Gene Literature Dashboard

Viewing June 2017 — 414 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← May 2017 July 2017 →
Also flagged:aminoacyl-tRNA synthetasesdiseases of the nervous systemprotein synthesismitochondrialneurologic illnessestranslational
Journal Article 2017-06-30 No Snippets Ognjenović J, Simonović M.
Show Full Abstract

Aminoacyl-tRNA synthetases (AaRSs) are ubiquitously expressed enzymes that ensure accurate translation of the genetic information into functional proteins. These enzymes also execute a variety of non-canonical functions that are significant for regulation of diverse cellular processes and that reside outside the realm of protein synthesis. Associations between faults in AaRS-mediated processes and human diseases have been long recognized. Most recent research findings strongly argue that 10 cytosolic and 14 mitochondrial AaRSs are implicated in some form of pathology of the human nervous system. The advent of modern whole-exome sequencing makes it all but certain that similar associations between the remaining 15 ARS genes and neurologic illnesses will be defined in future. It is not surprising that an intense scientific debate about the role of translational machinery, in general, and AaRSs, in particular, in the development and maintenance of the healthy human neural cell types and the brain is sparked. Herein, we summarize the current knowledge about causative links between mutations in human AaRSs and diseases of the nervous system and briefly discuss future directions.

Also flagged:gene expressionproteasometocancersmultiple myelomamyeloma
Journal Article 2017-06-30 No Snippets Mitra AK, Harding T, Mukherjee UK, Jang JS, Li Y, HongZheng R, Jen J, Sonneveld P, Kumar S, Kuehl WM, Rajkumar V, Van Ness B.
Show Full Abstract

Extensive interindividual variation in response to chemotherapy is a major stumbling block in achieving desirable efficacy in the treatment of cancers, including multiple myeloma (MM). In this study, our goal was to develop a gene expression signature that predicts response specific to proteasome inhibitor (PI) treatment in MM. Using a well-characterized panel of human myeloma cell lines (HMCLs) representing the biological and genetic heterogeneity of MM, we created an in vitro chemosensitivity profile in response to treatment with the four PIs bortezomib, carfilzomib, ixazomib and oprozomib as single agents. Gene expression profiling was performed using next-generation high-throughput RNA-sequencing. Applying machine learning-based computational approaches including the supervised ensemble learning methods Random forest and Random survival forest, we identified a 42-gene expression signature that could not only distinguish good and poor PI response in the HMCL panel, but could also be successfully applied to four different clinical data sets on MM patients undergoing PI-based chemotherapy to distinguish between extraordinary (good and poor) outcomes. Our results demonstrate the use of in vitro modeling and machine learning-based approaches to establish predictive biomarkers of response and resistance to drugs that may serve to better direct myeloma patient treatment options.

Also flagged:SOX9cartilage injuryinjurySRY-type high-mobility group box-9chondrogenesisgreen fluorescence protein
Journal Article 2017-06-30 ✓ 5 Snippets Zhang X, Wu S, Naccarato T, Prakash-Damani M, Chou Y, Chu CQ, Zhu Y.
In-Text Gene Mentions

…SOX5 andSOX6co-operate with SOX9…

…both SOX5 andSOX6and SOX9 further…

…upregulates SOX5 andSOX6expression [ 13…

…SOX5 Hs01425825_cn andSOX6Hs00264525_m1).…

…as SOX5 and/orSOX6which co-operate with…

Show Full Abstract

Microfracture, a common procedure for treatment of cartilage injury, induces fibrocartilage repair by recruiting bone marrow derived mesenchymal stem cells (MSC) to the site of cartilage injury. However, fibrocartilage is inferior biomechanically to hyaline cartilage. SRY-type high-mobility group box-9 (SOX9) is a master regulator of chondrogenesis by promoting proliferation and differentiation of MSC into chondrocytes. In this study we aimed to test the therapeutic potential of cell penetrating recombinant SOX9 protein in regeneration of hyaline cartilage in situ at the site of cartilage injury. We generated a recombinant SOX9 protein which was fused with super positively charged green fluorescence protein (GFP) (scSOX9) to facilitate cell penetration. scSOX9 was able to induce chondrogenesis of bone marrow derived MSC in vitro. In a rabbit cartilage injury model, scSOX9 in combination with microfracture significantly improved quality of repaired cartilage as shown by macroscopic appearance. Histological analysis revealed that the reparative tissue induced by microfracture with scSOX9 had features of hyaline cartilage; and collagen type II to type I ratio was similar to that in normal cartilage. This short term in vivo study demonstrated that when administered at the site of microfracture, scSOX9 was able to induce reparative tissue with features of hyaline cartilage.

Also flagged:cardiovascular diseasescoronary artery diseaseacute coronary syndromeheart failuremetabolic diseasesmetabolic disease
Journal Article 2017-06-30 ✓ 5 Snippets Šatrauskienė A, Navickas R, Laucevičius A, Huber HJ.
In-Text Gene Mentions

…factors SP1 andSOX6are potential specific…

SOX6was identified in…

SOX6is a transcription…

…DecreasedSOX6expression may hence…

…notion of decreasedSOX6and cardiac muscle…

Show Full Abstract

<h4>Background</h4>Numerous recent studies suggest the potential of circulating MicroRNAs (miRs) in peripheral blood samples as diagnostic or prognostic markers for coronary artery disease (CAD), acute coronary syndrome (ACS) and heart failure (HF). However, literature often remains inconclusive regarding as to which markers are most indicative for which of the above diseases. This shortcoming is mainly due to the lack of a systematic analyses and absence of information on the functional pathophysiological role of these miRs and their target genes.<h4>Methods</h4>We here provide an-easy-to-use scoring approach to investigate the likelihood of regulation of several miRs and their target genes from literature by identifying consensus patterns of regulation. We therefore have screened over 1000 articles that study mRNA markers in cardiovascular and metabolic diseases, and devised a scoring algorithm to identify consensus means for miRs and genes regulation across several studies. We then aimed to identify differential markers between CAD, ACS and HF.<h4>Results</h4>We first identified miRs (miR-122, -126, -223, -138 and -370) as commonly regulated within a group of metabolic disease, while investigating cardiac-related pathologies (CAD, ACS, HF) revealed a decisive role of miR-1, -499, -208b, and -133a. Looking at differential markers between cardiovascular disease revealed miR-1, miR-208a and miR-133a to distinguish ACS and CAD to HF. Relating differentially expressed miRs to their putative gene targets using MirTarBase, we further identified HCN2/4 and LASP1 as potential markers of CAD and ACS, but not in HF. Likewise, BLC-2 was found oppositely regulated between CAD and HF. Interestingly, while studying overlap in target genes between CAD, ACS and HF only revealed little similarities, mapping these genes to gene ontology terms revealed a surprising similarity between CAD and ACS compared to HF.<h4>Conclusion</h4>We conclude that our analysis using gene and miR scores allows the extraction of meaningful markers and the elucidation of differential pathological functions between cardiac diseases and provides a novel approach for literature screening for miR and gene consensus patterns. The analysis is easy to use and extendable upon further emergent literature as we provide an Excel sheet for this analysis to the community.

Also flagged:TMEM14BTMEM14APTPLBCKAP5EDARTMEM14D
Journal Article 2017-06-30 ✓ 5 Snippets Sánchez-Valle J, Tejero H, Ibáñez K, Portero JL, Krallinger M, Al-Shahrour F, Tabarés-Seisdedos R, Baudot A, Valencia A.
In-Text Gene Mentions

TRIM38

SERPINC1

CACNA1E

FBXL4

RABGAP1L

Show Full Abstract

Epidemiological studies indicate that patients suffering from Alzheimer's disease have a lower risk of developing lung cancer, and suggest a higher risk of developing glioblastoma. Here we explore the molecular scenarios that might underlie direct and inverse co-morbidities between these diseases. Transcriptomic meta-analyses reveal significant numbers of genes with inverse patterns of expression in Alzheimer's disease and lung cancer, and with similar patterns of expression in Alzheimer's disease and glioblastoma. These observations support the existence of molecular substrates that could at least partially account for these direct and inverse co-morbidity relationships. A functional analysis of the sets of deregulated genes points to the immune system, up-regulated in both Alzheimer's disease and glioblastoma, as a potential link between these two diseases. Mitochondrial metabolism is regulated oppositely in Alzheimer's disease and lung cancer, indicating that it may be involved in the inverse co-morbidity between these diseases. Finally, oxidative phosphorylation is a good candidate to play a dual role by decreasing or increasing the risk of lung cancer and glioblastoma in Alzheimer's disease.

Also flagged:brain-derived neurotrophic factorcell differentiationBDNFgene expressionmethylationtranscription factor
Journal Article 2017-06-30 ✓ 2 Snippets Kertes DA, Bhatt SS, Kamin HS, Hughes DA, Rodney NC, Mulligan CJ.
In-Text Gene Mentions

…binding sites forPOU3F2and STAT5A.…

POU3F2is involved in…

Show Full Abstract

<h4>Background</h4>The <i>BDNF</i> gene codes for brain-derived neurotrophic factor, a growth factor involved in neural development, cell differentiation, and synaptic plasticity. Present in both the brain and periphery, BDNF plays critical roles throughout the body and is essential for placental and fetal development. Rodent studies show that early life stress, including prenatal stress, broadly alters <i>BDNF</i> methylation, with presumed changes in gene expression. No studies have assessed prenatal exposure to maternal traumatic stress and <i>BDNF</i> methylation in humans. This study examined associations of prenatal exposure to maternal stress and <i>BDNF</i> methylation at CpG sites across the <i>BDNF</i> gene.<h4>Results</h4>Among 24 mothers and newborns in the eastern Democratic Republic of Congo, a region with extreme conflict and violence to women, maternal experiences of war trauma and chronic stress were associated with <i>BDNF</i> methylation in umbilical cord blood, placental tissue, and maternal venous blood. Associations of maternal stress and <i>BDNF</i> methylation showed high tissue specificity. The majority of significant associations were observed in putative transcription factor binding regions.<h4>Conclusions</h4>This is the first study in humans to examine <i>BDNF</i> methylation in relation to prenatal exposure to maternal stress in three tissues simultaneously and the first in any mammalian species to report associations of prenatal stress and <i>BDNF</i> methylation in placental tissue. The findings add to the growing body of evidence highlighting the importance of considering epigenetic effects when examining the impacts of trauma and stress, not only for adults but also for offspring exposed via effects transmitted before birth.

Also flagged:Nervousgene expressionneurodegenerative disordersneurodegenerative diseasesAmyotrophic Lateral Sclerosisnucleotides
Journal Article 2017-06-30 ✓ 1 Snippet Quan Z, Zheng D, Qing H.
In-Text Gene Mentions

Huntingtin (HTT) is an essential gene for HD, a CAG trinucleotide repeat expansion in exon 1, and the main cause of HD.

Show Full Abstract

Accumulating studies have revealed that the human genome encodes tens of thousands of long non-coding RNAs (lncRNAs), which participate in multiple biological networks modulating gene expression via transcriptional, post-transcriptional and epigenetic regulation. Strikingly, a large fraction of tissue-specific lncRNAs are expressed in the Central Nervous System (CNS) with precisely regulated temporal and spatial expression patterns. These brain-specific lncRNAs are also featured with the cell-type specificity, the highest signals of evolutionary conservation, and their preferential location adjacent to brain-expressed protein-coding genes. Mounting evidence has indicated dysregulation or mutations in lncRNA gene loci are associated with a variety of CNS-associated neurodegenerative disorders, such as Alzheimer's, Parkinson's, Huntington's diseases, Amyotrophic Lateral Sclerosis and others. However, how lncRNAs contribute to these disorders remains to be further explored and studied. In this review article, we systematically and comprehensively summarize the current studies of lncRNAs, demonstrate the specificity of lncRNAs expressed in the brain, their functions during neural development and expression profiles in major cell types of the CNS, highlight the regulatory mechanisms of several studied lncRNAs that may play essential roles in the pathophysiology of neurodegenerative diseases, and discuss the current challenges and future perspectives of lncRNA studies involved in neurodegenerative and other diseases.

Also flagged:Calciumneurodegenerative disordersneurodegenerative diseasesADHDPD
Journal Article 2017-06-30 No Snippets Pchitskaya E, Popugaeva E, Bezprozvanny I.
Show Full Abstract

Calcium (Ca<sup>2+</sup>) is a ubiquitous second messenger that regulates various activities in eukaryotic cells. Especially important role calcium plays in excitable cells. Neurons require extremely precise spatial-temporal control of calcium-dependent processes because they regulate such vital functions as synaptic plasticity. Recent evidence indicates that neuronal calcium signaling is abnormal in many of neurodegenerative disorders such as Alzheimer's disease (AD), Huntington's disease (HD) and Parkinson's disease (PD). These diseases represent a major medical, social, financial and scientific problem, but despite enormous research efforts, they are still incurable and only symptomatic relief drugs are available. Thus, new approaches and targets are needed. This review highlight neuronal calcium-signaling abnormalities in these diseases, with particular emphasis on the role of neuronal store-operated Ca<sup>2+</sup> entry (SOCE) pathway and its potential relevance as a therapeutic target for treatment of neurodegeneration.

Also flagged:Iron-overload syndromesheart failureCardiacdilated cardiomyopathydilatediron
Journal Article 2017-06-30 ✓ 5 Snippets Aronow WS.
In-Text Gene Mentions

The 4 subtypes are type 1 caused by the high iron (HFE) gene which accounts for more than 80% of hemochromatosis cases, type 2 caused by the hemojuvelin gene, type 3 caused by the transferrin receptor-2 gene, and type 4 caused by the ferroportin gene.

…Cardiachemochromatosisis characterized by…

…Cardiachemochromatosisshould be considered…

…patients with cardiachemochromatosis.…

…Management of cardiachemochromatosis

Show Full Abstract

Iron-overload syndromes may be hereditary or acquired. Patients may be asymptomatic early in the disease. Once heart failure develops, there is rapid deterioration. Cardiac hemochromatosis is characterized by a dilated cardiomyopathy with dilated ventricles, reduced ejection fraction, and reduced fractional shortening. Deposition of iron may occur in the entire cardiac conduction system, especially the atrioventricular node. Cardiac hemochromatosis should be considered in any patient with unexplained heart failure. Screening for systemic iron overload with serum ferritin and transferin saturation should be performed. If these tests are consistent with iron overload, further noninvasive and histologic confirmation is indicated to confirm organ involvement with iron overload. Cardiac magnetic resonance imaging is superior to other diagnostic tests since it can quantitatively assess myocardial iron load. Therapeutic phlebotomy is the therapy of choice in nonanemic patients with cardiac hemochromatosis. Therapeutic phlebotomy should be started in men with serum ferritin levels of 300 μg/l or more and in women with serum ferritin levels of 200 μg/l or more. Therapeutic phlebotomy consists of removing 1 unit of blood (450 to 500 ml) weekly until the serum ferritin level is 10 to 20 μg/l and maintenance of the serum ferritin level at 50 μg/l or lower thereafter by periodic removal of blood. Phlebotomy is not a treatment option in patients with anemia (secondary iron-overload disorders) nor in patients with severe congestive heart failure. In these patients, the treatment of choice is iron chelation therapy.

Also flagged:trinucleotideMyotonic Dystrophy Type 1hydrogenwaterProtoncytosine
Journal Article 2017-06-29 No Snippets Chen JL, VanEtten DM, Fountain MA, Yildirim I, Disney MD.
Show Full Abstract

RNA repeat expansions cause a host of incurable, genetically defined diseases. The most common class of RNA repeats consists of trinucleotide repeats. These long, repeating transcripts fold into hairpins containing 1 × 1 internal loops that can mediate disease via a variety of mechanism(s) in which RNA is the central player. Two of these disorders are Huntington's disease and myotonic dystrophy type 1, which are caused by r(CAG) and r(CUG) repeats, respectively. We report the structures of two RNA constructs containing three copies of a r(CAG) [r(3×CAG)] or r(CUG) [r(3×CUG)] motif that were modeled with nuclear magnetic resonance spectroscopy and simulated annealing with restrained molecular dynamics. The 1 × 1 internal loops of r(3×CAG) are stabilized by one-hydrogen bond (cis Watson-Crick/Watson-Crick) AA pairs, while those of r(3×CUG) prefer one- or two-hydrogen bond (cis Watson-Crick/Watson-Crick) UU pairs. Assigned chemical shifts for the residues depended on the identity of neighbors or next nearest neighbors. Additional insights into the dynamics of these RNA constructs were gained by molecular dynamics simulations and a discrete path sampling method. Results indicate that the global structures of the RNA are A-form and that the loop regions are dynamic. The results will be useful for understanding the dynamic trajectory of these RNA repeats but also may aid in the development of therapeutics.

Also flagged:deathhemorrhagic shockimmune responseTlr13Il1bCcl6
Journal Article 2017-06-29 ✓ 1 Snippet Braga D, Barcella M, D'Avila F, Lupoli S, Tagliaferri F, Santamaria MH, DeLano FA, Baselli G, Schmid-Schönbein GW, Kistler EB, Aletti F, Barlassina C.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Hemorrhagic shock is a leading cause of morbidity and mortality worldwide. Significant blood loss may lead to decreased blood pressure and inadequate tissue perfusion with resultant organ failure and death, even after replacement of lost blood volume. One reason for this high acuity is that the fundamental mechanisms of shock are poorly understood. Proteomic and metabolomic approaches have been used to investigate the molecular events occurring in hemorrhagic shock but, to our knowledge, a systematic analysis of the transcriptomic profile is missing. Therefore, a pilot analysis using paired-end RNA sequencing was used to identify changes that occur in the blood transcriptome of rats subjected to hemorrhagic shock after blood reinfusion. Hemorrhagic shock was induced using a Wigger's shock model. The transcriptome of whole blood from shocked animals shows modulation of genes related to inflammation and immune response (Tlr13, Il1b, Ccl6, Lgals3), antioxidant functions (Mt2A, Mt1), tissue injury and repair pathways (Gpnmb, Trim72) and lipid mediators (Alox5ap, Ltb4r, Ptger2) compared with control animals. These findings are congruent with results obtained in hemorrhagic shock analysis by other authors using metabolomics and proteomics. The analysis of blood transcriptome may be a valuable tool to understand the biological changes occurring in hemorrhagic shock and a promising approach for the identification of novel biomarkers and therapeutic targets. Impact statement This study provides the first pilot analysis of the changes occurring in transcriptome expression of whole blood in hemorrhagic shock (HS) rats. We showed that the analysis of blood transcriptome is a useful approach to investigate pathways and functional alterations in this disease condition. This pilot study encourages the possible application of transcriptome analysis in the clinical setting, for the molecular profiling of whole blood in HS patients.

Also flagged:hematoxylinstreptavidinPrdx2peroxidasenucleibiotin
Journal Article 2017-06-29 ✓ 1 Snippet Wu F, Tian F, Zeng W, Liu X, Fan J, Lin Y, Zhang Y.
In-Text Gene Mentions

One study showed that Prdx3 and Prdx4 may have an important role in implantation and production of autoimmune antibodies against them may be related with miscarriages.19 Another study showed that FKBP52-Prdx6 signaling is useful for successful implantation.20 Further, our previous research demonstrated that Prdx2 expression was significantly downregulated in uterine lymphocytes isolated from NOD mice with impaired fertility, and that Prdx2 inhibition increased the cytotoxicity of uNK cells and thus increased the percentage of embryo loss in CBA/J × DBA/2J mice.21, 22 However, no studies have yet investigated the role of Prdx2 in trophoblasts of RM, which makes the present study the first of its kind.

Show Full Abstract

Peroxiredoxin (Prdx) 2 is an antioxidant protein that utilizes its redox-sensitive cysteine groups to reduce hydrogen peroxide molecules and protect cells against oxidative damage from reactive oxygen species (ROS). However, its function in trophoblasts at the maternal-fetal interface has not been clarified yet. In this study, significantly lower Prdx2 expression was found in the first-trimester villous cytotrophoblasts of patients with recurrent miscarriage (RM) than in cytotrophoblasts from healthy controls. Further, Prdx2 knockdown inhibited proliferation and increased apoptosis of trophoblast cells. The reason for this may be an increase in the level of cellular ROS after knockdown of Prdx2, which may subsequently lead to an increase in the expression of phosphorylated p53 (p-p53) and p38-MAPK/p21. Prdx2 knockdown also impaired the fusion of BeWo cells induced by forskolin. Bioinformatics analysis identified a c-Myc-binding site in the Prdx2 promoter region, and chromatin immunoprecipitation verified that c-Myc directly bound to a site in this locus. Suppression and overexpression of c-Myc resulted in reduction and increase of Prdx2 expression respectively. Furthermore, we demonstrated that c-Myc was downregulated in the first-trimester cytotrophoblasts of patients with RM, and its downregulation is also related with inhibited cell proliferation, increased apoptosis, as well as upregulated p21 expression and p-p53/p53 ratio. Our findings indicate that Prdx2 might have an important role in the regulation of trophoblast proliferation and apoptosis during early pregnancy, and that its expression is mediated by c-Myc. Thus, these two proteins may be involved in the pathogenesis of RM and may represent potential therapeutic targets.

Also flagged:Necroptosisneurodegenerative diseaseschronic progressive disordersdeathreceptor-interacting proteinRIP
Journal Article 2017-06-29 ✓ 4 Snippets Zhang S, Tang MB, Luo HY, Shi CH, Xu YM.
In-Text Gene Mentions

Investigator evaluated the Nec-1 in R6/2 transgenic mouse model of HD, which expresses exon 1 of mutant human htt gene.75 Given that Nec-1 can cross the blood-brain barrier easily but has a short half-life, about 1 h,76 Zhu et al. delivered Nec-1 intracerebroventricularly with Alzet osmotic pump to ensure continuous supply of the drug.44 Consequently, the expression of full-length RIP1 protein is increased in R6/2 mice compared with wild-type control.44 Nec-1 treatment helped maintain the motor functions and body weights in the R6/2 mice and significantly delayed disease onset.

…Mutant Huntingtin (Htt) with expanded polyQ…

…stably expressing mutantHttfragment was established…

…of mutant humanhttgene.…

Show Full Abstract

Neurodegenerative diseases are a group of chronic progressive disorders characterized by neuronal loss. Necroptosis, a recently discovered form of programmed cell death, is a cell death mechanism that has necrosis-like morphological characteristics. Necroptosis activation relies on the receptor-interacting protein (RIP) homology interaction motif (RHIM). A variety of RHIM-containing proteins transduce necroptotic signals from the cell trigger to the cell death mediators RIP3 and mixed lineage kinase domain-like protein (MLKL). RIP1 plays a particularly important and complex role in necroptotic cell death regulation ranging from cell death activation to inhibition, and these functions are often cell type and context dependent. Increasing evidence suggests that necroptosis plays an important role in the pathogenesis of neurodegenerative diseases. Moreover, small molecules such as necrostatin-1 are thought inhibit necroptotic signaling pathway. Understanding the precise mechanisms underlying necroptosis and its interactions with other cell death pathways in neurodegenerative diseases could provide significant therapeutic insights. The present review is aimed at summarizing the molecular mechanisms of necroptosis and highlighting the emerging evidence on necroptosis as a major driver of neuron cell death in neurodegenerative diseases.

Also flagged:SIRT1SIRT6cardiovascular diseaseCVDatherosclerosisheart failure
Journal Article 2017-06-29 No Snippets D'Onofrio N, Servillo L, Balestrieri ML.
Show Full Abstract

<h4>Significance</h4>Oxidative stress represents the common hallmark of pathological conditions associated with cardiovascular disease (CVD), including atherosclerosis, heart failure, hypertension, aging, diabetes, and other vascular system-related diseases. The sirtuin (SIRT) family, comprising seven proteins (SIRT1-SIRT7) sharing a highly conserved nicotinamide adenine dinucleotide (NAD<sup>+</sup>)-binding catalytic domain, attracted a great attention for the past few years as stress adaptor and epigenetic enzymes involved in the cellular events controlling aging-related disorder, cancer, and CVD. Recent Advances: Among sirtuins, SIRT1 and SIRT6 are the best characterized for their protective roles against inflammation, vascular aging, heart disease, and atherosclerotic plaque development. This latest role has been only recently unveiled for SIRT6. Of interest, in recent years, complex signaling networks controlled by SIRT1 and SIRT6 common to stress resistance, vascular aging, and CVD have emerged.<h4>Critical issues</h4>We provide a comprehensive overview of recent developments on the molecular signaling pathways controlled by SIRT1 and SIRT6, two post-translational modifiers proven to be valuable tools to dampen inflammation and oxidative stress at the cardiovascular level.<h4>Future directions</h4>A deeper understanding of the epigenetic mechanisms through which SIRT1 and SIRT6 act in the signalings responsible for onset and development CVD is a prime scientific endeavor of the upcoming years. Multiple "omic" technologies will have widespread implications in understanding such mechanisms, speeding up the achievement of selective and efficient pharmacological modulation of sirtuins for future applications in the prevention and treatment of CVD. Antioxid. Redox Signal. 28, 711-732.

Also flagged:transcription factorsgene expressionHearinghearing impairmentlossaging
Journal Article 2017-06-29 No Snippets Iki T, Tanaka M, Kitajiri SI, Kita T, Kawasaki Y, Mizukoshi A, Fujibuchi W, Nakagawa T, Nakahata T, Ito J, Omori K, Saito MK.
Show Full Abstract

Various tissues possess tissue-specific stem/progenitor cells, including the inner ears. Stem/progenitor cells of the inner ear can be isolated as so-called otospheres from differentiated cells using a sphere forming assay. Although recent studies have demonstrated the characteristics of otospheres to some extent, most of the features of these cells are unknown. In this report, we describe the findings of transcriptome analyses with a cDNA microarray of otospheres derived from the cochleae of the inner ears of neonatal mice in order to clarify the gene expression profile of otic stem/progenitor cells. There were common transcription factors between otospheres and embryonic stem cells, which were supposed to be due to the stemness of otospheres. In comparison with the cochlear sensory epithelium, the otospheres shared characteristics with the cochlea, although several transcription factors specific for otospheres were identified. These transcription factors are expected to be essential for maintaining the characteristics of otospheres, and appear to be candidate genes that promote the direct conversion of cells into otic stem/progenitor cells.

Also flagged:Chronic hepatitis Bliver diseaseHBeAgcell cycleNF-κBmitochondrial
Journal Article 2017-06-29 ✓ 1 Snippet Hou J, Brouwer WP, Kreefft K, Gama L, Price SL, Janssen HLA, French PJ, Vanwolleghem T, Boonstra A.
In-Text Gene Mentions

…cirrhosis, Wilson's disease,hemochromatosisor any other…

Show Full Abstract

Chronic hepatitis B is a highly heterogeneous liver disease characterized by phases with fluctuations in viral replication and progressive liver damage in some, but not all infected individuals. Despite four decades of research, insight into host determinants underlying these distinct clinical phases-immunotolerant, immune active, inactive carrier, and HBeAg-negative hepatitis-remains elusive. We performed an in-depth transcriptome analysis of archived FFPE liver biopsies of each clinical phase to address host determinants associated with the natural history. Therefore, we determined, for the first time, intrahepatic global expression profiles of well-characterized chronic HBV patients at different clinical phases. Our data, obtained by microarray, demonstrate that B cells and NK/cytotoxic-related genes in the liver, including CD19, TNFRSF13C, GZMH, and KIR2DS3, were differentially expressed across the clinical HBV phases, which was confirmed by modular analysis and also Nanostring arrays in an independent cohort. Compared to the immunotolerant phase, 92 genes were differentially expressed in the liver during the immune active phase, 46 in the inactive carrier phase, and 71 in the HBeAg-negative phase. Furthermore, our study also revealed distinctive transcription of genes associated with cell cycle activity, NF-κB signaling, cytotoxic function and mitochondrial respiration between clinical phases. Our data define for the first time using microarray unique transcriptomes in the HBV-infected liver during consecutive clinical phases. We demonstrate that fluctuations of viral loads and liver damage coincide with fluctuations in the liver transcriptome and point to functional- immune and non-immune- components contributing to the clinical phenotype in patients.

Also flagged:infectionhepatitis virus coinfectionHIV infectionmethadoneantibodiessurface antigen
Journal Article 2017-06-29 No Snippets Ishizaki A, Tran VT, Nguyen CH, Tanimoto T, Hoang HTT, Pham HV, Phan CTT, Bi X, Pham TV, Ichimura H.
Show Full Abstract

We previously reported a significant reduction in the prevalence of human immunodeficiency virus type 1 (HIV) from 2007 to 2012 in people who inject drugs (PWID; 35.9% to 18.5%, p < 0.001) and female sex workers (FSW; 23.1% to 9.8%, p < 0.05), but not in blood donors (BD) or pregnant women, in Haiphong, Vietnam. Our aim in the present study was to assess trends in the prevalence of infection with hepatitis B and C viruses (HBV and HCV, respectively). We also investigated the coinfection rates of HBV and HCV with HIV in the same groups. Between 2007 and 2012, HBV prevalence was significantly decreased in BD (18.1% vs. 9.0%, p = 0.007) and slightly decreased in FSW (11.0% vs. 3.9%, p = 0.21), but not in PWID (10.7% vs. 11.1%, p = 0.84). HCV prevalence was significantly decreased in PWID (62.1% in 2007 vs. 42.7% in 2008, p < 0.0001), but it had rebounded to 58.4% in 2012 (2008 vs. 2012, p < 0.0001). HCV prevalence also increased in FSW: 28.6% in 2007 and 2009 vs. 35.3% in 2012; however, this difference was not significant (2007 vs. 2012, p = 0.41). Rates of coinfection with HBV and HCV among HIV-infected PWID and FSW did not change significantly during the study period. Our findings suggest that the current harm reduction programs designed to prevent HIV transmission in PWID and FSW may be insufficient to prevent the transmission of hepatitis viruses, particularly HCV, in Haiphong, Vietnam. New approaches, such as the introduction of catch-up HBV vaccination to vulnerable adult populations and the introduction of HCV treatment as prevention, should be considered to reduce morbidity and mortality due to HIV and hepatitis virus coinfection in Vietnam.

Also flagged:ethanolRPT6mycCPTformamidecanavanine
Journal Article 2017-06-29 ✓ 5 Snippets Marquez-Lona EM, Torres-Machorro AL, Gonzales FR, Pillus L, Patrick GN.
In-Text Gene Mentions

Htt

The growth of myc-RPT6 and myc-rpt6-S119D strains expressing all mutant Htt polyQ variants upon challenge with canavanine was comparable to cells transformed with the vector control (Fig 3B).

…(HD) related huntingtin (Htt) protein with expanded…

…the extent ofHttaggregation in our…

…HD related huntingtin (Htt) protein with expanded…

Show Full Abstract

The ubiquitin proteasome system (UPS) is a highly conserved and tightly regulated biochemical pathway that degrades the majority of proteins in eukaryotic cells. Importantly, the UPS is responsible for counteracting altered protein homeostasis induced by a variety of proteotoxic stresses. We previously reported that Rpt6, the ATPase subunit of the 19S regulatory particle (RP) of the 26S proteasome, is phosphorylated in mammalian neurons at serine 120 in response to neuronal activity. Furthermore, we found that Rpt6 S120 phosphorylation, which regulates the activity and distribution of proteasomes in neurons, is relevant for proteasome-dependent synaptic remodeling and function. To better understand the role of proteasome phosphorylation, we have constructed models of altered Rpt6 phosphorylation in S. cerevisiae by introducing chromosomal point mutations that prevent or mimic phosphorylation at the conserved serine (S119). We find that mutants which prevent Rpt6 phosphorylation at this site (rpt6-S119A), had increased susceptibility to proteotoxic stress, displayed abnormal morphology and had reduced proteasome activity. Since impaired proteasome function has been linked to the aggregation of toxic proteins including the Huntington's disease (HD) related huntingtin (Htt) protein with expanded polyglutamine repeats, we evaluated the extent of Htt aggregation in our phospho-dead (rpt6-S119A) and phospho-mimetic (rpt6-S119D) mutants. We showed Htt103Q aggregate size to be significantly larger in rpt6-S119A mutants compared to wild-type or rpt6-S119D strains. Furthermore, we observed that phosphorylation of endogenous Rpt6 at S119 is increased in response to various stress conditions. Together, these data suggest that Rpt6 phosphorylation at S119 may play an important function in proteasome-dependent relief of proteotoxic stress that can be critical in protein aggregation pathologies.

Also flagged:FTOobesitychromosomal regionchromosomeIRX3IRX5
Journal Article 2017-06-29 ✓ 2 Snippets Sobalska-Kwapis M, Suchanecka A, Słomka M, Siewierska-Górska A, Kępka E, Strapagiel D.
In-Text Gene Mentions

A number of different obesity-susceptible loci have been reported by the GWAS approach (MC4R, MC3R, SLC6A14, TMEM18, POMC, BDNF, NEGR1) [11].

…, BDNF ,NEGR1) [ 11…

Show Full Abstract

<h4>Background/objectives</h4>Genome-wide association studies (GWAS) have identified many loci associated with body mass index (BMI) in many different populations. Variants in the FTO locus are reported to be one of the strongest genetic predictors of obesity. Recent publications pointed also to a topologically associated domain (TAD) which is identified as a novel region affecting BMI. The TAD area encompasses the IRXB cluster (IRX3, IRX5, IRX6), FTO and RPGRIP1L genes.<h4>Subjects/methods</h4>In this study, we investigated the relationship between variation of the FTO and IRX genes and obesity in Poles. We presented a case-control association analysis (normal versus overweight and/or obesity group) of Polish adult individuals (N = 5418). We determined whether or not the chromosomal region 16:53 500 000-55 500 000 contains polymorphic variants which are correlated with BMI in Polish population, including sex and age stratified analysis.<h4>Results</h4>The obtained results showed that the problem of weight-height abnormalities differently affects populations of Polish women and men (χ2 = 187.1; p<0.0001). From 353 SNPs enrolled to this study, 86 were statistically significant (highest χ2 = 15.72; p = 7.35E-05 observed for rs1558902). Linkage disequilibrium (LD) analysis revealed 61 blocks in the tested region of chromosome 16, with 24 SNPs located within the same block (block 8) of approximately 40 kb, in almost complete LD (|D'|>0.98, r2>0.80). We confirmed presence of the genetic susceptibility loci located in intron 1 of the FTO gene, which were correlated with BMI in our study group. For the first time, our analyses revealed strong association of FTO intronic variants (block 8) with overweight in group of men only. We have also identified association of the IRX region with overweight and/or obesity in Polish individuals.<h4>Conclusion</h4>Our study demonstrated how tested SNPs make differential contributions to obesity and overweight risk. We revealed sex dependent differences in the distribution of tested loci which are associated with BMI in the population of Poles.

Also flagged:clear cell renal cell carcinomaoncocytomarenal cell tumorsmethylationchromophobe renal cell carcinomaHOXA9
Journal Article 2017-06-29 ✓ 1 Snippet Pires-Luís AS, Costa-Pinheiro P, Ferreira MJ, Antunes L, Lobo F, Oliveira J, Henrique R, Jerónimo C.
In-Text Gene Mentions

PCDH17and TCF21 promoter…

Show Full Abstract

<h4>Background</h4>Promoter methylation has emerged as a promising class of epigenetic biomarkers for diagnosis and prognosis of renal cell tumors (RCTs). Although differential gene promoter methylation patterns have been reported for the major subtypes (clear cell, papillary and chromophobe renal cell carcinoma, and oncocytoma), validation of diagnostic performance in independent series have been seldom performed. Herein, we aimed at assessing the diagnostic performance of genes previously shown to be hypermethylated in RCTs in different clinical settings.<h4>Methods</h4>Promoter methylation levels of HOXA9 and OXR1 were assessed by quantitative methylation specific PCR. ROC curves were generated for OXR1, OXR1 combined with MST1R and HOXA9. Sensitivity, specificity, positive predictive value, negative predictive value and accuracy were computed, maximizing specificity. Methylation levels were also correlated with clinical and pathological relevant parameters.<h4>Results</h4>HOXA9 and OXR1 promoter methylation was disclosed in 73 and 87% of RCTs, respectively. A two-gene methylation panel comprising OXR1 and MST1R identified malignancy with 98% sensitivity and 100% specificity, and clear cell renal cell carcinoma with 90% sensitivity and 98% specificity. HOXA9 promoter methylation allowed for discrimination between oncocytoma and both papillary and chromophobe renal cell carcinoma but only with 77% sensitivity and 73% specificity. Significantly higher OXR1 promoter methylation levels (p = 0.005) were associated with high nuclear grade in ccRCC.<h4>Conclusions</h4>A panel including OXR1 and MST1R promoter methylation allows specific and sensitive identification of renal cell tumors, and, especially, of clear cell renal cell carcinoma. Moreover, higher OXR1 promoter methylation levels associate with clear cell renal cell carcinoma nuclear grade, a surrogate for tumor aggressiveness. Thus, gene promoter methylation analysis might a useful ancillary tool in diagnostic management of renal masses.

Also flagged:nucleusaxonsbehavioralwaterRobo3axon
Journal Article 2017-06-29 ✓ 1 Snippet Tsytsarev V, Arakawa H, Zhao S, Chédotal A, Erzurumlu RS.
In-Text Gene Mentions

DCC

Show Full Abstract

The whisker system is an important sensory organ with extensive neural representations in the brain of the mouse. Patterned neural modules (barrelettes) in the ipsilateral principal sensory nucleus of the trigeminal nerve (PrV) correspond to the whiskers. Axons of the PrV barrelette neurons cross the midline and confer the whisker-related patterning to the contralateral ventroposteromedial nucleus of the thalamus, and subsequently to the cortex. In this way, specific neural modules called barreloids and barrels in the contralateral thalamus and cortex represent each whisker. Partial midline crossing of the PrV axons, in a conditional Robo3 mutant (<i>Robo3<sup>R3-5</sup>cKO</i>) mouse line, leads to the formation of bilateral whisker maps in the ventroposteromedial, as well as the barrel cortex. We used voltage-sensitive dye optical imaging and somatosensory and motor behavioral tests to characterize the consequences of bifacial maps in the thalamocortical system. Voltage-sensitive dye optical imaging verified functional, bilateral whisker representation in the barrel cortex and activation of distinct cortical loci following ipsilateral and contralateral stimulation of the specific whiskers. The mutant animals were comparable with the control animals in sensorimotor tests. However, they showed noticeable deficits in all of the whisker-dependent or -related tests, including Y-maze exploration, horizontal surface approach, bridge crossing, gap crossing, texture discrimination, floating in water, and whisking laterality. Our results indicate that bifacial maps along the thalamocortical system do not offer a functional advantage. Instead, they lead to impairments, possibly due to the smaller size of the whisker-related modules and interference between the ipsilateral and contralateral whisker representations in the same thalamus and cortex.<b>SIGNIFICANCE STATEMENT</b> The whisker sensory system plays a quintessentially important role in exploratory behavior of mice and other nocturnal rodents. Here, we studied a novel mutant mouse line, in which the projections from the brainstem to the thalamus are disrupted. This led to formation of bilateral whisker maps in both the thalamus and the cortex. The two whisker maps crowd in a space normally devoted to the contralateral map alone and in a nonoverlapping fashion. Stimulation of the whiskers on either side activates the corresponding region of the map. Mice with bilateral whisker maps perform well in general sensorimotor tasks but show poor performance in specific tests that require whisker-dependent tactile discrimination. These observations indicate that contralateral, instead of bilateral, representation of the sensory space plays a critical role in acuity and fine discrimination during somesthesis.

Also flagged:metalschromiummanganesecardiovascular diseasesCVDmyocardial infarction
Journal Article 2017-06-29 No Snippets Zhang J, Cavallari JM, Fang SC, Weisskopf MG, Lin X, Mittleman MA, Christiani DC.
Show Full Abstract

<h4>Background</h4>Environmental and occupational exposure to metals is ubiquitous worldwide, and understanding the hazardous metal components in this complex mixture is essential for environmental and occupational regulations.<h4>Objective</h4>To identify hazardous components from metal mixtures that are associated with alterations in cardiac autonomic responses.<h4>Methods</h4>Urinary concentrations of 16 types of metals were examined and 'acceleration capacity' (AC) and 'deceleration capacity' (DC), indicators of cardiac autonomic effects, were quantified from ECG recordings among 54 welders. We fitted linear mixed-effects models with least absolute shrinkage and selection operator (LASSO) to identify metal components that are associated with AC and DC. The Bayesian Information Criterion was used as the criterion for model selection procedures.<h4>Results</h4>Mercury and chromium were selected for DC analysis, whereas mercury, chromium and manganese were selected for AC analysis through the LASSO approach. When we fitted the linear mixed-effects models with 'selected' metal components only, the effect of mercury remained significant. Every 1 µg/L increase in urinary mercury was associated with -0.58 ms (-1.03, -0.13) changes in DC and 0.67 ms (0.25, 1.10) changes in AC.<h4>Conclusion</h4>Our study suggests that exposure to several metals is associated with impaired cardiac autonomic functions. Our findings should be replicated in future studies with larger sample sizes.

Also flagged:glucosetype 2 diabetes mellitusinsulinsecretiontype 2 diabetesdiabetes
Journal Article 2017-06-29 No Snippets Paddock E, Hohenadel MG, Piaggi P, Vijayakumar P, Hanson RL, Knowler WC, Krakoff J, Chang DC.
Show Full Abstract

<h4>Aims/hypothesis</h4>Elevated 2-h plasma glucose concentration (2 h-PG) during a 75 g OGTT predict the development of type 2 diabetes mellitus. However, 1-h plasma glucose concentration (1 h-PG) is associated with insulin secretion and may be a better predictor of type 2 diabetes. We aimed to investigate the association between 1 h-PG and 2 h-PG using gold standard methods for measuring insulin secretion and action. We also compared 1 h-PG and 2 h-PG as predictors of type 2 diabetes mellitus.<h4>Methods</h4>This analysis included adult volunteers without diabetes, predominantly Native Americans of Southwestern heritage, who were involved in a longitudinal epidemiological study from 1965 to 2007, with a baseline OGTT that included measurement of 1 h-PG. Group 1 (n = 716) underwent an IVGTT and hyperinsulinaemic-euglycaemic clamp for measurement of acute insulin response (AIR) and insulin-stimulated glucose disposal (M), respectively. Some members of Group 1 (n = 490 of 716) and members of a second, larger, group (Group 2; n = 1946) were followed-up to assess the development of type 2 diabetes (median 9.0 and 12.8 years follow-up, respectively).<h4>Results</h4>Compared with 2 h-PG (r = -0.281), 1 h-PG (r = -0.384) was more closely associated with AIR, whereas, compared with 1 h-PG (r = -0.340), 2 h-PG (r = -0.408) was more closely associated with M. Measures of 1 h-PG and 2 h-PG had similar abilities to predict type 2 diabetes, which did not change when both were included in the model. A 1 h-PG cut-off of 9.3 mmol/l provided similar levels of sensitivity and specificity as a 2 h-PG cut-off of 7.8 mmol/l; the latter is used to define impaired glucose tolerance, a recognised predictor of type 2 diabetes mellitus.<h4>Conclusions/interpretation</h4>The 1 h-PG was associated with important physiological predictors of type 2 diabetes and was as effective as 2 h-PG for predicting type 2 diabetes mellitus. The 1 h-PG is, therefore, an alternative method of identifying individuals with an elevated risk of type 2 diabetes mellitus.

Also flagged:tumorolfactomedin 4CD11bintegrin alpha-2colorectal cancerCancer
Journal Article 2017-06-29 ✓ 5 Snippets Yang Q, Bavi P, Wang JY, Roehrl MH.
In-Text Gene Mentions

Further confirmation with tissue from 43 patients by Western blotting, immunohistochemistry, and tissue microarray deemed OLFM4, CD11b, and ITGA2 to be significantly overexpressed in both primary colon tumors and liver metastases.

Using follow-up validation in two independent cohorts, we discovered that OLFM4, CD11b, and ITGA2 are proteins that are overexpressed in both primary colon tumors and liver metastases.

…including olfactomedin 4 (OLFM4), CD11b, integrin α2…

…tissue microarray deemedOLFM4, CD11b, and ITGA2…

…we discovered thatOLFM4, CD11b, and ITGA2…

Show Full Abstract

Late-stage colorectal cancer with liver metastasis is common and affords poor prognosis, yet there is a dearth of reliable biomarkers. Cancer is often characterized by an increase in serologic autoantibodies. Hence, we embarked on an immuno-proteomic strategy by using autoantibodies to discover antigens in tumor tissue as potential cancer markers. Matched sets of tissues from primary colon cancer, liver metastases, and adjacent benign tissues were obtained from colon cancer patients. Tissue proteins were extracted, and autoantigens were uncovered by immunoblotting with autoantibodies and sequenced by mass spectrometry. Informatics analyses identified 48 proteins that were found in tumor only but were absent in normal tissue. Five of these were reproducibly found in two independent experiments, including olfactomedin 4 (OLFM4), CD11b, integrin α2 (ITGA2), periostin, and thrombospondin-2. Further confirmation with tissue from 43 patients by Western blotting, immunohistochemistry, and tissue microarray deemed OLFM4, CD11b, and ITGA2 to be significantly overexpressed in both primary colon tumors and liver metastases. These tumor tissue autoantigens may serve as promising markers for developing differential diagnostics and immunotherapies for colorectal cancers, in particular, those with tendency to progress to liver metastases.<h4>Biological significance</h4>Late-stage colorectal cancer with liver metastasis is common and affords poor prognosis, yet there is a dearth of reliable biomarkers. Cancer is often characterized by an increase in serologic autoantibodies. Cancer tissue immunogens - antigens capable of inducing specific antibody production in patients - are promising targets for development of precision diagnostics and immunotherapies. In our manuscript, we describe on an immuno-proteomic strategy by using autoantibodies to discover antigens in tumor tissue as potential cancer markers. Matched sets of tissues from primary colon cancer, liver metastases, and adjacent benign tissues were analyzed. Putative autoantigens were first uncovered by immunoblotting with autoantibodies and sequenced by mass spectrometry. Informatics analyses identified 48 proteins that were found in tumor only but were absent in normal tissue. Using follow-up validation in two independent cohorts, we discovered that OLFM4, CD11b, and ITGA2 are proteins that are overexpressed in both primary colon tumors and liver metastases. We highlight the possible roles of these 3 proteins in carcinogenesis and tumor microenvironment and the implications for autoantigenic immune recognition. More generally, colon cancer biomarkers with autoantigenic properties, like the ones we describe in our manuscript, may open new opportunities for diagnosis, molecular classification, and therapy of colorectal cancer, particularly of aggressive tumors with tendency to progress to liver metastases. The autoantigenic properties of biomarkers are also expected to be of great relevance for immunotherapeutic development.

Also flagged:Channelopathiesion channelsion channelgene expressionvoltage-gated calcium channelL-type calcium channel
Journal Article 2017-06-29 No Snippets Seitter H, Koschak A.
Show Full Abstract

Channelopathies are a diverse group of human disorders that are caused by mutations in genes coding for ion channels or channel-regulating proteins. Several dozen channelopathies have been identified that involve both non-excitable cells as well as electrically active tissues like brain, skeletal and smooth muscle or the heart. In this review, we start out from the general question which ion channel genes are expressed tissue-selectively. We mined the human gene expression database Human Protein Atlas (HPA) for tissue-enriched ion channel genes and found 85 genes belonging to the ion channel families. Most of these genes were enriched in brain, testis and muscle and a complete list of the enriched ion channel genes is provided. We further focused on the tissue distribution of voltage-gated calcium channel (VGCC) genes including different brain areas and the retina based on the human gene expression from the FANTOM5 dataset. The expression data is complemented by an overview of the tissue-dependent aspects of L-type calcium channel (LTCC) function, dysfunction and pharmacology, as well as of their splice variants. Finally, we focus on the pathology of tissue-restricted LTCC channelopathies and their treatment options. This article is part of the Special Issue entitled 'Channelopathies.'

Also flagged:growth hormoneGHinsulin-like growth factor-1acromegalyGH deficiencyaging
Journal Article 2017-06-29 No Snippets Duran-Ortiz S, Brittain AL, Kopchick JJ.
Show Full Abstract

Growth hormone (GH) is a protein that is known to stimulate postnatal growth, counter regulate insulin's action and induce expression of insulin-like growth factor-1. GH exerts anabolic or catabolic effects depending upon on the targeted tissue. For instance, GH increases skeletal muscle and decreases adipose tissue mass. Our laboratory has spent the past two decades studying these effects, including the effects of GH excess and depletion, on the proteome of several mouse and human tissues. This review first discusses proteomic techniques that are commonly used for these types of studies. We then examine the proteomic differences found in mice with excess circulating GH (bGH mice) or mice with disruption of the GH receptor gene (GHR<sup>-/-</sup>). We also describe the effects of increased and decreased GH action on the proteome of adult patients with either acromegaly, GH deficiency or patients after short-term GH treatment. Finally, we explain how these proteomic studies resulted in the discovery of potential biomarkers for GH action, particularly those related with the effects of GH on aging, glucose metabolism and body composition.

Also flagged:Plasma Cell DyscrasiaAmyloid CardiomyopathyAutonomic DysfunctionSystemic amyloidosisprimary light chain amyloidosisorthostatic hypotension
Journal Article 2017-06-29 ✓ 3 Snippets Tabet R, Zaidan J, Karam B, Saouma S, Ghavami F.
In-Text Gene Mentions

…Wegener disease, andhemochromatosis, among others […

…such as amyloidosis,hemochromatosis, or even sarcoidosis.…

…The diagnosis ofhemochromatosisand sarcoidosis became…

Show Full Abstract

Systemic amyloidosis is a rare multisystem disease caused by incorrectly folded proteins that deposit pathologically in different tissues and organs of the human body. It has a very wide spectrum of clinical presentations according to the affected organ(s), and its diagnosis is commonly delayed. Cardiac involvement is the leading cause of morbidity and mortality and carries a poor prognosis, especially in primary light chain amyloidosis. Therefore any delay in the diagnosis can result in devastating outcomes for the patient. We report the case of a 65-year-old man who presented with dizziness and lightheadedness. He was found to have orthostatic hypotension and further investigations revealed the diagnosis of amyloid cardiomyopathy complicating a plasma cell dyscrasia. What is worth noting, in this case, is that the patient had cardiac amyloidosis presenting primarily as autonomic dysfunction and orthostatic hypotension, without any cardiac-specific symptoms such as heart failure or angina. This is a very unusual presentation of advanced-stage cardiac amyloidosis. This article highlights the variety of clinical presentations of cardiac amyloidosis, and focuses on the recent progress such as novel diagnostic and surveillance approaches using imaging, biomarkers, and new histological typing techniques. Current and future promising treatment options are also discussed, including methods directly targeting the amyloid deposits.

Also flagged:venous thromboembolismthrombophiliafactor V Leidenprothrombinprotein Cprotein S
Journal Article 2017-06-29 ✓ 1 Snippet Lee EJ, Dykas DJ, Leavitt AD, Camire RM, Ebberink E, García de Frutos P, Gnanasambandan K, Gu SX, Huntington JA, Lentz SR, Mertens K, Parish CR, Rezaie AR, Sayeski PP, Cromwell C, Bar N, Halene S, Neparidze N, Parker TL, Burns AJ, Dumont A, Yao X, Chaar CIO, Connors JM, Bale AE, Lee AI.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

Genetics play a significant role in venous thromboembolism (VTE), yet current clinical laboratory-based testing identifies a known heritable thrombophilia (factor V Leiden, prothrombin gene mutation G20210A, or a deficiency of protein C, protein S, or antithrombin) in only a minority of VTE patients. We hypothesized that a substantial number of VTE patients could have lesser-known thrombophilia mutations. To test this hypothesis, we performed whole-exome sequencing (WES) in 64 patients with VTE, focusing our analysis on a novel 55-gene extended thrombophilia panel that we compiled. Our extended thrombophilia panel identified a probable disease-causing genetic variant or variant of unknown significance in 39 of 64 study patients (60.9%), compared with 6 of 237 control patients without VTE (2.5%) (<i>P</i> < .0001). Clinical laboratory-based thrombophilia testing identified a heritable thrombophilia in only 14 of 54 study patients (25.9%). The majority of WES variants were either associated with thrombosis based on prior reports in the literature or predicted to affect protein structure based on protein modeling performed as part of this study. Variants were found in major thrombophilia genes, various <i>SERPIN</i> genes, and highly conserved areas of other genes with established or potential roles in coagulation or fibrinolysis. Ten patients (15.6%) had >1 variant. Sanger sequencing performed in family members of 4 study patients with and without VTE showed generally concordant results with thrombotic history. WES and extended thrombophilia testing are promising tools for improving our understanding of VTE pathogenesis and identifying inherited thrombophilias.

Also flagged:autism spectrum disordersserotonin transportercatechol-O-methyl transferaseCOMTAutism
Journal Article 2017-06-28 ✓ 3 Snippets Yang PY, Menga YJ, Li T, Huang Y.
In-Text Gene Mentions

© 2017 International Society for Autism Research, Wiley Periodicals, Inc.<h4>Lay summary</h4>Our results showed no evidence of significant association of either COMT rs4680 or 5-HTT 5-HTTLPR variants with ASD, showing that these two genes may not be major susceptible genetic factors in ASD occurrence, and may have a reciprocal action with each other in combination with environmental factors.

…to serotonin transporter (5-HTT) and catechol-O-methyl transf…

…whether COMT and5-HTTare associated with…

Show Full Abstract

Autism spectrum disorders (ASD) are related to serotonin transporter (5-HTT) and catechol-O-methyl transferase (COMT) as two most monoaminergic polymorphic variations. However, multiple studies assessing rs4680 and 5-HTTLPR variants in ASD have reported inconsistent results. Therefore, we conducted an integrated meta-analysis to combine case-control and transmission/disequilibrium test (TDT) studies to determine whether COMT and 5-HTT are associated with ASD. We searched multiple electronic databases (PubMed, EmBase and Web of Science) to identify studies assessing the rs4680 and 5-HTTLPR variants in ASD from Jan 1997 to Dec 2016. Then allelic data from case-control and TDT studies were analyzed by the Catmap package in the R software. A total of 5 studies were eligible for the meta-analysis of rs4680, including 3 case-control, 1 TDT and 1 TDT & case-control studies. Meanwhile, 22 studies of 5-HTTLPR were available, including 16 TDT, 4 case-control and 2 TDT & case-control studies. The current meta-analysis included 814 ASD cases, 741 controls and 311 families related to rs4680; 749 ASD cases, 1,118 controls and 1,861 families relevant to 5-HTTLPR were also evaluated. For rs4680, the pooled OR was 1.18 (95% CI = 0.87-1.59, P = 0.29, P<sub>heterogeneity</sub>  < 0.00001). There was no significant association of rs4680 with risk of ASD between the two subgroups. For 5-HTTLPR, the pooled OR was 1.05 (95% CI = 0.92-1.20, P = 0.4652, P<sub>heterogeneity</sub>  < 0.00001). Meanwhile, we found no significant risk in individual case-control or TDT studies. The above findings indicated that neither COMT rs4680 nor 5-HTT 5-HTTLPR polymorphism significantly affects ASD risk. Autism Res 2017, 10: 1722-1736. © 2017 International Society for Autism Research, Wiley Periodicals, Inc.<h4>Lay summary</h4>Our results showed no evidence of significant association of either COMT rs4680 or 5-HTT 5-HTTLPR variants with ASD, showing that these two genes may not be major susceptible genetic factors in ASD occurrence, and may have a reciprocal action with each other in combination with environmental factors. These findings further provide evidence that a single gene variant may not dictate autism occurrence, but possibly contributes to a specific phenotype or subtype of ASD.

Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative disorderbrain atrophysegmentationCAP
Journal Article 2017-06-28 ✓ 1 Snippet Wu D, Faria AV, Younes L, Mori S, Brown T, Johnson H, Paulsen JS, Ross CA, Miller MI, PREDICT-HD Investigators and Coordinators of the Huntington Study Group.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder that progressively affects motor, cognitive, and emotional functions. Structural MRI studies have demonstrated brain atrophy beginning many years prior to clinical onset ("premanifest" period), but the order and pattern of brain structural changes have not been fully characterized. In this study, we investigated brain regional volumes and diffusion tensor imaging (DTI) measurements in premanifest HD, and we aim to determine (1) the extent of MRI changes in a large number of structures across the brain by atlas-based analysis, and (2) the initiation points of structural MRI changes in these brain regions. We adopted a novel multivariate linear regression model to detect the inflection points at which the MRI changes begin (namely, "change-points"), with respect to the CAG-age product (CAP, an indicator of extent of exposure to the effects of CAG repeat expansion). We used approximately 300 T1-weighted and DTI data from premanifest HD and control subjects in the PREDICT-HD study, with atlas-based whole brain segmentation and change-point analysis. The results indicated a distinct topology of structural MRI changes: the change-points of the volumetric measurements suggested a central-to-peripheral pattern of atrophy from the striatum to the deep white matter; and the change points of DTI measurements indicated the earliest changes in mean diffusivity in the deep white matter and posterior white matter. While interpretation needs to be cautious given the cross-sectional nature of the data, these findings suggest a spatial and temporal pattern of spread of structural changes within the HD brain. Hum Brain Mapp 38:5035-5050, 2017. © 2017 Wiley Periodicals, Inc.

Also flagged:lung cancermelanomalung adenocarcinomacutaneous melanomaLUADprimary tumor
Journal Article 2017-06-28 No Snippets Wu M, Zang Y, Zhang S, Huang J, Ma S.
Show Full Abstract

For the prognosis of complex diseases, beyond the main effects of genetic (G) and environmental (E) factors, gene-environment (G-E) interactions also play an important role. Many approaches have been developed for detecting important G-E interactions, most of which assume that measurements are complete. In practical data analysis, missingness in E measurements is not uncommon, and failing to properly accommodate such missingness leads to biased estimation and false marker identification. In this study, we conduct G-E interaction analysis with prognosis data under an accelerated failure time (AFT) model. To accommodate missingness in E measurements, we adopt a nonparametric kernel-based data augmentation approach. With a well-designed weighting scheme, a nice "byproduct" is that the proposed approach enjoys a certain robustness property. A penalization approach, which respects the "main effects, interactions" hierarchy, is adopted for selection (of important interactions and main effects) and regularized estimation. The proposed approach has sound interpretations and a solid statistical basis. It outperforms multiple alternatives in simulation. The analysis of TCGA data on lung cancer and melanoma leads to interesting findings and models with superior prediction.

Also flagged:relateddyslexiawaterbehavioralRAS
Journal Article 2017-06-28 No Snippets Richards T, Pettet M, Askren M, Mestre Z, Grabowski T, Yagle K, Wallis P, Northey M, Abbott R, Berninger V.
Show Full Abstract

Thirteen students with and twelve students without spelling disabilities judged whether sentences (1/3 all correct spellings, 1/3 with homonym foil, 1/3 with morpheme foil) were meaningful while event-related potentials (ERPs) were measured with EGI Geodesic EEG System 300 (128-channel hydro-cell nets). For N400, Rapid Automatic Switching (RAS) correlated with comprehending sentences with homonym foils in control group but with morpheme foils in SLD group. For P600, dictated spelling correlated with comprehending sentences with morpheme foils in the control group but solving anagrams with homonym foils in the SLD group. Educational significance and neuropsychological significance of these contrasting results are discussed.

Also flagged:Ironpathogenesischronic diseasesmetabolismiron deficiencydeficiency
Journal Article 2017-06-28 No Snippets Imam MU, Zhang S, Ma J, Wang H, Wang F.
Show Full Abstract

Oxidative stress is a common denominator in the pathogenesis of many chronic diseases. Therefore, antioxidants are often used to protect cells and tissues and reverse oxidative damage. It is well known that iron metabolism underlies the dynamic interplay between oxidative stress and antioxidants in many pathophysiological processes. Both iron deficiency and iron overload can affect redox state, and these conditions can be restored to physiological conditions using iron supplementation and iron chelation, respectively. Similarly, the addition of antioxidants to these treatment regimens has been suggested as a viable therapeutic approach for attenuating tissue damage induced by oxidative stress. Notably, many bioactive plant-derived compounds have been shown to regulate both iron metabolism and redox state, possibly through interactive mechanisms. This review summarizes our current understanding of these mechanisms and discusses compelling preclinical evidence that bioactive plant-derived compounds can be both safe and effective for managing both iron deficiency and iron overload conditions.

Also flagged:HemoglobinvesiclesoxygenHbcoagulationcell proliferation
Journal Article 2017-06-28 ✓ 1 Snippet Azuma H, Fujihara M, Sakai H.
In-Text Gene Mentions

…the development ofhemochromatosis.…

Show Full Abstract

Hemoglobin vesicles (HbVs) are oxygen carriers consisting of Hb molecules and liposome in which human hemoglobin (Hb) molecules are encapsulated. Investigations of HbV biocompatibility have shown that HbVs have no significant effect on either the quality or quantity of blood components such as RBC, WBC, platelets, complements, or coagulation factors, reflecting its excellent biocompatibility. However, their effects on the immune system remain to be evaluated. HbVs might affect the function of macrophages because they accumulate in the reticuloendothelial system. Results show that splenic T cell proliferation is suppressed after injection of not only HbV but also empty liposome into rat, and show that macrophages that internalized liposomal particles are responsible for the suppression. However, the effect is transient. Antibody production is entirely unaffected. Further investigation revealed that those macrophages were similar to myeloid-derived suppressor cells (MDSCs) in terms of morphology, cell surface markers, and the immune-suppression mechanism. Considering that MDSCs appear in various pathological conditions, the appearance of MDSC-like cells might reflect the physiological immune system response against the substantial burden of liposomal microparticles. Therefore, despite the possible induction of immunosuppressive cells, HbVs are an acceptable and promising candidate for use as a blood substitute in a clinical setting.

Also flagged:biofilm formationmelioidosistranscriptional regulatorspolysaccharidesinfectionexopolysaccharide
Journal Article 2017-06-28 No Snippets Borlee GI, Plumley BA, Martin KH, Somprasong N, Mangalea MR, Islam MN, Burtnick MN, Brett PJ, Steinmetz I, AuCoin DP, Belisle JT, Crick DC, Schweizer HP, Borlee BR.
Show Full Abstract

Burkholderia pseudomallei, the causative agent of melioidosis, is an important public health threat due to limited therapeutic options for treatment. Efforts to improve therapeutics for B. pseudomallei infections are dependent on the need to understand the role of B. pseudomallei biofilm formation and its contribution to antibiotic tolerance and persistence as these are bacterial traits that prevent effective therapy. In order to reveal the genes that regulate and/or contribute to B. pseudomallei 1026b biofilm formation, we screened a sequence defined two-allele transposon library and identified 118 transposon insertion mutants that were deficient in biofilm formation. These mutants include transposon insertions in genes predicted to encode flagella, fimbriae, transcriptional regulators, polysaccharides, and hypothetical proteins. Polysaccharides are key constituents of biofilms and B. pseudomallei has the capacity to produce a diversity of polysaccharides, thus there is a critical need to link these biosynthetic genes with the polysaccharides they produce to better understand their biological role during infection. An allelic exchange deletion mutant of the entire B. pseudomallei biofilm-associated exopolysaccharide biosynthetic cluster was decreased in biofilm formation and produced a smooth colony morphology suggestive of the loss of exopolysaccharide production. Conversely, deletion of the previously defined capsule I polysaccharide biosynthesis gene cluster increased biofilm formation. Bioinformatics analyses combined with immunoblot analysis and glycosyl composition studies of the partially purified exopolysaccharide indicate that the biofilm-associated exopolysaccharide is neither cepacian nor the previously described acidic exopolysaccharide. The biofilm-associated exopolysaccharide described here is also specific to the B. pseudomallei complex of bacteria. Since this novel exopolysaccharide biosynthesis cluster is retained in B. mallei, it is predicted to have a role in colonization and infection of the host. These findings will facilitate further advances in understanding the pathogenesis of B. pseudomallei and improve diagnostics and therapeutic treatment strategies.

Also flagged:MyrceneAgingMMPsoxygenmatrix metalloproteinase-1MMP-1
Journal Article 2017-06-28 No Snippets Hwang E, Ngo HTT, Park B, Seo SA, Yang JE, Yi TH.
Show Full Abstract

Myrcene is an aromatic volatile compound that is commercially well-known as a flavor ingredient in the food industry and a fragrance in the soap and detergent industry. Given the worldwide interest in natural antiphotoaging products, we investigated the protective effects of myrcene in UVB-irradiated human dermal fibroblasts (NHDFs). NHDFs were subjected to 144[Formula: see text]mJ/cm<sup>2</sup>of UVB irradiation. The expression of intracellular reactive oxygen species (ROS), matrix metalloproteinase-1 (MMP-1), MMP-3, interleukin-6 (IL-6), transforming growth factor (TGF-[Formula: see text]1) and type I procollagen were examined. We showed that myrcene decreased the production of ROS, MMP-1, MMP-3, and IL-6, and increased TGF-[Formula: see text]1 and type I procollagen secretions. Furthermore, myrcene treatment (0.1-10[Formula: see text][Formula: see text]M) dramatically reduced the activation of MAPK-related signaling molecules such as p-ERK, p-p38, and p-JNK and AP-1 including p-c-Jun and p-c-Fos. Our data indicate that myrcene has a potential protective effect on UVB-induced human skin photoaging. Therefore, myrcene might have applications in the skincare industry.

Also flagged:ironalpha-synucleinPDmetabolismquinazolinonebinding
Journal Article 2017-06-28 ✓ 1 Snippet Finkelstein DI, Billings JL, Adlard PA, Ayton S, Sedjahtera A, Masters CL, Wilkins S, Shackleford DM, Charman SA, Bal W, Zawisza IA, Kurowska E, Gundlach AL, Ma S, Bush AI, Hare DJ, Doble PA, Crawford S, Gautier EC, Parsons J, Huggins P, Barnham KJ, Cherny RA.
In-Text Gene Mentions

…overload analogous tohemochromatosisor thalassemia in…

Show Full Abstract

Elevated iron in the SNpc may play a key role in Parkinson's disease (PD) neurodegeneration since drug candidates with high iron affinity rescue PD animal models, and one candidate, deferirpone, has shown efficacy recently in a phase two clinical trial. However, strong iron chelators may perturb essential iron metabolism, and it is not yet known whether the damage associated with iron is mediated by a tightly bound (eg ferritin) or lower-affinity, labile, iron pool. Here we report the preclinical characterization of PBT434, a novel quinazolinone compound bearing a moderate affinity metal-binding motif, which is in development for Parkinsonian conditions. In vitro, PBT434 was far less potent than deferiprone or deferoxamine at lowering cellular iron levels, yet was found to inhibit iron-mediated redox activity and iron-mediated aggregation of α-synuclein, a protein that aggregates in the neuropathology. In vivo, PBT434 did not deplete tissue iron stores in normal rodents, yet prevented loss of substantia nigra pars compacta neurons (SNpc), lowered nigral α-synuclein accumulation, and rescued motor performance in mice exposed to the Parkinsonian toxins 6-OHDA and MPTP, and in a transgenic animal model (hA53T α-synuclein) of PD. These improvements were associated with reduced markers of oxidative damage, and increased levels of ferroportin (an iron exporter) and DJ-1. We conclude that compounds designed to target a pool of pathological iron that is not held in high-affinity complexes in the tissue can maintain the survival of SNpc neurons and could be disease-modifying in PD.

Also flagged:hepatocellular carcinomaliver cirrhosisALPgadoxetic acidtumorportal hypertension
Journal Article 2017-06-28 ✓ 1 Snippet Kurucay M, Kloth C, Kaufmann S, Nikolaou K, Bösmüller H, Horger M, Thaiss WM.
In-Text Gene Mentions

…= 1) andhemochromatosis( n =…

Show Full Abstract

<h4>Background</h4>MRI and perfusion-CT (PCT) are both useful imaging techniques for detection and characterization of liver lesions. The aim of this study was to compare the diagnostic accuracy of imaging parameters derived from PCT and gadoxetic acid-enhanced MRI in patients with hepatocellular carcinoma (HCC).<h4>Methods</h4>36 patients with liver cirrhosis and a total of 67 lesions referred to our hospital for multi-parametric diagnosis of HCC-suspected liver lesions in the setting of liver cirrhosis were prospectively enrolled and underwent PCT and MRI. HCC diagnosis was confirmed either by histology (n = 60) or interval growth (n = 7). For PCT, mean/max blood flow (BF), blood volume (BV), k-trans, arterial liver perfusion (ALP), portal venous perfusion (PVP) and hepatic perfusion index (HPI) were quantified. Two readers identified the lesions based on single maps each being blinded to the number of lesions. MRI-protocol included fat-suppressed T1w-VIBE sequences obtained before, 2, 5, 10 and 20 min after the injection of gadoxetic acid as well as non-enhanced coronal HASTE, axial T1w-VIBE, fat-suppressed T2w-TSE and DWI. Quantitative analysis was performed using enhancement ratios between tumor and liver parenchyma for post-contrast in the hepatobiliary phase (RIR<sub>HB</sub>), arterial (ER<sub>a</sub>) and late-venous (ER<sub>v</sub>) phases as well as signal intensity ratios (liver/parenchyma) on T1w (RIR<sub>T1</sub>) and T2w (RIR<sub>T2</sub>).<h4>Results</h4>In PCT analysis, all lesions exhibited high BF<sub>max</sub> values (63-250 mL/100 g tissue) and were visible on HPI maps with high degrees of arterial blood supply of (HPI > 96%). In MRI, RIR<sub>HB</sub> was negative in 8/67. 12/67 HCCs were missed on DWI. 46/67 HCCs showed wash-in and 47/67 HCC showed wash-out of contrast agent. 6/67 HCCs were missed on T1w and 11/67 were missed on T2w-sequences when analyzed separately, while analysis of multiparametric MRI combining typical enhancement pattern, visibility on hepatobiliary phase and T1w-images the same number of lesions as PCT irrespective of their size (1-19 cm) were detected. Quantification of early enhancement by ER<sub>a</sub> or ER<sub>v</sub> did not improve detection rates.<h4>Conclusions</h4>Perfusion-CT and gadoxetic acid-enhanced MRI were comparable in detecting HCC lesions. For PCT a mean HPI > 96% proved to be a very robust parameter for detection and characterization of HCC.

Also flagged:RhoASpinal Cord InjurySynaptogenesistranscription factorssynthesisgrowth cone-related factors
Journal Article 2017-06-28 ✓ 1 Snippet Devaux S, Cizkova D, Mallah K, Karnoub MA, Laouby Z, Kobeissy F, Blasko J, Nataf S, Pays L, Mériaux C, Fournier I, Salzet M.
In-Text Gene Mentions

neuronal growth regulator 1

Show Full Abstract

The therapeutic use of RhoA inhibitors (RhoAi) has been experimentally tested in spinal cord injury (SCI). In order to decipher the underlying molecular mechanisms involved in such a process, an <i>in vitro</i> neuroproteomic-systems biology platform was developed in which the pan-proteomic profile of the dorsal root ganglia (DRG) cell line ND7/23 DRG was assessed in a large array of culture conditions using RhoAi and/or conditioned media obtained from SCI <i>ex vivo</i> derived spinal cord slices. A fine mapping of the spatio-temporal molecular events of the RhoAi treatment in SCI was performed. The data obtained allow a better understanding of regeneration/degeneration induced above and below the lesion site. Results notably showed a time-dependent alteration of the transcription factors profile along with the synthesis of growth cone-related factors (receptors, ligands, and signaling pathways) in RhoAi treated DRG cells. Furthermore, we assessed in a rat SCI model the <i>in vivo</i> impact of RhoAi treatment administered <i>in situ</i> via alginate scaffold that was combined with FK506 delivery. The improved recovery of locomotion was detected only at the early postinjury time points, whereas after overall survival a dramatic increase of synaptic contacts on outgrowing neurites in affected segments was observed. We validate these results by <i>in vivo</i> proteomic studies along the spinal cord segments from tissue and secreted media analyses, confirming the increase of the synaptogenesis expression factors under RhoAi treatment. Taken together, we demonstrate that RhoAi treatment seems to be useful to stimulate neurite outgrowth in both <i>in vitro</i> as well <i>in vivo</i> environments. However, for <i>in vivo</i> experiments there is a need for sustained delivery regiment to facilitate axon regeneration and promote synaptic reconnections with appropriate target neurons also at chronic phase, which in turn may lead to higher assumption for functional improvement.

Also flagged:gene expressionreverse transcriptasepolytetrafluoroethyleneRNasepolystyreneGelatin
Journal Article 2017-06-28 No Snippets Yoda T, Hosokawa M, Takahashi K, Sakanashi C, Takeyama H, Kambara H.
Show Full Abstract

Site-specific gene expression analyses are important for understanding tissue functions. Despite rapid developments in DNA-related technologies, the site-specific analysis of whole genome expression for a tissue remains challenging. Thus, a new tool is required for capturing multiple tissue micro-dissections or single cells while retaining the positional information. Here, we describe the development of such a system, which can pick up micro-dissections by punching a tissue repeatedly in a very short period, e.g., 5 s/sampling cycle. A photo of the punched tissue provides information on the dissected positions, allowing site-specific gene expression analysis. We demonstrate the site-specific analysis of a frozen tissue slice of mouse brain by analyzing many micro-dissections produced from the tissue at a 300-μm pitch. The site-specific analysis provided new insights into the gene expression profiles in a tissue and on tissue functions. The analysis of site-specific whole genome expression may therefore, open new avenues in life science.

Also flagged:fetal hypothyroidismgene expressionThyroid hormone deficiencyintrauterine growth restrictionIUGRFH
Journal Article 2017-06-28 ✓ 2 Snippets Yousefzadeh N, Jeddi S, Ghiasi R, Alipour MR.
In-Text Gene Mentions

…region Y-box 6 (Sox6), and purine-rich element-bin…

…(74%), Thrap1 (47%),Sox6(49%), and Purβ…

Show Full Abstract

Thyroid hormone deficiency during fetal life (fetal hypothyroidism) causes intrauterine growth restriction (IUGR). Fetal hypothyroidism (FH) could attenuate normal cardiac functions in the later life of the offspring rats. The aim of this study was to evaluate the contribution of myomiR network and its target gene expression in cardiac dysfunction in fetal hypothyroid rats. Six Pregnant female rats were divided into two groups: Control consumed tap water, and the hypothyroid group received water containing 0.025% 6-propyl-2-thiouracil during gestation. Hearts from male offspring rats in adulthood (month 3) were tested with Langendorff apparatus for measuring hemodynamic parameters. Expressions of miR-208a, -208b, and -499 and its target genes including thyroid hormone receptor 1 (Thrap1), sex-determining region Y-box 6 (Sox6), and purine-rich element-binding protein β (Purβ) were measured by qPCR. FH rats had lower LVDP (%20), +dp/dt (%26), -dp/dt (%20), and heart rate (%21) than controls. FH rats at month 3 had a higher expression of β-MHC (190%), Myh7b (298%), and lower expression of α-MHC (36%) genes in comparison with controls. FH rats at month 3 had a higher expression of miR-499 (520%) and miR-208b (439%) and had lower expression of miR-208a (74%), Thrap1 (47%), Sox6 (49%), and Purβ (45%) compared with controls. Our results showed that thyroid hormone deficiency during fetal life changes the pattern of gene expression of myomiR network and its target genes in fetal heart, which, in turn, resulted in increased β-MHC expression and associated cardiac dysfunction in adulthood.

Also flagged:sodiumthrombinfibrinogenvWFprothrombinTFPI
Journal Article 2017-06-28 ✓ 1 Snippet Zhang D, Qu J, Xiong M, Qiao Y, Wang D, Liu F, Li D, Hu M, Zhang J, Wang F, Zhao X, Shi C.
In-Text Gene Mentions

…Anxa5, Vwf, Serpine1,Ptgis, Thbd, Thbs1, Plg,…

Show Full Abstract

Trauma complicated by seawater immersion is a complex pathophysiological process with higher mortality than trauma occurring on land. This study investigated the role of vascular endothelial cells (VECs) in trauma development in a seawater environment. An open abdominal injury rat model was used. The rat core temperatures in the seawater (SW, 22°C) group and normal sodium (NS, 22°C) group declined equivalently. No rats died within 12 hours in the control and NS groups. However, the median lethal time of the rats in the SW group was only 260 minutes. Among the 84 genes involved in rat VEC biology, the genes exhibiting the high expression changes (84.62%, 11/13) on a qPCR array were associated with thrombin activity. The plasma activated partial thromboplastin time and fibrinogen and vWF levels decreased, whereas the prothrombin time and TFPI levels increased, indicating intrinsic and extrinsic coagulation pathway activation and inhibition, respectively. The plasma plasminogen, FDP, and D-dimer levels were elevated after 2 hours, and those of uPA, tPA, and PAI-1 exhibited marked changes, indicating disseminated intravascular coagulation (DIC). Additionally, multiorgan haemorrhagia was observed. It indicated that seawater immersion during trauma may increase DIC, elevating mortality. VECs injury might play an essential role in this process.

Also flagged:Female-factor infertilityfemale infertilitygene expressioncell cyclemitochondrialDDX4
Journal Article 2017-06-28 ✓ 1 Snippet Tsai TS, Johnson J, White Y, John JC.
In-Text Gene Mentions

…), huntingtin (Htt), E2F transcription…

Show Full Abstract

Female-factor infertility can be caused by poor oocyte quality and depleted ovarian reserves. Egg precursor cells (EPCs), isolated from the ovarian cortex, have the potential to be used to overcome female infertility. We aimed to define the origins of EPCs by analyzing their gene expression profiles and mtDNA content using a mini-pig model. We characterized FAC-sorted DDX4<sup>+</sup>-derived porcine EPCs by performing RNA-sequencing and determined that they utilize pathways important for cell cycle and proliferation, which supports the existence of adult mitotically active oogonial cells. Expression of the pluripotent markers <i>Sox2</i> and <i>Oct4</i>, and the primitive germ cell markers <i>Blimp1</i> and <i>Stella</i> were not detected. However, <i>Nanog</i> and <i>Ddx4</i> were expressed, as were the primitive germ cell markers <i>Fragilis</i>, <i>c-Kit</i> and <i>Tert</i>. Moreover, porcine EPCs expressed self-renewal and proliferation markers including <i>Myc</i>, <i>Esrrb</i>, <i>Id2</i>, <i>Klf4</i>, <i>Klf5</i>, <i>Stat3</i>, <i>Fgfr1</i>, <i>Fgfr2</i> and <i>Il6st</i>. The presence of <i>Zp1</i>, <i>Zp2</i>, <i>Zp3</i> and <i>Nobox</i> were not detected, indicating that porcine EPCs are not indicative of mature primordial oocytes. We performed mitochondrial DNA Next Generation Sequencing and determined that one mtDNA variant harbored by EPCs was present in oocytes, preimplantation embryos and somatic tissues over three generations in our mini-pig model indicating the potential germline origin of EPCs.

Journal Article 2017-06-28 ✓ 5 Snippets Rutherford MD, Akram A.
In-Text Gene Mentions

…ience of the Merton HTT in South West Londo…

…ld be feasible in a HTT setting with patien…

…d enable the Merton HTT to respond to servi…

…nned visit from the HTT, RTF would be sough…

…device, and 1 tablet per HTT was deployed. …

Show Full Abstract

<h4>Aims and method</h4>To discuss the methods involved in gathering real-time feedback (RTF) by a London Home Treatment Team. We hypothesized that RTF would lead to changes in service provision and improvements in patient and carer feedback. Patients were invited to provide RTF on discharge. Quantitative and qualitative data were collected and analyzed centrally by the Trust before being disseminated to the team and changes made based upon the results. Quantitative feedback on the team's performance in the first 6 months of RTF use was compared against data from the 6 months prior to March 2015 using 2-tailed <i>Z</i> tests.<h4>Results</h4>There were significant improvements in feedback around the team visiting at the agreed times (<i>P</i> = .0069) and patients feeling that they had been involved in treatment decisions (<i>P</i> = .0371).<h4>Clinical implications</h4>Real-time feedback is a potentially valuable method for obtaining patient feedback and can result in service improvements if used appropriately.

Also flagged:rumiDehaparvadiscmeniTric
Journal Article 2017-06-27 ✓ 5 Snippets Moulinier L, Ripp R, Castillo G, Poch O, Sissler M.
In-Text Gene Mentions

There is a large panel of related autosomal recessive disorders, with reports of leukodystrophy (for mutations in AARS2, DARS2, EARS2, MARS2), epileptic encephalopathy (CARS2, FARS2, PARS2, NARS2, IARS2, RARS2, TARS2, VARS2), Perrault syndrome (HARS2, LARS2), MLASA syndrome (YARS2), HUPRA syndrome (SARS2), cardiomyopathy (AARS2, KARS, GARS), hearing loss or deafness (MARS2, NARS2), or intellectual disability (RARS2, WARS2).

The first correlation between a mutation affecting a mt‐aaRS and a human disease dates back to 2007, when mutations within the DARS2 gene, coding for mt‐AspRS, were associated with a leukoencephalopathy (LBSL) (Scheper et al., 2007).

…mutations within theDARS2gene, coding for…

…mutations in theDARS2gene (Scheper et…

…is observed inDARS2(31 different mutations),…

Show Full Abstract

Numerous mutations in each of the mitochondrial aminoacyl-tRNA synthetases (aaRSs) have been implicated in human diseases. The mutations are autosomal and recessive and lead mainly to neurological disorders, although with pleiotropic effects. The processes and interactions that drive the etiology of the disorders associated with mitochondrial aaRSs (mt-aaRSs) are far from understood. The complexity of the clinical, genetic, and structural data requires concerted, interdisciplinary efforts to understand the molecular biology of these disorders. Toward this goal, we designed MiSynPat, a comprehensive knowledge base together with an ergonomic Web server designed to organize and access all pertinent information (sequences, multiple sequence alignments, structures, disease descriptions, mutation characteristics, original literature) on the disease-linked human mt-aaRSs. With MiSynPat, a user can also evaluate the impact of a possible mutation on sequence-conservation-structure in order to foster the links between basic and clinical researchers and to facilitate future diagnosis. The proposed integrated view, coupled with research on disease-related mt-aaRSs, will help to reveal new functions for these enzymes and to open new vistas in the molecular biology of the cell. The purpose of MiSynPat, freely available at http://misynpat.org, is to constitute a reference and a converging resource for scientists and clinicians.

Also flagged:major depressive disorderpsychiatric diseasemonoaminedepressioninfectionpro-inflammatory cytokines
Journal Article 2017-06-27 ✓ 1 Snippet Kopschina Feltes P, Doorduin J, Klein HC, Juárez-Orozco LE, Dierckx RA, Moriguchi-Jeckel CM, de Vries EF.
In-Text Gene Mentions

…transporter (SERT or5-HTT) and consequently 5-HT…

Show Full Abstract

Major depressive disorder (MDD) is a prevalent and disabling psychiatric disease with rates of non-responsiveness to antidepressants ranging from 30-50%. Historically, the monoamine depletion hypothesis has dominated the view on the pathophysiology of depression. However, the lack of responsiveness to antidepressants and treatment resistance suggests that additional mechanisms might play a role. Evidence has shown that a subgroup of depressive patients may have an underlying immune deregulation that could explain the lack of therapeutic benefit from antidepressants. Stimuli like inflammation and infection can trigger the activation of microglia to release pro-inflammatory cytokines, acting on two main pathways: (1) activation of the hypothalamic-pituitary adrenal axis, generating an imbalance in the serotonergic and noradrenergic circuits; (2) increased activity of the enzyme indoleamine-2,3-dioxygenase, resulting in depletion of serotonin levels and the production of quinolinic acid. If this hypothesis is proven true, the subgroup of MDD patients with increased levels of pro-inflammatory cytokines, mainly IL-6, TNF-α and IL-1β, might benefit from an anti-inflammatory intervention. Here, we discuss the pre-clinical and clinical studies that have provided support for treatment with non-steroidal anti-inflammatory drugs in depressed patients with inflammatory comorbidities or an elevated immune profile, as well as evidences for anti-inflammatory properties of standard antidepressants.

Also flagged:Vitamin CNeurodegenerative DiseasesPsychiatric Disordersmyelinsynthesiscatecholamine
Journal Article 2017-06-27 ✓ 1 Snippet Kocot J, Luchowska-Kocot D, Kiełczykowska M, Musik I, Kurzepa J.
In-Text Gene Mentions

HD is caused by a mutation (a CAG expansion) in the huntingtin gene (HTT), which results in an abnormal polyglutamine expansion in the huntingtin (HTT) protein and consequently HTT aggregation [113].

Show Full Abstract

Vitamin C (Vit C) is considered to be a vital antioxidant molecule in the brain. Intracellular Vit C helps maintain integrity and function of several processes in the central nervous system (CNS), including neuronal maturation and differentiation, myelin formation, synthesis of catecholamine, modulation of neurotransmission and antioxidant protection. The importance of Vit C for CNS function has been proven by the fact that targeted deletion of the sodium-vitamin C co-transporter in mice results in widespread cerebral hemorrhage and death on post-natal day one. Since neurological diseases are characterized by increased free radical generation and the highest concentrations of Vit C in the body are found in the brain and neuroendocrine tissues, it is suggested that Vit C may change the course of neurological diseases and display potential therapeutic roles. The aim of this review is to update the current state of knowledge of the role of vitamin C on neurodegenerative diseases including Alzheimer's disease, Parkinson's disease, Huntington's disease, multiple sclerosis and amyotrophic sclerosis, as well as psychiatric disorders including depression, anxiety and schizophrenia. The particular attention is attributed to understanding of the mechanisms underlying possible therapeutic properties of ascorbic acid in the presented disorders.

Also flagged:fundusRDH5variegate porphyriaPPOXFHcancer
Journal Article 2017-06-27 ✓ 1 Snippet Vassy JL, Christensen KD, Schonman EF, Blout CL, Robinson JO, Krier JB, Diamond PM, Lebo M, Machini K, Azzariti DR, Dukhovny D, Bates DW, MacRae CA, Murray MF, Rehm HL, McGuire AL, Green RC, MedSeq Project.
In-Text Gene Mentions

HFE

Show Full Abstract

<h4>Background</h4>Whole-genome sequencing (WGS) in asymptomatic adults might prevent disease but increase health care use without clinical value.<h4>Objective</h4>To describe the effect on clinical care and outcomes of adding WGS to standardized family history assessment in primary care.<h4>Design</h4>Pilot randomized trial. (ClinicalTrials.gov: NCT01736566).<h4>Setting</h4>Academic primary care practices.<h4>Participants</h4>9 primary care physicians (PCPs) and 100 generally healthy patients recruited at ages 40 to 65 years.<h4>Intervention</h4>Patients were randomly assigned to receive a family history report alone (FH group) or in combination with an interpreted WGS report (FH + WGS group), which included monogenic disease risk (MDR) results (associated with Mendelian disorders), carrier variants, pharmacogenomic associations, and polygenic risk estimates for cardiometabolic traits. Each patient met with his or her PCP to discuss the report.<h4>Measurements</h4>Clinical outcomes and health care use through 6 months were obtained from medical records and audio-recorded discussions between PCPs and patients. Patients' health behavior changes were surveyed 6 months after receiving results. A panel of clinician-geneticists rated the appropriateness of how PCPs managed MDR results.<h4>Results</h4>Mean age was 55 years; 58% of patients were female. Eleven FH + WGS patients (22% [95% CI, 12% to 36%]) had new MDR results. Only 2 (4% [CI, 0.01% to 15%]) had evidence of the phenotypes predicted by an MDR result (fundus albipunctatus due to RDH5 and variegate porphyria due to PPOX). Primary care physicians recommended new clinical actions for 16% (CI, 8% to 30%) of FH patients and 34% (CI, 22% to 49%) of FH + WGS patients. Thirty percent (CI, 17% to 45%) and 41% (CI, 27% to 56%) of FH and FH + WGS patients, respectively, reported making a health behavior change after 6 months. Geneticists rated PCP management of 8 MDR results (73% [CI, 39% to 99%]) as appropriate and 2 results (18% [CI, 3% to 52%]) as inappropriate.<h4>Limitation</h4>Limited sample size and ancestral and socioeconomic diversity.<h4>Conclusion</h4>Adding WGS to primary care reveals new molecular findings of uncertain clinical utility. Nongeneticist providers may be able to manage WGS results appropriately, but WGS may prompt additional clinical actions of unclear value.<h4>Primary funding source</h4>National Institutes of Health.

Also flagged:oligonucleotidesimmune responsecancerrheumatoid arthritisbindinginsulin
Journal Article 2017-06-27 No Snippets Kaczmarek JC, Kowalski PS, Anderson DG.
Show Full Abstract

The rapid expansion of the available genomic data continues to greatly impact biomedical science and medicine. Fulfilling the clinical potential of genetic discoveries requires the development of therapeutics that can specifically modulate the expression of disease-relevant genes. RNA-based drugs, including short interfering RNAs and antisense oligonucleotides, are particularly promising examples of this newer class of biologics. For over two decades, researchers have been trying to overcome major challenges for utilizing such RNAs in a therapeutic context, including intracellular delivery, stability, and immune response activation. This research is finally beginning to bear fruit as the first RNA drugs gain FDA approval and more advance to the final phases of clinical trials. Furthermore, the recent advent of CRISPR, an RNA-guided gene-editing technology, as well as new strides in the delivery of messenger RNA transcribed in vitro, have triggered a major expansion of the RNA-therapeutics field. In this review, we discuss the challenges for clinical translation of RNA-based therapeutics, with an emphasis on recent advances in delivery technologies, and present an overview of the applications of RNA-based drugs for modulation of gene/protein expression and genome editing that are currently being investigated both in the laboratory as well as in the clinic.

Also flagged:HNF4αironinflammatory responsesoxygenIOdextran
Journal Article 2017-06-27 ✓ 2 Snippets Li M, Tang Y, Wu L, Mo F, Wang X, Li H, Qi R, Zhang H, Srivastava A, Ling C.
In-Text Gene Mentions

…a genetic knockout (Hfe−/− ) mouse…

Hfe

Show Full Abstract

Hepatic iron overload (IO) is a major complication of transfusional therapy. It was generally thought that IO triggers substantial inflammatory responses by producing reactive oxygen species in hepatic macrophages. Recently, a decrease in microRNA-122 (miR-122) expression was observed in a genetic knockout (Hfe<sup>-/-</sup>) mouse model of IO. Because hepatocyte-enriched miR-122 is a key regulator of multiple hepatic pathways, including inflammation, it is of interest whether hepatocyte directly contributes to IO-mediated hepatic inflammation. Here, we report that IO induced similar inflammatory responses in human primary hepatocytes and Thp-1-derived macrophages. In the mouse liver, IO resulted in altered expression of not only inflammatory genes but also >230 genes that are known targets of miR-122. In addition, both iron-dextran injection and a 3% carbonyl iron-containing diet led to upregulation of hepatic inflammation, which was associated with a significant reduction in HNF4α expression and its downstream target, miR-122. Interestingly, the same signaling pathway was changed in macrophage-deficient mice, suggesting that macrophages are not the only target of IO. Most importantly, hepatocyte-specific overexpression of miR-122 rescued IO-mediated hepatic inflammation. Our findings indicate the direct involvement of hepatocytes in IO-induced hepatic inflammation and are informative for developing new molecular targets and preventative therapies for patients with major hemoglobinopathy.

