decreased risk of clinical vertebral fracture (OR = 0.82; FDR p = 7.4 × 10<sup>-4</sup> ). Both SNPs are noncoding and were associated with increased mRNA expression levels in human bone biopsies: rs2468531 with SLC1A3 (β = 0.28, FDR p = 0.01, involved in glutamate signaling and osteogenic response to mechanical loading) and rs12742784 with EPHB2 (β = 0.12, FDR p = 1.7 × 10<sup>-3</sup> , functions in bone-related ephrin signaling). Both genes are expressed in murine osteoblasts. This is the first study to link SLC1A3 and EPHB2 to clinically relevant vertebral osteoporosis phenotypes. These results may help elucidate vertebral bone biology and novel approaches to reducing vertebral fracture incidence. © 2016 American Society for Bone and Mineral Research.

Also flagged:CD209aCD169diphtheria toxin receptorBgnTNFG-CSFR
Journal Article 2016-09-06 ✓ 2 Snippets Lu XJ, Chen Q, Rong YJ, Yang GJ, Li CH, Xu NY, Yu CH, Wang HY, Zhang S, Shi YH, Chen J.
In-Text Gene Mentions

…six pooled mobilizedC57BL/six micemice (CD45.2) in…

…six pooled mobilizedC57BL/six micemice (CD45.2).…

Show Full Abstract

Haematopoietic stem cells (HSCs) can differentiate into cells of all lineages in the blood. However, the mechanisms by which cytokines in the blood affect HSC homeostasis remain largely unknown. Here we show that leukocyte cell-derived chemotaxin 2 (LECT2), a multifunctional cytokine, induces HSC expansion and mobilization. Recombinant LECT2 administration results in HSC expansion in the bone marrow and mobilization to the blood via CD209a. The effect of LECT2 on HSCs is reduced after specific depletion of macrophages or reduction of osteolineage cells. LECT2 treatment reduces the tumour necrosis factor (TNF) expression in macrophages and osteolineage cells. In TNF knockout mice, the effect of LECT2 on HSCs is reduced. Moreover, LECT2 induces HSC mobilization in irradiated mice, while granulocyte colony-stimulating factor does not. Our results illustrate that LECT2 is an extramedullar cytokine that contributes to HSC homeostasis and may be useful to induce HSC mobilization.

Also flagged:hepatic steatosishepatitisvirusHBV) infectionsteatosisHBV infection
Journal Article 2016-09-06 ✓ 1 Snippet Zhang Z, Wang G, Kang K, Wu G, Wang P.
In-Text Gene Mentions

…as Wilson’s disease,hemochromatosis, and α-1-antitrypsin deficien…

Show Full Abstract

The aim of the present study was to construct a cost-effective noninvasive diagnostic index for prediction of hepatic steatosis in patients with hepatitis B virus(HBV) infection. From January 2011 to January 2015, a total of 364 consecutive subjects who underwent liver biopsies were enrolled. The Receiver-operating characteristic(ROC) curves and Obuchowski measure were constructed to evaluate the diagnostic accuracy of the new index. The AUROCs of steatosis index of patients with HBV infection (SIHBV) in predicting of steatosis were 0.929 (95% confidence interval:0.889-0.970, P < 0.05) in the model group and 0.855 (0.794-0.917, P < 0.05) in the validation group respectively. Comparisons of AUROCs demonstrated that SIHBV was significantly superior to Korean Score, fatty liver index (FLI), hepatic steatosis index (HSI), lipid accumulation product(LAP), and fatty liver disease (FLD) index for prediction of hepatic steatosis in model group and validation group(all P < 0.01). Especially for patients with hepatic steatosis percentage of 5.0-9.9% and 10.0-19.9%, SIHBV had a sensitivity of 63.6% and 79.2%, whereas it were 29.1% and 45.8% for Ultrasonography (all P < 0.05). In conclusion, as a cost-effective, simple, noninvasive, and readily available method, SIHBV may act as a massive screening tool before further examinations such as MRI, CT, transient elastography, or liver biopsy, especially for developing countries.

Also flagged:spermatogenesisnitrogennucleoproteinChloroformethanolmembrane
Journal Article 2016-09-06 No Snippets Kasimanickam V, Kastelic J.
Show Full Abstract

Sperm contain microRNAs (miRNAs), which may have roles in epigenetic control. Regarding phylogenetic relationships among various swine breeds, Yorkshire and Landrace, are considered phenotypically and genetically very similar, but distinctly different from Duroc. The objective of the present study was to compare abundance of boar sperm miRNAs in these three breeds. Overall, 252 prioritized miRNAs were investigated using real-time PCR; relative expression of miRNAs in sperm was similar in Yorkshire and Landrace boars, but significantly different compared to Duroc. Seventeen miRNAs (hsa-miR-196a-5p, hsa-miR-514a-3p, hsa-miR-938, hsa-miR-372-3p, hsa-miR-558, hsa-miR-579-3p, hsa-miR-595, hsa-miR-648, hsa-miR-524-3p, hsa-miR-512-3p, hsa-miR-429, hsa-miR-639, hsa-miR-551a, hsa-miR-624-5p, hsa-miR-585-3p, hsa-miR-508-3p and hsa-miR-626) were down-regulated (P < 0.05; fold regulation ≤-2) in Yorkshire and Landrace sperm, compared to Duroc sperm. Furthermore, three miRNAs (hsa-miR-9-5p, hsa-miR-150-5p, and hsa-miR-99a-5p) were significantly up-regulated in Yorkshire and Landrace sperm compared to Duroc sperm, However, 240 miRNAs were not significantly different (within + 2 fold) between Yorkshire and Landrace sperm. We concluded that miRNAs in sperm were not significantly different between Yorkshire and Landrace boars, but there were significant differences between those two breeds and Duroc boars. Furthermore, integrated target genes for selected down-regulated miRNAs (identified via an in-silico method) appeared to participate in spermatogenesis and sperm functions.

Also flagged:metabolismgene expressionPregnancygestationplacentationmembranes
Journal Article 2016-09-06 No Snippets Hansen VL, Schilkey FD, Miller RD.
Show Full Abstract

Live birth has emerged as a reproductive strategy many times across vertebrate evolution; however, mammals account for the majority of viviparous vertebrates. Marsupials are a mammalian lineage that last shared a common ancestor with eutherians (placental mammals) over 148 million years ago. Marsupials are noted for giving birth to highly altricial young after a short gestation, and represent humans' most distant viviparous mammalian relatives. Here we ask what insight can be gained into the evolution of viviparity in mammals specifically and vertebrates in general by analyzing the global uterine transcriptome in a marsupial. Transcriptome analyses were performed using NextGen sequencing of uterine RNA samples from the gray short-tailed opossum, Monodelphis domestica. Samples were collected from late stage pregnant, virgin, and non-pregnant experienced breeders. Three different algorithms were used to determine differential expression, and results were confirmed by quantitative PCR. Over 900 opossum gene transcripts were found to be significantly more abundant in the pregnant uterus than non-pregnant, and over 1400 less so. Most with increased abundance were genes related to metabolism, immune systems processes, and transport. This is the first study to characterize the transcriptomic differences between pregnant, non-pregnant breeders, and virgin marsupial uteruses and helps to establish a set of pregnancy-associated genes in the opossum. These observations allowed for comparative analyses of the differentially transcribed genes with other mammalian and non-mammalian viviparous species, revealing similarities in pregnancy related gene expression over 300 million years of amniote evolution.

Also flagged:pathogenesisatherosclerosishypertensionheart failurevasodilationcycle
Journal Article 2016-09-06 No Snippets Liu SH, Wang JJ, Cheng DC, Su CH, Lin TH.
Show Full Abstract

<h4>Background</h4>The endothelial function has been proven to be an important factor in the pathogenesis of atherosclerosis, hypertension and heart failure. The flow-mediated vasodilation (FMD) of the peripheral artery is an endothelium-dependent function. Brachial-artery ultrasound scanning is the popular method for evaluating FMD. However, good technical training on ultrasonography is required for the user to obtain high-quality data. Therefore, the goal of this study was to propose a new method which only used a sphygmomanometer cuff to occlude the blood flow and record the vascular volume waveform (Vwave).<h4>Results</h4>We used this method to assess the FMD in the menstrual cycle for 26 volunteer females. All female subjects were evaluated two times (M: menstrual phase; F: luteal phase) in one menstrual cycle and for two cycles. In the first cycle, the FMD volume ratio in M was 101.9 ± 45.5 % and was higher in L, at 137.5 ± 62.1 % (p = 0.0032 versus M). In the second cycle, the FMD volume ratios in M and L were 91.4 ± 37.0 % and 124.0 ± 56.4 %, respectively (p < 0.001 vs. M).<h4>Conclusions</h4>Our results have confirmed those results in the study of Hametner et al. Blood pressure measurement and FMD assessment all used the same mechanic of digital blood pressure monitor, which makes our method suitable using at home.

Also flagged:CDH1CTNNB1esophageal cancercell adhesionE-cadherinBeta catenin
Journal Article 2016-09-06 ✓ 4 Snippets Ishiguro H, Wakasugi T, Terashita Y, Sakamoto N, Tanaka T, Mizoguchi K, Sagawa H, Okubo T, Takeyama H.
In-Text Gene Mentions

APC, adenomatous polyposis coli; AXIN1, axis inhibitor 1; CDH1, cadherin 1; CTNNB1, catenin, beta-1; DCC, deleted in colorectal cancer; DEC1, deleted in esophageal cancer 1; DFF45, DNA fragmentation factor 45; DLC1, deleted in lung cancer 1; ESCC, esophageal squamous cell carcinoma; MDM2, mouse double minute 2 homolog; PTTG1, pituitary tumor transforming gene 1

Recent studies have found that several genes and molecules are involved in the origin and/or progression of esophageal cancer, including TP53 [1], deleted in esophageal cancer 1 (DEC1) [2], deleted in colorectal cancer (DCC) [3], deleted in lung cancer 1 (DLC1) [4], cyclinD1 [5], and adenomatous polyposis coli (APC) [6].

…colorectal cancer (DCC) [ 3…

…CTNNB1, catenin, beta-1;DCC, deleted in colorectal…

Show Full Abstract

<h4>Background</h4>E-cadherin/CDH1 is one of the proteins involved in cell adhesion, and it is known that decreased expression of E-cadherin induces lymph node metastasis in esophageal cancer. Beta catenin/CTNNB1, which is an important component of the Wnt signaling pathway, binds to E-cadherin at the cell membrane, where the complex of these two proteins functions in the stabilization of cell adhesion. However, its role in the pathogenesis of esophageal cancer is still unknown.<h4>Methods</h4>This study included 86 patients with esophageal cancer who underwent surgery between 1998 and 2007. The expression of the E-cadherin/CDH1 gene product (E-cadherin/CDH1) and that of the beta catenin/CTNNB1 protein in the cell membrane were analyzed by immunohistochemistry. We examined the correlations among CDH1 or CTNNB1 expression, clinicopathological factors, and the prognosis of patients with ESCC.<h4>Results</h4>CDH1 and CTNNB1 were expressed in 52.3 % (45/86) and 36.0 % (31/86) of tumor samples, respectively. Both CDH1 and CTNNB1 were co-expressed in 22.1 % (19/86) of esophageal cancer tissues. CDH1 expression correlated with the p-stage (stages I-II vs stages III-IV, p = 0.032), T factor (T1-2 vs T3-4, p = 0.0088), and lymphatic invasion (p = 0.019). However, CDH1 expression did not correlate with the N factor or the blood vessel invasion. CTNNB1 expression correlated with the T factor (T1-2 vs T3-4, p = 0.0015), p-stage (stages I-II vs stages III-IV, p = 0.030), and lymphatic invasion (p = 0.007). The CDH1(+)/CTNNB1(+) phenotype was inversely correlated with the T factor, N factor, p-stage, lymphatic invasion, and blood vessel invasion. Furthermore, patients whose tumors were double-positive for CDH1 and CTNNB1 had a significantly higher survival rate than those whose tumors were negative for CDH1 or CTNNB1 (log-rank test, p = 0.0192). The T factor and N factor had a strong negative correlation with double-positive tumors. These were both independent prognostic factors, as was the double-positive phenotype. A univariate analysis indicated that the T factor, the N factor, and CDH1 and CTNNB1 co-expression were significant variables that predicted survival (hazard ratio, 2.387; 95 % confidence interval, 1.115-5.102; p = 0.025).<h4>Conclusions</h4>Decreased expression of CDH1 or CTNNB1 in the cell membranes of cancer cells is associated with poor survival of patients with esophageal cancer.

Also flagged:zinctranscription repressorKOX1HDinflammatory responsesneuron-specific enolase
Journal Article 2016-09-06 ✓ 5 Snippets Agustín-Pavón C, Mielcarek M, Garriga-Canut M, Isalan M.
In-Text Gene Mentions

We recently developed a ZF transcription repressor (ZF-KOX1) able to bind to expanded DNA CAG-repeats in the huntingtin (HTT) gene, which are found in Huntington’s disease (HD).

In HD, the huntingtin (HTT) gene is expanded in a region containing repeats of the glutamine-encoding DNA triplet, CAG.

This ZF acutely repressed mutant HTT expression in a mouse model of HD and delayed neurological symptoms (clasping) for up to 3 weeks.

…the huntingtin (HTT) gene, which…

…the huntingtin (HTT) gene is…

Show Full Abstract

<h4>Background</h4>Synthetic zinc finger (ZF) proteins can be targeted to desired DNA sequences and are useful tools for gene therapy. We recently developed a ZF transcription repressor (ZF-KOX1) able to bind to expanded DNA CAG-repeats in the huntingtin (HTT) gene, which are found in Huntington's disease (HD). This ZF acutely repressed mutant HTT expression in a mouse model of HD and delayed neurological symptoms (clasping) for up to 3 weeks. In the present work, we sought to develop a long-term single-injection gene therapy approach in the brain.<h4>Method</h4>Since non-self proteins can elicit immune and inflammatory responses, we designed a host-matched analogue of ZF-KOX1 (called mZF-KRAB), to treat mice more safely in combination with rAAV vector delivery. We also tested a neuron-specific enolase promoter (pNSE), which has been reported as enabling long-term transgene expression, to see whether HTT repression could be observed for up to 6 months after AAV injection in the brain.<h4>Results</h4>After rAAV vector delivery, we found that non-self proteins induce significant inflammatory responses in the brain, in agreement with previous studies. Specifically, microglial cells were activated at 4 and 6 weeks after treatment with non-host-matched ZF-KOX1 or GFP, respectively, and this was accompanied by a moderate neuronal loss. In contrast, the host-matched mZF-KRAB did not provoke these effects. Nonetheless, we found that using a pCAG promoter (CMV early enhancer element and the chicken β-actin promoter) led to a strong reduction in ZF expression by 6 weeks after injection. We therefore tested a new non-viral promoter to see whether the host-adapted ZF expression could be sustained for a longer time. Vectorising mZF-KRAB with a promoter-enhancer from neuron-specific enolase (Eno2, rat) resulted in up to 77 % repression of mutant HTT in whole brain, 3 weeks after bilateral intraventricular injection of 10(10) virions. Importantly, repressions of 48 % and 23 % were still detected after 12 and 24 weeks, respectively, indicating that longer term effects are possible.<h4>Conclusion</h4>Host-adapted ZF-AAV constructs displayed a reduced toxicity and a non-viral pNSE promoter improved long-term ZF protein expression and target gene repression. The optimized constructs presented here have potential for treating HD.

Also flagged:BDNFaxonalHDsynthesisbrain-derived neurotrophic factoraxons
Journal Article 2016-09-06 ✓ 1 Snippet Zhao X, Chen XQ, Han E, Hu Y, Paik P, Ding Z, Overman J, Lau AL, Shahmoradian SH, Chiu W, Thompson LM, Wu C, Mobley WC.
In-Text Gene Mentions

Htt

Show Full Abstract

Corticostriatal atrophy is a cardinal manifestation of Huntington's disease (HD). However, the mechanism(s) by which mutant huntingtin (mHTT) protein contributes to the degeneration of the corticostriatal circuit is not well understood. We recreated the corticostriatal circuit in microfluidic chambers, pairing cortical and striatal neurons from the BACHD model of HD and its WT control. There were reduced synaptic connectivity and atrophy of striatal neurons in cultures in which BACHD cortical and striatal neurons were paired. However, these changes were prevented if WT cortical neurons were paired with BACHD striatal neurons; synthesis and release of brain-derived neurotrophic factor (BDNF) from WT cortical axons were responsible. Consistent with these findings, there was a marked reduction in anterograde transport of BDNF in BACHD cortical neurons. Subunits of the cytosolic chaperonin T-complex 1 (TCP-1) ring complex (TRiC or CCT for chaperonin containing TCP-1) have been shown to reduce mHTT levels. Both CCT3 and the apical domain of CCT1 (ApiCCT1) decreased the level of mHTT in BACHD cortical neurons. In cortical axons, they normalized anterograde BDNF transport, restored retrograde BDNF transport, and normalized lysosomal transport. Importantly, treating BACHD cortical neurons with ApiCCT1 prevented BACHD striatal neuronal atrophy by enhancing release of BDNF that subsequently acts through tyrosine receptor kinase B (TrkB) receptor on striatal neurons. Our findings are evidence that TRiC reagent-mediated reductions in mHTT enhanced BDNF delivery to restore the trophic status of BACHD striatal neurons.

Also flagged:SCAPSREBPLuteinizing hormoneLHsteroidogenesischolesterol
Journal Article 2016-09-06 No Snippets Shimizu-Albergine M, Van Yserloo B, Golkowski MG, Ong SE, Beavo JA, Bornfeldt KE.
Show Full Abstract

Luteinizing hormone (LH) stimulates steroidogenesis largely through a surge in cyclic AMP (cAMP). Steroidogenic rates are also critically dependent on the availability of cholesterol at mitochondrial sites of synthesis. This cholesterol is provided by cellular uptake of lipoproteins, mobilization of intracellular lipid, and de novo synthesis. Whether and how these pathways are coordinated by cAMP are poorly understood. Recent phosphoproteomic analyses of cAMP-dependent phosphorylation sites in MA10 Leydig cells suggested that cAMP regulates multiple steps in these processes, including activation of the SCAP/SREBP pathway. SCAP [sterol-regulatory element-binding protein (SREBP) cleavage-activating protein] acts as a cholesterol sensor responsible for regulating intracellular cholesterol balance. Its role in cAMP-mediated control of steroidogenesis has not been explored. We used two CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9 (CRISPR associated protein 9) knockout approaches to test the role of SCAP in steroidogenesis. Our results demonstrate that SCAP is required for progesterone production induced by concurrent inhibition of the cAMP phosphodiesterases PDE4 and PDE8. These inhibitors increased SCAP phosphorylation, SREBP2 activation, and subsequent expression of cholesterol biosynthetic genes, whereas SCAP deficiency largely prevented these effects. Reexpression of SCAP in SCAP-deficient cells restored SREBP2 protein expression and partially restored steroidogenic responses, confirming the requirement of SCAP-SREBP2 in steroidogenesis. Inhibitors of 3-hydroxy-3-methylglutaryl-Coenzyme A reductase and isoprenylation attenuated, whereas exogenously provided cholesterol augmented, PDE inhibitor-induced steroidogenesis, suggesting that the cholesterol substrate needed for steroidogenesis is provided by both de novo synthesis and isoprenylation-dependent mechanisms. Overall, these results demonstrate a novel role for LH/cAMP in SCAP/SREBP activation and subsequent regulation of steroidogenesis.

