Gene Literature Dashboard

Viewing November 2017 — 425 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← October 2017 December 2017 →
Also flagged:zinc finger nucleasebeta thalassemiaβ-thalassemiasynthesissickle cell anemiabinding
Journal Article 2017-11-30 ✓ 4 Snippets Modares Sadeghi M, Shariati L, Hejazi Z, Shahbazi M, Tabatabaiefar MA, Khanahmad H.
In-Text Gene Mentions

Inducing indel mutation in the SOX6 gene by zinc finger nuclease for gamma reactivation: An approach towards gene therapy of beta thalassemia.

…mutation in theSOX6gene by zinc…

…domain region ofSOX6to reactivate γ-globin…

…induce indel onSOX6gene in adult…

Show Full Abstract

β-thalassemia is a common autosomal recessive disorder characterized by a deficiency in the synthesis of β-chains. Evidences show that increased HbF levels improve the symptoms in patients with β-thalassemia or sickle cell anemia. In this study, ZFN technology was applied to induce a mutation in the binding domain region of SOX6 to reactivate γ-globin expression. The sequences coding for ZFP arrays were designed and sub cloned in TDH plus as a transfer vector. The ZFN expression was confirmed using Western blot analysis. In the next step, using the site-directed mutagenesis strategy through the overlap PCR, a missense mutation (D64V) was induced in the catalytic domain of the integrase gene in the packaging plasmid and verified using DNA sequencing. Then, the integrase minus lentivirus containing ZFN cassette was packaged. Transduction of K562 cells with this virus was performed. Mutation detection assay was performed. The indel percentage of the cells transducted with lenti virus containing ZFN was 31%. After 5 days of erythroid differentiation with 15 μg/mL cisplatin, the levels of γ-globin mRNA were sixfold in the cells treated with ZFN compared to untreated cells. In the meantime, the measurement of HbF expression levels was carried out using hemoglobin electrophoresis and showed the same results. Integrase minus lentivirus can provide a useful tool for efficient transient gene expression and helps avoid disadvantages of gene targeting using the native virus. The ZFN strategy applied here to induce indel on SOX6 gene in adult erythroid progenitors may provide a method to activate fetal hemoglobin expression in individuals with β-thalassemia.

Also flagged:systemic cancerERBB2canceresophageal cancerdisseminated cancerprimary tumor
Journal Article 2017-11-30 ✓ 1 Snippet Hoffmann M, Pasch S, Schamberger T, Maneck M, Möhlendick B, Schumacher S, Brockhoff G, Knoefel WT, Izbicki J, Polzer B, Stoecklein NH, Klein CA.
In-Text Gene Mentions

…a single ERBB2-amplifiedDCCwas the most…

Show Full Abstract

Early metastatic dissemination and evolution of disseminated cancer cells (DCCs) outside the primary tumor is one reason for the failure of adjuvant therapies because it generates molecular genotypes and phenotypes different from primary tumors, which still underlie therapy decisions. Since ERBB2 amplification in esophageal DCCs but not in primary tumor cells predict outcome, we aimed to establish an assay with diagnostic reliability for single DCCs or circulating tumor cells. For this, we evaluated copy number alterations of more than 600 single DCCs from multiple cancer types to define reference regions suitable for quantification of target regions, such as ERBB2. We then compared ERBB2 quantitative PCR (qPCR) measurements with fluorescent in situ hybridization (FISH) data of various breast cancer cell lines and identified the aberration-calling threshold. The method was applied to two independent cohorts of esophageal cancer patients from Hamburg (n = 59) and Düsseldorf (n = 53). We found a high correlation between the single cell qPCR assay and the standard FISH assay (R = 0.98) and significant associations between amplification and survival for both patient cohorts (Hamburg (HH), p = 0.033; Düsseldorf (D), p = 0.052; pooled HH + D, p = 0.002) when applied to DCCs of esophageal cancer patients. Detection of a single ERBB2-amplified DCC was the most important risk factor for death from esophageal cancer (relative risk = 4.22; 95% CI = 1.91-9.32; p < 0.001). In our study, we detected ERBB2-amplified cells in 7% of patients. These patients could benefit from anti-ERBB2 targeting therapies.

Also flagged:viral infectionimmune responseinterferonIFNhost cellIFN regulatory factor 3
Journal Article 2017-11-30 No Snippets Crosse KM, Monson EA, Beard MR, Helbig KJ.
Show Full Abstract

The ability of a host to curb a viral infection is heavily reliant on the effectiveness of an initial antiviral innate immune response, resulting in the upregulation of interferon (IFN) and, subsequently, IFN-stimulated genes (ISGs). ISGs serve to mount an antiviral state within a host cell, and although the specific antiviral function of a number of ISGs has been characterized, the function of many of these ISGs remains to be determined. Recent research has uncovered a novel role for a handful of ISGs, some of them directly induced by IFN regulatory factor 3 in the absence of IFN itself. These ISGs, most with potent antiviral activity, are also able to augment varying arms of the innate immune response to viral infection, thereby strengthening this response. This new understanding of the role of ISGs may, in turn, help the recent advancement of novel therapeutics aiming to augment innate signaling pathways in an attempt to control viral infection and pathogenesis.

Also flagged:major depressive disorderschizophreniaMood instabilitypsychotic disordersmoodpsychiatric disorders
Journal Article 2017-11-30 ✓ 5 Snippets Ward J, Strawbridge RJ, Bailey MES, Graham N, Ferguson A, Lyall DM, Cullen B, Pidgeon LM, Cavanagh J, Mackay DF, Pell JP, O'Donovan M, Escott-Price V, Smith DJ.
In-Text Gene Mentions

DCC is the receptor for the guidance cue netrin 1, which has a central role in the development of the nervous system, including (but not limited to) the organisation and function of mesocorticolimbic dopamine systems28.

…instability, including theDCC netrin 1 receptornetrin 1 receptor…

…1 receptor (DCC) gene, eukaryotic…

…(index SNP rs8084280;DCC).…

…chromosome 18 (theDCCgene) for males…

Show Full Abstract

Mood instability is a core clinical feature of affective and psychotic disorders. In keeping with the Research Domain Criteria approach, it may be a useful construct for identifying biology that cuts across psychiatric categories. We aimed to investigate the biological validity of a simple measure of mood instability and evaluate its genetic relationship with several psychiatric disorders, including major depressive disorder (MDD), bipolar disorder (BD), schizophrenia, attention deficit hyperactivity disorder (ADHD), anxiety disorder and post-traumatic stress disorder (PTSD). We conducted a genome-wide association study (GWAS) of mood instability in 53,525 cases and 60,443 controls from UK Biobank, identifying four independently associated loci (on chromosomes 8, 9, 14 and 18), and a common single-nucleotide polymorphism (SNP)-based heritability estimate of ~8%. We found a strong genetic correlation between mood instability and MDD (r <sub>g</sub> = 0.60, SE = 0.07, p = 8.95 × 10<sup>-17</sup>) and a small but significant genetic correlation with both schizophrenia (r <sub>g</sub> = 0.11, SE = 0.04, p = 0.01) and anxiety disorders (r <sub>g</sub> = 0.28, SE = 0.14, p = 0.04), although no genetic correlation with BD, ADHD or PTSD was observed. Several genes at the associated loci may have a role in mood instability, including the DCC netrin 1 receptor (DCC) gene, eukaryotic translation initiation factor 2B subunit beta (eIF2B2), placental growth factor (PGF) and protein tyrosine phosphatase, receptor type D (PTPRD). Strengths of this study include the very large sample size, but our measure of mood instability may be limited by the use of a single question. Overall, this work suggests a polygenic basis for mood instability. This simple measure can be obtained in very large samples; our findings suggest that doing so may offer the opportunity to illuminate the fundamental biology of mood regulation.

Also flagged:PTSDtraumaTRAM1L1alcohol abusechromosomeTMPRSS15
Journal Article 2017-11-30 ✓ 1 Snippet Morey RA, Davis SL, Garrett ME, Haswell CC, Mid-Atlantic MIRECC Workgroup, Marx CE, Beckham JC, McCarthy G, Hauser MA, Ashley-Koch AE.
In-Text Gene Mentions

…intronic locus withinDCC(rs62097986) that encodes…

Show Full Abstract

Depending on the traumatic event, a significant fraction of trauma survivors subsequently develop PTSD. The additional variability in PTSD risk is expected to arise from genetic susceptibility. Unfortunately, several genome-wide association studies (GWAS) have failed to identify a consistent genetic marker for PTSD. The heritability of intermediate phenotypes such as regional brain volumes is often 80% or higher. We conducted a GWAS of subcortical brain volumes in a sample of recent military veteran trauma survivors (n = 157), grouped into PTSD (n = 66) and non-PTSD controls (n = 91). Covariates included PTSD diagnosis, sex, intracranial volume, ancestry, childhood trauma, SNP×PTSD diagnosis, and SNP×childhood trauma. We identified several genetic markers in high linkage disequilibrium (LD) with rs9373240 (p = 2.0 × 10<sup>-7</sup>, FDR q = 0.0375) that were associated with caudate volume. We also observed a significant interaction between rs9373240 and childhood trauma (p-values = 0.0007-0.002), whereby increased trauma exposure produced a stronger association between SNPs and increased caudate volume. We identified several SNPs in high LD with rs34043524, which is downstream of the TRAM1L1 gene that were associated with right lateral ventricular volume (p = 1.73 × 10<sup>-7</sup>; FDR q = 0.032) and were also associated with lifetime alcohol abuse or dependence (p = 2.49 × 10<sup>-7</sup>; FDR q = 0.0375). Finally, we identified several SNPs in high LD with rs13140180 (p = 2.58 × 10<sup>-7</sup>; FDR q = .0016), an intergenic region on chromosome 4, and several SNPs in the TMPRSS15 associated with right nucleus accumbens volume (p = 2.58 × 10<sup>-7</sup>; FDR q = 0.017). Both TRAM1L1 and TMPRSS15 have been previously implicated in neuronal function. Key results survived genome-wide multiple-testing correction in our sample. Leveraging neuroimaging phenotypes may offer a shortcut, relative to clinical phenotypes, in mapping the genetic architecture and neurobiological pathways of PTSD.

Also flagged:bindinglocalizationtranscriptional regulatorsmetabolic diseasesobesitydiabetes
Journal Article 2017-11-30 ✓ 1 Snippet Giroud M, Scheideler M.
In-Text Gene Mentions

…on staufen 1 (STAU1)-mediated messenger RNA decay…

Show Full Abstract

Single cell organisms can surprisingly exceed the number of human protein-coding genes, which are thus not at the origin of the complexity of an organism. In contrast, the relative amount of non-protein-coding sequences increases consistently with organismal complexity. Moreover, the mammalian transcriptome predominantly comprises non-(protein)-coding RNAs (ncRNA), of which the long ncRNAs (lncRNAs) constitute the most abundant part. lncRNAs are highly species- and tissue-specific with very versatile modes of action in accordance with their binding to a large spectrum of molecules and their diverse localization. lncRNAs are transcriptional regulators adding an additional regulatory layer in biological processes and pathophysiological conditions. Here, we review lncRNAs affecting metabolic organs with a focus on the liver, pancreas, skeletal muscle, cardiac muscle, brain, and adipose organ. In addition, we will discuss the impact of lncRNAs on metabolic diseases such as obesity and diabetes. In contrast to the substantial number of lncRNA loci in the human genome, the functionally characterized lncRNAs are just the tip of the iceberg. So far, our knowledge concerning lncRNAs in energy homeostasis is still in its infancy, meaning that the rest of the iceberg is a treasure chest yet to be discovered.

Also flagged:OchratoxinAochratoxin Aantibodyaflatoxinsfumonisins
Journal Article 2017-11-30 No Snippets Oplatowska-Stachowiak M, Kleintjens T, Sajic N, Haasnoot W, Campbell K, Elliott CT, Salden M.
Show Full Abstract

T-2 toxin/HT-2 toxin (T-2/HT-2) and ochratoxin A (OTA) are mycotoxins that can contaminate a variety of agricultural commodities. To protect consumers' health, indicative limits for T-2/HT-2 and maximum limits for OTA have been set by the European Commission, requiring food business operators and controlling agencies to conduct routine checks for the presence of these harmful contaminants. Screening methods are increasingly used for monitoring purposes. Due to the demand for new and improved screening tools, two individual detection methods, T-2/HT-2 and OTA enzyme-linked immunosorbent assays (ELISAs), were developed in this study. The T-2/HT-2 ELISA was based on a T-2 monoclonal antibody with an IC<sub>50</sub> (50% inhibitory concentration) of 0.28 ng/mL and 125% cross-reactivity with HT-2. As regards the OTA ELISA, a new sensitive monoclonal antibody specific to OTA with an IC<sub>50</sub> of 0.13 ng/mL was produced. Both developed ELISA tests were then validated in agricultural commodities in accordance with the new performance criteria guidelines for the validation of screening methods for mycotoxins included in Commission Regulation (EU) No 519/2014. The T-2/HT-2 ELISA was demonstrated to be suitable for the detection of T-2/HT-2 in cereals and baby food at and above the screening target concentration (STC) of 12.5 μg/kg and 7.5 μg/kg, respectively. The OTA ELISA was shown to be applicable for the detection of OTA in cereals, coffee, cocoa and wine at and above the STC of 2 μg/kg, 2.5 μg/kg, 2.5 μg/kg and 0.4 ng/mL, respectively. The accuracy of both ELISAs was further confirmed by analysing proficiency test and reference samples. The developed methods can be used for sensitive and high-throughput screening for the presence of T-2/HT-2 and OTA in agricultural commodities.

Also flagged:EHFHypotensionmigraineidiopathic intracranial hypertensionpapilledemacranial nerve palsies
Journal Article 2017-11-30 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

…Association of 5-HTT gene polymorphisms wit…

Show Full Abstract

No abstract available.

Also flagged:schizophreniabipolar diseaseautism spectrum disordersattention deficit hyperactivity disorderADHDdepression
Journal Article 2017-11-30 ✓ 5 Snippets Glessner JT, Li J, Wang D, March M, Lima L, Desai A, Hadley D, Kao C, Gur RE, Cohen N, Sleiman PMA, Li Q, Hakonarson H, Janssen-CHOP Neuropsychiatric Genomics Working Group.
In-Text Gene Mentions
⭐ same-sentence co-mention

Among these 23 loci, ten (PAX5, RERE, VRK2, MEF2C, L3MBTL2, DCC, SORCS3, NEGR1, VRK2, LIN28B) were shared with other neuropsychiatric disorders (SCZ, BD, ASD, ADHD) reported in the GWAS catalog [20].

…, RERE ,VRK2, MEF2C ,…

…, L3MBTL2 ,DCC, SORCS3 ,…

⭐ same-sentence co-mention

…, SORCS3 ,NEGR1, VRK2 ,…

⭐ same-sentence co-mention

…, NEGR1 ,VRK2, LIN28B )…

Show Full Abstract

<h4>Background</h4>Neurodevelopmental and neuropsychiatric disorders represent a wide spectrum of heterogeneous yet inter-related disease conditions. The overlapping clinical presentations of these diseases suggest a shared genetic etiology. We aim to identify shared structural variants spanning the spectrum of five neuropsychiatric disorders.<h4>Methods</h4>We investigated copy number variations (CNVs) in five cohorts, including schizophrenia (SCZ), bipolar disease (BD), autism spectrum disorders (ASD), attention deficit hyperactivity disorder (ADHD), and depression, from 7849 cases and 10,799 controls. CNVs were called based on intensity data from genome-wide SNP arrays and CNV frequency was compared between cases and controls in each disease cohort separately. Meta-analysis was performed via a gene-based approach. Quantitative PCR (qPCR) was employed to validate novel significant loci.<h4>Results</h4>In our meta-analysis, two genes containing CNVs with exonic overlap reached genome-wide significance threshold of meta P value < 9.4 × 10<sup>-6</sup> for deletions and 7.5 × 10<sup>-6</sup> for duplications. We observed significant overlap between risk CNV loci across cohorts. In addition, we identified novel significant associations of DOCK8/KANK1 duplications (meta P value = 7.5 × 10<sup>-7</sup>) across all cohorts, and further validated the CNV region with qPCR.<h4>Conclusions</h4>In the first large scale meta-analysis of CNVs across multiple neurodevelopmental/psychiatric diseases, we uncovered novel significant associations of structural variants in the locus of DOCK8/KANK1 shared by five diseases, suggesting common etiology of these clinically distinct neurodevelopmental conditions.

Also flagged:EndocannabinoidHuntington's diseaseHDneurodegenerative diseasecognitive disordersglutamate
Journal Article 2017-11-30 ✓ 1 Snippet Sepers MD, Smith-Dijak A, LeDue J, Kolodziejczyk K, Mackie K, Raymond LA.
In-Text Gene Mentions

Htt

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disease affecting predominantly striatum and cortex that results in motor and cognitive disorders. Before a motor phenotype, animal models of HD show aberrant cortical-striatal glutamate signaling. Here, we tested synaptic plasticity of cortical excitatory synapses onto striatal spiny projection neurons (SPNs) early in the YAC128 mouse model of HD. High-frequency stimulation-induced long-term depression, mediated by the endocannabinoid anandamide and cannabinoid receptor 1 (CB1), was significantly attenuated in male and female YAC128 SPNs. Indirect pathway SPNs, which are more vulnerable in HD, were most affected. Our experiments show metabotropic glutamate receptor and endocannabinoid 2-arachidonoylglycerol-dependent plasticity, as well as direct CB1 activation by agonists, was similar in YAC128 and FVB/N wild-type SPNs suggesting that presynaptic CB1 is functioning normally. These results are consistent with a specific impairment in postsynaptic anandamide synthesis in YAC128 SPN. Strikingly, although suppression of degradation of anandamide was not effective, elevating 2-arachidonoylglycerol levels restored long-term depression in YAC128 striatal neurons. Together, these results have potential implications for neuroprotection and ameliorating early cognitive and motor deficits in HD.<b>SIGNIFICANCE STATEMENT</b> Huntington's disease (HD) is an inherited neurodegenerative disease with no cure. Recent studies find impairment of the endocannabinoid system in animal models but the functional implication for synaptic plasticity in HD remains unclear. Sepers et al. show a selective deficit in synaptic plasticity mediated by the endocannabinoid anandamide, but not 2-arachidonoylglycerol in a mouse model of HD. The deficit is rescued by selectively elevating levels of 2-arachidonoylglycerol produced on-demand. This mechanism could be targeted in the development of future therapeutics for HD.

Also flagged:Bisphenol Apolycarbonatepolyvinyl chloridewaterreproductioncancer
Journal Article 2017-11-30 No Snippets Herz C, Tran HTT, Schlotz N, Michels K, Lamy E.
Show Full Abstract

Controversy exists about the human health risk of environmental exposure to bisphenol A (BPA). Telomerase activity is emerging both as biomarker and contributing factor for age-related diseases. The effects of BPA exposure at 1-1000 nM on telomerase, DNA integrity and cell proliferation were investigated in PBMC from human donors. Telomerase activity was determined by TRAP-ELISA assay and mRNA expression by qRT-PCR. Mechanistic studies were carried out on the ER/GPR30-ERK pathway using specific inhibitors/antagonists, the comet assay to quantify DNA damage and flow cytometry for cell proliferation. 24 h BPA exposure inhibited telomerase in a non-monotonic pattern with a peak inhibition of 32% at 1 nM (p ≤ 0.01). A significant telomerase inhibition was evident at 1 h after exposure with a minimum at 6 h. Elevated levels of DNA damage frequency and decrease in cell proliferation were evident upon long-term exposure. The results further demonstrate that BPA triggered rapidly an ER/GPR30-ERK transduction pathway that leads to decreased telomerase activity in human PBMC. This is the first study to demonstrate adverse impact of BPA at levels of current human exposure on telomerase in normal cells, mediated by ER/GPR30-ERK. The results suggest a potentially harmful influence of BPA on immune cells and should be addressed in future studies.

Also flagged:ESR1breast cancerestrogenfulvestrantbindingestrogen receptor-α
Journal Article 2017-11-30 No Snippets Martin LA, Ribas R, Simigdala N, Schuster E, Pancholi S, Tenev T, Gellert P, Buluwela L, Harrod A, Thornhill A, Nikitorowicz-Buniak J, Bhamra A, Turgeon MO, Poulogiannis G, Gao Q, Martins V, Hills M, Garcia-Murillas I, Fribbens C, Patani N, Li Z, Sikora MJ, Turner N, Zwart W, Oesterreich S, Carroll J, Ali S, Dowsett M.
Show Full Abstract

Resistance to endocrine therapy remains a major clinical problem in breast cancer. Genetic studies highlight the potential role of estrogen receptor-α (ESR1) mutations, which show increased prevalence in the metastatic, endocrine-resistant setting. No naturally occurring ESR1 mutations have been reported in in vitro models of BC either before or after the acquisition of endocrine resistance making functional consequences difficult to study. We report the first discovery of naturally occurring ESR1 <sup>Y537C</sup> and ESR1 <sup>Y537S</sup> mutations in MCF7 and SUM44 ESR1-positive cell lines after acquisition of resistance to long-term-estrogen-deprivation (LTED) and subsequent resistance to fulvestrant (ICIR). Mutations were enriched with time, impacted on ESR1 binding to the genome and altered the ESR1 interactome. The results highlight the importance and functional consequence of these mutations and provide an important resource for studying endocrine resistance.

Also flagged:mitochondrialmitophagymitochondriamitotracker greennucleoidsmitochondrion
Journal Article 2017-11-30 No Snippets de Almeida MJ, Luchsinger LL, Corrigan DJ, Williams LJ, Snoeck HW.
Show Full Abstract

Hematopoietic stem cells (HSCs) produce most cellular energy through glycolysis rather than through mitochondrial respiration. Consistent with this notion, mitochondrial mass has been reported to be low in HSCs. However, we found that staining with MitoTracker Green, a commonly used dye to measure mitochondrial content, leads to artefactually low fluorescence specifically in HSCs because of dye efflux. Using mtDNA quantification, enumeration of mitochondrial nucleoids, and fluorescence intensity of a genetically encoded mitochondrial reporter, we unequivocally show here that HSCs and multipotential progenitors (MPPs) have higher mitochondrial mass than lineage-committed progenitors and mature cells. Despite similar mitochondrial mass, respiratory capacity of MPPs exceeds that of HSCs. Furthermore, although elevated mitophagy has been invoked to explain low mitochondrial mass in HSCs, we observed that mitochondrial turnover capacity is comparatively low in HSCs. We propose that the role of mitochondria in HSC biology may have to be revisited in light of these findings.

Also flagged:Acute myeloid leukaemiaAMLpathogenesisbiotransformationleukaemiaKMT2A
Journal Article 2017-11-30 ✓ 5 Snippets Pombo-de-Oliveira MS, Andrade FG, Brisson GD, Dos Santos Bueno FV, Cezar IS, Noronha EP.
In-Text Gene Mentions

In this context, the most common KMT2A fusion partners in our series of i-AML are: MLLT3/AF9 (35.7%), MLLT1/ENL (15.3%), MLLT4/AF6 (14.1%), MLLT10/AF10 (10%), AFF1/AF4 and MLL-PTD (6.1%).

According to data from MLLrecombinome, the most frequent rearrangements occur either with MLLT3/AF9, MLLT1/ENL, ELL, MLLT10/AF10, MLLT4/AF6 or AFF1/AF4 genes, or are derived from gene internal duplications (MLL-PTDs) representing ~90% of AML cases.

…, ELL ,MLLT10/ AF10 ,…

…, MLLT4 ,MLLT10, AFF1 and…

…, MLLT4/AF6 (14.1%),MLLT10/AF10 (10%), AFF1/AF4 and…

Show Full Abstract

Acute myeloid leukaemia (AML) in early childhood is characterised by a high frequency of recurrent genomic aberrations associated with distinct myeloid subtypes, clinical outcomes and pathogenesis. Genomic instability is the first step of pathogenic mechanism in early childhood AML. A sum of adverse events is necessary to the development of infant AML (i-AML), which includes latency of biochemical-molecular and cellular effects. Inherited genetic susceptibility associated with exposures to biotransformation substances can modulate the risk of DNA damage and it is a very important piece in the pathogenic puzzle. In this review, we have aimed to explore the chain of events in the time-points of the natural history of i-AML, which includes maternal exposures during pregnancy, the speculations about the formation of somatic mutations during foetal life and the secondary genomic aberrations associated with i-AML. The modulation of risk conferred by xenobiotic metabolism´s genes variants is the bottom line of the pathogenic process. Since we have conducted observational and molecular investigations in early childhood leukaemia, the data focused here is based on Brazilian findings with summarised results of our experience with epidemiological and molecular studies in early-age leukaemia.

Also flagged:Cytosineadenineguaninespinocerebellar ataxiasdentatorubral-pallidoluysian atrophyspinobulbar muscular atrophy
Journal Article 2017-11-30 ✓ 5 Snippets Keo A, Aziz NA, Dzyubachyk O, van der Grond J, van Roon-Mom WMC, Lelieveldt BPF, Reinders MJT, Mahfouz A.
In-Text Gene Mentions

It would be interesting to evaluate whether this triangular relation between HTT, ATN1, and ATXN2 is dysregulated in all polyQ diseases, especially HD, DRPLA, and SCA2.

In HD, up to 75% of the variability in AAO can be explained by the HTT CAG repeat length (Hmida-Ben Brahim et al., 2014), while in SCA1, SCA2, SCA3, SCA6, and SCA7, the CAG repeat in the causative gene explains between 32 and 80% of the AAO variability (Tezenas et al., 2014).

Cytosine-adenine-guanine (CAG) repeat expansions in the coding regions of nine polyglutamine (polyQ) genes (HTT, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, ATN1, AR, and TBP) are the cause of several neurodegenerative diseases including Huntington’s disease (HD), six different spinocerebellar ataxias (SCAs), dentatorubral-pallidoluysian atrophy, and spinobulbar muscular atrophy.

Ubiquitin may be involved in HD pathogenesis through the relationships between HTT, ATN1, and ATXN2. The ubiquitin-proteasome system (UPS) has been linked extensively to the pathogenesis of neurodegenerative diseases, including HD and other SCAs (Williams and Paulson, 2008; Arrasate and Finkbeiner, 2012; Atkin and Paulson, 2014; Dantuma and Bott, 2014; Ortega and Lucas, 2014; Bettencourt et al., 2016).

In addition, we observed strong connectivity of ATXN2 and AR with HTT in the pons that has been described to undergo atrophy in SCA2 (Ying et al., 2006).

Show Full Abstract

Cytosine-adenine-guanine (CAG) repeat expansions in the coding regions of nine polyglutamine (polyQ) genes (<i>HTT</i>, <i>ATXN1</i>, <i>ATXN2</i>, <i>ATXN3</i>, <i>CACNA1A</i>, <i>ATXN7</i>, <i>ATN1</i>, <i>AR</i>, and <i>TBP</i>) are the cause of several neurodegenerative diseases including Huntington's disease (HD), six different spinocerebellar ataxias (SCAs), dentatorubral-pallidoluysian atrophy, and spinobulbar muscular atrophy. The expanded CAG repeat length in the causative gene is negatively related to the age-at-onset (AAO) of clinical symptoms. In addition to the expanded CAG repeat length in the causative gene, the normal CAG repeats in the other polyQ genes can affect the AAO, suggesting functional interactions between the polyQ genes. However, there is no detailed assessment of the relationships among polyQ genes in pathologically relevant brain regions. We used gene co-expression analysis to study the functional relationships among polyQ genes in different brain regions using the Allen Human Brain Atlas (AHBA), a spatial map of gene expression in the healthy brain. We constructed co-expression networks for seven anatomical brain structures, as well as a region showing a specific pattern of atrophy in HD patients detected by magnetic resonance imaging (MRI) of the brain. In this HD-associated region, we found that <i>ATN1</i> and <i>ATXN2</i> were co-expressed and shared co-expression partners which were enriched for DNA repair genes. We observed a similar co-expression pattern in the frontal lobe, parietal lobe, and striatum in which this relation was most pronounced. Given that the co-expression patterns for these anatomical structures were similar to those for the HD-associated region, our results suggest that their disruption is likely involved in HD pathology. Moreover, <i>ATN1</i> and <i>ATXN2</i> also shared many co-expressed genes with <i>HTT</i>, the causative gene of HD, across the brain. Although this triangular relationship among these three polyQ genes may also be dysregulated in other polyQ diseases, stronger co-expression patterns between <i>ATN1</i> and <i>ATXN2</i> observed in the HD-associated region, especially in the striatum, may be more specific to HD.

Also flagged:-phenylimidazoleamino5pyridazinestetrahydroimidazo[1,5b ]pyridazines
Journal Article 2017-11-30 No Snippets Vandyshev DY, Shikhaliev KS, Potapov AY, Krysin MY, Zubkov FI, Sapronova LV.
Show Full Abstract

The novel cascade two-stage reaction between itaconimides and 1,2-diamino-4-phenylimidazole proceeds regio- and chemoselectively to form tetrahydroimidazo[1,5-<i>b</i>]pyridazines and includes nucleophilic C-addition by the activated C=C double bond and subsequent intramolecular recyclization of the intermediate with the amino group involved.

Also flagged:Indomethacinpaclitaxeldextrandisulfideglutathionetumor
Journal Article 2017-11-30 No Snippets Wang S, Tan X, Li S, Zhou Y, Geng P, Hua A, Deng A, Yu Z.
Show Full Abstract

Development of multidrug resistance against antitumor agents is a major limiting factor for the successful chemotherapy. Currently, both amphiphilic polymeric micelles and chemosensitizers have been proposed to overcome MDR during chemotherapy. Herein, the redox-responsive polymeric micelles composed of dextran and indomethacin (as chemosensitizer) using a disulfide bond as the linker are prepared (DEX-SS-IND) for delivery of antitumor agent paclitaxel (PTX). The high level of glutathione in tumor cells selectively breaks the disulfide bond, leading to the rapid breakdown and deformation of redox-responsive polymeric micelles. The data show that DEX-SS-IND can spontaneously form the stable micelles with high loading content (9.48 ± 0.41%), a favorable size of 45 nm with a narrow polydispersity (0.157), good stability, and glutathione-triggered drug release behavior due to the rapid breakdown of disulfide bond between DEX and IND. <i>In vitro</i> antitumor assay shows DEX-SS-IND/PTX micelles effectively inhibit the proliferation of PTX-resistant breast cancer (MCF-7/PTX) cells. More impressively, DEX-SS-IND/PTX micelles possess the improved plasma pharmacokinetics, enhanced antitumor efficacy on tumor growth in the xenograft models of MCF-7/PTX cells, and better <i>in vivo</i> safety. Overall, DEX-SS-IND/PTX micelles display a great potential for cancer treatment, especially for multidrug resistance tumors.

Also flagged:Lyme diseasemulti-systemic diseasemelittinDoxycyclineCefoperazoneDaptomycin
Journal Article 2017-11-29 No Snippets Socarras KM, Theophilus PAS, Torres JP, Gupta K, Sapi E.
Show Full Abstract

Lyme disease is a tick-borne, multi-systemic disease, caused by the bacterium <i>Borrelia burgdorferi.</i> Though antibiotics are used as a primary treatment, relapse often occurs after the discontinuation of antimicrobial agents. The reason for relapse remains unknown, however previous studies suggest the possible presence of antibiotic resistant Borrelia round bodies, persisters and attached biofilm forms. Thus, there is an urgent need to find antimicrobial agents suitable to eliminate all known forms of <i>B. burgdorferi</i>. In this study, natural antimicrobial agents such as <i>Apis mellifera</i> venom and a known component, melittin, were tested using SYBR Green I/PI, direct cell counting, biofilm assays combined with LIVE/DEAD and atomic force microscopy methods. The obtained results were compared to standalone and combinations of antibiotics such as Doxycycline, Cefoperazone, Daptomycin, which were recently found to be effective against Borrelia persisters. Our findings showed that both bee venom and melittin had significant effects on all the tested forms of <i>B. burgdorferi.</i> In contrast, the control antibiotics when used individually or even in combinations had limited effects on the attached biofilm form. These findings strongly suggest that whole bee venom or melittin could be effective antimicrobial agents for <i>B. burgdorferi;</i> however, further research is necessary to evaluate their effectiveness in vivo, as well as their safe and effective delivery method for their therapeutic use.

Also flagged:citratechronic kidney diseaseiron deficiency anemiaphosphorusironferric
Journal Article 2017-11-29 ✓ 1 Snippet Chertow GM, Block GA, Neylan JF, Pergola PE, Uhlig K, Fishbane S.
In-Text Gene Mentions

…a history ofhemochromatosiswere excluded from…

Show Full Abstract

Two randomized, placebo-controlled trials conducted in patients with nondialysis-dependent (NDD) chronic kidney disease (CKD), iron deficiency anemia, and normal or elevated serum phosphorus demonstrated that ferric citrate (FC) significantly increased hemoglobin and decreased serum phosphate concentrations. Pooling these trial results could provide a more robust evaluation of the safety and efficacy of FC in this population. We pooled results of a phase 2 (n = 149) and 3 trial (n = 233) of patients randomized and treated for up to 12 and 16 weeks, respectively. The starting dose in both trials was three 1-g (elemental iron 210 mg) tablets/day with food, up to 12 tablets/day. Doses were titrated in the phase 2 and 3 trials to lower serum phosphate concentrations to a target range (0.97-1.13 mmol/L) and to achieve a ≥10-g/L hemoglobin increase, respectively. Safety was assessed in all patients who received ≥1 dose of FC (n = 190) and placebo (n = 188). Treatment-emergent adverse events (AEs) were reported in 143 of 190 (75.3%) FC-treated and 116 of 188 (61.7%) placebo-treated patients; gastrointestinal AEs were the most frequent (94 [49.5%] vs. 52 [27.7%], respectively). Specific events reported in >5% of patients (FC vs. placebo, respectively) included discolored feces (41 [21.6%] vs. 0 [0.0%]), diarrhea (39 [20.5%] vs. 23 [12.2%]), constipation (35 [18.4%] vs. 19 [10.1%]), and nausea (18 [9.5%] vs. 8 [4.3%]). Twenty FC-treated (10.5%) and 21 placebo-treated patients (11.2%) experienced a serious AE. Two patients (1.1%) died in each group. A pooled efficacy assessment demonstrated a consistent hemoglobin rise and modest serum phosphate decline, with few excursions below the normal range. When used for treatment of patients with NDD-CKD, FC contributes to gastrointestinal AEs at higher rates than placebo, while simultaneously correcting two of the principal metabolic manifestations of CKD (iron deficiency anemia and relative hyperphosphatemia).

Also flagged:Chl1DNA helicaseScc2chromosomesisterDNA polymerase processivity factor
Journal Article 2017-11-29 ✓ 1 Snippet Shen D, Skibbens RV.
In-Text Gene Mentions

Condensinsubunit Smc2 was…

Show Full Abstract

Chl1 DNA helicase promotes sister chromatid cohesion and associates with both the cohesion establishment acetyltransferase Eco1/Ctf7 and the DNA polymerase processivity factor PCNA that supports Eco1/Ctf7 function. Mutation in CHL1 results in precocious sister chromatid separation and cell aneuploidy, defects that arise through reduced levels of chromatin-bound cohesins which normally tether together sister chromatids (trans tethering). Mutation of Chl1 family members (BACH1/BRIP/FANCJ and DDX11/ChlR1) also exhibit genotoxic sensitivities, consistent with a role for Chl1 in trans tethering which is required for efficient DNA repair. Chl1 promotes the recruitment of Scc2 to DNA which is required for cohesin deposition onto DNA. There is limited evidence, however, that Scc2 also directs the deposition onto DNA of condensins which promote tethering in cis (intramolecular DNA links). Here, we test the ability of Chl1 to promote cis tethering and the role of both Chl1 and Scc2 to promote condensin recruitment to DNA. The results reveal that chl1 mutant cells exhibit significant condensation defects both within the rDNA locus and genome-wide. Importantly, chl1 mutant cell condensation defects do not result from reduced chromatin binding of condensin, but instead through reduced chromatin binding of cohesin. We tested scc2-4 mutant cells and similarly found no evidence of reduced condensin recruitment to chromatin. Consistent with a role for Scc2 specifically in cohesin deposition, scc2-4 mutant cell condensation defects are irreversible. We thus term Chl1 a novel regulator of both chromatin condensation and sister chromatid cohesion through cohesin-based mechanisms. These results reveal an exciting interface between DNA structure and the highly conserved cohesin complex.

Also flagged:secsynthesisacetic acidhypocretin-1HcrtLipid
Journal Article 2017-11-29 ✓ 2 Snippets Toyoda H, Honda Y, Tanaka S, Miyagawa T, Honda M, Honda K, Tokunaga K, Kodama T.
In-Text Gene Mentions

Besides the HLA locus, several additional narcolepsy susceptibility loci were identified by genome-wide association studies [12–18], which suggest that immune-regulating genes (TCRA, P2RY11, TNFSF4, CTSH, TCRB, ZNF365, IL10RB-IFNAR1, and CCR1/CCR3) and a fatty acid metabolism-related gene (CPT1B/CHKB) are involved in the development of narcolepsy.

…, P2RY11 ,TNFSF4, CTSH ,…

Show Full Abstract

Narcolepsy is caused by the loss of hypocretin (Hcrt) neurons and is associated with multiple genetic and environmental factors. Although abnormalities in immunity are suggested to be involved in the etiology of narcolepsy, no decisive mechanism has been established. We previously reported chemokine (C-C motif) receptor 3 (CCR3) as a novel susceptibility gene for narcolepsy. To understand the role of CCR3 in the development of narcolepsy, we investigated sleep-wake patterns of Ccr3 knockout (KO) mice. Ccr3 KO mice exhibited fragmented sleep patterns in the light phase, whereas the overall sleep structure in the dark phase did not differ between Ccr3 KO mice and wild-type (WT) littermates. Intraperitoneal injection of lipopolysaccharide (LPS) promoted wakefulness and suppressed both REM and NREM sleep in the light phase in both Ccr3 KO and WT mice. Conversely, LPS suppressed wakefulness and promoted NREM sleep in the dark phase in both genotypes. After LPS administration, the proportion of time spent in wakefulness was higher, and the proportion of time spent in NREM sleep was lower in Ccr3 KO compared to WT mice only in the light phase. LPS-induced changes in sleep patterns were larger in Ccr3 KO compared to WT mice. Furthermore, we quantified the number of Hcrt neurons and found that Ccr3 KO mice had fewer Hcrt neurons in the lateral hypothalamus compared to WT mice. We found abnormalities in sleep patterns in the resting phase and in the number of Hcrt neurons in Ccr3 KO mice. These observations suggest a role for CCR3 in sleep-wake regulation in narcolepsy patients.

Also flagged:microtubule-associated protein TauMAPTTaulocalizationsmicrotubuleAD
Journal Article 2017-11-29 No Snippets Sotiropoulos I, Galas MC, Silva JM, Skoulakis E, Wegmann S, Maina MB, Blum D, Sayas CL, Mandelkow EM, Mandelkow E, Spillantini MG, Sousa N, Avila J, Medina M, Mudher A, Buee L.
Show Full Abstract

Since the discovery of the microtubule-associated protein Tau (MAPT) over 40 years ago, most studies have focused on Tau's role in microtubule stability and regulation, as well as on the neuropathological consequences of Tau hyperphosphorylation and aggregation in Alzheimer's disease (AD) brains. In recent years, however, research efforts identified new interaction partners and different sub-cellular localizations for Tau suggesting additional roles beyond its standard function as microtubule regulating protein. Moreover, despite the increasing research focus on AD over the last decades, Tau was only recently considered as a promising therapeutic target for the treatment and prevention of AD as well as for neurological pathologies beyond AD e.g. epilepsy, excitotoxicity, and environmental stress. This review will focus on atypical, non-standard roles of Tau on neuronal function and dysfunction in AD and other neurological pathologies providing novel insights about neuroplastic and neuropathological implications of Tau in both the central and the peripheral nervous system.

Also flagged:colon adenocarcinomaepithelial cancersGalNAc-Tscolon cancercolon adenocarcinomascancer
Journal Article 2017-11-29 ✓ 1 Snippet Lavrsen K, Dabelsteen S, Vakhrushev SY, Levann AMR, Haue AD, Dylander A, Mandel U, Hansen L, Frödin M, Bennett EP, Wandall HH.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Aberrant expression of <i>O</i>-glycans is a hallmark of epithelial cancers. Mucin-type <i>O-</i>glycosylation is initiated by a large family of UDP-GalNAc:polypeptide <i>N</i>-acetylgalactosaminyltransferases (GalNAc-Ts) that target different proteins and are differentially expressed in cells and organs. Here, we investigated the expression patterns of all of the GalNAc-Ts in colon cancer by analyzing transcriptomic data. We found that GalNAc-T6 was highly up-regulated in colon adenocarcinomas but absent in normal-appearing adjacent colon tissue. These results were verified by immunohistochemistry, suggesting that GalNAc-T6 plays a role in colon carcinogenesis. To investigate the function of GalNAc-T6 in colon cancer, we used precise gene targeting to produce isogenic colon cancer cell lines with a knockout/rescue system for <i>GALNT6</i> GalNAc-T6 expression was associated with a cancer-like, dysplastic growth pattern, whereas <i>GALNT6</i> knockout cells showed a more normal differentiation pattern, reduced proliferation, normalized cell-cell adhesion, and formation of crypts in tissue cultures. <i>O-</i>Glycoproteomic analysis of the engineered cell lines identified a small set of GalNAc-T6-specific targets, suggesting that this isoform has unique cellular functions. In support of this notion, the genetically and functionally closely related GalNAc-T3 homolog did not show compensatory functionality for effects observed for GalNAc-T6. Taken together, these data strongly suggest that aberrant GalNAc-T6 expression and site-specific glycosylation is involved in oncogenic transformation.

Also flagged:emphysemaalpha1-antitrypsin deficiencyAATDgene expressionCOPDcytokine
Journal Article 2017-11-29 ✓ 1 Snippet Esquinas C, Janciauskiene S, Gonzalo R, Mas de Xaxars G, Olejnicka B, Belmonte I, Barrecheguren M, Rodriguez E, Nuñez A, Rodriguez-Frias F, Miravitlles M.
In-Text Gene Mentions

…>1) included HLA-DRB5,OLFM4, HBEGF, LFT, MMP8,…

Show Full Abstract

<h4>Introduction</h4>COPD has complex etiologies involving both genetic and environmental determinants. Among genetic determinants, the most recognized is a severe PiZZ (Glu342Lys) inherited alpha1-antitrypsin deficiency (AATD). Nonetheless, AATD patients present a heterogeneous clinical evolution, which has not been completely explained by sociodemographic or clinical factors. Here we performed the gene expression profiling of blood cells collected from mild and severe COPD patients with PiZZ AATD. Our aim was to identify differences in messenger RNA (mRNA) and microRNA (miRNA) expressions that may be associated with disease severity.<h4>Materials and methods</h4>Peripheral blood mononuclear cells from 12 COPD patients with PiZZ AATD (6 with severe disease and 6 with mild disease) were used in this pilot, high-throughput microarray study. We compared the cellular expression levels of RNA and miRNA of the 2 groups, and performed functional and enrichment analyses using the Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene-ontology (GO) terms. We also integrated the miRNA and the differentially expressed putative target mRNA. For data analyses, we used the R statistical language R Studio (version 3.2.5).<h4>Results</h4>The severe and mild COPD-AATD groups were similar in terms of age, gender, exacerbations, comorbidities, and use of augmentation therapy. In severe COPD-AATD patients, we found 205 differentially expressed genes (DEGs) (114 upregulated and 91 downregulated) and 28 miRNA (20 upregulated and 8 downregulated) compared to patients with mild COPD-AATD disease. Of these, hsa-miR-335-5p was downregulated and 12 target genes were involved in cytokine signaling, MAPK/mk2, JNK signaling cascades, and angiogenesis were much more highly expressed in severe compared with mild patients.<h4>Conclusions</h4>Despite the small sample size, we identified downregulated miRNA (hsa-miR-335) and the activation of pathways related to inflammation and angiogenesis on comparing patients with severe vs mild COPD-AATD. Nonetheless, our findings warrant further validation in large studies.

Also flagged:AminoglucosecancertumorsGlucose transporter-1GLUT-1glutathione
Journal Article 2017-11-28 No Snippets Zhou Y, Wen H, Gu L, Fu J, Guo J, Du L, Zhou X, Yu X, Huang Y, Wang H.
Show Full Abstract

<h4>Background</h4>Chemotherapeutic drugs used for cancer therapy frequently encounter multiple-drug resistance (MDR). Nanoscale carriers that can target tumors to accumulate and release drugs intracellularly have the greatest potential for overcoming MDR. Glucose transporter-1 (GLUT-1) and glutathione (GSH) overexpression in cancer cells was exploited to assemble aminoglucose (AG)-conjugated, redox-responsive nanomicelles from a single disulfide bond-bridged block polymer of polyethylene glycol and polylactic acid (AG-PEG-SS-PLA). However, whether this dual functional vector can overcome MDR in lung cancer is unknown.<h4>Results</h4>In this experiment, AG-PEG-SS-PLA was synthetized successfully, and paclitaxel (PTX)-loaded AG-PEG-SS-PLA (AG-PEG-SS-PLA/PTX) nanomicelles exhibited excellent physical properties. These nanomicelles show enhanced tumor targeting as well as drug accumulation and retention in MDR cancer cells. Caveolin-dependent endocytosis is mainly responsible for nanomicelle internalization. After internalization, the disulfide bond of AG-PEG-SS-PLA is cleaved in the presence of high intracellular glutathione levels, causing the hydrophobic core to become a polar aqueous solution, which subsequently results in nanomicelle disassembly and the rapid release of encapsulated PTX. Reduced drug resistance was observed in cancer cells in vitro. The caspase-9 and caspase-3 cascade was activated by the AG-PEG-SS-PLA/PTX nanomicelles through upregulation of the pro-apoptotic proteins Bax and Bid and suppression of the anti-apoptotic protein Bcl-2, thereby increasing apoptosis. Furthermore, significantly enhanced tumor growth inhibition was observed in nude mice bearing A549/ADR xenograft tumors after the administration of AG-PEG-SS-PLA/PTX nanomicelles via tail injection.<h4>Conclusions</h4>These promising results indicate that AG-PEG-SS-PLA/PTX nanomicelles could provide the foundation for a paradigm shift in MDR cancer therapy.

Also flagged:chronic disorderautismschizophreniaobsessive-compulsive disorderneurodevelopmental disordersNRXN1
Journal Article 2017-11-28 No Snippets Grünblatt E, Oneda B, Ekici AB, Ball J, Geissler J, Uebe S, Romanos M, Rauch A, Walitza S.
Show Full Abstract

<h4>Background</h4>Obsessive-Compulsive Disorder (OCD) is a common and chronic disorder in which a person has uncontrollable, reoccurring thoughts and behaviours. It is a complex genetic condition and, in case of early onset (EO), the patients manifest a more severe phenotype, and an increased heritability. Large (>500 kb) copy number variations (CNVs) previously associated with autism and schizophrenia have been reported in OCD. Recently, rare CNVs smaller than 500 kb overlapping risk loci for other neurodevelopmental conditions have also been reported in OCD, stressing the importance of examining CNVs of any size range. The aim of this study was to further investigate the role of rare and small CNVs in the aetiology of EO-OCD.<h4>Methods</h4>We performed high-resolution chromosomal microarray analysis in 121 paediatric OCD patients and in 124 random controls to identify rare CNVs (>50 kb) which might contribute to EO-OCD.<h4>Results</h4>The frequencies and the size of the observed rare CNVs in the patients did not differ from the controls. However, we observed a significantly higher frequency of rare CNVs affecting brain related genes, especially deletions, in the patients (OR = 1.98, 95% CI 1.02-3.84; OR = 3.61, 95% CI 1.14-11.41, respectively). Similarly, enrichment-analysis of CNVs gene content, performed with three independent methods, confirmed significant clustering of predefined genes involved in synaptic/brain related functional pathways in the patients but not in the controls. In two patients we detected de-novo CNVs encompassing genes previously associated with different neurodevelopmental disorders (NRXN1, ANKS1B, UHRF1BP1).<h4>Conclusions</h4>Our results further strengthen the role of small rare CNVs, particularly deletions, as susceptibility factors for paediatric OCD.

Also flagged:histonetopo IIH2Bhistoneschromatincore histones
Journal Article 2017-11-28 ✓ 1 Snippet Erives AJ.
In-Text Gene Mentions

…Genes forlinker histoneshistones (H1/H5) have…

Show Full Abstract

<h4>Background</h4>While the genomes of eukaryotes and Archaea both encode the histone-fold domain, only eukaryotes encode the core histone paralogs H2A, H2B, H3, and H4. With DNA, these core histones assemble into the nucleosomal octamer underlying eukaryotic chromatin. Importantly, core histones for H2A and H3 are maintained as neofunctionalized paralogs adapted for general bulk chromatin (canonical H2 and H3) or specialized chromatin (H2A.Z enriched at gene promoters and cenH3s enriched at centromeres). In this context, the identification of core histone-like "doublets" in the cytoplasmic replication factories of the Marseilleviridae (MV) is a novel finding with possible relevance to understanding the origin of eukaryotic chromatin. Here, we analyze and compare the core histone doublet genes from all known MV genomes as well as other MV genes relevant to the origin of the eukaryotic replisome.<h4>Results</h4>Using different phylogenetic approaches, we show that MV histone domains encode obligate H2B-H2A and H4-H3 dimers of possible proto-eukaryotic origin. MV core histone moieties form sister clades to each of the four eukaryotic clades of canonical and variant core histones. This suggests that MV core histone moieties diverged prior to eukaryotic neofunctionalizations associated with paired linear chromosomes and variant histone octamer assembly. We also show that MV genomes encode a proto-eukaryotic DNA topoisomerase II enzyme that forms a sister clade to eukaryotes. This is a relevant finding given that DNA topo II influences histone deposition and chromatin compaction and is the second most abundant nuclear protein after histones.<h4>Conclusions</h4>The combined domain architecture and phylogenomic analyses presented here suggest that a primitive origin for MV histone genes is a more parsimonious explanation than horizontal gene transfers + gene fusions + sufficient divergence to eliminate relatedness to eukaryotic neofunctionalizations within the H2A and H3 clades without loss of relatedness to each of the four core histone clades. We thus suggest MV histone doublet genes and their DNA topo II gene possibly were acquired from an organism with a chromatinized replisome that diverged prior to the origin of eukaryotic core histone variants for H2/H2A.Z and H3/cenH3. These results also imply that core histones were utilized ancestrally in viral DNA compaction and/or protection from host endonucleases.

Also flagged:CHARGE syndromeembryogenesiscell migrationcraniofacial disordersCHD7genetic disorder
Journal Article 2017-11-28 ✓ 5 Snippets Okuno H, Renault Mihara F, Ohta S, Fukuda K, Kurosawa K, Akamatsu W, Sanosaka T, Kohyama J, Hayashi K, Nakajima K, Takahashi T, Wysocka J, Kosaki K, Okano H.
In-Text Gene Mentions

POU3F2F: CGGCGGATCAAACTGGGATTT…

POU3F2R: TTGCGCTGCGATCTTGTCTAT…

…hPOU3F2distal enhancer F:…

…hPOU3F2distal enhancer R:…

…four selected genes,POU3F2, OLFM3 ,…

Show Full Abstract

CHARGE syndrome is caused by heterozygous mutations in the chromatin remodeler, <i>CHD7,</i> and is characterized by a set of malformations that, on clinical grounds, were historically postulated to arise from defects in neural crest formation during embryogenesis. To better delineate neural crest defects in CHARGE syndrome, we generated induced pluripotent stem cells (iPSCs) from two patients with typical syndrome manifestations, and characterized neural crest cells differentiated in vitro from these iPSCs (iPSC-NCCs). We found that expression of genes associated with cell migration was altered in CHARGE iPSC-NCCs compared to control iPSC-NCCs. Consistently, CHARGE iPSC-NCCs showed defective delamination, migration and motility in vitro, and their transplantation <i>in ovo</i> revealed overall defective migratory activity in the chick embryo. These results support the historical inference that CHARGE syndrome patients exhibit defects in neural crest migration, and provide the first successful application of patient-derived iPSCs in modeling craniofacial disorders.

Also flagged:glutamatedopamineschizophrenianucleotidesnucleotideglutamate receptor
Journal Article 2017-11-28 No Snippets Castellani CA, Melka MG, Gui JL, Gallo AJ, O'Reilly RL, Singh SM.
Show Full Abstract

<h4>Background</h4>Monozygotic twins are valuable in assessing the genetic vs environmental contribution to diseases. In the era of complete genome sequences, they allow identification of mutational mechanisms and specific genes and pathways that offer predisposition to the development of complex diseases including schizophrenia.<h4>Methods</h4>We sequenced the complete genomes of two pairs of monozygotic twins discordant for schizophrenia (MZD), including one representing a family tetrad. The family specific complete sequences have allowed identification of post zygotic mutations between MZD genomes. It allows identification of affected genes including relevant network and pathways that may account for the diseased state in pair specific patient.<h4>Results</h4>We found multiple twin specific sequence differences between co-twins that included small nucleotides [single nucleotide variants (SNV), small indels and block substitutions], copy number variations (CNVs) and structural variations. The genes affected by these changes belonged to a number of canonical pathways, the most prominent ones are implicated in schizophrenia and related disorders. Although these changes were found in both twins, they were more frequent in the affected twin in both pairs. Two specific pathway defects, glutamate receptor signaling and dopamine feedback in cAMP signaling pathways, were uniquely affected in the two patients representing two unrelated families.<h4>Conclusions</h4>We have identified genome-wide post zygotic mutations in two MZD pairs affected with schizophrenia. It has allowed us to use the threshold model and propose the most likely cause of this disease in the two patients studied. The results support the proposition that each schizophrenia patient may be unique and heterogeneous somatic de novo events may contribute to schizophrenia threshold and discordance of the disease in monozygotic twins.

Also flagged:blindnessadvanced nuclear sclerosisnuclear sclerosisRNF149cataractage
Journal Article 2017-11-28 No Snippets Loomis SJ, Klein AP, Lee KE, Chen F, Bomotti S, Truitt B, Iyengar SK, Klein R, Klein BEK, Duggal P.
Show Full Abstract

<h4>Purpose</h4>Nuclear cataract is the most common subtype of age-related cataract, the leading cause of blindness worldwide. It results from advanced nuclear sclerosis, or opacity in the center of the optic lens, and is affected by both genetic and environmental risk factors, including smoking. We sought to understand the genetic factors associated with nuclear sclerosis through interrogation of rare and low frequency coding variants using exome array data.<h4>Methods</h4>We analyzed Illumina Human Exome Array data for 1,488 participants of European ancestry in the Beaver Dam Eye Study who were without cataract surgery for association with nuclear sclerosis grade, controlling for age and sex. We performed single-variant regression analysis for 32,138 variants with minor allele frequency (MAF) ≥0.003. In addition, gene-based analysis of 11,844 genes containing at least two variants with MAF < 0.05 was performed using a gene-based unified burden and non-burden sequence kernel association test (SKAT-O). Additionally, both single-variant and gene-based analyses were analyzed stratified by smoking status.<h4>Results</h4>No single-variant test was statistically significant after Bonferroni correction (p < 1.6 × 10<sup>-6</sup>; top single nucleotide polymorphism (SNP): rs144458991, p = 2.83 × 10<sup>-5</sup>). Gene-based tests were suggestively associated with the gene RNF149 overall (p = 8.29 × 10<sup>-6</sup>) and among never smokers (N = 790, p = 2.67 × 10<sup>-6</sup>).<h4>Conclusions</h4>This study did not find a significant genetic association with nuclear sclerosis, the possible association with the RNF149 gene highlights a potential candidate gene for future studies that aim to understand the genetic architecture of nuclear sclerosis.

Also flagged:CircularRNA binding proteinstranscriptional regulatorsexonucleaseendosomesgene expression
Journal Article 2017-11-28 No Snippets Haque S, Harries LW.
Show Full Abstract

Splicing events do not always produce a linear transcript. Circular RNAs (circRNAs) are a class of RNA that are emerging as key new members of the gene regulatory milieu, which are produced by back-splicing events within genes. In circRNA formation, rather than being spliced in a linear fashion, exons can be circularised by use of the 3' acceptor splice site of an upstream exon, leading to the formation of a circular RNA species. circRNAs have been demonstrated across species and have the potential to present genetic information in new orientations distinct from their parent transcript. The importance of these RNA players in gene regulation and normal cellular homeostasis is now beginning to be recognised. They have several potential modes of action, from serving as sponges for micro RNAs and RNA binding proteins, to acting as transcriptional regulators. In accordance with an important role in the normal biology of the cell, perturbations of circRNA expression are now being reported in association with disease. Furthermore, the inherent stability of circRNAs conferred by their circular structure and exonuclease resistance, and their expression in blood and other peripheral tissues in association with endosomes and microvesicles, renders them excellent candidates as disease biomarkers. In this review, we explore the state of knowledge on this exciting class of transcripts in regulating gene expression and discuss their emerging role in health and disease.

Also flagged:Caffeic acidgxuTelOH-3Ferulic acidCH2
Journal Article 2017-11-28 ✓ 2 Snippets Luo X, Du C, Cheng H, Chen JH, Lin C.
In-Text Gene Mentions

…with anticoagulant, includingantithrombin-IIIand plasminogen.…

…(2J4I), fibrinogen (3GHG),antithrombin-III(2ANT), plasminogen (1QRZ),…

Show Full Abstract

In this study, three type II phenolic acids (caffeic acid, <i>p</i>-hydroxycinnamic acid, and ferulic acid) were used to synthesize a total of 18 phenolic acid derivatives. With molecular docking for molecule design and target protein (factors) screening, in combination with the confirmation of target proteins (factors) by surface plasmon resonance, and the evaluation of haemostatic and anticoagulant activities with five blood assays (plasma recalcification time, prothrombin time, activated partial thromboplastin time, fibrinogen, and thrombin time), the data indicated that caffeic acid derivatives showed certain anticoagulant or procoagulant activities and that two other series contained compounds with the best anticoagulant activities. Using Materials Studio analysis, particular functional groups that affect anticoagulant or procoagulant activities were revealed, and these conclusions can guide the discovery of compounds with better activities.

Also flagged:CD34antibodiesquartzantibodybiotinsignal transduction
Journal Article 2017-11-28 No Snippets Maglio O, Costanzo S, Cercola R, Zambrano G, Mauro M, Battaglia R, Ferrini G, Nastri F, Pavone V, Lombardi A.
Show Full Abstract

A cost-effective immunosensor for the detection and isolation of dental pulp stem cells (DPSCs) based on a quartz crystal microbalance (QCM) has been developed. The recognition mechanism relies on anti-CD34 antibodies, DPSC-specific monoclonal antibodies that are anchored on the surface of the quartz crystals. Due to its high specificity, real time detection, and low cost, the proposed technology has a promising potential in the field of cell biology, for the simultaneous detection and sorting of stem cells from heterogeneous cell samples. The QCM surface was properly tailored through a biotinylated self-assembled monolayer (SAM). The biotin-avidin interaction was used to immobilize the biotinylated anti-CD34 antibody on the gold-coated quartz crystal. After antibody immobilization, a cellular pellet, with a mixed cell population, was analyzed; the results indicated that the developed QCM immunosensor is highly specific, being able to detect and sort only CD34+ cells. Our study suggests that the proposed technology can detect and efficiently sort any kind of cell from samples with high complexity, being simple, selective, and providing for more convenient and time-saving operations.

Also flagged:Heat shock proteins HSPB8DNAJC5BHepatitis Cheat shock proteinsHSPschaperones
Journal Article 2017-11-28 No Snippets Braga ACS, Carneiro BM, Batista MN, Akinaga MM, Bittar C, Rahal P.
Show Full Abstract

Hepatitis C is a disease caused by the hepatitis C virus (HCV), and an estimated 3% of the world population is infected with the virus. During replication, HCV interacts with several cellular proteins. Studies have shown that several heat shock proteins (HSPs) have an altered expression profile in the presence of the virus, and some HSPs interact directly with HCV proteins. In the present study, we evaluated the expression levels of heat shock proteins in vitro in the presence and absence of HCV. The differential expression of 84 HSPs and chaperones was observed using a qPCR array, comparing HCV uninfected and infected Huh7.5 cells. To validate qPCR array, the differentially expressed genes were tested by real-time PCR in three different HCV models: subgenomic HCV replicon cells (SGR-JFH-1), JFH-1 infected cells (both genotype 2a) and subgenomic S52 cells (genotype 3). The HSPB8 gene showed increased expression in all three viral models. We silenced HSPB8 expression and observed an increase in viral replication. In contrast, when we increased the expression of HSPB8, a decrease in the HCV replication rate was observed. The same procedure was adopted for DNAJC5B, and HCV showed a similar replication pattern as that observed for HSPB8. These results suggest that HSPB8 may act as an intracellular factor against hepatitis C virus replication and that DNAJC5B has the same function, with more relevant results for genotype 3. We also evaluated the direct interactions between HCV and HSP proteins, and the IP experiments showed that the HCV NS4B protein interacts with HSPB8. These results contribute to a better understanding of the mechanisms involved in HCV replication.

Also flagged:chromatininseminationextracellularextracellular regioncalciumbinding
Journal Article 2017-11-28 ✓ 1 Snippet van Son M, Tremoen NH, Gaustad AH, Myromslien FD, Våge DI, Stenseth EB, Zeremichael TT, Grindflek E.
In-Text Gene Mentions

…members PRDX1 andPRDX6have been associated…

Show Full Abstract

<h4>Background</h4>Sperm DNA is protected against fragmentation by a high degree of chromatin packaging. It has been demonstrated that proper chromatin packaging is important for boar fertility outcome. However, little is known about the molecular mechanisms underlying differences in sperm DNA fragmentation. Knowledge of sequence variation influencing this sperm parameter could be beneficial in selecting the best artificial insemination (AI) boars for commercial production. The aim of this study was to identify genes differentially expressed in testis tissue of Norwegian Landrace and Duroc boars, with high and low sperm DNA fragmentation index (DFI), using transcriptome sequencing.<h4>Results</h4>Altogether, 308 and 374 genes were found to display significant differences in expression level between high and low DFI in Landrace and Duroc boars, respectively. Of these genes, 71 were differentially expressed in both breeds. Gene ontology analysis revealed that significant terms in common for the two breeds included extracellular matrix, extracellular region and calcium ion binding. Moreover, different metabolic processes were enriched in Landrace and Duroc, whereas immune response terms were common in Landrace only. Variant detection identified putative polymorphisms in some of the differentially expressed genes. Validation showed that predicted high impact variants in RAMP2, GIMAP6 and three uncharacterized genes are particularly interesting for sperm DNA fragmentation in boars.<h4>Conclusions</h4>We identified differentially expressed genes between groups of boars with high and low sperm DFI, and functional annotation of these genes point towards important biochemical pathways. Moreover, variant detection identified putative polymorphisms in the differentially expressed genes. Our results provide valuable insights into the molecular network underlying DFI in pigs.

Also flagged:PPARαlipidmetabolismphosphorylationextracellularlipid transporters
Journal Article 2017-11-28 No Snippets Pearsall EA, Cheng R, Zhou K, Takahashi Y, Matlock HG, Vadvalkar SS, Shin Y, Fredrick TW, Gantner ML, Meng S, Fu Z, Gong Y, Kinter M, Humphries KM, Szweda LI, Smith LEH, Ma JX.
Show Full Abstract

<h4>Background</h4>Peroxisome proliferator activated receptor-alpha (PPARα) is a ubiquitously expressed nuclear receptor. The role of endogenous PPARα in retinal neuronal homeostasis is unknown. Retinal photoreceptors are the highest energy-consuming cells in the body, requiring abundant energy substrates. PPARα is a known regulator of lipid metabolism, and we hypothesized that it may regulate lipid use for oxidative phosphorylation in energetically demanding retinal neurons.<h4>Results</h4>We found that endogenous PPARα is essential for the maintenance and survival of retinal neurons, with Pparα <sup>-/-</sup> mice developing retinal degeneration first detected at 8 weeks of age. Using extracellular flux analysis, we identified that PPARα mediates retinal utilization of lipids as an energy substrate, and that ablation of PPARα ultimately results in retinal bioenergetic deficiency and neurodegeneration. This may be due to PPARα regulation of lipid transporters, which facilitate the internalization of fatty acids into cell membranes and mitochondria for oxidation and ATP production.<h4>Conclusion</h4>We identify an endogenous role for PPARα in retinal neuronal survival and lipid metabolism, and furthermore underscore the importance of fatty acid oxidation in photoreceptor survival. We also suggest PPARα as a putative therapeutic target for age-related macular degeneration, which may be due in part to decreased mitochondrial efficiency and subsequent energetic deficits.

Also flagged:localised prostate cancerprostate cancerCaPcancerlung cancerprostate specific antigen
Journal Article 2017-11-28 No Snippets Evans SM, Millar JL, Moore CM, Lewis JD, Huland H, Sampurno F, Connor SE, Villanti P, Litwin MS.
Show Full Abstract

<h4>Purpose</h4>Globally, prostate cancer treatment and outcomes for men vary according to where they live, their race and the care they receive. The TrueNTH Global Registry project was established as an international registry monitoring care provided to men with localised prostate cancer (CaP).<h4>Participants</h4>Sites with existing CaP databases in Movember fundraising countries were invited to participate in the international registry. In total, 25 Local Data Centres (LDCs) representing 113 participating sites across 13 countries have nominated to contribute to the project. It will collect a dataset based on the International Consortium for Health Outcome Measures (ICHOM) standardised dataset for localised CaP.<h4>Findings to date</h4>A governance strategy has been developed to oversee registry operation, including transmission of reversibly anonymised data. LDCs are represented on the Project Steering Committee, reporting to an Executive Committee. A Project Coordination Centre and Data Coordination Centre (DCC) have been established. A project was undertaken to compare existing datasets, understand capacity at project commencement (baseline) to collect the ICHOM dataset and assist in determining the final data dictionary. 21/25 LDCs provided data dictionaries for review. Some ICHOM data fields were well collected (diagnosis, treatment start dates) and others poorly collected (complications, comorbidities). 17/94 (18%) ICHOM data fields were relegated to non-mandatory fields due to poor capture by most existing registries. Participating sites will transmit data through a web interface biannually to the DCC.<h4>Future plans</h4>Recruitment to the TrueNTH Global Registry-PCOR project will commence in late 2017 with sites progressively contributing reversibly anonymised data following ethical review in local regions. Researchers will have capacity to source deidentified data after the establishment phase. Quality indicators are to be established through a modified Delphi approach in later 2017, and it is anticipated that reports on performance against quality indicators will be provided to LDCs.

Also flagged:serotonin transporterposttraumatic stress disorderPTSDanxiety disordermental disordersabuse
Journal Article 2017-11-28 ✓ 4 Snippets Zhao M, Yang J, Wang W, Ma J, Zhang J, Zhao X, Qiu X, Yang X, Qiao Z, Song X, Wang L, Jiang S, Zhao E, Yang Y.
In-Text Gene Mentions

…trptamine, 5-HT) transporter (5-HTT) gene ( SLC6A4…

…variations in the5-HTTgene affect behavioral…

…Specifically,5-HTTknockout mice showed…

…have shown that5-HTTgene variants are…

Show Full Abstract

Exposure to stress predicts the occurrence of posttraumatic stress disorder (PTSD) in individuals harboring the serotonin transporter promoter variant 5-HTTLPR. We carried out a meta-analysis of studies investigating the interaction between 5-HTTLPR, stress, and PTSD to clarify the interrelatedness of these factors. We reviewed all relevant studies published in English before May 2016. The Lipták-Stouffer z-score method for meta-analysis was applied to combined data. The z score was separately calculated for the stressful life events, childhood adversity, bi- and triallelic loci, and cross-sectional and longitudinal studies subgroups. A total of 14 studies with 15,883 subjects met our inclusion criteria. We found strong evidence that the presence of 5-HTTLPR influenced the relationship between stress and PTSD (P = 0.00003), with the strongest effects observed in the cross-sectional and longitudinal groups (P = 0.01 and 2.0 × 10<sup>-6</sup>, respectively). Stressful life events and childhood adversity separately interacted with 5-HTTLPR in PTSD (P = 2.0 × 10<sup>-8</sup> and 0.003, respectively). When the studies were stratified by locus classification, the evidence was stronger for the triallelic (P = 4.0 × 10<sup>-8</sup>) than for the biallelic (P = 0.054) locus subgroup. There was strong evidence that 5-HTTLPR influences the relationship between stress and PTSD.

Also flagged:CNNM2bcpNucleusCervix_UteriSNP2SNP1
Journal Article 2017-11-28 ✓ 2 Snippets Watanabe K, Taskesen E, van Bochoven A, Posthuma D.
In-Text Gene Mentions

NEGR1

…BMI such asNEGR1, TOMM40 ,…

Show Full Abstract

A main challenge in genome-wide association studies (GWAS) is to pinpoint possible causal variants. Results from GWAS typically do not directly translate into causal variants because the majority of hits are in non-coding or intergenic regions, and the presence of linkage disequilibrium leads to effects being statistically spread out across multiple variants. Post-GWAS annotation facilitates the selection of most likely causal variant(s). Multiple resources are available for post-GWAS annotation, yet these can be time consuming and do not provide integrated visual aids for data interpretation. We, therefore, develop FUMA: an integrative web-based platform using information from multiple biological resources to facilitate functional annotation of GWAS results, gene prioritization and interactive visualization. FUMA accommodates positional, expression quantitative trait loci (eQTL) and chromatin interaction mappings, and provides gene-based, pathway and tissue enrichment results. FUMA results directly aid in generating hypotheses that are testable in functional experiments aimed at proving causal relations.

Also flagged:Ecto-ADP-ribosyltransferaseecto-ADP-ribosyltransferasesADP-ribosylationcell surface proteinsextracellulartranslational
Journal Article 2017-11-28 No Snippets Rissiek B, Menzel S, Leutert M, Cordes M, Behr S, Jank L, Ludewig P, Gelderblom M, Rissiek A, Adriouch S, Haag F, Hottiger MO, Koch-Nolte F, Magnus T.
Show Full Abstract

Mammalian ecto-ADP-ribosyltransferases (ecto-ARTs or also ARTCs) catalyze the ADP-ribosylation of cell surface proteins using extracellular nicotinamide adenine dinucleotide (NAD<sup>+</sup>) as substrate. By this post-translational protein modification, ecto-ARTs modulate the function of various target proteins. A functional role of ARTC2 has been demonstrated for peripheral immune cells such as T cells and macrophages. Yet, little is known about the role of ecto-ARTs in the central nervous system and on microglia. Here, we identified ARTC2.1 as the major ecto-ART expressed on murine microglia. ARTC2.1 expression was strongly upregulated on microglia upon co-stimulation with LPS and an ERK1/2 inhibitor or upon IFNβ stimulation. We identified several target proteins modified by ARTC2.1 on microglia with a recently developed mass spectrometry approach, including two receptors for immunoglobulin G (IgG), FcγR1 and FcγR2B. Both proteins were verified as targets of ARTC2.1 in vitro using a radiolabeling assay with <sup>32</sup>P-NAD<sup>+</sup> as substrate. Moreover, ADP-ribosylation of both targets strongly inhibited their capacity to bind IgG. In concordance, ARTC2.1 induction in WT microglia and subsequent cell surface ADP-ribosylation significantly reduced the phagocytosis of IgG-coated latex beads, which was unimpaired in NAD<sup>+</sup>/DTT treated microglia from ARTC2.1<sup>-/-</sup> mice. Hence, induction of ARTC2.1 expression under inflammatory conditions, and subsequent ADP-ribosylation of cell surface target proteins could represent a hitherto unnoticed mechanism to regulate the immune response of murine microglia.

Also flagged:luciferaselocomotionmyosin heavy chainsuppressor of fusedSufuhedgehog
Journal Article 2017-11-28 ✓ 3 Snippets Chu W, Zhang F, Song R, Li Y, Wu P, Chen L, Cheng J, Du S, Zhang J.
In-Text Gene Mentions

…(MyoD, MEF2C, HDAC4,Sox6, SETD8, MAPK, ACO2,…

…the transcription factors (Sox6, Purβ and Sp3)/β-MyHC…

…pathway in whichSox6plays a vital…

Show Full Abstract

Fish myotomes are comprised of anatomically segregated fast and slow muscle fibers that possess different metabolic and contractile properties. Although the expression profile properties in fast and slow muscle fibers had been investigated at the mRNA levels, a comprehensive analysis at proteomic and microRNA transcriptomic levels is limited. In the present study, we first systematically compared the proteomic and microRNA transcriptome of the slow and fast muscles of Chinese perch (Siniperca chuatsi). Total of 2102 proteins were identified in muscle tissues. Among them, 99 proteins were differentially up-regulated and 400 were down-regulated in the fast muscle compared with slow muscle. MiRNA microarrays revealed that 199 miRNAs identified in the two types of muscle fibers. Compared with the fast muscle, the 32 miRNAs was up-regulated and 27 down-regulated in the slow muscle. Specifically, expression of miR-103 and miR-144 was negatively correlated with SmyD1a and SmyD1b expression in fast and slow muscles, respectively. The luciferase reporter assay further verified that the miR-103 and miR-144 directly regulated the SmyD1a and SmyD1b expression by targeting their 3'-UTR. The constructed miRNA-SmyD1 interaction network might play an important role in controlling the development and performance of different muscle fiber types in Chinese perch.

Also flagged:SynthesispleuromutilintiamulinValnemulinwatervalnemulin hydrochloride
Journal Article 2017-11-28 No Snippets Dong X, Shu X, Wang Y, Niu Z, Xu S, Zhang Y, Zhao S.
Show Full Abstract

Valnemulin, successfully developed by Sandoz in 1984, is a new generation derivative of pleuromutilin related to tiamulin. Valnemulin has low water-solubility, a short half-life period, low bioavailability, and instability. The application of valnemulin was restricted. Therefore, finding a more moderate delivery system is necessary to improve the shortcomings of valnemulin. The purpose of the study was to improve the strong stability and the irritation caused by of valnemulin hydrochloride power through pegylated-valnemulin prodrug mode. The prepared pegylated-valnemulin prodrug was characterized and evaluated by in vitro release performance under buffer solutions with pH levels of 7.4 and 3.6. The loading rate of valnemulin in PEG-succinic-valnemulin prodrug was determined by ultraviolet spectrophotometer and high performance liquid chromatography (HPLC). HPLC with evaporative light scattering detector was applied to determine the amount of PEG-succinic acid. The loading rate of valnemulin in PEG-succinic-valnemulin prodrug was 6.46%. PEG-succinic-valnemulin prodrug demonstrated a satisfactory solubility of valnemulin with 523 mg·ml<sup>-1</sup> and excellent stability verified by the stability experiment. The result of the in vitro release test showed that the prepared PEG-valnemulin prodrug has controlled release ability and the release rate of valnemulin from PEG-valnemulin prodrug with a pH of 7.4 was 64.98%, which was higher than that of pH3.6 with release rate of 31.90%. Therefore, the prepared PEG-succinic-valnemulin prodrug has great application potential.

Also flagged:neurocognitionepisodic memoryCOMTCNR1AKT1DBH
Journal Article 2017-11-28 ✓ 2 Snippets Cosker E, Schwitzer T, Ramoz N, Ligier F, Lalanne L, Gorwood P, Schwan R, Laprévote V.
In-Text Gene Mentions

The CNR1, AKT1, DBH and 5-HTT/SLC6A4 genes may also modulate effects.<h4>Conclusion</h4>Most of these genes are linked to schizophrenia.

…AKT1, DBH and5-HTT/SLC6A4 genes may also…

Show Full Abstract

<h4>Background</h4>Cannabis is one of the most widely-used drugs in industrialized countries. It is now well established that cannabis use impacts neurocognition. In the intoxication period time episodic memory, working memory and attention are impacted and impulsivity is increased. The long-term effects of cannabis use tend to be similar. Various internal factors, such as sex differences, modulate this impact. It is unclear whether genetic variations can also influence the impact of cannabis on neurocognition. We set out to examine the impact of genetic variations on neurocognition in cannabis users.<h4>Method</h4>We conducted a search via the PubMed, Web of Science, and ScienceDirect databases to identify studies measuring neurocognition and assessing genotypes in the context of cannabis use.<h4>Results</h4>We included 13 articles. We found that working memory, verbal and visual memory and sustained attention are more impacted during intoxication in subjects with the Val COMT allele. COMT gene could also modulate sustained attention in regular use. The CNR1, AKT1, DBH and 5-HTT/SLC6A4 genes may also modulate effects.<h4>Conclusion</h4>Most of these genes are linked to schizophrenia. A fuller understanding of their impact on the effects of cannabis on neurocognition would thus help elucidate the mechanisms linking cannabis and psychosis. However, evidence is still scant, and more research is needed.

Also flagged:fibrinolysisvenous thromboembolismdigestionpeptideanionextracellular vesicle
Journal Article 2017-11-28 ✓ 1 Snippet Stachowicz A, Siudut J, Suski M, Olszanecki R, Korbut R, Undas A, Wiśniewski JR.
In-Text Gene Mentions

…factor XIII a,antithrombin-IIIand fibrinogen gamma…

Show Full Abstract

<h4>Background</h4>It is well known that fibrin network binds a large variety of proteins, including inhibitors and activators of fibrinolysis, which may affect clot properties, such as stability and susceptibility to fibrinolysis. Specific plasma clot composition differs between individuals and may change in disease states. However, the plasma clot proteome has not yet been in-depth analyzed, mainly due to technical difficulty related to the presence of a highly abundant protein-fibrinogen and fibrin that forms a plasma clot.<h4>Methods</h4>The aim of our study was to optimize quantitative proteomic analysis of fibrin clots prepared ex vivo from citrated plasma of the peripheral blood drawn from patients with prior venous thromboembolism (VTE). We used a multiple enzyme digestion filter aided sample preparation, a multienzyme digestion (MED) FASP method combined with LC-MS/MS analysis performed on a Proxeon Easy-nLC System coupled to the Q Exactive HF mass spectrometer. We also evaluated the impact of peptide fractionation with pipet-tip strong anion exchange (SAX) method on the obtained results.<h4>Results</h4>Our proteomic approach revealed 476 proteins repeatedly identified in the plasma fibrin clots from patients with VTE including extracellular vesicle-derived proteins, lipoproteins, fibrinolysis inhibitors, and proteins involved in immune responses. The MED FASP method using three different enzymes: LysC, trypsin and chymotrypsin increased the number of identified peptides and proteins and their sequence coverage as compared to a single step digestion. Peptide fractionation with a pipet-tip strong anion exchange (SAX) protocol increased the depth of proteomic analyses, but also extended the time needed for sample analysis with LC-MS/MS.<h4>Conclusions</h4>The MED FASP method combined with a label-free quantification is an excellent proteomic approach for the analysis of fibrin clots prepared ex vivo from citrated plasma of patients with prior VTE.

Also flagged:methylationendoplasmic reticuluminsulin resistancemetabolic diseasesmetabolic disordersMethyl
Journal Article 2017-11-28 ✓ 1 Snippet Ramos-Lopez O, Riezu-Boj JI, Milagro FI, Martinez JA, MENA Project.
In-Text Gene Mentions

…666486 (EIF2AK1), cg03211481 (DNAJC1), cg18357645 (OS9), cg0580187…

Show Full Abstract

A sustained activation of the unfolded protein response and the subsequent endoplasmic reticulum (ER) stress has been involved in the onset and severity of several metabolic diseases. The aim of this study was to analyze the association of DNA methylation signatures at ER stress genes with adiposity traits and related metabolic disorders. An epigenomic analysis within the Methyl Epigenome Network Association (MENA) project was conducted in an adult population (n=474). DNA methylation status in peripheral white blood cells was analyzed by a microarray approach. KEGG database was used to the characterization and discrimination of genes involved in the "protein processing in endoplasmic reticulum pathway". Anthropometric measurements and plasma metabolic profiles were analyzed. A total of 15 CpG sites at genes participating in ER pathway were strongly correlated with BMI after adjusted linear regression analyses (p<0.0001). These included cg08188400 (MAP2K7), cg20541779 (CASP12), cg24776411 (EIF2AK1), cg14190817 (HSPA5), cg21376454 (ERN1), cg06666486 (EIF2AK1), cg03211481 (DNAJC1), cg18357645 (OS9), cg05801879 (MBTPS1), cg20964082 (ERO1LB), cg17300868 (NFE2L2), cg03384128 (EIF2AK4), cg02712587 (EIF2AK4), cg04972384 (SELS), cg02240686 (EIF2AK2). Noteworthy, most of them were implicated in ER stress (p=2.9E-09). However, only methylation levels at cg20964082 (ERO1LB), cg17300868 (NFE2L2), cg05801879 (MBTPS1), and cg03384128 (EIF2AK4) also correlated with total fat mass. Interestingly, significant associations between methylation patterns at cg20964082 (ERO1LB) and cg17300868 (NFE2L2) and insulin and HOMA-IR index were found, whereas cg05801879 (MBTPS1) and cg03384128 (EIF2AK4) were correlated with triglyceride levels. This study suggests associations of methylation signatures at ER stress genes with adiposity and insulin resistance, as revealed by discriminative pathway analyses.

Also flagged:Neurodegenerative disordersprionHuntingtinHuntington's diseaseneurodegenerative diseasesHD
Journal Article 2017-11-28 No Snippets Masnata M, Cicchetti F.
Show Full Abstract

Neurodegenerative disorders are not only characterized by specific patterns of cell loss but the presence and accumulation of various pathological proteins-both of which correlate with disease evolution. There is now mounting evidence to suggest that these pathological proteins present with toxic, at times prion-like, properties and can therefore seed pathology in neighboring as well remotely connected healthy neurons as they spread across the brain. What is less clear, at this stage, is how much this actually contributes to, and drives, the core pathogenic events. In this review, we present a comprehensive, up-to-date summary of the reported <i>in vitro</i> studies that support the spreading and seeding capacities of pathological proteins, with an emphasis on mutant huntingtin protein in the context of Huntington's disease, although <i>in vivo</i> work remains to be performed to validate this theory in this particular disease. We have further reviewed these findings in light of their potential implications for the development of novel therapeutic approaches.

Also flagged:sickle cell diseaseerythropoiesissickle cell anemiaSry type HMG boxanemiaBeta-thalassemia syndromes
Journal Article 2017-11-28 ✓ 5 Snippets Li J, Lai Y, Luo J, Luo L, Liu R, Liu Z, Zhao W.
In-Text Gene Mentions

This is the first report on <i>γ</i>-globin induction by downregulation of SOX6 in human erythroblasts derived from <i>β</i>-thalassemia major.

Murine SOX6 null mutants (p100H) show delayed growth, myopathy, and atrioventricular heart block and die within 2 weeks following birth [23].