Also flagged:cancerRAD51RAD50cell deathGAPDHBMI1
Journal Article 2017-06-27 ✓ 1 Snippet Patel N, Garikapati KR, Pandita RK, Singh DK, Pandita TK, Bhadra U, Bhadra MP.
In-Text Gene Mentions

…a componentof thepolycomb repressiverepressive complex (PRC1)…

Show Full Abstract

The B-lymphoma Moloney murine leukemia virus insertion region-1 protein (BMI1) acts as an oncogene in various cancers, including breast cancer. Recent evidence suggests that BMI1 is rapidly recruited to sites of DNA double strand breaks where it facilitates histone H2A ubiquitination and DNA double strand break repair by homologous recombination. Here we show that miR-15a and miR-16 expression is decreased during the initial period after DNA damage where it would otherwise down-regulate BMI1, impairing DNA repair. Elevated miR-15a and miR-16 levels down-regulated BMI1 and other polycomb group proteins like RING1A, RING1B, EZH2 and also altered the expression of proteins associated with the BMI1 dependent ubiquitination pathway. Antagonizing the expression of miR-15a and miR-16, enhanced BMI1 protein levels and increased DNA repair. Further, overexpression of miR-15a and miR-16 sensitized breast cancer cells to DNA damage induced by the chemotherapeutic drug doxorubicin. Our results suggest that miR-15a and miR-16 mediate the down-regulation of BMI1, which impedes DNA repair while elevated levels can sensitize breast cancer cells to doxorubicin leading to apoptotic cell death. This data identifies a new target for manipulating DNA damage response that could impact the development of improved therapeutics for breast cancer.

Also flagged:lipidoxygenmetabolismpolymeraseheat shock protein 60HSP60
Journal Article 2017-06-27 ✓ 5 Snippets Xia X, Li G, Xing Y, Ding Y, Ren T, Kan J.
In-Text Gene Mentions

…binding protein 1 (PEBP1) and up-regulated expression…

…and peroxiredoxin 6 (PRDX6).<h4>Conclusions</h4>HSP60, P…

⭐ same-sentence co-mention

…X6).<h4>Conclusions</h4>HSP60,PEBP1, ECH, and PRDX6…

⭐ same-sentence co-mention

…PEBP1, ECH, andPRDX6may be involved…

…the regulation ofPRDX6may be related…

Show Full Abstract

<h4>Purpose</h4>Whole grain exhibits potential for regulating lipid levels, possibly because of its antioxidant activity. This study aims to investigate the antioxidant activity of whole grain highland hull-less barley (WHLB) and its effect on liver protein expression profiles in rats fed with high-fat diets.<h4>Methods</h4>Antioxidant activity of WHLB was investigated in vitro by analyzing phenolic and pentosan contents and oxygen radical absorbance capacity (ORAC). Proteins involved in lipid regulation were investigated in vivo by analyzing liver protein expression profiles in Sprague-Dawley rats fed with high-fat diet (HFD) with or without WHLB.<h4>Results</h4>WHLB possessed high total phenolic content (259.90 mg/100 g), total pentosan content (10.74 g/100 g), and ORAC values (418.05 ± 5.65 μmol/g). Rats fed with WHLB diet exhibited significantly (P < 0.05) lower liver lipid levels than those fed with the control HFD diet. Seven differentially expressed proteins were detected through liver proteome analysis and were found to be correlated with 11 pathways, including lipid metabolism, through annotation with Kyoto Encyclopedia of Genes and Genomes. Quantitative real-time polymerase chain reaction analysis showed that rats given with WHLB diet exhibited down-regulated expression of heat shock protein 60 (HSP60) and phosphatidylethanolamine binding protein 1 (PEBP1) and up-regulated expression of enoyl-coenzyme A hydratase (ECH) and peroxiredoxin 6 (PRDX6).<h4>Conclusions</h4>HSP60, PEBP1, ECH, and PRDX6 may be involved in the lipid regulatory effect of WHLB. Moreover, the regulation of PRDX6 may be related to the antioxidant activity of WHLB.

Also flagged:deathPDLRRK2genetic disorderADpathogenesis
Journal Article 2017-06-27 ✓ 1 Snippet Lee AJ, Marder K, Alcalay RN, Mejia-Santana H, Orr-Urtreger A, Giladi N, Bressman S, Wang Y.
In-Text Gene Mentions

…repeat in theHTTgene, but is…

Show Full Abstract

In genetic epidemiological studies, family history data are collected on relatives of study participants and used to estimate the age-specific risk of disease for individuals who carry a causal mutation. However, a family member's genotype data may not be collected because of the high cost of in-person interview to obtain blood sample or death of a relative. Previously, efficient nonparametric genotype-specific risk estimation in censored mixture data has been proposed without considering covariates. With multiple predictive risk factors available, risk estimation requires a multivariate model to account for additional covariates that may affect disease risk simultaneously. Therefore, it is important to consider the role of covariates in genotype-specific distribution estimation using family history data. We propose an estimation method that permits more precise risk prediction by controlling for individual characteristics and incorporating interaction effects with missing genotypes in relatives, and thus, gene-gene interactions and gene-environment interactions can be handled within the framework of a single model. We examine performance of the proposed methods by simulations and apply them to estimate the age-specific cumulative risk of Parkinson's disease (PD) in carriers of the LRRK2 G2019S mutation using first-degree relatives who are at genetic risk for PD. The utility of estimated carrier risk is demonstrated through designing a future clinical trial under various assumptions. Such sample size estimation is seen in the Huntington's disease literature using the length of abnormal expansion of a CAG repeat in the HTT gene but is less common in the PD literature. Copyright © 2017 John Wiley & Sons, Ltd.

Also flagged:ureaGAPDHCSN3PPARGLALBAbilirubin
Journal Article 2017-06-27 ✓ 2 Snippets Rosa F, Osorio JS, Trevisi E, Yanqui-Rivera F, Estill CT, Bionaz M.
In-Text Gene Mentions

MRPL39

…ribosomal protein L39 (MRPL39) ] based on…

Show Full Abstract

Mastitis is a major disease in dairy cows resulting in significant economic losses. In vitro works suggest that ruminants peroxisome proliferator-activated receptor gamma (PPAR<i>γ</i>) can aid in improving the response to mastitis and can control milk fat synthesis. The objectives of the present experiment were to test if treatment with the putative PPAR<i>γ</i> agonist 2,4-thiazolidinedione (TZD) improves (1) the response to subclinical mastitis and (2) milk fat production. Lactating goats received daily injections of 8 mg/kg BW of TZD or saline for 3 weeks. After one week of TZD injection, half of the goats in each group received intramammary infusion of <i>Strep. uberis</i> or saline in both halves for a total of 4 groups (<i>n</i> = 6/group). TZD treatment did not affect milk fat but had positive effect on milk somatic cells count, blood nonesterified fatty acids, inflammatory markers, and liver function. TZD significantly increased myeloperoxidase but did not affect leukocytes phagocytosis or insulin. TZD increased adipocytes size and had minor effect on expression of PPAR<i>γ</i> target genes in mammary epithelial cells but not in adipose tissue. Overall, TZD ameliorated the response to intramammary infection but the effect on milk fat synthesis and expression of related transcripts was less than expected.

Also flagged:zinc finger antisense 1cancerscancersolid cancersnucleotidesprotein synthesis
Journal Article 2017-06-27 ✓ 2 Snippets Liu F, Gao H, Li S, Ni X, Zhu Z.
In-Text Gene Mentions

Located on the antisense strand of the Znfx1 promoter region, lncRNA ZFAS1 suggested up-regulated tumorigenesis and advanced cancer progression.

…strand of theZnfx1promoter region, lncRNA…

Show Full Abstract

Dysregulation of long non-coding RNA zinc finger antisense 1 (ZFAS1) has been reported in many types of cancers. We performed a synthetic analysis to clarify its prognostic significance as a cancer molecular-marker. Several databases (including PubMed, Web of Science, Embase together with Wanfang and China National Knowledge Internet database) were retrieved to identify ZFAS1-related articles. A total of eight articles were included in this meta-analysis. Hazard ratios (HR) and 95% confidence intervals (CI) were applied to assess the association between ZFAS1 expression level and overall survival (OS). Odds ratios (OR) were calculated with RevMan 5.3 software to determine the relationship between ZFAS1 expression and clinicopathologic features. The pooled results of the meta-analysis indicated that high ZFAS1 expression level was positively correlated with poor OS (HR = 1.87, 95% CI: 1.38-2.36, p< 0.001) in human solid cancers. The statistical significance was also observed in subgroup analysis stratified by the cancer type, analysis method, sample size and follow-up time. Furthermore, the elevated ZFAS1 expression was significantly related to positive lymph node metastasis (OR = 4.18, 95% CI: 2.70-6.48, p< 0.001). The present results suggest that ZFAS1 might be served as a novel promising biomarker for prognosis in Chinese patients with solid cancers.

Also flagged:prostate carcinomaPCagene expressionBCRmethylationMT1E
Journal Article 2017-06-27 ✓ 5 Snippets Demidenko R, Daniunaite K, Bakavicius A, Sabaliauskaite R, Skeberdyte A, Petroska D, Laurinavicius A, Jankevicius F, Lazutka JR, Jarmalaite S.
In-Text Gene Mentions

In Kaplan-Meier analysis, GPR52 (p = 0.033), in addition to tumor stage (pT; p = 0.020) and grade group (G; p < 0.001), was a significant predictor of BCR (Figure 2A, 2B).

…< 0.001) andGPR52(p = 0.002)…

…of expression wereGPR52(FC 2.3; p…

…CHI3L2, FABP7, GHRH,GPR52, MT1E, OLR1, and…

…< 0.001) andGPR52(FC 1.7; p…

Show Full Abstract

Differentiation of indolent and aggressive prostate carcinoma (PCa) at the time of diagnosis is currently one of the major challenges. This study aimed at identification of prognostic biomarkers to aid in predicting biochemical recurrence (BCR) of the disease. Microarray-based gene expression profiling in tissues of 8 BCR and 8 No-BCR cases revealed expression differences of 455 genes, most of which were down-regulated in BCR cases. Eleven genes were selected for validation by real-time PCR in the first PCa cohort (N = 55), while seven of them were further validated in the second, independent, PCa cohort (N = 53). Down-regulation of <i>MT1E</i> (p < 0.001) and <i>GPR52</i> (p = 0.002) expression and up-regulated levels of <i>EZH2</i> (p = 0.025) were specific biomarkers of BCR in at least one of the two PCa cohorts, but only <i>MT1E</i> expression retained the independent prognostic value in a multivariate analysis (p < 0.001). DNA methylation analysis (114 PCa and 24 non-cancerous tissues) showed frequent <i>MT1E</i> methylation in PCa (p < 0.001) and was associated (p < 0.010) with the down-regulated expression in one PCa cohort. The results of our study suggest <i>MT1E</i> down-regulation as a potential feature of aggressive PCa.

Also flagged:metastatic melanomaphosphatidylethanolamine-binding protein 1gene expressionphosphatidylethanolamine binding protein 1RKIPchronic inflammatory disease
Journal Article 2017-06-27 ✓ 5 Snippets Buschow SI, Ramazzotti M, Reinieren-Beeren IMJ, Heinzerling LM, Westdorp H, Stefanini I, Beltrame L, Hato SV, Ellebaek E, Gross S, Nguyen VA, Weinlich G, Ragoussis J, Baban D, Schuler-Thurner B, Svane IM, Romani N, Austyn JM, De Vries IJM, Schuler G, Cavalieri D, Figdor CG.
In-Text Gene Mentions

F) Expression of PEBP1 in blood or PBMC samples of healthy donors versus patients suffering from Ankylosing spondylitis (AS; GDS5231), Schnitzler syndrome (SS; GSE70019) and rheumatoid arthritis (RA; GDS3794) as retrieved using GEO2R.

Although we discovered a similar favorable association between high PEBP1 expression and survival, our finding is on white blood cells, not on tumor cells.

PEBP1 has previously been described to modulate several major cancer and inflammatory signaling pathways [31–34].

It remains to be determined whether PEBP1 is directly driving the skewing of T cell-mediated immunity towards robust anti-tumor responses, or is merely a bystander gene reflecting the state of the immune system.

Based on the molecular context in which we find PEBP1 to be expressed, we postulate that a decrease in PEBP1 may be indicative of a skewing of the (DC-vaccine-triggered) immune response towards chronic inflammation/myeloid immune suppression rather than towards an effective anti-tumor response.

Show Full Abstract

Immunotherapy for metastatic melanoma offers great promise but, to date, only a subset of patients have responded. There is an urgent need to identify ways of allocating patients to the most beneficial therapy, to increase survival and decrease therapy-associated morbidity and costs. Blood-based biomarkers are of particular interest because of their straightforward implementation in routine clinical care. We sought to identify markers for dendritic cell (DC) vaccine-based immunotherapy against metastatic melanoma through gene expression analysis of peripheral blood mononuclear cells. A large-scale microarray analysis of 74 samples from two treatment centers, taken directly after the first round of DC vaccination, was performed. We found that phosphatidylethanolamine binding protein 1 (<i>PEBP1)</i>/Raf Kinase inhibitory protein (RKIP) expression can be used to identify a significant proportion of patients who performed poorly after DC vaccination. This result was validated by q-PCR analysis on blood samples from a second cohort of 95 patients treated with DC vaccination in four different centers. We conclude that low <i>PEBP1</i> expression correlates with poor overall survival after DC vaccination. Intriguingly, this was only the case for expression of <i>PEBP1</i> after, but not prior to, DC vaccination. Moreover, the change in <i>PEBP1</i> expression upon vaccination correlated well with survival. Further analyses revealed that <i>PEBP1</i> expression positively correlated with genes involved in T cell responses but inversely correlated with genes associated with myeloid cells and aberrant inflammation including <i>STAT3, NOTCH1</i>, and <i>MAPK1</i>. Concordantly, PEBP1 inversely correlated with the myeloid/lymphoid-ratio and was suppressed in patients suffering from chronic inflammatory disease.

Also flagged:Cyclosporin ACell Cycleinflammatory disordersbone resorptionperiodontitisperiodontal diseases
Journal Article 2017-06-27 No Snippets Abbaszadeh HA, Peyvandi AA, Peyvandi AA, Sadeghi Y, Safaei A, Zamanian-Azodi M, Khoramgah MS, Rezaei-Tavirani M.
Show Full Abstract

<b>Introduction:</b> Periodontitis is a set of inflammatory disorders characterized by periodontal attachment loss and alveolar bone resorption. Because of deficiency in periodontitis mechanical therapy, this study was aimed to explore the molecular influence of the erbiumdoped: yttrium aluminum garnet (Er:YAG) laser and cyclosporin A (CsA) on human gingival fibroblasts (HGFs) for improvement in periodontal diseases therapy. <b>Methods:</b> We focused on articles that studied the proteome profiles of HGFs after treatment with laser irradiation and application of CsA. The topological features of differentially expressed proteins were analyzed using Cytoscape Version 3.4.0 followed by module selection from the protein-protein interaction (PPI) network using Cluster ONE plugin. In addition, we performed gene ontology (GO) enrichment analysis for the densely connected region and key proteins in both PPI networks. <b>Results:</b> Analysis of PPI network of Er:YAG laser irradiation on HGFs lead to introducing YWHAZ, VCP, HNRNPU, YWHAE, UBA52, CLTC, FUS and IGHG1 as key proteins while similar analysis revealed that ACAT1, CTSD, ALDOA, ANXA2, PRDX1, LGALS3, ARHGDI and EEF1A1 are the crucial proteins related to the effect of drug. GO enrichment analysis of hubbottleneck proteins of the 2 networks showed the different significant biological processes and cellular components. The functional enrichments of module of Er:YAG laser network are included as fatty acid transmembrane transport, cytokinesis, regulation of RNA splicing and asymmetric protein localization. There are not any significant clusters in network of HGF treated by CsA. <b>Conclusion:</b> The results indicate that there are 2 separate biomarker panels for the 2 treatment methods.

Also flagged:breast cancersecretionscancertrypsinpeptidesbreast cancer type 1 susceptibility protein
Journal Article 2017-06-26 ✓ 1 Snippet Shaheed SU, Tait C, Kyriacou K, Mullarkey J, Burrill W, Patterson LH, Linforth R, Salhab M, Sutton CW.
In-Text Gene Mentions

…growth factor (EGF),insulin‐like growth factors Igrowth factors I…

Show Full Abstract

<h4>Purpose</h4>Nipple secretions are protein-rich and a potential source of breast cancer biomarkers for breast cancer screening. Previous studies of specific proteins have shown limited correlation with clinicopathological features. Our aim, in this pilot study, was to investigate the intra- and interpatient protein composition of nipple secretions and the implications for their use as liquid biopsies.<h4>Experimental design</h4>Matched pairs of nipple discharge/nipple aspirate fluid (NAF, n = 15) were characterized for physicochemical properties and SDS-PAGE. Four pairs were selected for semiquantitative proteomic profiling and trypsin-digested peptides analyzed using 2D-LC Orbitrap Fusion MS. The resulting data were subject to bioinformatics analysis and statistical evaluation for functional significance.<h4>Results</h4>A total of 1990 unique proteins were identified many of which are established cancer-associated markers. Matched pairs shared the greatest similarity (average Pearson correlation coefficient of 0.94), but significant variations between individuals were observed.<h4>Conclusions and clinical relevance</h4>This was the most complete proteomic study of nipple discharge/nipple aspirate fluid to date providing a valuable source for biomarker discovery. The high level of milk proteins in healthy volunteer samples compared to the cancer patients was associated with galactorrhoea. Using matched pairs increased confidence in patient-specific protein levels but changes relating to cancer stage require investigation of a larger cohort.

Also flagged:gene expressionBMPSMADLIFSTAT3FGF2
Journal Article 2017-06-26 ✓ 1 Snippet Zimmerlin L, Park TS, Zambidis ET.
In-Text Gene Mentions

polycomb repressors

Show Full Abstract

Although human embryonic stem cells (hESCs) were first derived almost 20 years ago, it was only recently acknowledged that they share closer molecular and functional identity to postimplantation lineage-primed murine epiblast stem cells than to naïve preimplantation inner cell mass-derived mouse ESCs (mESCs). A myriad of transcriptional, epigenetic, biochemical, and metabolic attributes have now been described that distinguish naïve and primed pluripotent states in both rodents and humans. Conventional hESCs and human induced pluripotent stem cells (hiPSCs) appear to lack many of the defining hallmarks of naïve mESCs. These include important features of the naïve ground state murine epiblast, such as an open epigenetic architecture, reduced lineage-primed gene expression, and chimera and germline competence following injection into a recipient blastocyst-stage embryo. Several transgenic and chemical methods were recently reported that appear to revert conventional human PSCs to mESC-like ground states. However, it remains unclear if subtle deviations in global transcription, cell signaling dependencies, and extent of epigenetic/metabolic shifts in these various human naïve-reverted pluripotent states represent true functional differences or alternatively the existence of distinct human pluripotent states along a spectrum. In this study, we review the current understanding and developmental features of various human pluripotency-associated phenotypes and discuss potential biological mechanisms that may support stable maintenance of an authentic epiblast-like ground state of human pluripotency.

Also flagged:amino acidbindingnanomaterialsgraphenewater
Journal Article 2017-06-26 ✓ 1 Snippet Zhang L, Feng M, Zhou R, Luan B.
In-Text Gene Mentions

…the huntingtin protein (HTT-N17) exhibit appreciable diff…

Show Full Abstract

A globular protein's folded structure in its physiological environment is largely determined by its amino acid sequence. Recently, newly discovered transformer proteins as well as intrinsically disordered proteins may adopt the folding-upon-binding mechanism where their secondary structures are highly dependent on their binding partners. Due to the various applications of nanomaterials in biological sensors and potential wearable devices, it is important to discover possible conformational changes of proteins on nanomaterials. Here, through molecular dynamics simulations, we show that the first 17 residues of the huntingtin protein (HTT-N17) exhibit appreciable differences during its folding on 2D-nanomaterials, such as graphene and MoS<sub>2</sub> nanosheets. Namely, the protein is disordered on the graphene surface but is helical on the MoS<sub>2</sub> surface. Despite that the amphiphilic environment at the nanosheet-water interface promotes the folding of the amphipathic proteins (such as HTT-N17), competitions between protein-nanosheet and intra-protein interactions yield very different protein conformations. Therefore, as engineered binding partners, nanomaterials might significantly affect the structures of adsorbed proteins.

Also flagged:cancertumourcancerstumourssuppressor genesgene expression
Journal Article 2017-06-26 No Snippets Hu Z, Yau C, Ahmed AA.
Show Full Abstract

Nonsense-mediated decay (NMD) eliminates transcripts with premature termination codons. Although NMD-induced loss-of-function has been shown to contribute to the genesis of particular cancers, its global functional consequence in tumours has not been characterized. Here we develop an algorithm to predict NMD and apply it on somatic mutations reported in The Cancer Genome Atlas. We identify more than 73 K mutations that are predicted to elicit NMD (NMD-elicit). NMD-elicit mutations in tumour suppressor genes (TSGs) are associated with significant reduction in gene expression. We discover cancer-specific NMD-elicit signatures in TSGs and cancer-associated genes. Our analysis reveals a previously unrecognized dependence of hypermutated tumours on hypofunction of genes that are involved in chromatin remodelling and translation. Half of hypermutated stomach adenocarcinomas are associated with NMD-elicit mutations of the translation initiators LARP4B and EIF5B. Our results unravel strong therapeutic opportunities by targeting tumour dependencies on NMD-elicit mutations.

Also flagged:methylationosteoporosispostmenopausal osteoporosismineralmetabolismMEPE
Journal Article 2017-06-26 ✓ 1 Snippet Reppe S, Lien TG, Hsu YH, Gautvik VT, Olstad OK, Yu R, Bakke HG, Lyle R, Kringen MK, Glad IK, Gautvik KM.
In-Text Gene Mentions

SOX6

Show Full Abstract

DNA methylation affects expression of associated genes and may contribute to the missing genetic effects from genome-wide association studies of osteoporosis. To improve insight into the mechanisms of postmenopausal osteoporosis, we combined transcript profiling with DNA methylation analyses in bone. RNA and DNA were isolated from 84 bone biopsies of postmenopausal donors varying markedly in bone mineral density (BMD). In all, 2529 CpGs in the top 100 genes most significantly associated with BMD were analyzed. The methylation levels at 63 CpGs differed significantly between healthy and osteoporotic women at 10% false discovery rate (FDR). Five of these CpGs at 5% FDR could explain 14% of BMD variation. To test whether blood DNA methylation reflect the situation in bone (as shown for other tissues), an independent cohort was selected and BMD association was demonstrated in blood for 13 of the 63 CpGs. Four transcripts representing inhibitors of bone metabolism-MEPE, SOST, WIF1, and DKK1-showed correlation to a high number of methylated CpGs, at 5% FDR. Our results link DNA methylation to the genetic influence modifying the skeleton, and the data suggest a complex interaction between CpG methylation and gene regulation. This is the first study in the hitherto largest number of postmenopausal women to demonstrate a strong association among bone CpG methylation, transcript levels, and BMD/fracture. This new insight may have implications for evaluation of osteoporosis stage and susceptibility.

Also flagged:Gordon Holmes syndromesasArrhythmogenic Right Ventricular DysplasiabehaviouraltranslationalCas9
Journal Article 2017-06-26 No Snippets Meehan TF, Conte N, West DB, Jacobsen JO, Mason J, Warren J, Chen CK, Tudose I, Relac M, Matthews P, Karp N, Santos L, Fiegel T, Ring N, Westerberg H, Greenaway S, Sneddon D, Morgan H, Codner GF, Stewart ME, Brown J, Horner N, International Mouse Phenotyping Consortium, Haendel M, Washington N, Mungall CJ, Reynolds CL, Gallegos J, Gailus-Durner V, Sorg T, Pavlovic G, Bower LR, Moore M, Morse I, Gao X, Tocchini-Valentini GP, Obata Y, Cho SY, Seong JK, Seavitt J, Beaudet AL, Dickinson ME, Herault Y, Wurst W, de Angelis MH, Lloyd KCK, Flenniken AM, Nutter LMJ, Newbigging S, McKerlie C, Justice MJ, Murray SA, Svenson KL, Braun RE, White JK, Bradley A, Flicek P, Wells S, Skarnes WC, Adams DJ, Parkinson H, Mallon AM, Brown SDM, Smedley D.
Show Full Abstract

Although next-generation sequencing has revolutionized the ability to associate variants with human diseases, diagnostic rates and development of new therapies are still limited by a lack of knowledge of the functions and pathobiological mechanisms of most genes. To address this challenge, the International Mouse Phenotyping Consortium is creating a genome- and phenome-wide catalog of gene function by characterizing new knockout-mouse strains across diverse biological systems through a broad set of standardized phenotyping tests. All mice will be readily available to the biomedical community. Analyzing the first 3,328 genes identified models for 360 diseases, including the first models, to our knowledge, for type C Bernard-Soulier, Bardet-Biedl-5 and Gordon Holmes syndromes. 90% of our phenotype annotations were novel, providing functional evidence for 1,092 genes and candidates in genetically uncharacterized diseases including arrhythmogenic right ventricular dysplasia 3. Finally, we describe our role in variant functional validation with The 100,000 Genomes Project and others.

Also flagged:Diabetestype 1 diabetesobesitycarbohydratecarbohydratesmetabolic syndrome
Journal Article 2017-06-26 ✓ 1 Snippet Beyerlein A, Uusitalo UM, Virtanen SM, Vehik K, Yang J, Winkler C, Kersting M, Koletzko S, Schatz D, Aronsson CA, Elding Larsson H, Krischer JP, Ziegler AG, Norris JM, Hummel S, TEDDY Study Group.
In-Text Gene Mentions

…rs368794 (KCTD15), rs2568958 (NEGR1), rs925946 (BDNF), rs7647305…

Show Full Abstract

<h4>Objective</h4>The associations of energy, protein, carbohydrate, and fat intake with weight status up to the age of 5.5 years were prospectively assessed in The Environmental Determinants of Diabetes in the Young (TEDDY) study.<h4>Methods</h4>Food record data (over 3 days) and BMI measurements between 0.25 and 5.5 years were available from 5,563 children with an increased genetic risk for type 1 diabetes followed from shortly after birth. Odds ratios (ORs) were calculated for overweight and obesity by previous intake of energy, protein, carbohydrate, and fat with adjustment for potential confounders.<h4>Results</h4>Having overweight or obesity at the age of 5.5 years was positively associated with mean energy intake in previous age intervals (e.g., adjusted OR [95% CI] for overweight: 1.06 [1.04-1.09] per 100 kcal intake at the age of 4.5-5.0 years) and with protein intake after the age of 3.5 and 4.5 years, respectively (e.g., adjusted OR for overweight: 1.06 [1.03-1.09] per 1% of energy intake at the age of 4.5-5.0 years). The respective associations with carbohydrate and fat intake were less consistent.<h4>Conclusions</h4>These findings indicate that energy and protein intake are positively associated with increased risk for overweight in childhood but yield no evidence for potential programming effects of protein intake in infancy.

Also flagged:phosphoruswaterOrgphosphatesoxidessodium
Journal Article 2017-06-26 No Snippets Li X, Wang B, Yang T, Zhu D, Nie Z, Xu J.
Show Full Abstract

Soil phosphorus (P) fractions and runoff P concentration were measured to understand the fate of soil P entering surface runoff water during summer cropping season of different double cropping systems under two fertilizer regimes. The dominant form of runoff P was particulate P (PP). Runoff total P (TP) was higher at the vegetative growth stage and lower at the crop reproductive stage. TP and PP were derived mainly from soil Olsen-P, Al-P and Fe-P and amounts increased with sediment content in runoff water. Runoff P discharge was closely related to the changes in soil P forms. Soil Olsen-P, mainly consisting of some Ca2-P and Al-P, was increased by elevating fertilizer rate. Along with crop growth, there were active interconversions among Olsen-P, Org-P, Fe-P and O-Al-P in the soil, and some available P converted into Ca10-P, with O-Fe-P possibly being a transitional form for this conversion. The oilseed rape/corn system had less runoff TP at the early stage, and wheat/sweet potato system had a lower runoff P at the late stage. Intercropping corn with sweet potato in the field with oilseed rape as a previous crop may be helpful for alleviating runoff P load during the summer in this region.

Also flagged:IronobesitydeathHIF-2αLepleptin
Journal Article 2017-06-26 ✓ 2 Snippets Ma X, Pham VT, Mori H, MacDougald OA, Shah YM, Bodary PF.
In-Text Gene Mentions

Adipocytes express common regulators of iron homeostasis including iron-regulatory proteins (e.g. ferritin and hepcidin)[15], as well as iron-related proteins with restricted tissue expression (e.g. TfR2-Transferrin Receptor 2, HFE-encoding Human hemochromatosis protein, and HAMP-hepcidin) [16].

…TfR2-Transferrin Receptor 2,HFE-encoding Human hemochromatosi…

Show Full Abstract

<h4>Background</h4>Iron dysregulation is a potential contributor to the pathology of obesity-related metabolic complications. KK/HIJ (KK) mice, a polygenic obese mouse model, have elevated serum iron levels. A subset of KK male mice display a bronzing of epididymal adipose tissue (eAT) associated with >100-fold (p<0.001) higher iron concentration.<h4>Methods</h4>To further phenotype and characterize the adipose tissue iron overload, 27 male KK mice were evaluated. 14 had bronzing eAT and 13 had normal appearing eAT. Fasting serum and tissues were collected for iron content, qPCR, histology and western blot.<h4>Results</h4>High iron levels were confirmed in bronzing eAT (High Iron group, HI) versus normal iron level (NI) in normal appearing eAT. Surprisingly, iron levels in subcutaneous and brown adipose depots were not different between the groups (p>0.05). The eAT histology revealed iron retention, macrophage clustering, tissue fibrosis, cell death as well as accumulation of HIF-2α in the high iron eAT. qPCR showed significantly decreased Lep (leptin) and AdipoQ (adiponectin), whereas Tnfα (tumor necrosis factor α), and Slc40a1 (ferroportin) were up-regulated in HI (p<0.05). Elevated HIF-2α, oxidative stress and local insulin signaling loss was also observed.<h4>Significance</h4>Our data suggest that deposition of iron in adipose tissue is limited to the epididymal depot in male KK mice. A robust adipose tissue remodeling is concomitant with the high iron concentration, which causes local adipose tissue insulin resistance.

Also flagged:prostate cancerdeathprostate-specific antigenPCatumorcancers
Journal Article 2017-06-26 No Snippets Pashaei E, Pashaei E, Ahmady M, Ozen M, Aydin N.
Show Full Abstract

<h4>Background</h4>Prostate cancer (PCa) is a leading reason of death in men and the most diagnosed malignancies in the western countries at the present time. After radical prostatectomy (RP), nearly 30% of men develop clinical recurrence with high serum prostate-specific antigen levels. An important challenge in PCa research is to identify effective predictors of tumor recurrence. The molecular alterations in microRNAs are associated with PCa initiation and progression. Several miRNA microarray studies have been conducted in recurrence PCa, but the results vary among different studies.<h4>Methods</h4>We conducted a meta-analysis of 6 available miRNA expression datasets to identify a panel of co-deregulated miRNA genes and overlapping biological processes. The meta-analysis was performed using the 'MetaDE' package, based on combined P-value approaches (adaptive weight and Fisher's methods), in R version 3.3.1.<h4>Results</h4>Meta-analysis of six miRNA datasets revealed miR-125A, miR-199A-3P, miR-28-5P, miR-301B, miR-324-5P, miR-361-5P, miR-363*, miR-449A, miR-484, miR-498, miR-579, miR-637, miR-720, miR-874 and miR-98 are commonly upregulated miRNA genes, while miR-1, miR-133A, miR-133B, miR-137, miR-221, miR-340, miR-370, miR-449B, miR-489, miR-492, miR-496, miR-541, miR-572, miR-583, miR-606, miR-624, miR-636, miR-639, miR-661, miR-760, miR-890, and miR-939 are commonly downregulated miRNA genes in recurrent PCa samples in comparison to non-recurrent PCa samples. The network-based analysis showed that some of these miRNAs have an established prognostic significance in other cancers and can be actively involved in tumor growth. Gene ontology enrichment revealed many target genes of co-deregulated miRNAs are involved in "regulation of epithelial cell proliferation" and "tissue morphogenesis". Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis indicated that these miRNAs regulate cancer pathways. The PPI hub proteins analysis identified CTNNB1 as the most highly ranked hub protein. Besides, common pathway analysis showed that TCF3, MAX, MYC, CYP26A1, and SREBF1 significantly interact with those DE miRNA genes. The identified genes have been known as tumor suppressors and biomarkers which are closely related to several cancer types, such as colorectal cancer, breast cancer, PCa, gastric, and hepatocellular carcinomas. Additionally, it was shown that the combination of DE miRNAs can assist in the more specific detection of the PCa and prediction of biochemical recurrence (BCR).<h4>Conclusion</h4>We found that the identified miRNAs through meta-analysis are candidate predictive markers for recurrent PCa after radical prostatectomy.

Also flagged:IGF2BP1insulin-like growth factor 2 mRNA-binding protein 1beta-liketransductiontranscription factorBCL11A
Journal Article 2017-06-26 ✓ 1 Snippet de Vasconcellos JF, Tumburu L, Byrnes C, Lee YT, Xu PC, Li M, Rabel A, Clarke BA, Guydosh NR, Proia RL, Miller JL.
In-Text Gene Mentions

SOX6

Show Full Abstract

Here we investigated in primary human erythroid tissues a downstream element of the heterochronic <i>let-7</i> miRNA pathway, the insulin-like growth factor 2 mRNA-binding protein 1 (IGF2BP1), for its potential to affect the hemoglobin profiles in human erythroblasts. Comparison of adult bone marrow to fetal liver lysates demonstrated developmental silencing in IGF2BP1. Erythroid-specific overexpression of IGF2BP1 caused a nearly complete and pancellular reversal of the adult pattern of hemoglobin expression toward a more fetal-like phenotype. The reprogramming of hemoglobin expression was achieved at the transcriptional level by increased <i>gamma-globin</i> combined with decreased <i>beta-globin</i> transcripts resulting in <i>gamma-globin</i> rising to 90% of total beta-like mRNA. <i>Delta-globin</i> mRNA was reduced to barely detectable levels. <i>Alpha-globin</i> levels were not significantly changed. Fetal hemoglobin achieved levels of 68.6 ± 3.9% in the IGF2BP1 overexpression samples compared with 5.0 ± 1.8% in donor matched transduction controls. In part, these changes were mediated by reduced protein expression of the transcription factor BCL11A. mRNA stability and polysome studies suggest IGF2BP1 mediates posttranscriptional loss of BCL11A. These results suggest a mechanism for chronoregulation of fetal and adult hemoglobin expression in humans.

Also flagged:type II interferon γIFNγIFNγ receptorimmune responseType II IFNautoimmune diseases
Journal Article 2017-06-26 No Snippets Green DS, Young HA, Valencia JC.
Show Full Abstract

Interferon γ (IFNγ) is a pleiotropic protein secreted by immune cells. IFNγ signals through the IFNγ receptor, a protein complex that mediates downstream signaling events. Studies into IFNγ signaling have provided insight into the general concepts of receptor signaling, receptor internalization, regulation of distinct signaling pathways, and transcriptional regulation. Although IFNγ is the central mediator of the adaptive immune response to pathogens, it has been shown to be involved in several non-infectious physiological processes. This review will provide an introduction into IFNγ signaling biology and the functional roles of IFNγ in the autoimmune response.

Also flagged:cDNARhoAaxondendritesaxonal growthneurotrophin-3
Journal Article 2017-06-26 No Snippets Takano T, Wu M, Nakamuta S, Naoki H, Ishizawa N, Namba T, Watanabe T, Xu C, Hamaguchi T, Yura Y, Amano M, Hahn KM, Kaibuchi K.
Show Full Abstract

A long-standing question in neurodevelopment is how neurons develop a single axon and multiple dendrites from common immature neurites. Long-range inhibitory signaling from the growing axon is hypothesized to prevent outgrowth of other immature neurites and to differentiate them into dendrites, but the existence and nature of this inhibitory signaling remains unknown. Here, we demonstrate that axonal growth triggered by neurotrophin-3 remotely inhibits neurite outgrowth through long-range Ca<sup>2+</sup> waves, which are delivered from the growing axon to the cell body. These Ca<sup>2+</sup> waves increase RhoA activity in the cell body through calcium/calmodulin-dependent protein kinase I. Optogenetic control of Rho-kinase combined with computational modeling reveals that active Rho-kinase diffuses to growing other immature neurites and inhibits their outgrowth. Mechanistically, calmodulin-dependent protein kinase I phosphorylates a RhoA-specific GEF, GEF-H1, whose phosphorylation enhances its GEF activity. Thus, our results reveal that long-range inhibitory signaling mediated by Ca<sup>2+</sup> wave is responsible for neuronal polarization.Emerging evidence suggests that gut microbiota influences immune function in the brain and may play a role in neurological diseases. Here, the authors offer in vivo evidence from a Drosophila model that supports a role for gut microbiota in modulating the progression of Alzheimer's disease.

Also flagged:Chd8autismcognitive impairmentgene expressionneurodevelopmental disordersneurogenesis
Journal Article 2017-06-26 ✓ 1 Snippet Gompers AL, Su-Feher L, Ellegood J, Copping NA, Riyadh MA, Stradleigh TW, Pride MC, Schaffler MD, Wade AA, Catta-Preta R, Zdilar I, Louis S, Kaushik G, Mannion BJ, Plajzer-Frick I, Afzal V, Visel A, Pennacchio LA, Dickel DE, Lerch JP, Crawley JN, Zarbalis KS, Silverman JL, Nord AS.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

The chromatin remodeling gene CHD8 represents a central node in neurodevelopmental gene networks implicated in autism. We examined the impact of germline heterozygous frameshift Chd8 mutation on neurodevelopment in mice. Chd8<sup>+/del5</sup> mice displayed normal social interactions with no repetitive behaviors but exhibited cognitive impairment correlated with increased regional brain volume, validating that phenotypes of Chd8<sup>+/del5</sup> mice overlap pathology reported in humans with CHD8 mutations. We applied network analysis to characterize neurodevelopmental gene expression, revealing widespread transcriptional changes in Chd8<sup>+/del5</sup> mice across pathways disrupted in neurodevelopmental disorders, including neurogenesis, synaptic processes and neuroimmune signaling. We identified a co-expression module with peak expression in early brain development featuring dysregulation of RNA processing, chromatin remodeling and cell-cycle genes enriched for promoter binding by Chd8, and we validated increased neuronal proliferation and developmental splicing perturbation in Chd8<sup>+/del5</sup> mice. This integrative analysis offers an initial picture of the consequences of Chd8 haploinsufficiency for brain development.

Also flagged:scaffold proteinsbrain disordersgene expressionschizophreniaautism spectrum disordersdevelopmental delay
Journal Article 2017-06-26 ✓ 1 Snippet Li J, Zhang W, Yang H, Howrigan DP, Wilkinson B, Souaiaia T, Evgrafov OV, Genovese G, Clementel VA, Tudor JC, Abel T, Knowles JA, Neale BM, Wang K, Sun F, Coba MP.
In-Text Gene Mentions

Lrrc7

Show Full Abstract

The postsynaptic density (PSD) contains a collection of scaffold proteins used for assembling synaptic signaling complexes. However, it is not known how the core-scaffold machinery associates in protein-interaction networks or how proteins encoded by genes involved in complex brain disorders are distributed through spatiotemporal protein complexes. Here using immunopurification, proteomics and bioinformatics, we isolated 2,876 proteins across 41 in vivo interactomes and determined their protein domain composition, correlation to gene expression levels and developmental integration to the PSD. We defined clusters for enrichment of schizophrenia, autism spectrum disorders, developmental delay and intellectual disability risk factors at embryonic day 14 and adult PSD in mice. Mutations in highly connected nodes alter protein-protein interactions modulating macromolecular complexes enriched in disease risk candidates. These results were integrated into a software platform, Synaptic Protein/Pathways Resource (SyPPRes), enabling the prioritization of disease risk factors and their placement within synaptic protein interaction networks.

Also flagged:transcription factorsdevelopmental disorderAscl1Lmx1bPitx3PD
Journal Article 2017-06-26 ✓ 1 Snippet Oliveira MAP, Balling R, Smidt MP, Fleming RMT.
In-Text Gene Mentions

…, 202 whileSox6expression becomes restricted…

Show Full Abstract

A specific set of brainstem nuclei are susceptible to degeneration in Parkinson's disease. We hypothesise that neuronal vulnerability reflects shared phenotypic characteristics that confer selective vulnerability to degeneration. Neuronal phenotypic specification is mainly the cumulative result of a transcriptional regulatory program that is active during the development. By manual curation of the developmental biology literature, we comprehensively reconstructed an anatomically resolved cellular developmental lineage for the adult neurons in five brainstem regions that are selectively vulnerable to degeneration in prodromal or early Parkinson's disease. We synthesised the literature on transcription factors that are required to be active, or required to be inactive, in the development of each of these five brainstem regions, and at least two differentially vulnerable nuclei within each region. Certain transcription factors, e.g., <i>Ascl1</i> and <i>Lmx1b</i>, seem to be required for specification of many brainstem regions that are susceptible to degeneration in early Parkinson's disease. Some transcription factors can even distinguish between differentially vulnerable nuclei within the same brain region, e.g., <i>Pitx3</i> is required for specification of the substantia nigra pars compacta, but not the ventral tegmental area. We do not suggest that Parkinson's disease is a developmental disorder. In contrast, we consider identification of shared developmental trajectories as part of a broader effort to identify the molecular mechanisms that underlie the phenotypic features that are shared by selectively vulnerable neurons. Systematic in vivo assessment of fate determining transcription factors should be completed for all neuronal populations vulnerable to degeneration in early Parkinson's disease.

Also flagged:Thymolisopropylmonoterpenephenolmalignant diseaseslipoprotein
Journal Article 2017-06-26 No Snippets Nagoor Meeran MF, Javed H, Al Taee H, Azimullah S, Ojha SK.
Show Full Abstract

Thymol, chemically known as 2-isopropyl-5-methylphenol is a colorless crystalline monoterpene phenol. It is one of the most important dietary constituents in thyme species. For centuries, it has been used in traditional medicine and has been shown to possess various pharmacological properties including antioxidant, free radical scavenging, anti-inflammatory, analgesic, antispasmodic, antibacterial, antifungal, antiseptic and antitumor activities. The present article presents a detailed review of the scientific literature which reveals the pharmacological properties of thymol and its multiple therapeutic actions against various cardiovascular, neurological, rheumatological, gastrointestinal, metabolic and malignant diseases at both biochemical and molecular levels. The noteworthy effects of thymol are largely attributed to its anti-inflammatory (<i>via</i> inhibiting recruitment of cytokines and chemokines), antioxidant (<i>via</i> scavenging of free radicals, enhancing the endogenous enzymatic and non-enzymatic antioxidants and chelation of metal ions), antihyperlipidemic (<i>via</i> increasing the levels of high density lipoprotein cholesterol and decreasing the levels of low density lipoprotein cholesterol and low density lipoprotein cholesterol in the circulation and membrane stabilization) (<i>via</i> maintaining ionic homeostasis) effects. This review presents an overview of the current <i>in vitro</i> and <i>in vivo</i> data supporting thymol's therapeutic activity and the challenges concerning its use for prevention and its therapeutic value as a dietary supplement or as a pharmacological agent or as an adjuvant along with current therapeutic agents for the treatment of various diseases. It is one of the potential candidates of natural origin that has shown promising therapeutic potential, pharmacological properties and molecular mechanisms as well as pharmacokinetic properties for the pharmaceutical development of thymol.

Also flagged:Amelogenesis imperfectadiseases ofenamel formationamelogenesisenamel matrix proteinsproteases
Journal Article 2017-06-26 No Snippets Smith CEL, Poulter JA, Antanaviciute A, Kirkham J, Brookes SJ, Inglehearn CF, Mighell AJ.
Show Full Abstract

Amelogenesis imperfecta (AI) is the name given to a heterogeneous group of conditions characterized by inherited developmental enamel defects. AI enamel is abnormally thin, soft, fragile, pitted and/or badly discolored, with poor function and aesthetics, causing patients problems such as early tooth loss, severe embarrassment, eating difficulties, and pain. It was first described separately from diseases of dentine nearly 80 years ago, but the underlying genetic and mechanistic basis of the condition is only now coming to light. Mutations in the gene <i>AMELX</i>, encoding an extracellular matrix protein secreted by ameloblasts during enamel formation, were first identified as a cause of AI in 1991. Since then, mutations in at least eighteen genes have been shown to cause AI presenting in isolation of other health problems, with many more implicated in syndromic AI. Some of the encoded proteins have well documented roles in amelogenesis, acting as enamel matrix proteins or the proteases that degrade them, cell adhesion molecules or regulators of calcium homeostasis. However, for others, function is less clear and further research is needed to understand the pathways and processes essential for the development of healthy enamel. Here, we review the genes and mutations underlying AI presenting in isolation of other health problems, the proteins they encode and knowledge of their roles in amelogenesis, combining evidence from human phenotypes, inheritance patterns, mouse models, and <i>in vitro</i> studies. An LOVD resource (http://dna2.leeds.ac.uk/LOVD/) containing all published gene mutations for AI presenting in isolation of other health problems is described. We use this resource to identify trends in the genes and mutations reported to cause AI in the 270 families for which molecular diagnoses have been reported by 23rd May 2017. Finally we discuss the potential value of the translation of AI genetics to clinical care with improved patient pathways and speculate on the possibility of novel treatments and prevention strategies for AI.

Also flagged:Liver fibrosischronic liver diseasesschistosome infectionhepatitis infectionmetabolic diseasealcoholism
Journal Article 2017-06-26 ✓ 1 Snippet Gao J, Qin XJ, Jiang H, Chen JF, Wang T, Zhang T, Xu SZ, Song JM.
In-Text Gene Mentions

…include viral infection,hemochromatosis, primary biliary cirrhosis,…

Show Full Abstract

Liver fibrosis is caused by liver injury induced by a number of chronic liver diseases, including schistosome infection, hepatitis infection, metabolic disease, alcoholism and cholestasis. The tissue damage occurring after injury or inflammation of the liver is a reversible lesion; however, liver fibrosis has become a worldwide problem and poses a threat to human health. The development of an effective drug for the prevention and treatment of liver fibrosis is ongoing and uses information from different occurrences of liver fibrosis. In the present study, carbon tetrachloride (CCl<sub>4</sub>)-induced metabonomic changes in serum and urine at 12 weeks were analyzed using gas chromatography-mass spectrometry (GC/MS) to investigate potential biomarkers. Liver fibrosis was induced in rats by subcutaneous injections of CCl<sub>4</sub> twice a week for 12 consecutive weeks. Histopathological changes were used to assess the successful production of a CCl<sub>4</sub>-induced liver fibrosis model. Serum and urine samples from the two groups were collected at 12 weeks. The metabolic profile changes were analyzed by GC/MS alongside principal component analysis and orthogonal projections to latent structures. Metabolic profile studies indicated that the clustering of the two groups could be separated and seven metabolites in serum and five metabolites in urine were identified. In serum, the metabolites identified included isoleucine, L-malic acid, α-copper, carnitine, hippuric acid, glutaric acid and glucose. In urine 2-hydroxy butyric acid, isoleucine, N-acetyl-β-alanine, cytidine and corticoid were identified. The present study demonstrated that the pathogenesis of liver fibrosis may be associated with the dysfunction of a number of metabolic pathways, including glucose, amino acid, P450, fatty acid, nucleic acid, water-electrolyte and glutathione biosynthesis. Assessing potential biomarkers may therefore provide novel targets and theories for the innovation of novel drugs to prevent and cure liver fibrosis.

Also flagged:RANBP10Huntington's diseaseHDcytoskeletonsintracellularRAN binding protein 10
Journal Article 2017-06-24 ✓ 5 Snippets Her LS, Mao SH, Chang CY, Cheng PH, Chang YF, Yang HI, Chen CM, Yang SH.
In-Text Gene Mentions

Huntington's disease (HD) is a human inheritable autosomal dominant disease, and this is caused by a mutation of CAG trinucleotide repeats in the exon 1 region of Huntingtin (HTT) gene 1.

To further confirm the harmful effects of RANBP10 in HD, we detected the aggregate profiling in brains of R6/2-RANBP10 double transgenic mice (D-Tg) overexpressing mutant HTT and RANBP10, and aggregates of mutant HTT were displayed in both D-Tg and R6/2 mice (Figure 4E).

Mutant HTT is involved in abnormal gene regulation, and post-transcriptional regulation of non-coding RNAs, especially microRNAs (miRNAs), has been extensively attracted in the field of HD.

…of Huntingtin (HTT) gene 1…

…RANBP10 on endogenousHTTin vivo using…

Show Full Abstract

MicroRNAs (miRNAs) play important roles in several neurobiological processes, including the development and progression of diseases. Previously, we identified that one specific miRNA, miR-196a, provides neuroprotective effects on Huntington's disease (HD), although the detailed mechanism is still unclear. Based on our bioinformatic analyses, we hypothesize miR-196a might offer neuroprotective functions through improving cytoskeletons of brain cells. Here, we show that miR-196a could enhance neuronal morphology, further ameliorating intracellular transport, synaptic plasticity, neuronal activity, and learning and memory abilities. Additionally, we found that miR-196a could suppress the expression of RAN binding protein 10 (RANBP10) through binding to its 3' untranslated region, and higher expression of RANBP10 exacerbates neuronal morphology and intracellular transport. Furthermore, miR-196a enhances neuronal morphology through suppressing RANBP10 and increasing the ability of β-tubulin polymerization. Most importantly, we observed higher expression of RANBP10 in the brains of HD transgenic mice, and higher expression of RANBP10 might exacerbate the pathological aggregates in HD. Taken together, we provide evidence that enhancement of neuronal morphology through RANBP10 is one of the neuroprotective mechanisms for miR-196a. Since miR-196a has also been reported in other neuronal diseases, this study might offer insights with regard to the therapeutic use of miR-196a in other neuronal diseases.

Also flagged:HuntingtinHydrogenglutaminesHDglutaminenucleotide
Journal Article 2017-06-23 ✓ 4 Snippets Kang H, Vázquez FX, Zhang L, Das P, Toledo-Sherman L, Luan B, Levitt M, Zhou R.
In-Text Gene Mentions

There exists strong correlation between the extended polyglutamines (polyQ) within exon-1 of Huntingtin protein (Htt) and age onset of Huntington's disease (HD); however, the underlying molecular mechanism is still poorly understood.

…of Huntingtin protein (Htt) and age onset…

…the folding ofHtt-exon-1 across five different…

Htt

Show Full Abstract

There exists strong correlation between the extended polyglutamines (polyQ) within exon-1 of Huntingtin protein (Htt) and age onset of Huntington's disease (HD); however, the underlying molecular mechanism is still poorly understood. Here we apply extensive molecular dynamics simulations to study the folding of Htt-exon-1 across five different polyQ-lengths. We find an increase in secondary structure motifs at longer Q-lengths, including β-sheet content that seems to contribute to the formation of increasingly compact structures. More strikingly, these longer Q-lengths adopt supercompact structures as evidenced by a surprisingly small power-law scaling exponent (0.22) between the radius-of-gyration and Q-length that is substantially below expected values for compact globule structures (∼0.33) and unstructured proteins (∼0.50). Hydrogen bond analyses further revealed that the supercompact behavior of polyQ is mainly due to the "glue-like" behavior of glutamine's side chains with significantly more side chain-side chain H-bonds than regular proteins in the Protein Data Bank (PDB). The orientation of the glutamine side chains also tend to be "buried" inside, explaining why polyQ domains are insoluble on their own.

Also flagged:Calcificationmetal ionspolyurethanehydroxyapatitecalciumdegradation
Journal Article 2017-06-23 No Snippets Singh C, Wang X.
Show Full Abstract

Pathologic calcification leads to structural deterioration of implant materials via stiffening, stress cracking, and other structural disintegration mechanisms, and the effect can be critical for implants intended for long-term or permanent implantation. This study demonstrates the potential of using specific metal ions (MI)s for inhibiting pathological calcification in polyurethane (PU) implants. The hypothesis of using MIs as anti-calcification agents was based on the natural calcium-antagonist role of Mg<sup>2+</sup> ions in human body, and the anti-calcification effect of Fe<sup>3+</sup> ions in bio-prosthetic heart valves has previously been confirmed. In vitro calcification results indicated that a protective covering mesh of MI-doped PU can prevent calcification by preventing hydroxyapatite crystal growth. However, microstructure and mechanical characterisation revealed oxidative degradation effects from Fe<sup>3+</sup> ions on the mechanical properties of the PU matrix. Therefore, from both a mechanical and anti-calcification effects point of view, Mg<sup>2+</sup> ions are more promising candidates than Fe<sup>3+</sup> ions. The in vitro MI release experiments demonstrated that PU microphase separation and the structural design of PU-MI matrices were important determinants of release kinetics. Increased phase separation in doped PU assisted in consistent long-term release of dissolved MIs from both hard and soft segments of the PU. The use of a composite-sandwich mesh design prevented an initial burst release which improved the late (>20 days) release rate of MIs from the matrix.

Also flagged:deathcaspaseproteasesynapsesdendritic spinesIAP
Journal Article 2017-06-23 ✓ 1 Snippet Mukherjee A, Williams DW.
In-Text Gene Mentions

It is caused by an abnormal expansion of a trinucleotide repeat coding for Glutamine (Q) in the huntingtin (htt) gene, and caspase-6 is emerging as the key caspase in HD pathogenesis.87 Caspase-3 and -6 can cleave Htt to release the N-terminal poly-Q tract, whose toxicity depends on the length of the poly-Q and its nuclear localization,88, 89, 90 which can cause transcriptional upregulation of caspase-1.91 Cognitive deficits with defects in synaptic plasticity are an early symptom of HD,92 also observed in mouse models.93, 94, 95 mHtt caused dendritic spine loss and impaired normal experience-dependent synaptic plasticity in a R6/2 HD mouse model.96 WtHtt is known to be anti-apoptotic,97, 98 but whether the presence of mHtt directly impacts caspases requires further investigation.

Show Full Abstract

Nervous systems are arguably the most fascinating and complex structures in the known universe. How they are built, changed by experience and then degenerate are some of the biggest questions in biology. Regressive phenomena, such as neuron pruning and programmed cell death, have a key role in the building and maintenance of the nervous systems. Both of these cellular mechanisms deploy the caspase family of protease enzymes. In this review, we highlight the non-apoptotic function of caspases during nervous system development, plasticity and disease, particularly focussing on their role in structural remodelling. We have classified pruning as either macropruning, where complete branches are removed, or micropruning, where individual synapses or dendritic spines are eliminated. Finally we discuss open questions and possible future directions within the field.

Also flagged:Small GTPasesmonomeric GTPasessmallGTPasevesiclecytoskeleton
Journal Article 2017-06-23 No Snippets Rivero C, Traubenik S, Zanetti ME, Blanco FA.
Show Full Abstract

The superfamily of small monomeric GTPases originated in a common ancestor of eukaryotic multicellular organisms and, since then, it has evolved independently in each lineage to cope with the environmental challenges imposed by their different life styles. Members of the small GTPase family function in the control of vesicle trafficking, cytoskeleton rearrangements and signaling during crucial biological processes, such as cell growth and responses to environmental cues. In this review, we discuss the emerging roles of these small GTPases in the pathogenic and symbiotic interactions established by plants with microorganisms present in their nearest environment, in which membrane trafficking is crucial along the different steps of the interaction, from recognition and signal transduction to nutrient exchange.

Also flagged:enteric fevereosinopeniafeverbradycardiaparatyphoid feversystemic infection
Journal Article 2017-06-23 ✓ 1 Snippet Matono T, Kutsuna S, Kato Y, Katanami Y, Yamamoto K, Takeshita N, Hayakawa K, Kanagawa S, Kaku M, Ohmagari N.
In-Text Gene Mentions

…ure, sarcoidosis, amyloidosis,hemochromatosis, collagen vascular disease,…

Show Full Abstract

<h4>Background</h4>The lack of characteristic clinical findings and accurate diagnostic tools has made the diagnosis of enteric fever difficult. We evaluated the classic signs of relative bradycardia and eosinopenia as diagnostic predictors for enteric fever among travellers who had returned from the tropics or subtropics.<h4>Methods</h4>This matched case-control study used data from 2006 to 2015 for culture-proven enteric fever patients as cases. Febrile patients (>38.3°C) with non-enteric fever, who had returned from the tropics or subtropics, were matched to the cases in a 1:3 ratio by age (±3 years), sex, and year of diagnosis as controls. Cunha's criteria were used for relative bradycardia. Absolute eosinopenia was defined as an eosinophilic count of 0/μL.<h4>Results</h4>Data from 160 patients (40 cases and 120 controls) were analysed. Cases predominantly returned from South Asia (70% versus 18%, p <0.001). Relative bradycardia (88% versus 51%, p <0.001) and absolute eosinopenia (63% versus 38%, p = 0.008) were more frequent in cases than controls. In multivariate logistic regression analysis, return from South Asia (aOR: 21.6; 95% CI: 7.17-64.9) and relative bradycardia (aOR: 11.7; 95% CI: 3.21-42.5) were independent predictors for a diagnosis of enteric fever. The positive likelihood ratio was 4.00 (95% CI: 2.58-6.20) for return from South Asia, 1.72 (95% CI: 1.39-2.13) for relative bradycardia, and 1.63 (95%CI: 1.17-2.27) for absolute eosinopenia. The negative predictive values of the three variables were notably high (83-92%);. however, positive predictive values were 35-57%.<h4>Conclusions</h4>The classic signs of relative bradycardia and eosinopenia were not specific for enteric fever; however both met the criteria for being diagnostic predictors for enteric fever. Among febrile returned travellers, relative bradycardia and eosinopenia should be re-evaluated for predicting a diagnosis of enteric fever in non-endemic areas prior to obtaining blood cultures.

Also flagged:watergene expressionInsulin-like 3Insl3solute carriersSlc45a3
Journal Article 2017-06-23 No Snippets Kordonowy L, MacManes M.
Show Full Abstract

<h4>Background</h4>The understanding of genomic and physiological mechanisms related to how organisms living in extreme environments survive and reproduce is an outstanding question facing evolutionary and organismal biologists. One interesting example of adaptation is related to the survival of mammals in deserts, where extreme water limitation is common. Research on desert rodent adaptations has focused predominantly on adaptations related to surviving dehydration, while potential reproductive physiology adaptations for acute and chronic dehydration have been relatively neglected. This study aims to explore the reproductive consequences of acute dehydration by utilizing RNAseq data in the desert-specialized cactus mouse (Peromyscus eremicus).<h4>Results</h4>We exposed 22 male cactus mice to either acute dehydration or control (fully hydrated) treatment conditions, quasimapped testes-derived reads to a cactus mouse testes transcriptome, and then evaluated patterns of differential transcript and gene expression. Following statistical evaluation with multiple analytical pipelines, nine genes were consistently differentially expressed between the hydrated and dehydrated mice. We hypothesized that male cactus mice would exhibit minimal reproductive responses to dehydration; therefore, this low number of differentially expressed genes between treatments aligns with current perceptions of this species' extreme desert specialization. However, these differentially expressed genes include Insulin-like 3 (Insl3), a regulator of male fertility and testes descent, as well as the solute carriers Slc45a3 and Slc38a5, which are membrane transport proteins that may facilitate osmoregulation.<h4>Conclusions</h4>These results suggest that in male cactus mice, acute dehydration may be linked to reproductive modulation via Insl3, but not through gene expression differences in the subset of other a priori tested reproductive hormones. Although water availability is a reproductive cue in desert-rodents exposed to chronic drought, potential reproductive modification via Insl3 in response to acute water-limitation is a result which is unexpected in an animal capable of surviving and successfully reproducing year-round without available external water sources. Indeed, this work highlights the critical need for integrative research that examines every facet of organismal adaptation, particularly in light of global climate change, which is predicted, amongst other things, to increase climate variability, thereby exposing desert animals more frequently to the acute drought conditions explored here.

Also flagged:thyroxine-binding globulinphotonsluciferaseagarosehaematoxylintrypsin
Journal Article 2017-06-23 ✓ 5 Snippets Ohmori T, Nagao Y, Mizukami H, Sakata A, Muramatsu SI, Ozawa K, Tominaga SI, Hanazono Y, Nishimura S, Nureki O, Sakata Y.
In-Text Gene Mentions

Disruption of the Serpinc1 gene by a single AAV vector system restored hemostasis in hemophilia B mice.

Phenotypic correction of hemophilia by disruption of Serpinc1

…Testzym ® SATIII(Sekisui Medical Co.,…

…by disruption ofSerpinc1

…AT gene (Serpinc1) by CRISPR/Cas9…

Show Full Abstract

Haemophilia B, a congenital haemorrhagic disease caused by mutations in coagulation factor IX gene (F9), is considered an appropriate target for genome editing technology. Here, we describe treatment strategies for haemophilia B mice using the clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 system. Administration of adeno-associated virus (AAV) 8 vector harbouring Staphylococcus aureus Cas9 (SaCas9) and single guide RNA (sgRNA) to wild-type adult mice induced a double-strand break (DSB) at the target site of F9 in hepatocytes, sufficiently developing haemophilia B. Mutation-specific gene editing by simultaneous induction of homology-directed repair (HDR) sufficiently increased FIX levels to correct the disease phenotype. Insertion of F9 cDNA into the intron more efficiently restored haemostasis via both processes of non-homologous end-joining (NHEJ) and HDR following DSB. Notably, these therapies also cured neonate mice with haemophilia, which cannot be achieved with conventional gene therapy with AAV vector. Ongoing haemophilia therapy targeting the antithrombin gene with antisense oligonucleotide could be replaced by SaCas9/sgRNA-expressing AAV8 vector. Our results suggest that CRISPR/Cas9-mediated genome editing using an AAV8 vector provides a flexible approach to induce DSB at target genes in hepatocytes and could be a good strategy for haemophilia gene therapy.

Also flagged:Eicosapentaenoic anddocosahexaenoic acidsphospholipase A2gene expressionsOmega-3 polyunsaturated fatty acidsmajor depressive disorder
Journal Article 2017-06-23 ✓ 2 Snippets Su KP, Yang HT, Chang JP, Shih YH, Guu TW, Kumaran SS, Gałecki P, Walczewska A, Pariante CM.
In-Text Gene Mentions

The gene expressions of COX-2, cPLA2, TPH-2 and 5-HTT did not differ between MDD cases and healthy controls.<h4>Conclusions</h4>EPA differentiates from DHA in clinical antidepressant efficacy and in upregulating cPLA2 gene regulations, which supports the clinical observation showing the superiority of EPA's antidepressant effects.<h4>Trial registration</h4>ClinicalTrials.gov identifier: NCT02615405.

…cPLA2, TPH-2 and5-HTTdid not differ…

Show Full Abstract

<h4>Introduction</h4>Omega-3 polyunsaturated fatty acids (PUFAs) have been proven critical in the development and management of major depressive disorder (MDD) by a number of epidemiological, clinical and preclinical studies, but the molecular mechanisms underlying this therapeutic action are yet to be understood. Although eicosapentaenoic acid (EPA) seems to be the active component of omega-3 PUFAs' antidepressant effects, the biological research about the difference of specific genetic regulations between EPA and docosahexaenoic acid (DHA), the two main components of omega-3 PUFAs, is still lacking in human subjects.<h4>Methods</h4>We conducted a 12-week randomized-controlled trial comparing the effects of EPA and DHA on gene expressions of phospholipase A2 (cPLA2) and cyclooxygenase-2 (COX2), serotonin transporter (5HTT), and Tryptophan hydroxylase 2 (TPH-2) in 27 MDD patients. In addition, the erythrocyte PUFA compositions and the candidate gene expressions were also compared between these 27 MDD patients and 22 healthy controls.<h4>Results</h4>EPA was associated with a significant decrease in HAM-D scores (CI: -13 to -21, p<0.001) and significant increases in erythrocyte levels of EPA (CI: +1.0% to +2.9%, p=0.001) and DHA (CI: +2.9% to +5.6%, p=0.007). DHA treatment was associated with a significant decrease in HAM-D scores (CI: -6 to -14, p<0.001) and a significant increase in DHA levels (CI: +0.2% to +2.3%, p=0.047), but not of EPA levels. The cPLA2 gene expression levels were significantly increased in patients received EPA (1.9 folds, p=0.038), but not DHA (1.08 folds, p=0.92). There was a tendency for both EPA and DHA groups to decrease COX-2 gene expressions. The gene expressions of COX-2, cPLA2, TPH-2 and 5-HTT did not differ between MDD cases and healthy controls.<h4>Conclusions</h4>EPA differentiates from DHA in clinical antidepressant efficacy and in upregulating cPLA2 gene regulations, which supports the clinical observation showing the superiority of EPA's antidepressant effects.<h4>Trial registration</h4>ClinicalTrials.gov identifier: NCT02615405.

Also flagged:Brn2watertranscription factorsmelanomakeratin 5aquaporin 5
Journal Article 2017-06-23 No Snippets Chee MK, Jo SK, Sohn KC, Kim CD, Lee JH, Lee YH.
Show Full Abstract

Eccrine sweat glands regulate body temperature by secreting water and electrolytes. In humans, eccrine sweat glands are ubiquitous in the skin, except in the lips and external genitalia. In mice, eccrine sweat glands are present only in the paw pad. Brn2 is a protein belonging to a large family of transcription factors. A few studies have examined Brn2 in melanoma cells and epidermal keratinocytes. This study investigated changes in the skin in the K5-Brn2 transgenic mouse, which overexpresses Brn2 and contains the keratin 5 promotor. Interestingly, the volume of eccrine sweat glands was reduced markedly in the K5-Brn2 transgenic mouse compared with the wild-type, while the expression of aquaporin 5, important molecule in sweat secretion, was increased in each sweat gland cell, probably to compensate for the reduction in gland development. However, sweating response to a pilocarpine injection in the hind paw was significantly decreased in the K5-Brn2 transgenic mouse compared with the wild-type. The paw epidermis was thicker in the K5-Brn2 transgenic mouse compared with the wild-type. Taken together, eccrine sweat gland development and sweat secretion were suppressed markedly in the K5-Brn2 transgenic mouse. These results may be associated with dominant development of the epidermis by Brn2 overexpression in the paw skin.

Also flagged:Ironhypogonadismdiabetic endocrinopathyiron overload syndromesgonadotropin-releasing hormoneGnRH
Journal Article 2017-06-23 ✓ 3 Snippets Macchi C, Steffani L, Oleari R, Lettieri A, Valenti L, Dongiovanni P, Romero-Ruiz A, Tena-Sempere M, Cariboni A, Magni P, Ruscica M.
In-Text Gene Mentions

Conversely, mice placed on IED showed a significant increment in hypothalamic GnRH gene expression (+34%) and in the intensity of GnRH-neuron innervation of the median eminence (+1.5-fold); similar changes were found in the murine model HFE<sup>-/-</sup>, resembling human hemochromatosis.<h4>Conclusions</h4>IED-fed adult male mice show severe impairment of hypothalamus-pituitary-gonadal axis without a relevant contribution of the hypothalamic compartment, which thus appears sufficiently protected from systemic iron overload.

…the murine modelHFE<sup>-/-</sup>, resembling hum…

…up>-/-</sup>, resembling humanhemochromatosis.<h4>Conclusions</h4>IED-fed a…

Show Full Abstract

<h4>Introduction</h4>Iron overload leads to multiple organ damage including endocrine organ dysfunctions. Hypogonadism is the most common non-diabetic endocrinopathy in primary and secondary iron overload syndromes.<h4>Aim</h4>To explore the molecular determinants of iron overload-induced hypogonadism with specific focus on hypothalamic derangements. A dysmetabolic male murine model fed iron-enriched diet (IED) and cell-based models of gonadotropin-releasing hormone (GnRH) neurons were used.<h4>Results</h4>Mice fed IED showed severe hypogonadism with a significant reduction of serum levels of testosterone (-83%) and of luteinizing hormone (-86%), as well as reduced body weight gain, body fat and plasma leptin. IED mice had a significant increment in iron concentration in testes and in the pituitary. Even if iron challenge of in vitro neuronal models (GN-11 and GT1-7 GnRH cells) resulted in 10- and 5-fold iron content increments, respectively, no iron content changes were found in vivo in hypothalamus of IED mice. Conversely, mice placed on IED showed a significant increment in hypothalamic GnRH gene expression (+34%) and in the intensity of GnRH-neuron innervation of the median eminence (+1.5-fold); similar changes were found in the murine model HFE<sup>-/-</sup>, resembling human hemochromatosis.<h4>Conclusions</h4>IED-fed adult male mice show severe impairment of hypothalamus-pituitary-gonadal axis without a relevant contribution of the hypothalamic compartment, which thus appears sufficiently protected from systemic iron overload.

Also flagged:segmentationgene expressiontranscriptional repressorsNotchtorproline-rich nuclear receptor co-activator
Journal Article 2017-06-23 ✓ 1 Snippet Gallagher TL, Tietz KT, Morrow ZT, McCammon JM, Goldrich ML, Derr NL, Amacher SL.
In-Text Gene Mentions

STAU1

Show Full Abstract

Vertebrate segmentation is controlled by the segmentation clock, a molecular oscillator that regulates gene expression and cycles rapidly. The expression of many genes oscillates during segmentation, including hairy/Enhancer of split-related (her or Hes) genes, which encode transcriptional repressors that auto-inhibit their own expression, and deltaC (dlc), which encodes a Notch ligand. We previously identified the tortuga (tor) locus in a zebrafish forward genetic screen for genes involved in cyclic transcript regulation and showed that cyclic transcripts accumulate post-splicing in tor mutants. Here we show that cyclic mRNA accumulation in tor mutants is due to loss of pnrc2, which encodes a proline-rich nuclear receptor co-activator implicated in mRNA decay. Using an inducible in vivo reporter system to analyze transcript stability, we find that the her1 3'UTR confers Pnrc2-dependent instability to a heterologous transcript. her1 mRNA decay is Dicer-independent and likely employs a Pnrc2-Upf1-containing mRNA decay complex. Surprisingly, despite accumulation of cyclic transcripts in pnrc2-deficient embryos, we find that cyclic protein is expressed normally. Overall, we show that Pnrc2 promotes 3'UTR-mediated decay of developmentally-regulated segmentation clock transcripts and we uncover an additional post-transcriptional regulatory layer that ensures oscillatory protein expression in the absence of cyclic mRNA decay.

Also flagged:cancercervical squamous cancerCervical canceroncogenestumorsuppressors
Journal Article 2017-06-23 No Snippets Lin W, Feng M, Li X, Zhong P, Guo A, Chen G, Xu Q, Ye Y.
Show Full Abstract

Cervical cancer is the fourth leading cause of cancer mortality in women worldwide. High‑risk human papillomavirus infection is a major cause of cervical cancer. A previous study revealed the role of different oncogenes and tumor suppressors in cervical cancer initiation and progression. However, the complicated genetic network regulating cervical cancer remains largely unknown. The present study reported transcriptome sequencing analysis of three cervical squamous cell cancer tissues and paired normal cervical tissues. Transcriptomic analysis revealed that 2,519 genes were differently expressed between cervical cancer tissues and their corresponding normal tissues. Among these, 236 differentially expressed genes (DEGs) were statistically significant, including many DEGs that were novel in cervical cancer, including gastrulation brain homeobox 2,5‑hydroxytryptamine receptor 1D and endothelin 3. These 236 significant DEGs were highly enriched in 28 functional gene ontology categories. The Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis suggested involvement of these DEGs in multiple pathways. The present study provides a transcriptome landscape of cervical cancer in Chinese patients and an improved understanding of the genetic regulatory network in cervical cancer tumorigenesis.

Also flagged:type I collagendimethylformamidedichloromethanecollagencarbodiimideamide
Journal Article 2017-06-23 No Snippets Gentile P, McColgan-Bannon K, Gianone NC, Sefat F, Dalgarno K, Ferreira AM.
Show Full Abstract

Biosynthetic materials have emerged as one of the most exciting and productive fields in polymer chemistry due to their widespread adoption and potential applications in tissue engineering (TE) research. In this work, we report the synthesis of a poly(ε-caprolactone)-<i>graft</i>-collagen (PCL-<i>g</i>-Coll) copolymer. We combine its good mechanical and biodegradable PCL properties with the great biological properties of type I collagen as a functional material for TE. PCL, previously dissolved in dimethylformamide/dichloromethane mixture, and reacted with collagen using carbodiimide coupling chemistry. The synthesised material was characterised physically, chemically and biologically, using pure PCL and PCL/Coll blend samples as control. Infrared spectroscopy evidenced the presence of amide I and II peaks for the conjugated material. Similarly, XPS evidenced the presence of C-N and N-C=O bonds (8.96 ± 2.02% and 8.52 ± 0.63%; respectively) for PCL-<i>g</i>-Coll. Static contact angles showed a slight decrease in the conjugated sample. However, good biocompatibility and metabolic activity was obtained on PCL-<i>g</i>-Coll films compared to PCL and blend controls. After 3 days of culture, fibroblasts exhibited a spindle-like morphology, spreading homogeneously along the PCL-<i>g</i>-Coll film surface. We have engineered a functional biosynthetic polymer that can be processed by electrospinning.

Also flagged:lipaseacute pancreatitispancreatic cancerglutamatetetraphenylethyleneamino
Journal Article 2017-06-23 No Snippets Shi J, Deng Q, Wan C, Zheng M, Huang F, Tang B.
Show Full Abstract

As a sudden inflammation of the pancreas, acute pancreatitis presents severe complications and a high mortality rate, despite treatment. Lipase in serum serves as an essential biomarker of acute pancreatitis and even pancreatic cancer. Therefore, developing robust, convenient and sensitive probing of lipase levels is greatly needed. In this work, we present glutamate functionalized tetraphenylethylene (TPE) as a "turn-on" fluorescent probe (<b>S1</b>) based on the aggregation-induced emission (AIE) mechanism for lipase levels with new recognition units. In heterogeneous media, the hydrophilic amino and carboxyl groups in the probe were specifically introduced to facilitate its full access to lipase at the oil-water interface and achieve an interfacially controlled AIE process. The linear response of fluorescence ranging from 0 to 80 U L<sup>-1</sup>, which included the concentration range of the lipase level in human serum, considering the dilution factor if necessary, the limit of detection as low as 0.13 U L<sup>-1</sup>, and the fast response time (7 min) were determined. The value of the apparent Michaelis-Menten constant (<i>K</i><sub>m</sub>) was obtained as 4.23 μM, which indicated superior affinity between lipase and the probe molecule. The selectivity, photostability, dynamic monitoring of the enzymatic reaction, and preliminary commercial enzyme activity screening were summarized. As far as we know, this is the fastest, easiest and most sensitive method for lipase level probing in the reported literature. Finally, probing the lipase level for the first time in real human serum samples was also conducted successfully.

bioRxiv 2017-06-23 Preprint (No Snippets API) Plooster M, Menon S, Winkle CC, Urbina FL, Monkiewicz C, Phend KD, Weinberg RJ, Gupton SL.
Show Full Abstract

Extracellular netrin-1 and its receptor DCC promote axon branching in developing cortical neurons. Netrin-dependent morphogenesis is preceded by multimerization of DCC, activation of FAK and Src family kinases, and increases in exocytic vesicle fusion, yet how these occurrences are linked is unknown. Here we demonstrate that TRIM9-dependent ubiquitination of DCC blocks the interaction with and phosphorylation of FAK. Upon netrin-1 stimulation TRIM9 promotes DCC multimerization, but TRIM9-dependent ubiquitination of DCC is reduced, which promotes an interaction with FAK and subsequent FAK activation. We found that inhibition of FAK activity blocks elevated frequencies of exocytosis in vitro and elevated axon branching in vitro and in vivo. Although FAK inhibition decreased SNARE-mediated exocytosis, assembled SNARE complexes and vesicles adjacent to the plasma membrane were increased, suggesting a novel role for FAK in the progression from assembled SNARE complexes to vesicle fusion in developing murine neurons. <h4>Abbreviations used in this paper</h4> DCC Deleted in Colorectal Cancer TRIM Tripartite Motif SFK src family kinase DCC KR non ubiquitinatable DCC mutant VAMP vesicle associated membrane protein TRIM9ΔRING TRIM9 lacking the ubiquitin ligase RING domain TRIM9ΔSPRY TRIM9 variant lacking the DCC-binding SPRY domain TIRF Total Internal Reflection Fluorescence pY phosphotyrosine FAKi pharmacological FAK inhibitor 14 FRNK FAK related non-kinase STX-1A syntaxin 1A IP immunoprecipitate

bioRxiv 2017-06-23 Preprint (No Snippets API) Lima J, Sharp T, Taylor AM, Bannerman DM, McHugh SB.
Show Full Abstract

The serotonin (5-HT) transporter (5-HTT) regulates 5-HT availability at the synapse. Low or null 5-HTT expression results in increased 5-HT availability and has been reported to produce anxious and depressive phenotypes, although this remains highly controversial despite two decades of investigation. Paradoxically, SSRIs, which also increase 5-HT availability, reduce the symptoms of anxiety and depression. An emerging ‘network plasticity’ theory of 5-HT function argues that, rather than influencing mood directly, increasing 5-HT availability enhances learning about emotionally-significant events but evidence supporting this theory is inconclusive. Here, we tested one key prediction of this theory: that increased 5-HT availability enhances aversive learning. In experiment 1, we trained 5-HTT knock-out mice (5-HTTKO), which have increased 5-HT availability, and wild-type mice (WT) on an aversive discrimination learning task in which one auditory cue was paired with an aversive outcome whereas a second auditory cue was not. Simultaneously we recorded neuronal and hemodynamic responses from the amygdala, a brain region necessary for aversive learning. 5-HTTKO mice exhibited superior discrimination learning than WTs, and had stronger theta-frequency neuronal oscillations and larger amygdala hemodynamic responses to the aversive cues, which predicted the extent of learning. In experiment 2, we found that acute SSRI treatment (in naïve non-transgenic mice), given specifically before fear learning sessions, enhanced subsequent fear memory recall. Collectively, our data demonstrate that reducing 5-HTT activity (and thereby increasing 5-HT availability) enhances amygdala responsivity to aversive events and facilitates learning for emotionally-relevant cues. Our findings support the network plasticity theory of 5-HT function.

Also flagged:fermentationto oxidative stressnitratenucleotideamino acidbiosynthesis
Journal Article 2017-06-22 ✓ 1 Snippet León-Zayas R, Peoples L, Biddle JF, Podell S, Novotny M, Cameron J, Lasken RS, Bartlett DH.
In-Text Gene Mentions

DCC

Show Full Abstract

Candidate phyla (CP) are broad phylogenetic clusters of organisms that lack cultured representatives. Included in this fraction is the candidate Parcubacteria superphylum. Specific characteristics that have been ascribed to the Parcubacteria include reduced genome size, limited metabolic potential and exclusive reliance on fermentation for energy acquisition. The study of new environmental niches, such as the marine versus terrestrial subsurface, often expands the understanding of the genetic potential of taxonomic groups. For this reason, we analyzed 12 Parcubacteria single amplified genomes (SAGs) from sediment samples collected within the Challenger Deep of the Mariana Trench, obtained during the Deepsea Challenge (DSC) Expedition. Many of these SAGs are closely related to environmental sequences obtained from deep-sea environments based on 16S rRNA gene similarity and BLAST matches to predicted proteins. DSC SAGs encode features not previously identified in Parcubacteria obtained from other habitats. These include adaptation to oxidative stress, polysaccharide modification and genes associated with respiratory nitrate reduction. The DSC SAGs are also distinguished by relative greater abundance of genes for nucleotide and amino acid biosynthesis, repair of alkylated DNA and the synthesis of mechanosensitive ion channels. These results present an expanded view of the Parcubacteria, among members residing in an ultra-deep hadal environment.

Also flagged:chromatinorganizationhistonecancergene expressionbreast cancer
Journal Article 2017-06-22 No Snippets Fritz AJ, Ghule PN, Boyd JR, Tye CE, Page NA, Hong D, Shirley DJ, Weinheimer AS, Barutcu AR, Gerrard DL, Frietze S, van Wijnen AJ, Zaidi SK, Imbalzano AN, Lian JB, Stein JL, Stein GS.
Show Full Abstract

Alterations in nuclear morphology are common in cancer progression. However, the degree to which gross morphological abnormalities translate into compromised higher-order chromatin organization is poorly understood. To explore the functional links between gene expression and chromatin structure in breast cancer, we performed RNA-seq gene expression analysis on the basal breast cancer progression model based on human MCF10A cells. Positional gene enrichment identified the major histone gene cluster at chromosome 6p22 as one of the most significantly upregulated (and not amplified) clusters of genes from the normal-like MCF10A to premalignant MCF10AT1 and metastatic MCF10CA1a cells. This cluster is subdivided into three sub-clusters of histone genes that are organized into hierarchical topologically associating domains (TADs). Interestingly, the sub-clusters of histone genes are located at TAD boundaries and interact more frequently with each other than the regions in-between them, suggesting that the histone sub-clusters form an active chromatin hub. The anchor sites of loops within this hub are occupied by CTCF, a known chromatin organizer. These histone genes are transcribed and processed at a specific sub-nuclear microenvironment termed the major histone locus body (HLB). While the overall chromatin structure of the major HLB is maintained across breast cancer progression, we detected alterations in its structure that may relate to gene expression. Importantly, breast tumor specimens also exhibit a coordinate pattern of upregulation across the major histone gene cluster. Our results provide a novel insight into the connection between the higher-order chromatin organization of the major HLB and its regulation during breast cancer progression.

Also flagged:/β-hydrolaseMESTbehavioralglucosegene expressionlipid
Journal Article 2017-06-22 ✓ 1 Snippet Anunciado-Koza RP, Manuel J, Mynatt RL, Zhang J, Kozak LP, Koza RA.
In-Text Gene Mentions

…2 genes (Negr1, Mrap )…

Show Full Abstract

Interindividual variation of white adipose tissue (WAT) expression of mesoderm specific transcript (Mest), a paternally-expressed imprinted gene belonging to the α/β-hydrolase fold protein family, becomes apparent among genetically inbred mice fed high fat diet (HFD) and is positively associated with adipose tissue expansion (ATE). To elucidate a role for MEST in ATE, mice were developed with global and adipose tissue inactivation of Mest. Mice with homozygous (MestgKO) and paternal allelic (MestpKO) inactivation of Mest were born at expected Mendelian frequencies, showed no behavioral or physical abnormalities, and did not perturb expression of the Mest locus-derived microRNA miR-335. MestpKO mice fed HFD showed reduced ATE and adipocyte hypertrophy, improved glucose tolerance, and reduced WAT expression of genes associated with hypoxia and inflammation compared to littermate controls. Remarkably, caloric intake and energy expenditure were unchanged between genotypes. Mice with adipose tissue inactivation of Mest were phenotypically similar to MestpKO, supporting a role for WAT MEST in ATE. Global profiling of WAT gene expression of HFD-fed control and MestpKO mice detected few differences between genotypes; nevertheless, genes with reduced expression in MestpKO mice were associated with immune processes and consistent with improved glucose homeostasis. Ear-derived mesenchymal stem cells (EMSC) from MestgKO mice showed no differences in adipogenic differentiation compared to control cells unless challenged by shRNA knockdown of Gpat4, an enzyme that mediates lipid accumulation in adipocytes. Reduced adipogenic capacity of EMSC from MestgKO after Gpat4 knockdown suggests that MEST facilitates lipid accumulation in adipocytes. Our data suggests that reduced diet-induced ATE in MEST-deficient mice diminishes hypoxia and inflammation in WAT leading to improved glucose tolerance and insulin sensitivity. Since inactivation of Mest in mice has minimal additional effects aside from reduction of ATE, an intervention that mitigates MEST function in adipocytes is a plausible strategy to obviate obesity and type-2-diabetes.

Also flagged:extracellularendocytosisIroncell homeostasissmall GTPaseRab5
Journal Article 2017-06-22 ✓ 1 Snippet Metzendorf C, Zeigerer A, Seifert S, Sparla R, Najafi B, Canonne-Hergaux F, Zerial M, Muckenthaler MU.
In-Text Gene Mentions

…h Hereditary Hemochromatosis (HFE, TFR2 and HJV)…

Show Full Abstract

Liver cells communicate with the extracellular environment to take up nutrients via endocytosis. Iron uptake is essential for metabolic activities and cell homeostasis. Here, we investigated the role of the endocytic system for maintaining iron homeostasis. We specifically depleted the small GTPase Rab5 in the mouse liver, causing a transient loss of the entire endo-lysosomal system. Strikingly, endosome depletion led to a fast reduction of hepatic iron levels, which was preceded by an increased abundance of the iron exporter ferroportin. Compensatory changes in livers of Rab5-depleted mice include increased expression of transferrin receptor 1 as well as reduced expression of the iron-regulatory hormone hepcidin. Serum iron indices (serum iron, free iron binding capacity and total iron binding capacity) in Rab5-KD mice were increased, consistent with an elevated splenic and hepatic iron export. Our data emphasize the critical importance of the endosomal compartments in hepatocytes to maintain hepatic and systemic iron homeostasis in vivo. The short time period (between day four and five) upon which these changes occur underscore the fast dynamics of the liver iron pool.

Also flagged:SMAD4extracellularblood vesselpathogenesisthoracic aortic aneurysm and dissectionluciferase
Journal Article 2017-06-22 ✓ 2 Snippets Wang Y, Huang HY, Bian GL, Yu YS, Ye WX, Hua F, Chen YH, Shen ZY.
In-Text Gene Mentions

…C allele inSox6binding site (Supplement…

…C allele inSox6binding site (Supplemental…

Show Full Abstract

Recent studies indicate important roles for SMAD4 in SMCs proliferation, extracellular matrix maintenance, and blood vessel remodeling. However, the genetic effects of SMAD4 in the pathogenesis of thoracic aortic aneurysm and dissection (TAAD) are still largely unknown. Here we identified a functional variant of SMAD4 which might be involved in the pathological progression of TAAD. Five tagging SNPs of SMAD4 were genotyped in 202 TAAD cases and 400 controls using MALDI-TOF. rs12455792 CT or TT variant genotypes was associated with an significantly elevated TAAD risk (adjusted OR=1.58, 95%CI=1.09-2.30) under a dominant genetic model. It was located in the 5'UTR and predicted to influence transcription activity and RNA folding of SMAD4. In luciferase reporter assay, rs12455792 T allele markedly decreased luciferase activities. Accordingly, SMAD4 expression in tissues was lower in patients with CT or TT genotypes, compared with CC. Movat's pentachrome showed that rs12455792 T allele enhanced SMCs loss and fibers accumulation. With angiotensin II induction, rate of Apoptotic SMCs was significantly higher while SMAD4 silenced. Moreover, rs12455792 T allele also increased Versican degradation via ADAMTS-4. In conclusion, this variant might promote SMCs apoptosis and proteoglycans degradation, and further facilitate the progress of TAAD. Our findings identified rs12455792 as a predictor for progression of vascular media pathological changes related thoracic aortic disorders.

Also flagged:Cellulose Acetatedegradationcelluloseacetatecell adhesionmagnesium
Journal Article 2017-06-22 No Snippets Neacsu P, Staras AI, Voicu SI, Ionascu I, Soare T, Uzun S, Cojocaru VD, Pandele AM, Croitoru SM, Miculescu F, Cotrut CM, Dan I, Cimpean A.
Show Full Abstract

Despite their good biocompatibility and adequate mechanical behavior, the main limitation of Mg alloys might be their high degradation rates in a physiological environment. In this study, a novel Mg-based alloy exhibiting an elastic modulus E = 42 GPa, Mg-1Ca-0.2Mn-0.6Zr, was synthesized and thermo-mechanically processed. In order to improve its performance as a temporary bone implant, a coating based on cellulose acetate (CA) was realized by using the dipping method. The formation of the polymer coating was demonstrated by FT-IR, XPS, SEM and corrosion behavior comparative analyses of both uncoated and CA-coated alloys. The potentiodynamic polarization test revealed that the CA coating significantly improved the corrosion resistance of the Mg alloy. Using a series of in vitro and in vivo experiments, the biocompatibility of both groups of biomaterials was assessed. In vitro experiments demonstrated that the media containing their extracts showed good cytocompatibility on MC3T3-E1 pre-osteoblasts in terms of cell adhesion and spreading, viability, proliferation and osteogenic differentiation. In vivo studies conducted in rats revealed that the intramedullary coated implant for fixation of femur fracture was more efficient in inducing bone regeneration than the uncoated one. In this manner, the present study suggests that the CA-coated Mg-based alloy holds promise for orthopedic aplications.

Also flagged:Voltage-gated calcium channelsCalcium ion channelsprostate cancercancerlung cancersCACNA1C
Journal Article 2017-06-22 ✓ 5 Snippets Phan NN, Wang CY, Chen CF, Sun Z, Lai MD, Lin YC.
In-Text Gene Mentions

Compared with normal tissue, CACNA1E showed fold changes between −3.061 and −2.027, P-values between 2.62×10−5 and 5–3.18×10−6, and a gene ranking in the top 1–3% of downregulated genes in gastric and brain cancer, respectively (Table V).

Therefore, CACNA1E was proposed as a potential therapeutic target for these specific cancer subtypes.

…CACNA1D, CACNA1A, CACNA1B,CACNA1E, CACNA1H and CACNA1I)…

…members (CACNA1A, CACNA1B,CACNA1E, CACNA1G and CACNA1I)…

…encode the L-type,CACNA1Eencodes the R-type,…

Show Full Abstract

Voltage-gated calcium channels (VGCCs) comprise five subtypes: The L-type; R-type; N-type; P/Q-type; and T-type, which are encoded by α<sub>1</sub> subunit genes. Calcium ion channels also have confirmed roles in cellular functions, including mitogenesis, proliferation, differentiation, apoptosis and metastasis. An association between VGCCs, a reduction in proliferation and an increase in apoptosis in prostate cancer cells has also been reported. Therefore, in the present study, the online clinical database Oncomine was used to identify the alterations in the mRNA expression level of VGCCs in 19 cancer subtypes. Overall, VGCC family genes exhibited under-expression in numerous types of cancer, including brain, breast, kidney and lung cancers. Notably, the majority of VGCC family members (CACNA1C, CACNA1D, CACNA1A, CACNA1B, CACNA1E, CACNA1H and CACNA1I) exhibited low expression in brain tumors, with mRNA expression levels in the top 1-9% of downregulated gene rankings. A total of 5 VGCC family members (CACNA1A, CACNA1B, CACNA1E, CACNA1G and CACNA1I) were under-expressed in breast cancer, with a gene ranking in the top 1-10% of the low-expressed genes compared with normal tissue. In kidney and lung cancers, CACNA1S, CACNA1C, CACNA1D, CACNA1A and CACNA1H exhibited low expression, with gene rankings in the top 1-8% of downregulated genes. In conclusion, the present findings may contribute to the development of new cancer treatment approaches by identifying target genes involved in specific types of cancer.

Also flagged:TRIM59non-small cell lung cancerLung cancercancerNSCLCTripartite
Journal Article 2017-06-22 No Snippets Hao L, Du B, Xi X.
Show Full Abstract

Lung cancer is the leading cause of cancer-associated mortality worldwide and its prognosis is poor. Few effective biomarkers for non-small cell lung cancer (NSCLC) have been translated into the clinical practice aiming to assist in the treatment plan design and prognosis evaluation. The aim of the present study was to identify novel potential prognostic biomarkers for NSCLC. Tripartite motif 59 (TRIM59) was identified from a microarray dataset of matched-samples and was verified as an aberrantly upregulated gene in NSCLC tissue. The expression level of TRIM59 in NSCLC subtypes was observed to be significantly increased in large cell lung carcinoma and squamous cell carcinoma as compared with that in adenocarcinoma. Its expression correlated with several clinicopathological features, including gender, smoking habits, and unfavorable tumor node and pathological stages. Notably, TRIM59 demonstrated a negative correlation with survival time and its overexpression indicated a poor prognosis in NSCLC. Furthermore, univariate and multivariate Cox's regression analyses indicated that TRIM59 was an independent prognostic factor in tumor tissue as compared with age, gender, tumor stage, node stage, and metastasis. Gene set enrichment analysis and protein-protein interaction network construction revealed that TRIM59 was associated with oncogenic mammalian target of rapamycin (MTOR) and eukaryotic initiation factor 4E (EIF4E) signaling through ubiquitin C binding. In conclusion, it was revealed that TRIM59 is a novel prognostic biomarker modulating oncogenic MTOR and EIF4E signaling pathways in NSCLC. These findings provided a novel insight into the clinical application of TRIM59. Therefore, TRIM59 may serve as an independent predictor for prognosis and a potential therapeutic target for NSCLC.