Also flagged:Genetic Diseasesneurological disordersneurological diseasecentral nervous system diseasesmetabolismgenetic disease
Journal Article 2016-09-06 No Snippets Barral S, Kurian MA.
Show Full Abstract

The study of neurological disorders often presents with significant challenges due to the inaccessibility of human neuronal cells for further investigation. Advances in cellular reprogramming techniques, have however provided a new source of human cells for laboratory-based research. Patient-derived induced pluripotent stem cells (iPSCs) can now be robustly differentiated into specific neural subtypes, including dopaminergic, inhibitory GABAergic, motorneurons and cortical neurons. These neurons can then be utilized for in vitro studies to elucidate molecular causes underpinning neurological disease. Although human iPSC-derived neuronal models are increasingly regarded as a useful tool in cell biology, there are a number of limitations, including the relatively early, fetal stage of differentiated cells and the mainly two dimensional, simple nature of the in vitro system. Furthermore, clonal variation is a well-described phenomenon in iPSC lines. In order to account for this, robust baseline data from multiple control lines is necessary to determine whether a particular gene defect leads to a specific cellular phenotype. Over the last few years patient-derived neural cells have proven very useful in addressing several mechanistic questions related to central nervous system diseases, including early-onset neurological disorders of childhood. Many studies report the clinical utility of human-derived neural cells for testing known drugs with repurposing potential, novel compounds and gene therapies, which then can be translated to clinical reality. iPSCs derived neural cells, therefore provide great promise and potential to gain insight into, and treat early-onset neurological disorders.

Also flagged:hereditary angioedemadeathanxietydepressiongenetic disorderC1 inhibitor
Journal Article 2016-09-06 ✓ 1 Snippet Aygören-Pürsün E, Bygum A, Beusterien K, Hautamaki E, Sisic Z, Boysen HB, Caballero T.
In-Text Gene Mentions

…Patient Organization forC1 InhibitorInhibitor Deficiencies; the…

Show Full Abstract

<h4>Objective</h4>To estimate health status utility (preference) weights for hereditary angioedema (HAE) during an attack and between attacks using data from the Hereditary Angioedema Burden of Illness Study in Europe (HAE-BOIS-Europe) survey. Utility measures quantitatively describe the net impact of a condition on a patient's life; a score of 0.0 reflects death and 1.0 reflects full health.<h4>Study design and methods</h4>The HAE-BOIS-Europe was a cross-sectional survey conducted in Spain, Germany, and Denmark to assess the real-world experience of HAE from the patient perspective. Survey items that overlapped conceptually with the EuroQol 5-Dimensions (EQ-5D) domains (pain/discomfort, mobility, self-care, usual activities, and anxiety/depression) were manually crosswalked to the corresponding UK population-based EQ-5D utility weights. EQ-5D utilities were computed for each respondent in the HAE-BOIS-Europe survey for acute attacks and between attacks.<h4>Results</h4>Overall, a total of 111 HAE-BOIS-Europe participants completed all selected survey items and thus allowed for computation of EQ-5D-based utilities. The mean utilities for an HAE attack and between attacks were 0.44 and 0.72, respectively. Utilities for an acute attack were dependent on the severity of pain of the last attack (0.61 for no pain or mild pain, 0.47 for moderate pain, and 0.08 for severe pain). There were no significant differences across countries. Mean utilities derived from the study approach compare sensibly with other disease states for both acute attacks and between attacks.<h4>Conclusion</h4>The impacts of HAE translate into substantial health status disutilities associated with acute attacks as well as between attacks, documenting that the detrimental effects of HAE are meaningful from the patient perspective. Results were consistent across countries with regard to pain severity and in comparison to similar disease states. The results can be used to raise awareness of HAE as a serious disease with wide-ranging personal and social impacts.

Also flagged:pancreatic acinar cell carcinomaductal adenocarcinomaACCtumorpancreatic ductal adenocarcinomatumors
Journal Article 2016-09-06 ✓ 2 Snippets Wang Q, Wang X, Guo R, Li G.
In-Text Gene Mentions

However, it is accepted that the molecular mechanisms involved are different from those of the more frequent DACs and neuroendocrine tumors.1,18 ACCs present as a distinct microsatellite stable and chromosomal unstable genotype with mutations in DCC and c-Myc with loss of APC gene function.

…with mutations inDCCand c-Myc with…

Show Full Abstract

Pancreatic acinar cell carcinoma (ACC) is a rare tumor that is difficult to diagnose preoperatively. The aim of this study was to evaluate and describe the computed tomography (CT) features of ACC and compare the results with pancreatic ductal adenocarcinoma (DAC) for improving preoperative diagnosis. The control group consisted of 34 patients with DAC collected from the pathology electronic database. The CT imaging from nine patients with pathologically confirmed ACC was retrospectively reviewed. Two radiologists independently assessed the tumor location, size, texture, and enhancement patterns. We found that 64.3% (9/14) of ACC tumors were homogeneous and 35.7% (5/14) had necrosis. The percentage of common bile duct and pancreatic ductal dilation was 14.3% (2/14) and 7.1% (1/14), respectively. The mean size of ACC was 50.1±24.2 mm. The mean attenuation of ACC was 35.4±3.9 Hounsfield unit (HU) before enhancement, 73.1±42.9 HU in arterial phase, and 71.8±15.6 HU in port venous phase. It is difficult to distinguish ACC from DAC preoperatively only based on CT findings. However, compared with DAC, we found that ACC tumors are likely to be larger and contain more heterogeneous intratumoral necrotic hypovascular regions, and less pancreatic ductal and common biliary dilation.

Also flagged:Pigmentationtranscription factorsCREBFOXD3LEF-1MITF
Journal Article 2016-09-06 ✓ 5 Snippets Irizarry KJ, Bryden RL.
In-Text Gene Mentions

…FOXD3, LEF-1, MITF,POU3F2, and USF-1) that…

…FOXD3, LEF-1, MITF,POU3F2, and USF-1.…

…sites are blue,POU3F2binding sites are…

…Domain detection withPOU3F2identified a POU-specific…

…ThePOU3F2alignment ( Figure…

Show Full Abstract

Color variation provides the opportunity to investigate the genetic basis of evolution and selection. Reptiles are less studied than mammals. Comparative genomics approaches allow for knowledge gained in one species to be leveraged for use in another species. We describe a comparative vertebrate analysis of conserved regulatory modules in pythons aimed at assessing bioinformatics evidence that transcription factors important in mammalian pigmentation phenotypes may also be important in python pigmentation phenotypes. We identified 23 python orthologs of mammalian genes associated with variation in coat color phenotypes for which we assessed the extent of pairwise protein sequence identity between pythons and mouse, dog, horse, cow, chicken, anole lizard, and garter snake. We next identified a set of melanocyte/pigment associated transcription factors (CREB, FOXD3, LEF-1, MITF, POU3F2, and USF-1) that exhibit relatively conserved sequence similarity within their DNA binding regions across species based on orthologous alignments across multiple species. Finally, we identified 27 evolutionarily conserved clusters of transcription factor binding sites within ~200-nucleotide intervals of the 1500-nucleotide upstream regions of AIM1, DCT, MC1R, MITF, MLANA, OA1, PMEL, RAB27A, and TYR from <i>Python bivittatus</i>. Our results provide insight into pigment phenotypes in pythons.

Also flagged:dimethylsiloxanediscpolycarbonatesynthesispolyethylenepolymerase
Journal Article 2016-09-06 No Snippets Ahmed N, Sukovich D, Abate AR.
Show Full Abstract

Microfluidic devices are valuable for a variety of biotechnology applications, such as synthesizing biochemical libraries, screening enzymes, and analyzing single cells. However, normally, the devices are controlled using specialized pumps, which require expert knowledge to operate. Here, we demonstrate operation of poly(dimethylsiloxane) devices without pumps. We build a scaffold that holds the device and reagents to be infused in a format that can be inserted into a 50 mL falcon tube and spun in a common lab centrifuge. By controlling the device design and centrifuge spin speed, we infuse the reagents at controlled flow rates. We demonstrate the encapsulation and culture of clonal colonies of red and green <i>Escherichia coli</i> in droplets seeded from single cells.

Also flagged:Ebola virus infectioninnate responseinfectionimmune responseinterferonISG15
Journal Article 2016-09-05 ✓ 2 Snippets Caballero IS, Honko AN, Gire SK, Winnicki SM, Melé M, Gerhardinger C, Lin AE, Rinn JL, Sabeti PC, Hensley LE, Connor JH.
In-Text Gene Mentions

This population includes several neutrophil-associated genes (OLFM4, CD177, SERPINB1, S100P, PTX3 and MMP8), suggesting that there is an accumulation of neutrophils in PBCMs during the course of infection.

… neutrophil-associated genes (OLFM4, CD177, SERPINB1, S100P,…

Show Full Abstract

<h4>Background</h4>Ebola virus is the causative agent of a severe syndrome in humans with a fatality rate that can approach 90 %. During infection, the host immune response is thought to become dysregulated, but the mechanisms through which this happens are not entirely understood. In this study, we analyze RNA sequencing data to determine the host response to Ebola virus infection in circulating immune cells.<h4>Results</h4>Approximately half of the 100 genes with the strongest early increases in expression were interferon-stimulated genes, such as ISG15, OAS1, IFIT2, HERC5, MX1 and DHX58. Other highly upregulated genes included cytokines CXCL11, CCL7, IL2RA, IL2R1, IL15RA, and CSF2RB, which have not been previously reported to change during Ebola virus infection. Comparing this response in two different models of exposure (intramuscular and aerosol) revealed a similar signature of infection. The strong innate response in the aerosol model was seen not only in circulating cells, but also in primary and secondary target tissues. Conversely, the innate immune response of vaccinated macaques was almost non-existent. This suggests that the innate response is a major aspect of the cellular response to Ebola virus infection in multiple tissues.<h4>Conclusions</h4>Ebola virus causes a severe infection in humans that is associated with high mortality. The host immune response to virus infection is thought to be an important aspect leading to severe pathology, but the components of this overactive response are not well characterized. Here, we analyzed how circulating immune cells respond to the virus and found that there is a strong innate response dependent on active virus replication. This finding is in stark contrast to in vitro evidence showing a suppression of innate immune signaling, and it suggests that the strong innate response we observe in infected animals may be an important contributor to pathogenesis.

Also flagged:CAStumorchromosome segregation 1-like proteincellular apoptosis susceptibility proteincancerchromosome
Journal Article 2016-09-05 ✓ 5 Snippets Jiang MC.
In-Text Gene Mentions

CSE1L (chromosome segregation 1-like protein), also named as CAS (cellular apoptosis susceptibility protein), is highly expressed in most cancer types.

This review will focus on CSE1L expression in cancers, its relationship to Ras/ERK and cAMP/PKA signaling pathways in melanoma development, its potential for the development of ADCs and tumor imaging reagents, and secretory phosphorylated CSE1L for monitoring the emergence of drug resistance in targeted cancer therapy.

CSE1L/CAS is a multiple functional protein that plays roles in apoptosis, cell survival, chromosome assembly, nucleocytoplasmic transport, microvesicle formation, and cancer metastasis; some of the functions are explicitly correlated.

CSE1L also regulates the expression and phosphorylation of CREB (cAMP response element binding protein) and MITF (microphthalmia-associated transcription factor) and is thus involved in the melanogenesis and progression of melanoma.

CSE1L is also a cancer serum biomarker.

Show Full Abstract

CSE1L (chromosome segregation 1-like protein), also named as CAS (cellular apoptosis susceptibility protein), is highly expressed in most cancer types. CSE1L/CAS is a multiple functional protein that plays roles in apoptosis, cell survival, chromosome assembly, nucleocytoplasmic transport, microvesicle formation, and cancer metastasis; some of the functions are explicitly correlated. CSE1L is also a cancer serum biomarker. The phosphorylation of CAS is regulated by the extracellular signal-regulated kinase (ERK). The RAS/RAF/MAPK/ERK signaling pathways are the essential targets of most targeted cancer drugs, thus serum phosphorylated CSE1L may be a potential biomarker for monitoring drug resistance in targeted therapy. CSE1L can regulate Ras-induced ERK phosphorylation. CSE1L also regulates the expression and phosphorylation of CREB (cAMP response element binding protein) and MITF (microphthalmia-associated transcription factor) and is thus involved in the melanogenesis and progression of melanoma. CAS is an exosome/microvesicle membrane protein. Tumor cells consistently secrete microvesicles and tumor-derived microvesicles may be accumulated around tumors. Therefore, microvesicle membrane CSE1L may be a potential target for the development of high-efficacy antibody-drug conjugates (ADCs) for cancer therapy. This review will focus on CSE1L expression in cancers, its relationship to Ras/ERK and cAMP/PKA signaling pathways in melanoma development, its potential for the development of ADCs and tumor imaging reagents, and secretory phosphorylated CSE1L for monitoring the emergence of drug resistance in targeted cancer therapy.

Also flagged:PEX2E3 ubiquitin ligasePeroxisomesorganelleslipidperoxisome
Journal Article 2016-09-05 ✓ 1 Snippet Sargent G, van Zutphen T, Shatseva T, Zhang L, Di Giovanni V, Bandsma R, Kim PK.
In-Text Gene Mentions

…shown relative toAbt1loading control.…

Show Full Abstract

Peroxisomes are metabolic organelles necessary for anabolic and catabolic lipid reactions whose numbers are highly dynamic based on the metabolic need of the cells. One mechanism to regulate peroxisome numbers is through an autophagic process called pexophagy. In mammalian cells, ubiquitination of peroxisomal membrane proteins signals pexophagy; however, the E3 ligase responsible for mediating ubiquitination is not known. Here, we report that the peroxisomal E3 ubiquitin ligase peroxin 2 (PEX2) is the causative agent for mammalian pexophagy. Expression of PEX2 leads to gross ubiquitination of peroxisomes and degradation of peroxisomes in an NBR1-dependent autophagic process. We identify PEX5 and PMP70 as substrates of PEX2 that are ubiquitinated during amino acid starvation. We also find that PEX2 expression is up-regulated during both amino acid starvation and rapamycin treatment, suggesting that the mTORC1 pathway regulates pexophagy by regulating PEX2 expression levels. Finally, we validate our findings in vivo using an animal model.

Also flagged:Six1homeoproteinhomeoproteinstranscription factorsfactorsgene expression
Journal Article 2016-09-05 ✓ 5 Snippets Sakakibara I, Wurmser M, Dos Santos M, Santolini M, Ducommun S, Davaze R, Guernec A, Sakamoto K, Maire P.
In-Text Gene Mentions

We present the evidence that Six1 homeoproteins are required in mouse SOL muscles for the acquisition of the fast MyHCIIA phenotype by controlling MyHCIIA expression and the expression of other fast-type muscle genes among which Sox6, and by controlling efficient glucose utilization through the control of glycolytic and of Krebs cycle genes.

…phenotypes are HDACs,Sox6and Linc-Myh known…

Sox6gene, a known…

…proteins, and forSox6a known repressor…

…the absence ofSox6down regulation (Fig.…

Show Full Abstract

<h4>Background</h4>Adult skeletal muscles are composed of slow and fast myofiber subtypes which each express selective genes required for their specific contractile and metabolic activity. Six homeoproteins are transcription factors regulating muscle cell fate through activation of myogenic regulatory factors and driving fast-type gene expression during embryogenesis.<h4>Results</h4>We show here that Six1 protein accumulates more robustly in the nuclei of adult fast-type muscles than in adult slow-type muscles, this specific enrichment takes place during perinatal growth. Deletion of Six1 in soleus impaired fast-type myofiber specialization during perinatal development, resulting in a slow phenotype and a complete lack of Myosin heavy chain 2A (MyHCIIA) expression. Global transcriptomic analysis of wild-type and Six1 mutant myofibers identified the gene networks controlled by Six1 in adult soleus muscle. This analysis showed that Six1 is required for the expression of numerous genes encoding fast-type sarcomeric proteins, glycolytic enzymes and controlling intracellular calcium homeostasis. Parvalbumin, a key player of calcium buffering, in particular, is a direct target of Six1 in the adult myofiber.<h4>Conclusions</h4>This analysis revealed that Six1 controls distinct aspects of adult muscle physiology in vivo, and acts as a main determinant of fast-fiber type acquisition and maintenance.

Also flagged:cell growthleukemiaantimicrobial peptidessulfuric acidhydrogenperoxide
Journal Article 2016-09-05 No Snippets Cermak N, Olcum S, Delgado FF, Wasserman SC, Payer KR, A Murakami M, Knudsen SM, Kimmerling RJ, Stevens MM, Kikuchi Y, Sandikci A, Ogawa M, Agache V, Baléras F, Weinstock DM, Manalis SR.
Show Full Abstract

Methods to rapidly assess cell growth would be useful for many applications, including drug susceptibility testing, but current technologies have limited sensitivity or throughput. Here we present an approach to precisely and rapidly measure growth rates of many individual cells simultaneously. We flow cells in suspension through a microfluidic channel with 10-12 resonant mass sensors distributed along its length, weighing each cell repeatedly over the 4-20 min it spends in the channel. Because multiple cells traverse the channel at the same time, we obtain growth rates for >60 cells/h with a resolution of 0.2 pg/h for mammalian cells and 0.02 pg/h for bacteria. We measure the growth of single lymphocytic cells, mouse and human T cells, primary human leukemia cells, yeast, Escherichia coli and Enterococcus faecalis. Our system reveals subpopulations of cells with divergent growth kinetics and enables assessment of cellular responses to antibiotics and antimicrobial peptides within minutes.

Also flagged:NucleotidesmtlDglnPK12gcvPguanines
Journal Article 2016-09-04 No Snippets Kaplan OI, Berber B, Hekim N, Doluca O.
Show Full Abstract

Many studies show that short non-coding sequences are widely conserved among regulatory elements. More and more conserved sequences are being discovered since the development of next generation sequencing technology. A common approach to identify conserved sequences with regulatory roles relies on topological changes such as hairpin formation at the DNA or RNA level. G-quadruplexes, non-canonical nucleic acid topologies with little established biological roles, are increasingly considered for conserved regulatory element discovery. Since the tertiary structure of G-quadruplexes is strongly dependent on the loop sequence which is disregarded by the generally accepted algorithm, we hypothesized that G-quadruplexes with similar topology and, indirectly, similar interaction patterns, can be determined using phylogenetic clustering based on differences in the loop sequences. Phylogenetic analysis of 52 G-quadruplex forming sequences in the Escherichia coli genome revealed two conserved G-quadruplex motifs with a potential regulatory role. Further analysis revealed that both motifs tend to form hairpins and G quadruplexes, as supported by circular dichroism studies. The phylogenetic analysis as described in this work can greatly improve the discovery of functional G-quadruplex structures and may explain unknown regulatory patterns.