…type HMG box (SOX6) is a potent…

…expression by downregulatingSOX6to alleviate anemia…

…by downregulation ofSOX6in human erythroblasts…

Show Full Abstract

<h4>Background</h4>Fetal hemoglobin (HbF; <i>α</i><sub>2</sub><i>γ</i><sub>2</sub>) is a potent genetic modifier of the severity of <i>β</i>-thalassemia and sickle cell anemia. Differences in the levels of HbF that persist into adulthood affect the severity of sickle cell disease and the <i>β</i>-thalassemia syndromes. Sry type HMG box (SOX6) is a potent silencer of HbF. Here, we reactivated <i>γ</i>-globin expression by downregulating SOX6 to alleviate anemia in the <i>β</i>-thalassemia patients.<h4>Methods</h4>SOX6 was downregulated by lentiviral RNAi (RNA interference) in K562 cell line and an <i>in vitro</i> culture model of human erythropoiesis in which erythroblasts are derived from the normal donor mononuclear cells (MNC) or <i>β</i>-thalassemia major MNC. The expression of <i>γ</i>-globin was analyzed by qPCR (quantitative real-time PCR) and WB (western blot).<h4>Results</h4>Our data showed that downregulation of SOX6 induces <i>γ</i>-globin production in K562 cell line and human erythrocytes from normal donors and <i>β</i>-thalassemia major donors, without altering erythroid maturation.<h4>Conclusions</h4>This is the first report on <i>γ</i>-globin induction by downregulation of SOX6 in human erythroblasts derived from <i>β</i>-thalassemia major.

Also flagged:colorectal cancertumortumorslymph node metastasescancerAPC
Journal Article 2017-11-27 ✓ 2 Snippets Árnadóttir SS, Jeppesen M, Lamy P, Bramsen JB, Nordentoft I, Nordentoft I, Knudsen M, Vang S, Madsen MR, Thastrup O, Thastrup J, L Andersen C.
In-Text Gene Mentions

In general, mutations in main cancer drivers for CRC (such as TP53, APC, KRAS, DCC, and BRAF) were observed across all samples from each patient.

…APC, KRAS, BRAF,DCC, and TP53.…

Show Full Abstract

Patient-derived in vitro cultures of colorectal cancer (CRC) may help guide treatment strategies prior to patient treatment. However, most previous studies have been performed on a single biopsy per tumor. The purpose of this study was to analyze multiple spatially distinct biopsies from CRCs and see how well intratumor heterogeneity (ITH) was recapitulated in matching patient-derived spheroids. Three to five biopsies were collected from six CRC tumors. Each biopsy was split in two; one half was used for spheroid culturing, while the other half was used for DNA and RNA purification. For two patients, lymph node metastases were analyzed. Somatic mutations were called from whole exome sequencing data. Each tumor contained mutations shared across all biopsies and spheroids, including major CRC drivers such as APC, KRAS, and TP53. At the same time, all tumors exhibited ITH on both mutation and copy number level. The concordance between biopsies and spheroids ranged between 40 and 70% for coding mutations. For three patients, the biopsy and spheroid from matching areas clustered together, meaning that the spheroid resembled the area of origin more than the other areas. However, all biopsies and spheroids contained private mutations. Therefore, multiple cultures from spatially distinct sites of the tumor increase the insight into the genetic profile of the entire tumor. Molecular subtypes were called from RNA sequencing data. When based on transcripts from both cancer and noncancerous cells, the subtypes were largely independent of sampling site. In contrast, subtyping based on cancer cell transcripts alone was dependent on sample site and genetic ITH. In conclusion, all examined CRC tumors showed genetic ITH. Spheroid cultures partly reflected this ITH, and having multiple cultures from distinct tumor sites improved the representation of the genetic tumor subclones. This should be taken into account when establishing patient-derived models for drug screening.

Also flagged:translation termination factoreRF1polysomesribosomeribosomal subunitseIF4E
Journal Article 2017-11-27 ✓ 1 Snippet Denis CL, Richardson R, Park S, Zhang C, Xi W, Laue TM, Wang X.
In-Text Gene Mentions

Htt

Show Full Abstract

The eukaryotic eRF1 translation termination factor plays an important role in recognizing stop codons and initiating the end to translation. However, which exact complexes contain eRF1 and at what abundance is not clear. We have used analytical ultracentrifugation with fluorescent detection system to identify the protein complexome of eRF1 in the yeast Saccharomyces cerevisiae. In addition to eRF1 presence in translating polysomes, we found that eRF1 associated with five other macromolecular complexes: 77S, 57S, 39S, 28S, and 20S in size. Generally equal abundances of each of these complexes were found. The 77S complex primarily contained the free 80S ribosome consistent with in vitro studies and did not appear to contain significant levels of the monosomal translating complex that co-migrates with the free 80S ribosome. The 57S and 39S complexes represented, respectively, free 60S and 40S ribosomal subunits bound to eRF1, associations not previously reported. The novel 28S and 20S complexes (containing minimal masses of 830 KDa and 500 KDa, respectively) lacked significant RNA components and appeared to be oligomeric, as eRF1 has a mass of 49 KDa. The majority of polysomal complexes containing eRF1 were both substantially deadenylated and lacking in closed-loop factors eIF4E and eIF4G. The thirteen percent of such translating polysomes that contained poly(A) tails had equivalent levels of eIF4E and eIF4G, suggesting these complexes were in a closed-loop structure. The identification of eRF1 in these unique and previously unrecognized complexes suggests a variety of new roles for eRF1 in the regulation of cellular processes.

Also flagged:axon guidanceaxonaxonsmembranedendritesneurological disorders
Journal Article 2017-11-27 No Snippets Howard LJ, Brown HE, Wadsworth BC, Evans TA.
Show Full Abstract

Studies in the fruit fly Drosophila melanogaster have provided many fundamental insights into the genetic regulation of neural development, including the identification and characterization of evolutionarily conserved axon guidance pathways and their roles in important guidance decisions. Due to its highly organized and fast-developing embryonic nervous system, relatively small number of neurons, and molecular and genetic tools for identifying, labeling, and manipulating individual neurons or small neuronal subsets, studies of axon guidance in the Drosophila embryonic CNS have allowed researchers to dissect these genetic mechanisms with a high degree of precision. In this review, we discuss the major axon guidance pathways that regulate midline crossing of axons and the formation and guidance of longitudinal axon tracts, two processes that contribute to the development of the precise three-dimensional structure of the insect nerve cord. We focus particularly on recent insights into the roles and regulation of canonical midline axon guidance pathways, and on additional factors and pathways that have recently been shown to contribute to axon guidance decisions at and near the midline.

Also flagged:Estrogenc-Kitbreast cancerestrogen receptorERHER2
Journal Article 2017-11-27 ✓ 2 Snippets Harrell JC, Shroka TM, Jacobsen BM.
In-Text Gene Mentions

…phenol red free MEM+5%DCC, NEAA and insulin…

…red free DMEM/L15+10%DCC, and SUM44PE cells…

Show Full Abstract

Among the molecular subtypes of breast cancer are luminal (A or B) estrogen receptor positive (ER+), HER2+, and triple negative (basal-like). In addition to the molecular subtypes, there are 18 histologic breast cancer subtypes classified on appearance, including invasive lobular breast carcinoma (ILC), which are 8-15% of all breast cancers and are largely ER+ tumors. We used a new model of ER+ ILC, called BCK4. To determine the estrogen regulated genes in our ILC model, we examined BCK4 xenograft tumors from mice supplemented with or without estrogen using gene expression arrays. Approximately 3000 genes were regulated by estrogen in vivo. Hierarchical cluster analyses of the BCK4 derived tumors compared with ER+ and ER- breast cancer cell lines show the estrogen treated BCK4 tumors group with ER- breast cancers most likely due to a high proliferation score, while tumors from cellulose supplemented mice were more related to ER+ breast tumor cells. To elucidate genes regulated in vitro by estrogen in BCK4 cells, we performed expression profiling using Illumina arrays of the BCK4 cell line, treated with or without estrogen in vitro. A set of ~200 overlapping genes were regulated by estrogen in the BCK4 cell line and xenograft tumors, and pathway analysis revealed that the c-Kit pathway might be a target to reduce estrogen-induced proliferation. Subsequent studies found that inhibition of c-Kit activity using imatinib mesylate (Gleevec®) blocked estrogen mediated stimulation of BCK4 tumors and BCK4 cells in vitro as effectively as the anti-estrogen fulvestrant (Faslodex®). Decreased expression of c-Kit using shRNA also decreased baseline and estrogen induced proliferation in vitro and in vivo. These studies are the first to indicate that c-Kit inhibition is an effective approach to target c-Kit+ ILC.

Also flagged:CNTD2COQ9GCGRNDUFA9NEU2PYCR1
Journal Article 2017-11-27 ✓ 5 Snippets Murray J, Todd KV, Bakre A, Orr-Burks N, Jones L, Wu W, Tripp RA.
In-Text Gene Mentions

…by KD ofBTN2A1and GCGR (~3-fold),…

…CNTD2 (3-fold), whereBTN2A1, EP300, GCGR, and…

…KD ofBTN2A1, STRADA, SVOPL and…

…following KD ofBTN2A1~40-fold ( Fig…

…KD ofBTN2A1and SVOPL dramatically…

Show Full Abstract

Using genome-wide small interfering RNA (siRNA) screens for poliovirus, influenza A virus and rotavirus, we validated the top 6 gene hits PV, RV or IAV to search for host genes that when knocked-down (KD) enhanced virus permissiveness and replication over wild type Vero cells or HEp-2 cells. The enhanced virus replication was tested for 12 viruses and ranged from 2-fold to >1000-fold. There were variations in virus-specific replication (strain differences) across the cell lines examined. Some host genes (CNTD2, COQ9, GCGR, NDUFA9, NEU2, PYCR1, SEC16G, SVOPL, ZFYVE9, and ZNF205) showed that KD resulted in enhanced virus replication. These findings advance platform-enabling vaccine technology, the creation of diagnostic cells substrates, and are informative about the host mechanisms that affect virus replication in mammalian cells.

Also flagged:DNasehypersensitivityRUNX2CTCFgene expressionchromatin
Journal Article 2017-11-27 No Snippets Tai PWL, Wu H, van Wijnen AJ, Stein GS, Stein JL, Lian JB.
Show Full Abstract

The ability to discover regulatory sequences that control bone-related genes during development has been greatly improved by massively parallel sequencing methodologies. To expand our understanding of cis-regulatory regions critical to the control of gene expression during osteoblastogenesis, we probed the presence of open chromatin states across the osteoblast genome using global DNase hypersensitivity (DHS) mapping. Our profiling of MC3T3 mouse pre-osteoblasts during differentiation has identified more than 224,000 unique DHS sites. Approximately 65% of these sites are dynamic during temporal stages of osteoblastogenesis, and a majority of them are located within non-promoter (intergenic and intronic) regions. Nearly half of all DHS sites (both constitutive and dynamic) overlap binding events of the bone-essential RUNX2 and/or the chromatin-related CTCF transcription factors. This finding reinforces the role of these regulatory proteins as essential components of the bone gene regulome. We observe a reduction in chromatin accessibility throughout the genome between pre-osteoblast and early osteoblasts. Our analysis also defined a class of differentially expressed genes that harbor DHS peaks centered within 1 kb downstream of transcriptional end sites (TES). These DHSs at the 3'-flanks of genes exhibit dynamic changes during differentiation that may impact regulation of the osteoblast genome. Taken together, the distribution of DHS regions within non-promoter locations harboring osteoblast and chromatin related transcription factor binding motifs, reflect novel cis-regulatory requirements to support temporal gene expression in differentiating osteoblasts.

Also flagged:bullamamPapLatCytbmitochondrial
Journal Article 2017-11-27 No Snippets Peçanha WT, Althoff SL, Galiano D, Quintela FM, Maestri R, Gonçalves GL, Freitas TRO.
Show Full Abstract

Pleistocene climatic oscillations favoured the expansion of grassland ecosystems and open vegetation landscapes throughout the Neotropics, and influenced the evolutionary history of species adapted to such environments. In this study, we sampled populations of the rodent Oxymycterus nasutus endemic to open areas in the Pampas and Atlantic Forest biomes to assess the tempo and mode of population divergence using an integrative approach, including coalescence theory, ecological niche models, and morphometry. Our results indicated that these O. nasutus populations exhibited high levels of genetic structure. Six major mtDNA clades were found, structuring these biomes into distinct groups. Estimates of their divergence times was indicated to be 0.571 myr. The high degree of genetic structure is reflected in the analyses of geometric morphometric; skull differences between lineages in the two ecoregions were detected. During the last glacial maximum, there was a strong increase in suitable abiotic conditions for O. nasutus. Distinct molecular markers revealed a population expansion over time, with a possible demographic retraction during the post-glacial period. Considering that all clades coalesce with the last interglacial maximum, our results indicated that reduction in suitable conditions during this period may have resulted in a possible vicariance associated with refuge isolation.

Also flagged:nonalcoholic fatty liver diseaseNAFLDchronic liver diseasenonalcoholic steatohepatitisNASHliver cirrhosis
Journal Article 2017-11-27 ✓ 1 Snippet Lee MS, Bae JM, Joo SK, Woo H, Lee DH, Jung YJ, Kim BG, Lee KL, Kim W.
In-Text Gene Mentions

…Wilson disease orhemochromatosis, (v) habitual excessive…

Show Full Abstract

The diagnostic performance of supersonic shear imaging (SSI) in comparison with those of transient elastography (TE) and acoustic radiation force impulse imaging (ARFI) for staging fibrosis in nonalcoholic fatty liver disease (NAFLD) patients has not been fully assessed, especially in Asian populations with relatively lean NAFLD compared to white populations. Thus, we focused on comparing the diagnostic performances of TE, ARFI, and SSI for staging fibrosis in a head-to-head manner, and identifying the clinical, anthropometric, biochemical, and histological features which might affect liver stiffness measurement (LSM) in our prospective biopsy-proven NAFLD cohort. In this study, ninety-four patients with biopsy-proven NAFLD were included prospectively. Liver stiffness was measured using TE, SSI, and ARFI within 1 month of liver biopsy. The diagnostic performance for staging fibrosis was assessed using receiver operating characteristic (ROC) analysis. Anthropometric data were evaluated as covariates influencing LSM by regression analyses. Liver stiffness correlated with fibrosis stage (p < 0.05); the area under the ROC curve of TE (kPa), SSI (kPa), and ARFI (m/s) were as follows: 0.757, 0.759, and 0.657 for significant fibrosis and 0.870, 0.809, and 0.873 for advanced fibrosis. Anthropometric traits were significant confounders affecting SSI, while serum liver injury markers significantly confounded TE and ARFI. In conclusion, the LSM methods had similar diagnostic performance for staging fibrosis in patients with NAFLD. Pre-LSM anthropometric evaluation may help predict the reliability of SSI.

Also flagged:ObesityType 2 Diabetesbipolar disorderschizophreniacomplexmineral
Journal Article 2017-11-27 ✓ 5 Snippets Zhang Q, Wu KH, He JY, Zeng Y, Greenbaum J, Xia X, Liu HM, Lv WQ, Lin X, Zhang WD, Xi YL, Shi XZ, Sun CQ, Deng HW.
In-Text Gene Mentions

For the 30 genes the identified pleiotropic SNPs were annotated to, we found twelve of them (AKAP6, NPAS3, PSRC1, MYBPHL, MIR29A, GABRG1, ZNF664, FAM101A, LOC10272396, LINC01052, GPR139, and PUM1) were not identified by any BMI or T2D related GWASs.

Furthermore, ZNF664 was previously reported to show suggestive association (P < 1E-4) with adiponectin45, a protein involved in many metabolic processes including glucose regulation and fatty acid oxidation46.

…, GABRG1 ,ZNF664, FAM101A ,…

…regions of genesZNF664and PUM1 respectively,…

…regions of genesZNF664and PUM1 and…

Show Full Abstract

Genome-wide association studies (GWASs) have been performed extensively in diverse populations to identify single nucleotide polymorphisms (SNPs) associated with complex diseases or traits. However, to date, the SNPs identified fail to explain a large proportion of the variance of the traits/diseases. GWASs on type 2 diabetes (T2D) and obesity are generally focused on individual traits independently, and genetic intercommunity (common genetic contributions or the product of over correlated phenotypic world) between them are largely unknown, despite extensive data showing that these two phenotypes share both genetic and environmental risk factors. Here, we applied a recently developed genetic pleiotropic conditional false discovery rate (cFDR) approach to discover novel loci associated with BMI and T2D by incorporating the summary statistics from existing GWASs of these two traits. Conditional Q-Q and fold enrichment plots were used to visually demonstrate the strength of pleiotropic enrichment. Adopting a cFDR nominal significance level of 0.05, 287 loci were identified for BMI and 75 loci for T2D, 23 of which for both traits. By incorporating related traits into a conditional analysis framework, we observed significant pleiotropic enrichment between obesity and T2D. These findings may provide novel insights into the etiology of obesity and T2D, individually and jointly.

Also flagged:TumorAutophagydegradationorganellesinfectionsneurodegenerative diseases
Journal Article 2017-11-27 ✓ 1 Snippet Boutouja F, Brinkmeier R, Mastalski T, El Magraoui F, Platta HW.
In-Text Gene Mentions

KLHL20-KO mice show that ablation of KLHL20 enhances diabetes-associated muscle atrophy [163].

Show Full Abstract

Autophagy contributes to cellular homeostasis through the degradation of various intracellular targets such as proteins, organelles and microbes. This relates autophagy to various diseases such as infections, neurodegenerative diseases and cancer. A central component of the autophagy machinery is the class III phosphatidylinositol 3-kinase (PI3K-III) complex, which generates the signaling lipid phosphatidylinositol 3-phosphate (PtdIns3P). The catalytic subunit of this complex is the lipid-kinase VPS34, which associates with the membrane-targeting factor VPS15 as well as the multivalent adaptor protein BECLIN 1. A growing list of regulatory proteins binds to BECLIN 1 and modulates the activity of the PI3K-III complex. Here we discuss the regulation of BECLIN 1 by several different types of ubiquitination, resulting in distinct polyubiquitin chain linkages catalyzed by a set of E3 ligases. This contribution is part of the Special Issue "Ubiquitin System".

Also flagged:Ubiquitin Chainsubiquitinantibodiescell cycle
Journal Article 2017-11-27 No Snippets Stolz A, Dikic I.
Show Full Abstract

The biological diversity of ubiquitination resides in the multivalent nature of linkage-specific homotypic and heterotypic ubiquitin (Ub) chains. A recent publication by Yau et al. in Cell describes the development of K11/K48-bispecific antibodies and a physiological role for K11/K48 heterotypic chains in regulation of the cell cycle and clearance of aggregated proteins.

Also flagged:fluconazoletetracyclineCandida albicans infectionazoleCandida albicans infectionsminocycline
Journal Article 2017-11-27 No Snippets Gu W, Yu Q, Yu C, Sun S.
Show Full Abstract

<h4>Objectives</h4>Treatment of azole-resistant Candida albicans infections continues to pose significant challenges. With limited options of licensed agents, drug combinations may be a practical treatment alternative. In our previous studies, the combinations minocycline/fluconazole (MINO/FLC) and doxycycline/fluconazole (DOXY/FLC) shown synergistic effects in vitro. It is necessary to explore their appropriate dosage, potential toxicity and in vivo efficacy.<h4>Methods</h4>The Galleria mellonella infection model was employed to study the in vivo efficacy of MINO/FLC and DOXY/FLC by survival analysis, quantification of C. albicans fungal burden and histological studies.<h4>Results</h4>The survival rates of G. mellonella larvae infected with lethal doses of resistant C. albicans CA10 increased significantly when treated with the drug combinations compared with FLC treatment alone, and the fungal burden was reduced by almost four-fold. The histopathological study showed that fewer infected areas in larvae were observed and the destructive degree was less when larvae were exposed to the drug combinations.<h4>Conclusions</h4>These findings suggest that combination of a tetracycline antibiotic (MINO or DOXY) with FLC has antifungal activity against azole-resistant C. albicans in vivo. This is in agreement with several previous in vitro studies and provides preliminary in vivo evidence that such a combination might be useful therapeutically.

Also flagged:Huntingtinchoreadystoniacognitive declinedeathHD
Journal Article 2017-11-27 ✓ 5 Snippets Aguiar S, van der Gaag B, Cortese FAB.
In-Text Gene Mentions

Many HD therapeutics target downstream consequences and symptoms of the causal pathogenic mutation in the Huntingtin (HTT) gene, while a few next-generation therapies target mHTT itself (see Table 1) [11].

Huntington’s Disease (HD) is a genetically dominant trinucleotide repeat disorder resulting from CAG repeats within the Huntingtin (HTT) gene exceeding a normal range (> 36 CAGs).

The mutant HTT gene does not confer any salutary effect, other than a possible lower incidence of cancer, perhaps because p53 is activated in HD [1, 2] Fig. 1.

It is known that conditional silencing of transgenic mutant HTT (mHTT) reverses HD in mice, showing that mHTT is required for HD progression [12].

Huntington’s Disease (HD) is a genetically dominant trinucleotide repeat disorder caused by CAG repeats within the Huntingtin (HTT) gene (chromosome 4p16.3) exceeding a normal range (> 36 CAGs).

Show Full Abstract

Huntington's Disease (HD) is a genetically dominant trinucleotide repeat disorder resulting from CAG repeats within the Huntingtin (HTT) gene exceeding a normal range (> 36 CAGs). Symptoms of the disease manifest in middle age and include chorea, dystonia, and cognitive decline. Typical latency from diagnosis to death is 20 years. There are currently no disease-modifying therapies available to HD patients. RNAi is a potentially curative therapy for HD. A popular line of research employs siRNA or antisense oligonucleotides (ASO) to knock down mutant Huntingtin mRNA (mHTT). Unfortunately, this modality requires repeated dosing, commonly exhibit off target effects (OTEs), and exert renal and hepatic toxicity. In contrast, a single AAV-mediated short-hairpin RNA (shRNA) dose can last years with low toxicity. In addition, we highlight research indicating that shRNA elicits fewer OTEs than siRNA when tested head-to-head. Despite this promise, shRNA therapy has been held back by difficulties controlling expression (oversaturating cells with toxic levels of RNA construct). In this review, we compare RNAi modalities for HD and propose novel methods of optimizing shRNA expression and on-target fidelity.

Also flagged:Fingolimod hydrochloridesphingosinemultiple sclerosisMScanceroxygen
Journal Article 2017-11-27 ✓ 1 Snippet Hagihara K, Kinoshita K, Ishida K, Hojo S, Kameoka Y, Satoh R, Takasaki T, Sugiura R.
In-Text Gene Mentions

…Atp15, SPAC27E2.11c, andMrpl39) were mapped to…

Show Full Abstract

Fingolimod hydrochloride (FTY720), a sphingosine-1-phosphate (S1P) analogue, is an approved immune modulator for the treatment of multiple sclerosis (MS). Notably, in addition to its well-known mode of action as an S1P modulator, accumulating evidence suggests that FTY720 induces apoptosis in various cancer cells via reactive oxygen species (ROS) generation. Although the involvement of multiple signaling molecules, such as JNK (Jun N-terminal kinase), Akt (alpha serine/threonine-protein kinase) and Sphk has been reported, the exact mechanisms how FTY720 induces cell growth inhibition and the functional relationship between FTY720 and these signaling pathways remain elusive. Our previous reports using the fission yeast <i>Schizosaccharomyces pombe</i> as a model system to elucidate FTY720-mediated signaling pathways revealed that FTY720 induces an increase in intracellular Ca<sup>2+</sup> concentrations and ROS generation, which resulted in the activation of the transcriptional responses downstream of Ca<sup>2+</sup>/calcineurin signaling and stress-activated MAPK signaling, respectively. Here, we performed a genome-wide screening for genes whose deletion induces FTY720-sensitive growth in <i>S. pombe</i> and identified 49 genes. These gene products are related to the biological processes involved in metabolic processes, transport, transcription, translation, chromatin organization, cytoskeleton organization and intracellular signal transduction. Notably, most of the FTY720-sensitive deletion cells exhibited NAC-remedial FTY720 sensitivities and dysregulated ROS homeostasis. Our results revealed a novel gene network involving ROS homeostasis and the possible mechanisms of the FTY720 toxicity.

Also flagged:BCL11Aγ-globinβ-thalassemiaGene Expressionnucleotidesdegradation
Journal Article 2017-11-26 ✓ 1 Snippet Gasparello J, Fabbri E, Bianchi N, Breveglieri G, Zuccato C, Borgatti M, Gambari R, Finotti A.
In-Text Gene Mentions

…(constituted also bySox6, GATA-1, Fog-1, Mi-2/NuRD…

Show Full Abstract

The involvement of microRNAs in the control of repressors of human <i>γ-globin</i> gene transcription has been firmly demonstrated, as described for the miR-486-3p mediated down-regulation of BCL11A. On the other hand, we have reported that miR-210 is involved in erythroid differentiation and, possibly, in <i>γ-globin</i> gene up-regulation. In the present study, we have identified the coding sequence of BCL11A as a possible target of miR-210. The following results sustain this hypothesis: (a) interactions between miR-210 and the miR-210 BCL11A site were demonstrated by SPR-based biomolecular interaction analysis (BIA); (b) the miR-210 site of BCL11A is conserved through molecular evolution; (c) forced expression of miR-210 leads to decrease of BCL11A-XL and increase of γ-globin mRNA content in erythroid cells, including erythroid precursors isolated from β-thalassemia patients. Our study suggests that the coding mRNA sequence of BCL11A can be targeted by miR-210. In addition to the theoretical point of view, these data are of interest from the applied point of view, supporting a novel strategy to inhibit BCL11A by mimicking miR-210 functions, accordingly with the concept supported by several papers and patent applications that inhibition of BCL11A is an efficient strategy for fetal hemoglobin induction in the treatment of β-thalassemia.

Also flagged:cytopeniainfectious diseasesdefectsinfectionssolid tumorsadenoma
Journal Article 2017-11-26 No Snippets Valent P, Akin C, Arock M, Bock C, George TI, Galli SJ, Gotlib J, Haferlach T, Hoermann G, Hermine O, Jäger U, Kenner L, Kreipe H, Majeti R, Metcalfe DD, Orfao A, Reiter A, Sperr WR, Staber PB, Sotlar K, Schiffer C, Superti-Furga G, Horny HP.
Show Full Abstract

Cancer evolution is a step-wise non-linear process that may start early in life or later in adulthood, and includes pre-malignant (indolent) and malignant phases. Early somatic changes may not be detectable or are found by chance in apparently healthy individuals. The same lesions may be detected in pre-malignant clonal conditions. In some patients, these lesions may never become relevant clinically whereas in others, they act together with additional pro-oncogenic hits and thereby contribute to the formation of an overt malignancy. Although some pre-malignant stages of a malignancy have been characterized, no global system to define and to classify these conditions is available. To discuss open issues related to pre-malignant phases of neoplastic disorders, a working conference was organized in Vienna in August 2015. The outcomes of this conference are summarized herein and include a basic proposal for a nomenclature and classification of pre-malignant conditions. This proposal should assist in the communication among patients, physicians and scientists, which is critical as genome-sequencing will soon be offered widely for early cancer-detection.

Also flagged:Down syndromeEZRSOD1MAPRE3PHBaging
Journal Article 2017-11-26 No Snippets Vacano GN, Gibson DS, Turjoman AA, Gawryluk JW, Geiger JD, Duncan M, Patterson D.
Show Full Abstract

This study was designed to investigate the brain proteome of the Ts65Dn mouse model of Down syndrome. We profiled the cerebellum and hippocampus proteomes of 6- and 12-month-old trisomic and disomic mice by difference gel electrophoresis. We quantified levels of 2082 protein spots and identified 272 (170 unique UniProt accessions) by mass spectrometry. Four identified proteins are encoded by genes trisomic in the Ts65Dn mouse. Three of these (CRYZL11, EZR, and SOD1) were elevated with p-value <0.05, and 2 proteins encoded by disomic genes (MAPRE3 and PHB) were reduced. Intergel comparisons based on age (6 vs. 12 months) and brain region (cerebellum vs. hippocampus) revealed numerous differences. Specifically, 132 identified proteins were different between age groups, and 141 identified proteins were different between the 2 brain regions. Our results suggest that compensatory mechanisms exist, which ameliorate the effect of trisomy in the Ts65Dn mice. Differences observed during aging may play a role in the accelerated deterioration of learning and memory seen in Ts65Dn mice.

Also flagged:CDK5hepatocellular carcinomacyclin-dependent kinase 5tumorcell cyclecirrhosis
Journal Article 2017-11-26 No Snippets Zhang R, Lin P, Yang H, He Y, Dang YW, Feng ZB, Chen G.
Show Full Abstract

To investigate the clinical role and biological function of cyclin-dependent kinase 5 (CDK5) in hepatocellular carcinoma (HCC), 412 surgically resected tissue samples (HCC, n=171; non-HCC=241) were obtained and analyzed with immunohistochemistry. The diagnostic and prognostic values of CDK5 expression levels in HCC were clarified. Moreover, RNA-seq data or microarray datasets from The Cancer Genome Atlas (TCGA) (HCC, n=374; normal, n=50) or other public databases (HCC, n=1864; non-tumor=1995) regarding CDK5 in HCC were extracted and examined. Several bioinformatic methods were performed to identify CDK5-regulated pathways. <i>In vitro</i> experiments were adopted to measure proliferation and apoptosis in HCC cells after CDK5 mRNA was inhibited in the HCC cell lines HepG2 and HepB3. Based on immunohistochemistry, CDK5 expression levels were notably increased in HCC tissues (n=171) compared with normal (n=33, <i>P</i><0.001), cirrhosis (n=37, <i>P</i><0.001), and adjacent non-cancerous liver (n=171, <i>P</i><0.001) tissues. The up-regulation of CDK5 was associated with higher differentiation (<i>P</i><0.001), metastasis (<i>P</i><0.001), advanced clinical TNM stages (<i>P</i><0.001), portal vein tumor embolus (<i>P</i>=0.003) and vascular invasion (<i>P</i>=0.004). Additionally, TCGA data analysis also revealed significantly increased CDK5 expression in HCC compared with non-cancerous hepatic tissues (<i>P</i><0.001). The pooled standard mean deviation (SMD) based on 36 included datasets (HCC, n=2238; non-cancerous, n=2045) indicated that CDK5 was up-regulated in HCC (SMD=1.23, 95% CI: 1.00-1.45, <i>P</i><0.001). The area under the curve (AUC) of the summary receiver operating characteristic (SROC) curve was 0.88. Furthermore, CDK5 knock-down inhibited proliferation and promoted apoptosis. In conclusion, CDK5 plays an essential role in the initiation and progression of HCC, most likely via accelerating proliferation and suppressing apoptosis in HCC cells by regulating the cell cycle and DNA replication pathways.

Also flagged:rheumatoid arthritisRAchromosomesCOL4A1plaqueSLC17A2
Journal Article 2017-11-26 ✓ 1 Snippet Arya R, Escalante A, Farook VS, Restrepo JF, Battafarano DF, Almeida M, Kos MZ, Fourcaudot MJ, Mummidi S, Kumar S, Curran JE, Jenkinson CP, Blangero J, Duggirala R, Del Rincon I.
In-Text Gene Mentions

TRIM38

Show Full Abstract

<h4>Background and aims</h4>Little is known about specific genetic determinants of carotid-intima-media thickness (CIMT) and carotid plaque in subjects with rheumatoid arthritis (RA). We have used the Metabochip array to fine map and replicate loci that influence variation in these phenotypes in Mexican Americans (MAs) and European Americans (EAs).<h4>Methods</h4>CIMT and plaque were measured using ultrasound from 700 MA and 415 EA patients with RA and we conducted association analyses with the Metabochip single nucleotide polymorphism (SNP) data using PLINK.<h4>Results</h4>In MAs, 12 SNPs from 11 chromosomes and 6 SNPs from 6 chromosomes showed suggestive associations (p < 1 × 10<sup>-4</sup>) with CIMT and plaque, respectively. The strongest association was observed between CIMT and rs17526722 (SLC17A2 gene) (β ± SE = -0.84 ± 0.18, p = 3.80 × 10<sup>-6</sup>). In EAs, 9 SNPs from 7 chromosomes and 7 SNPs from 7 chromosomes showed suggestive associations with CIMT and plaque, respectively. The top association for CIMT was observed with rs1867148 (PPCDC gene, β ± SE = -0.28 ± 0.06, p = 5.11 × 10<sup>-6</sup>). We also observed strong association between plaque and two novel loci: rs496916 from COL4A1 gene (OR = 0.51, p = 3.15 × 10<sup>-6</sup>) in MAs and rs515291 from SLCA13 gene (OR = 0.50, p = 3.09 × 10<sup>-5</sup>) in EAs.<h4>Conclusions</h4>We identified novel associations between CIMT and variants in SLC17A2 and PPCDC genes, and between plaque and variants from COL4A1 and SLCA13 that may pinpoint new candidate risk loci for subclinical atherosclerosis associated with RA.

Also flagged:Prdx1peroxiredoxin 1cholesterolmacroautophagyautophagylipid
Journal Article 2017-11-25 ✓ 1 Snippet Jeong SJ, Kim S, Park JG, Jung IH, Lee MN, Jeon S, Kweon HY, Yu DY, Lee SH, Jang Y, Kang SW, Han KH, Miller YI, Park YM, Cheong C, Choi JH, Oh GT.
In-Text Gene Mentions

…PRDXs (PRDX1 toPRDX6) are distributed in…

Show Full Abstract

Oxidative stress activates macroautophagy/autophagy and contributes to atherogenesis via lipophagic flux, a form of lipid removal by autophagy. However, it is not known exactly how endogenous antioxidant enzymes are involved in lipophagic flux. Here, we demonstrate that the antioxidant PRDX1 (peroxiredoxin 1) has a crucial role in the maintenance of lipophagic flux in macrophages. PRDX1 is more highly expressed than other antioxidant enzymes in monocytes and macrophages. We determined that Prdx1 deficiency induced excessive oxidative stress and impaired maintenance of autophagic flux in macrophages. Prdx1-deficient macrophages had higher intracellular cholesterol mass and lower cholesterol efflux compared with wild type. This perturbation in cholesterol homeostasis was due to impaired lipophagic cholesterol hydrolysis caused by excessive oxidative stress, resulting in the inhibition of free cholesterol formation and the reduction of NR1H3 (nuclear receptor subfamily 1, group H, member 3) activity. Notably, impairment of both lipophagic flux and cholesterol efflux was restored by the 2-Cys PRDX-mimics ebselen and gliotoxin. Consistent with this observation, apoe <sup>-/-</sup> mice transplanted with bone marrow from prdx1<sup>-/-</sup>apoe<sup>-/-</sup> mice had increased plaque formation compared with apoe<sup>-/-</sup> BM-transplanted recipients. This study reveals that PRDX1 is crucial to regulating lipophagic flux and maintaining macrophage cholesterol homeostasis against oxidative stress. We suggest that PRDX1-dependent control of oxidative stress may provide a strategy for treating atherosclerosis and autophagy-related human diseases.

Also flagged:Cholestasislow-phospholipid-associated cholelithiasisLPACsyndrome
Journal Article 2017-11-25 ✓ 2 Snippets Cardoso MF, E Branco JC, Anapaz V, Rodrigues CG, Carvalho R, Horta D, Martins A, Reis J.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

The low-phospholipid-associated cholelithiasis (LPAC) syndrome is a form of symptomatic cholelithiasis occurring in young adults, characterized by recurrence of symptoms after cholecystectomy and presence of hepatolithiasis. The case refers to a healthy 39-year-old Caucasian male who presented with abdominal pain and jaundice. His blood tests showed conjugated hyperbilirubinemia and elevated liver enzymes (total bilirubin 6.65 mg/dL, γ-glutamyltransferase 699 IU/L) and abdominal computed tomography revealed dilation of common bile duct and left intrahepatic ducts. Magnetic resonance cholangiopancreatography identified choledocholithiasis, retrieved by endoscopic retrograde cholangiopancreatography, after which there was a worsening of jaundice (total bilirubin 23 mg/dL), which persisted for several weeks, possibly due to ciprofloxacin toxicity. After an extensive workup including liver biopsy, the identification of two foci of hepatolithiasis on reevaluation abdominal ultrasound raised the hypothesis of LPAC syndrome and the patient was started on ursodeoxycholic acid, with remarkable improvement. Genetic testing identified the mutation c.1954A>G (p.Arg652Gly) in ABCB4 gene (homozygous) and c.1331T>C (p.Val444Ala) in ABCB11 gene (heterozygous). In conclusion, we describe the unique case of an adult male with choledocholithiasis, hepatolithiasis, and persistent conjugated hyperbilirubinemia after retrieval of stones, fulfilling the criteria for LPAC syndrome and with possible superimposed drug-induced liver injury, in whom ABCB4 and ABCB11 mutations were found, both of which had not been previously described in association with LPAC.

Also flagged:chromatinsignal transductioncancertumoursolid tumourshaematological cancers
Journal Article 2017-11-24 No Snippets Anastasiadou E, Jacob LS, Slack FJ.
Show Full Abstract

Thousands of unique non-coding RNA (ncRNA) sequences exist within cells. Work from the past decade has altered our perception of ncRNAs from 'junk' transcriptional products to functional regulatory molecules that mediate cellular processes including chromatin remodelling, transcription, post-transcriptional modifications and signal transduction. The networks in which ncRNAs engage can influence numerous molecular targets to drive specific cell biological responses and fates. Consequently, ncRNAs act as key regulators of physiological programmes in developmental and disease contexts. Particularly relevant in cancer, ncRNAs have been identified as oncogenic drivers and tumour suppressors in every major cancer type. Thus, a deeper understanding of the complex networks of interactions that ncRNAs coordinate would provide a unique opportunity to design better therapeutic interventions.

Also flagged:amino acidglutaminealaninepeptidesproteinopathiespolypeptides
Journal Article 2017-11-24 ✓ 1 Snippet Darling AL, Uversky VN.
In-Text Gene Mentions

The most well studied polyQ expanded gene is HTT, which upon expansion of the homopeptide region, is responsible for the pathogenesis associated with Huntington’s disease.

Show Full Abstract

Intrinsically disordered proteins and proteins with intrinsically disordered regions have been shown to be highly prevalent in disease. Furthermore, disease-causing expansions of the regions containing tandem amino acid repeats often push repetitive proteins towards formation of irreversible aggregates. In fact, in disease-relevant proteins, the increased repeat length often positively correlates with the increased aggregation efficiency and the increased disease severity and penetrance, being negatively correlated with the age of disease onset. The major categories of repeat extensions involved in disease include poly-glutamine and poly-alanine homorepeats, which are often times located in the intrinsically disordered regions, as well as repeats in non-coding regions of genes typically encoding proteins with ordered structures. Repeats in such non-coding regions of genes can be expressed at the mRNA level. Although they can affect the expression levels of encoded proteins, they are not translated as parts of an affected protein and have no effect on its structure. However, in some cases, the repetitive mRNAs can be translated in a non-canonical manner, generating highly repetitive peptides of different length and amino acid composition. The repeat extension-caused aggregation of a repetitive protein may represent a pivotal step for its transformation into a proteotoxic entity that can lead to pathology. The goals of this article are to systematically analyze molecular mechanisms of the proteinopathies caused by the poly-glutamine and poly-alanine homorepeat expansion, as well as by the polypeptides generated as a result of the microsatellite expansions in non-coding gene regions and to examine the related proteins. We also present results of the analysis of the prevalence and functional roles of intrinsic disorder in proteins associated with pathological repeat expansions.

Also flagged:transcription factortranscription factorsTFcancerurokinasetumor
Journal Article 2017-11-24 ✓ 2 Snippets Kim P, Ballester LY, Zhao Z.
In-Text Gene Mentions

…, KDM5A ,MLLT10, NCOR2 ,…

…VAV1, TBL1XR1, EP300,MLLT10, ETV6, LIN28A ,…

Show Full Abstract

Genomic rearrangements involving transcription factors (TFs) can form fusion proteins resulting in either enhanced, weakened, or even loss of TF activity. Functional domain (FD) retention is a critical factor in the activity of transcription factor fusion genes (TFFGs). A systematic investigation of FD retention in TFFGs and their outcome (e.g. expression changes) in a pan-cancer study has not yet been completed. Here, we examined the FD retention status in 386 TFFGs across 13 major cancer types and identified 83 TFFGs involving 67 TFs that retained FDs. To measure the potential biological relevance of TFs in TFFGs, we introduced a Major Active Isofusion Index (MAII) and built a prioritized TFFG network using MAII scores and the observed frequency of fusion positive samples. Interestingly, the four TFFGs (<i>PML-RARA, RUNX1-RUNX1T1, TMPRSS2-ERG</i>, and <i>SFPQ-TFE3</i>) with the highest MAII scores showed 50 differentially expressed target genes (DETGs) in fusion-positive versus fusion-negative cancer samples. DETG analysis revealed that they were involved in tumorigenesis-related processes in each cancer type. <i>PLAU</i>, which encodes plasminogen activator urokinase and serves as a biomarker for tumor invasion, was found to be consistently activated in the samples with the highest MAII scores. Among the 50 DETGs, 21 were drug targetable genes. Fourteen of these 21 DETGs were expressed in acute myeloid leukemia (AML) samples. Accordingly, we constructed an AML-specific TFFG network, which included 38 DETGs in <i>RUNX1-RUNX1T1</i> or <i>PML-RARA</i> positive samples. In summary, this study revealed several TFFGs and their potential target genes, and provided insights into the clinical implications of TFFGs.

Also flagged:primary central nervous system lymphomaPrimary central nervous system lymphomasmatureB-cell lymphomastumorshuman leukocyte antigen class 2
Journal Article 2017-11-24 No Snippets Waldera-Lupa DM, Etemad-Parishanzadeh O, Brocksieper M, Kirchgaessler N, Seidel S, Kowalski T, Montesinos-Rongen M, Deckert M, Schlegel U, Stühler K.
Show Full Abstract

Primary central nervous system lymphomas (PCNSLs) are mature B-cell lymphomas confined to the central nervous system (CNS). Blood-brain barrier (BBB) dysfunction drastically alters the cerebrospinal fluid (CSF) proteome in PCNSL patients. To reveal the interaction of PCNSL tumors with CNS structures and the vasculature, we conducted a whole-proteome analysis of CSF from PCNSL patients (<i>n</i> = 17 at initial diagnosis) and tumor-free controls (<i>n</i> = 10) using label-free quantitative mass spectrometry. We identified 601 proteins in the CSF proteome using a one-step approach without further prefractionation, and quantified 438 proteins in detail using the Hi-N method. An immunoassay revealed that 70% of the patients in our unselected PCNSL patient cohort had BBB dysfunction. Correlation analysis indicated that 127 (30%) of the quantified proteins were likely increased in PCSNL patients due to BBB dysfunction. After the exclusion of these proteins, 66 were found to differ in abundance (fold-change > 2.0, <i>p</i> < 0.05) between PCNSL and control CSF proteomes, and most of those were associated with the CNS. These data also provide the first evidence that proteomic changes in CSF from PCNSL patients are mainly associated with protein ectodomain shedding, and that shedding of human leukocyte antigen class 2 proteins is a mechanism of tumor-cell immune evasion.

Also flagged:neurodegenerative disordersHuntington diseaseHDpolyglutamineantibodydegradation
Journal Article 2017-11-23 ✓ 2 Snippets Sun X, Fu Y, Pan Y, Lu B.
In-Text Gene Mentions

Huntington disease (HD), which is mainly caused by cytotoxicity of the mutant HTT (huntingtin

…recognition of mutantHTT(huntingtin) proteins by…

Show Full Abstract

Protein misfolding is the common theme for neurodegenerative disorders including Huntington disease (HD), which is mainly caused by cytotoxicity of the mutant HTT (huntingtin) protein (mHTT). The soluble mHTT has an expanded polyglutamine (polyQ) stretch that may adopt multiple conformations, among which the one recognized by the polyQ antibody 3B5H10 is the most toxic due to unknown mechanisms. In a recent study, we showed that the 3B5H10-recognized mHTT species has a slower degradation rate due to its resistance to selective macroautophagy/autophagy. In HD mouse brain tissues as well as HD patient fibroblasts and post-mortem brain tissues, the 3B5H10-recognized mHTT species lacks Lys63-polyubiquitination and SQSTM1/p62 interaction, which are essential for cargo recognition by selective autophagy. Collectively, we discovered that the mHTT protein is subject to conformation-dependent recognition by selective autophagy, which is more selective than what we perceived: the process can be selective among different conformations of the same protein, leading to conformation-dependent differences in protein degradation and toxicity.

Also flagged:Preeclampsiahypertensionintrauterine growth restrictiongestationantibodyischemia
Journal Article 2017-11-23 No Snippets Elfarra J, Amaral LM, McCalmon M, Scott JD, Cunningham MW, Gnam A, Ibrahim T, LaMarca B, Cornelius DC.
Show Full Abstract

Preeclampsia is associated with hypertension, small-for-gestational-age babies, and increased cytolytic natural killer (NK) cells. The specific role of cytolytic NK cells in the pathophysiology of preeclampsia has not been clearly defined. We hypothesized that <u>R</u>educed <u>U</u>terine <u>P</u>erfusion <u>P</u>ressure (RUPP) stimulates proliferation and cytolytic activation of NK cells, and that reducing NK cells in RUPP would prevent hypertension, intrauterine growth restriction, and inflammation in response to placental ischemia. RUPP was induced on gestation day (GD) 14 in pregnant rats. NK cells were depleted by i.p. administration of anti-asialo GM1 antibody on GDs 15 and 17. Placental and circulating NK cells were quantified via flow cytometry, mean arterial pressure (MAP), fetal weights, and cytokines were measured on GD 19. Total placental NK cells were 7.4 ± 2% of gated cells in normal pregnant (NP; <i>n</i>=10) and 16.5 ± 3% of gated cells in RUPP (<i>n</i>=10) rats. Furthermore, cytolytic placental NK cells also increased in RUPP. Depletion of NK cells in RUPP (RUPP + anti-ASGM1) significantly improved MAP and fetal weights. MAP was 108 ± 2 mmHg in NP, 125 ± 2 mmHg in RUPP, and 112 ± 2 mmHg in RUPP + anti-ASGM1 (<i>n</i>=12). Fetal weight was 2.32 ± 0.05 in NP, 1.8 ± 0.04g in RUPP, and increased to 2.0 ± 0.04g in RUPP + anti-ASGM1. Placental interferon-γ (IFN-γ) was 40.4 ± 5.2 pg/mg in NP, 72.17 ± 3.2 pg/mg in RUPP, and 44.0 ± 6.5 pg/mg in RUPP + anti-ASGM1 (<i>P</i><0.05). Placental tumor necrosis factor-α (TNF-α) was 17.9 ± 1.7 pg/mg in NP, 23.9 ± 2.2 pg/mg in RUPP, and 12.9 ± 2.3 pg/mg in RUPP + anti-ASGM1 (<i>P</i><0.05). Depletion of NK cells significantly lowered MAP, intrauterine growth restriction, and inflammation in RUPP rats indicating that cytolytic NK cells are important in preeclampsia pathophysiology.

Also flagged:proteasesreproductionpeptidesmetalloproteaseshyaluronidasetranslational
Journal Article 2017-11-23 No Snippets Cajado-Carvalho D, Galvão J, Kuniyoshi AK, Carneiro PDS, Paes Leme AF, Pauletti BA, Marengo EB, Portaro FV.
Show Full Abstract

Scorpion stings are the main cause of human envenomation in Brazil and, for the treatment of victims, the World Health Organization (WHO) recommends the use of antivenoms. The first step to achieve effective antivenom is to use a good quality venom pool and to evaluate it, with LD<sub>50</sub> determination as the most accepted procedure. It is, however, time-consuming and requires advanced technical training. Further, there are significant ethical concerns regarding the number of animals required for testing. Hence, we investigated the correspondence between LD<sub>50</sub> results, in vitro assays, and a strong correlation with proteolytic activity levels was observed, showing, remarkably, that proteases are potential toxicity markers for <i>Tityus serrulatus</i> venom. The comparison of reversed-phase chromatographic profiles also has a potential application in venoms' quality control, as there were fewer neurotoxins detected in the venom with high LD<sub>50</sub> value. These results were confirmed by mass spectrometry analysis. Therefore, these methods could precede the LD<sub>50</sub> assay to evaluate the venom excellence by discriminating-and discarding-poor-quality batches, and, consequently, with a positive impact on the number of animals used. Notably, proposed assays are fast and inexpensive, being technically and economically feasible in <i>Tityus serrulatus</i> venom quality control to produce effective antivenoms.

Also flagged:histoneSpin1tumorMyf5sarcomeremyogenesis
Journal Article 2017-11-23 ✓ 1 Snippet Greschik H, Duteil D, Messaddeq N, Willmann D, Arrigoni L, Sum M, Jung M, Metzger D, Manke T, Günther T, Schüle R.
In-Text Gene Mentions

…, Eya1 ,Sox6).…

Show Full Abstract

While several studies correlated increased expression of the histone code reader Spin1 with tumor formation or growth, little is known about physiological functions of the protein. We generated Spin1<sup>M5</sup> mice with ablation of Spin1 in myoblast precursors using the Myf5-Cre deleter strain. Most Spin1<sup>M5</sup> mice die shortly after birth displaying severe sarcomere disorganization and necrosis. Surviving Spin1<sup>M5</sup> mice are growth-retarded and exhibit the most prominent defects in soleus, tibialis anterior, and diaphragm muscle. Transcriptome analyses of limb muscle at embryonic day (E) 15.5, E16.5, and at three weeks of age provided evidence for aberrant fetal myogenesis and identified deregulated skeletal muscle (SkM) functional networks. Determination of genome-wide chromatin occupancy in primary myoblast revealed direct Spin1 target genes and suggested that deregulated basic helix-loop-helix transcription factor networks account for developmental defects in Spin1<sup>M5</sup> fetuses. Furthermore, correlating histological and transcriptome analyses, we show that aberrant expression of titin-associated proteins, abnormal glycogen metabolism, and neuromuscular junction defects contribute to SkM pathology in Spin1<sup>M5</sup> mice. Together, we describe the first example of a histone code reader controlling SkM development in mice, which hints at Spin1 as a potential player in human SkM disease.

Also flagged:eltrombopagaplastic anemiaglobulinAApancytopeniacyclosporine A
Journal Article 2017-11-23 ✓ 1 Snippet Lengline E, Drenou B, Peterlin P, Tournilhac O, Abraham J, Berceanu A, Dupriez B, Guillerm G, Raffoux E, de Fontbrune FS, Ades L, Balsat M, Chaoui D, Coppo P, Corm S, Leblanc T, Maillard N, Terriou L, Socié G, de Latour RP.
In-Text Gene Mentions

…hospital admissions, secondaryhemochromatosis, and death.…

Show Full Abstract

Few therapeutic options are available for patients with aplastic anemia who are ineligible for transplantation or refractory to immunosuppressive therapy. Eltrombopag was recently shown to produce trilineage responses in refractory patients. However, the effects of real-life use of this drug remain unknown. This retrospective study (2012-2016) was conducted by the French Reference Center for Aplastic Anemia on patients with relapsed/refractory aplastic anemia, and patients ineligible for antithymocyte globulin or transplantation, who received eltrombopag for at least 2 months. Forty-six patients with aplastic anemia were given eltrombopag without prior antithymocyte globulin treatment (n=11) or after antithymocyte globulin administration (n=35) in a relapsed/refractory setting. Eltrombopag (median daily dose 150 mg) was introduced 17 months (range, 8-50) after the diagnosis of aplastic anemia. At last followup, 49% were still receiving treatment, 9% had stopped due to a robust response, 2% due to toxicity and 40% due to eltrombopag failure. Before eltrombopag treatment, all patients received regular transfusions. The overall rates of red blood cell and platelet transfusion independence were 7%, 33%, 46% and 46% at 1, 3, 6 months and last follow-up. Responses were slower to develop in antithymocyte treatment-naïve patients. In patients achieving transfusion independence, hemoglobin concentration and platelet counts improved by 3 g/dL (interquartile range, 1.4-4.5) and 42×10<sup>9</sup>/L (interquartile range, 11-100), respectively. Response in at least one lineage (according to National Institutes of Health criteria) was observed in 64% of antithymocyte treatment-naïve and 74% of relapsed/refractory patients, while trilineage improvement was observed in 27% and 34%, respectively. We found high rates of hematologic improvement and transfusion independence in refractory aplastic anemia patients but also in patients ineligible for antithymocyte globulin receiving first-line treatment. In conclusion, elderly patients unfit for antithymocyte globulin therapy may benefit from eltrombopag.

Also flagged:impairmenthyperopiananophthalmosMFRPangle closure glaucomacystic macular edema
Journal Article 2017-11-23 ✓ 2 Snippets Velez G, Tsang SH, Tsai YT, Hsu CW, Gore A, Abdelhakim AH, Mahajan M, Silverman RH, Sparrow JR, Bassuk AG, Mahajan VB.
In-Text Gene Mentions

We identified downregulation of protein pathways linked to retinal degeneration: cilia assembly (CEP97), oxidative stress (PRDX6), iron metabolism (Ferritin), and cell growth (BSG and CSPG5; Fig. 3B,C)10–15.

…(CEP97), oxidative stress (PRDX6), iron metabolism (Ferritin),…

Show Full Abstract

Hyperopia (farsightedness) is a common and significant cause of visual impairment, and extreme hyperopia (nanophthalmos) is a consequence of loss-of-function MFRP mutations. MFRP deficiency causes abnormal eye growth along the visual axis and significant visual comorbidities, such as angle closure glaucoma, cystic macular edema, and exudative retinal detachment. The Mfrp <sup>rd6</sup> /Mfrp <sup>rd6</sup> mouse is used as a pre-clinical animal model of retinal degeneration, and we found it was also hyperopic. To test the effect of restoring Mfrp expression, we delivered a wild-type Mfrp to the retinal pigmented epithelium (RPE) of Mfrp <sup>rd6</sup> /Mfrp <sup>rd6</sup> mice via adeno-associated viral (AAV) gene therapy. Phenotypic rescue was evaluated using non-invasive, human clinical testing, including fundus auto-fluorescence, optical coherence tomography, electroretinography, and ultrasound. These analyses showed gene therapy restored retinal function and normalized axial length. Proteomic analysis of RPE tissue revealed rescue of specific proteins associated with eye growth and normal retinal and RPE function. The favorable response to gene therapy in Mfrp <sup>rd6</sup> /Mfrp <sup>rd6</sup> mice suggests hyperopia and associated refractive errors may be amenable to AAV gene therapy.

Also flagged:diabetesalbuminlinoleic acidSIX3SIX2TMC6
Journal Article 2017-11-23 No Snippets Hachiya T, Komaki S, Hasegawa Y, Ohmomo H, Tanno K, Hozawa A, Tamiya G, Yamamoto M, Ogasawara K, Nakamura M, Hitomi J, Ishigaki Y, Sasaki M, Shimizu A.
Show Full Abstract

Glycated haemoglobin (HbA<sub>1c</sub>) is widely used as a biomarker for the diagnosis of diabetes, for population-level screening, and for monitoring the glycaemic status during medical treatment. Although the heritability of HbA<sub>1c</sub> has been estimated at ~55-75%, a much smaller proportion of phenotypic variance is explained by the HbA<sub>1c</sub>-associated variants identified so far. To search for novel loci influencing the HbA<sub>1c</sub> levels, we conducted a genome-wide meta-analysis of 2 non-diabetic Japanese populations (n = 7,704 subjects in total). We identified 2 novel loci that achieved genome-wide significance: TMC6-TMC8 (P = 5.3 × 10<sup>-20</sup>) and SIX3-SIX2 (P = 8.6 × 10<sup>-9</sup>). Data from the largest-scale European GWAS conducted for HbA<sub>1c</sub> supported an association between the novel TMC6-TMC8 locus and HbA<sub>1c</sub> (P = 2.7 × 10<sup>-3</sup>). The association analysis with glycated albumin and glycation gap conducted using our Japanese population indicated that the TMC6-TMC8 and SIX3-SIX2 loci may influence the HbA<sub>1c</sub> level through non-glycaemic and glycaemic pathways, respectively. In addition, the pathway-based analysis suggested that the linoleic acid metabolic and 14-3-3-mediated signalling pathways were associated with HbA<sub>1c</sub>. These findings provide novel insights into the molecular mechanisms that modulate the HbA<sub>1c</sub> level in non-diabetic subjects.

Also flagged:GAPDHβ actinSODcatalaseCSCCYP1A1
Journal Article 2017-11-23 ✓ 5 Snippets Haque S, Sinha N, Ranjit S, Midde NM, Kashanchi F, Kumar S.
In-Text Gene Mentions

PRDX6

…of catalase andPRDX6in exosomes derived…

…Cruz, Dallas, TX;PRDX6Rabbit Mab, LS…

…catalase, GSTK1, andPRDX6levels respectively (Fig.…

…CYP2A6, SOD-2, andPRDX6in exosomes derived…

Show Full Abstract

Smoking is known to exacerbate HIV-1 pathogenesis, especially in monocytes, through the oxidative stress pathway. Exosomes are known to alter HIV-1 pathogenesis through inter-cellular communication. However, the role of exosomes in smoking-mediated HIV-1 pathogenesis is unknown. In this study, we investigated the effect of cigarette smoke condensate (CSC) on the characteristics of monocyte-derived exosomes and their influence on HIV-1 replication. Initially, we demonstrated that CSC reduced total protein and antioxidant capacity in exosomes derived from HIV-1-infected and uninfected macrophages. The exosomes from CSC-treated uninfected cells showed a protective effect against cytotoxicity and viral replication in HIV-1-infected macrophages. However, exosomes derived from HIV-1-infected cells lost their protective capacity. The results suggest that the exosomal defense is likely to be more effective during the early phase of HIV-1 infection and diminishes at the latter phase. Furthermore, we showed CSC-mediated upregulation of catalase in exosomes from uninfected cells, with a decrease in the levels of catalase and PRDX6 in exosomes derived from HIV-1-infected cells. These results suggest a potential role of antioxidant enzymes, which are differentially packaged into CSC-exposed HIV-1-infected and uninfected cell-derived exosomes, on HIV-1 replication of recipient cells. Overall, our study suggests a novel role of exosomes in tobacco-mediated HIV-1 pathogenesis.

Also flagged:Prune belly syndromeEagle-Barrett syndromecongenital disordercryptorchidismBMPR1BSTIM1
Journal Article 2017-11-23 No Snippets Boghossian NS, Sicko RJ, Giannakou A, Dimopoulos A, Caggana M, Tsai MY, Yeung EH, Pankratz N, Cole BR, Romitti PA, Browne ML, Fan R, Liu A, Kay DM, Mills JL.
Show Full Abstract

Prune belly syndrome (PBS), also known as Eagle-Barrett syndrome, is a rare congenital disorder characterized by absence or hypoplasia of the abdominal wall musculature, urinary tract anomalies, and cryptorchidism in males. The etiology of PBS is largely unresolved, but genetic factors are implicated given its recurrence in families. We examined cases of PBS to identify novel pathogenic copy number variants (CNVs). A total of 34 cases (30 males and 4 females) with PBS identified from all live births in New York State (1998-2005) were genotyped using Illumina HumanOmni2.5 microarrays. CNVs were prioritized if they were absent from in-house controls, encompassed ≥10 consecutive probes, were ≥20 Kb in size, had ≤20% overlap with common variants in population reference controls, and had ≤20% overlap with any variant previously detected in other birth defect phenotypes screened in our laboratory. We identified 17 candidate autosomal CNVs; 10 cases each had one CNV and four cases each had two CNVs. The CNVs included a 158 Kb duplication at 4q22 that overlaps the BMPR1B gene; duplications of different sizes carried by two cases in the intron of STIM1 gene; a 67 Kb duplication 202 Kb downstream of the NOG gene, and a 1.34 Mb deletion including the MYOCD gene. The identified rare CNVs spanned genes involved in mesodermal, muscle, and urinary tract development and differentiation, which might help in elucidating the genetic contribution to PBS. We did not have parental DNA and cannot identify whether these CNVs were de novo or inherited. Further research on these CNVs, particularly BMP signaling is warranted to elucidate the pathogenesis of PBS.

Also flagged:ThbdRatCancerPLGKLKB1bright
Journal Article 2017-11-23 ✓ 1 Snippet Sahu A, Jha PK, Prabhakar A, Singh HD, Gupta N, Gupta N, Chatterjee T, Tyagi T, Sharma S, Kumari B, Singh S, Nair V, Goel S, Ashraf MZ.
In-Text Gene Mentions

…S deficiency andAntithrombin-IIIdeficiency.…

Show Full Abstract

Venous thromboembolism (VTE), the third leading cardiovascular complication, requires more understanding at molecular levels. Here, we have identified miR-145 as a key molecule for regulating thrombus formation in venous thrombosis (VT) employing network based bioinformatics approach and in vivo experiments. Levels of miR-145 showed an inverse correlation with thrombus load determined by coagulation variables. MiRNA target prediction tools and in vitro study identified tissue factor (TF) as a target gene for miR-145. The restoration of miR-145 levels in thrombotic animals via in vivo miR-145 mimic delivery resulted in decreased TF level and activity, accompanied by reduced thrombogenesis. MiR-145 levels were also reduced in VT patients and correlated with increased TF levels in patients, thereby, confirming our preclinical findings. Our study identifies a previously undescribed role of miRNA in VT by regulating TF expression. Therefore, restoration of miR-145 levels may serve as a promising therapeutic strategy for management of VT.

Also flagged:carrageenanhistaminecoagulationbacterial infectionscancerdysentery
Journal Article 2017-11-23 ✓ 1 Snippet Ismail H, Rasheed A, Haq IU, Jafri L, Ullah N, Dilshad E, Sajid M, Mirza B.
In-Text Gene Mentions

…Activation ofantithrombin-IIIis the one…

Show Full Abstract

Five medicinal plants of Pakistan were investigated for their antinociceptive, anti-inflammatory, antidepressant, and anticoagulant potential. Antinociceptive activity was estimated by hot plate and writhing assay. In hot plate assay, <i>Quercus dilatata</i> (52.2%) and <i>Hedera nepalensis</i> (59.1%) showed moderate while <i>Withania coagulans</i> (65.3%) displayed a significant reduction in pain. On the other hand, in writhing assay, <i>Quercus dilatata</i> (49.6%), <i>Hedera nepalensis</i> (52.7%), and <i>Withania coagulans</i> (62.0%) showed comparative less activity. In anti-inflammatory assays crude extracts showed significant edema inhibition in a dose dependent manner. In carrageenan assay, the highest activity was observed for <i>Withania coagulans</i> (70.0%) followed by <i>Quercus dilatata</i> (66.7%) and <i>Hedera nepalensis</i> (63.3%). Similar behavior was observed in histamine assay with percentage inhibitions of 74.3%, 60.4%, and 63.5%, respectively. Antidepressant activity was estimated by forced swim test and the most potent activity was revealed by <i>Withania coagulans</i> with immobility time 2.2s (95.9%) followed by <i>Hedera nepalensis</i> with immobility time 25.3s (53.4%). Moreover, the crude extracts of <i>Fagonia cretica</i> (74.6%), <i>Hedera nepalensis</i> (73.8%), and <i>Phytolacca latbenia</i> (67.3%) showed good anticoagulant activity with coagulation times 86.9s, 84.3s, and 67.5s, respectively. Collectively, the results demonstrate that these five plants have rich medicinal constituents which can be further explored.

Also flagged:selenoprotein glutathione peroxidase 2seleniumcalcium-activated chloride channel regulator 1CLCA1CLCA2CLCA3
Journal Article 2017-11-23 ✓ 1 Snippet Lennicke C, Rahn J, Wickenhauser C, Lichtenfels R, Müller AS, Wessjohann LA, Kipp AP, Seliger B.
In-Text Gene Mentions

…(DUSP3) and peroxiredoxin-6 (PRDX6) were downregulated under…

Show Full Abstract

The selenoprotein glutathione peroxidase 2 (GPx2) is expressed in the epithelium of the gastrointestinal tract, where it is thought to be involved in maintaining mucosal homeostasis. To gain novel insights into the role of GPx2, proteomic profiles of colonic tissues either derived from wild type (WT) or GPx2 knockout (KO) mice, maintained under selenium (Se) deficiency or adequate Se supplementation conditions were established and analyzed. Amongst the panel of differentially expressed proteins, the calcium-activated chloride channel regulator 1 (CLCA1) was significantly down-regulated in GPx2 KO versus WT mice regardless of the given Se status. Moreover, transcript levels of the isoforms CLCA2 and CLCA3 showed a similar expression pattern. In the intestine, CLCA1 is usually restricted to mucin-producing goblet cells. However, although -SeKO mice had the highest numbers of goblet cells as confirmed by significantly enhanced mRNA expression levels of the goblet cell marker mucin-2, the observed expression pattern suggests that GPx2 KO goblet cells might be limited in synthesizing CLCA1. Furthermore, transcript levels of differentiation markers such as chromogranin-1 (Chga) for enteroendocrine cells and leucine-rich repeat-containing G-protein coupled receptor 5 (Lgr5) for stem cells were also downregulated in GPx2 KO mice. Moreover, this was accompanied by a downregulation of the mRNA expression levels of the intestinal hormones glucagon-like peptide 1 (Glp1), ghrelin (Ghrl) and somatostatin (Sst). Thus, it seems that GPx2 might be important for the modulation of cell fate decisions in the murine intestinal epithelium.

Also flagged:CachexiaSarcopeniacongestive heart failureCHFcardiac cachexiadilated cardiomyopathy
Journal Article 2017-11-23 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:malignant neoplasmskin cancersdeathtumorsarsenicimmune suppression
Journal Article 2017-11-22 No Snippets Pellegrini C, Maturo MG, Di Nardo L, Ciciarelli V, Gutiérrez García-Rodrigo C, Fargnoli MC.
Show Full Abstract

Basal cell carcinoma (BCC) is the most common human cancer and represents a growing public health care problem. Several tumor suppressor genes and proto-oncogenes have been implicated in BCC pathogenesis, including the key components of the Hedgehog pathway, <i>PTCH</i>1 and <i>SMO</i>, the <i>TP</i>53 tumor suppressor, and members of the <i>RAS</i> proto-oncogene family. Aberrant activation of the Hedgehog pathway represents the molecular driver in basal cell carcinoma pathogenesis, with the majority of BCCs carrying somatic point mutations, mainly ultraviolet (UV)-induced, and/or copy-loss of heterozygosis in the <i>PTCH</i>1 gene. Recent advances in sequencing technology allowed genome-scale approaches to mutation discovery, identifying new genes and pathways potentially involved in BCC carcinogenesis. Mutational and functional analysis suggested <i>PTPN</i>14 and <i>LATS</i>1, both effectors of the Hippo-YAP pathway, and <i>MYCN</i> as new BCC-associated genes. In addition, emerging reports identified frequent non-coding mutations within the regulatory promoter sequences of the <i>TERT</i> and <i>DPH</i>3<i>-OXNAD</i>1 genes. Thus, it is clear that a more complex genetic network of cancer-associated genes than previously hypothesized is involved in BCC carcinogenesis, with a potential impact on the development of new molecular targeted therapies. This article reviews established knowledge and new hypotheses regarding the molecular genetics of BCC pathogenesis.

Also flagged:SynthesisSpironucleosidesnucleosidecarbonsugarnucleosides
Journal Article 2017-11-22 No Snippets Soengas RG, da Silva G, Estévez JC.
Show Full Abstract

Spironucleosides are a type of conformationally restricted nucleoside analogs in which the anomeric carbon belongs simultaneously to the sugar moiety and to the base unit. This locks the nucleic base in a specific orientation around the <i>N</i>-glycosidic bond, imposing restrictions on the flexibility of the sugar moiety. Anomeric spiro-functionalized nucleosides have gained considerable importance with the discovery of hydantocidin, a natural spironucleoside isolated from fermentation broths of <i>Streptomyces hygroscopicus</i> which exhibits potent herbicidal activity. The biological activity of hydantocidin has prompted considerable synthetic interest in this nucleoside and also in a variety of analogues, since important pharmaceutical leads can be found among modified nucleoside analogues. We present here an overview of the most important advances in the synthesis of spironucleosides.

Also flagged:tumorcancerbreast cancerBRCAgene expressioncell proliferation
Journal Article 2017-11-22 No Snippets Dopazo J, Erten C.
Show Full Abstract

<h4>Background</h4>Identification of driver genes related to certain types of cancer is an important research topic. Several systems biology approaches have been suggested, in particular for the identification of breast cancer (BRCA) related genes. Such approaches usually rely on differential gene expression and/or mutational landscape data. In some cases interaction network data is also integrated to identify cancer-related modules computationally.<h4>Results</h4>We provide a framework for the comparative graph-theoretical analysis of networks integrating the relevant gene expression, mutations, and potein-protein interaction network data. The comparisons involve a graph-theoretical analysis of normal and tumor network pairs across all instances of a given set of breast cancer samples. The network measures under consideration are based on appropriate formulations of various centrality measures: betweenness, clustering coefficients, degree centrality, random walk distances, graph-theoretical distances, and Jaccard index centrality.<h4>Conclusions</h4>Among all the studied centrality-based graph-theoretical properties, we show that a betweenness-based measure differentiates BRCA genes across all normal versus tumor network pairs, than the rest of the popular centrality-based measures. The AUROC and AUPR values of the gene lists ordered with respect to the measures under study as compared to NCBI BioSystems pathway and the COSMIC database of cancer genes are the largest with the betweenness-based differentiation, followed by the measure based on degree centrality. In order to test the robustness of the suggested measures in prioritizing cancer genes, we further tested the two most promising measures, those based on betweenness and degree centralities, on randomly rewired networks. We show that both measures are quite resilient to noise in the input interaction network. We also compared the same measures against a state-of-the-art alternative disease gene prioritization method, MUFFFINN. We show that both our graph-theoretical measures outperform MUFFINN prioritizations in terms of ROC and precions/recall analysis. Finally, we filter the ordered list of the best measure, the betweenness-based differentiation, via a maximum-weight independent set formulation and investigate the top 50 genes in regards to literature verification. We show that almost all genes in the list are verified by the breast cancer literature and three genes are presented as novel genes that may potentialy be BRCA-related but missing in literature.

Also flagged:IronType 2 DiabetesdiabetesSLC40A1TMPRSS6death
Journal Article 2017-11-22 ✓ 4 Snippets Meidtner K, Podmore C, Kröger J, van der Schouw YT, Bendinelli B, Agnoli C, Arriola L, Barricarte A, Boeing H, Cross AJ, Dow C, Ekblom K, Fagherazzi G, Franks PW, Gunter MJ, Huerta JM, Jakszyn P, Jenab M, Katzke VA, Key TJ, Khaw KT, Kühn T, Kyrø C, Mancini FR, Melander O, Nilsson PM, Overvad K, Palli D, Panico S, Quirós JR, Rodríguez-Barranco M, Sacerdote C, Sluijs I, Stepien M, Tjonneland A, Tumino R, Forouhi NG, Sharp SJ, Langenberg C, Schulze MB, Riboli E, Wareham NJ.
In-Text Gene Mentions

…genes (rs1799945 (HFEH63D), rs1800562 (…

…H63D), rs1800562 (HFEC282Y), rs236918 (…

HFE

hemochromatosis

Show Full Abstract

<h4>Objective</h4>Meat intake has been consistently shown to be positively associated with incident type 2 diabetes. Part of that association may be mediated by body iron status, which is influenced by genetic factors. We aimed to test for interactions of genetic and dietary factors influencing body iron status in relation to the risk of incident type 2 diabetes.<h4>Research design and methods</h4>The case-cohort comprised 9,347 case subjects and 12,301 subcohort participants from eight European countries. Single nucleotide polymorphisms (SNPs) were selected from genome-wide association studies on iron status biomarkers and candidate gene studies. A ferritin-related gene score was constructed. Multiplicative and additive interactions of heme iron and SNPs as well as the gene score were evaluated using Cox proportional hazards regression.<h4>Results</h4>Higher heme iron intake (per 1 SD) was associated with higher ferritin levels (β = 0.113 [95% CI 0.082; 0.144]), but not with transferrin (-0.019 [-0.043; 0.006]) or transferrin saturation (0.016 [-0.006; 0.037]). Five SNPs located in four genes (rs1799945 [<i>HFE</i> H63D], rs1800562 [<i>HFE</i> C282Y], rs236918 [<i>PCK7</i>], rs744653 [<i>SLC40A1</i>], and rs855791 [<i>TMPRSS6</i> V736A]) were associated with ferritin. We did not detect an interaction of heme iron and the gene score on the risk of diabetes in the overall study population (<i>P</i><sub>add</sub> = 0.16, <i>P</i><sub>mult</sub> = 0.21) but did detect a trend toward a negative interaction in men (<i>P</i><sub>add</sub> = 0.04, <i>P</i><sub>mult</sub> = 0.03).<h4>Conclusions</h4>We found no convincing evidence that the interplay of dietary and genetic factors related to body iron status associates with type 2 diabetes risk above the level expected from the sum or product of the two individual exposures.

Also flagged:methanemineralization4watermetabolismnitrate
Journal Article 2017-11-22 No Snippets Aben RCH, Barros N, van Donk E, Frenken T, Hilt S, Kazanjian G, Lamers LPM, Peeters ETHM, Roelofs JGM, de Senerpont Domis LN, Stephan S, Velthuis M, Van de Waal DB, Wik M, Thornton BF, Wilkinson J, DelSontro T, Kosten S.
Show Full Abstract

Methane (CH<sub>4</sub>) strongly contributes to observed global warming. As natural CH<sub>4</sub> emissions mainly originate from wet ecosystems, it is important to unravel how climate change may affect these emissions. This is especially true for ebullition (bubble flux from sediments), a pathway that has long been underestimated but generally dominates emissions. Here we show a remarkably strong relationship between CH<sub>4</sub> ebullition and temperature across a wide range of freshwater ecosystems on different continents using multi-seasonal CH<sub>4</sub> ebullition data from the literature. As these temperature-ebullition relationships may have been affected by seasonal variation in organic matter availability, we also conducted a controlled year-round mesocosm experiment. Here 4 °C warming led to 51% higher total annual CH<sub>4</sub> ebullition, while diffusion was not affected. Our combined findings suggest that global warming will strongly enhance freshwater CH<sub>4</sub> emissions through a disproportional increase in ebullition (6-20% per 1 °C increase), contributing to global warming.

Also flagged:CD151glomerular diseasemembranegene expressionmatrix metalloproteaseMMP-10
Journal Article 2017-11-22 ✓ 1 Snippet Naudin C, Smith B, Bond DR, Dun MD, Scott RJ, Ashman LK, Weidenhofer J, Roselli S.
In-Text Gene Mentions

…Gdnf, Adora2b andHtt), inflammation (…

Show Full Abstract

In humans and FVB/N mice, loss of functional tetraspanin CD151 is associated with glomerular disease characterised by early onset proteinuria and ultrastructural thickening and splitting of the glomerular basement membrane (GBM). To gain insight into the molecular mechanisms associated with disease development, we characterised the glomerular gene expression profile at an early stage of disease progression in FVB/N Cd151 <sup>-/-</sup> mice compared to Cd151 <sup>+/+</sup> controls. This study identified 72 up-regulated and 183 down-regulated genes in FVB/N Cd151 <sup>-/-</sup> compared to Cd151 <sup>+/+</sup> glomeruli (p < 0.05). Further analysis highlighted induction of the matrix metalloprotease MMP-10 and the extracellular matrix protein mindin (encoded by Spon2) in the diseased FVB/N Cd151 <sup>-/-</sup> GBM that did not occur in the C57BL/6 diseased-resistant strain. Interestingly, mindin was also detected in urinary samples of FVB/N Cd151 <sup>-/-</sup> mice, underlining its potential value as a biomarker for glomerular diseases associated with GBM alterations. Gene set enrichment and pathway analysis of the microarray dataset showed enrichment in axon guidance and actin cytoskeleton signalling pathways as well as activation of inflammatory pathways. Given the known function of mindin, its early expression in the diseased GBM could represent a trigger of both further podocyte cytoskeletal changes and inflammation, thereby playing a key role in the mechanisms of disease progression.

Also flagged:Phospholipase A2synthesisprostate cancercervical cancercancerupconversion nanoparticles
Journal Article 2017-11-22 No Snippets Sharipov M, Tawfik SM, Gerelkhuu Z, Huy BT, Lee YI.
Show Full Abstract

We report the effective synthesis of biocompatible upconversion nanoparticles (UCNP)-loaded phosphate micelles and successful delivery of UCNPs to prostate cancer cells via secreted phospholipase A2 (sPLA-2) enzyme cleavage of the loaded micelles for the first time. The activity of the (sPLA-2) enzyme toward the synthesized micelles was investigated and confirmed by LC-MS. TEM results showed that the micelles have a size distribution of 80 to 150 nm, whereas UCNP-loaded micelles range from 200 to 350 nm, indicating the successful loading of UCNPs. The selective release of UCNPs to prostate cancer cells rather than other cells, specifically cervical cancer cells, was observed and confirmed by a range of bioimaging studies. Moreover, cytotoxicity assays confirmed the biocompatibility of the UCNP-loaded micelles.

Also flagged:Alzheimeranxietybreast cancercongenital heart defectscongenital diaphragmatic herniamultiple congenital anomalies
Journal Article 2017-11-22 No Snippets Wynn J, Martinez J, Bulafka J, Duong J, Zhang Y, Chiuzan C, Preti J, Cremona ML, Jobanputra V, Fyer AJ, Klitzman RL, Appelbaum PS, Chung WK.
Show Full Abstract

The impact of returning secondary results from exome sequencing (ES) on patients/participants is important to understand as ES is increasingly utilized in clinical care and research. Participants were recruited from studies using ES and were separated into two arms: 107 who had ES and were offered the choice to learn secondary results (ES group) and 85 who had not yet had ES (No ES group). Questionnaires were administered at baseline and 1 and 12 months, following results disclosure (ES group) or enrollment (No ES group). While the majority (65%) elected to learn all results following pre-test counseling, it was reduced from the 76% who indicated a desire for all results at baseline. Thirty-seven percent received results associated with an increased personal disease risk. There were no differences in changes in any of the psychological and social measures from baseline to post-results disclosure between the ES and No ES groups. Receiving a wide range of secondary findings appeared to have little measurable impact on most participants. The experience of learning secondary results may be related to participants' previous experiences with genetics, as well as the genetic counseling provided. Future research with a more diverse, genetically naïve group, as well as scalable methods of delivery, is needed.

Also flagged:annexinpolypeptidepolynucleotidepolypeptidesribonucleic acidsamino acid
Journal Article 2017-11-22 No Snippets Gore S, Sanz García E, Hendrickx PMS, Gutmanas A, Westbrook JD, Yang H, Feng Z, Baskaran K, Berrisford JM, Hudson BP, Ikegawa Y, Kobayashi N, Lawson CL, Mading S, Mak L, Mukhopadhyay A, Oldfield TJ, Patwardhan A, Peisach E, Sahni G, Sekharan MR, Sen S, Shao C, Smart OS, Ulrich EL, Yamashita R, Quesada M, Young JY, Nakamura H, Markley JL, Berman HM, Burley SK, Velankar S, Kleywegt GJ.
Show Full Abstract

The Worldwide PDB recently launched a deposition, biocuration, and validation tool: OneDep. At various stages of OneDep data processing, validation reports for three-dimensional structures of biological macromolecules are produced. These reports are based on recommendations of expert task forces representing crystallography, nuclear magnetic resonance, and cryoelectron microscopy communities. The reports provide useful metrics with which depositors can evaluate the quality of the experimental data, the structural model, and the fit between them. The validation module is also available as a stand-alone web server and as a programmatically accessible web service. A growing number of journals require the official wwPDB validation reports (produced at biocuration) to accompany manuscripts describing macromolecular structures. Upon public release of the structure, the validation report becomes part of the public PDB archive. Geometric quality scores for proteins in the PDB archive have improved over the past decade.

Also flagged:SleepdegradationE3 ligaseCLOCK
Journal Article 2017-11-22 ✓ 5 Snippets Li Q, Li Y, Wang X, Qi J, Jin X, Tong H, Zhou Z, Zhang ZC, Han J.
In-Text Gene Mentions

Our study uncovered a critical molecular linkage between the circadian clock and the electrical activity of pacemaker neurons and demonstrated that CLOCK-dependent Fbxl4 expression rhythmically downregulates GABA<sub>A</sub> receptor level to increase the activity of pacemaker neurons and promote wakefulness.

Fbxl4Serves as a…

…the E3 ligaseFbxl4promotes GABA<sub>A</sub> rece…

…we demonstrated thatFbxl4regulates the timing…

…onstrated that CLOCK-dependentFbxl4expression rhythmically downre…

Show Full Abstract

The timing of sleep is tightly governed by the circadian clock, which contains a negative transcriptional feedback loop and synchronizes the physiology and behavior of most animals to daily environmental oscillations. However, how the circadian clock determines the timing of sleep is largely unclear. In vertebrates and invertebrates, the status of sleep and wakefulness is modulated by the electrical activity of pacemaker neurons that are circadian regulated and suppressed by inhibitory GABAergic inputs. Here, we showed that Drosophila GABA<sub>A</sub> receptors undergo rhythmic degradation in arousal-promoting large ventral lateral neurons (lLNvs) and their expression level in lLNvs displays a daily oscillation. We also demonstrated that the E3 ligase Fbxl4 promotes GABA<sub>A</sub> receptor ubiquitination and degradation and revealed that the transcription of fbxl4 in lLNvs is CLOCK dependent. Finally, we demonstrated that Fbxl4 regulates the timing of sleep through rhythmically reducing GABA sensitivity to modulate the excitability of lLNvs. Our study uncovered a critical molecular linkage between the circadian clock and the electrical activity of pacemaker neurons and demonstrated that CLOCK-dependent Fbxl4 expression rhythmically downregulates GABA<sub>A</sub> receptor level to increase the activity of pacemaker neurons and promote wakefulness.

Also flagged:acetylcholinePKCRaf-1MEK1ERK1Raf
Journal Article 2017-11-22 ✓ 4 Snippets Albano GD, Bonanno A, Moscato M, Anzalone G, Di Sano C, Riccobono L, Wenzel SE, Profita M.
In-Text Gene Mentions

<h4>Background</h4>Cigarette smoke extract (CSE) affects the expression of non-neuronal components of cholinergic system in bronchial epithelial cells and, as PEBP1/Raf-mediated MAPK1/2 and ERK1/2 pathway, promotes inflammation and oxidative stress.<h4>Aims</h4>We studied whether Acetylcholine (ACh) is involved in the mechanism of crosstalk between mAChRM3 and β2Adrenergic receptors (β2AR) promoting, via PI3/PKC/PBEP1/Raf/MEK1/2/ERK1/2 activation, β2AR desensitization, inflammation and, oxidative stress in a bronchial epithelial cell line (16HBE) after long-term exposure to cigarette smoke extract (LECSE).<h4>Methods</h4>We evaluated mAChRM3 and Choline Acetyltransferase (ChAT) expression, ACh production, PEBP1, ERk1/2, and β2AR phosphorylation, as well as NOX-4, ROS production and IL-8 release in 16HBE after LECSE.