Also flagged:metalsglutathione S-transferasesGSTcatalaserhodanese3-mercaptopyruvate sulphur transferase
Journal Article 2017-06-22 ✓ 1 Snippet Aladesanmi OT, Agboola FK, Okonji RE.
In-Text Gene Mentions

…may lead tohemochromatosisand, in severe…

Show Full Abstract

<h4>Background</h4>Many natural aquatic bodies have been contaminated with heavy metals released from domestic, industrial and other anthropogenic activities. Fish are an important bioindicator species and play an important role in the monitoring of water pollution.<h4>Objectives</h4>This study shows the effect of heavy metals on the distribution of glutathione S-transferases (GST), catalase, rhodanese and 3-mercaptopyruvate sulphur transferase (3-MST) isolated from the liver, gills, fins and muscle of Clarias gariepinus.<h4>Methods</h4>Glutathione S-transferase, catalase, rhodanese and 3-mercaptopyruvate S-transferase enzymes were isolated from the liver and gills of fish by homogenization of each tissue (with specific buffers for each enzyme) and centrifugation. Serial dilutions of the crude enzymes were then assayed for residual enzymatic activities using standard enzyme assay protocol.<h4>Results</h4>The results showed heavy metals in the liver and muscle of the investigated fish. This study indicated significant accumulation of heavy metals in the tissues/organ of the fish from Ilesha, Osogbo and Yakoyo fish ponds. These are three main towns in Osun State where the major occupation is fish farming. The relationship between enzymatic activities and heavy metal content in C gariepinus tissue showed positive and significant (p<0.05) correlations between lead (Pb) and GST as well as chromium (Cr) and GST. This implies that higher concentrations of Pb and Cr induced the expression of greater GST activity in the fish tissue.<h4>Conclusions</h4>The study concluded that the pattern of response of GST, catalase, rhodanese and 3-MST activities in the various organs/tissues of C gariepinus to the heavy metals suggests that the excitation or inhibitions of their activities are organ specific. Further biochemical studies of fish tissues/organs are needed to characterize the enzymatic changes associated with heavy metal pollution.

Also flagged:MitochondrialMetabolismHuntington DiseaseHDneurodegenerative disorderbehavioral
Journal Article 2017-06-21 No Snippets Krizova J, Stufkova H, Rodinova M, Macakova M, Bohuslavova B, Vidinska D, Klima J, Ellederova Z, Pavlok A, Howland DS, Zeman J, Motlik J, Hansikova H.
Show Full Abstract

<h4>Background</h4>Huntington disease (HD) is a fatal neurodegenerative disorder involving reduced muscle coordination, mental and behavioral changes, and testicular degeneration. In order to further clarify the decreased fertility and penetration ability of the spermatozoa of transgenic HD minipig boars (TgHD), we applied a set of mitochondrial metabolism (MM) parameter measurements to this promising biological material, which can be collected noninvasively in longitudinal studies.<h4>Objective</h4>We aimed to optimize methods for MM measurements in spermatozoa and to establish possible biomarkers of HD in TgHD spermatozoa expressing the N-terminal part of mutated human huntingtin.<h4>Methods</h4>Semen samples from 12 TgHD and wild-type animals, aged 12-65 months, were obtained repeatedly during the study. Respiration was measured by polarography, MM was assessed by the detection of oxidation of radiolabeled substrates (mitochondrial energy-generating system; MEGS), and the content of the oxidative phosphorylation system subunits was detected by Western blot. Three possibly interfering factors were statistically analyzed: the effect of HD, generation and aging.<h4>Results</h4>We found 5 MM parameters which were significantly diminished in TgHD spermatozoa and propose 3 specific MEGS incubations and complex I-dependent respiration as potential biomarkers of HD in TgHD spermatozoa.<h4>Conclusions</h4>Our results suggest a link between the gain of toxic function of mutated huntingtin in TgHD spermatozoa and the observed MM and/or glycolytic impairment. We determined 4 biomarkers useful for HD phenotyping and experimental therapy monitoring studies in TgHD minipigs.

Also flagged:heparinpolysaccharidebiosynthesisuronic acidsamino sugarsester sulfates
Journal Article 2017-06-21 ✓ 5 Snippets van der Meer JY, Kellenbach E, van den Bos LJ.
In-Text Gene Mentions

…action on antithrombin (ATIII) which is an…

…PotentiatedATIII, subsequently inhibits the…

…which heparin potentiatesATIIIdiffers for these…

…The potentiation ofATIIItowards factor Xa…

…allosteric activation ofATIIIby a specific…

Show Full Abstract

The purification of heparin from offal is an old industrial process for which commercial recipes date back to 1922. Although chemical, chemoenzymatic, and biotechnological alternatives for this production method have been published in the academic literature, animal-tissue is still the sole source for commercial heparin production in industry. Heparin purification methods are closely guarded industrial secrets which are not available to the general (scientific) public. However by reviewing the academic and patent literature, we aim to provide a comprehensive overview of the general methods used in industry for the extraction of heparin from animal tissue.

Also flagged:gastrointestinal cancersgastric cancercancerHelicobacter pylori infectionalcoholcolorectal cancers
Journal Article 2017-06-21 No Snippets Mao Y, Yan C, Lu Q, Zhu M, Yu F, Wang C, Dai J, Ma H, Hu Z, Shen H, Jin G.
Show Full Abstract

Epidemiological studies have linked body mass index (BMI) with risk of gastrointestinal cancers. However, for gastric cancer, the relationship is more controversial. In particular, it is unclear whether the observed association is due to confounding or bias inherent in conventional observational studies. To investigate whether BMI is causally associated with gastric cancer risk, we applied Mendelian randomization using individual-level data from 2631 gastric cancer cases and 4373 cancer-free controls. We derived a weighted genetic risk score (wGRS) using 37 BMI-associated genetic variants as an instrumental variable. We used logistic regression to estimate odds ratios (OR) and 95% confidence intervals (CI) for associations between genetically predicted BMI and gastric cancer risk. We observed that higher genetically determined BMI was associated with increased gastric cancer risk (per standard deviation (SD) increase in the wGRS: OR=1.07, 95% CI: 1.02-1.13, P=4.94 × 10<sup>-3</sup>). Compared with individuals in the bottom tertile of the BMI wGRS, those in the top tertile had 1.14-fold (95% CI: 1.01-1.29) increased risk of developing gastric cancer. Sensitivity analyses using alternative causal inference measures demonstrated consistent association. Our study indicated that genetically high BMI was associated with increased gastric cancer risk, suggesting that high BMI may have a causal role in the etiology of gastric cancer.

Also flagged:envelopebiotinylationmembranelamin ASun2vaccinia-related kinase-2
Journal Article 2017-06-21 ✓ 5 Snippets Birendra Kc, May DG, Benson BV, Kim DI, Shivega WG, Ali MH, Faustino RS, Campos AR, Roux KJ.
In-Text Gene Mentions

A variety of functions have been reported for VRK2, including regulation of mitogen-activated protein kinase signaling (Blanco et al., 2007; Fernandez et al., 2010, 2012), apoptosis (Acar, 1982; Monsalve et al., 2013), tumor cell invasion (Vazquez-Cedeira and Lazo, 2012), expression of cyclooxygenase-2 (Vazquez-Cedeira and Lazo, 2012), and chaperonin function (Kim et al., 2014a,b).

…fy vaccinia-related kinase-2 (VRK2) as a candidate…

…we show thatVRK2phosphorylates barrier to…

…membrane targeting motif,VRK2is identified as…

…the transmembrane kinaseVRK2at the NE,…

Show Full Abstract

The nuclear envelope (NE) is critical for numerous fundamental cellular functions, and mutations in several NE constituents can lead to a heterogeneous spectrum of diseases. We used proximity biotinylation to uncover new constituents of the inner nuclear membrane (INM) by comparative BioID analysis of lamin A, Sun2 and a minimal INM-targeting motif. These studies identify vaccinia-related kinase-2 (VRK2) as a candidate constituent of the INM. The transmembrane VRK2A isoform is retained at the NE by association with A-type lamins. Furthermore, VRK2A physically interacts with A-type, but not B-type, lamins. Finally, we show that VRK2 phosphorylates barrier to autointegration factor (BAF), a small and highly dynamic chromatin-binding protein, which has roles including NE reassembly, cell cycle, and chromatin organization in cells, and subtly alters its nuclear mobility. Together these findings support the value of using BioID to identify unrecognized constituents of distinct subcellular compartments refractory to biochemical isolation and reveal VRK2A as a transmembrane kinase in the NE that regulates BAF.

Also flagged:mecNR1H3SIRT1bar-1sir-2.1Huntington's disease
Journal Article 2017-06-21 ✓ 5 Snippets Farina F, Lambert E, Commeau L, Lejeune FX, Roudier N, Fonte C, Parker JA, Boddaert J, Verny M, Baulieu EE, Neri C.
In-Text Gene Mentions

Htt

htt

Thus, 17βE2 and MAP4343 may protect from the stress vulnerability induced by full length Htt expression in HD mouse striatal cells.

MAP4343, 17ßE2 and isoquercitrin also promote stress resistance in mutant Htt striatal cells derived from knock-in HD mice.

Additionally, isoquercitrin specifically reduces the stress vulnerability of mutant Htt mouse striatal cells (Fig. 3C), with no effect on the expression levels of full length huntingtin (Fig. 3D).

Show Full Abstract

Helping neurons to compensate for proteotoxic stress and maintain function over time (neuronal compensation) has therapeutic potential in aging and neurodegenerative disease. The stress response factor FOXO3 is neuroprotective in models of Huntington's disease (HD), Parkinson's disease and motor-neuron diseases. Neuroprotective compounds acting in a FOXO-dependent manner could thus constitute bona fide drugs for promoting neuronal compensation. However, whether FOXO-dependent neuroprotection is a common feature of several compound families remains unknown. Using drug screening in C. elegans nematodes with neuronal expression of human exon-1 huntingtin (128Q), we found that 3ß-Methoxy-Pregnenolone (MAP4343), 17ß-oestradiol (17ßE2) and 12 flavonoids including isoquercitrin promote neuronal function in 128Q nematodes. MAP4343, 17ßE2 and isoquercitrin also promote stress resistance in mutant Htt striatal cells derived from knock-in HD mice. Interestingly, daf-16/FOXO is required for MAP4343, 17ßE2 and isoquercitrin to sustain neuronal function in 128Q nematodes. This similarly applies to the GSK3 inhibitor lithium chloride (LiCl) and, as previously described, to resveratrol and the AMPK activator metformin. Daf-16/FOXO and the targets engaged by these compounds define a sub-network enriched for stress-response and neuronally-active pathways. Collectively, these data highlights the dependence on a daf-16/FOXO-interaction network as a common feature of several compound families for prolonging neuronal function in HD.

Also flagged:major depressive disorderserotonin transporterdepressionmajor depression disordersleepanxiety
Journal Article 2017-06-21 ✓ 5 Snippets Igata N, Kakeda S, Watanabe K, Ide S, Kishi T, Abe O, Igata R, Katsuki A, Iwata N, Yoshimura R, Korogi Y.
In-Text Gene Mentions

Thus, the s promoter allelic variant is linked to reduced 5-HTT mRNA expression, resulting in less serotonin reuptake than with the l-allelic variant4, 5.

One of the major genetic factors determining inter-individual differences in stress reactivity is the serotonin transporter (5-HTT) gene polymorphism, which mediates reuptake and recycling of released serotonin following neuronal stimulation.

…the serotonin transporter (5-HTT) gene polymorphism, which…

…linked to reduced5-HTTmRNA expression, resulting…

…association between the5-HTTgenotype and physiological…

Show Full Abstract

Individuals with s/s genotype of serotonin transporter gene-linked promotor region (5-HTTLPR), which appear with a high frequency in Japanese, exhibit more diagnosable depression in relation to stressful life events than those with the s/l or l/l genotype. We prospectively investigated the brain volume changes in first-episode and medication naïve major depression disorder patients (MDD) with the s/s genotype in Japanese. We assessed the differences between 27 MDD with the s/s genotype and 44 healthy subjects (HS) with the same genotype using a whole-brain voxel-by-voxel statistical analysis of MRI. Gray matter volume in a brain region with significant clusters obtained via voxel-based morphometry analysis were measured and, as an exploratory analysis, evaluated for relationships to the subcategory scores (core, sleep, activity, psychic, somatic anxiety, delusion) of the Hamilton Depression Rating Scale (HAM-D) and the Social Readjustment Rating Scale (SRRS). The brain volume in the left insula lobe was significantly smaller in the MDD than in the HS. The left insula lobe volume correlated negatively with the "psychic" score of HAM-D and the SRRS. In a Japanese population with the s/s genotype, we found an atrophy of the insula in the MDD, which might be associated with "psychic" symptom and stress events.

Also flagged:Huntington's DiseaseMitochondriaHDneurodegenerative disordercognitive declineHuntingtin
Journal Article 2017-06-21 ✓ 1 Snippet Jodeiri Farshbaf M, Ghaedi K.
In-Text Gene Mentions

…encodes Huntingtin protein (Htt).…

Show Full Abstract

Huntington's disease (HD) as an inherited neurodegenerative disorder leads to neuronal loss in striatum. Progressive motor dysfunction, cognitive decline, and psychiatric disturbance are the main clinical symptoms of the HD. This disease is caused by expansion of the CAG repeats in exon 1 of the huntingtin which encodes Huntingtin protein (Htt). Various cellular and molecular events play role in the pathology of HD. Mitochondria as important organelles play crucial roles in the most of neurodegenerative disorders like HD. Critical roles of the mitochondria in neurons are ATP generation, Ca<sup>2+</sup> buffering, ROS generation, and antioxidant activity. Neurons as high-demand energy cells closely related to function, maintenance, and dynamic of mitochondria. In the most neurological disorders, mitochondrial activities and dynamic are disrupted which associate with high ROS level, low ATP generation, and apoptosis. Accumulation of mutant huntingtin (mHtt) during this disease may evoke mitochondrial dysfunction. Here, we review recent findings to support this hypothesis that mHtt could cause mitochondrial defects. In addition, by focusing normal huntingtin functions in neurons, we purpose mitochondria and Huntingtin association in normal condition. Moreover, mHtt affects various cellular signaling which ends up to mitochondrial biogenesis. So, it could be a potential candidate to decline ATP level in HD. We conclude how mitochondrial biogenesis plays a central role in the neuronal survival and activity and how mHtt affects mitochondrial trafficking, maintenance, integrity, function, dynamics, and hemostasis and makes neurons vulnerable to degeneration in HD.

Also flagged:Gli1hedgehogossificationCD133BMPHh
Journal Article 2017-06-21 ✓ 1 Snippet Kan C, Chen L, Hu Y, Ding N, Li Y, McGuire TL, Lu H, Kessler JA, Kan L.
In-Text Gene Mentions

Sox6

Show Full Abstract

Heterotopic ossification (HO), acquired or hereditary, endochondral or intramembranous, is the formation of true bone outside the normal skeleton. Since perivascular Gli1+ progenitors contribute to injury induced organ fibrosis, and CD133 is expressed by a variety of populations of adult stem cells, this study utilized Cre-lox based genetic lineage tracing to test the contribution to endochondral HO of adult stem/progenitor cells that expressed either Gli1 or CD133. We found that both lineages contributed broadly to different normal tissues with distinct patterns, but that only Gli1-creERT labeled stem/progenitor cells contributed to all stages of endochondral HO in a BMP dependent, injury induced, transgenic mouse model. Hedgehog (Hh) signaling was abnormal at endochondral HO lesion sites with increased signaling surrounding the lesion but diminished signaling within it. Thus, local dysregulation of Hh signaling participates in the pathophysiology of endochondral HO. However, unlike a previous report of intramembranous HO, systemic inhibition of Hh signaling was insufficient to prevent the initiation of the endochondral HO process or to treat the existing endochondral HO, suggesting that Hh participates in, but is not essential for endochondral HO in this model. This could potentially reflect the underlying difference between intramembranous and endochondral HO. Nevertheless, identification of this novel stem/precursor cell population as a HO-contributing cell population provides a potential drugable target.

Also flagged:Condensin IITFIIICchromosomecohesinchromatinorganization
Journal Article 2017-06-21 ✓ 2 Snippets Yuen KC, Slaughter BD, Gerton JL.
In-Text Gene Mentions

Condensinand TFIIIC peaks…

Condensinis present in…

Show Full Abstract

Structural maintenance of chromosome complexes, such as cohesin, have been implicated in a wide variety of chromatin-dependent functions such as genome organization, replication, and gene expression. How these complexes find their sites of association and affect local chromosomal processes is not well understood. We report that condensin II, a complex distinct from cohesin, physically interacts with TFIIIC, and they both colocalize at active gene promoters in the mouse and human genomes, facilitated by interaction between NCAPD3 and the epigenetic mark H3K4me3. Condensin II is important for maintaining high levels of expression of the histone gene clusters as well as the interaction between these clusters in the mouse genome. Our findings suggest that condensin II is anchored to the mammalian genome by a combination of H3K4me3 and the sequence-specific binding of TFIIIC, and that condensin supports the expression of active gene-dense regions found at the boundaries of topological domains. Together, our results support a working model in which condensin II contributes to topological domain boundary-associated gene activity in the mammalian genome.

Also flagged:Tumorchitosanfolateendocytosisconjugationgene silencing
Journal Article 2017-06-21 No Snippets Li L, Hu X, Zhang M, Ma S, Yu F, Zhao S, Liu N, Wang Z, Wang Y, Guan H, Pan X, Gao Y, Zhang Y, Liu Y, Yang Y, Tang X, Li M, Liu C, Li Z, Mei X.
Show Full Abstract

Highly specific and efficient delivery of siRNA is still unsatisfactory. Herein, a dual tumor-targeting siRNA delivery system combining pRNA dimers with chitosan nanoparticles (CNPPs) was designed to improve the specificity and efficiency of siRNA delivery. In this dual delivery system, folate-conjugated and PEGylated chitosan nanoparticles encapsulating pRNA dimers were used as the first class of delivery system and would selectively deliver intact pRNA dimers near or into target cells. pRNA dimers simultaneously carrying siRNA and targeting aptamer, the second class of delivery system, would specifically deliver siRNA into the target cells via aptamer-mediated endocytosis or proper particle size. To certify the delivering efficiency of this dual system, CNPPs, pRNA dimers alone, chitosan nanoparticles containing siRNA with folate conjugation and PEGylation (CNPS), and chitosan nanoparticles containing pRNA dimers alone (CN) were first prepared. Then, we observed that treatment with CNPPs resulted in increased cellular uptake, higher cell apoptosis, stronger cell cytotoxicity, and more efficacious gene silencing compared to the other three formulations. Higher accumulation of siRNA in the tumor site, stronger tumor inhibition, and longer circulating time were also observed with CNPPs compared to other formulations. In conclusion, this dual nanocarrier system showed high targeting and favorable therapeutic efficacy both in vitro and in vivo. Thereby, a new approach is provided in this study for specific and efficient delivery of siRNA, which lays a foundation for the development of pRNA hexamers, which can simultaneously carry six different substances.

Also flagged:etherdiethyl etherfolic acidvinyl etherS21glycin
Journal Article 2017-06-21 ✓ 1 Snippet Mukherjee S, Dinda H, Chakraborty I, Bhattacharyya R, Das Sarma J, Shunmugam R.
In-Text Gene Mentions

DCC

Show Full Abstract

A multifunctional stimuli-responsive nanotheranostic agent provides huge benefits in nanomedicine by combining both the diagnostic agent and the drug molecule in a single system. This nanosystem is capable of doing multiple tasks, for example, diagnosis, drug delivery, and monitoring the therapeutic response. Hence, theranostic agents are expected to play a significant role in personalized medicine. Herein, a new class of nanotheranostic agents, <b>Pnr-Cbt-Cpt-Pg-Bn</b>, is proposed for the effective delivery of camptothecin. This new class of polymer has been functionalized with a superparamagnetic norbornene cobalt unit for its use in magnetic resonance imaging (MRI). The NMR one-dimensional image confirms the MRI capability of this nanotheranostic agent. This is further modified with the poly(ethylene glycol)-biotin moiety for biocompatibility and site-specificity. The uniqueness of the design is confirmed by an in vitro study where a greater uptake of the nanotheranostic agent is observed when compared with free drugs. Hence, this new class of copolymer shows improved potential as nanotheranostic agents in drug delivery.

Plasma proteome of buffaloes.

Also flagged:proteindigestionalbuminfibrinogen-αfibrinogen-βfibrinogen-γ
Journal Article 2017-06-20 ✓ 1 Snippet de Pontes LG, Cavassan NRV, de Barros LC, Ferreira Junior RS, Barraviera B, Santos LDD.
In-Text Gene Mentions

…roglobulin, apolipoprotein A1,antithrombin-III, endopin 2B, fetuin-B,…

Show Full Abstract

The proteomic approach has aroused the interest of veterinary medicine researchers, especially regarding the production of biopharmaceuticals and diagnosis of diseases in farm animals. Water buffaloes have gained prominence in the world economy due to the quality of their milk, meat, and leather, in addition to being an important donor of blood components. This work aimed to identify and characterize the proteins present in the blood plasma of Murrah buffaloes (Bubalus bubalis) through 2D electrophoresis, in gel protein digestion followed by mass spectrometry technique and for albumin depletion, in solution protein digestion followed by shotgun analysis. Our results showed the identification of 112 protein spots and 35 individual proteins, respectively. The abundant proteins were represented by albumin, fibrinogen-α, fibrinogen-β, fibrinogen-γ, immunoglobulins in general, α-1-antiproteinase, α-1B-glycoprotein, α-2-HS-glycoprotein, α-macroglobulin, apolipoprotein A1, antithrombin-III, endopin 2B, fetuin-B, retinol-binding protein, serotransferrin, transthyretin and vitamin D-binding protein. Most of these proteins are related to the signaling pathways of the complement system and coagulation cascade. The results allowed a better understanding of the protein composition of these blood components, thus promoting studies on animal health in the search for molecular markers of zoonotic diseases in buffaloes.

Also flagged:Homeostasistransition metalsironmanganesemetal transportersoxygen
Journal Article 2017-06-20 ✓ 1 Snippet Colomer-Winter C, Gaca AO, Lemos JA.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

In <i>Enterococcus faecalis</i>, the regulatory nucleotides pppGpp and ppGpp, collectively, (p)ppGpp, are required for growth in blood, survival within macrophages, and virulence. However, a clear understanding of how (p)ppGpp promotes virulence in <i>E. faecalis</i> and other bacterial pathogens is still lacking. In the host, the essential transition metals iron (Fe) and manganese (Mn) are not readily available to invading pathogens because of a host-driven process called nutritional immunity. Considering its central role in adaptation to nutritional stresses, we hypothesized that (p)ppGpp mediates <i>E. faecalis</i> virulence through regulation of metal homeostasis. Indeed, supplementation of serum with either Fe or Mn restored growth and survival of the Δ<i>rel</i> Δ<i>relQ</i> [(p)ppGpp<sup>0</sup>] strain to wild-type levels. Using a chemically defined medium, we found that (p)ppGpp accumulates in response to either Fe depletion or Mn depletion and that the (p)ppGpp<sup>0</sup> strain has a strong growth requirement for Mn that is alleviated by Fe supplementation. Although inactivation of the nutrient-sensing regulator <i>codY</i> restored some phenotypes of the (p)ppGpp<sup>0</sup> strain, transcriptional analysis showed that the (p)ppGpp/CodY network does not promote transcription of known metal transporters. Interestingly, physiologic and enzymatic investigations suggest that the (p)ppGpp<sup>0</sup> strain requires higher levels of Mn in order to cope with high levels of endogenously produced reactive oxygen species (ROS). Because (p)ppGpp mediates antibiotic persistence and virulence in several bacteria, our findings have broad implications and provide new leads for the development of novel therapeutic and preventive strategies against <i>E. faecalis</i> and beyond.

Also flagged:long-term memorypsychiatric disorderlocalizationtranslinmemorytranscriptional regulator
Journal Article 2017-06-20 No Snippets Teng S, Thomson PA, McCarthy S, Kramer M, Muller S, Lihm J, Morris S, Soares DC, Hennah W, Harris S, Camargo LM, Malkov V, McIntosh AM, Millar JK, Blackwood DH, Evans KL, Deary IJ, Porteous DJ, McCombie WR.
Show Full Abstract

Schizophrenia (SCZ), bipolar disorder (BD) and recurrent major depressive disorder (rMDD) are common psychiatric illnesses. All have been associated with lower cognitive ability, and show evidence of genetic overlap and substantial evidence of pleiotropy with cognitive function and neuroticism. Disrupted in schizophrenia 1 (DISC1) protein directly interacts with a large set of proteins (DISC1 Interactome) that are involved in brain development and signaling. Modulation of DISC1 expression alters the expression of a circumscribed set of genes (DISC1 Regulome) that are also implicated in brain biology and disorder. Here we report targeted sequencing of 59 DISC1 Interactome genes and 154 Regulome genes in 654 psychiatric patients and 889 cognitively-phenotyped control subjects, on whom we previously reported evidence for trait association from complete sequencing of the DISC1 locus. Burden analyses of rare and singleton variants predicted to be damaging were performed for psychiatric disorders, cognitive variables and personality traits. The DISC1 Interactome and Regulome showed differential association across the phenotypes tested. After family-wise error correction across all traits (FWER<sub>across</sub>), an increased burden of singleton disruptive variants in the Regulome was associated with SCZ (FWER<sub>across</sub> P=0.0339). The burden of singleton disruptive variants in the DISC1 Interactome was associated with low cognitive ability at age 11 (FWER<sub>across</sub> P=0.0043). These results identify altered regulation of schizophrenia candidate genes by DISC1 and its core Interactome as an alternate pathway for schizophrenia risk, consistent with the emerging effects of rare copy number variants associated with intellectual disability.

Also flagged:Colorectal cancercancerdeathbiosynthesiscell cycleorganization
Journal Article 2017-06-20 No Snippets Lucas C, Barnich N, Nguyen HTT.
Show Full Abstract

Colorectal cancer, the fourth leading cause of cancer-related death worldwide, is a multifactorial disease involving genetic, environmental and lifestyle risk factors. In addition, increased evidence has established a role for the intestinal microbiota in the development of colorectal cancer. Indeed, changes in the intestinal microbiota composition in colorectal cancer patients compared to control subjects have been reported. Several bacterial species have been shown to exhibit the pro-inflammatory and pro-carcinogenic properties, which could consequently have an impact on colorectal carcinogenesis. This review will summarize the current knowledge about the potential links between the intestinal microbiota and colorectal cancer, with a focus on the pro-carcinogenic properties of bacterial microbiota such as induction of inflammation, the biosynthesis of genotoxins that interfere with cell cycle regulation and the production of toxic metabolites. Finally, we will describe the potential therapeutic strategies based on intestinal microbiota manipulation for colorectal cancer treatment.

Also flagged:Metforminneurodegenerative disorderHDAMPKtype 2-diabetesHuntington's disease
Journal Article 2017-06-20 ✓ 5 Snippets Hervás D, Fornés-Ferrer V, Gómez-Escribano AP, Sequedo MD, Peiró C, Millán JM, Vázquez-Manrique RP.
In-Text Gene Mentions

The database cohort includes HD patients disease together with pre-manifest carriers of the mutant allele of the htt gene (people with 36 or more CAG triplets), and controls.

Huntington disease (HD, OMIM entry #143100) is a dominant, inherited neurodegenerative disease caused by an abnormal CAG expansion within the first exon of the huntingtin gene, htt. This gene encodes a cytosolic protein, huntingtin (Htt) whose function is still unclear, although several roles have been suggested [1].

Huntington’s disease (HD) is an inherited, dominant neurodegenerative disorder caused by an abnormal expansion of CAG triplets in the huntingtin gene (htt).

…huntingtin gene (htt).…

…the huntingtin gene,htt.…

Show Full Abstract

Huntington's disease (HD) is an inherited, dominant neurodegenerative disorder caused by an abnormal expansion of CAG triplets in the huntingtin gene (htt). Despite extensive efforts to modify the progression of HD thus far only symptomatic treatment is available. Recent work suggests that treating invertebrate and mice HD models with metformin, a well-known AMPK activator which is used worldwide to treat type 2-diabetes, reduces mutant huntingtin from cells and alleviates many of the phenotypes associated to HD. Herein we report statistical analyses of a sample population of participants in the Enroll-HD database, a world-wide observational study on HD, to assess the effect of metformin intake in HD patients respect to cognitive status using linear models. This cross-sectional study shows for the first time that the use of metformin associates with better cognitive function in HD patients.

Also flagged:methylationlung cancerhypermethylationhistonetumorsuppressor
Journal Article 2017-06-20 No Snippets Kiehl S, Zimmermann T, Savai R, Pullamsetti SS, Seeger W, Bartkuhn M, Dammann RH.
Show Full Abstract

Epigenetic deregulation is of importance in tumorigenesis. In particular CpG islands (CGI), are frequently hypermethylated. Here, genome-wide DNA-methylation profiles of 480,000 CpGs in lung cancer cells were generated. It was observed that intra- and intergenic CGI exhibited higher methylation compared to normal cells. The functional annotation of hypermethylated CGI revealed that the hypermethylation was associated with homeobox domain genes and targets marked by repressive histone modifications. The strongest methylation variation was observed in transitional areas of CGI, termed shores. 5'-shores of promoter-associated CGI in lung cancer cell lines were higher methylated than 3'-shores. Within two tandem-oriented genes, a significant hypermethylation of the downstream-located CGI promoters was revealed. Hypermethylation correlates with the length of the intergenic region between such tandem genes. As the RASSF1A tumor suppressor gene represents such a downstream tandem gene, its silencing was analyzed using an inducible system. It was determined that the induction of an upstream gene led to a repression of RASSF1A through a process involving histone deacetylases and CPSF1. A tumor-specific increase in expression of histone deacetylases and CPSF1 was detected in lung cancer. Our results suggest that the downstream gene could be susceptible to epigenetic silencing when organized in a tandem orientation.

Also flagged:Huntington's diseaseHDchromosomeMSH3DHFRMTRNR2L2
Journal Article 2017-06-20 ✓ 1 Snippet Moss DJH, Pardiñas AF, Langbehn D, Lo K, Leavitt BR, Roos R, Durr A, Mead S, TRACK-HD investigators, REGISTRY investigators, Holmans P, Jones L, Tabrizi SJ.
In-Text Gene Mentions

<h4>Background</h4>Huntington's disease is caused by a CAG repeat expansion in the huntingtin gene, HTT.

Show Full Abstract

<h4>Background</h4>Huntington's disease is caused by a CAG repeat expansion in the huntingtin gene, HTT. Age at onset has been used as a quantitative phenotype in genetic analysis looking for Huntington's disease modifiers, but is hard to define and not always available. Therefore, we aimed to generate a novel measure of disease progression and to identify genetic markers associated with this progression measure.<h4>Methods</h4>We generated a progression score on the basis of principal component analysis of prospectively acquired longitudinal changes in motor, cognitive, and imaging measures in the 218 indivduals in the TRACK-HD cohort of Huntington's disease gene mutation carriers (data collected 2008-11). We generated a parallel progression score using data from 1773 previously genotyped participants from the European Huntington's Disease Network REGISTRY study of Huntington's disease mutation carriers (data collected 2003-13). We did a genome-wide association analyses in terms of progression for 216 TRACK-HD participants and 1773 REGISTRY participants, then a meta-analysis of these results was undertaken.<h4>Findings</h4>Longitudinal motor, cognitive, and imaging scores were correlated with each other in TRACK-HD participants, justifying use of a single, cross-domain measure of disease progression in both studies. The TRACK-HD and REGISTRY progression measures were correlated with each other (r=0·674), and with age at onset (TRACK-HD, r=0·315; REGISTRY, r=0·234). The meta-analysis of progression in TRACK-HD and REGISTRY gave a genome-wide significant signal (p=1·12 × 10<sup>-10</sup>) on chromosome 5 spanning three genes: MSH3, DHFR, and MTRNR2L2. The genes in this locus were associated with progression in TRACK-HD (MSH3 p=2·94 × 10<sup>-8</sup>DHFR p=8·37 × 10<sup>-7</sup> MTRNR2L2 p=2·15 × 10<sup>-9</sup>) and to a lesser extent in REGISTRY (MSH3 p=9·36 × 10<sup>-4</sup>DHFR p=8·45 × 10<sup>-4</sup>MTRNR2L2 p=1·20 × 10<sup>-3</sup>). The lead single nucleotide polymorphism (SNP) in TRACK-HD (rs557874766) was genome-wide significant in the meta-analysis (p=1·58 × 10<sup>-8</sup>), and encodes an aminoacid change (Pro67Ala) in MSH3. In TRACK-HD, each copy of the minor allele at this SNP was associated with a 0·4 units per year (95% CI 0·16-0·66) reduction in the rate of change of the Unified Huntington's Disease Rating Scale (UHDRS) Total Motor Score, and a reduction of 0·12 units per year (95% CI 0·06-0·18) in the rate of change of UHDRS Total Functional Capacity score. These associations remained significant after adjusting for age of onset.<h4>Interpretation</h4>The multidomain progression measure in TRACK-HD was associated with a functional variant that was genome-wide significant in our meta-analysis. The association in only 216 participants implies that the progression measure is a sensitive reflection of disease burden, that the effect size at this locus is large, or both. Knockout of Msh3 reduces somatic expansion in Huntington's disease mouse models, suggesting this mechanism as an area for future therapeutic investigation.<h4>Funding</h4>The European Commission FP7 NeurOmics project; CHDI Foundation; the Medical Research Council UK; the Brain Research Trust; and the Guarantors of Brain.

Also flagged:anemiafetal hemoglobinBCL11AerythropoiesisHbHBB
Journal Article 2017-06-20 No Snippets Thein SL.
Show Full Abstract

The remarkable phenotypic diversity of β thalassemia that range from severe anemia and transfusion-dependency, to a clinically asymptomatic state exemplifies how a spectrum of disease severity can be generated in single gene disorders. While the genetic basis for β thalassemia, and how severity of the anemia could be modified at different levels of its pathophysiology have been well documented, therapy remains largely supportive with bone marrow transplant being the only cure. Identification of the genetic variants modifying fetal hemoglobin (HbF) production in combination with α globin genotype provide some prediction of disease severity for β thalassemia but generation of a personalized genetic risk score to inform prognosis and guide management requires a larger panel of genetic modifiers yet to be discovered. Nonetheless, genetic studies have been successful in characterizing the key variants and pathways involved in HbF regulation, providing new therapeutic targets for HbF reactivation. BCL11A has been established as a quantitative repressor, and progress has been made in manipulating its expression using genomic and gene-editing approaches for therapeutic benefits. Recent discoveries and understanding in the mechanisms associated with ineffective and abnormal erythropoiesis have also provided additional therapeutic targets, a couple of which are currently being tested in clinical trials.

Also flagged:deathimmune responsespattern recognition receptorschemokinesIFN-γIL-17
Journal Article 2017-06-20 ✓ 1 Snippet Wu C, Qin X, Li P, Pan T, Ren W, Li N, Peng Y.
In-Text Gene Mentions

…primary antibodies wereactivator of transcription 1of transcription 1…

Show Full Abstract

<i>Pasteurella multocida</i> infection in cattle causes serious epidemic diseases and leads to great economic losses in livestock industry; however, little is known about the interaction between host and <i>P. multocida</i> in the lungs. To explore a fully insight into the host responses in the lungs during <i>P. multocida</i> infection, a mouse model of <i>Pasteurella</i> pneumonia was established by intraperitoneal infection, and then transcriptomic analysis of infected lungs was performed. <i>P. multocida</i> localized and grew in murine lungs, and induced inflammation in the lungs, as well as mice death. With transcriptomic analysis, approximately 10<sup>7</sup> clean reads were acquired. 4236 differently expressed genes (DEGs) were detected during <i>P. multocida</i> infection, of which 1924 DEGs were up-regulated. By gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) enrichments, 5,303 GO enrichments and 116 KEGG pathways were significantly enriched in the context of <i>P. multocida</i> infection. Interestingly, genes related to immune responses, such as pattern recognition receptors (PRRs), chemokines and inflammatory cytokines, were significantly up-regulated, suggesting the key roles of these genes in <i>P. multocida</i> infection. Transcriptomic data showed that IFN-γ/IL-17-related genes were increased, which were validated by qRT-PCR, ELISA, and immunoblotting. Our study characterized the transcriptomic profile of the lungs in mice upon <i>Pasteurella</i> infection, and our findings could provide valuable information with respect to better understanding the responses in mice during <i>P. multocida</i> infection.

Also flagged:IronSickle Cell DiseaseFerritinalanine transaminaseALTaspartate aminotransferase
Journal Article 2017-06-20 ✓ 1 Snippet Yassin M, Soliman A, De Sanctis V, Nashwan A, Abusamaan S, Moustafa A, Kohla S, Soliman D.
In-Text Gene Mentions

…were tested forhemochromatosisgenes C282Y, and…

Show Full Abstract

<h4>Introduction</h4>Sickle cell disease (SCD) is one of the leading causes of morbidity and mortality worldwide, causing damage and dysfunction in multiple organs. The complications of this disease are numerous, affect every organ and/or tissue in the body and vary considerably among patients over the time challenging its management.<h4>The aim of our study</h4>To determine the iron status of 17 patients with non-transfusion-dependent sickle cell disease ( NT-SCD) patients and six patients with transfusion dependent sickle cell disease (TD- SCD) using both serum ferritin level (SF) and Ferriscan® evaluation of liver iron content (LIC). We correlated the values of LIC with SF levels and some hepatic enzymes (alanine transaminase-ALT, aspartate aminotransferase -AST, alkaline phosphatase -ALP and albumin).<h4>Results</h4>17 adults with NT-SCD (n = 17, age: 32±15 years) were studied. Seven of NT-SCD had SF > 500 μg/L, 4 out of the seven had high liver iron measured by FerriScan® (> 30 mg/g/ tissue dry weight - dw). Two patients had high LIC despite a concomitant SF concentration < 500 μg/L. Two patients had high SF (1.117 μg/L and 675 μg/L) while their LIC was normal (< 30 mg/g/dw). Five patients had elevated ALT and/or AST) concentrations. In TD-SCD (n = 6, age = 25 ± 11 years), 2 patients had SF <500 μg/L, one of them had high LIC (127 mg/g/DW). Liver enzymes were high in two patients. SF concentration correlated significantly with LIC (r = 0.85, p < 0.001). Neither SF level nor LIC was correlated significantly with hepatic enzyme levels.<h4>Conclusions</h4>A significant number of our patients with NT-SCD had high LIC, high SF and elevated liver enzymes (ALT and AST). Despite some limitations of our study, due to the limited number of NT-SCD patients, these findings have important clinical implications. Therefore, we recommend measuring SF and LIC in NT-SCD patients to apply preventive measures with iron chelation therapy in patients with high LIC.

Also flagged:acute lymphoblastic leukemiaALLmixed-lineage leukemiaMLLAF10ARID5B
Journal Article 2017-06-20 ✓ 5 Snippets Hiwatari M, Seki M, Akahoshi S, Yoshida K, Miyano S, Shiraishi Y, Tanaka H, Chiba K, Ogawa S, Takita J.
In-Text Gene Mentions

Silliman et al (10) emphasized that truncated MLLT10/AF10 protein in normal cells and truncated MLLT10/AF10-CALM protein in leukemic cells retain a cysteine-rich motif and leukemia-associated protein (LAP) (11) and would function as dominant-negative inhibitors of full-length AF10 or associated proteins (12).

MLLT10/AF10-MKX proteins in leukemic cells retain a cysteine-rich motif and LAP.

Molecular studies reveal MLL-MLLT10/AF10 and ARID5B-MLL gene fusions displaced in a case of infantile acute lymphoblastic leukemia with complex karyotype

In the present report, a new case of infantile ALL with MLL-MLLT10/AF10 and 10;11 rearrangements was presented.

…Molecular studies reveal MLL-MLLT10/AF10 and ARID5B-MLL gene…

Show Full Abstract

The present report describes a unique infantile acute lymphoblastic leukemia (ALL) case with cryptic mixed-lineage leukemia (MLL) rearrangements with 11q23 chromosomal translocation. <i>MLL</i> break-apart signals were identified by fluorescence <i>in situ</i> hybridization, and transcriptome sequencing revealed <i>MLL</i>-myeloid/lymphoid or mixed-lineage leukemia; translocated To, 10 (<i>MLLT10</i>)/<i>AF10</i> fusion transcripts. Analysis also revealed a previously unreported <i>MLLT10</i>/<i>AF10</i>-homeobox protein Mohawk (<i>MKX</i>) transcript, where the 5' portion of <i>MLLT10/AF10</i> at 10p12.31 was fused out-of-frame with the 3' portion of <i>MKX</i> at 10p12.1, which is closely located to <i>MLLT10</i>/<i>AF10</i>. Furthermore, the reciprocal 3'-<i>MLL</i> gene segment was fused in-frame to AT-rich interaction domain (<i>ARID</i>)<i>5B</i> at 10q21. Previously, common allelic variants in <i>ARID5B</i>, which are directly associated with hematopoietic differentiation and development, have been repeatedly and significantly associated with childhood ALL. The heterozygous genotype in <i>ARID5B</i> (RefSNP: rs10821936) increased the risk for leukemia with <i>MLL</i>-rearrangement. In particular, single nucleotide polymorphisms of <i>ARID5B</i> conferred increased risk for <i>MLL-MLLT3/AF9</i>. Based on these findings, the authors propose that while the presence of reciprocal <i>MLL</i> alleles has been detected in this patient, different pathological disease mechanisms may be at play due to individual recombination events.

Also flagged:apixabanthrombinprothrombinfactor VIIprothrombin complexFX a
Journal Article 2017-06-20 No Snippets Schultz NH, Tran HTT, Bjørnsen S, Henriksson CE, Sandset PM, Holme PA.
Show Full Abstract

<h4>Background</h4>The number of patients under treatment with FXa inhibitors is increasing, but there is no concensus on how to reverse their anticoagulant effect in case of a life-threatening bleeding. A specific antidote is not yet commercially available. Prothrombin complex concentrate (PCC), activated PCC (aPCC) and recombinant factor VIIa (rFVIIa) are suggested available reversal agents.<h4>Objectives</h4>To find the most effective reversal agent to apixaban and to determine the optimal dose.<h4>Patients/methods</h4>PCC, aPCC, and rFVIIa at concentrations imitating 80%, 100%, and 125% of suggested therapeutic doses were added to blood drawn from apixaban-treated patients (n=30). aPCC was also tested in a 50% dose. Samples from healthy subjects (n=40) were used as controls. Thromboelastometry in whole blood (WB) and thrombin generation in platelet-poor plasma (PPP) were measured to assess the reversal effect.<h4>Results</h4>aPCC shortened clotting time (CT) in WB, and increased the peak thrombin concentration and velocity index in PPP to a greater extent than PCC and rFVIIa. No significant differences were seen between rFVIIa and aPCC on thrombin generation lag time, or between PCC and aPCC on endogenous thrombin potential (ETP). The 50% dose of aPCC had a slightly inferior effect, but was comparable to the other reversal agents.<h4>Conclusions</h4>In this in vitro study the 80% dose of aPCC (40 IU/kg) reversed the anticoagulant effect of apixaban more effectively than the corresponding dose of rFVIIa and PCC both in WB (CT) and PPP (peak, ETP).

Also flagged:vascular malformation syndromesProteus syndromethromboembolismovergrowth disorderAKT1deep venous thrombosis
Journal Article 2017-06-19 ✓ 1 Snippet Keppler-Noreuil KM, Lozier JN, Sapp JC, Biesecker LG.
In-Text Gene Mentions

ATIII

Show Full Abstract

Patients with overgrowth and complex vascular malformation syndromes, including Proteus syndrome have an increased risk of thromboembolism. Proteus syndrome is a mosaic, progressive overgrowth disorder involving vasculature, skin, and skeleton, and caused by a somatic activating mutation in AKT1. We conducted a comprehensive review of the medical histories and hematologic evaluations of 57 patients with Proteus syndrome to identify potential risk factors for thrombosis. We found that six of ten patients, who were deceased, died secondary to deep venous thrombosis and/or pulmonary embolism. Of the remaining 47 living patients, six had thromboembolic events that all occurred postoperatively and in an affected limb. Eleven of 21 patients had an abnormal hypercoagulable panel including Factor V Leiden heterozygotes, antithrombin III deficiency, positive lupus anticoagulant, or Protein C or S deficiencies. We observed that eight of 17 patients had an abnormal D-dimer level >0.5 mcg/dl, but deep venous thromboses occurred in only four of those with D-dimer >1.0 mcg/dl. We conclude that the predisposition to thrombosis is likely to be multifaceted with risk factors including vascular malformations, immobility, surgery, additional prothrombotic factors, and possible pathophysiologic effects of the somatic AKT1 mutation on platelet function or the vascular endothelium. The D-dimer test is useful as a screen for thromboembolism, although the screening threshold may need to be adjusted for patients with this disorder. We propose developing a registry to collect D-dimer and outcome data to facilitate adjustment of the D-dimer threshold for Proteus syndrome and related disorders, including PIK3CA-Related Overgrowth Spectrum.

Also flagged:neurological disorderscortical infarctsmigraineneurological diseasesneurodegenerative disordersstroke
Journal Article 2017-06-19 No Snippets Ikram MA, Zonneveld HI, Roshchupkin G, Smith AV, Franco OH, Sigurdsson S, van Duijn C, Uitterlinden AG, Launer LJ, Vernooij MW, Gudnason V, Adams HH.
Show Full Abstract

Cerebral blood flow is an important process for brain functioning and its dysregulation is implicated in multiple neurological disorders. While environmental risk factors have been identified, it remains unclear to what extent the flow is regulated by genetics. Here we performed heritability and genome-wide association analyses of cerebral blood flow in a population-based cohort study. We included 4472 persons free of cortical infarcts who underwent genotyping and phase-contrast magnetic resonance flow imaging (mean age 64.8 ± 10.8 years). The flow rate, cross-sectional area of the vessel, and flow velocity through the vessel were measured in the basilar artery and bilateral carotids. We found that the flow rate of the basilar artery is most heritable (h2 (SE) = 24.1 (9.8), p-value = 0.0056), and this increased over age. The association studies revealed two significant loci for the right carotid artery area (rs12546630, p-value = 2.0 × 10<sup>-8</sup>) and velocity (rs2971609, p-value = 1.4 × 10<sup>-8</sup>), with the latter showing a concordant effect in an independent sample (N = 1350, p-value = 0.057, meta-analyzed p-value = 2.5 × 10<sup>-9</sup>). These loci were also associated with other cerebral blood flow parameters below genome-wide significance, and rs2971609 lies in a known migraine locus. These findings establish that cerebral blood flow is under genetic control with potential relevance for neurological diseases.

Also flagged:Nonalcoholic fatty liver diseasecirrhosisNAFLDdiabetesDigestive and Kidney Diseasesliver disease
Journal Article 2017-06-19 ✓ 1 Snippet Caussy C, Soni M, Cui J, Bettencourt R, Schork N, Chen CH, Ikhwan MA, Bassirian S, Cepin S, Gonzalez MP, Mendler M, Kono Y, Vodkin I, Mekeel K, Haldorson J, Hemming A, Andrews B, Salotti J, Richards L, Brenner DA, Sirlin CB, Loomba R, Familial NAFLD Cirrhosis Research Consortium.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>The risk of advanced fibrosis in first-degree relatives of patients with nonalcoholic fatty liver disease and cirrhosis (NAFLD-cirrhosis) is unknown and needs to be systematically quantified. We aimed to prospectively assess the risk of advanced fibrosis in first-degree relatives of probands with NAFLD-cirrhosis.<h4>Methods</h4>This is a cross-sectional analysis of a prospective cohort of 26 probands with NAFLD-cirrhosis and 39 first-degree relatives. The control population included 69 community-dwelling twin, sib-sib, or parent-offspring pairs (n = 138), comprising 69 individuals randomly ascertained to be without evidence of NAFLD and 69 of their first-degree relatives. The primary outcome was presence of advanced fibrosis (stage 3 or 4 fibrosis). NAFLD was assessed clinically and quantified by MRI proton density fat fraction (MRI-PDFF). Advanced fibrosis was diagnosed by liver stiffness greater than 3.63 kPa using magnetic resonance elastography (MRE).<h4>Results</h4>The prevalence of advanced fibrosis in first-degree relatives of probands with NAFLD-cirrhosis was significantly higher than that in the control population (17.9% vs. 1.4%, P = 0.0032). Compared with controls, the odds of advanced fibrosis among the first-degree relatives of probands with NAFLD-cirrhosis were odds ratio 14.9 (95% CI, 1.8-126.0, P = 0.0133). Even after multivariable adjustment by age, sex, Hispanic ethnicity, BMI, and diabetes status, the risk of advanced fibrosis remained both statistically and clinically significant (multivariable-adjusted odds ratio 12.5; 95% CI, 1.1-146.1, P = 0.0438).<h4>Conclusion</h4>Using a well-phenotyped familial cohort, we demonstrated that first-degree relatives of probands with NAFLD-cirrhosis have a 12 times higher risk of advanced fibrosis. Advanced fibrosis screening may be considered in first-degree relatives of NAFLD-cirrhosis patients.<h4>Trial registration</h4><h4>Ucsd irb</h4>140084.<h4>Funding</h4>National Institute of Diabetes and Digestive and Kidney Diseases and National Institute of Environmental Health Sciences, NIH.

Also flagged:Cas9neurodegenerative disorderHuntingtinpolyglutamineglutamineneurodegenerative diseases
Journal Article 2017-06-19 ✓ 5 Snippets Yang S, Chang R, Yang H, Zhao T, Hong Y, Kong HE, Sun X, Qin Z, Jin P, Li S, Li XJ.
In-Text Gene Mentions

Huntington's disease is a neurodegenerative disorder caused by a polyglutamine repeat in the Huntingtin gene (HTT).

Although suppressing the expression of mutant HTT (mHTT) has been explored as a therapeutic strategy to treat Huntington's disease, considerable efforts have gone into developing allele-specific suppression of mHTT expression, given that loss of Htt in mice can lead to embryonic lethality.

…that loss ofHttin mice can…

…Huntingtin gene (HTT).…

…expression of mutantHTT(mHTT) has been…

Show Full Abstract

Huntington's disease is a neurodegenerative disorder caused by a polyglutamine repeat in the Huntingtin gene (HTT). Although suppressing the expression of mutant HTT (mHTT) has been explored as a therapeutic strategy to treat Huntington's disease, considerable efforts have gone into developing allele-specific suppression of mHTT expression, given that loss of Htt in mice can lead to embryonic lethality. It remains unknown whether depletion of HTT in the adult brain, regardless of its allele, could be a safe therapy. Here, we report that permanent suppression of endogenous mHTT expression in the striatum of mHTT-expressing mice (HD140Q-knockin mice) using CRISPR/Cas9-mediated inactivation effectively depleted HTT aggregates and attenuated early neuropathology. The reduction of mHTT expression in striatal neuronal cells in adult HD140Q-knockin mice did not affect viability, but alleviated motor deficits. Our studies suggest that non-allele-specific CRISPR/Cas9-mediated gene editing could be used to efficiently and permanently eliminate polyglutamine expansion-mediated neuronal toxicity in the adult brain.

Also flagged:Chromatinchromosomegene expressionHBG1Glutaminepenicillin
Journal Article 2017-06-19 ✓ 1 Snippet Werner MS, Sullivan MA, Shah RN, Nadadur RD, Grzybowski AT, Galat V, Moskowitz IP, Ruthenburg AJ.
In-Text Gene Mentions

…a protocadherin (PCDH17), that is…

Show Full Abstract

We recently described a new class of long noncoding RNAs (lncRNAs) that are distinguished by especially tight chromatin association and whose presence is strongly correlated to expression of nearby genes. Here, we examine the cis-enhancer mechanism of this class of chromatin-enriched RNA (cheRNA) across multiple human cell lines. cheRNAs are largely cell type specific and provide the most reliable chromatin signature to predict cis-gene transcription in every human cell type examined. Targeted depletion of three cheRNAs decreases expression of their neighboring genes, indicating potential co-activator function, and single-molecule fluorescence in situ hybridization (smFISH) of one cheRNA-distal target gene pair suggests a spatial overlap consistent with a role in chromosome looping. Additionally, the cheRNA HIDALGO stimulates the fetal hemoglobin subunit gamma 1 (HBG1) gene during erythroid differentiation by promoting contacts to a downstream enhancer. Our results suggest that multiple cheRNAs activate proximal lineage-specific gene transcription.

Also flagged:CDK6actinBCL2SOX5CCND1CCNE1
Journal Article 2017-06-19 ✓ 1 Snippet Tian R, Wang J, Yan H, Wu J, Xu Q, Zhan X, Gui Z, Ding M, He J.
In-Text Gene Mentions

…SOXD including SOX5,SOX6and SOX13 as…

Show Full Abstract

The function of miR16 in multiforme glioblastoma multiforme (GBM) and its stem cells (GSCs) remains elusive. To this end, we investigated the patterns of miR16 expression in these cells and their correlation with malignant behaviors and clinical outcomes. The levels of miR16 and its targeted genes in tumor tissue of GBM and GBM SGH44, U87, U251 cells as well as their stem cell counterparts were measured by qRT-PCR or western blot or immunohistochemistry. Luciferase reporter assay was used to confirm the binding of miR16 to 3'-UTR of its target genes. The effects of miR16 on malignant behaviors were investigated, including tumor cell viability, soft-agar colony formation, GSCs Matrigel colony forming and migration and invasion as well as nude mice xenograft model. Differentially expression patterns of miR16 in glioblastoma cells and GSCs cells were found in this study. Changes of miR16 targeted genes, Bcl2 (B cell lymphoma 2), CDK6 (Cyclin-dependent kinase 6), CCND1 (cyclin D1), CCNE1 (cyclin E1) and SOX5 were confirmed in glioblastoma cell lines and tissue specimens. In vitro and in vivo studies showed that tumor cell proliferation was inhibited by miR16 mimic, but enhanced by miR16 inhibitor. The expression level of miR16 positively correlates with GSCs differentiation, but negatively with the abilities of migration, motility, invasion and colony formation in glioblastoma cells. The inhibitory effects of miR16 on its target genes were also found in nude mice xenograft model. Our findings revealed that the miR16 functions as a tumor suppressor in GSCs and its association with prognosis in GBM.

Also flagged:curcumincancerscancerdeathprostate cancergene expression
Journal Article 2017-06-19 ✓ 2 Snippets Rivera M, Ramos Y, Rodríguez-Valentín M, López-Acevedo S, Cubano LA, Zou J, Zhang Q, Wang G, Boukli NM.
In-Text Gene Mentions

The differentially expressed proteins included downregulated antioxidant markers such as peroxiredoxin 6 (PRDX6) and protein DJ-1 (PARK7) with significant fold changes of –1.39 and –1.51, respectively, correlating with the upregulation of reactive oxygen species markers such as annexin A1 (ANXA1) [20] and sulfiredoxin-1 (SRXN1), with fold changes of 1.45 and 1.38, respectively, in curcumin-treated PC3 cells.

…as peroxiredoxin 6 (PRDX6) and protein DJ-1…

Show Full Abstract

Curcumin, an extract from the turmeric rhizome (Curcuma longa), is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12) and Poly (ADP-ribose) polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses.

Also flagged:CHRNA4methylphenidateCSMD2SUCNR1NAV2COMT
Journal Article 2017-06-19 ✓ 1 Snippet Heinrich H, Grunitz J, Stonawski V, Frey S, Wahl S, Albrecht B, Goecke TW, Beckmann MW, Kornhuber J, Fasching PA, Moll GH, Eichler A.
In-Text Gene Mentions

…the serotonergic system:5-HTT/ SLC6A4 ,…

Show Full Abstract

In order to better understand the underpinnings of attention-deficit/hyperactivity disorder (ADHD), we targeted the relationship of attentional, cognitive control and motivational processes with DNA methylation patterns of 60 candidate genes in boys at early school age. Participants (6 to 8 years; N = 82) were selected from a German longitudinal cohort (FRANCES). ADHD-related behaviour was assessed via maternal ratings. Performance and event-related potential measures (inter alia Cue-P3 and Nogo-P3), which were recorded in a motivational go/nogo task, indicated diminished attentional orienting, reduced inhibitory response control and a larger motivational effect on performance in ADHD already at this relatively young age. Methylation patterns were analysed in buccal cell DNA with the Illumina HumanMethylation 450K array. For CpG sites at genes of the dopaminergic (COMT, ANKK1) and the neurotrophic (BDNF, NGFR) system, associations with the Nogo-P3 as well as ADHD symptom severity were found suggesting that these systems are involved in response control deficits in ADHD. Methylation effects related to both functional aspects and ADHD behaviour were also observed for DPP10 and TPH2. Epigenetic mechanisms may play a role in ADHD-associated deficits but findings need to be replicated in larger samples and are limited by the fact that only peripheral methylation could be considered.

Also flagged:protocadherinscadherindendriteaxonsynaptogenesissynapse
Journal Article 2017-06-19 No Snippets Peek SL, Mah KM, Weiner JA.
Show Full Abstract

The protocadherins (Pcdhs), which make up the most diverse group within the cadherin superfamily, were first discovered in the early 1990s. Data implicating the Pcdhs, including ~60 proteins encoded by the tandem Pcdha, Pcdhb, and Pcdhg gene clusters and another ~10 non-clustered Pcdhs, in the regulation of neural development have continually accumulated, with a significant expansion of the field over the past decade. Here, we review the many roles played by clustered and non-clustered Pcdhs in multiple steps important for the formation and function of neural circuits, including dendrite arborization, axon outgrowth and targeting, synaptogenesis, and synapse elimination. We further discuss studies implicating mutation or epigenetic dysregulation of Pcdh genes in a variety of human neurodevelopmental and neurological disorders. With recent structural modeling of Pcdh proteins, the prospects for uncovering molecular mechanisms of Pcdh extracellular and intracellular interactions, and their role in normal and disrupted neural circuit formation, are bright.

Also flagged:proteaseacute myeloid leukemiaAMLmatrix metalloproteasesADAM12uPA
Journal Article 2017-06-19 ✓ 3 Snippets Honnemyr M, Bruserud Ø, Brenner AK.
In-Text Gene Mentions

…coagulation (ADAM TS13,serpin C1C1), inflammation (fetuin…

…ults</h4>Detectable release ofserpin C1C1 and E1,…

serpin C1

Show Full Abstract

<h4>Introduction</h4>Acute myeloid leukemia (AML) cells show constitutive release of matrix metalloproteases and their inhibitors. We now investigated this constitutive release of protease/protease regulators associated with carcinogenesis (ADAM12, uPA, cystatin B), angiogenesis (serpin E1, uPA, CD147), cancer cell migration (uPA, cystatin C), coagulation (ADAM TS13, serpin C1), inflammation (fetuin A, caspase 1, cystatin C), monocytic differentiation (CFD) or regulation of hematopoiesis (neutrophil elastase).<h4>Methods</h4>AML blasts from 79 consecutive patients were cultured in serum-free medium and mediator levels determined in culture supernatants.<h4>Results</h4>Detectable release of serpin C1 and E1, cystatin B and C, CD147 and uPA was seen for most patients. These mediators together with fetuin A, caspase 1, and CFD were included in a hierarchical clustering analysis and three patient subsets were identified (high, intermediate, and low release). High levels were associated with monocytic differentiation. Global gene expression analyses showed increased levels of several zinc finger proteins for low-release patients and high expression of several cell surface molecules, ATPases, and calcium-binding proteins for high-release patients. Constitutive release of several mediators was also seen for normal hematopoietic cells and mesenchymal stem cells. In cocultures of the latter and AML blasts, the release level for most mediators was altered to resemble the levels of the mesenchymal cells cultured alone.<h4>Conclusion</h4>Differences in constitutive release of protease/protease regulators are a part of the disease heterogeneity in AML.

Also flagged:joint diseaseosteoarthritisOAdegradationembryoid bodycartilage injury
Journal Article 2017-06-19 ✓ 1 Snippet Suchorska WM, Augustyniak E, Richter M, Łukjanow M, Filas V, Kaczmarczyk J, Trzeciak T.
In-Text Gene Mentions

…type II collagen,Sox6and Sox9 as…

Show Full Abstract

<h4>Introduction</h4>Human articular cartilage has a poor regenerative capacity. This often results in the serious joint disease- osteoarthritis (OA) that is characterized by cartilage degradation. An inability to self-repair provided extensive studies on AC regeneration. The cell-based cartilage tissue engineering is a promising approach for cartilage regeneration. So far, numerous cell types have been reported to show chondrogenic potential, among others human embryonic stem cells (hESCs).<h4>Materials and methods</h4>However, the currently used methods for directed differentiation of human ESCs into chondrocyte-like cells via embryoid body (EB) formation, micromass culture (MC) and pellet culture (PC) are not highly efficient and require further improvement. In the present study, these three methods for hESCs differentiation into chondrocyte-like cells in the presence of chondrogenic medium supplemented with diverse combination of growth factors (GFs) were evaluated and modified.<h4>Results</h4>The protocols established here allow highly efficient, simple and inexpensive production of a large number of chondrocyte-like cells suitable for transplantation into the sites of cartilage injury. The most crucial issue is the selection of appropriate GFs in defined concentration. The obtained stem-derived cells reveal the presence of chondrogenic markers such as type II collagen, Sox6 and Sox9 as well as the lack or significantly lower level of pluripotency markers including Nanog and Oct3/4.<h4>Discussion</h4>The most efficient method is the differentiation throughout embryoid bodies. In turn, chondrogenic differentiation via pellet culture is the most promising method for implementation on clinical scale. The most useful GFs are TGF-β1, -3 and BMP-2 that possess the most chondrogenic potential. These methods can also be used to obtain chondrocyte-like cells from differentiating induced pluripotent stem cells (iPSCs).

Also flagged:autosomal dominantlyneurodegenerative disorderHDpro-inflammatory cytokinesIL-1βIL-6
Journal Article 2017-06-19 ✓ 4 Snippets Yang HM, Yang S, Huang SS, Tang BS, Guo JF.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by expanded CAG trinucleotide repeats (>36) in exon 1 of HTT gene that encodes huntingtin protein.

…exon 1 ofHTTgene that encodes…

…expansion in theHTTgene, which translates…

…translates into huntingtin (HTT) protein with an…

Show Full Abstract

Huntington's disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by expanded CAG trinucleotide repeats (>36) in exon 1 of <i>HTT</i> gene that encodes huntingtin protein. Although HD is characterized by a predominant loss of neurons in the striatum and cortex, previous studies point to a critical role of aberrant accumulation of mutant huntingtin in microglia that contributes to the progressive neurodegeneration in HD, through both cell-autonomous and non-cell-autonomous mechanisms. Microglia are resident immune cells in the central nervous system (CNS), which function to surveil the microenvironment at a quiescent state. In response to various pro-inflammatory stimuli, microglia become activated and undergo two separate phases (M1 and M2 phenotype), which release pro-inflammatory cytokines (IL-1β, IL-6, and TNF-α), anti-inflammatory cytokines, and growth factors (TGF-β, CD206, and Arg1), respectively. Immunoregulation by microglial activation could be either neurotoxic or neuroprotective. In this review, we summarized current understanding about microglial activation in the pathogenesis and progression of HD, with a primary focus of M1 and M2 phenotype of activated microglia and their corresponding signaling pathways.

Also flagged:glycationHemoglobinglucosenephropathydiabetesglomerular filtration
Journal Article 2017-06-19 ✓ 1 Snippet Fiorentino TV, Marini MA, Succurro E, Sciacqua A, Andreozzi F, Perticone F, Sesti G.
In-Text Gene Mentions

…as amyloidosis andhemochromatosis, history of drug…

Show Full Abstract

Hemoglobin glycation index (HGI), calculated as the difference between the observed value of HbA1 and the predicted HbA1c based on plasma glucose concentration, is a measure of the individual tendency toward non-enzymatic hemoglobin glycation which has been found to be positively associated with nephropathy in subjects with diabetes. In this cross-sectional study we aimed to evaluate whether higher HGI levels are associated with impaired kidney function also among nondiabetic individuals. The study group comprised 1505 White nondiabetic individuals stratified in quartiles according to HGI levels. Estimated glomerular filtration rate (eGFR) was calculated by using the MDRD equation. Individuals in the intermediate and high HGI groups exhibited a worse metabolic phenotype with increased levels of visceral obesity, total cholesterol, triglycerides, inflammatory biomarkers such as hsCRP and white blood cells count and lower values of HDL and insulin sensitivity assessed by Matsuda index in comparison to the lowest quartile of HGI. Subjects in the intermediate and high HGI groups displayed a graded decrease of eGFR levels in comparison with the lowest quartile of HGI. In a logistic regression analysis individuals in the highest quartile of HGI exhibited a significantly 3.6-fold increased risk of having chronic kidney disease (95% CI: 1.13-11.24, <i>P</i> = 0.03) and a significantly 1.6-fold increased risk of having a mildly reduced kidney function (95% CI: 1.19-2.28, <i>P</i> = 0.003) in comparison to individuals in the lowest HGI group. In conclusion HGI may be a useful tool to identify nondiabetic individuals with an increased risk of having kidney dysfunction.

Also flagged:cancerpolymerasesiliconoxygenprostate cancerL-glutamine
Journal Article 2017-06-19 No Snippets Kim SC, Premasekharan G, Clark IC, Gemeda HB, Paris PL, Abate AR.
Show Full Abstract

Uniform amplification of low input DNA is important for applications across biology, including single-cell genomics, forensic science, and microbial and viral sequencing. However, the requisite biochemical amplification methods are prone to bias, skewing sequence proportions and obscuring signals relating to copy number. Digital droplet multiple displacement amplification enables uniform amplification, but requires expert knowledge of microfluidics to generate monodisperse emulsions. In addition, existing microfluidic methods are tedious and labor intensive for preparing many samples. Here, we introduce rapid emulsification multiple displacement amplification, a method to generate monodisperse droplets with a hand-held syringe and hierarchical droplet splitter. While conventional microfluidic devices require >10 minutes to emulsify a sample, our system takes tens of seconds and yields data of equivalent quality. We demonstrate the approach by using it to accurately measure copy number variation in single cancer cells.

Also flagged:EpilepticEpilepsygabapentinoxcarbazepinelamotriginetopiramate
Journal Article 2017-06-19 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

HTT

Show Full Abstract

No abstract available.

Also flagged:HypopituitarismacromegalyprolactinomasCraniopharyngiomasbrainsubarachnoid hemorrhage
Journal Article 2017-06-18 ✓ 1 Snippet Doknić M, Pekić S, Miljić D, Soldatović I, Popović V, Stojanović M, Petakov M.
In-Text Gene Mentions

…of TBI, neurosarcoidosis,hemochromatosis, meningitis, and SAH…

Show Full Abstract

There are only a few published studies related to the population-based etiology of hypopituitarism. New risks for developing hypopituitarism have been recognized in the last 10 years. <i>Aim</i>. To present data regarding the etiology of hypopituitarism collected in a tertiary center over the last decade. This is a cross-sectional database study. <i>Patients and Methods</i>. We included 512 patients (pts) with hypopituitarism, with a mean age of 45.9 ± 1.7 yrs (range: 18-82; male: 57.9%). <i>Results</i>. Nonfunctional pituitary adenomas were presented in 205 pts (40.5%), congenital causes in 74 pts (14.6%), while acromegaly and prolactinomas were presented in 37 (7.2%) and 36 (7.0%) patients, respectively. Craniopharyngiomas were detected in 30 pts (5.9%), and head trauma due to trauma brain injury-TBI and subarachnoid hemorrhage-SAH in 27 pts (5.4%). Survivors of hemorrhagic fever with renal syndrome (HFRS) and those with previous cranial irradiation were presented in the same frequency (18 pts, 3.5% each). <i>Conclusion</i>. The most common causes of hypopituitarism in our database are pituitary adenomas. Increased awareness of the other causes of pituitary dysfunction, such as congenital, head trauma, extrapituitary cranial irradiation, and infections, is the reason for a higher frequency of these etiologies of hypopituitarism in the presented database.

Also flagged:Chromatingene expressionpost-translational modificationshistonehistonesnucleosome
Journal Article 2017-06-17 ✓ 1 Snippet Giaimo BD, Ferrante F, Borggrefe T.
In-Text Gene Mentions

…(also known aschromatin modifiersmodifiers) at specific…

Show Full Abstract

Signaling pathways regulate gene expression programs via the modulation of the chromatin structure at different levels, such as by post-translational modifications (PTMs) of histone tails, the exchange of canonical histones with histone variants, and nucleosome eviction. Such regulation requires the binding of signal-sensitive transcription factors (TFs) that recruit chromatin-modifying enzymes at regulatory elements defined as enhancers. Understanding how signaling cascades regulate enhancer activity requires a comprehensive analysis of the binding of TFs, chromatin modifying enzymes, and the occupancy of specific histone marks and histone variants. Chromatin immunoprecipitation (ChIP) assays utilize highly specific antibodies to immunoprecipitate specific protein/DNA complexes. The subsequent analysis of the purified DNA allows for the identification the region occupied by the protein recognized by the antibody. This work describes a protocol to efficiently perform ChIP of histone proteins in a mature mouse T-cell line. The presented protocol allows for the performance of ChIP assays in a reasonable timeframe and with high reproducibility.

Also flagged:denguedengue infectionDIfebrile illnessesglycineserine
Journal Article 2017-06-17 ✓ 2 Snippets Banerjee A, Shukla S, Pandey AD, Goswami S, Bandyopadhyay B, Ramachandran V, Das S, Malhotra A, Agarwal A, Adhikari S, Rahman M, Chatterjee S, Bhattacharya N, Basu N, Pandey P, Sood V, Vrati S.
In-Text Gene Mentions

Several upregulated genes in the inflammatory process (MPO, DEFA4, ELANE, AUZ1, CTSG, OLFM4, SLC16A14, and CRISP3) that were associated with the dengue disease progression are known to facilitate leukocyte-mediated migration, and neutrophil activation and degranulation process.

…ELANE, AUZ1, CTSG,OLFM4, SLC16A14, and CRISP3)…

Show Full Abstract

Patients infected with Dengue virus usually present a mild, self-limiting febrile dengue infection (DI) that occasionally leads to a potentially lethal complication, called the severe dengue (DS). The ability to identify the prognostic markers of DS could allow an improved disease intervention and management. To identify the transcriptional signatures associated with the dengue disease progression, we carried out the high-throughput sequencing of the RNA isolated from the peripheral blood mononuclear cells (PBMCs) of the dengue patients of varying severity and compared with that in the patients with other febrile illnesses (OFIs) or the healthy controls. The transcriptional signatures that discriminated the DS patients from OFI and DI patients were broadly related to the pathways involving glycine, serine, and threonine metabolisms, extracellular matrix organization, ubiquitination, and cytokines and inflammatory response. Several upregulated genes in the inflammatory process (MPO, DEFA4, ELANE, AUZ1, CTSG, OLFM4, SLC16A14, and CRISP3) that were associated with the dengue disease progression are known to facilitate leukocyte-mediated migration, and neutrophil activation and degranulation process. High activity of MPO and ELANE in the plasma samples of the follow-up and recovered dengue patients, as well as and the presence of a larger amount of cell-free dsDNA in the DS patients, suggested an association of neutrophil-mediated immunity with dengue disease progression. Careful monitoring of some of these gene transcripts, and control of the activity of proteins encoded by them, may have a great translational significance for the prognosis and management of the dengue patients.

Also flagged:metabolismAGTRBP4cardiovascular diseasesCVDtissue remodeling
Journal Article 2017-06-17 ✓ 1 Snippet Cabral E, Soares H, Guimarães H, Vitorino R, Ferreira R, Henriques-Coelho T.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

<h4>Highlights</h4>Urine proteomics allows the identification of the pathways modulated in neonates.Up-regulated pathways in preterm include immunity, metabolism and oxidative stress.Some of these pathways seem to be modulated by the nutritional support.AGT and RBP4 might be related to the development of cardiovascular diseases.<h4>Abstract</h4>Preterm birth has been associated with an increased risk of cardiovascular diseases (CVD) in adulthood. The goal of our study was to give new molecular insights on the relationship between prematurity and CVD risk and to identify putative biomarkers that would facilitate the development of effective screening and therapeutic strategies. In this sense, mass spectrometry (MS)-based proteomics was applied to the characterization of urine protein profile.GeLC-MS/MS analysis of urine (desalted and concentrated with a 10-kDa filter) followed by bioinformatics was applied for the characterization of preterm and full-term neonates. Urine proteome profiling retrieved 434 unique proteins, from which 126 were common to both groups, 37 were unique to preterm and 58 to full-term neonates. Protein-protein interaction analysis for unique proteins and common ones present in significant distinct levels retrieved immune system, metabolism, defense systems and tissue remodeling as the most representative clusters in preterm neonates.Metabolic adaptation along with the up-regulation of heart growth (identified by angiotensinogen and retinol-binding protein 4) may account for an increased CVD risk in preterm neonates. These proteins may have predictive value of CVD in adulthood of this specific group of neonates. The follow-up of urinary proteome dynamics of preterm and full-term neonates will be crucial for the validation of this hypothesis.

Also flagged:GPCRG-protein-coupled receptorsepsisatherosclerosisGPCRsGpr39
Journal Article 2017-06-16 No Snippets Kaur H, Carvalho J, Looso M, Singh P, Chennupati R, Preussner J, Günther S, Albarrán-Juárez J, Tischner D, Classen S, Offermanns S, Wettschureck N.
Show Full Abstract

G-protein-coupled receptor (GPCR) expression is extensively studied in bulk cDNA, but heterogeneity and functional patterning of GPCR expression in individual vascular cells is poorly understood. Here, we perform a microfluidic-based single-cell GPCR expression analysis in primary smooth muscle cells (SMC) and endothelial cells (EC). GPCR expression is highly heterogeneous in all cell types, which is confirmed in reporter mice, on the protein level and in human cells. Inflammatory activation in murine models of sepsis or atherosclerosis results in characteristic changes in the GPCR repertoire, and we identify functionally relevant subgroups of cells that are characterized by specific GPCR patterns. We further show that dedifferentiating SMC upregulate GPCRs such as Gpr39, Gprc5b, Gprc5c or Gpr124, and that selective targeting of Gprc5b modulates their differentiation state. Taken together, single-cell profiling identifies receptors expressed on pathologically relevant subpopulations and provides a basis for the development of new therapeutic strategies in vascular diseases.

Also flagged:endometrial stromal sarcomaYWHAEuterine sarcomaBCORtumorsendometrial stromal sarcomas
Journal Article 2017-06-16 ✓ 1 Snippet Chiang S, Lee CH, Stewart CJR, Oliva E, Hoang LN, Ali RH, Hensley ML, Arias-Stella JA, Frosina D, Jungbluth AA, Benayed R, Ladanyi M, Hameed M, Wang L, Kao YC, Antonescu CR, Soslow RA.
In-Text Gene Mentions

polycomb repressive

Show Full Abstract

Recognition of high-grade endometrial stromal sarcoma is important because of its aggressive clinical behavior. Morphologic features of YWHAE-NUTM2 high-grade endometrial stromal sarcoma may overlap with other uterine sarcoma types. BCOR immunoexpression was studied in these tumors and their morphologic mimics to assess its diagnostic utility. BCOR immunohistochemical staining was performed on archival tissue from 28 high-grade endometrial stromal sarcomas with classic morphology (20 YWHAE-NUTM2, 5 ZC3H7B-BCOR, 3 BCOR-ZC3H7B), 3 high-grade endometrial stromal sarcomas with unusual morphology and unknown gene rearrangement status, 66 low-grade endometrial stromal sarcomas, 21 endometrial stromal nodules, 38 uterine leiomyosarcomas, and 19 uterine leiomyomas. Intensity of nuclear staining and percentage of positive tumor cells were recorded. Strong diffuse nuclear BCOR staining (defined as >95% of tumor cells) was seen in the round cell component of all 20 (100%) classic YWHAE-NUTM2 high-grade endometrial stromal sarcomas and the 3 unusual high-grade endometrial stromal sarcomas which prompted FISH studies confirming YWHAE rearrangement in 2 tumors. Genomic PCR confirmed the presence of BCOR exon 16 internal tandem duplication in the third case. Diffuse BCOR staining was strong in three and weak in one BCOR-rearranged high-grade endometrial stromal sarcoma while absent in the remaining four BCOR-rearranged tumors. BCOR staining was weakly positive in <5% of tumor cells in 4 of 66 (6%) low-grade endometrial stromal sarcomas and 1 of 18 (6%) endometrial stromal nodules and weakly to moderately positive in <5-40% of tumor cells in 6 of 31 (19%) leiomyosarcomas. No BCOR staining was seen in the remaining low-grade endometrial stromal sarcomas, endometrial stromal nodules, leiomyosarcomas, or any of the leiomyomas. BCOR immunohistochemical staining is a highly sensitive marker for YWHAE-NUTM2 high-grade endometrial stromal sarcoma with both classic and unusual morphology and identifies a subset of high-grade endometrial stromal sarcoma with BCOR alterations, including BCOR rearrangement and internal tandem duplication.

Also flagged:psychiatric syndromeschoreadementiaanxietyvisionpsychiatric
Journal Article 2017-06-16 No Snippets Paoli RA, Botturi A, Ciammola A, Silani V, Prunas C, Lucchiari C, Zugno E, Caletti E.
Show Full Abstract

Huntington's disease is a disorder that results in motor, cognitive, and psychiatric problems. The symptoms often take different forms and the presence of disturbances of the psychic sphere reduces patients' autonomy and quality of life, also impacting patients' social life. It is estimated that a prevalence between 33% and 76% of the main psychiatric syndromes may arise in different phases of the disease, often in atypical form, even 20 years before the onset of chorea and dementia. We present a narrative review of the literature describing the main psychopathological patterns that may be found in Huntington's disease, searching for a related article in the main database sources (Medline, ISI Web of Knowledge, Scopus, and Medscape). Psychiatric conditions were classified into two main categories: affective and nonaffective disorders/symptoms; and anxiety and neuropsychiatric features such as apathy and irritability. Though the literature is extensive, it is not always convergent, probably due to the high heterogeneity of methods used. We summarize main papers for pathology and sample size, in order to present a synoptic vision of the argument. Since the association between Huntington's disease and psychiatric symptoms was demonstrated, we argue that the prevalent and more invalidating psychiatric components should be recognized as early as possible during the disease course in order to best address psychopharmacological therapy, improve quality of life, and also reduce burden on caregivers.

Also flagged:p53Ulcerative colitisidiopathic inflammatory disordercolon cancerscolitic cancersUlcerative Colitis-Associated Cancer
Journal Article 2017-06-16 ✓ 1 Snippet Kobayashi K, Tomita H, Shimizu M, Tanaka T, Suzui N, Miyazaki T, Hara A.
In-Text Gene Mentions

…WNT, RAS, p53,DCC, and transforming growth…

Show Full Abstract

Ulcerative colitis (UC) is defined as an idiopathic inflammatory disorder primarily involving the mucosa and submucosa of the colon. UC-associated colon cancers (also known as colitic cancers) develop through the inflammation-dysplasia sequence, which is a major problem affecting the prognosis of patients with UC. It is therefore very important to detect malignancy from UC at an early stage. As precancerous lesions arising in UC, there are pathological adenomatous changes, basal cell changes, in situ anaplasia, clear cell changes, and pan-cellular change. It is considered that the mutation of the p53 gene plays a crucial role, and the protein expression of p53 in dysplastic crypts may serve as a good biomarker in the early stages of UC-associated colon carcinogenesis. Immunohistochemistry for p53 is a very valuable diagnostic tool in UC-associated colon cancers. However, protein expression of p53 is not always universal, and additional methods may be required to assess p53 status in UC-associated colon cancers.

Also flagged:Hemophagocytic lymphohistiocytosispathogenesistumorMhematologic malignanciesinfection
Journal Article 2017-06-16 No Snippets Daver N, McClain K, Allen CE, Parikh SA, Otrock Z, Rojas-Hernandez C, Blechacz B, Wang S, Minkov M, Jordan MB, La Rosée P, Kantarjian HM.
Show Full Abstract

Hemophagocytic lymphohistiocytosis (HLH) is a syndrome of severe immune activation and dysregulation resulting in extreme and often life-threatening inflammation. HLH has been well recognized in pediatric populations, and most current diagnostic and therapeutic guidelines are based on pediatric HLH. Recently there has been recognition of HLH in adults, especially secondary to immune deregulation by an underlying rheumatologic, infectious, or malignant condition. This review is focused on malignancy-associated HLH (M-HLH), in which possible mechanisms of pathogenesis include severe inflammation, persistent antigen stimulation by the tumor cells, and loss of immune homeostasis because of chemotherapy, hematopoietic stem cell transplantation, or infection. Previously considered rare, M-HLH may occur in up to 1% of patients with hematologic malignancies. M-HLH is often missed or diagnosed late in most published studies, and it has been associated with a poor median survival of less than 2 months. Identification of the clinical and laboratory features specific to M-HLH in adults may allow early detection, consultation with HLH experts, and intervention. Improved management of adult M-HLH with optimal combinations of T-lympholytic and immunosuppressive agents and the incorporation of novel agents based on the pediatric experience hopefully will improve outcomes in adults with M-HLH. Cancer 2017;123:3229-40. © 2017 American Cancer Society.

Also flagged:synthesislipid AlipopolysaccharidesToll-like receptorsunsaturated lipidscarboxyl
Journal Article 2017-06-16 No Snippets Gao J, Guo Z.
Show Full Abstract

Lipid A is one of the core structures of bacterial lipopolysaccharides (LPSs), and it is mainly responsible for the strong immunostimulatory activities of LPS through interactions with the Toll-like receptors and other molecules in the human immune system. To obtain structurally homogeneous and well-defined lipid As and its derivatives in quantities meaningful for various biological studies and applications, their chemical synthesis has become a focal point. This review has provided a survey of significant progresses made in the synthesis of lipid A, and its derivatives that carry diverse saturated and unsaturated lipids, have the phosphate group at its reducing end replaced with a more stable phosphate or carboxyl group, or lack the reducing end phosphate or both phosphate groups, as well as progresses in the synthesis of LPS analogs and other lipid A conjugates. These synthetic molecules have facilitated the elucidation of the structure-activity relationships of lipid A useful for the design and development of lipid A based therapeutics, such as those utilized to treat sepsis, and other medical applications, for example the use of monophosphoryl lipid A as a carrier molecule for the study of fully synthetic self-adjuvanting conjugate vaccines. These topics are also briefly covered in the current review.

Also flagged:BIRreplication forksdevelopmental diseasesneurological disorderscancersneurodegenerative diseases
Journal Article 2017-06-16 No Snippets Leffak M.
Show Full Abstract

The instability of microsatellite DNA repeats is responsible for at least 40 neurodegenerative diseases. Recently, Mirkin and co-workers presented a novel mechanism for microsatellite expansions based on break-induced replication (BIR) at sites of microsatellite-induced replication stalling and fork collapse. The BIR model aims to explain single-step, large expansions of CAG/CTG trinucleotide repeats in dividing cells. BIR has been characterized extensively in Saccharomyces cerevisiae as a mechanism to repair broken DNA replication forks (single-ended DSBs) and degraded telomeric DNA. However, the structural footprints of BIR-like DSB repair have been recognized in human genomic instability and tied to the etiology of diverse developmental diseases; thus, the implications of the paper by Kim et al. (Kim JC, Harris ST, Dinter T, Shah KA, et al., Nat Struct Mol Biol 24: 55-60) extend beyond trinucleotide repeat expansion in yeast and microsatellite instability in human neurological disorders. Significantly, insight into BIR-like repair can explain certain pathways of complex genome rearrangements (CGRs) initiated at non-B form microsatellite DNA in human cancers.

Also flagged:WNTMAPKtumourApctumoursgene expression
Journal Article 2017-06-16 ✓ 5 Snippets Cammareri P, Vincent DF, Hodder MC, Ridgway RA, Murgia C, Nobis M, Campbell AD, Varga J, Huels DJ, Subramani C, Prescott KLH, Nixon C, Hedley A, Barry ST, Greten FR, Inman GJ, Sansom OJ.
In-Text Gene Mentions

…, Lgr5 andOlfm4mRNA was performed…

…For Lgr5 andOlfm4quantification, areas were…

…markers Lgr5 andOlfm4in CDS (…

…of Lgr5 andOlfm4in CDS (…

…increased Lgr5 andOlfm4expression levels in…

Show Full Abstract

Recent studies have suggested increased plasticity of differentiated cells within the intestine to act both as intestinal stem cells (ISCs) and tumour-initiating cells. However, little is known of the processes that regulate this plasticity. Our previous work has shown that activating mutations of Kras or the NF-κB pathway can drive dedifferentiation of intestinal cells lacking Apc. To investigate this process further, we profiled both cells undergoing dedifferentiation in vitro and tumours generated from these cells in vivo by gene expression analysis. Remarkably, no clear differences were observed in the tumours; however, during dedifferentiation in vitro we found a marked upregulation of TGFβ signalling, a pathway commonly mutated in colorectal cancer (CRC). Genetic inactivation of TGFβ type 1 receptor (Tgfbr1/Alk5) enhanced the ability of Kras<sup>G12D/+</sup> mutation to drive dedifferentiation and markedly accelerated tumourigenesis. Mechanistically this is associated with a marked activation of MAPK signalling. Tumourigenesis from differentiated compartments is potently inhibited by MEK inhibition. Taken together, we show that tumours arising in differentiated compartments will be exposed to different suppressive signals, for example, TGFβ and blockade of these makes tumourigenesis more efficient from this compartment.

Also flagged:Rho-kinaseY-27632S100 proteinextracellularchondrosarcomaoxygen
Journal Article 2017-06-16 ✓ 2 Snippets Piltti J, Bygdell J, Fernández-Echevarría C, Marcellino D, Lammi MJ.
In-Text Gene Mentions

…coactivators SOX5 andSOX626 .…

…SOX trio (SOX5,SOX6and SOX9), and…

Show Full Abstract

Articular chondrocytes are slowly dividing cells that tend to lose their cell type-specific phenotype and ability to produce structurally and functionally correct cartilage tissue when cultured. Thus, culture conditions, which enhance the maintenance of chondrocyte phenotype would be very useful for cartilage research. Here we show that Rho-kinase inhibition by Y-27632 under hypoxic conditions efficiently maintains and even enhances chondrocyte-specific extracellular matrix production by chondrocytic cells. The effects of long-term Y-27632 exposure to human chondrosarcoma 2/8 cell phenotype maintenance and extracellular matrix production were studied at normoxia and at a 5% low oxygen atmosphere. Y-27632 treatment at normoxia induced ACAN and COL2A1 gene up-regulation and a minor increase of sulfated glycosaminoglycans (sGAGs), while type II collagen expression was not significantly up-regulated. A further increase in expression of ACAN and COL2A1 was achieved with Y-27632 treatment and hypoxia. The production of sGAGs increased by 65.8%, and ELISA analysis revealed a 6-fold up-regulation of type II collagen. Y-27632 also induced the up-regulation of S100-A1 and S100-B proteins and modified the expression of several other S100 protein family members, such as S100-A4, S100-A6, S100-A13 and S100-A16. The up-regulation of S100-A1 and S100-B proteins is suggested to enhance the chondrocytic phenotype of these cells.

Also flagged:exocytosisRAB11protein 5protein 2RPGINS
Journal Article 2017-06-16 ✓ 3 Snippets Zhang X, Jiang S, Mitok KA, Li L, Attie AD, Martin TFJ.
In-Text Gene Mentions

UNC13C

PLCL1

…, PLCB1 ,PLCL1, PRKCA ,…

Show Full Abstract

Dense-core vesicle (DCV) exocytosis is a SNARE (soluble <i>N</i>-ethylmaleimide-sensitive fusion attachment protein receptor)-dependent anterograde trafficking pathway that requires multiple proteins for regulation. Several C2 domain-containing proteins are known to regulate Ca<sup>2+</sup>-dependent DCV exocytosis in neuroendocrine cells. In this study, we identified others by screening all (∼139) human C2 domain-containing proteins by RNA interference in neuroendocrine cells. 40 genes were identified, including several encoding proteins with known roles (CAPS [calcium-dependent activator protein for secretion 1], Munc13-2, RIM1, and SYT10) and many with unknown roles. One of the latter, BAIAP3, is a secretory cell-specific Munc13-4 paralog of unknown function. BAIAP3 knockdown caused accumulation of fusion-incompetent DCVs in BON neuroendocrine cells and lysosomal degradation (crinophagy) of insulin-containing DCVs in INS-1 β cells. BAIAP3 localized to endosomes was required for Golgi trans-Golgi network 46 (TGN46) recycling, exhibited Ca<sup>2+</sup>-stimulated interactions with TGN SNAREs, and underwent Ca<sup>2+</sup>-stimulated TGN recruitment. Thus, unlike other Munc13 proteins, BAIAP3 functions indirectly in DCV exocytosis by affecting DCV maturation through its role in DCV protein recycling. Ca<sup>2+</sup> rises that stimulate DCV exocytosis may stimulate BAIAP3-dependent retrograde trafficking to maintain DCV protein homeostasis and DCV function.

Also flagged:anxietydepressionserotonin transporteranxiety disorderspsychiatric disordersneuropsychiatric disorders
Journal Article 2017-06-16 ✓ 5 Snippets Rogers J, Li S, Lanfumey L, Hannan AJ, Renoir T.
In-Text Gene Mentions

Using the elevated-plus maze and the light-dark box, we found that environmental enrichment ameliorated the abnormal innate anxiety of 5-HTT KO mice on both tests.

Along with being the main target of many antidepressant medications, the serotonin transporter (5-HTT) is known to be involved in the pathophysiology of depression and anxiety disorders.

In conclusion, our data suggest that environmental enrichment specifically reduces innate anxiety of 5-HTT KO mice with no amelioration of the depression-like behaviour.

…the serotonin transporter (5-HTT) is known to…

…mice with varying5-HTTgenotypes are invaluable…

Show Full Abstract

Along with being the main target of many antidepressant medications, the serotonin transporter (5-HTT) is known to be involved in the pathophysiology of depression and anxiety disorders. In line with this, mice with varying 5-HTT genotypes are invaluable tools to study depression- and anxiety-like behaviours as well as the mechanisms mediating potential therapeutics. There is clear evidence that both genetic and environmental factors play a role in the aetiology of psychiatric disorders. In that regard, housing paradigms which seek to enhance cognitive stimulation and physical activity have been shown to exert beneficial effects in animal models of neuropsychiatric disorders. In the present study, we examined the effects of environmental enrichment on affective-like behaviours and sensorimotor gating function of 5-HTT knock-out (KO) mice. Using the elevated-plus maze and the light-dark box, we found that environmental enrichment ameliorated the abnormal innate anxiety of 5-HTT KO mice on both tests. In contrast, environmental enrichment did not rescue the depression-like behaviour displayed by 5-HTT KO mice in the forced-swim test. Finally, measuring pre-pulse inhibition, we found no effect of genotype or treatment on sensorimotor gating. In conclusion, our data suggest that environmental enrichment specifically reduces innate anxiety of 5-HTT KO mice with no amelioration of the depression-like behaviour. This has implications for the current use of clinical interventions for patients with symptoms of both anxiety and depression.