Also flagged:Glucocorticoidcorticosteroidswound healingGlucocorticoidsautoimmune diseasesallergies
Journal Article 2016-09-04 No Snippets Kadmiel M, Janoshazi A, Xu X, Cidlowski JA.
Show Full Abstract

Glucocorticoids play diverse roles in almost all physiological systems of the body, including both anti-inflammatory and immunosuppressive roles. Synthetic glucocorticoids are one of the most widely prescribed drugs and are used in the treatment of conditions such as autoimmune diseases, allergies, ocular disorders and certain types of cancers. In the interest of investigating glucocorticoid actions in the cornea of the eye, we established that multiple cell types in mouse corneas express functional glucocorticoid receptor (GR) with corneal epithelial cells having robust expression. To define glucocorticoid actions in a cell type-specific manner, we employed immortalized human corneal epithelial (HCE) cell line to define the glucocorticoid transcriptome and elucidated its functions in corneal epithelial cells. Over 4000 genes were significantly regulated within 6 h of dexamethasone treatment, and genes associated with cell movement, cytoskeletal remodeling and permeability were highly regulated. Real-time in vitro wound healing assays revealed that glucocorticoids delay wound healing by attenuating cell migration. These functional alterations were associated with cytoskeletal remodeling at the wounded edge of a scratch-wounded monolayer. However, glucocorticoid treatment improved the organization of tight-junction proteins and enhanced the epithelial barrier function. Our results demonstrate that glucocorticoids profoundly alter corneal epithelial gene expression and many of these changes likely impact both wound healing and epithelial cell barrier function.

Also flagged:chromosomeneurological disorderscancersimmunoglobulinIgmitochondrial
Journal Article 2016-09-04 No Snippets Richard P, Manley JL.
Show Full Abstract

Aberrant R-loop structures are increasingly being realized as an important contributor to human disease. R loops, which are mainly co-transcriptional, abundant RNA/DNA hybrids, form naturally and can indeed be beneficial for transcription regulation at certain loci. However, their unwanted persistence elsewhere or in particular situations can lead to DNA double-strand breaks, chromosome rearrangements, and hypermutation, which are all sources of genomic instability. Mutations in genes involved in R-loop resolution or mutations leading to R-loop formation at specific genes affect the normal physiology of the cell. We discuss here the examples of diseases for which a link with R loops has been described, as well as how disease-causing mutations might participate in the development and/or progression of diseases that include repeat-associated conditions, other neurological disorders, and cancers.

Also flagged:transcription factorsgene expressiontranscription factorchromatinestradiolE2
Journal Article 2016-09-03 No Snippets Pendse SN, Maertens A, Rosenberg M, Roy D, Fasani RA, Vantangoli MM, Madnick SJ, Boekelheide K, Fornace AJ, Odwin SA, Yager JD, Hartung T, Andersen ME, McMullen PD.
Show Full Abstract

The twenty-first century vision for toxicology involves a transition away from high-dose animal studies to in vitro and computational models (NRC in Toxicity testing in the 21st century: a vision and a strategy, The National Academies Press, Washington, DC, 2007). This transition requires mapping pathways of toxicity by understanding how in vitro systems respond to chemical perturbation. Uncovering transcription factors/signaling networks responsible for gene expression patterns is essential for defining pathways of toxicity, and ultimately, for determining the chemical modes of action through which a toxicant acts. Traditionally, transcription factor identification is achieved via chromatin immunoprecipitation studies and summarized by calculating which transcription factors are statistically associated with up- and downregulated genes. These lists are commonly determined via statistical or fold-change cutoffs, a procedure that is sensitive to statistical power and may not be as useful for determining transcription factor associations. To move away from an arbitrary statistical or fold-change-based cutoff, we developed, in the context of the Mapping the Human Toxome project, an enrichment paradigm called information-dependent enrichment analysis (IDEA) to guide identification of the transcription factor network. We used a test case of activation in MCF-7 cells by 17β estradiol (E2). Using this new approach, we established a time course for transcriptional and functional responses to E2. ERα and ERβ were associated with short-term transcriptional changes in response to E2. Sustained exposure led to recruitment of additional transcription factors and alteration of cell cycle machinery. TFAP2C and SOX2 were the transcription factors most highly correlated with dose. E2F7, E2F1, and Foxm1, which are involved in cell proliferation, were enriched only at 24 h. IDEA should be useful for identifying candidate pathways of toxicity. IDEA outperforms gene set enrichment analysis (GSEA) and provides similar results to weighted gene correlation network analysis, a platform that helps to identify genes not annotated to pathways.

Also flagged:ubiquitinproteasomechromosomemedulloblastomasgene expressionAPC
Journal Article 2016-09-03 No Snippets Vriend J, Marzban H.
Show Full Abstract

Chromosome 17 abnormalities are often observed in medulloblastomas (MBs), particularly those classified in the consensus Groups 3 and 4. Herein we review MB signature genes associated with chromosome 17 and the relationship of these signature genes to the ubiquitin-proteasome system. While clinical investigators have not focused on the ubiquitin-proteasome system in relation to MB, a substantial amount of data on the topic has been hidden in the form of supplemental datasets of gene expression. A supplemental dataset associated with the Thompson classification of MBs shows that a subgroup of MB with 17p deletions is characterized by reduced expression of genes for several core particle subunits of the beta ring of the proteasome (β1, β4, β5, β7). One of these genes (PSMB6, the gene for the β1 subunit) is located on chromosome 17, near the telomeric end of 17p. By comparison, in the WNT group of MBs only one core proteasome subunit, β6, associated with loss of a gene (PSMB1) on chromosome 6, was down-regulated in this dataset. The MB subgroups with the worst prognosis have a significant association with chromosome 17 abnormalities and irregularities of APC/C cyclosome genes. We conclude that the expression of proteasome subunit genes and genes for ubiquitin ligases can contribute to prognostic classification of MBs. The therapeutic value of targeting proteasome subunits and ubiquitin ligases in the various subgroups of MB remains to be determined separately for each classification of MB.

Also flagged:docosahexaenoic acideicosapentaenoic acidphospholipidstetracosahexaenoic acidfatty acidbeta-oxidation
Journal Article 2016-09-02 ✓ 1 Snippet Park HG, Lawrence P, Engel MG, Kothapalli K, Brenna JT.
In-Text Gene Mentions

ECI2

Show Full Abstract

Docosahexaenoic acid (22:6n-3) supplementation in humans causes eicosapentaenoic acid (20:5n-3) levels to rise in plasma, but not in neural tissue where 22:6n-3 is the major omega-3 in phospholipids. We determined whether neuronal cells (Y79 and SK-N-SH) metabolize 22:6n-3 differently from non-neuronal cells (MCF7 and HepG2). We observed that (13) C-labeled 22:6n-3 was primarily esterified into cell lipids. We also observed that retroconversion of 22:6n-3 to 20:5n-3 was 5- to 6-fold greater in non-neural compared to neural cells and that retroconversion predominated over elongation to tetracosahexaenoic acid (24:6n-3) by 2-5-fold. The putative metabolic intermediates, (13) C-labeled 22:5n-3 and (13) C-labeled 24:5n-3, were not detected in our assays. Analysis of the expression of enzymes involved in fatty acid beta-oxidation revealed that MCF7 cells abundantly expressed the mitochondrial enzymes CPT1A, ECI1, and DECR1, whereas the peroxisomal enzyme ACOX1 was abundant in HepG2 cells, thus suggesting that the initial site of 22:6n-3 oxidation depends on the cell type. Our data reveal that non-neural cells more actively metabolize 22:6n-3 to 20:5n-3 via channeled retroconversion, while neural cells retain 22:6n-3.

Also flagged:PeptidomimeticsDehydroepiandrosteroneSynthesiscell proliferationhepatoma cancerlung cancer
Journal Article 2016-09-02 No Snippets Wang X, Su H, Wang W, Chen C, Cao X.
Show Full Abstract

A series of novel peptidomimetics bearing dehydroepiandrosterone moiety were designed, synthesized, and evaluated for their inhibition activities against cell proliferation. According to the preliminary studies on inhibitory activities, some of the newly prepared compounds indicated significantly inhibition activities against human hepatoma cancer (HepG2), human lung cancer (A549), human melanoma (A875) cell lines compared with the control 5-fluorouracil. Especially, compounds Ii (IC50 < 14 μM) and Ik (IC50 < 13 μM) exhibited obvious inhibition activities against all tested cell lines. The highly potential compound Ik induced apoptosis in HepG2 cells were analyzed by flow cytometry, and the apoptotic effects of compound Ik were further evaluated using Annexin V-FITC/propidium iodide dual staining assay, which revealed these highly potential compounds induced cell death in HepG2 cells at least partly by apoptosis.

Also flagged:Down syndromeUSP16TTC3gene expressionSrychromosome
Journal Article 2016-09-02 ✓ 1 Snippet Guedj F, Pennings JL, Massingham LJ, Wick HC, Siegel AE, Tantravahi U, Bianchi DW.
In-Text Gene Mentions

…, MRPL10 andMRPL39) and other…

Show Full Abstract

Anatomical and functional brain abnormalities begin during fetal life in Down syndrome (DS). We hypothesize that novel prenatal treatments can be identified by targeting signaling pathways that are consistently perturbed in cell types/tissues obtained from human fetuses with DS and mouse embryos. We analyzed transcriptome data from fetuses with trisomy 21, age and sex-matched euploid controls, and embryonic day 15.5 forebrains from Ts1Cje, Ts65Dn, and Dp16 mice. The new datasets were compared to other publicly available datasets from humans with DS. We used the human Connectivity Map (CMap) database and created a murine adaptation to identify FDA-approved drugs that can rescue affected pathways. USP16 and TTC3 were dysregulated in all affected human cells and two mouse models. DS-associated pathway abnormalities were either the result of gene dosage specific effects or the consequence of a global cell stress response with activation of compensatory mechanisms. CMap analyses identified 56 molecules with high predictive scores to rescue abnormal gene expression in both species. Our novel integrated human/murine systems biology approach identified commonly dysregulated genes and pathways. This can help to prioritize therapeutic molecules on which to further test safety and efficacy. Additional studies in human cells are ongoing prior to pre-clinical prenatal treatment in mice.

Also flagged:AFarrhythmiapathogenesiscardiovascular diseaseatrial fibrillationflutter
Journal Article 2016-09-02 ✓ 1 Snippet Lubitz SA, Brody JA, Bihlmeyer NA, Roselli C, Weng LC, Christophersen IE, Alonso A, Boerwinkle E, Gibbs RA, Bis JC, NHLBI GO Exome Sequencing Project, Cupples LA, Mohler PJ, Nickerson DA, Muzny D, Perez MV, Psaty BM, Soliman EZ, Sotoodehnia N, Lunetta KL, Benjamin EJ, Heckbert SR, Arking DE, Ellinor PT, Lin H.
In-Text Gene Mentions

…gene encoding thehemochromatosistype 2 peptide.…

Show Full Abstract

Atrial fibrillation (AF) is a morbid and heritable arrhythmia. Over 35 genes have been reported to underlie AF, most of which were described in small candidate gene association studies. Replication remains lacking for most, and therefore the contribution of coding variation to AF susceptibility remains poorly understood. We examined whole exome sequencing data in a large community-based sample of 1,734 individuals with and 9,423 without AF from the Framingham Heart Study, Cardiovascular Health Study, Atherosclerosis Risk in Communities Study, and NHLBI-GO Exome Sequencing Project and meta-analyzed the results. We also examined whether genetic variation was enriched in suspected AF genes (N = 37) in AF cases versus controls. The mean age ranged from 59 to 73 years; 8,656 (78%) were of European ancestry. None of the 99,404 common variants evaluated was significantly associated after adjusting for multiple testing. Among the most significantly associated variants was a common (allele frequency = 86%) missense variant in SYNPO2L (rs3812629, p.Pro707Leu, [odds ratio 1.27, 95% confidence interval 1.13-1.43, P = 6.6x10-5]) which lies at a known AF susceptibility locus and is in linkage disequilibrium with a top marker from prior analyses at the locus. We did not observe significant associations between rare variants and AF in gene-based tests. Individuals with AF did not display any statistically significant enrichment for common or rare coding variation in previously implicated AF genes. In conclusion, we did not observe associations between coding genetic variants and AF, suggesting that large-effect coding variation is not the predominant mechanism underlying AF. A coding variant in SYNPO2L requires further evaluation to determine whether it is causally related to AF. Efforts to identify biologically meaningful coding variation underlying AF may require large sample sizes or populations enriched for large genetic effects.

Also flagged:Chromosomeinitiator protein DnaAcell cycleDARS1DnaAorigin of replication
Journal Article 2016-09-02 ✓ 5 Snippets Frimodt-Møller J, Charbon G, Krogfelt KA, Løbner-Olesen A.
In-Text Gene Mentions

The DARS2 deletion was moved from ALO4254 into ALO4255 by P1 transduction, selecting for chloramphenicol resistance, resulting in MG1655 tonA ΔDARS2::cat (ALO4257).

…redundant DARS1 andDARS2regions play different…

…origin concentration, whetherDARS2is also involved…

…sequences, DARS1 ,DARS2, and datA…

…DARS1 , andDARS2.…

Show Full Abstract

Chromosome replication in Escherichia coli is in part controlled by three non-coding genomic sequences, DARS1, DARS2, and datA that modulate the activity of the initiator protein DnaA. The relative distance from oriC to the non-coding regions are conserved among E. coli species, despite large variations in genome size. Here we use a combination of i) site directed translocation of each region to new positions on the bacterial chromosome and ii) random transposon mediated translocation followed by culture evolution, to show genetic evidence for the importance of position. Here we provide evidence that the genomic locations of these regulatory sequences are important for cell cycle control and bacterial fitness. In addition, our work shows that the functionally redundant DARS1 and DARS2 regions play different roles in replication control. DARS1 is mainly involved in maintaining the origin concentration, whether DARS2 is also involved in maintaining single cell synchrony.

Also flagged:hereditary haemochromatosishepatocellular carcinomaironmetabolismcirrhosisliver disease
Journal Article 2016-09-02 ✓ 1 Snippet Ooka K, Onyiuke I, Zhang X, Taddei TH.
In-Text Gene Mentions

HFE

Show Full Abstract

Hereditary haemochromatosis is a multisystem disorder of iron metabolism. Hepatic manifestations include hepatomegaly, cirrhosis and hepatocellular carcinoma. Hepatocellular carcinoma is almost always preceded by cirrhosis. We present a case of an 83-year-old man without history of liver disease or iron overload who presented with abdominal pain. Workup revealed mildly elevated transaminases, ferritin of 3996 and a solitary liver tumour. Biopsy was consistent with hepatocellular carcinoma in a background of haemosiderosis without cirrhosis. He was diagnosed with hereditary haemochromatosis and hepatocellular carcinoma. He underwent a partial hepatectomy and was started on routine phlebotomy and surveillance imaging. He has improved and has not had signs of recurrence or new complications of haemochromatosis. We suggest a possible reason for his unique and late presentation.

Also flagged:urinary incontinencePrimary Prostate Cancerprostate cancerPCaRPcancer
Journal Article 2016-09-02 No Snippets Chang P, Regan MM, Ferrer M, Guedea F, Patil D, Wei JT, Hembroff LA, Michalski JM, Saigal CS, Litwin MS, Hamstra DA, Kaplan ID, Ciezki JP, Klein EA, Kibel AS, Sandler HM, Dunn RL, Crociani CM, Sanda MG, PROST-QA Consortium.
Show Full Abstract

<h4>Purpose</h4>Harms of prostate cancer treatment on urinary health related quality of life have been thoroughly studied. In this study we evaluated not only the harms but also the potential benefits of prostate cancer treatment in relieving the pretreatment urinary symptom burden.<h4>Materials and methods</h4>In American (1,021) and Spanish (539) multicenter prospective cohorts of men with localized prostate cancer we evaluated the effects of radical prostatectomy, external radiotherapy or brachytherapy in relieving pretreatment urinary symptoms and in inducing urinary symptoms de novo, measured by changes in urinary medication use and patient reported urinary bother.<h4>Results</h4>Urinary symptom burden improved in 23% and worsened in 28% of subjects after prostate cancer treatment in the American cohort. Urinary medication use rates before treatment and 2 years after treatment were 15% and 6% with radical prostatectomy, 22% and 26% with external radiotherapy, and 19% and 46% with brachytherapy, respectively. Pretreatment urinary medication use (OR 1.4, 95% CI 1.0-2.0, p = 0.04) and pretreatment moderate lower urinary tract symptoms (OR 2.8, 95% CI 2.2-3.6) predicted prostate cancer treatment associated relief of baseline urinary symptom burden. Subjects with pretreatment lower urinary tract symptoms who underwent radical prostatectomy experienced the greatest relief of pretreatment symptoms (OR 4.3, 95% CI 3.0-6.1), despite the development of deleterious de novo urinary incontinence in some men. The magnitude of pretreatment urinary symptom burden and beneficial effect of cancer treatment on those symptoms were verified in the Spanish cohort.<h4>Conclusions</h4>Men with pretreatment lower urinary tract symptoms may experience benefit rather than harm in overall urinary outcome from primary prostate cancer treatment. Practitioners should consider the full spectrum of urinary symptom burden evident before prostate cancer treatment in treatment decisions.

Also flagged:Metastatic Lung CancerEGFRALKtyrosine kinaseNSCLCtumor
Journal Article 2016-09-02 No Snippets Shinde R, Cao X, Kothari S.
Show Full Abstract

<h4>Background</h4>Epidermal growth factor receptor (EGFR) gene mutations and anaplastic lymphoma kinase (ALK) gene rearrangements are key therapeutic targets for biomarker-driven treatment with an EGFR or ALK tyrosine kinase inhibitor (TKI) in patients with metastatic non-small cell lung cancer (NSCLC). To appropriately guide treatment decisions, since 2011, the National Comprehensive Cancer Network and the American Society of Clinical Oncology therefore recommend EGFR and ALK analysis in tumor samples obtained at the time of diagnosis in patients with non-squamous NSCLC. Currently, there are limited data on utilization patterns and cost of biopsy procedures and biomarker tests in patients with metastatic NSCLC who receive an EGFR or ALK TKI.<h4>Objectives</h4>To (a) describe utilization patterns and costs associated with biopsy procedures and biomarker testing in patients with NSCLC who received erlotinib or crizotinib between 2009 and 2012 and (b) investigate the timing of these procedures relative to the erlotinib or crizotinib index date.<h4>Methods</h4>Adult patients with metastatic lung cancer were identified by ICD-9-CM diagnostic codes within the Truven Health Analytic MarketScan database. Patients were included in the analysis if they had an index erlotinib or crizotinib claim between January 1, 2009, and September 30, 2012 (index period) and were continuously enrolled for ≥ 12 months before the index claim. Because there is no specific ICD-9-CM diagnostic code for NSCLC, patients with metastatic lung cancer who received erlotinib or crizotinib were considered to have metastatic NSCLC. Using CPT and ICD-9-CM codes, lung biopsy procedures performed during the 24 months before or 12 months after the index claim date were identified. For every patient, biomarker testing claims for EGFR and ALK were identified using the molecular pathology stacked CPT code during the 2 months before or 1 month after the index date. The frequency of claims for biopsy procedures and biomarker testing was analyzed descriptively. The overall summary measures for biomarker testing, especially frequency of EGFR testing in patients receiving erlotinib, was also described as before and after 2011, the year when biomarker testing became part of the guidelines. Per patient and overall costs for biopsy procedures and biomarker testing were calculated from payer and patient perspectives.<h4>Results</h4>Of the 4,926 identified patients, 4,801 (97.5%) received erlotinib, and 125 (2.5%) received crizotinib. Biopsy procedure claims were identified for 3,579 (72.7%) patients, including 3,503 (73.0%) erlotinib recipients and 76 (60.8%) crizotinib recipients. Biomarker testing claims were identified for 675 (13.7%) patients, including 634 (13.2%) erlotinib recipients and 41 (32.8%) crizotinib recipients. Overall, most biomarker testing procedures (476 of 741) were identified in 435 (of 675) patients after year 2011. Also, among erlotinib recipients, percentage of patients receiving EGFR testing was increased over the index period. Per patient mean (SD) numbers of biopsy procedures and biomarker tests were 1.2 (1.1) and 0.2 (0.4), respectively. In the outpatient setting, per patient mean (SD) cost per biopsy procedure was $1,223 ($1,899) from the payer perspective and $60 ($147) from the patient perspective, whereas in the inpatient setting, it was $8,163 ($18,712) and $180 ($691), respectively. Among patients receiving at least 1 biomarker test, the per patient mean (SD) cost for the overall population was $891 ($1,062) and $43 ($229); for erlotinib recipients, it was $906 ($1,084) and $42 ($228); and for crizotinib recipients, it was $664 ($576) and $55 ($243) in payer and patient perspectives, respectively.<h4>Conclusions</h4>This study provides insight into the use and cost of biopsy and biomarker testing procedures in patients with metastatic NSCLC. The low frequency of biomarker testing highlights the need for more awareness of testing to guide treatment decisions in these patients. Costs associated with biopsy procedures and biomarker testing provide insight into the economic impact on metastatic NSCLC patients treated with targeted therapy.<h4>Disclosures</h4>This study was sponsored by Merck & Co. Shinde is a study manager working for Merck under contract with AllSourcePPS, an Agile 1 company in Huntington Beach, California. Cao and Kothari are employees of Merck & Co., Kenilworth, New Jersey. Study concept and design were contributed primarily by Shinde and Kothari. Data analysis was performed by Cao. Data interpretation was performed by Shinde, Cao, and Kothari. Shinde wrote the manuscript with assistance from Cao and Kothari. The revision was completed primarily by Shinde and Kothari.