…cells and, asPEBP1/Raf-mediated MAPK1/2 and ERK1…

…expression, ACh production,PEBP1, ERk1/2, and β2AR…

…uction which enhances PI3/PKC/PEBP1/Raf-ERK1/2 pathway activation…

Show Full Abstract

<h4>Background</h4>Cigarette smoke extract (CSE) affects the expression of non-neuronal components of cholinergic system in bronchial epithelial cells and, as PEBP1/Raf-mediated MAPK1/2 and ERK1/2 pathway, promotes inflammation and oxidative stress.<h4>Aims</h4>We studied whether Acetylcholine (ACh) is involved in the mechanism of crosstalk between mAChRM3 and β2Adrenergic receptors (β2AR) promoting, via PI3/PKC/PBEP1/Raf/MEK1/2/ERK1/2 activation, β2AR desensitization, inflammation and, oxidative stress in a bronchial epithelial cell line (16HBE) after long-term exposure to cigarette smoke extract (LECSE).<h4>Methods</h4>We evaluated mAChRM3 and Choline Acetyltransferase (ChAT) expression, ACh production, PEBP1, ERk1/2, and β2AR phosphorylation, as well as NOX-4, ROS production and IL-8 release in 16HBE after LECSE. The inhibitory activity of Hemicholinium (HCh-3) (a potent choline uptake blocker), LY294002 (a highly selective inhibitor of PI3 kinase), Tiotropium (Spiriva®) (anticholinergic drug) and Olodaterol (β<sub>2</sub>AR agonist), were tested in 16HBE after LECSE.<h4>Results</h4>mAChRM3, ChAT, ACh activity, pPEBP1, pβ2AR, pERK1/2, ROS, NOX-4 and IL-8 increased after LECSE in 16HBE LECSE compared to untreated cells. HCh-3 and LY294002 (alone or in combination) as well as Tiotropium (Spiriva®) or Olodaterol (alone or in combination) all reduced the levels of pPEBP1, pβ2AR, pERK1/2, ROS, NOX-4, and IL-8 in 16HBE LECSE compared to untreated cells.<h4>Conclusions</h4>LECSE promotes ACh production which enhances PI3/PKC/PEBP1/Raf-ERK1/2 pathway activation, heterologous β2AR desensitization, as well as release of inflammatory and oxidative mediators in bronchial epithelial cells. The use of anticholinergic drugs and long-acting β2-agonists, alone or in combination may be dampen these inflammatory mechanisms when used in combination in some epithelial cell types.

Also flagged:myelodysplastic syndromeshematopoietic stem cellchromosomehematopoiesissplicing factorstranscription factors
Journal Article 2017-11-22 ✓ 1 Snippet Dussiau C, Fontenay M.
In-Text Gene Mentions

…volving epigenetic regulators,chromatin modifiersmodifiers, splicing factors,…

Show Full Abstract

Myelodysplastic syndromes (MDS) are hematopoietic stem cell (HSC) disorders in which recurrent chromosome abnormalities and gene mutations define a clonal hematopoiesis. The MDS-initiating cell is a rare HSC which transmits the genetic abnormalities to its myeloid and lymphoid progeny. The heterogeneity of MDS phenotypes could be linked to the diversity of genetic events involving epigenetic regulators, chromatin modifiers, splicing factors, transcription factors and signaling adaptors, the various combinations and order of mutations in cooperating genes, and the variegation of clonal hematopoietic hierarchy. Usually, epigenetic and splicing gene mutations occur first. A combination of one epigenetic event with a splicing gene alteration is frequent. The HSC compartment is invaded by a dominant and few minor clones organized linearly or with a branched architecture. The dominant clone containing the first initiating mutations produces myeloid and lymphoid lineages in transplanted immune-deficient mice. The mutations confer a selective advantage to myeloid progenitors at the expense of lymphoid progenitors. In the context of differentiation, one mutation may favor the amplification of granulo-monocytic progenitor, which drives the transformation into acute myeloid leukemia. Understanding the hierarchy of mutations provides insights on the mechanism of transformation. Investigation of mutation pattern and distribution along the hematopoietic tree may influence the therapeutic decision for targeted therapy.

Also flagged:Nucleosidereverse transcriptaseacquired immunodeficiency syndromemitochondrialmitochondrial DNA (mtDNA) polymerase gammaPolg
Journal Article 2017-11-22 No Snippets Young MJ.
Show Full Abstract

Nucleoside reverse transcriptase inhibitors (NRTIs) were the first drugs used to treat human immunodeficiency virus (HIV) the cause of acquired immunodeficiency syndrome. Development of severe mitochondrial toxicity has been well documented in patients infected with HIV and administered NRTIs. <i>In vitro</i> biochemical experiments have demonstrated that the replicative mitochondrial DNA (mtDNA) polymerase gamma, Polg, is a sensitive target for inhibition by metabolically active forms of NRTIs, nucleotide reverse transcriptase inhibitors (NtRTIs). Once incorporated into newly synthesized daughter strands NtRTIs block further DNA polymerization reactions. Human cell culture and animal studies have demonstrated that cell lines and mice exposed to NRTIs display mtDNA depletion. Further complicating NRTI off-target effects on mtDNA maintenance, two additional DNA polymerases, Pol beta and PrimPol, were recently reported to localize to mitochondria as well as the nucleus. Similar to Polg, <i>in vitro</i> work has demonstrated both Pol beta and PrimPol incorporate NtRTIs into nascent DNA. Cell culture and biochemical experiments have also demonstrated that antiviral ribonucleoside drugs developed to treat hepatitis C infection act as off-target substrates for POLRMT, the mitochondrial RNA polymerase and primase. Accompanying the above-mentioned topics, this review examines: (1) mtDNA maintenance in human health and disease, (2) reports of DNA polymerases theta and zeta (Rev3) localizing to mitochondria, and (3) additional drugs with off-target effects on mitochondrial function. Lastly, mtDNA damage may induce cell death; therefore, the possibility of utilizing compounds that disrupt mtDNA maintenance to kill cancer cells is discussed.

Also flagged:gene expressiontitanium dioxidecolorectal tumourspolycarbonatewatersevoflurane
Journal Article 2017-11-22 No Snippets Proquin H, Jetten MJ, Jonkhout MCM, Garduño-Balderas LG, Briedé JJ, de Kok TM, Chirino YI, van Loveren H.
Show Full Abstract

We investigated gene expression responses in BALB/c mice exposed by gavage to 5 mg/kg bw/day of E171 for 2, 7, 14 and 21 days. Food additive E171 (titanium dioxide) has been shown to induce oxidative stress and DNA damage <i>in vitro</i> as well as facilitating growth of colorectal tumours <i>in vivo</i>. Full genome expression changes of the colon of mice were investigated by using Agilent SurePrint G3 mouse Gene exp 60kv2 microarrays slides. The data presented in this DiB include all differentially expressed for each time point with EntrezGeneID, gene symbols, gene names and Log2FC as well as genes included in pathways after over-representation analysis in ConsensusPathDataBase. The functions of these genes in relation to the colon were described in our associated article (Proquin et al., 2017 in press) [1]. Raw and normalized gene expression data are available through NCBI GEO (GEO accession: GSE92563).

Also flagged:synthesisnorditerpenecyclopropanationlymphocytic leukemiacarcinomacycloheptanone
Journal Article 2017-11-21 No Snippets Roizen JL, Jones AC, Smith RC, Virgil SC, Stoltz BM.
Show Full Abstract

Recently, we reported a convergent cyclopropanation-Cope approach to the core of ineleganolide, which was the first disclosed synthesis of the core of the norditerpene natural product ineleganolide. In this complementary work, a model system for the core of ineleganolide has been prepared through a series of tandem cyclopropanation-Cope and translactonization-Cope rearrangements. Work with this model system has enriched our understanding of the cyclopropanation-Cope rearrangement sequence. Additionally, research into this model system has driven the development of tandem translactonization-Cope rearrangements.

Also flagged:mitochondrialnucleotidecytochrome bcobnicotinamide dehydrogenase subunit 1nad 1
Journal Article 2017-11-21 No Snippets Dao TTH, Nguyen TTG, Gabriël S, Bui KL, Dorny P, Le TH.
Show Full Abstract

<h4>Background</h4>An opisthorchiid liver fluke was recently reported from ducks (Anas platyrhynchos) in Binh Dinh Province of Central Vietnam, and referred to as "Opisthorchis viverrini-like". This species uses common cyprinoid fishes as second intermediate hosts as does Opisthorchis viverrini, with which it is sympatric in this province. In this study, we refer to the liver fluke from ducks as "Opisthorchis sp. BD2013", and provide new sequence data from the mitochondrial (mt) genome and the nuclear ribosomal transcription unit. A phylogenetic analysis was conducted to clarify the basal taxonomic position of this species from ducks within the genus Opisthorchis (Digenea: Opisthorchiidae).<h4>Methods</h4>Adults and eggs of liver flukes were collected from ducks, metacercariae from fishes (Puntius brevis, Rasbora aurotaenia, Esomus metallicus) and cercariae from snails (Bithynia funiculata) in different localities in Binh Dinh Province. From four developmental life stage samples (adults, eggs, metacercariae and cercariae), the complete cytochrome b (cob), nicotinamide dehydrogenase subunit 1 (nad1) and cytochrome c oxidase subunit 1 (cox1) genes, and near-complete 18S and partial 28S ribosomal DNA (rDNA) sequences were obtained by PCR-coupled sequencing. The alignments of nucleotide sequences of concatenated cob + nad1 + cox1, and of concatenated 18S + 28S were separately subjected to phylogenetic analyses. Homologous sequences from other trematode species were included in each alignment.<h4>Results</h4>Phylogenetic trees were inferred from concatenated (cob + nad1 + cox1) nucleotide sequences and combined 18S + 28S nucleotide sequences of five Opisthorchis sp. BD2013 samples and additional reference taxa. Both trees demonstrated the anticipated clustering of taxa within the superfamily Opisthorchioidea, the paraphyly of the genus Opisthorchis and the sister-species relationship of Opisthorchis sp. BD2013 with O. viverrini.<h4>Conclusions</h4>While it is likely that Opisthorchis sp. BD2013 is distinct from O. viverrini, it is clearly a sister taxon of O. viverrini within the limited number of Opisthorchis species for which appropriate sequence data are available. The new sequences provided here will assist the diagnosis and the taxonomic clarification of the opisthorchiid species.

Also flagged:UNC93B1STIM1major histocompatibility complex class Iacidificationdegradationcytosol
Journal Article 2017-11-21 No Snippets Maschalidi S, Nunes-Hasler P, Nascimento CR, Sallent I, Lannoy V, Garfa-Traore M, Cagnard N, Sepulveda FE, Vargas P, Lennon-Duménil AM, van Endert P, Capiod T, Demaurex N, Darrasse-Jèze G, Manoury B.
Show Full Abstract

Dendritic cells (DC) have the unique ability to present exogenous antigens via the major histocompatibility complex class I pathway to stimulate naive CD8<sup>+</sup> T cells. In DCs with a non-functional mutation in Unc93b1 (3d mutation), endosomal acidification, phagosomal maturation, antigen degradation, antigen export to the cytosol and the function of the store-operated-Ca<sup>2+</sup>-entry regulator STIM1 are impaired. These defects result in compromised antigen cross-presentation and anti-tumor responses in 3d-mutated mice. Here, we show that UNC93B1 interacts with the calcium sensor STIM1 in the endoplasmic reticulum, a critical step for STIM1 oligomerization and activation. Expression of a constitutively active STIM1 mutant, which no longer binds UNC93B1, restores antigen degradation and cross-presentation in 3d-mutated DCs. Furthermore, ablation of STIM1 in mouse and human cells leads to a decrease in cross-presentation. Our data indicate that the UNC93B1 and STIM1 cooperation is important for calcium flux and antigen cross-presentation in DCs.

Also flagged:BRCA1psychiatric disordersschizophreniaanorexia nervosaovarian cancerBRCA2
Journal Article 2017-11-21 ✓ 1 Snippet Lázaro-Muñoz G, Farrell MS, Crowley JJ, Filmyer DM, Shaughnessy RA, Josiassen RC, Sullivan PF.
In-Text Gene Mentions

…genetic variation inHTT12 (OMIM #…

Show Full Abstract

There is an emerging consensus that genomic researchers should, at a minimum, offer to return to individual participants clinically valid, medically important and medically actionable genomic findings (for example, pathogenic variants in BRCA1) identified in the course of research. However, this is not a common practice in psychiatric genetics research. Furthermore, psychiatry researchers often generate findings that do not meet all of these criteria, yet there may be ethically compelling arguments to offer selected results. Here, we review the return of results debate in genomics research and propose that, as for genomic studies of other medical conditions, psychiatric genomics researchers should offer findings that meet the minimum criteria stated above. Additionally, if resources allow, psychiatry researchers could consider offering to return pre-specified 'clinically valuable' findings even if not medically actionable-for instance, findings that help corroborate a psychiatric diagnosis, and findings that indicate important health risks. Similarly, we propose offering 'likely clinically valuable' findings, specifically, variants of uncertain significance potentially related to a participant's symptoms. The goal of this Perspective is to initiate a discussion that can help identify optimal ways of managing the return of results from psychiatric genomics research.

Also flagged:major depressive disorderdepressionmajor depressionpsychiatric disordersserotonin-transporterBDNF
Journal Article 2017-11-21 ✓ 1 Snippet Van der Auwera S, Peyrot WJ, Milaneschi Y, Hertel J, Baune B, Breen G, Byrne E, Dunn EC, Fisher H, Homuth G, Levinson D, Lewis C, Mills N, Mullins N, Nauck M, Pistis G, Preisig M, Rietschel M, Ripke S, Sullivan P, Teumer A, Völzke H, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium, Boomsma DI, Wray NR, Penninx B, Grabe H.
In-Text Gene Mentions

LRRIQ3

Show Full Abstract

Gene by environment (GxE) interaction studies have investigated the influence of a number of candidate genes and variants for major depressive disorder (MDD) on the association between childhood trauma and MDD. Most of these studies are hypothesis driven and investigate only a limited number of SNPs in relevant pathways using differing methodological approaches. Here (1) we identified 27 genes and 268 SNPs previously associated with MDD or with GxE interaction in MDD and (2) analyzed their impact on GxE in MDD using a common approach in 3944 subjects of European ancestry from the Psychiatric Genomics Consortium who had completed the Childhood Trauma Questionnaire. (3) We subsequently used the genome-wide SNP data for a genome-wide case-control GxE model and GxE case-only analyses testing for an enrichment of associated SNPs. No genome-wide significant hits and no consistency among the signals of the different analytic approaches could be observed. This is the largest study for systematic GxE interaction analysis in MDD in subjects of European ancestry to date. Most of the known candidate genes/variants could not be supported. Thus, their impact on GxE interaction in MDD may be questionable. Our results underscore the need for larger samples, more extensive assessment of environmental exposures, and greater efforts to investigate new methodological approaches in GxE models for MDD.

Also flagged:DepressionNRXN3neurexin 3citalopramescitalopramITGA9
Journal Article 2017-11-21 ✓ 1 Snippet Fabbri C, Tansey KE, Perlis RH, Hauser J, Henigsberg N, Maier W, Mors O, Placentino A, Rietschel M, Souery D, Breen G, Curtis C, Sang-Hyuk L, Newhouse S, Patel H, Guipponi M, Perroud N, Bondolfi G, O'Donovan M, Lewis G, Biernacka JM, Weinshilboum RM, Farmer A, Aitchison KJ, Craig I, McGuffin P, Uher R, Lewis CM.
In-Text Gene Mentions

Forkhead Box C1

Show Full Abstract

Genome-wide association studies have generally failed to identify polymorphisms associated with antidepressant response. Possible reasons include limited coverage of genetic variants that this study tried to address by exome genotyping and dense imputation. A meta-analysis of Genome-Based Therapeutic Drugs for Depression (GENDEP) and Sequenced Treatment Alternatives to Relieve Depression (STAR*D) studies was performed at the single-nucleotide polymorphism (SNP), gene and pathway levels. Coverage of genetic variants was increased compared with previous studies by adding exome genotypes to previously available genome-wide data and using the Haplotype Reference Consortium panel for imputation. Standard quality control was applied. Phenotypes were symptom improvement and remission after 12 weeks of antidepressant treatment. Significant findings were investigated in NEWMEDS consortium samples and Pharmacogenomic Research Network Antidepressant Medication Pharmacogenomic Study (PGRN-AMPS) for replication. A total of 7062 950 SNPs were analyzed in GENDEP (n=738) and STAR*D (n=1409). rs116692768 (P=1.80e-08, ITGA9 (integrin α9)) and rs76191705 (P=2.59e-08, NRXN3 (neurexin 3)) were significantly associated with symptom improvement during citalopram/escitalopram treatment. At the gene level, no consistent effect was found. At the pathway level, the Gene Ontology (GO) terms GO: 0005694 (chromosome) and GO: 0044427 (chromosomal part) were associated with improvement (corrected P=0.007 and 0.045, respectively). The association between rs116692768 and symptom improvement was replicated in PGRN-AMPS (P=0.047), whereas rs76191705 was not. The two SNPs did not replicate in NEWMEDS. ITGA9 codes for a membrane receptor for neurotrophins and NRXN3 is a transmembrane neuronal adhesion receptor involved in synaptic differentiation. Despite their meaningful biological rationale for being involved in antidepressant effect, replication was partial. Further studies may help in clarifying their role.

Also flagged:Aconitase 2cytosine adenine guanineHDAco2mitochondrialpolyglutamine
Journal Article 2017-11-21 ✓ 5 Snippets Chen CM, Wu YR, Chang KH.
In-Text Gene Mentions

The genetic mutation of HD is an expanded cytosine adenine guanine (CAG) trinucleotide repeat that encodes a polyglutamine (polyQ) tract in the huntingtin (Htt) protein [1].

Given that Htt is expressed ubiquitously, and parallel CNS and peripheral pathogenic pathways have been shown [10,25,26,27], we hypothesized that the decreased Aco2 and its activity may be detectable in peripheral blood cells of HD patients and PreHD carriers, and may therefore serve as a potential biomarker.

…in the huntingtin (Htt) protein [ 1…

…change in theHttwhich tends to…

…of the humanHttgene carrying 150…

Show Full Abstract

Huntington's disease (HD) is caused by an unstable cytosine adenine guanine (CAG) trinucleotide repeat expansion encoding a polyglutamine tract in the huntingtin protein. Previously, we identified several up- and down-regulated protein molecules in the striatum of the Hdh<sup>(CAG)150</sup> knock-in mice at 16 months of age, a mouse model which is modeling the early human HD stage. Among those molecules, aconitase 2 (Aco2) located in the mitochondrial matrix is involved in the energy generation and susceptible to increased oxidative stress that would lead to inactivation of Aco2 activity. In this study, we demonstrate decreased Aco2 protein level and activity in the brain of both Hdh<sup>(CAG)150</sup> and R6/2 mice. Aco2 activity was decreased in striatum of Hdh<sup>(CAG)150</sup> mice at 16 months of age as well as R6/2 mice at 7 to 13 weeks of age. Aco2 activity in the striatum of R6/2 mice could be restored by the anti-oxidant, <i>N</i>-acetyl-l-cysteine, supporting that decreased Aco2 activity in HD is probably caused by increased oxidative damage. Decreased Aco2 activity was further found in the peripheral blood mononuclear cells (PBMC) of both HD patients and pre-symptomatic HD mutation (PreHD) carriers, while the decreased Aco2 protein level of PBMC was only present in HD patients. Aco2 activity correlated significantly with motor score, independence scale, and functional capacity of the Unified Huntington's Disease Rating Scale as well as disease duration. Our study provides a potential biomarker to assess the disease status of HD patients and PreHD carriers.

Also flagged:Deliriumcognitive declineAlzheimerneuropsychiatric syndromeacute cognitive dysfunctiondementia
Journal Article 2017-11-21 ✓ 2 Snippets Tsui A, Kuh D, Richards M, Davis D.
In-Text Gene Mentions

…memory, search speed,ACE-III, and its subdomains)…

…For theACE-III, delirium symptoms were…

Show Full Abstract

<h4>Introduction</h4>Few population studies have investigated whether longitudinal decline after delirium in mid-to-late life might affect specific cognitive domains.<h4>Methods</h4>Participants from a birth cohort completing assessments of search speed, verbal memory, and the Addenbrooke's Cognitive Examination at age 69 were asked about delirium symptoms between ages 60 and 69 years. Linear regression models estimated associations between delirium symptoms and cognitive outcomes.<h4>Results</h4>Period prevalence of delirium between 60 and 69 years was 4% (95% confidence interval 3.2%-4.9%). Self-reported symptoms of delirium over the seventh decade were associated with worse scores in the Addenbrooke's Cognitive Examination (-1.7 points; 95% confidence interval -3.2, -0.1; P = .04). In association with delirium symptoms, verbal memory scores were initially lower, with subsequent decline in search speed by the age of 69 years. These effects were independent of other Alzheimer's risk factors.<h4>Discussion</h4>Delirium symptoms may be common even at relatively younger ages, and their presence may herald cognitive decline, particularly in search speed, over this time period.

Also flagged:obesitygestationdiabeteshypertensiongestational diabetescocaine
Journal Article 2017-11-21 ✓ 1 Snippet Meng Y, Groth SW, Stewart P, Smith JA.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Background</h4>Excessive gestational weight gain (GWG) has a long-term impact on women's body weight and contributes to the development of obesity in the mother and her child. Many risk factors for GWG have been identified, but to date, only 6-33.8% of the variance in GWG has been explained. The purpose of this study was to evaluate the overall variance of GWG that can be explained by including weight-adjusted resting metabolic rate (aRMR) and a genetic risk score constructed on obesity-related genes in addition to sociodemographic and lifestyle factors.<h4>Methods</h4>In this observational study involving 55 African American women, data collected/measured during pregnancy included sociodemographic factors, medical information, lifestyle factors, aRMR, and seven obesity-related genes. Multivariable linear regression was performed to evaluate the variance in GWG explained by the potential risk factors listed above.<h4>Results</h4>The mean GWG was 15 kg (±7.5 kg), and 63.6% of women gained more than the Institute of Medicine's GWG recommendations. The final regression model explained 53.3% of the variance in GWG. Higher genetic risk score, lower aRMR, and higher dietary intake of total energy and percentage of fat were significantly associated with increased GWG ( p < .05). These factors explained 18% additional variance in GWG over that explained by significant sociodemographic and lifestyle factors in the analysis (i.e., maternal age, prepregnancy body mass index, parity, illegal drug use, and education).<h4>Conclusion</h4>Overall, our results indicate that the genetic risk score, aRMR, and dietary intake have a substantial impact on GWG in African American women.

Also flagged:RNA polymerase IIdosage compensationchromosomeschromosomedosage compensation complexPol II
Journal Article 2017-11-21 ✓ 2 Snippets Dasmeh P.
In-Text Gene Mentions

…dosage compensation complex (DCC).…

…the role ofDCCon RNA polymerase…

Show Full Abstract

In heterogametic organisms, expression of unequal number of X chromosomes in males and females is balanced by a process called dosage compensation. In Drosophila and mammals, dosage compensation involves nearly two-fold up-regulation of the X chromosome mediated by dosage compensation complex (DCC). Experimental studies on the role of DCC on RNA polymerase II (Pol II) transcription in mammals disclosed a non-linear relationship between Pol II densities at different transcription steps and mRNA expression. An ∼20-30% increase in Pol II densities corresponds to a rough 200% increase in mRNA expression and two-fold up-regulation. Here, using a simple kinetic model of Pol II transcription calibrated by in vivo measured rate constants of different transcription steps in mammalian cells, we demonstrate how this non-linearity can be explained by multi-step transcriptional regulation. Moreover, we show how multi-step enhancement of Pol II transcription can increase mRNA production while leaving Pol II densities unaffected. Our theoretical analysis not only recapitulates experimentally observed Pol II densities upon two-fold up-regulation but also points to erroneous interpretations of Pol II profiles from chromatin immunoprecipitation sequencing (ChIP-seq) or global run-on assays.

Also flagged:immune dysfunctionmitochondrial diseasesImmunometabolismmetabolismmitochondriamitochondrial disease
Journal Article 2017-11-21 No Snippets Kapnick SM, Pacheco SE, McGuire PJ.
Show Full Abstract

Immunometabolism aims to define the role of intermediary metabolism in immune cell function, with bioenergetics and the mitochondria recently taking center stage. To date, the medical literature on mitochondria and immune function extols the virtues of mouse models in exploring this biologic intersection. While the laboratory mouse has become a standard for studying mammalian biology, this model comprises part of a comprehensive approach. Humans, with their broad array of inherited phenotypes, serve as a starting point for studying immunometabolism; specifically, patients with mitochondrial disease. Using this top-down approach, the mouse as a model organism facilitates further exploration of the consequences of mutations involved in mitochondrial maintenance and function. In this review, we will discuss the emerging phenotype of immune dysfunction in mitochondrial disease as a model for understanding the role of the mitochondria in immune function in available mouse models.

Also flagged:PhosphorylationHdhphosphorfithuntingtinstan
Journal Article 2017-11-21 ✓ 5 Snippets Cariulo C, Azzollini L, Verani M, Martufi P, Boggio R, Chiki A, Deguire SM, Cherubini M, Gines S, Marsh JL, Conforti P, Cattaneo E, Santimone I, Squitieri F, Lashuel HA, Petricca L, Caricasole A.
In-Text Gene Mentions

Phosphorylation of huntingtin at residue T3 is decreased in Huntington's disease and modulates mutant huntingtin protein conformation.

HTT

Levels of pT3 HTT as detected by the anti-pT3 pAb in SDS/PAGE WB are clearly decreased in brain cortex from heterozygous Q7/Q111 and homozygous Q111/Q111 mice compared with WT (Q7/Q7) mice, despite comparable total soluble huntingtin protein levels as detected by MAB2166 (epitope amino acids 442–457; Fig. 4A) or the monoclonal antibody D7F7 (epitope around amino acid 1,220; Fig. S3A, i).

Accumulating evidence indicates that the first 17 amino acids of HTT (N17) play a key role in modulating mutant HTT toxicity (30, 64).

MAB2166 was supplied by a commercial source (catalog #MAB2166; Millipore) and binds to a 15-aa region spanning from amino acids 445 to 459 of the human HTT protein (50).

Show Full Abstract

Posttranslational modifications can have profound effects on the biological and biophysical properties of proteins associated with misfolding and aggregation. However, their detection and quantification in clinical samples and an understanding of the mechanisms underlying the pathological properties of misfolding- and aggregation-prone proteins remain a challenge for diagnostics and therapeutics development. We have applied an ultrasensitive immunoassay platform to develop and validate a quantitative assay for detecting a posttranslational modification (phosphorylation at residue T3) of a protein associated with polyglutamine repeat expansion, namely Huntingtin, and characterized its presence in a variety of preclinical and clinical samples. We find that T3 phosphorylation is greatly reduced in samples from Huntington's disease models and in Huntington's disease patients, and we provide evidence that bona-fide T3 phosphorylation alters Huntingtin exon 1 protein conformation and aggregation properties. These findings have significant implications for both mechanisms of disease pathogenesis and the development of therapeutics and diagnostics for Huntington's disease.

Also flagged:Protocadherin-αC2axonsneuropsychiatric diseasescytoplasmicprotocadherin-αPcdh-α
Journal Article 2017-11-21 ✓ 1 Snippet Katori S, Noguchi-Katori Y, Okayama A, Kawamura Y, Luo W, Sakimura K, Hirabayashi T, Iwasato T, Yagi T.
In-Text Gene Mentions

…transporter (SERT) antibody (HTT-N77, a generous gift…

Show Full Abstract

Serotonergic axons extend diffuse projections throughout various brain areas, and serotonergic system disruption causes neuropsychiatric diseases. Loss of the cytoplasmic region of protocadherin-α (Pcdh-α) family proteins, products of the diverse clustered Pcdh genes, causes unbalanced distributions (densification and sparsification) of serotonergic axons in various target regions. However, which Pcdh-α member(s) are responsible for the phenotype is unknown. Here we demonstrated that Pcdh-αC2 (αC2), a Pcdh-α isoform, was highly expressed in serotonergic neurons, and was required for normal diffusion in single-axon-level analyses of serotonergic axons. The loss of αC2 from serotonergic neurons, but not from their target brain regions, led to unbalanced distributions of serotonergic axons. Our results suggest that αC2 expressed in serotonergic neurons is required for serotonergic axon diffusion in various brain areas. The αC2 extracellular domain displays homophilic binding activity, suggesting that its homophilic interaction between serotonergic axons regulates axonal density via αC2's cytoplasmic domain.

Also flagged:Nurr1TNF-αnuclear receptororphan nuclear receptorsinflammatory responsescytotoxic response
Journal Article 2017-11-21 No Snippets Xie X, Peng L, Zhu J, Zhou Y, Li L, Chen Y, Yu S, Zhao Y.
Show Full Abstract

Nurr1 is a member of the nuclear receptor 4 family of orphan nuclear receptors that is decreased in inflammatory responses and leads to neurons death in Parkinson's disease. Abnormal expression of Nurr1 have been attributed to various signaling pathways, but little is known about microRNAs (miRNAs) regulation of Nurr1 in ischemia/reperfusion injury. To investigate the post transcriptional regulatory networks of Nurr1, we used a miRNA screening approach and identified miR-145-5p as a putative regulator of Nurr1. By using computer predictions, we identified and confirmed a miRNA recognition element in the 3'UTR of Nurr1 that was responsible for miR-145-5p-mediated suppression. We next demonstrated that overexpression of Nurr1 inhibited TNF-α expression in microglia by trans-repression and finally attenuated ischemia/reperfusion-induced inflammatory and cytotoxic response of neurons. Results of further <i>in vivo</i> study revealed that anti-miR-145-5p administration brought about increasing expression of Nurr1 and reduction of infarct volume in acute cerebral ischemia. Administration of anti-miR-145-5p promotes neurological outcome of rats post MCAO/R. It might be an effective therapeutic strategy to relieve neurons injury upon ischemia/reperfusion of rats through interrupting the axis signaling of miR-145-5p- Nurr1-TNF-α in acute phase.

Also flagged:ManganeseGFPRFPneurodegenerative diseasesgene expressionoligonucleotides
Journal Article 2017-11-21 ✓ 1 Snippet Sanchez-Ramos J, Song S, Kong X, Foroutan P, Martinez G, Dominguez-Viqueria W, Mohapatra S, Mohapatra S, Haraszti RA, Khvorova A, Aronin N, Sava V.
In-Text Gene Mentions

htt

Show Full Abstract

The overall objective of the present research was to develop a nanocarrier system for non-invasive delivery to brain of molecules useful for gene therapy. Manganese-containing nanoparticles (mNPs) carrying <i>anti</i>-eGFP siRNA were tested in cell cultures of eGFP-expressing cell line of mouse fibroblasts (NIH3T3). The optimal mNPs were then tested <i>in vivo</i> in mice. Following intranasal instillation, mNPs were visualized by 7T MRI throughout brain at 24 and 48 hrs. mNPs were effective in significantly reducing GFP mRNA expression in Tg GFP+ mice in olfactory bulb, striatum, hippocampus and cortex. Intranasal instillation of mNPS loaded with dsDNA encoding RFP also resulted in expression of the RFP in multiple brain regions. In conclusion, mNPs carrying siRNA, or dsDNA were capable of delivering the payload from nose to brain. This approach for delivery of gene therapies to humans, if successful, will have a significant impact on disease-modifying therapeutics of neurodegenerative diseases.

Also flagged:hepatopulmonary syndromeHPSPortopulmonary hypertensionhereditary hemorrhagic telangiectasiaHHTliver disease
Journal Article 2017-11-20 ✓ 1 Snippet Krynytska I, Marushchak M, Mikolenko A, Bob A, Smachylo I, Radetska L, Sopel O.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Hepatopulmonary syndrome (HPS) is a severe complication of advanced liver disease associated with an extremely poor prognosis. HPS is diagnosed in 4-47% of patients with cirrhosis and in 15-20% of candidates for liver transplantation. In addition, severe hypoxia is associated with a high risk of complications of liver transplantation (a 30% chance during the first 90 days) and increases the gap between transplantation and improving arterial oxygenation. The pathogenesis of HPS is not fully understood, and no effective pharmacological treatment has been developed yet. Currently, the treatment of choice for HPS is orthotopic liver transplantation. Non-specific clinical criteria and the lack of standardized diagnostic criteria for determining HPS can lead to diagnostic errors. Portopulmonary hypertension and hereditary hemorrhagic telangiectasia, also known as Osler-Weber-Rendu syndrome, are pulmonary complications of liver disease which should be differentially diagnosed from HPS.

Also flagged:extracellularpositronphotonsystemic autoimmune diseasesdesmoplastic cancersfibronectin
Journal Article 2017-11-20 ✓ 1 Snippet Baues M, Dasgupta A, Ehling J, Prakash J, Boor P, Tacke F, Kiessling F, Lammers T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Fibrosis plays an important role in many different pathologies. It results from tissue injury, chronic inflammation, autoimmune reactions and genetic alterations, and it is characterized by the excessive deposition of extracellular matrix components. Biopsies are routinely employed for fibrosis diagnosis, but they suffer from several drawbacks, including their invasive nature, sampling variability and limited spatial information. To overcome these limitations, multiple different imaging tools and technologies have been evaluated over the years, including X-ray imaging, computed tomography (CT), ultrasound (US), magnetic resonance imaging (MRI), positron emission tomography (PET) and single-photon emission computed tomography (SPECT). These modalities can provide anatomical, functional and molecular imaging information which is useful for fibrosis diagnosis and staging, and they may also hold potential for the longitudinal assessment of therapy responses. Here, we summarize the use of non-invasive imaging techniques for monitoring fibrosis in systemic autoimmune diseases, in parenchymal organs (such as liver, kidney, lung and heart), and in desmoplastic cancers. We also discuss how imaging biomarkers can be integrated in (pre-) clinical research to individualize and improve anti-fibrotic therapies.

Also flagged:SynthesisOrexin-1 Receptorneuropeptidesdrug addictiontetrahydroisoquinolineOX 1 receptor
Journal Article 2017-11-20 No Snippets Perrey DA, Decker AM, Zhang Y.
Show Full Abstract

Orexins are hypothalamic neuropeptides playing important roles in many functions including the motivation of addictive behaviors. Blockade of the orexin-1 receptor has been suggested as a potential strategy for the treatment of drug addiction. We have previously reported OX<sub>1</sub> receptor antagonists based on the tetrahydroisoquinoline scaffold with excellent OX<sub>1</sub> potency and selectivity; however, these compounds had high lipophilicity (clogP > 5) and low to moderate solubility. In an effort to improve their properties, we have designed and synthesized a series of analogues where the 7-position substituents known to favor OX<sub>1</sub> potency and selectivity were retained, and groups of different nature were introduced at the 1-position where substitution was generally tolerated as demonstrated in previous studies. Compound 44 with lower lipophilicity (clogP = 3.07) displayed excellent OX<sub>1</sub> potency ( K<sub>e</sub> = 5.7 nM) and selectivity (>1,760-fold over OX<sub>2</sub>) in calcium mobilization assays. In preliminary ADME studies, 44 showed excellent kinetic solubility (>200 μM), good CNS permeability ( P<sub>app</sub> = 14.7 × 10<sup>-6</sup> cm/sec in MDCK assay), and low drug efflux (efflux ratio = 3.3).

Also flagged:AmphetaminedopamineNetrin-1 receptorRobo 1Robo1dopamine D2 receptor
Journal Article 2017-11-20 ✓ 5 Snippets Cuesta S, Restrepo-Lozano JM, Silvestrin S, Nouel D, Torres-Berrío A, Reynolds LM, Arvanitogiannis A, Flores C.
In-Text Gene Mentions

These findings identify miR-218 as regulator of DCC in the VTA both in normal development and after drug exposure in adolescence.

However, how DCC expression in dopamine neurons is itself regulated is completely unknown.

Amphetamine in adolescence, but not in adulthood, increases miR-218 in the VTA and this event is required for drug-induced downregulation of Dcc mRNA and protein expression.

This effect seems to be specific to Dcc because amphetamine does not alter Robo1.

We have previously linked the amphetamine-induced disruption of dopamine connectivity and prefrontal cortex maturation during adolescence to the downregulation of the Netrin-1 receptor, DCC, in dopamine neurons.

Show Full Abstract

The development of the dopamine input to the medial prefrontal cortex occurs during adolescence and is a process that is vulnerable to disruption by stimulant drugs such as amphetamine. We have previously linked the amphetamine-induced disruption of dopamine connectivity and prefrontal cortex maturation during adolescence to the downregulation of the Netrin-1 receptor, DCC, in dopamine neurons. However, how DCC expression in dopamine neurons is itself regulated is completely unknown. MicroRNA (miRNA) regulation of mRNA translation and stability is a prominent mechanism linking environmental events to changes in protein expression. Here, using male mice, we show that miR-218 is expressed in dopamine neurons and is a repressor of DCC. Whereas Dcc mRNA levels increase from early adolescence to adulthood, miR-218 exhibits the exact opposite switch, most likely maintaining postnatal Dcc expression. This dynamic regulation appears to be selective to Dcc since the expression of Robo 1, the other guidance cue receptor target of miR-218, does not vary with age. Amphetamine in adolescence, but not in adulthood, increases miR-218 in the VTA and this event is required for drug-induced downregulation of Dcc mRNA and protein expression. This effect seems to be specific to Dcc because amphetamine does not alter Robo1. Furthermore, the upregulation of miR-218 by amphetamine requires dopamine D2 receptor activation. These findings identify miR-218 as regulator of DCC in the VTA both in normal development and after drug exposure in adolescence.

Also flagged:FOXAtumorepithelial-mesenchymal transitiongene expressiontranscription factorschromatin
Journal Article 2017-11-20 ✓ 1 Snippet Jägle S, Busch H, Freihen V, Beyes S, Schrempp M, Boerries M, Hecht A.
In-Text Gene Mentions

…, EPHB3 ,OLFM4) [ 31…

Show Full Abstract

Phenotypic conversion of tumor cells through epithelial-mesenchymal transition (EMT) requires massive gene expression changes. How these are brought about is not clear. Here we examined the impact of the EMT master regulator SNAIL1 on the FOXA family of transcription factors which are distinguished by their particular competence to induce chromatin reorganization for the activation of transcriptional enhancer elements. We show that the expression of SNAIL1 and FOXA genes is anticorrelated in transcriptomes of colorectal tumors and cell lines. In cellular EMT models, ectopically expressed Snail1 directly represses FOXA1 and triggers downregulation of all FOXA family members, suggesting that loss of FOXA expression promotes EMT. Indeed, cells with CRISPR/Cas9-induced FOXA-deficiency acquire mesenchymal characteristics. Furthermore, ChIP-seq data analysis of FOXA chromosomal distribution in relation to chromatin structural features which characterize distinct states of transcriptional activity, revealed preferential localization of FOXA factors to transcriptional enhancers at signature genes that distinguish epithelial from mesenchymal colon tumors. To validate the significance of this association, we investigated the impact of FOXA factors on structure and function of enhancers at the CDH1, CDX2 and EPHB3 genes. FOXA-deficiency and expression of dominant negative FOXA2 led to chromatin condensation at these enhancer elements. Site-directed mutagenesis of FOXA binding sites in reporter gene constructs and by genome-editing in situ impaired enhancer activity and completely abolished the active chromatin state of the EPHB3 enhancer. Conversely, expression of FOXA factors in cells with inactive CDX2 and EPHB3 enhancers led to chromatin opening and de novo deposition of the H3K4me1 and H3K27ac marks. These findings establish the pioneer function of FOXA factors at enhancer regions of epithelial genes and demonstrate their essential role in maintaining enhancer structure and function. Thus, by repressing FOXA family members, SNAIL1 targets transcription factors at strategically important positions in gene-regulatory hierarchies, which may facilitate transcriptional reprogramming during EMT.

Also flagged:innate immunitycomplement activationlectinC3aC5acomplement proteins
Journal Article 2017-11-20 ✓ 1 Snippet Sagar A, Dai W, Minot M, LeCover R, Varner JD.
In-Text Gene Mentions

…controlled by theC1 InhibitorInhibitor (C1-Inh); C1-Inh…

Show Full Abstract

Complement is an important pathway in innate immunity, inflammation, and many disease processes. However, despite its importance, there are few validated mathematical models of complement activation. In this study, we developed an ensemble of experimentally validated reduced order complement models. We combined ordinary differential equations with logical rules to produce a compact yet predictive model of complement activation. The model, which described the lectin and alternative pathways, was an order of magnitude smaller than comparable models in the literature. We estimated an ensemble of model parameters from in vitro dynamic measurements of the C3a and C5a complement proteins. Subsequently, we validated the model on unseen C3a and C5a measurements not used for model training. Despite its small size, the model was surprisingly predictive. Global sensitivity and robustness analysis suggested complement was robust to any single therapeutic intervention. Only the simultaneous knockdown of both C3 and C5 consistently reduced C3a and C5a formation from all pathways. Taken together, we developed a validated mathematical model of complement activation that was computationally inexpensive, and could easily be incorporated into pre-existing or new pharmacokinetic models of immune system function. The model described experimental data, and predicted the need for multiple points of therapeutic intervention to fully disrupt complement activation.

Also flagged:p27cell adhesionCip-Kipcyclin-dependent kinasetumourstranscriptional regulator
Journal Article 2017-11-20 ✓ 3 Snippets Biçer A, Orlando S, Islam ABMMK, Gallastegui E, Besson A, Aligué R, Bachs O, Pujol MJ.
In-Text Gene Mentions

…annotated to Mef2c,SOX6and Shox2 (…

…Mefc2 or toSox6, luciferase expression was…

…observed increase ofSox6, involved in neuron…

Show Full Abstract

The protein p27Kip1 (p27), a member of the Cip-Kip family of cyclin-dependent kinase inhibitors, is involved in tumorigenesis and a correlation between reduced levels of this protein in human tumours and a worse prognosis has been established. Recent reports revealed that p27 also behaves as a transcriptional regulator. Thus, it has been postulated that the development of tumours with low amounts of p27 could be propitiated by deregulation of transcriptional programs under the control of p27. However, these programs still remain mostly unknown. The aim of this study has been to define the transcriptional programs regulated by p27 by first identifying the p27-binding sites (p27-BSs) on the whole chromatin of quiescent mouse embryonic fibroblasts. The chromatin regions associated to p27 have been annotated to the most proximal genes and it has been considered that the expression of these genes could by regulated by p27. The identification of the chromatin p27-BSs has been performed by Chromatin Immunoprecipitation Sequencing (ChIP-seq). Results revealed that p27 associated with 1839 sites that were annotated to 1417 different genes being 852 of them protein coding genes. Interestingly, most of the p27-BSs were in distal intergenic regions and introns whereas, in contrast, its association with promoter regions was very low. Gene ontology analysis of the protein coding genes revealed a number of relevant transcriptional programs regulated by p27 as cell adhesion, intracellular signalling and neuron differentiation among others. We validated the interaction of p27 with different chromatin regions by ChIP followed by qPCR and demonstrated that the expressions of several genes belonging to these programs are actually regulated by p27. Finally, cell adhesion assays revealed that the adhesion of p27-/- cells to the plates was much higher that controls, revealing a role of p27 in the regulation of a transcriptional program involved in cell adhesion.

Also flagged:Zinc transportersinsulin resistancetype 2 diabetesmetabolisminsulinzinc
Journal Article 2017-11-20 ✓ 2 Snippets Norouzi S, Adulcikas J, Sohal SS, Myers S.
In-Text Gene Mentions

…iron overload inhemochromatosis[ 58 ].…

…frequently associated withhemochromatosisand patients with…

Show Full Abstract

<h4>Background</h4>Zinc is a metal ion that is essential for growth and development, immunity, and metabolism, and therefore vital for life. Recent studies have highlighted zinc's dynamic role as an insulin mimetic and a cellular second messenger that controls many processes associated with insulin signaling and other downstream pathways that are amendable to glycemic control.<h4>Main body</h4>Mechanisms that contribute to the decompartmentalization of zinc and dysfunctional zinc transporter mechanisms, including zinc signaling are associated with metabolic disease, including type 2 diabetes. The actions of the proteins involved in the uptake, storage, compartmentalization and distribution of zinc in cells is under intense investigation. Of these, emerging research has highlighted a role for several zinc transporters in the initiation of zinc signaling events in cells that lead to metabolic processes associated with maintaining insulin sensitivity and thus glycemic homeostasis.<h4>Conclusion</h4>This raises the possibility that zinc transporters could provide novel utility to be targeted experimentally and in a clinical setting to treat patients with insulin resistance and thus introduce a new class of drug target with utility for diabetes pharmacotherapy.

Also flagged:Ironhydroxyl7,8-dihydroguanosineoverloadexcretionsulfate
Journal Article 2017-11-20 No Snippets Cejvanovic V, Kjær LK, Bergholdt HKM, Torp-Pedersen A, Henriksen T, Weimann A, Ellervik C, Poulsen HE.
Show Full Abstract

Iron promotes formation of hydroxyl radicals by the Fenton reaction, subsequently leading to potential oxidatively generated damage of nucleic acids. Oxidatively generated damage to RNA, measured as 8-oxo-7,8-dihydroguanosine (8-oxoGuo) in urine, is increased in patients with genetic iron overload, which have led us to test the hypothesis that high iron status, assessed by iron biomarkers and genetic disposition, increases urinary excretion of 8-oxoGuo. In a general Danish population study we used a Mendelian randomization design with HFE genotypes as a proxy for iron status and supplemented with ex vivo experiments in mice muscle tissue exposed to iron(II) sulfate to attempt to clarify this hypothesis. The biomarkers ferritin, transferrin, and transferrin saturation (TS) were associated with 8-oxoGuo (in linear univariable and multivariable regression analyses: P < 0.001). Mendelian randomization indicated a causal pathway between genetically elevated iron biomarkers (assessed by ferritin and TS) and high levels of 8-oxoGuo. The ex vivo experiments showed a monotonically increase in 8-oxoGuo with increased iron concentration (ANOVA: P = 0.0008) that was prevented with iron chelation (P = 0.01). Our results indicate a causal relationship between iron biomarkers and 8-oxoGuo. Furthermore, the ex vivo experiment shows a mechanistic link between iron and 8-oxoGuo formation. Both iron overload and the biomarker 8-oxoGuo have been linked to e.g. diabetes, which merits future studies to investigate if iron induced 8-oxoGuo is involved in disease development.

Also flagged:ING1Gene Expressionofhistoneinhibitor of growth family member 1Ppp3r1
Journal Article 2017-11-20 ✓ 1 Snippet Leighton LJ, Zhao Q, Li X, Dai C, Marshall PR, Liu S, Wang Y, Zajaczkowski EL, Khandelwal N, Kumar A, Bredy TW, Wei W.
In-Text Gene Mentions

Lrrc7

Show Full Abstract

Epigenetic regulation of activity-induced gene expression involves multiple levels of molecular interaction, including histone and DNA modifications, as well as mechanisms of DNA repair. Here we demonstrate that the genome-wide deposition of inhibitor of growth family member 1 (ING1), which is a central epigenetic regulatory protein, is dynamically regulated in response to activity in primary cortical neurons. ING1 knockdown leads to decreased expression of genes related to synaptic plasticity, including the regulatory subunit of calcineurin, Ppp3r1. In addition, ING1 binding at a site upstream of the transcription start site (TSS) of Ppp3r1 depends on yet another group of neuroepigenetic regulatory proteins, the Piwi-like family, which are also involved in DNA repair. These findings provide new insight into a novel mode of activity-induced gene expression, which involves the interaction between different epigenetic regulatory mechanisms traditionally associated with gene repression and DNA repair.

Also flagged:Gene ExpressionLiver DiseaseAHdeathCorticosteroidscorticosteroid
Journal Article 2017-11-20 ✓ 1 Snippet Trépo E, Goossens N, Fujiwara N, Song WM, Colaprico A, Marot A, Spahr L, Demetter P, Sempoux C, Im GY, Saldarriaga J, Gustot T, Devière J, Thung SN, Minsart C, Sersté T, Bontempi G, Abdelrahman K, Henrion J, Degré D, Lucidi V, Rubbia-Brandt L, Nair VD, Nair VD, Moreno C, Deltenre P, Hoshida Y, Franchimont D.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background & aims</h4>Patients with severe alcoholic hepatitis (AH) have a high risk of death within 90 days. Corticosteroids, which can cause severe adverse events, are the only treatment that increases short-term survival. It is a challenge to predict outcomes of patients with severe AH. Therefore, we developed a scoring system to predict patient survival, integrating baseline molecular and clinical variables.<h4>Methods</h4>We obtained fixed liver biopsy samples from 71 consecutive patients diagnosed with severe AH and treated with corticosteroids from July 2006 through December 2013 in Brussels, Belgium (derivation cohort). Gene expression patterns were analyzed by microarrays and clinical data were collected for 180 days. We identified gene expression signatures and clinical data that are associated with survival without liver transplantation at 90 and 180 days after initiation of corticosteroid therapy. Findings were validated using liver biopsies from 48 consecutive patients with severe AH treated with corticosteroids, collected from March 2010 through February 2015 at hospitals in Belgium and Switzerland (validation cohort 1) and in liver biopsies from 20 patients (9 received corticosteroid treatment), collected from January 2012 through May 2015 in the United States (validation cohort 2).<h4>Results</h4>We integrated data on expression patterns of 123 genes and the model for end-stage liver disease (MELD) scores to assign patients to groups with poor survival (29% survived 90 days and 26% survived 180 days) and good survival (76% survived 90 days and 65% survived 180 days) (P < .001) in the derivation cohort. We named this assignment system the gene signature-MELD (gs-MELD) score. In validation cohort 1, the gs-MELD score discriminated patients with poor survival (43% survived 90 days) from those with good survival (96% survived 90 days) (P < .001). The gs-MELD score also discriminated between patients with a poor survival at 180 days (34% survived) and a good survival at 180 days (84% survived) (P < .001). The time-dependent area under the receiver operator characteristic curve for the score was 0.86 (95% confidence interval 0.73-0.99) for survival at 90 days, and 0.83 (95% confidence interval 0.71-0.96) for survival at 180 days. This score outperformed other clinical models to predict survival of patients with severe AH in validation cohort 1. In validation cohort 2, the gs-MELD discriminated patients with a poor survival at 90 days (12% survived) from those with a good survival at 90 days (100%) (P < .001).<h4>Conclusions</h4>We integrated data on baseline liver gene expression pattern and the MELD score to create the gs-MELD scoring system, which identifies patients with severe AH, treated or not with corticosteroids, most and least likely to survive for 90 and 180 days.

Also flagged:LeukemiacancerSERCAacute lymphoblastic leukemiaALLfolic acid
Journal Article 2017-11-20 No Snippets Roti G, Qi J, Kitara S, Sanchez-Martin M, Saur Conway A, Varca AC, Su A, Wu L, Kung AL, Ferrando AA, Bradner JE, Stegmaier K.
Show Full Abstract

On-target drug delivery remains a challenge in cancer precision medicine; it is difficult to deliver a targeted therapy to cancer cells without incurring toxicity to normal tissues. The SERCA (sarco-endoplasmic reticulum Ca<sup>2+</sup> ATPase) inhibitor thapsigargin inhibits mutant NOTCH1 receptors compared with wild type in T cell acute lymphoblastic leukemia (T-ALL), but its administration is predicted to be toxic in humans. Leveraging the addiction of ALL to folic acid, we conjugated folate to an alcohol derivative of thapsigargin via a cleavable ester linkage. JQ-FT is recognized by folate receptors on the plasma membrane and delivered into leukemia cells as a potent antileukemic agent. In mechanistic and translational models of T-ALL, we demonstrate NOTCH1 inhibition in vitro and in vivo. These proof-of-concept studies support the further optimization of this first-in-class NOTCH1 inhibitor with dual selectivity: leukemia over normal cells and NOTCH1 mutants over wild-type receptors. Furthermore, tumor-specific disruption of Notch signaling may overcome legitimate concerns associated with the tumor suppressor function of nontargeted Notch pathway inhibitors.

Also flagged:autoimmune biliary diseasechromosomec3biliary diseasepathogenesischolangiopathies
Journal Article 2017-11-20 ✓ 1 Snippet Huang W, Rainbow DB, Wu Y, Adams D, Shivakumar P, Kottyan L, Karns R, Aronow B, Bezerra J, Gershwin ME, Peterson LB, Wicker LS, Ridgway WM.
In-Text Gene Mentions

Serpinc1

Show Full Abstract

We previously reported that NOD.c3c4 mice develop spontaneous autoimmune biliary disease (ABD) with anti-mitochondrial Abs, histopathological lesions, and autoimmune T lymphocytes similar to human primary biliary cholangitis. In this article, we demonstrate that ABD in NOD.c3c4 and related NOD ABD strains is caused by a chromosome 1 region that includes a novel mutation in polycystic kidney and hepatic disease 1 (<i>Pkhd1</i>). We show that a long terminal repeat element inserted into intron 35 exposes an alternative polyadenylation site, resulting in a truncated <i>Pkhd1</i> transcript. A novel NOD congenic mouse expressing aberrant <i>Pkhd1</i>, but lacking the c3 and c4 chromosomal regions (NOD.<i>Abd3</i>), reproduces the immunopathological features of NOD ABD. RNA sequencing of NOD.<i>Abd3</i> common bile duct early in disease demonstrates upregulation of genes involved in cholangiocyte injury/morphology and downregulation of immunoregulatory genes. Consistent with this, bone marrow chimera studies show that aberrant <i>Pkhd1</i> must be expressed in the target tissue (cholangiocytes) and the immune system (bone marrow). Mutations of <i>Pkhd1</i> produce biliary abnormalities in mice but have not been previously associated with autoimmunity. In this study, we eliminate clinical biliary disease by backcrossing this <i>Pkhd1</i> mutation onto the C57BL/6 genetic background; thus, the NOD genetic background (which promotes autoimmunity) is essential for disease. We propose that loss of functional <i>Pkhd1</i> on the NOD background produces early bile duct abnormalities, initiating a break in tolerance that leads to autoimmune cholangitis in NOD.<i>Abd3</i> congenic mice. This model is important for understanding loss of tolerance to cholangiocytes and is relevant to the pathogenesis of several human cholangiopathies.

Also flagged:gene expressionCD55morphogenesislumenmembraneestrus
Journal Article 2017-11-20 ✓ 1 Snippet Pal B, Chen Y, Vaillant F, Vaillant F, Jamieson P, Gordon L, Rios AC, Wilcox S, Fu N, Liu KH, Jackling FC, Davis MJ, Lindeman GJ, Smyth GK, Visvader JE.
In-Text Gene Mentions

…regulators, Zeb2 ,Sox6, Egr1 ,…

Show Full Abstract

The mammary epithelium comprises two primary cellular lineages, but the degree of heterogeneity within these compartments and their lineage relationships during development remain an open question. Here we report single-cell RNA profiling of mouse mammary epithelial cells spanning four developmental stages in the post-natal gland. Notably, the epithelium undergoes a large-scale shift in gene expression from a relatively homogeneous basal-like program in pre-puberty to distinct lineage-restricted programs in puberty. Interrogation of single-cell transcriptomes reveals different levels of diversity within the luminal and basal compartments, and identifies an early progenitor subset marked by CD55. Moreover, we uncover a luminal transit population and a rare mixed-lineage cluster amongst basal cells in the adult mammary gland. Together these findings point to a developmental hierarchy in which a basal-like gene expression program prevails in the early post-natal gland prior to the specification of distinct lineage signatures, and the presence of cellular intermediates that may serve as transit or lineage-primed cells.

Also flagged:neurodevelopmental disordersATRXCASKCHD8GNASIFIH1
Journal Article 2017-11-20 ✓ 5 Snippets Popp B, Ekici AB, Thiel CT, Hoyer J, Wiesener A, Kraus C, Reis A, Reis A, Zweier C.
In-Text Gene Mentions

Twenty five of these were identified in 923 established NDD genes (based on SysID database, status November 2016) (ACTB, AHDC1, ANKRD11, ATP6V1B2, ATRX, CASK, CHD8, GNAS, IFIH1, KCNQ2, KMT2A, KRAS, MAOA, MED12, MED13L, RIT1, SETD5, SIN3A, TCF4, TRAPPC11, TUBA1A, WAC, ZBTB18, ZMYND11), two in 543 (SysID) candidate genes (ZNF292, BPTF), and additionally a de novo loss-of-function variant in LRRC7, not previously implicated in NDDs.

…loss-of-function variant inLRRC7, not previously…

…nonsense variant inLRRC7in a patient…

LRRC7encodes a brain-specific…

…genes and identifyingLRRC7as a novel…

Show Full Abstract

High throughput sequencing has greatly advanced disease gene identification, especially in heterogeneous entities. Despite falling costs this is still an expensive and laborious technique, particularly when studying large cohorts. To address this problem we applied Exome Pool-Seq as an economic and fast screening technology in neurodevelopmental disorders (NDDs). Sequencing of 96 individuals can be performed in eight pools of 12 samples on less than one Illumina sequencer lane. In a pilot study with 96 cases we identified 27 variants, likely or possibly affecting function. Twenty five of these were identified in 923 established NDD genes (based on SysID database, status November 2016) (ACTB, AHDC1, ANKRD11, ATP6V1B2, ATRX, CASK, CHD8, GNAS, IFIH1, KCNQ2, KMT2A, KRAS, MAOA, MED12, MED13L, RIT1, SETD5, SIN3A, TCF4, TRAPPC11, TUBA1A, WAC, ZBTB18, ZMYND11), two in 543 (SysID) candidate genes (ZNF292, BPTF), and additionally a de novo loss-of-function variant in LRRC7, not previously implicated in NDDs. Most of them were confirmed to be de novo, but we also identified X-linked or autosomal-dominantly or autosomal-recessively inherited variants. With a detection rate of 28%, Exome Pool-Seq achieves comparable results to individual exome analyses but reduces costs by >85%. Compared with other large scale approaches using Molecular Inversion Probes (MIP) or gene panels, it allows flexible re-analysis of data. Exome Pool-Seq is thus well suited for large-scale, cost-efficient and flexible screening in characterized but heterogeneous entities like NDDs.

Also flagged:Nestinbreast cancergene expressionestrogen receptorERintermediate filament
Journal Article 2017-11-20 ✓ 1 Snippet Asleh K, Won JR, Gao D, Voduc KD, Nielsen TO.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Basal-like breast cancers, originally recognized by gene expression profiling, can be clinically identified using immunohistochemical (IHC) definitions that require estrogen receptor (ER) negativity. However, some basal cases are ER positive and are mistakenly considered to be luminal by standard IHC approaches, leading to suboptimal treatment choices. Nestin, an intermediate filament expressed in many stem cells, is a recently identified positive marker of basal-like phenotype independent of ER status. In this study, we evaluated its clinical associations and prognostic capacity in a large breast cancer cohort.<h4>Methods</h4>A tissue microarray series of clinically annotated invasive breast cancers with 12.6-year median follow-up was assessed for nestin expression by IHC. Kaplan-Meier and Cox regression models were used to evaluate the prognostic significance of nestin status, for the primary endpoint of breast cancer-specific survival (BCSS).<h4>Results</h4>Among 3641 cases interpretable for nestin by IHC, positive staining was found in 371 cases (10%) and was significantly associated with poor prognostic factors including other markers of basal-like differentiation. Patients with nestin-positive tumors had a significantly lower 10 year BCSS (HR 1.97, 95% CI 1.62-2.40; P < 0.001). Importantly, within the large group of 2323 ER+ cases, nestin positivity identified a subgroup of 120 patients (5%) with a significantly inferior 10-year BCSS (HR 1.50, 95% CI 1.10-2.13; P = 0.02).<h4>Conclusions</h4>Nestin IHC positivity is associated with the poor clinical outcomes and reduced survival rates that characterize the gene expression basal-like subtype. This easily applicable tool identifies ER+ poor prognosis basal phenotype patients that are currently being missed by "Triple negative" or "Core basal" IHC definitions.

Also flagged:Bipolar disordervoltage-gated calcium channelsCalciumpathogenesisbehaviouralmood instability
Journal Article 2017-11-20 No Snippets Harrison PJ, Geddes JR, Tunbridge EM.
Show Full Abstract

Bipolar disorder (BD) is a leading cause of global disability. Its biological basis is unknown, and its treatment unsatisfactory. Here, we review two recent areas of progress. First, the discovery of risk genes and their implications, with a focus on voltage-gated calcium channels as part of the disease process and as a drug target. Second, facilitated by new technologies, it is increasingly apparent that the bipolar phenotype is more complex and nuanced than simply one of recurring manic and depressive episodes. One such feature is persistent mood instability, and efforts are underway to understand its mechanisms and its therapeutic potential. BD illustrates how psychiatry is being transformed by contemporary neuroscience, genomics, and digital approaches.

Also flagged:aneurysmsKawasaki diseasecardiac diseasecoronary artery dilationcoronary artery aneurysmswound healing
Journal Article 2017-11-20 ✓ 5 Snippets Liu W, Liu C, Zhang L, Xie X, Gu X, Sang C, Xu M, Xu W, Jia H.
In-Text Gene Mentions

The present study proposed that MBL2, CFH, KNG1, SERPINC1 and FN1 may be a potentially excellent indicator group for distinguishing the two major KD complications, CAD and CAA.

In particular, MBL2 and CFH exhibited reduced expression levels within the CAD samples, and the opposite results were obtained for KNG and SERPINC1, in which the expression levels were downregulated within CAA samples.

Thus, the five proteins, CFH, MBL2, KNG1, FN1 and SERPINC1 were selected as candidate proteins associated with CAD and CAA.

In conclusion, the present study identified five candidate proteins differentially expressed in patients with KD and CAD/CAA: CFH, MBL2, KNG1, FN1 and SERPINC1.

The downregulation of KNG1 and SERPINC1 observed in KD with CAA samples may increase blood coagulation to enhance thrombosis.

Show Full Abstract

Kawasaki disease (KD) is an acquired cardiac disease with a high incidence that affects children. KD has various complications, including coronary artery dilation (CAD) and coronary artery aneurysms (CAA). The identification of differentially expressed proteins and the underlying mechanisms may be the key to understanding differences between these KD complications. In the present study, isobaric tags for relative and absolute quantitation were used to identify variations in serum proteins between KD patients with CAD and CAA. In total, 87 (37 upregulated and 50 downregulated) and 65 (33 upregulated and 32 downregulated) significantly differentially‑expressed proteins were identified in comparisons between control samples (healthy individuals) and those obtained from patients with KD and with CAD or CAA. Investigation into the underlying biological process revealed that variations between the two complications were associated with the wound healing response, as well as lipoprotein‑ and cholesterol‑associated processes. Important proteins involved in the formation of the wound healing signaling network were identified via enriched biological processes and pathway analysis using ClueGo and ReactomeFIViz software. In the present study, 5 significantly differentially‑expressed proteins, including mannose binding lectin 2 (MBL2), complement factor H (CFH), kininogen 1 (KNG1), serpin family C member 1 (SERPINC1) and fibronectin 1 (FN1), were selected and confirmed by western blotting. Analysis indicated that these proteins were associated to immunity, inflammation and metabolism, serving a key role within each module, which has never been reported previously. The present study proposed that MBL2, CFH, KNG1, SERPINC1 and FN1 may be a potentially excellent indicator group for distinguishing the two major KD complications, CAD and CAA.

Also flagged:tumoroncogenescancercolorectal cancergastric cancercancers
Journal Article 2017-11-20 ✓ 1 Snippet Yan W, Gao X, Zhang S.
In-Text Gene Mentions

…The over-expression ofSOX6could reverse the…

Show Full Abstract

<h4>Background</h4>MicroRNAs (miRNAs) are small non-coding RNA molecules, which participate in diverse biological processes and may regulate tumor suppressor genes or oncogenes. Rs11614913 in miR-196a2 and rs3746444 in miR-499 are shown to associate with increased/decreased cancer risk. This meta-analysis was performed to systematically assess the overall association.<h4>Materials and methods</h4>We searched Pubmed, Web of Knowledge, EMBASE, Chinese National Knowledge Infrastructure (CNKI) databases until December 2016 to identify eligible studies. Odds ratios (ORs) and 95% confidence intervals (CIs) were used to estimate the strength of the associations.<h4>Results</h4>We assessed published studies of the association between these microRNA polymorphisms and cancer risk from 56 studies with 21958/26436 cases/controls for miR-196a2 and from 37 studies with 13759/17946 cases/controls for miR-499. The results demonstrated that miR-196a2 rs11614913 was significantly associated with a decreased cancer risk, in particular with a decreased risk for colorectal cancer and gastric cancer, or for Asian population subgroup. In addition, miR-499 rs3746444 polymorphism was observed as a risk factor for cancers, in particular, for breast cancer, or for in the Asian population.<h4>Conclusions</h4>Our meta-analysis suggests that the rs11614913 most likely contributes to decreased susceptibility to cancer, especially in Asians and colorectal cancer and gastric cancer, and that the rs3746444 may increase risk for cancer. Furthermore, more well-designed studies with large sample size are still necessary to further elucidate the association between polymorphisms and different kinds of cancers risk.

Also flagged:FOXC1FOXmetabolismcancersbreast cancerbasal-like breast cancer
Journal Article 2017-11-20 ✓ 1 Snippet Wang J, Li W, Zheng X, Pang X, Du G.
In-Text Gene Mentions

…FOXC1 (Forkhead Box C1Box C1) is…

Show Full Abstract

FOXC1 is a vital member of FOX families which play important roles in biological processes including proliferation, differentiation, apoptosis, migration, invasion, metabolism, and longevity. Here we are focusing on roles of FOXC1 and their mechanisms in cancers. FOXC1 promoted progress of many cancers, such as breast cancer (especially basal-like breast cancer), hepatocellular carcinoma, gastric cancer and so on. FOXC1 was also found to be associated with drug resistance of cancers. FOXC1 promoted metastasis of cancers by increasing expression of MMP7, NEDD9 and Snail. Proliferation and invasion of cancers were increased by FOXC1 by mediating NF-κB, MST1R and KLF4 expression. FOXC1 was associated with development by regulating expression of FGF19 and MSX1. Recently, FOXC1 was found to be required for niche of stem cells or development of stem cells by mediating expression of Gli2, CXCL12, SCF, NFATC1, BMP and Myh7. Overall, FOXC1 exerts its functions by many mechanisms and may be used as a potential biomarker for diseases.

Also flagged:HAMPPathophysiologyHepcidin25-amino acidpeptide hormoneiron
Journal Article 2017-11-20 ✓ 2 Snippets Pandey S, Pandey SK, Shah V.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

Hepcidin is a 25-amino acid peptide hormone produced by hepatocytes and plays a key role in body iron metabolism. Hepcidin deficiency is the cause of iron overload in hereditary hemochromatosis, iron-loading anemia, and its excess is associated with anemia of inflammation, chronic disease and iron deficiency anemia (IDA). The aims of this study was to evaluate <i>HAMP</i> gene mutation, namely IVS2 + 1(-G) (c.148-150 + 1del) and Gly71 Asp (c.212G > A (rs104894696) association with iron status in IDA conditions. Our study participants were 500 IDA patients and 550 age and sex-matched healthy controls. Hepcidin, ferritin and CRP analysis was done by ELISA method while ESR analysis was done according to Wintrobe method. CBC analysis was done by auto-analyzer. Two mutations in the <i>HAMP</i> genes were analysed by PCR RFLP method. Among the IDA patients, 7 were heterozygous for Met50del IVS2 + 1(-G) mutation. Nine IDA patients were heterozygous for G71D G-A mutation and homozygous were not identified in both mutations.Controls were showing heterozygous frequency 1.8 and 2.1% of Met50del IVS2 + 1(-G) and G71D G-A mutations respectively. Mutation of <i>HAMP</i> (Met50del IVS2 + 1(-G) and G71D G-A) were clinically associated with IDA and act as modulator of disease.

Also flagged:FluorideHydroxyapatitepairingwatermetalshalogen
Journal Article 2017-11-20 No Snippets Nayak B, Samant A, Patel R, Misra PK.
Show Full Abstract

Hydroxyapatite (HAp) was successfully synthesized from egg shells, a low cost and easily available biodegradable waste, by the precipitation method and characterized by X-ray diffraction (XRD), scanning electron microscopy, Fourier transform infrared, and Brunauer-Emmett-Teller (BET) surface area analysis. The surface area of HAp was found to be 144 m<sup>2</sup>/g with a crystalline size of 9-99 nm from the BET and XRD data. The maximum fluoride removal efficiency within 1 h using 0.3 g of the synthesized adsorbent at pH 6 was 95%. The adsorption of fluoride followed second-order kinetics, indicating that chemisorptions are the rate-limiting step. The experimental data were well fitted with Langmuir and Freundlich isotherms, validating both monolayer and multilayer sorption during the fluoride adsorption onto the porous HAp. The positive adsorption of F<sup>-</sup> ions at the HAp interface can be attributed to ion exchange/ion pairing and H-bonding below the pH<sub>pzc</sub> of HAp (pH<sub>pzc</sub> = 8), and the negative adsorption can be attributed to the electrostatic repulsion between O<sup>-</sup> and F<sup>-</sup> ions at alkaline pH. Both physical and chemical adsorption phenomena were also evidenced from the molecular parking area data. The results of a batch experiment show that the HAp synthesized from egg shells can be used as an effective, low-cost adsorbent for fluoride removal from a contaminated aqueous solution as well as groundwater compared to other adsorbents.

Also flagged:Liver CirrhosisHBV) infectionalcoholic liver diseasenonalcoholic fatty liver diseaseautoimmune liver diseasecirrhosis
Journal Article 2017-11-19 ✓ 1 Snippet Chang B, Li B, Sun Y, Teng G, Huang A, Huang A, Li J, Zou Z.
In-Text Gene Mentions

…liver disease (12%),hemochromatosis(4%), and nonalcoholic…

Show Full Abstract

<h4>Background</h4>Over the last 20 years, the prevalence of hepatitis B virus (HBV) infection in China has decreased gradually due to the application of a national HBV vaccination program. In contrast, the prevalence of alcoholic liver disease (ALD), nonalcoholic fatty liver disease, autoimmune liver disease, and drug-induced liver injury has markedly increased.<h4>Methods</h4>We conducted a retrospective review of 82,562 hospitalized patients diagnosed with liver cirrhosis in Beijing 302 Hospital from 2002 to 2013.<h4>Results</h4>The top four etiologies of cirrhosis were HBV, HCV, ALD, and autoimmune liver disease. The percentage of HBV cirrhosis decreased from 81.53% in 2002 to 66.0% in 2013, whereas the frequency of alcoholic cirrhosis increased from 3.34% in 2002 to 8.40% in 2013. Females (84.34%) accounted for the majority of cirrhotic patients with autoimmune liver diseases. Males accounted for 80.16% of HBV cirrhosis patients and 98.02% of alcoholic cirrhosis patients.<h4>Conclusion</h4>In Beijing 302 Hospital, the top four etiologies of cirrhosis were HBV, HCV, ALD, and autoimmune liver disease. Over the last 12 years, the prevalence of HBV cirrhosis has decreased gradually, whereas that of alcoholic cirrhosis has increased significantly.

Also flagged:interferon gammagastric cancertumorsolid tumorSTATprogrammed death 1
Journal Article 2017-11-18 ✓ 1 Snippet Mimura K, Teh JL, Okayama H, Shiraishi K, Kua LF, Koh V, Smoot DT, Ashktorab H, Oike T, Suzuki Y, Fazreen Z, Asuncion BR, Shabbir A, Yong WP, So J, Soong R, Kono K.
In-Text Gene Mentions

It has been reported that IFN‐γ can stimulate the MAPK pathway in addition to the JAK‐STAT pathway, and the MAPK pathway was a major contributor to IFN‐γ‐induced overexpression of PD‐L1 in malignant plasma cells and lymphoma.34, 35, 36 Another study recently reported that oncogenic signaling induces PD‐L1 expression on tumor cells through the PI3K‐AKT pathway.19, 37 Therefore, we assessed the effect of IFN‐γ on the JAK‐STAT, MAPK and PI3K‐AKT pathway using western blot and gene expression array analyses in two IFN‐γ resistant (KYSE70 and MKN74) and two sensitive (MKN‐7 and NUGC‐3) GC cell lines, as well as two non‐cancer (HEK293T and HFE‐145) cell lines.

Show Full Abstract

Despite multidisciplinary treatment for patients with advanced gastric cancer, their prognosis remains poor. Therefore, the development of novel therapeutic strategies is urgently needed, and immunotherapy utilizing anti-programmed death 1/-programmed death ligand-1 mAb is an attractive approach. However, as there is limited information on how programmed death ligand-1 is upregulated on tumor cells within the tumor microenvironment, we examined the mechanism of programmed death ligand-1 regulation with a particular focus on interferon gamma in an in vitro setting and in clinical samples. Our in vitro findings showed that interferon gamma upregulated programmed death ligand-1 expression on solid tumor cells through the JAK-signal transducer and activator of transcription pathway, and impaired the cytotoxicity of tumor antigen-specific CTL against tumor cells. Following treatment of cells with anti-programmed death ligand-1 mAb after interferon gamma-pre-treatment, the reduced anti-tumor CTL activity by interferon gamma reached a higher level than the non-treatment control targets. In contrast, programmed death ligand-1 expression on tumor cells also significantly correlated with epithelial-mesenchymal transition phenotype in a panel of solid tumor cells. In clinical gastric cancer samples, tumor membrane programmed death ligand-1 expression significantly positively correlated with the presence of CD8-positive T cells in the stroma and interferon gamma expression in the tumor. The results suggest that gastric cancer patients with high CD8-positive T-cell infiltration may be more responsive to anti-programmed death 1/-programmed death ligand-1 mAb therapy.

Also flagged:cancerNRF2AKR1C1EGFRBCRPHDAC1
Journal Article 2017-11-18 ✓ 1 Snippet Choi BH, Ryu DY, Ryoo IG, Kwak MK.
In-Text Gene Mentions

…MECOM, PTPRR, RPS6KA6,TAOK3, TGFBR2 ) belonged…

Show Full Abstract

The nuclear factor (erythroid-derived 2)-like 2 (NFE2L2/NRF2) plays a critical role in the expression of multiple antioxidant and detoxifying enzymes. Herein, we provide evidence of the molecular links between NRF2 and oncogenic signaling hepatocyte growth factor receptor (HGFR/c-MET) and epidermal growth factor receptor (EGFR). Interfering RNA-induced stable inhibition of <i>NRF2</i> in ovarian carcinoma SKOV3 and renal carcinoma A498 reduced the levels of c-MET and EGFR. MicroRNA-206 (miR-206) that was increased in both <i>NRF2</i>-silenced cells was predicted as a dual regulator of c-MET and EGFR. As experimental evidence, miR-206 decreased c-MET and EGFR levels through a direct binding to the 3'-untranslated region of the <i>c-MET</i> and <i>EGFR</i> genes. The treatment of <i>NRF2-</i>knockdown cells with the miR-206 inhibitor could restore c-MET and EGFR levels. The miR-206-mediated c-MET/EGFR repression resulted in two outcomes. First, presumably through the inhibition of c-MET/EGFR-dependent cell proliferation, overexpression of miR-206 inhibited tumor growth in SKOV3-inoculated nude mice. Second, reduced c-MET/EGFR in <i>NRF2</i>-silenced cells affected breast cancer resistance protein (BCRP/ABCG2) levels. The pharmacological and genetic inhibition of c-MET or EGFR, as well as the miR-206 mimic treatment, repressed BCRP levels and increased cellular accumulation of doxorubicin. In line with these, treatment of <i>NRF2</i>-silenced SKOV3 with the miR-206 inhibitor elevated BCRP levels and consequently made these cells more resistant to doxorubicin treatment. Collectively, our results demonstrated that the <i>NRF2</i> silencing-inducible miR-206 targeted both c-MET and EGFR, and subsequently suppressed the BCRP level in cancer cells.

Also flagged:ironmalariaanemiamalaria infectionmetabolismbone morphogenetic protein
Journal Article 2017-11-17 ✓ 1 Snippet Spottiswoode N, Armitage AE, Williams AR, Fyfe AJ, Biswas S, Hodgson SH, Llewellyn D, Choudhary P, Draper SJ, Duffy PE, Drakesmith H.
In-Text Gene Mentions

…type II receptors,Hfe, and TfR2.…

Show Full Abstract

Epidemiological observations have linked increased host iron with malaria susceptibility, and perturbed iron handling has been hypothesized to contribute to the potentially life-threatening anemia that may accompany blood-stage malaria infection. To improve our understanding of these relationships, we examined the pathways involved in regulation of the master controller of iron metabolism, the hormone hepcidin, in malaria infection. We show that hepcidin upregulation in <i>Plasmodium berghei</i> murine malaria infection was accompanied by changes in expression of bone morphogenetic protein (BMP)/sons of mothers against decapentaplegic (SMAD) pathway target genes, a key pathway involved in hepcidin regulation. We therefore investigated known agonists of the BMP/SMAD pathway and found that <i>Bmp</i> gene expression was not increased in infection. In contrast, activin B, which can signal through the BMP/SMAD pathway and has been associated with increased hepcidin during inflammation, was upregulated in the livers of <i>Plasmodium berghei</i>-infected mice; hepatic activin B was also upregulated at peak parasitemia during infection with <i>Plasmodium chabaudi</i> Concentrations of the closely related protein activin A increased in parallel with hepcidin in serum from malaria-naive volunteers infected in controlled human malaria infection (CHMI) clinical trials. However, antibody-mediated neutralization of activin activity during murine malaria infection did not affect hepcidin expression, suggesting that these proteins do not stimulate hepcidin upregulation directly. In conclusion, we present evidence that the BMP/SMAD signaling pathway is perturbed in malaria infection but that activins, although raised in malaria infection, may not have a critical role in hepcidin upregulation in this setting.

Also flagged:GBF1ORF1replicasehost cellsbrefeldin Aguanine nucleotide exchange factors
Journal Article 2017-11-17 No Snippets Farhat R, Ankavay M, Lebsir N, Gouttenoire J, Jackson CL, Wychowski C, Moradpour D, Dubuisson J, Rouillé Y, Cocquerel L.
Show Full Abstract

The hepatitis E virus (HEV) genome is a single-stranded, positive-sense RNA that encodes three proteins including the ORF1 replicase. Mechanisms of HEV replication in host cells are unclear, and only a few cellular factors involved in this step have been identified so far. Here, we used brefeldin A (BFA) that blocks the activity of the cellular Arf guanine nucleotide exchange factors GBF1, BIG1, and BIG2, which play a major role in reshuffling of cellular membranes. We showed that BFA inhibits HEV replication in a dose-dependent manner. The use of siRNA and Golgicide A identified GBF1 as a host factor critically involved in HEV replication. Experiments using cells expressing a mutation in the catalytic domain of GBF1 and overexpression of wild type GBF1 or a BFA-resistant GBF1 mutant rescuing HEV replication in BFA-treated cells, confirmed that GBF1 is the only BFA-sensitive factor required for HEV replication. We demonstrated that GBF1 is likely required for the activity of HEV replication complexes. However, GBF1 does not colocalise with the ORF1 protein, and its subcellular distribution is unmodified upon infection or overexpression of viral proteins, indicating that GBF1 is likely not recruited to replication sites. Together, our results suggest that HEV replication involves GBF1-regulated mechanisms.

Also flagged:lipooligosaccharideJapanese encephalitistoll-like receptor 4liposomeIgGantibody
Journal Article 2017-11-17 No Snippets Ko A, Wui SR, Ryu JI, Do HTT, Lee YJ, Lim SJ, Rhee I, Jung DI, Park JA, Choi JA, Song MK, Lee NG.
Show Full Abstract

Adjuvants are essential vaccine components used to enhance, accelerate, and/or prolong adaptive immunity against specific vaccine antigens. In this study, we compared the adjuvanticity of two adjuvant formulations containing de-O-acylated lipooligosaccharide (dLOS), a toll-like receptor 4 agonist, on the Japanese encephalitis (JE) vaccine in mice. Mice were immunized once or twice at a two-week interval with inactivated JE vaccine in the absence or presence of adjuvant. We found that both the alum- and the liposome-based formulation induced significantly faster and higher serum IgG antibody responses as compared with the non-adjuvanted vaccine after either one or two immunizations. The antibody titers of the mouse immune sera correlated with 50% plaque reduction neutralization test (PRNT<sub>50</sub>) antibody titers. In addition, the dLOS/liposome formulation was more effective in inducing a Th1-type immune response than the dLOS/alum formulation, as suggested by a strong antigen-specific interferon (IFN)-γ response. Based on these results, we suggest that both alum- and liposome-based adjuvant formulations containing dLOS may be used for the development of JE vaccines with improved immunogenicity.

Also flagged:juvenile rheumatoid arthritisasthmaautismpervasive developmental disordertype 1 diabetesNDFIP1
Journal Article 2017-11-17 ✓ 2 Snippets Robinson JR, Denny JC, Roden DM, Van Driest SL.
In-Text Gene Mentions

In a pediatric cohort, PheWAS replicated many prior known GWAS associations, including SNPs associated with juvenile rheumatoid arthritis, asthma, autism, and pervasive developmental disorder, and type 1 diabetes.12 Several new SNP‐disease associations were identified within the pediatric population as well, including a cluster of association near the NDFIP1 gene (associated with mental retardation), PLCL1 (developmental delay), and the IL5‐IL13 region (eosinophilic esophagitis).12

…with mental retardation),PLCL1(developmental delay), and…

Show Full Abstract

No abstract available.

Also flagged:chromatinARNT2transcription factorglioblastomatumorhistone modifications
Journal Article 2017-11-17 ✓ 5 Snippets Bogeas A, Morvan-Dubois G, El-Habr EA, Lejeune FX, Defrance M, Narayanan A, Kuranda K, Burel-Vandenbos F, Sayd S, Delaunay V, Dubois LG, Parrinello H, Rialle S, Fabrega S, Idbaih A, Haiech J, Bièche I, Virolle T, Goodhardt M, Chneiweiss H, Junier MP.
In-Text Gene Mentions

To probe the functional relevance of the co-variations disclosed by analysis of glioblastoma tissues and single cells transcriptomes, we determined the effect of ARNT2 knockdown on the expression of SOX9, POU3F2 and OLIG2 in independent GBM stem-like cell cultures (6240** and 5706**) distinct from TG1 and TG1-miR.

We found that ARNT2 knockdown decreased the expression of SOX9, POU3F2 and OLIG2, transcription factors implicated in glioblastoma cell tumorigenicity, and repressed glioblastoma stem-like cell tumorigenic properties in vivo.

We found that ARNT2 knockdown not only impaired the cell tumorigenicity in vivo but also resulted in decreased expression of SOX9, POU3F2 and OLIG2, hence placing ARNT2 at the core of transcriptional regulations of glioblastoma cell tumorigenicity.

To ascertain the functional relevance of this association, we focused on three transcription factors members of this stem signature SOX9, POU3F2 and OLIG2, since the knockdown of these factors has previously been reported to inhibit glioblastoma cell tumorigenicity in vivo [31, 44, 68].