Also flagged:CDKN1CKCNQ1chromosomesHAL1transcription factorsSOX
Journal Article 2017-06-16 No Snippets De Donato M, Hussain T, Rodulfo H, Peters SO, Imumorin IG, Thomas BN.
Show Full Abstract

KCNQ1OT1 is located in the region with the highest number of genes showing genomic imprinting, but the mechanisms controlling the genes under its influence have not been fully elucidated. Therefore, we conducted a comparative analysis of the KCNQ1/KCNQ1OT1-CDKN1C region to study its conservation across the best assembled eutherian mammalian genomes sequenced to date and analyzed potential elements that may be implicated in the control of genomic imprinting in this region. The genomic features in these regions from human, mouse, cattle, and dog show a higher number of genes and CpG islands (detected using cpgplot from EMBOSS), but lower number of repetitive elements (including short interspersed nuclear elements and long interspersed nuclear elements), compared with their whole chromosomes (detected by RepeatMasker). The KCNQ1OT1-CDKN1C region contains the highest number of conserved noncoding sequences (CNS) among mammals, where we found 16 regions containing about 38 different highly conserved repetitive elements (using mVista), such as LINE1 elements: L1M4, L1MB7, HAL1, L1M4a, L1Med, and an LTR element: MLT1H. From these elements, we found 74 CNS showing high sequence identity (>70%) between human, cattle, and mouse, from which we identified 13 motifs (using Multiple Em for Motif Elicitation/Motif Alignment and Search Tool) with a significant probability of occurrence, 3 of which were the most frequent and were used to find transcription factor-binding sites. We detected several transcription factors (using JASPAR suite) from the families SOX, FOX, and GATA. A phylogenetic analysis of these CNS from human, marmoset, mouse, rat, cattle, dog, horse, and elephant shows branches with high levels of support and very similar phylogenetic relationships among these groups, confirming previous reports. Our results suggest that functional DNA elements identified by comparative genomics in a region densely populated with imprinted mammalian genes may be related to the regulation of imprinted gene expression.

Also flagged:Neurodegenerative Disordersendoplasmic reticulumlumendeathHuntington diseaseamyotrophic lateral sclerosis
Journal Article 2017-06-16 ✓ 1 Snippet Remondelli P, Renna M.
In-Text Gene Mentions

Reduced the accumulation of mutant Htt in a mouse model of HD

Show Full Abstract

In eukaryotic cells, the endoplasmic reticulum (ER) is the cell compartment involved in secretory protein translocation and quality control of secretory protein folding. Different conditions can alter ER function, resulting in the accumulation of unfolded or misfolded proteins within the ER lumen. Such a condition, known as ER stress, elicits an integrated adaptive response known as the unfolded protein response (UPR) that aims to restore proteostasis within the secretory pathway. Conversely, in prolonged cell stress or insufficient adaptive response, UPR signaling causes cell death. ER dysfunctions are involved and contribute to neuronal degeneration in several human diseases, including Alzheimer, Parkinson and Huntington disease and amyotrophic lateral sclerosis. The correlations between ER stress and its signal transduction pathway known as the UPR with neuropathological changes are well established. In addition, much evidence suggests that genetic or pharmacological modulation of UPR could represent an effective strategy for minimizing the progressive neuronal loss in neurodegenerative diseases. Here, we review recent results describing the main cellular mechanisms linking ER stress and UPR to neurodegeneration. Furthermore, we provide an up-to-date panoramic view of the currently pursued strategies for ameliorating the toxic effects of protein unfolding in disease by targeting the ER UPR pathway.

Also flagged:ironsickle cell diseasethalassemiamyelodysplastic syndromesdeferoxaminedeferasirox
Journal Article 2017-06-16 ✓ 2 Snippets Shah NR.
In-Text Gene Mentions

…hepcidin expression preventshemochromatosisin thalassemia and…

…in patients withhemochromatosis[ 13 ].…

Show Full Abstract

Iron overload is a concern for patients who require repeated red-blood-cell transfusions due to conditions such as sickle cell disease, thalassemia, or myelodysplastic syndromes. The recommended treatment for removing excess iron in these patients is iron chelation therapy. Currently available iron chelators include deferoxamine, which is administered by injection, and deferasirox and deferiprone, both of which are administered orally. Adherence to iron chelator therapy is an important consideration and may be affected by side effects. A new formulation of deferasirox, a film-coated tablet (FCT), has the potential to improve adherence by offering greater flexibility in administration compared with the original formulation of deferasirox, a dispersible tablet (DT) for oral suspension. This review provides an overview of the currently available iron chelator formulations, with a focus on a comparison between deferasirox DT for oral suspension and deferasirox FCT. The new formulation may be associated with fewer side effects and has increased bioavailability. In addition, alternative strategies for iron chelation, such as combining two different iron chelators, will be discussed.

Also flagged:Dopaminesynapsesaxonaxon growthaxonsreceptor
Journal Article 2017-06-16 ✓ 5 Snippets Reynolds LM, Pokinko M, Torres-Berrío A, Cuesta S, Lambert LC, Del Cid Pellitero E, Wodzinski M, Manitt C, Krimpenfort P, Kolb B, Flores C.
In-Text Gene Mentions

When DCC-dependent adolescent targeting events are disrupted, dopamine axons continue to grow ectopically from the nucleus accumbens to the PFC and profoundly change PFC structural and functional development.

Importantly, we discover that DCC, a guidance cue receptor, controls the extent of this protracted growth by determining where and when dopamine axons recognize their final target.

We then paired this recombination with cell-specific knockdown of the netrin-1 receptor DCC to determine its role in adolescent dopamine axon growth.

DCC ReceptorsReceptors Drive Prefrontal…

…the netrin-1 receptorDCCto determine its…

Show Full Abstract

<h4>Background</h4>Dopaminergic input to the prefrontal cortex (PFC) increases throughout adolescence and, by establishing precisely localized synapses, calibrates cognitive function. However, why and how mesocortical dopamine axon density increases across adolescence remains unknown.<h4>Methods</h4>We used a developmental application of axon-initiated recombination to label and track the growth of dopamine axons across adolescence in mice. We then paired this recombination with cell-specific knockdown of the netrin-1 receptor DCC to determine its role in adolescent dopamine axon growth. We then assessed how altering adolescent PFC dopamine axon growth changes the structural and functional development of the PFC by quantifying pyramidal neuron morphology and cognitive performance.<h4>Results</h4>We show, for the first time, that dopamine axons continue to grow from the striatum to the PFC during adolescence. Importantly, we discover that DCC, a guidance cue receptor, controls the extent of this protracted growth by determining where and when dopamine axons recognize their final target. When DCC-dependent adolescent targeting events are disrupted, dopamine axons continue to grow ectopically from the nucleus accumbens to the PFC and profoundly change PFC structural and functional development. This leads to alterations in cognitive processes known to be impaired across psychiatric conditions.<h4>Conclusions</h4>The prolonged growth of dopamine axons represents an extraordinary period for experience to influence their adolescent trajectory and predispose to or protect against psychopathology. DCC receptor signaling in dopamine neurons is a molecular link where genetic and environmental factors may interact in adolescence to influence the development and function of the prefrontal cortex.

Also flagged:cancerscolorectal cancerglucosemetabolismdigestive cancercancer
Journal Article 2017-06-16 ✓ 1 Snippet Yan S, Han B, Gao S, Wang X, Wang Z, Wang F, Zhang J, Xu D, Sun B.
In-Text Gene Mentions

…in colon cancer (DCC), as biomarkers either…

Show Full Abstract

Currently available studies have suggested that a number of exosome-encapsulated microRNAs (miRNAs) are recognized as stable biomarkers for cancers. However, little is known about the effect of exosomal miRNAs on colorectal cancer (CRC). The aim of study is to identify specific miRNAs in serum exosomes, which may serve as potential diagnostic and prognostic biomarkers and therapeutic targets for CRC. Microarray analyses of miRNAs in serum exosomes from 3 primary CRC patients and 3 healthy controls were performed. Those differentially expressed exosome-encapsulated miRNAs were verified in exosome-enriched serum samples from 77 CRC patients and 20 healthy controls by quantitative real-time PCR (qRT-PCR). A total of 39 aberrantly expressed miRNAs in serum exosomes were identified by microarray analysis. After confirmation by qRT-PCR, we found that 5 exosome-encapsulated miRNAs (miR-638, miR-5787, miR-8075, miR-6869-5p and miR-548c-5p) were significantly down-regulated, while 2 exosome-encapsulated miRNAs (miR-486-5p and miR-3180-5p) were significantly up-regulated in serum. Decreased levels of miR-638 in serum exosomes were associated with increased risk of liver metastasis and later TNM stage of CRC. Networks analyses revealed that 5 aberrantly expressed miRNAs (miR-638, miR-5787, miR-8075, miR-6869-5p, and miR-548c-5p) might be involved in the process of glucose metabolism in CRC. The present study shows the specific serum profile of exosome-encapsulated miRNAs in CRC. Those specific miRNAs in serum exosomes may serve as disease biomarkers and novel therapeutic targets for CRC.

Also flagged:breast cancernucleotidesbindinggene expressioncell differentiationmetabolism
Journal Article 2017-06-16 ✓ 2 Snippets Mu K, Wu ZZ, Yu JP, Guo W, Wu N, Wei LJ, Zhang H, Zhao J, Liu JT.
In-Text Gene Mentions

The presence of this mismatch would affect Sox6 and Rod1 genes, which are important in the etiology of several cancers [49].

…mismatch would affectSox6and Rod1 genes,…

Show Full Abstract

Single nucleotide polymorphisms (SNPs) in three microRNAs (miRNAs), rs2910164 in miR-146a, rs11614913 in miR-196a2, and rs3746444 in miR-499, have been associated with breast cancer (BC) susceptibility, but the evidence is conflicting. To obtain a more robust assessment of the association between these miRNA variants and BC risk, we carried out a meta-analysis through systematic literature retrieval from the PubMed and Embase databases. A total of 9 case-control studies on rs2910164, 12 on rs11614913, and 7 on rs3746444 were included. Pooled odds ratios and 95% confidence intervals were used to evaluate associations with BC risk. Overall analysis showed that rs2910164 was not associated with BC susceptibility in any genetic model, whereas rs11614913 was associated with a decreased risk in both the allelic contrast and recessive models, and rs3746444 imparted an increased risk in all genetic models. Stratified analyses showed that rs11614913 may decrease the risk of BC in the heterozygote model in Asians, and in all genetic models, except the heterozygote model, when the sample size is ≥ 500. Subgroup analysis indicated that rs3746444 was associated with increased risk of BC in Asians, but not Caucasians, at all sample sizes. This meta-analysis suggests that rs11614913 in miR-196a2 may decrease the risk of BC, while rs3746444 in miR-499 may increase it, especially in Asians when the sample size is large. We propose that rs11614913(C > T) and rs3746444 (A > G) may be useful biomarkers predictive of BC risk.

Also flagged:Lipocalin 2Ironcell proliferationLcn2siderophore-binding antimicrobial proteinmetabolism
Journal Article 2017-06-16 No Snippets Guo BX, Wang QQ, Li JH, Gan ZS, Zhang XF, Wang YZ, Du HH.
Show Full Abstract

Iron is an essential nutrient that facilitates cell proliferation and growth, which plays a pivotal role in modulating the battle for survival between mammalian hosts and their pathogens. Pathogenic bacteria secrete siderophores to acquire iron from the host. However, lipocalin 2 (Lcn2), a siderophore-binding antimicrobial protein, binds to siderophores to prevent bacterial uptake of iron, which is critical for the control of systemic infection with <i>Escherichia coli</i> (<i>E. coli</i>). But few studies focus on the anti-infective response of Lcn2 in the intestines by inhibiting bacterial proliferation based on microbial iron metabolism. In this study, we showed that iron was sequestrated within cells in a piglet model of <i>E. coli</i> K88 infection. Siderophores was produced following <i>E. coli</i> K88 infection and siderophore-related genes expression was upregulated in iron-deficiency environment <i>in vitro</i>. Meanwhile, we found that Lcn2 expression was rapidly and robustly induced in jejunum by <i>E. coli</i> K88 infection and could be stimulated by IL-17 and IL-22. Furthermore, both Lcn2 induced in epithelial cells IPEC-1 and added exogenously as a recombinant protein could inhibit the growth of <i>E. coli</i>. We can conclude that Lcn2 is a crucial component of mucosal immune defense against intestinal infection with <i>E. coli</i> K88.

Also flagged:congenital disorders of glycosylationPGM1D-galactoseglycosylationglycanTransferrin
Journal Article 2017-06-15 ✓ 5 Snippets Wong SY, Gadomski T, van Scherpenzeel M, Honzik T, Hansikova H, Holmefjord KSB, Mork M, Bowling F, Sykut-Cegielska J, Koch D, Hertecant J, Preston G, Jaeken J, Peeters N, Perez S, Nguyen DD, Crivelly K, Emmerzaal T, Gibson KM, Raymond K, Abu Bakar N, Foulquier F, Poschet G, Ackermann AM, He M, Lefeber DJ, Thiel C, Kozicz T, Morava E.
In-Text Gene Mentions

Antithrombin-IIIlevels and transferrin-glycosy…

…Transferrin glycosylation andATIIIlevels were useful…

…IX, aPTT, andATIII), were measured in…

ATIIInormalized in patients…

…While patient 2’sATIIIdropped 30 %…

Show Full Abstract

PurposePhosphoglucomutase-1 deficiency is a subtype of congenital disorders of glycosylation (PGM1-CDG). Previous casereports in PGM1-CDG patients receiving oral D-galactose (D-gal) showed clinical improvement. So far no systematic in vitro and clinical studies have assessed safety and benefits of D-gal supplementation. In a prospective pilot study, we evaluated the effects of oral D-gal in nine patients.MethodsD-gal supplementation was increased to 1.5 g/kg/day (maximum 50 g/day) in three increments over 18 weeks. Laboratory studies were performed before and during treatment to monitor safety and effect on serum transferrin-glycosylation, coagulation, and liver and endocrine function. Additionally, the effect of D-gal on cellular glycosylation was characterized in vitro.ResultsEight patients were compliant with D-gal supplementation. No adverse effects were reported. Abnormal baseline results (alanine transaminase, aspartate transaminase, activated partial thromboplastin time) improved or normalized already using 1 g/kg/day D-gal. Antithrombin-III levels and transferrin-glycosylation showed significant improvement, and increase in galactosylation and whole glycan content. In vitro studies before treatment showed N-glycan hyposialylation, altered O-linked glycans, abnormal lipid-linked oligosaccharide profile, and abnormal nucleotide sugars in patient fibroblasts. Most cellular abnormalities improved or normalized following D-gal treatment. D-gal increased both UDP-Glc and UDP-Gal levels and improved lipid-linked oligosaccharide fractions in concert with improved glycosylation in PGM1-CDG.ConclusionOral D-gal supplementation is a safe and effective treatment for PGM1-CDG in this pilot study. Transferrin glycosylation and ATIII levels were useful trial end points. Larger, longer-duration trials are ongoing.

Also flagged:IL-1βVEGFangiogenesisatherosclerosiscancerinterleukin 1-β
Journal Article 2017-06-15 ✓ 4 Snippets Mohr T, Haudek-Prinz V, Slany A, Grillari J, Micksche M, Gerner C.
In-Text Gene Mentions

…HUVEC around LTA4H,SERPINC1, ANXA1, PSMA6, GSTP1,…

…network centers aroundSERPINC, which inhibits thrombin…

…namely VNN1, FN1,SERPINC1.…

…The neighborhood ofSERPINC1has been described…

Show Full Abstract

Endothelial cells represent major effectors in inflammation and angiogenesis, processes that drive a multitude of pathological states such as atherosclerosis and cancer. Both inflammation and angiogenesis are interconnected with each other in the sense that many pro-inflammatory proteins possess proangiogenic properties and vice versa. To elucidate this interplay further, we present a comparative proteome study of inflammatory and angiogenic activated endothelial cells. HUVEC were stimulated with interleukin 1-β and VEGF, respectively. Cultured primary cells were fractionated into secreted, cytoplasmic and nuclear protein fractions and processed for subsequent LC-MS/MS analysis. Obtained protein profiles were filtered for fraction-specific proteins to address potential cross fractional contamination, subjected to comparative computational biology analysis (GO-Term enrichment analysis, weighted gene co-expression analysis) and compared to published mRNA profiles of IL-1β respectively VEGF stimulated HUVEC. GO Term enrichment analysis and comparative pathway analysis revealed features such as NOD and NfkB signaling for inflammatory activated HUVEC and VEGF and ErB signaling for VEGF-activated HUVEC with potential crosstalk via map kinases MAP2K2. Weighted protein co-expression network analysis revealed several potential hub genes so far not associated with driver function in inflammation or angiogenesis such as HSPG2, ANXA3, and GPI. "Classical" inflammation or angiogenesis markers such as IL6, CXCL8 or CST1 were found in a less central position within the co-expression networks. In conclusion, this study reports a framework for the computational biology based analysis of proteomics data applied to cytoplasmic, nucleic and extracellular fractions of quiescent, inflammatory and angiogenic activated HUVEC. Novel potential hub genes relevant for these processes were successfully identified.

Also flagged:Deficiencyendoplasmic reticulumliver diseaseHRD1Endoplasmic Reticulum Associated DegradationHERPUD1
Journal Article 2017-06-15 ✓ 5 Snippets Joly P, Vignaud H, Di Martino J, Ruiz M, Garin R, Restier L, Belmalih A, Marchal C, Cullin C, Arveiler B, Fergelot P, Gitler AD, Lachaux A, Couthouis J, Bouchecareilh M.
In-Text Gene Mentions

Finally, these findings support a larger scale screening for HERPUD1 R50H and HFE H63D variants in the sub-group of 1ATD patients developing significant chronic hepatic injuries (hepatomegaly, chronic cholestasis, elevated liver enzymes) and at risk developing liver cirrhosis.

ERAD defects and the HFE-H63D variant are associated with increased risk of liver damages in Alpha 1-Antitrypsin Deficiency.

Based on our results, we predict that an ERAD dysfunction associated with a light or moderate accumulation of a misfolded protein such as HFE H63D overcome the liver’s capacity to deal with Z-1AT aggregates accumulation, which in turn trigger UPR mediated cell death and lead to a complete liver failure.

ERAD defects and the HFE-H63D variant are associated with increased risk of liver damages in Alpha 1-Antitrypsin Deficiency

…Z-1AT homozygous cases:HFEH63D and HERPUD1…

Show Full Abstract

<h4>Background</h4>The most common and severe disease causing allele of Alpha 1-Antitrypsin Deficiency (1ATD) is Z-1AT. This protein aggregates in the endoplasmic reticulum, which is the main cause of liver disease in childhood. Based on recent evidences and on the frequency of liver disease occurrence in Z-1AT patients, it seems that liver disease progression is linked to still unknown genetic factors.<h4>Methods</h4>We used an innovative approach combining yeast genetic screens with next generation exome sequencing to identify and functionally characterize the genes involved in 1ATD associated liver disease.<h4>Results</h4>Using yeast genetic screens, we identified HRD1, an Endoplasmic Reticulum Associated Degradation (ERAD) associated protein, as an inducer of Z-mediated toxicity. Whole exome sequencing of 1ATD patients resulted in the identification of two variants associated with liver damages in Z-1AT homozygous cases: HFE H63D and HERPUD1 R50H. Functional characterization in Z-1AT model cell lines demonstrated that impairment of the ERAD machinery combined with the HFE H63D variant expression decreased both cell proliferation and cell viability, while Unfolded Protein Response (UPR)-mediated cell death was hyperstimulated.<h4>Conclusion</h4>This powerful experimental pipeline allowed us to identify and functionally validate two genes involved in Z-1AT-mediated severe liver toxicity. This pilot study moves forward our understanding on genetic modifiers involved in 1ATD and highlights the UPR pathway as a target for the treatment of liver diseases associated with 1ATD. Finally, these findings support a larger scale screening for HERPUD1 R50H and HFE H63D variants in the sub-group of 1ATD patients developing significant chronic hepatic injuries (hepatomegaly, chronic cholestasis, elevated liver enzymes) and at risk developing liver cirrhosis.

Also flagged:Borderline personality disorderstress-related disordersemotional dysregulationemotion dysregulationpersonality disorderssexual abuse
Journal Article 2017-06-15 ✓ 1 Snippet Cattane N, Rossi R, Lanfredi M, Cattaneo A.
In-Text Gene Mentions

…Serotonin Transporter 1 (5-HTT), Monoamine Oxidase A…

Show Full Abstract

<h4>Background</h4>According to several studies, the onset of the Borderline Personality Disorder (BPD) depends on the combination between genetic and environmental factors (GxE), in particular between biological vulnerabilities and the exposure to traumatic experiences during childhood. We have searched for studies reporting possible alterations in several biological processes and brain morphological features in relation to childhood trauma experiences and to BPD. We have also looked for epigenetic mechanisms as they could be mediators of the effects of childhood trauma in BPD vulnerability.<h4>Discussion</h4>We prove the role of alterations in Hypothalamic-Pituitary-Adrenal (HPA) axis, in neurotrasmission, in the endogenous opioid system and in neuroplasticity in the childhood trauma-associated vulnerability to develop BPD; we also confirm the presence of morphological changes in several BPD brain areas and in particular in those involved in stress response. Not so many studies are available on epigenetic changes in BPD patients, although these mechanisms are widely investigated in relation to stress-related disorders. A better comprehension of the biological and epigenetic mechanisms, affected by childhood trauma and altered in BPD patients, could allow to identify "at high risk" subjects and to prevent or minimize the development of the disease later in life.

Also flagged:bronchiolitisobliterative bronchiolitisOBindoleamine 2,3-dioxygenaseIDOinterferon-γ
Journal Article 2017-06-15 No Snippets Zheng G, Qiu G, Ge M, He J, Huang L, Chen P, Wang W, Xu Q, Hu Y, Shu Q, Xu J.
Show Full Abstract

<h4>Background</h4>Long-term survival of lung transplantation is hindered by the development of obliterative bronchiolitis (OB). Adipose-derived stem cells (ASCs) were documented to have more potent immunosuppressive ability than mesenchymal stem cells (MSCs) from bone marrow and placenta. The goal of our study is to evaluate the effect of repeated administration of ASCs on OB and the involvement of indoleamine 2,3-dioxygenase (IDO) mediating the protective effect of ASCs in a heterotopic tracheal transplantation (HTT) model.<h4>Methods</h4>For studies in vitro, ASCs were treated with interferon-γ (IFN-γ). For in vivo study, tracheas from BALB/c or C57BL/6 donors were transplanted into C57BL/6 recipients to create a HTT model. On days 0, 1, 3, 5, 8, 12, 15, 20 and 25 post-transplant, the allogeneic recipient mice were administered intravenously with phosphate buffered saline, 1 × 10<sup>6</sup> human ASCs, or 1 × 10<sup>6</sup> human ASCs plus 1-methyltryptophan (1-MT), an IDO inhibitor. On days 3, 7, 14 and 28, serum, trachea and spleen samples were harvested for analysis.<h4>Results</h4>ASCs homed to heterotopic tracheal grafts after infusion. Multiple doses of ASCs significantly increased tracheal IDO levels in allografts. There were significant increases in graft and serum IFN-γ levels in allografts compared with isografts. IFN-γ elevated IDO expression and activity in ASCs in vitro. ASCs alleviated OB in allografts as evidenced by reduced epithelial loss, epithelial apoptosis, and intraluminal obstruction. The effects of ASCs on OB were blocked by 1-MT. 1-MT also blocked the alterations in pro and anti-inflammatory cytokines as well as CD3+ T cell infiltration induced by ASCs. ASCs induced not only splenic levels of CD4+CD25+Foxp3+ regulatory T cells (Treg) but also IL-10 and TGF-β-producing Treg. Furthermore, IDO inhibition abolished the changes of splenic Treg induced by ASCs. In addition, Treg reduction by cyclophosphamide treatment did not alter the effects of ASCs on tracheal IDO expression in allografts confirming Treg induction is downstream of IDO.<h4>Conclusions</h4>Repeated doses of ASCs are capable of ameliorating OB. ASCs act at least in part via elevating IDO expression. ASCs promote the generation of Treg and suppress T cell infiltration via an IDO-dependent mechanism.

Also flagged:VEGFSLErheumatic diseasevascular endothelial growth factorretinoic acid inducible gene-Imelanoma differentiation associated gene 5
Journal Article 2017-06-15 ✓ 4 Snippets Aterido A, Julià A, Carreira P, Blanco R, López-Longo JJ, Venegas JJP, Olivé À, Andreu JL, Aguirre-Zamorano MÁ, Vela P, Nolla JM, Marenco-de la Fuente JL, Zea A, Pego JM, Freire M, Díez E, López-Lasanta M, López-Lasanta M, López-Corbeto M, Palau N, Tortosa R, Gelpí JL, Absher D, Myers RM, Fernández-Nebro A, Marsal S.
In-Text Gene Mentions

Other significant findings include the association between renal disorder and TNFSF4, malar rash and FCGR2A and hematological disorder and variation in the IL21 gene.

Also, the previously identified association between genetic variation in the TNFSF4 gene and renal disorder was replicated in the discovery cohort [9].

…renal disorder andTNFSF4, malar rash…

…variation in theTNFSF4gene and renal…

Show Full Abstract

<h4>Background</h4>Systemic lupus erythematosus (SLE) is a genetically complex rheumatic disease characterized by heterogeneous clinical manifestations of unknown etiology. Recent studies have suggested the existence of a genetic basis for SLE heterogeneity. The objective of the present study was to identify new genetic variation associated with the clinically relevant phenotypes in SLE.<h4>Methods</h4>A two-stage pathway-based approach was used to identify the genetic variation associated with the main clinical phenotypes in SLE. In the discovery stage, 482 SLE patients were genotyped using Illumina Human Quad610 microarrays. Association between 798 reference genetic pathways from the Molecular Signatures Database and 11 SLE phenotypes was tested using the set-based method implemented in PLINK software. Pathways significantly associated after multiple test correction were subsequently tested for replication in an independent cohort of 425 SLE patients. Using an in silico approach, we analyzed the functional effects of common SLE therapies on the replicated genetic pathways. The association of known SLE risk variants with the development of the clinical phenotypes was also analyzed.<h4>Results</h4>In the discovery stage, we found a significant association between the vascular endothelial growth factor (VEGF) pathway and oral ulceration (P value for false discovery rate (P <sub>FDR</sub>) < 0.05), and between the negative regulation signaling pathway of retinoic acid inducible gene-I/melanoma differentiation associated gene 5 and the production of antinuclear antibodies (P <sub>FDR</sub> < 0.05). In the replication stage, we validated the association between the VEGF pathway and oral ulceration. Therapies commonly used to treat mucocutaneous phenotypes in SLE were found to strongly influence VEGF pathway gene expression (P = 4.60e-4 to 5.38e-14). Analysis of known SLE risk loci identified a strong association between PTPN22 and the risk of hematologic disorder and with the development of antinuclear antibodies.<h4>Conclusions</h4>The present study has identified VEGF genetic pathway association with the risk of oral ulceration in SLE. New therapies targeting the VEGF pathway could be more effective in reducing the severity of this phenotype. These findings represent a first step towards the understanding of the genetic basis of phenotype heterogeneity in SLE.

Also flagged:oxygenEPAS1EGLN1hypoxia inducible factorHIFTBN
Journal Article 2017-06-15 No Snippets Zhang C, Lu Y, Feng Q, Wang X, Lou H, Liu J, Ning Z, Yuan K, Wang Y, Zhou Y, Deng L, Liu L, Yang Y, Li S, Ma L, Zhang Z, Jin L, Su B, Kang L, Xu S.
Show Full Abstract

<h4>Background</h4>The genetic relationships reported by recent studies between Sherpas and Tibetans are controversial. To gain insights into the population history and the genetic basis of high-altitude adaptation of the two groups, we analyzed genome-wide data in 111 Sherpas (Tibet and Nepal) and 177 Tibetans (Tibet and Qinghai), together with available data from present-day human populations.<h4>Results</h4>Sherpas and Tibetans show considerable genetic differences and can be distinguished as two distinct groups, even though the divergence between them (~3200-11,300 years ago) is much later than that between Han Chinese and either of the two groups (~6200-16,000 years ago). Sub-population structures exist in both Sherpas and Tibetans, corresponding to geographical or linguistic groups. Differentiation of genetic variants between Sherpas and Tibetans associated with adaptation to either high-altitude or ultraviolet radiation were identified and validated by genotyping additional Sherpa and Tibetan samples.<h4>Conclusions</h4>Our analyses indicate that both Sherpas and Tibetans are admixed populations, but the findings do not support the previous hypothesis that Tibetans derive their ancestry from Sherpas and Han Chinese. Compared to Tibetans, Sherpas show higher levels of South Asian ancestry, while Tibetans show higher levels of East Asian and Central Asian/Siberian ancestry. We propose a new model to elucidate the differentiated demographic histories and local adaptations of Sherpas and Tibetans.

Also flagged:IronCopperiron-overload disordersdeficiencycopper deficiencysynthesis
Journal Article 2017-06-15 ✓ 1 Snippet Ha JH, Doguer C, Collins JF.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

High-iron feeding of rodents has been commonly used to model human iron-overload disorders. We recently noted that high-iron consumption impaired growth and caused severe systemic copper deficiency in growing rats, but the mechanism by which this occurred could not be determined due to technical limitations. In the current investigation, we thus utilized mice; first to determine if the same phenomenon occurred in another mammalian species, and secondly since we could assess in vivo copper absorption in mice. We hypothesized that excessive dietary iron impaired intestinal copper absorption. Weanling, male mice were thus fed AIN-93G-based diets containing high (HFe) (~8800 ppm) or adequate (AdFe) (~80 ppm) iron in combination with low (~0.9 ppm), adequate (~9 ppm) or high (~180 ppm) copper for several weeks. Iron and copper homeostasis was subsequently assessed. Mice consuming the HFe diets grew slower, were anemic, and had lower hepatic copper levels and serum ceruloplasmin activity. These physiologic perturbations were all prevented by higher dietary copper, demonstrating that copper depletion was the underlying cause. Furthermore, homeostatic regulation of copper absorption was noted in the mice consuming the AdFe diets, with absorption increasing as dietary copper decreased. HFe-fed mice did not have impaired copper absorption (disproving our hypothesis), but homeostatic control of absorption was disrupted. There were also noted perturbations in the tissue distribution of copper in the HFe-fed mice, suggesting that altered storage and thus bioavailability contributed to the noted copper deficiency. Dietary iron loading thus antagonizes copper homeostasis leading to pathological symptoms of severe copper depletion.

Also flagged:axonsnucleusShhWntFgfCxcr4
Journal Article 2017-06-15 ✓ 1 Snippet Roberson S, Halpern ME.
In-Text Gene Mentions

DCC

Show Full Abstract

The habenular nuclei are a conserved integrating center in the vertebrate epithalamus, where they modulate diverse behaviors. Despite their importance, our understanding of habenular development is incomplete. Time-lapse imaging and fate mapping demonstrate that the dorsal habenulae (dHb) of zebrafish are derived from <i>dbx1b</i>-expressing (<i>dbx1b<sup>+</sup></i> ) progenitors, which transition into <i>cxcr4b</i>-expressing neuronal precursors. The precursors give rise to differentiated neurons, the axons of which innervate the midbrain interpeduncular nucleus (IPN). Formation of the <i>dbx1b<sup>+</sup></i> progenitor population relies on the activity of the Shh, Wnt and Fgf signaling pathways. Wnt and Fgf function additively to generate dHb progenitors. Surprisingly, Wnt signaling also negatively regulates <i>fgf8a</i>, confining expression to a discrete dorsal diencephalic domain. Moreover, the Wnt and Fgf pathways have opposing roles in transcriptional regulation of components of the Cxcr4-chemokine signaling pathway. The chemokine pathway, in turn, directs the posterior outgrowth of dHb efferents toward the IPN and, when disrupted, results in ectopic, anteriorly directed axonal projections. The results define a signaling network underlying the generation of dHb neurons and connectivity with their midbrain target.

Also flagged:Sin3aco-repressorrespiratory insufficiencycell cycle arrestG1 phasecell cycle
Journal Article 2017-06-15 ✓ 1 Snippet Yao C, Carraro G, Konda B, Guan X, Mizuno T, Chiba N, Kostelny M, Kurkciyan A, David G, McQualter JL, Stripp BR.
In-Text Gene Mentions

Suds3

Show Full Abstract

Mechanisms that regulate tissue-specific progenitors for maintenance and differentiation during development are poorly understood. Here, we demonstrate that the co-repressor protein Sin3a is crucial for lung endoderm development. Loss of Sin3a in mouse early foregut endoderm led to a specific and profound defect in lung development with lung buds failing to undergo branching morphogenesis and progressive atrophy of the proximal lung endoderm with complete epithelial loss at later stages of development. Consequently, neonatal pups died at birth due to respiratory insufficiency. Further analysis revealed that loss of Sin3a resulted in embryonic lung epithelial progenitor cells adopting a senescence-like state with permanent cell cycle arrest in G1 phase. This was mediated at least partially through upregulation of the cell cycle inhibitors Cdkn1a and Cdkn2c. At the same time, loss of endodermal Sin3a also disrupted cell differentiation of the mesoderm, suggesting aberrant epithelial-mesenchymal signaling. Together, these findings reveal that Sin3a is an essential regulator for early lung endoderm specification and differentiation.

Also flagged:Cul3localizationneddylationSCCROKLHL21Aurora B
Journal Article 2017-06-15 ✓ 1 Snippet Huang G, Kaufman AJ, Xu K, Manova K, Singh B.
In-Text Gene Mentions

KLHL20

Show Full Abstract

Squamous cell carcinoma-related oncogene (SCCRO)/DCUN1D1, a component of the neddylation E3 complex, regulates the activity of the cullin-RING-ligase type of ubiquitination E3s by promoting neddylation of cullin family members. Studies have shown that SCCRO regulates proliferation <i>in vitro</i> and <i>in vivo</i> Here we show that inactivation of SCCRO results in prolonged mitotic time because of delayed and/or failed abscission. The effects of SCCRO on abscission involve its role in neddylation and localization of Cul3 to the midbody. The Cul3 adaptor KLHL21 mediates the effects of SCCRO on abscission, as it fails to localize to the midbody in SCCRO-deficient cells during abscission, and its inactivation resulted in phenotypic changes identical to SCCRO inactivation. Ubiquitination-promoted turnover of Aurora B at the midbody was deficient in SCCRO- and KLHL21-deficient cells, suggesting that it is the target of Cul3<sup>KLHL21</sup> at the midbody. Correction of abscission delays in SCCRO-deficient cells with addition of an Aurora B inhibitor at the midbody stage suggests that Aurora B is the target of SCCRO-promoted Cul3<sup>KLHL21</sup> activity. The activity of other Cul3-anchored complexes, including Cul3<sup>KLHL9/KLHL13</sup>, was intact in SCCRO-deficient cells, suggesting that SCCRO selectively, rather than collectively, neddylates cullins <i>in vivo</i> Combined, these findings support a model in which the SCCRO, substrate, and substrate adaptors cooperatively provide tight control of neddylation and cullin-RING-ligase activity <i>in vivo</i>.

Also flagged:hydroxylapatitecharprolineAromatic CompoundsMagnesium1042
Journal Article 2017-06-15 No Snippets Butler DH, Shahack-Gross R.
Show Full Abstract

Ichthyoarchaeological evidence is uncommon at ancient hunter-gatherer sites from various regions and timeframes. This research contributes to the development of microarchaeological techniques useful for identifying fishing economies in situations where classifiable bones are unavailable. Specifically, traces of heat altered bone mineral in domestic hearths are expected to provide markers for discarded fish remains. We used a series of laboratory incineration experiments to characterize the mineralogy of burned salmonid vertebrae. Fourier transform infrared spectroscopy and x-ray diffraction distinguished the formation of beta magnesium tricalcium phosphate (βMgTCP) at temperatures as low as 600 °C. Bones from a sample of game mammals and birds did not form this phase at temperatures below 1,000 °C. We propose that this neoformed mineral can serve as a proxy for hunter-gatherer salmonid fishing when typical ichthyoarchaeological evidence is absent. Using Fourier transform infrared spectroscopy, it will be possible to rapidly and inexpensively determine the presence of βMgTCP in fragmentary burned bone remains associated with combustion features. The occurrence of βMgTCP in archaeological hearth features will offer a new means of further evaluating the temporal, geographic, and cultural scope of salmonid harvesting. We also acknowledge the value of biphasic hydroxylapatite-βMgTCP recovered from Atlantic salmon vertebrae as a bioceramic.

Also flagged:ProtonSteatosishepatic steatosisnonalcoholic steatohepatitisNASHobeticholic acid
Journal Article 2017-06-15 No Snippets Middleton MS, Heba ER, Hooker CA, Bashir MR, Fowler KJ, Sandrasegaran K, Brunt EM, Kleiner DE, Doo E, Van Natta ML, Lavine JE, Neuschwander-Tetri BA, Sanyal A, Loomba R, Sirlin CB, NASH Clinical Research Network.
Show Full Abstract

<h4>Background & aims</h4>We assessed the diagnostic performance of magnetic resonance imaging (MRI) proton density fat fraction (PDFF) in grading hepatic steatosis and change in hepatic steatosis in adults with nonalcoholic steatohepatitis (NASH) in a multi-center study, using central histology as reference.<h4>Methods</h4>We collected data from 113 adults with NASH participating in a multi-center, randomized, double-masked, placebo-controlled, phase 2b trial to compare the efficacy cross-sectionally and longitudinally of obeticholic acid vs placebo. Hepatic steatosis was assessed at baseline and after 72 weeks of obeticholic acid or placebo by liver biopsy and MRI (scanners from different manufacturers, at 1.5T or 3T). We compared steatosis estimates by PDFF vs histology. Histologic steatosis grade was scored in consensus by a pathology committee. Cross-validated receiver operating characteristic (ROC) analyses were performed.<h4>Results</h4>At baseline, 34% of subjects had steatosis grade 0 or 1, 39% had steatosis grade 2, and 27% had steatosis grade 3; corresponding mean PDFF values were 9.8%±3.7%, 18.1%±4.3%, and 30.1%±8.1%. PDFF classified steatosis grade 0-1 vs 2-3 with an area under the ROC curve (AUROC) of 0.95 (95% CI, 0.91-0.98), and grade 0-2 vs grade 3 steatosis with an AUROC of 0.96 (95% CI, 0.93-0.99). PDFF cut-off values at 90% specificity were 16.3% for grades 2-3 and 21.7% for grade 3, with corresponding sensitivities of 83% and 84%. After 72 weeks' of obeticholic vs placebo, 42% of subjects had a reduced steatosis grade (mean reduction in PDFF from baseline of 7.4%±8.7%), 49% had no change in steatosis grade (mean increase in PDFF from baseline of 0.3%±6.3%), and 9% had an increased steatosis grade (mean increase in PDFF from baseline of 7.7%±6.0%). PDFF change identified subjects with reduced steatosis grade with an AUROC of 0.81 (95% CI, 0.71-0.91) and increased steatosis grade with an AUROC of 0.81 (95% CI, 0.63-0.99). A PDFF reduction of 5.15% identified subjects with reduced steatosis grade with 90% specificity and 58% sensitivity, whereas a PDFF increase of 5.6% identified those with increased steatosis grade with 90% specificity and 57% sensitivity.<h4>Conclusions</h4>Based on data from a phase 2 randomized controlled trial of adults with NASH, PDFF estimated by MRI scanners of different field strength and at different sites, accurately classifies grades and changes in hepatic steatosis when histologic analysis of biopsies is used as a reference.

Also flagged:proton pumppantoprazole
Journal Article 2017-06-15 ✓ 5 Snippets Vanclooster A, van Deursen C, Jaspers R, Cassiman D, Koek G.
In-Text Gene Mentions

Proton Pump Inhibitors Decrease Phlebotomy Need in HFE Hemochromatosis: Double-Blind Randomized Placebo-Controlled Trial.

HFE Hemochromatosis

HFE-related hemochromatosis

…Phlebotomy Need inHFEHemochromatosis: Double-Blind …

…Need in HFEHemochromatosis: Double-Blind Randomized Plac…

Show Full Abstract

Phlebotomy constitutes the established treatment for HFE-related hemochromatosis. Retrospective studies have suggested proton pump inhibitors (PPIs) reduce the need for phlebotomy in this population. We conducted a randomized controlled trial to prove this. Thirty p.C282Y homozygous patients were randomly allocated to PPI (pantoprazole 40 mg/day) or placebo for 12 months. Phlebotomies were performed when serum ferritin was > 100 μg/L. Phlebotomy need turned out to be significantly lower in patients taking PPI (P = .0052). PPI treatment significantly reduces the need for phlebotomies in p.C282Y homozygous patients. In view of the known long-term safety profile of PPI, they can be a valuable addition to standard therapy. Clinicaltrials.gov: NCT01524757.

Also flagged:upper respiratory infectionsinfluenza-like illnessinfluenzaviral infectionsAcute respiratory infectionscell growth
Journal Article 2017-06-15 ✓ 2 Snippets Chiu SC, Lin YC, Wang HC, Hsu JJ, Yeh TK, Liu HF, Lin JH.
In-Text Gene Mentions

Of note, HRV/HEV most part of the non-influenza infections in Taiwan, and data from further laboratory investigations showed that 11 (84.6%) of these cases were caused by enteroviruses CA2, CA6, and CA10.

…CA2, CA6, andCA10.…

Show Full Abstract

<h4>Objectives</h4>To improve diagnosis as part of laboratory surveillance in Taiwan, influenza-like illness (ILI) surveillance was conducted using a new multiplex PCR assay (FilmArray) and the results compared to those of conventional methods The study was performed during the winter months.<h4>Methods</h4>Throat swabs from patients with an ILI presenting to physicians in sentinel practices were collected during the 2016-2017 influenza season.<h4>Results</h4>A total of 52 samples tested positive by FilmArray Respiratory Panel. Forty percent were influenza A virus, and subtype H3N2 virus was the major epidemic strain. However, nearly 60% of ILI cases seen at sentinel sites were caused by non-influenza pathogens. The results of the FilmArray assay and cell culture were identical, and this assay was more sensitive than a rapid influenza diagnostic test. Genetic analyses revealed new influenza A H3N2 variants belonging to a novel subclade 3C.2a2.<h4>Conclusions</h4>The FilmArray assay facilitates urgent testing and laboratory surveillance for common viral and bacterial respiratory pathogens. This study demonstrated the use of a highly sensitive assay using clinical samples that is feasible for application worldwide. This may lead to an increased rate of diagnosis of viral infections and to improved patient outcomes, and in particular to a reduction in the overuse of antibiotics and antivirals.

Also flagged:Nitroglycerinserotonin transporteranandamideMigraineneurological diseasesserotonin
Journal Article 2017-06-15 ✓ 2 Snippets Nagy-Grócz G, Bohár Z, Fejes-Szabó A, Laborc KF, Spekker E, Tar L, Vécsei L, Párdutz Á.
In-Text Gene Mentions

…on serotonin transporter (5-HTT) expression in the…

…able to increase5-HTTexpression in the…

Show Full Abstract

Migraine is one of the most prevalent neurological diseases, which affects 16% of the total population. The exact pathomechanism of this disorder is still not well understood, but it seems that serotonin and its transporter have a crucial role in the pathogenesis. One of the animal models of migraine is the systemic administration of nitroglycerin (NTG), a nitric oxide (NO) donor. NO can initiate a central sensitization process in the trigeminal system, which is also present in migraineurs. Recent studies showed that the endocannabinoid system has a modulatory role on the trigeminal activation and sensitization. Our aim was to investigate the effect of an endogenous cannabinoid, anandamide (AEA) on the NTG-induced changes on serotonin transporter (5-HTT) expression in the upper cervical spinal cord (C1-C2) of the rat, where most of the trigeminal nociceptive afferents convey. The animals were divided into four groups. Rats in the first group, called placebo, received only the vehicle solution as treatment. In the second group, they were treated with an intraperitoneal (i.p.) injection of NTG (10mg/kg). Rats in the third and fourth groups received i.p. AEA (2×5mg/kg) half hour before and one hour after the placebo or NTG treatment. Four hours after placebo/NTG injection, the animals were perfused and the cervical spinal cords were removed for immunohistochemistry and Western blotting. Our results show that both NTG and AEA alone are able to increase 5-HTT expression in the C1-C2 segments. Combination of NTG and AEA has an opposing effect on this marker, nullifying the effects of non-combined administration, probably by negative feedback mechanisms.

Also flagged:non-alcoholic fatty liver diseaseNAFLDASTnon-alcoholic fatty livernon-alcoholic steatohepatitisNASH
Journal Article 2017-06-15 ✓ 1 Snippet Kawamura Y, Ikeda K, Arase Y, Fujiyama S, Hosaka T, Kobayashi M, Saitoh S, Sezaki H, Akuta N, Suzuki F, Suzuki Y, Kumada H.
In-Text Gene Mentions

…diseases, such ashemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

Objective To detect the aggressive phenotype (AP) of non-alcoholic fatty liver disease (NAFLD) based on the initial laboratory data and clinical characteristics. Methods We enrolled 144 patients with histologically proven NAFLD. For the first analysis, 24 NAFLD patients underwent repeat biopsy to establish a discriminant formula for predicting the AP of NAFLD (D-APN). The AP was defined by NAFLD that had been maintained or progressed to a fibrotic stage beyond stage 2. In the second analysis, we analyzed the distribution of the AP in each stage of disease and the incidence of the PNPLA3 rs738409 GG genotype in AP in 120 other patients. Results After the analysis, the following function was found to discriminate the disease phenotype: z=0.150×body mass index (kg/m<sup>2</sup>)+0.085×age (years)+1.112×ln (AST) (IU/L)+0.127×ln (m-AST)-12.96. A positive result indicates the AP of NAFLD. The discriminant functions had a positive predictive value of 94% and a negative predictive value of 71%. The distribution of the AP and the incidence of the PNPLA3 GG genotype in the AP in each stage of the disease among the 120 patients were as follows: non-alcoholic fatty liver, 30%/33%; non-alcoholic steatohepatitis (NASH) stage 1, 53%/26%; stage 2, 71%/70%; stage 3, 92%/57%; and stage 4, 93%/64%; there was a significant increase in the incidence of the AP as the disease progressed (p<0.001). Conclusion The new discriminant formula was useful for predicting disease progression potential in NAFLD patients and the incidence of the PNPLA3 GG genotype was elevated according to the distribution of AP.

Also flagged:platelet activationpulmonary hypertensionβ-thalassemiacoagulationPHP-selectin
Journal Article 2017-06-15 ✓ 1 Snippet Fayed MA, Abdel-Hady HE, Hafez MM, Salama OS, Al-Tonbary YA.
In-Text Gene Mentions

…serum protein-C andantithrombin-IIIlevels were significantly…

Show Full Abstract

<h4>Background</h4>The increased survival rate of thalassemic patients has led to unmasking of management related complications which were infrequently encountered.<h4>Objective</h4>Study the increased coagulation and platelet activation in children with β-thalassemia, to analyze the factors that lead to such hypercoagulable state and to study pulmonary hypertension (PH) in conjunction with platelet activation and hypercoagulable state in children with β-thalassemia.<h4>Methods</h4>36 Egyptian children with β-thalassemia with a mean age of 9.9years (±4.7 SD). In addition, 20 healthy Egyptian children matched for age and sex were enrolled as a control group. Both were subjected to clinical and laboratory assessments. Echocardiography was done to the patient group and PH was diagnosed based on calculated mean pulmonary artery pressure [MPAP] >25mmHg.<h4>Results</h4>We found that, mean±SD serum P-selectin level (platelet activator marker) was significantly higher in thalassemic patients (2337±566pg/ml) in comparison to controls (1467±247pg/ml) (P<0.001). Mean serum protein-C and antithrombin-III levels were significantly lower in thalassemic patients (1.2±1.3µg/ml, 27.3±7.5mg/dl) in comparison to controls (2.3±1.3µg/ml, 35.1±4.1mg/dl) (P=0.003 and <0.001) respectively. PH was detected in 17 (47.2%) patients and it was significantly associated with splenectomy (P=0.01) and non-transfusion dependent thalassemia (NTDT) (P=0.04). PH was positively correlated with serum levels of P-selectin (r=0.38, P=0.02), fibrinogen (r=0.41, P=0.01) and negatively correlated with serum protein-C level (r=-0.48, P=0.003).<h4>Conclusion</h4>A chronic hypercoagulable state and platelet activation is present in children with β-thalassemia. Splenectomy and transfusion infrequency are the main risk factors noted to be associated with such hypercoagulable state and platelet activation and consequently the PH among our thalassemic patients.

Also flagged:Dosage compensationchromosomesex chromosomeschromosomesgene expressionchromatin
Journal Article 2017-06-15 ✓ 5 Snippets Richard G, Legeai F, Prunier-Leterme N, Bretaudeau A, Tagu D, Jaquiéry J, Le Trionnaire G.
In-Text Gene Mentions

…dosage compensation complex (DCC) resulting in a…

…accessibility by theDCC[ 28 ,…

…TheDCCbinds to the…

…mediated by theDCC, thus resulting in…

…regulated by theDCC[ 29 ].…

Show Full Abstract

<h4>Background</h4>Heterogametic species display a differential number of sex chromosomes resulting in imbalanced transcription levels for these chromosomes between males and females. To correct this disequilibrium, dosage compensation mechanisms involving gene expression and chromatin accessibility regulations have emerged throughout evolution. In insects, these mechanisms have been extensively characterized only in Drosophila but not in insects of agronomical importance. Aphids are indeed major pests of a wide range of crops. Their remarkable ability to switch from asexual to sexual reproduction during their life cycle largely explains the economic losses they can cause. As heterogametic insects, male aphids are X0, while females (asexual and sexual) are XX.<h4>Results</h4>Here, we analyzed transcriptomic and open chromatin data obtained from whole male and female individuals to evaluate the putative existence of a dosage compensation mechanism involving differential chromatin accessibility of the pea aphid's X chromosome. Transcriptomic analyses first showed X/AA and XX/AA expression ratios for expressed genes close to 1 in males and females, respectively, suggesting dosage compensation in the pea aphid. Analyses of open chromatin data obtained by Formaldehyde-Assisted Isolation of Regulatory Elements (FAIRE-seq) revealed a X chromosome chromatin accessibility globally and significantly higher in males than in females, while autosomes' chromatin accessibility is similar between sexes. Moreover, chromatin environment of X-linked genes displaying similar expression levels in males and females-and thus likely to be compensated-is significantly more accessible in males.<h4>Conclusions</h4>Our results suggest the existence of an underlying epigenetic mechanism enhancing the X chromosome chromatin accessibility in males to allow X-linked gene dose correction between sexes in the pea aphid, similar to Drosophila. Our study gives new evidence into the comprehension of dosage compensation in link with chromatin biology in insects and newly in a major crop pest, taking benefits from both transcriptomic and open chromatin data.

Also flagged:Beta-2 Microglobulinrenal diseaseschronic kidney diseasealbuminFc receptorchronic allograft nephropathy
Journal Article 2017-06-15 ✓ 2 Snippets Argyropoulos CP, Chen SS, Ng YH, Roumelioti ME, Shaffi K, Singh PP, Tzamaloukas AH.
In-Text Gene Mentions

β2M also complexes with many non-classical MHC-I like molecules (MHC-Ib) such as CD1, MR1 (33), HLA-E, -F, -G (34, 35), neonatal Fc receptor (FcRn) (36–38), and HFE/HLA-H that are involved in mucosal immunity, tumor surveillance, maternofetal immune tolerance, immunoglobulin and albumin homeostasis as well as iron metabolism.

The genetics and the clinical manifestations of hemochromatosis are very complex (106), but iron overload is seen irrespective of whether the genetic lesion refers to HFE or β2M. Nevertheless, there are important biochemical differences, since β2M-deficient mice have higher hepcidin levels which correlate inversely with the severity of hepatic iron overload (88).

Show Full Abstract

There is currently an unmet need for better biomarkers across the spectrum of renal diseases. In this paper, we revisit the role of beta-2 microglobulin (β<sub>2</sub>M) as a biomarker in patients with chronic kidney disease and end-stage renal disease. Prior to reviewing the numerous clinical studies in the area, we describe the basic biology of β<sub>2</sub>M, focusing in particular on its role in maintaining the serum albumin levels and reclaiming the albumin in tubular fluid through the actions of the neonatal Fc receptor. Disorders of abnormal β<sub>2</sub>M function arise as a result of altered binding of β<sub>2</sub>M to its protein cofactors and the clinical manifestations are exemplified by rare human genetic conditions and mice knockouts. We highlight the utility of β<sub>2</sub>M as a predictor of renal function and clinical outcomes in recent large database studies against predictions made by recently developed whole body population kinetic models. Furthermore, we discuss recent animal data suggesting that contrary to textbook dogma urinary β<sub>2</sub>M may be a marker for glomerular rather than tubular pathology. We review the existing literature about β<sub>2</sub>M as a biomarker in patients receiving renal replacement therapy, with particular emphasis on large outcome trials. We note emerging proteomic data suggesting that β<sub>2</sub>M is a promising marker of chronic allograft nephropathy. Finally, we present data about the role of β<sub>2</sub>M as a biomarker in a number of non-renal diseases. The goal of this comprehensive review is to direct attention to the multifaceted role of β<sub>2</sub>M as a biomarker, and its exciting biology in order to propose the next steps required to bring this recently rediscovered biomarker into the twenty-first century.

Also flagged:Deferasiroxliver failuredeathsickle cell anemiafulminant hepatitisiron
Journal Article 2017-06-15 ✓ 1 Snippet Braga CCB, Benites BD, de Albuquerque DM, Alvarez MC, Seva-Pereira T, Duarte BKL, Costa FF, Gilli SCO, Saad STO.
In-Text Gene Mentions

…cell disease andhemochromatosisreceiving Deferasirox (DFX),…

Show Full Abstract

This manuscript describes the case of a patient with sickle cell anemia who died of fulminant hepatitis after therapy with the iron chelator Deferasirox. The patient was homozygous for the -1774delG polymorphism in the <i>Abcc2</i> gene, which raises the concern about the use of hepatotoxic drugs in this specific context.

Also flagged:ISL1GAPDHOlig2Olig1MS2NEUROG2
Journal Article 2017-06-15 ✓ 1 Snippet Li S, Zhang A, Xue H, Li D, Liu Y.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Neural cell fate is determined by a tightly controlled transcription regulatory network during development. The ability to manipulate the expression of multiple transcription factors simultaneously is required to delineate the complex picture of neural cell development. Because of the limited carrying capacity of the commonly used viral vectors, such as lentiviral or retroviral vectors, it is often challenging to perform perturbation experiments on multiple transcription factors. Here we have developed a piggyBac (PB) transposon-based CRISPR activation (CRISPRa) all-in-one system, which allows for simultaneous and stable endogenous transactivation of multiple transcription factors and long non-coding RNAs. As a proof of principle, we showed that the PB-CRISPRa system could accelerate the differentiation of human induced pluripotent stem cells into neurons and astrocytes by triggering endogenous expression of different sets of transcription factors. The PB-CRISPRa system has the potential to become a convenient and robust tool in neuroscience, which can meet the needs of a variety of in vitro and in vivo gain-of-function applications.

Also flagged:OsteoarthritisOAdegenerative joint diseasedegradationproteinsMMP-3
Journal Article 2017-06-15 ✓ 1 Snippet Guo W, Xu P, Jin T, Wang J, Fan D, Hao Z, Ji Y, Jing S, Han C, Du J, Jiang D, Wen S, Wang J.
In-Text Gene Mentions

…upus erythematosus, psoriasis,hemochromatosis, previous knee injury,…

Show Full Abstract

Osteoarthritis (OA) is the most common late-onset degenerative joint disease., It is characterized by progressive degradation of articular cartilage. We investigated the association between OA occurrence and single nucleotide polymorphisms (SNPs) in the <i>matrix metalloproteinase-3</i> (<i>MMP-3</i>) gene involved in the breakdown of extra-cellular matrix proteins. The study included 100 male OA patients and 197 healthy men from the north area of China. Eight <i>MMP-3</i> SNPs were genotyped. Odds ratios (ORs) with 95% confidence intervals (95%CIs) and multivariate logistic regression analysis were used to assess the association. Multivariate logistic regression analysis was used to identify SNPs that correlated with OA susceptibility. We found that rs639752 (dominant, OR = 2.03, 95% CI: 1.03-4.01, <i>P</i> = 0.038; over-dominant, OR = 2.00, 95% CI: 1.03-3.88, <i>P</i> = 0.037); rs520540 (dominant, OR = 2.03, 95% CI: 1.03-4.01, <i>P</i> = 0.038; over-dominant, OR = 2.00, 95% CI: 1.03-3.88, <i>P</i> = 0.037); rs602128 (dominant, OR = 2.03, 95% CI: 1.03-4.01, <i>P</i> = 0.038; over-dominant, OR = 2.01, 95% CI: 1.03-3.89, <i>P</i> = 0.037); and rs679620 (dominant, OR = 2.03, 95% CI: 1.03-4.01, <i>P</i> = 0.038; over-dominant, OR = 2.04, 95% CI: 1.05-3.96, <i>P</i> = 0.033) were associated with the increased risk of OA. Our results suggest that these SNPs may contribute to OA development, and could serve as molecular markers of OA susceptibility.

bioRxiv 2017-06-15 Preprint (No Snippets API) Eeftens JM, Bisht S, Kerssemakers J, Haering CH, Dekker C.
Show Full Abstract

<h4>ABSTRACT</h4> Condensin, a conserved member of the SMC protein family of ring-shaped multi-subunit protein complexes, is essential for structuring and compacting chromosomes. Despite its key role, its molecular mechanism has remained largely unknown. Here, we employ single-molecule magnetic tweezers to measure, in real-time, the compaction of individual DNA molecules by the budding yeast condensin complex. We show that compaction proceeds in large (~200nm) steps, driving DNA molecules into a fully condensed state against forces of up to 2pN. Compaction can be reversed by applying high forces or adding buffer of high ionic strength. While condensin can stably bind DNA in the absence of ATP, ATP hydrolysis by the SMC subunits is required for rendering the association salt-insensitive and for subsequent compaction. Our results indicate that the condensin reaction cycle involves two distinct steps, where condensin first binds DNA through electrostatic interactions before using ATP hydrolysis to encircle the DNA topologically within its ring structure, which initiates DNA compaction. The finding that both binding modes are essential for its DNA compaction activity has important implications for understanding the mechanism of chromosome compaction.

Also flagged:gene expressionvisionpigmentationsleepOtx2Mitf
Journal Article 2017-06-14 ✓ 1 Snippet Stahl BA, Gross JB.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Organisms that are isolated into extreme environments often evolve extreme phenotypes. However, global patterns of dynamic gene expression changes that accompany dramatic environmental changes remain largely unknown. The blind Mexican cavefish, Astyanax mexicanus, has evolved a number of severe cave-associated phenotypes including loss of vision and pigmentation, craniofacial bone fusions, increased fat storage, reduced sleep, and amplified nonvisual sensory systems. Interestingly, surface-dwelling forms have repeatedly entered different caves throughout Mexico, providing a natural set of "replicate" instances of cave isolation. These surrogate "ancestral" surface-dwelling forms persist in nearby rivers, enabling direct comparisons to the "derived" cave-dwelling form. We evaluated changes associated with subterranean isolation by measuring differential gene expression in two geographically distinct cave-dwelling populations (Pachón and Tinaja). To understand the impact of these expression changes on development, we performed RNA-sequencing across four critical stages during which troglomorphic traits first appear in cavefish embryos. Gene ontology (GO) studies revealed similar functional profiles evolved in both independent cave lineages. However, enrichment studies indicated that similar GO profiles were occasionally mediated by different genes. Certain "master" regulators, such as Otx2 and Mitf, appear to be important loci for cave adaptation, as remarkably similar patterns of expression were identified in both independent cave lineages. This work reveals that adaptation to an extreme environment, in two distinct cavefish lineages, evolves through a combination of unique and shared gene expression patterns. Shared expression profiles reflect common environmental pressures, while unique expression likely reflects the fact that similar adaptive traits evolve through diverse genetic mechanisms.

Also flagged:Peptidespeptideamino acidaminocaproic acidinfectionsimmune response
Journal Article 2017-06-14 No Snippets Huertas NJ, Monroy ZJR, Medina RF, Castañeda JEG.
Show Full Abstract

Peptides derived from LfcinB were designed and synthesized, and their antibacterial activity was tested against <i>Escherichia coli</i> ATCC 25922 and <i>Staphylococcus aureus</i> ATCC 25923. Specifically, a peptide library was constructed by systemically removing the flanking residues (N or C-terminal) of Lfcin 17-31 (<sup>17</sup>FKCRRWQWRMKKLGA<sup>31</sup>), maintaining in all peptides the <sup>20</sup>RRWQWR<sup>25</sup> sequence that corresponds to the minimal antimicrobial motif. For this research, also included were (i) a peptide containing an Ala instead of Cys ([Ala<sup>19</sup>]-LfcinB 17-31) and (ii) polyvalent peptides containing the RRWQWR sequence and a non-natural amino acid (aminocaproic acid). We established that the lineal peptides LfcinB 17-25 and LfcinB 17-26 exhibited the greatest activity against <i>E. coli</i> ATCC 25922 and <i>S. aureus</i> ATCC 25923, respectively. On the other hand, polyvalent peptides, a dimer and a tetramer, exhibited the greatest antibacterial activity, indicating that multiple copies of the sequence increase the activity. Our results suggest that the dimeric and tetrameric sequence forms potentiate the antibacterial activity of lineal sequences that have exhibited moderate antibacterial activity.

Also flagged:Phosphorusdeathcardiovascular diseasekidney diseasemineralchronic kidney disease
Journal Article 2017-06-14 No Snippets Chang AR, Anderson C.
Show Full Abstract

Although phosphorus is an essential nutrient required for multiple physiological functions, recent research raises concerns that high phosphorus intake could have detrimental effects on health. Phosphorus is abundant in the food supply of developed countries, occurring naturally in protein-rich foods and as an additive in processed foods. High phosphorus intake can cause vascular and renal calcification, renal tubular injury, and premature death in multiple animal models. Small studies in human suggest that high phosphorus intake may result in positive phosphorus balance and correlate with renal calcification and albuminuria. Although serum phosphorus is strongly associated with cardiovascular disease, progression of kidney disease, and death, limited data exist linking high phosphorus intake directly to adverse clinical outcomes. Further prospective studies are needed to determine whether phosphorus intake is a modifiable risk factor for kidney disease.

Also flagged:mastitislipopolysaccharidelipoteichoic acidcell wallimmune responsebehavioral
Journal Article 2017-06-14 No Snippets Giovannini AEJ, van den Borne BHP, Wall SK, Wellnitz O, Bruckmaier RM, Spadavecchia C.
Show Full Abstract

<h4>Background</h4>Pain accompanying mastitis has gained attention recently as a relevant welfare compromising aspect of disease. Adequate pain recognition and therapy are necessary in the context of a modern and ethically acceptable dairy care. For research purposes mastitis is often induced by intramammary infusion of immunogenic bacterial cell wall components. Lipopolysaccharide (LPS) from Escherichia coli and lipoteichoic acid (LTA) from Staphylococcus aureus are commonly administered to this end. While the immune response to specific immunogenic components has been well characterized, not much is known about their role on the expression of pain indicators. The aim of this study was to trial the effects of an intramammary challenge of LTA or LPS on the degree of pain and discomfort as indicated by both physiological and behavioral variables in cows. The hypothesis was that a similar degree of pain can be identified in LTA as well as in LPS induced mastitis.<h4>Results</h4>On the challenge day, compared to pre-challenge, total pain index increased for all treatment groups (LPS; LTA and control), the LPS group having significantly higher values than the control group (P = 0.01). Similarly, pain visual analogue scale (VAS) increased significantly in all cows following treatment on the challenge day. Furthermore, compared to baseline, higher VAS were found 3, 4 and 5 h after the challenge in cows of the LPS group (P<sub>3h, 4h</sub> < 0.001 and P<sub>5h</sub> = 0.001) and 7 h after the challenge in cows of the LTA group (P<sub>7h</sub> = 0.002). In the control group, VAS was higher 5 h after the challenge (P<sub>5h</sub> = 0.001). On the challenge day, udder edema was higher in the LPS than in the control group (P = 0.007). Furthermore, 4 h after the challenge, milk cortisol was significantly higher than at baseline in the LPS group (P < 0.001).<h4>Conclusions</h4>When administered at equipotent doses targeting a standard somatic cell count increase, intramammary LPS seems to be accompanied by a higher degree of pain and discomfort than LTA, as suggested by the modifications of the outcome variables total pain index, VAS, udder edema and milk cortisol.

Also flagged:obesitypolygenic obesityhypertensionhypertriglyceridemiaINScytokine
Journal Article 2017-06-14 ✓ 1 Snippet Say YH, Say YH.
In-Text Gene Mentions

The serotonin transporter protein (SERT or 5-HTT), which is encoded by SLC6A4, recycles serotonin (5-HT) after an action potential and regulates the availability of serotonin at the synaptic cleft [100].

Show Full Abstract

<h4>Background</h4>Despite the fact that insertions/deletions (INDELs) are the second most common type of genetic variations and variable number tandem repeats (VNTRs) represent a large portion of the human genome, they have received far less attention than single nucleotide polymorphisms (SNPs) and larger forms of structural variation like copy number variations (CNVs), especially in genome-wide association studies (GWAS) of complex diseases like polygenic obesity. This is exemplified by the vast amount of review papers on the role of SNPs and CNVs in obesity, its related traits (like anthropometric measurements, biochemical variables, and eating behavior), and its related complications (like hypertension, hypertriglyceridemia, hypercholesterolemia, and insulin resistance-collectively known as metabolic syndrome). Hence, this paper reviews the types of INDELs and VNTRs that have been studied for association with obesity and its related traits and complications. These INDELs and VNTRs could be found in the obesity loci or genes from the earliest GWAS and candidate gene association studies, like FTO, genes in the leptin-proopiomelanocortin pathway, and UCP2/3. Given the important role of the brain serotonergic and dopaminergic reward system in obesity susceptibility, the association of INDELs and VNTRs in these neurotransmitters' metabolism and transport genes with obesity is also reviewed. Next, the role of INS VNTR in obesity and its related traits is questionable, since recent large-scale studies failed to replicate the earlier positive associations. As obesity results in chronic low-grade inflammation of the adipose tissue, the proinflammatory cytokine gene IL1RA and anti-inflammatory cytokine gene IL4 have VNTRs that are implicated in obesity. A systemic proinflammatory state in combination with activation of the renin-angiotensin system and decreased nitric oxide bioavailability as found in obesity leads to endothelial dysfunction. This explains why VNTR and INDEL in eNOS and ACE, respectively, could be predisposing factors of obesity. Finally, two novel genes, DOCK5 and PER3, which are involved in the regulation of the Akt/MAPK pathway and circadian rhythm, respectively, have VNTRs and INDEL that might be associated with obesity.<h4>Short conclusion</h4>In conclusion, INDELs and VNTRs could have important functional consequences in the pathophysiology of obesity, and research on them should be continued to facilitate obesity prediction, prevention, and treatment.

Also flagged:neurodegenerative diseaseneurodegenerative diseaseslocalizationtauparkinmitochondrial
Journal Article 2017-06-14 ✓ 3 Snippets Fernius J, Starkenberg A, Thor S.
In-Text Gene Mentions

Neurodegenerative diseases (NDs) have increasingly been linked to dysfunction of specific proteins, often unique to one disease, e.g. amyloid precursor protein (APP) to Alzheimer's disease (AD), parkin (Park) to Parkinson's disease (PD), huntingtin (HTT) to Huntington's disease (HD), and superoxide dismutase (SOD1) to amyotrophic lateral sclerosis (ALS) (Kaur et al., 2016; Lill, 2016; Nopoulos, 2016; Selkoe and Hardy, 2016).

…disease (PD), huntingtin (HTT) to Huntington's disease…

…SOD1, α-synuclein (SNCA),HTT, ataxin-1 (ATX1) and…

Show Full Abstract

Genetic, biochemical and histological studies have identified a number of different proteins as key drivers of human neurodegenerative diseases. Although different proteins are typically involved in different diseases, there is also considerable overlap. Addressing disease protein dysfunction in an <i>in vivo</i> neuronal context is often time consuming and requires labor-intensive analysis of transgenic models. To facilitate the rapid, cellular analysis of disease protein dysfunction, we have developed a fruit fly (<i>Drosophila melanogaster</i>) adult leg neuron assay. We tested the robustness of 41 transgenic fluorescent reporters and identified a number that were readily detected in the legs and could report on different cellular events. To test these reporters, we expressed a number of human proteins involved in neurodegenerative disease, in both their mutated and wild-type versions, to address the effects on reporter expression and localization. We observed strikingly different effects of the different disease proteins upon the various reporters with, for example, Aβ<sup>1-42</sup> being highly neurotoxic, tau, parkin and HTT<sup>128Q</sup> affecting mitochondrial distribution, integrity or both, and Aβ<sup>1-42</sup>, tau, HTT<sup>128Q</sup> and ATX1<sup>82Q</sup> affecting the F-actin network. This study provides proof of concept for using the <i>Drosophila</i> adult leg for inexpensive and rapid analysis of cellular effects of neurodegenerative disease proteins in mature neurons.

Also flagged:synthesischromosomeSmc3histonecohesinsister
Journal Article 2017-06-14 No Snippets Zhang J, Shi D, Li X, Ding L, Tang J, Liu C, Shirahige K, Cao Q, Lou H.
Show Full Abstract

Two sister chromatids must be held together by a cohesion process from their synthesis during S phase to segregation in anaphase. Despite its pivotal role in accurate chromosome segregation, how cohesion is established remains elusive. Here, we demonstrate that yeast Rtt101-Mms1, Cul4 family E3 ubiquitin ligases are stronger dosage suppressors of loss-of-function <i>eco1</i> mutants than PCNA The essential cohesion reaction, Eco1-catalyzed Smc3 acetylation is reduced in the absence of Rtt101-Mms1. One of the adaptor subunits, Mms22, associates directly with Eco1. Point mutations (L61D/G63D) in Eco1 that abolish the interaction with Mms22 impair Smc3 acetylation. Importantly, an <i>eco1LGpol30A251V</i> double mutant displays additive Smc3ac reduction. Moreover, Smc3 acetylation and cohesion defects also occur in the mutants of other replication-coupled nucleosome assembly (RCNA) factors upstream or downstream of Rtt101-Mms1, indicating unanticipated cross talk between histone modifications and cohesin acetylation. These data suggest that fork-associated Cul4-Ddb1 E3s, together with PCNA, coordinate chromatin reassembly and cohesion establishment on the newly replicated sister chromatids, which are crucial for maintaining genome and chromosome stability.

Also flagged:Iron transport proteinsironheme transport proteinsferrireductasesferroxidaseschaperones
Journal Article 2017-06-14 ✓ 1 Snippet Knutson MD.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Cellular iron homeostasis is maintained by iron and heme transport proteins that work in concert with ferrireductases, ferroxidases, and chaperones to direct the movement of iron into, within, and out of cells. Systemic iron homeostasis is regulated by the liver-derived peptide hormone, hepcidin. The interface between cellular and systemic iron homeostasis is readily observed in the highly dynamic iron handling of four main cell types: duodenal enterocytes, erythrocyte precursors, macrophages, and hepatocytes. This review provides an overview of how these cell types handle iron, highlighting how iron and heme transporters mediate the exchange and distribution of body iron in health and disease.

Also flagged:IronmetabolismHepcidinexportermineraloxygen
Journal Article 2017-06-14 No Snippets Coffey R, Ganz T.
Show Full Abstract

The regulation of iron metabolism in biological systems centers on providing adequate iron for cellular function while limiting iron toxicity. Because mammals cannot excrete iron, mechanisms have evolved to control iron acquisition, storage, and distribution at both systemic and cellular levels. Hepcidin, the master regulator of iron homeostasis, controls iron flows into plasma through inhibition of the only known mammalian cellular iron exporter ferroportin. Hepcidin is feedback-regulated by iron status and strongly modulated by inflammation and erythropoietic demand. This review highlights recent advances that have changed our understanding of iron metabolism and its regulation.

Also flagged:digestioncell surfaceproteoglycanGene expressioncollagenasetrypsin
Journal Article 2017-06-14 No Snippets Megat Abdul Wahab R, Mohamed Rozali NA, Senafi S, Zainol Abidin IZ, Zainal Ariffin Z, Zainal Ariffin SH.
Show Full Abstract

<h4>Background</h4>Stem cells are normally isolated from dental pulps using the enzymatic digestion or the outgrowth method. However, the effects of the isolation method on the quality of the isolated stem cells are not studied in detail in murine models. The aim of this study was to compare the matrices secreted by osteoblast and chondrocytes differentiated from dental pulp stem cells isolated through different means.<h4>Method</h4>DPSC from murine incisors were isolated through either the outgrowth (DPSC-OG) or the enzymatic digestion (DPSC-ED) method. Cells at passage 4 were used in this study. The cells were characterized through morphology and expression of cell surface markers. The cells' doubling time when cultured using different seeding densities was calculated and analyzed using one-way ANOVA and Tukey's multiple comparison post-test. The ability of cells to differentiate to chondrocyte and osteoblast was evaluated through staining and analysis on the matrices secreted.<h4>Results</h4>Gene expression analysis showed that DPSC-OG and DPSC-ED expressed dental pulp mesenchymal stem cell markers, but not hematopoietic stem cell markers. The least number of cells that could have been used to culture DPSC-OG and DPSC-ED with the shortest doubling time was 5 × 10<sup>2</sup> cells/cm<sup>2</sup> (11.49 ± 2.16 h) and 1 × 10<sup>2</sup> cells/cm<sup>2</sup> (10.55 h ± 0.50), respectively. Chondrocytes differentiated from DPSC-ED produced  2 times more proteoglycan and at a faster rate than DPSC-OG. FTIR revealed that DPSC-ED differentiated into osteoblast also secreted matrix, which more resembled a calvaria.<h4>Discussion</h4>Isolation approaches might have influenced the cell populations obtained. This, in turn, resulted in cells with different proliferation and differentiation capability. While both DPSC-OG and DPSC-ED expressed mesenchymal stem cell markers, the percentage of cells carrying each marker might have differed between the two methods. Regardless, enzymatic digestion clearly yielded cells with better characteristics than outgrowth.

Also flagged:Nrf2Oxidativemood dysfunctionGulf war illnesspyridostigminebromide
Journal Article 2017-06-14 ✓ 3 Snippets Shetty GA, Hattiangady B, Upadhya D, Bates A, Attaluri S, Shuai B, Kodali M, Shetty AK.
In-Text Gene Mentions

…[B19]), Prdx2 (B20),Prdx6(B21), prion protein…

…Prdx1, Prdx2 andPrdx6(B19-B21), and Txnrd1…

…Nudt1, Park7, Prdx1-2,Prdx6, Prnp, Psmb5, Sqstm1,…

Show Full Abstract

Memory and mood dysfunction are the key symptoms of Gulf war illness (GWI), a lingering multi-symptom ailment afflicting >200,000 veterans who served in the Persian Gulf War-1. Research probing the source of the disease has demonstrated that concomitant exposures to anti-nerve gas agent pyridostigmine bromide (PB), pesticides, and war-related stress are among the chief causes of GWI. Indeed, exposures to GWI-related chemicals (GWIR-Cs) and mild stress in animal models cause memory and mood impairments alongside reduced neurogenesis and chronic low-level inflammation in the hippocampus. In the current study, we examined whether exposure to GWIR-Cs and stress causes chronic changes in the expression of genes related to increased oxidative stress, mitochondrial dysfunction, and inflammation in the hippocampus. We also investigated whether GWI is linked with chronically increased activation of Nrf2 (a master regulator of antioxidant response) in the hippocampus, and inflammation and enhanced oxidative stress at the systemic level. Adult male rats were exposed daily to low-doses of PB and pesticides (DEET and permethrin), in combination with 5 min of restraint stress for 4 weeks. Analysis of the hippocampus performed 6 months after the exposure revealed increased expression of many genes related to oxidative stress response and/or antioxidant activity (<i>Hmox1, Sepp1</i>, and <i>Srxn1</i>), reactive oxygen species metabolism (<i>Fmo2, Sod2</i>, and <i>Ucp2</i>) and oxygen transport (<i>Ift172</i> and <i>Slc38a1</i>). Furthermore, multiple genes relevant to mitochondrial respiration (<i>Atp6a1, Cox6a1, Cox7a2L, Ndufs7, Ndufv1, Lhpp, Slc25a10</i>, and <i>Ucp1</i>) and neuroinflammation (<i>Nfkb1, Bcl6, Csf2, IL6, Mapk1, Mapk3, Ngf, N-pac</i>, and <i>Prkaca</i>) were up-regulated, alongside 73-88% reduction in the expression of anti-inflammatory genes <i>IL4</i> and <i>IL10</i>, and nuclear translocation and increased expression of Nrf2 protein. These hippocampal changes were associated with elevated levels of pro-inflammatory cytokines and chemokines (Tnfa, IL1b, IL1a, Tgfb, and Fgf2) and lipid peroxidation byproduct malondialdehyde in the serum, suggesting the presence of an incessant systemic inflammation and elevated oxidative stress. These results imply that chronic oxidative stress, inflammation, and mitochondrial dysfunction in the hippocampus, and heightened systemic inflammation and oxidative stress likely underlie the persistent memory and mood dysfunction observed in GWI.

Also flagged:Alzheimer's diseaseADneurodegenerative disorderdementiaLOADapolipoprotein E
Journal Article 2017-06-14 ✓ 4 Snippets Giri M, Shah A, Upreti B, Rai JC.
In-Text Gene Mentions

Hemochromatosis(HFE)…

…Hemochromatosis (HFE)…

…TheHFEgene is located…

…Mutation of theHFEgene increases the…

Show Full Abstract

Alzheimer's disease (AD) is a heterogeneous neurodegenerative disorder and it is the most common form of dementia in the elderly. Early onset AD is caused by mutations in three genes: <i>Amyloid-β precursor protein, presenilin 1</i> (<i>PSEN1</i>) and <i>PSEN2</i>. Late onset AD (LOAD) is complex and apolipoprotein E is the only unanimously accepted genetic risk factor for its development. Various genes implicated in AD have been identified using advanced genetic technologies, however, there are many additional genes that remain unidentified. The present review highlights the genetics of early and LOAD and summarizes the genes involved in different signaling pathways. This may provide insight into neurodegenerative disease research and will facilitate the development of effective strategies to combat AD.

Also flagged:Nonalcoholic fatty liver diseaseNAFLDliver diseasenonalcoholic steatohepatitiscirrhosishepatocellular carcinoma
Journal Article 2017-06-14 No Snippets Wang C, Gong J, Wu H.
Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is the most prevalent liver disease worldwide, the morbidity of which closely correlates with diversity of ethnicity, minority, family and location. Its histology spans from simple steatosis, to nonalcoholic steatohepatitis, which ultimately results in fibrosis, cirrhosis and hepatocellular carcinoma. The accelerating prevalence of NAFLD is due to an incremental incidence of metabolic syndrome that is distinguished by dyslipidemia, glucose impairment, obesity, excessive oxidative stress and adipocytokine impairment. Additionally, the pathogenesis of NAFLD is thought to be a multifactorial and complicated disease associated with lifestyle habits, nutritional factors and genetics. However, the pathogenesis and underlying mechanism in the development of NAFLD caused by genetics remains unclear. People have been increasingly emphasizing on the relationship between NAFLD and gene polymorphisms in recent years, with the aim of having a comprehensive elucidation of associated gene polymorphisms influencing the pathogenesis of the disease. In the current article, the authors attempted to critically summarize the most recently identified gene polymorphisms from the facets of glucose metabolism, fatty acid metabolism, oxidative stress and related cytokines in NAFLD that contribute to promoting the progression of the disease.

Also flagged:WarfarinCYP3A4acute limb ischemiadeep venous thrombosispulmonary artery embolismcytochrome P450 3A4
Journal Article 2017-06-14 ✓ 1 Snippet Ma XW, Hao CN, Gu ZC, Ye M, Li M, Zhang L.
In-Text Gene Mentions

thrombin-III

Show Full Abstract

Patients with acute limb ischemia, deep venous thrombosis and pulmonary artery embolism may be treated with warfarin. The dose-response interaction of warfarin is associated with numerous factors, depending on which an uncommon life-threatening bleeding may occur. The present case study reported on a patient with acute limb ischemia and a history of warfarin-induced bleeding ten years previously and who again developed life threatening bleeding associated with warfarin treatment and received vascular surgery. In this patient, a cytochrome P450 3A4 loss-of-function mutation decreased the effective dose of warfarin. Although this was a rare case, clinicians should be alert to the bleeding risk associated with such rare genetic mutations.

Also flagged:photoprobesbindingPALbenzophenonesarylazidesdiazirines
Journal Article 2017-06-14 ✓ 1 Snippet Guo H, Li Z.
In-Text Gene Mentions

TAOK3

Show Full Abstract

Photoaffinity labeling (PAL) has been widely applied in various research areas such as medicinal chemistry, chemical biology and structural biology, owing to its capability of investigating non-covalent ligand-protein interactions under native environments and elucidating protein structures, functions <i>etc.</i> One important application of this technique is to use affinity-based proteome profiling (A<i>f</i>BP) coupled with bioimaging for profiling drug-target interactions <i>in situ</i>. In order to accurately report drug-target interactions <i>via</i> these approaches, several considerations as follows need to be made: (1) maximally retaining bioactivities of photoprobes upon functionalization with a photoreactive group and a reporter tag from a parental compound; (2) performing proteome profiling and imaging <i>in situ</i> simultaneously, to monitor drug-target interactions in different manners; and (3) developing excellent photo-crosslinkers capable of photo-crosslinking and fluorescence turn-on at the same time. With these considerations in mind, we have developed three versions of "minimalist" bioorthogonal handle-containing photo-crosslinkers (L3-L6) during the years and successfully applied them in all kinds of small bioactive molecules for protein labeling and cellular imaging studies. In this mini-review, the features and functions of these linkers are specifically highlighted and summarized.

Also flagged:tryptophan hydroxylase 2gene expressionTPH2synthesisserotoninGata2
Journal Article 2017-06-13 ✓ 1 Snippet Nawa Y, Kaneko H, Oda M, Tsubonoya M, Hiroi T, Gentile MT, Colucci-D'Amato L, Takahashi R, Matsui H.
In-Text Gene Mentions

…Gata3, Lmx1b, Pet-1, 5-Htt, and Vmat2) and…

Show Full Abstract

Tryptophan hydroxylase 2 (TPH2) is the key enzyme in the synthesis of neuronal serotonin. Although previous studies suggest that TPH2 neuron-restrictive silencer element (NRSE) functions as a negative regulator dependent on neuron-restrictive silencer factor (NRSF) activity, the underlying mechanisms are yet to be fully elucidated. Here, we show a detailed analysis of the NRSE-mediated repression of the human TPH2 (hTPH2) promoter activity in RN46A cells, a cell line derived from rat raphe neurons. Quantitative real-time RT-PCR analysis revealed the expression of serotonergic marker genes (Mash1, Nkx2.2, Gata2, Gata3, Lmx1b, Pet-1, 5-Htt, and Vmat2) and Nrsf gene in RN46A cells. Tph1 mRNA is the prevalent form expressed in RN46A cells; Tph2 mRNA is also expressed but at a lower level. Electrophoretic mobility shift assays and reporter assays showed that hTPH2 NRSE is necessary for the efficient DNA binding of NRSF and for the NRSF-dependent repression of the hTPH2 promoter activity. The hTPH2 promoter activity was increased by knockdown of NRSF, or over-expression of the engineered NRSF (a dominant-negative mutant or a DNA-binding domain and activation domain fusion protein). MS-275, a class I histone deacetylase (HDAC) inhibitor, was found to be more potent than MC-1568, a class II HDAC inhibitor, in enhancing the hTPH2 promoter activity. Furthermore, treatment with the ubiquitin-specific protease 7 deubiquitinase inhibitors, P-22077 or HBX 41108, increased the hTPH2 promoter activity. Collectively, our data demonstrate that the hTPH2 NRSE-mediated promoter repression via NRSF involves class I HDACs and is modulated by the ubiquitin-specific protease 7-mediated deubiquitination and stabilization of NRSF.

Also flagged:protein Cprotein SATPCPROCPS
Journal Article 2017-06-13 ✓ 5 Snippets Wypasek E, Corral J, Alhenc-Gelas M, Sydor W, Iwaniec T, Celińska-Lowenhoff M, Potaczek DP, Blecharczyk A, Zawilska K, Musiał J, Undas A.
In-Text Gene Mentions

OBJECTIVES    The aim of the study was to characterize the frequency of SERPINC1, PROC, and PROS1 mutations and their thromboembolic manifestations in patients with AT, PC, or PS deficiencies, inhabiting southern Poland.

…antithrombin (AT; gene:SERPINC1), protein C (PC;…

…the frequency ofSERPINC1, PROC, and PROS1…

…mostly in theSERPINC1and PROC genes.…

…those in theSERPINC1and PROS1 genes.…

Show Full Abstract

INTRODUCTION    Inherited deficiencies of natural anticoagulants such as antithrombin (AT; gene: SERPINC1), protein C (PC; PROC), and protein S (PS; PROS1), with the prevalence in the general European population of 0.02% to 0.17%, 0.2% to 0.3%, and 0.5%, respectively, are associated with increased risk of thromboembolic events. Only a few case reports of Polish deficient patients with known causal mutations have been published so far. OBJECTIVES    The aim of the study was to characterize the frequency of SERPINC1, PROC, and PROS1 mutations and their thromboembolic manifestations in patients with AT, PC, or PS deficiencies, inhabiting southern Poland. PATIENTS AND METHODS     Ninety unrelated patients (mean [SD] age, 40.1 [13.2] years) with AT (n = 35), PC (n = 28), or PS (n = 27) deficiencies, with a history of venous 73 (81%) or arterial 17 (19%) thromboembolism, were screened for mutations using the Sanger sequencing or multiplex ligation‑dependent probe amplification. RESULTS    Twenty mutations (29%) described here were new, mostly in the SERPINC1 and PROC genes. Missense mutations accounted for 84% of all mutations in the PROC gene and approximately 50% of those in the SERPINC1 and PROS1 genes. In all 3 genes, the ratio of nonsense and splice-site mutations was 8% to 31% and 8% to 23%, respectively. The mutation detection rate was 90% for AT or PC when anticoagulant activity was below 70%, while for the PROS1 gene, the rate reached 80% at the free PS levels below 40%. CONCLUSIONS    To our knowledge, this is the largest cohort of Polish patients deficient in natural anticoagulants and evaluated for the causal genetic background. Several new Polish detrimental mutations were detected, mostly in AT- and PC‑deficient patients.

Also flagged:CD33leukemiaacute myeloid leukemiaAMLcalicheamicinacute promyelocytic leukemia
Journal Article 2017-06-13 ✓ 1 Snippet Godwin CD, Gale RP, Walter RB.
In-Text Gene Mentions

HFE

Show Full Abstract

CD33 is variably expressed on leukemia blasts in almost all patients with acute myeloid leukemia (AML) and possibly leukemia stem cells in some. Efforts to target CD33 therapeutically have focused on gemtuzumab ozogamicin (GO; Mylotarg), an antibody-drug conjugate delivering a DNA-damaging calicheamicin derivative. GO is most effective in acute promyelocytic leukemia but induces remissions in other AML types and received accelerated approval in the US in 2000. However, because a large follow-up study showed no survival improvement and increased early deaths the drug manufacturer voluntarily withdrew the US New Drug Application in 2010. More recently, a meta-analysis of data from several trials reported better survival in adults with favorable- and intermediate-risk cytogenetics but not adverse-risk AML randomized to receive GO along with intensive induction chemotherapy. As a result, GO is being re-evaluated by regulatory agencies. Responses to GO are diverse and predictive biological response markers are needed. Besides cytogenetic risk, ATP-binding cassette transporter activity and possibly CD33 display on AML blasts may predict response, but established clinical assays and prospective validation are lacking. Single-nucleotide polymorphisms in CD33 may also be predictive, most notably rs12459419 where the minor T-allele leads to decreased display of full-length CD33 and preferential translation of a splice variant not recognized by GO. Data from retrospective analyses suggest only patients with the rs12459419 CC genotype may benefit from GO therapy but confirmation is needed. Most important may be markers for AML cell sensitivity to calicheamicin, which varies over 100 000-fold, but useful assays are unavailable. Novel CD33-targeted drugs may overcome some of GO's limitations but it is currently unknown whether such drugs will be more effective in patients benefitting from GO and/or improve outcomes in patients not benefitting from GO, and what the supportive care requirements will be to enable their safe use.

Also flagged:HLA-B*5701abacavirhypersensitivityHLA-B*1502carbamazepinetoxic epidermal necrolysis
Journal Article 2017-06-13 No Snippets Verbelen M, Weale ME, Lewis CM.
Show Full Abstract

Pharmacogenetics (PGx) has the potential to personalize pharmaceutical treatments. Many relevant gene-drug associations have been discovered, but PGx-guided treatment needs to be cost-effective as well as clinically beneficial to be incorporated into standard health-care. We reviewed economic evaluations for PGx associations listed in the US Food and Drug Administration (FDA) Table of Pharmacogenomic Biomarkers in Drug Labeling. We determined the proportion of evaluations that found PGx-guided treatment to be cost-effective or dominant over the alternative strategies, and estimated the impact on this proportion of removing the cost of genetic testing. Of the 137 PGx associations in the FDA table, 44 economic evaluations, relating to 10 drugs, were identified. Of these evaluations, 57% drew conclusions in favour of PGx testing, of which 30% were cost-effective and 27% were dominant (cost-saving). If genetic information was freely available, 75% of economic evaluations would support PGx-guided treatment, of which 25% would be cost-effective and 50% would be dominant. Thus, PGx-guided treatment can be a cost-effective and even a cost-saving strategy. Having genetic information readily available in the clinical health record is a realistic future prospect, and would make more genetic tests economically worthwhile.

Also flagged:membranesvesiclesorganellesLipidcytoskeletonmembrane
Journal Article 2017-06-13 No Snippets Dasgupta S, Auth T, Gompper G.
Show Full Abstract

Systems with interfaces are abundant in both technological applications and biology. While a fluid interface separates two fluids, membranes separate the inside of vesicles from the outside, the interior of biological cells from the environment, and compartmentalize cells into organelles. The physical properties of interfaces are characterized by interface tension, those of membranes are characterized by bending and stretching elasticity. Amphiphilic molecules like surfactants that are added to a system with two immiscible fluids decrease the interface tension and induce a bending rigidity. Lipid bilayer membranes of vesicles can be stretched or compressed by osmotic pressure; in biological cells, also the presence of a cytoskeleton can induce membrane tension. If the thickness of the interface or the membrane is small compared with its lateral extension, both can be described using two-dimensional mathematical surfaces embedded in three-dimensional space. We review recent work on the interaction of particles with interfaces and membranes. This can be micrometer-sized particles at interfaces that stabilise emulsions or form colloidosomes, as well as typically nanometer-sized particles at membranes, such as viruses, parasites, and engineered drug delivery systems. In both cases, we first discuss the interaction of single particles with interfaces and membranes, e.g. particles in external fields, non-spherical particles, and particles at curved interfaces, followed by interface-mediated interaction between two particles, many-particle interactions, interface and membrane curvature-induced phenomena, and applications.

Also flagged:cancerleukaemiasolid tumourtumoursolid tumoursovarian cancer
Journal Article 2017-06-13 No Snippets Hendriks HR, Govaerts AS, Fichtner I, Burtles S, Westwell AD, Peters GJ.
Show Full Abstract

<h4>Background</h4>The European NCI compounds programme, a joint initiative of the EORTC Research Branch, Cancer Research Campaign and the US National Cancer Institute, was initiated in 1993. The objective was to help the NCI in reducing the backlog of in vivo testing of potential anticancer compounds, synthesised in Europe that emerged from the NCI in vitro 60-cell screen.<h4>Methods</h4>Over a period of more than twenty years the EORTC-Cancer Research Campaign panel reviewed ∼2000 compounds of which 95 were selected for further evaluation. Selected compounds were stepwise developed with clear go/no go decision points using a pharmacologically directed programme.<h4>Results</h4>This approach eliminated quickly compounds with unsuitable pharmacological properties. A few compounds went into Phase I clinical evaluation. The lessons learned and many of the principles outlined in the paper can easily be applied to current and future drug discovery and development programmes.<h4>Conclusions</h4>Changes in the review panel, restrictions regarding numbers and types of compounds tested in the NCI in vitro screen and the appearance of targeted agents led to the discontinuation of the European NCI programme in 2017 and its transformation into an academic platform of excellence for anticancer drug discovery and development within the EORTC-PAMM group. This group remains open for advice and collaboration with interested parties in the field of cancer pharmacology.