Also flagged:Transferrinironmethylphenyl1,2,3,6-tetrahydropyridineCeruloplasmin
Journal Article 2016-09-02 ✓ 1 Snippet Ayton S, Lei P, Mclean C, Bush AI, Finkelstein DI.
In-Text Gene Mentions

…dyshomeostasis (for example,hemochromatosis).…

Show Full Abstract

Iron deposition in Parkinson's disease (PD) is a potential disease-modifying target. We previously showed that supplementation of the iron-exporter, ceruloplasmin, selectively corrected nigral iron elevation in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) model. Ceruloplasmin delivers iron to transferrin (Tf), the extracellular iron-transporting protein. We show that Tf protein levels are decreased in the nigra of post-mortem PD brains compared with controls (-35%; <i>n</i>=10 each). Because Tf traffics iron away from iron-replete tissues, we hypothesized that Tf supplementation could selectively facilitate iron export from the nigra in PD. In cultured neurons, Tf treatment corrected iron accumulation, and subcutaneous Tf to mice ameliorated iron accumulation and motor deficits in the MPTP model of PD. Although these data support a role for Tf in the disease mechanism for PD, and its potential use for correcting disorders of iron overload, Tf therapy also caused systemic iron depletion, which could limit its application for PD.

Also flagged:infertilemetabolismphosphorylationproteinbiosynthesisresponse to oxidative stress
Journal Article 2016-09-01 ✓ 2 Snippets Cui Z, Sharma R, Agarwal A.
In-Text Gene Mentions

CSE1L: CSE1 chromosome segregation…

…portin-1 (XPO1), exporting-2 (CSE1L), importin subunit beta…

Show Full Abstract

Dysfunctional spermatozoa maturation is the main reason for the decrease in sperm motility and morphology in infertile men. Ejaculated spermatozoa from healthy fertile men were separated into four fractions using three-layer density gradient. Proteins were extracted and bands were digested on a LTQ-Orbitrap Elite hybrid mass spectrometer system. Functional annotations of proteins were obtained using bioinformatics tools and pathway databases. Western blotting was performed to verify the expression levels of the proteins of interest. 1469 proteins were identified in four fractions of spermatozoa. The number of detected proteins decreased according to the maturation level of spermatozoa. During spermatozoa maturation, proteins involved in gamete generation, cell motility, energy metabolism and oxidative phosphorylation processes showed increasing expression levels and those involved in protein biosynthesis, protein transport, protein ubiquitination, and response to oxidative stress processes showed decreasing expression levels. We validated four proteins (HSP 70 1A, clusterin, tektin 2 and tektin 3) by Western blotting. The study shows protein markers that may provide insight into the ejaculated spermatozoa proteins in different stages of sperm maturation that may be altered or modified in infertile men.

Also flagged:metabolismconnective tissue diseasesTOLLIPInterstitial Lung Diseaseidiopathic pulmonary fibrosisN -acetylcysteine
Journal Article 2016-09-01 No Snippets Oldham JM, Noth I, Martinez FJ.
Show Full Abstract

<h4>Purpose of review</h4>Interstitial lung disease (ILD) is comprised of a heterogeneous group of disorders with highly variable natural histories and response to therapies. Pharmacogenetics focuses on the variability in drug response because of the presence of genetic factors that influence drug metabolism or disease activity. In this article, we review relevant drug-specific and disease-specific polymorphisms that may influence therapeutic response, and then highlight a recently identified drug-gene interaction in patients with idiopathic pulmonary fibrosis (IPF).<h4>Recent findings</h4>The emergence of high-throughput genomic technology has allowed for identification of gene polymorphisms associated with susceptibility to specific disease states, including IPF and several connective tissue diseases known to cause ILD. IPF risk loci span a diverse group of genes, while most associated with connective tissue disease are critical to immune signaling. A recent pharmacogenetic analysis of patients enrolled in an IPF clinical trial identified a variant within TOLLIP to be associated with differential response to N-acetylcysteine therapy.<h4>Summary</h4>Though few pharmacogenetic investigations have been conducted in patients with ILD to date, ample opportunities for pharmacogenetic exploration exist in this patient population. Such exploration will advance our understanding of specific ILDs and help usher in an era of personalized medicine.

Also flagged:mitochondrialpyruvate dehydrogenaseMDM2p53Dihydrolipoamide dehydrogenaseE3
Journal Article 2016-09-01 No Snippets Way L, Faktor J, Dvorakova P, Nicholson J, Vojtesek B, Graham D, Ball KL, Hupp T.
Show Full Abstract

Drugs targeting MDM2's hydrophobic pocket activate p53. However, these agents act allosterically and have agonist effects on MDM2's protein interaction landscape. Dominant p53-independent MDM2-drug responsive-binding proteins have not been stratified. We used as a variable the differential expression of MDM2 protein as a function of cell density to identify Nutlin-3 responsive MDM2-binding proteins that are perturbed independent of cell density using SWATH-MS. Dihydrolipoamide dehydrogenase, the E3 subunit of the mitochondrial pyruvate dehydrogenase complex, was one of two Nutlin-3 perturbed proteins identified fours hour posttreatment at two cell densities. Immunoblotting confirmed that dihydrolipoamide dehydrogenase was induced by Nutlin-3. Depletion of MDM2 using siRNA also elevated dihydrolipoamide dehydrogenase in Nutlin-3 treated cells. Mitotracker confirmed that Nutlin-3 inhibits mitochondrial activity. Enrichment of mitochondria using TOM22+ immunobeads and TMT labeling defined key changes in the mitochondrial proteome after Nutlin-3 treatment. Proximity ligation identified rearrangements of cellular protein-protein complexes in situ. In response to Nutlin-3, a reduction of dihydrolipoamide dehydrogenase/dihydrolipoamide acetyltransferase protein complexes highlighted a disruption of the pyruvate dehydrogenase complex. This coincides with an increase in MDM2/dihydrolipoamide dehydrogenase complexes in the nucleus that was further enhanced by the nuclear export inhibitor Leptomycin B. The data suggest one therapeutic impact of MDM2 drugs might be on the early perturbation of specific protein-protein interactions within the mitochondria. This methodology forms a blueprint for biomarker discovery that can identify rearrangements of MDM2 protein-protein complexes in drug-treated cells.

Also flagged:pancreatic cystscystFNcystsbenignpancreatic cyst
Journal Article 2016-09-01 ✓ 1 Snippet Kowalski T, Siddiqui A, Loren D, Mertz HR, Mallat D, Haddad N, Malhotra N, Sadowski B, Lybik MJ, Patel SN, Okoh E, Rosenkranz L, Karasik M, Golioto M, Linder J, Catalano MF, Al-Haddad MA.
In-Text Gene Mentions

…), 18q (DCC), 21q (…

Show Full Abstract

<h4>Goals</h4>To examine the utility of integrated molecular pathology (IMP) in managing surveillance of pancreatic cysts based on outcomes and analysis of false negatives (FNs) from a previously published cohort (n=492).<h4>Background</h4>In endoscopic ultrasound with fine-needle aspiration (EUS-FNA) of cyst fluid lacking malignant cytology, IMP demonstrated better risk stratification for malignancy at approximately 3 years' follow-up than International Consensus Guideline (Fukuoka) 2012 management recommendations in such cases.<h4>Study</h4>Patient outcomes and clinical features of Fukuoka and IMP FN cases were reviewed. Practical guidance for appropriate surveillance intervals and surgery decisions using IMP were derived from follow-up data, considering EUS-FNA sampling limitations and high-risk clinical circumstances observed. Surveillance intervals for patients based on IMP predictive value were compared with those of Fukuoka.<h4>Results</h4>Outcomes at follow-up for IMP low-risk diagnoses supported surveillance every 2 to 3 years, independent of cyst size, when EUS-FNA sampling limitations or high-risk clinical circumstances were absent. In 10 of 11 patients with FN IMP diagnoses (2% of cohort), EUS-FNA sampling limitations existed; Fukuoka identified high risk in 9 of 11 cases. In 4 of 6 FN cases by Fukuoka (1% of cohort), IMP identified high risk. Overall, 55% of cases had possible sampling limitations and 37% had high-risk clinical circumstances. Outcomes support more cautious management in such cases when using IMP.<h4>Conclusions</h4>Adjunct use of IMP can provide evidence for relaxed surveillance of patients with benign cysts that meet Fukuoka criteria for closer observation or surgery. Although infrequent, FN results with IMP can be associated with EUS-FNA sampling limitations or high-risk clinical circumstances.

Also flagged:Acute Myeloid LeukemiaMLLCD4
Journal Article 2016-09-01 No Snippets Lee JM, Kim IS, Lee JN, Park SH, Kim HH, Chang CL, Lee EY, Kim HR, Oh SH, Song SA.
Show Full Abstract

No abstract available.

Also flagged:MLLSEPT5Acute Myeloid Leukemia
Journal Article 2016-09-01 No Snippets Wang N, Wu X, Sheng G, Ma L, Wen L, Yao H, Chen S.
Show Full Abstract

No abstract available.

Also flagged:Huntington DiseaseHDNucleotideJPH3ATN1TBP
Journal Article 2016-09-01 ✓ 1 Snippet Mariani LL, Tesson C, Charles P, Cazeneuve C, Hahn V, Youssov K, Freeman L, Grabli D, Roze E, Noël S, Peuvion JN, Bachoud-Levi AC, Brice A, Stevanin G, Durr A.
In-Text Gene Mentions

We identified mutations in genes associated with neurodegeneration, including CACNA1A (n = 2), VPS13A (n = 1), UBQLN2 (n = 1), and VCP (n = 1).<h4>Conclusions and relevance</h4>Huntington disease phenocopies without CAG repeat expansions in HTT are not rare, occurring in 12.4% (28 of 226) herein, and should be considered in genetic counseling.

Show Full Abstract

<h4>Importance</h4>Huntington disease (HD), a prototypic monogenic disease, is caused by an expanded CAG repeat in the HTT gene exceeding 35 units. However, not all patients with an HD phenotype carry the pathological expansion in HTT, and the positive diagnosis rate is poor.<h4>Objectives</h4>To examine patients with HD phenotypes to determine the frequency of HD phenocopies with typical features of HD but without pathological CAG repeat expansions in HTT in an attempt to improve the positive diagnosis rate.<h4>Design, setting, and participants</h4>Between January 1, 2004, and April 18, 2011, a total of 226 consecutive index patients with an HD phenotype were referred to specialized clinics of the French National Huntington Disease Reference Centre for Rare Diseases. They underwent detailed clinical examination and follow-up, as well as neuropsychological, biological, imaging, and genetic examinations. Nucleotide expansions in JPH3, ATN1, TBP, and C9ORF72 and mutations in PRNP, as well as acquired conditions commonly causing HD phenocopies, were first screened.<h4>Main outcomes and measures</h4>The diagnostic rate of HD phenocopies and frequency of other etiologies using deep clinical phenotyping and next generation sequencing. Our goal was to improve the genetic diagnosis of HD phenocopies and to identify new HD related genes.<h4>Results</h4>One hundred ninety-eight patients carried a pathological CAG repeat expansion in HTT, whereas 28 patients (12 women and 16 men) did not. Huntington disease phenocopies accounted for 12.4%, and their mean (SD) age at onset was similar to those of the HD-HTT group (47.3 [12.7] years vs 50.3 [16.4] years, P = .29). We first identified 3 patients with abnormal CTG expansions in JPH3, a fourth patient with an antiphospholipid syndrome, and a fifth patient with B12 avitaminosis. A custom-made 63-gene panel was generated based on clinical evolution and exome sequencing. It contained genes responsible for HD phenocopies and other neurodegenerative conditions, as well as candidate genes from exome sequencing in 3 index cases with imaging features of brain iron accumulation. We identified mutations in genes associated with neurodegeneration, including CACNA1A (n = 2), VPS13A (n = 1), UBQLN2 (n = 1), and VCP (n = 1).<h4>Conclusions and relevance</h4>Huntington disease phenocopies without CAG repeat expansions in HTT are not rare, occurring in 12.4% (28 of 226) herein, and should be considered in genetic counseling. We used next-generation sequencing combined with clinical data and disease evolution to explore multiple etiologies simultaneously. Our combined clinical and genetic exploration of 28 HD phenocopies identified the underlying cause in 35.7% (10 of 28). In conclusion, the etiologies of HD phenocopies are heterogeneous, and clinical evolution should be taken into account when searching for a genetic cause. The panel of candidate genes to be examined is larger than expected but can be guided by specific imaging and clinical features. Other neurodegenerative diseases with late onset in which variant segregation cannot be verified could be productively explored with the combined approach illustrated herein.

Also flagged:infectious diseasechlorinegastroenteritisinfectious diseasesinfectionenteropathogens
Journal Article 2016-09-01 ✓ 2 Snippets Pijnacker R, Mughini-Gras L, Vennema H, Enserink R, VAN DEN Wijngaard CC, Kortbeek T, VAN Pelt W.
In-Text Gene Mentions

…to further identifyDCCcharacteristics associated wit…

DCC

Show Full Abstract

Insights into transmission dynamics of enteropathogens in children attending daycare are limited. Here we aimed at identifying daycare centre (DCC) characteristics associated with time-clustered occurrence of enteropathogens in DCC-attending children. For this purpose, we used the KIzSS network, which comprises 43 DCCs that participated in infectious disease surveillance in The Netherlands during February 2010-February 2013. Space-time scan statistics were used to identify clusters of rotavirus, norovirus, astrovirus, Giardia lamblia and Cryptosporidium spp. in a two-dimensional DCC characteristic space constructed using canonical correlation analysis. Logistic regression models were then used to further identify DCC characteristics associated with increased or decreased odds for clustering of enteropathogens. Factors associated with increased odds for enteropathogen clustering in DCCs were having indoor/outdoor paddling pools or sandpits, owning animals, high numbers of attending children, and reporting outbreaks to local health authorities. Factors associated with decreased odds for enteropathogen clustering in DCCs were cleaning child potties in designated waste disposal stations, cleaning vomit with chlorine-based products, daily cleaning of toys, extra cleaning of toys during a suspected outbreak, and excluding children with gastroenteritis. These factors provide targets for reducing the burden of gastrointestinal morbidity associated with time-clustered occurrence of major enteropathogens in DCC attendees.

Also flagged:Ubc13ubiquitin E2 conjugating enzymeE3 ligaseslysineubiquitincancers
Journal Article 2016-09-01 ✓ 1 Snippet Hodge CD, Spyracopoulos L, Glover JN.
In-Text Gene Mentions

The primary feature of HD is the variable DNA repeat expansion of CAG in the huntingtin (HTT) gene [231, 232], which translates into a huntingtin protein (or fragment) with a lengthened N-terminal polyglutamine region prone to aggregation in neurons and accumulation in synaptic regions [233].

Show Full Abstract

Ubc13 is an ubiquitin E2 conjugating enzyme that participates with many different E3 ligases to form lysine 63-linked (Lys63) ubiquitin chains that are critical to signaling in inflammatory and DNA damage response pathways. Recent studies have suggested Ubc13 as a potential therapeutic target for intervention in various human diseases including several different cancers, alleviation of anti-cancer drug resistance, chronic inflammation, and viral infections. Understanding a potential therapeutic target from different angles is important to assess its usefulness and potential pitfalls. Here we present a global review of Ubc13 from its structure, function, and cellular activities, to its natural and chemical inhibition. The aim of this article is to review the literature that directly implicates Ubc13 in a biological function, and to integrate structural and mechanistic insights into the larger role of this critical E2 enzyme. We discuss observations of multiple Ubc13 structures that suggest a novel mechanism for activation of Ubc13 that involves conformational change of the active site loop.

Also flagged:cancercancersbreast cancerBCAS3BCAS4NOTCH
Journal Article 2016-09-01 No Snippets Zhao J, Li X, Yao Q, Li M, Zhang J, Ai B, Liu W, Wang Q, Feng C, Liu Y, Bai X, Song C, Li S, Li E, Xu L, Li C.
Show Full Abstract

While gene fusions have been increasingly detected by next-generation sequencing (NGS) technologies based methods in human cancers, these methods have limitations in identifying driver fusions. In addition, the existing methods to identify driver gene fusions ignored the specificity among different cancers or only considered their local rather than global topology features in networks. Here, we proposed a novel network-based method, called RWCFusion, to identify phenotype-specific cancer driver gene fusions. To evaluate its performance, we used leave-one-out cross-validation in 35 cancers and achieved a high AUC value 0.925 for overall cancers and an average 0.929 for signal cancer. Furthermore, we classified 35 cancers into two classes: haematological and solid, of which the haematological got a highly AUC which is up to 0.968. Finally, we applied RWCFusion to breast cancer and found that top 13 gene fusions, such as BCAS3-BCAS4, NOTCH-NUP214, MED13-BCAS3 and CARM-SMARCA4, have been previously proved to be drivers for breast cancer. Additionally, 8 among the top 10 of the remaining candidate gene fusions, such as SULF2-ZNF217, MED1-ACSF2, and ACACA-STAC2, were inferred to be potential driver gene fusions of breast cancer by us.