Determination of human ARNT2 mRNA levels by QPCR in these tumors showed ARNT2 as well as OLIG2, POU3F2 and SOX9 transcripts levels similar to tumors of the shCTL group (Online Resource 16G).

Show Full Abstract

Although a growing body of evidence indicates that phenotypic plasticity exhibited by glioblastoma cells plays a central role in tumor development and post-therapy recurrence, the master drivers of their aggressiveness remain elusive. Here we mapped the changes in active (H3K4me3) and repressive (H3K27me3) histone modifications accompanying the repression of glioblastoma stem-like cells tumorigenicity. Genes with changing histone marks delineated a network of transcription factors related to cancerous behavior, stem state, and neural development, highlighting a previously unsuspected association between repression of ARNT2 and loss of cell tumorigenicity. Immunohistochemistry confirmed ARNT2 expression in cell sub-populations within proliferative zones of patients' glioblastoma. Decreased ARNT2 expression was consistently observed in non-tumorigenic glioblastoma cells, compared to tumorigenic cells. Moreover, ARNT2 expression correlated with a tumorigenic molecular signature at both the tissue level within the tumor core and at the single cell level in the patients' tumors. We found that ARNT2 knockdown decreased the expression of SOX9, POU3F2 and OLIG2, transcription factors implicated in glioblastoma cell tumorigenicity, and repressed glioblastoma stem-like cell tumorigenic properties in vivo. Our results reveal ARNT2 as a pivotal component of the glioblastoma cell tumorigenic signature, located at a node of a transcription factor network controlling glioblastoma cell aggressiveness.

Also flagged:mmaA4S-adenosylmethionineinfectionInnate immunityimmune responsesparasitic infections
Journal Article 2017-11-17 No Snippets De Serrano LO, Burkhart DJ.
Show Full Abstract

Vaccinology is one of the most important cornerstones in modern medicine, providing better quality of life. The human immune system is composed of innate and adaptive immune processes that interplay when infection occurs. Innate immunity relies on pathogen-associated molecular patterns which are recognized by pathogen recognition receptors localized in antigen presenting cells. After antigen processing and presentation, CD4<sup>+</sup> T cell polarization occurs, further leading to B cell and CD8<sup>+</sup> activation and humoral and cell-mediated adaptive immune responses. Liposomes are being employed as vaccine technologies and their design is of importance to ensure proper immune responses. Physicochemical parameters like liposome size, charge, lamellarity and bilayer fluidity must be completely understood to ensure optimal vaccine stability and efficacy. Liposomal vaccines can be developed to target specific immune cell types for the induction of certain immune responses. In this review, we will present promising liposomal vaccine approaches for the treatment of important viral, bacterial, fungal and parasitic infections (including tuberculosis, TB). Cationic liposomes are the most studied liposome types due to their enhanced interaction with the negatively charged immune cells. Thus, a special section on the cationic lipid dimethyldioctadecylammonium and TB is also presented.

Also flagged:localizationdendritesRNA-binding proteinsRBPStau2long-term depression
Journal Article 2017-11-17 ✓ 2 Snippets Berger SM, Fernández-Lamo I, Schönig K, Fernández Moya SM, Ehses J, Schieweck R, Clementi S, Enkel T, Grothe S, von Bohlen Und Halbach O, Segura I, Delgado-García JM, Gruart A, Kiebler MA, Bartsch D.
In-Text Gene Mentions

…the ubiquitous Staufen1 (Stau1) and the more…

…Stau2 depletion withoutStau1compensatory upregulation (Fig…

Show Full Abstract

<h4>Background</h4>Dendritic messenger RNA (mRNA) localization and subsequent local translation in dendrites critically contributes to synaptic plasticity and learning and memory. Little is known, however, about the contribution of RNA-binding proteins (RBPs) to these processes in vivo.<h4>Results</h4>To delineate the role of the double-stranded RBP Staufen2 (Stau2), we generate a transgenic rat model, in which Stau2 expression is conditionally silenced by Cre-inducible expression of a microRNA (miRNA) targeting Stau2 mRNA in adult forebrain neurons. Known physiological mRNA targets for Stau2, such as RhoA, Complexin 1, and Rgs4 mRNAs, are found to be dysregulated in brains of Stau2-deficient rats. In vivo electrophysiological recordings reveal synaptic strengthening upon stimulation, showing a shift in the frequency-response function of hippocampal synaptic plasticity to favor long-term potentiation and impair long-term depression in Stau2-deficient rats. These observations are accompanied by deficits in hippocampal spatial working memory, spatial novelty detection, and in tasks investigating associative learning and memory.<h4>Conclusions</h4>Together, these experiments reveal a critical contribution of Stau2 to various forms of synaptic plasticity including spatial working memory and cognitive management of new environmental information. These findings might contribute to the development of treatments for conditions associated with learning and memory deficits.

Also flagged:cancerresponse to radiationalpha-linolenic acidmetabolismcell cycletelomeres
Journal Article 2017-11-17 ✓ 1 Snippet Wu YH, Graff RE, Passarelli MN, Hoffman JD, Ziv E, Hoffmann TJ, Witte JS.
In-Text Gene Mentions

MLLT10

Show Full Abstract

<b>Background:</b> There exists compelling evidence that some genetic variants are associated with the risk of multiple cancer sites (i.e., pleiotropy). However, the biological mechanisms through which the pleiotropic variants operate are unclear.<b>Methods:</b> We obtained all cancer risk associations from the National Human Genome Research Institute-European Bioinformatics Institute GWAS Catalog, and correlated cancer risk variants were clustered into groups. Pleiotropic variant groups and genes were functionally annotated. Associations of pleiotropic cancer risk variants with noncancer traits were also obtained.<b>Results:</b> We identified 1,431 associations between variants and cancer risk, comprised of 989 unique variants associated with 27 unique cancer sites. We found 20 pleiotropic variant groups (2.1%) composed of 33 variants (3.3%), including novel pleiotropic variants rs3777204 and rs56219066 located in the <i>ELL2</i> gene. Relative to single-cancer risk variants, pleiotropic variants were more likely to be in genes (89.0% vs. 65.3%, <i>P</i> = 2.2 × 10<sup>-16</sup>), and to have somewhat larger risk allele frequencies (median RAF = 0.49 versus 0.39, <i>P</i> = 0.046). The 27 genes to which the pleiotropic variants mapped were suggestive for enrichment in response to radiation and hypoxia, alpha-linolenic acid metabolism, cell cycle, and extension of telomeres. In addition, we observed that 8 of 33 pleiotropic cancer risk variants were associated with 16 traits other than cancer.<b>Conclusions:</b> This study identified and functionally characterized genetic variants showing pleiotropy for cancer risk.<b>Impact:</b> Our findings suggest biological pathways common to different cancers and other diseases, and provide a basis for the study of genetic testing for multiple cancers and repurposing cancer treatments. <i>Cancer Epidemiol Biomarkers Prev; 27(1); 75-85. ©2017 AACR</i>.

Also flagged:interstitial lung diseasePDcancerNAToxygeninterstital pulmonary fibrosis
Journal Article 2017-11-17 No Snippets Johnson MJ, Jamali A, Ross J, Fairhurst C, Boland J, Reigada C, Hart SP, Grande G, Currow DC, Wells AU, Bajwah S, Papadopoulos T, Bland JM, Yorke J.
Show Full Abstract

The inter-rater/test-retest reliability and construct validity of a palliative care needs assessment tool in interstitial lung disease (NAT:PD-ILD) were tested using NAT:PD-ILD-guided video-recorded consultations, and NAT:PD-ILD-guided consultations, and patient and carer-report outcomes (St George's Respiratory Questionnaire (SGRQ)-ILD, Carer Strain Index (CSI)/Carer Support Needs Assessment Tool (CSNAT)). 11/16 items reached at least fair inter-rater agreement; 5 items reached at least moderate test-retest agreement. 4/6 patient constructs demonstrated agreement with SGRQ-I scores (Kendall's tau-b, 0.24-20.36; P<0.05). 4/7 carer constructs agreed with the CSI/CSNAT items (kappa, 0.23-20.53). The NAT:PD-ILD is reliable and valid. Clinical effectiveness and implementation are to be evaluated.

Also flagged:Cholesterolmembranebrain diseasesAlzheimer diseaseADneurodegenerative disease
Journal Article 2017-11-17 ✓ 2 Snippets Arenas F, Garcia-Ruiz C, Fernandez-Checa JC.
In-Text Gene Mentions

…in the Huntingtin (htt) gene.…

…that the multifunctionalhttprotein intimately interacts…

Show Full Abstract

Cholesterol is a critical component of membrane bilayers where it plays key structural and functional roles by regulating the activity of diverse signaling platforms and pathways. Particularly enriched in brain, cholesterol homeostasis in this organ is singular with respect to other tissues and exhibits a heterogeneous regulation in distinct brain cell populations. Due to the key role of cholesterol in brain physiology and function, alterations in cholesterol homeostasis and levels have been linked to brain diseases and neurodegeneration. In the case of Alzheimer disease (AD), however, this association remains unclear with evidence indicating that either increased or decreased total brain cholesterol levels contribute to this major neurodegenerative disease. Here, rather than analyzing the role of total cholesterol levels in neurodegeneration, we focus on the contribution of intracellular cholesterol pools, particularly in endolysosomes and mitochondria through its trafficking via specialized membrane domains delineated by the contacts between endoplasmic reticulum and mitochondria, in the onset of prevalent neurodegenerative diseases such as AD, Parkinson disease, and Huntington disease as well as in lysosomal disorders like Niemann-Pick type C disease. We dissect molecular events associated with intracellular cholesterol accumulation, especially in mitochondria, an event that results in impaired mitochondrial antioxidant defense and function. A better understanding of the mechanisms involved in the distribution of cholesterol in intracellular compartments may shed light on the role of cholesterol homeostasis disruption in neurodegeneration and may pave the way for specific intervention opportunities.

Also flagged:sickle cell diseaseBCL11AHBS1LMYBhydroxycarbamideglobin
Journal Article 2017-11-16 No Snippets Paikari A, Sheehan VA.
Show Full Abstract

Fetal haemoglobin (HbF, α2γ2) induction has long been an area of investigation, as it is known to ameliorate the clinical complications of sickle cell disease (SCD). Progress in identifying novel HbF-inducing strategies has been stymied by limited understanding of gamma (γ)-globin regulation. Genome-wide association studies (GWAS) have identified variants in BCL11A and HBS1L-MYB that are associated with HbF levels. Functional studies have established the roles of BCL11A, MYB, and KLF1 in γ-globin regulation, but this information has not yielded new pharmacological agents. Several drugs are under investigation in clinical trials as HbF-inducing agents, but hydroxycarbamide remains the only widely used pharmacologic therapy for SCD. Autologous transplant of edited haematopoietic stem cells holds promise as a cure for SCD, either through HbF induction or correction of the causative mutation, but several technical and safety hurdles must be overcome before this therapy can be offered widely, and pharmacological therapies are still needed.

Also flagged:CCN2Serotonin5-hydroxytryptamineconnective tissue growth factorCTGFphosphorylation
Journal Article 2017-11-16 ✓ 5 Snippets Hori A, Nishida T, Takashiba S, Kubota S, Takigawa M.
In-Text Gene Mentions

…and anti-5-HT transporter (5-HTT) antibodies were from…

…2B R and5-HTTproteins in HCS-2/8…

…reported as being5-HTT[ 30 ],…

…form of the5-HTTmay be the…

…2B R and5-HTTproteins, and that…

Show Full Abstract

Serotonin (5-hydroxytryptamine: 5-HT) is recognized as a neurotransmitter in the central nerve system and as a regulator of systemic blood pressure in the peripheral tissues. Recently, it was reported that 5-HT2 receptors (5-HT2Rs) were expressed in cartilage tissues lacking both vessels and neurons, suggesting possible novel functions of 5-HT during cartilage development and regeneration. Our previous data indicated that CCN family protein 2/connective tissue growth factor (CCN2/CTGF) plays a central role in cartilage development and regeneration. Therefore, the aim of this study was to investigate the effect of 5-HT on the production of CCN2 in chondrocytes. Firstly, we showed that the mRNAs of 5-HT2R subtypes 5-HT2AR and 5-HT2BR, were expressed in a human chondrocytic cell line, HCS-2/8; however, 5-HT2CR mRNA was not detected. In addition, exogenously added 5-HT did not affect the 5-HT2AR and 5-HT2BR expressions. Next, we demonstrated that CCN2 production was increased by treatment with a 5-HT2AR agonist and the combination of 5-HT and 5-HT2BR antagonist. In contrast, treatment with a 5-HT2BR agonist and the combination of 5-HT and 5-HT2AR antagonist decreased CCN2 production. Furthermore, we showed that phosphorylation of Akt and p38 MAPK were increased by treatment with 5-HT2AR agonist, and that phosphorylation of PKCε, PKCζ, ERK1/2 and JNK were increased by treatment with 5-HT2BR agonist. Finally, we found that 5-HT2AR was localized in the growth plate, whereas 5-HT2BR was localized in the articular cartilage. These findings suggest that 5-HT promotes CCN2 production through the 5-HT2AR in growth plates, and that it represses CCN2 production through the 5-HT2BR in articular cartilage for harmonized development of long bones.

Also flagged:TGF-β1osteoarthritisknee osteoarthritiseffusionOATGF-β
Journal Article 2017-11-16 ✓ 1 Snippet Guermazi A, Kalsi G, Niu J, Crema MD, Copeland RO, Orlando A, Noh MJ, Roemer FW.
In-Text Gene Mentions

…disease or chondrocalcinosis,hemochromatosis, inflammatory arthritis, necr…

Show Full Abstract

<h4>Background</h4>To determine effects of allogeneic human chondrocytes expressing TGF-β1 (TG-C) on structural progression of MRI features of knee osteoarthritis over a 1 year period.<h4>Methods</h4>This phase II randomized controlled trial of TG-C included patients with moderate to advanced osteoarthritis. Patients were randomized to receive an intraarticular 3:1 mixture of non-transduced allogeneic human chondrocytes and TG-C or placebo. 3 T MRI was acquired for all patients at baseline and follow-up (3, 6 and 12 months). MRIs were assessed using the WORMS system including cartilage damage, bone marrow lesions (BMLs), meniscal damage/extrusion, Hoffa-, effusion-synovitis, and osteophytes. Analyses were performed on a whole knee level, compartmental level, and subregional level. Binary logistic regression with Generalized Estimating Equation was used to compare risks of progression, adjusting for baseline age and gender. Mann - Whitney - Wilcoxon tests were used to assess differences for continuous variables.<h4>Results</h4>Fifty-seven Patients were included in the TG-C group and 29 in the placebo group. At 12 months, knees in the TG-C group showed less progression of cartilage damage compared to placebo on a whole knee level (34.6% vs. 47.9%; adjusted RR 0.7, 95%CI [0.5-1.1], p = 0.077). Less progression of Hoffa-synovitis and effusion-synovitis was observed in the TG-C group compared to placebo (9.6% vs. 21.1%, adjusted RR 0.5, 95%CI [0.2,1.2], p = 0.115). No statistically significant differences were seen for BMLs, meniscal damage and osteophytes.<h4>Conclusions</h4>Intraarticular treatment with TG-C showed fewer patients in the treated group with progression in structural OA features and other MRI-defined inflammatory markers such as Hoffa-synovitis and effusion-synovitis. However, no differences were observed in regard to progression of BMLs and meniscal damage, or hypertrophic osteophyte formation.<h4>Trial registration</h4>NCT01221441 .Registered 13th October, 2010.

Also flagged:Splicing factormyelodysplastic syndromesmyeloid neoplasmspathogenesisanemialeukopenia
Journal Article 2017-11-16 ✓ 1 Snippet Kon A, Yamazaki S, Nannya Y, Kataoka K, Ota Y, Nakagawa MM, Yoshida K, Shiozawa Y, Morita M, Yoshizato T, Sanada M, Nakayama M, Koseki H, Nakauchi H, Ogawa S.
In-Text Gene Mentions

Mllt10

Show Full Abstract

Splicing factor mutations are characteristic of myelodysplastic syndromes (MDS) and related myeloid neoplasms and implicated in their pathogenesis, but their roles in the development of MDS have not been fully elucidated. In the present study, we investigated the consequence of mutant <i>Srsf2</i> expression using newly generated <i>Vav1-Cre</i>-mediated conditional knockin mice. Mice carrying a heterozygous <i>Srsf2</i> P95H mutation showed significantly reduced numbers of hematopoietic stem and progenitor cells (HSPCs) and differentiation defects both in the steady-state condition and transplantation settings. <i>Srsf2</i>-mutated hematopoietic stem cells (HSCs) showed impaired long-term reconstitution compared with control mice in competitive repopulation assays. Although the <i>Srsf2</i> mutant mice did not develop MDS under the steady-state condition, when their stem cells were transplanted into lethally irradiated mice, the recipients developed anemia, leukopenia, and erythroid dysplasia, which suggests the role of replicative stress in the development of an MDS-like phenotype in <i>Srsf2</i>-mutated mice. RNA sequencing of the <i>Srsf2</i>-mutated HSPCs revealed a number of abnormal splicing events and differentially expressed genes, including several potential targets implicated in the pathogenesis of hematopoietic malignancies, such as <i>Csf3r</i>, <i>Fyn</i>, <i>Gnas</i>, <i>Nsd1</i>, <i>Hnrnpa2b1</i>, and <i>Trp53bp1</i> Among the mutant <i>Srsf2</i>-associated splicing events, most commonly observed were the enhanced inclusion and/or exclusion of cassette exons, which were caused by the altered consensus motifs for the recognition of exonic splicing enhancers. Our findings suggest that the mutant <i>Srsf2</i> leads to a compromised HSC function by causing abnormal RNA splicing and expression, contributing to the deregulated hematopoiesis that recapitulates the MDS phenotypes, possibly as a result of additional genetic and/or environmental insults.

Also flagged:GATAD2BASCC3DSCAML 1HELZDopamineschizophrenia
Journal Article 2017-11-16 No Snippets Chen CH, Wang Y, Lo MT, Schork A, Fan CC, Holland D, Kauppi K, Smeland OB, Djurovic S, Sanyal N, Hibar DP, Thompson PM, Thompson WK, Andreassen OA, Dale AM.
Show Full Abstract

Discovering genetic variants associated with human brain structures is an on-going effort. The ENIGMA consortium conducted genome-wide association studies (GWAS) with standard multi-study analytical methodology and identified several significant single nucleotide polymorphisms (SNPs). Here we employ a novel analytical approach that incorporates functional genome annotations (e.g., exon or 5'UTR), total linkage disequilibrium (LD) scores and heterozygosity to construct enrichment scores for improved identification of relevant SNPs. The method provides increased power to detect associated SNPs by estimating stratum-specific false discovery rate (FDR), where strata are classified according to enrichment scores. Applying this approach to the GWAS summary statistics of putamen volume in the ENIGMA cohort, a total of 15 independent significant SNPs were identified (conditional FDR < 0.05). In contrast, 4 SNPs were found based on standard GWAS analysis (P < 5 × 10<sup>-8</sup>). These 11 novel loci include GATAD2B, ASCC3, DSCAML1, and HELZ, which are previously implicated in various neural related phenotypes. The current findings demonstrate the boost in power with the annotation-informed FDR method, and provide insight into the genetic architecture of the putamen.

Also flagged:encephalitisPOWV infectioninfectioninterferoninterferon-stimulatedTRIMs
Journal Article 2017-11-16 ✓ 2 Snippets Mlera L, Meade-White K, Dahlstrom E, Baur R, Kanakabandi K, Virtaneva K, Porcella SF, Bloom ME.
In-Text Gene Mentions

…containing 7), andPRDX6(peroxiredoxin 6).…

…as DDX23 ,DDX27, DDX49 ,…

Show Full Abstract

Powassan virus (POWV) is a tick-borne Flavivirus responsible for life-threatening encephalitis in North America and some regions of Russia. The ticks that have been reported to transmit the virus belong to the Ixodes species, and they feed on small-to-medium-sized mammals, such as Peromyscus leucopus mice, skunks, and woodchucks. We previously developed a P. leucopus mouse model of POWV infection, and the model is characterized by a lack of clinical signs of disease following intraperitoneal or intracranial inoculation. However, intracranial inoculation results in mild subclinical encephalitis from 5 days post infection (dpi), but the encephalitis resolves by 28 dpi. We used RNA sequencing to profile the P. leucopus mouse brain transcriptome at different time points after intracranial challenge with POWV. At 24 h post infection, 42 genes were significantly differentially expressed and the number peaked to 232 at 7 dpi before declining to 31 at 28 dpi. Using Ingenuity Pathway Analysis, we determined that the genes that were significantly expressed from 1 to 15 dpi were mainly associated with interferon signaling. As a result, many interferon-stimulated genes (ISGs) were upregulated. Some of the ISGs include an array of TRIMs (genes encoding tripartite motif proteins). These results will be useful for the identification of POWV restriction factors.

Also flagged:lung carcinomaIFASARShepatitisMT-4Influenza
Journal Article 2017-11-16 ✓ 2 Snippets Gröner A, Broumis C, Fang R, Nowak T, Popp B, Schäfer W, Roth NJ.
In-Text Gene Mentions

…mediates except antithrombin (ATIII) and API (Table…

…exception is theATIIIintermediate where high…

Show Full Abstract

<h4>Background</h4>Careful selection and testing of plasma reduces the risk of blood-borne viruses in the starting material for plasma-derived products. Furthermore, effective measures such as pasteurization at 60°C for 10 hours have been implemented in the manufacturing process of therapeutic plasma proteins such as human albumin, coagulation factors, immunoglobulins, and enzyme inhibitors to inactivate blood-borne viruses of concern. A comprehensive compilation of the virus reduction capacity of pasteurization is presented including the effect of stabilizers used to protect the therapeutic protein from modifications during heat treatment.<h4>Study design and methods</h4>The virus inactivation kinetics of pasteurization for a broad range of viruses were evaluated in the relevant intermediates from more than 15 different plasma manufacturing processes. Studies were carried out under the routine manufacturing target variables, such as temperature and product-specific stabilizer composition. Additional studies were also performed under robustness conditions, that is, outside production specifications.<h4>Results</h4>The data demonstrate that pasteurization inactivates a wide range of enveloped and nonenveloped viruses of diverse physicochemical characteristics. After a maximum of 6 hours' incubation, no residual infectivity could be detected for the majority of enveloped viruses. Effective inactivation of a range of nonenveloped viruses, with the exception of nonhuman parvoviruses, was documented.<h4>Conclusion</h4>Pasteurization is a very robust and reliable virus inactivation method with a broad effectiveness against known blood-borne pathogens and emerging or potentially emerging viruses. Pasteurization has proven itself to be a highly effective step, in combination with other complementary safety measures, toward assuring the virus safety of final product.

Also flagged:Malariahost cellsCD34CD133stem cell factorIL-3
Journal Article 2017-11-16 ✓ 1 Snippet Armistead JS, Adams JH.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Malaria prevalence has declined in the past 10 years, especially outside of sub-Saharan Africa. However, the proportion of cases due to Plasmodium vivax is increasing, accounting for up to 90-100% of the malaria burden in endemic regions. Nonetheless, investments in malaria research and control still prioritize Plasmodium falciparum while largely neglecting P. vivax. Specific biological features of P. vivax, particularly invasion of reticulocytes, occurrence of dormant liver forms of the parasite, and the potential for transmission of sexual-stage parasites prior to onset of clinical illness, promote its persistence and hinder development of research tools and interventions. This review discusses recent advances in P. vivax research, current knowledge of its unique biology, and proposes priorities for P. vivax research and control efforts.

Also flagged:Ebola virus diseaseimmune responsescoagulationsepsisinfectionpathogenesis
Journal Article 2017-11-16 ✓ 1 Snippet Eisfeld AJ, Halfmann PJ, Wendler JP, Kyle JE, Burnum-Johnson KE, Peralta Z, Maemura T, Walters KB, Watanabe T, Fukuyama S, Yamashita M, Jacobs JM, Kim YM, Casey CP, Stratton KG, Webb-Robertson BM, Gritsenko MA, Monroe ME, Weitz KK, Shukla AK, Tian M, Neumann G, Reed JL, van Bakel H, Metz TO, Smith RD, Waters KM, N'jai A, Sahr F, Kawaoka Y.
In-Text Gene Mentions

OLFM4

Show Full Abstract

The pathogenesis of human Ebola virus disease (EVD) is complex. EVD is characterized by high levels of virus replication and dissemination, dysregulated immune responses, extensive virus- and host-mediated tissue damage, and disordered coagulation. To clarify how host responses contribute to EVD pathophysiology, we performed multi-platform 'omics analysis of peripheral blood mononuclear cells and plasma from EVD patients. Our results indicate that EVD molecular signatures overlap with those of sepsis, imply that pancreatic enzymes contribute to tissue damage in fatal EVD, and suggest that Ebola virus infection may induce aberrant neutrophils whose activity could explain hallmarks of fatal EVD. Moreover, integrated biomarker prediction identified putative biomarkers from different data platforms that differentiated survivors and fatalities early after infection. This work reveals insight into EVD pathogenesis, suggests an effective approach for biomarker identification, and provides an important community resource for further analysis of human EVD severity.

Also flagged:programmed cell death protein 1PD-1cancersPD-L1proteasomedegradation
Journal Article 2017-11-16 ✓ 1 Snippet Zhang J, Bu X, Wang H, Zhu Y, Geng Y, Nihira NT, Tan Y, Ci Y, Wu F, Dai X, Guo J, Huang YH, Fan C, Ren S, Sun Y, Freeman GJ, Sicinski P, Wei W.
In-Text Gene Mentions

KLHL20construct was offered…

Show Full Abstract

Treatments that target immune checkpoints, such as the one mediated by programmed cell death protein 1 (PD-1) and its ligand PD-L1, have been approved for treating human cancers with durable clinical benefit. However, many patients with cancer fail to respond to compounds that target the PD-1 and PD-L1 interaction, and the underlying mechanism(s) is not well understood. Recent studies revealed that response to PD-1-PD-L1 blockade might correlate with PD-L1 expression levels in tumour cells. Hence, it is important to understand the mechanistic pathways that control PD-L1 protein expression and stability, which can offer a molecular basis to improve the clinical response rate and efficacy of PD-1-PD-L1 blockade in patients with cancer. Here we show that PD-L1 protein abundance is regulated by cyclin D-CDK4 and the cullin 3-SPOP E3 ligase via proteasome-mediated degradation. Inhibition of CDK4 and CDK6 (hereafter CDK4/6) in vivo increases PD-L1 protein levels by impeding cyclin D-CDK4-mediated phosphorylation of speckle-type POZ protein (SPOP) and thereby promoting SPOP degradation by the anaphase-promoting complex activator FZR1. Loss-of-function mutations in SPOP compromise ubiquitination-mediated PD-L1 degradation, leading to increased PD-L1 levels and reduced numbers of tumour-infiltrating lymphocytes in mouse tumours and in primary human prostate cancer specimens. Notably, combining CDK4/6 inhibitor treatment with anti-PD-1 immunotherapy enhances tumour regression and markedly improves overall survival rates in mouse tumour models. Our study uncovers a novel molecular mechanism for regulating PD-L1 protein stability by a cell cycle kinase and reveals the potential for using combination treatment with CDK4/6 inhibitors and PD-1-PD-L1 immune checkpoint blockade to enhance therapeutic efficacy for human cancers.

Also flagged:Threatbehavioralmental illnesspsychiatric disordersdepressionanxiety
Journal Article 2017-11-16 No Snippets Avinun R, Nevo A, Knodt AR, Elliott ML, Hariri AR.
Show Full Abstract

<h4>Background</h4>Low replication rates are a concern in most, if not all, scientific disciplines. In psychiatric genetics specifically, targeting intermediate brain phenotypes, which are more closely associated with putative genetic effects, was touted as a strategy leading to increased power and replicability. In the current study, we attempted to replicate previously published associations between single nucleotide polymorphisms and threat-related amygdala reactivity, which represents a robust brain phenotype not only implicated in the pathophysiology of multiple disorders, but also used as a biomarker of future risk.<h4>Methods</h4>We conducted a literature search for published associations between single nucleotide polymorphisms and threat-related amygdala reactivity and found 37 unique findings. Our replication sample consisted of 1117 young adult volunteers (629 women, mean age 19.72 ± 1.25 years) for whom both genetic and functional magnetic resonance imaging data were available.<h4>Results</h4>Of the 37 unique associations identified, only three replicated as previously reported. When exploratory analyses were conducted with different model parameters compared to the original findings, significant associations were identified for 28 additional studies: eight of these were for a different contrast/laterality; five for a different gender and/or race/ethnicity; and 15 in the opposite direction and for a different contrast, laterality, gender, and/or race/ethnicity. No significant associations, regardless of model parameters, were detected for six studies. Notably, none of the significant associations survived correction for multiple comparisons.<h4>Conclusions</h4>We discuss these patterns of poor replication with regard to the general strategy of targeting intermediate brain phenotypes in genetic association studies and the growing importance of advancing the replicability of imaging genetics findings.

Also flagged:F-box proteinscancercancershistone modificationsmethylationSCF
Journal Article 2017-11-16 ✓ 1 Snippet Shen J, Spruck C.
In-Text Gene Mentions

…that FBXO22 andFBXL4independently regulate KDM4A…

Show Full Abstract

Epigenetic abnormalities are now realized as important as genetic alterations in contributing to the initiation and progression of cancer. Recent advancements in the cancer epigenetics field have identified extensive alterations of the epigenetic network in human cancers, including histone modifications and DNA methylation. F-box proteins, the substrate receptors of SCF (SKP1-Cullin1-F-box protein) E3 ubiquitin ligases, can directly and indirectly affect the balance of epigenetic regulation. In this brief review, we discuss our current understanding of F-box proteins in cellular epigenetic regulation and how dysregulation of these processes contribute to cancer development.

Also flagged:Cap1adenylyl cyclase-associated protein 1multi-drug resistance gene 1MDR1vulvovaginal candidiasisfluconazole
Journal Article 2017-11-16 No Snippets Feng W, Yang J, Yang L, Li Q, Zhu X, Xi Z, Qiao Z, Cen W.
Show Full Abstract

The aim of the present study was to investigate the association between Mrr1, adenylyl cyclase-associated protein 1 (Cap1) and multi-drug resistance gene 1 (MDR1), and to assess the mutations in Mrr1 and Cap1 in azole-resistant <i>Candida albicans</i> strains. The study isolated 68 <i>C. albicans</i> strains from patients with vulvovaginal candidiasis. Drug susceptibility testing was conducted to characterize the resistance profile of these strains to fluconazole, itraconazole and voriconazole. Polymerase chain reaction (PCR) amplification was performed for Cap1 and Mrr1, and the PCR products were sequenced to identify any mutations. Reverse transcription-quantitative PCR was performed to measure Cap1, Mrr1 and MDR1 mRNA in <i>C. albicans</i> strains. The results of the present study indicated S381N, P311S and A390T missense mutations in Cap1 and T917M, T923I, N937K, E1020Q, F1032L and S1037L missense mutations in Mrr1 in azole-resistant <i>C. albicans</i> strains. Fluconazole-resistant strains had significantly elevated Cap1 and MDR1 mRNA levels compared with fluconazole-sensitive strains (P<0.01). The mRNA levels of Cap1, Mrr1 and MDR1 were significantly increased in the strains resistant to all three of fluconazole, itraconazole and voriconazole compared with strains sensitive to the three agents (P<0.001, P=0.037 and P<0.001, respectively). Cap1 expression was positively correlated with MDR1 expression in fluconazole-resistant strains (P<0.05). No significant correlation was observed between Cap1, Mrr1 and MDR1 in the strains resistant to fluconazole, itraconazole or voriconazole. The results of the present study suggested that fluconazole resistance may involve MDR1 overexpression mediated by Cap1 overexpression. Cross-resistance between fluconazole, itraconazole and voriconazole may be associated with mutations in Cap1 and Mrr1, rather than their overexpression. In addition, the present study also revealed two novel mutations in Mrr1; T917M and T923I. These findings may provide a basis for elucidating the molecular mechanisms of and improving therapeutic treatments to tackle azole resistance.

Also flagged:fibroblast growth factor 5FGF5primary hypertensionHypertensioncerebrovascular diseaseprimary
Journal Article 2017-11-16 ✓ 2 Snippets Ren Y, Jiao X, Zhang L.
In-Text Gene Mentions

The genome-wide association study discovered a number of primary hypertension related genes, such as ATP2B1, CYP17A1, PLEKHA7, SH2B3, MTHFR, CASZ1, ULK4, HFE, EBF1 and FGF5 (Hong et al., 2010, Lin et al., 2011, Liu et al., 2011b, Haddad et al., 2016, Kathirvel and Subban, 2016, Xi et al., 2013, Weili, 2008, Fox et al., 2011).

…MTHFR, CASZ1, ULK4,HFE, EBF1 and FGF5…

Show Full Abstract

<h4>Objective</h4>To explore the expression level of FGF5 in the peripheral blood of primary hypertension patients and its clinical significance.<h4>Methods</h4>The 34 patients with primary hypertension treated in this hospital from June 2012 to June 2014 were selected as the observation group, while the 25 patients at this hospital who had physical exam with heathy results were selected as control group. Venous blood was drawn early in the morning after an overnight fast. FGF5, mRNA and protein level changes in the peripheral blood cells and peripheral blood serum were analyzed by real-time fluorescence based quantitative PCR (RT-PCR) and enzyme-linked immunosorbent assay (ELISA). FGF5 gene SNP (rs16998073) were amplified by PCR and inserted into T vector, and its genetic variation were analyzed by sequencing. The relationship of FGF5 protein levels and genetic variation with diastolic/systolic blood pressure was also analyzed.<h4>Results</h4>Comparing with the control group, the observation group's FGF5 mRNA and protein levels significantly increased in the peripheral blood cells and peripheral blood. The difference was statistically significant (P < .05). Correlation analysis showed that FGF5 protein level and systolic/diastolic blood pressure were positively correlated (P < .05). T/A genetic variation of FGF5 gene SNP (rs16998073) and diastolic/systolic blood pressure were positively correlated (P < .05).<h4>Conclusion</h4>The FGF5 mRNA and protein expression levels of the patients with primary hypertension were abnormal and had genetic variation, which were associated with blood pressure of the patients with primary hypertension.

Also flagged:lem2pim1cut11GFPCut14nuclei
Journal Article 2017-11-15 ✓ 2 Snippets Aoki K, Niki H.
In-Text Gene Mentions

Condensinwould be released…

Condensinmight be dephosphorylated…

Show Full Abstract

After mitosis, nuclear reorganization occurs together with decondensation of mitotic chromosomes and reformation of the nuclear envelope, thereby restoring the Ran-GTP gradient between the nucleus and cytoplasm. The Ran-GTP gradient is dependent on Pim1/RCC1. Interestingly, a defect in Pim1/RCC1 in <i>Schizosaccharomyces pombe</i> causes postmitotic condensation of chromatin, namely hypercondensation, suggesting a relationship between the Ran-GTP gradient and chromosome decondensation. However, how Ran-GTP interacts with chromosome decondensation is unresolved. To examine this interaction, we used <i>Schizosaccharomyces japonicus</i>, which is known to undergo partial breakdown of the nuclear membrane during mitosis. We found that Pim1/RCC1 was localized on nuclear pores, but this localization failed in a temperature-sensitive mutant of Pim1/RCC1. The mutant cells exhibited hypercondensed chromatin after mitosis due to prolonged association of condensin on the chromosomes. Conceivably, a condensin-dephosphorylation defect might cause hypercondensed chromatin, since chromosomal localization of condensin is dependent on phosphorylation by cyclin-dependent kinase (CDK). Indeed, CDK-phospho-mimic mutation of condensin alone caused untimely condensin localization, resulting in hypercondensed chromatin. Together, these results suggest that dephosphorylation of CDK sites of condensin might require the Ran-GTP gradient produced by nuclear pore-localized Pim1/RCC1.

Also flagged:NUTmidline carcinomaepithelial cancernuclear protein in testisBRD4bromodomain 4
Journal Article 2017-11-15 ✓ 5 Snippets Cavalieri S, Stathis A, Fabbri A, Sonzogni A, Perrone F, Tamborini E, Pelosi G, de Braud F, Platania M.
In-Text Gene Mentions

If these mutations were confirmed to play a role in this neoplasm, clinical trials analyzing targeted therapies should be considered, eg. colorectal cancer-like chemotherapies for DCC mutations, hypomethylating agents for MLL3 mutations or SF3B1 inhibitors in case of specific somatic mutations.

Next-generation sequencing technology identified somatic mutations in deleted in colorectal cancer (DCC), mixed lineage leukemia protein 3 (MLL3), and splicing factor 3B subunit 1 (SF3B1) genes in NMC cells from both primitive cancer and metastases.

…in colorectal cancer (DCC), mixed lineage leukemia…

…is the firstDCC, MLL3, and SF3B1…

…cancer-like chemotherapies forDCCmutations, hypomethylating age…

Show Full Abstract

<h4>Introduction:</h4>NUT midline carcinoma (NMC) is a rare and aggressive epithelial cancer arising from median organs. It is driven by chromosomal translocation t(15;19) involving the rearrangement of NUT (nuclear protein in testis) and BRD4 (bromodomain 4) genes leading to fusion oncoprotein BRD4-NUT.<h4>Case presentation:</h4>We report the case of a woman who was previously treated with induction chemotherapy, surgery, radiotherapy and adjuvant trastuzumab for HER-2 positive invasive ductal carcinoma of the breast. After 6 months of follow-up a lung nodule appeared. A biopsy showed an adenocarcinoma fetal type/lung blastoma, so a left inferior lobectomy was performed: NMC harboring BRD4-NUT rearrangement was diagnosed. After 9 months of follow-up, bone and soft tissue metastases occurred, so the patient was given radiotherapy. Next-generation sequencing technology identified somatic mutations in deleted in colorectal cancer (DCC), mixed lineage leukemia protein 3 (MLL3), and splicing factor 3B subunit 1 (SF3B1) genes in NMC cells from both primitive cancer and metastases. The patient was treated with the experimental BRD4 inhibitor for 10 months, until the disease progressed to the lung and bone. After spinal cord compression, the patient was offered palliative radiotherapy to bone and eventually died aged 39 years.<h4>Conclusions:</h4>To the best of our knowledge, our case is the first DCC, MLL3, and SF3B1 mutated NUT midline carcinoma reported in the literature. If these mutations were confirmed to play a role in this neoplasm, clinical trials analyzing targeted therapies should be considered, eg. colorectal cancer-like chemotherapies for DCC mutations, hypomethylating agents for MLL3 mutations or SF3B1 inhibitors in case of specific somatic mutations.

Also flagged:Transcription factorsmelanomacancertumorstumorBRAF V600E
Journal Article 2017-11-15 No Snippets Cohen-Solal KA, Kaufman HL, Lasfar A.
Show Full Abstract

Resistance to targeted therapy in cancer is often coupled with the acquisition of a pro-invasive phenotype by tumors cells and a highly permissive tumor microenvironment promoting drug resistance. Transcription factors are frequently shown as major points of convergence of multiple dysregulated receptors and signaling pathways in cancer. Several transcription factors are now incriminated as drivers of both drug resistance and invasiveness. We focused this review on critical transcription factors playing a causal role in both the resistance to BRAF V600E-targeted therapy and the pro-invasive behavior of melanoma cells. Simultaneous rewiring of pro-oncogenic signaling pathways, phenotype switching or phenotypic plasticity supporting pro-invasive/pro-metastatic behavior, actin remodeling, and bidirectional interactions between tumor microenvironment and melanoma cells represent major challenges for overcoming resistance to BRAF V600E inhibitors (BRAFi) and will be discussed. Although it represents an underdeveloped area of translational investigation, inhibition of transcription factors may open new avenues to combat resistance to BRAFi.

Also flagged:agingaxoncell proliferationsynapsehatchingkinase
Journal Article 2017-11-15 No Snippets Ivakhnitskaia E, Lin RW, Hamada K, Chang C.
Show Full Abstract

Molecular oscillators are well known for their roles in temporal control of some biological processes like cell proliferation, but molecular mechanisms that provide temporal control of differentiation and postdifferentiation events in cells are less understood. In the nervous system, establishment of neuronal connectivity during development and decline in neuronal plasticity during aging are regulated with temporal precision, but the timing mechanisms are largely unknown. Caenorhabditis elegans has been a preferred model for aging research and recently emerges as a new model for the study of developmental and postdevelopmental plasticity in neurons. In this review we discuss the emerging mechanisms in timing of developmental lineage progression, axon growth and pathfinding, synapse formation, and reorganization, and neuronal plasticity in development and aging. We also provide a current view on the conserved core axon regeneration molecules with the intention to point out potential regulatory points of temporal controls. We highlight recent progress in understanding timing mechanisms that regulate decline in regenerative capacity, including progressive changes of intrinsic timers and co-opting the aging pathway molecules. WIREs Dev Biol 2018, 7:e305. doi: 10.1002/wdev.305 This article is categorized under: Invertebrate Organogenesis > Worms Establishment of Spatial and Temporal Patterns > Regulation of Size, Proportion, and Timing Nervous System Development > Worms Gene Expression and Transcriptional Hierarchies > Regulatory RNA.

Also flagged:Retinoic acidvitamin ARAgoblet cell differentiationReg3gretinoic acid receptor alpha
Journal Article 2017-11-15 ✓ 2 Snippets Jijon HB, Suarez-Lopez L, Diaz OE, Das S, De Calisto J, Parada-kusz M, Yaffe MB, Pittet MJ, Mora JR, Belkaid Y, Xavier RJ, Villablanca EJ.
In-Text Gene Mentions

…ng technologies, 1:400), anti-OLFM4(Cell signaling technologies,…

…cells for olfactomedin-4 (OLFM4), a robust intestinal…

Show Full Abstract

Retinoic acid (RA), a dietary vitamin A metabolite, is crucial in maintaining intestinal homeostasis. RA acts on intestinal leukocytes to modulate their lineage commitment and function. Although the role of RA has been characterized in immune cells, whether intestinal epithelial cells (IECs) rely on RA signaling to exert their immune-regulatory function has not been examined. Here we demonstrate that lack of RA receptor α (RARα) signaling in IECs results in deregulated epithelial lineage specification, leading to increased numbers of goblet cells and Paneth cells. Mechanistically, lack of RARα resulted in increased KLF4<sup>+</sup> goblet cell precursors in the distal bowel, whereas RA treatment inhibited klf4 expression and goblet cell differentiation in zebrafish. These changes in secretory cells are associated with increased Reg3g, reduced luminal bacterial detection, and an underdeveloped intestinal immune system, as evidenced by an almost complete absence of lymphoid follicles and gut resident mononuclear phagocytes. This underdeveloped intestinal immune system shows a decreased ability to clear infection with Citrobacter rodentium. Collectively, our findings indicate that epithelial cell-intrinsic RARα signaling is critical to the global development of the intestinal immune system.

Also flagged:methylationtranslationalgene expressionCas9TET1demethylation
Journal Article 2017-11-15 No Snippets Kraiczy J, Nayak KM, Howell KJ, Ross A, Forbester J, Salvestrini C, Mustata R, Perkins S, Andersson-Rolf A, Leenen E, Liebert A, Vallier L, Rosenstiel PC, Stegle O, Dougan G, Heuschkel R, Koo BK, Zilbauer M.
Show Full Abstract

<h4>Objective</h4>Human intestinal epithelial organoids (IEOs) are increasingly being recognised as a highly promising translational research tool. However, our understanding of their epigenetic molecular characteristics and behaviour in culture remains limited.<h4>Design</h4>We performed genome-wide DNA methylation and transcriptomic profiling of human IEOs derived from paediatric/adult and fetal small and large bowel as well as matching purified human gut epithelium. Furthermore, organoids were subjected to in vitro differentiation and genome editing using CRISPR/Cas9 technology.<h4>Results</h4>We discovered stable epigenetic signatures which define regional differences in gut epithelial function, including induction of segment-specific genes during cellular differentiation. Established DNA methylation profiles were independent of cellular environment since organoids retained their regional DNA methylation over prolonged culture periods. In contrast to paediatric and adult organoids, fetal gut-derived organoids showed distinct dynamic changes of DNA methylation and gene expression in culture, indicative of an in vitro maturation. By applying CRISPR/Cas9 genome editing to fetal organoids, we demonstrate that this process is partly regulated by TET1, an enzyme involved in the DNA demethylation process. Lastly, generating IEOs from a child diagnosed with gastric heterotopia revealed persistent and distinct disease-associated DNA methylation differences, highlighting the use of organoids as disease-specific research models.<h4>Conclusions</h4>Our study demonstrates striking similarities of epigenetic signatures in mucosa-derived IEOs with matching primary epithelium. Moreover, these results suggest that intestinal stem cell-intrinsic DNA methylation patterns establish and maintain regional gut specification and are involved in early epithelial development and disease.

Also flagged:Abnormal spindle-like microcephaly-associated proteinFBLN1KMT2Cchylomicron remodelingTPR and ankyrin repeat-containing protein 1protein-lipid complex
Journal Article 2017-11-15 ✓ 4 Snippets Sharma NK, Tashima AK, Brunialti MKC, Ferreira ER, Torquato RJS, Mortara RA, Machado FR, Assuncao M, Rigato O, Salomao R.
In-Text Gene Mentions

SERPINC1

DNAH10

…including DNAH5, DNAH8,DNAH10, DNAH11 and DNAH12…

…DNAH12 (upregulated); DNAH5,DNAH10, and DNAH11 were…

Show Full Abstract

Sepsis is a life-threatening disorder characterized by organ dysfunction and a major cause of mortality worldwide. The major challenge in studying sepsis is its diversity in such factors as age, source of infection and etiology. Recently, genomic and proteomic approaches have improved our understanding of its complex pathogenesis. In the present study, we use quantitative proteomics to evaluate the host proteome response in septic patients secondary to community-acquired pneumonia (CAP). Samples obtained at admission and after 7 days of follow-up were analyzed according to the outcomes of septic patients. The patients' proteome profiles were compared with age- and gender-matched healthy volunteers. Bioinformatic analyses of differentially expressed proteins showed alteration in the cytoskeleton, cellular assembly, movement, lipid metabolism and immune responses in septic patients. Actin and gelsolin changes were assessed in mononuclear cells using immunofluorescence, and a higher expression of gelsolin and depletion of actin were observed in survivor patients. Regarding lipid metabolism, changes in cholesterol, HDL and apolipoproteins were confirmed using enzymatic colorimetric methods in plasma. Transcriptomic studies revealed a massive change in gene expression in sepsis. Our proteomic results stressed important changes in cellular structure and metabolism, which are possible targets for future interventions of sepsis.

Also flagged:saltdegradationmineralchromosomePhosphorusZinc
Journal Article 2017-11-15 ✓ 1 Snippet Hussain B, Lucas SJ, Ozturk L, Budak H.
In-Text Gene Mentions

…However, bHLH140, GATA26,ZNFX1-NFXL1, EIN3, ABI3, ARF3,…

Show Full Abstract

Soil salinization and degradation is one of the consequences of climate change. Identification of major salt tolerance genes and marker assisted selection (MAS) can accelerate wheat breeding for this trait. We genotyped 154 wheat F<sub>2</sub> lines derived from a cross between salt tolerant and susceptible cultivars using the Axiom Wheat Breeder's Genotyping Array. A high-density linkage map of 988 single nucleotide polymorphisms (SNPs) was constructed and utilized for quantitative trait loci (QTL) mapping for salt tolerance traits and mineral concentrations under salinity. Of 49 mapped QTLs, six were for Na<sup>+</sup> exclusion (NAX) and two QTLs (qSNAX.2 A.1, qSNAX.2 A.2) on chromosome 2 A coincided with a reported major NAX QTL (Nax1 or HKT1;4). Two other major NAX QTLs were mapped on 7 A, which contributed 11.23 and 18.79% of the salt tolerance respectively. In addition to Ca<sup>+2</sup> and Mg<sup>+2</sup> QTLs, twenty-seven QTLs for tissue Phosphorus, Zinc, Iron, Manganese, Copper, Sulphur and Boron concentrations under salinity were also mapped. The 1293 segregating SNPs were annotated/located within genes for various ion channels, signalling pathways, transcription factors (TFs), metabolic pathways and 258 of them showed differential expression in silico under salinity. These findings will create new opportunities for salt tolerance breeding programs.

Also flagged:cancerorganochlorinesprotein synthesiscancersgene expressiongene expressions
Journal Article 2017-11-15 No Snippets Ghosh S, Loffredo CA, Mitra PS, Trnovec T, Palkovicova Murinova L, Sovcikova E, Hoffman EP, Makambi KH, Dutta SK.
Show Full Abstract

The risk of cancer due to PCB exposure in humans is highly debated. In eastern Slovakia, high exposure of the population to organochlorines (especially PCBs) was associated with various disease and disorder pathways, viz., endocrine disruption, metabolic disorder & diabetes, and cancer, thereby disturbing several cellular processes, including protein synthesis, stress response, and apoptosis. We have evaluated a Slovak cohort (45-month children, at lower and higher levels of PCB exposure from the environment) for disease and disorder development to develop early disease cancer biomarkers that could shed new light on possible mechanisms for the genesis of cancers under such chemical exposures, and identify potential avenues for prevention.Microarray studies of global gene expression were conducted from the 45-month-old children on the Affymetrix platform followed by Ingenuity Pathway Analysis (IPA®) to associate the affected genes with their mechanistic pathways. High-throughput qRT-PCR TaqMan low-density array (TLDA) was performed to further validate the selected genes on the whole blood cells of the most highly exposed children from the study cohort (n = 71). TP53, MYC, BCL2, and LRP12 differential gene expressions suggested strong relationships between potential future tumor promotion and PCB exposure in Slovak children. The IPA analysis further detected the most important signaling pathways, including molecular mechanism of cancers, prostate cancer signaling, ovarian cancer signaling, P53 signaling, oncostatin M signaling, and their respective functions (viz., prostate cancer, breast cancer, progression of tumor, growth of tumor, and non-Hodgkin's disease). The results suggest that PCB exposures, even at the early age of these children, may have lifelong consequences for the future development of chronic diseases.

Also flagged:top 1topmemoryStapinkDFC
Journal Article 2017-11-15 No Snippets Liu J, Liao X, Xia M, He Y.
Show Full Abstract

The human brain is a large, interacting dynamic network, and its architecture of coupling among brain regions varies across time (termed the "chronnectome"). However, very little is known about whether and how the dynamic properties of the chronnectome can characterize individual uniqueness, such as identifying individuals as a "fingerprint" of the brain. Here, we employed multiband resting-state functional magnetic resonance imaging data from the Human Connectome Project (N = 105) and a sliding time-window dynamic network analysis approach to systematically examine individual time-varying properties of the chronnectome. We revealed stable and remarkable individual variability in three dynamic characteristics of brain connectivity (i.e., strength, stability, and variability), which was mainly distributed in three higher order cognitive systems (i.e., default mode, dorsal attention, and fronto-parietal) and in two primary systems (i.e., visual and sensorimotor). Intriguingly, the spatial patterns of these dynamic characteristics of brain connectivity could successfully identify individuals with high accuracy and could further significantly predict individual higher cognitive performance (e.g., fluid intelligence and executive function), which was primarily contributed by the higher order cognitive systems. Together, our findings highlight that the chronnectome captures inherent functional dynamics of individual brain networks and provides implications for individualized characterization of health and disease.

Also flagged:immune responsesCD4CD8copolymerheparinsulfamethazine
Journal Article 2017-11-15 No Snippets Duong HTT, Kim NW, Thambi T, Giang Phan VH, Lee MS, Yin Y, Jeong JH, Lee DS.
Show Full Abstract

Successful delivery of a DNA vaccine to antigen-presenting cells and their subsequent stimulation of CD4<sup>+</sup> and CD8<sup>+</sup> T cell immunity remains an inefficient process. In general, the delivery of prophylactic vaccines is mainly mired by low transfection efficacy, poor immunogenicity, and safety issues from the materials employed. Currently, several strategies have been exploited to improve immunogenicity, but an effective strategy for safe and pain-free delivery of DNA vaccines is complicated. Herein, we report the rapid delivery of polyplex-based DNA vaccines using microneedle arrays coated with a polyelectrolyte multilayer assembly of charge reversal pH-responsive copolymer and heparin. The charge reversal pH-responsive copolymer, composed of oligo(sulfamethazine)-b-poly(ethylene glycol)-b-poly(amino urethane) (OSM-b-PEG-b-PAEU), was used as a triggering layer in the polyelectrolyte multilayer assembly on microneedles. Charge reversal characteristics of this copolymer, that is, the OSM-b-PEG-b-PAEU copolymer exhibit, positive charge at low pH (pH4.03) and becoming negative charge when exposed to physiological pH conditions (pH7.4), allowing the facile assembly and disassembly of polyelectrolyte multilayers. The electrostatic repulsion between heparin and OSM-b-PEG-b-PAEU charge reversal copolymer triggered the release of DNA vaccines. DNA vaccines laden on microneedles are effectively transfected into RAW 264.7 macrophage cells in vitro. Vaccination of BALB/c mice by DNA vaccine-loaded microneedle arrays coated with a polyelectrolyte multilayer generated antigen-specific robust immune responses. These findings provide potential strategy of charge reversal pH-responsive copolymers coated microneedles for DNA vaccine delivery.

Also flagged:pathogenesisIdiopathic macular holesvisionmacular holesmembraneα-2-macroglobulin
Journal Article 2017-11-15 No Snippets Zhang P, Zhu M, Zhao Y, Qian J, Dufresne C, Turner R, Semba RD, Solomon SD.
Show Full Abstract

Idiopathic macular holes (IMH) are full-thickness defects of retinal tissue that cause severe vision loss due to disruption of the anatomic fovea. Abnormal vitreous traction is involved in the formation of macular holes. Both glial cells and hyalocytes contribute to epiretinal membrane formation in IMH. In order to gain further insight into the pathophysiology of IMH, we conducted a discovery phase investigation of the vitreous proteome in four patients with macular holes and six controls using one-dimensional gel fractionation and liquid chromatography-tandem mass spectrometry analyses on an Orbitrap Elite mass spectrometer. Of a total of 5912 vitreous proteins, 32 proteins had increased and 39 proteins had decreased expression in IMH compared with controls, using a false discovery rate approach with p value < 0.001 and q value < 0.05. IMH was associated with increased expression of proteins in the complement pathway, α-2-macroglobulin, a major inducer of Müller glial cell migration, fibrinogen, and extracellular matrix proteins, and decreased expression of proteins involved in protein folding and actin filament binding. A proteomic approach revealed proteins and biological pathways that may be involved in the pathogenesis of IMH and could be targeted for future studies.

Also flagged:GlycosylphosphatidylinositolCell Adhesion Moleculescell surface glycoproteinstransmembranemembranesynapse formation
Journal Article 2017-11-15 ✓ 5 Snippets Tan RPA, Leshchyns'ka I, Sytnyk V.
In-Text Gene Mentions

A genome-wide copy number scan identified NEGR1 to be one of five new candidate genes involved in dyslexia (Veerappa et al., 2013).

In Dark Agouti rats, NEGR1 is upregulated in response to venlafaxine (VLX), a serotonin and noradrenaline reuptake inhibitor used to treat major depressive disorder (MDD), suggesting that NEGR1 contributes to the VLX effect in MDD possibly by contributing to the establishment of new neuronal connections and changes in synaptic plasticity (Tamási et al., 2014).

A recent study showing that NEGR1 interacts with Niemann-Pick disease Type C2 (NPC2) protein and functions in cholesterol transport (Kim et al., 2017) suggests that GPI-anchored IgSF CAMs may also be involved in regulation of the lipid composition of the plasma membrane.

Patient case studies found that deletions of 1p31.1 to 1p31.3 containing the NEGR1 gene present with developmental co-ordination disorder, attention deficit/hyperactivity disorder, learning disability, as well as delayed speech and language development (Gillberg and FitzPatrick, 2010; Tassano et al., 2015).

Further suggestive of the role NEGR1 has in brain disorders, NEGR1 is also elevated in the CSF of bipolar and depressed patients (Maccarrone et al., 2013).

Show Full Abstract

Immunoglobulin superfamily (IgSF) cell adhesion molecules (CAMs) are cell surface glycoproteins that not only mediate interactions between neurons but also between neurons and other cells in the nervous system. While typical IgSF CAMs are transmembrane molecules, this superfamily also includes CAMs, which do not possess transmembrane and intracellular domains and are instead attached to the plasma membrane via a glycosylphosphatidylinositol (GPI) anchor. In this review, we focus on the role GPI-anchored IgSF CAMs have as signal transducers and ligands in neurons, and discuss their functions in regulation of neuronal development, synapse formation, synaptic plasticity, learning, and behavior. We also review the links between GPI-anchored IgSF CAMs and brain disorders.

Also flagged:SynthesisRiboseanilinopyrimidineEGFRtyrosine kinasenon-small cell lung cancer
Journal Article 2017-11-15 No Snippets Hu X, Wang D, Tong Y, Tong L, Wang X, Zhu L, Xie H, Li S, Yang Y, Xu Y.
Show Full Abstract

The synthesis of a series of ribose-modified anilinopyrimidine derivatives was efficiently achieved by utilizing DBU or <i>t</i>BuOLi-promoted coupling of ribosyl alcohols with 2,4,5-trichloropyrimidine as key step. Preliminary biological evaluation of this type of compounds as new EGFR tyrosine kinase inhibitors for combating EGFR L858R/T790M mutant associated with drug resistance in the treatment of non-small cell lung cancer revealed that 3-<i>N</i>-acryloyl-5-<i>O</i>-anilinopyrimidine ribose derivative <b>1a</b> possessed potent and specific inhibitory activity against EGFR L858R/T790M over WT EGFR. Based upon molecular docking studies of the binding mode between compound <b>1a</b> and EGFR, the distance between the Michael receptor and the pyrimidine scaffold is considered as an important factor for the inhibitory potency and future design of selective EGFR tyrosine kinase inhibitors against EGFR L858R/T790M mutants.

Also flagged:neurodegenerative diseasesneurodegenerative disorderscognitioneditingclustered regularly interspaced short palindromic repeatsCas
Journal Article 2017-11-15 ✓ 3 Snippets Shin JW, Lee JM.
In-Text Gene Mentions

Complete lack of Htt leads to embryo lethality in mice,52, –54 and compound heterozygous nullifying variants in HTT are associated with a neurodevelopmental disorder in humans.55 Whether or not huntingtin is dispensable in the adult brain is controversial.56,57 However, loss of one copy of the gene due to balanced translocation does not cause HD,58 supporting therapeutic CRISPR/Cas gene silencing.

HD is a dominantly inherited neurodegenerative disease, caused by an expansion of CAG trinucleotide repeat in the first exon of huntingtin gene (HTT).3,29HTT CAG repeat is highly polymorphic in the normal population30; once their lengths become greater than 35, various characteristic neurological symptoms occur.29 The first attempt to reduce the size of the disease-generating CAG repeat in induced pluripotent stem cells (iPSCs) derived from an individual with HD (carrying 72 and 19 CAGs) was based on homologous recombination using a repair template of bacterial artificial chromosome (BAC) containing the entire HTT with a normal CAG repeat (21 CAGs).31 Expression profiling analysis and apoptosis assays showed that genetically corrected iPSC clonal lines showed normalization of various cellular pathogenic signaling pathways (e.g. cadherin, TGF-β, BDNF) and disease phenotypes (e.g. susceptibility to cell death),31 supporting its therapeutic benefits.

It has been recently demonstrated that the expression levels of HTT could be lowered by CRISPR/Cas approaches using a single gRNA, targeting non-coding regions of the gene.61 In mesenchymal stem cells extracted from the bone marrow of the YAC128 HD mouse model,62 single gRNA-mediated CRISPR/Cas9 DNA editing at the 5′ untranslated region (UTR) or exon1–intron1 junction of HTT resulted in reduced HTT mRNA and protein expression levels.61 A significant reduction of HTT mRNA expression levels was also achieved by targeting the transcription start site of HTT using a single gRNA and dead Cas9 (dCas9) (Figure 2(e)).63 If genetic variations that permit allele-specific CRISPR/Cas9 targeting are available in the region important for transcriptional and/or translational regulation of HTT, this approach may provide therapeutic benefits without producing significant side effects in HD.

Show Full Abstract

Over the past few decades, as gene discovery methods and sequencing technologies have evolved, many genetic variations that significantly increase the risk of or cause neurodegenerative diseases have been identified. However, knowledge of those pathogenic mutations and subsequent mechanism-focused studies has rarely yielded effective treatments, warranting alternative strategies for refining rational therapeutic targets. Nevertheless, with the evolution of gene targeting methods, it has been increasingly recognized that the disease-causing gene itself is the best therapeutic target even when we do not have a full understanding of its biological functions. Considering this, CRISPR/Cas gene editing technology offers the promise of permanently silencing or correcting the disease-causing mutations, potentially overcoming key limitations of RNA-targeting approaches. The versatile CRISPR/Cas-based strategies have the potential to become treatment options for challenging disorders such as neurodegenerative diseases. Here, we summarize recent reports of preclinical applications of CRISPR/Cas in models of neurodegenerative disorders to provide perspectives on therapeutic gene editing for diseases of the nervous system.

Also flagged:IronStearoyl-CoenzymeA DesaturaseSCDfatty acidmetabolismγ-glutamyltranspeptidase
Journal Article 2017-11-15 ✓ 1 Snippet Wu Y, Baylin A, Colacino JA.
In-Text Gene Mentions

…study subjects, andhemochromatosispatients.…

Show Full Abstract

<h4>Background</h4>Stearoyl-coenzyme A desaturase (SCD) is a key enzyme in fatty acid metabolism, and elevated SCD activity is associated with multiple adverse health outcomes. Diet, hormone levels, and environmental exposures are potential factors affecting SCD activity. Less is known about the relationship between micronutrients, including iron, and SCD activity.<h4>Objective</h4>The aim of this study was to investigate the association between serum ferritin level, a biomarker of circulating iron levels, and the Δ9 desaturase index (C16:1/C16:0), a biomarker of estimated SCD activity, among women in the United States.<h4>Methods</h4>The association between serum ferritin and the Δ9 desaturase index was assessed in a cross-sectional study of 447 female participants, aged 20-49 y, from NHANES 2003-2004. The multivariate analyses were performed utilizing generalized linear modeling, adjusting for potential confounders. Mediation of the relationship between serum ferritin and Δ9 desaturase index by γ-glutamyltranspeptidase (GGT), a biomarker of oxidative stress, was also assessed.<h4>Results</h4>Increased ferritin was significantly associated with a higher Δ9 desaturase index. Adjusting for waist circumference, age, race, and cotinine levels, an interquartile range increase in serum ferritin corresponded to 3.92% (95% CI: 0.88%, 7.05%) higher Δ9 desaturase index. GGT, the biomarker used to measure oxidative stress level, did not appear to mediate the association between ferritin and Δ9 desaturase index. After stratifying by pregnancy status, these associations were limited to nonpregnant individuals.<h4>Conclusions</h4>Elevated SCD activity may be associated with increased iron storage inside the human body; the association did not appear to be mediated via oxidative stress, as estimated by GGT levels.

Also flagged:mitochondrialsecondary coenzyme Q deficiencyphosphorylationgene expressionsynthesiscoenzyme
Journal Article 2017-11-14 ✓ 1 Snippet Kühl I, Miranda M, Atanassov I, Kuznetsova I, Hinze Y, Mourier A, Filipovska A, Larsson NG.
In-Text Gene Mentions

…mt-tRNA synthetase (Dars2) deficient knockout…

Show Full Abstract

Dysfunction of the oxidative phosphorylation (OXPHOS) system is a major cause of human disease and the cellular consequences are highly complex. Here, we present comparative analyses of mitochondrial proteomes, cellular transcriptomes and targeted metabolomics of five knockout mouse strains deficient in essential factors required for mitochondrial DNA gene expression, leading to OXPHOS dysfunction. Moreover, we describe sequential protein changes during post-natal development and progressive OXPHOS dysfunction in time course analyses in control mice and a middle lifespan knockout, respectively. Very unexpectedly, we identify a new response pathway to OXPHOS dysfunction in which the intra-mitochondrial synthesis of coenzyme Q (ubiquinone, Q) and Q levels are profoundly decreased, pointing towards novel possibilities for therapy. Our extensive omics analyses provide a high-quality resource of altered gene expression patterns under severe OXPHOS deficiency comparing several mouse models, that will deepen our understanding, open avenues for research and provide an important reference for diagnosis and treatment.

Also flagged:MAPK11HIPK3Huntington's diseaseHDkinasesMAPK-related kinases
Journal Article 2017-11-14 No Snippets Tejwani L, Lim J.
Show Full Abstract

In a paper recently published in Cell Research, Yu et al. identify two MAPK-related kinases, MAPK11 and HIPK3, as positive regulators of levels of mutant huntingtin protein, a toxic species highly involved in Huntington's disease (HD) pathology. The identification and validation of these kinases as therapeutic targets for knockdown in multiple relevant experimental model systems reveal novel potential approaches for treatment of HD.

Also flagged:SynthesisPeptidesL1ferrocenecysteinepeptide
Journal Article 2017-11-14 No Snippets Lara Carrillo JA, Fierro Medina R, Manríquez Rocha J, Bustos Bustos E, Insuasty Cepeda DS, García Castañeda JE, Rivera Monroy ZJ.
Show Full Abstract

In order to obtain gold electrode surfaces modified with Human Papillomavirus L1 protein (HPV L1)-derived peptides, two sequences, SPINNTKPHEAR and YIK, were chosen. Both have been recognized by means of sera from patients infected with HPV. The molecules, Fc-Ahx-SPINNTKPHEAR, Ac-C-<i>Ahx</i>-(Fc)KSPINNTKPHEAR, Ac-C-<i>Ahx</i>-SPINNTKPHEAR(Fc)K, C-<i>Ahx</i>-SPINNTKPHEAR, and (YIK)₂-<i>Ahx</i>-C, were designed, synthesized, and characterized. Our results suggest that peptides derived from the SPINNTKPHEAR sequence, containing ferrocene and cysteine residues, are not stable and not adequate for electrode surface modification. The surface of polycrystalline gold electrodes was modified with the peptides C-Ahx-SPINNTKPHEAR or (YIK)₂-Ahx-C through self-assembly. The modified polycrystalline gold electrodes were characterized via infrared spectroscopy and electrochemical measurements. The thermodynamic parameters, surface coverage factor, and medium pH effect were determined for these surfaces. The results indicate that surface modification depends on the peptide sequence (length, amino acid composition, polyvalence, etc.). The influence of antipeptide antibodies on the voltammetric response of the modified electrode was evaluated by comparing results obtained with pre-immune and post-immune serum samples.

Also flagged:regulation ofgene expressionbindingadipocyte differentiationobesitymaternal obesity
Journal Article 2017-11-14 ✓ 1 Snippet Le DH, Verbeke L, Son LH, Chu DT, Pham VH.
In-Text Gene Mentions

…expression of theHTTgene, whose mutation…

Show Full Abstract

<h4>Background</h4>MicroRNAs (miRNAs) have been shown to play an important role in pathological initiation, progression and maintenance. Because identification in the laboratory of disease-related miRNAs is not straightforward, numerous network-based methods have been developed to predict novel miRNAs in silico. Homogeneous networks (in which every node is a miRNA) based on the targets shared between miRNAs have been widely used to predict their role in disease phenotypes. Although such homogeneous networks can predict potential disease-associated miRNAs, they do not consider the roles of the target genes of the miRNAs. Here, we introduce a novel method based on a heterogeneous network that not only considers miRNAs but also the corresponding target genes in the network model.<h4>Results</h4>Instead of constructing homogeneous miRNA networks, we built heterogeneous miRNA networks consisting of both miRNAs and their target genes, using databases of known miRNA-target gene interactions. In addition, as recent studies demonstrated reciprocal regulatory relations between miRNAs and their target genes, we considered these heterogeneous miRNA networks to be undirected, assuming mutual miRNA-target interactions. Next, we introduced a novel method (RWRMTN) operating on these mutual heterogeneous miRNA networks to rank candidate disease-related miRNAs using a random walk with restart (RWR) based algorithm. Using both known disease-associated miRNAs and their target genes as seed nodes, the method can identify additional miRNAs involved in the disease phenotype. Experiments indicated that RWRMTN outperformed two existing state-of-the-art methods: RWRMDA, a network-based method that also uses a RWR on homogeneous (rather than heterogeneous) miRNA networks, and RLSMDA, a machine learning-based method. Interestingly, we could relate this performance gain to the emergence of "disease modules" in the heterogeneous miRNA networks used as input for the algorithm. Moreover, we could demonstrate that RWRMTN is stable, performing well when using both experimentally validated and predicted miRNA-target gene interaction data for network construction. Finally, using RWRMTN, we identified 76 novel miRNAs associated with 23 disease phenotypes which were present in a recent database of known disease-miRNA associations.<h4>Conclusions</h4>Summarizing, using random walks on mutual miRNA-target networks improves the prediction of novel disease-associated miRNAs because of the existence of "disease modules" in these networks.

Also flagged:EB1End binding protein 1microtubulecancerneuronal diseasesbinding
Journal Article 2017-11-14 No Snippets Almeida TB, Carnell AJ, Barsukov IL, Berry NG.
Show Full Abstract

End binding protein 1 (EB1) is a key element in the complex network of protein-protein interactions at microtubule (MT) growing ends, which has a fundamental role in MT polymerisation. EB1 is an important protein target as it is involved in regulating MT dynamic behaviour, and has been associated with several disease states, such as cancer and neuronal diseases. Diverse EB1 binding partners are recognised through a conserved four amino acid motif, (serine-X-isoleucine-proline) which exists within an intrinsically disordered region. Here we report the use of a multidisciplinary computational and experimental approach for the discovery of the first small molecule scaffold which targets the EB1 recruiting domain. This approach includes virtual screening (structure- and ligand-based design) and multiparameter compound selection. Subsequent studies on the selected compounds enabled the elucidation of the NMR structures of the C-terminal domain of EB1 in the free form and complexed with a small molecule. These structures show that the binding site is not preformed in solution, and ligand binding is fundamental for the binding site formation. This work is a successful demonstration of the combination of modelling and experimental methods to enable the discovery of compounds which bind to these challenging systems.

Also flagged:hydroxymethyl) alkanoatecurcuminoidcell cycletriple-negative breast adenocarcinomaCurcuminwater
Journal Article 2017-11-14 No Snippets Chang LC, Hsieh MT, Yang JS, Lu CC, Tsai FJ, Tsao JW, Chiu YJ, Kuo SC, Lee KH.
Show Full Abstract

Curcumin has been shown to exert potential antitumor activity in vitro and in vivo involved in multiple signaling pathways. However, the application of curcumin is still limited because of its poor hydrophilicity and low bio-availability. In the present study, we investigated the therapeutic effects of a novel and water soluble bis(hydroxymethyl) alkanoate curcuminoid derivative, MTH-3, on human breast adenocarcinoma MDA-MB-231 cells. This study investigated the effect of MTH-3 on cell viability, cell cycle and induction of autophagy and apoptosis in MDA-MB-231 cells. After 24-h treatment with MTH-3, a concentration-dependent decrease in MDA-MB-231 cell viability was observed, and the IC50 value was 5.37±1.22 µM. MTH-3 significantly triggered G2/M phase arrest and apoptosis in MDA-MB-231 cells. Within a 24-h treatment, MTH-3 decreased the CDK1 activity by decreasing CDK1 and cyclin B1 protein levels. MTH-3-induced apoptosis was further confirmed by morphological assessment and annexin V/PI staining assay. Induction of apoptosis caused by MTH-3 was accompanied by an apparent increase of DR3, DR5 and FADD and, as well as a marked decrease of Bcl-2 and Bcl-xL protein expression. MTH-3 also decreased the protein levels of Ero1, PDI, PERK and calnexin, as well as increased the expression of IRE1α, CHOP and Bip that consequently led to ER stress and MDA-MB-231 cell apoptosis. In addition, MTH-3-treated cells were involved in the autophagic process and cleavage of LC3B was observed. MTH-3 enhanced the protein levels of LC3B, Atg5, Atg7, Atg12, p62 and Beclin-1 in MDA-MB-231 cells. Finally, DNA microarray was carried out to investigate the level changes of gene expression modulated by MTH-3 in MDA-MB-231 cells. Taken together, our results suggest that MTH-3 might be a novel therapeutic agent for the treatment of triple-negative breast cancer in the near future.

Also flagged:hepatocellular carcinomaGene ExpressioncalciumNOS1ADRA1AADRA1B
Journal Article 2017-11-14 ✓ 2 Snippets Liang HW, Yang X, Wen DY, Gao L, Zhang XY, Ye ZH, Luo J, Li ZY, He Y, Pang YY, Chen G.
In-Text Gene Mentions

…), such asCACNA1E, HTR4, CACNA1C, CHRM3,…

…targeting CACNA1A, CACNA1C,CACNA1E, CACNA1I and PRKCB…

Show Full Abstract

Increasing evidence has demonstrated that microRNA (miR)‑133a‑3p is an important regulator of hepatocellular carcinoma (HCC). In the present study, the diagnostic role of miR‑133a‑3p in HCC, and the potential functional pathways, were both explored based on publicly available data. Eligible microarray datasets were collected from NCBI Gene Expression Omnibus (GEO) database and ArrayExpress database. The data related to HCC and matched adjacent normal tissues were also downloaded from The Cancer Genome Atlas (TCGA). Published studies reporting the association between miR‑133a‑3p expression and HCC were reviewed from multiple databases. By combining the data derived from three sources (GEO, TCGA and published studies), the authors analyzed the comprehensive relationship between miR‑133a‑3p expression and clinicopathological features of HCC. Eventually, putative targets of miR‑133a‑3p in HCC were selected for further bioinformatics prediction. A total of eight published microarray datasets were gathered, and the pooled results demonstrated that the expression of miR‑133a‑3p in the tumor group was lower than that in normal groups [standardized mean difference (SMD)=‑0.54; 95% confidence interval (CI), ‑0.74 to ‑0.35; P<0.001]. Consistently, the level of miR‑133a‑1 in HCC was reduced markedly compared to normal tissues (P<0.001) based on TCGA data, and the AUC value of low miR‑133a‑1 expression for HCC diagnosis was 0.670 (P<0.001). Furthermore, the combined SMD of all datasets (GEO, TCGA and literature) suggested that significant difference was observed between the HCC group and the normal control group, and lower miR‑133a‑3p expression in HCC group was noted (SMD=‑0.69; 95% CI, ‑1.10 to ‑0.29; P=0.001). In addition, the authors discovered five key genes of the calcium signaling pathway (NOS1, ADRA1A, ADRA1B, ADRA1D and TBXA2R) that may probably be targeted by miR‑133a‑3p in HCC. The study reveals that miR‑133a‑3p may function as a tumor suppressor in HCC. The prospective novel pathways and key genes of miR‑133a‑3p could offer potential biomarkers for HCC; however, the predictions require further confirmation.

Also flagged:neuron migrationcell bodiesaxonNetrin-1embryogenesisShh
Journal Article 2017-11-14 ✓ 3 Snippets Kim M, Bjorke B, Mastick GS.
In-Text Gene Mentions

…ection by attractive Netrin-1/DCCcues.…

DCC

DCC receptors

Show Full Abstract

Motor neurons differentiate from progenitor cells and cluster as motor nuclei, settling next to the floor plate in the brain stem and spinal cord. Although precise positioning of motor neurons is critical for their functional input and output, the molecular mechanisms that guide motor neurons to their proper positions remain poorly understood. Here, we review recent evidence of motor neuron positioning mechanisms, highlighting situations in which motor neuron cell bodies can migrate, and experiments that show that their migration is regulated by axon guidance cues. The view that emerges is that motor neurons are actively trapped or restricted in static positions, as the cells balance a push in the dorsal direction by repulsive Slit/Robo cues and a pull in the ventral direction by attractive Netrin-1/DCC cues. These new functions of guidance cues are necessary fine-tuning to set up patterns of motor neurons at their proper positions in the neural tube during embryogenesis.

Also flagged:photosynthesisPHBPPchromosomechromosomalchromosomes
Journal Article 2017-11-14 No Snippets Turuspekov Y, Baibulatova A, Yermekbayev K, Tokhetova L, Chudinov V, Sereda G, Ganal M, Griffiths S, Abugalieva S.
Show Full Abstract

<h4>Background</h4>Spring wheat is the largest agricultural crop grown in Kazakhstan with an annual sowing area of 12 million hectares in 2016. Annually, the country harvests around 15 million tons of high quality grain. Despite environmental stress factors it is predicted that the use of new technologies may lead to increases in productivity from current levels of 1.5 to up to 3 tons per hectare. One way of improving wheat productivity is by the application of new genomic oriented approaches in plant breeding projects. Genome wide association studies (GWAS) are emerging as powerful tools for the understanding of the inheritance of complex traits via utilization of high throughput genotyping technologies and phenotypic assessments of plant collections. In this study, phenotyping and genotyping data on 194 spring wheat accessions from Kazakhstan, Russia, Europe, and CIMMYT were assessed for the identification of marker-trait associations (MTA) of agronomic traits by using GWAS.<h4>Results</h4>Field trials in Northern, Central and Southern regions of Kazakhstan using 194 spring wheat accessions revealed strong correlations of yield with booting date, plant height, biomass, number of spikes per plant, and number of kernels per spike. The accessions from Europe and CIMMYT showed high breeding potential for Southern and Central regions of the country in comparison with the performance of the local varieties. The GGE biplot method, using average yield per plant, suggested a clear separation of accessions into their three breeding origins in relationship to the three environments in which they were evaluated. The genetic variation in the three groups of accessions was further studied using 3245 polymorphic SNP (single nucleotide polymorphism) markers. The application of Principal Coordinate analysis clearly grouped the 194 accessions into three clades according to their breeding origins. GWAS on data from nine field trials allowed the identification of 114 MTAs for 12 different agronomic traits.<h4>Conclusions</h4>Field evaluation of foreign germplasm revealed its poor yield performance in Northern Kazakhstan, which is the main wheat growing region in the country. However, it was found that EU and CIMMYT germplasm has high breeding potential to improve yield performance in Central and Southern regions. The use of Principal Coordinate analysis clearly separated the panel into three distinct groups according to their breeding origin. GWAS based on use of the TASSEL 5.0 package allowed the identification of 114 MTAs for twelve agronomic traits. The study identifies a network of key genes for improvement of yield productivity in wheat growing regions of Kazakhstan.

Also flagged:axon growthcell growthbindingProteoglycansHSPGsaxonal
Journal Article 2017-11-14 ✓ 1 Snippet Yu P, Pearson CS, Geller HM.
In-Text Gene Mentions

Dcc

Show Full Abstract

Proteoglycans (PGs) in the extracellular matrix (ECM) play vital roles in axon growth and navigation, plasticity, and regeneration of injured neurons. Different classes of PGs may support or inhibit cell growth, and their functions are determined in part by highly specific structural features. Among these, the pattern of sulfation on the PG sugar chains is a paramount determinant of a diverse and flexible set of outcomes. Recent studies of PG sulfation illustrate the challenges of attributing biological actions to specific sulfation patterns, and suggest ways in which highly similar molecules may exert opposing effects on neurons. The receptors for PGs, which have yet to be fully characterized, display a similarly nuanced spectrum of effects. Different classes of PG function via overlapping families of receptors and signaling pathways. This enables them to control axon growth and guidance with remarkable specificity, but it poses challenges for determining the precise binding interactions and downstream effects of different PGs and their assorted sulfated epitopes. This review examines existing and emerging evidence for the roles of PG sulfation and receptor interactions in determining how these complex molecules influence neuronal development, growth, and function.

Also flagged:TNFCD4viral infectionTNF receptorTNFRSFGITR
Journal Article 2017-11-14 No Snippets Chang YH, Wang KC, Chu KL, Clouthier DL, Tran AT, Torres Perez MS, Zhou AC, Abdul-Sater AA, Watts TH.
Show Full Abstract

T cell antigen-presenting cell (APC) interactions early during chronic viral infection are crucial for determining viral set point and disease outcome, but how and when different APC subtypes contribute to these outcomes is unclear. The TNF receptor superfamily (TNFRSF) member GITR is important for CD4<sup>+</sup> T cell accumulation and control of chronic lymphocytic choriomeningitis virus (LCMV). We found that type I interferon (IFN-I) induced TNFSF ligands GITRL, 4-1BBL, OX40L, and CD70 predominantly on monocyte-derived APCs and CD80 and CD86 predominantly on classical dendritic cells (cDCs). Mice with hypofunctional GITRL in Lyz2<sup>+</sup> cells had decreased LCMV-specific CD4<sup>+</sup> T cell accumulation and increased viral load. GITR signals in CD4<sup>+</sup> T cells occurred after priming to upregulate OX40, CD25, and chemokine receptor CX3CR1. Thus IFN-I (signal 3) induced a post-priming checkpoint (signal 4) for CD4<sup>+</sup> T cell accumulation, revealing a division of labor between cDCs and monocyte-derived APCs in regulating T cell expansion.

Also flagged:SLC40A1type 4 hereditary hemochromatosisFpnironferroportin diseasetype 4B hemochromatosis
Journal Article 2017-11-14 ✓ 1 Snippet Majore S, Bonaccorsi di Patti MC, Valiante M, Polticelli F, Cortese A, Di Bartolomeo S, De Bernardo C, De Muro M, Faienza F, Radio FC, Grammatico P, Musci G.
In-Text Gene Mentions

…type 4 hereditaryhemochromatosis.…

Show Full Abstract

Mutations of SLC40A1 encoding ferroportin (Fpn), the unique cellular iron exporter, severely affect iron homeostasis causing type 4 hereditary hemochromatosis, an autosomal dominant iron overload condition with variable phenotypic manifestations. This disease can be classified as type 4A, better known as "ferroportin disease", which is due to "loss of function" mutations that lead to decreased iron export from cells, or as type 4B hemochromatosis, which is caused by "gain of function" mutations, conferring partial or complete resistance to hepcidin-mediated Fpn degradation. In this work, we discuss clinical and molecular findings on a group of patients in whom a SLC40A1 single copy missense variant was identified. Three novel variants, p.D181N, p.G204R and p.R296Q were functionally characterized. Fpn D181N and R296Q mutants can be classified as full or partial loss of function, respectively. Replacement of G204 with arginine appears to cause a more complex defect with impact both on iron export function and hepcidin sensitivity. This finding confirms the difficulty of predicting the effect of a mutation on the molecular properties of Fpn in order to provide an exhaustive explanation to the wide variability of the phenotype in type 4 hereditary hemochromatosis.