Also flagged:RGS12Prostate CancerchromosomeMNX1AKTtumor
Journal Article 2017-06-13 ✓ 1 Snippet Wang Y, Wang J, Zhang L, Karatas OF, Shao L, Zhang Y, Castro P, Creighton CJ, Ittmann M.
In-Text Gene Mentions

HTT

Show Full Abstract

African American (AA) men exhibit a relatively high incidence and mortality due to prostate cancer even after adjustment for socioeconomic factors, but the biological basis for this disparity is unclear. Here, we identify a novel region on chromosome 4p16.3 that is lost selectively in AA prostate cancer. The negative regulator of G-protein signaling RGS12 was defined as the target of 4p16.3 deletions, although it has not been implicated previously as a tumor-suppressor gene. RGS12 transcript levels were relatively reduced in AA prostate cancer, and prostate cancer cell lines showed decreased RGS12 expression relative to benign prostate epithelial cells. Notably, RGS12 exhibited potent tumor-suppressor activity in prostate cancer and prostate epithelial cell lines <i>in vitro</i> and <i>in vivo</i> We found that RGS12 expression correlated negatively with the oncogene MNX1 and regulated its expression <i>in vitro</i> and <i>in vivo</i> Further, MNX1 was regulated by AKT activity, and RGS12 expression decreased total and activated AKT levels. Our findings identify RGS12 as a candidate tumor-suppressor gene in AA prostate cancer, which acts by decreasing expression of AKT and MNX1, establishing a novel oncogenic axis in this disparate disease setting. <i>Cancer Res; 77(16); 4247-57. ©2017 AACR</i>.

Also flagged:propofolgamma-aminobutyric acid (GABA) receptorSCN9AGABAA1GABAA2CHRM2
Journal Article 2017-06-13 ✓ 5 Snippets Zhong Q, Chen X, Zhao Y, Liu R, Yao S.
In-Text Gene Mentions

Five of the 35 investigated genes were postulated to be involved in propofol pharmacokinetics (CYP1A2, ABCB1, TAOK3, FAM53B, and ADH4), ten genes were postulated to be directly or indirectly involved in the pharmacodynamics of the response to propofol (OPRM1, GR1N3A, GR1N2B, OPRD1, GAL, ADRB1, COMT, CNR1, P2RX7, and FAAH), and twenty genes are known to participate in the mechanism of action of propofol (NOS3, GABAB2, GABAA6, GABAA1, GABAG2, GABAA2, GABA, 5HT2A, 5-HTTLPR, CHRNA5, CHRM2, DAT, DRD2, DRD3, CSNK1E, ANKK1, calcium channel, potassium channel, GIRK, and sodium channel).

Cytochrome P450 family (CYP450), ATP-binding cassette (ABCB1), serine/threonine-protein kinase 3 (TAOK3), family with sequence similarity 53 member B (FAM53B), and the cannabinoid receptor (CNR1) are postulated to be involved in propofol pharmacokinetics; opioid receptors (OPRM1 and OPRD1), β-adrenoceptor (ADRB1), Catechol-O-methyltransferase (COMT), and ligand-gated ion channel (P2RX7) are postulated to be directly or indirectly involved in the pharmacodynamic response to propofol; nitric oxide synthase (NOS3), GABA type A (GABAA) receptor, NMDA receptors (GR1N3A and GR1N2B), Galanin (GAL), fatty acid amide hydrolase (FAAH), 5-hydroxytryptamine receptor (5HT2A), cholinergic receptors (CHRM2 and CHRNA5), dopamine transporters (DAT and DRD2), casein kinase (CSNK1E), calcium channels, potassium channels (KCNS1 and GIRK) and sodium channels (SCN9A) are also likely involved in the action of propofol7, 10–23.

…e/threonine-protein kinase 3 (TAOK3), family with sequence…

…armacokinetics (CYP1A2, ABCB1,TAOK3, FAM53B, and ADH4),…

…including CYP450, ABCB1,TAOK3, FAM53B, CNR1, OPRM1,…

Show Full Abstract

Significant individual susceptibility to intravenous anesthetic propofol exists. The etiology of individual variability in the response to propofol may be influenced by genetic polymorphisms in metabolic and functional pathways. With current pharmacogenetics and modern molecular biology technologies, it is possible to study the influence of genetic polymorphisms on susceptibility to propofol. When inducing general anesthesia with intravenous propofol, high individual susceptibility to propofol was found. Using Sequenom MassARRAY single-nucleotide polymorphism (SNP) genotyping, we identified a mutation (rs6313) in the 5HT2A gene that was correlated to individual susceptibility to propofol effect-site concentration (Cep) and onset time of propofol induction. Carriers of the minor allele (G) of 5HT2A rs6313 required less propofol (20% decrease in Cep) and less time (40% decrease in onset time) to induce anesthesia. Moreover, associations were found between the gamma-aminobutyric acid (GABA) receptor SNP rs2279020 and the SCN9A SNP rs6746030 and the susceptibility of bispectral index (BIS) after propofol-induced anesthesia. In addition, dominant mutations in GABAA1 rs2279020, GABAA2 rs11503014, and CHRM2 rs1824024 were putatively associated with cardiovascular susceptibility to propofol anesthesia. No gene-gene interactions were found through a standardized measure of linkage disequilibrium and a multifactor dimensionality reduction analysis. Our results suggest that genetic polymorphisms related to mechanisms of propofol anesthesia are involved in propofol susceptibility.

Also flagged:RatZFP36SNESFRS2ybx2-aHNRNPA1
Journal Article 2017-06-13 ✓ 1 Snippet Hirai T, Mulpuri Y, Cheng Y, Xia Z, Li W, Ruangsri S, Spigelman I, Nishimura I.
In-Text Gene Mentions

…Gpx7, Gpx8, Prdx5,Prdx6, Mgst2, Mgst3) (Fig.…

Show Full Abstract

Neuronal cells express considerable plasticity responding to environmental cues, in part, through subcellular mRNA regulation. Here we report on the extensive changes in distribution of mRNAs in the cell body and axon compartments of peripheral sensory neurons and the 3' untranslated region (3'UTR) landscapes after unilateral sciatic nerve entrapment (SNE) injury in rats. Neuronal cells dissociated from SNE-injured and contralateral L4 and L5 dorsal root ganglia were cultured in a compartmentalized system. Axonal and cell body RNA samples were separately subjected to high throughput RNA sequencing (RNA-Seq). The injured axons exhibited enrichment of mRNAs related to protein synthesis and nerve regeneration. Lengthening of 3'UTRs was more prevalent in the injured axons, including the newly discovered alternative cleavage and polyadenylation of NaV1.8 mRNA. Alternative polyadenylation was largely independent from the relative abundance of axonal mRNAs; but they were highly clustered in functional pathways related to RNA granule formation in the injured axons. These RNA-Seq data analyses indicate that peripheral nerve injury may result in highly selective mRNA enrichment in the affected axons with 3'UTR alterations potentially contributing to the mechanism of neuropathic pain.

Also flagged:PathogenesisSystemic Lupus ErythematosusSLEchronic autoimmune diseaseautoantibodyto
Journal Article 2017-06-13 No Snippets Moulton VR, Suarez-Fueyo A, Meidan E, Li H, Mizui M, Tsokos GC.
Show Full Abstract

Systemic lupus erythematosus (SLE) is a chronic autoimmune disease affecting multiple organs. A complex interaction of genetics, environment, and hormones leads to immune dysregulation and breakdown of tolerance to self-antigens, resulting in autoantibody production, inflammation, and destruction of end-organs. Emerging evidence on the role of these factors has increased our knowledge of this complex disease, guiding therapeutic strategies and identifying putative biomarkers. Recent findings include the characterization of genetic/epigenetic factors linked to SLE, as well as cellular effectors. Novel observations have provided an improved understanding of the contribution of tissue-specific factors and associated damage, T and B lymphocytes, as well as innate immune cell subsets and their corresponding abnormalities. The intricate web of involved factors and pathways dictates the adoption of tailored therapeutic approaches to conquer this disease.

Also flagged:tumorethanequinolizinepyranethylphagocytosis
Journal Article 2017-06-13 No Snippets Xu X, Wang Y, Wu J, Hu X, Zhu H, Zhang X, Wang Y, Gui L, Zhao M, Peng S.
Show Full Abstract

To overcome the harmful side effects, low tolerance, and undesirable outcomes of the anticancer drugs, we used ethane-1,2-diamine to bridge antitumoral (<i>S</i>)-3-acetyl-4-oxo-tetrahydroindolo[2,3-a]quinolizine-6-carboxylic acid (ATIQC) and tumor-targeting d-glucuronic acid, thereby providing (6<i>S</i>)-3-acetyl-4-oxo-<i>N</i>-(2-(3,4,5,6-tetrahydroxytetrahydro-2H-pyran-2-carboxamido)ethyl)-4,6,7,12-tetrahydroindolo[2,3-a]quinolizine-6-carboxamide (ATIQCTPC). Atomic force microscopy images visualized, that in serum, ATIQCTPC formed particles of height <81 nm. These particles effectively avoided phagocytosis of macrophages and were stable in blood circulation. Distribution analysis indicated that ATIQCTPC accumulated and released ATIQC in the tumor tissue through a targeting manner. Thus, the antitumor and the anti-thrombotic activities of ATIQCTPC were 100-fold higher than those of ATIQC, and ATIQCTPC was able to prevent cancer patients from suffering from thrombosis. Based on the observation that ATIQCTPC decreased serum tumor necrosis factor-α (TNF-α) and interleukin-8 (IL-8) in S180 mice, we hypothesized that this is the mechanism that ATIQCTPC utilized to slow tumor growth. Additionally, we observed that ATIQCTPC inhibited thrombosis by decreasing serum P-selectin of thrombotic rats. The intermolecular association and the hexamerization manner of ATIQCTPC were experimentally evidenced and correlated with the formation of the nanoparticles.

Also flagged:sepsisproteinsinterleukin-2 receptor α-chainscavenger receptor cysteine-rich-type-1sCD163tumor-necrosis factor receptor superfamily-member-6
Journal Article 2017-06-13 ✓ 1 Snippet Garcia-Obregon S, Azkargorta M, Seijas I, Pilar-Orive J, Borrego F, Elortza F, Boyano MD, Astigarraga I.
In-Text Gene Mentions

…validated by ELISA:Antithrombin-III(AT-III), Clusterin (CLUS)…

Show Full Abstract

<h4>Background</h4>Sepsis is a life-threatening illness with a challenging diagnosis. Current serum biomarkers are not sensitive enough for diagnosis. With the aim of finding proteins associated with sepsis, serum protein profile was compared between patients and healthy donors and serum classical inflammatory proteins were analyzed in both groups.<h4>Methods</h4>Serum protein profiles were characterized by two-dimensional electrophoresis (2DE). Identification of the proteins was carried out by mass spectrophotometry and their validation was performed by Enzyme-Linked-ImmunoSorbent Assay (ELISA) in a cohort of 85 patients and 67 healthy donors. Seven classical inflammatory proteins were analyzed in the same cohort by ELISA: interleukin-2 receptor α-chain (sCD25), scavenger receptor cysteine-rich-type-1 (sCD163), tumor-necrosis factor receptor superfamily-member-6 (sFas), hemeoxigenase-1 decycling (HO-1), interleukin-6 (IL-6), interleukin-18 (IL-18) and intercellular adhesion-molecule-1 (sICAM-1).<h4>Results</h4>After 2DE, 20 significantly differently expressed spots were identified by mass spectrometry analysis, revealing deregulation of six different proteins upon sepsis and 50% were validated by ELISA: Antithrombin-III (AT-III), Clusterin (CLUS) and Serum amyloid A-1 (SAA-1). Serum concentration of AT-III and CLUS was significantly lower in patients' serum, whereas SAA-1 showed higher values in septic patients. Serum concentration of the seven inflammatory proteins was significantly increased in septic patients. Functional analysis of the ten deregulated proteins revealed an enrichment of proteins related mainly to the activation of the immune response.<h4>Conclusion</h4>We have identified a panel of ten potential sepsis marker proteins biologically connected and validated in a large number of patients, whose analysis could be considered as a complementary tool for the diagnosis of sepsis.

Also flagged:POM121actinautophagyactin, gammaprotein 2Beta-LG
Journal Article 2017-06-13 No Snippets Brohi RD, Wang L, Hassine NB, Cao J, Talpur HS, Wu D, Huang CJ, Rehman ZU, Bhattarai D, Huo LJ.
Show Full Abstract

Mature spermatozoa have highly condensed DNA that is essentially silent both transcriptionally and translationally. Therefore, post translational modifications are very important for regulating sperm motility, morphology, and for male fertility in general. Protein sumoylation was recently demonstrated in human and rodent spermatozoa, with potential consequences for sperm motility and DNA integrity. We examined the expression and localization of small ubiquitin-related modifier-1 (SUMO-1) in the sperm of water buffalo (<i>Bubalus bubalis</i>) using immunofluorescence analysis. We confirmed the expression of SUMO-1 in the acrosome. We further found that SUMO-1 was lost if the acrosome reaction was induced by calcium ionophore A23187. Proteins modified or conjugated by SUMO-1 in water buffalo sperm were pulled down and analyzed by mass spectrometry. Sixty proteins were identified, including proteins important for sperm morphology and motility, such as relaxin receptors and cytoskeletal proteins, including tubulin chains, actins, and dyneins. Forty-six proteins were predicted as potential sumoylation targets. The expression of SUMO-1 in the acrosome region of water buffalo sperm and the identification of potentially SUMOylated proteins important for sperm function implicates sumoylation as a crucial PTM related to sperm function.

Also flagged:Spinocerebellar Ataxia Type 2ExtracellularSuperoxide DismutaseSCA2neurodegenerative disorderSOD3
Journal Article 2017-06-13 ✓ 1 Snippet Almaguer-Gotay D, Almaguer-Mederos LE, Aguilera-Rodríguez R, Rodríguez-Labrada R, Cuello-Almarales D, Estupiñán-Domínguez A, Velázquez-Pérez LC, González-Zaldívar Y, Vázquez-Mojena Y.
In-Text Gene Mentions

…reduction in mutanthtt-induced caspase activation wa…

Show Full Abstract

<h4>Background</h4>Spinocerebellar ataxia type 2 (SCA2) is an inherited and still incurable neurodegenerative disorder. Evidence suggests that pro-oxidant agents as well as factors involved in antioxidant cellular defenses are part of SCA2 physiopathology.<h4>Aim</h4>To assess the influence of superoxide dismutase (SOD3) and catalase (CAT) enzymatic activities on the SCA2 syndrome.<h4>Method</h4>Clinical, molecular, and electrophysiological variables, as well as SOD3 and CAT enzymatic activities were evaluated in 97 SCA2 patients and in 64 age- and sex-matched control individuals.<h4>Results</h4>Spinocerebellar ataxia type 2 patients had significantly lower SOD3 enzymatic activity than the control group. However, there were no differences between patients and controls for CAT enzymatic activity. The effect size for the loss of patients' SOD3 enzymatic activity was 0.342, corresponding to a moderate effect. SOD3 and CAT enzymatic activities were not associated with the CAG repeat number at the <i>ATXN2</i> gene. SOD3 and CAT enzymatic activities did not show significant associations with the age at onset, severity score, or the studied electrophysiological markers.<h4>Conclusion</h4>There is a reduced SOD3 enzymatic activity in SCA2 patients with no repercussion on the clinical phenotype.

Also flagged:Visceral leishmaniasispeptidepeptidesHLAhistone H1kinetoplastid membrane protein 11
Journal Article 2017-06-13 No Snippets Athanasiou E, Agallou M, Tastsoglou S, Kammona O, Hatzigeorgiou A, Kiparissides C, Karagouni E.
Show Full Abstract

Visceral leishmaniasis, caused by <i>Leishmania</i> (<i>L</i>.) <i>donovani</i> and <i>L. infantum</i> protozoan parasites, can provoke overwhelming and protracted epidemics, with high case-fatality rates. An effective vaccine against the disease must rely on the generation of a strong and long-lasting T cell immunity, mediated by CD4<sup>+</sup> T<sub>H1</sub> and CD8<sup>+</sup> T cells. Multi-epitope peptide-based vaccine development is manifesting as the new era of vaccination strategies against <i>Leishmania</i> infection. In this study, we designed chimeric peptides containing HLA-restricted epitopes from three immunogenic <i>L. infantum</i> proteins (cysteine peptidase A, histone H1, and kinetoplastid membrane protein 11), in order to be encapsulated in poly(lactic-<i>co</i>-glycolic) acid nanoparticles with or without the adjuvant monophosphoryl lipid A (MPLA) or surface modification with an octapeptide targeting the tumor necrosis factor receptor II. We aimed to construct differentially functionalized peptide-based nanovaccine candidates and investigate their capacity to stimulate the immunomodulatory properties of dendritic cells (DCs), which are critical regulators of adaptive immunity generated upon vaccination. According to our results, DCs stimulation with the peptide-based nanovaccine candidates with MPLA incorporation or surface modification induced an enhanced maturation profile with prominent IL-12 production, promoting allogeneic T cell proliferation and intracellular production of IFNγ by CD4<sup>+</sup> and CD8<sup>+</sup> T cell subsets. In addition, DCs stimulated with the peptide-based nanovaccine candidate with MPLA incorporation exhibited a robust transcriptional activation, characterized by upregulated genes indicative of vaccine-driven DCs differentiation toward type 1 phenotype. Immunization of HLA A2.1 transgenic mice with this peptide-based nanovaccine candidate induced peptide-specific IFNγ-producing CD8<sup>+</sup> T cells and conferred significant protection against <i>L. infantum</i> infection. Concluding, our findings supported that encapsulation of more than one chimeric multi-epitope peptides from different immunogenic <i>L. infantum</i> proteins in a proper biocompatible delivery system with the right adjuvant is considered as an improved promising approach for the development of a vaccine against VL.

Also flagged:polymeraseanxietydepressive disordersserotonin transporterSLC6A4MAO-A
Journal Article 2017-06-13 ✓ 5 Snippets Schneider-Matyka D, Jurczak A, Szkup M, Samochowiec A, Grzywacz A, Wieder-Huszla S, Grochans E.
In-Text Gene Mentions

The aim of this study was to establish the relationship between personality traits of postmenopausal women and the presence of the 44-bp VNTR polymorphism in the serotonin transporter (5-HTT) (<i>SLC6A4</i>) promoter region and the 30-bp VNTR polymorphism in the <i>MAO-A</i> promoter region.

Research conducted so far provides evidence for the influence of the serotonin transporter (5-HTT) gene (SLC6A4) on developing anxiety-related personality traits.

The study of 157 Hungarian students, concerning the influence of VNTR polymorphisms in the dopamine D4 receptor gene and the 5-HTT gene (SLC6A4) on personality traits according to the TCI, demonstrated that respondents with the s/s genotype of the polymorphism in the 5-HTT (SLC6A4) promoter region and the dopamine D4 receptor gene 7-repeat allele had higher levels of HA than other genotypic groups.23 Evidence was also pro-vided for the association between the 5-HTTLPR polymorphism and neuroticism, regarded as a risk factor for affective disorders.24 According to the study carried out in Finland, neuroticism was linked to the occurrence of anxiety and depressive symptoms.25 It was also found that the presence of the “s” allele of the 5-HTTLPR polymorphism resulted in lower 5-HTT expression and, consequently, an increase in impulsive behaviors.

The “s” allele of the 5-HTT gene presumably causes the lower expression and weaker function of serotonin transporter, resulting in disturbance of transmission and consequently higher impulsiveness and avoidant personality.1,4 In carriers of the s-allele genotype of the 5-HTT gene (SLC6A4), stressful life events may evoke more severe depressive symptoms and trigger more frequent suicidal attempts than in individuals with the “l” allele.5 According to Cloninger, HA predisposes to the occurrence of depressive symptoms and/or anxiety disorders.1 HA is a personality trait characterized by excessive anxiety, pessimism, and shyness accompanied by constant fear, uncertainty, and tiring out quickly.

…the serotonin transporter (5-HTT) ( SLC6A4 )…

Show Full Abstract

The aim of this study was to establish the relationship between personality traits of postmenopausal women and the presence of the 44-bp VNTR polymorphism in the serotonin transporter (5-HTT) (<i>SLC6A4</i>) promoter region and the 30-bp VNTR polymorphism in the <i>MAO-A</i> promoter region. The study's aim was also to determine the influence of personality traits on the quality of postmenopausal women's lives. The study involved 214 postmenopausal women from northwest Poland, with an average age of 56.8±4.08 years. It was performed using the Temperament and Character Inventory-Revised and the Short Form Health Survey. DNA polymorphisms were identified by means of polymerase chain reaction. Analysis demonstrated that the s/s genotype was significantly more common than the l/l genotype in women with higher fear of uncertainty. In a group with higher enlightened second nature and empathy, the l/s genotype was considerably more common than the l/l genotype. There were statistically significant associations between selected aspects of quality of life and personality traits such as enlightened second nature, transpersonal identification, purposefulness, and self-transcendence. The s/s genotype of the 44-bp VNTR polymorphism in the 5-HTT (<i>SLC6A4</i>) promoter region may increase the tendency to avoid harm within the fear of uncertainty dimension. Carriers of this genotype may have predisposition to anxiety and depressive disorders. The l/s genotype of the 44-bp VNTR polymorphism in the 5-HTT (<i>SLC6A4</i>) promoter region contributes to increased expression of enlightened second nature and empathy. Some personality traits may influence the quality of women's lives.

Also flagged:Primary ImmunodeficienciesImmunodeficiencyprimary immunodeficiencyPIDprimary antibody deficienciescombined immunodeficiencies
Journal Article 2017-06-13 No Snippets Aghamohammadi A, Abolhassani H, Kutukculer N, Wassilak SG, Pallansch MA, Kluglein S, Quinn J, Sutter RW, Wang X, Sanal O, Latysheva T, Ikinciogullari A, Bernatowska E, Tuzankina IA, Costa-Carvalho BT, Franco JL, Somech R, Karakoc-Aydiner E, Singh S, Bezrodnik L, Espinosa-Rosales FJ, Shcherbina A, Lau YL, Nonoyama S, Modell F, Modell V, JMF Centers Network Investigators and Study Collaborators, Barbouche MR, McKinlay MA.
Show Full Abstract

Immunodeficiency-associated vaccine-derived polioviruses (iVDPVs) have been isolated from primary immunodeficiency (PID) patients exposed to oral poliovirus vaccine (OPV). Patients may excrete poliovirus strains for months or years; the excreted viruses are frequently highly divergent from the parental OPV and have been shown to be as neurovirulent as wild virus. Thus, these patients represent a potential reservoir for transmission of neurovirulent polioviruses in the post-eradication era. In support of WHO recommendations to better estimate the prevalence of poliovirus excreters among PIDs and characterize genetic evolution of these strains, 635 patients including 570 with primary antibody deficiencies and 65 combined immunodeficiencies were studied from 13 OPV-using countries. Two stool samples were collected over 4 days, tested for enterovirus, and the poliovirus positive samples were sequenced. Thirteen patients (2%) excreted polioviruses, most for less than 2 months following identification of infection. Five (0.8%) were classified as iVDPVs (only in combined immunodeficiencies and mostly poliovirus serotype 2). Non-polio enteroviruses were detected in 30 patients (4.7%). Patients with combined immunodeficiencies had increased risk of delayed poliovirus clearance compared to primary antibody deficiencies. Usually, iVDPV was detected in subjects with combined immunodeficiencies in a short period of time after OPV exposure, most for less than 6 months. Surveillance for poliovirus excretion among PID patients should be reinforced until polio eradication is certified and the use of OPV is stopped. Survival rates among PID patients are improving in lower and middle income countries, and iVDPV excreters are identified more frequently. Antivirals or enhanced immunotherapies presently in development represent the only potential means to manage the treatment of prolonged excreters and the risk they present to the polio endgame.

Also flagged:type 2 diabetesliver cirrhosistype 2 diabetes mellitusalcoholic cirrhosisCirrhosisalcohol
Journal Article 2017-06-13 ✓ 1 Snippet Hsieh PH, Huang JY, Nfor ON, Lung CC, Ho CC, Liaw YP.
In-Text Gene Mentions

…, 36 ],hemochromatosis[ 37 ],…

Show Full Abstract

<h4>Background</h4>The link between the subcategories of liver cirrhosis and type 2 diabetes is not well known. We investigated the association of type 2 diabetes mellitus with alcoholic cirrhosis and cirrhosis without alcohol.<h4>Methods</h4>This nationwide cohort study used the Taiwan National Health Insurance Research Database. Cirrhotic individuals and their matched controls were identified from 2001-2008. In all, 9 313 cirrhotic patients aged 20 years or older were matched by age, sex, and index date with the non-cirrhotic individuals (<i>n</i> = 37 252). Cirrhosis was categorized into alcoholic cirrhosis and cirrhosis without alcohol. Type 2 diabetes mellitus was identified from January 2001- December 2011.<h4>Results</h4>The incidence densities (per 1 000 person-months) of type 2 diabetes were as follows: 1.14 (95% CI: 1.09-1.20) in the non-cirrhotic group, 1.88 (CI 1.76-2.01) in patients with cirrhosis, 1.62 (CI 1.48-1.78) in patients with cirrhosis without alcohol, and 2.92 (CI 2.64-3.23) in patients with alcoholic cirrhosis. The adjusted hazards ratio (aHR) for type 2 diabetes mellitus among cirrhotic individuals was 0.774 (CI: 0.715-0.8934). Alcoholic cirrhotic men had a significantly higher risk of type 2 diabetes (aHR 1.182, CI: 1.046-1.335) compared with non-cirrhotic individuals. Increased risks were seen in men (aHR 1.690; CI: 1.455-1.963) and women (aHR 1.715; CI: 1.113-2.645) with alcoholic cirrhosis compared to those with cirrhosis without alcohol.<h4>Conclusions</h4>This study indicates that alcoholic cirrhosis is a significant risk factor for type 2 diabetes mellitus compared with cirrhosis without alcohol.

Also flagged:nanoparticlefolic acidbreast cancerfolic acid receptorstumorcation
Journal Article 2017-06-13 No Snippets Chen H, Wang F, Moore T, Qi B, Sulejmanovic D, Hwu SJ, Mefford OT, Alexis F, Anker JN.
Show Full Abstract

Nanophosphors are promising contrast agents for deep tissue optical imaging applications because they can be excited by X-ray and near infrared light that penetrates deeply through tissue and generates almost no autofluorescence background in the tissue. For these bioimaging applications, the nanophosophors should ideally be small, monodispersed and brightly luminescent. However, most methods used to improve luminescence yield by annealing the particles to reduce crystal and surface defects (e.g. using flux or sintering agents) also cause particle fusion or require multiple component core-shell structures. Here, we report a novel method to prepare bright, uniformly sized X-ray nanophosphors (Gd<sub>2</sub>O<sub>2</sub>S:Eu or Tb) and upconversion nanophosphors (Y<sub>2</sub>O<sub>2</sub>S: Yb/Er, or Yb/Tm) with large crystal domain size without causing aggregation. A core-shell nanoparticle is formed, with NaF only in the core. We observe that increasing the NaF sintering agent concentration up to 7.6 mol% increases both crystal domain size and luminescence intensity (up to 40% of commercial microphosphors) without affecting the physical particticle diameter. Above 7.6 mol%, particle fusion is observed. The annealing is insensitive to the cation (Na<sup>+</sup> or K<sup>+</sup>) but varies strongly with anion, with F<sup>-</sup>>Cl<sup>-</sup>>CO<sub>3</sub><sup>2-</sup>>Br<sup>-</sup>>I<sup>-</sup>. The luminescence depends strongly on crystal domain size. The data agree reasonably well with a simple domain surface quenching model, although the size-dependence suggests additional quenching mechanisms within small domains. The prepared bright nanophosphors were subsequently functionalized with PEG-folic acid to target MCF-7 breast cancer cells which overexpress folic acid receptors. Both X-ray and upconversion nanophosphors provided low background and bright luminescence which was imaged through 1 cm chicken breast tissue at a low dose of nanophosphors 200 µL (0.1 mg/mL). We anticipate these highly monodispersed and bright X-ray and upconversion nanophosphors will have significant potential for tumor targeted imaging.

Also flagged:NucleophosminOxidative Stress HomeostasisoxygencancerNPMcancers
Journal Article 2017-06-12 ✓ 5 Snippets Liu GY, Shi JX, Shi SL, Liu F, Rui G, Li X, Gao LB, Deng XL, Li QF.
In-Text Gene Mentions

These observations demonstrated that the expression and localization of NPM affected the homeostatic balance of oxidative stress in tumor cells via PRDX6 protein.

…Homeostasis via AntioxidantPRDX6.…

…of peroxiredoxin 6 (PRDX6), a member of…

…of NPM upregulatedPRDX6, and decreased ROS.…

…PRDX1, PRDX4, andPRDX6.…

Show Full Abstract

Reactive oxygen species (ROS) play both deleterious and beneficial roles in cancer cells. Nucleophosmin (NPM) is heavily implicated in cancers of diverse origins, being its gene over-expression in solid tumors or frequent mutations in hematological malignancies. However, the role and regulatory mechanism of NPM in oxidative stress are unclear. Here, we found that NPM regulated the expression of peroxiredoxin 6 (PRDX6), a member of thiol-specific antioxidant protein family, consequently affected the level and distribution of ROS. Our data indicated that NPM knockdown caused the increase of ROS and its relocation from cytoplasm to nucleoplasm. In contrast, overexpression or cytoplasmic localization of NPM upregulated PRDX6, and decreased ROS. In addition, NPM knockdown decreased peroxiredoxin family proteins, including PRDX1, PRDX4, and PRDX6. Co-immunoprecipitation further confirmed the interaction between PRDX6 and NPM. Moreover, NSC348884, an inhibitor specifically targeting NPM oligomerization, decreased PRDX6 and significantly upregulated ROS. These observations demonstrated that the expression and localization of NPM affected the homeostatic balance of oxidative stress in tumor cells via PRDX6 protein. The regulation axis of NPM/PRDX/ROS may provide a novel therapeutic target for cancer treatment. J. Cell. Biochem. 118: 4697-4707, 2017. © 2017 Wiley Periodicals, Inc.

Also flagged:Chlorpyrifosmembraneorganellescholinergic enzymeacetylcholinesteraseAChE
Journal Article 2017-06-12 ✓ 1 Snippet Gao J, Naughton SX, Beck WD, Hernandez CM, Wu G, Wei Z, Yang X, Bartlett MG, Terry AV.
In-Text Gene Mentions

htt

Show Full Abstract

Chlorpyrifos (CPF) is an extensively used organophosphorus pesticide that has recently come under increasing scrutiny due to environmental health concerns particularly its association with neurodevelopmental defects. While the insecticidal actions and acute toxicity of CPF are attributed to its oxon metabolite (CPO) which potently inhibits the cholinergic enzyme acetylcholinesterase (AChE), there is significant evidence that CPF, CPO, and other organophosphates may affect a variety of neuronal targets and processes that are not directly related to AChE. Previously, in adult rat sciatic nerves ex vivo and postnatal neurons from rats in vitro we observed that CPF and CPO impaired the movements of vesicles and mitochondria in axons. Here, in embryonic neurons from rats in culture, we evaluated 24h exposures to CPF and CPO across picomolar to micromolar concentrations for effects on fast axonal transport of membrane bound organelles (MBOs) that contained the amyloid precursor protein (APP) tagged with the fluorescent marker, Dendra2 (APPDendra2). The most notable observations of this study were concentration-dependent decreases in the velocity and percentage of MBOs moving in the anterograde direction, an increase in the number of stationary MBOs, and an increased frequency of pauses associated with both CPF and CPO. These effects occurred at concentrations that did not significantly inhibit AChE activity, they were not blocked by cholinergic receptor antagonists, and they were not associated with compromised cell viability. These effects of CPF and CPO may be significant given the importance of axonal transport to neuronal development as well the function of fully developed neurons.

Also flagged:lung cancerGene expressionlung adenocarcinomaRNASET2SECISBP2LNRG1
Journal Article 2017-06-12 No Snippets McKay JD, Hung RJ, Han Y, Zong X, Carreras-Torres R, Christiani DC, Caporaso NE, Johansson M, Xiao X, Li Y, Byun J, Dunning A, Pooley KA, Qian DC, Ji X, Liu G, Timofeeva MN, Bojesen SE, Wu X, Le Marchand L, Albanes D, Bickeböller H, Aldrich MC, Bush WS, Tardon A, Rennert G, Teare MD, Field JK, Kiemeney LA, Lazarus P, Haugen A, Lam S, Schabath MB, Andrew AS, Shen H, Hong YC, Yuan JM, Bertazzi PA, Pesatori AC, Ye Y, Diao N, Su L, Zhang R, Brhane Y, Leighl N, Johansen JS, Mellemgaard A, Saliba W, Haiman CA, Wilkens LR, Fernandez-Somoano A, Fernandez-Tardon G, van der Heijden HFM, Kim JH, Dai J, Hu Z, Davies MPA, Marcus MW, Brunnström H, Manjer J, Melander O, Muller DC, Overvad K, Trichopoulou A, Tumino R, Doherty JA, Barnett MP, Chen C, Goodman GE, Cox A, Taylor F, Woll P, Brüske I, Wichmann HE, Manz J, Muley TR, Risch A, Rosenberger A, Grankvist K, Johansson M, Shepherd FA, Tsao MS, Arnold SM, Haura EB, Bolca C, Holcatova I, Janout V, Kontic M, Lissowska J, Mukeria A, Ognjanovic S, Orlowski TM, Scelo G, Swiatkowska B, Zaridze D, Bakke P, Skaug V, Zienolddiny S, Duell EJ, Butler LM, Koh WP, Gao YT, Houlston RS, McLaughlin J, Stevens VL, Joubert P, Lamontagne M, Nickle DC, Obeidat M, Timens W, Zhu B, Song L, Kachuri L, Artigas MS, Tobin MD, Wain LV, SpiroMeta Consortium, Rafnar T, Thorgeirsson TE, Reginsson GW, Stefansson K, Hancock DB, Bierut LJ, Spitz MR, Gaddis NC, Lutz SM, Gu F, Johnson EO, Kamal A, Pikielny C, Zhu D, Lindströem S, Jiang X, Tyndale RF, Chenevix-Trench G, Beesley J, Bossé Y, Chanock S, Brennan P, Landi MT, Amos CI.
Show Full Abstract

Although several lung cancer susceptibility loci have been identified, much of the heritability for lung cancer remains unexplained. Here 14,803 cases and 12,262 controls of European descent were genotyped on the OncoArray and combined with existing data for an aggregated genome-wide association study (GWAS) analysis of lung cancer in 29,266 cases and 56,450 controls. We identified 18 susceptibility loci achieving genome-wide significance, including 10 new loci. The new loci highlight the striking heterogeneity in genetic susceptibility across the histological subtypes of lung cancer, with four loci associated with lung cancer overall and six loci associated with lung adenocarcinoma. Gene expression quantitative trait locus (eQTL) analysis in 1,425 normal lung tissue samples highlights RNASET2, SECISBP2L and NRG1 as candidate genes. Other loci include genes such as a cholinergic nicotinic receptor, CHRNA2, and the telomere-related genes OFBC1 and RTEL1. Further exploration of the target genes will continue to provide new insights into the etiology of lung cancer.

Also flagged:peptidesindolicidinconjugationinfectionimmune responseinfections
Journal Article 2017-06-12 No Snippets Pradhan B, Guha D, Murmu KC, Sur A, Ray P, Das D, Aich P.
Show Full Abstract

<h4>Background</h4>Antimicrobial peptides (AMPs) have the potential to serve as an alternative to antibiotic. AMPs usually exert bactericidal activity via direct killing of microbial pathogens. Reports have proposed that by harnessing innate immune activation, AMPs can regulate pathogen invasion and may control infection. It has been reported that AMPs could be utilized to activate the innate mucosal immune response in order to eliminate pathogenic infections. This way of controlling pathogen infection, by activating host immunity, confers the potential to the select AMPs to alleviate the problem of antibiotic resistance. Among various AMPs tested LL-37 and indolicidin, showed promise to be potential candidates for eliciting enhanced host innate immune responses. LL-37 and indolicidin had exhibited substantial innate immune activation in both human and murine macrophages. Dosage for each of the AMPs, however, was high with adverse side effects.<h4>Results</h4>In this study, we reported that upon conjugation with carbon nanotubes (CNT), each AMP remained biologically functional at a concentration that was 1000-fold less than the dosage required for free AMP to remain active in the cells.<h4>Conclusions</h4>Current study also revealed that while indolicidin induced signalling events mediated through the TNFRSF1A pathway in THP1 cells, followed by activation of NFκB and c-JUN pathways, treatment of cells with LL-37 induced signalling events by activating IL1R, with subsequent activation of NFκB and NFAT2. Thp1 cells, primed with CNT conjugated LL-37 or indolicidin, are protected against Salmonella typhimurium infection at 16 h post challenge.

Also flagged:obesityosteoarthritisOAfatty acidssecretionprotein secretion
Journal Article 2017-06-12 No Snippets Medina-Luna D, Santamaría-Olmedo MG, Zamudio-Cuevas Y, Martínez-Flores K, Fernández-Torres J, Martínez-Nava GA, Clavijo-Cornejo D, Hernández-Díaz C, Olivos-Meza A, Gomez-Quiroz LE, Gutiérrez-Ruiz MC, Pineda C, Blanco F, Reginato AM, López-Reyes A.
Show Full Abstract

<h4>Background</h4>Currently, two pathogenic pathways describe the role of obesity in osteoarthritis (OA); one through biomechanical stress, and the other by the contribution of systemic inflammation. The aim of this study was to evaluate the effect of free fatty acids (FFA) in human chondrocytes (HC) expression of proinflammatory factors and reactive oxygen species (ROS).<h4>Methods</h4>HC were exposed to two different concentrations of FFA in order to evaluate the secretion of adipokines through cytokines immunoassays panel, quantify the protein secretion of FFA-treated chondrocytes, and fluorescent cytometry assays were performed to evaluate the reactive oxygen species (ROS) production.<h4>Results</h4>HC injury was observed at 48 h of treatment with FFA. In the FFA-treated HC the production of reactive oxygen species such as superoxide radical, hydrogen peroxide<sub>,</sub> and the reactive nitrogen species increased significantly in a at the two-dose tested (250 and 500 μM). In addition, we found an increase in the cytokine secretion of IL-6 and chemokine IL-8 in FFA-treated HC in comparison to the untreated HC.<h4>Conclusion</h4>In our in vitro model of HC, a hyperlipidemia microenvironment induces an oxidative stress state that enhances the inflammatory process mediated by adipokines secretion in HC.

Also flagged:Colicin E7 DNaseImmunity protein 7bindingDNasemembraneRNA-binding proteins
Journal Article 2017-06-12 ✓ 2 Snippets Vassylyeva MN, Klyuyev S, Vassylyev AD, Wesson H, Zhang Z, Renfrow MB, Wang H, Higgins NP, Chow LT, Vassylyev DG.
In-Text Gene Mentions

Condensin

Condensins

Show Full Abstract

Protein purification is an essential primary step in numerous biological studies. It is particularly significant for the rapidly emerging high-throughput fields, such as proteomics, interactomics, and drug discovery. Moreover, purifications for structural and industrial applications should meet the requirement of high yield, high purity, and high activity (HHH). It is, therefore, highly desirable to have an efficient purification system with a potential to meet the HHH benchmark in a single step. Here, we report a chromatographic technology based on the ultra-high-affinity (<i>K</i><sub>d</sub> ∼ 10<sup>-14</sup>-10<sup>-17</sup> M) complex between the Colicin E7 DNase (CE7) and its inhibitor, Immunity protein 7 (Im7). For this application, we mutated CE7 to create a CL7 tag, which retained the full binding affinity to Im7 but was inactivated as a DNase. To achieve high capacity, we developed a protocol for a large-scale production and highly specific immobilization of Im7 to a solid support. We demonstrated its utility with one-step HHH purification of a wide range of traditionally challenging biological molecules, including eukaryotic, membrane, toxic, and multisubunit DNA/RNA-binding proteins. The system is simple, reusable, and also applicable to pulldown and kinetic activity/binding assays.

Also flagged:replication stress response proteinETAA1lymphocyticinfectionTP53phosphorylation
Journal Article 2017-06-12 No Snippets Miosge LA, Sontani Y, Chuah A, Horikawa K, Russell TA, Mei Y, Wagle MV, Howard DR, Enders A, Tscharke DC, Goodnow CC, Parish IA.
Show Full Abstract

T-cell immunity requires extremely rapid clonal proliferation of rare, antigen-specific T lymphocytes to form effector cells. Here we identify a critical role for ETAA1 in this process by surveying random germ line mutations in mice using exome sequencing and bioinformatic annotation to prioritize mutations in genes of unknown function with potential effects on the immune system, followed by breeding to homozygosity and testing for immune system phenotypes. Effector CD8<sup>+</sup> and CD4<sup>+</sup> T-cell formation following immunization, lymphocytic choriomeningitis virus (LCMV) infection, or herpes simplex virus 1 (HSV1) infection was profoundly decreased despite normal immune cell development in adult mice homozygous for two different <i>Etaa1</i> mutations: an exon 2 skipping allele that deletes Gly78-Leu119, and a Cys166Stop truncating allele that eliminates most of the 877-aa protein. ETAA1 deficiency decreased clonal expansion cell autonomously within the responding T cells, causing no decrease in their division rate but increasing TP53-induced mRNAs and phosphorylation of H2AX, a marker of DNA replication stress induced by the ATM and ATR kinases. Homozygous ETAA1-deficient adult mice were otherwise normal, healthy, and fertile, although slightly smaller, and homozygotes were born at lower frequency than expected, consistent with partial lethality after embryonic day 12. Taken together with recently reported evidence in human cancer cell lines that ETAA1 activates ATR kinase through an exon 2-encoded domain, these findings reveal a surprisingly specific requirement for this ATR activator in adult mice restricted to rapidly dividing effector T cells. This specific requirement may provide new ways to suppress pathological T-cell responses in transplantation or autoimmunity.

Also flagged:TGF-β1GARPTGF-βcytokinemembrane proteinisotype switching
Journal Article 2017-06-12 ✓ 1 Snippet Dedobbeleer O, Stockis J, van der Woning B, Coulie PG, Lucas S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Production of active TGF-β is regulated at a posttranslational level and implies release of the mature cytokine dimer from the inactive, latent TGF-β precursor. There are several cell-type specific mechanisms of TGF-β activation. We identified a new mechanism operating on the surface of human regulatory T cells and involving membrane protein GARP, which binds latent TGF-β1. The paracrine activity of regulatory T cell-derived TGF-β1 contributes to immunosuppression and can be inhibited with anti-GARP Abs. Whether other immune cell types use surface GARP to activate latent TGF-β1 was not known. We show in this study that stimulated, human B lymphocytes produce active TGF-β1 from surface GARP/latent TGF-β1 complexes with isotype switching to IgA production.

Also flagged:otitispneumoniameningitispneumococcal diseaseantibodiesinfluenza
Journal Article 2017-06-12 ✓ 1 Snippet Gjini E.
In-Text Gene Mentions

…Concerning the entry rate μ, I considered the mean duration of DCC attendance per child per setting (Table 1), accounting for the proportions in different age groups and the maximal age of daycare attendees.…

Show Full Abstract

Although mean efficacy of multivalent pneumococcus vaccines has been intensively studied, variance in vaccine efficacy (VE) has been overlooked. Different net individual protection across settings can be driven by environmental conditions, local serotype and clonal composition, as well as by socio-demographic and genetic host factors. Understanding efficacy variation has implications for population-level effectiveness and other eco-evolutionary feedbacks. Here I show that realized VE can vary across epidemiological settings, by applying a multi-site-one-model approach to data post-vaccination. I analyse serotype prevalence dynamics following PCV7, in asymptomatic carriage in children attending day care in Portugal, Norway, France, Greece, Hungary and Hong-Kong. Model fitting to each dataset provides site-specific estimates for vaccine efficacy against acquisition, and pneumococcal transmission parameters. According to this model, variable serotype replacement across sites can be explained through variable PCV7 efficacy, ranging from 40% in Norway to 10% in Hong-Kong. While the details of how this effect is achieved remain to be determined, here I report three factors negatively associated with the VE readout, including initial prevalence of serotype 19F, daily mean temperature, and the Gini index. The study warrants more attention on local modulators of vaccine performance and calls for predictive frameworks within and across populations.

Also flagged:Hydroxybenzyl alcoholcerebral arteryPARP-1NADPH oxidaseischemic brain damageAlcohol
Journal Article 2017-06-12 ✓ 1 Snippet Luo L, Kim SW, Lee HK, Kim ID, Lee H, Lee JK.
In-Text Gene Mentions

Prdx6

Show Full Abstract

4-Hydroxybenzyl alcohol (4-HBA) is an important phenolic constituent of Gastrodia elata (GE) Blume, which is used as a traditional herbal medicine in East Asia. Many activities have been reported to underlie the beneficial effects of 4-HBA in brain, such as, anti-oxidative, anti-inflammatory, anti-excitotoxic, and anti-apoptotic effects in neurons and microglia. Here, the authors demonstrate the robust neuroprotective effects of 4-HBA in rat middle cerebral artery occlusion (MCAO) model of stroke, and showed anti-Zn<sup>2+</sup> toxicity in neurons and astrocytes as a molecular mechanism contributing to these effects. Intraperitoneal administration of 4-HBA (20 mg/kg) in Sprague-Dawley rats 1 h after MCAO reduced infarct volumes to 27.1 ± 9.2% of that of MCAO controls and significantly ameliorated motor impairments and neurological deficits. Significant suppressions of Zn<sup>2+</sup>-induced cell death, ROS generation, and PARP-1 induction by 4-HBA were observed in primary cortical cultures. 4-HBA also protected astrocytes from Zn<sup>2+</sup>-induced toxicity and suppressing ROS generation by employing slightly different molecular mechanisms, i.e., suppressing PARP-1 induction and NAD depletion under acute Zn<sup>2+</sup>-treatment and suppressing p67 NADPH oxidase subunit induction under chronic Zn<sup>2+</sup>-treatment. Results indicate that the protective effects of 4-HBA against Zn<sup>2+</sup>-toxicity in neurons and astrocytes contribute to its robust neuroprotective effects in the postischemic brain. Considering the pleiotropic effects of 4-HBA, which have been reported in previous reports and added in the present study, it has therapeutic potential for the amelioration of ischemic brain damage.

Also flagged:HSPB8dipeptidesAmyotrophic lateral sclerosisALSfrontotemporal dementianeurodegenerative diseases
Journal Article 2017-06-12 ✓ 2 Snippets Cristofani R, Crippa V, Vezzoli G, Rusmini P, Galbiati M, Cicardi ME, Meroni M, Ferrari V, Tedesco B, Piccolella M, Messi E, Carra S, Poletti A.
In-Text Gene Mentions

Examples include mutant SOD1 linked to some fALS (Crippa et al. 2010b); polyglutamine (polyQ) containing proteins like androgen receptor (ARpolyQ) and huntingtin (HTT) (Carra et al. 2008a; Giorgetti et al. 2015; Rusmini et al. 2013), causing spinal and bulbar muscular atrophy (SBMA) and Huntington’s disease (HD), respectively; beta-amyloid (A-beta) linked to Alzheimer disease (AD) (Wilhelmus et al. 2006); alpha-synuclein (alpha-syn) causing Parkinson’s disease (PD) (Bruinsma et al. 2011); and other misfolded proteins such as mutated HSPB5 causing neuropathy (Arndt et al. 2010; Chavez Zobel et al. 2003; Sanbe et al. 2009; Vicart et al. 1998).

…(ARpolyQ) and huntingtin (HTT) (Carra et al.…

Show Full Abstract

Amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are two neurodegenerative diseases in which similar pathogenic mechanisms are involved. Both diseases associate to the high propensity of specific misfolded proteins, like TDP-43 or FUS, to mislocalize and aggregate. This is partly due to their intrinsic biophysical properties and partly as a consequence of failure of the neuronal protein quality control (PQC) system. Several familial ALS/FTD cases are linked to an expansion of a repeated G4C2 hexanucleotide sequence present in the C9ORF72 gene. The G4C2, which localizes in an untranslated region of the C9ORF72 transcript, drives an unconventional repeat-associated ATG-independent translation. This leads to the synthesis of five different dipeptide repeat proteins (DPRs), which are not "classical" misfolded proteins, but generate aberrant aggregation-prone unfolded conformations poorly removed by the PQC system. The DPRs accumulate into p62/SQSTM1 and ubiquitin positive inclusions. Here, we analyzed the biochemical behavior of the five DPRs in immortalized motoneurons. Our data suggest that while the DPRs are mainly processed via autophagy, this system is unable to fully clear their aggregated forms, and thus they tend to accumulate in basal conditions. Overexpression of the small heat shock protein B8 (HSPB8), which facilitates the autophagy-mediated disposal of a large variety of classical misfolded aggregation-prone proteins, significantly decreased the accumulation of most DPR insoluble species. Thus, the induction of HSPB8 might represent a valid approach to decrease DPR-mediated toxicity and maintain motoneuron viability.

Also flagged:TumormethylationSALL3GAPDHMSPMUP
Journal Article 2017-06-12 ✓ 2 Snippets Misawa K, Mochizuki D, Imai A, Misawa Y, Endo S, Mima M, Kawasaki H, Carey TE, Kanazawa T.
In-Text Gene Mentions

DCC

…colorectal cancer (DCC), galanin receptor…

Show Full Abstract

<h4>Background</h4>This study examined <i>Sal-like protein</i> (<i>SALL)3</i> methylation profiles of head and neck cancer (HNSCC) patients at diagnosis and follow-up and evaluated their prognostic significance and value as a biomarker. <i>SALL3</i> expression was examined in a panel of cell lines by quantitative reverse transcription polymerase chain reaction (RT-PCR). The methylation status of the <i>SALL3</i> promoter was examined by quantitative methylation-specific PCR.<h4>Results</h4><i>SALL3</i> promoter methylation was associated with transcriptional inhibition and was correlated with disease recurrence in 64.8% of cases, with an odds ratio of 1.914 (95% confidence interval: 1.157-3.164; <i>P</i> = 0.011) by multivariate Cox proportional hazard regression analysis. <i>SALL3</i> promoter hypermethylation showed highly discriminatory receiver operator characteristic curve profiles that clearly distinguished HNSCC from adjacent normal mucosal tissue, and was correlated with reduced disease-free survival (DFS) (log-rank test, <i>P</i> = 0.01). Hypermethylation of tumor-related genes was higher among patients with <i>SALL3</i> methylation than among those without methylation (<i>P</i> < 0.001). Furthermore, <i>SALL3</i> hypermethylation was associated with expression of <i>TET1</i>, <i>TET2</i>, and <i>DNMT3A</i> genes.<h4>Conclusions</h4>This study suggests that CpG hypermethylation is a likely mechanism of <i>SALL3</i> gene inactivation, supporting the hypothesis that the <i>SALL3</i> gene may play a role in the tumorigenesis of HNSCC and may serve as an important biomarker.

Also flagged:Asthmachronic diseasewatercorticosteroidsLung diseaseCardiovascular disease
Journal Article 2017-06-12 No Snippets Phipatanakul W, Koutrakis P, Coull BA, Kang CM, Wolfson JM, Ferguson ST, Petty CR, Samnaliev M, Cunningham A, Sheehan WJ, Gaffin JM, Baxi SN, Lai PS, Permaul P, Liang L, Thorne PS, Adamkiewicz G, Brennan KJ, Baccarelli AA, Gold DR.
Show Full Abstract

Asthma is the most common chronic disease of childhood in the United States, causes significant morbidity, particularly in the inner-city, and accounts for billions of dollars in health care utilization. Home environments are established sources of exposure that exacerbate symptoms and home-based interventions are effective. However, elementary school children spend 7 to 12h a day in school, primarily in one classroom. From the observational School Inner-City Asthma Study we learned that student classroom-specific exposures are associated with worsening asthma symptoms and decline in lung function. We now embark on a randomized, blinded, sham-controlled school environmental intervention trial, built on our extensively established school/community partnerships, to determine the efficacy of a school-based intervention to improve asthma control. This factorial school/classroom based environmental intervention will plan to enroll 300 students with asthma from multiple classrooms in 40 northeastern inner-city elementary schools. Schools will be randomized to receive either integrated pest management versus control and classrooms within these schools to receive either air purifiers or sham control. The primary outcome is asthma symptoms during the school year. This study is an unprecedented opportunity to test whether a community of children can benefit from school or classroom environmental interventions. If effective, this will have great impact as an efficient, cost-effective intervention for inner city children with asthma and may have broad public policy implications.

Also flagged:head and neck squamous cell carcinomaHNSCCoropharyngeal squamous cell carcinomahead and neck cancermalignant neoplasmsSquamous cell carcinoma
Journal Article 2017-06-12 No Snippets Faraji F, Zaidi M, Fakhry C, Gaykalova DA.
Show Full Abstract

This review examines the general cellular and molecular underpinnings of human papillomavirus (HPV)-related carcinogenesis in the context of head and neck squamous cell carcinoma (HNSCC) and focuses on HPV-positive oropharyngeal squamous cell carcinoma in areas for which specific data is available. It covers the major pathways dysregulated in HPV-positive HNSCC and the genome-wide changes associated with this disease.

Also flagged:Glycyrrhetinic acidsilicahepatocellular carcinomatumorsynthesisCurcumin
Journal Article 2017-06-12 No Snippets Lv Y, Li J, Chen H, Bai Y, Zhang L.
Show Full Abstract

In this study, a glycyrrhetinic acid-functionalized mesoporous silica nanoparticle (MSN-GA) was prepared for active tumor targeting. MSN-GA exhibited satisfactory loading capacity for insoluble drugs, uniform size distribution, and specific tumor cell targeting. Glycyrrhetinic acid, a hepatocellular carcinoma-targeting group, was covalently decorated on the surface of MSN via an amido bond. The successful synthesis of MSN-GA was validated by the results of Fourier transform infrared spectroscopy, transmission electron microscopy (TEM), and zeta potential measurement. TEM images revealed the spherical morphology and uniform size distribution of the naked MSN and MSN-GA. Curcumin (CUR), an insoluble model drug, was loaded into MSN-GA (denoted as MSN-GA-CUR) with a high-loading capacity (8.78%±1.24%). The results of the in vitro cellular experiment demonstrated that MSN-GA-CUR significantly enhanced cytotoxicity and cellular uptake toward hepatocellular carcinoma (HepG2) cells via a specific GA receptor-mediated endocytosis mechanism. The results of this study provide a promising nanoplatform for the targeting of hepatocellular carcinoma.

Also flagged:Alkyl ProtocatechuateLipidDodecyl protocatechuateprotocatechuic acidacidextracellular artificial matrix proteins
Journal Article 2017-06-12 No Snippets Medina-Alarcón KP, Singulani JL, Voltan AR, Sardi JCO, Petrônio MS, Santos MB, Polaquini CR, Regasini LO, Bolzani VS, da Silva DHS, Chorilli M, Mendes-Giannini MJS, Fusco-Almeida AM.
Show Full Abstract

Dodecyl protocatechuate (dodecyl) is a derivative of protocatechuic acid (3,4-dihydroxybenzoic acid) that possesses anti-oxidant and antifungal properties. Nanostructured lipid systems (NLS) can potentiate the action of many antifungal agents, reducing the required dose and side effects by improving their activity. This work aimed to evaluate dodecyl protocatechuate loaded into a NLS (NLS+dodecyl) as a strategy for the treatment of <i>Paracoccidioides brasiliensis</i> and <i>P. lutzii in vitro.</i> Antifungal activity against <i>P. brasiliensis</i> and <i>P. lutzii</i> was evaluated using the microdilution technique. NLS+dodecyl showed high antifungal activity with a minimum inhibitory concentration ranging from 0.06 to 0.03 μg/mL; 4- to 16-fold higher than that of free dodecyl. NLS+dodecyl was able to inhibit fungal adhesion of the extracellular artificial matrix proteins (laminin and fibronectin), resulting in 82.4 and 81% inhibition, respectively, an increase of 8-17% compared with free dodecyl. These findings corroborate previous results demonstrating 65 and 74% inhibition of fungal adhesion in pulmonary fibroblast cells by dodecyl and NLS+dodecyl, respectively, representing a 9% increase in inhibition for NLS+dodecyl. Subsequently, cytotoxicity was evaluated using the 0.4% sulforhodamine B assay. NLS+dodecyl did not exhibit cytotoxicity in MRC5 (human pneumocyte) and HepG2 (human hepatic carcinoma) cells, thus increasing the selectivity index for NLS+dodecyl. In addition, cytotoxicity was evaluated <i>in vivo</i> using the <i>Caenorhabditis elegans</i> model; neither dodecyl nor NLS+dodecyl exhibited any toxic effects. Taken together, these results suggest that NLS can be used as a strategy to improve the activity of dodecyl against <i>P. brasiliensis</i> and <i>P. lutzii</i> because it improves antifungal activity, increases the inhibition of fungal adhesion in lung cells and the extracellular matrix <i>in vitro</i>, and does not exhibit any toxicity both <i>in vitro</i> and <i>in vivo</i>.

Also flagged:tumorstumorThyroid transcription factor‐1KRASMKL 2lung adenocarcinoma
Journal Article 2017-06-10 ✓ 1 Snippet Griesing S, Kajino T, Tai MC, Liu Z, Nakatochi M, Shimada Y, Suzuki M, Takahashi T.
In-Text Gene Mentions

…unrelated genomic regions,TAOK3and CDH10 ,…

Show Full Abstract

Thyroid transcription factor-1 (TTF-1), also known as NKX2-1, plays a role as a lineage-survival oncogene in lung adenocarcinoma that possesses double-edged sword characteristics. Although evidence from previous studies has steadily accumulated regarding the roles of TTF-1 in transcriptional regulation of protein-coding genes, little is known about its regulatory relationship with microRNAs. Here, we utilized an integrative approach designed to extract maximal information from expression profiles of both patient tumors in vivo and TTF-1-inducible cell lines in vitro, which identified microRNA (miR)-532-5p as a novel transcriptional target of TTF-1. We found that miR-532-5p is directly regulated by TTF-1 through its binding to a genomic region located 8 kb upstream of miR-532-5p, which appears to impose transcriptional regulation independent of that of CLCN5, a protein-coding gene harboring miR-532-5p in its intron 3. Furthermore, our results identified KRAS and MKL2 as novel direct targets of miR-532-5p. Introduction of miR-532-5p mimics markedly induced apoptosis in KRAS-mutant as well as KRAS wild-type lung adenocarcinoma cell lines. Interestingly, miR-532-5p showed effects on MEK-ERK pathway signaling, specifically in cell lines sensitive to siKRAS treatment, whereas those miR-532-5p-mediated effects were clearly rendered as phenocopies by repressing expression or inhibiting the function of MKL2 regardless of KRAS mutation status. In summary, our findings show that miR-532-5p is a novel transcriptional target of TTF-1 that plays a tumor suppressive role by targeting KRAS and MKL2 in lung adenocarcinoma.

Also flagged:Fluoxetinemalformationscardiovascular malformationsseptal defectsdefectshypertension
Journal Article 2017-06-10 No Snippets Gao SY, Wu QJ, Zhang TN, Shen ZQ, Liu CX, Xu X, Ji C, Zhao YH.
Show Full Abstract

<h4>Aims</h4>To investigate the safety of fluoxetine use during pregnancy, and to better understand the relationship between maternal fluoxetine use during the first trimester and congenital malformations in infants.<h4>Methods</h4>PubMed and Web of Science databases were systematically searched from inception to 21 March 2016. Additional studies were identified in a manual search of the reference lists. Two reviewers independently extracted data. A third reviewer checked the data. Estimates were pooled using a random-effects model to calculate the summarized relative ratios (RR) and 95% confidence intervals (CI).<h4>Results</h4>Among 1918 initially identified articles, 16 cohort studies were included. The offspring of pregnant women exposed to fluoxetine during the first trimester had a statistically increased risk of major malformations (RR = 1.18, 95% CI = 1.08-1.29), cardiovascular malformations (RR = 1.36, 95% CI = 1.17-1.59), septal defects (RR = 1.38, 95% CI = 1.19-1.61), and non-septal defects (RR = 1.39, 95% CI = 1.12-1.73) with low heterogeneity in infants. There were no significant observations of other system-specific malformations in the nervous system, eye, urogenital system, digestive system, respiratory system, or musculoskeletal system, respectively. There was no indication of publication bias.<h4>Conclusions</h4>The results of this meta-analysis indicate maternal fluoxetine use is associated with a slightly increased risk of cardiovascular malformations in infants. Health care providers and pregnant women must weigh the risk-benefit potential of these drugs when making decisions about whether to treat with fluoxetine during pregnancy.

Also flagged:organic compoundsbindingchannel proteinswatertrypsinaromatic
Journal Article 2017-06-10 No Snippets Harger M, Li D, Wang Z, Dalby K, Lagardère L, Piquemal JP, Ponder J, Ren P.
Show Full Abstract

The capabilities of the polarizable force fields for alchemical free energy calculations have been limited by the high computational cost and complexity of the underlying potential energy functions. In this work, we present a GPU-based general alchemical free energy simulation platform for polarizable potential AMOEBA. Tinker-OpenMM, the OpenMM implementation of the AMOEBA simulation engine has been modified to enable both absolute and relative alchemical simulations on GPUs, which leads to a ∼200-fold improvement in simulation speed over a single CPU core. We show that free energy values calculated using this platform agree with the results of Tinker simulations for the hydration of organic compounds and binding of host-guest systems within the statistical errors. In addition to absolute binding, we designed a relative alchemical approach for computing relative binding affinities of ligands to the same host, where a special path was applied to avoid numerical instability due to polarization between the different ligands that bind to the same site. This scheme is general and does not require ligands to have similar scaffolds. We show that relative hydration and binding free energy calculated using this approach match those computed from the absolute free energy approach. © 2017 Wiley Periodicals, Inc.

Also flagged:CYP2C19clopidogrelTPMTthiopurinesSLCO1B1simvastatin
Journal Article 2017-06-09 No Snippets Luzum JA, Pakyz RE, Elsey AR, Haidar CE, Peterson JF, Whirl-Carrillo M, Handelman SK, Palmer K, Pulley JM, Beller M, Schildcrout JS, Field JR, Weitzel KW, Cooper-DeHoff RM, Cavallari LH, O'Donnell PH, Altman RB, Pereira N, Ratain MJ, Roden DM, Embi PJ, Sadee W, Klein TE, Johnson JA, Relling MV, Wang L, Weinshilboum RM, Shuldiner AR, Freimuth RR, Pharmacogenomics Research Network Translational Pharmacogenetics Program.
Show Full Abstract

Numerous pharmacogenetic clinical guidelines and recommendations have been published, but barriers have hindered the clinical implementation of pharmacogenetics. The Translational Pharmacogenetics Program (TPP) of the National Institutes of Health (NIH) Pharmacogenomics Research Network was established in 2011 to catalog and contribute to the development of pharmacogenetic implementations at eight US healthcare systems, with the goal to disseminate real-world solutions for the barriers to clinical pharmacogenetic implementation. The TPP collected and normalized pharmacogenetic implementation metrics through June 2015, including gene-drug pairs implemented, interpretations of alleles and diplotypes, numbers of tests performed and actionable results, and workflow diagrams. TPP participant institutions developed diverse solutions to overcome many barriers, but the use of Clinical Pharmacogenetics Implementation Consortium (CPIC) guidelines provided some consistency among the institutions. The TPP also collected some pharmacogenetic implementation outcomes (scientific, educational, financial, and informatics), which may inform healthcare systems seeking to implement their own pharmacogenetic testing programs.

Also flagged:oxygendihydrorhodamine 123123cancerdeoxyfluoro
Journal Article 2017-06-09 No Snippets Gallina ME, Kim TJ, Shelor M, Vasquez J, Mongersun A, Kim M, Tang SKY, Abbyad P, Pratx G.
Show Full Abstract

Radiotracers are widely used to track molecular processes, both in vitro and in vivo, with high sensitivity and specificity. However, most radionuclide detection methods have spatial resolution inadequate for single-cell analysis. A few existing methods can extract single-cell information from radioactive decays, but the stochastic nature of the process precludes high-throughput measurement (and sorting) of single cells. In this work, we introduce a new concept for translating radioactive decays occurring stochastically within radiolabeled single-cells into an integrated, long-lasting fluorescence signal. Single cells are encapsulated in radiofluorogenic droplets containing molecular probes sensitive to byproducts of ionizing radiation (primarily reactive oxygen species, or ROS). Different probes were examined in bulk solutions, and dihydrorhodamine 123 (DHRh 123) was selected as the lead candidate due to its sensitivity and reproducibility. Fluorescence intensity of DHRh 123 in bulk increased at a rate of 54% per Gy of X-ray radiation and 15% per MBq/ml of 2-deoxy-2-[<sup>18</sup>F]-fluoro-d-glucose ([<sup>18</sup>F]FDG). Fluorescence imaging of microfluidic droplets showed the same linear response, but droplets were less sensitive overall than the bulk ROS sensor (detection limit of 3 Gy per droplet). Finally, droplets encapsulating radiolabeled cancer cells allowed, for the first time, the detection of [<sup>18</sup>F]FDG radiotracer uptake in single cells through fluorescence activation. With further improvements, we expect this technology to enable quantitative measurement and selective sorting of single cells based on the uptake of radiolabeled small molecules.

Also flagged:wound healingcancermembranevesiclesantibodyvesicle-associated membrane proteins
Journal Article 2017-06-09 No Snippets Jena BP, Stemmer PM, Wang S, Mao G, Lewis KT, Walz DA.
Show Full Abstract

In the past 50 years, isolated blood platelets have had restricted use in wound healing, cancer therapy, and organ and tissue transplant, to name a few. The major obstacle for its unrestricted use has been, among others, the presence of ultrahigh concentrations of growth factors and the presence of both pro-angiogenic and anti-angiogenic proteins. To overcome this problem requires the isolation and separation of the membrane bound secretory vesicles containing the different factors. In the current study, high-resolution imaging of isolated secretory vesicles from human platelets using atomic force microscopy (AFM) and mass spectrometry enabled characterization of the remaining vesicles size and composition following their immunoseparation. The remaining vesicles obtained following osmotic lysis, when subjected to immunoseparation employing antibody to different vesicle-associated membrane proteins (VAMPs), demonstrate for the first time that VAMP-3-, VAMP-7-, and VAMP-8-specific vesicles each possesses distinct size range and composition. These results provide a window into our understanding of the heterogeneous population of vesicles in human platelets and their stability following both physical manipulation using AFM and osmotic lysis of the platelet. This study further provides a platform for isolation and the detailed characterization of platelet granules, with promise for their future use in therapy. Additionally, results from the study demonstrate that secretory vesicles of different size found in cells reflect their unique and specialized composition and function.

Also flagged:Hepatitis Einfectious diseasesZoonotic InfectionsinfectionsGT3GT4
Journal Article 2017-06-09 No Snippets Berto A, Pham HA, Thao TTN, Vy NHT, Caddy SL, Hiraide R, Tue NT, Goodfellow I, Carrique-Mas JJ, Thwaites GE, Baker S, Boni MF, VIZIONS consortium.
Show Full Abstract

Viral pathogens account for a significant proportion of the burden of emerging infectious diseases in humans. The Wellcome Trust-Vietnamese Initiative on Zoonotic Infections (WT-VIZIONS) is aiming to understand the circulation of viral zoonotic pathogens in animals that pose a potential risk to human health. Evidence suggests that human exposure and infections with hepatitis E virus (HEV) genotypes (GT) 3 and 4 results from zoonotic transmission. Hypothesising that HEV GT3 and GT4 are circulating in the Vietnamese pig population and can be transmitted to humans, we aimed to estimate the seroprevalence of HEV exposure in a population of farmers and the general population. We additionally performed sequence analysis of HEV in pig populations in the same region to address knowledge gaps regarding HEV circulation and to evaluate if pigs were a potential source of HEV exposure. We found a high prevalence of HEV GT3 viral RNA in pigs (19.1% in faecal samples and 8.2% in rectal swabs) and a high HEV seroprevalence in pig farmers (16.0%) and a hospital-attending population (31.7%) in southern Vietnam. The hospital population was recruited as a general-population proxy even though this particular population subgroup may introduce bias. The detection of HEV RNA in pigs indicates that HEV may be a zoonotic disease risk in this location, although a larger sample size is required to infer an association between HEV positivity in pigs and seroprevalence in humans.

Also flagged:NLRC3inflammatory responsescell proliferationdeathtumorPI3K
Journal Article 2017-06-09 ✓ 2 Snippets Karki R, Malireddi RKS, Zhu Q, Kanneganti TD.
In-Text Gene Mentions

…markers BMI1 andOLFM4are upregulated in…

OLFM4

Show Full Abstract

Nucleotide-binding domain, leucine-rich-repeat-containing proteins (NLRs) are intracellular innate immune sensors of pathogen-associated and damage-associated molecular patterns. NLRs regulate diverse biologic processes such as inflammatory responses, cell proliferation and death, and gut microbiota to attenuate tumorigenesis. In a recent publication in Nature, we identified NLRC3 as a negative regulator of PI3K-mTOR signaling and characterized its potential tumor suppressor function. Enterocytes lacking NLRC3 cannot control cellular proliferation because they are unable to suppress activation of PI3K-mTOR signaling pathways. In this Extra-View, we explore possible mechanisms through which NLRC3 regulates cellular proliferation and cell death. Besides interacting with PI3K, NLRC3 associates with TRAF6 and mTOR, confirming our recent finding that NLRC3 negatively regulates the PI3K-mTOR axis. Herein, we show that NLRC3 suppresses c-Myc expression and activation of PI3K-AKT targets FoxO3a and FoxO1 in the colon of Nlrc3<sup>-/-</sup> mice, suggesting that additional signaling pathways contribute to increased cellular proliferation. Moreover, NLRC3 suppresses colorectal tumorigenesis by promoting cellular apoptosis. Genes encoding intestinal stem cell markers BMI1 and OLFM4 are upregulated in the colon of Nlrc3<sup>-/-</sup> mice. Herein, we discuss recent findings and explore mechanisms through which NLRC3 regulates PI3K-mTOR signaling. Our studies highlight the therapeutic potential of modulating NLRC3 to prevent and treat cancer.

Also flagged:CD11bIRF-4CD11cIRF4IL-4OT-II
Journal Article 2017-06-09 ✓ 2 Snippets Mayer JU, Demiri M, Agace WW, MacDonald AS, Svensson-Frej M, Milling SW.
In-Text Gene Mentions

…as Cd80 andTnfsf4, which encodes…

…example, CD80 andTnfsf4, which encodes…

Show Full Abstract

T-helper 2 (Th2) cell responses defend against parasites. Although dendritic cells (DCs) are vital for the induction of T-cell responses, the DC subpopulations that induce Th2 cells in the intestine are unidentified. Here we show that intestinal Th2 responses against Trichuris muris worms and Schistosoma mansoni eggs do not develop in mice with IRF-4-deficient DCs (IRF-4<sup>f/f</sup> CD11c-cre). Adoptive transfer of conventional DCs, in particular CD11b-expressing DCs from the intestine, is sufficient to prime S. mansoni-specific Th2 responses. Surprisingly, transferred IRF-4-deficient DCs also effectively prime S. mansoni-specific Th2 responses. Egg antigens do not induce the expression of IRF-4-related genes. Instead, IRF-4<sup>f/f</sup> CD11c-cre mice have fewer CD11b<sup>+</sup> migrating DCs and fewer DCs carrying parasite antigens to the lymph nodes. Furthermore, CD11b<sup>+</sup>CD103<sup>+</sup> DCs induce Th2 responses in the small intestine, whereas CD11b<sup>+</sup>CD103<sup>-</sup> DCs perform this role in the colon, revealing a specific functional heterogeneity among intestinal DCs in inducing Th2 responses.

Also flagged:hematologic disordersBCRABLtyrosine kinasesolid tumorscancer
Journal Article 2017-06-09 No Snippets Marron JM, Joffe S.
Show Full Abstract

As our technological capacities improve, genomic testing is increasingly integrating into patient care. The field of clinical hematology is no exception. Genomic testing carries great promise, but several ethical issues must be considered whenever such testing is performed. This review addresses these ethical considerations, including issues surrounding informed consent and the uncertainty of the results of genomic testing; the challenge of incidental findings; and possible inequities in access to and benefit from such testing. Genomic testing is likely to transform the practice of both benign and malignant hematology, but clinicians must carefully consider these core ethical issues in order to make the most of this exciting and evolving technology.

Also flagged:malignant pleural mesotheliomacancermetabolismnucleotidestumouroncogenes
Journal Article 2017-06-09 No Snippets De Santi C, Melaiu O, Bonotti A, Cascione L, Di Leva G, Foddis R, Cristaudo A, Lucchi M, Mora M, Truini A, Tironi A, Murer B, Boldorini R, Cipollini M, Gemignani F, Gasparini P, Mutti L, Landi S.
Show Full Abstract

Malignant pleural mesothelioma (MPM) is an aggressive human cancer and miRNAs can play a key role for this disease. In order to broaden the knowledge in this field, the miRNA expression was investigated in a large series of MPM to discover new pathways helpful in diagnosis, prognosis and therapy. We employed nanoString nCounter system for miRNA profiling on 105 MPM samples and 10 healthy pleura. The analysis was followed by the validation of the most significantly deregulated miRNAs by RT-qPCR in an independent sample set. We identified 63 miRNAs deregulated in a statistically significant way. MiR-185, miR-197, and miR-299 were confirmed differentially expressed, after validation study. In addition, the results of the microarray analysis corroborated previous findings concerning miR-15b-5p, miR-126-3p, and miR-145-5p. Kaplan-Meier curves were used to explore the association between miRNA expression and overall survival (OS) and identified a 2-miRNA prognostic signature (Let-7c-5p and miR-151a-5p) related to hypoxia and energy metabolism respectively. In silico analyses with DIANA-microT-CDS highlighted 5 putative targets in common between two miRNAs. With the present work we showed that the pattern of miRNAs expression is highly deregulated in MPM and that a 2-miRNA signature can be a new useful tool for prognosis in MPM.

Also flagged:ESCCCell ProliferationEsophageal squamous cell carcinomacancerscancerCCND1
Journal Article 2017-06-09 ✓ 2 Snippets Jiang L, Zhao Z, Zheng L, Xue L, Zhan Q, Song Y.
In-Text Gene Mentions

Increased miR-16 expression has been reported in 40 ESCC tissues compared with their paired adjacent normal tissues and upregulation of miR-16 in ESCC cells could inhibit cell apoptosis and promote cell growth by regulating the protein expression of SOX6 and RECK [19].

…protein expression ofSOX6and RECK [19]…

Show Full Abstract

Esophageal squamous cell carcinoma (ESCC) is one of the most aggressive cancers in China, but the underlying molecular mechanism of ESCC is still unclear. Involvement of microRNAs has been demonstrated in cancer initiation and progression. Despite the reported function of miR-503 in several human cancers, its detailed anti-oncogenic role and clinical significance in ESCC remain undefined. In this study, we examined miR-503 expression by qPCR and found the downregulation of miR-503 expression in ESCC tissue relative to adjacent normal tissues. Further investigation in the effect of miR-503 on ESCC cell proliferation, migration, and invasion showed that enhanced expression of miR-503 inhibited ESCC aggressive phenotype and overexpression of CCND1 reversed the effect of miR-503-mediated ESCC cell aggressive phenotype. Our study further identified CCND1 as the target gene of miR-503. Thus, miR-503 functions as a tumor suppressor and has an important role in ESCC by targeting CCND1.

Also flagged:Acidmetabolic disordersinfectionscancerexcretionhydroxyapatite
Journal Article 2017-06-09 No Snippets Jaswal AP, Meena VK, Prakash S, Pandey A, Singh B, Mishra AK, Hazari PP.
Show Full Abstract

<h4>Objective</h4>Metastasis of the osseous tissue is one of the frequent and severe aggravations as a result of several neoplastic conditions, such as metabolic disorders, infections, and cancer. The objective of this study was to evaluate the pertinence of [<sup>68</sup>Ga]-trans-1,2-cyclohexyldinitrilo tetramethylene phosphonic acid (CDTMP) as a potential bone imaging agent for positron emission tomography (PET) applications as well as to assess [<sup>188</sup>Re]-CDTMP for bone pain palliation in metastatic skeletal disorders.<h4>Methods</h4><sup>68</sup>Ga complex of CDTMP was prepared at 80°C at pH 3.5, and <sup>188</sup>Re complex of CDTMP was prepared at room temperature. [<sup>68</sup>Ga]-CDTMP complex was investigated as PET tracer while the therapeutic efficacy was assessed for [<sup>188</sup>Re]-CDTMP. Labeling efficiency, biodistribution, myelotoxicity, and imaging studies were carried out for the complexes synthesized. Both PET and MicroPET imaging studies were performed for [<sup>68</sup>Ga]-CDTMP whereas SPECT acquisitions were acquired for [<sup>188</sup>Re]-CDTMP. Data were analyzed semiquantitatively for all the scintigraphic scans obtained.<h4>Results</h4>The radiolabeling efficiency was observed to be >70% for [<sup>68</sup>Ga]-CDTMP. High bone uptake of [<sup>68</sup>Ga]-CDTMP as compared to contralateral tissue was found in PET imaging in Balb/C mice and New Zealand rabbit; the similar result for bone uptake was correlated in the biodistribution study of the compound in BALB/c mice at different time intervals. Biodistribution experiments carried out in mice showed maximum uptake of 6.12 ± 1.22%ID/g at 45 min postinjection. For [<sup>188</sup>Re]-CDTMP, total skeletal uptake was 8.12 ± 1.11%ID/g observed at 1 h postinjection from biodistribution data. High renal uptake confirms renal route of excretion. A good hydroxyapatite binding too was seen for both the complexes. No evidence of destruction or adverse functioning of vital organs was observed for the <sup>188</sup>Re complex.<h4>Conclusion</h4>[<sup>68</sup>Ga]-CDTMP complex can be used as a promising PET bone imaging agent and [<sup>188</sup>Re]-CDTMP as a surrogate moiety for therapeutic application. Owing to the short half-life of <sup>68</sup>Ga (68 min), cyclotron-independent radiopharmacy, fast clearance, and rapid renal excretion as evidenced in preclinical animal models. Very low myelotoxicity and highly selective bone uptake prove the potential of [<sup>188</sup>Re]-CDTMP for therapeutic application.

Also flagged:synthesisnucleotidespenicillin binding proteinnucleotidepenicillinHuntingtin
Journal Article 2017-06-09 ✓ 4 Snippets Jensen PA.
In-Text Gene Mentions

…and the humanHTTgene.…

…human Huntingtin (HTT) gene.…

…TheHTTgene contains a…

…BecauseHTTis expressed in…

Show Full Abstract

No abstract available.

Also flagged:Vitamin CDoxycyclinecancermitochondrialMT-ND3MT-CO2
Journal Article 2017-06-09 No Snippets De Francesco EM, Bonuccelli G, Maggiolini M, Sotgia F, Lisanti MP.
Show Full Abstract

Here, we developed a new synthetic lethal strategy for further optimizing the eradication of cancer stem cells (CSCs). Briefly, we show that chronic treatment with the FDA-approved antibiotic Doxycycline effectively reduces cellular respiration, by targeting mitochondrial protein translation. The expression of four mitochondrial DNA encoded proteins (MT-ND3, MT-CO2, MT-ATP6 and MT-ATP8) is suppressed, by up to 35-fold. This high selection pressure metabolically synchronizes the surviving cancer cell sub-population towards a predominantly glycolytic phenotype, resulting in metabolic inflexibility. We directly validated this Doxycycline-induced glycolytic phenotype, by using metabolic flux analysis and label-free unbiased proteomics. Next, we identified two natural products (Vitamin C and Berberine) and six clinically-approved drugs, for metabolically targeting the Doxycycline-resistant CSC population (Atovaquone, Irinotecan, Sorafenib, Niclosamide, Chloroquine, and Stiripentol). This new combination strategy allows for the more efficacious eradication of CSCs with Doxycycline, and provides a simple pragmatic solution to the possible development of Doxycycline-resistance in cancer cells. In summary, we propose the combined use of i) Doxycycline (Hit-1: targeting mitochondria) and ii) Vitamin C (Hit-2: targeting glycolysis), which represents a new synthetic-lethal metabolic strategy for eradicating CSCs. This type of metabolic Achilles' heel will allow us and others to more effectively "starve" the CSC population.

Also flagged:chromosomalantimicrobial resistanceARmatingLigationInfections
Journal Article 2017-06-09 No Snippets George S, Pankhurst L, Hubbard A, Votintseva A, Stoesser N, Sheppard AE, Mathers A, Norris R, Navickaite I, Eaton C, Iqbal Z, Crook DW, Phan HTT.
Show Full Abstract

This study aimed to assess the feasibility of using the Oxford Nanopore Technologies (ONT) MinION long-read sequencer in reconstructing fully closed plasmid sequences from eight <i>Enterobacteriaceae</i> isolates of six different species with plasmid populations of varying complexity. Species represented were <i>Escherichia coli</i>, <i>Klebsiella pneumoniae</i>, <i>Citrobacter freundii</i>, <i>Enterobacter cloacae, Serratia marcescens</i> and <i>Klebsiella oxytoca</i>, with plasmid populations ranging from 1-11 plasmids with sizes of 2-330 kb. Isolates were sequenced using Illumina (short-read) and ONT's MinION (long-read) platforms, and compared with fully resolved PacBio (long-read) sequence assemblies for the same isolates. We compared the performance of different assembly approaches including SPAdes, plasmidSPAdes, hybridSPAdes, Canu, Canu+Pilon (canuPilon) and npScarf in recovering the plasmid structures of these isolates by comparing with the gold-standard PacBio reference sequences. Overall, canuPilon provided consistently good quality assemblies both in terms of assembly statistics (N50, number of contigs) and assembly accuracy [presence of single nucleotide polymorphisms (SNPs)/indels with respect to the reference sequence]. For plasmid reconstruction, Canu recovered 70 % of the plasmids in complete contigs, and combining three assembly approaches (Canu or canuPilon, hybridSPAdes and plasmidSPAdes) resulted in a total 78 % recovery rate for all the plasmids. The analysis demonstrated the potential of using MinION sequencing technology to resolve important plasmid structures in <i>Enterobacteriaceae</i> species independent of and in conjunction with Illumina sequencing data. A consensus assembly derived from several assembly approaches could present significant benefit in accurately resolving the greatest number of plasmid structures.

Also flagged:Polymercancerdoxorubicinhydrazoneimiquimodbiotin
Journal Article 2017-06-09 No Snippets Wen YH, Lee TY, Fu PC, Lo CL, Chiang YT.
Show Full Abstract

Multifunctional polymer nanoparticles have been developed for cancer treatment because they could be easily designed to target cancer cells and to enhance therapeutic efficacy according to cancer hallmarks. In this study, we synthesized a pH-sensitive polymer, poly(methacrylic acid-<i>co</i>-histidine/doxorubicin/biotin) (HBD) in which doxorubicin (DOX) was conjugated by a hydrazone bond to encapsulate an immunotherapy drug, imiquimod (IMQ), to form dual cancer-targeting and dual drug-loaded nanoparticles. At low pH, polymeric nanoparticles could disrupt and simultaneously release DOX and IMQ. Our experimental results show that the nanoparticles exhibited pH-dependent drug release behavior and had an ability to target cancer cells via biotin and protonated histidine.

Also flagged:mechano growth factor EpeptideaxonalMechano growth factorMGFamino acids
Journal Article 2017-06-08 ✓ 4 Snippets Liu M, Niu X, Zhou G, Jia Z, Li P, Fan Y.
In-Text Gene Mentions

…and its receptorDCCis still unclear.…

…of Netrin-1 andDCCin primary cultured…

…of Netrin-1 andDCCafter nerve injury.…

…ough upregulation of Netrin-1/DCCsignalling in neuronal…

Show Full Abstract

Establishing appropriate synaptic connections and plasticity is a critical need in neuronal regeneration and development. Mechano growth factor (MGF) and its C-terminal E-domain peptide with 24 amino acids, MGF-Ct24E, are potential neuroprotective agents. Our preliminary study indicates that Netrin-1 can guide axonal growth and its expression is sensitive to MGF, but how MGF regulates the expression of Netrin-1 and its receptor DCC is still unclear. Here, we investigate the effect of MGF-Ct24E on the expression of Netrin-1 and DCC in primary cultured cortical neurons in vitro and the adult rat brain in vivo. MTT assay shows that MGF-Ct24E can significantly protect primary cortical neurons against nerve injury. There is a significant increase in axonal elongation after MGF-Ct24E treatment at concentrations of 0.5 and 1.0 μg/ml. Real-time polymerase chain reaction assay indicates that MGF-Ct24E can effectively promote the expression of Netrin-1 and DCC in primary cultured cortical neurons. To identify the certain mechanism of MGF-Ct24E on neuronal guidance and growth, adult rats are subjected to intramuscular injection of MGF-Ct24E after traumatic brain injury. Rats injected with MGF-Ct24E start eating and drinking within 14 days, indicating that MGF-Ct24E can promote rehabilitation. HE staining and immunohistochemistry assays of brain section slices reveal that MGF-Ct24E treatment can significantly inhibit the haemorrhage of traumatic brain injury and promote expression of Netrin-1. Further investigation of protein expression by Western blot assay shows that MGF-Ct24E promotes expression of Netrin-1 and DCC after nerve injury. MGF-Ct24E can effectively improve axonal guidance through upregulation of Netrin-1/DCC signalling in neuronal regeneration. Copyright © 2016 John Wiley & Sons, Ltd.

Also flagged:congestive heart failurecardiomyopathyheart muscle disordershypertrophic cardiomyopathyamino acidpathogenesis
Journal Article 2017-06-08 No Snippets Szabadosova V, Boronova I, Ferenc P, Tothova I, Bernasovska J, Zigova M, Kmec J, Bernasovsky I.
Show Full Abstract

<h4>Background</h4>As the leading cause of congestive heart failure, cardiomyopathy represents a heterogenous group of heart muscle disorders. Despite considerable progress being made in the genetic diagnosis of cardiomyopathy by detection of the mutations in the most prevalent cardiomyopathy genes, the cause remains unsolved in many patients. High-throughput mutation screening in the disease genes for cardiomyopathy is now possible because of using target enrichment followed by next-generation sequencing. The aim of the study was to analyze a panel of genes associated with dilated or hypertrophic cardiomyopathy based on previously published results in order to identify the subjects at risk.<h4>Methods</h4>The method of next-generation sequencing by IlluminaHiSeq 2500 platform was used to detect sequence variants in 16 individuals diagnosed with dilated or hypertrophic cardiomyopathy. Detected variants were filtered and the functional impact of amino acid changes was predicted by computational programs.<h4>Results</h4>DNA samples of the 16 patients were analyzed by whole exome sequencing. We identified six nonsynonymous variants that were shown to be pathogenic in all used prediction softwares: rs3744998 (EPG5), rs11551768 (MGME1), rs148374985 (MURC), rs78461695 (PLEC), rs17158558 (RET) and rs2295190 (SYNE1). Two of the analyzed sequence variants had minor allele frequency (MAF)<0.01: rs148374985 (MURC), rs34580776 (MYBPC3).<h4>Conclusion</h4>Our data support the potential role of the detected variants in pathogenesis of dilated or hypertrophic cardiomyopathy; however, the possibility that these variants might not be true disease-causing variants but are susceptibility alleles that require additional mutations or injury to cause the clinical phenotype of disease must be considered.

Also flagged:gene expressionminoxidilandrogenetic alopeciakeratinILKAkt
Journal Article 2017-06-08 No Snippets Stamatas GN, Wu J, Pappas A, Mirmirani P, McCormick TS, Cooper KD, Consolo M, Schastnaya J, Ozerov IV, Aliper A, Zhavoronkov A.
Show Full Abstract

Androgenetic alopecia is the most common form of hair loss. Minoxidil has been approved for the treatment of hair loss, however its mechanism of action is still not fully clarified. In this study, we aimed to elucidate the effects of 5% minoxidil topical foam on gene expression and activation of signaling pathways in vertex and frontal scalp of men with androgenetic alopecia. We identified regional variations in gene expression and perturbed signaling pathways using in silico Pathway Activation Network Decomposition Analysis (iPANDA) before and after treatment with minoxidil. Vertex and frontal scalp of patients showed a generally similar response to minoxidil. Both scalp regions showed upregulation of genes that encode keratin associated proteins and downregulation of ILK, Akt, and MAPK signaling pathways after minoxidil treatment. Our results provide new insights into the mechanism of action of minoxidil topical foam in men with androgenetic alopecia.

Also flagged:SynthesisPeptidepathogenesismultiple sclerosisMSautoimmune demyelinating disease
Journal Article 2017-06-08 No Snippets Yannakakis MP, Simal C, Tzoupis H, Rodi M, Dargahi N, Prakash M, Mouzaki A, Platts JA, Apostolopoulos V, Tselios TV.
Show Full Abstract

Encephalitogenic T cells are heavily implicated in the pathogenesis of multiple sclerosis (MS), an autoimmune demyelinating disease of the central nervous system. Their stimulation is triggered by the formation of a trimolecular complex between the human leukocyte antigen (HLA), an immunodominant myelin basic protein (MBP) epitope, and the T cell receptor (TCR). We detail herein our studies directed towards the rational design and synthesis of non-peptide mimetic molecules, based on the immunodominant MBP<sub>83-96</sub> epitope that is recognized by the TCR in complex with HLA. We focused our attention on the inhibition of the trimolecular complex formation and consequently the inhibition of proliferation of activated T cells. A structure-based pharmacophore model was generated, in view of the interactions between the TCR and the HLA-MBP<sub>83-96</sub> complex. As a result, new candidate molecules were designed based on lead compounds obtained through the ZINC database. Moreover, semi-empirical and density functional theory methods were applied for the prediction of the binding energy between the proposed non-peptide mimetics and the TCR. We synthesized six molecules that were further evaluated in vitro as TCR antagonists. Analogues <b>15</b> and <b>16</b> were able to inhibit to some extent the stimulation of T cells by the immunodominant MBP<sub>83-99</sub> peptide from immunized mice. Inhibition was followed to a lesser degree by analogues <b>17</b> and <b>18</b> and then by analogue <b>19</b>. These studies show that lead compounds <b>15</b> and <b>16</b> may be used for immunotherapy against MS.

Also flagged:etherWatersynthesisIronestersMagnesium
Journal Article 2017-06-08 No Snippets Sancineto L, Pinto Vargas J, Monti B, Arca M, Lippolis V, Perin G, Lenardao EJ, Santi C.
Show Full Abstract

We describe here an atom efficient procedure to prepare selenol esters in good to excellent yields by reacting [(PhSe)₂Zn] or [(PhSe)₂Zn]TMEDA with acyl chlorides under "on water" conditions. The method is applicable to a series of aromatic and aliphatic acyl chlorides and tolerates the presence of other functionalities in the starting material.