Also flagged:SH2B1type 2 diabetesobesityDiabetesinsulinsugar
Journal Article 2016-09-01 ✓ 1 Snippet Lange LA, Graff M, Lange EM, Young KL, Richardson AS, Mohlke KL, North KE, Harris KM, Gordon-Larsen P.
In-Text Gene Mentions

NEGR1

Show Full Abstract

Glycated hemoglobin (HbA1c) is used to classify glycaemia and type 2 diabetes (T2D). Body mass index (BMI) is a predictor of HbA1c levels and T2D. We tested 43 established BMI and obesity loci for association with HbA1c in a nationally representative multiethnic sample of young adults from the National Longitudinal Study of Adolescent to Adult Health [Add Health: age 24-34 years; n = 5641 European Americans (EA); 1740 African Americans (AA); 1444 Hispanic Americans (HA)] without T2D, using two levels of covariate adjustment (Model 1: age, sex, smoking, and geographic region; Model 2: Model 1 covariates plus BMI). Bonferroni adjustment was made for 43 SNPs and we considered P < 0.0011 statistically significant. Means (SD) for HbA1c were 5.4% (0.3) in EA, 5.7% (0.4) in AA, and 5.5% (0.3) in HA. We observed significant evidence for association with HbA1c for two variants near SH2B1 in EA (rs4788102, P = 2.2 × 10(-4) ; rs7359397, P = 9.8 × 10(-4) ) for Model 1. Both results were attenuated after adjustment for BMI (rs4788102, P = 1.7 × 10(-3) ; rs7359397, P = 4.6 × 10(-3) ). No variant reached Bonferroni-corrected significance in AA or HA. These results suggest that SH2B1 polymorphisms are associated with HbA1c, largely independent of BMI, in EA young adults.

Also flagged:p21RAC1PAK6non-small cell lung cancerlung cancercancer
Journal Article 2016-09-01 ✓ 5 Snippets Raja R, Sahasrabuddhe NA, Radhakrishnan A, Syed N, Solanki HS, Puttamallesh VN, Balaji SA, Nanjappa V, Datta KK, Babu N, Renuse S, Patil AH, Izumchenko E, Prasad TS, Chang X, Rangarajan A, Sidransky D, Pandey A, Gowda H, Chatterjee A.
In-Text Gene Mentions

…kinases such asTAOK3(S324) (3-fold), MAPK14…

…PAK6 such asTAOK3and MAPK14 which…

…an independent study,TAOK3was found to…

…PAK6 (S560) andTAOK3(S324) are depicted…

…our study includedTAOK3(S324), MAPK14 (Y182)…

Show Full Abstract

Epidemiological data clearly establishes cigarette smoking as one of the major cause for lung cancer worldwide. Recently, targeted therapy has become one of the most preferred modes of treatment for cancer. Though certain targeted therapies such as anti-EGFR are in clinical practice, they have shown limited success in lung cancer patients who are smokers. This demands discovery of alternative drug targets through systematic investigation of cigarette smoke-induced signaling mechanisms. To study the signaling events activated in response to cigarette smoke, we carried out SILAC-based phosphoproteomic analysis of H358 lung cancer cells chronically exposed to cigarette smoke. We identified 1,812 phosphosites, of which 278 phosphosites were hyperphosphorylated (≥ 3-fold) in H358 cells chronically exposed to cigarette smoke. Our data revealed hyperphosphorylation of S560 within the conserved kinase domain of PAK6. Activation of PAK6 is associated with various processes in cancer including metastasis. Mechanistic studies revealed that inhibition of PAK6 led to reduction in cell proliferation, migration and invasion of the cigarette smoke treated cells. Further, siRNA mediated silencing of PAK6 resulted in decreased invasive abilities in a panel of non-small cell lung cancer (NSCLC) cells. Consistently, mice bearing tumor xenograft showed reduced tumor growth upon treatment with PF-3758309 (group II PAK inhibitor). Immunohistochemical analysis revealed overexpression of PAK6 in 66.6% (52/78) of NSCLC cases in tissue microarrays. Taken together, our study indicates that PAK6 is a promising novel therapeutic target for NSCLC, especially in smokers.

Also flagged:Vitamin EIroniron deficiencybutyrateinflammatory responseIL-4
Journal Article 2016-09-01 ✓ 1 Snippet Tang M, Frank DN, Sherlock L, Ir D, Robertson CE, Krebs NF.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Iron therapy induces inflammation, which could decrease iron absorption. Increased exposure of iron in the gut could also alter microbiome file. Providing antioxidants such as vitamin E with iron therapy has been associated with reduced oxidative potential.<h4>Objective</h4>The aim of the present study was to test the efficacy of adding vitamin E to therapeutic iron therapy on iron repletion, inflammation markers, and gut microbiome in iron-deficient infants and toddlers.<h4>Design</h4>This was a randomized, double-blind, control trial in which infants and toddlers (Denver, CO metro area) who were at risk of iron deficiency were screened. Eligible participants were randomized to receive iron therapy (6 mg · kg · day) plus placebo (n = 22) or iron (6 mg · kg · day) and vitamin E (18 mg/day, n = 14) for 8 weeks. Iron and inflammation status, and gut microbiome (16S sequencing) were analyzed in all participants before and after the treatment.<h4>Results</h4>After 8 weeks of treatment, average serum ferritin level returned to normal for both iron + placebo and iron + vitamin E groups at 33.3 ± 20.2 and 33.5 ± 21.5 μg/L, respectively. Serum vitamin E concentration increased in iron + vitamin E group. No change over time was observed regarding serum interleukin-4, tumor necrosis factor-α, or fecal calprotectin. The relative abundance of the genus Roseburia (phylum Firmicutes), a butyrate producer, increased in the Fe + E group (Δ1.3%, P < 0.01). Also at the genus level, the genus Escherichia decreased by 1.2% on average among all participants (effect of time P = 0.01).<h4>Conclusions</h4>Using a therapeutic iron dose of 6 mg · kg · day is effective in treating iron deficiency during an 8-week period, without inducing persistent inflammatory response. Changes of the gut microbiome raised the possibility that antioxidant therapy in conjunction with therapeutic iron supplementation could potentially improve microbial community profiles in the intestinal tract.

Also flagged:GluN2Bnitric oxideHemeeIF2α kinaseN-Methyl D-Aspartate ReceptorNMDAR
Journal Article 2016-09-01 ✓ 1 Snippet Ramos-Fernández E, Tajes M, Ill-Raga G, Vargas L, Busquets-García A, Bosch-Morató M, Guivernau B, Valls-Comamala V, Gomis M, Grau C, Grau C, Fandos C, Rosen MD, Rabinowitz MH, Inestrosa N, Maldonado R, Altafaj X, Ozaita A, Alvarez A, Vicente R, Valverde MA, Muñoz FJ.
In-Text Gene Mentions

…(PERK), and theGeneral Control Non-repressed 2 kinaseControl Non-repressed 2…

Show Full Abstract

The activation of N-Methyl D-Aspartate Receptor (NMDAR) by glutamate is crucial in the nervous system function, particularly in memory and learning. NMDAR is composed by two GluN1 and two GluN2 subunits. GluN2B has been reported to participate in the prevalent NMDAR subtype at synapses, the GluN1/2A/2B. Here we studied the regulation of GluN2B expression in cortical neurons finding that glutamate up-regulates GluN2B translation through the action of nitric oxide (NO), which induces the phosphorylation of the eukaryotic translation initiation factor 2 α (eIF2α). It is a process mediated by the NO-heme-regulated eIF2α kinase (HRI), as the effect was avoided when a specific HRI inhibitor or a HRI small interfering RNA (siHRI) were used. We found that the expressed GluN2B co-localizes with PSD-95 at the postsynaptic ending, which strengthen the physiological relevance of the proposed mechanism. Moreover the receptors bearing GluN2B subunits upon NO stimulation are functional as high Ca2+ entry was measured and increases the co-localization between GluN2B and GluN1 subunits. In addition, the injection of the specific HRI inhibitor in mice produces a decrease in memory retrieval as tested by the Novel Object Recognition performance. Summarizing our data suggests that glutamatergic stimulation induces HRI activation by NO to trigger GluN2B expression and this process would be relevant to maintain postsynaptic activity in cortical neurons.

Also flagged:Chronic Liver Diseasehepatic steatosisironliver fibrosiscirrhosisportal hypertension
Journal Article 2016-09-01 ✓ 1 Snippet Tan CH, Venkatesh SK.
In-Text Gene Mentions

…overload secondary tohemochromatosisor hemosiderosis.…

Show Full Abstract

Recent advances in the noninvasive imaging of chronic liver disease have led to improvements in diagnosis, particularly with magnetic resonance imaging (MRI). A comprehensive evaluation of the liver may be performed with the quantification of the degree of hepatic steatosis, liver iron concentration, and liver fibrosis. In addition, MRI of the liver may be used to identify complications of cirrhosis, including portal hypertension, ascites, and the development of hepatocellular carcinoma. In this review article, we discuss the state of the art techniques in liver MRI, namely, magnetic resonance elastography, hepatobiliary phase MRI, and liver fat and iron quantification MRI. The use of these advanced techniques in the management of chronic liver diseases, including nonalcoholic fatty liver disease, will be elaborated.

Also flagged:nitric oxideasthmacorticosteroidscorticosteroideosinophiliclung inflammation
Journal Article 2016-09-01 No Snippets Petsky HL, Kew KM, Turner C, Chang AB.
Show Full Abstract

<h4>Background</h4>Asthma guidelines aim to guide health practitioners to optimise treatment for patients so as to minimise symptoms, improve or maintain good lung function, and prevent acute exacerbations or flare-ups. The principle of asthma guidelines is based on a step-up or step-down regimen of asthma medications to maximise good health outcomes using minimum medications. Asthma maintenance therapies reduce airway inflammation that is usually eosinophilic. Tailoring asthma medications in accordance with airway eosinophilic levels may improve asthma outcomes such as indices of control or reduce exacerbations or both. Fractional exhaled nitric oxide (FeNO) is a marker of eosinophilic inflammation, and as it is easy to measure, has an advantage over other measurements of eosinophilic inflammation (for example sputum eosinophils).<h4>Objectives</h4>To evaluate the efficacy of tailoring asthma interventions based on exhaled nitric oxide (FeNO), in comparison to not using FeNO, that is management based on clinical symptoms (with or without spirometry/peak flow) or asthma guidelines or both, for asthma-related outcomes in adults.<h4>Search methods</h4>We searched the Cochrane Airways Group Specialised Register of Trials, the Cochrane Central Register of Controlled Trials (CENTRAL), MEDLINE, EMBASE, and reference lists of articles. The last searches were undertaken in June 2016.<h4>Selection criteria</h4>All randomised controlled trials (RCTs) comparing adjustment of asthma medications based on exhaled nitric oxide levels compared to not using FeNO, that is management based on clinical symptoms (with or without spirometry/peak flow) or asthma guidelines or both.<h4>Data collection and analysis</h4>We reviewed results of searches against predetermined criteria for inclusion. We independently selected relevant studies in duplicate. Two review authors independently assessed trial quality and extracted data. We contacted study authors for further information, receiving responses from four.<h4>Main results</h4>We included seven adult studies; these studies differed in a variety of ways including definition of asthma exacerbations, FeNO cutoff levels used (15 to 35 ppb), the way in which FeNO was used to adjust therapy, and duration of study (4 to 12 months). Of 1700 randomised participants, 1546 completed the trials. The mean ages of the participants ranged from 28 to 54 years old. The inclusion criteria for the participants in each study varied, but all had a diagnosis of asthma and required asthma medications. In the meta-analysis, there was a significant difference in the primary outcome of asthma exacerbations between the groups, favouring the FeNO group. The number of people having one or more asthma exacerbations was significantly lower in the FeNO group compared to the control group (odds ratio (OR) 0.60, 95% confidence interval (CI) 0.43 to 0.84). The number needed to treat to benefit (NNTB) over 52 weeks was 12 (95% CI 8 to 32). Those in the FeNO group were also significantly more likely to have a lower exacerbation rate than the controls (rate ratio 0.59, 95% CI 0.45 to 0.77). However, we did not find a difference between the groups for exacerbations requiring hospitalisation (OR 0.14, 95% CI 0.01 to 2.67) or rescue oral corticosteroids (OR 0.86, 95% CI 0.50 to 1.48). There was also no significant difference between groups for any of the secondary outcomes (FEV<sub>1</sub>, FeNO levels, symptoms scores, or inhaled corticosteroid doses at final visit).We considered three included studies that had inadequate blinding to have a high risk of bias. However, when these studies were excluded from the meta-analysis, the difference between the groups for the primary outcomes (exacerbations) remained statistically significant. The GRADE quality of the evidence ranged from moderate (for the outcome 'exacerbations') to very low (for the outcome 'inhaled corticosteroid dose at final visit') based on the lack of blinding and statistical heterogeneity. Six of the seven studies were industry supported, but the company had no role in the study design or data analyses.<h4>Authors' conclusions</h4>With new studies included since the last version of this review, which included adults and children, this updated meta-analysis in adults with asthma showed that tailoring asthma medications based on FeNO levels (compared with primarily on clinical symptoms) decreased the frequency of asthma exacerbations but did not impact on day-to-day clinical symptoms, end-of-study FeNO levels, or inhaled corticosteroid dose. Thus, the universal use of FeNO to help guide therapy in adults with asthma cannot be advocated. As the main benefit shown in the studies in this review was a reduction in asthma exacerbations, the intervention may be most useful in adults who have frequent exacerbations. Further RCTs encompassing different asthma severity, ethnic groups in less affluent settings, and taking into account different FeNO cutoffs are required.

Also flagged:DJ-1infectionresponse tooxygenviral infectionmitochondria
Journal Article 2016-09-01 No Snippets Ghosh S, Mukherjee S, Sengupta N, Roy A, Dey D, Chakraborty S, Chattopadhyay D, Banerjee A, Basu A.
Show Full Abstract

Network analysis through graph theory provides a quantitative approach to characterize specific proteins and their constituent assemblies that underlie host-pathogen interactions. In the present study, graph theory was used to analyze the interactome designed out of 50 differentially expressing proteins from proteomic analysis of Chandipura Virus (CHPV, Family: Rhabdoviridae) infected mouse brain tissue to identify the primary candidates for intervention. Using the measure of degree centrality, that quantifies the connectedness of a single protein within a milieu of several other interacting proteins, DJ-1 was selected for further molecular validation. To elucidate the generality of DJ-1's role in propagating infection its role was also monitored in another RNA virus, Japanese Encephalitis Virus (JEV, Family: Flaviviridae) infection. Concurrently, DJ-1 got over-expressed in response to reactive oxygen species (ROS) generation following viral infection which in the early phase of infection migrated to mitochondria to remove dysfunctional mitochondria through the process of mitophagy. DJ-1 was also observed to modulate the viral replication and interferon responses along with low-density lipoprotein (LDL) receptor expression in neurons. Collectively these evidences reveal a comprehensive role for DJ-1 in neurotropic virus infection in the brain.

Also flagged:atrophyneurodegenerative diseaseHDbehaviouralbrain atrophyHdh
Journal Article 2016-09-01 ✓ 2 Snippets Steventon JJ, Trueman RC, Ma D, Yhnell E, Bayram-Weston Z, Modat M, Cardoso J, Ourselin S, Lythgoe M, Stewart A, Rosser AE, Jones DK.
In-Text Gene Mentions

…with diffuse mutantHttstaining from an…

…As mutantHttis expressed throughout…

Show Full Abstract

Huntington's disease (HD) is a genetically-determined neurodegenerative disease. Characterising neuropathology in mouse models of HD is commonly restricted to cross-sectional ex vivo analyses, beset by tissue fixation issues. In vivo longitudinal magnetic resonance imaging (MRI) allows for disease progression to be probed non-invasively. In the HdhQ150 mouse model of HD, in vivo MRI was employed at two time points, before and after the onset of motor signs, to assess brain macrostructure and white matter microstructure. Ex vivo MRI, immunohistochemistry, transmission electron microscopy and behavioural testing were also conducted. Global brain atrophy was found in HdhQ150 mice at both time points, with no neuropathological progression across time and a selective sparing of the cerebellum. In contrast, no white matter abnormalities were detected from the MRI images or electron microscopy images alike. The relationship between motor function and MR-based structural measurements was different for the HdhQ150 and wild-type mice, although there was no relationship between motor deficits and histopathology. Widespread neuropathology prior to symptom onset is consistent with patient studies, whereas the absence of white matter abnormalities conflicts with patient data. The myriad reasons for this inconsistency require further attention to improve the translatability from mouse models of disease.

Also flagged:Osteoporosismetabolic bone diseasebone resorptionZBTB40GPR177FGFRL1
Journal Article 2016-09-01 ✓ 1 Snippet Kitjaroentham A, Hananantachai H, Phonrat B, Preutthipan S, Tungtrongchitr R.
In-Text Gene Mentions

…, TNFRSF11B ,SOX6, LRP5 ,…

Show Full Abstract

<h4>Background</h4>Osteoporosis, characterized by low bone mineral density (BMD) and high bone fracture risk, is prevalent in Thai menopausal women. Genetic factors are known to play a key role in BMD. Low density lipoprotein receptor-related protein 5 (LRP5), a co-receptor in the Wnt/beta-catenin pathway, is involved in many aspects of bone biology. As coding single nucleotide polymorphisms (cSNPs) of LRP5, including A1330V (rs3736228), and Asian-related Q89R (rs41494349) and N740N (rs2306862), are associated with lowered BMD, this study aimed to determine the relationship between these LRP5 polymorphisms and BMD in 277 Thai menopausal women.<h4>Results</h4>Only rs3736228 deviated from the Hardy-Weinberg equilibrium of allele frequency (p = 0.022). The median, range and p value for the BMD related to each SNP parameter were compared (Mann-Whitney U test). Significant differences were observed between wild-type and risk alleles for both rs3736228 (total radial, p = 0.011; and radial 33, p = 0.001) and rs2306862 (radial 33: p = 0.015) SNPs, with no significant difference for rs41494349 SNP. Linkage disequilibrium was strong for both rs3736228 and rs2306862 SNPs. Haplotype analysis identified high CC frequency in both normal and osteopenia/osteoporosis groups, with a significant odds ratio for carrying the TT haplotype; however, this was non-significant after adjusting for age. Multivariate binary logistic regression analysis performed for rs3736228 showed that individuals with a body mass index <25 kg/m(2) had an increased risk of osteoporosis for each decade, but the polymorphism had no effect.<h4>Conclusions</h4>This study did not identify LRP5 polymorphisms as a risk factor for osteoporosis in Thai menopausal women. Further studies with larger sample sizes are needed to further clarify the role of LRP5 as a genetic determinant of osteoporosis.

Also flagged:Coronary Heart DiseaseAgingδ-aminolevulinic acid dehydrataseALADheme oxygenase-1HMOX1
Journal Article 2016-09-01 ✓ 5 Snippets Ding N, Wang X, Weisskopf MG, Sparrow D, Schwartz J, Hu H, Park SK.
In-Text Gene Mentions

We assessed possible effect modification by genetic polymorphisms in ALAD, HFE, HMOX1, VDR, GSTP1, GSTT1, GSTM1, APOE, AGTR1 and AGT individually and as the genetic risk score (GRS) on the association between cumulative lead exposure and incident coronary heart disease (CHD) events.

A number of genes and gene encoding proteins have been identified to play important roles in lead toxicokinetics and/or toxicodynamics: δ-aminolevulinic acid dehydratase (ALAD), an enzyme on the heme-biosynthetic pathway that binds over 80% of lead in erythrocytes [9]; hemochromatosis (HFE), a membrane protein that regulates uptake of cellular iron and other divalent metals including lead [10]; heme oxygenase-1 (HMOX1), a heme-degrading enzyme that plays an important role in the inflammation and oxidative stress induced by lead [11–14]; vitamin D receptor (VDR) that plays a role in calcium homeostasis that influences the absorption and retention of lead into blood and bone [15]; apolipoprotein E (APOE) that affects lipid metabolism, down-regulates blood lead concentrations, and possesses antioxidative property [16–18]; glutathione S-transferases (GSTs), a family of phase-II detoxification isozymes involved in catalyzing the conjugation of lead and glutathione to form a thermodynamically stable complex, which decreases lead bioavailability and protects against lead toxicity through reduced oxidative stress [19–22]; and the renin-angiotensin system involved in the development of hypertension where lead exposure may enhance blood angiotensin I levels by increasing plasma renin activity, which in turn contribute to production and activation of substrate-induced angiotensin converting enzyme [23,24].