Also flagged:CBFA2T2kidney cancerRCCWound healingOCT4cell migration
Journal Article 2017-11-14 No Snippets Chen DC, Liang YD, Peng L, Wang YZ, Ai CZ, Zhu XX, Yan YW, Saeed Y, Yu B, Huang J, Gao Y, Liu J, Jiang YZ, Liu M, Chen D.
Show Full Abstract

<h4>Background</h4>Renal cell carcinoma (RCC) is the most common kidney cancer, accounting for approximately 80-90% of all primary kidney cancer. Treatment for patients with advanced RCC remains unsatisfactory. Rare cancer stem cells (CSCs) are proposed to be responsible for failure of current treatment.<h4>Methods</h4>OncoLnc was used as a tool for interactively exploring survival correlations. Gene manipulation and expression analysis were carried out using siRNA, RT-PCR and Western blotting. Wound healing and invasion assays were used for phenotypical characterization. Aldefluor assay and FACS sorting Sphere culture were used to determine the "stemness" of CSCs. Co-Immunoprecipitation (Co-IP) was used to examine the interaction between OCT4 and CBFA2T2. Student's t-test and Chi square test was used to analyze statistical significance.<h4>Results</h4>CBFA2T2 expression can significantly predict the survival of RCC patients. Knocking-down of CBFA2T2 can inhibit cell migration and invasion in RCC cells in vitro, and reduce ALDH<sup>high</sup> CSCs populations. CBFA2T2 expression is necessary for sphere-forming ability and cancer stem cells marker expression in RCC cell lines.<h4>Conclusions</h4>Our data suggest that CBFA2T2 expression correlates with aggressive characteristics of RCC and CBFA2T2 is required for maintenance of "stemness" through regulation of stem cells factors, thereby highlighting CBFA2T2 as a potential therapeutic target for RCC treatment.

Also flagged:Artregulation ofgene expressionbindingfactorsepigenetic factors
Journal Article 2017-11-14 ✓ 1 Snippet Fletcher JC.
In-Text Gene Mentions

…chromatin remodeling proteins,histone modifying methyltransferasemodifying methyltransferase an…

Show Full Abstract

Multicellular organisms rely on the precise and consistent regulation of gene expression to direct their development in tissue- and cell-type specific patterns. This regulatory activity involves arrays of DNA-binding transcription factors and epigenetic factors that modify chromatin structure. Among the chromatin modifiers, trithorax (trxG) and Polycomb (PcG) group proteins play important roles in orchestrating the stable activation and repression of gene expression, respectively. These proteins have generally antagonistic functions in maintaining cell and tissue homeostasis as well as in mediating widespread transcriptional reprogramming during developmental transitions. Plants utilize multiple trxG factors to regulate gene transcription as they modulate their development in response to both endogenous and environmental cues. Here, I will discuss the roles of trxG factors and their associated proteins in post-embryonic plant development.

Also flagged:TPRHcn2methylationFig1ASMtio
Journal Article 2017-11-14 No Snippets Martos SN, Li T, Ramos RB, Lou D, Dai H, Xu JC, Gao G, Gao Y, Wang Q, An C, Zhang X, Jia Y, Dawson VL, Dawson TM, Ji H, Wang Z.
Show Full Abstract

Imprinted genes are vulnerable to environmental influences during early embryonic development, thereby contributing to the onset of disease in adulthood. Monoallelic methylation at several germline imprints has been reported as DNMT1-dependent. However, which of these two epigenetic attributes, DNMT1-dependence or allelic methylation, renders imprinted genes susceptible to environmental stressors has not been determined. Herein, we developed a new approach, referred to as NORED, to identify 2468 DNMT1-dependent DNA methylation patterns in the mouse genome. We further developed an algorithm based on a genetic variation-independent approach (referred to as MethylMosaic) to detect 2487 regions with bimodal methylation patterns. Two approaches identified 207 regions, including known imprinted germline allele-specific methylation patterns (ASMs), that were both NORED and MethylMosaic regions. Examination of methylation in four independent mouse embryonic stem cell lines shows that two regions identified by both NORED and MethylMosaic (<i>Hcn2</i> and <i>Park7</i>) did not display parent-of-origin-dependent allelic methylation. In these four F1 hybrid cell lines, genetic variation in Cast allele at <i>Hcn2</i> locus introduces a transcription factor binding site for MTF-1 that may predispose Cast allelic hypomethylation in a reciprocal cross with either C57 or 129 strains. In contrast, each allele of <i>Hcn2</i> ASM in J1 inbred cell line and <i>Park7</i> ASM in four F1 hybrid cell lines seems to exhibit similar propensity to be either hypo- or hypermethylated, suggesting a 'random, switchable' ASM. Together with published results, our data on ASMs prompted us to propose a hypothesis of regional 'autosomal chromosome inactivation (ACI)' that may control a subset of autosomal genes. Therefore, our results open a new avenue to understand monoallelic methylation and provide a rich resource of candidate genes to examine in environmental and nutritional exposure models.

Also flagged:prostate cancerPCaGene Expressioncell adhesionofcyclic adenosine monophosphate
Journal Article 2017-11-14 No Snippets Yajun C, Yuan T, Zhong W, Bin X.
Show Full Abstract

The present study aimed to identify potential genes associated with prostate cancer (PCa) recurrence following radical prostatectomy (RP) in order to improve the prediction of the prognosis of patients with PCa. The GSE25136 microarray dataset, including 39 recurrent and 40 non-recurrent PCa samples, was downloaded from the Gene Expression Omnibus database. Differentially-expressed genes (DEGs) were identified using limma packages, and the pheatmap package was used to present the DEGs screened using a hierarchical cluster analysis. Furthermore, gene ontology functional enrichment analysis was used to predict the potential functions of the DEGs. Subsequently, Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses were performed to analyze pathway enrichment of DEGs in the regulatory network. Lastly, a protein-protein interaction (PPI) network of the DEGs was constructed using Cytoscape software to understand the interactions between these DEGs. A total of 708 DEGs were identified in the recurrent and non-recurrent PCa samples. Functional annotation revealed that these DEGs were primarily involved in cell adhesion, negative regulation of growth, and the cyclic adenosine monophosphate and mitogen-activated protein kinase (MAPK) signaling pathways. Furthermore, five key genes, including cluster of differentiation 22, insulin-like growth factor-1, inhibin β A subunit, MAPK kinase 5 and receptor tyrosine kinase like orphan receptor 1, were identified through PPI network analysis. The results of the present study have provided novel ideas for predicting the prognosis of patients with PCa following RP.

Also flagged:ADAR1Adenosine deaminase acting on RNA 1adenosineinosinetype-I interferoncytoplasmic
Journal Article 2017-11-13 ✓ 3 Snippets Solomon O, Di Segni A, Cesarkas K, Porath HT, Marcu-Malina V, Mizrahi O, Stern-Ginossar N, Kol N, Farage-Barhom S, Glick-Saar E, Lerenthal Y, Levanon EY, Amariglio N, Unger R, Goldstein I, Eyal E, Rechavi G.
In-Text Gene Mentions

…binding sites forSTAU1, an RNA binding…

…, based onSTAU1hiCLIP data; Methods…

…increased numbers ofSTAU1binding sites compare…

Show Full Abstract

Adenosine deaminase acting on RNA 1 (ADAR1) is the master RNA editor, catalyzing the deamination of adenosine to inosine. RNA editing is vital for preventing abnormal activation of cytosolic nucleic acid sensing pathways by self-double-stranded RNAs. Here we determine, by parallel analysis of RNA secondary structure sequencing (PARS-seq), the global RNA secondary structure changes in ADAR1 deficient cells. Surprisingly, ADAR1 silencing resulted in a lower global double-stranded to single-stranded RNA ratio, suggesting that A-to-I editing can stabilize a large subset of imperfect RNA duplexes. The duplexes destabilized by editing are composed of vastly complementary inverted Alus found in untranslated regions of genes performing vital biological processes, including housekeeping functions and type-I interferon responses. They are predominantly cytoplasmic and generally demonstrate higher ribosomal occupancy. Our findings imply that the editing effect on RNA secondary structure is context dependent and underline the intricate regulatory role of ADAR1 on global RNA secondary structure.

Also flagged:cancertumorgene expressiontumorsmelanomacolorectal tumor
Journal Article 2017-11-13 No Snippets Racle J, de Jonge K, Baumgaertner P, Speiser DE, Gfeller D.
Show Full Abstract

Immune cells infiltrating tumors can have important impact on tumor progression and response to therapy. We present an efficient algorithm to simultaneously estimate the fraction of cancer and immune cell types from bulk tumor gene expression data. Our method integrates novel gene expression profiles from each major non-malignant cell type found in tumors, renormalization based on cell-type-specific mRNA content, and the ability to consider uncharacterized and possibly highly variable cell types. Feasibility is demonstrated by validation with flow cytometry, immunohistochemistry and single-cell RNA-Seq analyses of human melanoma and colorectal tumor specimens. Altogether, our work not only improves accuracy but also broadens the scope of absolute cell fraction predictions from tumor gene expression data, and provides a unique novel experimental benchmark for immunogenomics analyses in cancer research (http://epic.gfellerlab.org).

Also flagged:transcription factorbindingtranscription factorsRNA polymeraseRNAPgene expression
Journal Article 2017-11-13 ✓ 3 Snippets Lagator M, Sarikas S, Acar H, Bollback JP, Guet CC.
In-Text Gene Mentions

…them as RNAP),transcription factor CIfactor CI (…

…Thetranscription factor CIfactor CI represses…

…way, concentration ofCI transcription factortranscription factor in…

Show Full Abstract

Most phenotypes are determined by molecular systems composed of specifically interacting molecules. However, unlike for individual components, little is known about the distributions of mutational effects of molecular systems as a whole. We ask how the distribution of mutational effects of a transcriptional regulatory system differs from the distributions of its components, by first independently, and then simultaneously, mutating a transcription factor and the associated promoter it represses. We find that the system distribution exhibits increased phenotypic variation compared to individual component distributions - an effect arising from intermolecular epistasis between the transcription factor and its DNA-binding site. In large part, this epistasis can be qualitatively attributed to the structure of the transcriptional regulatory system and could therefore be a common feature in prokaryotes. Counter-intuitively, intermolecular epistasis can alleviate the constraints of individual components, thereby increasing phenotypic variation that selection could act on and facilitating adaptive evolution.

Also flagged:tunneling nanotubegap junctionsextracellularvesiclesheparinnanotubes
Journal Article 2017-11-13 ✓ 1 Snippet Thayanithy V, O'Hare P, Wong P, Zhao X, Steer CJ, Subramanian S, Lou E.
In-Text Gene Mentions

ncer and endothelial cells3000 nm & 400 nm[2] Connor et al., 2015NegativeTransfer of miRNA was reduced to basal levelsLysosomes mediated transfer of cystinosin & cystinebetween mouse fibroblasts and macrophages1000 nm[7] Naphade et al., 2015NegativeDecreased cysteine transferTransfer of DiD between NRK, CHO and HeLa cells450 nm[13] Schoelermann et al., 2015NegativeTransfer of DiD was reducedTransfer of CD40L-induced cytoplasmic and cell surface–associated material from T cells to dendritic cells450 nm[17] Zaccard et al., 2014NegativeDecrease in transferTransfer of prion particles between mouse neuronal cells400 nm[4] Gousset et al., 2009NegativePrion transfer was entirely abolishedTransfer of cues for cell migration from endothelial cells to bronchial epithelial cells400 nm[18] Zani et al., 2010NegativeBronchial epithelial cell migration required direct cell contact with endothelial cellsTransfer of prion particles in mouse neuronal cells400 nm[5] Langevin et al., 2010NegativePrion transfer was reduced over 98%Transfer of mitochondria from vascular smooth muscle cells to mesenchymal cells400 nm[16] Vallabhaneni et al., 2012NegativeDirect cell contact was required for mitochondrial transferTransfer of p-glycoprotein between MCF-7 breast cancer cells400 nm[42] Pasquier et al., 2012NegativeReduced p-glycoprotein transferTransfer of Huntington mutant protein (Htt) aggregates in mouse neuronal cells400 nm[3] Costanzo et al., 2013NegativeHtt aggregate transfer was blocked by over 95%Transfer of contact dependent proliferation cues from astrocytes to glioma cells400 nm[19] Zhang and Zhang, 2015NegativeDecreased transfer of molecular cuesTransfer of mCherry from senescent cells to NK cells400 nm[1] Biran et al., 2015NegativemCherry transfer was reducedTransfer of soluble amino acids between bacterial cells200 nm[9] Pande et al., 2015NegativeAmino acid transfer was entirely blockedMitochondrial transfer in MDA-MB231, OVCAR3, SKOV3 and MCF-7 cellsNA[42] Pasquier et al., 2013NegativeDecrease in mitochondrial transferThese experiments used transwell membrane filters with a range of pore sizes to separate two populations of cells, in order to demonstrate cellular transfer that was dependent on cell contact by any means (including TNTs) Table 2Published

Show Full Abstract

<h4>Background</h4>Tunneling nanotubes (TNTs) are naturally-occurring filamentous actin-based membranous extensions that form across a wide spectrum of mammalian cell types to facilitate long-range intercellular communication. Valid assays are needed to accurately assess the downstream effects of TNT-mediated transfer of cellular signals in vitro. We recently reported a modified transwell assay system designed to test the effects of intercellular transfer of a therapeutic oncolytic virus, and viral-activated drugs, between cells via TNTs. The objective of the current study was to demonstrate validation of this in vitro approach as a new method for effectively excluding diffusible forms of long- and close-range intercellular transfer of intracytoplasmic cargo, including exosomes/microvesicles and gap junctions in order to isolate TNT-selective cell communication.<h4>Methods</h4>We designed several steps to effectively reduce or eliminate diffusion and long-range transfer via these extracellular vesicles, and used Nanoparticle Tracking Analysis to quantify exosomes following implementation of these steps.<h4>Results</h4>The experimental approach outlined here effectively reduced exosome trafficking by >95%; further use of heparin to block exosome uptake by putative recipient cells further impeded transfer of these extracellular vesicles.<h4>Conclusions</h4>This validated assay incorporates several steps that can be taken to quantifiably control for extracellular vesicles in order to perform studies focused on TNT-selective communication.

Also flagged:Cerebral ischemiaischemic strokeSAHH2SRSF1EAA2brain ischemia
Journal Article 2017-11-13 No Snippets García-Berrocoso T, Llombart V, Colàs-Campàs L, Hainard A, Licker V, Penalba A, Ramiro L, Simats A, Bustamante A, Martínez-Saez E, Canals F, Sanchez JC, Montaner J.
Show Full Abstract

Cerebral ischemia entails rapid tissue damage in the affected brain area causing devastating neurological dysfunction. How each component of the neurovascular unit contributes or responds to the ischemic insult in the context of the human brain has not been solved yet. Thus, the analysis of the proteome is a straightforward approach to unraveling these cell proteotypes. In this study, post-mortem brain slices from ischemic stroke patients were obtained corresponding to infarcted (IC) and contralateral (CL) areas. By means of laser microdissection, neurons and blood brain barrier structures (BBB) were isolated and analyzed using label-free quantification. MS data are available via ProteomeXchange with identifier PXD003519. Ninety proteins were identified only in neurons, 260 proteins only in the BBB and 261 proteins in both cell types. Bioinformatics analyses revealed that repair processes, mainly related to synaptic plasticity, are outlined in microdissected neurons, with nonexclusive important functions found in the BBB. A total of 30 proteins showing <i>p</i> < 0.05 and fold-change> 2 between IC and CL areas were considered meaningful in this study: 13 in neurons, 14 in the BBB and 3 in both cell types. Twelve of these proteins were selected as candidates and analyzed by immunohistofluorescence in independent brains. The MS findings were completely verified for neuronal SAHH2 and SRSF1 whereas the presence in both cell types of GABT and EAA2 was only validated in neurons. In addition, SAHH2 showed its potential as a prognostic biomarker of neurological improvement when analyzed early in the plasma of ischemic stroke patients. Therefore, the quantitative proteomes of neurons and the BBB (or proteotypes) after human brain ischemia presented here contribute to increasing the knowledge regarding the molecular mechanisms of ischemic stroke pathology and highlight new proteins that might represent putative biomarkers of brain ischemia or therapeutic targets.

Also flagged:mitochondriamitochondrionmitochondrialrespiratory chainpentosephosphate
Journal Article 2017-11-13 ✓ 1 Snippet Michaletti A, Gioia M, Tarantino U, Zolla L.
In-Text Gene Mentions

…(PRDX5) and 6 (PRDX6), superoxide dismutase (SODC)…

Show Full Abstract

The response of human primary osteoblasts exposed to simulated microgravity has been investigated and analysis of metabolomic and proteomic profiles demonstrated a prominent dysregulation of mitochondrion homeostasis. Gravitational unloading treatment induced a decrease in mitochondrial proteins, mainly affecting efficiency of the respiratory chain. Metabolomic analysis revealed that microgravity influenced several metabolic pathways; stimulating glycolysis and the pentose phosphate pathways, while the Krebs cycle was interrupted at succinate-fumarate transformation. Interestingly, proteomic analysis revealed that Complex II of the mitochondrial respiratory chain, which catalyses the biotransformation of this step, was under-represented by 50%. Accordingly, down-regulation of quinones 9 and 10 was measured. Complex III resulted in up-regulation by 60%, while Complex IV was down-regulated by 14%, accompanied by a reduction in proton transport synthesis of ATP. Finally, microgravity treatment induced an oxidative stress response, indicated by significant decreases in oxidised glutathione and antioxidant enzymes. Decrease in malate dehydrogenase induced a reverse in the malate-aspartate shuttle, contributing to dysregulation of ATP synthesis. Beta-oxidation of fatty acids was inhibited, promoting triglyceride production along with a reduction in the glycerol shuttle. Taken together, our findings suggest that microgravity may suppress bone cell functions, impairing mitochondrial energy potential and the energy state of the cell.

Also flagged:proteasomeproteolysisporeubiquitinchaperonesbinding
Journal Article 2017-11-13 No Snippets Kozai T, Sekiguchi T, Satoh T, Yagi H, Kato K, Uchihashi T.
Show Full Abstract

The 20S proteasome is a core particle of the eukaryotic proteasome responsible for proteolysis and is composed of layered α and β hetero-heptameric rings. The α7 subunit, which is one of components of the α ring, is known to self-assemble into a double-ringed homo-tetradecamer composed of two layers of the α7 heptameric ring. The α7 tetradecamer is known to disassemble upon the addition of α6 subunit, producing a 1:7 hetero-octameric α6-α7 complex. However, the detailed disassembly mechanism remains unclear. Here, we applied high-speed atomic force microscopy (HS-AFM) to dissect the disassembly process of the α7 double ring caused by interaction with the α6. HS-AFM movies clearly demonstrated two different modes of interaction in which the α6 monomer initially cracks at the interface between the stacked two α7 single rings and the subsequent intercalation of the α6 monomer in the open pore of the α7 single ring blocks the re-association of the single rings into the double ring. This result provides a mechanistic insight about the disassembly process of non-native homo-oligomers formed by proteasome components which is crucial for the initial process for assembly of 20S proteasome.

Also flagged:deathcell surfaceatrial fibrillationmitochondrialextracellularmyocardial infarction
Journal Article 2017-11-13 ✓ 1 Snippet Doll S, Dreßen M, Geyer PE, Itzhak DN, Braun C, Doppler SA, Meier F, Deutsch MA, Lahm H, Lange R, Krane M, Mann M.
In-Text Gene Mentions

…the ubiquitin ligaseTRIM38, the tumor suppressor…

Show Full Abstract

The heart is a central human organ and its diseases are the leading cause of death worldwide, but an in-depth knowledge of the identity and quantity of its constituent proteins is still lacking. Here, we determine the healthy human heart proteome by measuring 16 anatomical regions and three major cardiac cell types by high-resolution mass spectrometry-based proteomics. From low microgram sample amounts, we quantify over 10,700 proteins in this high dynamic range tissue. We combine copy numbers per cell with protein organellar assignments to build a model of the heart proteome at the subcellular level. Analysis of cardiac fibroblasts identifies cellular receptors as potential cell surface markers. Application of our heart map to atrial fibrillation reveals individually distinct mitochondrial dysfunctions. The heart map is available at maxqb.biochem.mpg.de as a resource for future analyses of normal heart function and disease.

Also flagged:proteinopathiesHuntington's diseaseneurodegenerative diseasesHDHuntingtinTau
Journal Article 2017-11-13 ✓ 5 Snippets St-Amour I, Turgeon A, Goupil C, Planel E, Hébert SS.
In-Text Gene Mentions

Notably, we observed that 88% of HD patients with Vonsattel grade 4 neuropathology displayed at least one non-Htt proteinopathy compared to 29% in controls.

Interestingly, α-Syn aggregation correlated with Htt, TDP-43 and phosphorylated-Tau in HD but not in controls.

Huntington's disease (HD) is an inherited NDD caused by autosomal-dominant expanded CAG trinucleotide repeat mutation in the gene coding for Huntingtin (Htt).

In HD brain, we observed reduced soluble protein (but not mRNA) levels of Htt, α-Syn, and Tau.

…coding for Huntingtin (Htt).…

Show Full Abstract

Accumulating evidence highlights the potential role of mixed proteinopathies (i.e., abnormal protein aggregation) in the development of clinical manifestations of neurodegenerative diseases (NDD). Huntington's disease (HD) is an inherited NDD caused by autosomal-dominant expanded CAG trinucleotide repeat mutation in the gene coding for Huntingtin (Htt). Previous studies have suggested the coexistence of phosphorylated-Tau, α-synuclein (α-Syn) and TAR DNA-binding protein 43 (TDP-43) inclusions in HD. However, definite evidence that HD pathology in humans can be accompanied by other proteinopathies is still lacking. Using human post-mortem putamen samples from 31 controls and 56 HD individuals, we performed biochemical analyses of the expression, oligomerization and aggregation of Tau, α-Syn, TDP-43, and Amyloid precursor protein (APP)/Aβ. In HD brain, we observed reduced soluble protein (but not mRNA) levels of Htt, α-Syn, and Tau. Our results also support abnormal phosphorylation of Tau in more advanced stages of disease. Aberrant splicing of Tau exons 2, 3 (exclusion) and 10 (inclusion) was also detected in HD patients, leading to higher 0N4R and lower 1N3R isoforms. Finally, following formic acid extraction, we observed increased aggregation of TDP-43, α-Syn, and phosphorylated-Tau during HD progression. Notably, we observed that 88% of HD patients with Vonsattel grade 4 neuropathology displayed at least one non-Htt proteinopathy compared to 29% in controls. Interestingly, α-Syn aggregation correlated with Htt, TDP-43 and phosphorylated-Tau in HD but not in controls. The impact of this work is twofold: (1) it provides compelling evidences that Tau, α-Syn and TDP-43 proteinopathies are increased in HD, and (2) it suggests the involvement of common mechanisms leading to abnormal accumulation of aggregation-prone proteins in NDD. Further studies will be needed to decipher the impact of these proteinopathies on clinical manifestation of HD.

Also flagged:ironhereditary hemochromatosisHHiron overload disordersdiabetescardiomyopathy
Journal Article 2017-11-13 ✓ 3 Snippets Kawabata H.
In-Text Gene Mentions

…bi-allelic mutations ofHFE.…

…systemic iron regulation;HFE, hemojuvelin, and TFR2…

…of patients with non-HFEHH might have…

Show Full Abstract

Hereditary hemochromatosis (HH) is a group of genetic iron overload disorders that manifest with various symptoms, including hepatic dysfunction, diabetes, and cardiomyopathy. Classic HH type 1, which is common in Caucasians, is caused by bi-allelic mutations of HFE. Severe types of HH are caused by either bi-allelic mutations of HFE2 that encodes hemojuvelin (type 2A) or HAMP that encodes hepcidin (type 2B). HH type 3, which is of intermediate severity, is caused by bi-allelic mutations of TFR2 that encodes transferrin receptor 2. Mutations of SLC40A1 that encodes ferroportin, the only cellular iron exporter, causes either HH type 4A (loss-of-function mutations) or HH type 4B (gain-of-function mutations). Studies on these gene products uncovered a part of the mechanisms of the systemic iron regulation; HFE, hemojuvelin, and TFR2 are involved in iron sensing and stimulating hepcidin expression, and hepcidin downregulates the expression of ferroportin of the target cells. Phlebotomy is the standard treatment for HH, and early initiation of the treatment is essential for preventing irreversible organ damage. However, because of the rarity and difficulty in making the genetic diagnosis, a large proportion of patients with non-HFE HH might have been undiagnosed; therefore, awareness of this disorder is important.

Also flagged:Zinc-finger proteinszinc-fingerubiquitinprotein degradationsignal transductioncell migration
Journal Article 2017-11-13 No Snippets Cassandri M, Smirnov A, Novelli F, Pitolli C, Agostini M, Malewicz M, Melino G, Raschellà G.
Show Full Abstract

Zinc-finger proteins (ZNFs) are one of the most abundant groups of proteins and have a wide range of molecular functions. Given the wide variety of zinc-finger domains, ZNFs are able to interact with DNA, RNA, PAR (poly-ADP-ribose) and other proteins. Thus, ZNFs are involved in the regulation of several cellular processes. In fact, ZNFs are implicated in transcriptional regulation, ubiquitin-mediated protein degradation, signal transduction, actin targeting, DNA repair, cell migration, and numerous other processes. The aim of this review is to provide a comprehensive summary of the current state of knowledge of this class of proteins. Firstly, we describe the actual classification of ZNFs, their structure and functions. Secondly, we focus on the biological role of ZNFs in the development of organisms under normal physiological and pathological conditions.

Also flagged:Microbial DysbiosisChronic hepatitis Bepidemic diseasehepatitis B virusHBV) infectionliver failure
Journal Article 2017-11-13 No Snippets Wang J, Wang Y, Zhang X, Liu J, Zhang Q, Zhao Y, Peng J, Feng Q, Dai J, Sun S, Zhao Y, Zhao L, Zhang Y, Hu Y, Zhang M.
Show Full Abstract

Chronic hepatitis B (CHB) is a global epidemic disease that results from hepatitis B virus (HBV) infection and may progress to severe liver failure, including liver fibrosis, cirrhosis and hepatocellular carcinoma. Previous evidence has indicated that the dysbiosis of gut microbiota occurs after liver virus infection and is associated with severe liver disease. The aim of this study is to elucidate the compositional and functional characteristics of the gut microbiota in early-stage CHB and to understand their influence on disease progression. We investigated the gut microbial composition of stool samples from 85 CHB patients with low Child-Pugh scores and 22 healthy controls using the Illumina MiSeq sequencing platform. Furthermore, the serum metabolome of 40 subjects was measured by gas chromatography mass spectrometry. Compared with the controls, significant alteration in the gut microbiota was observed in the CHB patients; 5 operational taxonomic units (OTUs) belonging to <i>Actinomyces, Clostridium sensu stricto</i>, unclassified Lachnospiraceae and <i>Megamonas</i> were increased, and 27 belonging to <i>Alistipes, Asaccharobacter, Bacteroides, Butyricimonas, Clostridium IV, Escherichia/Shigella, Parabacteroides, Ruminococcus</i>, unclassified Bacteria, unclassified Clostridiales, Unclassified Coriobacteriaceae, unclassified Enterobacteriaceae, unclassified Lachnospiraceae and unclassified Ruminococcaceae were decreased. The inferred metagenomic information of gut microbiota in CHB showed 21 enriched and 17 depleted KEGG level-2 pathways. Four OTUs, OTU38 (<i>Streptococcus</i>), OTU124 (<i>Veillonella</i>), OTU224 (<i>Streptococcus</i>), and OTU55 (<i>Haemophilus</i>), had high correlations with hosts' hepatic function indices and 10 serum metabolites, including phenylalanine and tyrosine, which are aromatic amino acids that play pathogenic roles in liver disease. In particular, these 4 OTUs were significantly higher in patients with higher Child-Pugh scores, who also showed diminished phenylalanine and tryptophan metabolisms in the inferred gut metagenomic functions. These compositional and functional changes in the gut microbiota in early-stage CHB patients suggest the potential contributions of gut microbiota to the progression of CHB, and thus provide new insight into gut microbiota-targeted interventions to improve the prognosis of this disease.

Also flagged:Renal Cell Carcinomakidney cancerclear cell renal cell carcinomaccRCCpathogenesisVHL
Journal Article 2017-11-13 ✓ 1 Snippet Kumar A, Kumari N, Gupta V, Prasad R.
In-Text Gene Mentions

…that codes forchromatin modifiersmodifiers (PBRM1, SETD2…

Show Full Abstract

Renal cell carcinoma is the most common form of the kidney cancer accounting for more than 85% of the cases of which clear cell renal cell carcinoma (ccRCC) is the major histological subtype. The central molecular signature for ccRCC pathogenesis is the biallelic inactivation of VHL gene due to the presence of mutations/hyper-methylation/complete gene loss, which results in the downstream HIF activation. These events lead to increased tyrosine kinase receptor signalling pathways (RAS/MEK/ERK pathway, PI3K/AKT/mTOR pathway and NF-κB pathway), which through their downstream effector proteins causes the cell to proliferate and migrate. Recent studies have shown that VHL inactivation alone is not sufficient to induce the tumor. Mutations in numerous other genes that codes for chromatin modifiers (PBRM1, SETD2 and BAP1) and signalling proteins (PTEN and mTOR) have been identified along with activation of alternate signalling pathways like STAT and Sonic Hedgehog (SHH) pathway. It has also been shown that STAT pathway also works cooperatively with HIF to enhance the tumor progression. However, SHH pathway reactivation resulted in tumor regardless of the VHL status, indicating the complex nature of the tumor at the molecular level. Therefore, understanding the complete aetiology of ccRCC is important for future therapeutics.

Also flagged:hepatic fibrosisironNAFLDnon‐alcoholic fatty liver diseaseFerritinhepatosteatosis
Journal Article 2017-11-13 ✓ 1 Snippet El Nakeeb N, Saleh SA, Massoud YM, Hussein A, Hamed R.
In-Text Gene Mentions

…the viral hepatitis,hemochromatosis, autoimmune liver disease,…

Show Full Abstract

<h4>Background and aim</h4>Many studies have found a relationship between hepatic iron, serum ferritin, and non-alcoholic fatty liver disease (NAFLD) or its progress. The aim of this study is to assess the value of serum ferritin as a non-invasive marker in the prediction of hepatic fibrosis in NAFLD.<h4>Methods</h4>This study included 113 subjects who were classified into three groups. Group I included 30 healthy subjects as control with no clinical, radiological, and histological features of NAFLD. Group II included 31 NAFLD patients without hepatic fibrosis. Group III included 52 patients with hepatic fibrosis on top of NAFLD.<h4>Results</h4>Serum ferritin was determined using ferritin ELISA kit. Fibrosis 4 score was calculated. Liver biopsy was conducted for included patients. Significantly higher levels of serum ferritin were found in patients with hepatic fibrosis on top of NAFLD than controls. Receiver operating characteristic curve analysis revealed that an optimum cutoff level of 51.95 ng/mL was the best to predict fibrosis on top of NAFLD with diagnostic sensitivity and specificity of 65% and 60%, respectively, and area under the curve = 0.658.<h4>Conclusion</h4>Higher serum ferritin was found in patients with hepatic fibrosis on top of NAFLD. Serum ferritin was found to be a predictor of fibrosis on top of NAFLD with moderate sensitivity and specificity.

Abstracts from HSG 2017

Also flagged:Huntington Diseasemovement disorderAggressionStrokevasopressinbehaviors
Journal Article 2017-11-13 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

HTT

Show Full Abstract

No abstract available.

Also flagged:Gastric Cancergene expressionbindingnucleotidesregulation ofdegradation
Journal Article 2017-11-12 ✓ 1 Snippet Liu W, Ma R, Yuan Y.
In-Text Gene Mentions

Xu et al. demonstrated that highly expressed TINCR could mediate stability and degradation of KLF2 mRNA by acting with TINCR-STAU1, resulting in decreased expression of CDKN1A/P21 and CDKN2B/P15, accelerated cell growth, redistribution of G0/G1 and S phases of the cell cycles well as promotion of cell proliferation, and suppressed apoptosis of GC cells 33.

Show Full Abstract

Noncoding RNAs play critical roles in regulating protein-coding genes and comprise two major classes: long noncoding RNAs (lncRNAs) and microRNAs (miRNAs). LncRNAs regulate gene expression at transcriptional, post-transcriptional, and epigenetic levels via multiple action modes. LncRNAs can also function as endogenous competitive RNAs for miRNAs and indirectly regulate gene expression post-transcriptionally. By binding to the 3'-untranslated regions (3'-UTR) of target genes, miRNAs post-transcriptionally regulate gene expression. Herein, we conducted a review of post-transcriptional regulation by lncRNAs and miRNAs of genes associated with biological behaviors of gastric cancer.

Also flagged:Lupusdiffuse large B-cell lymphomaDLBCLSLElymphomaCD40
Journal Article 2017-11-12 ✓ 1 Snippet Bernatsky S, Velásquez García HA, Spinelli JJ, Gaffney P, Smedby KE, Ramsey-Goldman R, Wang SS, Adami HO, Albanes D, Angelucci E, Ansell SM, Asmann YW, Becker N, Benavente Y, Berndt SI, Bertrand KA, Birmann BM, Boeing H, Boffetta P, Bracci PM, Brennan P, Brooks-Wilson AR, Cerhan JR, Chanock SJ, Clavel J, Conde L, Cotenbader KH, Cox DG, Cozen W, Crouch S, De Roos AJ, de Sanjose S, Di Lollo S, Diver WR, Dogan A, Foretova L, Ghesquières H, Giles GG, Glimelius B, Habermann TM, Haioun C, Hartge P, Hjalgrim H, Holford TR, Holly EA, Jackson RD, Kaaks R, Kane E, Kelly RS, Klein RJ, Kraft P, Kricker A, Lan Q, Lawrence C, Liebow M, Lightfoot T, Link BK, Maynadie M, McKay J, Melbye M, Molina TJ, Monnereau A, Morton LM, Nieters A, North KE, Novak AJ, Offit K, Purdue MP, Rais M, Riby J, Roman E, Rothman N, Salles G, Severi G, Severson RK, Skibola CF, Slager SL, Smith A, Smith MT, Southey MC, Staines A, Teras LR, Thompson CA, Tilly H, Tinker LF, Tjonneland A, Turner J, Vajdic CM, Vermeulen RCH, Vijai J, Vineis P, Virtamo J, Wang Z, Weinstein S, Witzig TE, Zelenetz A, Zeleniuch-Jacquotte A, Zhang Y, Zheng T, Zucca M, Clarke AE.
In-Text Gene Mentions

…necrosis factor superfamilyTNFSF4, was associated with…

Show Full Abstract

<h4>Objective</h4>Determinants of the increased risk of diffuse large B-cell lymphoma (DLBCL) in SLE are unclear. Using data from a recent lymphoma genome-wide association study (GWAS), we assessed whether certain lupus-related single nucleotide polymorphisms (SNPs) were also associated with DLBCL.<h4>Methods</h4>GWAS data on European Caucasians from the International Lymphoma Epidemiology Consortium (InterLymph) provided a total of 3857 DLBCL cases and 7666 general-population controls. Data were pooled in a random-effects meta-analysis.<h4>Results</h4>Among the 28 SLE-related SNPs investigated, the two most convincingly associated with risk of DLBCL included the CD40 SLE risk allele rs4810485 on chromosome 20q13 (OR per risk allele=1.09, 95% CI 1.02 to 1.16, p=0.0134), and the HLA SLE risk allele rs1270942 on chromosome 6p21.33 (OR per risk allele=1.17, 95% CI 1.01 to 1.36, p=0.0362). Of additional possible interest were rs2205960 and rs12537284. The rs2205960 SNP, related to a cytokine of the tumour necrosis factor superfamily TNFSF4, was associated with an OR per risk allele of 1.07, 95% CI 1.00 to 1.16, p=0.0549. The OR for the rs12537284 (chromosome 7q32, IRF5 gene) risk allele was 1.08, 95% CI 0.99 to 1.18, p=0.0765.<h4>Conclusions</h4>These data suggest several plausible genetic links between DLBCL and SLE.

Also flagged:Head and Neck CancerEGFRantiepidermal growth factor receptorhead and neck squamous cell carcinomaHNSCCCancer
Journal Article 2017-11-12 ✓ 1 Snippet Bossi P, Siano M, Bergamini C, Cossu Rocca M, Sponghini AP, Giannoccaro M, Tonella L, Paoli A, Marchesi E, Perrone F, Pilotti S, Locati LD, Canevari S, Licitra L, De Cecco L.
In-Text Gene Mentions

…we observed thatchromatin modifiersmodifiers (KMTA2-MLL, RCOR1,…

Show Full Abstract

Prediction of benefit from combined chemotherapy and the antiepidermal growth factor receptor cetuximab is a not yet solved question in head and neck squamous cell carcinoma (HNSCC). In a selected series of 14 long progression-free survival (PFS) and 26 short PFS patients by whole gene and microRNA expression analysis, we developed a model potentially predictive of cetuximab sensitivity. To better decipher the "omics" profile of our patients, we detected transcript fusions by RNA-seq through a Pan-Cancer panel targeting 1385 cancer genes. Twenty-seven different fusion transcripts, involving mRNA and long noncoding RNA (lncRNA), were identified. The majority of fusions (81%) were intrachromosomal, and 24 patients (60%) harbor at least one of them. The presence/absence of fusions and the presence of more than one fusion were not related to outcome, while the lncRNA-containing fusions resulted enriched in long PFS patients (<i>P</i> = 0.0027). The CD274-PDCD1LG2 fusion was present in 7/14 short PFS patients harboring fusions and was absent in long PFS patients (<i>P</i> = 0.0188). Among the short PFS patients, those harboring this fusion had the worst outcome (<i>P</i> = 0.0172) and increased K-RAS activation (<i>P</i> = 0.00147). The associations between HNSCC patient's outcome following cetuximab treatment and lncRNA-containing fusions or the CD274-PDCD1LG2 fusion deserve validation in prospective clinical trials.

Also flagged:deleted intransmembrane proteinaxonsneurological disordersdevelopmental split brain syndromecolorectal cancer
Journal Article 2017-11-11 ✓ 5 Snippets Marsh APL, Edwards TJ, Galea C, Cooper HM, Engle EC, Jamuar SS, Méneret A, Moutard ML, Nava C, Rastetter A, Robinson G, Rouleau G, Roze E, Spencer-Smith M, Trouillard O, Billette de Villemeur T, Walsh CA, Yu TW, IRC5 Consortium, Heron D, Sherr EH, Richards LJ, Depienne C, Leventer RJ, Lockhart PJ.
In-Text Gene Mentions

Germline DCC mutations disrupt the development of predominantly commissural tracts in the central nervous system (CNS) and cause a spectrum of neurological disorders.

DCCmutation update: Congenital…

…GermlineDCCmutations disrupt the…

…and predicted loss-of-functionDCCmutations cause congenital…

…ic, predicted loss-of-functionDCCmutations cause developmental…

Show Full Abstract

The deleted in colorectal cancer (DCC) gene encodes the netrin-1 (NTN1) receptor DCC, a transmembrane protein required for the guidance of commissural axons. Germline DCC mutations disrupt the development of predominantly commissural tracts in the central nervous system (CNS) and cause a spectrum of neurological disorders. Monoallelic, missense, and predicted loss-of-function DCC mutations cause congenital mirror movements, isolated agenesis of the corpus callosum (ACC), or both. Biallelic, predicted loss-of-function DCC mutations cause developmental split brain syndrome (DSBS). Although the underlying molecular mechanisms leading to disease remain poorly understood, they are thought to stem from reduced or perturbed NTN1 signaling. Here, we review the 26 reported DCC mutations associated with abnormal CNS development in humans, including 14 missense and 12 predicted loss-of-function mutations, and discuss their associated clinical characteristics and diagnostic features. We provide an update on the observed genotype-phenotype relationships of congenital mirror movements, isolated ACC and DSBS, and correlate this to our current understanding of the biological function of DCC in the development of the CNS. All mutations and their associated phenotypes were deposited into a locus-specific LOVD (https://databases.lovd.nl/shared/genes/DCC).

Also flagged:Keshan diseasecongestive cardiomyopathyseleniumcardiomyopathiesLGALS3BPPZP
Journal Article 2017-11-11 ✓ 5 Snippets Sun Y, Gao C, Wang X, Liu Y.
In-Text Gene Mentions

A2M, Akt, APOA2, APOE, C3, C9, calpain, CFH, chymotrypsin, Collagen type IV, Collagen (s), CP, Ecm, elastase, F2, F5, Fibrin, Fibrinogen, FN1, HDL, HDL-cholesterol, Intergrin, Laminin, LDL, MAC, Map, Pld, PLG, Pro-inflammatory Cytokine, Serine Protease, SERPINA1, SERPINC1, trypsin, VLDL-cholesterol, VTN

Respectively, there were 3 proteins (C1QB, CP, APOA2) remarkably altered in CKD and 3 (F5, SERPINC1, CFH) in LKD.

SERPINC1 and F5 increased in LKD, but in CKD, they decreased.

…and 3 (F5,SERPINC1, CFH) in LKD.…

…PLG, SERPINA andSERPINC).…

Show Full Abstract

Keshan disease is a congestive cardiomyopathy. Dietary selenium deficiency combined with additional stressors are recognized to cause the cardiomyopathies. In this study, clinical condition of individuals with different subtypes including chronic and latent were analyzed. ECG abnormalities, chest radiography, echocardiography and blood selenium concentration were assessed. Subsequently, in effort to uncover proteins that were reliably changed in patients, isobaric tags for absolute and relative quantitation technology was applied. Bioinformatics analysis of the differentially expressed proteins were performed by means of Gene Ontology classification, KEGG pathway, and Ingenuity Pathway Analysis. ELISA experiment was used to detect the interesting proteins. As a result, chronic patients showed more EGC abnormalities compared to Latent. All patients had low blood selenium level. Proteomics data revealed 28 differentially expressed proteins. By ELISA variation, LGALS3BP was increased in chronic patients. PZP was elevated specially in latent patients. The above results might be beneficial for further biomarkers discovery and Keshan disease pathological mechanism study.

Also flagged:aplastic anemiacirrhosishepatocellular carcinomatumorliver tumorchromosome
Journal Article 2017-11-11 ✓ 3 Snippets Adams P, Howlett C, Xenocostas A, Chakrabarti S.
In-Text Gene Mentions

…post‐liver transplantation inhemochromatosiswith aplastic anemia…

…42‐year‐old man withhemochromatosisand cirrhosis developed…

…Genetic testing forhemochromatosisin 1998 confirmed…

Show Full Abstract

A 42-year-old man with hemochromatosis and cirrhosis developed aplastic anemia. He underwent liver transplantation from a female donor and splenectomy, and his aplastic anemia spontaneously resolved. A bone marrow examination 6 months after the liver transplant showed 17.5% female cells. He did well for 13 years without the need for any blood product support but then developed bone pain and was found to have metastatic hepatocellular carcinoma in the vertebral bodies. Molecular analysis demonstrated that the tumor cells were from his original liver. No primary liver tumor was identified in the explant. The case demonstrates the application of fluorescent <i>in situ</i> hybridization with X and Y chromosome-specific probes to study chimerism and tumor origin after liver transplantation between individuals of different sex. (<i>Hepatology Communications</i> 2018;2:13-15).

Also flagged:Pggenomic imprintingBpbrain developmenttissue homeostasiscancer
Journal Article 2017-11-10 ✓ 1 Snippet Varrault A, Eckardt S, Girard B, Le Digarcher A, Sassetti I, Meusnier C, Ripoll C, Badalyan A, Bertaso F, McLaughlin KJ, Journot L, Bouschet T.
In-Text Gene Mentions

Pou3f2

Show Full Abstract

One strategy for stem cell-based therapy of the cerebral cortex involves the generation and transplantation of functional, histocompatible cortical-like neurons from embryonic stem cells (ESCs). Diploid parthenogenetic Pg-ESCs have recently emerged as a promising source of histocompatible ESC derivatives for organ regeneration but their utility for cerebral cortex therapy is unknown. A major concern with Pg-ESCs is genomic imprinting. In contrast with biparental Bp-ESCs derived from fertilized oocytes, Pg-ESCs harbor two maternal genomes but no sperm-derived genome. Pg-ESCs are therefore expected to have aberrant expression levels of maternally expressed (MEGs) and paternally expressed (PEGs) imprinted genes. Given the roles of imprinted genes in brain development, tissue homeostasis and cancer, their deregulation in Pg-ESCs might be incompatible with therapy. Here, we report that, unexpectedly, only one gene out of 7 MEGs and 12 PEGs was differentially expressed between Pg-ESCs and Bp-ESCs while 13 were differentially expressed between androgenetic Ag-ESCs and Bp-ESCs, indicating that Pg-ESCs but not Ag-ESCs, have a Bp-like imprinting compatible with therapy. In vitro, Pg-ESCs generated cortical-like progenitors and electrophysiologically active glutamatergic neurons that maintained the Bp-like expression levels for most imprinted genes. In vivo, Pg-ESCs participated to the cortical lineage in fetal chimeras. Finally, transplanted Pg-ESC derivatives integrated into the injured adult cortex and sent axonal projections in the host brain. In conclusion, mouse Pg-ESCs generate functional cortical-like neurons with Bp-like imprinting and their derivatives properly integrate into both the embryonic cortex and the injured adult cortex. Collectively, our data support the utility of Pg-ESCs for cortical therapy. Stem Cells 2018;36:192-205.

Also flagged:virionsviral genomevirionRNA polymeraseviral infectionhost cell
Journal Article 2017-11-10 No Snippets Grossegesse M, Doellinger J, Tyshaieva A, Schaade L, Nitsche A.
Show Full Abstract

DNA viruses, like poxviruses, possess a highly stable genome, suggesting that adaptation of virus particles to specific cell types is not restricted to genomic changes. Cowpox viruses are zoonotic poxviruses with an extraordinarily broad host range, demonstrating their adaptive potential in vivo. To elucidate adaptation mechanisms of poxviruses, we isolated cowpox virus particles from a rat and passaged them five times in a human and a rat cell line. Subsequently, we analyzed the proteome and genome of the non-passaged virions and each passage. While the overall viral genome sequence was stable during passaging, proteomics revealed multiple changes in the virion composition. Interestingly, an increased viral fitness in human cells was observed in the presence of increased immunomodulatory protein amounts. As the only minor variant with increasing frequency during passaging was located in a viral RNA polymerase subunit and, moreover, most minor variants were found in transcription-associated genes, protein amounts were presumably regulated at transcription level. This study is the first comparative proteome analysis of virus particles before and after cell culture propagation, revealing proteomic changes as a novel poxvirus adaptation mechanism.

Also flagged:gene expressioncancerpseudouridinemethyladenosine5-methylcytosinepost-translational modifications
Journal Article 2017-11-10 ✓ 1 Snippet Jacob R, Zander S, Gutschner T.
In-Text Gene Mentions

ZNFX1antisense RNA 1…

Show Full Abstract

The broad application of next-generation sequencing technologies in conjunction with improved bioinformatics has helped to illuminate the complexity of the transcriptome, both in terms of quantity and variety. In humans, 70-90% of the genome is transcribed, but only ~2% carries the blueprint for proteins. Hence, there is a huge class of non-translated transcripts, called long non-coding RNAs (lncRNAs), which have received much attention in the past decade. Several studies have shown that lncRNAs are involved in a plethora of cellular signaling pathways and actively regulate gene expression via a broad selection of molecular mechanisms. Only recently, sequencing-based, transcriptome-wide studies have characterized different types of post-transcriptional chemical modifications of RNAs. These modifications have been shown to affect the fate of RNA and further expand the variety of the transcriptome. However, our understanding of their biological function, especially in the context of lncRNAs, is still in its infancy. In this review, we will focus on three epitranscriptomic marks, namely pseudouridine (Ψ), <i>N</i>⁶-methyladenosine (m⁶A) and 5-methylcytosine (m⁵C). We will introduce writers, readers, and erasers of these modifications, and we will present methods for their detection. Finally, we will provide insights into the distribution and function of these chemical modifications in selected, cancer-related lncRNAs.

Also flagged:Cell cycle arrestp53tumorcell cycleDREAMtranscriptional repressor
Journal Article 2017-11-10 No Snippets Engeland K.
Show Full Abstract

Activation of the p53 tumor suppressor can lead to cell cycle arrest. The key mechanism of p53-mediated arrest is transcriptional downregulation of many cell cycle genes. In recent years it has become evident that p53-dependent repression is controlled by the p53-p21-DREAM-E2F/CHR pathway (p53-DREAM pathway). DREAM is a transcriptional repressor that binds to E2F or CHR promoter sites. Gene regulation and deregulation by DREAM shares many mechanistic characteristics with the retinoblastoma pRB tumor suppressor that acts through E2F elements. However, because of its binding to E2F and CHR elements, DREAM regulates a larger set of target genes leading to regulatory functions distinct from pRB/E2F. The p53-DREAM pathway controls more than 250 mostly cell cycle-associated genes. The functional spectrum of these pathway targets spans from the G<sub>1</sub> phase to the end of mitosis. Consequently, through downregulating the expression of gene products which are essential for progression through the cell cycle, the p53-DREAM pathway participates in the control of all checkpoints from DNA synthesis to cytokinesis including G<sub>1</sub>/S, G<sub>2</sub>/M and spindle assembly checkpoints. Therefore, defects in the p53-DREAM pathway contribute to a general loss of checkpoint control. Furthermore, deregulation of DREAM target genes promotes chromosomal instability and aneuploidy of cancer cells. Also, DREAM regulation is abrogated by the human papilloma virus HPV E7 protein linking the p53-DREAM pathway to carcinogenesis by HPV. Another feature of the pathway is that it downregulates many genes involved in DNA repair and telomere maintenance as well as Fanconi anemia. Importantly, when DREAM function is lost, CDK inhibitor drugs employed in cancer treatment such as Palbociclib, Abemaciclib and Ribociclib can compensate for defects in early steps in the pathway upstream from cyclin/CDK complexes. In summary, the p53-p21-DREAM-E2F/CHR pathway controls a plethora of cell cycle genes, can contribute to cell cycle arrest and is a target for cancer therapy.

Also flagged:Regnase-1FibrosisRoquinRNA binding proteinsdegradationcell activation
Journal Article 2017-11-10 No Snippets Cui X, Mino T, Yoshinaga M, Nakatsuka Y, Hia F, Yamasoba D, Tsujimura T, Tomonaga K, Suzuki Y, Uehata T, Takeuchi O.
Show Full Abstract

Regnase-1 and Roquin are RNA binding proteins that are essential for degradation of inflammatory mRNAs and maintenance of immune homeostasis. Although deficiency of either of the proteins leads to enhanced T cell activation, their functional relationship in T cells has yet to be clarified because of lethality upon mutation of both Regnase-1 and Roquin. By using a Regnase-1 conditional allele, we show that mutations of both Regnase-1 and Roquin in T cells leads to massive lymphocyte activation. In contrast, mutation of either Regnase-1 or Roquin affected T cell activation to a lesser extent than the double mutation, indicating that Regnase-1 and Roquin function nonredundantly in T cells. Interestingly, Regnase-1 and Roquin double-mutant mice suffered from severe inflammation and early formation of fibrosis, especially in the heart, along with the increased expression of <i>Ifng</i>, but not <i>Il4</i> or <i>Il17a</i> Consistently, mutation of both Regnase-1 and Roquin leads to a huge increase in the Th1, but not the Th2 or Th17, population in spleens compared with T cells with a single Regnase-1 or Roquin deficiency. Regnase-1 and Roquin are capable of repressing the expression of a group of mRNAs encoding factors involved in Th1 differentiation, such as <i>Furin</i> and <i>Il12rb1</i>, via their 3' untranslated regions. Moreover, Regnase-1 is capable of repressing Roquin mRNA. This cross-regulation may contribute to the synergistic control of T cell activation/polarization. Collectively, our results demonstrate that Regnase-1 and Roquin maintain T cell immune homeostasis and regulate Th1 polarization synergistically.

Also flagged:rapamycinironmyocardial infarctionFerroptosisdeathMechanistic target of rapamycin
Journal Article 2017-11-10 ✓ 1 Snippet Baba Y, Higa JK, Shimada BK, Horiuchi KM, Suhara T, Kobayashi M, Woo JD, Aoyagi H, Marh KS, Kitaoka H, Matsui T.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Clinical studies have suggested that myocardial iron is a risk factor for left ventricular remodeling in patients after myocardial infarction. Ferroptosis has recently been reported as a mechanism of iron-dependent nonapoptotic cell death. However, ferroptosis in the heart is not well understood. Mechanistic target of rapamycin (mTOR) protects the heart against pathological stimuli such as ischemia. To define the role of cardiac mTOR on cell survival in iron-mediated cell death, we examined cardiomyocyte (CM) cell viability under excess iron and ferroptosis conditions. Adult mouse CMs were isolated from cardiac-specific mTOR transgenic mice, cardiac-specific mTOR knockout mice, or control mice. CMs were treated with ferric iron [Fe(III)]-citrate, erastin, a class 1 ferroptosis inducer, or Ras-selective lethal 3 (RSL3), a class 2 ferroptosis inducer. Live/dead cell viability assays revealed that Fe(III)-citrate, erastin, and RSL3 induced cell death. Cotreatment with ferrostatin-1, a ferroptosis inhibitor, inhibited cell death in all conditions. mTOR overexpression suppressed Fe(III)-citrate, erastin, and RSL3-induced cell death, whereas mTOR deletion exaggerated cell death in these conditions. 2',7'-Dichlorodihydrofluorescein diacetate measurement of reactive oxygen species (ROS) production showed that erastin-induced ROS production was significantly lower in mTOR transgenic versus control CMs. These findings suggest that ferroptosis is a significant type of cell death in CMs and that mTOR plays an important role in protecting CMs against excess iron and ferroptosis, at least in part, by regulating ROS production. Understanding the effects of mTOR in preventing iron-mediated cell death will provide a new therapy for patients with myocardial infarction. NEW & NOTEWORTHY Ferroptosis has recently been reported as a new form of iron-dependent nonapoptotic cell death. However, ferroptosis in the heart is not well characterized. Using cultured adult mouse cardiomyocytes, we demonstrated that the mechanistic target of rapamycin plays an important role in protecting cardiomyocytes against excess iron and ferroptosis.

Also flagged:NK 4cholinephytatepyrophosphatePhosphorusmononucleotides
Journal Article 2017-11-10 No Snippets Liu J, Yang J, Cade-Menun BJ, Hu Y, Li J, Peng C, Ma Y.
Show Full Abstract

Soil legacy phosphorus (P) represents a substantial secondary P resource to postpone the global P crisis. To fully utilize this P reserve, the transformation of legacy P speciation in a black soil with and without P fertilization for 27 years was investigated by chemical fractionation, molecular-level bulk (P K-edge X-ray absorption near-edge, XANES; solution <sup>31</sup>P nuclear magnetic resonance) and microprobe (µ-X-ray fluorescence and µ-XANES) spectroscopy. Results from both fractionation and P bulk-XANES concordantly indicated that Ca<sub>2</sub>-P [Ca(H<sub>2</sub>PO<sub>4</sub>)<sub>2</sub>] acts as a reserve of labile P in response to soils with or without P fertilization. Cropping for 27 years depleted hydroxyapatite while enriched iron-bound P in soils irrespective of P application. Similar accumulation of soil organic P (P<sub>o</sub>), probably due to root residue inputs, occurred in both soils with and without P fertilization; the accumulated P<sub>o</sub> was present as orthophosphate diesters in soils with P fertilization more than in soils without P fertilization, suggesting that the release of labile P<sub>o</sub> was triggered by soil P deficits. These results provide vital information for agronomically and environmentally sustainable P management by demonstrating the potential crop availability of legacy soil P, which could reduce future P fertilization.

Also flagged:neurodegenerative disorderHDbrain atrophyanxietyaggressionpathogenesis
Journal Article 2017-11-10 ✓ 1 Snippet Snyder BR, Chan AWS.
In-Text Gene Mentions

HTT

Show Full Abstract

Huntington's disease (HD) is a complex neurodegenerative disorder that has no cure. Although treatments can often be given to relieve symptoms, the neuropathology associated with HD cannot be stopped or reversed. HD is characterized by degeneration of the striatum and associated pathways that leads to impairment in motor and cognitive functions as well as psychiatric disturbances. Although cell and rodent models for HD exist, longitudinal study in a transgenic HD nonhuman primate (i.e., rhesus macaque; HD monkeys) shows high similarity in its progression with human patients. Progressive brain atrophy and changes in white matter integrity examined by magnetic resonance imaging are coherent with the decline in cognitive behaviors related to corticostriatal functions and neuropathology. HD monkeys also express higher anxiety and irritability/aggression similar to human HD patients that other model systems have not yet replicated. While a comparative model approach is critical for advancing our understanding of HD pathogenesis, HD monkeys could provide a unique platform for preclinical studies and long-term assessment of translatable outcome measures. This review summarizes the progress in the development of the transgenic HD monkey model and the opportunities for advancing HD preclinical research.

Also flagged:cortisolheat illnessdeathheat strokeheat-related illnesscatecholamines
Journal Article 2017-11-10 No Snippets Stacey MMJ, Delves SK, Woods DR, Britland SE, Macconnachie L, Allsopp AJ, Brett SJ, Fallowfield JL, Boos CJ.
Show Full Abstract

<h4>Purpose</h4>Heat adaptation (HA) is critical to performance and health in a hot environment. Transition from short-term heat acclimatisation (STHA) to long-term heat acclimatisation (LTHA) is characterised by decreased autonomic disturbance and increased protection from thermal injury. A standard heat tolerance test (HTT) is recommended for validating exercise performance status, but any role in distinguishing STHA from LTHA is unreported. The aims of this study were to (1) define performance status by serial HTT during structured natural HA, (2) evaluate surrogate markers of autonomic activation, including heart rate variability (HRV), in relation to HA status.<h4>Methods</h4>Participants (n = 13) were assessed by HTT (60-min block-stepping, 50% VO<sub>2</sub>peak) during STHA (Day 2, 6 and 9) and LTHA (Day 23). Core temperature (Tc) and heart rate (HR) were measured every 5 min. Sampling for HRV indices (RMSSD, LF:HF) and sympathoadrenal blood measures (cortisol, nephrines) was undertaken before and after (POST) each HTT.<h4>Results</h4>Significant (P < 0.05) interactions existed for Tc, logLF:HF, cortisol and nephrines (two-way ANOVA; HTT by Day). Relative to LTHA, POST results differed significantly for Tc (Day 2, 6 and 9), HR (Day 2), logRMSSD (Day 2 and Day 6), logLF:HF (Day 2 and Day 6), cortisol (Day 2) and nephrines (Day 2 and Day 9). POST differences in HRV (Day 6 vs. 23) were + 9.9% (logRMSSD) and - 18.6% (logLF:HF).<h4>Conclusions</h4>Early reductions in HR and cortisol characterised STHA, whereas LTHA showed diminished excitability by Tc, HRV and nephrine measures. Measurement of HRV may have potential to aid real-time assessment of readiness for activity in the heat.

Also flagged:Ironmetabolism-reductionmembranesHepcidingenetic hemochromatosis
Journal Article 2017-11-10 ✓ 1 Snippet Daher R, Manceau H, Karim Z.
In-Text Gene Mentions

…therapy for genetichemochromatosisand chelation therapy…

Show Full Abstract

Although iron is vital, its free form is likely to be involved in oxidation-reduction reactions, leading to the formation of free radicals and oxidative stress. Living organisms have developed protein systems to transport free iron through the cell membranes and biological fluids and store it in a non-toxic and readily mobilizable form to avoid iron toxicity. Hepcidin plays a crucial role in maintaining iron homeostasis. Hepcidin expression is directly regulated by variations in iron intake and its repression leads to an increase in bioavailable serum iron level. However, in pathological situations, prolonged repression often leads to pathological iron overload. In this review, we describe the different molecular mechanisms responsible for the maintenance of iron metabolism and the consequences of iron overload. Indeed, genetic hemochromatosis and post-transfusional siderosis are the two main conditions responsible for iron overload. Long-term iron overload is deleterious, and treatment relies on venesection therapy for genetic hemochromatosis and chelation therapy for iron overload resulting from multiple transfusions.

Also flagged:dichloroacetatepyruvate dehydrogenasecomplex deficiencymitochondrial diseasePDCmitochondrial matrix enzyme mega
Journal Article 2017-11-10 No Snippets Stacpoole PW, Shuster J, Thompson JLPS, Prather RA, Lawson LA, Zou B, Buchsbaum R, Nixon SJ.
Show Full Abstract

We developed an Observer-Reported Outcome (ObsRO) survey instrument to be applied in a multicenter, placebo-controlled, crossover randomized controlled trial of dichloroacetate in children with pyruvate dehydrogenase complex deficiency. The instrument quantifies a subject's at-home level of functionality, as reported by a parent/caregiver, who were instrumental in providing the clinical descriptors and domains that formed the instrument's content. Feasibility testing of the ObsRO tool showed it to be easy to use and comprehensive in capturing the major clinical functional limitations of affected children and requires less than 5min for a parent/caregiver to complete daily.

Also flagged:E2F1cell cycle regulatory proteinstranscription factorcell cyclemetabolismobesity
Journal Article 2017-11-10 No Snippets Denechaud PD, Fajas L, Giralt A.
Show Full Abstract

In the past years, several lines of evidence have shown that cell cycle regulatory proteins also can modulate metabolic processes. The transcription factor E2F1 is a central player involved in cell cycle progression, DNA-damage response, and apoptosis. Its crucial role in the control of cell fate has been extensively studied and reviewed before; however, here, we focus on the participation of E2F1 in the regulation of metabolism. We summarize recent findings about the cell cycle-independent roles of E2F1 in various tissues that contribute to global metabolic homeostasis and highlight that E2F1 activity is increased during obesity. Finally, coming back to the pivotal role of E2F1 in cancer development, we discuss how E2F1 links cell cycle progression with different metabolic adaptations required for cell growth and survival.

Also flagged:Huntington's diseaseHDgenetic neurodegenerative disordertumorsDARPP-32BDNF
Journal Article 2017-11-10 ✓ 1 Snippet Al-Gharaibeh A, Culver R, Stewart AN, Srinageshwar B, Spelde K, Frollo L, Kolli N, Story D, Paladugu L, Anwar S, Crane A, Wyse R, Maiti P, Dunbar GL, Rossignol J.
In-Text Gene Mentions

…huntingtin gene (HTT), and the…

Show Full Abstract

Huntington's disease (HD) is a genetic neurodegenerative disorder characterized by neuronal loss and motor dysfunction. Although there is no effective treatment, stem cell transplantation offers a promising therapeutic strategy, but the safety and efficacy of this approach needs to be optimized. The purpose of this study was to test the potential of intra-striatal transplantation of induced pluripotent stem cell-derived neural stem cells (iPS-NSCs) for treating HD. For this purpose, we developed mouse adenovirus-generated iPSCs, differentiated them into neural stem cells <i>in vitro</i>, labeled them with Hoechst, and transplanted them bilaterally into striata of 10-month old wild type (WT) and HD YAC128 mice. We assessed the efficiency of these transplanted iPS-NSCs to reduce motor deficits in YAC128 mice by testing them on an accelerating rotarod task at 1 day prior to transplantation, and then weekly for 10 weeks. Our results showed an amelioration of locomotor deficits in YAC128 mice that received iPS-NSC transplantations. Following testing, the mice were sacrificed, and their brains were analyzed using immunohistochemistry and Western blot (WB). The results from our histological examinations revealed no signs of tumors and evidence that many iPS-NSCs survived and differentiated into region-specific neurons (medium spiny neurons) in both WT and HD mice, as confirmed by co-labeling of Hoechst-labeled transplanted cells with NeuN and DARPP-32. Also, counts of Hoechst-labeled cells revealed that a higher proportion were co-labeled with DARPP-32 and NeuN in HD-, compared to WT- mice, suggesting a dissimilar differentiation pattern in HD mice. Whereas significant decreases were found in counts of NeuN- and DARPP-32-labeled cells, and for neuronal density measures in striata of HD vehicle controls, such decrements were not observed in the iPS-NSCs-transplanted-HD mice. WB analysis showed increase of BDNF and TrkB levels in striata of transplanted HD mice compared to HD vehicle controls. Collectively, our data suggest that iPS-NSCs may provide an effective option for neuronal replacement therapy in HD.

Also flagged:conjugationpaclitaxelnanoparticlecurcumindryPEG
Journal Article 2017-11-10 No Snippets Thulasidasan AKT, Retnakumari AP, Shankar M, Vijayakurup V, Anwar S, Thankachan S, Pillai KS, Pillai JJ, Nandan CD, Alex VV, Chirayil TJ, Sundaram S, Kumar GSV, Anto RJ.
Show Full Abstract

Nanoencapsulation has emerged as a novel strategy to enhance the pharmacokinetic and therapeutic potential of conventional drugs. Recent studies from our lab have established the efficacy of curcumin in sensitizing cervical cancer cells and breast cancer cells towards paclitaxel and 5-FU chemotherapy respectively. Factors that hinder the clinical use of curcumin as a sensitizer or therapeutic agent include its poor bioavailability and retention time. Earlier reports of improvement in bioavailability and retention of drugs upon nanoencapsulation have motivated us in developing various nanoformulations of curcumin, which were found to exhibit significant enhancement in bioavailability and retention time as assessed by our previous <i>in vitro</i> studies. Among the various formulations tested, curcumin-entrapped in PLGA-PEG nanoparticles conjugated to folic acid (PPF-curcumin) displayed maximum cell death. In the present study, we have demonstrated the efficacy of this formulation in augmenting the bioavailability and retention time of curcumin, <i>in vivo</i>, in <i>Swiss albino</i> mice. Further, the acute and chronic toxicity studies proved that the formulation is pharmacologically safe. We have also evaluated its potential in chemosensitizing cervical cancer cells to paclitaxel and have verified the results using cervical cancer xenograft model in NOD-SCID mice. Folic acid conjugation significantly enhanced the efficacy of curcumin in down-regulating various survival signals induced by paclitaxel in cervical cancer cells and have considerably improved its potential in inhibiting the tumor growth of cervical cancer xenografts. The non-toxic nature coupled with improved chemosensitization potential makes PPF-curcumin a promising candidate formulation for clinical trials.

Also flagged:polysaccharidelipidmetabolismpolysaccharidesrhamnosemannose
Journal Article 2017-11-10 ✓ 3 Snippets Yang Z, Wang J, Li J, Xiong L, Chen H, Liu X, Wang N, Ouyang K, Wang W.
In-Text Gene Mentions

HFE-induced hyperlipidemia and non-alcoholic fatty liver

HFE-induced hyperlipidemia

…and protecting againstHFE-induced hyperlipidemia and no…

Show Full Abstract

The objective of this study was to analyse the structure of CPP-2, and to observe the pharmacological effects of CPP-2 on lipid metabolism and oxidative stress. CPP-2, eluted as two main fractions comprised of two polysaccharides with Mw of 307 and 3.7kDa, was mainly consisted of rhamnose, mannose, glucose and galactose in a molar ratio of 1.00:0.78:3.22:0.45. The results showed that treatment with CPP-2 could improve blood lipid levels (TC, TG, HDL-C and LDL-C), liver lipid levels (TC and TG) and antioxidant status (SOD, T-AOC, GSH-PX, MDA and LPO). In addition, the histopathological observations of mice livers and the GPT activities indicated that CPP-2 could attenuate liver cell injury. The present findings demonstrated that CPP-2 might be effective in lowering lipid and protecting against HFE-induced hyperlipidemia and non-alcoholic fatty liver.

Also flagged:photonsegmentationelectronelectronsmineralwater
Journal Article 2017-11-09 No Snippets Zeinali-Rafsanjani B, Faghihi R, Mosleh-Shirazi MA, Saeedi-Moghadam M, Jalli R, Sina S.
Show Full Abstract

<h4>Objective</h4>MRI-only treatment planning (TP) can be advantageous in paediatric radiotherapy. However, electron density extraction is necessary for dose calculation. Normally, after bone segmentation, a bulk density is assigned. However, the variation of bone bulk density in patients makes the creation of pseudo CTs challenging. This study aims to assess the effects of bone density variations in children on radiation attenuation and dose calculation for MRI-only TP.<h4>Methods</h4>Bone contents of <15-year-old children were calculated, and substituted in the Oak Ridge National Laboratory paediatric phantoms. The percentage depth dose and beam profile of 150 kVp and 6 MV photon and 6 MeV electron beams were then calculated using Xcom, MCNPX (Monte Carlo N-particle version X) and ORLN phantoms.<h4>Results</h4>Using 150 kVp X-rays, the difference in attenuation coefficient was almost 5% between an 11-year-old child and a newborn, and ~8% between an adult and a newborn. With megavoltage radiation, the differences were smaller but still important. For an 18 MV photon beam, the difference of radiation attenuation between an 11-year-old child and a newborn was 4% and ~7.4% between an adult and a newborn. For 6 MeV electrons, dose differences were observed up to the 2 cm depth. The percentage depth dose difference between 1 and 10-year-olds was 18.5%, and between 10 and 15-year-olds was 24%.<h4>Conclusion</h4>The results suggest that for MRI-only TP of photon- or electron-beam radiotherapy, the bone densities of each age group should be defined separately for accurate dose calculation. Advances in knowledge: This study highlights the need for more age-specific determination of bone electron density for accurate dose calculations in paediatric MRI-only radiotherapy TP.

Also flagged:alkylpolyethylene glycolsynthesiscarbosilanespolyimideSmAP F
Journal Article 2017-11-09 No Snippets Korblova ED, Guzman E, Maclennan JE, Glaser MA, Shao R, Garcia E, Shen Y, Visvanathan R, Clark NA, Walba DM.
Show Full Abstract

We have previously reported the first realization of an orthogonal ferroelectric bent-core SmAP<sub>F</sub> phase by directed design in mesogens with a single tricarbosilane-terminated alkoxy tail. Given the potentially useful electrooptic properties of this phase, including analog phase-only electrooptic index modulation with optical latching, we have been exploring its "structure space", searching for novel SmAP<sub>F</sub> mesogens. Here, we report two classes of these-the first designed to optimize the dynamic range of the index modulation in parallel-aligned cells by lowering the bend angle of the rigid core, and the second expanding the structure space of the phase by replacing the tricarbosilane-terminated alkyl tail with a polyfluorinated polyethylene glycol oligomer.

Also flagged:phospholipidshydroperoxidescatalasecytosolsuperoxide dismutaseglutathione peroxidase
Journal Article 2017-11-09 ✓ 2 Snippets Moustafa AN, Ibrahim MH, Mousa SO, Hassan EE, Mohamed HF, Moness HM.
In-Text Gene Mentions

As, DCC augments the antioxidant system by enhancing the activities of antioxidant enzymes SOD, CAT, GPx and TAS, on one hand and decreasing hyperlipidemia, on the other hand.

…ConclusionDCCwas associated with…

Show Full Abstract

<h4>Background</h4>Although delayed cord clamping (DCC) is a recent WHO recommendation, early cord clamping (ECC) is still a routine practice in many countries. Limited researches studied the effect of delayed cord clamping on oxidative stress in term neonates; In this study we aim to assess the influence of cord clamping either early or late on oxidative stress in term neonates and to evaluate the association of oxidative stress and cord blood lipids.<h4>Methods</h4>One-hundred mothers and their term neonates were included in the present study. Umbilical cord blood samples were collected from the umbilical vein and umbilical artery immediately following labor.<h4>Results</h4>Total cholesterol, total triglycerides and phospholipids levels were significantly higher in the ECC group than the DCC group (p < 0.001 in all). Plasma total antioxidant status was higher in the DCC group than the ECC group (p < 0.001). While, plasma hydroperoxides were lower in the DCC group than the ECC group (p < 0.001). Levels of erythrocytes catalase cytosol, superoxide dismutase and glutathione peroxidase were significantly higher in the DCC group than the ECC group (p < 0.001).<h4>Conclusion</h4>DCC was associated with a decrease in cord blood lipids and an augmented antioxidant activity. This suggests the protective effect of DCC on the future health of the term neonates and supports the application of DCC in active management of 3rd stage of labor in term neonates.

Also flagged:hydroxyapatiteBMP-7peptideHAcalcium phosphateBMP-2
Journal Article 2017-11-09 No Snippets Wang Q, Wang M, Lu X, Wang K, Fang L, Ren F, Lu G.
Show Full Abstract

Hydroxyapatite (HA) is the principal inorganic component of bones and teeth and has been widely used as a bone repair material because of its good biocompatibility and bioactivity. Understanding the interactions between proteins and HA is crucial for designing biomaterials for bone regeneration. In this study, we evaluated the effects of atomic-level nano-structured HA (110) surfaces on the adsorption of bone morphogenetic protein-7 (BMP-7) and its derived peptide (KQLNALSVLYFDD) using molecular dynamics and density functional theory methods. The results indicated that the atomic-level morphology of HA significantly affected the interaction strength between proteins and HA substrates. The interactions of BMP-7 and its derived peptide with nano-concave and nano-pillar HA surfaces were stronger than those with flat or nano-groove HA surfaces. The results also revealed that if the groove size of nano-structured HA surfaces matched that of residues in the protein or peptide, these residues were likely to spread into the grooves of the nano-groove, nano-concave, and nano-pillar HA, further strengthening the interactions. These results are helpful in better understanding the adsorption behaviors of proteins onto nano-structured HA surfaces, and provide theoretical guidance for designing novel bioceramic materials for bone regeneration and tissue engineering.

Also flagged:keratinocyte differentiationepidermal cell differentiationFGF5SGK3IGFBP7OXTR
Journal Article 2017-11-09 ✓ 1 Snippet Li X, Su R, Wan W, Zhang W, Jiang H, Qiao X, Fan Y, Zhang Y, Wang R, Liu Z, Wang Z, Liu B, Ma Y, Zhang H, Zhao Q, Zhong T, Di R, Jiang Y, Chen W, Wang W, Dong Y, Li J.
In-Text Gene Mentions

…KITLG , andHTT) 10 .…

Show Full Abstract

Inner Mongolia and Liaoning cashmere goats are two outstanding Chinese multipurpose breeds that adapt well to the semi-arid temperate grassland. These two breeds are characterized by their soft cashmere fibers, thus making them great models to identify genomic regions that are associated with cashmere fiber traits. Whole-genome sequencing of 70 cashmere goats produced more than 5.52 million single-nucleotide polymorphisms and 710,600 short insertions and deletions. Further analysis of these genetic variants showed some population-specific molecular markers for the two cashmere goat breeds that are otherwise phenotypically similar. By analyzing F <sub>ST</sub> and θ<sub>π</sub> outlier values, we identified 135 genomic regions that were associated with cashmere fiber traits within the cashmere goat populations. These selected genomic regions contained genes, which are potential involved in the production of cashmere fiber, such as FGF5, SGK3, IGFBP7, OXTR, and ROCK1. Gene ontology enrichment analysis of identified short insertions and deletions also showed enrichment in keratinocyte differentiation and epidermal cell differentiation. These findings demonstrate that this genomic resource will facilitate the breeding of cashmere goat and other Capra species in future.

Also flagged:lysC-lysbiomoleculelysineaspartate kinase IIIL-lysine
Journal Article 2017-11-09 ✓ 5 Snippets Song L, Zeng AP.
In-Text Gene Mentions

…aspartate kinase III (AK-III) under in vivo…

…Aspartate kinase III (AK-III), encoded by lysC…

AK-IIIis allosterically inhibited…

AK-IIIwas chosen in…

…lysC gene encodingAK-IIIwas amplified by…

Show Full Abstract

Cells are capable of rapid replication and performing tasks adaptively and ultra-sensitively and can be considered as cheap "biological-robots". Here we propose to engineer cells for screening biomolecules in parallel and with high sensitivity. Specifically, we place the biomolecule variants (library) on the bacterial phage M13. We then design cells to screen the library based on cell-phage interactions mediated by a specific intracellular signal change caused by the biomolecule of interest. For proof of concept, we used intracellular lysine concentration in E. coli as a signal to successfully screen variants of functional aspartate kinase III (AK-III) under in vivo conditions, a key enzyme in L-lysine biosynthesis which is strictly inhibited by L-lysine. Comparative studies with flow cytometry method failed to distinguish the wild-type from lysine resistance variants of AK-III, confirming a higher sensitivity of the method. It opens up a new and effective way of in vivo high-throughput screening for functional molecules and can be easily implemented at low costs.

Also flagged:Brightcaspase-3EREGdefectschromogranin AGAPDH
Journal Article 2017-11-09 ✓ 5 Snippets Liu M, Zhang Z, Sampson L, Zhou X, Nalapareddy K, Feng Y, Akunuru S, Melendez J, Davis AK, Bi F, Geiger H, Xin M, Zheng Y.
In-Text Gene Mentions

OLFM4

Olfm4

qRT-PCR performed 1 day after tamoxifen-induced RHOA deletion revealed a similar transcriptional reduction of ISC markers, i.e., Lgr5, Ascl2, and Olfm4, which is associated with a reduction of canonical Wnt markers Axin2 and Cyclin D1 in RhoA KO enteroids (Figure 3D).

…, Ascl2 ,Olfm4, and Bmi1…

…Lgr5 : Mm00438890_m1;Olfm4: Mm01320260_m1;…

Show Full Abstract

RHOA, a founding member of the Rho GTPase family, is critical for actomyosin dynamics, polarity, and morphogenesis in response to developmental cues, mechanical stress, and inflammation. In murine small intestinal epithelium, inducible RHOA deletion causes a loss of epithelial polarity, with disrupted villi and crypt organization. In the intestinal crypts, RHOA deficiency results in reduced cell proliferation, increased apoptosis, and a loss of intestinal stem cells (ISCs) that mimic effects of radiation damage. Mechanistically, RHOA loss reduces YAP signaling of the Hippo pathway and affects YAP effector epiregulin (EREG) expression in the crypts. Expression of an active YAP (S112A) mutant rescues ISC marker expression, ISC regeneration, and ISC-associated Wnt signaling, but not defective epithelial polarity, in RhoA knockout mice, implicating YAP in RHOA-regulated ISC function. EREG treatment or active β-catenin Catnb<sup>lox(ex3)</sup> mutant expression rescues the RhoA KO ISC phenotypes. Thus, RHOA controls YAP-EREG signaling to regulate intestinal homeostasis and ISC regeneration.

Also flagged:kinasebindingkinasesBTKPTK2PTK2B
Journal Article 2017-11-09 ✓ 1 Snippet Huang HT, Dobrovolsky D, Paulk J, Yang G, Weisberg EL, Doctor ZM, Buckley DL, Cho JH, Ko E, Jang J, Shi K, Choi HG, Griffin JD, Li Y, Treon SP, Fischer ES, Bradner JE, Tan L, Gray NS.
In-Text Gene Mentions

KLHL20

Show Full Abstract

Heterobifunctional molecules that recruit E3 ubiquitin ligases, such as cereblon, for targeted protein degradation represent an emerging pharmacological strategy. A major unanswered question is how generally applicable this strategy is to all protein targets. In this study, we designed a multi-kinase degrader by conjugating a highly promiscuous kinase inhibitor with a cereblon-binding ligand, and used quantitative proteomics to discover 28 kinases, including BTK, PTK2, PTK2B, FLT3, AURKA, AURKB, TEC, ULK1, ITK, and nine members of the CDK family, as degradable. This set of kinases is only a fraction of the intracellular targets bound by the degrader, demonstrating that successful degradation requires more than target engagement. The results guided us to develop selective degraders for FLT3 and BTK, with potentials to improve disease treatment. Together, this study demonstrates an efficient approach to triage a gene family of interest to identify readily degradable targets for further studies and pre-clinical developments.

Also flagged:Angioedemahereditary angioedemaC1 inhibitordeficiencyC1-INHbradykinin
Journal Article 2017-11-09 ✓ 1 Snippet Gianni P, Loules G, Zamanakou M, Kompoti M, Csuka D, Psarros F, Magerl M, Moldovan D, Maurer M, Speletas MG, Farkas H, Germenis AE.
In-Text Gene Mentions

…Genetic Determinants ofC1 InhibitorInhibitor Deficiency Angioedem…

Show Full Abstract

<h4>Background</h4>In view of the large heterogeneity in the clinical presentation of hereditary angioedema due to C1 inhibitor deficiency (C1-INH-HAE), great efforts are being made towards detecting measurable biological determinants of disease severity that can help to improve the management of the disease. Considering the central role that plasma kallikrein plays in bradykinin production, we investigated the contribution of the functional polymorphism KLKB1-428G/A to the disease phenotype.<h4>Methods</h4>We studied 249 C1-INH-HAE patients from 114 European families, and we explored possible associations of C1-INH-HAE clinical features with carriage of KLKB1-428G/A, combined or not with that of the functional F12-46C/T polymorphism.<h4>Results</h4>Carriers of the G allele of the KLKB1-428G/A polymorphism exhibited a significantly delayed disease onset (i.e., by 4.1 years [p < 0.001], depending on the zygocity status), while carriers of both the KLKB1-428G/A and the F12-46C/T polymorphism displayed an 8.8-year delay in disease onset (p < 0.001) and a 64% lower probability of needing long-term prophylactic treatment (p = 0.019).<h4>Conclusions</h4>These findings support our initial hypothesis that functional alterations in genes of proteins involved in bradykinin metabolism and function affect the clinical phenotype and possibly contribute to the pathogenesis of C1-INH-HAE. Given that an earlier onset of symptoms is inversely correlated with the subsequent course of the disease and, eventually, the need for long-term prophylaxis, these polymorphisms may be helpful prognostic biomarkers of disease severity.

Also flagged:leukoencephalopathymitochondrial aspartyl-tRNA synthetase 2lactateLBSLIntractable DiseasesTranscription Cycle
Journal Article 2017-11-09 ✓ 5 Snippets Shimojima K, Higashiguchi T, Kishimoto K, Miyatake S, Miyake N, Takanashi JI, Matsumoto N, Yamamoto T.
In-Text Gene Mentions

Definite diagnosis of LBSL is established by the demonstration of mutations in the mitochondrial aspartyl-tRNA synthetase 2 gene (DARS2), which encodes mitochondrial aspartyl-tRNA synthetase, the enzyme that attaches the amino acid aspartate to the correct mitochondrial transfer RNA.2 Aspartyl-tRNA is necessary in the translation of mitochondrial messenger RNA into protein.3 The majority of the LBSL cases is due to compound heterozygous DARS2 mutations.

A Japanese patient with LBSL showed compound heterozygous DARS2 mutations c.358_359delinsTC (p.Gly120Ser) and c.228-15C>G (splicing error).

Here we present a male with LBSL in whom a novel DARS2 mutation was identified.

From these findings, we concluded that LBSL features in this patient are derived from compound heterozygous mutations in DARS2.

The mitochondrial aspartyl-tRNA synthetase 2 gene (DARS2) is responsible for leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL).

Show Full Abstract

The mitochondrial aspartyl-tRNA synthetase 2 gene (<i>DARS2</i>) is responsible for leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation (LBSL). A Japanese patient with LBSL showed compound heterozygous <i>DARS2</i> mutations c.358_359delinsTC (p.Gly120Ser) and c.228-15C>G (splicing error). This provides further evidence that most patients with LBSL show compound heterozygous mutations in <i>DARS2</i> in association with a common splicing mutation in the splicing acceptor site of intron 2.