Also flagged:SunS21OximeS11S30Pyriproxyfen
Journal Article 2017-06-08 No Snippets Sun GS, Xu X, Jin SH, Lin L, Zhang JJ.
Show Full Abstract

Based on the structural framework of a pyriproxyfen metabolite, nineteen oxime ester derivatives were synthesized via reaction of the carboxylic acids with 4-(2-(2-pyridinyloxy)ethoxy)benzaldehyde oxime. The corresponding structures were comprehensively characterized by ¹H-nuclear magnetic resonance (NMR), <sup>13</sup>C-NMR, and electrospray ionization high-resolution mass spectrometry (ESI-HRMS). All of the compounds were screened for their insecticidal activities against <i>Plutella xylostella</i> and <i>Myzus persicae</i>, and for their ovicidal activities against <i>Helicoverpa armigera</i> eggs. The results obtained show that most of the oxime ester derivatives displayed moderate to high insecticidal activities and ovicidal activities at a concentration of 600 ug/mL. In particular, the ovicidal activity of compounds <b>5j</b>, <b>5o</b>, <b>5p</b>, <b>5q</b>, and <b>5s</b> was determined to be 100%. Importantly, some of the compounds presented even higher biological activities than the reference compound pyriproxyfen. For example, compound <b>5</b><b>j</b> displayed an insecticidal activity value of 87.5% against <i>Myzus persicae</i>, whereas the activity value of pyriproxyfen was 68.3% at a concentration of 600 ug/mL. Among the synthesized compounds <b>5</b><b>j</b> and <b>5</b><b>s</b> exhibited broad biological activity spectra.

Also flagged:silvercopperbenzenetolueneethylbenzenexylenes
Journal Article 2017-06-08 No Snippets Mosier-Boss PA.
Show Full Abstract

The SERS effect was initially discovered in the 1970s. Early research focused on understanding the phenomenon and increasing enhancement to achieve single molecule detection. From the mid-1980s to early 1990s, research started to move away from obtaining a fundamental understanding of the phenomenon to the exploration of analytical applications. At the same time, significant developments occurred in the field of photonics that led to the advent of inexpensive, robust, compact, field-deployable Raman systems. The 1990s also saw rapid development in nanoscience. This convergence of technologies (photonics and nanoscience) has led to accelerated development of SERS substrates to detect a wide range of chemical and biological analytes. It would be a monumental task to discuss all the different kinds of SERS substrates that have been explored. Likewise, it would be impossible to discuss the use of SERS for both chemical and biological detection. Instead, a review of the most common metallic (Ag, Cu, and Au) SERS substrates for chemical detection only is discussed, as well as SERS substrates that are commercially available. Other issues with SERS for chemical detection have been selectivity, reversibility, and reusability of the substrates. How these issues have been addressed is also discussed in this review.

Also flagged:transcriptional regulatorscell physiologycerebellar degeneration-related 1CDR1bindingsex-determining region Y
Journal Article 2017-06-08 No Snippets Zeng X, Lin W, Guo M, Zou Q.
Show Full Abstract

Circular RNA (circRNA) is mainly generated by the splice donor of a downstream exon joining to an upstream splice acceptor, a phenomenon known as backsplicing. It has been reported that circRNA can function as microRNA (miRNA) sponges, transcriptional regulators, or potential biomarkers. The availability of massive non-polyadenylated transcriptomes data has facilitated the genome-wide identification of thousands of circRNAs. Several circRNA detection tools or pipelines have recently been developed, and it is essential to provide useful guidelines on these pipelines for users, including a comprehensive and unbiased comparison. Here, we provide an improved and easy-to-use circRNA read simulator that can produce mimicking backsplicing reads supporting circRNAs deposited in CircBase. Moreover, we compared the performance of 11 circRNA detection tools on both simulated and real datasets. We assessed their performance regarding metrics such as precision, sensitivity, F1 score, and Area under Curve. It is concluded that no single method dominated on all of these metrics. Among all of the state-of-the-art tools, CIRI, CIRCexplorer, and KNIFE, which achieved better balanced performance between their precision and sensitivity, compared favorably to the other methods.

Also flagged:HIV infectionperoxisomeneurocognitive disordersHANDneurological syndromeAIDS
Journal Article 2017-06-08 No Snippets Xu Z, Asahchop EL, Branton WG, Gelman BB, Power C, Hobman TC.
Show Full Abstract

HIV-associated neurocognitive disorders (HAND) represent a spectrum neurological syndrome that affects up to 25% of patients with HIV/AIDS. Multiple pathogenic mechanisms contribute to the development of HAND symptoms including chronic neuroinflammation and neurodegeneration. Among the factors linked to development of HAND is altered expression of host cell microRNAs (miRNAs) in brain. Here, we examined brain miRNA profiles among HIV/AIDS patients with and without HAND. Our analyses revealed differential expression of 17 miRNAs in brain tissue from HAND patients. A subset of the upregulated miRNAs (miR-500a-5p, miR-34c-3p, miR-93-3p and miR-381-3p), are predicted to target peroxisome biogenesis factors (PEX2, PEX7, PEX11B and PEX13). Expression of these miRNAs in transfected cells significantly decreased levels of peroxisomal proteins and concomitantly decreased peroxisome numbers or affected their morphology. The levels of miR-500a-5p, miR-34c-3p, miR-93-3p and miR-381-3p were not only elevated in the brains of HAND patients, but were also upregulated during HIV infection of primary macrophages. Moreover, concomitant loss of peroxisomal proteins was observed in HIV-infected macrophages as well as in brain tissue from HIV-infected patients. HIV-induced loss of peroxisomes was abrogated by blocking the functions of the upregulated miRNAs. Overall, these findings point to previously unrecognized miRNA expression patterns in the brains of HIV patients. Targeting peroxisomes by up-regulating miRNAs that repress peroxisome biogenesis factors may represent a novel mechanism by which HIV-1 subverts innate immune responses and/or causes neurocognitive dysfunction.

Also flagged:lung cancerhiptriglyceridesS11S12S15
Journal Article 2017-06-08 No Snippets Carreras-Torres R, Johansson M, Haycock PC, Wade KH, Relton CL, Martin RM, Davey Smith G, Albanes D, Aldrich MC, Andrew A, Arnold SM, Bickeböller H, Bojesen SE, Brunnström H, Manjer J, Brüske I, Caporaso NE, Chen C, Christiani DC, Christian WJ, Doherty JA, Duell EJ, Field JK, Davies MPA, Marcus MW, Goodman GE, Grankvist K, Haugen A, Hong YC, Kiemeney LA, van der Heijden EHFM, Kraft P, Johansson MB, Lam S, Landi MT, Lazarus P, Le Marchand L, Liu G, Melander O, Park SL, Rennert G, Risch A, Haura EB, Scelo G, Zaridze D, Mukeriya A, Savić M, Lissowska J, Swiatkowska B, Janout V, Holcatova I, Mates D, Schabath MB, Shen H, Tardon A, Teare MD, Woll P, Tsao MS, Wu X, Yuan JM, Hung RJ, Amos CI, McKay J, Brennan P.
Show Full Abstract

<h4>Background</h4>Assessing the relationship between lung cancer and metabolic conditions is challenging because of the confounding effect of tobacco. Mendelian randomization (MR), or the use of genetic instrumental variables to assess causality, may help to identify the metabolic drivers of lung cancer.<h4>Methods and findings</h4>We identified genetic instruments for potential metabolic risk factors and evaluated these in relation to risk using 29,266 lung cancer cases (including 11,273 adenocarcinomas, 7,426 squamous cell and 2,664 small cell cases) and 56,450 controls. The MR risk analysis suggested a causal effect of body mass index (BMI) on lung cancer risk for two of the three major histological subtypes, with evidence of a risk increase for squamous cell carcinoma (odds ratio (OR) [95% confidence interval (CI)] = 1.20 [1.01-1.43] and for small cell lung cancer (OR [95%CI] = 1.52 [1.15-2.00]) for each standard deviation (SD) increase in BMI [4.6 kg/m2]), but not for adenocarcinoma (OR [95%CI] = 0.93 [0.79-1.08]) (Pheterogeneity = 4.3x10-3). Additional analysis using a genetic instrument for BMI showed that each SD increase in BMI increased cigarette consumption by 1.27 cigarettes per day (P = 2.1x10-3), providing novel evidence that a genetic susceptibility to obesity influences smoking patterns. There was also evidence that low-density lipoprotein cholesterol was inversely associated with lung cancer overall risk (OR [95%CI] = 0.90 [0.84-0.97] per SD of 38 mg/dl), while fasting insulin was positively associated (OR [95%CI] = 1.63 [1.25-2.13] per SD of 44.4 pmol/l). Sensitivity analyses including a weighted-median approach and MR-Egger test did not detect other pleiotropic effects biasing the main results.<h4>Conclusions</h4>Our results are consistent with a causal role of fasting insulin and low-density lipoprotein cholesterol in lung cancer etiology, as well as for BMI in squamous cell and small cell carcinoma. The latter relation may be mediated by a previously unrecognized effect of obesity on smoking behavior.

Also flagged:extracellularvesicleExtracellular vesiclesapoptotic bodiesalbuminmembrane-associated proteins
Journal Article 2017-06-08 No Snippets Pearson LJ, Klaharn IY, Thongsawang B, Manuprasert W, Saejew T, Somparn P, Chuengsaman P, Kanjanabuch T, Pisitkun T.
Show Full Abstract

Peritoneal dialysis inevitability results in activation of inflammatory processes and its efficiency is highly variable between patients. An improved method to isolate biomarkers and study pathophysiological mechanisms in peritoneal dialysis effluent (PDE) is expected to be of much benefit for the development of this treatment approach and help with patient management. Extracellular vesicles (EVs) are released as part of normal cellular processes. Their proteome is expected to reflect both type and health of their cell of origin. Although there is a significant interest in using EVs for "liquid biopsies", little is reported of their presence or composition in plentiful dialysis waste fluids, including peritoneal dialysis effluent (PDE). Here we determined the presence of EVs in PDE and subsequently characterized their proteome. EVs were first isolated from PDE using differential centrifugation, then a further enrichment using size exclusion chromatography (SEC) was performed. The presence of EVs was demonstrated using transmission electron microscopy, and their particle counts were investigated using nanoparticle tracking analysis and dynamic light scattering. Using tandem mass spectrometry, marker proteins from three types of EVs i.e. apoptotic bodies, ectosomes, and exosomes were identified. The proteomic results demonstrated that the isolation of EVs by differential centrifugation helped enrich for over 2,000 proteins normally masked by abundant proteins in PDE such as albumin and SEC markedly further improved the isolation of low abundant proteins. Gene ontology analysis of all identified proteins showed the marked enrichment of exosome and membrane-associated proteins. Over 3,700 proteins were identified in total, including many proteins with known roles in peritoneal pathophysiology. This study demonstrated the prominence of EVs in PDE and their potential value as a source of biomarkers for peritoneal dialysis patients.

Also flagged:C-reactive proteinGammaIron bindingSLAIronAlanine
Journal Article 2017-06-08 ✓ 2 Snippets Taubert R, Hardtke-Wolenski M, Noyan F, Lalanne C, Jonigk D, Schlue J, Krech T, Lichtinghagen R, Falk CS, Schlaphoff V, Bantel H, Muratori L, Manns MP, Jaeckel E.
In-Text Gene Mentions

…liver diseases beyondhemochromatosisand is mostly…

…liver diseases beyondhemochromatosis, like non-alcoholic fatty…

Show Full Abstract

Autoimmune hepatitis (AIH) is a chronic hepatitis with an increasing incidence. The majority of patients require life-long immunosuppression and incomplete treatment response is associated with a disease progression. An abnormal iron homeostasis or hyperferritinemia is associated with worse outcome in other chronic liver diseases and after liver transplantation. We assessed the capacity of baseline parameters including the iron status to predict the treatment response upon standard therapy in 109 patients with untreated AIH type 1 (AIH-1) in a retrospective single center study. Thereby, a hyperferritinemia (> 2.09 times upper limit of normal; Odds ratio (OR) = 8.82; 95% confidence interval (CI): 2.25-34.52) and lower immunoglobulins (<1.89 times upper limit of normal; OR = 6.78; CI: 1.87-24.59) at baseline were independently associated with the achievement of complete biochemical remission upon standard therapy. The predictive value increased when both variables were combined to a single treatment response score, when the cohort was randomly split into a training (area under the curve (AUC) = 0.749; CI 0.635-0.863) and internal validation cohort (AUC = 0.741; CI 0.558-0.924). Patients with a low treatment response score (<1) had significantly higher cumulative remission rates in the training (p<0.001) and the validation cohort (p = 0.024). The baseline hyperferritinemia was accompanied by a high serum iron, elevated transferrin saturations and mild hepatic iron depositions in the majority of patients. However, the abnormal iron status was quickly reversible under therapy. Mechanistically, the iron parameters were not stringently related to a hepatocellular damage. Ferritin rather seems deregulated from the master regulator hepcidin, which was down regulated, potentially mediated by the elevated hepatocyte growth factor. In conclusion, baseline levels of serum ferritin and immunoglobulins, which are part of the diagnostic work-up of AIH, can be used to predict the treatment response upon standard therapy in AIH-1, although confirmation from larger multicenter studies is pending.

Also flagged:inflammatory bowel diseaseulcerative colitisoxygenInflammatory bowel diseasesidiopathic diseasespathogenesis
Journal Article 2017-06-08 ✓ 1 Snippet Schieffer KM, Bruffy SM, Rauscher R, Koltun WA, Yochum GS, Gallagher CJ.
In-Text Gene Mentions

…disease, hemolytic anemia,hemochromatosis, benign and malignant…

Show Full Abstract

Chronic inflammation associated with inflammatory bowel disease (IBD) results in increased oxidative stress that damages the colonic microenvironment. Low levels of serum bilirubin, an endogenous antioxidant, have been associated with increased risk for Crohn's disease (CD). Therefore, the aim of this study was to examine whether total serum bilirubin levels are associated with ulcerative colitis (UC). We identified a retrospective case-control population (n = 6,649) from a single tertiary care center, Penn State Hershey Medical Center (PSU) and a validation cohort (n = 1,996) from Virginia Commonwealth University Medical Center (VCU). Cases were age- and sex-matched to controls (PSU: CD n = 254, UC n = 187; VCU: CD n = 233, UC n = 124). Total serum bilirubin levels were obtained from de-identified medical records and segregated into quartiles. Logistic regression analysis was performed on each quartile of total serum bilirubin compared to the last quartile (highest bilirubin levels) to determine the association of total serum bilirubin with UC. Similar to CD patients, UC patients demonstrated reduced levels of total serum bilirubin compared to controls at PSU and VCU. The lowest quartile of total serum bilirubin was independently associated with UC for the PSU (OR: 1.98 [95% CI: 1.09-3.63]) and VCU cohorts (OR: 6.07 [95% CI: 3.01-12.75]). Lower levels of the antioxidant bilirubin may reduce the capability of UC patients to remove reactive oxygen species leading to an increase in intestinal injury. Therapeutics that reduce oxidative stress may be beneficial for these patients.

Also flagged:alcoholsacetate estersethyl esterscompoundsfermentationand pentacyclic triterpenes
Journal Article 2017-06-08 No Snippets Mendes I, Sanchez I, Franco-Duarte R, Camarasa C, Schuller D, Dequin S, Sousa MJ.
Show Full Abstract

<h4>Background</h4>During must fermentation thousands of volatile aroma compounds are formed, with higher alcohols, acetate esters and ethyl esters being the main aromatic compounds contributing to floral and fruity aromas. The action of yeast, in particular Saccharomyces cerevisiae, on the must components will build the architecture of the wine flavour and its fermentation bouquet. The objective of the present work was to better understand the molecular and metabolic bases of aroma production during a fermentation process. For such, comparative transcriptomic and metabolic analysis was performed at two time points (5 and 50 g/L of CO<sub>2</sub> released) in fermentations conducted by four yeast strains from different origins and/or technological applications (cachaça, sake, wine, and laboratory), and multivariate factorial analyses were used to rationally identify new targets for improving aroma production.<h4>Results</h4>Results showed that strains from cachaça, sake and wine produced higher amounts of acetate esters, ethyl esters, acids and higher alcohols, in comparison with the laboratory strain. At fermentation time T1 (5 g/L CO<sub>2</sub> released), comparative transcriptomics of the three S. cerevisiae strains from different fermentative environments in comparison with the laboratory yeast S288c, showed an increased expression of genes related with tetracyclic and pentacyclic triterpenes metabolism, involved in sterol synthesis. Sake strain also showed upregulation of genes ADH7 and AAD6, involved in the formation of higher alcohols in the Ehrlich pathway. For fermentation time point T2 (50 g/L CO<sub>2</sub> released), again sake strain, but also VL1 strain, showed an increased expression of genes involved in formation of higher alcohols in the Ehrlich pathway, namely ADH7, ADH6 and AAD6, which is in accordance with the higher levels of methionol, isobutanol, isoamyl alcohol and phenylethanol observed.<h4>Conclusions</h4>Our approach revealed successful to integrate data from several technologies (HPLC, GC-MS, microarrays) and using different data analysis methods (PCA, MFA). The results obtained increased our knowledge on the production of wine aroma and flavour, identifying new gene in association to the formation of flavour active compounds, mainly in the production of fatty acids, and ethyl and acetate esters.

Also flagged:TumorRASGene Expressiontumorscancerepidermal growth factor receptor
Journal Article 2017-06-08 No Snippets Stephens RM, Yi M, Kessing B, Nissley DV, McCormick F.
Show Full Abstract

The 3 human RAS genes play pivotal roles regulating proliferation, differentiation, and survival in normal cells and become mutated in 15% to 20% of all human tumors and amplified in many others. In this report, we examined data from The Cancer Genome Atlas to investigate the relationship between RAS gene mutational status and messenger RNA expression. We show that all 3 RAS genes exhibit increased expression when they are mutated in a context-dependent manner. In the case of <i>KRAS</i>, this increase is manifested by a larger proportional increase in <i>KRAS4A</i> than <i>KRAS4B</i>, although both increase significantly. In addition, the mutational status of RAS genes can be associated with expression changes in other RAS genes, with most of these cases showing decreased expression. The mutational status associations with expression are recapitulated in cancer cell lines. Increases in expression are mediated by both copy number variation and contextual differences, including mutational status of epidermal growth factor receptor (<i>EGFR</i>) and <i>BRAF</i>. These findings potentially reveal an adaptive response during tumor evolution that is dependent on the mutational status of proximal genes in the RAS pathway and cellular context. Cell contextual differences in these adaptations may influence therapeutic responsiveness and alternative resistance mechanisms.

Also flagged:posterior reversible encephalopathy syndromePRESchronic renal failurealbuminAlbHb
Journal Article 2017-06-08 ✓ 1 Snippet Hu H, Xu S, Hu S, Xu W, Shui H.
In-Text Gene Mentions

thrombin-III

Show Full Abstract

Few studies have investigated posterior reversible encephalopathy syndrome (PRES) in patients with chronic renal failure (CRF). The present study analyzed the clinical manifestations, laboratory examinations and imaging features of PRES in patients with CRF. A total of 42 patients with CRF with or without PRES were recruited in the current retrospective case-control study. Patient data taken prior to the onset of PRES in patients with CRF and PRES (n=21) were collected and analyzed. At the same time, data from patients with CRF but without PRES (n=21) were also analyzed. Brain magnetic resonance imaging (MRI) scans were collected from patients in the PRES group. The mean blood pressure of patients in the PRES group was significantly higher than that of the control group (systolic blood pressure: 172±15 mmHg vs. 135±14 mmHg, P<0.01; diastolic blood pressure: 95±16 mmHg vs. 64±13 mmHg, P<0.01). Furthermore, compared with the control group, mean serum albumin (Alb) and hemoglobin (Hb) concentrations in the PRES group were significantly lower (Alb: 29.1±5.3 g/l vs. 34.6±6.1 g/l, P=0.001; Hb: 74±16 g/l vs. 89±28 g/l, P=0.037). By contrast, mean LDH concentration was significantly higher in the PRES group (LDH: 336±141 U/l vs. 235±89 U/l, P=0.004). In the PRES group, 24 h urine volume was significantly lower in the PRES group than in the control group (24 h urine volume: 651±520 ml vs. 982±518 ml, P=0.046). No significant differences in levels of serum potassium (4.5±0.6 mmol/l vs. 4.4±0.5 mmol/l, P=0.377), sodium (138.3±4.9 mmol/l vs. 139.0±6.8 mmol/l, P=0.325), calcium (2.0±0.24 mmol/l vs. 1.9±0.24 mmol/l, P=0.673), alanine aminotransferase; (24±14 U/l vs. 18±8 U/l, P=0.975); aspartate aminotransferase (29±11 U/l vs. 24±9 U/l, P=0.619) and uric acid (448±148 µmol/l vs. 378±116 µmol/l, P=0.599) were found between the two groups. PRES is a relatively common nervous system complication arising in patients with CRF. Certain biochemical markers, including Hb and Alb, may be associated with PRES. Diagnosing PRES is difficult as computed tomography (CT) brain scans may be normal and MRI scans, which are more sensitive than CT scans at diagnosing PRES, are not always performed in patients with CRF. Thus, brain MRI scans should be taken first in such patients when PRES is suspected.

Also flagged:metabolismmitochondrianucleusCHCHD2CHCHD10binding
Journal Article 2017-06-08 No Snippets Grossman LI, Purandare N, Arshad R, Gladyck S, Somayajulu M, Hüttemann M, Aras S.
Show Full Abstract

The central role of energy metabolism in cellular activities is becoming widely recognized. However, there are many gaps in our knowledge of the mechanisms by which mitochondria evaluate their status and call upon the nucleus to make adjustments. Recently, a protein family consisting of twin CX<sub>9</sub>C proteins has been shown to play a role in human pathophysiology. We focus here on two family members, the isoforms CHCHD2 (renamed MNRR1) and CHCHD10. The better studied isoform, MNRR1, has the unusual property of functioning in both the mitochondria and the nucleus and of having a different function in each. In the mitochondria, it functions by binding to cytochrome <i>c</i> oxidase (COX), which stimulates respiration. Its binding to COX is promoted by tyrosine-99 phosphorylation, carried out by ABL2 kinase (ARG). In the nucleus, MNRR1 binds to a novel promoter element in <i>COX4I2</i> and itself, increasing transcription at 4% oxygen. We discuss mutations in both MNRR1 and CHCHD10 found in a number of chronic, mostly neurodegenerative, diseases. Finally, we propose a model of a graded response to hypoxic and oxidative stresses, mediated under different oxygen tensions by CHCHD10, MNRR1, and HIF1, which operate at intermediate and very low oxygen concentrations, respectively.

Also flagged:NSCLCKRASEGFRnon-small cell lung canceroncogenestyrosine kinase
Journal Article 2017-06-08 ✓ 1 Snippet Dugay F, Llamas-Gutierrez F, Gournay M, Medane S, Mazet F, Chiforeanu DC, Becker E, Lamy R, Léna H, Rioux-Leclercq N, Belaud-Rotureau MA, Cabillic F.
In-Text Gene Mentions

…pathologists (FLG andDCC).…

Show Full Abstract

Targeted therapies have substantially changed the management of non-small cell lung cancer (NSCLC) patients with driver oncogenes. Given the high frequency, <i>EGFR</i> and <i>ALK</i> aberrations were the first to be detected and paved the way for tyrosine kinase inhibitor (TKI) treatments. Other kinases such as <i>ROS1</i> and more recently <i>RET</i> have emerged as promising targets, and ROS1 and RET TKIs are already available for precision medicine. We screened a large cohort of 713 Caucasian non-squamous NSCLC patients lacking <i>EGFR</i>/<i>KRAS</i>/<i>BRAF</i>/<i>HER2</i>/<i>PI3KCA</i>/<i>ALK</i> aberrations for <i>ROS1</i> and <i>RET</i> rearrangements using fluorescence <i>in situ</i> hybridization to determine the frequency and clinicopathological characteristics of ROS1- and RET-positive patients. Frequencies of <i>ROS1</i> and <i>RET</i> rearrangements were 2.1% and 2.52%, respectively. Contrary to common belief, both <i>ROS1</i> and <i>RET</i> rearrangements were detected in patients with a history of smoking, and the <i>RET</i>-positive patients were not younger than the negative patients. Moreover, <i>RET</i> but not <i>ROS1</i> rearrangement was associated with the female gender. Nearly half of the <i>ROS1</i>-rearranged patients were successfully treated with ROS1 TKIs. In contrast, only 5/18 RET-positive patients received off-label RET TKIs. Two patients had stable disease, and three experienced disease progression. In addition to the 18 RET-positive cases, 10 showed isolated 5' signals. The clinical relevance is unknown but if the frequency is confirmed by other groups, the question whether these patients are eligible to TKIs will arise. More potent RET TKIs are under development and may improve the response rate in RET-positive patients. Therefore, we recommend the routine implementation of RET testing in non-squamous NSCLC patients, including those with a history of smoking.

Also flagged:Hepatocellular Carcinomacell differentiationpathogenesissorafenibtumorregorafenib
Journal Article 2017-06-08 ✓ 1 Snippet Rinninella E, Cerrito L, Spinelli I, Cintoni M, Mele MC, Pompili M, Gasbarrini A, Gasbarrini A.
In-Text Gene Mentions

…inherited metabolic diseases (hemochromatosis, alpha-1-antitrypsin deficien…

Show Full Abstract

Hepatocarcinogenesis is a multistep process, heralded by abnormalities in cell differentiation and proliferation and sustained by an aberrant neoangiogenesis. Understanding the underlying molecular pathogenesis leading to hepatocellular carcinoma is a prerequisite to develop new drugs that will hamper or block the steps of these pathways. As hepatocellular carcinoma has higher arterial vascularization than normal liver, this could be a good target for novel molecular therapies. Introduction of the antiangiogenic drug sorafenib into clinical practice since 2008 has led to new perspectives in the management of this tumor. The importance of this drug lies not only in the modest gain of patients' survival, but in having opened a roadmap towards the development of new molecules and targets. Unfortunately, after the introduction of sorafenib, during the last years, a wide number of clinical trials on antiangiogenic therapies failed in achieving significant results. However, many of these trials are still ongoing and promise to improve overall survival and progression-free survival. A recent clinical trial has proven regorafenib effective in patients showing tumor progression under sorafenib, thus opening new interesting therapeutic perspectives. Many other expectations have been borne from the discovery of the immune checkpoint blockade, already known in other solid malignancies. Furthermore, a potential role in hepatocellular carcinoma therapy may derive from the use of branched-chain amino acids and of nutritional support. This review analyses the biomolecular pathways of hepatocellular carcinoma and the ongoing studies, the actual evidence and the future perspectives concerning drug therapy in this open field.

Also flagged:iron deficiencyironanemiaHemoglobinHbsulfate
Journal Article 2017-06-08 ✓ 1 Snippet Niittymäki P, Arvas M, Larjo A, Mattila P, Ihalainen J, Syrjälä M, Castrén J, Partanen J.
In-Text Gene Mentions

HFE

Show Full Abstract

Measuring the concentration of capillary hemoglobin (cHb) is a standard procedure before blood donation. To further assess the time period needed for cHb recovery after blood donation and to have a more in-depth understanding of features of recovery, we used data-mining tools in a large, retrospective data pool containing all 1 163 524 donor returns that took place in Finland in 2010 to 2015. The results show that the average recovery times for cHb to return back to the level preceding donation were substantially longer, over 200 days in all age groups, than were the minimum allowed donation intervals. cHb recovery was especially poor in women under the age of 30 who returned to donate soon after the minimum allowed donation interval. It was of interest that frequent donors recovered substantially faster, with the average recovery times of ∼100 days in men and ∼200 days in women, than did infrequent donors, suggesting that there is a subpopulation of donors who can donate frequently without fear of iron deficiency. Return interval in fact explained only 1% of the variation in cHb recovery, which points to unknown, individual features, such as genetic or lifestyle factors, warranting further studies and suggesting that simply extending the allowed donation intervals may not suffice to improve cHb recovery. The study demonstrates that data mining of blood bank records is a powerful tool for depicting features of blood donor population.

Also flagged:Tumorpolymerspolyethylene glycololigo ethylene glycolphosphorylcholinesalt
Journal Article 2017-06-07 No Snippets Jackson MA, Werfel TA, Curvino EJ, Yu F, Kavanaugh TE, Sarett SM, Dockery MD, Kilchrist KV, Jackson AN, Giorgio TD, Duvall CL.
Show Full Abstract

Although siRNA-based nanomedicines hold promise for cancer treatment, conventional siRNA-polymer complex (polyplex) nanocarrier systems have poor pharmacokinetics following intravenous delivery, hindering tumor accumulation. Here, we determined the impact of surface chemistry on the in vivo pharmacokinetics and tumor delivery of siRNA polyplexes. A library of diblock polymers was synthesized, all containing the same pH-responsive, endosomolytic polyplex core-forming block but different corona blocks: 5 kDa (benchmark) and 20 kDa linear polyethylene glycol (PEG), 10 kDa and 20 kDa brush-like poly(oligo ethylene glycol), and 10 kDa and 20 kDa zwitterionic phosphorylcholine-based polymers (PMPC). In vitro, it was found that 20 kDa PEG and 20 kDa PMPC had the highest stability in the presence of salt or heparin and were the most effective at blocking protein adsorption. Following intravenous delivery, 20 kDa PEG and PMPC coronas both extended circulation half-lives 5-fold compared to 5 kDa PEG. However, in mouse orthotopic xenograft tumors, zwitterionic PMPC-based polyplexes showed highest in vivo luciferase silencing (>75% knockdown for 10 days with single IV 1 mg/kg dose) and 3-fold higher average tumor cell uptake than 5 kDa PEG polyplexes (20 kDa PEG polyplexes were only 2-fold higher than 5 kDa PEG). These results show that high molecular weight zwitterionic polyplex coronas significantly enhance siRNA polyplex pharmacokinetics without sacrificing polyplex uptake and bioactivity within tumors when compared to traditional PEG architectures.

Also flagged:5-HTTLPRserotonin transporterbehavioralSLC6A4anxietydepression
Journal Article 2017-06-07 ✓ 2 Snippets Cao H, Harneit A, Walter H, Erk S, Braun U, Moessnang C, Geiger LS, Zang Z, Mohnke S, Heinz A, Romanczuk-Seiferth N, Mühleisen T, Mattheisen M, Witt SH, Cichon S, Nöthen MM, Rietschel M, Meyer-Lindenberg A, Tost H.
In-Text Gene Mentions

…genetic regulator of5-HTTexpression in the…

5-HTT

Show Full Abstract

The serotonin transporter-linked polymorphic region 5-HTTLPR is a key genetic regulator of 5-HTT expression in the human brain where the short allele S has been implicated in emotion dysregulation. However, the neural mechanism underlying the association between this variant and emotion processing is still unclear. Earlier studies suggested an effect of 5-HTTLPR on amygdala activation during emotional face processing. However, this association has been questioned in recent studies employing larger sample sizes and meta-analyses. Here, we examined a sample of 223 healthy subjects with a well-established fMRI emotional face processing task to (1) re-evaluate the association between 5-HTTLPR and amygdala activation, (2) explore potential network-based functional connectivity phenotypes for associations with 5-HTTLPR, and (3) probe the reliability, behavioral significance and potential structural confounds of the identified network phenotype. Our results revealed no significant effect of 5-HTTLPR on amygdala activation (P>0.79). However, the number of S alleles was significantly correlated with functional connectivity of a visual-limbic subnetwork (P<sub>FWE</sub>=0.03). The subnetwork cluster included brain regions that are pivotal to emotion regulation such as the hippocampus, orbitofrontal cortex, anterior cingulate gyrus, fusiform gyrus, and subcortex. Notably, individuals with lower subnetwork connectivity had significantly higher emotion suppression scores (P=0.01). Further, the connectivity metrics were test-retest reliable and independent from subnetwork gray matter volume and white matter anisotropy. Our data provide evidence for a functional network-based phenotype linking genetic variation in 5-HTTLPR to emotion regulation, and suggest that further critical evaluations of the association between 5-HTTLPR and amygdala activation are warranted.

Also flagged:CarbonateApatiteGemcitabineAnastrozolecancerdoxorubicin
Journal Article 2017-06-07 No Snippets Mozar FS, Chowdhury EH.
Show Full Abstract

pH sensitive nanoparticles of carbonate apatite (CA) have been proven to be effective delivery vehicles for DNA, siRNAs and proteins. More recently, conventional anti-cancer drugs, such as doxorubicin, methotrexate and cyclophosphamide have been successfully incorporated into CA for intracellular delivery to breast cancer cells. However, physical and chemical properties of drug molecules appeared to affect their interactions with CA, with hydrophillic drug so far exhibiting better binding affinity and cellular uptakes compared to hydrophobic drugs. In this study, anastrozole, a non-steroidal aromatase inhibitor which is largely hydrophobic, and gemcitabine, a hydrophilic nucleoside inhibitor were used as solubility models of chemotherapy drug. Aggregation tendency of poorly soluble drugs resulting in larger particle-drug complex size might be the main factor hindering their delivery effectiveness. For the first time, surface modification of CA with poly(ethylene glycol) (PEG) has shown promising result to drastically reduce anastrozole- loaded CA particle size, from approximately 1000 to 500 nm based on zeta sizer analysis. Besides PEG, a cell specific ligand, in this case fibronectin, was attached to the particles in order to facilitate receptor mediated endocytosis based on fibronectin-integrin interaction. High-performance liquid chromatography (HPLC) was performed to measure uptake of the drugs by breast cancer cells, revealing that surface modification increased the drug uptake, especially for the hydrophobic drug, compared to the uncoated particles and the free drug. In vitro chemosensitivity assay and in vivo tumor regression study also showed that coated apatite/drug nanoparticle complexes presented higher cytotoxicity and tumor regression effects than uncoated apatite/drug nanoparticles and free drugs, indicating that surface modification successfully created optimum particles size with the consequence of more effective uptake along with favorable pharmacokinetics of the particles.

Also flagged:autosomal dominant neurodegenerative diseaseHDparvalbuminNeurotoxicityneurodegenerative disordercytosine
Journal Article 2017-06-07 ✓ 5 Snippets Morigaki R, Goto S.
In-Text Gene Mentions

In HD, the amount of Htt and its mRNA present in surviving striatal neurons is not obviously altered, which suggests that Htt expression is not associated with cell type-specific loss in the striatum [175,176,177,178,179].

Htt and Rhes interactions may underlie the regional specificity of HD [160,161].

In HD, a mutation of the protein huntingtin (Htt), which involves the expansion of a cytosine-adenine-guanine (CAG) repeat encoding an extended glutamine tract (PolyQ), causes transcriptional dysregulation (Figure 1) resulting in multiple cellular dysfunctions such as intracellular signaling pathway alterations, protein trafficking defects, synaptic transmission impairments, proteasome dysfunction, and mitochondrial alterations [3,4,5].

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease caused by the expansion of a CAG trinucleotide repeat encoding an abnormally long polyglutamine tract (PolyQ) in the huntingtin (Htt) protein.

Despite the ubiquitous expression of mutant Htt (mHtt) throughout the brain, human pathology has shown that degeneration is specific to certain neuronal subpopulations affecting the striatum and, to a lesser extent, the cerebral cortex in patients with HD [4].

Show Full Abstract

Huntington's disease (HD) is an autosomal dominant neurodegenerative disease caused by the expansion of a CAG trinucleotide repeat encoding an abnormally long polyglutamine tract (PolyQ) in the huntingtin (Htt) protein. In HD, striking neuropathological changes occur in the striatum, including loss of medium spiny neurons and parvalbumin-expressing interneurons accompanied by neurodegeneration of the striosome and matrix compartments, leading to progressive impairment of reasoning, walking and speaking abilities. The precise cause of striatal pathology in HD is still unknown; however, accumulating clinical and experimental evidence suggests multiple plausible pathophysiological mechanisms underlying striatal neurodegeneration in HD. Here, we review and discuss the characteristic neurodegenerative patterns observed in the striatum of HD patients and consider the role of various huntingtin-related and striatum-enriched proteins in neurotoxicity and neuroprotection.

Also flagged:ironchronic diseasesanemiachronic diseasecardiovascular diseasehyperferritinemia
Journal Article 2017-06-07 ✓ 1 Snippet Kadoglou NPE, Biddulph JP, Rafnsson SB, Trivella M, Nihoyannopoulos P, Demakakos P.
In-Text Gene Mentions

…e hyperferritinemia indicatinghemochromatosis, while anemia entered…

Show Full Abstract

<h4>Background</h4>Ferritin constitutes a sensitive iron-storage index and multi-functional protein. Evidence on its association with mortality in general population is scarce and conflicting. We investigated the sex-specific associations of ferritin levels with all-cause and cardiovascular mortality in a population-based cohort.<h4>Methods</h4>Data came from the English Longitudinal Study of Ageing and the national mortality registry. The sample comprised 5,471 participants aged ≥52 years. Blood concentration of ferritin was measured at baseline in 2004-05. Sex-specific Cox proportional hazards models were estimated with adjustment for age, major chronic diseases, marital status, educational attainment, total net household wealth, anemia, inflammatory markers, body mass index, smoking, and physical activity. Stratified analyses by chronic disease status were also performed.<h4>Results</h4>We categorized ferritin in sex-specific quartiles. In men, we used, the following categorization: lowest (2-69ng/ml), second lowest (70-118ng/ml), second highest (reference category) (119-193ng/ml) and highest (194-598ng/ml) ferritin quartiles. In women, ferritin was categorized as follows: lowest (2-44ng/ml), second lowest (45-73ng/ml), second highest (reference category) (74-115ng/ml) and highest (116-341ng/ml) ferritin quartiles. 841 deaths of which 262 cardiovascular disease-related were recorded over a mean follow-up time of 7.7 years. Risk for all-cause mortality was found increased in men with hyperferritinemia (194-598ng/ml) and no history of major chronic diseases compared with the reference group [fully-adjusted HR: 1.49 (95%CI 1.03-2.16)]. Among women, those in the lowest ferritin quartile (2-44ng/ml) had increased risk for all-cause mortality [fully-adjusted HR: 1.59 (95%CI 1.18-2.13)] compared with the reference group after adjustment for all covariates. Regarding cardiovascular mortality, we observed a positive association with ferritin levels in men, which was blunted after adjustment for inflammatory markers and lifestyle parameters. Men with no major chronic diseases who were in the highest ferritin quartile had a significantly increased risk of cardiovascular mortality. No association between ferritin levels and cardiovascular mortality was detected in women.<h4>Conclusion</h4>Circulating ferritin levels showed sex-specific prognostic patterns. High ferritin levels in men with no major chronic disease and low ferritin levels in all women were associated with increased all-cause mortality after adjusting for covariates. High ferritin levels in men with no major chronic diseases were also independently associated with an increased risk of cardiovascular mortality. Future research is needed to clarify the prognostic role of ferritin.

Also flagged:heterochromatinHuntington's diseaseHDautosomal-dominant inherited neurological disorderHuntingtinhistone
Journal Article 2017-06-07 ✓ 3 Snippets Lee J, Hwang YJ, Kim Y, Lee MY, Hyeon SJ, Lee S, Kim DH, Jang SJ, Im H, Min SJ, Choo H, Pae AN, Kim DJ, Cho KS, Kowall NW, Ryu H.
In-Text Gene Mentions

Herein, we report that dSETDB1/ESET, a histone methyltransferase (HMT), is a mediator of mutant HTT-induced degeneration in a fly HD model.

Huntington's disease (HD) is an autosomal-dominant inherited neurological disorder caused by expanded CAG repeats in exon 1 of the Huntingtin (HTT) gene.

…of the Huntingtin (HTT) gene.…

Show Full Abstract

Huntington's disease (HD) is an autosomal-dominant inherited neurological disorder caused by expanded CAG repeats in exon 1 of the Huntingtin (HTT) gene. Altered histone modifications and epigenetic mechanisms are closely associated with HD suggesting that transcriptional repression may play a pathogenic role. Epigenetic compounds have significant therapeutic effects in cellular and animal models of HD, but they have not been successful in clinical trials. Herein, we report that dSETDB1/ESET, a histone methyltransferase (HMT), is a mediator of mutant HTT-induced degeneration in a fly HD model. We found that nogalamycin, an anthracycline antibiotic and a chromatin remodeling drug, reduces trimethylated histone H3K9 (H3K9me3) levels and pericentromeric heterochromatin condensation by reducing the expression of Setdb1/Eset. H3K9me3-specific ChIP-on-ChIP analysis identified that the H3K9me3-enriched epigenome signatures of multiple neuronal pathways including Egr1, Fos, Ezh1, and Arc are deregulated in HD transgenic (R6/2) mice. Nogalamycin modulated the expression of the H3K9me3-landscaped epigenome in medium spiny neurons and reduced mutant HTT nuclear inclusion formation. Moreover, nogalamycin slowed neuropathological progression, preserved motor function, and extended the life span of R6/2 mice. Together, our results indicate that modulation of SETDB1/ESET and H3K9me3-dependent heterochromatin plasticity is responsible for the neuroprotective effects of nogalamycin in HD and that small compounds targeting dysfunctional histone modification and epigenetic modification by SETDB1/ESET may be a rational therapeutic strategy in HD.

Also flagged:NeurofilamentatrophyCashCAPderSalp
Journal Article 2017-06-07 ✓ 5 Snippets Byrne LM, Rodrigues FB, Blennow K, Durr A, Leavitt BR, Roos RAC, Scahill RI, Tabrizi SJ, Zetterberg H, Langbehn D, Wild EJ.
In-Text Gene Mentions

HTT

We used Cox proportional hazard survival modelling to calculate hazard ratios (HRs) and 95% CIs for the correlation between baseline NfL concentration and subsequent onset of Huntington's disease within 3 years in premanifest HTT mutation carriers.

We tested the hypotheses that NfL concentrations would be raised in individuals with Huntington's disease, would increase as disease progressed, and that concentrations would correlate with disease onset in HTT mutation carriers with premanifest Huntington's disease and with clinical progression in those with manifest disease, therefore acting as an indicator of neurodegeneration.

The striking association we found between NfL concentrations in plasma and HTT CAG repeat count establishes a genetic dose–response connection in Huntington's disease.

…expansions in theHTTgene leading to…

Show Full Abstract

<h4>Background</h4>Blood biomarkers of neuronal damage could facilitate clinical management of and therapeutic development for Huntington's disease. We investigated whether neurofilament light protein NfL (also known as NF-L) in blood is a potential prognostic marker of neurodegeneration in patients with Huntington's disease.<h4>Methods</h4>We did a retrospective analysis of healthy controls and carriers of CAG expansion mutations in HTT participating in the 3-year international TRACK-HD study. We studied associations between NfL concentrations in plasma and clinical and MRI neuroimaging findings, namely cognitive function, motor function, and brain volume (global and regional). We used random effects models to analyse cross-sectional associations at each study visit and to assess changes from baseline, with and without adjustment for age and CAG repeat count. In an independent London-based cohort of 37 participants (23 HTT mutation carriers and 14 controls), we further assessed whether concentrations of NfL in plasma correlated with those in CSF.<h4>Findings</h4>Baseline and follow-up plasma samples were available from 97 controls and 201 individuals carrying HTT mutations. Mean concentrations of NfL in plasma at baseline were significantly higher in HTT mutation carriers than in controls (3·63 [SD 0·54] log pg/mL vs 2·68 [0·52] log pg/mL, p<0·0001) and the difference increased from one disease stage to the next. At any given timepoint, NfL concentrations in plasma correlated with clinical and MRI findings. In longitudinal analyses, baseline NfL concentration in plasma also correlated significantly with subsequent decline in cognition (symbol-digit modality test r=-0·374, p<0·0001; Stroop word reading r=-0·248, p=0·0033), total functional capacity (r=-0·289, p=0·0264), and brain atrophy (caudate r=0·178, p=0·0087; whole-brain r=0·602, p<0·0001; grey matter r=0·518, p<0·0001; white matter r=0·588, p<0·0001; and ventricular expansion r=-0·589, p<0·0001). All changes except Stroop word reading and total functional capacity remained significant after adjustment for age and CAG repeat count. In 104 individuals with premanifest Huntington's disease, NfL concentration in plasma at baseline was associated with subsequent clinical onset during the 3-year follow-up period (hazard ratio 3·29 per log pg/mL, 95% CI 1·48-7·34, p=0·0036). Concentrations of NfL in CSF and plasma were correlated in mutation carriers (r=0·868, p<0·0001).<h4>Interpretation</h4>NfL in plasma shows promise as a potential prognostic blood biomarker of disease onset and progression in Huntington's disease.<h4>Funding</h4>Medical Research Council, GlaxoSmithKline, CHDI Foundation, Swedish Research Council, European Research Council, Wallenberg Foundation, and Wolfson Foundation.

Also flagged:gene expressiontranslationalmyostatinMyoDproteinsfactors
Journal Article 2017-06-07 ✓ 5 Snippets D'Souza RF, Bjørnsen T, Zeng N, Aasen KMM, Raastad T, Cameron-Smith D, Mitchell CJ.
In-Text Gene Mentions

…Region Y)-Box 6 (SOX6), Phosphatase and tensin…

…< 0.001), andSOX6( p =…

…shown to repressSOX6, a key inhibitor…

…increased abundance ofSOX6.…

…for a greaterSOX6expression that may…

Show Full Abstract

Powerlifters are the epitome of muscular adaptation and are able to generate extreme forces. The molecular mechanisms underpinning the significant capacity for force generation and hypertrophy are not fully elucidated. MicroRNAs (miRs) are short non-coding RNA sequences that control gene expression via promotion of transcript breakdown and/or translational inhibition. Differences in basal miR expression may partially account for phenotypic differences in muscle mass and function between powerlifters and untrained age-matched controls. Muscle biopsies were obtained from m. vastus lateralis of 15 national level powerlifters (25.1 ± 5.8 years) and 13 untrained controls (24.1 ± 2.0 years). The powerlifters were stronger than the controls (isokinetic knee extension at 60°/s: 307.8 ± 51.6 Nm vs. 211.9 ± 41.9 Nm, respectively <i>P</i> < 0.001), and also had larger muscle fibers (type I CSA 9,122 ± 1,238 vs. 4,511 ± 798 μm<sup>2</sup><i>p</i> < 0.001 and type II CSA 11,100 ± 1,656 vs. 5,468 ± 1,477 μm<sup>2</sup><i>p</i> < 0.001). Of the 17 miRs species analyzed, 12 were differently expressed (<i>p</i> < 0.05) between groups with 7 being more abundant in powerlifters and five having lower expression. Established transcriptionally regulated miR downstream gene targets involved in muscle mass regulation, including myostatin and MyoD, were also differentially expressed between groups. Correlation analysis demonstrates the abundance of eight miRs was correlated to phenotype including peak strength, fiber size, satellite cell abundance, and fiber type regardless of grouping. The unique miR expression profiles between groups allow for categorization of individuals as either powerlifter or healthy controls based on a five miR signature (miR-126, -23b, -16, -23a, -15a) with considerable accuracy (100%). Thus, this unique miR expression may be important to the characterization of the powerlifter phenotype.

Also flagged:serotonin transporterserotonin5-hydroxytryptaminemajor depressiondysphoriathoughts
Journal Article 2017-06-07 ✓ 3 Snippets Takahashi H, Higuchi H, Sato K, Kamata M, Yoshida K, Nishimura K.
In-Text Gene Mentions

…a 5-HT transporter (5-HTT) gene-linked polymorphic regi…

…intron of the5-HTTgene (5-HTTVNTR), and…

…the 5-HT transporter (5-HTT).…

Show Full Abstract

<h4>Objective</h4>We investigated the association between serotonin- or 5-hydroxytryptamine (5-HT)-related gene polymorphisms and response to antidepressant treatment in a specific symptom cluster of major depression by using the three-factor model of the Montgomery-Åsberg Depression Rating Scale (MADRS), ie, dysphoria (items of sadness, pessimistic thoughts, and suicidal thoughts), retardation (items of lassitude, inability to feel, apparent sadness, and concentration difficulties), and vegetative symptoms (items of reduced sleep, reduced appetite, and inner tension).<h4>Methods</h4>This study was an open-label and nonrandomized trial. A total of 160 patients with baseline MADRS scores of ≥21, who were treated with fluvoxamine or milnacipran for 6 weeks, were included in the statistical analysis. Polymorphisms within a 5-HT transporter (5-HTT) gene-linked polymorphic region (5-HTTLPR), a variable number of tandem repeats in the second intron of the 5-HTT gene (5-HTTVNTR), and 5HT2A receptor (1438G/A) were determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).<h4>Results</h4>The 5-HTTLPR polymorphisms affected the MADRS score change in dysphoria, but not in retardation, vegetative, or total symptoms. Dysphoria scores significantly decreased in patients with the S/S genotype compared to those in patients with the short (S)/long (L) + L/L genotype. However, 5-HTTVNTR and 1438G/A polymorphisms were not significantly associated with the treatment response to any cluster of depressive symptoms. When a Bonferroni correction was made, however, our results did not reach the criteria for statistical significance.<h4>Conclusion</h4>The use of a single total depression rating scale may not be sufficient to accurately estimate the clinical response to antidepressants. Analyzing a subset of symptoms in psychological scales could be important when performing pharmacogenetic studies.

Also flagged:platelet-derived growth factor alphaPDGFRαlipidalpha smooth muscle actinCD34transcriptional factor
Journal Article 2017-06-07 No Snippets Endale M, Ahlfeld S, Bao E, Chen X, Green J, Bess Z, Weirauch M, Xu Y, Perl AK.
Show Full Abstract

The following data are derived from key stages of acinar lung development and define the developmental role of lung interstitial fibroblasts expressing platelet-derived growth factor alpha (PDGFRα). This dataset is related to the research article entitled "Temporal, spatial, and phenotypical changes of PDGFRα expressing fibroblasts during late lung development" (Endale et al., 2017) [1]. At E16.5 (canalicular), E18.5 (saccular), P7 (early alveolar) and P28 (late alveolar), PDGFRα<sup>GFP</sup> mice, in conjunction with immunohistochemical markers, were utilized to define the spatiotemporal relationship of PDGFRα<sup>+</sup> fibroblasts to endothelial, stromal and epithelial cells in both the proximal and distal acinar lung. Complimentary analysis with flow cytometry was employed to determine changes in cellular proliferation, define lipofibroblast and myofibroblast populations via the presence of intracellular lipid or alpha smooth muscle actin (αSMA), and evaluate the expression of CD34, CD29, and Sca-1. Finally, PDGFRα<sup>+</sup> cells isolated at each stage of acinar lung development were subjected to RNA-Seq analysis, data was subjected to Bayesian timeline analysis and transcriptional factor promoter enrichment analysis.

Also flagged:hydroxyapatitecalciumdegradationOsteoinductionosteogenesiscollagen
Journal Article 2017-06-07 No Snippets Ramírez Fernández MP, Mazón P, Gehrke SA, Calvo-Guirado JL, De Aza PN.
Show Full Abstract

Detailed information about graft material characteristic is crucial to evaluate their clinical outcomes. The present study evaluates the physico-chemical characteristics of two xenografts manufactured on an industrial scale deproteinized at different temperatures (non-sintered and sintered) in accordance with a protocol previously used in sinus lift procedures. It compares how the physico-chemical properties influence the material's performance in vivo by a histomorphometric study in retrieved bone biopsies following maxillary sinus augmentation in 10 clinical cases. An X-ray diffraction analysis revealed the typical structure of hydroxyapatite (HA) for both materials. Both xenografts were porous and exhibited intraparticle pores. Strong differences were observed in terms of porosity, crystallinity, and calcium/phosphate. Histomorphometric measurements on the bone biopsies showed statistically significant differences. The physic-chemical assessment of both xenografts, made in accordance with the protocol developed on an industrial scale, confirmed that these products present excellent biocompatibilitity, with similar characteristics to natural bone. The sintered HA xenografts exhibited greater osteoconductivity, but were not completely resorbable (30.80 ± 0.88% residual material). The non-sintered HA xenografts induced about 25.92 ± 1.61% of new bone and a high level of degradation after six months of implantation. Differences in the physico-chemical characteristics found between the two HA xenografts determined a different behavior for this material.

Also flagged:membraneDeltaBehavioural variant frontotemporal dementiaidiopathic normal pressure hydrocephalusneurodegenerative diseasesC9ORF72
Journal Article 2017-06-07 No Snippets Adam A, Robison J, Lu J, Jose R, Badran N, Vivas-Buitrago T, Rigamonti D, Sattar A, Omoush O, Hammad M, Dawood M, Maghaslah M, Belcher T, Carson K, Hoffberger J, Jusué Torres I, Foley S, Yasar S, Thai QA, Wemmer J, Klinge P, Al-Mutawa L, Al-Ghamdi H, Carson KA, Asgari M, de Zélicourt D, Kurtcuoglu V, Garnotel S, Salmon S, Balédent O, Lokossou A, Page G, Balardy L, Czosnyka Z, Payoux P, Schmidt EA, Zitoun M, Sevestre MA, Alperin N, Baudracco I, Craven C, Matloob S, Thompson S, Haylock Vize P, Thorne L, Watkins LD, Toma AK, Bechter K, Pong AC, Jugé L, Bilston LE, Cheng S, Bradley W, Hakim F, Ramón JF, Cárdenas MF, Davidson JS, García C, González D, Bermúdez S, Useche N, Mejía JA, Mayorga P, Cruz F, Martinez C, Matiz MC, Vallejo M, Ghotme K, Soto HA, Riveros D, Buitrago A, Mora M, Murcia L, Bermudez S, Cohen D, Dasgupta D, Curtis C, Domínguez L, Remolina AJ, Grijalba MA, Whitehouse KJ, Edwards RJ, Eleftheriou A, Lundin F, Fountas KN, Kapsalaki EZ, Smisson HF, Robinson JS, Fritsch MJ, Arouk W, Garzon M, Kang M, Sandhu K, Baghawatti D, Aquilina K, James G, Thompson D, Gehlen M, Schmid Daners M, Eklund A, Malm J, Gomez D, Guerra M, Jara M, Flores M, Vío K, Moreno I, Rodríguez S, Ortega E, Rodríguez EM, McAllister JP, Guerra MM, Morales DM, Sival D, Jimenez A, Limbrick DD, Ishikawa M, Yamada S, Yamamoto K, Junkkari A, Häyrinen A, Rauramaa T, Sintonen H, Nerg O, Koivisto AM, Roine RP, Viinamäki H, Soininen H, Luikku A, Jääskeläinen JE, Leinonen V, Kehler U, Lilja-Lund O, Kockum K, Larsson EM, Riklund K, Söderström L, Hellström P, Laurell K, Kojoukhova M, Sutela A, Vanninen R, Vanha KI, Timonen M, Rummukainen J, Korhonen V, Helisalmi S, Solje E, Remes AM, Huovinen J, Paananen J, Hiltunen M, Kurki M, Martin B, Loth F, Luciano M, Luikku AJ, Hall A, Herukka SK, Mattila J, Lötjönen J, Alafuzoff I, Jurjević I, Miyajima M, Nakajima M, Murai H, Shin T, Kawaguchi D, Akiba C, Ogino I, Karagiozov K, Arai H, Reis RC, Teixeira MJ, Valêncio CG, da Vigua D, Almeida-Lopes L, Mancini MW, Pinto FCG, Maykot RH, Calia G, Tornai J, Silvestre SSS, Mendes G, Sousa V, Bezerra B, Dutra P, Modesto P, Oliveira MF, Petitto CE, Pulhorn H, Chandran A, McMahon C, Rao AS, Jumaly M, Solomon D, Moghekar A, Relkin N, Hamilton M, Katzen H, Williams M, Bach T, Zuspan S, Holubkov R, Rigamonti A, Clemens G, Sharkey P, Sanyal A, Sankey E, Rigamonti K, Naqvi S, Hung A, Schmidt E, Ory-Magne F, Gantet P, Guenego A, Januel AC, Tall P, Fabre N, Mahieu L, Cognard C, Gray L, Buttner-Ennever JA, Takagi K, Onouchi K, Thompson SD, Thorne LD, Tully HM, Wenger TL, Kukull WA, Doherty D, Dobyns WB, Moran D, Vakili S, Patel MA, Elder B, Goodwin CR, Crawford JA, Pletnikov MV, Xu J, Blitz A, Herzka DA, Guerrero-Cazares H, Quiñones-Hinojosa A, Mori S, Saavedra P, Treviño H, Maitani K, Ziai WC, Eslami V, Nekoovaght-Tak S, Dlugash R, Yenokyan G, McBee N, Hanley DF.
Show Full Abstract

No abstract available.

Also flagged:Nonalcoholic fatty liver diseaseNAFLDliver diseasenonalcoholic steatohepatitishepatic steatosisliver fibrosis
Journal Article 2017-06-07 ✓ 1 Snippet Brunt EM.
In-Text Gene Mentions

…AIH, 21 alcohol,hemochromatosis, and even drug‐induced…

Show Full Abstract

Nonalcoholic fatty liver disease (NAFLD) is one of the most common underlying causes of chronically elevated liver tests and liver disease in adults and children worldwide and may be strongly suspected if not diagnosed by ever evolving and available serologic and imaging-based noninvasive tests. However, the definitive diagnosis of the most progressive form of NAFLD, nonalcoholic steatohepatitis, and the identification of fibrosis stage still require liver biopsy evaluation as noninvasive testing has not replaced some of the specifics or the totality of information obtainable from liver biopsy. In this review, both the role and value of a liver biopsy evaluation in NAFLD/ nonalcoholic steatohepatitis are examined from publications related to a selected variety of settings. Details of the most commonly used semiquantitative methods of analysis are discussed, and some useful potential pitfalls for differential diagnostic consideration in liver biopsy interpretation are given. (<i>Hepatology Communications</i> 2017;1:370-378).

Also flagged:bone morphogenetic proteinsBMPsparathyroid hormonePTHbone formationmagnesium
Journal Article 2017-06-07 No Snippets Wang W, Yeung KWK.
Show Full Abstract

Bone grafts have been predominated used to treat bone defects, delayed union or non-union, and spinal fusion in orthopaedic clinically for a period of time, despite the emergency of synthetic bone graft substitutes. Nevertheless, the integration of allogeneic grafts and synthetic substitutes with host bone was found jeopardized in long-term follow-up studies. Hence, the enhancement of osteointegration of these grafts and substitutes with host bone is considerably important. To address this problem, addition of various growth factors, such as bone morphogenetic proteins (BMPs), parathyroid hormone (PTH) and platelet rich plasma (PRP), into structural allografts and synthetic substitutes have been considered. Although clinical applications of these factors have exhibited good bone formation, their further application was limited due to high cost and potential adverse side effects. Alternatively, bioinorganic ions such as magnesium, strontium and zinc are considered as alternative of osteogenic biological factors. Hence, this paper aims to review the currently available bone grafts and bone substitutes as well as the biological and bio-inorganic factors for the treatments of bone defect.

Also flagged:Collagenbrain injurycerebrovascular diseaseextracellularwound healingstroke
Journal Article 2017-06-06 No Snippets Lee JC, Volpicelli EJ.
Show Full Abstract

Calvarial defects are common reconstructive dilemmas secondary to a variety of etiologies including traumatic brain injury, cerebrovascular disease, oncologic resection, and congenital anomalies. Reconstruction of the calvarium is generally undertaken for the purposes of cerebral protection, contour restoration for psychosocial well-being, and normalization of neurological dysfunction frequently found in patients with massive cranial defects. Current methods for reconstruction using autologous grafts, allogeneic grafts, or alloplastic materials have significant drawbacks that are unique to each material. The combination of wide medical relevance and the need for a better clinical solution render defects of the cranial skeleton an ideal target for development of regenerative strategies focused on calvarial bone. With the improved understanding of the instructive properties of tissue-specific extracellular matrices and the advent of precise nanoscale modulation in materials science, strategies in regenerative medicine have shifted in paradigm. Previously considered to be simple carriers of stem cells and growth factors, increasing evidence exists for differential materials directing lineage specific differentiation of progenitor cells and tissue regeneration. In this work, we review the clinical challenges for calvarial reconstruction, the anatomy and physiology of bone, and extracellular matrix-inspired, collagen-based materials that have been tested for in vivo cranial defect healing.

Also flagged:cancertumourcancersmismatch repairmethylationMLH1
Journal Article 2017-06-06 ✓ 2 Snippets Cortes-Ciriano I, Lee S, Park WY, Kim TM, Park PJ.
In-Text Gene Mentions

For instance, FAM129A, GMIP and NEK3 are altered in 107 (12%), 93 (10%) and 53 (6%) BRCA (breast cancer) tumours, respectively; ABT1 and SLC22A24 are altered in 19.6 and 14% of ACC (adrenocortical carcinoma) tumours; and ALPK2 and DPYSL2 are altered by frameshift MSI in 73 (17%) and 59 (14%) OV (ovarian serous cystadenocarcinoma) patients, respectively, but only in 62 of the remaining samples.

…cancer) tumours, respectively;ABT1and SLC22A24 are…

Show Full Abstract

Microsatellite instability (MSI) refers to the hypermutability of short repetitive sequences in the genome caused by impaired DNA mismatch repair. Although MSI has been studied for decades, large amounts of sequencing data now available allows us to examine the molecular fingerprints of MSI in greater detail. Here, we analyse ∼8,000 exomes and ∼1,000 whole genomes of cancer patients across 23 cancer types. Our analysis reveals that the frequency of MSI events is highly variable within and across tumour types. We also identify genes in DNA repair and oncogenic pathways recurrently subject to MSI and uncover non-coding loci that frequently display MSI. Finally, we propose a highly accurate exome-based predictive model for the MSI phenotype. These results advance our understanding of the genomic drivers and consequences of MSI, and our comprehensive catalogue of tumour-type-specific MSI loci will enable panel-based MSI testing to identify patients who are likely to benefit from immunotherapy.

Also flagged:schizophreniaL1retrotranspositionPDSERI1 exoribonuclease family member 3membrane
Journal Article 2017-06-06 No Snippets Doyle GA, Crist RC, Karatas ET, Hammond MJ, Ewing AD, Ferraro TN, Hahn CG, Berrettini WH.
Show Full Abstract

Whereas some rare genetic variants convey high risk for schizophrenia (SZ), common alleles conveying even moderate risk remain elusive. Long interspersed element-1s (L1) are mobile retrotransposons comprising ~17% of the human genome. L1 retrotransposition can cause somatic mosaicism during neurodevelopment by insertional mutagenesis. We hypothesized that, compared to controls, patients diagnosed with schizophrenia (PDS) may have increased numbers of deleterious L1 insertions, perhaps occurring de novo, in brain-expressed genes of dorsolateral prefrontal cortex (DLPFC) neurons. Neuronal and non-neuronal nuclei were separated by fluorescence-activated cell sorting from postmortem DLPFC of 36 PDS and 26 age-matched controls. Genomic sequences flanking the 3'-side of L1s were amplified from neuronal DNA, and neuronal L1 libraries were sequenced. Aligned sequences were analyzed for L1 insertions using custom bioinformatics programs. Ontology and pathway analyses were done on lists of genes putatively disrupted by L1s in PDS and controls. Cellular or population allele frequencies of L1s were assessed by droplet digital PCR or Taqman genotyping. We observed a statistically significant increase in the proportion of intragenic novel L1s in DLPFC of PDS. We found over-representation of L1 insertions within the gene ontologies 'cell projection' and 'postsynaptic membrane' in the gene lists derived from PDS samples, but not from controls. Cellular allele frequencies of examined L1 insertions indicated heterozygosity in genomes of DLPFC cells. An L1 within ERI1 exoribonuclease family member 3 (ERI3) was found to associate with SZ. These results extend prior work documenting increased L1 genetic burden in the brains of PDS and also identify unique genes that may provide new insight into the pathophysiology of schizophrenia.

Also flagged:attention-deficit/hyperactivity disorderADHDtelomerase reverse transcriptaseTERTNPSR1ESR1
Journal Article 2017-06-06 ✓ 3 Snippets van der Meer D, Hoekstra PJ, van Donkelaar M, Bralten J, Oosterlaan J, Heslenfeld D, Faraone SV, Franke B, Buitelaar JK, Hartman CA.
In-Text Gene Mentions

ADHD has been associated with polymorphisms in the glucocorticoid and mineralocorticoid receptor genes NR3C1 and NR3C2,18 which provide negative feedback to the HPA axis when activated by cortisol.19 We have found that NR3C1 interacts with psychosocial stress on ADHD severity, and that this gene–environment interaction (G × E) is further moderated by the serotonin transporter gene 5-HTT.20 Serotonin signaling is tightly coupled to the regulation of HPA axis activity,21 and 5-HTT is one of several serotonergic genes that have been repeatedly linked to ADHD.22, 23 The most extensively studied candidate genes for ADHD, the dopamine transporter (DAT1) and dopamine receptor D4 (DRD4) are also known to influence the effect of stressors on HPA axis activity.24, 25 Besides reports of G × E, stress-response genes have also been found to moderate each other’s effects on the HPA axis,26, 27 illustrating the complexity of the genetic architecture underlying the stress-response pathway.

…serotonin transporter gene5-HTT.…

…activity, 21 and5-HTTis one of…

Show Full Abstract

Identifying genetic variants contributing to attention-deficit/hyperactivity disorder (ADHD) is complicated by the involvement of numerous common genetic variants with small effects, interacting with each other as well as with environmental factors, such as stress exposure. Random forest regression is well suited to explore this complexity, as it allows for the analysis of many predictors simultaneously, taking into account any higher-order interactions among them. Using random forest regression, we predicted ADHD severity, measured by Conners' Parent Rating Scales, from 686 adolescents and young adults (of which 281 were diagnosed with ADHD). The analysis included 17 374 single-nucleotide polymorphisms (SNPs) across 29 genes previously linked to hypothalamic-pituitary-adrenal (HPA) axis activity, together with information on exposure to 24 individual long-term difficulties or stressful life events. The model explained 12.5% of variance in ADHD severity. The most important SNP, which also showed the strongest interaction with stress exposure, was located in a region regulating the expression of telomerase reverse transcriptase (TERT). Other high-ranking SNPs were found in or near NPSR1, ESR1, GABRA6, PER3, NR3C2 and DRD4. Chronic stressors were more influential than single, severe, life events. Top hits were partly shared with conduct problems. We conclude that random forest regression may be used to investigate how multiple genetic and environmental factors jointly contribute to ADHD. It is able to implicate novel SNPs of interest, interacting with stress exposure, and may explain inconsistent findings in ADHD genetics. This exploratory approach may be best combined with more hypothesis-driven research; top predictors and their interactions with one another should be replicated in independent samples.

Also flagged:serotonin transporter5serotoninageingdementiamembrane
Journal Article 2017-06-06 ✓ 5 Snippets Imlach AR, Ward DD, Vickers JC, Summers MJ, Felmingham KL.
In-Text Gene Mentions

A key biological regulator of serotonin function is the serotonin transporter gene (5-HTT), which encodes a presynaptic membrane-bound protein responsible for the re-uptake of serotonin from the synaptic cleft.6 A common polymorphism within the 5-HTT promoter region, serotonin transporter-linked polymorphic region (5-HTTLPR) is considered to influence the efficiency of serotonin re-uptake by the presynaptic 5-HTT.7 This polymorphism results in two alleles that differ in length: short ‘S’ and long ‘L’, with the S allele associated with reduced transcription of 5-HTT, fewer 5-HTT sites, less binding potential and therefore potentially less modulation of serotonin at the synapse.7, 8 A positron emission tomography study also linked higher verbal memory performance with greater 5-HTT availability in the prefrontal and parietal cortices of ecstasy users.9

To explore the impact of serotonin on memory function in the ageing brain, the aim of the present study was to examine the effect of a functional polymorphism of the 5-HTT gene (5-HTTLPR) on visual and verbal episodic memory performance, either independently or through interaction with age and gender, in healthy older adults.

…transporter gene (5-HTT), which encodes…

…polymorphism within the5-HTTpromoter region, serotonin…

…by the presynaptic5-HTT.…

Show Full Abstract

The S allele of the functional 5-HTTLPR polymorphism has previously been associated with reductions in memory function. Given the change in function of the serotonergic system in older adults, and the functional consequences of memory decline in this age group, further investigation into the impact of 5-HTTLPR in healthy older adults is required. This investigation examined the effect of 5-HTTLPR variants (S carriers versus L/L homozygotes) on verbal and visual episodic memory in 438 healthy older adults participating in the Tasmanian Healthy Brain Project (age range 50-79 years, M=60.35, s.d.=6.75). Direct effects of 5-HTTLPR on memory processes, in addition to indirect effects through interaction with age and gender, were assessed. Although no direct effects of 5-HTTLPR on memory processes were identified, our results indicated that gender significantly moderated the impact that 5-HTTLPR variants exerted on the relationship between age and verbal episodic memory function as assessed by the Rey Auditory Verbal Learning Test. No significant direct or indirect effects were identified in relation to visual memory performance. Overall, this investigation found evidence to suggest that 5-HTTLPR genotype affects the association of age and verbal episodic memory for males and females differently, with the predicted negative effect of S carriage present in males but not females. Such findings indicate a gender-dependent role for 5-HTTLPR in the verbal episodic memory system of healthy older adults.

Also flagged:ATXN3ATXN2ATXN1ATN1TBPATXN7
Journal Article 2017-06-06 ✓ 5 Snippets Gardiner SL, van Belzen MJ, Boogaard MW, van Roon-Mom WMC, Rozing MP, van Hemert AM, Smit JH, Beekman ATF, van Grootheest G, Schoevers RA, Oude Voshaar RC, Comijs HC, Penninx BWJH, van der Mast RC, Roos RAC, Aziz NA.
In-Text Gene Mentions

Recently, we showed that both relatively short and relatively long cytosine–adenine–guanine (CAG) repeats in the huntingtin gene (HTT) are associated with an increased risk of lifetime depression.

Huntington disease is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene.13, 14 Recently, we demonstrated that both relatively short and relatively large CAG repeats in the longer HTT allele are associated with lifetime depression, suggesting that repeat polymorphisms could also act as complex genetic modifiers of depression and account for part of its ‘missing heritability’.15

…huntingtin gene (HTT) are associated…

…the huntingtin (HTT) gene.…

…The effects ofHTT, ATXN7 and…

Show Full Abstract

Depression is one of the most prevalent and debilitating psychiatric disorders worldwide. Recently, we showed that both relatively short and relatively long cytosine-adenine-guanine (CAG) repeats in the huntingtin gene (HTT) are associated with an increased risk of lifetime depression. However, to what extent the variations in CAG repeat length in the other eight polyglutamine disease-associated genes (PDAGs) are associated with depression is still unknown. We determined the CAG repeat sizes of ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, ATN1 and AR in two well-characterized Dutch cohorts-the Netherlands Study of Depression and Anxiety and the Netherlands Study of Depression in Older Persons-including 2165 depressed and 1058 non-depressed individuals-aged 18-93 years. The association between PDAG CAG repeat size and the risk for depression was assessed via binary logistic regression. We found that the odds ratio (OR) for lifetime depression was significantly higher for individuals with >10, compared with subjects with ≤10, CAG repeats in both ATXN7 alleles (OR=1.90, confidence interval (CI) 1.26-2.85). For TBP we found a similar association: A CAG repeat length exceeding the median in both alleles was associated with an increased risk for lifetime depression (OR=1.33, CI 1.00-1.76). In conclusion, we observed that carriers of either ATXN7 or TBP alleles with relatively large CAG repeat sizes in both alleles had a substantially increased risk of lifetime depression. Our findings provide critical evidence for the notion that repeat polymorphisms can act as complex genetic modifiers of depression.

Also flagged:MYCNNeuroblastomaNBsolid tumourgene expressiontumours
Journal Article 2017-06-06 No Snippets Megiorni F, Colaiacovo M, Cialfi S, McDowell HP, Guffanti A, Camero S, Felsani A, Losty PD, Pizer B, Shukla R, Cappelli C, Ferrara E, Pizzuti A, Moles A, Dominici C.
Show Full Abstract

Neuroblastoma (NB) originates from neural crest-derived precursors and represents the most common childhood extracranial solid tumour. MicroRNAs (miRNAs), a class of small non-coding RNAs that participate in a wide variety of biological processes by regulating gene expression, appear to play an essential role within the NB context. High-throughput next generation sequencing (NGS) was applied to study the miRNA transcriptome in a cohort of NB tumours with and without MYCN-amplification (MNA and MNnA, respectively) and in dorsal root ganglia (DRG), as a control. Out of the 128 miRNAs differentially expressed in the NB vs. DRG comparison, 47 were expressed at higher levels, while 81 were expressed at lower levels in the NB tumours. We also found that 23 miRNAs were differentially expressed in NB with or without MYCN-amplification, with 17 miRNAs being upregulated and 6 being downregulated in the MNA subtypes. Functional annotation analysis of the target genes of these differentially expressed miRNAs demonstrated that many mRNAs were involved in cancer-related pathways, such as DNA-repair and apoptosis as well as FGFR and EGFR signalling. In particular, we found that miR-628-3p negatively affects MYCN gene expression. Furthermore, we identified a novel miRNA candidate with variable expression in MNA vs. MNnA tumours, whose putative target genes are implicated in the mTOR pathway. The present study provides further insight into the molecular mechanisms that correlate miRNA dysregulation to NB development and progression.

Also flagged:Low-grade gliomascell proliferationepithelial growth factor receptornerve growth factorson of sevenless homolog 1metabolism
Journal Article 2017-06-06 ✓ 3 Snippets Liu X, Song B, Li S, Wang N, Yang H.
In-Text Gene Mentions

Hematopoietic prostaglandin D synthase (HPGDS) and prostaglandin I2 (prostacyclin) synthase (PTGIS) were involved in the arachidonic acid metabolism.

…(prostacyclin) synthase (PTGIS) were involved…

…, HPGDS andPTGISwere significantly enriched…

Show Full Abstract

Low-grade gliomas (LGGs) are associated with neurological disability. The present study used microRNA (miRNA) expression profiles to identify risk miRNAs for potential prognosis of cerebral LGGs. miRNA expression profiles and clinical data from 408 patients with cerebral LGGs were obtained from the Cancer Genome Atlas database. Risk miRNAs were identified by plotting Kaplan‑Meier curves and Cox proportional hazard regression analysis with the survival and KMsurv packages in R. A regulatory network of miRNA‑targets was constructed, followed by gene ontology (GO) function and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis using the Database for Annotation, Visualization and Integrated Discovery. A protein‑protein interaction (PPI) network of miRNA targets was built using Search Tool for the Retrieval of Interacting Genes software, and sub‑pathway identification was performed using the iSubpathwayMiner package in R. In total, 39 miRNAs had significant effect on survival curves. Following the Cox analysis and construction of miRNA‑targets regulatory network, hsa‑miRNA (miR)‑326 was identified to regulate 397 target genes. Additionally, targets of miR‑326 were primarily enriched in the GO terms of cell proliferation, epithelial growth factor receptor and nerve growth factor signaling pathways. Additionally, son of sevenless homolog 1 (SOS1), neuroblastoma RAS viral oncogene homolog (NRAS), vitamin D receptor (VDR) and mothers against decapentaplegic family member 3 (SMAD3) were most enriched in the PPI network. Targets of miR‑326 were primarily enriched in sub‑pathways including sphingolipid metabolism and arachidonic acid metabolism, in which sphingomyelin synthase 1 (SGMS1) and hematopoietic prostaglandin D synthase (HPGDS) were screened out. Hsa‑miR‑326 was identified as a risk miRNA for prognosis and may improve the outcome prediction of patients with cerebral LGG. This miRNA may regulate cancer cell proliferation by targeting SOS1, NRAS, VDR, SMAD3, SGMS1 and HPGDS.

Also flagged:alcoholcancershead and neck canceroral cancernasopharyngeal carcinomacancer
Journal Article 2017-06-06 No Snippets Wang TH, Hsia SM, Shih YH, Shieh TM.
Show Full Abstract

Numerous environmental factors such as diet, alcohol use, stress, and environmental chemicals are known to elicit epigenetic changes, leading to increased rates of cancers and other diseases. The incidence of head and neck cancer, one of the most common cancers in Taiwanese males, is increasing: oral cancer and nasopharyngeal carcinoma are ranked fourth and tenth respectively, among the top ten cancers in this group, and a major cause of cancer-related deaths in Taiwanese males. Previous studies have identified smoking, alcohol use, and betel quid chewing as the three major causes of head and neck cancers; these three social habits are commonly observed in Taiwanese males, resulting in an increasing morbidity rate of head and neck cancers in this population. In this literature review, we discuss the association between specific components of betel quid, alcohol, and tobacco, and the occurrence of head and neck cancers, lung cancer, gastrointestinal cancers, and urethral cancer. We focus on regulatory mechanisms at the epigenetic level and their oncogenic effects. The review further discusses the application of FDA-approved epigenetic drugs as therapeutic strategies against cancer.

Also flagged:chondrogenesisBioluminescencegene expressionmetabolismluciferinluciferases
Journal Article 2017-06-06 No Snippets Je HJ, Kim MG, Kwon HJ.
Show Full Abstract

Since articular cartilage has a limited regeneration potential, for developing biological therapies for cartilage regeneration it is important to study the mechanisms underlying chondrogenesis of stem cells. Bioluminescence assays can visualize a wide range of biological phenomena such as gene expression, signaling, metabolism, development, cellular movements, and molecular interactions by using visible light and thus contribute substantially to elucidation of their biological functions. This article gives a concise review to introduce basic principles of bioluminescence assays and applications of the technology to visualize the processes of chondrogenesis and cartilage regeneration. Applications of bioluminescence assays have been highlighted in the methods of real-time monitoring of gene expression and intracellular levels of biomolecules and noninvasive cell tracking within animal models. This review suggests that bioluminescence assays can be applied towards a visual understanding of chondrogenesis and cartilage regeneration.

Also flagged:SynthesisHydroxyapatiteCancerandrographolideepidermoid skin cancerEpidermoid Carcinoma
Journal Article 2017-06-06 No Snippets Govindan B, Swarna Latha B, Nagamony P, Ahmed F, Saifi MA, Harrath AH, Alwasel S, Mansour L, Alsharaeh EH.
Show Full Abstract

Superparamagnetic Fe₃O₄ nanoparticles on hydroxyapatite nanorod based nanostructures (Fe₃O₄/HAp) were synthesized using hydrothermal techniques at 180 °C for 12 h and were used as drug delivery nanocarriers for cancer cell therapeutic applications. The synthesized Fe₃O₄/HAp nanocomposites were characterized by X-ray diffraction analysis (XRD), Field emission scanning electron microscopy (FESEM), Fourier transform infrared spectroscopy (FTIR), Brunauer-Emmett-Teller (BET)-analysis, and vibrating sample magnetometry (VSM). The morphologies of the Fe₃O₄/HAp nanocomposites show 15 nm Fe₃O₄ nanoparticles dispersed in the form of rods. The BET result shows that the synthesized samples have a high specific surface area of 80 m² g<sup>-1</sup> with mesoporous structures. Magnetic measurements revealed that the sample has high saturation magnetization of 18 emu/g with low coercivity. The Fe₃O₄/HAp nanocomposites had a large specific surface area (SSA), high mesoporous volume, and good magnetic property, which made it a suitable nanocarrier for targeted drug delivery systems. The chemotherapeutic agent, andrographolide, was used to investigate the drug delivery behavior of the Fe₃O₄/HAp nanocomposites. The human epidermoid skin cancer cells (A431) were used as the model targeting cell lines by treating with andrographolide loaded Fe₃O₄/HAp nanosystems and were further evaluated for their antiproliferative activities and the induction of apoptosis. Also, the present nanocomposite shows better biocompatibility, therefore it can be used as suitable drug vehicle for cancer therapy applications.

Also flagged:skin inflammationcancerskin cancer16S ribosomal RNA (rRNA)16S rRNANell2
Journal Article 2017-06-06 No Snippets Belheouane M, Gupta Y, Künzel S, Ibrahim S, Baines JF.
Show Full Abstract

<h4>Background</h4>Recent studies highlight the utility of quantitative trait locus (QTL) mapping for determining the contribution of host genetics to interindividual variation in the microbiota. We previously demonstrated that similar to the gut microbiota, abundances of bacterial taxa in the skin are significantly influenced by host genetic variation. In this study, we analyzed the skin microbiota of mice from the 15th generation of an advanced intercross line using a novel approach of extending bacterial trait mapping to both the 16S rRNA gene copy (DNA) and transcript (RNA) levels, which reflect relative bacterial cell number and activity, respectively.<h4>Results</h4>Remarkably, the combination of highly recombined individuals and 53,203 informative SNPs allowed the identification of genomic intervals as small as <0.1 megabases containing single genes. Furthermore, the inclusion of 16S rRNA transcript-level mapping dramatically increased the number of significant associations detected, with five versus 21 significant SNP-bacterial trait associations based on DNA- compared to RNA-level profiling, respectively. Importantly, the genomic intervals identified contain many genes involved in skin inflammation and cancer and are further supported by the bacterial traits they influence, which in some cases have known genotoxic or probiotic capabilities.<h4>Conclusions</h4>These results indicate that profiling based on the relative activity levels of bacterial community members greatly enhances the capability of detecting interactions between the host and its associated microbes. Finally, the identification of several genes involved in skin cancer suggests that similar to colon carcinogenesis, the resident microbiota may play a role in skin cancer susceptibility and its potential prevention and/or treatment.

Also flagged:ShikoninSignal transducer and activator of transcription 3STAT3tumorscancerbinding
Journal Article 2017-06-06 No Snippets Qiu HY, Zhu X, Luo YL, Lin HY, Tang CY, Qi JL, Pang YJ, Yang RW, Lu GH, Wang XM, Yang YH.
Show Full Abstract

Signal transducer and activator of transcription 3 (STAT3) is hyper-activated in diversiform human tumors and has been validated as an attractive therapeutic target. Current research showed that a natural product, shikonin, along with its synthetic analogues, is able to inhibit the activity of STAT3 potently. The potential space of shikonin in developing novel anti-cancer agents encouraged us to carry out the investigation of the probable binding mode with STAT3. From this foundation, we have designed new types of STAT3 SH2 inhibitors. Combined simulations were performed to filter for the lead compound, which was then substituted, synthesized and evaluated by a variety of bioassays. Among the entities, PMM-172 exhibited the best anti-proliferative activity against MDA-MB-231 cells with IC<sub>50</sub> value 1.98 ± 0.49 μM. Besides, it was identified to decrease luciferase activity, induce cell apoptosis and reduce mitochondrial transmembrane potential in MDA-MB-231 cells. Also, PMM-172 inhibited constitutive/inducible STAT3 activation without affecting STAT1 and STAT5 in MDA-MB-231 cells, and had no effect in non-tumorigenic MCF-10A cells. Moreover, PMM-172 suppressed STAT3 nuclear localization and STAT3 downstream target genes expression. Overall, these results indicate that the antitumor activity of PMM-172 is at least partially due to inhibition of STAT3 in breast cancer cells.

Also flagged:PCDH18Protocadherin18colorectal cancermethylationtumordemethylation
Journal Article 2017-06-06 ✓ 5 Snippets Zhou D, Tang W, Su G, Cai M, An HX, Zhang Y.
In-Text Gene Mentions

Recent studies demonstrated that some protocadherins act as tumor suppressors through interacting with Wnt/β-catenin signaling pathway, including PCDH8, PCDH10, PCDH17 and PCDH2015, 30, 31.

…PCDHs including PCDH8,PCDH17and PCDH20 were…

…subgroup as PCDH8,PCDH17and PCDH20 and…

…To explore whetherPCDH17influenced cell cycle,…

…including PCDH8, PCDH10,PCDH17and PCDH20 15…

Show Full Abstract

Protocadherin18 (PCDH18) was found to be preferentially methylated and inactivated in colorectal cancer (CRC) using bioinformatics tools. However, its biologic role in tumorgenesis remains unclear. Herein, we aimed to elucidate its epigenetic regulation and biological functions in CRC. The methylation status of PCDH18 was significant higher in CRC tissues than in adjacent non-tumor tissues (median, 15.17% vs. median, 0.4438%). Expression level of PCDH18 was significantly lower in primary CRCs than in nonmalignant tissues. Importantly, methylation status of PCDH18 in cell-free DNA of CRC patients was also significantly higher than in healthy subjects. PCDH18 was readily expressed in NCM460 cells, but downregulated in 100% (4/4) of CRC cell lines by promoter methylation, despite its expression could be restored through demethylation treatment. Overexpression of PCDH18 suppressed CRC cell viability, colony formation and migration. Meanwhile, the depletion of PCDH18 by siRNA in NCM460 cells enhanced the colonogenicity and migration ability and promoted β-catenin nuclear accumulation, whereas it inhibited cell cycle arrest. These effects were associated with upregulation of phospho-GSK-3β and cyclin D1, and downregulation of caspase3 and p21. Our results suggested that PCDH18 was a putative tumor suppressor with epigenetic silencing in CRC and a potential biomarker for CRC diagnosis.

Also flagged:ironmalariamalaria infectioninfectioniron deficiencyminerals
Journal Article 2017-06-06 No Snippets Aimone AM, Brown P, Owusu-Agyei S, Zlotkin SH, Cole DC.
Show Full Abstract

<h4>Objectives</h4>Patterns of infection among children with varying levels of iron status in a malaria endemic area may vary spatially in ways requiring integrated infection and iron deficiency control programmes. The objective of this secondary analysis was to determine the geospatial factors associated with malaria and non-malaria infection status among young Ghanaian children at the end of a 5-month iron intervention trial.<h4>Design</h4>Cluster-randomised controlled trial.<h4>Setting</h4>Rural Ghana PARTICIPANTS: 1943 children (6-35 months of age) with geocoded compounds.<h4>Interventions</h4>Point-of-use fortification with micronutrient powders containing vitamins and minerals with or without iron.<h4>Primary and secondary outcome measures</h4>Generalised linear geostatistical models with a Matern spatial correlation function were used to analyse four infection response variables, defined using different combinations of inflammation (C-reactive protein, CRP >5 mg/L) and malaria parasitaemia. Analyses were also stratified by treatment group to assess the independent effects of the iron intervention.<h4>Results</h4>The by-group and combined-group analyses both showed that baseline infection status was the most consistent predictor of endline infection risk, particularly when infection was defined using parasitaemia. In the No-iron group, age above 24 months and weight-for-length z-score at baseline were associated with high CRP at endline. Higher asset score was associated with a 12% decreased odds of endline infection, defined as CRP >5 mg/L and/or parasitaemia (OR 0.88, 95% credible interval 0.78 to 0.98), regardless of group. Maps of the predicted risk and spatial random effects showed a defined low-risk area around the District centre, regardless of how infection was defined.<h4>Conclusion</h4>In a clinical trial setting of iron fortification, where all children receive treated bed nets and access to malaria treatment, there may be geographical variation in the risk of infection with distinct high-risk and low-risk areas, particularly around municipal centres.<h4>Trial registration number</h4>clinicaltrials.gov, NCT01001871.

Also flagged:cirrhosisPortal vein system thrombosisAntithrombin IIIvein system thrombosisvascular diseaseportal hypertension
Journal Article 2017-06-06 ✓ 5 Snippets Gong C, Qin X, Yang J, Guo T.
In-Text Gene Mentions

…including: Antithrombin III (ATIII), low-molecular-weight hepari…

…that application ofATIIIseemed to be…

…we know, preoperativeATIIIactivity plays a…

…decreased levels ofATIIIactivity, which are…

ATIIIcan prevent PVST…

Show Full Abstract

<h4>Objective</h4>To determine the best anticoagulation strategy for the patients who underwent splenectomy with cirrhosis through network meta-analysis.<h4>Methods</h4>We conducted a systematic review of the literature in PubMed, Embase, and the Cochrane Library database. We extracted data on incidence of Portal vein system thrombosis (PVST) from studies that compared various anticoagulation strategies for use with patients who underwent splenectomy with cirrhosis. Network meta-analysis was conducted in ADDIS by evaluating the different incidence of PVST. Consistency and inconsistency models were developed to identify differences among the therapeutic strategies. Cumulative probability was utilized to rank the strategies under examination. Results. A total of 11 studies containing 1153 patients were included in the network meta-analysis. The results revealed that the application of Antithrombin III was the best anticoagulation option for patients who underwent splenectomy with cirrhosis (P = 0.59). The data of consistency and inconsistency models exhibited basically consistent and showed good convergence.<h4>Conclusions</h4>Application of Antithrombin III seemed to be the best anticoagulation strategy for cirrhotic patients who underwent splenectomy and should be considered a first-choice clinical reference.

Also flagged:SMYD3SET and MYND domain containing 3histone methyltransferaseHMTtranscription factorbreast cancer
Journal Article 2017-06-06 No Snippets Chen D, Liu L, Luo X, Mu A, Yan L, Chen X, Wang L, Wang N, He H, Zhou H, Zhang T.
Show Full Abstract

SET and MYND domain containing 3 (SMYD3) is a histone methyltransferase (HMT) and transcription factor, which serves important roles in carcinogenesis. Numerous downstream target genes of SMYD3 have been identified in previous studies. However, the downstream microRNA (miRNA) s regulated by SMYD3 are yet to be elucidated. In the present study, the results of miRNA microarray demonstrated that 30 miRNA expression profiles were upregulated, whilst 24 miRNAs were downregulated by >2.0-fold in the SMYD3-overexpressed MCF-7 breast cancer cells. The HMT activity was demonstrated to be essential for SMYD3-mediated transactivation of miR-200c-3p and the overexpression of miR-200c-3p inhibited the transactivation effects of SMYD3 on myocardin-related transcription factor-A-dependent migration-associated genes. To our best knowledge, the current study is the first to report on the transcriptional regulation of SMYD3 on miRNAs, and miR-200c may be a downstream negative regulator of the SMYD3-mediated pathway in the migration of breast cancer cells. These results may provide a novel theoretical basis to understand the mechanisms underlying the initiation, progression, diagnosis, prevention and therapy of breast cancer.

Also flagged:hepatocellular carcinomatumormalignant tumorsviral infectionsalcoholobesity
Journal Article 2017-06-06 ✓ 1 Snippet Ding XX, Zhu QG, Zhang SM, Guan L, Li T, Zhang L, Wang SY, Ren WL, Chen XM, Zhao J, Lin S, Liu ZZ, Bai YX, He B, Zhang HQ.
In-Text Gene Mentions

…alcohol, obesity andhemochromatosis.…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the third most frequent cause of tumor-related mortality and there are an estimated approximately 850,000 new cases annually. Most HCC patients are diagnosed at middle or advanced stage, losing the opportunity of surgery. The development of HCC is promoted by accumulated diverse genetic mutations, which confer selective growth advantages to tumor cells and are called "driver mutations". The discovery of driver mutations provides a novel precision medicine strategy for late stage HCC, called targeted therapy. In this review, we summarized currently discovered driver mutations and corresponding signaling pathways, made an overview of identification methods of driver mutations and genes, and classified targeted drugs for HCC. The knowledge of mutational landscape deepen our understanding of carcinogenesis and promise future precision medicine for HCC patients.

Also flagged:serotonin transporterserotoninpsychopathologiesanxietynucleuslocalization
Journal Article 2017-06-05 No Snippets Luo Q, Holroyd T, Mitchell D, Yu H, Cheng X, Hodgkinson C, Chen G, McCaffrey D, Goldman D, Blair RJ.
Show Full Abstract

Short allele carriers (S-carriers) of the serotonin transporter gene (5-HTTLPR) show an elevated amygdala response to emotional stimuli relative to long allele carriers (LL-homozygous). However, whether this reflects increased responsiveness of the amygdala generally or interactions between the amygdala and the specific input systems remains unknown. It is argued that the amygdala receives input via a quick subcortical and a slower cortical pathway. If the elevated amygdala response in S-carriers reflects generally increased amygdala responding, then group differences in amygdala should be seen across the amygdala response time course. However, if the difference is a secondary consequence of enhanced amygdala-cortical interactions, then group differences might only be present later in the amygdala response. Using magnetoencephalography (MEG), we found an enhanced amygdala response to fearful expressions starting 40-50 ms poststimulus. However, group differences in the amygdala were only seen 190-200 ms poststimulus, preceded by increased superior temporal sulcus (STS) responses in S-carriers from 130 to 140 ms poststimulus. An enhanced amygdala response to angry expressions started 260-270 ms poststimulus with group differences in the amygdala starting at 160-170 ms poststimulus onset, preceded by increased STS responses in S-carriers from 150 to 160 ms poststimulus. These suggest that enhanced amygdala responses in S-carriers might reflect enhanced STS-amygdala connectivity in S-carriers. Hum Brain Mapp 38:4313-4321, 2017. © 2017 Wiley Periodicals, Inc.