Polymorphisms in the δ-aminolevulinic acid dehydratase (ALAD), hemochromatosis (HFE), heme oxygenase-1 (HMOX1), vitamin D receptor (VDR), glutathione S-transferase (GST) supergene family (GSTP1, GSTT1, GSTM1), apolipoprotein E (APOE),angiotensin II receptor-1 (AGTR1) and angiotensinogen (AGT) genes, are believed to alter toxicokinetics and/or toxicodynamics of lead.

S2 Table shows that genotype frequencies, and incident CHD events by ALAD, HFE, HMOX1, VDR, GSTP1, GSTT1, GSTM1, APOE, AGTR1, and AGT genotypes.

…( ALAD ),hemochromatosis( HFE ),…

Show Full Abstract

<h4>Background</h4>Cumulative exposure to lead is associated with cardiovascular outcomes. Polymorphisms in the δ-aminolevulinic acid dehydratase (ALAD), hemochromatosis (HFE), heme oxygenase-1 (HMOX1), vitamin D receptor (VDR), glutathione S-transferase (GST) supergene family (GSTP1, GSTT1, GSTM1), apolipoprotein E (APOE),angiotensin II receptor-1 (AGTR1) and angiotensinogen (AGT) genes, are believed to alter toxicokinetics and/or toxicodynamics of lead.<h4>Objectives</h4>We assessed possible effect modification by genetic polymorphisms in ALAD, HFE, HMOX1, VDR, GSTP1, GSTT1, GSTM1, APOE, AGTR1 and AGT individually and as the genetic risk score (GRS) on the association between cumulative lead exposure and incident coronary heart disease (CHD) events.<h4>Methods</h4>We used K-shell-X-ray fluorescence to measure bone lead levels. GRS was calculated on the basis of 22 lead-related loci. We constructed Cox proportional hazard models to compute adjusted hazard ratios (HRs) and 95% confidence intervals (CIs) for incident CHD. We applied inverse probability weighting to account for potential selection bias due to recruitment into the bone lead sub-study.<h4>Results</h4>Significant effect modification was found by VDR, HMOX1, GSTP1, APOE, and AGT genetic polymorphisms when evaluated individually. Further, the bone lead-CHD associations became larger as GRS increases. After adjusting for potential confounders, a HR of CHD was 2.27 (95%CI: 1.50-3.42) with 2-fold increase in patella lead levels, among participants in the top tertile of GRS. We also detected an increasing trend in HRs across tertiles of GRS (p-trend = 0.0063).<h4>Conclusions</h4>Our findings suggest that lead-related loci as a whole may play an important role in susceptibility to lead-related CHD risk. These findings need to be validated in a separate cohort containing bone lead, lead-related genetic loci and incident CHD data.

Also flagged:cell proliferationCdkn2atranscription factorsPRCChromatinPRC 2
Journal Article 2016-09-01 ✓ 1 Snippet Chiacchiera F, Rossi A, Jammula S, Zanotti M, Pasini D.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Chromatin modifications shape cell heterogeneity by activating and repressing defined sets of genes involved in cell proliferation, differentiation and development. Polycomb-repressive complexes (PRCs) act synergistically during development and differentiation by maintaining transcriptional repression of common genes. PRC2 exerts this activity by catalysing H3K27 trimethylation. Here, we show that in the intestinal epithelium PRC2 is required to sustain progenitor cell proliferation and the correct balance between secretory and absorptive lineage differentiation programs. Using genetic models, we show that PRC2 activity is largely dispensable for intestinal stem cell maintenance but is strictly required for radiation-induced regeneration by preventing Cdkn2a transcription. Combining these models with genomewide molecular analysis, we further demonstrate that preferential accumulation of secretory cells does not result from impaired proliferation of progenitor cells induced by Cdkn2a activation but rather from direct regulation of transcription factors responsible for secretory lineage commitment. Overall, our data uncover a dual role of PRC2 in intestinal homeostasis highlighting the importance of this repressive layer in controlling cell plasticity and lineage choices in adult tissues.

Also flagged:cancertumorstumorcolorectal tumorsendometrial cancerscancers
Journal Article 2016-09-01 ✓ 1 Snippet Leiserson MD, Reyna MA, Raphael BJ.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<h4>Motivation</h4>The somatic mutations in the pathways that drive cancer development tend to be mutually exclusive across tumors, providing a signal for distinguishing driver mutations from a larger number of random passenger mutations. This mutual exclusivity signal can be confounded by high and highly variable mutation rates across a cohort of samples. Current statistical tests for exclusivity that incorporate both per-gene and per-sample mutational frequencies are computationally expensive and have limited precision.<h4>Results</h4>We formulate a weighted exact test for assessing the significance of mutual exclusivity in an arbitrary number of mutational events. Our test conditions on the number of samples with a mutation as well as per-event, per-sample mutation probabilities. We provide a recursive formula to compute P-values for the weighted test exactly as well as a highly accurate and efficient saddlepoint approximation of the test. We use our test to approximate a commonly used permutation test for exclusivity that conditions on per-event, per-sample mutation frequencies. However, our test is more efficient and it recovers more significant results than the permutation test. We use our Weighted Exclusivity Test (WExT) software to analyze hundreds of colorectal and endometrial samples from The Cancer Genome Atlas, which are two cancer types that often have extremely high mutation rates. On both cancer types, the weighted test identifies sets of mutually exclusive mutations in cancer genes with fewer false positives than earlier approaches.<h4>Availability and implementation</h4>See http://compbio.cs.brown.edu/projects/wext for software.<h4>Contact</h4>braphael@cs.brown.edu<h4>Supplementary information</h4>Supplementary data are available at Bioinformatics online.

Also flagged:gene expressionTissuedeathSFTPA1SFTPA2SFTPC
Journal Article 2016-09-01 ✓ 1 Snippet McCall MN, Illei PB, Halushka MK.
In-Text Gene Mentions

DNAH10

Show Full Abstract

The sources of gene expression variability in human tissues are thought to be a complex interplay of technical, compositional, and disease-related factors. To better understand these contributions, we investigated expression variability in a relatively homogeneous tissue expression dataset from the Genotype-Tissue Expression (GTEx) resource. In addition to identifying technical sources, such as sequencing date and post-mortem interval, we also identified several biological sources of variation. An in-depth analysis of the 175 genes with the greatest variation among 133 lung tissue samples identified five distinct clusters of highly correlated genes. One large cluster included surfactant genes (SFTPA1, SFTPA2, and SFTPC), which are expressed exclusively in type II pneumocytes, cells that proliferate in ventilator associated lung injury. High surfactant expression was strongly associated with death on a ventilator and type II pneumocyte hyperplasia. A second large cluster included dynein (DNAH9 and DNAH12) and mucin (MUC5B and MUC16) genes, which are exclusive to the respiratory epithelium and goblet cells of bronchial structures. This indicates heterogeneous bronchiole sampling due to the harvesting location in the lung. A small cluster included acute-phase reactant genes (SAA1, SAA2, and SAA2-SAA4). The final two small clusters were technical and gender related. To summarize, in a collection of normal lung samples, we found that tissue heterogeneity caused by harvesting location (medial or lateral lung) and late therapeutic intervention (mechanical ventilation) were major contributors to expression variation. These unexpected sources of variation were the result of altered cell ratios in the tissue samples, an underappreciated source of expression variation.

Also flagged:solid tumorsoncogenegrowth arrestchildhoodsarcomaAlveolar Rhabdomyosarcoma
Journal Article 2016-09-01 No Snippets Loupe JM, Miller PJ, Bonner BP, Maggi EC, Vijayaraghavan J, Zabaleta J, Taylor CM, Tsien F, Crabtree JS, Hollenbach AD.
Show Full Abstract

While many solid tumors are defined by the presence of a particular oncogene, the role that this oncogene plays in driving transformation through the acquisition of aneuploidy and overcoming growth arrest are often not known. Further, although aneuploidy is present in many solid tumors, it is not clear whether it is the cause or effect of malignant transformation. The childhood sarcoma, Alveolar Rhabdomyosarcoma (ARMS), is primarily defined by the t(2;13)(q35;q14) translocation, creating the PAX3-FOXO1 fusion protein. It is unclear what role PAX3-FOXO1 plays in the initial stages of tumor development through the acquisition and persistence of aneuploidy. In this study we demonstrate that PAX3-FOXO1 serves as a driver mutation to initiate a cascade of mRNA and miRNA changes that ultimately reprogram proliferating myoblasts to induce the formation of ARMS. We present evidence that cells containing PAX3-FOXO1 have changes in the expression of mRNA and miRNA essential for maintaining proper chromosome number and structure thereby promoting aneuploidy. Further, we demonstrate that the presence of PAX3-FOXO1 alters the expression of growth factor related mRNA and miRNA, thereby overriding aneuploid-dependent growth arrest. Finally, we present evidence that phosphorylation of PAX3-FOXO1 contributes to these changes. This is one of the first studies describing how an oncogene and post-translational modifications drive the development of a tumor through the acquisition and persistence of aneuploidy. This mechanism has implications for other solid tumors where large-scale genomics studies may elucidate how global alterations contribute to tumor phenotypes allowing the development of much needed multi-faceted tumor-specific therapeutic regimens.

Also flagged:nucleotidetranslationalhydatidiform moleamino acidpost-translational modificationsmitochondrial
Journal Article 2016-09-01 ✓ 1 Snippet Shirota M, Kinoshita K.
In-Text Gene Mentions

…, BCL6B ,HTTand IGFBP2 genes.…

Show Full Abstract

The protein coding sequences of the human reference genome GRCh38, RefSeq mRNA and UniProt protein databases are sometimes inconsistent with each other, due to polymorphisms in the human population, but the overall landscape of the discordant sequences has not been clarified. In this study, we comprehensively listed the discordant bases and regions between the GRCh38, RefSeq and UniProt reference sequences, based on the genomic coordinates of GRCh38. We observed that the RefSeq sequences are more likely to represent the major alleles than GRCh38 and UniProt, by assigning the alternative allele frequencies of the discordant bases. Since some reference sequences have minor alleles, functional and structural annotations may be performed based on rare alleles in the human population, thereby biasing these analyses. Some of the differences between the RefSeq and GRCh38 account for biological differences due to known RNA-editing sites. The definitions of the coding regions are frequently complicated by possible micro-exons within introns and by SNVs with large alternative allele frequencies near exon-intron boundaries. The mRNA or protein regions missing from GRCh38 were mainly due to small deletions, and these sequences need to be identified. Taken together, our results clarify overall consistency and remaining inconsistency between the reference sequences.

Also flagged:transcription factorscytoplasmtranscription factorMyoDC/EBPαcell differentiation
Journal Article 2016-09-01 ✓ 1 Snippet Srivastava D, DeWitt N.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

Cellular reprogramming technology has created new opportunities in understanding human disease, drug discovery, and regenerative medicine. While a combinatorial code was initially found to reprogram somatic cells to pluripotency, a "second generation" of cellular reprogramming involves lineage-restricted transcription factors and microRNAs that directly reprogram one somatic cell to another. This technology was enabled by gene networks active during development, which induce global shifts in the epigenetic landscape driving cell fate decisions. A major utility of direct reprogramming is the potential of harnessing resident support cells within damaged organs to regenerate lost tissue by converting them into the desired cell type in situ. Here, we review the progress in direct cellular reprogramming, with a focus on the paradigm of in vivo reprogramming for regenerative medicine, while pointing to hurdles that must be overcome to translate this technology into future therapeutics.

Also flagged:cancertumorzincmetabolismGata-3zinc-finger transcription factor
Journal Article 2016-09-01 ✓ 1 Snippet Singer M, Wang C, Cong L, Marjanovic ND, Kowalczyk MS, Zhang H, Nyman J, Sakuishi K, Kurtulus S, Gennert D, Xia J, Kwon JYH, Nevin J, Herbst RH, Yanai I, Rozenblatt-Rosen O, Kuchroo VK, Regev A, Anderson AC.
In-Text Gene Mentions

SUDS3

Show Full Abstract

Reversing the dysfunctional T cell state that arises in cancer and chronic viral infections is the focus of therapeutic interventions; however, current therapies are effective in only some patients and some tumor types. To gain a deeper molecular understanding of the dysfunctional T cell state, we analyzed population and single-cell RNA profiles of CD8(+) tumor-infiltrating lymphocytes (TILs) and used genetic perturbations to identify a distinct gene module for T cell dysfunction that can be uncoupled from T cell activation. This distinct dysfunction module is downstream of intracellular metallothioneins that regulate zinc metabolism and can be identified at single-cell resolution. We further identify Gata-3, a zinc-finger transcription factor in the dysfunctional module, as a regulator of dysfunction, and we use CRISPR-Cas9 genome editing to show that it drives a dysfunctional phenotype in CD8(+) TILs. Our results open novel avenues for targeting dysfunctional T cell states while leaving activation programs intact.

Also flagged:LipidBiosynthesismetabolismresponse to protein-folding stressmitochondriacytosol
Journal Article 2016-09-01 ✓ 1 Snippet Kim HE, Grant AR, Simic MS, Kohnz RA, Nomura DK, Durieux J, Riera CE, Sanchez M, Kapernick E, Wolff S, Dillin A.
In-Text Gene Mentions

Htt

Show Full Abstract

Defects in mitochondrial metabolism have been increasingly linked with age-onset protein-misfolding diseases such as Alzheimer's, Parkinson's, and Huntington's. In response to protein-folding stress, compartment-specific unfolded protein responses (UPRs) within the ER, mitochondria, and cytosol work in parallel to ensure cellular protein homeostasis. While perturbation of individual compartments can make other compartments more susceptible to protein stress, the cellular conditions that trigger cross-communication between the individual UPRs remain poorly understood. We have uncovered a conserved, robust mechanism linking mitochondrial protein homeostasis and the cytosolic folding environment through changes in lipid homeostasis. Metabolic restructuring caused by mitochondrial stress or small-molecule activators trigger changes in gene expression coordinated uniquely by both the mitochondrial and cytosolic UPRs, protecting the cell from disease-associated proteins. Our data suggest an intricate and unique system of communication between UPRs in response to metabolic changes that could unveil new targets for diseases of protein misfolding.

Also flagged:metabolismmitochondrialmitochondriavesiclesecretionserotonin
Journal Article 2016-09-01 ✓ 1 Snippet Berendzen KM, Durieux J, Shao LW, Tian Y, Kim HE, Wolff S, Liu Y, Dillin A.
In-Text Gene Mentions

Htt

Show Full Abstract

During neurodegenerative disease, the toxic accumulation of aggregates and misfolded proteins is often accompanied with widespread changes in peripheral metabolism, even in cells in which the aggregating protein is not present. The mechanism by which the central nervous system elicits a distal reaction to proteotoxic stress remains unknown. We hypothesized that the endocrine communication of neuronal stress plays a causative role in the changes in mitochondrial homeostasis associated with proteotoxic disease states. We find that an aggregation-prone protein expressed in the neurons of C. elegans binds to mitochondria, eliciting a global induction of a mitochondrial-specific unfolded protein response (UPR(mt)), affecting whole-animal physiology. Importantly, dense core vesicle release and secretion of the neurotransmitter serotonin is required for the signal's propagation. Collectively, these data suggest the commandeering of a nutrient sensing network to allow for cell-to-cell communication between mitochondria in response to protein folding stress in the nervous system.

Also flagged:diabetesprediabetesDiabetes mellitusType 2 diabetesobesitycarbohydrate
Journal Article 2016-09-01 ✓ 1 Snippet Erickson M, Braun K, List R, Utech A, Moore C, White DL, Garcia JM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>Evaluate the effectiveness of nutrition education interventions for diabetes prevention.<h4>Design</h4>Retrospective cohort design.<h4>Setting</h4>Tertiary-care US Veterans' Hospital, July 2007 to July 2012, using pre-existing database.<h4>Participants</h4>Prediabetic, adult veterans (n = 372), mostly men (94.4%, n = 351).<h4>Interventions</h4>Visits with existing nutrition education classes were collected.<h4>Main outcome measures</h4><h4>Primary outcome</h4>diabetes status; predictors: visits/encounters, age, body mass index, weight change, and hemoglobin A1c.<h4>Analysis</h4>Cox proportional hazards method, χ(2) test, and logistic regression.<h4>Results</h4>In this sample, prediabetic veterans who received nutrition education were less likely to develop diabetes when compared with prediabetic veterans who did not receive nutrition education (hazard ratio, 0.71; 95% confidence interval, 0.55-0.92; P < .01). This difference remained significant after adjusting for body mass index and weight change.<h4>Conclusions and implications</h4>Nutrition education was significantly associated with preventing the progression from prediabetes to diabetes in US Veterans participating in a nutrition education intervention at the Michael E. DeBakey Veterans Affairs Medical Center.

Also flagged:lactationyouMebendazoleparasitic infectionsnematode infectionscytoplasmic
Journal Article 2016-09-01 No Snippets Karra N, Cohen R, Berlin M, Dinavitser N, Koren G, Berkovitch M.
Show Full Abstract

<h4>Introduction</h4>Mebendazole is an effective drug widely used in the treatment of parasitic infections. Although theoretically considered as safe during lactation, no studies have evaluated its potential adverse effects in infants of breastfeeding mothers.<h4>Objectives</h4>We aimed to evaluate the safety of mebendazole in infants of lactating women treated with the drug.<h4>Methods</h4>Women referred for consultation regarding mebendazole use were invited to participate in the study. Overall 45 lactating women treated with various protocols of mebendazole were recruited in this case series study.<h4>Results</h4>Regardless of the treatment protocol used (single or repeated doses) mebendazole was well tolerated and was not associated with any adverse effects in infants of lactating mothers. There was mild GI irritability in two treated women.<h4>Conclusion</h4>This study provides first evidence in humans as to the safety of mebendazole in breastfeeding.

Also flagged:lipidbindingBGextracellularimmunoglobulincysteines
Journal Article 2016-09-01 No Snippets Chattaway J, Ramirez-Valdez RA, Chappell PE, Caesar JJ, Lea SM, Kaufman J.
Show Full Abstract

Mammalian butyrophilins have various important functions, one for lipid binding but others as ligands for co-inhibition of αβ T cells or for stimulation of γδ T cells in the immune system. The chicken BG homologues are dimers, with extracellular immunoglobulin variable (V) domains joined by cysteines in the loop equivalent to complementarity-determining region 1 (CDR1). BG genes are found in three genomic locations: BG0 on chromosome 2, BG1 in the classical MHC (the BF-BL region) and many BG genes in the BG region just outside the MHC. Here, we show that BG0 is virtually monomorphic, suggesting housekeeping function(s) consonant with the ubiquitous tissue distribution. BG1 has allelic polymorphism but minimal sequence diversity, with the few polymorphic residues at the interface of the two V domains, suggesting that BG1 is recognized by receptors in a conserved fashion. Any phenotypic variation should be due to the intracellular region, with differential exon usage between alleles. BG genes in the BG region can generate diversity by exchange of sequence cassettes located in loops equivalent to CDR1 and CDR2, consonant with recognition of many ligands or antigens for immune defence. Unlike the mammalian butyrophilins, there are at least three modes by which BG genes evolve.