Also flagged:colorectal cancerp42.3tumorWWOXK-rasCOX-2
Journal Article 2017-11-09 ✓ 5 Snippets Hao Y, Zhang J, Shan G, Zhang N, Jin W, Nan K.
In-Text Gene Mentions

…COX-2, p53, APC,DCCand PTEN, at…

…COX-2, p53, APC,DCCand PTEN, which…

…COX-2, p53, APC,DCC, PTEN.…

…COX-2, P53, APC,DCCand PTEN.…

…GO results ofDCCand PTEN.…

Show Full Abstract

<i>Objective:</i> to establish regulatory network of colorectal cancer involving p42.3 protein and to provide theoretical evidence for deep functional exploration of p42.3 protein in the onset and development of colorectal cancer. <i>Methods:</i> with protein similarity algorithm, reference protein set of p42.3 cell apoptosis was built according to structural features of p42.3. GO and KEGG databases were used to establish regulatory network of tumor cell apoptosis involving p42.3; meanwhile, the largest possible working pathway that involves p42.3 protein was screened out based on Bayesian network theory. Besides, GO and KEGG were used to build regulatory network on early diagnosis gene markers for colorectal cancer including WWOX, K-ras, COX-2, p53, APC, DCC and PTEN, at the same time, a regulatory network of colorectal cancer cell apoptosis which involves p42.3 was established. <i>Results:</i> cell apoptotic regulatory network that p42.3 participates in primarily consists of Bcl-2 family genes and the largest possible pathway is p42.3 → FKBP → Bcl-2 centered as FKBP protein. Combined with colorectal cancer regulatory network that involves early diagnosis gene markers, it can be predicted that p42.3 is most likely to regulate the colorectal cancer cell apoptosis through FKBP → Bcl-2 → Bax → caspase-9 → caspase-3 pathway. <i>Conclusion:</i> the colorectal cancer apoptosis network based on p42.3 established in the study provides theoretical evidence for deep exploration of p42.3 regulatory mechanism and molecular targeting treatment of colorectal cancer.

bioRxiv 2017-11-09 Preprint (No Snippets API) Elbatsh AM, Raaijmakers JA, van der Weide RH, Kuit de Bos J, Teunissen H, Bravo S, Medema RH, de Wit E, Haering CH, Rowland BD.
Show Full Abstract

<h4>ABSTRACT</h4> Chromosome condensation by condensin is essential for faithful chromosome segregation. Metazoans have two complexes, named condensin I and II. Both are thought to act by creating looped structures in DNA, but how they do so is unknown. Condensin’s SMC subunits together form a composite ATPase with two pseudo-symmetric ATPase sites. We reveal that these sites have opposite functions in the condensation process. One site drives condensation, while the other site rather has a dampening function. Mutation of this dampener site hyperactivates both condensin I and II complexes. We find that hyperactive condensin I efficiently shortens chromosomes in the total absence of condensin II. The two complexes form loops with different lengths, and specifically condensin II is key to the decatenation of sister chromatids and the formation of a straight chromosomal axis.

Also flagged:cAMP‐dependentcAMP‐dependent proteinRheumatoid Arthritisinflammatory arthritisnanoparticleSrc
Journal Article 2017-11-08 ✓ 1 Snippet Perl A.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

Metabolic pathways mediate lineage specification within the immune system through the regulation of glucose utilization, a process that generates energy in the form of ATP and synthesis of amino acids, nucleotides, and lipids to enable cell growth, proliferation, and survival. CD4+ T cells, a proinflammatory cell subset, preferentially produce ATP through glycolysis, whereas cells with an antiinflammatory lineage, such as memory and regulatory T cells, favor mitochondrial ATP generation. In conditions of metabolic stress or a shortage of nutrients, cells rely on autophagy to secure amino acids and other substrates, while survival depends on the sparing of mitochondria and maintenance of a reducing environment. The pentose phosphate pathway acts as a key gatekeeper of inflammation by supplying ribose-5-phosphate for cell proliferation and NADPH for antioxidant defenses. Increased lysosomal catabolism, accumulation of branched amino acids, glutamine, kynurenine, and histidine, and depletion of glutathione and cysteine activate the mechanistic target of rapamycin (mTOR), an arbiter of lineage development within the innate and adaptive immune systems. Mapping the impact of susceptibility genes to metabolic pathways allows for better understanding and therapeutic targeting of disease-specific expansion of proinflammatory cells. Therapeutic approaches aimed at glutathione depletion and mTOR pathway activation appear to be safe and effective for treating lupus, while an opposing intervention may be of benefit in rheumatoid arthritis. Environmental sources of origin for metabolites within immune cells may include microbiota and plants. Thus, a better understanding of the pathways of immunometabolism could provide new insights into the pathogenesis and treatment of the rheumatic diseases.

Also flagged:non-alcoholic fatty liver diseasenonalcoholic fatty liver diseaseNAFLDnonalcoholic steatohepatitisNASHhepatocellular carcinoma
Journal Article 2017-11-08 ✓ 1 Snippet Patel YA, Gifford EJ, Glass LM, McNeil R, Turner MJ, Han B, Provenzale D, Choi SS, Moylan CA, Hunt CM.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>With its increasing incidence, nonalcoholic fatty liver disease (NAFLD) is of particular concern in the Veterans Health Administration (VHA).<h4>Aims</h4>To evaluate risk factors for advanced fibrosis in biopsy-proven NAFLD in the VHA, to identify patients at risk for adverse outcomes.<h4>Methods</h4>In randomly selected cases from VHA databases (2005-2015), we performed a retrospective case-control study in adults with biopsy-defined NAFLD or normal liver.<h4>Results</h4>Of 2091 patients reviewed, 399 met inclusion criteria. Normal controls (n = 65) had normal liver function. The four NAFLD cohorts included: NAFL steatosis (n = 76), nonalcoholic steatohepatitis (NASH) without fibrosis (n = 68), NAFLD/NASH stage 1-3 fibrosis (n = 82), and NAFLD/NASH cirrhosis (n = 70). NAFLD with hepatocellular carcinoma (HCC) was separately identified (n = 38). Most patients were older White men. NAFLD patients with any fibrosis were on average severely obese (BMI>35 kg/m<sup>2</sup> ). Diabetes (54.4%-79.6%) and hypertension (85.8%-100%) were more common in NAFLD with fibrosis or HCC. Across NAFLD, 12.3%-19.5% were enrolled in diet/exercise programs and 0%-2.6% had bariatric surgery. Hispanics exhibited higher rates of NASH (20.6%), while Blacks had low NAFLD rates (1.4%-11.8%), particularly NAFLD cirrhosis and HCC (1.4%-2.6%). Diabetes (OR 11.8, P < .001) and BMI (OR 1.4, P < .001) were the most significant predictors of advanced fibrosis.<h4>Conclusions</h4>In the VHA, diabetes and severe obesity increased risk for advanced fibrosis in NAFLD. Of these patients, only a small proportion (~20%) had enrolled in diet/exercise programs or had bariatric surgery (~2%). These results suggest that providers should focus/tailor interventions to improve outcomes, particularly in those with diabetes and severe obesity.

Also flagged:chromosomessaltbindingchromosomecohesinchromatin
Journal Article 2017-11-08 ✓ 5 Snippets Eeftens JM, Bisht S, Kerssemakers J, Kschonsak M, Haering CH, Dekker C.
In-Text Gene Mentions

…AbstractCondensin, a conserved member…

Condensinremains bound to…

Condensinuses two distinct…

Condensinmight mediate DNA…

Condensindoes not compact…

Show Full Abstract

Condensin, a conserved member of the SMC protein family of ring-shaped multi-subunit protein complexes, is essential for structuring and compacting chromosomes. Despite its key role, its molecular mechanism has remained largely unknown. Here, we employ single-molecule magnetic tweezers to measure, in real time, the compaction of individual DNA molecules by the budding yeast condensin complex. We show that compaction can proceed in large steps, driving DNA molecules into a fully condensed state against forces of up to 2 pN. Compaction can be reversed by applying high forces or adding buffer of high ionic strength. While condensin can stably bind DNA in the absence of ATP, ATP hydrolysis by the SMC subunits is required for rendering the association salt insensitive and for the subsequent compaction process. Our results indicate that the condensin reaction cycle involves two distinct steps, where condensin first binds DNA through electrostatic interactions before using ATP hydrolysis to encircle the DNA topologically within its ring structure, which initiates DNA compaction. The finding that both binding modes are essential for its DNA compaction activity has important implications for understanding the mechanism of chromosome compaction.

Also flagged:membranemembrane proteinsphosphorylationfocal adhesiontranscription factorsgene expression
Journal Article 2017-11-08 ✓ 2 Snippets Tien WS, Chen PM, Chuang CY, Lui SM, Kuo HC, Chen YJ, Wu KP.
In-Text Gene Mentions

…(APP) and huntingtin (HTT), respectively 34 ,…

…proteins APP andHTTare involved in…

Show Full Abstract

Owing to the clinical potential of human induced pluripotent stem cells (hiPSCs) in regenerative medicine, a thorough examination of the similarities and differences between hiPSCs and human embryonic stem cells (hESCs) has become indispensable. Moreover, as the important roles of membrane proteins in biological signalling, functional analyses of membrane proteome are therefore promising. In this study, a pathway analysis by the bioinformatics tool GSEA was first performed to identify significant pathways associated with the three comparative membrane proteomics experiments: hiPSCs versus precursor human foreskin fibroblasts (HFF), hESCs versus precursor HFF, and hiPSCs versus hESCs. A following three-way pathway comparison was conducted to identify the differentially regulated pathways that may contribute to the differences between hiPSCs and hESCs. Our results revealed that pathways related to oxidative phosphorylation and focal adhesion may undergo incomplete regulations during the reprogramming process. This hypothesis was supported by another public proteomics dataset to a certain degree. The identified pathways and their core enriched proteins could serve as the starting point to explore the possible ways to make hiPSCs closer to hESCs.

Also flagged:synthesisRKIPERKMandibularRaf-1 kinase inhibitor proteinCTS
Journal Article 2017-11-08 No Snippets Sun L, Zhao J, Wang H, Pan Y, Wang L, Zhang WB.
Show Full Abstract

Mandibular hypoplasia is a common jaw deformity that affects breathing, occlusal function and facial aesthetics. Stimulating mandibular condylar growing with functional appliances is an ordinary but controversial treatment method in orthodontics. Therefore, it is vital to clarify how functional appliances affect condylar growing. Raf-1 kinase inhibitor protein (RKIP), as an endogenous inhibitory molecule of the ERK signaling, is postulated to involve in stress-induced response to articular cartilage. This study was to reveal the role of RKIP in regulating cartilage matrix synthesis with functional appliance treatment. Here, position rat mandibular forward simulating functional appliance effect to examine the stress-induced modification of mandibular condylar in vivo, meanwhile rat mandibular condylar chondrocytes (Mccs) were subjected to cyclic tensile stress (CTS, 16%, 1 HZ). The results showed that mandibular forward therapy enhanced condylar cartilage growth. The thicknesses of all layers of condylar cartilage were increased significantly. RKIP expression was also increased in the mature cartilage layer. In addition, CTS could enhance extracellular matrix formation and cartilage marker expression (aggrecan and collagen II), which shared a similar expression pattern with RKIP in Mccs. However, CTS induced up-regulation of collagen II and aggrecan was blocked by RKIP knockdown. Nuclear p-ERK, targeting downstream of RKIP, showed a decrease after CTS,which was disappeared in RKIP-knockdown Mccs. Taken together, physiological mechanical stimulation promotes cartilage growth modification by up-regulating RKIP through inhibiting ERK signaling pathway.

Also flagged:MPmitochondrialantibodyautismSOD1PRDX5
Journal Article 2017-11-08 No Snippets Malty RH, Aoki H, Kumar A, Phanse S, Amin S, Zhang Q, Minic Z, Goebels F, Musso G, Wu Z, Abou-Tok H, Meyer M, Deineko V, Kassir S, Sidhu V, Jessulat M, Scott NE, Xiong X, Vlasblom J, Prasad B, Foster LJ, Alberio T, Garavaglia B, Yu H, Bader GD, Nakamura K, Parkinson J, Babu M.
Show Full Abstract

Mitochondrial protein (MP) dysfunction has been linked to neurodegenerative disorders (NDs); however, the discovery of the molecular mechanisms underlying NDs has been impeded by the limited characterization of interactions governing MP function. Here, using mass spectrometry (MS)-based analysis of 210 affinity-purified mitochondrial (mt) fractions isolated from 27 epitope-tagged human ND-linked MPs in HEK293 cells, we report a high-confidence MP network including 1,964 interactions among 772 proteins (>90% previously unreported). Nearly three-fourths of these interactions were confirmed in mouse brain and multiple human differentiated neuronal cell lines by primary antibody immunoprecipitation and MS, with many linked to NDs and autism. We show that the SOD1-PRDX5 interaction, critical for mt redox homeostasis, can be perturbed by amyotrophic lateral sclerosis-linked SOD1 allelic variants and establish a functional role for ND-linked factors coupled with IκBɛ in NF-κB activation. Our results identify mechanisms for ND-linked MPs and expand the human mt interaction landscape.

Also flagged:Hereditary AngioedemaC1 inhibitorC1-INHestrogen
Journal Article 2017-11-08 ✓ 1 Snippet Veronez CL, Moreno AS, Constantino-Silva RN, Maia LSM, Ferriani MPL, Castro FFM, Valle SR, Nakamura VK, Cagini N, Gonçalves RF, Mansour E, Serpa FS, Coelho Dias GA, Piccirillo MA, Toledo E, de Souza Bernardes M, Cichon S, Stieber C, Arruda LK, Pesquero JB, Grumach AS.
In-Text Gene Mentions

…Angioedema with NormalC1 InhibitorInhibitor and F12…

Show Full Abstract

<h4>Background</h4>Hereditary angioedema (HAE) with normal C1 inhibitor (C1-INH) is a rare condition with clinical features similar to those of HAE with C1-INH deficiency. Mutations in the F12 gene have been identified in subsets of patients with HAE with normal C1-INH, mostly within families of European descent.<h4>Objectives</h4>Our aim was to describe clinical characteristics observed in Brazilians from 42 families with HAE and F12 gene mutations (FXII-HAE), and to compare these findings with those from other populations.<h4>Methods</h4>We evaluated a group of 195 individuals, which included 102 patients clinically diagnosed with FXII-HAE and their 93 asymptomatic relatives.<h4>Results</h4>Genetic analysis revealed that of the 195 subjects, 134 individuals (77.6% females) carried a pathogenic mutation in F12. The T328K substitution was found in 132 individuals, and the c.971_1018+24del72 deletion was found in 2 patients. The mean age at onset of symptoms in patients with FXII-HAE was 21.1 years. The most common symptoms were subcutaneous edema (85.8% of patients), abdominal pain attacks (69.7%), and upper airway edema (32.3%). Of male individuals carrying F12 mutations, 53.3% (16 of 30) were symptomatic. Compared with reports from Europe, fewer female patients (68.6%) reported an influence of estrogen on symptoms.<h4>Conclusions</h4>Our study included a large number of patients with FXII-HAE, and, as the first such study conducted in a South American population, it highlighted significant differences between this and other study populations. The high number of symptomatic males and patients with estrogen-independent FXII-HAE found here suggests that male sex and the absence of a hormonal influence should not discourage clinicians from searching for F12 mutations in cases of HAE with normal C1-INH.

Also flagged:Cullin 3Cullin 3-RING ligasesCRL3degradationadaptor proteinstumor
Journal Article 2017-11-08 No Snippets Cheng J, Guo J, Wang Z, North BJ, Tao K, Dai X, Wei W.
Show Full Abstract

Cullin 3-RING ligases (CRL3) play pivotal roles in the regulation of various physiological and pathological processes, including neoplastic events. The substrate adaptors of CRL3 typically contain a BTB domain that mediates the interaction between Cullin 3 and target substrates to promote their ubiquitination and subsequent degradation. The biological implications of CRL3 adaptor proteins have been well described where they have been found to play a role as either an oncogene, tumor suppressor, or can mediate either of these effects in a context-dependent manner. Among the extensively studied CRL3-based E3 ligases, the role of the adaptor protein SPOP (speckle type BTB/POZ protein) in tumorigenesis appears to be tissue or cellular context dependent. Specifically, SPOP acts as a tumor suppressor via destabilizing downstream oncoproteins in many malignancies, especially in prostate cancer. However, SPOP has largely an oncogenic role in kidney cancer. Keap1, another well-characterized CRL3 adaptor protein, likely serves as a tumor suppressor within diverse malignancies, mainly due to its specific turnover of its downstream oncogenic substrate, NRF2 (nuclear factor erythroid 2-related factor 2). In accordance with the physiological role the various CRL3 adaptors exhibit, several pharmacological agents have been developed to disrupt its E3 ligase activity, therefore blocking its potential oncogenic activity to mitigate tumorigenesis.

Also flagged:CD4immune responseneurosyphilisdefense responseT cell receptorMAPK
Journal Article 2017-11-08 No Snippets Liu LL, Zhu SG, Jiang XY, Ren J, Lin Y, Zhang NN, Tong ML, Zhang HL, Zheng WH, Fu HJ, Luo HJ, Lin LR, Yan JH, Yang TC.
Show Full Abstract

Recent studies have shown that several long noncoding RNAs (lncRNAs) are involved in regulating the immune response to cope with pathogenic invasion. To date, the roles of lncRNAs in the CD4+ T cell response to <i>Treponema pallidum</i> (<i>T. pallidum</i>) infection in neurosyphilis patients remain unknown. The mRNA and lncRNA expression profiles of CD4+ T cells that were isolated from neurosyphilis patients and healthy controls were analyzed by microarray. A total of 2258 lncRNAs and 1728 mRNAs were identified as over-expressed or under-expressed, respectively (fold change > 1.5) in the CD4+ T cells of neurosyphilis patients compared to the healthy controls. The lncRNA-mRNA co-expression network showed that 59 lncRNAs showed significant differences along with significantly different mRNAs. Among the 59 gene pairs, the <i>LOC79999</i> mRNA was positively correlated with the <i>RP11-160E2.16, RP11-160E2.11</i>, and <i>RP11-160E2.19</i> lncRNAs, and the <i>NKX1-1</i> mRNA was positively correlated with the <i>RP11-1398P2.1, RP11-160E2.19</i>, and <i>XLOC_003422</i> lncRNAs. The following five mRNAs were correlated with two differential lncRNAs: <i>DUSP16, AP000349.1, FAM115C, TIMM8A</i>, and <i>SMCHD1</i>. Gene Ontology (GO) analysis revealed that the differentially expressed coding genes were mainly involved in biological processes and the top 4 terms that associated with above-mentioned differentially expressed coding genes were as follows: defense response to fungus, defense response to bacterium, killing of cells of other organism and disruption of cells of another organism. A subsequent pathway analysis was also conducted, and several pathways, including the T cell receptor, MAPK, and TGF-beta signaling pathways, were associated with the differentially expressed mRNAs. This study reveals the differential expression profiles of lncRNAs in the CD4+ T cell response to the <i>T. pallidum</i> infection in neurosyphilis patients. LncRNAs are involved in key biological processes that comprise the CD4+ T cell response to the <i>T. pallidum</i> infection.

Also flagged:Ironmultiple sclerosisMSrelapsingprogressive MSC2
Journal Article 2017-11-08 ✓ 5 Snippets Hagemeier J, Ramanathan M, Schweser F, Dwyer MG, Lin F, Bergsland N, Weinstock-Guttman B, Zivadinov R.
In-Text Gene Mentions

Three (3) single nucleotide polymorphisms (SNPs) associated with iron regulation were genotyped: two SNPs in the human hereditary hemochromatosis protein gene <i>HFE</i>: rs1800562 (C282Y mutation) and rs1799945 (H63D mutation), as well as the rs1049296 SNP in the transferrin gene (C2 mutation).

Genetic variations in iron-regulating genes, e.g., H63A and C282Y variants of the human hemochromatosis (HFE) gene, can influence peripheral iron load (Burt et al., 1998).

In the present study, mutations in the HFE gene (C282Y & H63D) were not significantly more present in MS patients, although frequencies were overall higher.

Therefore, it may be that specifically within female MS patients, having any of the HFE or TF risk alleles could increase iron levels to a similar level as men.

…the human hereditaryhemochromatosisprotein gene HFE…

Show Full Abstract

Brain iron homeostasis is known to be disturbed in multiple sclerosis (MS), yet little is known about the association of common gene variants linked to iron regulation and pathological tissue changes in the brain. In this study, we investigated the association of genetic determinants linked to iron regulation with deep gray matter (GM) magnetic susceptibility in both healthy controls (HC) and MS patients. Four hundred (400) patients with MS and 150 age- and sex-matched HCs were enrolled and obtained 3 T MRI examination. Three (3) single nucleotide polymorphisms (SNPs) associated with iron regulation were genotyped: two SNPs in the human hereditary hemochromatosis protein gene <i>HFE</i>: rs1800562 (C282Y mutation) and rs1799945 (H63D mutation), as well as the rs1049296 SNP in the transferrin gene (C2 mutation). The effects of disease and genetic status were studied using quantitative susceptibility mapping (QSM) voxel-based analysis (VBA) and region-of-interest (ROI) analysis of the deep GM. The general linear model framework was used to compare groups. Analyses were corrected for age and sex, and adjusted for false discovery rate. We found moderate increases in susceptibility in the right putamen of participants with the C282Y (+ 6.1 ppb) and H63D (+ 6.9 ppb) gene variants vs. non-carriers, as well as a decrease in thalamic susceptibility of progressive MS patients with the C282Y mutation (left: - 5.3 ppb, right: - 6.7 ppb, p < 0.05). Female MS patients had lower susceptibility in the caudate (- 6.0 ppb) and putamen (left: - 3.9 ppb, right: - 4.6 ppb) than men, but only when they had a wild-type allele (p < 0.05). Iron-gene linked increases in putamen susceptibility (in HC and relapsing remitting MS) and decreases in thalamus susceptibility (in progressive MS), coupled with apparent sex interactions, indicate that brain iron in healthy and disease states may be influenced by genetic factors.

Also flagged:Ironiron-deficiency anemiaIDAIron deficiency anemiadeferoxamineammonium
Journal Article 2017-11-07 ✓ 1 Snippet Gulec A, Gulec S.
In-Text Gene Mentions

…toxicity in tissues (hemochromatosis).…

Show Full Abstract

Ankaferd Blood Stopper (ABS) comprises a mixture of plants and stops bleeding via forming a protein network by erythroid aggregation. Bleeding causes reduction of iron levels in body. It has been indicated that ABS contains significant amount of iron. Thus, we investigated the biological activity of ABS-derived iron on iron-regulated genes during iron-deficiency anemia (IDA). IDA We selected Caco-2 and HepG2 cell lines as in vitro models of human intestine and liver, respectively. Iron deficiency anemia was induced by deferoxamine. The cells were treated with ferric ammonium citrate (FAC) and ABS. Messenger RNA levels of iron-regulated genes were analyzed by quantitative reverse transcription polymerase chain reaction to elucidate whether iron in ABS behaved similar to inorganic iron (FAC) during IDA. The results showed that ABS-derived iron influenced transcriptions of iron-regulated marker genes, including divalent metal transporter ( Dmt1), transferrin receptor ( TfR), ankyrin repeat domain 37 ( Ankrd37), and hepcidin ( Hamp) in IDA-induced Caco-2 and HepG2 cells. Our results suggest that when ABS is used to stop tissue bleeding, it might have an ability to reduce levels of IDA.

Also flagged:Nanos RNA-binding proteinstranscription factorPRC2chromatinTHAPnanos
Journal Article 2017-11-07 ✓ 1 Snippet Lee CS, Lu T, Seydoux G.
In-Text Gene Mentions

…PRC2/MES-4 network ofchromatin modifiersmodifiers to reprogram…

Show Full Abstract

Nanos RNA-binding proteins are required for germline development in metazoans, but the underlying mechanisms remain poorly understood. We have profiled the transcriptome of primordial germ cells (PGCs) lacking the <i>nanos</i> homologs <i>nos-1</i> and <i>nos-2</i> in <i>C. elegans. nos-1nos-2</i> PGCs fail to silence hundreds of transcripts normally expressed in oocytes. We find that this misregulation is due to both delayed turnover of maternal transcripts and inappropriate transcriptional activation. The latter appears to be an indirect consequence of delayed turnover of the maternally-inherited transcription factor LIN-15B, a synMuvB class transcription factor known to antagonize PRC2 activity. PRC2 is required for chromatin reprogramming in the germline, and the transcriptome of PGCs lacking PRC2 resembles that of <i>nos-1nos-2</i> PGCs. Loss of maternal LIN-15B restores fertility to <i>nos-1nos-2</i> mutants. These findings suggest that Nanos promotes germ cell fate by downregulating maternal RNAs and proteins that would otherwise interfere with PRC2-dependent reprogramming of PGC chromatin.

Also flagged:IGFBP-3Vitamin D ReceptorInsulinObesityvitamin Dmetabolism
Journal Article 2017-11-07 No Snippets Moreno-Santos I, Castellano-Castillo D, Lara MF, Fernandez-Garcia JC, Tinahones FJ, Macias-Gonzalez M.
Show Full Abstract

Adipose tissue has traditionally only been considered as an energy storage organ. Nevertheless, the importance of this tissue in systemic physiology and, especially, in systemic inflammation has been highlighted in recent years. Adipose tissue expresses proteins related to vitamin D (VD) metabolism, and it has been proposed that it can act as a VD storage tissue. The active form of VD, 1,25-dihydroxyvitamin D3 (1,25(OH)₂D₃), is able to modify adipocyte and adipose tissue physiology via the VD receptor (VDR), decreasing the expression of pro-inflammatory cytokines in adipose tissue. Moreover, VD deficiency and VDR has been reported to be associated with obesity and diabetes. However, the results of the different studies are not conclusive. Insulin growth binding proteins (IGFBPs) have been identified in adipose tissue, but their roles are poorly understood. Therefore, the objective of this study was to analyze the plasma levels of VD and the gene expression of VDR in the adipose tissue of subjects with morbid obesity (MO) and with different degrees of insulin resistance (IR), as well as the functionality of direct interaction between IGFBP-3 and VDR, which could explain its inhibitory role in adipogenesis. Our results show a novel role of the VD system in the regulation and activation of IGFBP-3 in visceral adipose tissue (VAT) of patients with MO, as a new and alternative mechanism proposed in the insulin signaling associated with obesity.

Also flagged:cancercolorectal cancercolorectal adenomaadenomaadenomasmetabolism
Journal Article 2017-11-07 ✓ 1 Snippet Zhang J, Raju GS, Chang DW, Lin SH, Chen Z, Wu X.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Circulating microRNAs (miRNAs) are emerging as promising biomarkers for cancer. The objective of the current study was to investigate the potential of circulating cell-free miRNAs as biomarkers for colorectal cancer (CRC) and its precursor lesion, colorectal adenoma.<h4>Methods</h4>The serum levels of 800 miRNAs were assessed in a discovery set of 21 patients with CRC, 19 patients with adenoma, and 21 healthy controls using the NanoString miRNA analysis platform. Significantly differentially expressed miRNAs were examined further in a validation cohort of 34 patients with CRC, 33 patients with adenoma, and 35 healthy controls using Fluidigm quantitative polymerase chain reaction assays.<h4>Results</h4>The ratios between the expression values of the differentially expressed miRNAs were computed. Three miRNA ratios (miR-17-5p/miR-135b, miR-92a-3p/miR135b, and miR-451a/miR-491-5p) were validated for discriminating patients with adenoma and those with CRC from the healthy control group, and 5 miRNA ratios (let-7b/miR-367-3p, miR-130a-3p/miR-409-3p, miR-148-3p/miR-27b, miR-148a-3p/miR-409-3p, and miR-21-5p/miR-367-3p) were validated for discriminating patients with CRC from those with adenoma and healthy controls. The area under the receiver operating characteristic curve values for the 3 miRNA ratios in discriminating patients with adenoma from healthy controls were 0.831 and 0.735, respectively, in the discovery and validation sets. The area under the receiver operating characteristic curve values for the 5 miRNA ratios in discriminating patients with CRC from those with adenoma were 0.797 and 0.732, respectively, in the discovery and validation sets. Pathway analysis revealed that target genes regulated by the miRNAs from the miRNA ratios were enriched mainly in metabolism-related and inflammation-related pathways.<h4>Conclusions</h4>The data from the current study suggest that circulating miRNAs can distinguish patients with CRC and those with adenoma and may represent novel biomarkers for the early, noninvasive detection of CRC. Cancer 2018;124:785-96. © 2017 American Cancer Society.

Also flagged:metabolismcancertumorglucosemacromoleculesynthesis
Journal Article 2017-11-07 No Snippets An MX, Li S, Yao HB, Li C, Wang JM, Sun J, Li XY, Meng XN, Wang HQ.
Show Full Abstract

Aerobic glycolysis, a phenomenon known historically as the Warburg effect, is one of the hallmarks of cancer cells. In this study, we characterized the role of BAG3 in aerobic glycolysis of pancreatic ductal adenocarcinoma (PDAC) and its molecular mechanisms. Our data show that aberrant expression of BAG3 significantly contributes to the reprogramming of glucose metabolism in PDAC cells. Mechanistically, BAG3 increased Hexokinase 2 (HK2) expression, the first key enzyme involved in glycolysis, at the posttranscriptional level. BAG3 interacted with HK2 mRNA, and the degree of BAG3 expression altered recruitment of the RNA-binding proteins Roquin and IMP3 to the HK2 mRNA. BAG3 knockdown destabilized HK2 mRNA via promotion of Roquin recruitment, whereas BAG3 overexpression stabilized HK2 mRNA via promotion of IMP3 recruitment. Collectively, our results show that BAG3 promotes reprogramming of glucose metabolism via interaction with HK2 mRNA in PDAC cells, suggesting that BAG3 may be a potential target in the aerobic glycolysis pathway for developing novel anticancer agents.

Also flagged:Serotonin TransporterMethylationMajor DepressionSLC6A4major depressive disorderdepression
Journal Article 2017-11-07 ✓ 1 Snippet Schneider I, Kugel H, Redlich R, Grotegerd D, Bürger C, Bürkner PC, Opel N, Dohm K, Zaremba D, Meinert S, Schröder N, Straßburg AM, Schwarte K, Schettler C, Ambrée O, Rust S, Domschke K, Arolt V, Heindel W, Baune BT, Zhang W, Dannlowski U, Hohoff C.
In-Text Gene Mentions

5-HTT

Show Full Abstract

DNA methylation profiles of the serotonin transporter gene (SLC6A4) have been shown to alter SLC6A4 expression, drive antidepressant treatment response and modify brain functions. This study investigated whether methylation of an AluJb element in the SLC6A4 promotor was associated with major depressive disorder (MDD), amygdala reactivity to emotional faces, 5-HTTLPR/rs25531 polymorphism, and recent stress. MDD patients (n=122) and healthy controls (HC, n=176) underwent fMRI during an emotional face-matching task. Individual SLC6A4 AluJb methylation profiles were ascertained and associated with MDD, amygdala reactivity, 5-HTTLPR/rs25531, and stress. SLC6A4 AluJb methylation was significantly lower in MDD compared to HC and in stressed compared to less stressed participants. Lower AluJb methylation was particularly found in 5-HTTLPR/rs25531 risk allele carriers under stress and correlated with less depressive episodes. fMRI analysis revealed a significant interaction of AluJb methylation and diagnosis in the amygdala, with MDD patients showing lower AluJb methylation associated with decreased amygdala reactivity. While no joint effect of AluJb methylation and 5-HTTLPR/rs25531 existed, risk allele carriers showed significantly increased bilateral amygdala activation. These findings suggest a role of SLC6A4 AluJb methylation in MDD, amygdala reactivity, and stress reaction, partly interwoven with 5-HTTLPR/rs25531 effects. Patients with low methylation in conjunction with a shorter MDD history and decreased amygdala reactivity might feature a more stress-adaptive epigenetic process, maybe via theoretically possible endogenous antidepressant-like effects. In contrast, patients with higher methylation might possibly suffer from impaired epigenetic adaption to chronic stress. Further, the 5-HTTLPR/rs25531 association with amygdala activation was confirmed in our large sample.

Also flagged:Actbcongenital diaphragmatic herniapulmonary hypertensionprostacyclinendothelin receptorsEndothelin Converting Enzyme
Journal Article 2017-11-07 ✓ 1 Snippet Mous DS, Buscop-van Kempen MJ, Wijnen RMH, Tibboel D, Rottier RJ.
In-Text Gene Mentions

…2 synthase (Ptgis) between control…

Show Full Abstract

<h4>Background</h4>Patients with congenital diaphragmatic hernia (CDH) have structural and functional different pulmonary vessels, leading to pulmonary hypertension. They often fail to respond to standard vasodilator therapy targeting the major vasoactive pathways, causing a high morbidity and mortality. We analyzed whether the expression of crucial members of these vasoactive pathways could explain the lack of responsiveness to therapy in CDH patients.<h4>Methods</h4>The expression of direct targets of current vasodilator therapy in the endothelin and prostacyclin pathway was analyzed in human lung specimens of control and CDH patients.<h4>Results</h4>CDH lungs showed increased expression of both ETA and ETB endothelin receptors and the rate-limiting Endothelin Converting Enzyme (ECE-1), and a decreased expression of the prostaglandin-I<sub>2</sub> receptor (PTGIR). These data were supported by increased expression of both endothelin receptors and ECE-1, endothelial nitric oxide synthase and PTGIR in the well-established nitrofen-CDH rodent model.<h4>Conclusions</h4>Together, these data demonstrate aberrant expression of targeted receptors in the endothelin and prostacyclin pathway in CDH already early during development. The analysis of this unique patient material may explain why a significant number of patients do not respond to vasodilator therapy. This knowledge could have important implications for the choice of drugs and the design of future clinical trials internationally.

Also flagged:cancertumoursnucleotidenucleosometumourchromatin
Journal Article 2017-11-07 No Snippets Hurst LD, Batada NN.
Show Full Abstract

<h4>Background</h4>An important goal of cancer genomics is to identify systematically cancer-causing mutations. A common approach is to identify sites with high ratios of non-synonymous to synonymous mutations; however, if synonymous mutations are under purifying selection, this methodology leads to identification of false-positive mutations. Here, using synonymous somatic mutations (SSMs) identified in over 4000 tumours across 15 different cancer types, we sought to test this assumption by focusing on coding regions required for splicing.<h4>Results</h4>Exon flanks, which are enriched for sequences required for splicing fidelity, have ~ 17% lower SSM density compared to exonic cores, even after excluding canonical splice sites. While it is impossible to eliminate a mutation bias of unknown cause, multiple lines of evidence support a purifying selection model above a mutational bias explanation. The flank/core difference is not explained by skewed nucleotide content, replication timing, nucleosome occupancy or deficiency in mismatch repair. The depletion is not seen in tumour suppressors, consistent with their role in positive tumour selection, but is otherwise observed in cancer-associated and non-cancer genes, both essential and non-essential. Consistent with a role in splicing modulation, exonic splice enhancers have a lower SSM density before and after controlling for nucleotide composition; moreover, flanks at the 5' end of the exons have significantly lower SSM density than at the 3' end.<h4>Conclusions</h4>These results suggest that the observable mutational spectrum of cancer genomes is not simply a product of various mutational processes and positive selection, but might also be shaped by negative selection.

Also flagged:Clusterinchaperonecytosolendoplasmic reticulumneurodegenerative diseasesamyotrophic lateral sclerosis-associated protein
Journal Article 2017-11-07 ✓ 5 Snippets Gregory JM, Whiten DR, Brown RA, Barros TP, Kumita JR, Yerbury JJ, Satapathy S, McDade K, Smith C, Luheshi LM, Dobson CM, Wilson MR.
In-Text Gene Mentions

Htt-Q128 and Htt-Q72-GFP flies…

…Htt-Q128 andHtt-Q72-GFP flies were a…

…each of TDP-43,Htt-Q128 and mutant (R406W)…

…+/− CLU orHtt-Q72-GFP +/− CLU were…

…1 of theHttgene, containing a…

Show Full Abstract

It is now widely accepted in the field that the normally secreted chaperone clusterin is redirected to the cytosol during endoplasmic reticulum (ER) stress, although the physiological function(s) of this physical relocation remain unknown. We have examined in this study whether or not increased expression of clusterin is able to protect neuronal cells against intracellular protein aggregation and cytotoxicity, characteristics that are strongly implicated in a range of neurodegenerative diseases. We used the amyotrophic lateral sclerosis-associated protein TDP-43 as a primary model to investigate the effects of clusterin on protein aggregation and neurotoxicity in complementary in vitro, neuronal cell and Drosophila systems. We have shown that clusterin directly interacts with TDP-43 in vitro and potently inhibits its aggregation, and observed that in ER stressed neuronal cells, clusterin co-localized with TDP-43 and specifically reduced the numbers of cytoplasmic inclusions. We further showed that the expression of TDP-43 in transgenic Drosophila neurons induced ER stress and that co-expression of clusterin resulted in a dramatic clearance of mislocalized TDP-43 from motor neuron axons, partially rescued locomotor activity and significantly extended lifespan. We also showed that in Drosophila photoreceptor cells, clusterin co-expression gave ER stress-dependent protection against proteotoxicity arising from both Huntingtin-Q128 and mutant (R406W) human tau. We therefore conclude that increased expression of clusterin can provide an important defense against intracellular proteotoxicity under conditions that mimic specific features of neurodegenerative disease.

Also flagged:glutamineglutamatecancergene expressionpurinesynthesis
Journal Article 2017-11-07 No Snippets Tian Y, Du W, Cao S, Wu Y, Dong N, Wang Y, Xu Y.
Show Full Abstract

<h4>Background</h4>Glutamine and glutamate are known to play important roles in cancer biology. However, no detailed information is available in terms of their levels of involvement in various biological processes across different cancer types, whereas such knowledge could be critical for understanding the distinct characteristics of different cancer types. Our computational study aimed to examine the functional roles of glutamine and glutamate across different cancer types.<h4>Methods</h4>We conducted a comparative analysis of gene expression data of cancer tissues versus normal control tissues of 11 cancer types to understand glutamine and glutamate metabolisms in cancer. Specifically, we developed a linear regression model to assess differential contributions by glutamine and/or glutamate to each of seven biological processes in cancer versus control tissues.<h4>Results</h4>While our computational predictions were consistent with some of the previous observations, multiple novel predictions were made: (1) glutamine is generally not involved in purine synthesis in cancer except for breast cancer, and is similarly not involved in pyridine synthesis except for kidney cancer; (2) glutamine is generally not involved in ATP production in cancer; (3) glutamine's contribution to nucleotide synthesis is minimal if any in cancer; (4) glutamine is not involved in asparagine synthesis in cancer except for bladder and lung cancers; and (5) glutamate does not contribute to serine synthesis except for bladder cancer.<h4>Conclusions</h4>We comprehensively predicted the roles of glutamine and glutamate metabolisms in selected metabolic pathways in cancer tissues versus control tissues, which may lead to novel approaches to therapeutic development targeted at glutamine and/or glutamate metabolism. However, our predictions need further functional validation.

Also flagged:ZIKV infectionmicrocephalyGuillain-Barré syndromepathogenesiscell cycleimmune response
Journal Article 2017-11-07 ✓ 5 Snippets Hu B, Huo Y, Yang L, Chen G, Luo M, Yang J, Zhou J.
In-Text Gene Mentions

For instance, MAP2 underwent altend, while DCC was subject to alt3 after ZIKV infection (Additional file 1: Table S6 and Figure S4), even though the expression levels of these two genes remained the same.

On the other hand, DCC Netrin 1 Receptor (DCC), which mediates axon attraction of neuronal growth cones in the developing nervous system upon ligand binding [45], was subject to alt3 type of AS following the infection (Additional file 1: Table S6 and Figure S4).

…the other hand,DCC Netrin 1 ReceptorNetrin 1 Receptor…

…Netrin 1 Receptor (DCC), which mediates axon…

…underwent altend, whileDCCwas subject to…

Show Full Abstract

<h4>Background</h4>The Zika virus (ZIKV) is a mosquito-borne flavivirus that causes microcephaly and Guillain-Barré syndrome in infected individuals. To obtain insights into the mechanism of ZIKV infection and pathogenesis, we analyzed the transcriptome of ZIKV infected human neural progenitor cells (hNPCs) for changes in alternative splicing (AS), gene isoform (ISO) composition and long noncoding RNAs (lncRNAs) expression.<h4>Methods</h4>We analyzed differentially expressed lncRNAs, AS, ISO from RNA-seq data in ZIKV infected hNPCs.<h4>Results</h4>We obtained 149 differentially expressed lncRNAs, including potential viral targets to modulate cellular processes such as cell cycle, apoptosis and immune response. The infection induced 262 cases of AS occurring in 229 genes, which were enriched in cell death, RNA processing, transport, and neuron development. Among 691 differentially expressed ISOs, upregulated ISOs were enriched in signaling, regulation of transcription, and amino acid biosynthesis, while downregulated ISOs were mostly enriched in cell cycle. Importantly, these analyses revealed specific links between ZIKV induced changes in cellular pathways and the type of changes in the host transcriptome, suggesting important regulatory mechanisms.<h4>Conclusions</h4>Our analyses revealed candidate lncRNAs, AS events and ISOs which may function in ZIKV infection induced cell cycle disruption, apoptosis and attenuation of neurogenesis, and shed light on the roles of lncRNAs, AS and ISOs in virus-host interactions, and would facilitate future studies of ZIKV infection and pathogenesis.

Also flagged:neurodegenerative diseaseHDpathogenesisneurodegenerative disorderHuntingtinamino acid
Journal Article 2017-11-07 ✓ 2 Snippets Veldman MB, Yang XW.
In-Text Gene Mentions

…expansion in theHTTgene, its motor…

HTT

Show Full Abstract

Huntington's disease (HD), a dominantly inherited neurodegenerative disease, is defined by its genetic cause, a CAG-repeat expansion in the HTT gene, its motor and psychiatric symptomology and primary loss of striatal medium spiny neurons (MSNs). However, the molecular mechanisms from genetic lesion to disease phenotype remain largely unclear. Mouse models of HD have been created that exhibit phenotypes partially recapitulating those in the patient, and specifically, cortico-striatal disconnectivity appears to be a shared pathogenic event shared by HD mouse models and patients. Molecular studies have begun to unveil converging molecular and cellular pathogenic mechanisms that may account for cortico-striatal miscommunication in various HD mouse models. Systems biological approaches help to illuminate synaptic molecular networks as a nexus for HD cortio-striatal pathogenesis, and may offer new candidate targets to modify the disease.

Also flagged:oxygenCOPDAATDdeathalpha-1 antitrypsindeficiency
Journal Article 2017-11-07 No Snippets Ekström M, Tanash H.
Show Full Abstract

<h4>Background</h4>Individuals with severe alpha-1 antitrypsin deficiency (AATD) have an increased risk of developing COPD. However, outcomes during long-term oxygen therapy (LTOT) in patients with severe AATD and hypoxemia are unknown.<h4>Patients and methods</h4>This was a prospective, population-based, consecutive cohort study of patients on LTOT due to COPD in the period from January 1, 1987, to June 30, 2015, in the Swedish National Registry for Respiratory Failure (Swedevox). Severe AATD was identified using the Swedish AATD registry and confirmed by isoelectric focusing. Data on lung transplantation (LTx) were obtained from the two lung transplantation centers in Sweden. Mortality and causes of death were assessed based on the National Causes of Death Registry and analyzed using multivariable Cox regression.<h4>Results</h4>A total of 14,644 patients who started LTOT due to COPD were included in this study. No patient was lost to follow up. Patients with AATD were younger, included more males and more never smokers, and had fewer comorbidities. During a median follow-up of 1.6 years (interquartile range [IQR], 2.7) on LTOT, patients without severe AATD had a higher mortality, hazard ratio [HR] 1.53 (95% CI, 1.24-1.88), adjusting for age, sex, smoking status, body mass index, performance status, level of hypoxemia, and comorbidities. Cardiovascular deaths were increased. A higher proportion of AATD patients underwent LTx, 53 (19%) vs 118 (1%). Survival after LTx was similar for AATD and non-AATD patients and was predicted by age.<h4>Conclusion</h4>In oxygen-dependent COPD, patients with severe AATD have a longer survival time on LTOT, but they have a similar prognosis after lung transplantation compared with patients without AATD.

Also flagged:vulvovaginal candidiasisExtracellularCYR1gene expressionACT1TPK2
Journal Article 2017-11-07 ✓ 1 Snippet Liu X, Li T, Wang D, Yang Y, Sun W, Liu J, Sun S.
In-Text Gene Mentions

To evaluate the presence of resistant C. albicans (CA10) in tissue of G. mellonella, three larvae from different groups (infected only; and infected and treated with licofelone, fluconazole and licofelone-fluconazole) were collected at day 3 after infection.

Show Full Abstract

<i>Candida albicans</i> (<i>C. albicans</i>) is one of the important opportunistic fungal pathogens that is closely associated with disseminated or chronic infections. The objective of this study is to evaluate the synergistic antifungal effect of licofelone, which is dual microsomal prostaglandin E2 synthase/lipoxygenase (mPGES-1/LOX) inhibitor in combination with fluconazole against <i>C. albicans</i>. Here our results showed that licofelone (16 μg/mL) can synergistically work with fluconazole (1 μg/mL) against planktonic cells of fluconazole-resistant <i>C. albicans.</i> The two-drug combination inhibited the <i>C. albicans</i> biofilm formation over 12 h, and reduced the expression of extracellular phospholipase genes, biofilm-specific genes and RAS/cAMP/PKA pathway related genes. In addition, the two-drug combination inhibited the transition from yeast to hyphal growth form, and decreased the secreted aspartyl proteinase activity, while not affecting the drug efflux pumps activity. <i>Galleria mellonella</i> model was also used to confirm the antifungal activity of the drug combination <i>in vivo</i>. This study first indicates that the combination of fluconazole and licofelone has synergistic effect against resistant <i>C. albicans</i> and could be a promising therapeutic strategy for the antifungal treatment.

Also flagged:gene expressionobesityPCSK9amino acidlipoproteincholesterol
Journal Article 2017-11-07 ✓ 1 Snippet Cirillo E, Parnell LD, Evelo CT.
In-Text Gene Mentions

…KTCD15, MC4R, MTCH2,NEGR1, SEC16B, SH2B1, TMEM18)…

Show Full Abstract

Pathway analysis is a powerful method for data analysis in genomics, most often applied to gene expression analysis. It is also promising for single-nucleotide polymorphism (SNP) data analysis, such as genome-wide association study data, because it allows the interpretation of variants with respect to the biological processes in which the affected genes and proteins are involved. Such analyses support an interactive evaluation of the possible effects of variations on function, regulation or interaction of gene products. Current pathway analysis software often does not support data visualization of variants in pathways as an alternate method to interpret genetic association results, and specific statistical methods for pathway analysis of SNP data are not combined with these visualization features. In this review, we first describe the visualization options of the tools that were identified by a literature review, in order to provide insight for improvements in this developing field. Tool evaluation was performed using a computational epistatic dataset of gene-gene interactions for obesity risk. Next, we report the necessity to include in these tools statistical methods designed for the pathway-based analysis with SNP data, expressly aiming to define features for more comprehensive pathway-based analysis tools. We conclude by recognizing that pathway analysis of genetic variations data requires a sophisticated combination of the most useful and informative visual aspects of the various tools evaluated.

Also flagged:hydroxyapatitesecretionpro-inflammatory cytokineTNF-αanti-inflammatory cytokineTGF-β
Journal Article 2017-11-07 No Snippets Fernandes KR, Zhang Y, Magri AMP, Renno ACM, van den Beucken JJJP.
Show Full Abstract

The purpose of this study was to evaluate the effects of surface properties of bone implants coated with hydroxyapatite (HA) and β-tricalcium phosphate (β-TCP) on platelets and macrophages upon implant installation and compare them to grit-blasted Ti and Thermanox used as a control. Surface properties were characterized using scanning electron microscopy, profilometry, crystallography, Fourier transform infrared spectroscopy, and coating stability. For platelets, platelet adherence and morphology were assessed. For macrophages, morphology, proliferation, and polarization were evaluated. Surface characterization showed similar roughness of ∼2.5 μm for grit-blasted Ti discs, both with and without coating. Coating stability assessment showed substantial dissolution of HA and β-TCP coatings. Platelet adherence was significantly higher for grit-blasted Ti, Ti-HA, and Ti-β-TCP coatings compared to that of cell culture control Thermanox. Macrophage cultures revealed a decreased proliferation on both HA and β-TCP coated discs compared to both Thermanox and grit-blasted Ti. In contrast, secretion of pro-inflammatory cytokine TNF-α and anti-inflammatory cytokine TGF-β were marginal for grit-blasted Ti and Thermanox, while a coating-dependent increased secretion of pro- and anti-inflammatory cytokines was observed for HA and β-TCP coatings. The results demonstrated a significantly upregulated pro-inflammatory and anti-inflammatory cytokine secretion and marker gene expression of macrophages on HA and β-TCP coatings. Furthermore, HA induced an earlier M1 macrophage polarization but more M2 phenotype potency than β-TCP. In conclusion, our data showed that material surface affects the behaviors of first cell types attached to implants. Due to the demonstrated crucial roles of platelets and macrophages in bone healing and implant integration, this information will greatly aid the design of metallic implants for a higher rate of success in patients.

Also flagged:AMPA receptorglycoproteinsfertilizationOlfm1synaptosomesPhosphorylation
Journal Article 2017-11-06 ✓ 1 Snippet Nakaya N, Sultana A, Tomarev SI.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The olfm1a and olfm1b genes in zebrafish encode conserved secreted glycoproteins. These genes are preferentially expressed in the brain and retina starting from 16 h post-fertilization until adulthood. Functions of the Olfm1 gene is still unclear. Here, we produced and analyzed a null zebrafish mutant of both olfm1a and olfm1b genes (olfm1 null). olfm1 null fish were born at a normal Mendelian ratio and showed normal body shape and fertility as well as no visible defects from larval stages to adult. Olfm1 proteins were preferentially localized in the synaptosomes of the adult brain. Olfm1 co-immunoprecipitated with GluR2 and soluble NSF attachment protein receptor complexes indicating participation of Olfm1 in both pre- and post-synaptic events. Phosphorylation of GluR2 was not changed while palmitoylation of GluR2 was decreased in the brain synaptosomal membrane fraction of olfm1 null compared with wt fish. The levels of GluR2, SNAP25, flotillin1, and VAMP2 were markedly reduced in the synaptic microdomain of olfm1 null brain compared with wt. The internalization of GluR2 in retinal cells and the localization of VAMP2 in brain synaptosome were modified by olfm1 null mutation. This indicates that Olfm1 may regulate receptor trafficking from the intracellular compartments to the synaptic membrane microdomain, partly through the alteration of post-translational GluR2 modifications such as palmitoylation. Olfm1 may be considered a novel regulator of the composition and function of the α-amino-3-hydroxy-5-methylisoxazole-4-propionate receptor complex.

Also flagged:tumor suppressor p53p63p73transcription factorsp53cell cycle arrest
Journal Article 2017-11-06 ✓ 1 Snippet Koyama R, Tamura M, Nakagaki T, Ohashi T, Idogawa M, Suzuki H, Tokino T, Sasaki Y.
In-Text Gene Mentions

…3 (mSds3 orSUDS3).…

Show Full Abstract

The tumor suppressor p53 and its family members, p63 and p73, play a pivotal role in the cell fate determination in response to diverse upstream signals. As transcription factors, p53 family proteins regulate a number of genes that are involved in cell cycle arrest, apoptosis, senescence, and maintenance of genomic stability. Recent studies revealed that p53 family proteins are important for the regulation of cell invasion and migration. Microarray analysis showed that breast cancer metastasis suppressor 1-like (BRMS1L) is upregulated by p53 family proteins, specifically p53, TAp63γ, and TAp73β. We identified two responsive elements of p53 family proteins in the first intron and upstream of BRMS1L. These response elements are well conserved among mammals. Functional analysis showed that ectopic expression of BRMS1L inhibited cancer cell invasion and migration; knockdown of BRMS1L by siRNA induced the opposite effect. Importantly, clinical databases revealed that reduced BRMS1L expression correlated with poor prognosis in patients with breast and brain cancer. Together, these results strongly indicate that BRMS1L is one of the mediators downstream of the p53 pathway, and that it inhibits cancer cell invasion and migration, which are essential steps in cancer metastasis. Collectively, our results indicate that BRMS1L is involved in cancer cell invasion and migration, and could be a therapeutic target for cancer.

Also flagged:age-related cognitive declineneurodegenerative diseasegene expressionneurodegenerative disordersagingcognition
Journal Article 2017-11-06 ✓ 1 Snippet Logan MA.
In-Text Gene Mentions

Htt

Show Full Abstract

Glial cells are essential for proper formation and maintenance of the nervous system. During development, glia keep neuronal cell numbers in check and ensure that mature neural circuits are appropriately sculpted by engulfing superfluous cells and projections. In the adult brain, glial cells offer metabolic sustenance and provide critical immune support in the face of acute and chronic challenges. Dysfunctional glial immune activity is believed to contribute to age-related cognitive decline, as well as neurodegenerative disease risk, but we still know surprisingly little about the specific molecular pathways that govern glia-neuron communication in the healthy or diseased brain. Drosophila offers a versatile in vivo model to explore the conserved molecular underpinnings of glial cell biology and glial cell contributions to brain function, health, and disease susceptibility. This review addresses recent findings describing how Drosophila glial cells influence neuronal activity in the adult fly brain to support optimal brain function and, importantly, highlights new insights into specific glial defects that may contribute to neuronal demise.

Also flagged:visiongene expressiontranscription factorsChromatinprimary ciliummechanoreceptors
Journal Article 2017-11-06 ✓ 3 Snippets Daum JM, Keles Ö, Holwerda SJ, Kohler H, Rijli FM, Stadler M, Roska B.
In-Text Gene Mentions

…Neurog2 21-fold, andPou3f2(also known as…

…of Neurog1 andPou3f2was low also…

…, Myt1l ,Pou3f2(also known as…

Show Full Abstract

High-resolution daylight vision is mediated by cone photoreceptors. The molecular program responsible for the formation of their light sensor, the outer segment, is not well understood. We correlated daily changes in ultrastructure and gene expression in postmitotic mouse cones, between birth and eye opening, using serial block-face electron microscopy (EM) and RNA sequencing. Outer segments appeared rapidly at postnatal day six and their appearance coincided with a switch in gene expression. The switch affected over 14% of all expressed genes. Genes that switched off were rich in transcription factors and neurogenic genes. Those that switched on contained genes relevant for cone function. Chromatin rearrangements in enhancer regions occurred before the switch was completed, but not after. We provide a resource comprised of correlated EM, RNAseq, and ATACseq data, showing that the growth of a key compartment of a postmitotic cell involves an extensive switch in gene expression and chromatin accessibility.

Also flagged:neurological disordersaddictionfibroblast growth factorsWingless-INTNotchneurogenesis
Journal Article 2017-11-06 No Snippets Roberson S, Halpern ME.
Show Full Abstract

Accumulating evidence has reinforced that the habenular region of the vertebrate dorsal forebrain is an essential integrating center, and a region strongly implicated in neurological disorders and addiction. Despite the important and diverse neuromodulatory roles the habenular nuclei play, their development has been understudied. The emphasis of this review is on the dorsal habenular nuclei of zebrafish, homologous to the medial nuclei of mammals, as recent work has revealed new information about the signaling pathways that regulate their formation. Additionally, the zebrafish dorsal habenulae have become a valuable model for probing how left-right differences are established in a vertebrate brain. Sonic hedgehog, fibroblast growth factors and Wingless-INT proteins are all involved in the generation of progenitor cells and ultimately, along with Notch signaling, influence habenular neurogenesis and left-right asymmetry. Intriguingly, a genetic network has emerged that leads to the differentiation of dorsal habenular neurons and, through localized chemokine signaling, directs the posterior outgrowth of their newly emerging axons towards their postsynaptic target, the midbrain interpeduncular nucleus.

Also flagged:heart muscle diseasessarcomericsarcomeric proteinsmyosinomecamtiv mecarbilOM
Journal Article 2017-11-06 No Snippets Hashem S, Tiberti M, Fornili A.
Show Full Abstract

New promising avenues for the pharmacological treatment of skeletal and heart muscle diseases rely on direct sarcomeric modulators, which are molecules that can directly bind to sarcomeric proteins and either inhibit or enhance their activity. A recent breakthrough has been the discovery of the myosin activator omecamtiv mecarbil (OM), which has been shown to increase the power output of the cardiac muscle and is currently in clinical trials for the treatment of heart failure. While the overall effect of OM on the mechano-chemical cycle of myosin is to increase the fraction of myosin molecules in the sarcomere that are strongly bound to actin, the molecular basis of its action is still not completely clear. We present here a Molecular Dynamics study of the motor domain of human cardiac myosin bound to OM, where the effects of the drug on the dynamical properties of the protein are investigated for the first time with atomistic resolution. We found that OM has a double effect on myosin dynamics, inducing a) an increased coupling of the motions of the converter and lever arm subdomains to the rest of the protein and b) a rewiring of the network of dynamic correlations, which produces preferential communication pathways between the OM binding site and distant functional regions. The location of the residues responsible for these effects suggests possible strategies for the future development of improved drugs and the targeting of specific cardiomyopathy-related mutations.

Also flagged:TGF-β1GARPtransmembrane proteincell receptortransductionbinding
Journal Article 2017-11-06 ✓ 1 Snippet Stockis J, Liénart S, Colau D, Collignon A, Nishimura SL, Sheppard D, Coulie PG, Lucas S.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Human regulatory T cells (Tregs) suppress other T cells by converting the latent, inactive form of TGF-β1 into active TGF-β1. In Tregs, TGF-β1 activation requires GARP, a transmembrane protein that binds and presents latent TGF-β1 on the surface of Tregs stimulated through their T cell receptor. However, GARP is not sufficient because transduction of GARP in non-Treg T cells does not induce active TGF-β1 production. RGD-binding integrins were shown to activate TGF-β1 in several non-T cell types. Here we show that αVβ8 dimers are present on stimulated human Tregs but not in other T cells, and that antibodies against αV or β8 subunits block TGF-β1 activation in vitro. We also show that αV and β8 interact with GARP/latent TGF-β1 complexes in human Tregs. Finally, a blocking antibody against β8 inhibited immunosuppression by human Tregs in a model of xenogeneic graft-vs.-host disease induced by the transfer of human T cells in immunodeficient mice. These results show that TGF-β1 activation on the surface of human Tregs implies an interaction between the integrin αVβ8 and GARP/latent TGF-β1 complexes. Immunosuppression by human Tregs can be inhibited by antibodies against GARP or against the integrin β8 subunit. Such antibodies may prove beneficial against cancer or chronic infections.

Also flagged:chromatinCTCFcohesinneurodevelopmental disordersmethylationhistone modifications
Journal Article 2017-11-06 No Snippets Davis L, Onn I, Elliott E.
Show Full Abstract

Recent genetic and technological advances have determined a role for chromatin structure in neurodevelopment. In particular, compounding evidence has established roles for CTCF and cohesin, two elements that are central in the establishment of chromatin structure, in proper neurodevelopment and in regulation of behavior. Genetic aberrations in CTCF, and in subunits of the cohesin complex, have been associated with neurodevelopmental disorders in human genetic studies, and subsequent animal studies have established definitive, although sometime opposing roles, for these factors in neurodevelopment and behavior. Considering the centrality of these factors in cellular processes in general, the mechanisms through which dysregulation of CTCF and cohesin leads specifically to neurological phenotypes is intriguing, although poorly understood. The connection between CTCF, cohesin, chromatin structure, and behavior is likely to be one of the next frontiers in our understanding of the development of behavior in general, and neurodevelopmental disorders in particular.

Also flagged:Irontype 1 diabetes mellitusimmune-mediated diseaseinsulinhuman leukocyte antigenHLA
Journal Article 2017-11-06 ✓ 4 Snippets Kyvsgaard JN, Overgaard AJ, Thorsen SU, Hansen TH, Pipper CB, Mortensen HB, Pociot F, Svensson J.
In-Text Gene Mentions

Mutations in the High Iron Fe (HFE) genes (C282Y or H63D), less frequent mutations in the genes coding for hepcidin, ferroportin, transferrin receptor 2 or hemojuvelin (HFE2) are causes of hemochromatosis, which are characterized by the increased absorption of iron [27,28].

…High Iron Fe (HFE) genes (C282Y or…

…are causes ofhemochromatosis, which are characterized…

…metabolism genes e.g.,HFE, HJV, BMP6, Slc39A14,…

Show Full Abstract

(1) Background: Iron requirement increases during pregnancy and iron supplementation is therefore recommended in many countries. However, excessive iron intake may lead to destruction of pancreatic β-cells. Therefore, we aim to test if higher neonatal iron content in blood is associated with the risk of developing type 1 diabetes mellitus (T1D) in childhood; (2) Methods: A case-control study was conducted, including 199 children diagnosed with T1D before the age of 16 years from 1991 to 2005 and 199 controls matched on date of birth. Information on confounders was available in 181 cases and 154 controls. Iron was measured on a neonatal single dried blood spot sample and was analyzed by laser ablation inductively coupled plasma mass spectrometry. Multivariate logistic regression was used to evaluate if iron content in whole blood was associated with the risk of T1D; (3) Results: A doubling of iron content increased the odds of developing T1D more than two-fold (odds ratio (95% CI), 2.55 (1.04; 6.24)). Iron content increased with maternal age (<i>p</i> = 0.04) and girls had higher content than boys (<i>p</i> = 0.01); (4) Conclusions: Higher neonatal iron content associates to an increased risk of developing T1D before the age of 16 years. Iron supplementation during early childhood needs further investigation, including the causes of high iron in neonates.

Also flagged:gene expressiontumordeoxyribonucleic acidimmune responsemelanomainfection
Journal Article 2017-11-06 No Snippets Ansel A, Rosenzweig JP, Zisman PD, Gesundheit B.
Show Full Abstract

With the recent success of oncolytic viruses in clinical trials, efforts toward improved monitoring of the viruses and their mechanism have intensified. Four main gene expression strategies have been employed to date including: analyzing overall gene expression in tumor cells, looking at gene expression of a few specific genes in the tumor cells, focusing on gene expression of specific transgenes introduced into the virus, and following gene expression of certain viral genes. Each strategy presents certain advantages and disadvantages over the others. Various methods to organize the dysregulated genes into clusters have provided a window into the mechanism of action for these viruses. Methodologically, the combined approach of looking at both overall gene expression, the tumor cells and gene expression of viral genes, enables researchers to assess correlation between the introduction of the virus and the changes in the tumor. This would seem to be the most productive approach for future studies, providing much information on mechanism and timing.

Also flagged:pathogen recognition receptorsmembranecytoplasmNucleic acidstype I interferonsIFN-I
Journal Article 2017-11-06 No Snippets Wang L, Ning S.
Show Full Abstract

Pathogen-associated molecular patterns (PAMPs) and damage-associated molecular patterns (DAMPs) are recognized by different cellular pathogen recognition receptors (PRRs), which are expressed on cell membrane or in the cytoplasm of cells of the innate immune system. Nucleic acids derived from pathogens or from certain cellular conditions represent a large category of PAMPs/DAMPs that trigger production of type I interferons (IFN-I) in addition to pro-inflammatory cytokines, by specifically binding to intracellular Toll-like receptors or cytosolic receptors. These cytosolic receptors, which are not related to TLRs and we call them "Toll-free" receptors, include the RNA-sensing RIG-I like receptors (RLRs), the DNA-sensing HIN200 family, and cGAS, amongst others. Viruses have evolved myriad strategies to evoke both host cellular and viral factors to evade IFN-I-mediated innate immune responses, to facilitate their infection, replication, and establishment of latency. This review outlines these "Toll-free" innate immune pathways and recent updates on their regulation, with focus on cellular and viral factors with enzyme activities.

Also flagged:iron deficiencyIDIronlocomotionnutritionalanemia
Journal Article 2017-11-06 No Snippets Santos DCC, Angulo-Barroso RM, Li M, Bian Y, Sturza J, Richards B, Lozoff B.
Show Full Abstract

<h4>Background/objectives</h4>Poorer motor development is reported in infants with iron deficiency (ID). The role of timing, duration and severity is unclear. We assessed relations between ID timing, duration, and severity and gross motor scores, neurological integrity, and motor behavior quality at 9 months.<h4>Subjects/methods</h4>Iron status was determined at birth and 9 months in otherwise healthy term Chinese infants. The 9-month motor evaluation included the Peabody Developmental Motor Scale (PDMS-2), Infant Neurological International Battery (INFANIB), and motor quality factor. Motor outcomes were analyzed by ID timing (fetal-neonatal, infancy), duration, and severity. For severity, we also considered maternal iron status.<h4>Results</h4>The data were available for 1194 infants. Iron status was classified as fetal-neonatal and infancy ID (n = 253), fetal-neonatal ID (n = 256), infancy ID (n = 288), and not ID (n = 397). Compared with not ID, infants with fetal-neonatal or infancy ID had lower locomotion scores (effect size ds = 0.19, 0.18) and those with ID in both periods (longer duration) had lower locomotion and overall PDMS-2 gross motor scores (ds = 0.20, 0.18); ID groups did not differ. More severe ID in late pregnancy was associated with lower INFANIB Vestibular function (p = 0.01), and total score (p = 0.03). More severe ID in infancy was associated with lower scores for locomotion (p = 0.03), overall gross motor (p = 0.05).<h4>Conclusions</h4>Fetal-neonatal and/or infancy ID was associated with lower overall gross motor development and locomotion test scores at 9 months. Associations with ID severity varied by ID timing: more severe ID in late pregnancy, poorer neurological integrity; more severe ID in infancy, poorer gross motor development.

Also flagged:NSCLCgene expressioncancermethylationcell cycleSIRT1
Journal Article 2017-11-06 No Snippets Gamerith G, Rainer J, Huber JM, Hackl H, Trajanoski Z, Koeck S, Lorenz E, Kern J, Kofler R, Kelm JM, Zwierzina H, Amann A.
Show Full Abstract

This work evaluated gene expression differences between a hanging-drop 3D NSCLC model and 2D cell cultures and their <i>in-vivo</i> relevance by comparison to patient-derived data from The Cancer Genome Atlas. Gene expression of 2D and 3D cultures for Colo699 and A549 were assessed using Affymetrix HuGene 1.0 ST gene chips. Biostatistical analyses tested for reproducibility, comparability and significant differences in gene expression profiles between cell lines, experiments and culture methods. The analyses revealed a high interassay correlation within specific culture systems proving a high validity. 979 genes were altered in A549 and 1106 in Colo699 cells due to 3D cultivation. The overlap of changed genes between the cell lines was small (149), but the involved pathways in the reactome and GO- analyses showed a high overlap with DNA methylation, cell cycle, SIRT1, PKN1 pathway, DNA repair and oxidative stress as well known cancer-associated representatives. Additional specific GSEA-analyses revealed changes in immunologic and endothelial cell proliferation pathways, whereas hypoxic, EMT and angiogenic pathways were downregulated. Gene enrichment analyses showed 3D-induced gene up-regulations in the cell lines 38 to be represented in <i>in-vivo</i> samples of NSCLC patients using data of The Cancer Genome Atlas. Thus, our 3D NSCLC model might provide a tool for early drug development and investigation of microenvironment-associated mechanisms. However, this work also highlights the need for further individualization and model adaption to address remaining challenges.

Also flagged:MICALtranslationalcytoskeletoncanceractin regulatory enzyme
Journal Article 2017-11-06 No Snippets Yoon J, Terman JR.
Show Full Abstract

MICAL Redox enzymes have recently emerged as direct regulators of cell shape and motility - working through specific reversible post-translational oxidation of actin to disassemble and remodel the cytoskeleton. Links are also now emerging between MICALs and cancer, including our recent results that regulation of MICAL sensitizes cancer cells to the cancer drug Gleevec. Targeting this new actin regulatory enzyme system may thus provide new therapeutic options for cancer treatment.

Also flagged:hyperthyrotropinemiaTransient hypothyroidismThyroid hormoneoligodendrocytemyelinationoligodendrocyte dysplasia
Journal Article 2017-11-06 No Snippets Hung PL, Lui CC, Lee CC, Chien YH, Chen FS, Chen CC, Yu HR, Chung MY, Huang LT.
Show Full Abstract

Transient hypothyroidism is common in premature infants and increases the risk of adverse neurodevelopmental outcomes. Thyroid hormone (TH) is involved in oligodendrocyte development and myelination, however, whether transient hypothyroidism is associated with oligodendrocyte dysplasia and abnormal myelination is unclear. The aim of the present study was to investigate correlations among TH levels, neurodevelopmental outcomes and white matter (WM) microstructure in premature infants. The authors designed a cohort study recruiting 81 premature infants (age, 23-35 weeks). A total of 17 were born with a gestational age (GA) <30 weeks (early preterm group) and 64 of them were born with a GA ≥30 weeks (late preterm group). For outcome measurement, thyroid stimulating hormone (TSH) levels at 0, 18, and 24 h of admission were measured. Neurodevelopmental outcomes were assessed using Bayley III test. Diffusion tensor imaging was used to explore the characterization of WM microstructure. The data demonstrated that GA, however not TSH level was associated with neurodevelopmental outcomes in the following 2 years. Fractional anisotrophy (FA) increased with TSH0 levels over anterior limb of internal capsule, while axial diffusivity decreased with TSH0 levels over splenium of corpus callosum (CC). The late preterm group had more intact WM integrity over the internal and external capsule (EC) in FA compared with the early preterm group. Infants with motor dysfunction had significantly increased mean diffusivity (MD) values at regions of interest in the genu and splenium of CC. The results of the present study demonstrated that GA, however not transient hypothyroidism influenced neurodevelopmental outcomes in the premature infants. FA increased with age in a regionally-specific manner over regions of the internal capsule and EC. MD may act as a potential predictor for motor function in premature babies.

Also flagged:Primary Osteoporosisosteoporosisidiopathic osteoporosisluciferaseWNTmineral
Journal Article 2017-11-06 ✓ 1 Snippet Collet C, Ostertag A, Ricquebourg M, Delecourt M, Tueur G, Isidor B, Guillot P, Schaefer E, Javier RM, Funck-Brentano T, Orcel P, Laplanche JL, Cohen-Solal M.
In-Text Gene Mentions

…, malabsorption, hypogonadism,hemochromatosis, hyperthyroidism, hypercortis…

Show Full Abstract

Genetic determinants contribute to osteoporosis and enhance the risk of fracture. Genomewide association studies of unselected population-based individuals or families have identified polymorphisms in several genes related to low bone density, but not in osteoporotic patients with <i>Z</i>-score < -2.0 SD with fragility fracture(s). The aim of this study was to determine the causal genes of idiopathic osteoporosis in the adulthood. Also, we used next-generation sequencing of candidate genes in a cohort of 123 young or middle-aged adults with idiopathic osteoporosis. All patients were included if they had a low bone mineral density (<i>Z</i>-score < -2 SD), a diagnosis before age 55 years (mean ± SD, 48.4 ± 10.6 years; mean ± SD age at first fracture, 30.4 ± 17.4 years) and fracture or not. We found that 11 patients carried rare or novel variants in <i>COL1A2</i> (<i>n</i> = 4), <i>PLS3</i> (<i>n</i> = 2), <i>WNT1</i> (<i>n</i> = 4), or <i>DKK1</i> (<i>n</i> = 1). We showed a high prevalence of pathogenic variants in <i>LRP5</i>: 22 patients (17.8%) had the p.Val667Met variant, including three at the homozygous level and 16 (13%) carrying a novel or very rare variant. Functional analysis revealed that the <i>LRP5</i> missense variants resulted in reduced luciferase activity, which indicates reduced activation of canonical WNT signaling. The clinical phenotype of patients carrying causal gene variants was indistinguishable. In conclusion, molecular screening of young osteoporotic adults revealed several variants and could be useful to characterize susceptibility genes for personalizing treatment, in particular for the new anabolic drugs.© 2017 The Authors. <i>JBMR Plus</i> is published by Wiley Periodicals, Inc. on behalf of the American Society for Bone and Mineral Research.

Also flagged:Acute kidney injuryacute tubular necrosisrenal hemosiderosishemolysisironsepsis
Journal Article 2017-11-05 ✓ 1 Snippet Larcher M, Delas A, Delmas C, Cointault O, Dambrin C, Del Bello A, Kamar N.
In-Text Gene Mentions

…as well ashemochromatosis.…

Show Full Abstract

Acute kidney injury (AKI) is often observed after heart transplantation. In this setting, acute tubular necrosis is the main histological finding on kidneys. We report the unusual pathology found in a kidney from a heart-transplant patient. The patient experienced several hemodynamic insults, massive transfusion, and implantation of a mechanical circulatory-support device before heart transplantation: there was prolonged AKI after transplantation. A kidney biopsy revealed acute tubular necrosis and renal hemosiderosis, which was probably related to the transfusion and to mechanical circulatory-support device-induced intravascular hemolysis. Assessment of iron during resuscitation could have prevented, at least partly, AKI.

Also flagged:LipidMajor DepressionIL-1 receptorIL-2 receptorIL-6 receptortumor necrosis factor receptor 60
Journal Article 2017-11-04 ✓ 1 Snippet Sowa-Kućma M, Styczeń K, Siwek M, Misztak P, Nowak RJ, Dudek D, Rybakowski JK, Nowak G, Maes M.
In-Text Gene Mentions

…iron deficiency, thalasemia,hemochromatosis, liver cirrhosis, Wilson’s…

Show Full Abstract

To examine immune-inflammatory and oxidative (I&O) biomarkers in major depression (MDD) and its related phenotypes, we recruited 114 well-phenotyped depressed patients and 50 healthy controls and measured serum levels of interleukin (IL)-1α, soluble IL-1 receptor antagonist (sIL-1RA), soluble IL-2 receptor (sIL-2R), soluble IL-6 receptor (sIL-6R), soluble tumor necrosis factor receptor 60 and 80 kDa (sTNF-R1/R2), and thiobarbituric acid reactive substances (TBARS). Obtained results indicate that MDD is characterized by increased sIL-1RA, sTNF-R1, and TBARS concentrations. Melancholic depression is associated with increased sIL-6R but lowered IL-1α levels. A current episode of depression is accompanied by significantly increased sIL-6R compared to the remitted state. Treatment-resistant depression (TRD) is accompanied by increased sIL-6R and TBARS but lowered sTNF-R2 levels compared to non-TRD patients. These immune markers are not significantly correlated with Hamilton Depression Rating Scale (HDRS), Montgomery-Asberg Depression Scale (MADRS), number episodes, or age at onset. Our findings show that increased sIL-1RA, sTNF-R1, and TBARS levels may be trait markers of depression, while increased sIL-6R levels may be a state marker of melancholia and an acute phase of depression. MDD is accompanied by increased lipid peroxidation and simultaneous activation of immune pathways, and the compensatory anti-inflammatory reflex system (CIRS). TRD is characterized by highly increased oxidative stress and probably increased TNFα and IL-6 trans-signalling. Novel treatments for major depression should target oxidative stress pathways, while new treatments for TRD should primary target lipid peroxidation and also activated immune-inflammatory pathways.

Also flagged:nicomethanol hydrofluorideapatitemineralfluoridessodiumfluoride
Journal Article 2017-11-04 No Snippets Sharkov N.
Show Full Abstract

<h4>Aim</h4>To analyse the anti-caries properties of nicomethanol hydrofluoride (NH) and the benefit of its combination with siliglycol, a coating agent.<h4>Methods</h4>Fluoride (F) uptake by dental enamel and synthetic apatite treated with NH was measured in vitro and compared to treatment with mineral fluorides. The addition of siliglycol was also tested. The effect of NH (as a mouthwash) on salivary pH was also investigated in healthy human subjects and compared to the effect of a placebo and of nicomethanol alone.<h4>Results</h4>In vitro experiments showed a greater and faster F uptake on dental enamel or synthetic apatite treated with NH compared to sodium fluoride. F uptake was improved further by the addition of siliglycol. In healthy human subjects, pH reduction was strongly inhibited 5 min after two mouthrinses with NH. This effect was less pronounced but still statistically significant at 15 and 30 min (p < 0.05).<h4>Conclusions</h4>NH was able to promote the fixation of F ions and strengthen the dental structure. Its combination with siliglycol further improved F uptake by the tooth and the control/inhibition of dental biofilm development.

Also flagged:mineralcarbohydratewaterMineralsMicronutrient deficiencynitrogen
Journal Article 2017-11-04 No Snippets Omohimi CI, Piccirillo C, Roriz M, Ferraro V, Vasconcelos MW, Sanni LO, Tomlins K, Pintado MM, Abayomi LA.
Show Full Abstract

Yam (<i>Dioscorea</i> spp) is an essential tuber crop for hundreds of millions of people in many African, Asian and South American countries. Considering in particular Southwest Nigeria, chips, flakes and flours are amongst the most common shelf-stable traditionally-processed yam products. This paper reports a systematic study on the proximate (moisture, protein, carbohydrate, fibre, fat, ash and gross energy) and mineral composition of these three food commodities sold in Nigerian markets. Results showed no significant differences in the moisture, crude protein and fibre content of all samples (10.0-12.3, 2.7-4.3 and 1.3-2.0 wt%, respectively). Gross energy was also comparable for all yam derived food items (between 3300 and 3507 kcal/kg), contradicting the common belief that yam flakes have lower nutritional value than chips and flours. Considering the mineral composition, Ca, Mg, P and K were the predominant macronutrients. Micronutrients such as Zn, Co, Mn and Cu were also detected. Significant differences existed between products, and their various sources (markets). Principal component analysis showed a direct correlation between ash content of the samples and the assessed macronutrients, irrespective of the market, or the seller of the commodities. This study confirmed that yam derived food stuffs have an adequate nutritional composition, irrespective of their form and/or origin.

Also flagged:oxygentumorinnervationhydroxyapatitebeta-tricalcium phosphatecalcium phosphate
Journal Article 2017-11-04 No Snippets Marrella A, Marrella A, Lee TY, Lee DH, Karuthedom S, Syla D, Chawla A, Khademhosseini A, Jang HL.
Show Full Abstract

Blood vessels and nerve fibers are distributed throughout the entirety of skeletal tissue, and play important roles during bone development and fracture healing by supplying oxygen, nutrients, and cells. However, despite the successful development of bone mimetic materials that can replace damaged bone from a structural point of view, most of the available bone biomaterials often do not induce sufficient formation of blood vessels and nerves. In part, this is due to the difficulty of integrating and regulating multiple tissue types within artificial materials, which causes a gap between native skeletal tissue. Therefore, understanding the anatomy and underlying interaction mechanisms of blood vessels and nerve fibers in skeletal tissue is important to develop biomaterials that can recapitulate its complex microenvironment. In this perspective, we highlight the structure and osteogenic functions of the vascular and nervous system in bone, in a coupled manner. In addition, we discuss important design criteria for engineering vascularized, innervated, and neurovascularized bone implant materials, as well as recent advances in the development of such biomaterials. We expect that bone implant materials with neurovascularized networks can more accurately mimic native skeletal tissue and improve the regeneration of bone tissue.

Also flagged:ProcollagenMatrix MetalloproteinasesTGF-βSmadMAPKAP-1
Journal Article 2017-11-03 No Snippets Gao W, Lin P, Hwang E, Wang Y, Yan Z, Ngo HTT, Yi TH.
Show Full Abstract

Ultraviolet light-induced reactive oxygen species (ROS) damage human skin and prematurely cause aging. A growing body of research is focusing on considering plants and plant-derived compounds as antiphotoaging therapeutic material. Pterocarpus santalinus L., as an Indian traditional medicine, possesses antidiabetic, anti-inflammatory and antioxidative effects. Here, we studied the antiphotoaging effects of ethanolic extract of P. santalinus L. heartwood (EPS) on ultraviolet radiation B (UVB)-irradiated normal human dermal fibroblasts (NHDFs). Results showed that EPS significantly inhibited the upregulation of matrix metalloproteinases and IL-6 caused by UVB irradiation, and suppressed UVB-induced phosphorylation of extracellular signal-regulated kinase, Jun N-terminal kinase and p38, as well as the activation of AP-1 transcription factors. Further study indicated that UVB-induced production of MMP-1 and IL-6 could be inhibited by PD 98059 (an ERK inhibitor) and SP600125 (A JNK inhibitor), implied that EPS inhibited UVB-induced MMP-1 and IL-6 secretion by inactivating MAPK signaling pathway. In addition, EPS possessed an excellent antioxidant activity, which could increase cytoprotective antioxidants such as HO-1, NQ-O1 expression by facilitating the nuclear accumulation of Nrf2. Treatment of NHDFs with EPS also recovered UVB-induced procollagen type I reduction by activating TGF-β/Smad pathway. These findings demonstrated that EPS had a potential effect against UVB-induced skin photoaging.

Also flagged:Nucleosidediphosphatenucleoside triphosphatemembranepronucleotidenucleoside monophosphates
Journal Article 2017-11-03 No Snippets Meier C.
Show Full Abstract

In this review, our recent advances in the development of nucleoside di- and nucleoside triphosphate prodrugs is summarized. Previously, we had developed a successful membrane-permeable pronucleotide system for the intracellular delivery of nucleoside monophosphates as well, the so-called cycloSal-approach. In contrast to that work in which the delivery is initiated by a chemically driven hydrolysis reaction, for the di- and triphosphate delivery, an enzymatic trigger mechanism involving (carboxy)esterases had to be used. The other features of the new pronucleotide approaches are: (i) lipophilic modification was restricted to the terminal phosphate group leaving charges at the internal phosphate moieties and (ii) appropriate lipophilicity is introduced by long aliphatic residues within the bipartite prodrug moiety. The conceptional design of the di- and triphosphate prodrug systems will be described and the chemical synthesis, the hydrolysis properties, a structure-activity relationship and antiviral activity data will be discussed as well. The advantage of these new approaches is that all phosphorylation steps from the nucleoside analogue into the bioactive nucleoside triphosphate form can be bypassed in the case of the triphosphate prodrugs. Moreover, enzymatic processes like the deamination of nucleosides or nucleoside monophosphates which lead to catabolic clearance of the potential antivirally active compound can be avoided by the delivery of the higher phosphorylated nucleotides.

Also flagged:titaniumosteoarthritisjoint disorderhip osteoarthritisporeosteoporosis
Journal Article 2017-11-03 ✓ 1 Snippet Apostu D, Lucaciu O, Berce C, Lucaciu D, Cosma D.
In-Text Gene Mentions

…a serotonin transporter (5-HTT) on bone cells…

Show Full Abstract

Hip osteoarthritis is the most common joint disorder, and is represented by a degenerative process, resulting in pain and functional impairment. If conservative treatment for hip osteoarthritis fails, the only remaining option is hip arthroplasty. Despite good survival of implants, loosening of components is the most common complication. This leads to revision surgeries, which are technically demanding, expensive, and result in a low satisfaction rate. Uncemented hip replacements require proper osseointegration for increased survival. Physical characteristics of implants include biocompatibility, Young's modulus of elasticity, strength, and corrosion resistance, and each influence fixation of implants. Moreover, implant surface treatments, pore size, pore density, and femoral stem design should be appropriately selected. Patients' optimization of obesity, osteoporosis, cardiovascular disease, psychotic disorders, and smoking cessation are associated with a higher survival of implants. Surgical factors, such as approach, drilling and rasping, acetabular bone coverage, acetabular cup positioning, and implant size, also affect survival of implants. Avoiding drugs, which may impair osseointegration of implants, and having an appropriate rehabilitation protocol are important. Future directions include anabolic and anti-catabolic bone-acting drugs to enhance osseointegration of implants. Comprehensive knowledge of the factors mentioned above is important for preventing aseptic loosening, with important socioeconomic consequences.