Also flagged:spinal cord compression syndromesuperficial siderosismyelopathypathogenesisparaplegiaerectile dysfunction
Journal Article 2017-06-05 ✓ 1 Snippet Nasri A, Kacem I, Sidhom Y, Djebara MB, Gargouri A, Gouider R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Context</h4>Cervical root avulsion secondary to traumatic plexus injury is a rare etiology of superficial siderosis (SS) of the central nervous system (CNS). We describe the case of an isolated progressive compressive myelopathy revealing this complication and discuss the pathogenesis of such a presentation, its clinical and imaging peculiarities with a literature review.<h4>Findings</h4>We report on the case of a 48-year-old man with history of left brachial plexus injury at the age of 2 years. Since the age of 38 years, he had presented with a progressive paraplegia, bladder and erectile dysfunction, neuropathic pain and sensory level. The diagnosis was made by spinal cord and brain magnetic resonance follow-up imaging revealing hypointensity T2-weighted gradient echo linear dark rim around the entire neuraxis and cervical dural pseudomeningoceles. These MRI findings were suggestive of extensive hemosiderin deposition consolidating the diagnosis of SS of CNS.<h4>Conclusion/clinical relevance</h4>Our case report illustrates diagnosis difficulties in unusual or paucisymptomatic presentations of SS. A history of brachial plexus trauma with nerve root avulsion should prompt gradient-echo T2-weighted imaging to bring out such a complication. Superficial siderosis of the CNS should be included in the panel of differential diagnosis of the parethospastic syndromes and compressive myelopathy.

Also flagged:internalizing problemsanxietybehavioraldepressioninternalizing disordersanhedonia
Journal Article 2017-06-05 ✓ 1 Snippet Brock RL, Kochanska G, Boldt LJ.
In-Text Gene Mentions

5-HTT

Show Full Abstract

The present study demonstrates the interplay between interparental relationship satisfaction and child plasticity in the origins of internalizing problems in 99 community mothers, fathers, and children. Our cumulative measure of plasticity integrated genetics (5-HTTLPR polymorphism), psychophysiology (skin conductance level), and observed behavior (inhibition, sadness, joy). The interaction between plasticity and interparental relationship satisfaction reflected differential susceptibility. Compared with low-plasticity peers, high-plasticity children had more internalizing problems from 5.5 to 12 years when the interparental relationship at 4.5 years was acrimonious, but fewer problems when it was harmonious. Further, almost half of the children in this sample were "differentially affected" by the interaction such that greater plasticity was associated with fewer internalizing problems when their parents had a harmonious relationship, a key feature of differential susceptibility. (PsycINFO Database Record

Also flagged:GSK3βdegradationZNF322Aoncoproteinlung cancerzinc-finger 322A
Journal Article 2017-06-05 ✓ 2 Snippets Liao SY, Chiang CW, Hsu CH, Chen YT, Jen J, Juan HF, Lai WW, Wang YC.
In-Text Gene Mentions

CK1δ/GSK3β/FBXW7α axis promotes degradation of the ZNF322A oncoprotein to suppress lung cancer progression.

Overexpression of Cys2His2 zinc-finger 322A (ZNF322A) oncogenic transcription factor is associated with lung tumorigenesis.

Show Full Abstract

Overexpression of Cys2His2 zinc-finger 322A (ZNF322A) oncogenic transcription factor is associated with lung tumorigenesis. However, the mechanism of ZNF322A overexpression remains poorly understood. Here, we discover that protein stability of ZNF322A is regulated by coordinated phosphorylation and ubiquitination through the CK1δ/GSK3β/FBXW7α axis. CK1δ and GSK3β kinases sequentially phosphorylate ZNF322A at serine-396 and then serine-391. Moreover, the doubly phosphorylated ZNF322A protein creates a destruction motif for the ubiquitin ligase FBXW7α leading to ZNF322A protein destruction. Overexpression of FBXW7α induces ZNF322A protein degradation, thereby blocks ZNF322A transcription activity and suppresses ZNF322A-induced tumor growth and metastasis in vitro and in vivo. Clinically, overexpression of ZNF322A correlates with low FBXW7α or defective CK1δ/GSK3β-mediated phosphorylation in lung cancer patients. Multivariate Cox regression analysis indicates that patients with ZNF322A high/FBXW7 low expression profile can be used as an independent factor to predict the clinical outcome in lung cancer patients. Our results reveal a new mechanism of ZNF322A oncoprotein destruction regulated by the CK1δ/GSK3β/FBXW7α axis. Deregulation of this signaling axis results in ZNF322A overexpression and promotes cancer progression.

Also flagged:deathGlucocorticoidstopoisomerase IIacute lymphoblastic leukaemiaALLglucocorticoid receptor
Journal Article 2017-06-05 No Snippets Qattan MY, Bakker EY, Rajendran R, Chen DW, Saha V, Liu J, Zeef L, Schwartz JM, Mutti L, Demonacos C, Krstic-Demonacos M.
Show Full Abstract

Glucocorticoids (GCs) and topoisomerase II inhibitors are used to treat acute lymphoblastic leukaemia (ALL) as they induce death in lymphoid cells through the glucocorticoid receptor (GR) and p53 respectively. Mechanisms underlying ALL cell death and the contribution of the bone marrow microenvironment to drug response/resistance remain unclear. The role of the microenvironment and the identification of chemoresistance determinants were studied by transcriptomic analysis in ALL cells treated with Dexamethasone (Dex), and Etoposide (Etop) grown in the presence or absence of bone marrow conditioned media (CM). The necroptotic (RIPK1) and the apoptotic (caspase-8/3) markers were downregulated by CM, whereas the inhibitory effects of chemotherapy on the autophagy marker Beclin-1 (BECN1) were reduced suggesting CM exerts cytoprotective effects. GCs upregulated the RIPK1 ubiquitinating factor BIRC3 (cIAP2), in GC-sensitive (CEM-C7-14) but not in resistant (CEM-C1-15) cells. In addition, CM selectively affected GR phosphorylation in a site and cell-specific manner. GR is recruited to RIPK1, BECN1 and BIRC3 promoters in the sensitive but not in the resistant cells with phosphorylated GR forms being generally less recruited in the presence of hormone. FACS analysis and caspase-8 assays demonstrated that CM promoted a pro-survival trend. High molecular weight proteins reacting with the RIPK1 antibody were modified upon incubation with the BIRC3 inhibitor AT406 in CEM-C7-14 cells suggesting that they represent ubiquitinated forms of RIPK1. Our data suggest that there is a correlation between microenvironment-induced ALL proliferation and altered response to chemotherapy.

Also flagged:metaphasekinetochoremicrotubulechromatinkinetochoreschromosomes
Journal Article 2017-06-05 ✓ 1 Snippet Salmon ED, Bloom K.
In-Text Gene Mentions

Condensin

Show Full Abstract

At metaphase in mitotic cells, pulling forces at the kinetochore-microtubule interface create tension by stretching the centromeric chromatin between oppositely oriented sister kinetochores. This tension is important for stabilizing the end-on kinetochore microtubule attachment required for proper bi-orientation of sister chromosomes as well as for satisfaction of the Spindle Assembly Checkpoint and entry into anaphase. How force is coupled by proteins to kinetochore microtubules and resisted by centromere stretch is becoming better understood as many of the proteins involved have been identified. Recent application of genetically encoded fluorescent tension sensors within the mechanical linkage between the centromere and kinetochore microtubules are beginning to reveal - from live cell assays - protein specific contributions that are functionally important.

Also flagged:Gene expressiontranscription factorscancerepithelial cancersmetabolismDevelopmental Disorders
Journal Article 2017-06-05 ✓ 1 Snippet Babbitt CC, Haygood R, Nielsen WJ, Wray GA.
In-Text Gene Mentions

…, POU3F1 andPOU3F2, GATA1 ,…

Show Full Abstract

<h4>Background</h4>Despite evidence for adaptive changes in both gene expression and non-protein-coding, putatively regulatory regions of the genome during human evolution, the relationship between gene expression and adaptive changes in cis-regulatory regions remains unclear.<h4>Results</h4>Here we present new measurements of gene expression in five tissues of humans and chimpanzees, and use them to assess this relationship. We then compare our results with previous studies of adaptive noncoding changes, analyzing correlations at the level of gene ontology groups, in order to gain statistical power to detect correlations.<h4>Conclusions</h4>Consistent with previous studies, we find little correlation between gene expression and adaptive noncoding changes at the level of individual genes; however, we do find significant correlations at the level of biological function ontology groups. The types of function include processes regulated by specific transcription factors, responses to genetic or chemical perturbations, and differentiation of cell types within the immune system. Among functional categories co-enriched with both differential expression and noncoding adaptation, prominent themes include cancer, particularly epithelial cancers, and neural development and function.

Also flagged:androgen receptortriple-negative breast cancerestrogen receptor beta 1breast cancerARcell migration
Journal Article 2017-06-05 No Snippets Song W, Tang L, Xu Y, Sun Q, Yang F, Guan X.
Show Full Abstract

<h4>Background</h4>Increasing evidence has indicated an important role for estrogen receptor beta 1 (ERβ1) in breast cancer. However, the role of ERβ1 in the metastasis of androgen receptor (AR)-positive triple-negative breast cancer (TNBC) and the underlying mechanisms are still unknown.<h4>Methods</h4>Stable ERβ1-expressing TNBC cell lines were generated for this study. We detected the abilities of cell migration and invasion by wound-healing and transwell assays and the expression of E-cadherin and N-cadherin by quantitative RT-PCR (qRT-PCR) and western blotting assays in TNBC cell lines. Chromatin immunoprecipitation (ChIP) analysis was performed to assess the effect of AR on ERβ1 promoter. Tumor metastasis was evaluated in vivo using a lung metastasis mouse model. Lastly, immunohistochemical expression of ERβ1 in TNBC tissues was analyzed and correlated with clinicopathological features.<h4>Results</h4>ERβ1 suppressed the invasion and migration abilities of AR-positive TNBC cells and induced the downregulation of ZEB1. ZEB1 overexpression abrogated the increase in E-cadherin expression and the decrease in N-cadherin expression modulated by ERβ1. A lung metastasis mouse model showed that the incidence of metastasis was lower in ERβ1-expressing TNBC cells. Further, AR activation increased the anti-metastatic effect of ERβ1 in AR-positive TNBC cells, which accelerated ERβ1 transcription by functioning as a transcription factor that bound to the promoter of ERβ1. No significant change was observed in AR expression induced by ERβ1. Immunohistochemistry (IHC) analysis of TNBC clinical samples showed that ERβ1 and AR were positive in 31.7% and 23.2% of samples, respectively. ERβ1 expression was negatively correlated with ZEB1 expression and lymph node metastasis, and positively correlated with the expression of AR and E-cadherin.<h4>Conclusion</h4>Our findings suggested a potential role of ERβ1 in metastasis of AR-positive TNBC and provided novel insights into the mechanism of action of ERβ1 and the possible relationship between ERβ1 and AR.

Also flagged:IronWest Nile virus infectioninfectionammoniumcitratedeferoxamine
Journal Article 2017-06-05 ✓ 1 Snippet Duchemin JB, Paradkar PN.
In-Text Gene Mentions

…as well ashemochromatosisin patients […

Show Full Abstract

<h4>Background</h4>Mosquitoes are responsible for transmission of viruses, including dengue, West Nile and chikungunya viruses. Female mosquitoes are infected when they blood-feed on vertebrates, a required step for oogenesis. During this process, mosquitoes encounter high iron loads. Since iron is an essential nutrient for most organisms, including pathogens, one of the defense mechanisms for the host includes sequestration of iron away from the invading pathogen. Here, we determine whether iron availability affects viral replication in mosquitoes.<h4>Methods</h4>To elucidate effect of iron availability on mosquito cells during infection, Culex cells were treated with either ferric ammonium citrate (FAC) or the iron chelator, deferoxamine (DFX). Real time RT-PCR was performed using ferritin (heavy chain) and NRAMP as a measure of iron homeostasis in cells. To determine iron requirement for viral replication, Culex cells were knocked down for NRAMP using dsRNA. Finally, the results were validated in Culex mosquito-infection model, by treating infected mosquitoes with DFX to reduce iron levels.<h4>Results</h4>Our results show that infection of Culex cells led to induction in levels of ferritin (heavy chain) and NRAMP mRNAs in time-dependent manner. Results also showed that treatment of cells with FAC, reduced expression of NRAMP (iron transporter) and increase levels of ferritin (heavy chain). Interestingly, increasing iron levels increased viral titers; while reducing intracellular iron levels, either by NRAMP knock-down or using DFX, reduced viral titers. The results from Culex mosquito infection showed that mosquitoes treated with DFX had reduced viral titers compared with untreated controls in midgut as well as carcass 8 days pi. Saliva from mosquitoes treated with DFX also showed reduced viral titers compared with untreated controls, indicating low viral transmission capacity.<h4>Conclusions</h4>Our results indicate that iron is required for viral replication in mosquito cells. Mosquitoes respond to viral infection, by inducing expression of heavy chain ferritin, which sequesters available iron, reducing its availability to virus infected cells. The data indicates that heavy chain ferritin may be part of an immune mechanism of mosquitoes in response to viral infections.

Also flagged:chromatinRasthyroidtransposonsthyroid tumorthyroid tumors
Journal Article 2017-06-05 ✓ 1 Snippet Montero-Conde C, Leandro-Garcia LJ, Chen X, Oler G, Ruiz-Llorente S, Ryder M, Landa I, Sanchez-Vega F, La K, Ghossein RA, Bajorin DF, Knauf JA, Riordan JD, Dupuy AJ, Fagin JA.
In-Text Gene Mentions

MLLT10

Show Full Abstract

Oncogenic <i>RAS</i> mutations are present in 15-30% of thyroid carcinomas. Endogenous expression of mutant Ras is insufficient to initiate thyroid tumorigenesis in murine models, indicating that additional genetic alterations are required. We used Sleeping Beauty (SB) transposon mutagenesis to identify events that cooperate with Hras<sup>G12V</sup> in thyroid tumor development. Random genomic integration of SB transposons primarily generated loss-of-function events that significantly increased thyroid tumor penetrance in <i>Tpo-Cre/homozygous FR-Hras</i><sup><i>G12V</i></sup> mice. The thyroid tumors closely phenocopied the histological features of human RAS-driven, poorly differentiated thyroid cancers. Characterization of transposon insertion sites in the SB-induced tumors identified 45 recurrently mutated candidate cancer genes. These mutation profiles were remarkably concordant with mutated cancer genes identified in a large series of human poorly differentiated and anaplastic thyroid cancers screened by next-generation sequencing using the MSK-IMPACT panel of cancer genes, which we modified to include all SB candidates. The disrupted genes primarily clustered in chromatin remodeling functional nodes and in the PI3K pathway. <i>ATXN7</i>, a component of a multiprotein complex with histone acetylase activity, scored as a significant SB hit. It was recurrently mutated in advanced human cancers and significantly co-occurred with <i>RAS</i> or <i>NF1</i> mutations. Expression of <i>ATXN7</i> mutants cooperated with oncogenic RAS to induce thyroid cell proliferation, pointing to <i>ATXN7</i> as a previously unrecognized cancer gene.

Also flagged:dendriteaxonOlfactory ReceptorORaxonsaxonal
Journal Article 2017-06-05 ✓ 1 Snippet Ihara N, Ikegaya Y, Takeuchi H.
In-Text Gene Mentions

PCDH17

Show Full Abstract

The mouse olfactory system is often used to study mechanisms of neural circuit formation because of its simple anatomical structure. An Olfactory Sensory Neuron (OSN) is a bipolar cell with a single dendrite and a single unbranched axon. An OSN expresses only one Olfactory Receptor (OR) gene, OSNs expressing a given type of OR converge their axons to a few sets of invariant glomeruli in the Olfactory Bulb (OB). A remarkable feature of OSN projection is that the expressed ORs play instructive roles in axonal projection. ORs regulate the expression of multiple axon-sorting molecules and generate the combinatorial molecular code of axon-sorting molecules at the OSN axon termini. Thus, to understand the molecular mechanisms of OR-specific axon guidance mechanisms, it is vital to characterize their expression profiles at the OSN axon termini within the same glomerulus. The aim of this article was to introduce methods for collecting as many glomeruli as possible on a single OB section and for performing immunostaining using multiple antibodies. This would allow the comparison and analysis of the expression patterns of axon-sorting molecules without staining variation between OB sections.

Also flagged:peptidesmajor histocompatibility complex class Ipyrophosphatetumorinfectionpyrophosphates
Journal Article 2017-06-05 ✓ 3 Snippets Kabelitz D, Lettau M, Janssen O.
In-Text Gene Mentions

Recently,BTN2A2–/– mice were reported to exhibit enhanced T-cell responses as shown by greater severity of T-cell-dependent models of autoimmunity (experimental autoimmune encephalomyelitis [EAE]) but also enhanced response to tumor vaccination74.

Three isoforms of BTN3A differ in their cytosolic structure (BTN3A1: B30.2 domain; BTN3A2: no B30.2 domain; BTN3A3: B30.2 domain plus additional stretch of amino acids).

…cell activation—BTN3A2 andBTN3A3isoforms have been…

Show Full Abstract

In contrast to conventional T lymphocytes, which carry an αβ T-cell receptor and recognize antigens as peptides presented by major histocompatibility complex class I or class II molecules, human γδ T cells recognize different metabolites such as non-peptidic pyrophosphate molecules that are secreted by microbes or overproduced by tumor cells. Hence, γδ T cells play a role in immunosurveillance of infection and cellular transformation. Until recently, it has been unknown how the γδ T-cell receptor senses such pyrophosphates in the absence of known antigen-presenting molecules. Recent studies from several groups have identified a unique role of butyrophilin (BTN) protein family members in this process, notably of BTN3A1. BTNs are a large family of transmembrane proteins with diverse functions in lipid secretion and innate and adaptive immunity. Here we discuss current models of how BTN molecules regulate γδ T-cell activation. We also address the implications of these recent findings on the design of novel immunotherapeutic strategies based on the activation of γδ T cells.

Also flagged:ADGene ExpressionNDUFA4DLG4LRP1CDK5R1
Journal Article 2017-06-04 No Snippets Chang WS, Wang YH, Zhu XT, Wu CJ.
Show Full Abstract

BACKGROUND Our study aimed to identify key differentially expressed genes (DEGs) and miRNAs (DEmiRNAs) which can serve as potential biomarkers for diagnosis and therapy of Alzheimer's disease (AD). MATERIAL AND METHODS We performed miRNA and mRNA integrated analysis (MMIA) to identify DEGs and DEmiRNAs of AD. The AD-specific DEmiRNAs-targets interaction network was contrasted. Gene ontology (GO) and Kyoto encyclopedia of genes and genomes (KEGG) pathway enrichment analysis were performed. Q-RT-PCR was used to verify the expression of selected DEGs and DEmiRNAs. RESULTS We conducted MMIA of AD based on 1 miRNA dataset and 3 mRNA datasets derived from the Gene Expression Omnibus (GEO) database; 1759 DEGs and 12 DEmiRNAs were obtained. DEGs of AD were significantly enriched in Huntington's disease and AD. LRP1, CDK5R1, PLCb2, NDUFA4, and DLG4 were 5 DEGs regulated by 4 DEmiRNAs, including miR-26b-5p, miR-26a-5p, miR-107, and miR-103a-3p. These 4 miRNAs were the top 4 miRNAs covering most DEGs. According to the qRT-PCR results, the expression of PLCβ2, NDUFA4, DLG4, miR-107, and miR-103a-3p was consistent with our integrated analysis. CONCLUSIONS We concluded that LRP1, CDK5R1, PLCβ2, NDUFA4, and DLG4 may play a role in AD regulated by miR-26b-5p, miR-26a-5p, miR-107, and miR-103a-3p. Our findings will contribute to identification of biomarkers and new strategies for drug design for AD treatment.

Also flagged:Allergic RhinitisAsthmaallergic airway diseasesimmunoglobulin Eallergiesgrass pollen allergies
Journal Article 2017-06-04 No Snippets Luo W, Pan G, Huang H, Zheng P, Wei N, Zhang Y, Zeng G, Sun B.
Show Full Abstract

Sensitization to grass pollen imposes a global risk for allergic airway diseases. Although prevention relies on local investigation of the pollen allergens, data on this topic are limited in southern China. Any available data were obtained by self-report questionnaires, skin prick tests, and total or specific IgE tests using crude extracts. For many reasons, these methods are unreliable. Serum sIgE reactivity to Bermuda grass, Timothy grass, and Humulus scandens allergens in a cohort of patients from Greater Guangzhou (southern China's largest city and its outskirts) with allergic rhinitis and/or asthma were examined using a fully-automated immunoassay analyzer as a component-resolved diagnostics (CRD) tool. For the first time, a considerably high prevalence of Bermuda grass sIgE positivity was demonstrated in Chinese southerners with allergic rhinitis and/or asthma. In these patients, a subtle prevalence of sensitization to Timothy grass and Humulus scandens was also noted, which may arise from cross-reactivity, as the latter two are not common in the region. This was also supported by the detection of allergen components. Fully-automated immunoassay analyzers may offer satisfactory consistency between regions, laboratories, and institutions and over time. The automaticity of the instrument may enable a standardized detection that would not have been readily revealed before the advent of CRD. This is a study that uses a CRD approach to investigate sensitization to grass pollen allergens in southern China. It adds to current evidence in the literature. Future studies are needed to validate these findings. However, although CRD is a useful tool, the findings made with the fully-automated immunoassay analyzer should not substitute for other laboratory investigations, clinical evaluations, and physician expertise.

Also flagged:NanotubesMetabolismtissue homeostasistotunneling nanotubesmembrane
Journal Article 2017-06-04 No Snippets Vignais ML, Caicedo A, Brondello JM, Jorgensen C.
Show Full Abstract

Intercellular communications play a major role in tissue homeostasis and responses to external cues. Novel structures for this communication have recently been described. These tunneling nanotubes (TNTs) consist of thin-extended membrane protrusions that connect cells together. TNTs allow the cell-to-cell transfer of various cellular components, including proteins, RNAs, viruses, and organelles, such as mitochondria. Mesenchymal stem cells (MSCs) are both naturally present and recruited to many different tissues where their interaction with resident cells via secreted factors has been largely documented. Their immunosuppressive and repairing capacities constitute the basis for many current clinical trials. MSCs recruited to the tumor microenvironment also play an important role in tumor progression and resistance to therapy. MSCs are now the focus of intense scrutiny due to their capacity to form TNTs and transfer mitochondria to target cells, either in normal physiological or in pathological conditions, leading to changes in cell energy metabolism and functions, as described in this review.

Also flagged:PolypeptidewaterpolypeptidescancerCarboxy Anhydrides-carboxy anhydrides
Journal Article 2017-06-04 No Snippets Skoulas D, Christakopoulos P, Stavroulaki D, Santorinaios K, Athanasiou V, Iatrou H.
Show Full Abstract

The development of multifunctional polymeric materials for biological applications is mainly guided by the goal of achieving the encapsulation of pharmaceutical compounds through a self-assembly process to form nanoconstructs that control the biodistribution of the active compounds, and therefore minimize systemic side effects. Micelles are formed from amphiphilic polymers in a selective solvent. In biological applications, micelles are formed in water, and their cores are loaded with hydrophobic pharmaceutics, where they are solubilized and are usually delivered through the blood compartment. Even though a large number of polymeric materials that form nanocarrier delivery systems has been investigated, a surprisingly small subset of these technologies has demonstrated potentially curative preclinical results, and fewer have progressed towards commercialization. One of the most promising classes of polymeric materials for drug delivery applications is polypeptides, which combine the properties of the conventional polymers with the 3D structure of natural proteins, i.e., α-helices and β-sheets. In this article, the synthetic pathways followed to develop well-defined polymeric micelles based on polypeptides prepared through ring-opening polymerization (ROP) of N-carboxy anhydrides are reviewed. Among these works, we focus on studies performed on micellar delivery systems to treat cancer. The review is limited to systems presented from 2000⁻2017.

Also flagged:adenosinedopamineDRD2nucleusADORA2Aschizophrenia
Journal Article 2017-06-03 ✓ 5 Snippets Nishiyama K, Suzuki H, Maruyama M, Yoshihara T, Ohta H.
In-Text Gene Mentions

In contrast, the locomotor response to the ADORA2A antagonist istradefylline was significantly augmented in GPR52 KO mice compared to WT mice.

GPR52 KO and WT mice exhibited almost identical locomotor responses to the dopamine releaser methamphetamine and the N-methyl-d-aspartate antagonist MK-801.

GPR52 has been proposed as a therapeutic target for positive symptoms of schizophrenia, based on observations from pharmacological and transgenic mouse studies.

…Genetic deletion ofGPR52enhances the locomotor-stimula…

…potential role ofGPR52in the function…

Show Full Abstract

G protein-coupled receptor 52 (GPR52) is largely co-expressed with dopamine D<sub>2</sub> receptor (DRD2) in the striatum and nucleus accumbens, and this expression pattern is similar to that of adenosine A<sub>2A</sub> receptor (ADORA2A). GPR52 has been proposed as a therapeutic target for positive symptoms of schizophrenia, based on observations from pharmacological and transgenic mouse studies. However, the physiological role of GPR52 in dopaminergic functions in the basal ganglia remains unclear. Here, we used GPR52 knockout (KO) mice to examine the role of GPR52 in dopamine receptor-mediated and ADORA2A-mediated locomotor activity and dopamine receptor signaling. High expression of GPR52 protein in the striatum, nucleus accumbens, and lateral globus pallidus of wild type (WT) littermates was confirmed by immunohistochemical analysis. GPR52 KO and WT mice exhibited almost identical locomotor responses to the dopamine releaser methamphetamine and the N-methyl-d-aspartate antagonist MK-801. In contrast, the locomotor response to the ADORA2A antagonist istradefylline was significantly augmented in GPR52 KO mice compared to WT mice. Gene expression analysis revealed that striatal expression of DRD2, but not of dopamine D<sub>1</sub> receptor and ADORA2A, was significantly decreased in GPR52 KO mice. Moreover, a significant reduction in the mRNA expression of enkephalin, a marker of the activity of striatopallidal neurons, was observed in the striatum of GPR52 KO mice, suggesting that GPR52 deletion could enhance DRD2 signaling. Taken together, these results imply the physiological relevance of GPR52 in modulating the function of striatopallidal neurons, possibly by interaction of GPR52 with ADORA2A and DRD2.

Also flagged:Huntington diseaseHuntington's diseaseHDbehavioralpicrotoxinArc
Journal Article 2017-06-03 No Snippets Lamirault C, Yu-Taeger L, Doyère V, Riess O, Nguyen HP, El Massioui N.
Show Full Abstract

In Huntington's disease (HD), dysfunctional affective processes emerge as key symptoms of disturbances. In human HD and transgenic rat models of the disease, the amygdala was previously shown to have a reduced volume and to carry a high load of mutant huntingtin (mHTT) aggregates. In search of the pathophysiology of affective dysregulation in HD, we hypothesized a specific role of the central amygdala (CeA), known to be particularly involved in emotional regulation. Using transgenic BACHD rats carrying full-length human mHTT, we compared behavioral consequences of pharmacological modulation of CeA function by infusing GABA<sub>A</sub> receptor (GABA<sub>A</sub>R) antagonist picrotoxin into ∼4.5 month old BACHD and WT rats before confronting them to potentially threatening situations. Our results show that disinhibition of the CeA induced differential behaviors in WT and BACHD rats in our tasks: it increased social contacts and responses to the threatening warning signal in an avoidance task in BACHD rats but not in WT animals. At the cellular level, analyzes of amygdala alteration/dysfunction showed (1) an age-dependent increase in number and size of mHTT aggregates specifically in the CeA of BACHD rats; (2) no alteration of GABA and GABA<sub>A</sub>R expression level, but (3) an increased neuronal reactivity (Arc labelling) to a threatening stimulus in the medial part of this nucleus in 4.5 months old BACHD rats. These results suggest a basal pathological hyper-reactivity in the CeA (in particular its medial part) in the transgenic animals. Such amygdala dysfunction could account, at least in part, for affective symptoms in HD patients.

bioRxiv 2017-06-03 Preprint (No Snippets API) Tekel SJ, Vargas D, Song L, LaBaer J, Haynes KA.
Show Full Abstract

<h4>ABSTRACT</h4> Fusion proteins that specifically interact with biochemical marks on chromosomes represent a new class of synthetic transcriptional regulators that decode cell state information rather than DNA sequences. In multicellular organisms, information relevant to cell state, tissue identity, and oncogenesis is often encoded as biochemical modifications of histones, which are bound to DNA in eukaryotic nuclei and regulate gene expression states. We have previously reported the development and validation of the “Polycomb-based transcription factor” (PcTF), a fusion protein that recognizes histone modifications through a protein-protein interaction between its polycomb chromodomain (PCD) motif and trimethylated lysine 27 of histone H3 (H3K27me3) at genomic sites. We demonstrated that PcTF activates genes at methyl-histone-enriched loci in cancer-derived cell lines. However, PcTF induces modest activation of a methyl-histone associated reporter compared to a DNA-binding activator. Therefore, we modified PcTF to enhance its target affinity. Here, we demonstrate the activity of a modified regulator called Pc 2 TF, which has two tandem copies of the H3K27me3-binding PCD at the N-terminus. Pc 2 TF shows higher affinity for H3K27me3 in vitro and shows enhanced gene activation in HEK293 cells compared to PcTF. These results provide compelling evidence that the intrinsic histone-binding activity of the PCD motif can be used to tune the activity of synthetic histone-binding transcriptional regulators.

Also flagged:Hepatitis Chepatatitis C virusHCV) infectionleptinadiponectinplasminogen activator inhibitor-1
Journal Article 2017-06-02 ✓ 1 Snippet Chang ML, Hsu CM, Lin CH, Lin CY, Kuo CJ, Huang SW, Chen CW, Cheng HT, Yeh CT, Chiu CT.
In-Text Gene Mentions

…B virus infection,hemochromatosisor malignancy and…

Show Full Abstract

How hepatatitis C virus (HCV) infection affects the interplay among abundant adipokines in the host remains unclear. A prospective study was conducted with 450 consecutive genotype 1 (G1) and G2 HCV patients who completed a course of anti-HCV therapy and underwent pre-therapy and 24-week post-therapy surveys to assess various profiles and levels of abundant adipokines, including leptin, adiponectin, and plasminogen activator inhibitor-1 (PAI-1). Before anti-HCV therapy, multivariate analyses showed gender to be associated with leptin and adiponectin levels, and BMI with leptin and PAI-1 levels. Among patients with a sustained virological response (SVR, <i>n</i> = 372), associations at 24 weeks post-therapy were as follows: gender and BMI with all adipokine levels; hepatic steatosis and aspartate aminotransferase to platelet ratio index with adiponectin levels; and HOMA-IR and HCV genotype with PAI-1 levels. Paired t-tests revealed increased post-therapeutic PAI-1 levels in G1 SVR patients and decreased adiponectin levels in all SVR patients compared to pre-therapeutic levels. HCV infection may obscure associations between abundant adipokines and metabolic/hepatic profiles. In SVR patients, a higher hierarchical status of PAI-1 versus adiponectin in affecting glucose metabolism was noted at 24 weeks post-therapy. Such genotype-non-specific adiponectin decreases and G1-specific PAI-1 increases warrant careful follow-up of HCV patients after SVR according to viral genotype.

Also flagged:MetabolismTetrodotoxinsodium channelexcretionsecretionhydrogen
Journal Article 2017-06-02 No Snippets Hong B, Chen H, Han J, Xie Q, He J, Bai K, Dong Y, Yi R.
Show Full Abstract

Tetrodotoxin (TTX) is a powerful sodium channel blocker that in low doses can safely relieve severe pain. Studying the absorption, distribution, metabolism and excretion (ADME) of TTX is challenging given the extremely low lethal dose. We conducted radiolabeled ADME studies in Sprague-Dawley rats. After a single dose of 6 μg/(16 μCi/kg) 11-[³H]TTX, pharmacokinetics of plasma total radioactivity were similar in male and female rats. Maximum radioactivity (5.56 ng Eq./mL) was reached in 10 min. [³H]TTX was below detection in plasma after 24 h. The area under the curve from 0 to 8 h was 5.89 h·ng Eq./mL; mean residence time was 1.62 h and t<sub>½</sub> was 2.31 h. Bile secretion accounted for 0.43% and approximately 51% of the dose was recovered in the urine, the predominant route of elimination. Approximately 69% was recovered, suggesting that hydrogen tritium exchange in rats produced tritiated water excreted in breath and saliva. Average total radioactivity in the stomach, lungs, kidney and intestines was higher than plasma concentrations. Metabolite analysis of plasma, urine and feces samples demonstrated oxidized TTX, the only identified metabolite. In conclusion, TTX was rapidly absorbed and excreted in rats, a standard preclinical model used to guide the design of clinical trials.

Also flagged:Glycyrrhetinic Acidglycyrrhizinic acidcancertriterpenesbetulinic acidoleanolic acid
Journal Article 2017-06-02 No Snippets Xu B, Wu GR, Zhang XY, Yan MM, Zhao R, Xue NN, Fang K, Wang H, Chen M, Guo WB, Wang PL, Lei HM.
Show Full Abstract

Glycyrrhetinic Acid (<b>GA</b>), a triterpenoid aglycone component of the natural product glycyrrhizinic acid, was found to possess remarkable anti-proliferative and apoptosis-inducing activity in various cancer cell lines. Though <b>GA</b> was not as active as other triterpenes, such as betulinic acid and oleanolic acid, it could trigger apoptosis in tumor cells and it can be obtained easily and cheaply, which has stimulated scientific interest in using <b>GA</b> as a scaffold to synthesize new antitumor agents. The structural modifications of <b>GA</b> reported in recent decades can be divided into four groups, which include structural modifications on ring-A, ring-C, ring-E and multiple ring modifications. The lack of a comprehensive and recent review on this topic prompted us to gather more new information. This overview is dedicated to summarizing and updating the structural modification of <b>GA</b> to improve its antitumor activity published between 2005 and 2016. We reviewed a total of 210 <b>GA</b> derivatives that we encountered and compiled the most active <b>GA</b> derivatives along with their activity profile in different series. Furthermore, the structure activity relationships of these derivatives are briefly discussed. The included information is expected to be of benefit to further studies of structural modifications of <b>GA</b> to enhance its antitumor activity.

Also flagged:TamoxifenBreast CancereIF4Festrogen receptorhormone receptor-positive breast cancer
Journal Article 2017-06-02 No Snippets Fagan DH, Fettig LM, Avdulov S, Beckwith H, Peterson MS, Ho YY, Wang F, Polunovsky VA, Yee D.
Show Full Abstract

While selective estrogen receptor modulators, such as tamoxifen, have contributed to increased survival in patients with hormone receptor-positive breast cancer, the development of resistance to these therapies has led to the need to investigate other targetable pathways involved in oncogenic signaling. Approval of the mTOR inhibitor everolimus in the therapy of secondary endocrine resistance demonstrates the validity of this approach. Importantly, mTOR activation regulates eukaryotic messenger RNA translation. Eukaryotic translation initiation factor 4E (eIF4E), a component of the cap-dependent translation complex eIF4F, confers resistance to drug-induced apoptosis when overexpressed in multiple cell types. The eIF4F complex is downstream of multiple oncogenic pathways, including mTOR, making it an appealing drug target. Here, we show that the eIF4F translation pathway was hyperactive in tamoxifen-resistant (TamR) MCF-7L breast cancer cells. While overexpression of eIF4E was not sufficient to confer resistance to tamoxifen in MCF-7L cells, its function was necessary to maintain resistance in TamR cells. Targeting the eIF4E subunit of the eIF4F complex through its degradation using an antisense oligonucleotide (ASO) or via sequestration using a mutant 4E-BP1 inhibited the proliferation and colony formation of TamR cells and partially restored sensitivity to tamoxifen. Further, the use of these agents also resulted in cell cycle arrest and induction of apoptosis in TamR cells. Finally, the use of a pharmacologic agent which inhibited the eIF4E-eIF4G interaction also decreased the proliferation and anchorage-dependent colony formation in TamR cells. These results highlight the eIF4F complex as a promising target for patients with acquired resistance to tamoxifen and, potentially, other endocrine therapies.

Also flagged:adenine dinucleotide dehydrogenase subunit 5ITS1-5.8S-ITS228S rRNAcox 1nad 5ITS1-5,8S-ITS2
Journal Article 2017-06-02 No Snippets Minard G, Tran Van V, Tran FH, Melaun C, Klimpel S, Koch LK, Ly Huynh Kim K, Huynh Thi Thuy T, Tran Ngoc H, Potier P, Mavingui P, Valiente Moro C.
Show Full Abstract

<h4>Background</h4>The Aedes (Stegomyia) albopictus subgroup includes 11 cryptic species of which Ae. albopictus is the most widely distributed. Its global expansion associated with a documented vector competence for several emerging arboviruses raise obvious concerns in the recently colonized regions. While several studies have provided important insights regarding medical importance of Ae. albopicus, the investigations of the other sibling species are scarce. In Asia, indigenous populations within the Ae. albopictus subgroup can be found in sympatry. In the present study, we aimed to describe and compare molecular, morphological and bacterial symbionts composition among sympatric individuals from the Ae. albopictus subgroup inhabiting a Vietnamese protected area.<h4>Results</h4>Based on morphological structure of the cibarial armarture, we identified a cryptic species in the forest park at Bù Gia Mập in the south-eastern region of Vietnam. Analysis of nuclear (ITS1-5.8S-ITS2) and mitochondrial (cox1, nad5) markers confirmed the divergence between the cryptic species and Ae. albopictus. Analysis of midgut bacterial microbiota revealed a strong similarity among the two species with a notable difference; contrary to Ae. albopictus, the cryptic species did not harbour any Wolbachia infection.<h4>Conclusions</h4>These results could reflect either a recent invasion of Wolbachia in Ae. albopictus or alternatively a loss of this symbiont in the cryptic species. We argue that neglected species of the Ae. albopictus subgroup are of main importance in order to estimate variation of host-symbionts interactions across evolution.

Also flagged:calcium phosphatenanorodscalcium carbonateACPhydroxyapatitenanocrystals
Journal Article 2017-06-02 No Snippets Onuma K, Iijima M.
Show Full Abstract

Human tooth enamel has tightly packed c-axis-oriented hydroxyapatite (HAP: Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) nanorods with high elastic modulus. Fabrication of an enamel architecture in vitro supports the repair of teeth using HAP; however, existing methods require complex and laborious steps to form an enamel-like structure. Here we present a very simple and effective technique for forming artificial enamel in near-physiological solution using a substrate composed of amorphous calcium phosphate (ACP) nanoparticles. Without any functionalized modification of the substrate surface, faint dissolution and successive phase transformation automatically induce formation of an intermediate layer of low-crystalline HAP nanoparticles, on which highly oriented HAP nanorods grow by geometrical selection. We also show that an enamel structure forms on a substrate of amorphous calcium carbonate when the surface nanoparticles react so as to form an intermediate layer similar to that in ACP. Our results demonstrate that there is a wide range of substrate choices for nanorod array formation. Contrary to current understanding, a stable surface designed in nanoscale is not essential for the growth of arranged guest crystals. Reactive amorphous nanoparticles and their transformation efficiently induce a nanorod array structure.

Also flagged:neuropeptideinfectionbehaviouralleucine aminopeptidase 2LAP2immunoglobulin
Journal Article 2017-06-02 No Snippets Wang T, Zhao M, Liang D, Bose U, Kaur S, McManus DP, Cummins SF.
Show Full Abstract

<h4>Background</h4>Molluscs, including snails, are prone to parasite infection, which can lead to massive physiological and behavioural changes, yet many of the molecular components involved remain unresolved. Central to this point is the neural system that in snails consists of several ganglia that regulate the animals' physiology and behaviour patterns. The availability of a genomic resource for the freshwater snail Biomphalaria glabrata provides a mean towards the high throughput analysis of changes in the central nervous system (CNS) following infection with Schistosoma miracidia.<h4>Results</h4>In this study, we performed a proteomic analysis of the B. glabrata CNS at pre-patent infection, providing a list of proteins that were further used within a protein-protein interaction (PPI) framework against S. mansoni proteins. A hub with most connections for both non-infected and infected Biomphalaria includes leucine aminopeptidase 2 (LAP2), which interacts with numerous miracidia proteins that together belong to the immunoglobulin family of cell adhesion related molecules. We additionally reveal the presence of at least 165 neuropeptides derived from the precursors of buccalin, enterin, FMRF, FVRI, pedal peptide 1, 2, 3 and 4, RYamide, RFamide, pleurin and others. Many of these were present at significantly reduced levels in the snail's CNS post-infection, such as the egg laying hormone, a neuropeptide required to initiate egg laying in gastropod molluscs.<h4>Conclusions</h4>Our analysis demonstrates that LAP2 may be a key component that regulates parasite infection physiology, as well as establishing that parasite-induced reproductive castration may be facilitated by significant reductions in reproduction-associated neuropeptides. This work helps in our understanding of molluscan neuropeptides and further stimulates advances in parasite-host interactions.

Also flagged:Cyp1b1retinolvitamin A deficiencygene expressioncarbohydrateiron
Journal Article 2017-06-02 ✓ 1 Snippet Maguire M, Larsen MC, Foong YH, Tanumihardjo S, Jefcoate CR.
In-Text Gene Mentions

Hfe

Show Full Abstract

Cyp1b1 deletion and gestational vitamin A deficiency (GVAD) redirect adult liver gene expression. A matched sufficient pre- and post-natal diet, which has high carbohydrate and normal iron content (LF12), increased inflammatory gene expression markers in adult livers that were suppressed by GVAD and Cyp1b1 deletion. At birth on the LF12 diet, Cyp1b1 deletion and GVAD each suppress liver expression of the iron suppressor, hepcidin (Hepc), while increasing stellate cell activation markers and suppressing post-natal increases in lipogenesis. Hepc was less suppressed in Cyp1b1-/- pups with a standard breeder diet, but was restored by iron supplementation of the LF12 diet.<h4>Conclusions</h4>The LF12 diet delivered low post-natal iron and attenuated Hepc. Hepc decreases in Cyp1b1-/- and GVAD mice resulted in stellate activation and lipogenesis suppression. Endothelial BMP6, a Hepc stimulant, is a potential coordinator and Cyp1b1 target. These neonatal changes in Cyp1b1-/- mice link to diminished adult obesity and liver inflammation.

Also flagged:Secradical1041ESITBPcation
Journal Article 2017-06-02 No Snippets Asatryan R, Ruckenstein E, Hachmann J.
Show Full Abstract

This paper provides a first-principles theoretical investigation of the polytopal rearrangements and fluxional behavior of five-coordinate d<sup>7</sup>-transition metal complexes. Our work is primarily based on a potential energy surface analysis of the iron tetracarbonyl hydride radical HFe˙(CO)<sub>4</sub>. We demonstrate the existence of distorted coordination geometries in this prototypical system and, for the first time, introduce three general rearrangement mechanisms, which account for the non-ideal coordination. The first of these mechanisms constitutes a modified version of the Berry pseudorotation <i>via</i> a square-based pyramidal <i>C</i><sub>4v</sub> transition state that connects two chemically identical edge-bridged tetrahedral stereoisomers of <i>C</i><sub>2v</sub> symmetry. It differs from the classical Berry mechanism, which involves two regular <i>D</i><sub>3h</sub> equilibrium structures and a <i>C</i><sub>4v</sub> transition state. The second mechanism is related to the famous "tetrahedral jump" hypothesis, postulated by Muetterties for a number of d<sup>6</sup> HML<sub>4</sub> and H<sub>2</sub>ML<sub>4</sub> complexes. Here, our study suggests two fluxional rearrangement pathways <i>via</i> distinct types of <i>C</i><sub>2v</sub> transition states. Both pathways of this mechanism can be described as a single-ligand migration to a vacant position of an "octahedron", thus interchanging (switching) the apical and basal ligands of the initial quasi-square pyramidal isomer, which is considered as an idealized octahedron with a vacancy. Accordingly, we call this mechanism "octahedral switch". The third mechanism follows a butterfly-type isomerization featuring a key-angle deformation, and we thus call it "butterfly isomerization". It connects the quasi-square pyramidal and edge-bridged tetrahedral isomers of HFe˙(CO)<sub>4</sub> through a distorted edge-bridged tetrahedral transition state of <i>C</i><sub>s</sub> symmetry. Our paper discusses the overall features of the isomers and rearrangement mechanisms as well as their implications. We rationalize the existence of each stationary point through an electronic structure analysis and argue their relevance for isolobal analogues of HFe˙(CO)<sub>4</sub>.

Also flagged:behavioral problemsBehavioralMaternal DepressionDRD4brain-derived neurotrophic factorBDNF
Journal Article 2017-06-01 No Snippets Yan N, Benner A, Tucker-Drob E, Harden KP.
Show Full Abstract

As a stressful environment in families, mothers' depressive symptoms might increase children's risks of developing behavioral problems by exacerbating genetic influences. Using data from the nationally representative Early Childhood Longitudinal Study-Birth Cohort data of approximately 750 pairs of twins, we examined whether genetic influences on preschoolers' behavioral problems depended upon mothers' depressive symptoms. Results indicated that the genetic etiology for both internalizing and externalizing behaviors varied with maternal depressive symptoms at 9-months child age. Genetic effects on externalizing behaviors increased as mothers' depressive symptoms increased; however, genetics effects on internalizing behaviors increased when depressive symptoms either increased or decreased from the median level. These different patterns of interactive effects suggest potentially different mechanisms for the etiology of children's externalizing and internalizing behaviors.

Also flagged:diabetesbehavioralprediabetesmetformintroglitazoneglucose
Journal Article 2017-06-01 No Snippets Vitolins MZ, Isom SP, Blackwell CS, Kernodle D, Sydell JM, Pedley CF, Katula JA, Case LD, Goff DC.
Show Full Abstract

A number of research studies have attempted to translate the behavioral lifestyle intervention delivered in the Diabetes Prevention Program (DPP). To compare the active interventions of two trials, Diabetes Prevention Program DPP and Healthy Living Partnerships to Prevent Diabetes (HELP PD), after 1 and 2 years of intervention. DPP included 3234 adults with prediabetes randomized to intensive lifestyle intervention, metformin, troglitazone, or placebo. The lifestyle intervention, professionally delivered to individuals in a clinical setting, focused on diet and increased physical activity. HELP PD, a community-based translation of DPP, included 301 adults randomized to receive intensive lifestyle intervention or enhanced usual care. Mean weight-losses at 1 year (6.9 kg in DPP, 6.4 kg in HELP PD) and 2 years (5.5 kg in DPP, 4.4 kg in HELP PD) were similar across studies. Reductions in glucose were also similar across studies at both time points (5.2 mg/dL in DPP and 4.1 mg/dL in HELP PD at 1 year; 1.8 mg/dL and 1.6 mg/dL at 2 years). HELP PD participants achieved larger reductions in triglycerides at 1 and 2 years (38.4 mg/dL and 34.9 mg/dL, respectively) than DPP participants (24.8 mg/dL and 22.4 mg/dL). High-density lipoprotein decreased in HELP PD participants at year 1 (-0.6 mg/dL) and increased in DPP (1.2 mg/dL) but there were no significant differences in year 2. HELP PD, a community model for diabetes prevention, was similar to DPP in reducing body weight and lowering blood glucose, both important risk factors that should be controlled to reduce risk for developing type 2 diabetes.

Also flagged:idiopathic pulmonary fibrosisGene expressionpolymerasedefense responseNLRC4PGLYRP1
Journal Article 2017-06-01 No Snippets Molyneaux PL, Willis-Owen SAG, Cox MJ, James P, Cowman S, Loebinger M, Blanchard A, Edwards LM, Stock C, Daccord C, Renzoni EA, Wells AU, Moffatt MF, Cookson WOC, Maher TM.
Show Full Abstract

<h4>Rationale</h4>Changes in the respiratory microbiome are associated with disease progression in idiopathic pulmonary fibrosis (IPF). The role of the host response to the respiratory microbiome remains unknown.<h4>Objectives</h4>To explore the host-microbial interactions in IPF.<h4>Methods</h4>Sixty patients diagnosed with IPF were prospectively enrolled together with 20 matched control subjects. Subjects underwent bronchoalveolar lavage (BAL), and peripheral whole blood was collected into PAXgene tubes for all subjects at baseline. For subjects with IPF, additional samples were taken at 1, 3, and 6 months and (if alive) 1 year. Gene expression profiles were generated using Affymetrix Human Gene 1.1 ST arrays.<h4>Measurements and main results</h4>By network analysis of gene expression data, we identified two gene modules that strongly associated with a diagnosis of IPF, BAL bacterial burden (determined by 16S quantitative polymerase chain reaction), and specific microbial operational taxonomic units, as well as with lavage and peripheral blood neutrophilia. Genes within these modules that are involved in the host defense response include NLRC4, PGLYRP1, MMP9, and DEFA4. The modules also contain two genes encoding specific antimicrobial peptides (SLPI and CAMP). Many of these particular transcripts were associated with survival and showed longitudinal overexpression in subjects experiencing disease progression, further strengthening the relationship of the transcripts with disease.<h4>Conclusions</h4>Integrated analysis of the host transcriptome and microbial signatures demonstrated an apparent host response to the presence of an altered or more abundant microbiome. These responses remained elevated in longitudinal follow-up, suggesting that the bacterial communities of the lower airways may act as persistent stimuli for repetitive alveolar injury in IPF.

Also flagged:TGF-βdbl-1daf-7unc-129serine–threonine kinase receptorsSmads
Journal Article 2017-06-01 No Snippets Savage-Dunn C, Padgett RW.
Show Full Abstract

Transforming growth factor β (TGF-β) and related ligands have potent effects on an enormous diversity of biological functions in all animals examined. Because of the strong conservation of TGF-β family ligand functions and signaling mechanisms, studies from multiple animal systems have yielded complementary and synergistic insights. In the nematode <i>Caenorhabditis elegans</i>, early studies were instrumental in the elucidation of TGF-β family signaling mechanisms. Current studies in <i>C. elegans</i> continue to identify new functions for the TGF-β family in this organism as well as new conserved mechanisms of regulation.

Also flagged:Fibroblast Growth Factorglycocalyxdegradationsepsisfibroblast growth factor receptor(FGFR) 1
Journal Article 2017-06-01 ✓ 2 Snippets Yang Y, Haeger SM, Suflita MA, Zhang F, Dailey KL, Colbert JF, Ford JA, Picon MA, Stearman RS, Lin L, Liu X, Han X, Linhardt RJ, Schmidt EP.
In-Text Gene Mentions

…constitution after nonseptic (heparinase-IIImediated) or septic…

heparinase-III

Show Full Abstract

The endothelial glycocalyx is a heparan sulfate (HS)-rich endovascular structure critical to endothelial function. Accordingly, endothelial glycocalyx degradation during sepsis contributes to tissue edema and organ injury. We determined the endogenous mechanisms governing pulmonary endothelial glycocalyx reconstitution, and if these reparative mechanisms are impaired during sepsis. We performed intravital microscopy of wild-type and transgenic mice to determine the rapidity of pulmonary endothelial glycocalyx reconstitution after nonseptic (heparinase-III mediated) or septic (cecal ligation and puncture mediated) endothelial glycocalyx degradation. We used mass spectrometry, surface plasmon resonance, and in vitro studies of human and mouse samples to determine the structure of HS fragments released during glycocalyx degradation and their impact on fibroblast growth factor receptor (FGFR) 1 signaling, a mediator of endothelial repair. Homeostatic pulmonary endothelial glycocalyx reconstitution occurred rapidly after nonseptic degradation and was associated with induction of the HS biosynthetic enzyme, exostosin (EXT)-1. In contrast, sepsis was characterized by loss of pulmonary EXT1 expression and delayed glycocalyx reconstitution. Rapid glycocalyx recovery after nonseptic degradation was dependent upon induction of FGFR1 expression and was augmented by FGF-promoting effects of circulating HS fragments released during glycocalyx degradation. Although sepsis-released HS fragments maintained this ability to activate FGFR1, sepsis was associated with the downstream absence of reparative pulmonary endothelial FGFR1 induction. Sepsis may cause vascular injury not only via glycocalyx degradation, but also by impairing FGFR1/EXT1-mediated glycocalyx reconstitution.

Also flagged:protein tyrosine phosphatase non-receptor type 2PTPProtein tyrosine phosphatasessignal transductionCD45PTEN
Journal Article 2017-06-01 No Snippets Le HTT, Cho YC, Cho S.
Show Full Abstract

Protein tyrosine phosphatases (PTPs) play crucial roles in signal transduction and their functional alteration has been detected in many diseases. PTP inhibitors have been developed as therapeutic drugs for diseases that are related to the activity of PTPs. In this study, PTP inhibitor XIX, an inhibitor of CD45 and PTEN, was investigated whether it inhibits other PTPs. Protein tyrosine phosphatase non-receptor type 2 (PTPN2) was selectively inhibited by the inhibitor in a competitive manner. Drug affinity responsive target stability (DARTS) analysis showed that the inhibitor induces conformational changes in PTPN2. Phosphorylation levels of signal transducer and activator of transcription 3 (STAT3) at Tyr-705, a crucial site for STAT3 activation and target site of PTPN2, decreased upon exposure to the inhibitor. Our results suggest that PTP inhibitor XIX might be considered as an effective regulator of PTPN2 for treating diseases related to PTPN2. [BMB Reports 2017; 50(6): 329-334].

Also flagged:chromatinhistone modificationscell specificationgene expressionmethylationH2A.Z
Journal Article 2017-06-01 ✓ 5 Snippets Kazakevych J, Sayols S, Messner B, Krienke C, Soshnikova N.
In-Text Gene Mentions

…of genes (Olfm4, Kcnq1 and Lrig1…

…Between them wereOlfm4, Axin2, Scl12a2, Kcne3…

…Ascl2, Cd44, Slc12a2,Olfm4and Lrig1 ,…

…signature genes, includingOlfm4, Lrig1, Prom1, Slc12a2,…

…Kcne3, Lrig1 andOlfm4), H3K27me3 modification…

Show Full Abstract

Epigenetic mechanisms, including chromatin structure, chromatin dynamics and histone modifications play an important role for maintenance and differentiation of pluripotent embryonic stem cells. However, little is known about the molecular mechanisms of adult stem cell specification and differentiation. Here, we used intestinal stem cells (ISCs) as a model system to reveal the epigenetic changes coordinating gene expression programs during these processes. We found that two distinct epigenetic mechanisms participate in establishing the transcriptional program promoting ISC specification from embryonic progenitors. A large number of adult ISC signature genes are targets of repressive DNA methylation in embryonic intestinal epithelial progenitors. On the other hand, genes essential for embryonic development acquire H3K27me3 and are silenced during ISC specification. We also show that the repression of ISC signature genes as well as the activation of enterocyte specific genes is accompanied by a global loss of H2A.Z during ISCs differentiation. Our results reveal that, already during ISC specification, an extensive remodeling of chromatin both at promoters and distal regulatory elements organizes transcriptional landscapes operating in differentiated enterocytes, thus explaining similar chromatin modification patterns in the adult gut epithelium.

Also flagged:Protocadherin 19PCDH19NONOgene expressionepilepsyautism
Journal Article 2017-06-01 ✓ 2 Snippets Pham DH, Tan CC, Homan CC, Kolc KL, Corbett MA, McAninch D, Fox AH, Thomas PQ, Kumar R, Gecz J.
In-Text Gene Mentions

…, PCDH10 ,PCDH17and PCDH18 .…

…PCDH8, PCDH10, PCDH12,PCDH17, PCDH18, PCDHα6 and…

Show Full Abstract

De novo and inherited mutations of X-chromosome cell adhesion molecule protocadherin 19 (PCDH19) cause frequent, highly variable epilepsy, autism, cognitive decline and behavioural problems syndrome. Intriguingly, hemizygous null males are not affected while heterozygous females are, contradicting established X-chromosome inheritance. The disease mechanism is not known. Cellular mosaicism is the likely driver. We have identified p54nrb/NONO, a multifunctional nuclear paraspeckle protein with known roles in nuclear hormone receptor gene regulation, as a PCDH19 protein interacting partner. Using breast cancer cells we show that PCDH19-NONO complex is a positive co-regulator of ERα-mediated gene expression. Expression of mutant PCDH19 affects at least a subset of known ERα-regulated genes. These data are consistent with our findings that genes regulated by nuclear hormone receptors and those involved in the metabolism of neurosteroids in particular are dysregulated in PCDH19-epilepsy girls and affected mosaic males. Overall we define and characterize a novel mechanism of gene regulation driven by PCDH19, which is mediated by paraspeckle constituent NONO and is ERα-dependent. This PCDH19-NONO-ERα axis is of relevance not only to PCDH19-epilepsy and its comorbidities but likely also to ERα and generally nuclear hormone receptor-associated cancers.

Also flagged:gene expressiontranscription factorsBMAL1REV-ERBαlocalizationmetabolism
Journal Article 2017-06-01 No Snippets Fan Z, Zhao M, Joshi PD, Li P, Zhang Y, Guo W, Xu Y, Wang H, Zhao Z, Yan J.
Show Full Abstract

Circadian rhythm exerts its influence on animal physiology and behavior by regulating gene expression at various levels. Here we systematically explored circadian long non-coding RNAs (lncRNAs) in mouse liver and examined their circadian regulation. We found that a significant proportion of circadian lncRNAs are expressed at enhancer regions, mostly bound by two key circadian transcription factors, BMAL1 and REV-ERBα. These circadian lncRNAs showed similar circadian phases with their nearby genes. The extent of their nuclear localization is higher than protein coding genes but less than enhancer RNAs. The association between enhancer and circadian lncRNAs is also observed in tissues other than liver. Comparative analysis between mouse and rat circadian liver transcriptomes showed that circadian transcription at lncRNA loci tends to be conserved despite of low sequence conservation of lncRNAs. One such circadian lncRNA termed lnc-Crot led us to identify a super-enhancer region interacting with a cluster of genes involved in circadian regulation of metabolism through long-range interactions. Further experiments showed that lnc-Crot locus has enhancer function independent of lnc-Crot's transcription. Our results suggest that the enhancer-associated circadian lncRNAs mark the genomic loci modulating long-range circadian gene regulation and shed new lights on the evolutionary origin of lncRNAs.

Also flagged:coagulationtissue factorTFcoagulopathiesfactor VIIfactor VIII
Journal Article 2017-06-01 ✓ 1 Snippet Christie SA, Kornblith LZ, Howard BM, Conroy AS, Kunitake RC, Nelson MF, Hendrickson CM, Calfee CS, Callcut RA, Cohen MJ.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Background</h4>International normalized ratio (INR) and partial thromboplastin time (PTT) are used interchangeably to diagnose acute traumatic coagulopathy but reflect disparate activation pathways. In this study, we identified injury/patient characteristics and coagulation factors that drive contact pathway, tissue factor pathway (TF), and common pathway dysfunction by examining injured patients with discordant coagulopathies. We hypothesized that patients with INR/PTT discordance reflect differing phenotypes representing contact versus tissue factor pathway perturbations and that characterization will provide targets to guide individualized resuscitation.<h4>Methods</h4>Plasma samples were prospectively collected from 1,262 critically injured patients at a single Level I trauma center. Standard coagulation measures and an extensive panel of procoagulant and anticoagulant factors were assayed and analyzed with demographic and outcome data.<h4>Results</h4>Fourteen percent of patients were coagulopathic on admission. Among these, 48% had abnormal INR and PTT (BOTH), 43% had isolated prolonged PTT (PTT-CONTACT), and 9% had isolated elevated INR (INR-TF). PTT-CONTACT and BOTH had lower Glasgow Coma Scale score than INR-TF (p < 0.001). INR-TF had decreased factor VII activity compared with PTT-CONTACT, whereas PTT-CONTACT had decreased factor VIII activity compared with INR-TF. All coagulopathic patients had factor V deficits, but activity was lowest in BOTH, suggesting an additive downstream effect of disordered activation pathways. Patients with PTT-CONTACT received half as much packed red blood cell and fresh frozen plasma as did the other groups (p < 0.001). Despite resuscitation, mortality was higher for coagulopathic patients; mortality was highest in BOTH and higher in PTT-CONTACT than in INR-TF (71%, 60%, 41%; p = 0.04).<h4>Conclusions</h4>Discordant phenotypes demonstrate differential factor deficiencies consistent with dysfunction of contact versus tissue factor pathways with additive effects from common pathway dysfunction. Recognition and treatment of pathway-specific factor deficiencies driving different coagulopathic phenotypes in injured patients may individualize resuscitation and improve outcomes.<h4>Level of evidence</h4>Prognostic/epidemiological study, level II.

Also flagged:tumorCUX1transcriptional regulatortranscriptional regulatorstranscription factorsolid tumors
Journal Article 2017-06-01 No Snippets Arthur RK, An N, Khan S, McNerney ME.
Show Full Abstract

One third of tumor suppressors are haploinsufficient transcriptional regulators, yet it remains unknown how a 50% reduction of a transcription factor is translated at the cis-regulatory level into a malignant transcriptional program. We studied CUX1, a haploinsufficient transcription factor that is recurrently mutated in hematopoietic and solid tumors. We determined CUX1 DNA-binding and target gene regulation in the wildtype and haploinsufficient states. CUX1 binds with transcriptional activators and cohesin at distal enhancers across three different human cell types. Haploinsufficiency of CUX1 altered the expression of a large number of genes, including cell cycle regulators, with concomitant increased cellular proliferation. Surprisingly, CUX1 occupancy decreased genome-wide in the haploinsufficient state, and binding site affinity did not correlate with differential gene expression. Instead, differentially expressed genes had multiple, low-affinity CUX1 binding sites, features of analog gene regulation. A machine-learning algorithm determined that chromatin accessibility, enhancer activity, and distance to the transcription start site are features of dose-sensitive CUX1 transcriptional regulation. Moreover, CUX1 is enriched at sites of DNA looping, as determined by Hi-C analysis, and these loops connect CUX1 to the promoters of regulated genes. We propose an analog model for haploinsufficient transcriptional deregulation mediated by higher order genome architecture.

Also flagged:YARS2myopathylactic acidosissideroblastic anemiamitochondrial diseaselactate
Journal Article 2017-06-01 ✓ 1 Snippet Sommerville EW, Ng YS, Alston CL, Dallabona C, Gilberti M, He L, Knowles C, Chin SL, Schaefer AM, Falkous G, Murdoch D, Longman C, de Visser M, Bindoff LA, Rawles JM, Dean JCS, Petty RK, Farrugia ME, Haack TB, Prokisch H, McFarland R, Turnbull DM, Donnini C, Taylor RW, Gorman GS.
In-Text Gene Mentions

DARS2

Show Full Abstract

<h4>Importance</h4>YARS2 mutations have been associated with a clinical triad of myopathy, lactic acidosis, and sideroblastic anemia in predominantly Middle Eastern populations. However, the identification of new patients expands the clinical and molecular spectrum of mitochondrial disorders.<h4>Objectives</h4>To review the clinical, molecular, and genetic features of YARS2-related mitochondrial disease and to demonstrate a new Scottish founder variant.<h4>Design, setting, and participants</h4>An observational case series study was conducted at a national diagnostic center for mitochondrial disease in Newcastle upon Tyne, England, and review of cases published in the literature. Six adults in a well-defined mitochondrial disease cohort and 11 additional cases described in the literature were identified with YARS2 variants between January 1, 2000, and January 31, 2015.<h4>Main outcome and measures</h4>The spectrum of clinical features and disease progression in unreported and reported patients with pathogenic YARS2 variants.<h4>Results</h4>Seventeen patients (median [interquartile range] age at onset, 1.5 [9.8] years) with YARS2-related mitochondrial myopathy were identified. Fifteen individuals (88%) exhibited an elevated blood lactate level accompanied by generalized myopathy; only 12 patients (71%) manifested with sideroblastic anemia. Hypertrophic cardiomyopathy (9 [53%]) and respiratory insufficiency (8 [47%]) were also prominent clinical features. Central nervous system involvement was rare. Muscle studies showed global cytochrome-c oxidase deficiency in all patients tested and severe, combined respiratory chain complex activity deficiencies. Microsatellite genotyping demonstrated a common founder effect shared between 3 Scottish patients with a p.Leu392Ser variant. Immunoblotting from fibroblasts and myoblasts of an affected Scottish patient showed normal YARS2 protein levels and mild respiratory chain complex defects. Yeast modeling of novel missense YARS2 variants closely correlated with the severity of clinical phenotypes.<h4>Conclusions and relevance</h4>The p.Leu392Ser variant is likely a newly identified founder YARS2 mutation. Testing for pathogenic YARS2 variants should be considered in patients presenting with mitochondrial myopathy, characterized by exercise intolerance and muscle weakness even in the absence of sideroblastic anemia irrespective of ethnicity. Regular surveillance and early treatment for cardiomyopathy and respiratory muscle weakness is advocated because early treatment may mitigate the significant morbidity and mortality associated with this genetic disorder.

Also flagged:C-type natriuretic peptidelipidvesiclesbrain gliomaCNPvinorelbine
Journal Article 2017-06-01 No Snippets Wu JS, Mu LM, Bu YZ, Liu L, Yan Y, Hu YJ, Bai J, Zhang JY, Lu W, Lu WL.
Show Full Abstract

Chemotherapy of brain glioma faces a major obstacle owing to the inability of drug transport across the blood-brain barrier (BBB). Besides, neovasculatures in brain glioma site result in a rapid infiltration, making complete surgical removal virtually impossible. Herein, we reported a novel kind of C-type natriuretic peptide (CNP) modified vinorelbine lipid vesicles for transferring drug across the BBB, and for treating brain glioma along with disrupting neovasculatures. The studies were performed on brain glioma U87-MG cells in vitro and on glioma-bearing nude mice in vivo. The results showed that the CNP-modified vinorelbine lipid vesicles could transport vinorelbine across the BBB, kill the brain glioma, and destroy neovasculatures effectively. The above mechanisms could be associated with the following aspects, namely, long circulation in the blood; drug transport across the BBB via natriuretic peptide receptor B (NPRB)-mediated transcytosis; elimination of brain glioma cells and disruption of neovasculatures by targeting uptake and cytotoxic injury. Besides, CNP-modified vinorelbine lipid vesicles could induce apoptosis of the glioma cells. The mechanisms could be related to the activations of caspase 8, caspase 3, p53, and reactive oxygen species (ROS), and inhibition of survivin. Hence, CNP-modified lipid vesicles could be used as a carrier material for treating brain glioma and disabling glioma neovasculatures.

Also flagged:Chaperoneautophagymacroautophagydegradationglypican-3p62
Journal Article 2017-06-01 ✓ 1 Snippet Chava S, Lee C, Aydin Y, Chandra PK, Dash A, Chedid M, Thung SN, Moroz K, Wu T, Nayak NC, Dash S.
In-Text Gene Mentions

…disease, diabetes, andhemochromatosisalso contribute to…

Show Full Abstract

Macroautophagy and chaperone-mediated autophagy (CMA) represent two major lysosomal degradation processes and often compensate for one another to facilitate cell survival. The aim of this study was to determine whether these autophagy pathways could compensate for one another to promote HCC cell survival in the cirrhotic liver. Analysis of normal liver tissue showed no expression of glypican-3 or p62 proteins, suggesting that macroautophagy is the major contributor to autophagic flux under non-pathological conditions. Of 46 cirrhotic livers with HCC examined, 39 (84%) of HCCs showed increased expression of p62, and 36 (78%) showed increased expression of glypican-3, while adjacent non-tumorous hepatocytes were negative for expression of p62 and glypican-3, similar to normal liver tissue. These results suggest that macroautophagy flux is impaired in HCC. Furthermore, more than 95% of HCCs showed altered expression of LAMP-2A compared to the surrounding non-tumorous cirrhotic liver, consistent with induction of CMA in HCC. Elevated expression of glucose-regulated protein 78 (GRP78) and heat shock cognate protein (Hsc70) were detected in 100% of HCC and adjacent non-tumorous cirrhotic livers, suggesting that unresolved ER-stress is associated with HCC risk in liver cirrhosis. Interestingly, inhibition of lysosomal degradation using hydroxychloroquine (HCQ) induced expression of the tumor suppressor p53, promoted apoptosis, and inhibited HCC growth, whereas activation of autophagy using an mTOR inhibitor (Torin1) promoted HCC growth. Results of this study suggest that induction of CMA compensates for the impairment of macroautophagy to promote HCC survival in the cirrhotic liver.

Also flagged:LipiddegradationProstate cancermale cancerandrogen receptorAR
Journal Article 2017-06-01 ✓ 5 Snippets Itkonen HM, Brown M, Urbanucci A, Tredwell G, Ho Lau C, Barfeld S, Hart C, Guldvik IJ, Takhar M, Heemers HV, Erho N, Bloch K, Davicioni E, Derua R, Waelkens E, Mohler JL, Clarke N, Swinnen JV, Keun HC, Rekvig OP, Mills IG.
In-Text Gene Mentions

Here we show that Enoyl-CoA delta isomerase 2 (ECI2) is a novel AR-target that promotes prostate cancer cell survival.

Finally, we identified a clinically approved compound, perhexiline, which inhibits fatty acid degradation, and replicates the major findings for ECI2 knockdown.

ECI2 encodes for an enzyme involved in lipid metabolism, and we use multiple metabolite profiling platforms and RNA-seq to show that inhibition of ECI2 expression leads to decreased glucose utilization, accumulation of fatty acids and down-regulation of cell cycle related genes.

Based on these facts, we performed targeted phospholipidomic profiling of LNCaP prostate cancer cells after ECI2 knockdown, which revealed accumulation of all major classes of phospholipids, phosphatidylserine (PS), phosphatidylcholine (PC), phosphatidylethanolamine (PE) and phosphatidylinositol (PI) (Figure 3E and Supplementary Figure 2).

ECI2 knockdown decreased glucose consumption and lactate production, as measured from cell culture media (Figure 3B).

Show Full Abstract

Prostate cancer is the most common male cancer and androgen receptor (AR) is the major driver of the disease. Here we show that Enoyl-CoA delta isomerase 2 (ECI2) is a novel AR-target that promotes prostate cancer cell survival. Increased ECI2 expression predicts mortality in prostate cancer patients (p = 0.0086). ECI2 encodes for an enzyme involved in lipid metabolism, and we use multiple metabolite profiling platforms and RNA-seq to show that inhibition of ECI2 expression leads to decreased glucose utilization, accumulation of fatty acids and down-regulation of cell cycle related genes. In normal cells, decrease in fatty acid degradation is compensated by increased consumption of glucose, and here we demonstrate that prostate cancer cells are not able to respond to decreased fatty acid degradation. Instead, prostate cancer cells activate incomplete autophagy, which is followed by activation of the cell death response. Finally, we identified a clinically approved compound, perhexiline, which inhibits fatty acid degradation, and replicates the major findings for ECI2 knockdown. This work shows that prostate cancer cells require lipid degradation for survival and identifies a small molecule inhibitor with therapeutic potential.

Also flagged:Gastric cancerGastritisMSPatrophyCancerIRF4
Journal Article 2017-06-01 ✓ 1 Snippet Pirini F, Noazin S, Jahuira-Arias MH, Rodriguez-Torres S, Friess L, Michailidi C, Cok J, Combe J, Vargas G, Prado W, Soudry E, Pérez J, Yudin T, Mancinelli A, Unger H, Ili-Gangas C, Brebi-Mieville P, Berg DE, Hayashi M, Sidransky D, Gilman RH, Guerrero-Preston R.
In-Text Gene Mentions

…methylation of MOS,DCC, CRK , and…

Show Full Abstract

Clinically useful molecular tools to triage gastric cancer patients are not currently available. We aimed to develop a molecular tool to predict gastric cancer risk in endoscopy-driven biopsies obtained from high-risk gastric cancer clinics in low resource settings.We discovered and validated a DNA methylation biomarker panel in endoscopic samples obtained from 362 patients seen between 2004 and 2009 in three high-risk gastric cancer clinics in Lima, Perú, and validated it in 306 samples from the Cancer Genome Atlas project ("TCGA"). Global, epigenome wide and gene-specific DNA methylation analyses were used in a Phase I Biomarker Development Trial to identify a continuous biomarker panel that combines a Global DNA Methylation Index (GDMI) and promoter DNA methylation levels of IRF4, ELMO1, CLIP4 and MSC.We observed an inverse association between the GDMI and histological progression to gastric cancer, when comparing gastritis patients without metaplasia (mean = 5.74, 95% CI, 4.97-6.50), gastritis patients with metaplasia (mean = 4.81, 95% CI, 3.77-5.84), and gastric cancer cases (mean = 3.38, 95% CI, 2.82-3.94), respectively (p < 0.0001). Promoter methylation of IRF4 (p < 0.0001), ELMO1 (p < 0.0001), CLIP4 (p < 0.0001), and MSC (p < 0.0001), is also associated with increasing severity from gastritis with no metaplasia to gastritis with metaplasia and gastric cancer.Our findings suggest that IRF4, ELMO1, CLIP4 and MSC promoter methylation coupled with a GDMI>4 are useful molecular tools for gastric cancer risk stratification in endoscopic biopsies.

Also flagged:METBCR-ABL1tyrosine kinasebreakpoint cluster region-abelson 1imatinibchronic myeloid leukemia
Journal Article 2017-06-01 ✓ 3 Snippets Tsubaki M, Takeda T, Kino T, Sakai K, Itoh T, Imano M, Nakayama T, Nishio K, Satou T, Nishida S.
In-Text Gene Mentions

…satinib, bafetinib, ponatinib,DCC-2036, GNF-2, GNF-5, EPZ005687,…

…satinib, bafetinib, ponatinib,DCC-2036, GNF-2, and GNF-5.…

…matinib, dasatinib, ponatinib,DCC-2036, and GNF-5.…

Show Full Abstract

Resistance to the breakpoint cluster region-abelson 1 (BCR-ABL1) tyrosine kinase inhibitor (TKI) imatinib poses a major problem when treating chronic myeloid leukemia (CML). Imatinib resistance often results from a secondary mutation in BCR-ABL1. However, in the absence of a mutation in BCR-ABL1, the basis of BCR-ABL1-independent resistance must be elucidated. To gain insight into the mechanisms of BCR-ABL1-independent imatinib resistance, we performed an array-based comparative genomic hybridization. We identified various resistance-related genes, and focused on MET. Treatment with a MET inhibitor resensitized K562/IR cells to BCR-ABL1 TKIs. Combined treatment of K562/IR cells with imatinib and a MET inhibitor suppressed extracellular signal-regulated kinase 1/2 (ERK1/2) and c-Jun N-terminal kinase (JNK) activation, but did not affect AKT activation. Our findings implicate the MET/ERK and MET/JNK pathways in conferring resistance to imatinib, providing new insights into the mechanisms of BCR-ABL1 TKI resistance in CML.

Also flagged:RKIPclear cell renal cell carcinomaccRCCprostate cancerPCachronic kidney disease
Journal Article 2017-06-01 No Snippets Papale M, Vocino G, Lucarelli G, Rutigliano M, Gigante M, Rocchetti MT, Pesce F, Sanguedolce F, Bufo P, Battaglia M, Stallone G, Grandaliano G, Carrieri G, Gesualdo L, Ranieri E.
Show Full Abstract

Clear cell Renal Cell Carcinoma (ccRCC) causes over 13,000 deaths each year, and about 20,000 new cases/year in Europe. In most cases, the causes are unknown and, most importantly, there are no reliable biomarkers for the diagnosis and prognosis of this disease. The search for sensitive biomarkers for early diagnosis and prognosis of clear cell Renal Cell Carcinoma (ccRCC) is currently a fast growing field. We carried out proteomics analysis of 93 urinary samples of healthy subjects (HS) and patients affected by ccRCC, prostate cancer (PCa) and chronic kidney disease (CKD), that was able to successfully distinguish each group.The most significant candidate biomarker was identified by mass spectrometry as Raf Kinase Inhibitor Protein (RKIP), a key regulator of cell signaling, already described in several cancer types as a metastasis suppressor. By combining ELISA, immunoblotting and tissue microarray, we demonstrated that, in ccRCC, urinary excretion of RKIP and its phosphorylated form (p-RKIP) reflected the tissue expression of these putative biomarkers. Baseline urinary RKIP, evaluated in an independent cohort of 56 ccRCC patients and 28 HS, successfully distinguished both groups and, most importantly, a cut-off value of 10 ng/mg/g Pr/uCr enabled a highly accurate prediction of Cancer-specific survival and Progression-free survival. Furthermore, p-RKIP was totally undetectable in both tissue and urine samples of ccRCC, showing a great potential for diagnostics purposes.Our data indicate that urinary RKIP encompasses both the unphosphorylated and the phosphorylated form and that their combined evaluation can help in the diagnosis and prognosis of ccRCC.

Also flagged:exocytosisreceptor recyclingFilipinCpzPEGmacropinocytosis
Journal Article 2017-06-01 No Snippets Cui Y, Song X, Li S, He B, Yuan L, Dai W, Zhang H, Wang X, Yang B, Zhang Q.
Show Full Abstract

Among the diverse factors that may influence the therapeutic outcomes, the exocytosis of targeted drug delivery systems (TDDS) and its relationship with the corresponding receptor receive little attentions. In this study, cRGDfK modified gold nanoparticles (cRGDfK-PEG-AuNPs) were synthesized, and their cellular transportation including endocytosis and exocytosis, as well as the potential relations with αvβ3 integrin were carefully studied. The results showed that the enhanced and fast internalization of cRGDfK-PEG-AuNPs into U87 cells was associated with the high expression level of αvβ3 integrin. Importantly, the significant exocytosis of cRGDfK-PEG-AuNPs, but not the PEG conjugated gold nanoparticles (PEG-AuNPs), was found under the in vivo-simulated serum containing conditions. Interestingly, the exocytosis kinetics of nanoparticles was demonstrated to be tightly related with the recycling of the αvβ3 integrin, although the exocytosis of cRGDfK-PEG-AuNPs slightly lagged behind the receptor recycling. In effect, our findings uncover a new underlying behavior of receptor mediated TDDS and have implication for their rational design and application in the future.

Also flagged:IGF2mRNA binding protein 3IMP3gliomacell migrationglioblastoma
Journal Article 2017-06-01 ✓ 4 Snippets Bhargava S, Visvanathan A, Patil V, Kumar A, Kesari S, Das S, Hegde AS, Arivazhagan A, Santosh V, Somasundaram K.
In-Text Gene Mentions

…erse) : CAGCGTCAATTCCTGCAATGG,POU3F2(forward) : TGACGATCTCCACGCAGT…

…rward) : TGACGATCTCCACGCAGTAG,POU3F2(reverse) : GGCAGAAAGCTGTCCAAG…

…transcription factors- OLIG2,POU3F2, SOX2 and SALL2…

…SOX2, SALL2 andPOU3F2(Figure 6D ).…

Show Full Abstract

The diffusely infiltrative nature of glioblastoma (GBM) makes them highly recurrent. IGF2 mRNA-binding protein 3 (IMP3), a GBM upregulated RNA binding protein, promotes glioma cell migration. An integrative bioinformatics analysis identified p65 (RELA), a subunit of NF-κB heterodimer as a target and an important mediator of IMP3 promoted glioma cell migration. IMP3 increased p65 protein levels without any change in p65 transcript levels, but promoted its polysome association. RIP-PCR demonstrated the binding of IMP3 to p65 transcript. UV crosslinking experiments with in vitro transcribed RNA confirmed the specific and direct binding of IMP3 to sites on p65 3'UTR. Further, IMP3 induced luciferase activity from p65 3'UTR reporter carrying wild type sites but not mutated sites. Exogenous overexpression of p65 from a 3'UTR-less construct rescued the reduced migration of glioma cells in IMP3 silenced condition. In addition, IMP3 silencing inhibited glioma stem-like cell maintenance and migration. The exogenous overexpression of 3'UTR-less p65 significantly alleviated the inhibition of neurosphere formation observed in IMP3 silenced glioma stem-like cells. Further, we show that IMP3 is transcriptionally activated by NF-κB pathway indicating the presence of a positive feedback loop between IMP3 and p65. This study establishes p65 as a novel target of IMP3 in increasing glioma cell migration and underscores the significance of IMP3-p65 feedback loop for therapeutic targeting in GBM.

Also flagged:UHRF1ubiquitin-like with PHD and RING finger domains 1methylationcancerstumorretinoblastoma
Journal Article 2017-06-01 ✓ 1 Snippet Kan G, He H, Zhao Q, Li X, Li M, Yang H, Kim JK.
In-Text Gene Mentions

…also to recruitchromatin modifiersmodifiers such as…

Show Full Abstract

UHRF1 (ubiquitin-like with PHD and RING finger domains 1) is a critical regulator for DNA methylation, and its frequent overexpression in human cancers has been associated with tumor-promoting effects. However, whether the overexpressed UHRF1 contributes to the establishment and maintenance of tumor methylomes and whether this process can affect the tumorigenesis remain unclear. In this study, we show that UHRF1 is highly expressed in retinoblastoma, and genomes of human primary retinoblastoma and cell lines have differential DNA methylation patterns compared with those of normal retina, characterized by lower global methylation and higher promoter methylation of tumor suppressors. However, our genome-wide DNA methylation study uncovers that UHRF1 down-modulation in retinoblastoma cells exerts minor effects on the existing methylation patterns at both bulk genome and individual gene loci, suggesting that retinoblastoma methylome is primarily maintained by other mechanisms. Furthermore, using two murine retinoblastoma models, we found that high UHRF1 expression does not alter global methylation levels in both premalignant neonatal retina and retinoblastoma tumors, implying that DNA hypomethylation may not be an early mechanism driving retinoblastoma tumorigenesis unlike what has been proposed for other types of cancer. These results suggest that tumor-promoting functions of UHRF1 in retinoblastoma are largely independent of its role in DNA methylation.

Also flagged:Acute myeloid leukemiahematologicpathogenesiscancersPediatricAML
Journal Article 2017-06-01 No Snippets Zhu R, Zhao W, Fan F, Tang L, Liu J, Luo T, Deng J, Hu Y.
Show Full Abstract

Acute myeloid leukemia is a hematologic malignancy with significant molecular heterogeneity. MicroRNAs have important biological functions and play critical roles in pathogenesis and prognosis in a variety of cancers including acute myeloid leukemia. Some reports have constructed risk stratification systems for adult acute myeloid leukemia patients using microRNAs to predict an optimal outcome of patients. However, little has been done in pediatric and adolescent patients. The purpose of this study is to identify a panel of microRNA signature that could predict prognosis in younger cytogenetically normal acute myeloid leukemia patients by analyzing the data from The Cancer Genome Atlas. A total of 59 cytogenetically normal acute myeloid leukemia patients under 21 years with corresponding clinical data were enrolled in our study. Using univariate Cox's model, we found 17 miRNAs were significantly related with overall survival in pediatric and adolescent cytogenetically normal acute myeloid leukemia patients but no clinical parameter was found significant related with overall survival. The multivariate Cox regression identified high expression of hsa-miR-146b was independent poor prognostic factor and high expression of hsa-miR-181c and hsa-miR-4786 appeared to be favorable factors. A model was proposed based on these three miRNAs. Leave-one-out Cross Validation method and Permutation Test was further used to evaluate this model. The function role of has-mir-181c was further studied by carrying out flow cytometry and cell counting kit-8 (CCK-8) in U937 cell line. The results indicate that the 3-microRNA-based signature is a reliable prognostic biomarker for pediatric and adolescent cytogenetically normal acute myeloid leukemia patients.

Also flagged:CalciumKidney failuremetabolismchronic kidney diseasecationosteoporosis
Journal Article 2017-06-01 No Snippets Hill Gallant KM, Spiegel DM.
Show Full Abstract

<h4>Purpose of review</h4>The kidneys play a critical role in the balance between the internal milieu and external environment. Kidney failure is known to disrupt a number of homeostatic mechanisms that control serum calcium and normal bone metabolism. However, our understanding of calcium balance throughout the stages of chronic kidney disease is limited and the concept of balance itself, especially with a cation as complex as calcium, is often misunderstood. Both negative and positive calcium balance have important implications in patients with chronic kidney disease, where negative balance may increase risk of osteoporosis and fracture and positive balance may increase risk of vascular calcification and cardiovascular events. Here, we examine the state of current knowledge about calcium balance in adults throughout the stages of chronic kidney disease and discuss recommendations for clinical strategies to maintain balance as well as future research needs in this area.<h4>Recent findings</h4>Recent calcium balance studies in adult patients with chronic kidney disease show that neutral calcium balance is achieved with calcium intake near the recommended daily allowance. Increases in calcium through diet or supplements cause high positive calcium balance, which may put patients at risk for vascular calcification. However, heterogeneity in calcium balance exists among these patients. Given the available calcium balance data in this population, it appears clinically prudent to aim for recommended calcium intakes around 1000 mg/day to achieve neutral calcium balance and avoid adverse effects of either negative or positive calcium balance. Assessment of patients' dietary calcium intake could further equip clinicians to make individualized recommendations for meeting recommended intakes.

Also flagged:ApelinBevacizumabcancercolorectal cancertumourVEGF
Journal Article 2017-06-01 ✓ 2 Snippets Zuurbier L, Rahman A, Cordes M, Scheick J, Wong TJ, Rustenburg F, Joseph JC, Dynoodt P, Casey R, Drillenburg P, Gerhards M, Barat A, Klinger R, Fender B, O'Connor DP, Betge J, Ebert MP, Gaiser T, Prehn JHM, Griffioen AW, van Grieken NCT, Ylstra B, Byrne AT, van der Flier LG, Gallagher WM, Postel R.
In-Text Gene Mentions

…FDR p =0.05),PCDH17(FC 2.43, FDR…

…of 10 genes:PCDH17, SPP1 ,…

Show Full Abstract

Bevacizumab (bvz) is currently employed as an anti-angiogenic therapy across several cancer indications. Bvz response heterogeneity has been well documented, with only 10-15% of colorectal cancer (CRC) patients benefitting in general. For other patients, clinical efficacy is limited and side effects are significant. This reinforces the need for a robust predictive biomarker of response. To identify such a biomarker, we performed a DNA microarray-based transcriptional profiling screen with primary endothelial cells (ECs) isolated from normal and tumour colon tissues. Thirteen separate populations of tumour-associated ECs and 10 of normal ECs were isolated using fluorescence-activated cell sorting. We hypothesised that VEGF-induced genes were overexpressed in tumour ECs; these genes could relate to bvz response and serve as potential predictive biomarkers. Transcriptional profiling revealed a total of 2,610 differentially expressed genes when tumour and normal ECs were compared. To explore their relation to bvz response, the mRNA expression levels of top-ranked genes were examined using quantitative PCR in 30 independent tumour tissues from CRC patients that received bvz in the adjuvant setting. These analyses revealed that the expression of MMP12 and APLN mRNA was significantly higher in bvz non-responders compared to responders. At the protein level, high APLN expression was correlated with poor progression-free survival in bvz-treated patients. Thus, high APLN expression may represent a novel predictive biomarker for bvz unresponsiveness.

Also flagged:retinal vein occlusionVEGFbevacizumabMEEdemamacular edema
Journal Article 2017-06-01 No Snippets Scott IU, VanVeldhuisen PC, Ip MS, Blodi BA, Oden NL, King J, Antoszyk AN, Peters MA, Tolentino M, SCORE2 Investigator Group.
Show Full Abstract

<h4>Importance</h4>Macular edema (ME) is the leading cause of decreased visual acuity (VA) associated with retinal vein occlusion (RVO). Identifying factors associated with better outcomes in RVO eyes treated with anti-vascular endothelial growth factor (VEGF) therapy may provide information useful in counseling patients.<h4>Objective</h4>To investigate baseline characteristics associated with 6-month VA and central subfield thickness (CST) outcomes in participants in the Study of Comparative Treatments for Retinal Vein Occlusion 2 (SCORE2).<h4>Design, setting, and participants</h4>A total of 362 patients with central RVO or hemi-RVO were enrolled between September 17, 2014, and November 18, 2015, and randomized 1:1 in a masked fashion to receive bevacizumab or aflibercept. At month 6, 348 participants (96%) had VA outcomes measured and 335 participants (93%) had spectral domain optical coherence tomography outcomes measured. The current data analysis was conducted from February 27, 2017, to April 7, 2017.<h4>Interventions</h4>Eyes were randomly assigned to receive an intravitreal injection of bevacizumab, 1.25 mg, or aflibercept, 2.0 mg, at baseline and every 4 weeks, with the primary outcome measured at 6 months.<h4>Main outcomes and measures</h4>Change from baseline in VA letter score (VALS), VALS gain of 15 or more, change from baseline in CST, CST less than 300 µm, and resolution of ME. Baseline factors associated with 6-month outcome at the 0.05 level in univariate regressions were included in multivariate regressions, with those significant after multiplicity control by the Hochberg method reported.<h4>Results</h4>The mean (SD) age of patients was 69 (12) years, and 43% were women. Younger patient age (odds ratio [OR], 0.95 per year of age; 95% CI, 0.93-0.98; P = .007) and lower baseline VALS (OR, 0.96 per letter; 95% CI, 0.94-0.98; P < .001) were associated with a 6-month VALS gain of 15 or greater. Compared with bevacizumab, aflibercept treatment was associated with a higher odds of ME resolution (OR, 3.59; 95% CI, 2.22-5.80; P < .001) and CST less than 300 µm (OR,  5.30; 95% CI, 2.40-11.67; P = .001), but not with a better VA outcome. Macular edema was less likely to resolve in eyes that received anti-VEGF treatment prior to study participation (OR, 0.33; 95% CI, 0.17-0.64; P = .03).<h4>Conclusions and relevance</h4>In eyes treated with bevacizumab or aflibercept, younger age and worse baseline VALS were associated with better 6-month VA outcomes. Aflibercept treatment was associated with more favorable spectral domain optical coherence tomography outcomes but not VA outcomes. These findings may be useful in assessing expected response at month 6 after monthly injection of anti-VEGF agents for treating ME due to CRVO and HRVO.<h4>Trial registration</h4>clinicaltrials.gov Identifier: NCT01969708.

Also flagged:Gene expressionprostate cancerPCacancertumortumors
Journal Article 2017-06-01 No Snippets Jhun MA, Geybels MS, Wright JL, Kolb S, April C, Bibikova M, Ostrander EA, Fan JB, Feng Z, Stanford JL.
Show Full Abstract

Prostate cancer (PCa) is a leading cause of cancer-related mortality worldwide. Gleason score (GS) is one of the best predictors of PCa aggressiveness, but additional tumor biomarkers may improve its prognostic accuracy. We developed a gene expression signature of GS to enhance the prediction of PCa outcomes. Elastic net was used to construct a gene expression signature by contrasting GS 8-10 vs. ≤6 tumors in The Cancer Genome Atlas (TCGA) dataset. The constructed signature was then evaluated for its ability to predict recurrence and metastatic-lethal (ML) progression in a Fred Hutchinson (FH) patient cohort (N=408; NRecurrence=109; NMLprogression=27). The expression signature included transcripts representing 49 genes. In the FH cohort, a 25% increase in the signature was associated with a hazard ratio (HR) of 1.51 (P=2.7×10-5) for recurrence. The signature's area under the curve (AUC) for predicting recurrence and ML progression was 0.68 and 0.76, respectively. Compared to a model with age at diagnosis, pathological stage and GS, the gene expression signature improved the AUC for recurrence (3%) and ML progression (6%). Higher levels of the signature were associated with increased expression of genes in cell cycle-related pathways and decreased expression of genes in androgen response, estrogen response, oxidative phosphorylation, and apoptosis. This gene expression signature based on GS may improve the prediction of recurrence as well as ML progression in PCa patients after radical prostatectomy.