Also flagged:TRIM9Netrin-1Neuronal Morphogenesis
Journal Article 2016-09-01 No Snippets Aiken J, Buscaglia G.
Show Full Abstract

No abstract available.

Also flagged:JNKaxonsaxonSte20-related protein kinaseRac-type GTPasenonreceptor tyrosine kinase
Journal Article 2016-09-01 ✓ 1 Snippet Pastuhov SI, Fujiki K, Tsuge A, Asai K, Ishikawa S, Hirose K, Matsumoto K, Hisamoto N.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Unlabelled</h4>The mechanisms that govern the ability of specific neurons to regenerate their axons after injury are not well understood. In Caenorhabditis elegans, the initiation of axon regeneration is positively regulated by the JNK-MAPK pathway. In this study, we identify two components functioning upstream of the JNK pathway: the Ste20-related protein kinase MAX-2 and the Rac-type GTPase CED-10. CED-10, when bound by GTP, interacts with MAX-2 and functions as its upstream regulator in axon regeneration. CED-10, in turn, is activated by axon injury via signals initiated from the integrin α-subunit INA-1 and the nonreceptor tyrosine kinase SRC-1 and transmitted via the signaling module CED-2/CrkII-CED-5/Dock180-CED-12/ELMO. This module is also known to regulate the engulfment of apoptotic cells during development. Our findings thus reveal that the molecular machinery used for engulfment of apoptotic cells also promotes axon regeneration through activation of the JNK pathway.<h4>Significance statement</h4>The molecular mechanisms of axon regeneration after injury remain poorly understood. In Caenorhabditis elegans, the initiation of axon regeneration is positively regulated by the JNK-MAPK pathway. In this study, we show that integrin, Rac-GTPase, and several other molecules, all of which are known to regulate engulfment of apoptotic cells during development, also regulate axon regeneration. This signaling module activates the JNK-MAPK cascade via MAX-2, a PAK-like protein kinase that binds Rac. Our findings thus reveal that the molecular machinery used for engulfment of apoptotic cells also promotes axon regeneration through activation of the JNK pathway.

Also flagged:InterferonIFNindoleamine 2,3-dioxygenase 1IDO1TRIM56IFNα
Journal Article 2016-09-01 ✓ 5 Snippets Kane M, Zang TM, Rihn SJ, Zhang F, Kueck T, Alim M, Schoggins J, Rice CM, Wilson SJ, Bieniasz PD.
In-Text Gene Mentions

Both human and macaque variants of TRIM38 conferred substantial protection against infection with HIV-1, HIV-2, and SIVmac when expressed in THP-1 cells (5- to 10-fold), but not in MT4 cells (Figures 1, S1, S2, and S3).

…TLR7, IRF7, TRIM5,TRIM38, MYD88, IL1R, LGALS9,…

…An example wasTRIM38, whose expression activated…

…macaque variants ofTRIM38conferred substantial protecti…

…findings suggest thatTRIM38may participate in…

Show Full Abstract

Interferons (IFNs) exert their anti-viral effects by inducing the expression of hundreds of IFN-stimulated genes (ISGs). The activity of known ISGs is insufficient to account for the antiretroviral effects of IFN, suggesting that ISGs with antiretroviral activity are yet to be described. We constructed an arrayed library of ISGs from rhesus macaques and tested the ability of hundreds of individual macaque and human ISGs to inhibit early and late replication steps for 11 members of the retroviridae from various host species. These screens uncovered numerous ISGs with antiretroviral activity at both the early and late stages of virus replication. Detailed analyses of two antiretroviral ISGs indicate that indoleamine 2,3-dioxygenase 1 (IDO1) can inhibit retroviral replication by metabolite depletion while tripartite motif-56 (TRIM56) accentuates ISG induction by IFNα and inhibits the expression of late HIV-1 genes. Overall, these studies reveal numerous host proteins that mediate the antiretroviral activity of IFNs.

Also flagged:Thyroid noduleendocrine diseasesthyroid nodulesthyroid coldmalignantthyroid cold nodule
Journal Article 2016-09-01 ✓ 1 Snippet Wiyanto J, Kartamihardja AH, Nugrahadi T.
In-Text Gene Mentions

…(including amyloid orhemochromatosis), or nonthyroid neoplasms.…

Show Full Abstract

Thyroid nodule is one of the most common endocrine diseases in the world; it occurs in 4-7% of the general population. Depending on the method of discovery, 4-8% nodules are discovered using palpation, 10-41% with ultrasound (US), and 50% through autopsy where only 20% or less of cold thyroid nodules are caused by cancerous lesions. The aim of this study was to assess US as supporting modality for thyroid scintigraphy to predict malignancy in patient with thyroid cold nodules. In a retrospective study between 2009 and 2013, we analyzed 399 subjects with cold thyroid nodule, where 39 subjects (36 women and 3 men) presented with malignant thyroid cold nodule and 19 subjects underwent US. The US showed malignancy parameters in 8 (42.11%) subjects, while the rest of the 11 (57.89%) subject were benign. Out of all the subjects who underwent US in this study, only 8 (42.11%) subjects shown malignancy characteristics in cold thyroid nodule with papillary thyroid cancer (PTC). That means US parameters of malignant thyroid nodule do not always show up in malignant cold thyroid nodule.

Also flagged:B cell CLL/lymphoma 11ABCL11Atranscription factorsickle cell diseasethalassemiaB lymphopoiesis
Journal Article 2016-09-01 ✓ 1 Snippet Luc S, Huang J, McEldoon JL, Somuncular E, Li D, Rhodes C, Mamoor S, Hou S, Xu J, Orkin SH.
In-Text Gene Mentions

SOX6

Show Full Abstract

B cell CLL/lymphoma 11A (BCL11A) is a transcription factor and regulator of hemoglobin switching that has emerged as a promising therapeutic target for sickle cell disease and thalassemia. In the hematopoietic system, BCL11A is required for B lymphopoiesis, yet its role in other hematopoietic cells, especially hematopoietic stem cells (HSCs) remains elusive. The extensive expression of BCL11A in hematopoiesis implicates context-dependent roles, highlighting the importance of fully characterizing its function as part of ongoing efforts for stem cell therapy and regenerative medicine. Here, we demonstrate that BCL11A is indispensable for normal HSC function. Bcl11a deficiency results in HSC defects, typically observed in the aging hematopoietic system. We find that downregulation of cyclin-dependent kinase 6 (Cdk6), and the ensuing cell-cycle delay, correlate with HSC dysfunction. Our studies define a mechanism for BCL11A in regulation of HSC function and have important implications for the design of therapeutic approaches to targeting BCL11A.

Also flagged:NKX2-1transcription factorschromatingene expressiontranscription factorLHX6
Journal Article 2016-09-01 ✓ 1 Snippet Sandberg M, Flandin P, Silberberg S, Su-Feher L, Price JD, Hu JS, Kim C, Visel A, Nord AS, Rubenstein JLR.
In-Text Gene Mentions

Sox6

Show Full Abstract

The embryonic basal ganglia generates multiple projection neurons and interneuron subtypes from distinct progenitor domains. Combinatorial interactions of transcription factors and chromatin are thought to regulate gene expression. In the medial ganglionic eminence, the NKX2-1 transcription factor controls regional identity and, with LHX6, is necessary to specify pallidal projection neurons and forebrain interneurons. Here, we dissected the molecular functions of NKX2-1 by defining its chromosomal binding, regulation of gene expression, and epigenetic state. NKX2-1 binding at distal regulatory elements led to a repressed epigenetic state and transcriptional repression in the ventricular zone. Conversely, NKX2-1 is required to establish a permissive chromatin state and transcriptional activation in the sub-ventricular and mantle zones. Moreover, combinatorial binding of NKX2-1 and LHX6 promotes transcriptionally permissive chromatin and activates genes expressed in cortical migrating interneurons. Our integrated approach provides a foundation for elucidating transcriptional networks guiding the development of the MGE and its descendants.

Also flagged:Bone morphogenetic protein-2intervertebral disc degenerationcytokineBMP-2synthesisextracellular
Journal Article 2016-09-01 ✓ 5 Snippets Ye S, Ju B, Wang H, Lee KB.
In-Text Gene Mentions

Treatment with IL-18 and BMP-2 on NP and AF cells resulted in increased aggrecan, type II collagen, and SOX6 transcript expression and increased aggrecan and type II collagen protein expression relative to treatment with IL-18 alone.

In addition, transcript levels of SOX6 decreased significantly in NP and AF cells after treatment with IL-18 for 12 hours.

…type II collagen,SOX6, and matrix metalloproteinase…

…II collagen, andSOX6at 24 hours,…

…II collagen, andSOX6, resulting in reversal…

Show Full Abstract

<h4>Objectives</h4>Interleukin 18 (IL-18) is a regulatory cytokine that degrades the disc matrix. Bone morphogenetic protein-2 (BMP-2) stimulates synthesis of the disc extracellular matrix. However, the combined effects of BMP-2 and IL-18 on human intervertebral disc degeneration have not previously been reported. The aim of this study was to investigate the effects of the anabolic cytokine BMP-2 and the catabolic cytokine IL-18 on human nucleus pulposus (NP) and annulus fibrosus (AF) cells and, therefore, to identify potential therapeutic and clinical benefits of recombinant human (rh)BMP-2 in intervertebral disc degeneration.<h4>Methods</h4>Levels of IL-18 were measured in the blood of patients with intervertebral disc degenerative disease and in control patients. Human NP and AF cells were cultured in a NP cell medium and treated with IL-18 or IL-18 plus BMP-2. mRNA levels of target genes were measured by real-time polymerase chain reaction, and protein levels of aggrecan, type II collagen, SOX6, and matrix metalloproteinase 13 (MMP13) were assessed by western blot analysis.<h4>Results</h4>The serum level of patients (IL-18) increased significantly with the grade of IVD degeneration. There was a dramatic alteration in IL-18 level between the advanced degeneration (Grade III to V) group and the normal group (p = 0.008) Furthermore, IL-18 induced upregulation of the catabolic regulator MMP13 and downregulation of the anabolic regulators aggrecan, type II collagen, and SOX6 at 24 hours, contributing to degradation of disc matrix enzymes. However, BMP-2 antagonised the IL-18 induced upregulation of aggrecan, type II collagen, and SOX6, resulting in reversal of IL-18 mediated disc degeneration.<h4>Conclusions</h4>BMP-2 is anti-catabolic in human NP and AF cells, and its effects are partially mediated through provocation of the catabolic effect of IL-18. These findings indicate that BMP-2 may be a unique therapeutic option for prevention and reversal of disc degeneration.Cite this article: S. Ye, B. Ju, H. Wang, K-B. Lee. Bone morphogenetic protein-2 provokes interleukin-18-induced human intervertebral disc degeneration. Bone Joint Res 2016;5:412-418. DOI: 10.1302/2046-3758.59.BJR-2016-0032.R1.

Also flagged:AKR1B10hepatocellular carcinomaaldo-keto reductase family 1 member B10chronic hepatitis Cinterferonalanine aminotransferase
Journal Article 2016-09-01 ✓ 1 Snippet Murata A, Genda T, Ichida T, Amano N, Sato S, Tsuzura H, Sato S, Narita Y, Kanemitsu Y, Shimada Y, Hirano K, Iijima K, Wada R, Nagahara A, Watanabe S.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, and Wilson’s disease);…

Show Full Abstract

<h4>Aim</h4>To clarify the association between aldo-keto reductase family 1 member B10 (AKR1B10) expression and hepatocarcinogenesis after hepatitis C virus eradication.<h4>Methods</h4>In this study, we enrolled 303 chronic hepatitis C patients who had achieved sustained virological response (SVR) through interferon-based antiviral therapy. Pretreatment AKR1B10 expression in the liver was immunohistochemically assessed and quantified as a percentage of positive staining area by using image-analysis software. A multivariate Cox analysis was used to estimate the hazard ratios (HRs) of AKR1B10 expression for hepatocellular carcinoma (HCC) development after achieving SVR. The cumulative incidences of HCC development were evaluated using Kaplan-Meier analysis and the log-rank test.<h4>Results</h4>Of the 303 chronic hepatitis C patients, 153 (50.5%) showed scarce hepatic AKR1B10 expression, quantified as 0%, which was similar to the expression in control normal liver tissues. However, the remaining 150 patients (49.5%) exhibited various degrees of AKR1B10 expression in the liver, with a maximal AKR1B10 expression of 73%. During the median follow-up time of 3.6 years (range 1.0-10.0 years), 8/303 patients developed HCC. Multivariate analysis revealed that only high AKR1B10 expression (≥ 8%) was an independent risk factor for HCC development (HR = 15.4, 95%CI: 1.8-132.5, P = 0.012). The 5-year cumulative incidences of HCC development were 13.7% and 0.5% in patients with high and low AKR1B10 expression, respectively (P < 0.001). During the follow-up period after viral eradication, patients expressing high levels of AKR1B10 expressed markedly higher levels of alanine aminotransferase and α-fetoprotein than did patients exhibiting low AKR1B10 expression.<h4>Conclusion</h4>Chronic hepatitis C patients expressing high levels of hepatic AKR1B10 had an increased risk of HCC development even after SVR.

Also flagged:failuretranscription factorFoxP3cancerimmunologic responseimmune responses
Journal Article 2016-09-01 No Snippets Baroja-Mazo A, Revilla-Nuin B, Parrilla P, Martínez-Alarcón L, Ramírez P, Pons JA.
Show Full Abstract

Transplantation is the optimal treatment for end-stage organ failure, and modern immunosuppression has allowed important progress in short-term outcomes. However, immunosuppression poorly influences chronic rejection and elicits chronic toxicity in current clinical practice. Thus, a major goal in transplantation is to understand and induce tolerance. It is well established that human regulatory T cells expressing the transcription factor FoxP3 play important roles in the maintenance of immunological self-tolerance and immune homeostasis. The major regulatory T cell subsets and mechanisms of expansion that are critical for induction and long-term maintenance of graft tolerance and survival are being actively investigated. Likewise, other immune cells, such as dendritic cells, monocyte/macrophages or natural killer cells, have been described as part of the process known as "operational tolerance". However, translation of these results towards clinical practice needs solid tools to identify accurately and reliably patients who are going to be tolerant. In this way, a plethora of genetic and cellular biomarkers is raising and being validated worldwide in large multi-center clinical trials. Few of the studies performed so far have provided a detailed analysis of the impact of immunosuppression withdrawal on pre-existing complications derived from the long-term administration of immunosuppressive drugs and the side effects associated with them. The future of liver transplantation is aimed to develop new therapies which increase the actual low tolerant vs non-tolerant recipients ratio.

Also flagged:AtorvastatininsulinsynthesisRasRafERK
Journal Article 2016-09-01 No Snippets Sun H, Li Y, Sun B, Hou N, Yang J, Zheng M, Xu J, Wang J, Zhang Y, Zeng X, Shan C, Chang B, Chen L, Chang B.
Show Full Abstract

<h4>Backround</h4>Type 2 diabetes has become a global epidemic disease. Atorvastatin has become a cornerstone in the prevention and treatment of atherosclerosis. However, increasing evidence showed that statins can dose-dependently increase the risk of diabetes mellitus. The mechanism is not clear.<h4>Objective</h4>The Ras complex pathway (Ras/Raf/extracellular signal-regulated kinase [ERK]/cAMP response element-binding protein [CREB]) is the major pathway that regulates the gene transcription. Except for the inhibition of cholesterol synthesis by inhibiting the 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-COA) reductase, statins can also downregulate the phosphorylation of a series of downstream substrates including the key proteins of the Ras complex pathway, therefore may inhibit the insulin syntheses in pancreatic beta cells. In our study, we investigated the inhibitory effect and the underlying mechanism of atorvastatin on insulin synthesis in rat islets.<h4>Methods</h4>Islets were isolated from Wistar rats and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium. The insulin content in the medium was measured by radioimmunoassay before and after the treatment of 50 μM atorvastatin. Effect of atorvastatin on the expression of insulin message Ribonucleic acid (mRNA) in pancreatic islet beta cells was also detected using quantitative real-time polymerase chain reaction. Western blotting was used to explore the possible role of the Ras complex pathway (Ras/Raf/ERK/CREB) in atorvastatin-inhibited insulin synthesis. The effects of atorvastatin on the binding of nuclear transcription factor p-CREB with CRE in INS-1 cells were examined via chromatin immunoprecipitation assay.<h4>Results</h4>Compared with the control group, the insulin level decreased by 27.1% at 24 hours after atorvastatin treatment. Atorvastatin inhibited insulin synthesis by decreasing insulin mRNA expression of pancreatic islet beta cells. The activities of Ras, Raf-1, and p-CREB in the Ras complex pathway were inhibited by 50 μM atorvastatin in INS-1 cells in vitro. Moreover, 50 μM atorvastatin reduced the binding of p-CREB with deoxyribonucleic acid (DNA) in INS-1 cells in vitro.<h4>Conclusion</h4>Atorvastatin inhibits insulin synthesis in beta cells by inhibiting the activation of the Ras complex pathway.

Also flagged:Ironnon-alcoholic fatty liver diseaseNAFLDpathogenesisinsulin resistancemetabolism
Journal Article 2016-09-01 ✓ 5 Snippets Britton LJ, Subramaniam VN, Crawford DH.
In-Text Gene Mentions

This usually results from homozygous p.C282Y mutation of HFE (HFE-hemochromatosis)[79].

Iron-related genetic polymorphisms, such as those of the HFE gene, may contribute to NAFLD pathogenesis, although it would appear that, other than for individuals with hereditary hemochromatosis, the effect of these polymorphisms, is likely to be small.

To date, the majority of studies have focussed mainly on the role of hepatic iron and mutations in the HFE gene, the gene mutated in type 1 hereditary hemochromatosis.

The issue concerning the effect of heterozygous mutations in progression to NASH was highlighted by an analysis of HFE mutations within the NASH CRN cohort[85].

Other more mild iron loading phenotypes such as heterozygous HFE gene mutations and polymorphisms of TMPRSS6 may have disease modifying roles in NAFLD, although their effect is likely to be small.

Show Full Abstract

The mechanisms that promote liver injury in non-alcoholic fatty liver disease (NAFLD) are yet to be thoroughly elucidated. As such, effective treatment strategies are lacking and novel therapeutic targets are required. Iron has been widely implicated in the pathogenesis of NAFLD and represents a potential target for treatment. Relationships between serum ferritin concentration and NAFLD are noted in a majority of studies, although serum ferritin is an imprecise measure of iron loading. Numerous mechanisms for a pathogenic role of hepatic iron in NAFLD have been demonstrated in animal and cell culture models. However, the human data linking hepatic iron to liver injury in NAFLD is less clear, with seemingly conflicting evidence, supporting either an effect of iron in hepatocytes or within reticulo-endothelial cells. Adipose tissue has emerged as a key site at which iron may have a pathogenic role in NAFLD. Evidence for this comes indirectly from studies that have evaluated the role of adipose tissue iron with respect to insulin resistance. Adding further complexity, multiple strands of evidence support an effect of NAFLD itself on iron metabolism. In this review, we summarise the human and basic science data that has evaluated the role of iron in NAFLD pathogenesis.