Also flagged:pathogenesisexostosesMultiple hereditary exostoseshereditary multiple exostosesmultiple osteochondromasosteochondromas
Journal Article 2017-11-03 No Snippets Phan AQ, Pacifici M, Esko JD.
Show Full Abstract

Multiple hereditary exostoses (MHE) is an autosomal dominant disorder that affects about 1 in 50,000 children worldwide. MHE, also known as hereditary multiple exostoses (HME) or multiple osteochondromas (MO), is characterized by cartilage-capped outgrowths called osteochondromas that develop adjacent to the growth plates of skeletal elements in young patients. These benign tumors can affect growth plate function, leading to skeletal growth retardation, or deformations, and can encroach on nerves, tendons, muscles, and other surrounding tissues and cause motion impairment, chronic pain, and early onset osteoarthritis. In about 2-5% of patients, the osteochondromas can become malignant and life threatening. Current treatments consist of surgical removal of the most symptomatic tumors and correction of the major skeletal defects, but physical difficulties and chronic pain usually continue and patients may undergo multiple surgeries throughout life. Thus, there is an urgent need to find new treatments to prevent or reverse osteochondroma formation. The 2016 International MHE Research Conference was convened to provide a forum for the presentation of the most up-to-date and advanced clinical and basic science data and insights in MHE and related fields; to stimulate the forging of new perspectives, collaborations, and venues of research; and to publicize key scientific findings within the biomedical research community and share insights and relevant information with MHE patients and their families. This report provides a description, review, and assessment of all the exciting and promising studies presented at the Conference and delineates a general roadmap for future MHE research targets and goals.

Also flagged:RNA-binding proteinsneuroblastomapenicillinstreptomycinbasic fibroblast growth factorbFGF
Journal Article 2017-11-03 ✓ 5 Snippets Oh Y, Park J, Kim JI, Chang MY, Lee SH, Cho YH, Hwang J.
In-Text Gene Mentions

In support of this finding, regulation of STAU1 expression in mouse neural precursor cells had the same effects on neuronal differentiation as it did in human neuroblastoma cells.

…Staufen1 (STAU1) and Lin28B are…

STAU1triggers post-transcriptional …

…the connection betweenSTAU1and Lin28B and…

…the abundance ofSTAU1mRNA via miRNA…

Show Full Abstract

Staufen1 (STAU1) and Lin28B are RNA-binding proteins that are involved in neuronal differentiation as a function of post-transcriptional regulation. STAU1 triggers post-transcriptional regulation, including mRNA export, mRNA relocation, translation and mRNA decay. Lin28B also has multiple functions in miRNA biogenesis and the regulation of translation. Here, we examined the connection between STAU1 and Lin28B and found that Lin28B regulates the abundance of STAU1 mRNA via miRNA maturation. Decreases in the expression of both STAU1 and Lin28B were observed during neuronal differentiation. Depletion of STAU1 or Lin28B inhibited neuronal differentiation, and overexpression of STAU1 or Lin28B enhanced neuronal differentiation. Interestingly, the stability of STAU1 mRNA was modulated by miR-142-3p, whose maturation was regulated by Lin28B. Thus, miR-142-3p expression increased as Lin28B expression decreased during differentiation, leading to the reduction of STAU1 expression. The transcriptome from Staufen-mediated mRNA decay (SMD) targets during differentiation was analyzed, confirming that STAU1 was a key factor in neuronal differentiation. In support of this finding, regulation of STAU1 expression in mouse neural precursor cells had the same effects on neuronal differentiation as it did in human neuroblastoma cells. These results revealed the collaboration of two RNA-binding proteins, STAU1 and Lin28B, as a regulatory mechanism in neuronal differentiation.

Also flagged:Breast Cancercancertumorhuman epidermal growth factor receptor 2progesterone receptorPR
Journal Article 2017-11-03 ✓ 1 Snippet Collette J, Le Bourhis X, Adriaenssens E.
In-Text Gene Mentions

…transcriptional factor orchromatin modifiermodifier protein to…

Show Full Abstract

Breast cancer is one of the most common causes of cancer related deaths in women. Despite the progress in early detection and use of new therapeutic targets associated with development of novel therapeutic options, breast cancer remains a major problem in public health. Indeed, even if the survival rate has improved for breast cancer patients, the number of recurrences within five years and the five-year relative survival rate in patients with metastasis remain dramatic. Thus, the discovery of new molecular actors involved in breast progression is essential to improve the management of this disease. Numerous data indicate that long non-coding RNA are implicated in breast cancer development. The oncofetal lncRNA <i>H19</i> was the first RNA identified as a riboregulator. Studying of this lncRNA revealed its implication in both normal development and diseases. In this review, we summarize the different mechanisms of action of <i>H19</i> in human breast cancer.

Also flagged:transcription factorsproteasesrhythmsovipositioninfectioncircadian rhythms
Journal Article 2017-11-03 No Snippets de Bekker C, Will I, Hughes DP, Brachmann A, Merrow M.
Show Full Abstract

Various parasite-host interactions that involve adaptive manipulation of host behavior display time-of-day synchronization of certain events. One example is the manipulated biting behavior observed in Carpenter ants infected with Ophiocordyceps unilateralis sensu lato. We hypothesized that biological clocks play an important role in this and other parasite-host interactions. In order to identify candidate molecular clock components, we used two general strategies: bioinformatics and transcriptional profiling. The bioinformatics approach was used to identify putative homologs of known clock genes. For transcriptional profiling, RNA-Seq was performed on 48 h time courses of Ophiocordyceps kimflemingiae (a recently named species of the O. unilateralis complex), whose genome has recently been sequenced. Fungal blastospores were entrained in liquid media under 24 h light-dark (LD) cycles and were harvested at 4 h intervals either under LD or continuous darkness. Of all O. kimflemingiae genes, 5.3% had rhythmic mRNAs under these conditions (JTK Cycle, ≤ 0.057 statistical cutoff). Our data further indicates that a significant number of transcription factors have a peaked activity during the light phase (day time). The expression levels of a significant number of secreted enzymes, proteases, toxins and small bioactive compounds peaked during the dark phase or subjective night. These findings support a model whereby this fungal parasite uses its biological clock for phase-specific activity. We further suggest that this may be a general mechanism involved in parasite-host interactions.

Also flagged:FerroportinFerroportin DiseaseFDiron loading disorderhyperferritinemiaFPN1
Journal Article 2017-11-03 ✓ 5 Snippets Pietrangelo A.
In-Text Gene Mentions

Over the past decades, the term hemochromatosis has been inconsistently used in the literature and in clinical practice to imprecisely refer to: i) any form of body iron overload; ii) tissue iron overload causing organ damage and disease; iii) genetically determined iron overload; and, recently, iv) HFE-related iron overload.11 Recent discoveries in the field have shown that, regardless of the underlying genetic defect, a number of hereditary iron loading disorders (i.e. those due to loss-of-function mutations of HFE, TfR2, HJV, HAMP and gain-of-function mutations of FPN1) belong to the same syndromic entity as they share the pathogenic basis (lack of hepcidin function-activity), biochemical expressivity (high transferrin saturation and high serum ferritin), liver pathology features (iron accumulation in parenchymal cells with iron-spared Kupffer cells until late stage), damage and disease of distinct target organs (liver, heart, endocrine glands, joints), and the therapeutic approach with optimal response to phlebotomy.11 As discussed in the following sections, each individual feature reported above is different in classic FD.1 Therefore, using the term “hemochromatosis” for the classic FD or the term “Ferroportin Disease” for FPN1-associated HC, is misleading, particularly for clinicians, since clinical suspicion, diagnostic strategy and management differ profoundly.

At liver histology, parenchymal cells of these organs are largely spared (Figure 3), but discrete hepatocytic iron deposits are also appreciable, due to defective FPN1 activity in hepatocytes, even at early stages.16 Clinical presentation appears heterogeneous, but overall expressivity is milder than classic HC, and the associated liver disease is usually not as severe (Table 2 and Figure 3).1,16,17,56 As occurs in classic forms of HFE HC, also in the FD host factors (menses, blood loss, etc.), co-inheritance of mutations of other iron-genes or variants in genes associated to antioxidant defense and organ fibrosis, and associated pathological conditions (metabolic syndrome, viral hepatitis, etc.)may all affect the phenotype.

The pathogenic, biochemical and clinical signatures of FD are symmetrical and opposite to HFE and non HFE-HH: normal/sufficient enterocyte iron absorption, marked iron accumulation in non parenchymal cells in the FD versus increased iron absorption and marked iron accumulation in parenchymal cells in HH; hyperferritinemia with normal/low transferrin saturation in FD versus hyperferritinemia and high transferrin saturation in HH; intolerance to aggressive phlebotomy regimens in FD versus optimal response to intense phlebotomy in HH; mild and benign clinical course in FD versus potentially severe clinical expressivity in HH; vertical hereditary transmission and presentation at each generation of FD versus recessive transmission of most forms of HH (except FPN1-HH).

…due to eitherHFEor TfR2 ,…

…iron overload, includinghemochromatosis(HC) [synonymous for…

Show Full Abstract

Ferroportin Disease (FD) is an autosomal dominant hereditary iron loading disorder associated with heterozygote mutations of the ferroportin-1 (<i>FPN</i>) gene. It represents one of the commonest causes of genetic hyperferritinemia, regardless of ethnicity. FPN1 transfers iron from the intestine, macrophages and placenta into the bloodstream. In FD, loss-of-function mutations of FPN1 limit but do not impair iron export in enterocytes, but they do severely affect iron transfer in macrophages. This leads to progressive and preferential iron trapping in tissue macrophages, reduced iron release to serum transferrin (i.e. inappropriately low transferrin saturation) and a tendency towards anemia at menarche or after intense bloodletting. The hallmark of FD is marked iron accumulation in hepatic Kupffer cells. Numerous FD-associated mutations have been reported worldwide, with a few occurring in different populations and some more commonly reported (e.g. Val192del, A77D, and G80S). FPN1 polymorphisms also represent the gene variants most commonly responsible for hyperferritinemia in Africans. Differential diagnosis includes mainly hereditary hemochromatosis, the syndrome commonly due to either <i>HFE</i> or <i>TfR2</i>, <i>HJV</i>, <i>HAMP</i>, and, in rare instances, <i>FPN1</i> itself. Here, unlike FD, hyperferritinemia associates with high transferrin saturation, iron-spared macrophages, and progressive parenchymal cell iron load. Abdominal magnetic resonance imaging (MRI), the key non-invasive diagnostic tool for the diagnosis of FD, shows the characteristic iron loading SSL triad (spleen, spine and liver). A non-aggressive phlebotomy regimen is recommended, with careful monitoring of transferrin saturation and hemoglobin due to the risk of anemia. Family screening is mandatory since siblings and offspring have a 50% chance of carrying the pathogenic mutation.

Also flagged:liver cancerliver cancersalcoholCTNNB1tumoraflatoxin B1
Journal Article 2017-11-03 ✓ 3 Snippets Letouzé E, Shinde J, Renault V, Couchy G, Blanc JF, Tubacher E, Bayard Q, Bacq D, Meyer V, Semhoun J, Bioulac-Sage P, Prévôt S, Azoulay D, Paradis V, Imbeaud S, Deleuze JF, Zucman-Rossi J.
In-Text Gene Mentions

…intake, HCV, HBV,hemochromatosisand metabolic syndrome.…

…n = 7),hemochromatosis( n =…

…metabolic syndrome andhemochromatosiswere poorly represented.…

Show Full Abstract

Genomic alterations driving tumorigenesis result from the interaction of environmental exposures and endogenous cellular processes. With a diversity of risk factors, liver cancer is an ideal model to study these interactions. Here, we analyze the whole genomes of 44 new and 264 published liver cancers and we identify 10 mutational and 6 structural rearrangement signatures showing distinct relationships with environmental exposures, replication, transcription, and driver genes. The liver cancer-specific signature 16, associated with alcohol, displays a unique feature of transcription-coupled damage and is the main source of CTNNB1 mutations. Flood of insertions/deletions (indels) are identified in very highly expressed hepato-specific genes, likely resulting from replication-transcription collisions. Reconstruction of sub-clonal architecture reveals mutational signature evolution during tumor development exemplified by the vanishing of aflatoxin B1 signature in African migrants. Finally, chromosome duplications occur late and may represent rate-limiting events in tumorigenesis. These findings shed new light on the natural history of liver cancers.

Also flagged:OxoguanineDNA GlycosylaseDNA glycosylasesgene expression8-oxoguanine DNA glycosylase 1Ogg1
Journal Article 2017-11-03 ✓ 1 Snippet Hofer T, Duale N, Muusse M, Eide DM, Dahl H, Boix F, Andersen JM, Olsen AK, Myhre O.
In-Text Gene Mentions

…3 (Adrb1, Il1b,Prdx6) out of in…

Show Full Abstract

Environmental stressors inducing oxidative stress such as ionizing radiation may influence cognitive function and neuronal plasticity. Recent studies have shown that transgenic mice deficient of DNA glycosylases display unexpected cognitive deficiencies related to changes in gene expression in the hippocampus. The main objectives of the present study were to determine learning and memory performance in C57BL/6NTac 8-oxoguanine DNA glycosylase 1 (Ogg1)<sup>+/-</sup> (heterozygote) and Ogg1<sup>+/+</sup> (wild type, WT) mice, to study whether a single acute X-ray challenge (0.5 Gy, dose rate 0.457 Gy/min) influenced the cognitive performance in the Barnes maze, and if such differences were related to changes in gene expression levels in the hippocampus. We found that the Ogg1<sup>+/-</sup> mice exhibited poorer early-phase learning performance compared to the WT mice. Surprisingly, X-ray exposure of the Ogg1<sup>+/-</sup> animals improved their early-phase learning performance. No persistent effects on memory in the late-phase (6 weeks after irradiation) were observed. Our results further suggest that expression of 3 (Adrb1, Il1b, Prdx6) out of in total 35 genes investigated in the Ogg1<sup>+/-</sup> hippocampus is correlated to spatial learning in the Barnes maze.

Also flagged:Seasonal Affective DisorderSADMajor Depressive Disorderdepressionhypersomniacarbohydrate
Journal Article 2017-11-03 ✓ 5 Snippets Nørgaard M, Ganz M, Svarer C, Fisher PM, Churchill NW, Beliveau V, Grady C, Strother SC, Knudsen GM.
In-Text Gene Mentions

The role of the 5-HTT is to recycle serotonin back into the presynaptic neuron, thereby inactivating synaptic serotonin function (Kalbitzer et al., 2010; McMahon et al., 2016).

However, the expression and function of 5-HTT in the re-uptake of serotonin is dynamically controlled, and there exist two hypotheses related to the neuroplasticity or potentiation of 5-HTT; the first hypothesis (H1) supports that 5-HT might control its own reuptake, since elevated levels of 5-HT have been proven to limit the internalization of 5-HTT, consequently suggesting that low 5-HT concentrations result in a 5-HTT downregulation (Milak et al., 2005).

The mechanism by which 5-HTT adjustments cause SAD, has mainly been attributed to a seasonal dysregulation of 5-HTTs (McMahon et al., 2016; Tyrer et al., 2016) which are localized on the presynaptic terminal, ensuring that extracellular serotonin is inactivated and recycled into the presynaptic neuron.

SSRIs block the reuptake of serotonin, thereby increasing extracellular serotonin concentration, and reducing 5-HTT expression on the presynaptic cell membrane (Horschitz et al., 2001).

…rebral serotonin transporter (5-HTT) in winter, and…

Show Full Abstract

<b>Background:</b> Seasonal Affective Disorder (SAD) is a subtype of Major Depressive Disorder characterized by seasonally occurring depression that often presents with atypical vegetative symptoms such as hypersomnia and carbohydrate craving. It has recently been shown that unlike healthy people, patients with SAD fail to globally downregulate their cerebral serotonin transporter (5-HTT) in winter, and that this effect seemed to be particularly pronounced in female S-carriers of the 5-HTTLPR genotype. The purpose of this study was to identify a 5-HTT brain network that accounts for the adaption to the environmental stressor of winter in females with the short 5-HTTLPR genotype, a specific subgroup previously reported to be at increased risk for developing SAD. <b>Methods:</b> Nineteen females, either S' carriers (L<sub>G</sub>- and S-carriers) without SAD (<i>N</i> = 13, mean age 23.6 ± 3.2 year, range 19-28) or S' carriers with SAD (<i>N</i> = 6, mean age 23.7 ± 2.4, range 21-26) were PET-scanned with [<sup>11</sup>C]DASB during both summer and winter seasons (asymptomatic and symptomatic phase, 38 scans in total) in randomized order, defined as a 12-week interval centered on summer or winter solstice. We used a multivariate Partial Least Squares (PLS) approach with NPAIRS split-half cross-validation, to identify and map a whole-brain pattern of 5-HTT levels that distinguished the brains of females without SAD from females suffering from SAD. <b>Results:</b> We identified a pattern of 5-HTT levels, distinguishing females with SAD from those without SAD; it included the right superior frontal gyrus, brainstem, globus pallidus (bilaterally) and the left hippocampus. Across seasons, female S' carriers without SAD showed nominally higher 5-HTT levels in these regions compared to female S' carriers with SAD, but the group difference was only significant in the winter. Female S' carriers with SAD, in turn, displayed robustly increased 5-HTT levels in the ventral striatum (bilaterally), right orbitofrontal cortex, middle frontal gyrus (bilaterally), extending to the left supramarginal gyrus, left precentral gyrus and left postcentral gyrus during winter compared to female S' carriers without SAD. <b>Limitations:</b> The study is preliminary and limited by small sample size in the SAD group (<i>N</i> = 6). <b>Conclusions:</b> These findings provide novel exploratory evidence for a wintertime state-dependent difference in 5-HTT levels that may leave SAD females with the short 5-HTTLPR genotype more vulnerable to persistent stressors like winter. The affected brain regions comprise a distributed set of areas responsive to emotion, voluntary, and planned movement, executive function, and memory. The preliminary findings provide additional insight into the neurobiological components through which the anatomical distribution of serotonergic discrepancies between individuals genetically predisposed to SAD, but with different phenotypic presentations during the environmental stressor of winter, may constitute a potential biomarker for resilience against developing SAD.

Also flagged:Huntington Diseaseneurodegenerative disorderHDbehavioralcircadian rhythmicityautosomal dominant neurological disorder
Journal Article 2017-11-03 ✓ 3 Snippets Manfré G, Clemensson EKH, Kyriakou EI, Clemensson LE, van der Harst JE, Homberg JR, Nguyen HP.
In-Text Gene Mentions

…the huntingtin (HTT) gene (Huntington’s…

…the mutant humanHTTgene, under the…

…of the humanHTTpromoter and its…

Show Full Abstract

<b>Rationale</b>: Huntington disease (HD) is a progressive neurodegenerative disorder characterized by motor, cognitive and neuropsychiatric symptoms. HD is usually diagnosed by the appearance of motor deficits, resulting in skilled hand use disruption, gait abnormality, muscle wasting and choreatic movements. The BACHD transgenic rat model for HD represents a well-established transgenic rodent model of HD, offering the prospect of an in-depth characterization of the motor phenotype. <b>Objective</b>: The present study aims to characterize different aspects of motor function in BACHD rats, combining classical paradigms with novel high-throughput behavioral phenotyping. <b>Methods</b>: Wild-type (WT) and transgenic animals were tested longitudinally from 2 to 12 months of age. To measure fine motor control, rats were challenged with the pasta handling test and the pellet reaching test. To evaluate gross motor function, animals were assessed by using the holding bar and the grip strength tests. Spontaneous locomotor activity and circadian rhythmicity were assessed in an automated home-cage environment, namely the PhenoTyper. We then integrated existing classical methodologies to test motor function with automated home-cage assessment of motor performance. <b>Results</b>: BACHD rats showed strong impairment in muscle endurance at 2 months of age. Altered circadian rhythmicity and locomotor activity were observed in transgenic animals. On the other hand, reaching behavior, forepaw dexterity and muscle strength were unaffected. <b>Conclusions</b>: The BACHD rat model exhibits certain features of HD patients, like muscle weakness and changes in circadian behavior. We have observed modest but clear-cut deficits in distinct motor phenotypes, thus confirming the validity of this transgenic rat model for treatment and drug discovery purposes.

Also flagged:intestinal diseasecollagenShort-chain fatty acidsbutyratecell proliferationinterferon-γ
Journal Article 2017-11-03 ✓ 4 Snippets Wang Y, Kim R, Gunasekara DB, Reed MI, DiSalvo M, Nguyen DL, Bultman SJ, Sims CE, Magness ST, Allbritton NL.
In-Text Gene Mentions

…antibodies to olfactomedin-4 (Olfm4) (1:500, 14369; Cell…

…rative stem/progenitor cells (Olfm4+ ) are…

…(EdU + ,Olfm4+ ), with…

…colonic stem cells (Olfm4+ ) were…

Show Full Abstract

<h4>Background & aims</h4>The successful culture of intestinal organoids has greatly enhanced our understanding of intestinal stem cell physiology and enabled the generation of novel intestinal disease models. Although of tremendous value, intestinal organoid culture systems have not yet fully recapitulated the anatomy or physiology of the in vivo intestinal epithelium. The aim of this work was to re-create an intestinal epithelium with a high density of polarized crypts that respond in a physiologic manner to addition of growth factors, metabolites, or cytokines to the basal or luminal tissue surface as occurs in vivo.<h4>Methods</h4>A self-renewing monolayer of human intestinal epithelium was cultured on a collagen scaffold microfabricated with an array of crypt-like invaginations. Placement of chemical factors in either the fluid reservoir below or above the cell-covered scaffolding created a gradient of that chemical across the growing epithelial tissue possessing the in vitro crypt structures. Crypt polarization (size of the stem/proliferative and differentiated cell zones) was assessed in response to gradients of growth factors, cytokines, and bacterial metabolites.<h4>Results</h4>Chemical gradients applied to the shaped human epithelium re-created the stem/proliferative and differentiated cell zones of the in vivo intestine. Short-chain fatty acids applied as a gradient from the luminal side confirmed long-standing hypotheses that butyrate diminished stem/progenitor cell proliferation and promoted differentiation into absorptive colonocytes. A gradient of interferon-γ and tumor necrosis factor-α significantly suppressed the stem/progenitor cell proliferation, altering crypt formation.<h4>Conclusions</h4>The in vitro human colon crypt array accurately mimicked the architecture, luminal accessibility, tissue polarity, cell migration, and cellular responses of in vivo intestinal crypts.

Also flagged:Tetrahydrocannabinolic acidPPARγphytocannabinoidsbindingneuroblastomaHuntington's disease
Journal Article 2017-11-02 ✓ 1 Snippet Nadal X, Del Río C, Casano S, Palomares B, Ferreiro-Vera C, Navarrete C, Sánchez-Carnerero C, Cantarero I, Bellido ML, Meyer S, Morello G, Appendino G, Muñoz E.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Background and purpose</h4>Phytocannabinoids are produced in Cannabis sativa L. in acidic form and are decarboxylated upon heating, processing and storage. While the biological effects of decarboxylated cannabinoids such as Δ<sup>9</sup> -tetrahydrocannabinol have been extensively investigated, the bioactivity of Δ<sup>9</sup> -tetahydrocannabinol acid (Δ<sup>9</sup> -THCA) is largely unknown, despite its occurrence in different Cannabis preparations. Here we have assessed possible neuroprotective actions of Δ<sup>9</sup> -THCA through modulation of PPARγ pathways.<h4>Experimental approach</h4>The effects of six phytocannabinoids on PPARγ binding and transcriptional activity were investigated. The effect of Δ<sup>9</sup> -THCA on mitochondrial biogenesis and PPARγ coactivator 1-α expression was investigated in Neuro-2a (N2a) cells. The neuroprotective effect was analysed in STHdh<sup>Q111/Q111</sup> cells expressing a mutated form of the huntingtin protein and in N2a cells infected with an adenovirus carrying human huntingtin containing 94 polyQ repeats (mHtt-q94). The in vivo neuroprotective activity of Δ<sup>9</sup> -THCA was investigated in mice intoxicated with the mitochondrial toxin 3-nitropropionic acid (3-NPA).<h4>Key results</h4>Cannabinoid acids bind and activate PPARγ with higher potency than their decarboxylated products. Δ<sup>9</sup> -THCA increased mitochondrial mass in neuroblastoma N2a cells and prevented cytotoxicity induced by serum deprivation in STHdh<sup>Q111/Q111</sup> cells and by mutHtt-q94 in N2a cells. Δ<sup>9</sup> -THCA, through a PPARγ-dependent pathway, was neuroprotective in mice treated with 3-NPA, improving motor deficits and preventing striatal degeneration. In addition, Δ<sup>9</sup> -THCA attenuated microgliosis, astrogliosis and up-regulation of proinflammatory markers induced by 3-NPA.<h4>Conclusions and implications</h4>Δ<sup>9</sup> -THCA shows potent neuroprotective activity, which is worth considering for the treatment of Huntington's disease and possibly other neurodegenerative and neuroinflammatory diseases.

Also flagged:InsulinALTHMGB1ASTGlucoseTriglycerides
Journal Article 2017-11-02 No Snippets Yates KP, Deppe R, Comerford M, Masuoka H, Cummings OW, Tonascia J, Chalasani N, Vuppalanchi R, NASH CRN.
Show Full Abstract

<h4>Aim</h4>Serum high mobility group box 1 protein (HMGB1) is a proinflammatory molecule that could potentially serve as a biomarker for non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH) due to its correlation with degree of liver fibrosis. The aim of the current study was to examine the cross-sectional and longitudinal relationships between serum HMGB1 levels and liver histology in adults and children with NAFLD participating in two large randomized controlled trials.<h4>Methods</h4>Serum HMGB1 levels were measured at various time points in adults and children with NAFLD, who participated in PIVENS and TONIC clinical trials respectively. PIVENS trial compared vitamin E or pioglitazone to placebo in adults whereas TONIC trial compared vitamin E or metformin to placebo in children. Participants had liver biopsies at baseline and the end of treatment (96 weeks), and liver histology was reviewed by a central committee of study pathologists.<h4>Results</h4>In the cross-sectional analyses (n = 205 for PIVENS and 109 for TONIC), there was no significant relationship between serum HMGB1 levels and histological features such as steatosis, ballooning, inflammation, fibrosis, or presence of steatohepatitis in either adults or children. Serum HMGB1 levels did not change significantly during treatment either with placebo, vitamin E therapy (P = 0.81) or pioglitazone (P = 0.09) in the PIVENS trial. Similarly, serum HMGB1 levels did not change significantly during treatment either with placebo, metformin (P = 0.15) or vitamin E (P = 0.23) in the TONIC trial. In the longitudinal analyses (n = 105 for PIVENS and 109 for TONIC), changes in serum HMGB1 levels did not correlate with histologic improvement or resolution of NASH in either adults or children. There was no relationship between serum HMGB1 and ALT levels in either adults or children with NAFLD.<h4>Conclusion</h4>Serum HMGB1 levels were not associated with histological severity or treatment response in either children or adults with NAFLD.

Also flagged:CholesterolMetabolismACAT1cholesterol esterchromosomeamino acid
Journal Article 2017-11-02 ✓ 1 Snippet Hai Q, Ritchey B, Robinet P, Alzayed AM, Brubaker G, Zhang J, Smith JD.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<h4>Objective</h4>Cholesterol metabolism is a dynamic process involving intracellular trafficking, cholesterol esterification, and cholesterol ester hydrolysis. Our objective was to identify genes that regulate macrophage cholesterol metabolism.<h4>Approaches and results</h4>We performed quantitative trait loci mapping of free and esterified cholesterol levels and the ratio of esterified to free cholesterol in acetylated low-density lipoprotein-loaded bone marrow-derived macrophages from an AKR×DBA/2 strain intercross. Ten distinct cholesterol modifier loci were identified, and bioinformatics was used to prioritize candidate genes. The strongest locus was located on distal chromosome 1, which we named <i>Mcmm1</i> (macrophage cholesterol metabolism modifier 1). This locus harbors the <i>Soat1</i> (sterol O-acyltransferase 1) gene, encoding Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1), which esterifies free cholesterol. The parental AKR strain has an exon 2 deletion in Soat1, which leads to a 33 amino acid N-terminal truncation in ACAT1. CRISPR/Cas9 editing of DBA/2 embryonic stem cells was performed to replicate the AKR strain Soat1 exon 2 deletion, while leaving the remainder of the genome unaltered. DBA/2 stem cells and stem cells heterozygous and homozygous for the Soat1 exon 2 deletion were differentiated into macrophages and loaded with acetylated low-density lipoprotein. DBA/2 stem cell-derived macrophages accumulated less free cholesterol and more esterified cholesterol relative to cells heterozygous and homozygous for the Soat1 exon 2 deletion.<h4>Conclusions</h4>A Soat1 deletion present in AKR mice, and resultant N-terminal ACAT1 truncation, was confirmed to be a significant modifier of macrophage cholesterol metabolism. Other Mcmm loci candidate genes were prioritized via bioinformatics.

Also flagged:type I interferonMAVSsignalosometype I IFNmitochondriaviral infection
Journal Article 2017-11-02 ✓ 1 Snippet Qin Y, Su Z, Wu Y, Wu C, Jin S, Xie W, Jiang W, Zhou R, Cui J.
In-Text Gene Mentions

TRIM38

Show Full Abstract

MAVS signalosome plays an important role in RIG-I-like receptor (RLR)-induced antiviral signaling. Upon the recognition of viral RNAs, RLRs activate MAVS, which further recruits TRAF6 and other signaling proteins to initiate type I interferon (IFN) activation. MAVS signalosome also regulates virus-induced apoptosis to limit viral replication. However, the mechanisms that control the activity of MAVS signalosome are still poorly defined. Here, we report NLRP11, a Nod-like receptor, is induced by type I IFN and translocates to mitochondria to interact with MAVS upon viral infection. Using MAVS as a platform, NLRP11 degrades TRAF6 to attenuate the production of type I IFNs as well as virus-induced apoptosis. Our findings reveal the regulatory role of NLRP11 in antiviral immunity by disrupting MAVS signalosome.

Also flagged:Receptors forInsulin-Like Growth Factor-2AndrogensTriple-negative breast cancerbreast cancerIGF2
Journal Article 2017-11-02 No Snippets Hamilton N, Austin D, Márquez-Garbán D, Sanchez R, Chau B, Foos K, Wu Y, Vadgama J, Pietras R.
Show Full Abstract

Triple-negative breast cancer (TNBC) occurs in 10-15% of all breast cancer patients, yet it accounts for about half of all breast cancer deaths. There is an urgent need to identify new antitumor targets to provide additional treatment options for patients afflicted with this aggressive disease. Preclinical evidence suggests a critical role for insulin-like growth factor-2 (IGF2) and androgen receptor (AR) in regulating TNBC progression. To advance this work, a panel of TNBC cell lines was investigated with all cell lines showing significant expression of IGF2. Treatment with IGF2 stimulated cell proliferation in vitro (<i>p</i> < 0.05). Importantly, combination treatments with IGF1R inhibitors BMS-754807 and NVP-AEW541 elicited significant inhibition of TNBC cell proliferation (<i>p</i> < 0.001). Based on Annexin-V binding assays, BMS-754807, NVP-AEW541 and enzalutamide induced TNBC cell death (<i>p</i> < 0.005). Additionally, combination of enzalutamide with BMS-754807 or NVP-AEW541 exerted significant reductions in TNBC proliferation even in cells with low AR expression (<i>p</i> < 0.001). Notably, NVP-AEW541 and BMS-754807 reduced AR levels in BT549 TNBC cells. These results provide evidence that IGF2 promotes TNBC cell viability and proliferation, while inhibition of IGF1R/IR and AR pathways contribute to blockade of TNBC proliferation and promotion of apoptosis in vitro.

Also flagged:Brain-Derived Neurotrophic Factorneurogenesisbrain diseasesmental disordersneurodegenerative diseasesBDNF
Journal Article 2017-11-02 No Snippets Numakawa T, Odaka H, Adachi N.
Show Full Abstract

Altered neurogenesis is suggested to be involved in the onset of brain diseases, including mental disorders and neurodegenerative diseases. Neurotrophic factors are well known for their positive effects on the proliferation/differentiation of both embryonic and adult neural stem/progenitor cells (NSCs/NPCs). Especially, brain-derived neurotrophic factor (BDNF) has been extensively investigated because of its roles in the differentiation/maturation of NSCs/NPCs. On the other hand, recent evidence indicates a negative impact of the stress hormone glucocorticoids (GCs) on the cell fate of NSCs/NPCs, which is also related to the pathophysiology of brain diseases, such as depression and autism spectrum disorder. Furthermore, studies including ours have demonstrated functional interactions between neurotrophic factors and GCs in neural events, including neurogenesis. In this review, we show and discuss relationships among the behaviors of NSCs/NPCs, BDNF, and GCs.

Also flagged:Hepatocellular carcinomacancerschromosomesgene expressioncancer of the livercancer
Journal Article 2017-11-02 ✓ 1 Snippet Mehra M, Chauhan R.
In-Text Gene Mentions

…conditions such ashemochromatosis.…

Show Full Abstract

Hepatocellular carcinoma (HCC) is a major malignancy in the liver and has emerged as one of the main cancers in the world with a high mortality rate. However, the molecular mechanisms of HCC are still poorly understood. Long noncoding RNAs (lncRNAs) have recently come to the forefront as functional non-protein-coding RNAs that are involved in a variety of cellular processes ranging from maintaining the structural integrity of chromosomes to gene expression regulation in a spatiotemporal manner. Many recent studies have reported the involvement of lncRNAs in HCC which has led to a better understanding of the underlying molecular mechanisms operating in HCC. Long noncoding RNAs have been shown to regulate development and progression of HCC, and thus, lncRNAs have both diagnostic and therapeutic potentials. In this review, we present an overview of the lncRNAs involved in different stages of HCC and their potential in clinical applications which have been studied so far.

Also flagged:viral infectionsviral infectionAcute graft versus host diseaseHLAPD-1CMV infection
Journal Article 2017-11-02 ✓ 1 Snippet Withers B, Blyth E, Clancy LE, Yong A, Fraser C, Burgess J, Simms R, Brown R, Kliman D, Dubosq MC, Bishop D, Sutrave G, Ma CKK, Shaw PJ, Micklethwaite KP, Gottlieb DJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Donor-derived adoptive T-cell therapy is a safe and effective treatment of viral infection posttransplant, but it is limited by donor serostatus and availability and by its personalized nature. Off-the-shelf, third-party virus-specific T cells (VSTs) appear promising, but the long-term safety and durability of responses have yet to be established. We conducted a prospective study of 30 allogeneic hemopoietic stem cell transplant (HSCT) patients with persistent or recurrent cytomegalovirus (CMV) (n = 28), Epstein-Barr virus (n = 1), or adenovirus (n = 1) after standard therapy. Patients were treated with infusions of partially HLA-matched, third-party, ex vivo-expanded VSTs (total = 50 infusions) at a median of 75 days post-HSCT (range, 37 to 349 days). Safety, viral dynamics, and immune recovery were monitored for 12 months. Infusions were safe and well tolerated. Acute graft versus host disease occurred in 2 patients, despite a median HLA match between VSTs and the recipient of 2 of 6 antigens. At 12 months, the cumulative incidence of overall response was 93%. Virological control was durable in the majority of patients; the reintroduction of antiviral therapy after the final infusion occurred in 5 patients. CMV-specific T-cell immunity rose significantly and coincided with a rise in CD8<sup>+</sup> terminal effector cells. PD-1 expression was elevated on CD8<sup>+</sup> lymphocytes before the administration of third-party T cells and remained elevated at the time of viral control. Third-party VSTs show prolonged benefit, with virological control achieved in association with the recovery of CD8<sup>+</sup> effector T cells possibly facilitated by VST infusion. This trial was registered at www.clinicaltrials.gov as #NCT02779439 and www.anzctr.org.au as #ACTRN12613000603718.

Also flagged:cholangiocarcinomatumorpathogenesistranslationalcanceriCCA
Journal Article 2017-11-02 ✓ 1 Snippet Bragazzi MC, Ridola L, Safarikia S, Matteo SD, Costantini D, Nevi L, Cardinale V.
In-Text Gene Mentions

Hemochromatosishas also been…

Show Full Abstract

Cholangiocarcinoma (CCA) is a heterogeneous group of malignancies that may develop at any level of the biliary tree. CCA is currently classified into intrahepatic (iCCA), perihilar (pCCA) and distal (dCCA) on the basis of its anatomical location. Notably, although these three CCA subtypes have common features, they also have important inter- and intra-tumor differences that can affect their pathogenesis and outcome. A unique feature of CCA is that it manifests in the hepatic parenchyma or large intrahepatic and extrahepatic bile ducts, furnished by two distinct stem cell niches: the canals of Hering and the peribiliary glands, respectively. The complexity of CCA pathogenesis highlights the need for a multidisciplinary, translational, and systemic approach to this malignancy. This review focuses on advances in the knowledge of CCA histomorphology, risk factors, molecular pathogenesis, and subsets of CCA.

Also flagged:youaddhappyhowbreast cancerage‐related macular degeneration
Journal Article 2017-11-02 ✓ 1 Snippet Wang C, Cahill TJ, Parlato A, Wertz B, Zhong Q, Cunningham TN, Cummings JJ.
In-Text Gene Mentions

…medical management includinghemochromatosisand breast cancer.…

Show Full Abstract

<h4>Background</h4>With the availability of raw DNA generated from direct-to-consumer (DTC) testing companies, there has been a proliferation of third-party online services that are available to interpret the raw data for both genealogy and/or health purposes. This study examines the current landscape and downstream clinical implications of consumer use of third-party services.<h4>Methods</h4>Study participants were recruited online from social media platforms. A total of 321 survey respondents reported using third-party services for raw DNA interpretation.<h4>Results</h4>Participants were highly motivated to explore raw DNA for ancestral information (67%), individual health implications (62%), or both (40%). Participants primarily used one of seven companies to interpret raw DNA; 73% used more than one. Company choice was driven by the type of results offered (51%), price (45%), and online reviews (31%). Approximately 30% of participants shared results with a medical provider and 21% shared with more than one. Outcomes of sharing ranged from disinterest/discounting of the information to diagnosis of genetic conditions. Participants were highly satisfied with their decision to analyze raw DNA (M = 4.54/5), yet challenges in understanding interpretation results were reported irrespective of satisfaction ratings.<h4>Conclusion</h4>Consumers face challenges in understanding the results and may seek out clinical assistance in interpreting their raw DNA results.

Also flagged:Sox9BMP2Smad7arthritiscartilage injuriesBone morphogenetic protein 2
Journal Article 2017-11-02 ✓ 1 Snippet Zhao C, Jiang W, Zhou N, Liao J, Yang M, Hu N, Liang X, Xu W, Chen H, Liu W, Shi LL, Oliveira L, Wolf JM, Ho S, Athiviraham A, Tsai HM, He TC, Huang W.
In-Text Gene Mentions

…ogenesis may up-regulate Sox5/Sox6/Sox9 and hence enhance…

Show Full Abstract

Cartilage injuries caused by arthritis or trauma pose formidable challenges for effective clinical management due to the limited intrinsic proliferative capability of chondrocytes. Autologous stem cell-based therapies and transgene-enhanced cartilage tissue engineering may open new avenues for the treatment of cartilage injuries. Bone morphogenetic protein 2 (BMP2) induces effective chondrogenesis of mesenchymal stem cells (MSCs) and can thus be explored as a potential therapeutic agent for cartilage defect repair. However, BMP2 also induces robust endochondral ossification. Although the precise mechanisms through which BMP2 governs the divergence of chondrogenesis and osteogenesis remain to be fully understood, blocking endochondral ossification during BMP2-induced cartilage formation may have practical significance for cartilage tissue engineering. Here, we investigate the role of Sox9-donwregulated Smad7 in BMP2-induced chondrogenic differentiation of MSCs. We find that overexpression of Sox9 leads to a decrease in BMP2-induced Smad7 expression in MSCs. Sox9 inhibits BMP2-induced expression of osteopontin while enhancing the expression of chondrogenic marker Col2a1 in MSCs. Forced expression of Sox9 in MSCs promotes BMP2-induced chondrogenesis and suppresses BMP2-induced endochondral ossification. Constitutive Smad7 expression inhibits BMP2-induced chondrogenesis in stem cell implantation assay. Mouse limb explant assay reveals that Sox9 expands BMP2-stimulated chondrocyte proliferating zone while Smad7 promotes BMP2-intitated hypertrophic zone of the growth plate. Cell cycle analysis indicates that Smad7 induces significant early apoptosis in BMP2-stimulated MSCs. Taken together, our results strongly suggest that Sox9 may facilitate BMP2-induced chondrogenesis by downregulating Smad7, which can be exploited for effective cartilage tissue engineering.

Also flagged:serotonin transporteranejaculation
Journal Article 2017-11-01 No Snippets Huang YY, Zhang XS, Gao JJ, Gao P, Liang CZ.
Show Full Abstract

No abstract available.

Also flagged:neurological disordersneurological diseasesnervous disordersaxonssynapsesNeurological disorder
Journal Article 2017-11-01 ✓ 2 Snippets Aarthy M, Panwar U, Selvaraj C, Singh SK.
In-Text Gene Mentions

GABA-AT protein and Htt protein from HD has been studied with the help of the SBDD approaches.

…GABA-AT protein andHttprotein from HD…

Show Full Abstract

<h4>Objective</h4>The purpose of the review is to portray the theoretical concept on neurological disorders from research data.<h4>Background</h4>The freak changes in chemical response of nerve impulse causes neurological disorders. The research evidence of the effort done in the older history suggests that the biological drug targets and their effective feature with responsive drugs could be valuable in promoting the future development of health statistics structure for improved treatment for curing the nervous disorders.<h4>Methods</h4>In this review, we summarized the most iterative theoretical concept of structure based drug design approaches in various neurological disorders to unfathomable understanding of reported information for future drug design and development.<h4>Results</h4>On the premise of reported information we analyzed the model of theoretical drug designing process for understanding the mechanism and pathology of the neurological diseases which covers the development of potentially effective inhibitors against the biological drug targets. Finally, it also suggests the management and implementation of the current treatment in improving the human health system behaviors.<h4>Conclusion</h4>With the survey of reported information we concluded the development strategies of diagnosis and treatment against neurological diseases which leads to supportive progress in the drug discovery.

Also flagged:liver cancermelanomaimmune responsescapsidhepatocellular carcinomacancer
Journal Article 2017-11-01 ✓ 1 Snippet Dhungel B, Jayachandran A, Layton CJ, Steel JC.
In-Text Gene Mentions

…metabolic maladies (e.g.hemochromatosis) and nonalcoholic fatty…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the most common form of primary liver cancer with high incidence globally. Increasing mortality and morbidity rates combined with limited treatment options available for advanced HCC press for novel and effective treatment modalities. Gene therapy represents one of the most promising therapeutic options. With the recent approval of herpes simplex virus for advanced melanoma, the field of gene therapy has received a major boost. Adeno-associated virus (AAV) is among the most widely used and effective viral vectors today with safety and efficacy demonstrated in a number of human clinical trials. This review identifies the obstacles for effective AAV based gene delivery to HCC which primarily include host immune responses and off-target effects. These drawbacks could be more pronounced for HCC because of the underlying liver dysfunction in most of the patients. We discuss approaches that could be adopted to tackle these shortcomings and manufacture HCC-targeted vectors. The combination of transductional targeting by modifying the vector capsid and transcriptional targeting using HCC-specific promoters has the potential to produce vectors which can specifically seek HCC and deliver therapeutic gene without significant side effects. Finally, the identification of novel HCC-specific ligands and promoters should facilitate and expedite this process.

Also flagged:type 1 retinopathy of prematuritytype 1 ROPvascular endothelial growth factor
Journal Article 2017-11-01 ✓ 1 Snippet Sukgen EA, Söker G, Koçluk Y, Gülek B.
In-Text Gene Mentions

…Blood Flow inType 1 Retinopathy1 Retinopathy of…

Show Full Abstract

<h4>Purpose</h4>To evaluate the blood flow changes of the central retinal artery measured with color Doppler imaging (CDI) in infants receiving intravitreal aflibercept (IVA) for treatment of type 1 retinopathy of prematurity (ROP).<h4>Methods</h4>Patients with type 1 ROP were assessed prospectively by CDI following IVA. Color Doppler imaging was used to measure the peak systolic velocity, end diastolic velocity (EDV), pulsatility index (PI), and resistivity index (RI) of the central retinal artery (CRA) before IVA injection and 1 hour, 1 week, and 1 month after injection.<h4>Results</h4>A total of 29 eyes of 15 infants were included in this study. The mean gestational age at birth was 28.62 ± 2.48 weeks and the mean birthweight was 1,198.62 ± 348.99 g. All treated eyes showed complete regression of ROP and peripheral retinal vascularization continued. Measurements of EDV-CRA, RI-CRA, and PI-CRA showed significant changes after IVA treatment.<h4>Conclusions</h4>This study showed that IVA is an effective treatment for type 1 ROP. After IVA treatment, vascular resistance increases, ocular blood flow decreases, and changes in hemodynamic parameters of CRA may remain for a month. Further studies are needed to evaluate the effect of anti-vascular endothelial growth factor agents on ocular hemodynamics in infants with ROP.

Also flagged:Honokiolnasopharyngeal carcinomafolate receptorFRHKfolate
Journal Article 2017-11-01 No Snippets Yang B, Ni X, Chen L, Zhang H, Ren P, Feng Y, Chen Y, Fu S, Wu J.
Show Full Abstract

The purpose of this study was to develop a novel drug delivery system for a sustained and targeted delivery of honokiol (HK) to the nasopharyngeal carcinoma (NPC) HNE-1 cell lines, since the folate receptor (FR) is over-expressed on their surface. Emulsion solvent evaporation was used to develop the active targeting nanoparticles-loaded HK (ATNH) using copolymerpoly (ɛ-caprolactone)-poly (ethyleneglycol)-poly (ɛ-caprolactone) (PCEC), which was modified with folate (FA) by introducing Polythylenimine (PEI). ATNH characterization, including particle size distribution, morphology, drug loading, encapsulation efficiency and drug release, was performed. Transmission electron microscopy (TEM) and Fourier transform infrared spectroscopy (FTIR) were employed to evaluate the shape and construction, respectively. MTT assay, cell uptake study and apoptosis test were assayed to detect the antitumor properties and targeting uptake by HNE-1 cells in vitro. Cell-cycle redistribution, <sup>18 </sup>F-FDG PET/CT and immunohistochemistry were performed in vivo. The ATNH we developed were successfully synthesized and showed a suitable size distribution, high encapsulation efficiency, gradual release, and targeting uptake by the cells in vitro. Moreover, ATNH significantly inhibited tumor growth, metabolism, proliferation, micro-vessel generation, and caused cell-cycle arrest at G<sub>1</sub> phase. Thus, these nanoparticles we developed might represent a novel formulation for HK delivery and a promising potential therapy in the treatment of cancer.

Also flagged:acute respiratory tract infectionattention deficit hyperactivity disorderdeathpneumoniaglomerular disease
Journal Article 2017-11-01 ✓ 1 Snippet Khare R, Utidjian L, Ruth BJ, Kahn MG, Burrows E, Marsolo K, Patibandla N, Razzaghi H, Colvin R, Ranade D, Kitzmiller M, Eckrich D, Bailey LC.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Objective</h4>PEDSnet is a clinical data research network (CDRN) that aggregates electronic health record data from multiple children's hospitals to enable large-scale research. Assessing data quality to ensure suitability for conducting research is a key requirement in PEDSnet. This study presents a range of data quality issues identified over a period of 18 months and interprets them to evaluate the research capacity of PEDSnet.<h4>Materials and methods</h4>Results were generated by a semiautomated data quality assessment workflow. Two investigators reviewed programmatic data quality issues and conducted discussions with the data partners' extract-transform-load analysts to determine the cause for each issue.<h4>Results</h4>The results include a longitudinal summary of 2182 data quality issues identified across 9 data submission cycles. The metadata from the most recent cycle includes annotations for 850 issues: most frequent types, including missing data (>300) and outliers (>100); most complex domains, including medications (>160) and lab measurements (>140); and primary causes, including source data characteristics (83%) and extract-transform-load errors (9%).<h4>Discussion</h4>The longitudinal findings demonstrate the network's evolution from identifying difficulties with aligning the data to a common data model to learning norms in clinical pediatrics and determining research capability.<h4>Conclusion</h4>While data quality is recognized as a critical aspect in establishing and utilizing a CDRN, the findings from data quality assessments are largely unpublished. This paper presents a real-world account of studying and interpreting data quality findings in a pediatric CDRN, and the lessons learned could be used by other CDRNs.

Also flagged:IronIron DeficiencyChronic Obstructive Pulmonary DiseaseCOPDanemiaID
Journal Article 2017-11-01 No Snippets Cloonan SM, Mumby S, Adcock IM, Choi AMK, Chung KF, Quinlan GJ.
Show Full Abstract

No abstract available.

Also flagged:topotecanactinomycin Dembryonal brain tumorbrain tumorCNS tumorstopoisomerase
Journal Article 2017-11-01 ✓ 1 Snippet Schmidt C, Schubert NA, Brabetz S, Mack N, Schwalm B, Chan JA, Selt F, Herold-Mende C, Witt O, Milde T, Pfister SM, Korshunov A, Kool M.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Background</h4>Embryonal tumor with multilayered rosettes (ETMR) is a rare and aggressive embryonal brain tumor that solely occurs in infants and young children and has only recently been recognized as a separate brain tumor entity in the World Health Organization classification for CNS tumors. Patients have a very dismal prognosis with a median survival of 12 months upon diagnosis despite aggressive treatment. The aim of this study was to develop novel treatment regimens in a preclinical drug screen in order to inform potentially more active clinical trial protocols.<h4>Methods</h4>We have carried out an in vitro and in vivo drug screen using the ETMR cell line BT183 and its xenograft model. Furthermore, we have generated the first patient-derived xenograft (PDX) model for ETMR and evaluated our top drug candidates in an in vitro drug screen using this model.<h4>Results</h4>BT183 cells are very sensitive to the topoisomerase inhibitors topotecan and doxorubicin, to the epigenetic agents decitabine and panobinostat, to actinomycin D, and to targeted drugs such as the polo-like kinase 1 (PLK1) inhibitor volasertib, the aurora kinase A inhibitor alisertib, and the mammalian target of rapamycin (mTOR) inhibitor MLN0128. In xenograft mice, monotherapy with topotecan, volasertib, and actinomycin D led to a temporary response in tumor growth and a significant increase in survival. Finally, using multi-agent treatment regimens of topotecan or doxorubicin combined with methotrexate and vincristine, the response in tumor growth and survival was further increased compared with mice receiving single treatments.<h4>Conclusions</h4>We have identified several promising candidates for combination therapies in future clinical trials for ETMR patients.

Also flagged:ironinfectionhyperferritinemiaFerritinhemoproteinsoxygen
Journal Article 2017-11-01 ✓ 1 Snippet Kernan KF, Carcillo JA.
In-Text Gene Mentions

…primary or secondaryhemochromatosis.…

Show Full Abstract

Understanding of ferritin biology has traditionally centered on its role in iron storage and homeostasis, with low ferritin levels indicative of deficiency and high levels indicative of primary or secondary hemochromatosis. However, further work has shown that iron, redox biology and inflammation are inexorably linked. During infection, increased ferritin levels represent an important host defense mechanism that deprives bacterial growth of iron and protects immune cell function. It may also be protective, limiting the production of free radicals and mediating immunomodulation. Additionally, hyperferritinemia is a key acute-phase reactants, used by clinicians as an indication for therapeutic intervention, aimed at controlling inflammation in high-risk patients. One school of thought maintains that hyperferritinemia is an 'innocent bystander' biomarker of uncontrolled inflammation that can be used to gauge effectiveness of intervention. Other schools of thought maintain that ferritin induction could be a protective negative regulatory loop. Others maintain that ferritin is a key mediator of immune dysregulation, especially in extreme hyperferritinemia, via direct immune-suppressive and pro-inflammatory effects. There is a clear need for further investigation of the role of ferritin in uncontrolled inflammatory conditions both as a biomarker and mediator of disease because its occurrence identifies patients with high mortality risk and its resolution predicts their improved survival.

Also flagged:triterpenoidursolic acidhydroxyeat-2oxygensuperoxide dismutase
Journal Article 2017-11-01 No Snippets Negi H, Saikia SK, Pandey R.
Show Full Abstract

Species from lower invertebrates to a spectrum of mammals show antiaging health benefits of phytochemical(s). Here, we explored the pro-longevity effects of a natural triterpenoid, ursolic acid (3β-hydroxy-urs-12-en-28-oic acid; UA) in Caenorhabditis elegans with maximal life span being evident at 25 µM UA. Similar to eat-2 mutants, UA uptake by worm results in reduced fat storage and attenuation of reactive oxygen species (ROS), independent of superoxide dismutase(s) activation. The genetic requirements for UA-mediated longevity are quite similar to dietary restriction (DR) achieved through SKN-1/NRF-2 exhibiting upregulation of downstream target genes gcs-1 and daf-9. Longevity mechanism was independent of PHA-4/FOXA and attributed to partial dependence on sir-2.1. Altogether, our study suggests differential use of UA-elicited signaling cascades in nutrient sensing for longevity. Both the redox state and the proteostasis of an organism play critical role in aging and disease resistance. Interestingly, we observed a reduction of toxic protein aggregation in transgenic polyglutamine (polyQ) C. elegans model and UA-mediated JNK-1 (c-Jun-NH2-terminal kinase) activation in wild-type animals. Thus, our study demonstrates a small extent of prevention against proteotoxic stress by UA coupled with positive aspects of DR-mediated longevity.

Also flagged:NSCLCgene expressiontumorlung adenocarcinomachemotaxisNonsquamous Non–Small Cell Lung Cancer
Journal Article 2017-11-01 ✓ 1 Snippet Li B, Cui Y, Diehn M, Li R.
In-Text Gene Mentions

DCC

Show Full Abstract

<h4>Importance</h4>The prevalence of early-stage non-small cell lung cancer (NSCLC) is expected to increase with recent implementation of annual screening programs. Reliable prognostic biomarkers are needed to identify patients at a high risk for recurrence to guide adjuvant therapy.<h4>Objective</h4>To develop a robust, individualized immune signature that can estimate prognosis in patients with early-stage nonsquamous NSCLC.<h4>Design, setting, and participants</h4>This retrospective study analyzed the gene expression profiles of frozen tumor tissue samples from 19 public NSCLC cohorts, including 18 microarray data sets and 1 RNA-Seq data set for The Cancer Genome Atlas (TCGA) lung adenocarcinoma cohort. Only patients with nonsquamous NSCLC with clinical annotation were included. Samples were from 2414 patients with nonsquamous NSCLC, divided into a meta-training cohort (729 patients), meta-testing cohort (716 patients), and 3 independent validation cohorts (439, 323, and 207 patients). All patients underwent surgery with a negative surgical margin, received no adjuvant or neoadjuvant therapy, and had publicly available gene expression data and survival information. Data were collected from July 22 through September 8, 2016.<h4>Main outcomes and measures</h4>Overall survival.<h4>Results</h4>Of 2414 patients (1205 men [50%], 1111 women [46%], and 98 of unknown sex [4%]; median age [range], 64 [15-90] years), a prognostic immune signature of 25 gene pairs consisting of 40 unique genes was constructed using the meta-training data set. In the meta-testing and validation cohorts, the immune signature significantly stratified patients into high- vs low-risk groups in terms of overall survival across and within subpopulations with stage I, IA, IB, or II disease and remained as an independent prognostic factor in multivariate analyses (hazard ratio range, 1.72 [95% CI, 1.26-2.33; P < .001] to 2.36 [95% CI, 1.47-3.79; P < .001]) after adjusting for clinical and pathologic factors. Several biological processes, including chemotaxis, were enriched among genes in the immune signature. The percentage of neutrophil infiltration (5.6% vs 1.8%) and necrosis (4.6% vs 1.5%) was significantly higher in the high-risk immune group compared with the low-risk groups in TCGA data set (P < .003). The immune signature achieved a higher accuracy (mean concordance index [C-index], 0.64) than 2 commercialized multigene signatures (mean C-index, 0.53 and 0.61) for estimation of survival in comparable validation cohorts. When integrated with clinical characteristics such as age and stage, the composite clinical and immune signature showed improved prognostic accuracy in all validation data sets relative to molecular signatures alone (mean C-index, 0.70 vs 0.63) and another commercialized clinical-molecular signature (mean C-index, 0.68 vs 0.65).<h4>Conclusions and relevance</h4>The proposed clinical-immune signature is a promising biomarker for estimating overall survival in nonsquamous NSCLC, including early-stage disease. Prospective studies are needed to test the clinical utility of the biomarker in individualized management of nonsquamous NSCLC.

Also flagged:AtorvastatinOsteoporosisbone disorderstatinsbone morphogenetic protein 2tetracycline
Journal Article 2017-11-01 No Snippets Xie Y, Tan X, Huang J, Huang H, Zou P, Hu J.
Show Full Abstract

Osteoporosis is a common bone disorder where the declined bone mass is far more than normal physiological status and usually associated with enhanced fracture risk, reduced bone strength and even deteriorated quality of life. Recent studies showed that statins could exert beneficial effects on bones via promoting osteoblastic activity mediated by increased expression of bone morphogenetic protein 2 and also by suppressing osteoclast proliferation. In this study, we developed atorvastatin-loaded tetracycline-poly (ethylene glycol)-poly(lactic-co-glycolic acid) (TC-PEG-PLGA/ATO) micelles for the targeted treatment of osteoporosis. The TC-PEG-PLGA was synthesized under the action of coupling reagents and then ATO was encapsulated through solvent diffusion method with encapsulation efficiency and drug loading of 89.32 ± 2.48% and 8.20 ± 0.53%, respectively. The release of ATO from micelles could be maintained for more than 48 h in pH 7.4 PBS. Pharmacokinetic results further demonstrated that TC-PEG-PLGA micelles could effectively shield ATO leakage from micelles and prolong their circulation time. Benefiting from TC specifically binding to hydroxyapatite (HAp), TC-PEG-PLGA/ATO micelles exerted good bone-targeted ability, as demonstrated by in vitro HAp affinity assay and biodistribution. Pharmacodynamic studies showed that TC-PEG-PLGA/ATO micelles could effectively improve bone mineral density and bone mechanical strength in osteoporotic rats. These results suggest that TC-PEG-PLGA/ATO micelles hold significant promise for the targeted treatment of osteoporosis.

Also flagged:SPD1001trifluoroacetic acidSynthesisPDIESI
Journal Article 2017-11-01 No Snippets Zhang H, Xu W, Omari-Siaw E, Liu Y, Chen B, Chen D, Yu J, Xu X.
Show Full Abstract

Periplocymarin (PPM), a cardiac glycoside, has a narrow therapeutic index, poor tumor selectivity and severe cardiovascular toxicity which hinder its wide clinical applications in cancer treatment. Herein, we report novel redox-responsive prodrug-nanoparticles (MPSSV-NPs) self-assembled by co-nanoprecipitation of PPM-vitamin E conjugate and a PEG derivative of linoleate (mPEG2000-LA) in water. It was found that the characteristics of PPM-vitamin E nanoparticles (PSSV-NPs) were improved through co-nanoprecipitation with increased percentages of mPEG2000-LA. Moreover, the MPSSV-NPs were optimized according to the in vitro release and cytotoxicity study. Furthermore, the optimized MPSSV-NPs dramatically enhanced the circulation time and tumor distribution of PSSV-NPs after single intravenous injection. The in vivo studies in malignant H<sub>22</sub>-bearing mice revealed that MPSSV-NPs could effectively suppress tumor growth without causing obvious systemic toxicity. Altogether, these results suggested that MPSSV-NPs could offer a safe, multifunctional and viable nanoplatform for cardiac glycosides in cancer treatment.

Also flagged:amino groupdryhydrogenssynthesisS11amide
Journal Article 2017-11-01 No Snippets Chen R, Xu L, Fan Q, Li M, Wang J, Wu L, Li W, Duan J, Chen Z.
Show Full Abstract

Inhalation administration, compared with intravenous administration, significantly enhances chemotherapeutic drug exposure to the lung tissue and may increase the therapeutic effect for pulmonary anticancer. However, further identification of cancer cells after lung deposition of inhaled drugs is necessary to avoid side effects on normal lung tissue and to maximize drug efficacy. Moreover, as the action site of the major drug was intracellular organelles, drug target to the specific organelle is the final key for accurate drug delivery. Here, we designed a novel multifunctional nanoparticles (MNPs) for pulmonary antitumor and the material was well-designed for hierarchical target involved lung tissue target, cancer cell target, and mitochondrial target. The biodistribution in vivo determined by UHPLC-MS/MS method was employed to verify the drug concentration overwhelmingly increasing in lung tissue through inhaled administration compared with intravenous administration. Cellular uptake assay using A549 cells proved the efficient receptor-mediated cell endocytosis. Confocal laser scanning microscopy observation showed the location of MNPs in cells was mitochondria. All results confirmed the intelligent material can progressively play hierarchical target functions, which could induce more cell apoptosis related to mitochondrial damage. It provides a smart and efficient nanocarrier platform for hierarchical targeting of pulmonary anticancer drug. So far, this kind of material for pulmonary mitochondrial-target has not been seen in other reports.

Also flagged:Acute Lymphoblastic LeukaemiaAsparaginaseacute lymphoblastic leukemiaALLhypersensitivityDexamethasone
Journal Article 2017-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

No abstract available.

Also flagged:colorectal cancerLYPD8tumorretinoic acidColitisinflammatory bowel diseases
Journal Article 2017-11-01 No Snippets Yang Y, Jobin C.
Show Full Abstract

<h4>Purpose of review</h4>Microbiota is a major player in the pathogenesis of inflammatory bowel diseases (IBD) and colorectal cancer (CRC). Here, we summarize the key advances achieved in the past 18 months (ending June 2017) toward a better understanding of the role of microbiota in colitis and CRC development.<h4>Recent findings</h4>Accumulating evidence shows the essential role of intestinal barrier function (e.g. mucus, IgA, LCN2, LYPD8) in protecting against bacteria-induced inflammation and tumor development. Numerous signaling pathways (e.g. TLRs and NLRs), metabolites (e.g. indole, bile acids, retinoic acid) and small noncoding RNAs (e.g. miRNA) have been identified as key mediators regulating host-microbe interactions in the intestine. Novel microbial drivers of colitis and tumorigenesis (e.g. Alistipes finegoldii, Atopobium parvalum, Peptostreptococcus anaerobius) have been identified and their disease-promoting activities have been described.<h4>Summary</h4>IBD-associated colorectal cancer results from a complex breakdown of communication between the host and its microbiota, involving barrier function, immune signaling and metabolites.

Also flagged:thrombophiliavenous thromboembolismdeep venous thrombosisDVTfactor V LeidenMTHFR
Journal Article 2017-11-01 No Snippets Abdi AA, Osman A.
Show Full Abstract

Thrombophilia, commonly manifested as venous thromboembolism (VTE), is a worldwide concern but little is known on its genetic epidemiology in many parts of the globe particularly in the developing countries. Here we employed TaqMan genotyping and pyrosequencing to evaluate the prevalence of known common nucleotide polymorphisms associated with thrombophilia in a Somali population in the Puntland region of Somalia. We also employed next generation sequencing (NGS) to investigate other genetic variants in a Somali patient with deep venous thrombosis (DVT). As expected, we found no existence of factor V Leiden (rs6025) and prothrombin G20210A (rs1799963) in the Somali population. The G allele of ABO [261G/delG] polymorphism (rs8176719) was found at a frequency of 29%, similar to that observed in other African populations. We found the lowest so far reported frequency of MTHFR C677T (rs1801133) polymorphism in the Somali population (T allele frequency 1.5%). A novel and deleterious single nucleotide variation in exon 11 of coagulation factor V (c.1631A>G) causing Gln544Arg exchange in factor V was identified in a 29 years old Somali female with DVT. The same patient was heterozygous to VKORC1 Asp36Tyr polymorphism (rs61742245) that predisposes to warfarin resistance. In conclusion, this study shows that common hereditary factors for thromboembolism found in Caucasians are either less frequent or absent in the Somali population-similar to the situation in other Africans. NGS is possibly a better choice to detect genetic risk variants for thrombosis in this ethnic group.

Also flagged:galactoseresibufogeninasialoglycoprotein receptorliver cancercancerGalactosyl
Journal Article 2017-11-01 No Snippets Dong H, Tian L, Gao M, Xu H, Zhang C, Lv L, Zhang J, Wang C, Tian Y, Ma X.
Show Full Abstract

Liver cancer is one of the major diseases affecting human health. Modified drug delivery systems through the asialoglycoprotein receptor, which is highly expressed on the surface of hepatocytes, have become a research focus for the treatment of liver cancer. Resibufogenin (RBG) is a popular traditional Chinese medicine and natural anti-cancer drug that was isolated from Chansu, but its cardiotoxicity and hydrophobicity have limited its clinical applications. Galactosyl-succinyl-poloxamer 188 and galactosyl-succinyl-poloxamer 188-polylactide-co-glycolide (Gal-SP188-PLGA) were synthesized using galactose, P188, and PLGA to achieve active liver-targeting properties. RBG-loaded Gal-SP188-PLGA nanoparticles (RGPPNs) and coumarin-6-loaded Gal-SP188-PLGA nanoparticles (CGPPNs) were prepared. The in vitro cellular uptake, cytotoxicity, and apoptosis of nanoparticles in HepG2 cells were analyzed. The in vivo therapeutic effects of nanoparticles were assessed in a hepatocarcinogenic mouse model. The results showed that Gal-SP188-PLGA was successfully synthesized. The cellular uptake assay demonstrated that CGPPNs had superior active liver-targeting properties. The ratio of apoptotic cells was increased in the RGPPN group. In comparison to the other groups, RGPPNs showed superior in vivo therapeutic effects and anticancer efficacy. Thus, the active liver-targeting RGPPNs, which can enhance the pharmacological effects and decrease the toxicity of RBG, are expected to become a promising and effective treatment for liver cancer.

Also flagged:Bisphenol Abisphenol Sendoplasmic reticulumgestationgene expressionestradiol receptor 1
Journal Article 2017-11-01 ✓ 1 Snippet Pu Y, Gingrich JD, Steibel JP, Veiga-Lopez A.
In-Text Gene Mentions

SOX6

Show Full Abstract

The endocrine-disrupting chemical bisphenol A (BPA) increases adipose tissue mass in vivo and promotes adipogenesis in vitro; however, mechanisms explaining BPA's obesogenic effect remain unknown. We investigated the effects of gestational BPA and its analog, bisphenol S (BPS), exposure on the adipogenic differentiation ability of fetal preadipocytes and the role of endoplasmic reticulum stress in regulating this process. Pregnant sheep (n = 7 to 8 per group) mated to the same male were exposed to BPA or BPS from days 30 to 100 of gestation; pregnancies were terminated 20 days later. Adipose tissue was harvested and fetal preadipocytes isolated. Adipose tissue gene expression, adipocyte size, preadipocyte gene expression, adipogenic differentiation, and dynamic expression of genes involved in adipogenesis and endoplasmic reticulum stress were assessed. Gestational BPA enhanced adipogenic differentiation in female, but not male, preadipocytes. The unfolded protein response (UPR) pathway was upregulated in BPA-exposed female preadipocytes supportive of a higher endoplasmic reticulum stress. Increased expression of estradiol receptor 1 and glucocorticoid receptor in female preadipocytes suggests that this may be a potential cause behind the sex-specific effects observed upon BPA exposure. Gestational BPS affected adipogenic terminal differentiation gene expression in male preadipocytes, but not adipogenic differentiation potential. We demonstrate that gestational BPA exposure can modulate the differentiation ability of fetal preadipocytes. UPR upregulation in gestationally BPA-exposed female preadipocytes may contribute to the increased preadipocyte's adipogenic ability. The marked sex-specific effect of BPA highlights higher susceptibility of females to bisphenol A and potentially, a higher risk to develop obesity in adulthood.

Also flagged:chromosomeautosomescaffold attachment factor ASAF-Achromosomeshistone
Journal Article 2017-11-01 ✓ 1 Snippet Creamer KM, Lawrence JB.
In-Text Gene Mentions

…subunits of thepolycomb repressiverepressive complex PRC1…

Show Full Abstract

<i>XIST</i> RNA triggers the transformation of an active X chromosome into a condensed, inactive Barr body and therefore provides a unique window into transitions of higher-order chromosome architecture. Despite recent progress, how <i>XIST</i> RNA localizes and interacts with the X chromosome remains poorly understood. Genetic engineering of <i>XIST</i> into a trisomic autosome demonstrates remarkable capacity of <i>XIST</i> RNA to localize and comprehensively silence that autosome. Thus, <i>XIST</i> does not require X chromosome-specific sequences but operates on mechanisms available genome-wide. Prior results suggested <i>XIST</i> localization is controlled by attachment to the insoluble nuclear scaffold. Our recent work affirms that scaffold attachment factor A (SAF-A) is involved in anchoring <i>XIST</i>, but argues against the view that SAF-A provides a unimolecular bridge between RNA and the chromosome. Rather, we suggest that a complex meshwork of architectural proteins interact with <i>XIST</i> RNA. Parallel work studying the territory of actively transcribed chromosomes suggests that repeat-rich RNA 'coats' euchromatin and may impact chromosome architecture in a manner opposite of <i>XIST</i> A model is discussed whereby RNA may not just recruit histone modifications, but more directly impact higher-order chromatin condensation via interaction with architectural proteins of the nucleus.This article is part of the themed issue 'X-chromosome inactivation: a tribute to Mary Lyon'.

Also flagged:cancerdocetaxeltumorsSunCH2Lin2
Journal Article 2017-11-01 No Snippets Zhang S, Guan J, Sun M, Zhang D, Zhang H, Sun B, Guo W, Lin B, Wang Y, He Z, Luo C, Sun J.
Show Full Abstract

Breast cancer leads to high mortality of women in the world. Docetaxel (DTX) has been widely applied as one of the first-line chemotherapeutic drugs for breast cancer therapy. However, the clinical outcome of DTX is far from satisfaction due to its poor drug delivery efficiency. Herein, a novel disulfide bond bridged oleate prodrug of DTX was designed and synthesized to construct self-delivering prodrug-based nanosystem for improved anticancer efficacy of DTX. The uniquely engineered prodrug-nanoassemblies showed redox-responsive drug release, increased cellular uptake and comparable cytotoxicity against 4T1 breast cancer cells when compared with free DTX. In vivo, oleate prodrug-based nanoparticles (NPs) demonstrated significantly prolonged systemic circulation and increased accumulation in tumor site. As a result, prodrug NPs produced a notable antitumor activity in 4T1 breast cancer xenograft in BALB/c mice. This prodrug-based self-assembly and self-delivery strategy could be utilized to improve the delivery efficiency of DTX for breast cancer treatment.

Also flagged:carbapenemaseertapenemnucleotidechromosomecarbapenemHealthcare Associated Infections
Journal Article 2017-11-01 No Snippets Martin J, Phan HTT, Findlay J, Stoesser N, Pankhurst L, Navickaite I, De Maio N, Eyre DW, Toogood G, Orsi NM, Kirby A, Young N, Turton JF, Hill RLR, Hopkins KL, Woodford N, Peto TEA, Walker AS, Crook DW, Wilcox MH.
Show Full Abstract

<h4>Background</h4>Carbapenemase-producing Enterobacteriaceae (CPE), including KPC-producing Klebsiella pneumoniae (KPC-Kpn), are an increasing threat to patient safety.<h4>Objectives</h4>To use WGS to investigate the extent and complexity of carbapenemase gene dissemination in a controlled KPC outbreak.<h4>Materials and methods</h4>Enterobacteriaceae with reduced ertapenem susceptibility recovered from rectal screening swabs/clinical samples, during a 3 month KPC outbreak (2013-14), were investigated for carbapenemase production, antimicrobial susceptibility, variable-number-tandem-repeat profile and WGS [short-read (Illumina), long-read (MinION)]. Short-read sequences were used for MLST and plasmid/Tn4401 fingerprinting, and long-read sequence assemblies for plasmid identification. Phylogenetic analysis used IQTree followed by ClonalFrameML, and outbreak transmission dynamics were inferred using SCOTTI.<h4>Results</h4>Twenty patients harboured KPC-positive isolates (6 infected, 14 colonized), and 23 distinct KPC-producing Enterobacteriaceae were identified. Four distinct KPC plasmids were characterized but of 20 KPC-Kpn (from six STs), 17 isolates shared a single pKpQIL-D2 KPC plasmid. All isolates had an identical transposon (Tn4401a), except one KPC-Kpn (ST661) with a single nucleotide variant. A sporadic case of KPC-Kpn (ST491) with Tn4401a-carrying pKpQIL-D2 plasmid was identified 10 months before the outbreak. This plasmid was later seen in two other species and other KPC-Kpn (ST14,ST661) including clonal spread of KPC-Kpn (ST661) from a symptomatic case to nine ward contacts.<h4>Conclusions</h4>WGS of outbreak KPC isolates demonstrated blaKPC dissemination via horizontal transposition (Tn4401a), plasmid spread (pKpQIL-D2) and clonal spread (K. pneumoniae ST661). Despite rapid outbreak control, considerable dissemination of blaKPC still occurred among K. pneumoniae and other Enterobacteriaceae, emphasizing its high transmission potential and the need for enhanced control efforts.

Also flagged:IL-34toIκB kinase betaIL-34 receptorHDpathogenesis
Journal Article 2017-11-01 ✓ 1 Snippet Khoshnan A, Sabbaugh A, Calamini B, Marinero SA, Dunn DE, Yoo JH, Ko J, Lo DC, Patterson PH.
In-Text Gene Mentions

HTT

Show Full Abstract

Neuronal interleukin-34 (IL-34) promotes the expansion of microglia in the central nervous system-microglial activation and expansion are in turn implicated in the pathogenesis of Huntington's disease (HD). We thus examined whether the accumulation of an amyloidogenic exon-1 fragment of mutant huntingtin (mHTTx1) modulates the expression of IL-34 in dopaminergic neurons derived from a human embryonic stem cell line. We found that mHTTx1 aggregates induce IL-34 production selectively in post-mitotic neurons. Exposure of neurons to DNA damaging agents or the excitotoxin NMDA elicited similar results suggesting that IL-34 induction may be a general response to neuronal stress including the accumulation of misfolded mHTTx1. We further determined that knockdown or blocking the activity of IκB kinase beta (IKKβ) prevented the aggregation of mHTTx1 and subsequent IL-34 production. While elevated IL-34 itself had no effect on the aggregation or the toxicity of mHTTx1 in neuronal culture, IL-34 expression in a rodent brain slice model with intact neuron-microglial networks exacerbated mHTTx1-induced degeneration of striatal medium-sized spiny neurons. Conversely, an inhibitor of the IL-34 receptor reduced microglial numbers and ameliorated mHTTx1-mediated neurodegeneration. Together, these findings uncover a novel function for IKKβ/mHTTx1 interactions in regulating IL-34 production, and implicate a role for IL-34 in non-cell-autonomous, microglial-dependent neurodegeneration in HD.

Also flagged:TMTC3periventricular nodular heterotopiabrain malformationsintellectual disabilityIDepilepsy
Journal Article 2017-11-01 ✓ 1 Snippet Farhan SMK, Nixon KCJ, Everest M, Edwards TN, Long S, Segal D, Knip MJ, Arts HH, Chakrabarti R, Wang J, Robinson JF, Lee D, Mirsattari SM, Rupar CA, Siu VM, FORGE Canada Consortium, Poulter MO, Hegele RA, Kramer JM.
In-Text Gene Mentions

…( 3 ),ARFGEF2(OMIM 608097) (…

Show Full Abstract

Defects in neuronal migration cause brain malformations, which are associated with intellectual disability (ID) and epilepsy. Using exome sequencing, we identified compound heterozygous variants (p.Arg71His and p. Leu729ThrfsTer6) in TMTC3, encoding transmembrane and tetratricopeptide repeat containing 3, in four siblings with nocturnal seizures and ID. Three of the four siblings have periventricular nodular heterotopia (PVNH), a common brain malformation caused by failure of neurons to migrate from the ventricular zone to the cortex. Expression analysis using patient-derived cells confirmed reduced TMTC3 transcript levels and loss of the TMTC3 protein compared to parental and control cells. As TMTC3 function is currently unexplored in the brain, we gathered support for a neurobiological role for TMTC3 by generating flies with post-mitotic neuron-specific knockdown of the highly conserved Drosophila melanogaster TMTC3 ortholog, CG4050/tmtc3. Neuron-specific knockdown of tmtc3 in flies resulted in increased susceptibility to induced seizures. Importantly, this phenotype was rescued by neuron-specific expression of human TMTC3, suggesting a role for TMTC3 in seizure biology. In addition, we observed co-localization of TMTC3 in the rat brain with vesicular GABA transporter (VGAT), a presynaptic marker for inhibitory synapses. TMTC3 is localized at VGAT positive pre-synaptic terminals and boutons in the rat hypothalamus and piriform cortex, suggesting a role for TMTC3 in the regulation of GABAergic inhibitory synapses. TMTC3 did not co-localize with Vglut2, a presynaptic marker for excitatory neurons. Our data identified TMTC3 as a synaptic protein that is involved in PVNH with ID and epilepsy, in addition to its previously described association with cobblestone lissencephaly.

Also flagged:mitochondrial rRNA methyltransferasemitochondrialencephalomyopathystrokecitrullineMELAS) syndrome
Journal Article 2017-11-01 ✓ 2 Snippets Garone C, D'Souza AR, Dallabona C, Lodi T, Rebelo-Guiomar P, Rorbach J, Donati MA, Procopio E, Montomoli M, Guerrini R, Zeviani M, Calvo SE, Mootha VK, DiMauro S, Ferrero I, Minczuk M.
In-Text Gene Mentions

The central nervous system and heart are the most affected tissues with the majority of patients presenting with leukoencephalopathy, for example, TRNT1, TRIT1, NSUN3, TRMT5, DARS2, RARS2, EARS2, MTFMT (14–23) or hypertrophic cardiomyopathy for example, MTO1, ELAC2, GTPBP3, AARS2 (24–27).

…TRIT1, NSUN3, TRMT5,DARS2, RARS2, EARS2, MTFMT…

Show Full Abstract

Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation.

Also flagged:neuroticismchromosomeautismParkinson's diseaseschizophreniaemotional instability
Journal Article 2017-11-01 ✓ 1 Snippet Lo MT, Wang Y, Kauppi K, Sanyal N, Fan CC, Smeland OB, Schork A, Holland D, Hinds DA, Tung JY, Andreassen OA, Dale AM, Chen CH.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Neuroticism reflects emotional instability, and is related to various mental and physical health issues. However, the majority of genetic variants associated with neuroticism remain unclear. Inconsistent genetic variants identified by different genome-wide association studies (GWAS) may be attributable to low statistical power. We proposed a novel framework to improve the power for gene discovery by incorporating prior information of single nucleotide polymorphisms (SNPs) and combining two relevant existing tools, relative enrichment score (RES) and conditional false discovery rate (FDR). Here, SNP's conditional FDR was estimated given its RES based on SNP prior information including linkage disequilibrium (LD)-weighted genic annotation scores, total LD scores and heterozygosity. A known significant locus in chromosome 8p was excluded before estimating FDR due to long-range LD structure. Only one significant LD-independent SNP was detected by analyses of unconditional FDR and traditional GWAS in the discovery sample (N = 59 225), and notably four additional SNPs by conditional FDR. Three of the five SNPs, all identified by conditional FDR, were replicated (P < 0.05) in an independent sample (N = 170 911). These three SNPs are located in intronic regions of CADM2, LINGO2 and EP300 which have been reported to be associated with autism, Parkinson's disease and schizophrenia, respectively. Our approach using a combination of RES and conditional FDR improved power of traditional GWAS for gene discovery providing a useful framework for the analysis of GWAS summary statistics by utilizing SNP prior information, and helping to elucidate the links between neuroticism and complex diseases from a genetic perspective.

Also flagged:FOXOsproteasomeneurodegenerative disorderHDpathogenesisFOXO
Journal Article 2017-11-01 ✓ 3 Snippets Liu Y, Qiao F, Leiferman PC, Ross A, Schlenker EH, Wang H.
In-Text Gene Mentions

When HD NPCs were further differentiated into DARPP32-positive neurons, these HD neurons were more susceptible to death than WT neurons and formed Htt aggregates under the condition of oxidative stress.

…neurons and formedHttaggregates under the…

Htt

Show Full Abstract

Although it has been speculated that proteasome dysfunction may contribute to the pathogenesis of Huntington's disease (HD), a devastating neurodegenerative disorder, how proteasome activity is regulated in HD affected stem cells and somatic cells remains largely unclear. To better understand the pathogenesis of HD, we analyzed proteasome activity and the expression of FOXO transcription factors in three wild-type (WT) and three HD induced-pluripotent stem cell (iPSC) lines. HD iPSCs exhibited elevated proteasome activity and higher levels of FOXO1 and FOXO4 proteins. Knockdown of FOXO4 but not FOXO1 expression decreased proteasome activity. Following neural differentiation, the HD-iPSC-derived neural progenitor cells (NPCs) demonstrated lower levels of proteasome activity and FOXO expressions than their WT counterparts. More importantly, overexpression of FOXO4 but not FOXO1 in HD NPCs dramatically enhanced proteasome activity. When HD NPCs were further differentiated into DARPP32-positive neurons, these HD neurons were more susceptible to death than WT neurons and formed Htt aggregates under the condition of oxidative stress. Similar to HD NPCs, HD-iPSC-derived neurons showed reduced proteasome activity and diminished FOXO4 expression compared to WT-iPSC-derived neurons. Furthermore, HD iPSCs had lower AKT activities than WT iPSCs, whereas the neurons derived from HD iPSC had higher AKT activities than their WT counterparts. Inhibiting AKT activity increased both FOXO4 level and proteasome activity, indicating a potential role of AKT in regulating FOXO levels. These data suggest that FOXOs modulate proteasome activity, and thus represents a potentially valuable therapeutic target for HD.

Also flagged:Huntington DiseaseHDHuntingtonHuntington's Diseaseneurodegenerative disordercytosine
Journal Article 2017-11-01 ✓ 2 Snippets Long JD, Mills JA, Leavitt BR, Durr A, Roos RA, Stout JC, Reilmann R, Landwehrmeyer B, Gregory S, Gregory S, Scahill RI, Langbehn DR, Tabrizi SJ, Track-HD and Track-On Investigators.
In-Text Gene Mentions

Predictive genetic testing in Huntington disease (HD) enables therapeutic trials in HTT gene expansion mutation carriers prior to a motor diagnosis.