Also flagged:calciumlipidBcl-2lung cancertumorcalcium phosphate
Journal Article 2017-06-01 No Snippets Cai RQ, Liu DZ, Cui H, Cheng Y, Liu M, Zhang BL, Mei QB, Zhou SY.
Show Full Abstract

Bcl-2 gene is an important target to treat lung cancer. The small interference RNA (siRNA) of Bcl-2 gene (siBcl-2) can specifically silence Bcl-2 gene. However, naked siBcl-2 is difficult to accumulate in the tumor tissue to exert its activity. In this paper, a calcium phosphate lipid hybrid nanoparticle that possessed charge reversible property was prepared to enhance the activity of siBcl-2 in vivo. The average diameter and zeta potential of siBcl-2 loaded calcium phosphate lipid hybrid nanoparticles (LNPS@siBcl-2) were 80 nm and -13 mV at pH7.4 whereas the diameter and zeta potential changed to 1506 nm and +9 mV at pH5.0. LNPS@siBcl-2 could efficiently deliver siBcl-2 to the cytoplasm and significantly decreased the expression of Bcl-2 in A549 cells. Moreover, the in vivo experimental results showed that most of the Cy5-siBcl-2 accumulated in tumor tissue after LNPS@Cy5-siBcl-2 was administered to tumor-bearing mice by tail vein injection. Meanwhile, the expression of Bcl-2 was decreased but the expression of the BAX and Caspase-3 was increased in tumor tissue. LNPS@siBcl-2 significantly inhibited the growth of tumor in tumor-bearing mice without any obvious systemic toxicity. Thus, the charge reversible calcium phosphate lipid hybrid nanoparticle was an excellent siBcl-2 delivery carrier to improve the activity of siBcl-2 in vivo. LNPS@siBcl-2 has potential in the treatment of lung cancer.

Also flagged:E2F1TINCRgastric cancertranscription factorcancerstumor
Journal Article 2017-06-01 ✓ 5 Snippets Xu TP, Wang YF, Xiong WL, Ma P, Wang WY, Chen WM, Huang MD, Xia R, Wang R, Zhang EB, Liu YW, De W, Shu YQ.
In-Text Gene Mentions

E2F1 induces TINCR transcriptional activity and accelerates gastric cancer progression via activation of TINCR/STAU1/CDKN2B signaling axis.

Together, our findings suggest that E2F1/TINCR/STAU1/CDKN2B signaling axis contributes to the oncogenic potential of GC and may constitute a potential therapeutic target in this disease.

Our previous study revealed that most TINCR molecules are located within the cytoplasm, and are bound to STAU1 protein in GC cells, and the results are further confirmed in MGC803 and AGS cell lines (Supplementary Figure S2).

…could bind toSTAU1(staufen1) protein, and…

…activation of TINCR/STAU1/ CDKN2B signaling…

Show Full Abstract

Recent evidence indicates that E2F1 transcription factor have pivotal roles in the regulation of cellular processes, and is found to be dysregulated in a variety of cancers. Long non-coding RNAs (lncRNAs) are also reported to exert important effect on tumorigenesis. E2F1 is aberrantly expressed in gastric cancer (GC), and biology functions of E2F1 in GC are controversial. The biological characteristics of E2F1 and correlation between E2F1 and lncRNAs in GC remain to be found. In this study, integrated analysis revealed that E2F1 expression was significantly increased in GC cases and its expression was positively correlated with the poor pathologic stage, large tumor size and poor prognosis. Forced E2F1 expression promotes proliferation, whereas loss of E2F1 function decreased cell proliferation by blocking of cell cycle in GC cells. Mechanistic analyses indicated that E2F1 accelerates GC growth partly through induces TINCR transcription. TINCR could bind to STAU1 (staufen1) protein, and influence CDKN2B mRNA stability and expression, thereby affecting the proliferation of GC cells. Together, our findings suggest that E2F1/TINCR/STAU1/CDKN2B signaling axis contributes to the oncogenic potential of GC and may constitute a potential therapeutic target in this disease.

Also flagged:Huntington diseasepathogenesisHDautosomal dominant neurodegenerative diseaseamino acidcaspase-6
Journal Article 2017-06-01 ✓ 5 Snippets Schut MH, Patassini S, Kim EH, Bullock J, Waldvogel HJ, Faull RLM, Pepers BA, den Dunnen JT, van Ommen GB, van Roon-Mom WMC.
In-Text Gene Mentions

Between HD subjects the N-terminal htt fragment profile was similar with small interpersonal variation.

Although we were only able to perform our study on one subject, our results indicate that this 50kDa N-terminal htt fragment could be associated with PMD.

We observed that the western blot signal for full-length htt and N-terminal htt fragments was stronger in control subjects compared to HD subjects, and overall stronger in cortex tissue compared to striatal tissue, while no differences in the β-actin loading controls were observed (S1 Fig).

The htt N-terminal domain contains several proteolytic cleavage sites, some of which have been linked to HD pathology [11–14].

Huntington disease is associated with elongation of a CAG repeat in the HTT gene that results in a mutant huntingtin protein.

Show Full Abstract

Huntington disease is associated with elongation of a CAG repeat in the HTT gene that results in a mutant huntingtin protein. Several studies have implicated N-terminal huntingtin protein fragments in Huntington disease pathogenesis. Ideally, these fragments are studied in human brain tissue. However, the use of human brain tissue comes with certain unavoidable variables such as post mortem delay, artefacts from freeze-thaw cycles and subject-to-subject variation. Knowledge on how these variables might affect N-terminal huntingtin protein fragments in post mortem human brain is important for a proper interpretation of study results. The effect of post mortem delay on protein in human brain is known to vary depending on the protein of interest. In the present study, we have assessed the effect of post mortem delay on N-terminal huntingtin protein fragments using western blot. We mimicked post mortem delay in one individual control case and one individual Huntington disease case with low initial post mortem delay. The influence of subject-to-subject variation on N-terminal huntingtin fragments was assessed in human cortex and human striatum using two cohorts of control and Huntington disease subjects. Our results show that effects of post mortem delay on N-terminal huntingtin protein fragments are minor in our individual subjects. Additionally, one freeze-thaw cycle decreases the huntingtin western blot signal intensity in the cortex control subject, but does not introduce additional N-terminal huntingtin fragments. Our results suggest that subject-to-subject variation contributes more to variability in N-terminal huntingtin fragments than post mortem delay.

Also flagged:type 2 diabetes mellitusSteatohepatitisnon-alcoholic fatty liver diseaseNAFLDmetabolic syndromeMS
Journal Article 2017-06-01 ✓ 1 Snippet Masarone M, Rosato V, Aglitti A, Bucci T, Caruso R, Salvatore T, Sasso FC, Tripodi MF, Persico M.
In-Text Gene Mentions

…primary or secondaryhemochromatosis, Wilson disease, Budd-Chiari…

Show Full Abstract

Recent studies report a prevalence of non-alcoholic fatty liver disease (NAFLD) of between 70% and 80% in patients with metabolic syndrome (MS) and type 2 diabetes mellitus (T2DM). Nevertheless, it is not possible to differentiate between simple steatosis and non-alcoholic steatohepatitis (NASH) with non-invasive tests. The aim of this study was to differentiate between simple steatosis and NASH by liver biopsy in patients with hypertransaminasemia and MS or T2DM. Two hundred and fifteen patients with increased ALT levels and MS, and 136 patients at their first diagnosis of T2DM regardless of ALT values were consecutively admitted to a tertiary hepatology center between January 2004 and November 2014. Exclusion criteria were other causes of liver disease/ALT increase. Each patient underwent a clinical, laboratory and ultrasound evaluation, and a liver biopsy. Gender distribution, age, and body mass index were similar in the two groups of patients, whereas cholesterol levels, glycemia and blood pressure were significantly different between the two groups. The prevalence of NAFLD was 94.82% in MS patients and 100% in T2DM patients. NASH was present in 58.52% of MS patients and 96.82% of T2DM. Consequently, this study reveals that, by using liver biopsy, almost all patients with T2DM or MS have NAFLD, which in patients with T2DM means NASH. Importantly, it suggests that NASH may be one of the early complications of T2DM due to its pathophysiological correlation with insulin resistance.

Also flagged:magnesiumcalciummetabolismextracellularvascular calcificationvascular
Journal Article 2017-06-01 No Snippets Villa-Bellosta R.
Show Full Abstract

<h4>Objective</h4>An inverse relationship between serum magnesium concentration and vascular calcification has been reported following observational clinical studies. Moreover, several studies have been suggesting a protective effect of magnesium on the vascular calcification. However, the exact mechanism remains elusive, and investigators have speculated among a myriad of potential actions. The effect of magnesium on calcification of the aortic wall is yet to be investigated. In the present study, the effects of magnesium and calcium on the metabolism of extracellular PPi, the main endogenous inhibitor of vascular calcification, were investigated in the rat aorta.<h4>Approach and results</h4>Calcium and magnesium have antagonist effects on PPi hydrolysis in the aortic wall. Km and Ki values for PPi hydrolysis in rat aortic rings were 1.1 mmol/L magnesium and 32 μmol/L calcium, respectively, but ATP hydrolysis was not affected with calcium. Calcium deposition in the rat aortic wall dramatically increased when the magnesium concentration was increased (ratio of Mg:Ca = 1:1; 1.5 mmol/L calcium and 1.5 mmol/L magnesium) respect to low magnesium concentration (ratio Mg:Ca = 1:3, 1.5 mmol/L calcium and 0.75 mmol/L magnesium).<h4>Conclusion</h4>Data from observational clinical studies showing that the serum magnesium concentration is inversely correlated with vascular calcification could be reinterpreted as a compensatory regulatory mechanism that reduces both PPi hydrolysis and vascular calcification. The impact of magnesium in vascular calcification in humans could be studied in association with calcium levels, for example, as the magnesium:calcium ratio.

Also flagged:behavioralpsychiatric illnessbrain developmentorganizationmetabolismDPYSL2
Journal Article 2017-06-01 ✓ 1 Snippet Agoglia AE, Holstein SE, Small AT, Spanos M, Burrus BM, Hodge CW.
In-Text Gene Mentions

…(BDNF) and huntingtin (HTT).…

Show Full Abstract

Adolescence is a developmental period characterized by unique behavioral phenotypes (increased novelty seeking, risk taking, sociability and impulsivity) and increased risk for destructive behaviors, impaired decision making and psychiatric illness. Adaptive and maladaptive adolescent traits have been associated with development of the medial prefrontal cortex (mPFC), a brain region that mediates regulatory control of behavior. However, the molecular changes that underlie brain development and behavioral vulnerability have not been fully characterized. Using high-throughput 2D DIGE spot profiling with identification by MALDI-TOF mass spectrometry, we identified 62 spots in the PFC that exhibited age-dependent differences in expression. Identified proteins were associated with diverse cellular functions, including intracellular signaling, synaptic plasticity, cellular organization and metabolism. Separate Western blot analyses confirmed age-related changes in DPYSL2, DNM1, STXBP1 and CFL1 in the mPFC and expanded these findings to the dorsal striatum, nucleus accumbens, motor cortex, amygdala and ventral tegmental area. Ingenuity Pathway Analysis (IPA) identified functional interaction networks enriched with proteins identified in the proteomics screen, linking age-related alterations in protein expression to cellular assembly and development, cell signaling and behavior, and psychiatric illness. These results provide insight into potential molecular components of adolescent cortical development, implicating structural processes that begin during embryonic development as well as plastic adaptations in signaling that may work in concert to bring the cortex, and other brain regions, into maturity.

Also flagged:canceroncoproteinsE6E7degradationtumor suppressor p53
Journal Article 2017-06-01 No Snippets Fischer M, Uxa S, Stanko C, Magin TM, Engeland K.
Show Full Abstract

High risk human papilloma viruses cause several types of cancer. The HPV oncoproteins E6 and E7 are essential for oncogenic cell transformation. E6 mediates the degradation of the tumor suppressor p53, and E7 can form complexes with the retinoblastoma pRB tumor suppressor. Recently, it has been shown that HPV E7 can also interfere with the function of the DREAM transcriptional repressor complex. Disruption of DREAM-dependent transcriptional repression leads to untimely early expression of central cell cycle regulators. The p53-p21-DREAM pathway represents one important means of cell cycle checkpoint activation by p53. By activating this pathway, p53 can downregulate transcription of genes controlled by DREAM. Here, we present a genome-wide ranked list of genes deregulated by HPV E7 expression and relate it to datasets of cell cycle genes and DREAM targets. We find that DREAM targets are generally deregulated after E7 expression. Furthermore, our analysis shows that p53-dependent downregulation of DREAM targets is abrogated when HPV E7 is expressed. Thus, p53 checkpoint control is impaired by HPV E7 independently of E6. In summary, our analysis reveals that disruption of DREAM through the HPV E7 oncoprotein upregulates most, if not all, cell cycle genes and impairs p53's control of cell cycle checkpoints.

Also flagged:hypersensitivitynerve injuryhyperalgesiaintercellular adhesion molecule 1ICAM-1IL-1β
Journal Article 2017-06-01 ✓ 1 Snippet Fischer G, Wang F, Xiang H, Bai X, Yu H, Hogan QH.
In-Text Gene Mentions

immunoglobulin superfamily DCC subclass member 4

Show Full Abstract

Injury-induced neuropathic pain remains a serious clinical problem. Recent studies indicate that bone marrow stromal cells (BMSCs) effectively attenuate chronic neuropathic pain in animal models. Here, we examined the therapeutic effect of intrathecal administration of BMSCs isolated from young (1-month-old) rats on pain hypersensitivity induced by tibial nerve injury. Cerebrospinal fluid (CSF) was collected and analyzed to examine the effect of BMSC administration on the expression of 67 soluble factors in CSF. A sustained remission in injury-induced mechanical hyperalgesia was observed in BMSC-treated rats but not in control animals. Engrafted BMSCs were observed in spinal cords and dorsal root ganglia at 5 weeks after cell injection. Injury significantly decreased the levels of six soluble factors in CSF: intercellular adhesion molecule 1 (ICAM-1), interleukin-1β (IL-1β), IL-10, hepatocyte growth factor (HGF), Nope protein, and neurogenic locus notch homolog protein 1 (Notch-1). Intrathecal BMSCs significantly attenuated the injury-induced reduction of ICAM-1, IL-1β, HGF, IL-10, and Nope. This study adds to evidence supporting the use of intrathecal BMSCs in pain control and shows that this effect is accompanied by the reversal of injury-induced reduction of multiple CSF soluble factors. Our findings suggest that these soluble factors may be potential targets for treating chronic pain.

Also flagged:MigraineNucleotideFamilial hemiplegic migraine type 1FHM1CACNA1Apore
Journal Article 2017-06-01 ✓ 5 Snippets Ambrosini A, D'Onofrio M, Buzzi MG, Arisi I, Grieco GS, Pierelli F, Santorelli FM, Schoenen J.
In-Text Gene Mentions

We identified a polymorphism in exon 20 of the CACNA1E gene (Asp859Glu - rs35737760) that is more prevalent in hemiplegic and brain stem aura migraine.

Possible Involvement of the CACNA1E Gene in Migraine: A Search for Single Nucleotide Polymorphism in Different Clinical Phenotypes.

To search for differences in prevalence of a CACNA1E variant between migraine without aura, various phenotypes of migraine with aura, and healthy controls.

<h4>Objective</h4>To search for differences in prevalence of a CACNA1E variant between migraine without aura, various phenotypes of migraine with aura, and healthy controls.<h4>Background</h4>Familial hemiplegic migraine type 1 (FHM1) is associated with mutations in the CACNA1A gene coding for the alpha 1A (Ca<sub>v</sub> 2.1) pore-forming subunit of P/Q voltage-dependent Ca<sup>2+</sup> channels.

There was no significant difference between migraine with typical aura (10.9%) and controls.<h4>Conclusions</h4>We identified a polymorphism in exon 20 of the CACNA1E gene (Asp859Glu - rs35737760) that is more prevalent in hemiplegic and brain stem aura migraine.

Show Full Abstract

<h4>Objective</h4>To search for differences in prevalence of a CACNA1E variant between migraine without aura, various phenotypes of migraine with aura, and healthy controls.<h4>Background</h4>Familial hemiplegic migraine type 1 (FHM1) is associated with mutations in the CACNA1A gene coding for the alpha 1A (Ca<sub>v</sub> 2.1) pore-forming subunit of P/Q voltage-dependent Ca<sup>2+</sup> channels. These mutations are not found in the common forms of migraine with or without aura. The alpha 1E subunit (Ca<sub>v</sub> 2.3) is the counterpart of Ca<sub>v</sub> 2.1 in R-type Ca<sup>2+</sup> channels, has different functional properties, and is encoded by the CACNA1E gene.<h4>Methods</h4>First, we performed a total exon sequencing of the CACNA1E gene in three probands selected because they had no abnormalities in the three FHM genes. In a patient suffering from basilar-type migraine, we identified a single nucleotide polymorphism (SNP) in exon 20 of the CACNA1E gene (Asp859Glu - rs35737760; Minor Allele Frequency 0.2241) hitherto not studied in migraine. In a second step, we determined its occurrence in four groups by direct sequencing on blood genomic DNA: migraine patients without aura (N = 24), with typical aura (N = 55), complex neurological auras (N = 19; hemiplegic aura: N = 15; brain stem aura: N = 4), and healthy controls (N = 102).<h4>Results</h4>The Asp859Glu - rs35737760 SNP of the CACNA1E gene was present in 12.7% of control subjects and in 20.4% of the total migraine group. In the migraine group it was significantly over-represented in patients with complex neurological auras (42.1%), OR 4.98 (95% CI: 1.69-14.67, uncorrected P = .005, Bonferroni P = .030, 2-tailed Fisher's exact test). There was no significant difference between migraine with typical aura (10.9%) and controls.<h4>Conclusions</h4>We identified a polymorphism in exon 20 of the CACNA1E gene (Asp859Glu - rs35737760) that is more prevalent in hemiplegic and brain stem aura migraine. This missense variant causes a change from aspartate to glutamate at position 859 of the Ca<sub>v</sub> 2.3 protein and might modulate the function of R-type Ca<sup>2+</sup> channels. It could thus be relevant for migraine with complex neurological aura, although this remains to be proven.

Also flagged:HANDNeurocognitive DisordersHIV infectionchronic infectionasymptomatic neurocognitive impairmentANI
Journal Article 2017-06-01 ✓ 1 Snippet Ubaida-Mohien C, Lamberty B, Dickens AM, Mielke MM, Marcotte T, Sacktor N, Grant I, Letendre S, Franklin D, Cibrowski P, Tharakan R, McArthur JC, Fox H, Haughey NJ.
In-Text Gene Mentions

Serpin C1

Show Full Abstract

<h4>Background</h4>The prevalence of HIV-associated neurocognitive disorders (HAND) has not changed considerably in the last two decades. Potent antiretroviral therapy has shifted the severity of HAND to milder phenotypes, but excess morbidity and mortality continue to be associated with HAND. Changes in numerous markers of immune function, inflammation, and cellular stress have been repeatedly associated with HAND, but the underlying systems that drive these changes have not been identified.<h4>Method</h4>In this study, we used systems informatics to interrogate the cerebrospinal fluid proteomic content of longitudinal samples obtained from HIV-infected adults with stably unimpaired, stably impaired, worsening, or improving neurocognitive performance.<h4>Results and conclusion</h4>The patterns of change in cerebrospinal fluid protein content implicated the induction of acute phase and complement systems as important regulators of neurocognitive status. Worsening neurocognitive performance was preceded by induction of acute phase and complement systems, whereas improving neurocognitive performance was preceded by a downregulation of these systems.

Also flagged:Infectious Diseasedespneumoniatopkeyvan
Journal Article 2017-06-01 No Snippets Watson NL, Prosperi C, Driscoll AJ, Higdon MM, Park DE, Sanza M, DeLuca AN, Awori JO, Goswami D, Hammond E, Hossain L, Johnson C, Kamau A, Kuwanda L, Moore DP, Neyzari O, Onwuchekwa U, Parker D, Sapchookul P, Seidenberg P, Shamsul A, Siazeele K, Srisaengchai P, Sylla M, Levine OS, Murdoch DR, O'Brien KL, Wolff M, Deloria Knoll M.
Show Full Abstract

The Pneumonia Etiology Research for Child Health (PERCH) study is the largest multicountry etiology study of pediatric pneumonia undertaken in the past 3 decades. The study enrolled 4232 hospitalized cases and 5325 controls over 2 years across 9 research sites in 7 countries in Africa and Asia. The volume and complexity of data collection in PERCH presented considerable logistical and technical challenges. The project chose an internet-based data entry system to allow real-time access to the data, enabling the project to monitor and clean incoming data and perform preliminary analyses throughout the study. To ensure high-quality data, the project developed comprehensive quality indicator, data query, and monitoring reports. Among the approximately 9000 cases and controls, analyzable laboratory results were available for ≥96% of core specimens collected. Selected approaches to data management in PERCH may be extended to the planning and organization of international studies of similar scope and complexity.

Also flagged:RPAE3 LigaseRFWD3Fanconi anemiaE3 ubiquitin ligasereplication protein A
Journal Article 2017-06-01 ✓ 1 Snippet Feeney L, Muñoz IM, Lachaud C, Toth R, Appleton PL, Schindler D, Rouse J.
In-Text Gene Mentions

…such as theMMS22L-TONSL complex, have been…

Show Full Abstract

Defects in the repair of DNA interstrand crosslinks (ICLs) are associated with the genome instability syndrome Fanconi anemia (FA). Here we report that cells with mutations in RFWD3, an E3 ubiquitin ligase that interacts with and ubiquitylates replication protein A (RPA), show profound defects in ICL repair. An amino acid substitution in the WD40 repeats of RFWD3 (I639K) found in a new FA subtype abolishes interaction of RFWD3 with RPA, thereby preventing RFWD3 recruitment to sites of ICL-induced replication fork stalling. Moreover, single point mutations in the RPA32 subunit of RPA that abolish interaction with RFWD3 also inhibit ICL repair, demonstrating that RPA-mediated RFWD3 recruitment to stalled replication forks is important for ICL repair. We also report that unloading of RPA from sites of ICL induction is perturbed in RFWD3-deficient cells. These data reveal important roles for RFWD3 localization in protecting genome stability and preserving human health.

Also flagged:circadian rhythmscardiovascular dysautonomiacircadian activity rhythmsrhythmsautonomic dysfunctionbaroreceptor reflex
Journal Article 2017-06-01 ✓ 2 Snippets Cutler TS, Park S, Loh DH, Jordan MC, Yokota T, Roos KP, Ghiani CA, Colwell CS.
In-Text Gene Mentions

…the Huntington (Htt) gene which…

…MutantHttis expressed in…

Show Full Abstract

Cardiovascular dysautonomia as well as the deterioration of circadian rhythms are among the earliest detectable pathophysiological changes in individuals with Huntington's disease (HD). Preclinical research requires mouse models that recapitulate disease symptoms and the Q175 knock-in model offers a number of advantages but potential autonomic dysfunction has not been explored. In this study, we sought to test the dual hypotheses that cardiovascular dysautonomia can be detected early in disease progression in the Q175 model and that this dysfunction varies with the daily cycle. Using radiotelemetry implants, we observed a significant reduction in the diurnal and circadian activity rhythms in the Q175 mutants at the youngest ages. By middle age, the autonomically driven rhythms in core body temperature were highly compromised, and the Q175 mutants exhibited striking episodes of hypothermia that increased in frequency with mutant <i>huntingtin</i> gene dosage. In addition, Q175 mutants showed higher resting heart rate (HR) during sleep and greatly reduced correlation between activity and HR HR variability was reduced in the mutants in both time and frequency domains, providing more evidence of autonomic dysfunction. Measurement of the baroreceptor reflex revealed that the Q175 mutant could not appropriately increase HR in response to a pharmacologically induced decrease in blood pressure. Echocardiograms showed reduced ventricular mass and ejection fraction in mutant hearts. Finally, cardiac histopathology revealed localized points of fibrosis resembling those caused by myocardial infarction. Thus, the Q175 mouse model of HD exhibits cardiovascular dysautonomia similar to that seen in HD patients with prominent sympathetic dysfunction during the resting phase of the activity rhythm.

Also flagged:Huntington's diseaseHDdendritesKirvoltage-gated potassium channelscalcium
Journal Article 2017-06-01 ✓ 2 Snippets Sebastianutto I, Cenci MA, Fieblinger T.
In-Text Gene Mentions

Moreover, motorically impaired mice of both HD models showed a reduction in iSPN spine density and progressive formation of huntingtin (Htt) aggregates in the striatum.

…formation of huntingtin (Htt) aggregates in the…

Show Full Abstract

Striatal neurons forming the indirect pathway (iSPNs) are particularly vulnerable in Huntington's disease (HD). In this study we set out to investigate morphological and physiological alterations of iSPNs in two mouse models of HD with relatively slow disease progression (long CAG repeat R6/2 and zQ175-KI). Both were crossed with a transgenic mouse line expressing eGFP in iSPNs. Using the open-field and rotarod tests, we first defined two time points in relation to the occurrence of motor deficits in each model. Then, we investigated electrophysiological and morphological properties of iSPNs at both ages. Both HD models exhibited increased iSPN excitability already before the onset of motor deficits, associated with a reduced number of primary dendrites and decreased function of Kir- and voltage-gated potassium channels. Alterations that specifically occurred at symptomatic ages included increased calcium release by back-propagating action potentials in proximal dendrites, due to enhanced engagement of intracellular calcium stores. Moreover, motorically impaired mice of both HD models showed a reduction in iSPN spine density and progressive formation of huntingtin (Htt) aggregates in the striatum. Our study therefore reports iSPN-specific alterations relative to the development of a motor phenotype in two different mouse models of HD. While some alterations occur early and are partly non-progressive, others potentially provide a pathophysiological marker of an overt disease state.

Also flagged:nucleotidemetabolismThyroid disordersthyroid hormonesfollicular thyroid cancersuperoxide dismutase
Journal Article 2017-06-01 ✓ 2 Snippets Ramli NSF, Mat Junit S, Leong NK, Razali N, Jayapalan JJ, Abdul Aziz A.
In-Text Gene Mentions

It was recently reported that PRDX1 and PRDX6 expressions were significantly reduced in all PTCs compared to normal tissues, via V600E mutation in the BRAF gene (Nicolussi et al., 2014).

…that PRDX1 andPRDX6expressions were significantly…

Show Full Abstract

<h4>Background</h4>Synthesis of thyroid hormones and regulation of their metabolism involve free radicals that may affect redox balance in the body. Thyroid disorders causing variations in the levels of thyroid hormones may alter cellular oxidative stress. The aim of this study was to measure the antioxidant activities and biomarkers of oxidative stress in serum and red blood cells (RBC) of patients with benign and malignant thyroid disorders and to investigate if changes in the antioxidant activities in these patients were linked to alterations in genes encoding the antioxidant enzymes.<h4>Methods</h4>Forty-one patients with thyroid disorders from University of Malaya Medical Centre were recruited. They were categorised into four groups: multinodular goitre (MNG) (<i>n</i> = 18), follicular thyroid adenoma (FTA) (<i>n</i> = 7), papillary thyroid cancer (PTC) (<i>n</i> = 10), and follicular thyroid cancer (FTC) (<i>n</i> = 6). Serum and RBC of patients were analysed for antioxidant activities, antioxidant enzymes, and biomarkers of oxidative stress. Alterations in genes encoding the antioxidant enzymes were analysed using whole exome sequencing and PCR-DNA sequencing.<h4>Results</h4>Patients with thyroid disorders had significantly higher serum superoxide dismutase (SOD) and catalase (CAT) activities compared to control, but had lower activities in RBC. There were no significant changes in serum glutathione peroxidase (GPx) activity. Meanwhile, GPx activity in RBC was reduced in PTC and FTC, compared to control and the respective benign groups. Antioxidant activities in serum were decreased in the thyroid disorder groups when compared to the control group. The levels of malondialdehyde (MDA) were elevated in the serum of FTA group when compared to controls, while in the RBC, only the MNG and PTC groups showed higher MDA equivalents than control. Serum reactive oxygen species (ROS) levels in PTC group of both serum and RBC were significantly higher than control group. Whole exome sequencing has resulted in identification of 49 single nucleotide polymorphisms (SNPs) in MNG and PTC patients and their genotypic and allelic frequencies were calculated. Analyses of the relationship between serum enzyme activities and the total SNPs identified in both groups revealed no correlation.<h4>Discussion</h4>Different forms of thyroid disorders influence the levels of antioxidant status in the serum and RBC of these patients, implying varying capability of preventing oxidative stress. A more comprehensive study with a larger target population should be done in order to further evaluate the relationships between antioxidant enzymes gene polymorphisms and thyroid disorders, as well as strengthening the minor evidences provided in literatures.

Also flagged:metabolismRNA-binding proteinsbindingcytoplasmdegradationnuclear helicase
Journal Article 2017-06-01 No Snippets Elbarbary RA, Maquat LE.
Show Full Abstract

No abstract available.

Also flagged:Gene Expressioncancerchromatintumoursuppressor genesgene silencing
Journal Article 2017-06-01 ✓ 1 Snippet Parfett CL, Desaulniers D.
In-Text Gene Mentions

…such as thepolycomb repressiverepressive complexes, at…

Show Full Abstract

An emerging vision for toxicity testing in the 21st century foresees in vitro assays assuming the leading role in testing for chemical hazards, including testing for carcinogenicity. Toxicity will be determined by monitoring key steps in functionally validated molecular pathways, using tests designed to reveal chemically-induced perturbations that lead to adverse phenotypic endpoints in cultured human cells. Risk assessments would subsequently be derived from the causal in vitro endpoints and concentration vs. effect data extrapolated to human in vivo concentrations. Much direct experimental evidence now shows that disruption of epigenetic processes by chemicals is a carcinogenic mode of action that leads to altered gene functions playing causal roles in cancer initiation and progression. In assessing chemical safety, it would therefore be advantageous to consider an emerging class of carcinogens, the epigenotoxicants, with the ability to change chromatin and/or DNA marks by direct or indirect effects on the activities of enzymes (writers, erasers/editors, remodelers and readers) that convey the epigenetic information. Evidence is reviewed supporting a strategy for in vitro hazard identification of carcinogens that induce toxicity through disturbance of functional epigenetic pathways in human somatic cells, leading to inactivated tumour suppressor genes and carcinogenesis. In the context of human cell transformation models, these in vitro pathway measurements ensure high biological relevance to the apical endpoint of cancer. Four causal mechanisms participating in pathways to persistent epigenetic gene silencing were considered: covalent histone modification, nucleosome remodeling, non-coding RNA interaction and DNA methylation. Within these four interacting mechanisms, 25 epigenetic toxicity pathway components (SET1, MLL1, KDM5, G9A, SUV39H1, SETDB1, EZH2, JMJD3, CBX7, CBX8, BMI, SUZ12, HP1, MPP8, DNMT1, DNMT3A, DNMT3B, TET1, MeCP2, SETDB2, BAZ2A, UHRF1, CTCF, HOTAIR and ANRIL) were found to have experimental evidence showing that functional perturbations played "driver" roles in human cellular transformation. Measurement of epigenotoxicants presents challenges for short-term carcinogenicity testing, especially in the high-throughput modes emphasized in the Tox21 chemicals testing approach. There is need to develop and validate in vitro tests to detect both, locus-specific, and genome-wide, epigenetic alterations with causal links to oncogenic cellular phenotypes. Some recent examples of cell-based high throughput chemical screening assays are presented that have been applied or have shown potential for application to epigenetic endpoints.

Also flagged:gagenvpolAIDSSTDsViral Hepatitis
Journal Article 2017-06-01 No Snippets Amaral AG, Oliveira IB, Carneiro DC, Alcantara LC, Monteiro-Cunha JP.
Show Full Abstract

<h4>Background</h4>The high mutation rate of the human immunodeficiency virus (HIV) has created a public health challenge because the use of antiretroviral drugs can generate selective pressure that drives resistance in these viruses.<h4>Objective</h4>The aim of this work was to characterise the molecular and epidemiological profile of HIV in Bahia, Brazil.<h4>Methods</h4>DNA sequences from regions of HIV gag, pol, and env genes were obtained from previous studies performed in this area between 2002 and 2012. Their genotype and drug-resistance mutations were identified using bioinformatics tools. Clinical and epidemiological data were analysed.<h4>Findings</h4>Among 263 individuals (46.4% male), 97.5% were asymptomatic and 49.1% were receiving treatment. Most of the individuals were 31 to 40 years old (36.9%) and infected through heterosexual contact (40.7%). The predominant genotype was B (68.1%) followed by BF recombinants (18.6%). Among the individuals infected with either F or BF genotypes, 68.4% were women and 76.8% were infected through heterosexual transmission. The prevalence of associated mutations conferring antiretroviral resistance was 14.2%, with 3.8% of all mutations conferring resistance to protease inhibitors, 9.43% to nucleoside reverse transcriptase inhibitors, and 8.5% to non-nucleoside reverse transcriptase inhibitors. Drug resistance was higher in individuals receiving treatment (26.1%) than in the drug-naïve (4.3%) individuals.<h4>Main conclusions</h4>This study will contribute to the understanding and monitoring of HIV epidemic in this Brazilian region.

Also flagged:hypocalcemiacalciumvitamin Dparathyroid hormonePTHsalts
Journal Article 2017-06-01 ✓ 1 Snippet Carroll RW, Katz ML, Paul E, Jüppner H.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

Also flagged:mTORMilk Disorderbone resorptionVLDLRosteoclast differentiationRANKL
Journal Article 2017-06-01 ✓ 1 Snippet Huynh H, Wei W, Wan Y.
In-Text Gene Mentions

PTGIS

Show Full Abstract

It is unknown whether and how very-low density lipoprotein receptors (VLDLRs) impact skeletal homeostasis. Here, we report that maternal and offspring VLDLRs play opposite roles in osteoclastogenesis and bone resorption. VLDLR deletion in the offspring augments osteoclast differentiation by enhancing RANKL signaling, leading to osteoporosis. In contrast, VLDLR deletion in the mother alters milk metabolism, which inhibits osteoclast differentiation and causes osteopetrosis in the offspring. The maternal effects are dominant. VLDLR-null lactating mammary gland exhibits higher mTORC1 signaling and cholesterol biosynthesis. Pharmacological probing reveals that rapamycin, but not statin, treatment of the VLDLR-null mother can prevent both the low bone resorption and our previously described inflammatory fur loss in their offspring. Genetic rescue reveals that maternal mTORC1 attenuation in adipocytes, but not in myeloid cells, prevents offspring osteopetrosis and fur loss. Our studies uncover functions of VLDLR and mTORC1 in lactation and osteoclastogenesis, illuminating key mechanisms and therapeutic insights for bone and metabolic diseases.

Also flagged:infectionsHLA
Journal Article 2017-06-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

One donor heterozygous for HFE 63 reported high alcohol consumption.

Show Full Abstract

No abstract available.

Also flagged:reproductionfertilizationinfectionblastocyst formationoestradiolmetaphase
Journal Article 2017-06-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:developmental delaysdevelopmental delayDDintellectual disabilityIDautism spectrum disorders
Journal Article 2017-06-01 ✓ 1 Snippet Sansović I, Ivankov AM, Bobinec A, Kero M, Barišić I.
In-Text Gene Mentions

…point between genesPLCL1and SATB2 .…

Show Full Abstract

<h4>Aim</h4>To determine the diagnostic yield and criteria that could help to classify and interpret the copy number variations (CNVs) detected by chromosomal microarray (CMA) technique in patients with congenital and developmental abnormalities including dysmorphia, developmental delay (DD) or intellectual disability (ID), autism spectrum disorders (ASD) and congenital anomalies (CA).<h4>Method</h4>CMA analysis was performed in 337 patients with DD/ID with or without dysmorphism, ASD, and/or CA. In 30 of 337 patients, chromosomal imbalances had previously been detected by classical cytogenetic and molecular cytogenetic methods.<h4>Results</h4>In 73 of 337 patients, clinically relevant variants were detected and better characterized. Most of them were >1 Mb. Variants of unknown clinical significance (VOUS) were discovered in 35 patients. The most common VOUS size category was <300 kb (40.5%). Deletions and de novo imbalances were more frequent in pathogenic CNV than in VOUS category. CMA had a high diagnostic yield of 43/307, excluding patients previously detected by other methods.<h4>Conclusion</h4>CMA was valuable in establishing the diagnosis in a high proportion of patients. Criteria for classification and interpretation of CNVs include CNV size and type, mode of inheritance, and genotype-phenotype correlation. Agilent ISCA v2 Human Genome 8x60 K oligonucleotide microarray format proved to be reasonable resolution for clinical use, particularly in the regions that are recommended by the International Standard Cytogenomic Array (ISCA) Consortium and associated with well-established syndromes.

Also flagged:Histone H1.2ChromatinpRbE2Fhistonecell-cycle control
Journal Article 2017-06-01 ✓ 1 Snippet Munro S, Hookway ES, Floderer M, Carr SM, Konietzny R, Kessler BM, Oppermann U, La Thangue NB.
In-Text Gene Mentions

…We identifiedlinker histoneshistones as interaction…

Show Full Abstract

The retinoblastoma tumor suppressor protein pRb is a master regulator of cellular proliferation, principally through interaction with E2F and regulation of E2F target genes. Here, we describe the H1.2 linker histone as a major pRb interaction partner. We establish that H1.2 and pRb are found in a chromatin-bound complex on diverse E2F target genes. Interrogating the global influence of H1.2 on the genome-wide distribution of pRb indicated that the E2F target genes affected by H1.2 are functionally linked to cell-cycle control, consistent with the ability of H1.2 to hinder cell proliferation and the elevated levels of chromatin-bound H1-pRb complex, which occur in growth-arrested cells. Our results define a network of E2F target genes as susceptible to the regulatory influence of H1.2, where H1.2 augments global association of pRb with chromatin, enhances transcriptional repression by pRb, and facilitates pRb-dependent cell-cycle arrest.

Also flagged:Endosomal adaptor proteinslocalizationadaptor proteinAPPL1Rab5endosomes
Journal Article 2017-06-01 ✓ 1 Snippet Diggins NL, Webb DJ.
In-Text Gene Mentions

DCC

Show Full Abstract

Endosomal adaptor proteins are important regulators of signaling pathways underlying many biological processes. These adaptors can integrate signals from multiple pathways via localization to specific endosomal compartments, as well as through multiple protein-protein interactions. One such adaptor protein that has been implicated in regulating signaling pathways is the <u>a</u>daptor protein containing a <u>p</u>leckstrin homology (PH) domain, <u>p</u>hosphotyrosine-binding (PTB) domain, and <u>l</u>eucine zipper motif 1 (APPL1). APPL1 localizes to a subset of Rab5-positive endosomes through its Bin-Amphiphysin-Rvs and PH domains, and it coordinates signaling pathways through its interaction with many signaling receptors and proteins through its PTB domain. This review discusses our current understanding of the role of APPL1 in signaling and trafficking, as well as highlights recent work into the function of APPL1 in cell migration and adhesion.

Also flagged:cancerhepatocellular carcinomap53gene expressionWNTMDM4
Journal Article 2017-06-01 No Snippets Cancer Genome Atlas Research Network. Electronic address: wheeler@bcm.edu, Cancer Genome Atlas Research Network.
Show Full Abstract

Liver cancer has the second highest worldwide cancer mortality rate and has limited therapeutic options. We analyzed 363 hepatocellular carcinoma (HCC) cases by whole-exome sequencing and DNA copy number analyses, and we analyzed 196 HCC cases by DNA methylation, RNA, miRNA, and proteomic expression also. DNA sequencing and mutation analysis identified significantly mutated genes, including LZTR1, EEF1A1, SF3B1, and SMARCA4. Significant alterations by mutation or downregulation by hypermethylation in genes likely to result in HCC metabolic reprogramming (ALB, APOB, and CPS1) were observed. Integrative molecular HCC subtyping incorporating unsupervised clustering of five data platforms identified three subtypes, one of which was associated with poorer prognosis in three HCC cohorts. Integrated analyses enabled development of a p53 target gene expression signature correlating with poor survival. Potential therapeutic targets for which inhibitors exist include WNT signaling, MDM4, MET, VEGFA, MCL1, IDH1, TERT, and immune checkpoint proteins CTLA-4, PD-1, and PD-L1.

Also flagged:adenosine deaminaseADAAutoimmune Hepatitisinterface hepatitischronic inflammatory liver diseaseliver disease
Journal Article 2017-06-01 ✓ 1 Snippet Torgutalp M, Efe C, Babaoglu H, Kav T.
In-Text Gene Mentions

…tion, decompensated cirrhosis,hemochromatosis, Wilson’s disease, α1-anti…

Show Full Abstract

<h4>Aim</h4>To evaluate the relationship between serum adenosine deaminase (ADA) levels and histological features in patients with autoimmune hepatitis (AIH).<h4>Methods</h4>A total of 80 subjects (52 AIH cases and 28 healthy controls) were included in the study. Patients were diagnosed according to the simplified criteria suggested by the International Autoimmune Hepatitis Group. All of the cases had been diagnosed with AIH between 2010-2015 at Hacettepe University, Department of Gastroenterology. Serum blood samples were collected and stored at -80 °C until the biochemical estimation of ADA activity. The diagnosis of patients was confirmed by liver biopsy. Serum ADA > 20 U/L was considered to be high level.<h4>Results</h4>Mean serum ADA levels were significantly higher in AIH patients than those in healthy controls (25.4 ± 9.6 U/L <i>vs</i> 12.8 ± 2.2 U/L, <i>P</i> < 0.001). Serum ADA levels > 20 U/L were found in 63.5% AIH patients and in 0% healthy controls (<i>P</i> < 0.001). Mean serum ADA levels were significantly increased in each stage of histological activity: 15.2 ± 3.5 U/L for patients with mild interface hepatitis, 23.1 ± 10.0 U/L for patients with moderate interface hepatitis and 30.9 ± 7.0 U/L for patients with severe interface hepatitis (<i>P</i> < 0.001). Correlation analysis showed that there was a positive association between serum ADA levels and histological activity (<i>r</i> = 0.71, <i>P</i> < 0.001). Receiver operating characteristic analysis suggested that 24.5 U/L was the optimum cut-off point of ADA level for severe interface hepatitis (sensitivity 88%, specificity 85.2%, area under the curve: 0.88).<h4>Conclusion</h4>Because of the positive correlation with inflammatory activity, serum ADA level may be a potential biomarker for predicting or monitoring histological activity in patients with AIH.

Also flagged:morphinemetabolismbindingABC binding cassette drug transportersopioid receptorsion channels
Journal Article 2017-06-01 ✓ 2 Snippets Chen LK, Wang MH, Yang HJ, Fan SZ, Chen SS.
In-Text Gene Mentions

…KCNJ6, KCNJ9, andCACNA1Eare ion channels…

…calcium channel studied (CACNA1E).…

Show Full Abstract

Nausea and vomiting are probably the most unpleasant side effects that occur when morphine used. A number of studies have investigated the effect on pain relief of single nucleotide polymorphisms (SNPs) in genes involved in morphine's metabolism, distribution, binding, and cellular action. The mechanism through which morphine causes nausea and vomiting has not been elucidated clearly. We examined all the reported SNPs which are associated with the complications of morphine, including SNPs in genes for phase I and phase II metabolic enzymes, ABC binding cassette drug transporters, κ and δ opioid receptors, and ion channels implicated in the postreceptor action of morphine.A prospective, observational study in 129 female patients was conducted to investigate the effect of 14 SNPs on nausea or vomiting induced by intravenous patient-controlled analgesia (IVPCA) with morphine after gynecology surgery. Clinical phenotype, subjective complaints, and objective observations were recorded. DNA from blood samples was used to record the SNPs. Eleven SNPs were then analyzed further.No significant association with the presence of phenotype (nausea or vomiting) versus genotype was observed (all P > .05). No significant association with severity of phenotype versus genotype of the 11 SNPs was observed except for unadjusted data for rs2737703.There was no significant difference between severity or incidence of IVPCA morphine-induced nausea and vomiting and genotype (11 SNPs). Further study should perhaps be focused on mRNA and proteinomics rather than SNPs.

Also flagged:MDGA1Neuroligin 2synapsesynaptic cleftNLGN2synapses
Journal Article 2017-06-01 ✓ 1 Snippet Gangwar SP, Zhong X, Seshadrinathan S, Chen H, Machius M, Rudenko G.
In-Text Gene Mentions

DCC

Show Full Abstract

Neuroligins and neurexins promote synapse development and validation by forming trans-synaptic bridges spanning the synaptic cleft. Select pairs promote excitatory and inhibitory synapses, with neuroligin 2 (NLGN2) limited to inhibitory synapses and neuroligin 1 (NLGN1) dominating at excitatory synapses. The cell-surface molecules, MAM domain-containing glycosylphosphatidylinositol anchor 1 (MDGA1) and 2 (MDGA2), regulate trans-synaptic adhesion between neurexins and neuroligins, impacting NLGN2 and NLGN1, respectively. We have determined the molecular mechanism of MDGA action. MDGA1 Ig1-Ig2 is sufficient to bind NLGN2 with nanomolar affinity; its crystal structure reveals an unusual locked rod-shaped array. In the crystal structure of the complex, two MDGA1 Ig1-Ig2 molecules each span the entire NLGN2 dimer. Site-directed mutagenesis confirms the observed interaction interface. Strikingly, Ig1 from MDGA1 binds to the same region on NLGN2 as neurexins do. Thus, MDGAs regulate the formation of neuroligin-neurexin trans-synaptic bridges by sterically blocking access of neurexins to neuroligins.

Also flagged:Gallbladder cancerpathogenesisgallbladder carcinomacancerGallbladdercarcinoma
Journal Article 2017-06-01 No Snippets Sharma A, Sharma KL, Gupta A, Yadav A, Kumar A.
Show Full Abstract

Gallbladder cancer is a malignancy of biliary tract which is infrequent in developed countries but common in some specific geographical regions of developing countries. Late diagnosis and deprived prognosis are major problems for treatment of gallbladder carcinoma. The dramatic associations of this orphan cancer with various genetic and environmental factors are responsible for its poorly defined pathogenesis. An understanding to the relationship between epidemiology, molecular genetics and pathogenesis of gallbladder cancer can add new insights to its undetermined pathophysiology. Present review article provides a recent update regarding epidemiology, pathogenesis, and molecular genetics of gallbladder cancer. We systematically reviewed published literature on gallbladder cancer from online search engine PubMed (http://www.ncbi.nlm.nih.gov/pubmed). Various keywords used for retrieval of articles were Gallbladder, cancer Epidemiology, molecular genetics and bullion operators like AND, OR, NOT. Cross references were manually searched from various online search engines (http://www.ncbi.nlm.nih.gov/pubmed,https://scholar.google.co.in/, http://www.medline.com/home.jsp). Most of the articles published from 1982 to 2015 in peer reviewed journals have been included in this review.

Also flagged:Non-alcoholic fatty liver diseaseNAFLDsteatosishepatitiscirrhosishepatocellular carcinoma
Journal Article 2017-06-01 ✓ 3 Snippets Benedict M, Zhang X.
In-Text Gene Mentions

As it stands currently, approximately 7 categories of genes have been associated with NAFLD and are broken down as follows: (1) hepatic lipid export/oxidation in steatosis (PNPLA3, TM6SF2, NR1I2, PPAR-alpha, PEMT, MTTP, APOC3 and APOE); (2) glucose metabolism and insulin resistance (ENPP1/IRS1, GCKR, SLC2A1, GOAT, TCF7L2 and PPARG); (3) steatosis-hepatic lipid import or synthesis (SLC27A5, FADS1, and LPIN1); (4) steatohepatitis-oxidative stress (HFE, GCLC/GCLM, ABCC2 and SOD2); (5) steatohepatitis-endotoxin response (TLR4 and CD14); (6) cytokines (TNF and IL6); and (7) fibrosis (AGTR1 and KLF6)[49,72].

…be worked-up forhemochromatosisand HFE gene…

…for hemochromatosis andHFEgene mutations (…

Show Full Abstract

Non-alcoholic fatty liver disease (NAFLD) encompasses the simple steatosis to more progressive steatosis with associated hepatitis, fibrosis, cirrhosis, and in some cases hepatocellular carcinoma. NAFLD is a growing epidemic, not only in the United States, but worldwide in part due to obesity and insulin resistance leading to liver accumulation of triglycerides and free fatty acids. Numerous risk factors for the development of NAFLD have been espoused with most having some form of metabolic derangement or insulin resistance at the core of its pathophysiology. NAFLD patients are at increased risk of liver-related as well as cardiovascular mortality, and NAFLD is rapidly becoming the leading indication for liver transplantation. Liver biopsy remains the gold standard for definitive diagnosis, but the development of noninvasive advanced imaging, biochemical and genetic tests will no doubt provide future clinicians with a great deal of information and opportunity for enhanced understanding of the pathogenesis and targeted treatment. As it currently stands several medications/supplements are being used in the treatment of NAFLD; however, none seem to be the "magic bullet" in curtailing this growing problem yet. In this review we summarized the current knowledge of NAFLD epidemiology, risk factors, diagnosis, pathogenesis, pathologic changes, natural history, and treatment in order to aid in further understanding this disease and better managing NAFLD patients.

Also flagged:posterior polymorphous corneal dystrophyPPCDZEB1PPCD3polymerasetype IV collagens
Journal Article 2017-06-01 ✓ 2 Snippets Chung DD, Frausto RF, Lin BR, Hanser EM, Cohen Z, Aldave AJ.
In-Text Gene Mentions

A total of 49 evHCEnC-specific genes were expressed in each of the two PPCD and two control HCEnC samples, while six evHCEnC-specific genes (CA10, CRB2, EPHB1, GPR158, MGAT3, and PPP1R1B) were not expressed in either P5 or P6, but were expressed in the controls (Supplementary Table S4).

…evHCEnC-specific genes (CA10, CRB2 ,…

Show Full Abstract

<h4>Purpose</h4>To investigate the molecular basis of posterior polymorphous corneal dystrophy (PPCD) by examining the PPCD transcriptome and the effect of decreased ZEB1 expression on corneal endothelial cell (CEnC) gene expression.<h4>Methods</h4>Next-generation RNA sequencing (RNA-seq) analyses of corneal endothelium from two PPCD-affected individuals (one with PPCD3 and one of unknown genetic cause) compared with two age-matched controls, and primary human CEnC (pHCEnC) transfected with siRNA-mediated ZEB1 knockdown. The expression of selected differentially expressed genes was validated by quantitative polymerase chain reaction (qPCR) and/or assessed by in situ hybridization in the corneal endothelium of four independent cases of PPCD (one with PPCD3 and three of unknown genetic cause).<h4>Results</h4>Expression of 16% and 46% of the 104 protein-coding genes specific to ex vivo corneal endothelium was lost in the endothelium of two individuals with PPCD. Thirty-two genes associated with ZEB1 and 3 genes (BMP4, CCND1, ZEB1) associated with OVOL2 were differentially expressed in the same direction in both individuals with PPCD. Immunohistochemistry staining and RNA-seq analyses demonstrated variable expression of type IV collagens in PPCD corneas. Decreasing ZEB1 expression in pHCEnC altered expression of 711 protein-coding genes, many of which are associated with canonical pathways regulating various cellular processes.<h4>Conclusions</h4>Identification of the altered transcriptome in PPCD and in a cell-based model of PPCD provided insight into the molecular alterations characterizing PPCD. Further study of the differentially expressed genes associated with ZEB1 and OVOL2 is expected to identify candidate genes for individuals with PPCD and without a ZEB1 or OVOL2 mutation.

Also flagged:CKAP5EDARCKAP4GK2CKAP2HLA-DPB1
Journal Article 2017-06-01 ✓ 5 Snippets Yavorski JM, Stoll RJ, Samy MD, Mauro JA, Blanck G.
In-Text Gene Mentions

CACNA1E

FBXL4

ANKRD45

ZNF664

HTT

Show Full Abstract

<h4>Background</h4>Relatively little cancer genome atlas data has been associated with clinically relevant stratifications of individual cancers.<h4>Results</h4>Mutations in two subsets of a cytoskeletal related and adhesion-related protein coding region set (CAPCRs) were determined to have strong associations with a negative outcome for melanoma, in-cluding a subset constituted by: DSCAM, FAT3, MUC17 and PCDHGC5 (p < 0.0001).<h4>Conclusion</h4>Roles for CAPCR mutations in cancer progression raise a question about the potential dominant negative impact of these mutations for multi-meric subcellular and extra-cellular protein struc-tures.

Also flagged:gastric neoplasmcolorectal neoplasmsadenomacolorectal canceradenomascancer
Journal Article 2017-06-01 ✓ 2 Snippets Tsuchida C, Yoshitake N, Kino H, Kaneko Y, Nakano M, Tsuchida K, Tominaga K, Sasai T, Masuyama H, Yamagishi H, Imai Y, Hiraishi H.
In-Text Gene Mentions

Abnormalities in genes, such as P53, APC (adenomatous polyposis coli), DCC (deleted in colorectal carcinoma), and K-ras, are also known to be associated with development of gastrointestinal cancer of both the stomach and the large bowel[26-28].

…(adenomatous polyposis coli),DCC(deleted in colorectal…

Show Full Abstract

<h4>Aim</h4>To evaluate the usefulness of total colonoscopy (TCS) for patients undergoing gastric endoscopic submucosal dissection (ESD) and to assess risk factors for colorectal neoplasms.<h4>Methods</h4>Of the 263 patients who underwent ESD at our department between May 2010 and December 2013, 172 patients undergoing TCS during a one-year period before and after ESD were targeted. After excluding patients with a history of surgery or endoscopic therapy for colorectal neoplasms, 158 patients were analyzed. Of the 868 asymptomatic patients who underwent TCS during the same period because of positive fecal immunochemical test (FIT) results, 158 patients with no history of either surgery or endoscopic therapy for colorectal neoplasms who were matched for age and sex served as the control group for comparison.<h4>Results</h4>TCS revealed adenoma less than 10 mm in 53 patients (33.6%), advanced adenoma in 17 (10.8%), early colorectal cancer in 5 (3.2%), and advanced colorectal cancer in 4 (2.5%). When the presence or absence of adenoma less than 10 mm, advanced adenoma, and colorectal cancer and the number of adenomas were compared between patients undergoing ESD and FIT-positive patients, there were no statistically significant differences in any of the parameters assessed. The patients undergoing ESD appeared to have the same risk of colorectal neoplasms as the FIT-positive patients. Colorectal neoplasms were clearly more common in men than in women (<i>P</i> = 0.031). Advanced adenoma and cancer were significantly more frequent in patients with at least two of the following conditions: hypertension, dyslipidemia, and diabetes mellitus (<i>P</i> = 0.019).<h4>Conclusion</h4>In patients undergoing gastric ESD, TCS appears to be important for detecting synchronous double neoplasms. Advanced adenoma and cancer were more common in patients with at least two of the following conditions: hypertension, dyslipidemia, and diabetes mellitus. Caution is therefore especially warranted in patients with these risk factors.

Also flagged:chronic allograft nephropathiesend-stage renal diseaseESRDacute rejectionscreatinineimmune responses
Journal Article 2017-06-01 No Snippets Salvadori M, Tsalouchos A.
Show Full Abstract

Genomics, proteomics and molecular biology lead to tremendous advances in all fields of medical sciences. Among these the finding of biomarkers as non invasive indicators of biologic processes represents a useful tool in the field of transplantation. In addition to define the principal characteristics of the biomarkers, this review will examine the biomarker usefulness in the different clinical phases following renal transplantation. Biomarkers of ischemia-reperfusion injury and of delayed graft function are extremely important for an early diagnosis of these complications and for optimizing the treatment. Biomarkers predicting or diagnosing acute rejection either cell-mediated or antibody-mediated allow a risk stratification of the recipient, a prompt diagnosis in an early phase when the histology is still unremarkable. The kidney solid organ response test detects renal transplant recipients at high risk for acute rejection with a very high sensitivity and is also able to make diagnosis of subclinical acute rejection. Other biomarkers are able to detect chronic allograft dysfunction in an early phase and to differentiate the true chronic rejection from other forms of chronic allograft nephropathies no immune related. Finally biomarkers recently discovered identify patients tolerant or almost tolerant. This fact allows to safely reduce or withdrawn the immunosuppressive therapy.

Also flagged:deathrenal dysfunctionchronic liver diseasehepatocellular canceracute liver failureextrahepatic biliary atresia
Journal Article 2017-06-01 ✓ 1 Snippet Khorsandi SE, Giorgakis E, Vilca-Melendez H, O'Grady J, Heneghan M, Aluvihare V, Suddle A, Agarwal K, Menon K, Prachalias A, Srinivasan P, Rela M, Jassem W, Heaton N.
In-Text Gene Mentions

…that included Wilson’s,Hemochromatosisand Familial Amyloid…

Show Full Abstract

<h4>Aim</h4>To identify objective predictive factors for donor after cardiac death (DCD) graft loss and using those factors, develop a donor recipient stratification risk predictive model that could be used to calculate a DCD risk index (DCD-RI) to help in prospective decision making on organ use.<h4>Methods</h4>The model included objective data from a single institute DCD database (2005-2013, <i>n</i> = 261). Univariate survival analysis was followed by adjusted Cox-regressional hazard model. Covariates selected <i>via</i> univariate regression were added to the model <i>via</i> forward selection, significance level <i>P</i> = 0.3. The warm ischemic threshold was clinically set at 30 min. Points were given to each predictor in proportion to their hazard ratio. Using this model, the DCD-RI was calculated. The cohort was stratified to predict graft loss risk and respective graft survival calculated.<h4>Results</h4>DCD graft survival predictors were primary indication for transplant (<i>P</i> = 0.066), retransplantation (<i>P</i> = 0.176), MELD > 25 (<i>P</i> = 0.05), cold ischemia > 10 h (<i>P</i> = 0.292) and donor hepatectomy time > 60 min (<i>P</i> = 0.028). According to the calculated DCD-RI score three risk classes could be defined of low (DCD-RI < 1), standard (DCD-RI 2-4) and high risk (DCD-RI > 5) with a 5 years graft survival of 86%, 78% and 34%, respectively.<h4>Conclusion</h4>The DCD-RI score independently predicted graft loss (<i>P</i> < 0.001) and the DCD-RI class predicted graft survival (<i>P</i> < 0.001).

Also flagged:Cirrhotic CardiomyopathyHepatic cirrhosisaggressionsageingchronic liver diseasessteatohepatitis
Journal Article 2017-06-01 ✓ 1 Snippet Mocarzel LOC, Rossi MM, Miliosse BM, Lanzieri PG, Gismondi RA.
In-Text Gene Mentions

…such as inhemochromatosisand amyloidosis.…

Show Full Abstract

No abstract available.

Also flagged:ascorbic acidmetastatic castration-resistant prostate cancerprostate-specific antigenPSAmetabolismcastration-resistant prostate cancer
Journal Article 2017-06-01 ✓ 1 Snippet Nielsen TK, Højgaard M, Andersen JT, Jørgensen NR, Zerahn B, Kristensen B, Henriksen T, Lykkesfeldt J, Mikines KJ, Poulsen HE.
In-Text Gene Mentions

…oxalate renal stones;hemochromatosis; and glucose-6-phosphate dehy…

Show Full Abstract

<h4>Background</h4>Ascorbic acid (AA) has <i>in vivo</i> cytotoxic properties at concentrations that can only be achieved through intravenous (IV) administration in humans. Treatment with intravenous AA is widely and increasingly used in complementary medicine despite a lack of clinical evidence for the efficacy of this treatment.<h4>Methods</h4>This non-comparative, single-center, phase II trial included patients with chemotherapy-naïve, metastatic castration-resistant prostate cancer (mCRPC) from an outpatient clinic to evaluate the efficacy and safety of IV AA therapy. Patients received weekly infusions of AA (week 1, 5 g; week 2, 30 g; and weeks 3-12, 60 g) followed by efficacy evaluation at 12 weeks. The primary endpoint for efficacy was a 50% reduction in the prostate-specific antigen (PSA) level. The secondary endpoints included changes in health-related quality of life (HRQoL), biomarkers of bone metabolism, inflammation and bone scans. Clinicaltrials.gov identifier: NCT01080352.<h4>Results</h4>Twenty-three patients were enrolled in this study, and 20 completed the efficacy evaluation at 12 weeks. The mean baseline PSA level was 43 µg/L. No patient achieved a 50% PSA reduction; instead, a median increase in PSA of 17 µg/L was recorded at week 12. Among the secondary endpoints, no signs of disease remission were observed. In total, 53 adverse events (AEs) were recorded. Eleven were graded as "serious". Three AEs were directly related to AA, and all of which were related to fluid load.<h4>Conclusions</h4>Infusion with 60 g of AA did not result in disease remission. This study does not support the use of intravenous AA outside clinical trials.

Also flagged:sialic acidE-selectinPEGdexamethasoneacute kidney injurycell surface
Journal Article 2017-06-01 No Snippets Hu JB, Kang XQ, Liang J, Wang XJ, Xu XL, Yang P, Ying XY, Jiang SP, Du YZ.
Show Full Abstract

The effective treatment for acute kidney injury (AKI) is currently limited, and care is primarily supportive. Sialic acid (SA) is main component of Sialyl Lewis<sup>x</sup> antigen on the mammalian cell surface, which participates in E-selectin binding. Therefore, dexamethasone(DXM)-loaded E-selectin-targeting sialic acid-polyethylene glycol-dexamethasone (SA-PEG-DXM/DXM) conjugate micelles are designed for ameliorating AKI. The conjugates are synthesized via the esterification reaction between PEG and SA or DXM, and can spontaneously form micelles in an aqueous solution with a 65.6 µg/mL critical micelle concentration. Free DXM is incorporated into the micelles with 6.28 ± 0.21% drug loading content. <i>In vitro</i> DXM release from SA-PEG-DXM/DXM micelles can be prolonged to 48h. Much more SA-PEG-DXM micelles can be internalized by lipopolysaccharide (LPS)-activated human umbilical vein endothelial cells (HUVECs) in comparison to PEG-DXM micelles due to specific interaction between SA and E-selectin expressed on HUVECs, and consequently more SA-PEG-DXM micelles are accumulated in the kidney of AKI murine model. Furthermore, SA in SA-PEG-DXM conjugates can significantly ameliorate LPS-induced production of pro-inflammatory cytokines via suppressing LPS-activated Beclin-1/Atg5-Atg12-mediated autophagy to attenuate toxicity. Compared with free DXM and PEG-DXM/DXM micelles, SA-PEG-DXM/DXM micelles show better therapeutical effects, as reflected by the improved renal function, histopathological changes, pro-inflammatory cytokines, oxidative stress and expression of apoptotic related proteins.

Also flagged:Atrial FibrillationAFarrhythmiagene expressionion channelageing
Journal Article 2017-06-01 ✓ 2 Snippets van den Berg NWE, Kawasaki M, Berger WR, Neefs J, Meulendijks E, Tijsen AJ, de Groot JR.
In-Text Gene Mentions

…predicted Sox5 andSox6, negative factors of…

…of Sox5 andSox6, respectively.…

Show Full Abstract

Atrial fibrillation (AF) is the most common sustained arrhythmia and is associated with pronounced morbidity and mortality. Its prevalence, expected to further increase for the forthcoming years, and associated frequent hospitalizations turn AF into a major health problem. Structural and electrical atrial remodelling underlie the substrate for AF, but the exact mechanisms driving this remodelling remain incompletely understood. Recent studies have shown that microRNAs (miRNA), short non-coding RNAs that regulate gene expression, may be involved in the pathophysiology of AF. MiRNAs have been implicated in AF-induced ion channel remodelling and fibrosis. MiRNAs could therefore provide insight into AF pathophysiology or become novel targets for therapy with miRNA mimics or anti-miRNAs. Moreover, circulating miRNAs have been suggested as a new class of diagnostic and prognostic biomarkers of AF. However, the origin and function of miRNAs in tissue and plasma frequently remain unknown and studies investigating the role of miRNAs in AF vary in design and focus and even present contradicting results. Here, we provide a systematic review of the available clinical and functional studies investigating the tissue and plasma miRNAs in AF and will thereafter discuss the potential of miRNAs as biomarkers or novel therapeutic targets in AF.

Also flagged:Synaptosomal-associated protein 25Synaptosomal-associated protein 25 kDaSNAP-25synapseexocytosisneurotransmitter
Journal Article 2017-06-01 ✓ 3 Snippets Zhong ZQ, Xiang Y, Hu X, Wang YC, Zeng X, Wang XM, Xia QJ, Wang TH, Zhang X.
In-Text Gene Mentions

The levels of SNAP-25, PEBP1, SNCB and AQP4 were significantly decreased in the SCI group when compared with the sham group (Figure 3C), and SNAP-25 was most highly expressed in the two groups.

…binding protein 1 (PEBP1), beta-synuclein (SNCB) and…

…levels of SNAP-25,PEBP1, SNCB and AQP4…

Show Full Abstract

Synaptosomal-associated protein 25 kDa (SNAP-25) is localized on the synapse and participates in exocytosis and neurotransmitter release. Decreased expression of SNAP-25 is associated with Alzheimer's disease and attention deficit/hyperactivity disorder. However, the expression of SNAP-25 in spinal cord contusion injury is still unclear. We hypothesized that SNAP-25 is associated with sensory and locomotor functions after spinal cord injury. We established rat models of spinal cord contusion injury to detect gene changes with a gene array. A decreased level of SNAP-25 was detected by quantitative real time-polymerase chain reaction and western blot assay at 1, 3, 7, 14 and 28 days post injury. SNAP-25 was localized in the cytoplasm of neurons of the anterior and posterior horns, which are involved in locomotor and sensory functions. Our data suggest that reduced levels of SNAP-25 are associated with sensory and locomotor functions in rats with spinal cord contusion injury.

Also flagged:peripheral nerve injurycytokinecytokine receptorneuroactive ligand-receptoraxonpolymerase
Journal Article 2017-06-01 No Snippets Cheng Q, Wang YX, Yu J, Yi S.
Show Full Abstract

Wallerian degeneration is a critical biological process that occurs in distal nerve stumps after nerve injury. To systematically investigate molecular changes underlying Wallerian degeneration, we used a rat sciatic nerve transection model to examine microarray analysis outcomes and investigate significantly involved Kyoto Enrichment of Genes and Genomes (KEGG) pathways in injured distal nerve stumps at 0, 0.5, 1, 6, 12, and 24 hours, 4 days, 1, 2, 3, and 4 weeks after peripheral nerve injury. Bioinformatic analysis showed that only one KEGG pathway (cytokine-cytokine receptor interaction) was significantly enriched at an early time point (1 hour post-sciatic nerve transection). At later time points, the number of enriched KEGG pathways initially increased and then decreased. Three KEGG pathways were studied in further detail: cytokine-cytokine receptor interaction, neuroactive ligand-receptor interaction, and axon guidance. Moreover, temporal expression patterns of representative differentially expressed genes in these KEGG pathways were validated by real time-polymerase chain reaction. Taken together, the above three signaling pathways are important after sciatic nerve injury, and may increase our understanding of the molecular mechanisms underlying Wallerian degeneration.

Also flagged:Fragile X Syndromefragile XbehavioralAutismbehavioral impairmentsFMR1
Journal Article 2017-06-01 No Snippets Sherman SL, Kidd SA, Riley C, Berry-Kravis E, Andrews HF, Miller RM, Lincoln S, Swanson M, Kaufmann WE, Brown WT.
Show Full Abstract

<h4>Background and objective</h4>Advances in the care of patients with fragile X syndrome (FXS) have been hampered by lack of data. This deficiency has produced fragmentary knowledge regarding the natural history of this condition, healthcare needs, and the effects of the disease on caregivers. To remedy this deficiency, the Fragile X Clinic and Research Consortium was established to facilitate research. Through a collective effort, the Fragile X Clinic and Research Consortium developed the Fragile X Online Registry With Accessible Research Database (FORWARD) to facilitate multisite data collection. This report describes FORWARD and the way it can be used to improve health and quality of life of FXS patients and their relatives and caregivers.<h4>Methods</h4>FORWARD collects demographic information on individuals with FXS and their family members (affected and unaffected) through a 1-time registry form. The longitudinal database collects clinician- and parent-reported data on individuals diagnosed with FXS, focused on those who are 0 to 24 years of age, although individuals of any age can participate.<h4>Results</h4>The registry includes >2300 registrants (data collected September 7, 2009 to August 31, 2014). The longitudinal database includes data on 713 individuals diagnosed with FXS (data collected September 7, 2012 to August 31, 2014). Longitudinal data continue to be collected on enrolled patients along with baseline data on new patients.<h4>Conclusions</h4>FORWARD represents the largest resource of clinical and demographic data for the FXS population in the United States. These data can be used to advance our understanding of FXS: the impact of cooccurring conditions, the impact on the day-to-day lives of individuals living with FXS and their families, and short-term and long-term outcomes.

Also flagged:Junctional Tachycardiasupraventricular tachycardiaarrhythmiaArrhythmiasJunctional tachycardiasdigoxin
Journal Article 2017-06-01 ✓ 5 Snippets Ghani A, Ahsan I, Gottleib C.
In-Text Gene Mentions

Hemochromatosisas Junctional Tachycardia,…

…Further workup revealedhemochromatosisto be primary…

…a case ofhemochromatosispresenting as intractable…

…mutations of thehemochromatosisgene (HFE) are…

…the hemochromatosis gene (HFE) are C282Y, H63D,…

Show Full Abstract

We present here a 45-year-old male with no past medical problem who presented with palpitations. He was found to have supraventricular tachycardia intractable to medical therapy. Later his rhythm converted to junctional tachycardia. Further workup revealed hemochromatosis to be primary etiology causing the arrhythmia. The low index of suspicion for additional workup is key to diagnosis and successful outcome.

Also flagged:Tc1gene transferreproductiontransposaseretrotransposonsgene expression
Journal Article 2017-06-01 No Snippets Palazzo A, Caizzi R, Viggiano L, Marsano RM.
Show Full Abstract

The contribution of the transposons' promoter in the horizontal transfer process is quite overlooked in the scientific literature. To shed light on this aspect we have mimicked the horizontal transfer process in laboratory and assayed in a wide range of hosts (fly, human, yeast and bacteria) the promoter activity of the 5' terminal sequences in Bari1 and Bari3, two Drosophila transposons belonging to the Tc1-mariner superfamily. These sequences are able to drive the transcription of a reporter gene even in distantly related organisms at least at the episomal level. By combining bioinformatics and experimental approaches, we define two distinct promoter sequences for each terminal sequence analyzed, which allow transcriptional activity in prokaryotes and eukaryotes, respectively. We propose that the Bari family of transposons, and possibly other members of the Tc1-mariner superfamily, might have evolved "blurry promoters," which have facilitated their diffusion in many living organisms through horizontal transfer.

Also flagged:Generalized anxiety disorderanxiety disordersmental disorderspathogenesispsychiatric disordersmajor depressive disorder
Journal Article 2017-06-01 ✓ 2 Snippets Maron E, Nutt D.
In-Text Gene Mentions

Some other promising data have been reported by pharmacogenetic initiatives, where the intensive search for genetic treatment predictors has revealed a few genes, including the pituitary adenylate cyclase-activating peptide (PACAP), serotonin transporter (5-HTT), the serotonin 2A receptor gene (HTR2A), corticotropin-releasing hormone receptor 1 (CRHR1), dopamine receptor D3 (DRD3), nuclear receptor subfamily group C member 1 (NR3C1), and phosphodiesterase 1A (PDE1A), as potential markers predicting therapeutic response to SSRI medication in patients with GAD.72-78 In contrast, none of the investigated polymorphisms within dopamine receptor D2 (DRD2) or dopamine active transporter 1 (DAT1) genes showed an impact on venlafaxine XR treatment response in GAD.79

5-HTT, serotonin transporter; ACC, anterior cingulate cortex; ALIC, anterior limb of the internal capsule; Amy, amygdala; BG, basal ganglia; BNST, bed nucleus of the stria terminalis; BOLD, blood oxygen-level dependent; CBT, cognitive behavioral therapy; Ch/NAA, choline/N-acetylaspartate; Cin, cingulate; DAT, dopamine transporter; DLPFC, dorsolateral prefrontal cortex; dmPFC, dorsomedial prefrontal cortex; dPFC, doral prefrontal cortex; FC, functional connectivity; FG, fusiform gyrus; GMV, gray matter volume; Hip, hippocampus; Ins, insula; Lim, limbic; MB, midbrain; MFG, middle frontal gyrus; mPFC, medial prefrontal cortex; MRI, magnetic resonance spectroscopy; NAA/Cr, N-acetylaspartate/creatine; OG, orbital gyrus; paraCin, paracingulate; paraLim, paralimbic; PC, posterior cingulated; PET, positron emission tomography; PGC, pregenual cingulate; PrG, precentral gyrus; Put, putamen; rACC, rostal anterior cingulate cortex; RSFC, resting-state functional connectivity; SFG, superior frontal gyrus; SMG, supramarginal gyrus; SPECT, single-photon emission computed tomography; STG, superior temporal gyrus; Str, striatum; subGAC, subgenual anterior cingulate; Thal, thalamus; TP, temporal pole; VLPFC, ventrolateral prefrontal cortex; vmPFC, ventromedial prefrontal cortex; vPFC, ventral prefrontal cortex; VTA, ventral tegmental area; WM, white matter volume; wk, week

Show Full Abstract

Generalized anxiety disorder (GAD) is a prevalent and highly disabling mental health condition; however, there is still much to learn with regard to pertinent biomarkers, as well as diagnosis, made more difficult by the marked and common overlap of GAD with affective and anxiety disorders. Recently, intensive research efforts have focused on GAD, applying neuroimaging, genetic, and blood-based approaches toward discovery of pathogenetic and treatment-related biomarkers. In this paper, we review the large amount of available data, and we focus in particular on evidence from neuroimaging, genetic, and neurochemical measurements in GAD in order to better understand potential biomarkers involved in its etiology and treatment. Overall, the majority of these studies have produced results that are solitary findings, sometimes inconsistent and not clearly replicable. For these reasons, they have not yet been translated into clinical practice. Therefore, further research efforts are needed to distinguish GAD from other mental disorders and to provide new biological insights into its pathogenesis and treatment.

Also flagged:generalized anxiety disorderanxietyneuroticismserotoninnorepinephrinereuptake
Journal Article 2017-06-01 ✓ 5 Snippets Gottschalk MG, Domschke K.
In-Text Gene Mentions

We explore etiologic factors in gene-environment interaction approaches investigating childhood trauma, environmental adversity, and stressful life events in relation to selected candidate genes (5-HTT, NPSR1, COMT, MAOA, CRHR1, RGS2), Additionally, the pharmacogenetics of selective serotonin reuptake inhibitor/serotonin-norepinephrine reuptake inhibitor treatment are summarized (5-HTT, 5-HT2A, COMT, CRHR1).

Hierarchical multiple regression analysis in healthy individuals genotyped for their 5-HTTLPR-rs25531 haplotype discerned a significant gene-environment interaction of the 5-HTT haplotype, characterized by higher transcriptional activity/enzymatic activity (LA/LA) and childhood trauma intensity (CTQ), predicting increased anxiety sensitivity (Anxiety Sensitivity Index [ASI]).44 This effect was observed independent of sex-specific effects and notably, of a gene-environment correlation (rGE) between the 5-HTTLPR genotypes and childhood traumata.44 Moreover, a significant gene-environment interaction was found for childhood trauma (CTQ) and COMT rs4680 Met allele homozygosity, significantly explaining a proportion of the observed increased anxiety sensitivity (ASI).45 Similarly, an interaction of the MAOA-uVNTR short variants and increased exposure to childhood maltreatment predicted heightened scores of anxious apprehension (PSWQ) in the male sample subgroup; thus, early developmental adversities might interact with SNPs associated with decreased monoamine degradation, contributing toward psychiatric vulnerability.45

Finally, pharmacogenetic approaches applied to SSRI and SNRI treatment of GAD point to a potentially predictive role of serotonergic candidate genes (5-HTT, 5-HT2A), as well as the COMT and CRHR1 genes.

The most promising GWAS on trait anxiety severity or latent anxiety disorder factor scores detected encouraging hits in THBS2 and CAMKMT, in addition to studies centered around neuroticism, pointing repeatedly toward SNPs in an inversion polymorphism on chromosome 8, which showed extended genetic correlation with an anxiety disorder phenotype, Moreover, in candidate gene studies—partly combined with imaging and physiological readouts—converging evidence has been gathered for GAD susceptibility genes within the serotonergic and calecholaminergic systems (5-HTT, 5-HT1A, MAOA) as well as for the BDNF gene.

Furthermore, gene-environment studies have highlighted the importance of early developmental trauma and recent stressful life events in interaction with molecular plasticity markers and their combined relevance to GAD, trait anxiety, and anxiety sensitivity (5-HTT, NPSR1, COMT, MAOA, CRHR1, RGS2).

Show Full Abstract

This review serves as a systematic guide to the genetics of generalized anxiety disorder (GAD) and further focuses on anxiety-relevant endophenotypes, such as pathological worry fear of uncertainty, and neuroticism. We inspect clinical genetic evidence for the familialityl heritability of GAD and cross-disorder phenotypes based on family and twin studies. Recent advances of linkage studies, genome-wide association studies, and candidate gene studies (eg, <i>5-HTT, 5-HT1A, MAOA, BDNF</i>) are outlined. Functional and structural neuroimaging and neurophysiological readouts relating to peripheral stress markers and psychophysiology are further integrated, building a multilevel disease framework. We explore etiologic factors in gene-environment interaction approaches investigating childhood trauma, environmental adversity, and stressful life events in relation to selected candidate genes (<i>5-HTT, NPSR1, COMT, MAOA, CRHR1, RGS2</i>), Additionally, the pharmacogenetics of selective serotonin reuptake inhibitor/serotonin-norepinephrine reuptake inhibitor treatment are summarized (<i>5-HTT, 5-HT2A, COMT, CRHR1</i>). Finally, GAD and trait anxiety research challenges and perspectives in the field of genetics, including epigenetics, are discussed.

Also flagged:SLC6A4Gene ExpressionObsessive-Compulsive Disorderreverse transcriptionpolymeraseglyceraldehyde-3-phosphate dehydrogenase
Journal Article 2017-06-01 ✓ 2 Snippets Wang X, Zhao Q, Chen W, Yu S, Wang Z, Xiao Z.
In-Text Gene Mentions

There is significant research surrounding genes carrying an increased risk of OCD.[4] The gene SLC6A4 (serotonin transporter, 5-HTT or SERT), located on chromosome 17q11.1–q12, has been studied extensively for genetic Association with OCD.

…SLC6A4 (serotonin transporter,5-HTTor SERT), located…

Show Full Abstract

<h4>Background</h4>Serotonergic system dysfunction has been implicated in obsessive-compulsive disorder (OCD). This study examined peripheral SLC6A4 gene expression in OCD patients and healthy controls to explore the relationship between SLC6A4 and OCD.<h4>Methods</h4>Participants included 50 first episode OCD patients and 60 age and gender-matched healthy controls. Relative SLC6A4 gene expression were examined by real-time quantitative reverse transcription polymerase chain reaction (RT-PCR) in peripheral leukocytes of all the subjects. The Yale-Brown Obsessive Compulsive Scale (Y-BOCS) was used to assess the severity and subtype of OCD.<h4>Results</h4>SLC6A4 gene expression, normalized by glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were not significantly different between the OCD patients and healthy controls(<i>z</i>=-0.79, <i>p</i>=0.428). Male OCD patients showed a tendency of low gene expression of SLC6A4 in peripheral blood (<i>z</i>=-1.66, <i>p</i>=0.096). We did not find a significant correlation between SLC6A4 expression and the severity and subtype of OCD.<h4>Conclusion</h4>There is no correlation between SLC6A4 expression levels and the severity and subtype of OCD, but male OCD patients showed a tendency of low gene expression of SLC6A4 in peripheral blood. These results suggest that gene expression of SLC6A4 in peripheral blood may not be a useful biomarker of OCD in the Han Chinese population.

Also flagged:metallo-dependent amidohydrolasescaerulomycinspolyketide synthasenonribosomal peptide synthetaseoximemetallo-dependent amidohydrolase
Journal Article 2017-06-01 No Snippets Chen M, Pang B, Du YN, Zhang YP, Liu W.
Show Full Abstract

2,2'-Bipyridine (2,2'-BiPy) is an attractive core structure present in a number of biologically active natural products, including the structurally related antibiotics caerulomycins (CAEs) and collismycins (COLs). Their biosynthetic pathways share a similar key 2,2'-BiPy-l-leucine intermediate, which is desulfurated or sulfurated at C5, arises from a polyketide synthase/nonribosomal peptide synthetase hybrid assembly line. Focusing on the common off-line modification steps, we here report that the removal of the "auxiliary" l-leucine residue relies on the metallo-dependent amidohydrolase activity of CaeD or ColD. This activity leads to the production of similar 2,2'-BiPy carboxylate products that then receive an oxime functionality that is characteristic for both CAEs and COLs. Unlike many metallo-dependent amidohydrolase superfamily proteins that have been previously reported, these proteins (particularly CaeD) exhibited a strong zinc ion-binding capacity that was proven by site-specific mutagenesis studies to be essential to proteolytic activity. The kinetics of the conversions that respectively involve CaeD and ColD were analyzed, showing the differences in the efficiency and substrate specificity of these two proteins. These findings would generate interest in the metallo-dependent amidohydrolase superfamily proteins that are involved in the biosynthesis of bioactive natural products.

Also flagged:IronType 1 Diabeteswaterinsulinsecretionchronic disease
Journal Article 2017-06-01 No Snippets Søgaard KL, Ellervik C, Svensson J, Thorsen SU.
Show Full Abstract

<h4>Background</h4>The incidence of type 1 diabetes (T1D) is rising, which might be due to the influence of environmental factors. Biological and epidemiological evidence has shown that excess iron is associated with beta-cell damage and impaired insulin secretion.<h4>Aim</h4>In this review, our aim was to assess the association between iron and the risk of T1D.<h4>Methods</h4>A systematic literature search was performed in PubMed and EMBASE in July 2016. Studies investigating the effect of iron status/intake on the risk of developing T1D later were included, and study quality was evaluated. The results have been summarized in narrative form.<h4>Results</h4>From a total of 931 studies screened, we included 4 observational studies evaluating iron intake from drinking water or food during early life and the risk of T1D. The quality of the studies was moderate to high assessed via the nine-star Newcastle Ottawa Scale. One out of the four studies included in this review found estimates of dietary iron intake to be associated with risk of T1D development, whereas three studies found no such relationship for estimates of iron in drinking water.<h4>Conclusions</h4>The limited number of studies included found dietary iron, but not iron in drinking water, to be associated with risk of T1D. Further studies are needed to clarify the association between iron and risk of T1D, especially studies including measurements of body iron status.

Also flagged:VP6outer capsidVP7VP4RANcDNA
Journal Article 2017-06-01 No Snippets Jalilian S, Teimoori A, Makvandi M, Zandi M.
Show Full Abstract

<h4>Background and objectives</h4>Human rotavirus (RV) is responsible for most cases of acute gastroenteritis in infants, worldwide. Today, <i>in vitro</i> transcription (IVT) assay is widely used to develop efficient RNA for the biological experiments such as gene function analysis and reverse genetics. The aim of this study was to develop optimal full-length transcripts of the VP7 segment, using <i>in vitro</i> transcription assay.<h4>Materials and methods</h4>Special primers were designed in order to synthesize VP7 sequence of sense RNA in the process of IVT using T7 RNA polymerase. RT-PCR was performed using forward and reverse primers, containing T7 promoter sequence and <i>BstUI</i> restriction enzyme site, respectively. In order to synthesize ssRNA VP7, in accordance with the IVT technique, RV4-VP7 fragment was subcloned into PTZ57 R/T plasmid and digested by <i>BstUI</i> enzyme.<h4>Results</h4>The sequencing of the VP7 gene showed 99% identity withVP7 gene of rotavirus RV4 strain (Sequence ID: M64666.1). The analysis of purity of DNA fragment and ssRNA VP7 segment revealed that OD ratio of A260/A280 and quantity of nucleic acids were (1.9, 0.036 μg/μL) and (2.02, 0.98 μg/μL), respectively.<h4>Conclusion</h4>In the present study, a modified methodology of RNA synthetase was described by IVT assay, using T7RNA polymerase in order to transcribe the full-length transcripts of human VP7-RV4 strain. This method is applicable for reverse genetic approaches, especially for the production of reassortant RV vaccine.

Also flagged:gene expressionneurotransmittersstroke depressionserotonin transporter5norepinephrineα2 receptor
Journal Article 2017-06-01 ✓ 3 Snippets Xiao W, Zhang X, Wang Z, Wang Y, Guo X, He L, Liang F, Hu H.
In-Text Gene Mentions

<h4>Objective</h4>To observe the effects of acupuncture on mRNA of the neurotransmitter serotonin transporter (5-HTT), 5-HT<sub>1A</sub>receptor (5-HT<sub>1A</sub>R), norepinephrineα2 receptor (NEα<sub>2</sub>R) in brain tissue in rats with post-stroke depression.<h4>Methods</h4>Forty male SD rats were randomly divided into a normal group, a model group, a medication group and an acupuncture group, 10 rats in each one.

…mitter serotonin transporter (5-HTT), 5-HT<sub>1A</sub>receptor (…

…mRNA expressions of5-HTT, 5-HT<sub>1A</sub>R, NEα<sub>…

Show Full Abstract

<h4>Objective</h4>To observe the effects of acupuncture on mRNA of the neurotransmitter serotonin transporter (5-HTT), 5-HT<sub>1A</sub>receptor (5-HT<sub>1A</sub>R), norepinephrineα2 receptor (NEα<sub>2</sub>R) in brain tissue in rats with post-stroke depression.<h4>Methods</h4>Forty male SD rats were randomly divided into a normal group, a model group, a medication group and an acupuncture group, 10 rats in each one. The model of post-stroke depression was established by occlusion of middle cerebral artery and chronic unpredictable mild stress method. After model was successfully established, the rats in the normal group and model group received no treatment; the rats in medication group were treated with intragastric administration of fluoxetine (2 mg/kg); the rats in acupuncture group were treated with acupuncture at "Baihui" (GV 20), "Fengfu" (GV 16), "Shenmen" (HT 7) and "Taichong" (LR 3) for 20 min, during which manual stimulation was given once, once a day, 7 days as one course, and totally 3 courses were given with an interval of one day between courses. The changes of rat behavior and 5-HT, NE were observed after intervention; the RT-PCR method was applied to observe the mRNA of 5-HTT, 5-HT<sub>1A</sub>R, NEα<sub>2</sub>R in hippocampus, raphe nucleus and locus coeruleus.<h4>Results</h4>After treatment, compared with the normal group, the Zea Longa score in the model group was increased, while sugar water consumption, the number of horizontal and vertical movement of open-field test was reduced (all <i>P</i><0.01); compared with the model group, the Zea Longa score in the medication group and acupuncture group was reduced, while sugar water consumption, the number of horizontal and vertical movement of open-field test were increased (<i>P</i><0.01, <i>P</i><0.05); compared between the medication group and acupuncture group, the behavior changes were not significantly different (all <i>P</i>>0.05). After treatment, compared with the normal group, the content of 5-HT and NE in brain tissue and mRNA expression of 5-HTT, 5-HT<sub>1A</sub>R in hippocampus, raphe nucleus and locus coeruleus in the model group were reduced (all <i>P</i><0.01), but the mRNA expression of NEα<sub>2</sub>R was increased (<i>P</i><0.01);compared with the model group, the content of 5-HT and NE in brain tissue and mRNA expression of 5-HTT, 5-HT<sub>1A</sub>R in hippocampus, raphe nucleus and locus coeruleus in the medication group and acupuncture group were increased (<i>P</i><0.01, <i>P</i><0.05), while the mRNA expression of NEα<sub>2</sub>R was reduced (all <i>P</i><0.01). The differences between medication group and acupuncture group were not significantly different (all <i>P</i>>0.05).<h4>Conclusions</h4>Acupuncture could significantly improve behavioral change in rats with post-stroke depression, which may be related to the regulation of 5-HT, NE in cerebral cortex as well as mRNA expressions of 5-HTT, 5-HT<sub>1A</sub>R, NEα<sub>2</sub>R in hippocampus, raphe nucleus and locus coeruleus.

Also flagged:DAPP1phosphoinositide 3-kinasePI3KClass I PI3Ksphospholipidphosphatidylinositol
Journal Article 2017-06-01 No Snippets Durrant TN, Hutchinson JL, Heesom KJ, Anderson KE, Stephens LR, Hawkins PT, Marshall AJ, Moore SF, Hers I.
Show Full Abstract

The class I phosphoinositide 3-kinase (PI3K) isoforms play important roles in platelet priming, activation, and stable thrombus formation. Class I PI3Ks predominantly regulate cell function through their catalytic product, the signaling phospholipid phosphatidylinositol 3,4,5-trisphosphate [PtdIns(3,4,5)P<sub>3</sub>], which coordinates the localization and/or activity of a diverse range of binding proteins. Notably, the complete repertoire of these class I PI3K effectors in platelets remains unknown, limiting mechanistic understanding of class I PI3K-mediated control of platelet function. We measured robust agonist-driven PtdIns (3,4,5)P<sub>3</sub> generation in human platelets by lipidomic mass spectrometry (MS), and then used affinity-capture coupled to high-resolution proteomic MS to identify the targets of PtdIns (3,4,5)P<sub>3</sub> in these cells. We reveal for the first time a diverse platelet PtdIns(3,4,5)P<sub>3</sub> interactome, including kinases, signaling adaptors, and regulators of small GTPases, many of which are previously uncharacterized in this cell type. Of these, we show dual adaptor for phosphotyrosine and 3-phosphoinositides (DAPP1) to be regulated by Src-family kinases and PI3K, while platelets from DAPP1-deficient mice display enhanced thrombus formation on collagen in vitro. This was associated with enhanced platelet α/δ granule secretion and α<sub>IIb</sub>β<sub>3</sub> integrin activation downstream of the collagen receptor glycoprotein VI. Thus, we present the first comprehensive analysis of the PtdIns(3,4,5)P<sub>3</sub> signalosome of human platelets and identify DAPP1 as a novel negative regulator of platelet function. This work provides important new insights into how class I PI3Ks shape platelet function.

Also flagged:11:1benzoyl chloridephenolsilicaIronS21
Journal Article 2017-06-01 No Snippets Fröhlich T, Reiter C, Ibrahim MM, Beutel J, Hutterer C, Zeitträger I, Bahsi H, Leidenberger M, Friedrich O, Kappes B, Efferth T, Efferth T, Marschall M, Tsogoeva SB.
Show Full Abstract

Many quinazoline derivatives have been synthesized over the last few decades with great pharmacological potential, such as antimalarial, anti-inflammatory, antimicrobial, anticancer, and antiviral. But so far, no quinazoline-artemisinin hybrids have been reported in the literature. In the present study, five novel quinazoline-artemisinin hybrids were synthesized and evaluated for their in vitro biological activity against malarial parasites (<i>Plasmodium falciparum</i> 3D7), leukemia cells (CCRF-CEM and CEM/ADR5000), and human cytomegalovirus. Remarkably, hybrid <b>9</b> (EC<sub>50</sub> = 1.4 nM), the most active antimalarial compound of this study, was not only more potent than artesunic acid (EC<sub>50</sub> = 9.7 nM) but at the same time more active than the clinically used drugs dihydroartemisinin (EC<sub>50</sub> = 2.4 nM) and chloroquine (EC<sub>50</sub> = 9.8 nM). Furthermore, hybrids <b>9</b> and <b>10</b> were the most potent compounds with regard to anticytomegaloviral activity (EC<sub>50</sub> = 0.15-0.21 μM). They were able to outperform ganciclovir (EC<sub>50</sub> = 2.6 μM), which is the relevant standard drug of antiviral therapy, by a factor of 12-17. Moreover, we identified a new highly active quinazoline derivative, compound <b>14</b>, that is most effective in suppressing cytomegalovirus replication with an EC<sub>50</sub> value in the nanomolar range (EC<sub>50</sub> = 50 nM). In addition, hybrid <b>9</b> exhibited an antileukemia effect similar to that of artesunic acid, with EC<sub>50</sub> values in the low micromolar range, and was 45 times more active toward the multidrug-resistant CEM/ADR5000 cells (EC<sub>50</sub> = 0.5 μM) than the standard drug doxorubicin.