Also flagged:agingage-related diseasescardiolipin transporterAtp8b1cardiolipinmetabolism
Journal Article 2016-09-01 ✓ 2 Snippets Soundararajan R, Stearns TM, Czachor A, Fukumoto J, Turn C, Westermann-Clark E, Breitzig M, Tan L, Lockey RF, King BL, Kolliputi N.
In-Text Gene Mentions

…Another anti-oxidant gene,Prdx6encoding peroxiredoxin 6,…

PRDX6protein is involved…

Show Full Abstract

<h4>Objective</h4>Recent studies implicate cardiolipin oxidation in several age-related diseases. <i>Atp8b1</i> encoding Type 4 P-type ATPases is a cardiolipin transporter. Mutation in <i>Atp8b1</i> gene or inflammation of the lungs impairs the capacity of Atp8b1 to clear cardiolipin from lung fluid. However, the link between <i>Atp8b1</i> mutation and age-related gene alteration is unknown. Therefore, we investigated how <i>Atp8b1</i> mutation alters age-related genes.<h4>Methods</h4>We performed Affymetrix gene profiling of lungs isolated from young (7-9 wks, n=6) and aged (14 months, 14 M, n=6) C57BL/6 and <i>Atp8b1</i> mutant mice. In addition, Ingenuity Pathway Analysis (IPA) was performed. Differentially expressed genes were validated by quantitative real-time PCR (qRT-PCR).<h4>Results</h4>Global transcriptome analysis revealed 532 differentially expressed genes in <i>Atp8b1</i> lungs, 157 differentially expressed genes in C57BL/6 lungs, and 37 overlapping genes. IPA of age-related genes in <i>Atp8b1</i> lungs showed enrichment of Xenobiotic metabolism and Nrf2-mediated signaling pathways. The increase in <i>Adamts2</i> and <i>Mmp13</i> transcripts in aged <i>Atp8b1</i> lungs was validated by qRT-PCR. Similarly, the decrease in <i>Col1a1</i> and increase in <i>Cxcr6</i> transcripts was confirmed in both <i>Atp8b1</i> mutant and C57BL/6 lungs.<h4>Conclusion</h4>Based on transcriptome profiling, our study indicates that <i>Atp8b1</i> mutant mice may be susceptible to age-related lung diseases.

Also flagged:celecoxibgastric cancergastric carcinomadimethylsulfoxidephosphorylationchemokine
Journal Article 2016-09-01 No Snippets Song B, Du J, Feng Y, Gao YJ, Zhao JS.
Show Full Abstract

The aim of the present study was to investigate the mechanisms of long non-coding RNAs (lncRNAs) in a gastric cancer cell line treated with celecoxib. The human gastric carcinoma cell line NCI-N87 was treated with 15 µM celecoxib for 72 h (celecoxib group) and an equal volume of dimethylsulfoxide (control group), respectively. Libraries were constructed by NEBNext Ultra RNA Library Prep kit for Illumina. Paired-end RNA sequencing reads were aligned to a human hg19 reference genome using TopHat2. Differentially expressed genes (DEGs) and lncRNAs were identified using Cuffdiff. Enrichment analysis was performed using GO-function package and KEGG profile in Bioconductor. A protein-protein interaction network was constructed using STRING database and module analysis was performed using ClusterONE plugin of Cytoscape. <i>ATP5G1</i>, <i>ATP5G3</i>, <i>COX8A</i>, <i>CYC1</i>, <i>NDUFS3</i>, <i>UQCRC1</i>, <i>UQCRC2</i> and <i>UQCRFS1</i> were enriched in the oxidative phosphorylation pathway. <i>CXCL1</i>, <i>CXCL3</i>, <i>CXCL5</i> and <i>CXCL8</i> were enriched in the chemokine signaling and cytokine-cytokine receptor interaction pathways. <i>ITGA3</i>, <i>ITGA6</i>, <i>ITGB4</i>, <i>ITGB5</i>, <i>ITGB6</i> and <i>ITGB8</i> were enriched in the integrin-mediated signaling pathway. DEGs co-expressed with lnc-SCD-1:13, lnc-LRR1-1:2, lnc-PTMS-1:3, lnc-S100P-3:1, lnc-AP000974.1-1:1 and lnc-RAB3IL1-2:1 were enriched in the pathways associated with cancer, such as the basal cell carcinoma pathway in cancer. In conclusion, these DEGs and differentially expressed lncRNAs may be important in the celecoxib treatment of gastric cancer.

Also flagged:nanotubestauprion-like proteinsneurodegenerative diseasessecretionprions
Journal Article 2016-09-01 ✓ 1 Snippet Abounit S, Wu JW, Duff K, Victoria GS, Zurzolo C.
In-Text Gene Mentions

Htt

Show Full Abstract

The mechanisms of intercellular spreading of amyloidogenic proteins involved in neurodegenerative diseases have yet to be fully elucidated. While secretion has been implicated in the transfer of many proteins, including prions and α-synuclein, tunneling nanotubes (TNTs) have also been demonstrated for prions and mutant Huntingtin. Here, we provide further evidence that Tau aggregates, which have been demonstrated to predominantly be transferred via secretion, can also be found in TNTs. Additionally, cells that have taken up Tau have increased TNT formation. Coupled with previous evidence that other amyloidogenic aggregates also induce TNT formation we propose that misfolded protein aggregates can, through a common mechanism, promote the formation of TNTs and thereby their own intercellular transfer, contributing to the propagation of pathology.

Also flagged:lung adenocarcinomalung cancerLUADhesperidinatracuriumdeath
Journal Article 2016-09-01 No Snippets Sun Y, Zhang R, Jiang Z, Xia R, Zhang J, Liu J, Chen F.
Show Full Abstract

Despite recent advances in therapeutic strategies for lung cancer, mortality is still increasing. Therefore, there is an urgent need to identify effective novel drugs. In the present study, we implement drug repositioning for lung adenocarcinoma (LUAD) by a bioinformatics method followed by experimental validation. We first identified differentially expressed genes between LUAD tissues and nontumor tissues from RNA sequencing data obtained from The Cancer Genome Atlas database. Then, candidate small molecular drugs were ranked according to the effect of their targets on differentially expressed genes of LUAD by a random walk with restart algorithm in protein-protein interaction networks. Our method identified some potentially novel agents for LUAD besides those that had been previously reported (eg, hesperidin). Finally, we experimentally verified that atracurium, one of the potential agents, could induce A549 cells death in non-small-cell lung cancer-derived A549 cells by an MTT assay, acridine orange and ethidium bromide staining, and electron microscopy. Furthermore, Western blot assays demonstrated that atracurium upregulated the proapoptotic Bad and Bax proteins, downregulated the antiapoptotic p-Bad and Bcl-2 proteins, and enhanced caspase-3 activity. It could also reduce the expression of p53 and p21<sup>Cip1/Waf1</sup> in A549 cells. In brief, the candidate agents identified by our approach may provide greater insights into improving the therapeutic status of LUAD.

Also flagged:Urachal carcinomacancerurachal carcinomastumoradenocarcinomainvasive bladder tumors
Journal Article 2016-09-01 No Snippets Collins DC, Velázquez-Kennedy K, Deady S, Brady AP, Sweeney P, Power DG.
Show Full Abstract

Urachal carcinoma is an uncommon cancer whose rarity has precluded its study and evidence-based management strategies are lacking. This study assessed all urachal carcinomas in Ireland and clinical parameters in order to improve understanding. Urachal carcinomas diagnosed from 1994 to 2011 were identified from the National Cancer Registry in Ireland. Data obtained included patient age, gender, diagnostic year, pathology, tumor stage, patient treatment strategies and survival. Twenty-six urachal carcinomas were identified, the majority being adenocarcinoma. This comprised 0.3% of all invasive bladder tumors. Patients were predominantly male (62%) and over 50 years of age (58%). Twenty-two patients (85%) underwent surgery, with only six (23%) undergoing chemotherapy. On average, median overall survival was 2.6 years (range 0-15.2 yrs). Survival was longer in women (5 <i>vs.</i> 1.9 yrs), patients under 50 years of age (3.6 <i>vs.</i> 1.9 yrs), those without confirmed metastasis (4.1 <i>vs.</i> 0.7 yrs) and those who received chemotherapy (3.6 <i>vs.</i> 2.6 yrs). The overall survival of urachal carcinoma in Ireland is less than expected from published literature. This study highlights the need for centralization of rare tumors with international collaboration to identify the optimal treatment strategy and improve outcome.

Also flagged:neuropsychiatric diseasesneuropsychiatric diseasepsychiatric diseasegenetic diseasereproductionamyotrophic lateral sclerosis
Journal Article 2016-09-01 ✓ 2 Snippets Need AC, Goldstein DB.
In-Text Gene Mentions

The largest GWAS study for epilepsy combined data from 12 cohorts and searched for associations with genetic generalized epilepsy, focal epilepsy, and unclassified epilepsy.34 They identified two GWAS signals for “all epilepsy,” one centered on the SCN1A/SCN9A (sodium voltage-gated channel a subunit 1/sodium voltage-gated channel a subunit 9) gene and the other on the PCDH7 (protocadherin 7) gene; a third association was seen in the generalized epilepsy analysis, close to the VRK2 (vaccinia-related kinase 2) and FANCL (Fanconi anemia complementation group L) genes.

Interestingly, the epilepsy-associated allele close to VRK2 confers protection from epilepsy,34 but susceptibility to schizophrenia.38,55 Mutations in SCN1A are seen in familial epilepsy with phenotypes ranging from severe myoclonic epilepsy in infancy to benign febrile seizures; mutations are seen less frequently in SCN9A, with some suggestion of interaction between variants in SCN1A and SCN9A in mouse models of epilepsy.56 It is not yet clear whether the GWAS signal is a result of common variants with very small effect or rare variants in SCN1A and/or SCN9A causing synthetic associations.57

Show Full Abstract

Only a few years after its development, next-generation sequencing is rapidly becoming an essential part of clinical care for patients with serious neurological conditions, especially in the diagnosis of early-onset and severe presentations. Beyond this diagnostic role, there has been an explosion in definitive gene discovery in a range of neuropsychiatric diseases. This is providing new pointers to underlying disease biology and is beginning to outline a new framework for genetic stratification of neuropsychiatric disease, with clear relevance to both individual treatment optimization and clinical trial design. Here, we outline these developments and chart the expected impact on the treatment of neurological, neurodevelopmental, and psychiatric disease.

Also flagged:HydroxyapatitePeriodontal diseasereproductionwatergingival recessionBone Morphogenetic Proteins
Journal Article 2016-09-01 No Snippets Jain D, Sawhney A, Gupta B, Sharma S, Juneja S, Juneja M, Sharma S, Patil N.
Show Full Abstract

<h4>Introduction</h4>Previous studies have shown that Hydroxyapatite (HA) has shown good results in the treatment of intra-osseous periodontal defects. A newer variety of HA has been designed over a period of research which has nano-sized particles and is availed in a paste consistency called Nanocrystalline Hydroxyapatite paste (NHA paste). This variation in size and surface area of NHA paste can provide better results when used in intra-bony defects.<h4>Aim</h4>The purpose of this study was to compare the clinical and radiographic outcomes obtained with usage of NHA paste to those obtained with Demineralized Bone Matrix (DBM) in the treatment of periodontal intra-bony defects.<h4>Material and methods</h4>A clinical trial was carried out for a period of 12 months. A total of 26 intra-bony defects in 10 patients were divided into experimental and control sites. The experimental sites were debrided and grafted with NHA paste. The control sites were debrided and grafted with DBM-Xenograft. Probing Depth, Clinical Attachment Level (DCAL) and Gingival Margin (GM) position were recorded at baseline 3, 6, 9 and 12 months. Standardized radiographs were also documented at these recalls. The results were averaged (mean± standard deviation) for each parameter and Student t-test was used to determine intra-group statistical difference and One way analyses of variance (ANOVA) to test the difference between groups using Excel and SPSS (SPSS Inc, Chicago) software packages.<h4>Results</h4>On completion of 12 months, the mean percentage of PD reduction achieved in the experimental and control sites was 67.45% and 69.03% respectively (p<0.05). The mean percentage of gain achieved in CAL was 63.58% and 61.42% in the experimental and control sites respectively (p<0.05). Gingival recession was seen to be non-significant in the experimental and control sites. The mean percentage of bone fill in the control group obtained was 48.16% where as the percentage of bone fill obtained in the experimental group was 48.64% (p<0.05).<h4>Conclusion</h4>Overall, both therapies led to significant improvements of the investigated parameters. The NHA paste was as effective in terms of improving clinical and radiographic parameters as DBM-Xenograft, which is an already established bone graft. There is a need for further long term controlled studies evaluating the adjunctive benefits of usage of NHA paste in the treatment of periodontal intra-bony defects.

Also flagged:chromosomesorganizationchromosomechromatinhistonetranscription factors
Journal Article 2016-09-01 No Snippets Brackley CA, Michieletto D, Mouvet F, Johnson J, Kelly S, Cook PR, Marenduzzo D.
Show Full Abstract

We discuss a polymer model for the 3D organization of human chromosomes. A chromosome is represented by a string of beads, with each bead being "colored" according to 1D bioinformatic data (e.g., chromatin state, histone modification, GC content). Individual spheres (representing bi- and multi-valent transcription factors) can bind reversibly and selectively to beads with the appropriate color. During molecular dynamics simulations, the factors bind, and the string spontaneously folds into loops, rosettes, and topologically-associating domains (TADs). This organization occurs in the absence of any specified interactions between distant DNA segments, or between transcription factors. A comparison with Hi-C data shows that simulations predict the location of most boundaries between TADs correctly. The model is "fitting-free" in the sense that it does not use Hi-C data as an input; consequently, one of its strengths is that it can - in principle - be used to predict the 3D organization of any region of interest, or whole chromosome, in a given organism, or cell line, in the absence of existing Hi-C data. We discuss how this simple model might be refined to include more transcription factors and binding sites, and to correctly predict contacts between convergent CTCF binding sites.

Also flagged:acetylenicbetulinbetulonecancerbreast cancerpromyelocytic leukemia
Journal Article 2016-09-01 No Snippets Bębenek E, Kadela-Tomanek M, Chrobak E, Wietrzyk J, Sadowska J, Boryczka S.
Show Full Abstract

Betulin <b>1</b> and its semisynthetic derivatives exhibit a cytotoxic activity toward various cancer cell lines. These compounds are a promising and potential anticancer candidates. A series of betulin derivatives was prepared and tested for the antiproliferative activity in vitro against T47D breast cancer, CCRF/CEM leukemia, HL-60 promyelocytic leukemia, SW707 colorectal, murine P388 leukemia, as well as BALB3T3 normal fibroblasts cell lines. Cisplatin and betulin <b>1</b> were used as a reference compounds. Some derivatives of betulin showed a higher cytotoxic activity than the parent compound <b>1</b>. Two derivatives (<b>5</b> and <b>17</b>) were 24-fold potent than betulin <b>1</b> against the human promyelocytic leukemia cell line (HL-60), with an IC<sub>50</sub> value of 0.3 µg/mL.

Also flagged:serotonin transportersexual abuseSchizophreniaAffective Disorders5childhood
Journal Article 2016-09-01 ✓ 2 Snippets Çarkaxhiu Bulut G, Rodopman Arman A, Güney İ, Gültepe P.
In-Text Gene Mentions

…of serotonin transporter (5-HTT) gene polymorphism regarding…

5-HTT

Show Full Abstract

<h4>Introduction</h4>More than one-fourth adolescents are exposed to unexpected frightening experiences and traumas until adulthood. In this study, we aimed to determine the potential role of serotonin transporter (5-HTT) gene polymorphism regarding resilience factors in the symptom variability of individuals exposed to sexual abuse.<h4>Methods</h4>Adolescents aged 11-17 years, who were admitted to the Marmara University Child Psychiatry Outpatient Clinic Forensic division with sexual abuse experience history, were informed about the research, and volunteers were included in the study. Turkish versions of "Kiddie-Schedule for Affective Disorders and Schizophrenia-Present and Lifetime (K-SADS-PL)" was used to assess the psychopathology and functionality. The evaluation of participants also included self-reports based on "Eysenck Personality Inventory" and "Ways of Coping Inventory" for reflecting the resilience domain.<h4>Results</h4>The sample included 16 girls (88.9%) and 2 boys (11.1%), and the mean (±standard deviation) age was 14.58±1.97 years. Genotyping of the insertion/deletion polymorphism (5-HTTLPR) in the 5-HTT gene's transcriptional control zone was established, and 8 participants (44.4%) were determined to be of the LL genotype, while 7 (38.8%) were LS and 3 (16.6%) were SS carriers. Considering the relationship between coping styles regarding resilience and genetic variants, 87.5% of participants (n=7) exhibiting problem-focused coping style were determined found to carry the LL allele, while 90% (n=9) who exhibited emotion-focused coping styles were the SS-LS allele carriers (p=0.003).<h4>Conclusion</h4>Our findings suggest that 5-HTTLPR gene polymorphism has a significant impact on the formation of coping styles. More studies are needed to determine other factors involved in the complex relationship between 5-HTTLPR gene polymorphism and development of psychopathology.

Also flagged:neurological disorderpolyglutamineHDdisease of the central nervous systemheart diseasedeath
Journal Article 2016-09-01 ✓ 1 Snippet Melkani GC.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is a rare, inherited, progressive, and fatal neurological disorder resulting from expanded polyglutamine repeats in the huntingtin protein. While HD is predominately characterized as a disease of the central nervous system, mortality surveys and epidemiological studies reveal heart disease as one of the leading causes of death in HD patients. Emerging evidence supports a link between HD and cardiovascular disease, such as cardiac amyloidosis (accumulation of aggregates in the heart). Experimental animal and clinical studies have attempted to explain the mechanisms of HD-induced cardiac pathology in the association of protein misfolding, autophagic defects, oxidative stress, mitochondrial dysfunction, and cell death. HD is increasingly understood as a complex disease with peripheral components of cardiac and skeletal muscle pathophysiology. While the discovery of these linkages and apparent pathological markers is promising, the mechanism of HD-induced cardiac pathology and the nature of its cell autonomy remain elusive. Further study of the wide-ranging cardiac function in HD patients is needed. This review highlights published literature on the pathological factors associated with HD-induced cardiac amyloidosis and other cardiovascular diseases, and addresses gaps in this expanding area of study. Through comprehensive experimental and clinical studies, potential drugs can be tested to attenuate and/or ameliorate HD-induced cardiac pathology and mortality.

Also flagged:NeurodegenerationAutophagyAlzheimer'sParkinson'sHuntington's diseasesα-synuclein
Journal Article 2016-09-01 No Snippets Pupyshev AB, Korolenko TA, Tikhonova MA.
Show Full Abstract

The role of autophagy in cell survival and suppression of neurodegeneration was considered. We discussed its involvement in Alzheimer's, Parkinson's, and Huntington's diseases connected with accumulation of amy- loid-β, α-synuclein, and huntingtin, respectively. Autophagy is reduced in these diseases and in aging as well to various extent. Elimination of accumulated toxic proteins and structures is performed by autophagy mech- anisms (chaperon-mediated autophagy, macroautophagy, selected autophagy) in an interaction with ubiqui- tin-proteasome system. In many cases activation of mTOR-dependent autophagy and mTOR-independent regulatory pathways lead to the therapeutic effect of inhibition of neurodegeneration in cell cultures and an- imal models. Some autophagy enhancers such as resveratrol, metformin, rilmenidine, lithium, and curcumin are tested now in clinical trials.

Also flagged:Deathcriticalcentral line-associated bloodstream infectionchlorhexidine gluconateethanollumens
Journal Article 2016-09-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…anti-Xa, HEMOCHRON ACT,ATIII, fibrinogen) were collected…

Show Full Abstract

No abstract available.