HTT

Show Full Abstract

<h4>Importance</h4>Predictive genetic testing in Huntington disease (HD) enables therapeutic trials in HTT gene expansion mutation carriers prior to a motor diagnosis. Progression-free survival (PFS) is the composite of a motor diagnosis or a progression event, whichever comes first.<h4>Objective</h4>To determine if PFS provides feasible sample sizes for trials with mutation carriers who have not yet received a motor diagnosis.<h4>Design, setting, and participants</h4>This study uses data from the 2-phase, longitudinal cohort studies called Track and from a longitudinal cohort study called the Cooperative Huntington Observational Research Trial (COHORT). Track had 167 prediagnosis mutation carriers and 156 noncarriers, whereas COHORT had 366 prediagnosis mutation carriers and noncarriers. Track studies were conducted at 4 sites in 4 countries (Canada, France, England, and the Netherlands) from which data were collected from January 17, 2008, through November 17, 2014. The COHORT was conducted at 38 sites in 3 countries (Australia, Canada, and the United States) from which data were collected from February 14, 2006, through December 31, 2009. Results from the Track data were externally validated with data from the COHORT. The required sample size was estimated for a 2-arm prediagnosis clinical trial. Data analysis took place from May 1, 2016, to June 10, 2017.<h4>Main outcomes and measures</h4>The primary end point is PFS. Huntington disease progression events are defined for the Unified Huntington's Disease Rating Scale total motor score, total functional capacity, symbol digit modalities test, and Stroop word test.<h4>Results</h4>Of Track's 167 prediagnosis mutation carriers, 93 (55.6%) were women, and the mean (SD) age was 40.06 (8.92) years; of the 156 noncarriers, 87 (55.7%) were women, and the mean (SD) age was 45.58 (10.30) years. Of the 366 COHORT participants, 229 (62.5%) were women and the mean (SD) age was 42.21 (12.48) years. The PFS curves of the Track mutation carriers showed good external validity with the COHORT mutation carriers after adjusting for initial progression. For required sample size, PFS with a motor diagnosis or total motor score progression required about 4 times fewer participants than a motor diagnosis alone. Including additional cognitive progression events further reduced the number. For example, a 3-year trial with 10% attrition and a treatment effect of 50% requires a total of 661 with motor diagnosis as the survival end point but only 177 with a total motor score PFS.<h4>Conclusions and relevance</h4>Reasonably sized prediagnosis Huntington disease trials can be planned with PFS, and there is evidence of generalizability of this approach.

Also flagged:chromatinofgene expressionEbf1Pax5organization
Journal Article 2017-11-01 ✓ 2 Snippets Boya R, Yadavalli AD, Nikhat S, Kurukuti S, Palakodeti D, Pongubala JMR.
In-Text Gene Mentions

…Klf4, Vav3 andSox6are found to…

…Klf4, Vav3 andSox6) switch to…

Show Full Abstract

Genome organization in 3D nuclear-space is important for regulation of gene expression. However, the alterations of chromatin architecture that impinge on the B cell-fate choice of multi-potent progenitors are still unclear. By integrating in situ Hi-C analyses with epigenetic landscapes and genome-wide expression profiles, we tracked the changes in genome architecture as the cells transit from a progenitor to a committed state. We identified the genomic loci that undergo developmental switch between A and B compartments during B-cell fate determination. Furthermore, although, topologically associating domains (TADs) are stable, a significant number of TADs display structural alterations that are associated with changes in cis-regulatory interaction landscape. Finally, we demonstrate the potential roles for Ebf1 and its downstream factor, Pax5, in chromatin reorganization and transcription regulation. Collectively, our studies provide a general paradigm of the dynamic relationship between chromatin reorganization and lineage-specific gene expression pattern that dictates cell-fate determination.

Also flagged:pairingCdk5 regulatory subunit associated protein 1-like 1Cdkal1glucosemetabolismtype 2 diabetes
Journal Article 2017-11-01 ✓ 5 Snippets Fakruddin M, Wei FY, Emura S, Matsuda S, Yasukawa T, Kang D, Tomizawa K.
In-Text Gene Mentions

Because this cysteine residue is absolutely required for the enzyme activity of CDK5RAP1 (10), it is likely that the cytosolic CDK5RAP1_v2 cannot modify any RNA species.

Cdk5 regulatory subunit-associated protein 1regulatory subunit-associated …

…subunit-associated protein 1 (Cdk5rap1) is a homolog…

Cdk5rap1contains a mitochondria-target…

Cdk5rap1converts i 6…

Show Full Abstract

2-Methylthio-N6-isopentenyl modification of adenosine (ms2i6A) is an evolutionally conserved modification that is found in transfer RNAs (tRNAs). We have recently shown that Cdk5 regulatory subunit-associated protein 1 (Cdk5rap1) specifically converts i6A to ms2i6A at position A37 of four mitochondrial DNA-encoded tRNAs, and that the modification regulates efficient mitochondrial translation and energy metabolism in mammals. Curiously, a previous study reported that ms2i6A is present abundantly in nuclear-derived RNA species such as microRNAs, but not in tRNA fractions. To fully understand the molecular property of ms2i6A, the existence of non-canonical ms2i6A must be carefully validated. In the present study, we examined ms2i6A in total RNA purified from human and murine ρ0 cells, in which mitochondrial DNA-derived tRNAs were completely depleted. The ms2i6A was not detected in these cells at all. We generated a monoclonal antibody against ms2i6A and examined ms2i6A in murine RNAs using the antibody. The anti-ms2i6A antibody only reacted with the tRNA fractions and not in other RNA species. Furthermore, immunocytochemistry analysis using the antibody showed the predominant localization of ms2i6A in mitochondria and co-localization with the mitochondrial elongation factor Tu. Taken together, we propose that ms2i6A is a mitochondrial tRNA-specific modification and is absent from nuclear-encoded RNA species.

Also flagged:asialoglycoproteinoligonucleotidedegradationnucleasegene silencingexonuclease
Journal Article 2017-11-01 ✓ 1 Snippet Nair JK, Attarwala H, Sehgal A, Wang Q, Aluri K, Zhang X, Gao M, Liu J, Indrakanti R, Schofield S, Kretschmer P, Brown CR, Gupta S, Willoughby JLS, Boshar JA, Jadhav V, Charisse K, Zimmermann T, Fitzgerald K, Manoharan M, Rajeev KG, Akinc A, Hutabarat R, Maier MA.
In-Text Gene Mentions

…the AssayMax HumanATIIIELISA Kit (AssayPro,…

Show Full Abstract

Covalent attachment of a synthetic triantennary N-acetylagalactosamine (GalNAc) ligand to chemically modified siRNA has enabled asialoglycoprotein (ASGPR)-mediated targeted delivery of therapeutically active siRNAs to hepatocytes in vivo. This approach has become transformative for the delivery of RNAi therapeutics as well as other classes of investigational oligonucleotide therapeutics to the liver. For efficient functional delivery of intact drug into the desired subcellular compartment, however, it is critical that the nucleic acids are stabilized against nucleolytic degradation. Here, we compared two siRNAs of the same sequence but with different modification pattern resulting in different degrees of protection against nuclease activity. In vitro stability studies in different biological matrices show that 5'-exonuclease is the most prevalent nuclease activity in endo-lysosomal compartments and that additional stabilization in the 5'-regions of both siRNA strands significantly enhances the overall metabolic stability of GalNAc-siRNA conjugates. In good agreement with in vitro findings, the enhanced stability translated into substantially improved liver exposure, gene silencing efficacy and duration of effect in mice. Follow-up studies with a second set of conjugates targeting a different transcript confirmed the previous results, provided additional insights into kinetics of RISC loading and demonstrated excellent translation to non-human primates.

Also flagged:mitochondriamitochondrial diseasemitochondrial tRNA synthetasesaspartyl-tRNA synthetasewhite matter diseaseleukoencephalopathy
Journal Article 2017-11-01 ✓ 5 Snippets Aradjanski M, Dogan SA, Lotter S, Wang S, Hermans S, Wibom R, Rugarli E, Trifunovic A.
In-Text Gene Mentions

Our results now provide the first evidence that loss of DARS2 in adult neurons leads to strong mitochondrial dysfunction and progressive loss of cells.

Mutations in some of these genes, including aspartyl-tRNA synthetase (DARS2), lead to the onset of a white matter disease-leukoencephalopathy with brainstem and spinal cord involvement, and lactate elevation (LBSL) characterized by progressive spastic ataxia and characteristic leukoencephalopathy signature with multiple long-tract involvements.

DARS2protects against neuroinflamma…

…ing aspartyl-tRNA synthetase (DARS2), lead to the…

…phenotypes caused byDARS2deficiency when numerous…

Show Full Abstract

Although mitochondria are ubiquitous, each mitochondrial disease has surprisingly distinctly different pattern of tissue and organ involvement. Congruently, mutations in genes encoding for different mitochondrial tRNA synthetases result in the development of a very flamboyant group of diseases. Mutations in some of these genes, including aspartyl-tRNA synthetase (DARS2), lead to the onset of a white matter disease-leukoencephalopathy with brainstem and spinal cord involvement, and lactate elevation (LBSL) characterized by progressive spastic ataxia and characteristic leukoencephalopathy signature with multiple long-tract involvements. Puzzled by the white matter disease phenotypes caused by DARS2 deficiency when numerous other mutations in the genes encoding proteins involved in mitochondrial translation have a detrimental effect predominantly on neurons, we generated transgenic mice in which DARS2 was specifically depleted in forebrain-hippocampal neurons or myelin-producing cells. Our results now provide the first evidence that loss of DARS2 in adult neurons leads to strong mitochondrial dysfunction and progressive loss of cells. In contrast, myelin-producing cells seem to be resistant to cell death induced by DARS2 depletion despite robust respiratory chain deficiency arguing that LBSL might originate from the primary neuronal and axonal defect. Remarkably, our results also suggest a role for early neuroinflammation in the disease progression, highlighting the possibility for therapeutic interventions of this process.

Autoimmunity in narcolepsy.

Also flagged:narcolepsyhypocretinimmune responsessleepsleep disordercataplexy
Journal Article 2017-11-01 No Snippets Bonvalet M, Ollila HM, Ambati A, Mignot E.
Show Full Abstract

<h4>Purpose of review</h4>Summarize the recent findings in narcolepsy focusing on the environmental and genetic risk factors in disease development.<h4>Recent findings</h4>Both genetic and epidemiological evidence point towards an autoimmune mechanism in the destruction of orexin/hypocretin neurons. Recent studies suggest both humoral and cellular immune responses in the disease development.<h4>Summary</h4>Narcolepsy is a severe sleep disorder, in which neurons producing orexin/hypocretin in the hypothalamus are destroyed. The core symptoms of narcolepsy are debilitating, extreme sleepiness, cataplexy, and abnormalities in the structure of sleep. Both genetic and epidemiological evidence point towards an autoimmune mechanism in the destruction of orexin/hypocretin neurons. Importantly, the highest environmental risk is seen with influenza-A infection and immunization. However, how the cells are destroyed is currently unknown. In this review we summarize the disease symptoms, and focus on the immunological findings in narcolepsy. We also discuss the environmental and genetic risk factors as well as propose a model for disease development.

Also flagged:cuticular proteinssecretionlensphotoreceptorsextracellularexocytosis
Journal Article 2017-11-01 No Snippets Stahl AL, Baucom RS, Cook TA, Buschbeck EK.
Show Full Abstract

A key innovation for high resolution eyes is a sophisticated lens that precisely focuses light onto photoreceptors. The eyes of holometabolous larvae range from very simple eyes that merely detect light to eyes that are capable of high spatial resolution. Particularly interesting are the bifocal lenses of Thermonectus marmoratus larvae, which differentially focus light on spectrally-distinct retinas. While functional aspects of insect lenses have been relatively well studied, little work has explored their molecular makeup, especially in regard to more complex eye types. To investigate this question, we took a transcriptomic and proteomic approach to identify the major proteins contributing to the principal bifocal lenses of T. marmoratus larvae. Mass spectrometry revealed 10 major lens proteins. Six of these share sequence homology with cuticular proteins, a large class of proteins that are also major components of corneal lenses from adult compound eyes of Drosophila melanogaster and Anopheles gambiae. Two proteins were identified as house-keeping genes and the final two lack any sequence homologies to known genes. Overall the composition seems to follow a pattern of co-opting transparent and optically dense proteins, similar to what has been described for other animal lenses. To identify cells responsible for the secretion of specific lens proteins, we performed in situ hybridization studies and found some expression differences between distal and proximal corneagenous cells. Since the distal cells likely give rise to the periphery and the proximal cells to the center of the lens, our findings highlight a possible mechanism for establishing structural differences that are in line with the bifocal nature of these lenses. A better understanding of lens composition provides insights into the evolution of proper focusing, which is an important step in the transition between low-resolution and high-resolution eyes.

Also flagged:social behaviorsNeuNRare DiseasesimipramineHD 6isopropanol
Journal Article 2017-11-01 ✓ 5 Snippets Alpaugh M, Galleguillos D, Forero J, Morales LC, Lackey SW, Kar P, Di Pardo A, Holt A, Kerr BJ, Todd KG, Baker GB, Fouad K, Sipione S.
In-Text Gene Mentions

HTT

Htt

Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder caused by the pathological expansion of a trinucleotide (CAG) repeat in the gene that codes for huntingtin (HTT) (Group THsDCR 1993).

This mutation results in an abnormally long poly‐glutamine stretch at the N‐terminus of the mutant HTT (mHTT) protein, which in turn causes mHTT to misfold into toxic species and to aggregate.

…codes for huntingtin (HTT) (Group THsDCR 1993…

Show Full Abstract

Huntington's disease (HD) is a progressive neurodegenerative disorder characterized by motor, cognitive and psychiatric problems. Previous studies indicated that levels of brain gangliosides are lower than normal in HD models and that administration of exogenous ganglioside GM1 corrects motor dysfunction in the YAC128 mouse model of HD In this study, we provide evidence that intraventricular administration of GM1 has profound disease-modifying effects across HD mouse models with different genetic background. GM1 administration results in decreased levels of mutant huntingtin, the protein that causes HD, and in a wide array of beneficial effects that include changes in levels of DARPP32, ferritin, Iba1 and GFAP, modulation of dopamine and serotonin metabolism, and restoration of normal levels of glutamate, GABA, L-Ser and D-Ser. Treatment with GM1 slows down neurodegeneration, white matter atrophy and body weight loss in R6/2 mice. Motor functions are significantly improved in R6/2 mice and restored to normal in Q140 mice, including gait abnormalities that are often resistant to treatments. Psychiatric-like and cognitive dysfunctions are also ameliorated by GM1 administration in Q140 and YAC128 mice. The widespread benefits of GM1 administration, at molecular, cellular and behavioural levels, indicate that this ganglioside has strong therapeutic and disease-modifying potential in HD.

Also flagged:OxygenTraumatic Brain InjuryPbtO 2Brain Injuryglucosemetabolism
Journal Article 2017-11-01 No Snippets Okonkwo DO, Shutter LA, Moore C, Temkin NR, Puccio AM, Madden CJ, Andaluz N, Chesnut RM, Bullock MR, Grant GA, McGregor J, Weaver M, Jallo J, LeRoux PD, Moberg D, Barber J, Lazaridis C, Diaz-Arrastia RR.
Show Full Abstract

<h4>Objectives</h4>A relationship between reduced brain tissue oxygenation and poor outcome following severe traumatic brain injury has been reported in observational studies. We designed a Phase II trial to assess whether a neurocritical care management protocol could improve brain tissue oxygenation levels in patients with severe traumatic brain injury and the feasibility of a Phase III efficacy study.<h4>Design</h4>Randomized prospective clinical trial.<h4>Setting</h4>Ten ICUs in the United States.<h4>Patients</h4>One hundred nineteen severe traumatic brain injury patients.<h4>Interventions</h4>Patients were randomized to treatment protocol based on intracranial pressure plus brain tissue oxygenation monitoring versus intracranial pressure monitoring alone. Brain tissue oxygenation data were recorded in the intracranial pressure -only group in blinded fashion. Tiered interventions in each arm were specified and impact on intracranial pressure and brain tissue oxygenation measured. Monitors were removed if values were normal for 48 hours consecutively, or after 5 days. Outcome was measured at 6 months using the Glasgow Outcome Scale-Extended.<h4>Measurements and main results</h4>A management protocol based on brain tissue oxygenation and intracranial pressure monitoring reduced the proportion of time with brain tissue hypoxia after severe traumatic brain injury (0.45 in intracranial pressure-only group and 0.16 in intracranial pressure plus brain tissue oxygenation group; p < 0.0001). Intracranial pressure control was similar in both groups. Safety and feasibility of the tiered treatment protocol were confirmed. There were no procedure-related complications. Treatment of secondary injury after severe traumatic brain injury based on brain tissue oxygenation and intracranial pressure values was consistent with reduced mortality and increased proportions of patients with good recovery compared with intracranial pressure-only management; however, the study was not powered for clinical efficacy.<h4>Conclusions</h4>Management of severe traumatic brain injury informed by multimodal intracranial pressure and brain tissue oxygenation monitoring reduced brain tissue hypoxia with a trend toward lower mortality and more favorable outcomes than intracranial pressure-only treatment. A Phase III randomized trial to assess impact on neurologic outcome of intracranial pressure plus brain tissue oxygenation-directed treatment of severe traumatic brain injury is warranted.

Also flagged:Infectious DiseasesinfectionInfectious DiarrheawaterinfectionsShiga toxin
Journal Article 2017-11-01 ✓ 1 Snippet Shane AL, Mody RK, Crump JA, Tarr PI, Steiner TS, Kotloff K, Langley JM, Wanke C, Warren CA, Cheng AC, Cantey J, Pickering LK.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

These guidelines are intended for use by healthcare professionals who care for children and adults with suspected or confirmed infectious diarrhea. They are not intended to replace physician judgement regarding specific patients or clinical or public health situations. This document does not provide detailed recommendations on infection prevention and control aspects related to infectious diarrhea.

Also flagged:RecQ helicasebindingSSBsingle-stranded DNA binding proteinSingle-stranded DNA binding proteinsdegradation
Journal Article 2017-11-01 ✓ 5 Snippets Mills M, Harami GM, Seol Y, Gyimesi M, Martina M, Kovács ZJ, Kovács M, Neuman KC.
In-Text Gene Mentions

…fluorescence emission ofDCC-SSB is also sensitive…

…The reducedDCC-SSB fluorescence level may…

…between RecQ andDCC-SSB for ssDNA binding,…

…formation of a RecQ.DCC–SSB.ssDNA ternary complex wit…

…to that ofDCC-SSB.ssDNA alone.…

Show Full Abstract

The single-stranded DNA binding protein (SSB) of Escherichia coli plays essential roles in maintaining genome integrity by sequestering ssDNA and mediating DNA processing pathways through interactions with DNA-processing enzymes. Despite its DNA-sequestering properties, SSB stimulates the DNA processing activities of some of its binding partners. One example is the genome maintenance protein RecQ helicase. Here, we determine the mechanistic details of the RecQ-SSB interaction using single-molecule magnetic tweezers and rapid kinetic experiments. Our results reveal that the SSB-RecQ interaction changes the binding mode of SSB, thereby allowing RecQ to gain access to ssDNA and facilitating DNA unwinding. Conversely, the interaction of RecQ with the SSB C-terminal tail increases the on-rate of RecQ-DNA binding and has a modest stimulatory effect on the unwinding rate of RecQ. We propose that this bidirectional communication promotes efficient DNA processing and explains how SSB stimulates rather than inhibits RecQ activity.

Also flagged:NeuroanatomyGene Expressionsbehavioralgene expressionnucleuswater
Journal Article 2017-11-01 No Snippets Lee HJ, Schneider RF, Manousaki T, Kang JH, Lein E, Franchini P, Meyer A.
Show Full Abstract

Lateralized behavior ("handedness") is unusual, but consistently found across diverse animal lineages, including humans. It is thought to reflect brain anatomical and/or functional asymmetries, but its neuro-molecular mechanisms remain largely unknown. Lake Tanganyika scale-eating cichlid fish, Perissodus microlepis show pronounced asymmetry in their jaw morphology as well as handedness in feeding behavior-biting scales preferentially only from one or the other side of their victims. This makes them an ideal model in which to investigate potential laterality in neuroanatomy and transcription in the brain in relation to behavioral handedness. After determining behavioral handedness in P. microlepis (preferred attack side), we estimated the volume of the hemispheres of brain regions and captured their gene expression profiles. Our analyses revealed that the degree of behavioral handedness is mirrored at the level of neuroanatomical asymmetry, particularly in the tectum opticum. Transcriptome analyses showed that different brain regions (tectum opticum, telencephalon, hypothalamus, and cerebellum) display distinct expression patterns, potentially reflecting their developmental interrelationships. For numerous genes in each brain region, their extent of expression differences between hemispheres was found to be correlated with the degree of behavioral lateralization. Interestingly, the tectum opticum and telencephalon showed divergent biases on the direction of up- or down-regulation of the laterality candidate genes (e.g., grm2) in the hemispheres, highlighting the connection of handedness with gene expression profiles and the different roles of these brain regions. Hence, handedness in predation behavior may be caused by asymmetric size of brain hemispheres and also by lateralized gene expressions in the brain.

Also flagged:Paroxetineserotonin transporterserotonin receptor 1APDPanic Disorderpanic attacks
Journal Article 2017-11-01 ✓ 3 Snippets Watanabe T, Ueda M, Ishiguro S, Hayashi Y, Aoki A, Shinozaki M, Kato K, Akiyama K, Shimoda K.
In-Text Gene Mentions

…serotonin (5-HT) transporter (5-HTT), which removes 5-HT…

…The5-HTTgene has been…

…PD patients because5-HTTis the primary…

Show Full Abstract

<h4>Objective</h4>In this study, we investigated the determinants of remission and discontinuation of paroxetine pharmacotherapy in outpatients with panic disorder (PD).<h4>Methods</h4>Subjects were 79 outpatients diagnosed with PD who took 10-40 mg/day of paroxetine for 12 months. The candidate therapeutic determinants included the serotonin transporter gene-linked polymorphic region and the -1019C/G promoter polymorphism of the serotonin receptor 1A as genetic factors, educational background and marital status as environmental factors, and early improvement (EI) at 2 weeks as a clinical factor were assessed. The Clinical Global Impression scale was used to assess the therapeutic effects of the pharmacotherapy.<h4>Results</h4>Cox proportional hazards regression was performed to investigate the significant predictive factors of remission and discontinuation. EI was only a significant predictive factor of remission. EI was a significant predictive factor of remission (hazard ratio [HR], 2.709; 95% confidence interval [CI], 1.177-6.235). Otherwise, EI and marital status were significant predictive factors of the discontinuation. EI (HR, 0.266; 95% CI, 0.115-0.617) and being married (HR, 0.437; 95% CI, 0.204-0.939) were considered to reduce the risk of treatment discontinuation. In married subjects, EI was a significant predictive factor of the discontinuation (HR, 0.160; 95% CI, 0.045-0.565). However, in unmarried subjects, EI was not a significantly predictive factor for the discontinuation.<h4>Conclusion</h4>EI achievement appears to be a determinant of PD remission in paroxetine treatment. In married PD patients, EI achievement also appears to reduce a risk of discontinuation of paroxetine treatment.

Also flagged:transcription factorsneuropsychiatric diseaseArxOlig1Lhx6Met
Journal Article 2017-11-01 ✓ 1 Snippet Hu JS, Vogt D, Sandberg M, Rubenstein JL.
In-Text Gene Mentions

Sox6

Show Full Abstract

Cortical interneurons are a diverse group of neurons that project locally and are crucial for regulating information processing and flow throughout the cortex. Recent studies in mice have advanced our understanding of how these neurons are specified, migrate and mature. Here, we evaluate new findings that provide insights into the development of cortical interneurons and that shed light on when their fate is determined, on the influence that regional domains have on their development, and on the role that key transcription factors and other crucial regulatory genes play in these events. We focus on cortical interneurons that are derived from the medial ganglionic eminence, as most studies have examined this interneuron population. We also assess how these data inform our understanding of neuropsychiatric disease and discuss the potential role of cortical interneurons in cell-based therapies.

Drug and Device News.

Also flagged:Cancerepidermal growth factor receptorHER2metastatic breast cancerfulvestrantInsulin
Journal Article 2017-11-01 No Snippets Unknown Authors
Show Full Abstract

Approvals, new indications, regulatory activities, and more.

Also flagged:anemiadiarrheal diseasesenvironmental enteropathywaterbehavioraldefecation
Journal Article 2017-11-01 No Snippets Briceño B, Coville A, Gertler P, Martinez S.
Show Full Abstract

<h4>Summary</h4>The current evidence on handwashing and sanitation programs suggests limited impacts on health when at-scale interventions have been tested in isolation. However, no published experimental evidence currently exists that tests the interaction effects between sanitation and handwashing. We present the results of two large-scale, government-led handwashing and sanitation promotion campaigns in rural Tanzania, with the objective of tracing the causal chain from hygiene and sanitation promotion to changes in child health outcomes and specifically testing for potential interaction effects of combining handwashing and sanitation interventions.<h4>Methods</h4>The study is a factorial cluster-randomized control trial where 181 rural wards from 10 districts in Tanzania were randomly assigned to receive sanitation promotion, handwashing promotion, both interventions together or neither (control). Interventions were rolled out from February 2009 to June 2011 and the endline survey was conducted from May to November 2012, approximately one year after program completion. The sample was composed of households with children under 5 years old in the two largest villages in each ward. Masking was not possible due to the nature of the intervention, but enumerators played no part in the intervention and were blinded to treatment status. The primary outcome of interest was 7-day diarrhea prevalence for children under five. Intermediate outcomes of behavior change including improved latrine construction, levels of open defecation and handwashing with soap were also analyzed. Secondary health outcomes included anemia, height-for-age and weight-for-age of children under 5. An intention-to-treat analysis was used to assess the relationship between the interventions and outcomes of interest.<h4>Findings</h4>One year after the end of the program, ownership of improved latrines increased from 49.7% to 64.8% (95% CI 57.9%-71.7%) and regular open defecation decreased from 23.1% to 11.1% (95% CI 3.5%-18.7%) in sanitation promotion-only wards. Households in handwashing promotion-only wards showed marginal improvements in handwashing behavior related to food preparation but not at other critical junctures. There were no detectable interaction effects for the combined intervention. The associated cost-per-household gaining access to improved sanitation is estimated to be USD $194. Final effects on child health measured through diarrhea, anemia, stunting and wasting were absent in all treatment groups.<h4>Interpretation</h4>Although statistically significant, the changes in intermediate outcomes achieved through each intervention in isolation were not large enough to generate meaningful health impacts. With no observable signs of interaction, the combined intervention produced similar results. The study highlights the importance of focusing on intermediate outcomes of take up and behavior change as a critical first step in large-scale programs before realizing the changes in health that sanitation and hygiene interventions aim to deliver.<h4>Trial registration</h4>Clinicaltrials.gov NCT01465204.

Also flagged:NS1
Journal Article 2017-11-01 No Snippets Mata VE, Passos SRL, Hökerberg YHM, Berardinelli GM, Dos Santos MAB, Fukuoka LVB, Maciel ACFSR, Dos Santos Rodrigues CD, da Silva Santos A, de Vasconcellos Carvalhaes de Oliveira R.
Show Full Abstract

An error occurred during the publication of the original article [1].

Also flagged:osteoarthritisOAgouty arthritisrheumatoid arthritisknee OAdegradation
Journal Article 2017-11-01 ✓ 2 Snippets Yin CM, Suen WC, Lin S, Wu XM, Li G, Pan XH.
In-Text Gene Mentions

…trio response element (L-SOX5/SOX6/SOX9) and details about…

…transcription factors L-SOX5,SOX6, and SOX9.…

Show Full Abstract

<h4>Objectives</h4>This study looked to analyse the expression levels of microRNA-140-3p and microRNA-140-5p in synovial fluid, and their correlations to the severity of disease regarding knee osteoarthritis (OA).<h4>Methods</h4>Knee joint synovial fluid samples were collected from 45 patients with OA of the knee (15 mild, 15 moderate and 15 severe), ten healthy volunteers, ten patients with gouty arthritis, and ten with rheumatoid arthritis. The Kellgren-Lawrence grading (KLG) was used to assess the radiological severity of knee OA, and the patients were stratified into mild (KLG < 2), moderate (KLG = 2), and severe (KLG > 2). The expression of miR-140-3p and miR-140-5p of individual samples was measured by SYBR Green quantitative polymerase chain reaction (PCR) analysis. The expression of miR-140-3p and miR-140-5p was normalised to U6 internal control using the 2<sup>-△△CT</sup> method. All data were processed using SPSS software.<h4>Results</h4>Expression of both miR-140-3p and miR-140-5p was downregulated in OA synovial fluid, showing a statistical difference between the OA and non-OA group, and increased OA severity was associated with a decreased expression of miR-140-3p or miR-140-5p. The Spearman rank correlation analysis suggested that the expression of miR-140-3p or miR-140-5p was negatively correlated with OA severity. In addition, the expression of miR-140-5p was 7.4 times higher than that of miR-140-3p across all groups.<h4>Conclusion</h4>The dysregulation of miR-140-3p and miR-140-5p in synovial fluid and their correlations with the disease severity of OA may provide an important experimental basis for OA classification, and the miR-140-3p/miR-140-5p are of great potential as biomarkers in the diagnosis and clinical management of patients with OA.<b>Cite this article</b>: C-M. Yin, W-C-W. Suen, S. Lin, X-M. Wu, G. Li, X-H. Pan. Dysregulation of both miR-140-3p and miR-140-5p in synovial fluid correlate with osteoarthritis severity. <i>Bone Joint Res</i> 2017;6:612-618. DOI: 10.1302/2046-3758.611.BJR-2017-0090.R1.

Also flagged:LocalizationExtracellularUNC-5membraneUNC-5 receptoraxon
Journal Article 2017-11-01 ✓ 3 Snippets Limerick G, Tang X, Lee WS, Mohamed A, Al-Aamiri A, Wadsworth WG.
In-Text Gene Mentions

…cue via UNC-40 (DCC) and UNC-5 (UNC5)…

…(UNC5) and UNC-40 (DCC) Netrin Receptors…

DCC

Show Full Abstract

Neurons extend processes that vary in number, length, and direction of "outgrowth". Extracellular cues help determine outgrowth patterns. In <i>Caenorhabditis elegans</i>, neurons respond to the extracellular UNC-6 (netrin) cue via UNC-40 (DCC) and UNC-5 (UNC5) receptors. Previously, we presented evidence that UNC-40 asymmetric localization at the plasma membrane is self-organizing, and that UNC-40 can localize and mediate outgrowth at randomly selected sites. Here, we provide further evidence for a statistically-oriented asymmetric localization (SOAL) model in which UNC-5 receptor activity affects patterns of axon outgrowth by regulating UNC-40 asymmetric localization. According to the SOAL model, the direction of outgrowth activity fluctuates across the membrane over time. Random walk modeling predicts that increasing the degree to which the direction of outgrowth fluctuates will decrease the outward displacement of the membrane. By differentially affecting the degree to which the direction of outgrowth activity fluctuates over time, extracellular cues can produce different rates of outgrowth along the surface and create patterns of "extension". Consistent with the SOAL model, we show that <i>unc-5</i> mutations alter UNC-40 asymmetric localization, increase the degree to which the direction of outgrowth fluctuates, and reduce the extent of outgrowth in multiple directions relative to the source of UNC-6 These results are inconsistent with current models, which predict that UNC-5 mediates a "repulsive" response to UNC-6 Genetic interactions suggest that UNC-5 acts through the UNC-53 (NAV2) cytoplasmic protein to regulate UNC-40 asymmetric localization in response to both the UNC-6 and EGL-20 (Wnt) extracellular cues.

Also flagged:PI3-kinasephagosomedeathmembranephagosomesphagolysosomes
Journal Article 2017-11-01 ✓ 1 Snippet Liu J, Li M, Li L, Chen S, Wang X.
In-Text Gene Mentions

…The ubiquitin ligase Cul3-KLHL20is reported to…

Show Full Abstract

Apoptotic cells generated by programmed cell death are engulfed by phagocytes and enclosed within membrane-bound phagosomes. Maturation of apoptotic cell-containing phagosomes leads to formation of phagolysosomes where cell corpses are degraded. The class III phosphatidylinositol 3-kinase (PI3-kinase) VPS-34 coordinates with PIKI-1, a class II PI3-kinase, to produce PtdIns3P on phagosomes, thus promoting phagosome closure and maturation. Here, we identified UBC-13, an E2 ubiquitin-conjugating enzyme that functions in the same pathway with VPS-34 but in parallel to PIKI-1 to regulate PtdIns3P generation on phagosomes. Loss of <i>ubc-13</i> affects early steps of phagosome maturation, causing accumulation of cell corpses. We found that UBC-13 functions with UEV-1, a noncatalytic E2 variant, and CHN-1, a U-box-containing E3 ubiquitin ligase, to catalyze K63-linked poly-ubiquitination on VPS-34 both in vitro and in <i>Caenorhabditis elegans</i> Loss of <i>ubc-13</i>, <i>uev-1</i>, or <i>chn-1</i> disrupts ubiquitin modification of VPS-34 and causes significantly reduced VPS-34 protein levels. Our data suggest that K63-linked ubiquitin modification serves as a general mechanism to modulate VPS-34 stability in multiple processes.

Also flagged:HSP90polyglutamineubiquitin-specific protease 19USP19deubiquitinating enzymechaperone
Journal Article 2017-11-01 ✓ 5 Snippets He WT, Xue W, Gao YG, Hong JY, Yue HW, Jiang LL, Hu HY.
In-Text Gene Mentions

In the case of misfolded Htt that has not been cleared out in time, the accumulated proteins form insoluble aggregates, sequester molecular chaperones and other interacting partners, and consequently result in cytotoxicity and neurodegeneration in HD pathogenesis.

Htt-N90 consists of an N-terminal 17-residue sequence, a polyQ tract, and a proline-rich region (PRR) in the C-terminus (see Fig. 1a).

Due to their crucial role in HD pathogenesis, polyQ-expanded N-terminal fragments of Htt have been widely used in the related studies.

The pull-down experiment for GST-Htt-N9018Q or GST-Htt-N17118Q with HSP90 was carried out in a Tris-HCl buffer (50 mM Tris, pH 8.0, 150 mM KCl, 5 mM MgCl2, 2 mM DTT, 10% glycerol), while that for GST-Htt-N9018Q or GST-Htt-N9018QM with HSP90 was carried out in another Tris-HCl buffer (50 mM Tris, pH 8.0, 150 mM NaCl, 2 mM DTT, 10% glycerol).

Considering that Htt-N90 is implicated in HD pathogenesis14, this specific interaction with HSP90 is important for quality control of the Htt protein by the HSP90 chaperone system.

Show Full Abstract

Huntington's disease (HD) is caused by aberrant expansion of polyglutamine (polyQ) in the N-terminus of huntingtin (Htt). Our previous study has demonstrated that HSP90 is involved in the triage decision of Htt, but how HSP90 recognizes and regulates Htt remains elusive. We investigated the interaction between HSP90 and the N-terminal fragments of Htt (Htt-N), such as the N-terminal 90-residue fragment (Htt-N90). Our results showed that HSP90 binds to the N-terminal extreme of Htt-N in a sequence just ahead of the polyQ tract. Structural integration of the middle and C-terminal domains of HSP90 is essential for interacting with Htt-N90, and the dimerization mediated by the C-terminal domain facilitates this interaction. Moreover, ubiquitin-specific protease 19 (USP19), a deubiquitinating enzyme interacting with HSP90, up-regulates the protein level of Htt-N90 and consequently promotes its aggregation, whereas disruption of the interaction between Htt-N90 and HSP90 attenuates the effect of USP19 on Htt-N90. Thus, HSP90 interacts with Htt-N90 on the N-terminal amphipathic α-helix, and then recruits USP19 to modulate the protein level and aggregation of Htt-N90. This study provides mechanistic insights into the recognition between HSP90 and the N-terminus of Htt, and the triage decision for the Htt protein by the HSP90 chaperone system.

Also flagged:CDH3exocytosisC1RC1STrisomy 21TNFRSF8
Journal Article 2017-11-01 ✓ 3 Snippets Sullivan KD, Evans D, Pandey A, Hraha TH, Smith KP, Markham N, Rachubinski AL, Wolter-Warmerdam K, Hickey F, Espinosa JM, Blumenthal T.
In-Text Gene Mentions

CA10

SERPINC1

…and the inhibitorSERPINC1(Fig. 3g–i ),…

Show Full Abstract

Trisomy 21 (T21) causes Down syndrome (DS), but the mechanisms by which T21 produces the different disease spectrum observed in people with DS are unknown. We recently identified an activated interferon response associated with T21 in human cells of different origins, consistent with overexpression of the four interferon receptors encoded on chromosome 21, and proposed that DS could be understood partially as an interferonopathy. However, the impact of T21 on systemic signaling cascades in living individuals with DS is undefined. To address this knowledge gap, we employed proteomics approaches to analyze blood samples from 263 individuals, 165 of them with DS, leading to the identification of dozens of proteins that are consistently deregulated by T21. Most prominent among these proteins are numerous factors involved in immune control, the complement cascade, and growth factor signaling. Importantly, people with DS display higher levels of many pro-inflammatory cytokines (e.g. IL-6, MCP-1, IL-22, TNF-α) and pronounced complement consumption, resembling changes seen in type I interferonopathies and other autoinflammatory conditions. Therefore, these results are consistent with the hypothesis that increased interferon signaling caused by T21 leads to chronic immune dysregulation, and justify investigations to define the therapeutic value of immune-modulatory strategies in DS.

Also flagged:ironacute lymphoblastic leukemiaALLminimal residual diseasecancermalignant disease
Journal Article 2017-11-01 ✓ 2 Snippets Moafi A, Ziaie M, Abedi M, Rahgozar S, Reisi N, Nematollahi P, Moafi H.
In-Text Gene Mentions

…leukemia with ahemochromatosisgene, which causes…

…analysis of thehemochromatosisgenes according to…

Show Full Abstract

Iron is an intracellular element whose accumulation in the body is associated with tissue damage. This study examines the effect of iron on pediatric acute lymphoblastic leukemia (ALL) and its "response to treatment." At the end of the first year of treatment, bone marrow iron store (BMIS) was evaluated in children with ALL and the relationship between iron store and minimal residual disease was investigated. Moreover, the 3-year disease-free survival (3-DFS) of patients was determined. Patients' BMIS were compared with that of subjects with normal bone marrow. The study examined 93 children, including 78 Pre-B and 15 T-cell ALL patients. BMIS did not differ between the children with ALL and those with no evidence of cancer. BMIS was increased in 26.6% of patients at the end of the first year of treatment. Drug resistance and BM relapses were more prevalent in cases with high BMIS in both Pre-B and T-cell groups. Bone marrow iron store is not considered a risk factor for childhood ALL. However, high levels of BMIS are associated with poor response to treatment and the risk of relapse. Bone marrow iron store control during treatment can therefore help achieve better outcomes and improve the chances of recovery.

Also flagged:translation initiationtranslationalpathogenesisneurodegenerative disordersdeathnucleotide
Journal Article 2017-11-01 No Snippets Kapur M, Monaghan CE, Ackerman SL.
Show Full Abstract

Dynamic regulation of mRNA translation initiation and elongation is essential for the survival and function of neural cells. Global reductions in translation initiation resulting from mutations in the translational machinery or inappropriate activation of the integrated stress response may contribute to pathogenesis in a subset of neurodegenerative disorders. Aberrant proteins generated by non-canonical translation initiation may be a factor in the neuron death observed in the nucleotide repeat expansion diseases. Dysfunction of central components of the elongation machinery, such as the tRNAs and their associated enzymes, can cause translational infidelity and ribosome stalling, resulting in neurodegeneration. Taken together, dysregulation of mRNA translation is emerging as a unifying mechanism underlying the pathogenesis of many neurodegenerative disorders.

Also flagged:NeurexinSynapsesjunctionsNeurexinssynapsebinding
Journal Article 2017-11-01 No Snippets Südhof TC.
Show Full Abstract

Synapses are specialized junctions between neurons in brain that transmit and compute information, thereby connecting neurons into millions of overlapping and interdigitated neural circuits. Here, we posit that the establishment, properties, and dynamics of synapses are governed by a molecular logic that is controlled by diverse trans-synaptic signaling molecules. Neurexins, expressed in thousands of alternatively spliced isoforms, are central components of this dynamic code. Presynaptic neurexins regulate synapse properties via differential binding to multifarious postsynaptic ligands, such as neuroligins, cerebellin/GluD complexes, and latrophilins, thereby shaping the input/output relations of their resident neural circuits. Mutations in genes encoding neurexins and their ligands are associated with diverse neuropsychiatric disorders, especially schizophrenia, autism, and Tourette syndrome. Thus, neurexins nucleate an overall trans-synaptic signaling network that controls synapse properties, which thereby determines the precise responses of synapses to spike patterns in a neuron and circuit and which is vulnerable to impairments in neuropsychiatric disorders.

Also flagged:genetic diseasesguaninecytosinesSTRnucleotidechromosomes
Journal Article 2017-11-01 ✓ 1 Snippet Tang H, Kirkness EF, Lippert C, Biggs WH, Fabani M, Guzman E, Ramakrishnan S, Lavrenko V, Kakaradov B, Hou C, Hicks B, Heckerman D, Och FJ, Caskey CT, Venter JC, Telenti A.
In-Text Gene Mentions

Huntington disease is caused by an expansion of the CAG repeats in the first exon of the Huntingtin gene (HTT [MIM: 613004]).

Show Full Abstract

Short tandem repeats (STRs) are hyper-mutable sequences in the human genome. They are often used in forensics and population genetics and are also the underlying cause of many genetic diseases. There are challenges associated with accurately determining the length polymorphism of STR loci in the genome by next-generation sequencing (NGS). In particular, accurate detection of pathological STR expansion is limited by the sequence read length during whole-genome analysis. We developed TREDPARSE, a software package that incorporates various cues from read alignment and paired-end distance distribution, as well as a sequence stutter model, in a probabilistic framework to infer repeat sizes for genetic loci, and we used this software to infer repeat sizes for 30 known disease loci. Using simulated data, we show that TREDPARSE outperforms other available software. We sampled the full genome sequences of 12,632 individuals to an average read depth of approximately 30× to 40× with Illumina HiSeq X. We identified 138 individuals with risk alleles at 15 STR disease loci. We validated a representative subset of the samples (n = 19) by Sanger and by Oxford Nanopore sequencing. Additionally, we validated the STR calls against known allele sizes in a set of GeT-RM reference cell-line materials (n = 6). Several STR loci that are entirely guanine or cytosines (G or C) have insufficient read evidence for inference and therefore could not be assayed precisely by TREDPARSE. TREDPARSE extends the limit of STR size detection beyond the physical sequence read length. This extension is critical because many of the disease risk cutoffs are close to or beyond the short sequence read length of 100 to 150 bases.

Also flagged:polycythemiaoxygenheart failurechronic mountain sicknessresponse to hypoxiaBRINP3
Journal Article 2017-11-01 ✓ 1 Snippet Crawford JE, Amaru R, Song J, Julian CG, Racimo F, Cheng JY, Guo X, Yao J, Ambale-Venkatesh B, Lima JA, Rotter JI, Stehlik J, Moore LG, Prchal JT, Nielsen R.
In-Text Gene Mentions

SHISA6

Show Full Abstract

The increase in red blood cell mass (polycythemia) due to the reduced oxygen availability (hypoxia) of residence at high altitude or other conditions is generally thought to be beneficial in terms of increasing tissue oxygen supply. However, the extreme polycythemia and accompanying increased mortality due to heart failure in chronic mountain sickness most likely reduces fitness. Tibetan highlanders have adapted to high altitude, possibly in part via the selection of genetic variants associated with reduced polycythemic response to hypoxia. In contrast, high-altitude-adapted Quechua- and Aymara-speaking inhabitants of the Andean Altiplano are not protected from high-altitude polycythemia in the same way, yet they exhibit other adaptive features for which the genetic underpinnings remain obscure. Here, we used whole-genome sequencing to scan high-altitude Andeans for signals of selection. The genes showing the strongest evidence of selection-including BRINP3, NOS2, and TBX5-are associated with cardiovascular development and function but are not in the response-to-hypoxia pathway. Using association mapping, we demonstrated that the haplotypes under selection are associated with phenotypic variations related to cardiovascular health. We hypothesize that selection in response to hypoxia in Andeans could have vascular effects and could serve to mitigate the deleterious effects of polycythemia rather than reduce polycythemia itself.

Also flagged:Edoxabanvenous thromboembolismprotein Cprotein Swarfarinsynthesis
Journal Article 2017-11-01 No Snippets Yamazaki H, Yagi S, Torii Y, Amano R, Oomichi Y, Sangawa T, Fukuda D, Kadota M, Ise T, Ueno R, Hara T, Kusunose K, Matsuura T, Tobiume T, Yamaguchi K, Yamada H, Soeki T, Wakatsuki T, Akaike M, Sata M.
Show Full Abstract

<h4>Background</h4>It is well known that warfarin inhibits the synthesis of vitamin K-dependent anticoagulants, including thrombin, protein C and S, and factor Xa, leading, paradoxically, to an initial hypercoagulable state. Edoxaban, a direct inhibitor of activated factor X is widely used for the treatment of acute venous thromboembolism (VTE). However, the effect of edoxaban on circulating coagulation factors, in patients with acute VTE, remains unknown.<h4>Methods and results</h4>We enrolled 57 patients with acute VTE with/without pulmonary embolism treated with edoxaban (n=37) or warfarin (n=20) in a clinical setting. Before treatment and 2 weeks after treatment, we evaluated thrombotic burden using ultrasound or computed tomography angiography. We also evaluated thrombin generation, represented by prothrombin fragment F1+2; thrombus degradation, represented by D-dimer; and levels of anticoagulants, including protein C, protein S, and antithrombin III. Both edoxaban and warfarin treatment improved thrombotic burden and decreased prothrombin fragment F1+2, and D-dimer. Edoxaban treatment preserved protein C and protein S levels. In contrast, warfarin decreased protein C and protein S levels. Neither treatment affected antithrombin III.<h4>Conclusions</h4>Edoxaban improves VTE while preserving protein C and protein S levels, thereby indicating that edoxaban improves thrombotic burden while maintaining levels of anticoagulants.

Also flagged:natural killer cell proliferationOX40OX40Lcell activationactivationhepatoblastoma
Journal Article 2017-11-01 No Snippets Pollmann J, Götz JJ, Rupp D, Strauss O, Granzin M, Grünvogel O, Mutz P, Kramer C, Lasitschka F, Lohmann V, Björkström NK, Thimme R, Bartenschlager R, Cerwenka A.
Show Full Abstract

<h4>Background & aims</h4>Natural killer (NK) cells are found at increased frequencies in patients with hepatitis C virus (HCV). NK cell activation has been shown to correlate with HCV clearance and to predict a favourable treatment response. The aim of our study was to dissect mechanisms leading to NK cell activation and proliferation in response to HCV.<h4>Methods</h4>NK cell phenotype, proliferation, and function were assessed after the 6-day co-culture of human peripheral blood mononuclear cells with either HCV replicon-containing HuH6 hepatoblastoma cells or HCV-infected HuH7.5 cells. The results obtained were confirmed by immunohistochemistry of liver biopsies from patients with HCV and from HCV-negative controls.<h4>Results</h4>In HCV-containing co-cultures, a higher frequency of NK cells upregulated the expression of the high-affinity IL-2 receptor chain CD25, proliferated more rapidly, and produced higher amounts of interferon γ compared with NK cells from control co-cultures. This NK cell activation was dependent on IL-2, cell-cell contact-mediated signals, and HCV replicon-exposed monocytes. The tumour necrosis factor-receptor superfamily member OX40 was induced on the activated CD25<sup>±</sup> NK cell subset and this induction was abrogated by the depletion of CD14<sup>+</sup> monocytes. Moreover, OX40L was upregulated on CD14<sup>±</sup> monocyte-derived cells co-cultured with HCV-containing cells and also observed in liver biopsies from patients with HCV. Importantly, blocking of the OX40/OX40L interaction abolished both NK cell activation and proliferation.<h4>Conclusions</h4>Our results uncover a previously unappreciated cell-cell contact-mediated mechanism of NK cell activation and proliferation in response to HCV, mediated by monocyte-derived cells and the OX40/OX40L axis. These results reveal a novel mode of crosstalk between innate immune cells during viral infection.<h4>Lay summary</h4>Using a cell-culture model of hepatitis C virus (HCV) infection, our study revealed that natural killer (NK) cells become activated and proliferate when they are co-cultured with HCV-containing liver cells. The mechanism of this activation involves crosstalk with other innate immune cells and a cell-cell contact interaction mediated by the cell surface molecules OX40 and OX40L. Our study reveals a novel pathway leading to NK cell proliferation and activation against virus-infected cells that might be of relevance in antiviral immunity.

Also flagged:nucleotidescytochrome P-450CYPCYP2C9CYP2C19warfarin
Journal Article 2017-11-01 No Snippets Weinshilboum RM, Wang L.
Show Full Abstract

Pharmacogenomics is the use of genomic and other "omic" information to individualize drug selection and drug use to avoid adverse drug reactions and to maximize drug efficacy. The science underlying pharmacogenomics has evolved rapidly over the 50 years since it was first suggested that genetics might influence drug response phenotypes. That process has occurred in parallel with advances in DNA sequencing and other molecular technologies, with striking increases in our understanding of the human genome. There are now many validated examples of the clinical utility of pharmacogenomics, and this type of clinical genomic information is increasingly being generated in clinical laboratories, incorporated into electronic health records, and used to "tailor" or individualize drug therapy. This review will survey the origins and development of pharmacogenomics; it will address some of the challenges associated with the clinical implementation of pharmacogenomics; and it will attempt to foresee future advances in this important genomic discipline, one that almost certainly will be among the earliest and most widely adopted aspects of clinical genomics.

Also flagged:PeptidemalariaantibodyprolineCSPMSA1
Journal Article 2017-11-01 No Snippets Lozano JM, Varela Y, Silva Y, Ardila K, Forero M, Guasca L, Guerrero Y, Bermudez A, Alba P, Vanegas M, Patarroyo ME.
Show Full Abstract

Rational strategies for obtaining malaria vaccine candidates should include not only a proper selection of target antigens for antibody stimulation, but also a versatile molecular design based on ordering the right pieces from the complex pathogen molecular puzzle towards more active and functional immunogens. Classical <i>Plasmodium falciparum</i> antigens regarded as vaccine candidates have been selected as model targets in this study. Among all possibilities we have chosen epitopes of <i>Pf</i>CSP, STARP; MSA1 and <i>Pf</i>155/RESA from pre- and erythrocyte stages respectively for designing a large 82-residue chimeric immunogen. A number of options aimed at diminishing steric hindrance for synthetic procedures were assessed based on standard Fmoc chemistry such as building block orthogonal ligation; pseudo-proline and microwave-assisted procedures, therefore the large-chimeric target was produced, characterized and immunologically tested. Antigenicity and functional in vivo efficacy tests of the large-chimera formulations administered alone or as antigen mixtures have proven the stimulation of high antibody titers, showing strong correlation with protection and parasite clearance of vaccinated BALB/c mice after being lethally challenged with both <i>P. berghei</i>-ANKA and <i>P. yoelii</i> 17XL malaria strains. Besides, 3D structure features shown by the large-chimera encouraged as to propose using these rational designed large synthetic molecules as reliable vaccine candidate-presenting systems.

Also flagged:Cell wallintercellular spacescell wallsdeathmonosaccharidesoligosaccharides
Journal Article 2017-11-01 No Snippets Leite DCC, Grandis A, Tavares EQP, Piovezani AR, Pattathil S, Avci U, Rossini A, Cambler A, De Souza AP, Hahn MG, Buckeridge MS.
Show Full Abstract

<h4>Background and aims</h4>Aerenchyma develops in different plant organs and leads to the formation of intercellular spaces that can be used by the plant to transport volatile substances. Little is known about the role of cell walls in this process, although the mechanism of aerenchyma formation is known to involve programmed cell death and some cell wall modifications. We assessed the role that cell wall-related mechanisms might play in the formation of aerenchyma in sugarcane roots.<h4>Methods</h4>Sections of roots (5 cm) were subjected to microtomography analysis. These roots were divided into 1-cm segments and subjected to cell wall fractionation. We performed analyses of monosaccharides, oligosaccharides and lignin and glycome profiling. Sections were visualized by immunofluorescence and immunogold labelling using selected monoclonal antibodies against polysaccharide epitopes according to the glycome profiles.<h4>Key results</h4>During aerenchyma formation, gas spaces occupied up to 40 % of the cortex cross-section within the first 5 cm of the root. As some of the cortex cells underwent dissolution of the middle lamellae, leading to cell separation, cell expansion took place along with cell death. Mixed-linkage β-glucan was degraded along with some homogalacturonan and galactan, culminating in the formation of cell wall composites made of xyloglucan, arabinoxylans, cellulose and possibly lignin.<h4>Conclusion</h4>The composites formed seem to play a role in the physical-chemical properties of the gas chambers, providing mechanical resistance to forces acting upon the root and at the same time decreasing permeability to gases.

Also flagged:behavioralhypersensitivitymental health disordersbehavioral disordersschizophreniadepression
Journal Article 2017-11-01 ✓ 3 Snippets Walker DM, Bell MR, Flores C, Gulley JM, Willing J, Paul MJ.
In-Text Gene Mentions

DCC

DCC receptors

DCC receptor

Show Full Abstract

Adolescence is a time of significant neural and behavioral change with remarkable development in social, emotional, and cognitive skills. It is also a time of increased exploration and risk-taking (e.g., drug use). Many of these changes are thought to be the result of increased reward-value coupled with an underdeveloped inhibitory control, and thus a hypersensitivity to reward. Perturbations during adolescence can alter the developmental trajectory of the brain, resulting in long-term alterations in reward-associated behaviors. This review highlights recent developments in our understanding of how neural circuits, pubertal hormones, and environmental factors contribute to adolescent-typical reward-associated behaviors with a particular focus on sex differences, the medial prefrontal cortex, social reward, social isolation, and drug use. We then introduce a new approach that makes use of natural adaptations of seasonally breeding species to investigate the role of pubertal hormones in adolescent development. This research has only begun to parse out contributions of the many neural, endocrine, and environmental changes to the heightened reward sensitivity and increased vulnerability to mental health disorders that characterize this life stage.

Also flagged:gene expressionFriedreich's ataxiaprotein synthesisneurodegenerative diseaseFRDAFrataxin
Journal Article 2017-11-01 ✓ 2 Snippets Napierala JS, Li Y, Lu Y, Lin K, Hauser LA, Lynch DR, Napierala M.
In-Text Gene Mentions

…PRDX family member,PRDX6, is also…

PRDX6additionally functions in…

Show Full Abstract

Friedreich's ataxia (FRDA) is an autosomal recessive neurodegenerative disease usually caused by large homozygous expansions of GAA repeat sequences in intron 1 of the frataxin (<i>FXN</i>) gene. FRDA patients homozygous for GAA expansions have low <i>FXN</i> mRNA and protein levels when compared with heterozygous carriers or healthy controls. Frataxin is a mitochondrial protein involved in iron-sulfur cluster synthesis, and many FRDA phenotypes result from deficiencies in cellular metabolism due to lowered expression of <i>FXN</i> Presently, there is no effective treatment for FRDA, and biomarkers to measure therapeutic trial outcomes and/or to gauge disease progression are lacking. Peripheral tissues, including blood cells, buccal cells and skin fibroblasts, can readily be isolated from FRDA patients and used to define molecular hallmarks of disease pathogenesis. For instance, <i>FXN</i> mRNA and protein levels as well as <i>FXN</i> GAA-repeat tract lengths are routinely determined using all of these cell types. However, because these tissues are not directly involved in disease pathogenesis, their relevance as models of the molecular aspects of the disease is yet to be decided. Herein, we conducted unbiased RNA sequencing to profile the transcriptomes of fibroblast cell lines derived from 18 FRDA patients and 17 unaffected control individuals. Bioinformatic analyses revealed significantly upregulated expression of genes encoding plasma membrane solute carrier proteins in FRDA fibroblasts. Conversely, the expression of genes encoding accessory factors and enzymes involved in cytoplasmic and mitochondrial protein synthesis was consistently decreased in FRDA fibroblasts. Finally, comparison of genes differentially expressed in FRDA fibroblasts to three previously published gene expression signatures defined for FRDA blood cells showed substantial overlap between the independent datasets, including correspondingly deficient expression of antioxidant defense genes. Together, these results indicate that gene expression profiling of cells derived from peripheral tissues can, in fact, consistently reveal novel molecular pathways of the disease. When performed on statistically meaningful sample group sizes, unbiased global profiling analyses utilizing peripheral tissues are critical for the discovery and validation of FRDA disease biomarkers.

Also flagged:MelanomamelanomastumortumorsBRAFNRAS
Journal Article 2017-11-01 ✓ 1 Snippet Garman B, Anastopoulos IN, Krepler C, Brafford P, Sproesser K, Jiang Y, Wubbenhorst B, Amaravadi R, Bennett J, Beqiri M, Elder D, Flaherty KT, Frederick DT, Gangadhar TC, Guarino M, Hoon D, Karakousis G, Liu Q, Mitra N, Petrelli NJ, Schuchter L, Shannan B, Shields CL, Wargo J, Wenz B, Wilson MA, Xiao M, Xu W, Xu X, Yin X, Zhang NR, Davies MA, Herlyn M, Nathanson KL.
In-Text Gene Mentions

DCC

Show Full Abstract

Tumor-sequencing studies have revealed the widespread genetic diversity of melanoma. Sequencing of 108 genes previously implicated in melanomagenesis was performed on 462 patient-derived xenografts (PDXs), cell lines, and tumors to identify mutational and copy number aberrations. Samples came from 371 unique individuals: 263 were naive to treatment, and 108 were previously treated with targeted therapy (34), immunotherapy (54), or both (20). Models of all previously reported major melanoma subtypes (BRAF, NRAS, NF1, KIT, and WT/WT/WT) were identified. Multiple minor melanoma subtypes were also recapitulated, including melanomas with multiple activating mutations in the MAPK-signaling pathway and chromatin-remodeling gene mutations. These well-characterized melanoma PDXs and cell lines can be used not only as reagents for a large array of biological studies but also as pre-clinical models to facilitate drug development.

Also flagged:gene expressiontranslational-relatedmTORneurogenesismTORC1
Journal Article 2017-11-01 ✓ 1 Snippet Blair JD, Hockemeyer D, Doudna JA, Bateup HS, Floor SN.
In-Text Gene Mentions

STAU1

Show Full Abstract

Faithful cellular differentiation requires temporally precise activation of gene expression programs, which are coordinated at the transcriptional and translational levels. Neurons express the most complex set of mRNAs of any human tissue, but translational changes during neuronal differentiation remain incompletely understood. Here, we induced forebrain neuronal differentiation of human embryonic stem cells (hESCs) and measured genome-wide RNA and translation levels with transcript-isoform resolution. We found that thousands of genes change translation status during differentiation without a corresponding change in RNA level. Specifically, we identified mTOR signaling as a key driver for elevated translation of translation-related genes in hESCs. In contrast, translational repression in active neurons is mediated by regulatory sequences in 3' UTRs. Together, our findings identify extensive translational control changes during human neuronal differentiation and a crucial role of 3' UTRs in driving cell-type-specific translation.

Also flagged:neurodegenerative diseasesnucleotidetranslation initiationpeptideC9ORF72ALS
Journal Article 2017-11-01 No Snippets Gao FB, Richter JD, Cleveland DW.
Show Full Abstract

Eukaryotic translation is tightly regulated to ensure that protein production occurs at the right time and place. Recent studies on abnormal repeat proteins, especially in age-dependent neurodegenerative diseases caused by nucleotide repeat expansion, have highlighted or identified two forms of unconventional translation initiation: usage of AUG-like sites (near cognates) or repeat-associated non-AUG (RAN) translation. We discuss how repeat proteins may differ due to not just unconventional initiation, but also ribosomal frameshifting and/or imperfect repeat DNA replication, expansion, and repair, and we highlight how research on translation of repeats may uncover insights into the biology of translation and its contribution to disease.

Also flagged:acute liver failurecholelithiasisviral hepatitisacetaminophenautoimmune hepatitisischemic hepatopathy
Journal Article 2017-11-01 ✓ 2 Snippets Dalal KK, Holdbrook T, Peikin SR.
In-Text Gene Mentions

…serologies and negativeHFEgene mutation.…

…There was noHFEgene mutation detected.…

Show Full Abstract

Drug induced liver injury is responsible for 50% of acute liver failure in developed countries. Ayurvedic and homeopathic medicine have been linked to liver injury. This case describes the first documented case of Punarnava mandur and Kanchnar guggulu causing drug induced liver injury. Drug induced liver injury may be difficult to diagnosis, but use of multi-modalities tools including the ACG algorithms, causative assessment scales, histological findings, and imaging, is recommended. Advanced imaging, such as magnetic resonance cholangiopancreatography, may possibly have a greater role than previously reported in literature.

Also flagged:ExocytosismembranelysosomesSNAP-29matrix metalloproteasedystroglycan
Journal Article 2017-11-01 ✓ 2 Snippets Naegeli KM, Hastie E, Garde A, Wang Z, Keeley DP, Gordon KL, Pani AM, Kelley LC, Morrissey MA, Chi Q, Goldstein B, Sherwood DR.
In-Text Gene Mentions

…und that UNC-6(netrin)/UNC-40(DCC) signaling at the…

DCC

Show Full Abstract

Invasive cells use small invadopodia to breach basement membrane (BM), a dense matrix that encases tissues. Following the breach, a large protrusion forms to clear a path for tissue entry by poorly understood mechanisms. Using RNAi screening for defects in Caenorhabditis elegans anchor cell (AC) invasion, we found that UNC-6(netrin)/UNC-40(DCC) signaling at the BM breach site directs exocytosis of lysosomes using the exocyst and SNARE SNAP-29 to form a large protrusion that invades vulval tissue. Live-cell imaging revealed that the protrusion is enriched in the matrix metalloprotease ZMP-1 and transiently expands AC volume by more than 20%, displacing surrounding BM and vulval epithelium. Photobleaching and genetic perturbations showed that the BM receptor dystroglycan forms a membrane diffusion barrier at the neck of the protrusion, which enables protrusion growth. Together these studies define a netrin-dependent pathway that builds an invasive protrusion, an isolated lysosome-derived membrane structure specialized to breach tissue barriers.

Also flagged:carcinomatumorgrowth-differentiation factor 11GDF11E-cadherininhibitor of differentiation 2
Journal Article 2017-11-01 ✓ 1 Snippet Bajikar SS, Wang CC, Borten MA, Pereira EJ, Atkins KA, Janes KA.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Triple-negative breast cancer (TNBC) is an aggressive and heterogeneous carcinoma in which various tumor-suppressor genes are lost by mutation, deletion, or silencing. Here we report a tumor-suppressive mode of action for growth-differentiation factor 11 (GDF11) and an unusual mechanism of its inactivation in TNBC. GDF11 promotes an epithelial, anti-invasive phenotype in 3D triple-negative cultures and intraductal xenografts by sustaining expression of E-cadherin and inhibitor of differentiation 2 (ID2). Surprisingly, clinical TNBCs retain the GDF11 locus and expression of the protein itself. GDF11 bioactivity is instead lost because of deficiencies in its convertase, proprotein convertase subtilisin/kexin type 5 (PCSK5), causing inactive GDF11 precursor to accumulate intracellularly. PCSK5 reconstitution mobilizes the latent TNBC reservoir of GDF11 in vitro and suppresses triple-negative mammary cancer metastasis to the lung of syngeneic hosts. Intracellular GDF11 retention adds to the concept of tumor-suppressor inactivation and reveals a cell-biological vulnerability for TNBCs lacking therapeutically actionable mutations.

Also flagged:Sec61membraneendoplasmic reticulumtransloconpolypeptideorganelles
Journal Article 2017-11-01 No Snippets Lang S, Pfeffer S, Lee PH, Cavalié A, Helms V, Förster F, Zimmermann R.
Show Full Abstract

The membrane of the endoplasmic reticulum (ER) of nucleated human cells harbors the protein translocon, which facilitates membrane integration or translocation of almost every newly synthesized polypeptide targeted to organelles of the endo- and exocytotic pathway. The translocon comprises the polypeptide-conducting Sec61 channel and several additional proteins and complexes that are permanently or transiently associated with the heterotrimeric Sec61 complex. This ensemble of proteins facilitates ER targeting of precursor polypeptides, modification of precursor polypeptides in transit through the Sec61 complex, and Sec61 channel gating, i.e., dynamic regulation of the pore forming subunit to mediate precursor transport and calcium efflux. Recently, cryoelectron tomography of translocons in native ER membrane vesicles, derived from human cell lines or patient fibroblasts, and even intact cells has given unprecedented insights into the architecture and dynamics of the native translocon and the Sec61 channel. These structural data are discussed in light of different Sec61 channel activities including ribosome receptor function, membrane insertion, and translocation of newly synthesized polypeptides as well as the putative physiological roles of the Sec61 channel as a passive ER calcium leak channel. Furthermore, the structural insights into the Sec61 channel are incorporated into an overview and update on Sec61 channel-related diseases-the Sec61 channelopathies-and novel therapeutic concepts for their treatment.

Also flagged:SynapsesJNKneuropeptidesvesiclessynapseSynaptotagmin-4
Journal Article 2017-11-01 No Snippets Bharat V, Siebrecht M, Burk K, Ahmed S, Reissner C, Kohansal-Nodehi M, Steubler V, Zweckstetter M, Ting JT, Dean C.
Show Full Abstract

Delivery of neurotrophins and neuropeptides via long-range trafficking of dense core vesicles (DCVs) from the cell soma to nerve terminals is essential for synapse modulation and circuit function. But the mechanism by which transiting DCVs are captured at specific sites is unknown. Here, we discovered that Synaptotagmin-4 (Syt4) regulates the capture and spatial distribution of DCVs in hippocampal neurons. We found that DCVs are highly mobile and undergo long-range translocation but switch directions only at the distal ends of axons, revealing a circular trafficking pattern. Phosphorylation of serine 135 of Syt4 by JNK steers DCV trafficking by destabilizing Syt4-Kif1A interaction, leading to a transition from microtubule-dependent DCV trafficking to capture at en passant presynaptic boutons by actin. Furthermore, neuronal activity increased DCV capture via JNK-dependent phosphorylation of the S135 site of Syt4. Our data reveal a mechanism that ensures rapid, site-specific delivery of DCVs to synapses.

Also flagged:HDinclusion bodiespathogenesisneurodegenerative diseasesHuntingtons Disease
Journal Article 2017-11-01 ✓ 3 Snippets Hosp F, Gutiérrez-Ángel S, Schaefer MH, Cox J, Meissner F, Hipp MS, Hartl FU, Klein R, Dudanova I, Mann M.
In-Text Gene Mentions

…the huntingtin (HTT) gene, which…

…including endogenous mouseHtt( Figure S4…

…EndogenousHttwas also recruited…

Show Full Abstract

Aggregation of polyglutamine-expanded huntingtin exon 1 (HttEx1) in Huntington's disease (HD) proceeds from soluble oligomers to late-stage inclusions. The nature of the aggregates and how they lead to neuronal dysfunction is not well understood. We employed mass spectrometry (MS)-based quantitative proteomics to dissect spatiotemporal mechanisms of neurodegeneration using the R6/2 mouse model of HD. Extensive remodeling of the soluble brain proteome correlated with insoluble aggregate formation during disease progression. In-depth and quantitative characterization of the aggregates uncovered an unprecedented complexity of several hundred proteins. Sequestration to aggregates depended on protein expression levels and sequence features such as low-complexity regions or coiled-coil domains. In a cell-based HD model, overexpression of a subset of the sequestered proteins in most cases rescued viability and reduced aggregate size. Our spatiotemporally resolved proteome resource of HD progression indicates that widespread loss of cellular protein function contributes to aggregate-mediated toxicity.

Also flagged:antibodyPCSK9cholesterolProProtein Convertase Subtilisin/Kexin 9LDL-ReceptorsLDL-R
Journal Article 2017-11-01 No Snippets Wallemacq C.
Show Full Abstract

Evolocumab is a fully human monoclonal antibody (mAb) targeting ProProtein Convertase Subtilisin/Kexin 9 (PCSK9). PCSK9 is a circulating enzyme secreted by the liver and plays a key role in the LDL-Receptors (LDL-R) turnover. Binding of PCSK9 on the extracellular part of LDL-R is responsible for its degradation in the lysosome instead of its recycling to the cell surface, thereby producing a reduction in the number of LDL-R on the cell surface, a decreased LDL-C uptake and increased levels of LDL-C. Inhibiting PCSK9 is a new way to markedly reduce LDL-C. The development of mAbs that bind the extracellular PCSK9 and prevent its interaction with LDL-R is the most advanced and tested approach to PCSK9 inhibition to date. The clinical efficacy and safety of evolocumab have been studied in a number of controlled trials versus placebo or versus active comparator (ézétimibe) during 12 to 76 weeks. Added on statin, evolocumab reduced LDL-C up to 50 to 60 % from baseline. Evolocumab also reduced LCL-C in monotherapy in statin-intolerant patients. Evolocumab also significally reduced total cholesterol, non-HDL cholesterol, apoprotein B and lipoprotein(a). Safety and tolerance were good. Evolocumab is commercialized under the trade name Repatha® and administrated subcutaneously at the dose of 140 mg every 2 weeks or 420 mg once per month. Repatha® is approved in Belgium, with conditions, for the treatment of hypercholesterolemia in patients with heterozygous (HFe) and homozygous (HFo) familial hypercholesterolemia.

Also flagged:intellectual disabilityneurogenesiscinnarizinepotassium channelpsychiatric disordersautoimmune disorders
Journal Article 2017-11-01 No Snippets Lam M, Trampush JW, Yu J, Knowles E, Davies G, Liewald DC, Starr JM, Djurovic S, Melle I, Sundet K, Christoforou A, Reinvang I, DeRosse P, Lundervold AJ, Steen VM, Espeseth T, Räikkönen K, Widen E, Palotie A, Eriksson JG, Giegling I, Konte B, Roussos P, Giakoumaki S, Burdick KE, Payton A, Ollier W, Chiba-Falek O, Attix DK, Need AC, Cirulli ET, Voineskos AN, Stefanis NC, Avramopoulos D, Hatzimanolis A, Arking DE, Smyrnis N, Bilder RM, Freimer NA, Cannon TD, London E, Poldrack RA, Sabb FW, Congdon E, Conley ED, Scult MA, Dickinson D, Straub RE, Donohoe G, Morris D, Corvin A, Gill M, Hariri AR, Weinberger DR, Pendleton N, Bitsios P, Rujescu D, Lahti J, Le Hellard S, Keller MC, Andreassen OA, Deary IJ, Glahn DC, Malhotra AK, Lencz T.
Show Full Abstract

Here, we present a large (n = 107,207) genome-wide association study (GWAS) of general cognitive ability ("g"), further enhanced by combining results with a large-scale GWAS of educational attainment. We identified 70 independent genomic loci associated with general cognitive ability. Results showed significant enrichment for genes causing Mendelian disorders with an intellectual disability phenotype. Competitive pathway analysis implicated the biological processes of neurogenesis and synaptic regulation, as well as the gene targets of two pharmacologic agents: cinnarizine, a T-type calcium channel blocker, and LY97241, a potassium channel inhibitor. Transcriptome-wide and epigenome-wide analysis revealed that the implicated loci were enriched for genes expressed across all brain regions (most strongly in the cerebellum). Enrichment was exclusive to genes expressed in neurons but not oligodendrocytes or astrocytes. Finally, we report genetic correlations between cognitive ability and disparate phenotypes including psychiatric disorders, several autoimmune disorders, longevity, and maternal age at first birth.

Also flagged:Dusialic acidischemiasynthesisnanoparticlesPEG
Journal Article 2017-11-01 No Snippets Hu JB, Song GL, Liu D, Li SJ, Wu JH, Kang XQ, Qi J, Jin FY, Wang XJ, Xu XL, Ying XY, Yu L, You J, Du YZ.
Show Full Abstract

In an attempt to improve therapeutic efficacy of dexamethasone (DXM)-loaded solid lipid nanoparticles (NPs) for renal ischemia-reperfusion injury (IRI)-induced acute renal injury (AKI), sialic acid (SA) is used as a ligand to target the inflamed vascular endothelium. DXM-loaded SA-conjugated polyethylene glycol (PEG)ylated NPs (SA-NPs) are prepared via solvent diffusion method and show the good colloidal stability. SA-NPs reduce apoptotic human umbilical vein endothelial cells (HUVECs) via downregulating oxidative stress-induced Bax, upregulating Bcl-xL, and inhibiting Caspase-3 and Caspase-9 activation. Cellular uptake results suggest SA-NPs can be specifically internalized by the inflamed vascular endothelial cells (H<sub>2</sub>O<sub>2</sub>-pretreated HUVECs), and the mechanism is associated with the specific binding between SA and E-selectin receptor expressed on the inflamed vascular endothelial cells. Bio-distribution results further demonstrated the enhanced renal accumulation of DXM is achieved in AKI mice treated with SA-NPs, and its content is 2.70- and 5.88-fold higher than those treated with DXM and NPs at 6 h after intravenous administration, respectively. Pharmacodynamic studies demonstrate SA-NPs effectively ameliorate renal functions in AKI mice, as reflected by improved blood biochemical indexes, histopathological changes, oxidative stress levels and pro-inflammatory cytokines. Moreover, SA-NPs cause little negative effects on lymphocyte count and bone mineral density while DXM leads to severe osteoporosis. It is concluded that SA-NPs provide an efficient and targeted delivery of DXM for ischemia-reperfusion-induced injury-induced AKI, with improved therapeutic outcomes and reduced adverse effects.

Also flagged:lipopolysaccharidecytoskeletonorganizationinfections ofchronic obstructive pulmonary diseaseCOPD
Journal Article 2017-11-01 ✓ 1 Snippet D'Anna C, Cigna D, Di Sano C, Di Vincenzo S, Dino P, Ferraro M, Bini L, Bianchi L, Di Gaudio F, Gjomarkaj M, Pace E.
In-Text Gene Mentions

…2 (PSME2), Peroxiredoxin-6 (PRDX6), Annexin A5 (ANXA5)…

Show Full Abstract

The integrity of the respiratory epithelium is crucial for airway homeostasis. Tobacco smoke exposure and recurrent infections of the airways play a crucial role in the progression and in the decline of the respiratory function in chronic obstructive pulmonary disease (COPD). The aim of this study was to detect differentially expressed proteins in a bronchial epithelial cell line (16-HBE) stimulated with cigarette smoke extract (CSE) and lipopolysaccharide (LPS), a constituent of gram-negative bacteria, alone and/or in combination, by using two-dimensional electrophoresis (2DE) analysis coupled with matrix-assisted laser desorption/ionization time-of-flight mass spectrometry. Western blot analysis was applied to confirm the expression of significantly modulated proteins. Flow cytometry and immunofluorescence were used to assess F-actin polimerization by phalloidin method. Fourteen proteins, with significant (p < 0.05) changes in intensity, were identified at various experimental points: 6 were up-regulated and 8 were down-regulated. As expected, bioinformatic analysis revealed that most of these proteins are involved in anti-oxidant and immune responses and in cytoskeleton stability. Western blot analysis confirmed that: Proteasome activator complex subunit 2 (PSME2), Peroxiredoxin-6 (PRDX6), Annexin A5 (ANXA5) and Heat shock protein beta-1 (HSPB1) were reduced and Coactosin-like protein (COTL-1) was increased by co-exposure of CSE and LPS. Furthermore, LPS and CSE increased actin polimerization. In conclusion, although further validation studies are needed, our findings suggest that, CSE and LPS could contribute to the progressive deterioration of lung function, altering the expression of proteins involved in metabolic processes and cytoskeleton rearrangement in bronchial epithelial cells.

Also flagged:colorectal cancerscolorectal cancercolon cancerprimary tumorprimarytumor
Journal Article 2017-11-01 ✓ 2 Snippets Liu SS, Shi Q, Li HJ, Yang W, Han SS, Zong SQ, Li W, Hou FG.
In-Text Gene Mentions

In addition, RSCC was more commonly associated with RAS and BRAF mutations, a high CpG island methylator phenotype, mutagenic metabolites of cytochrome p450, MAPK signaling and MSI, whereas LSCRC was associated with APC, K-ras, DCC, p53 mutant EGFR signaling, Wnt signaling and HER1 and HER2 amplification which played a vital role in cancer generation and progression[21-24].

…with APC, K-ras,DCC, p53 mutant EGFR…

Show Full Abstract

<h4>Aim</h4>To explore the differences in the responses of left-sided colorectal cancer (LSCRC) and right-sided colon cancer (RSCC) to traditional Chinese medicine (TCM).<h4>Methods</h4>Patients with postoperative stage I-III colorectal cancer (CRC) were enrolled and divided into the LSCRC with or without TCM and RSCC with or without TCM groups depending on the primary tumor side and TCM administration. Patients in the TCM group were given TCM for at least 6 mo. Our research adopted disease-free survival (DFS) as the primary endpoint. We applied a Cox proportional hazards regression model for the multivariate factor analysis using Stata 12.0 and SPSS 22.0 software for data analysis.<h4>Results</h4>Of the 817 patients included in our study, 617 had LSCRC (TCM group, <i>n</i> = 404; Non-TCM group, <i>n</i> = 213), and 200 had RSCC (TCM group, <i>n =</i> 132; Non-TCM group, <i>n</i> = 68). The 6-year DFS for patients with LSCRC was 56.95% in the TCM group and 41.50% in the Non-TCM group (<i>P</i> = 0.000). For patients with RSCC, the 6-year DFS was 52.92% in the TCM group and 37.19% in the Non-TCM group (<i>P</i> = 0.003). Differences between LSCRC and RSCC were not statistically significant regardless of TCM ingestion.<h4>Conclusion</h4>Patients with either LSCRC or RSCC and who took TCM experienced longer DFS; furthermore, patients with RSCC benefited more from TCM in DFS.

Also flagged:Adhesion Regulating Molecule 1HAP40deathHuntington's diseasemitochondrialHuntingtin-associated protein 40
Journal Article 2017-11-01 ✓ 5 Snippets Huang ZN, Chung HM, Fang SC, Her LS.
In-Text Gene Mentions

Our previous studies have shown that overexpression of HAP40 impairs proteasome activity and increases accumulation of mutant Htt in the striatal HD model cells 24.

The onset of HD is linked to an expansion of the CAG repeats in interesting transcript 15 (IT15) gene that leads to an abnormally long poly glutamine (PolyQ) tract at the N-terminus of the encoded huntingtin (Htt) protein 12.

…interaction of mutantHttwith Drp1 increases…

…the encoded huntingtin (Htt) protein 12 .…

…stretch of mutantHtthas been shown…

Show Full Abstract

Striatal neuron death in Huntington's disease is associated with abnormal mitochondrial dynamics and functions. However, the mechanisms for this mitochondrial dysregulation remain elusive. Increased accumulation of Huntingtin-associated protein 40 (HAP40) has been shown to be associated with Huntington's disease. However, the link between increased HAP40 and Huntington's disease remains largely unknown. Here we show that HAP40 overexpression causes mitochondrial dysfunction and reduces cell viability in the immortalized mouse striatal neurons. HAP40-associated mitochondrial dysfunction is associated with reduction of adhesion regulating molecule 1 (ADRM1) protein. Consistently, depletion of ADRM1 by shRNAs impaired mitochondrial functions and increased mitochondrial fragmentation in mouse striatal cells. Moreover, reducing ADRM1 levels enhanced activity of fission factor dynamin-related GTPase protein 1 (Drp1) via increased phosphorylation at serine 616 of Drp1 (Drp1<sup>Ser616</sup>). Restoring ADRM1 protein levels was able to reduce HAP40-induced ROS levels and mitochondrial fragmentation and improved mitochondrial functions and cell viability. Moreover, reducing Drp1 activity by Drp1 inhibitor, Mdivi-1, ameliorates both HAP40 overexpression- and ADRM1 depletion-induced mitochondrial dysfunction. Taken together, our studies suggest that HAP40-mediated reduction of ADRM1 alters the mitochondrial fission activity and results in mitochondrial fragmentation and mitochondrial dysfunction.

Also flagged:peptidemitochondrialdeathgentamicingeranylgeranylacetonelactic-co
Journal Article 2017-11-01 No Snippets Kuang X, Zhou S, Guo W, Wang Z, Sun Y, Liu H.
Show Full Abstract

Aminoglycoside-induced hearing loss stems from damage or loss of mechanosensory hair cells in the inner ear. Intrinsic mitochondrial cell death pathway plays a key role in that cellular dysfunction for which no proven effective therapies against oto-toxicities exist. Therefore, the aim of the present study was to develop a new mitochondrial targeting drug delivery system (DDS) that provided improved protection from gentamicin. Particularly, SS-31 peptide-conjugated geranylgeranylacetone (GGA) loaded poly(lactic-co-glycolic acid) (PLGA) nanoparticles were constructed successfully via emulsion-solvent evaporation method. The zebrafish lateral line sensory system was used as an in vivo evaluating platform to investigate the protective efficiency against gentamicin. SS-31 modification significantly reduced the activity of mechanoelectrical transduction (MET) channel and gentamicin uptake in zebrafish lateral line hair cells. As expected, SS-31 conjugated nanoparticles showed mitochondrial specific accumulation in hair cells when compared with unconjugated formulations. Furthermore, intracellular SS-31 modified PLGA NPs slightly enhanced mitochondrial membrane potential (MMP, ΔΨ<sub>m</sub>) and then returned to a steady-state, indicating their effect on the respiratory chain complexes in mitochondria. GGA loaded SS-31 conjugated nanoparticles demonstrated the most favorable hair cells survivals against gentamicin when compared with unconjugated groups whereas blank formulations failed to exhibit potency, indicating that the efficiency was attributed to drug delivery of GGA. These results suggest that our constructed mitochondria-targeting PLGA based DDS have potential application in protecting hair cells from ototoxic agents.

Also flagged:CAPN5antibodyADNIVproteolysisdegradationtoll like receptor 4
Journal Article 2017-11-01 ✓ 2 Snippets Wang Y, Zhang X, Song Z, Gu F.
In-Text Gene Mentions

It also has been found that in neurodegenerative Huntington’s disease, CAPN5 is abnormally activated regulator for proteolytic of htt protein in neural cell death [8].

…for proteolytic ofhttprotein in neural…

Show Full Abstract

<i>CAPN5</i> has been linked to autosomal dominant neovascular inflammatory vitreoretinopathy (ADNIV). Activation of CAPN5 may increase proteolysis and degradation of a wide range of substrates to induce degeneration in the retina and the nerve system. Thus, we developed an inhibitory intracellular single chain variable fragment (scFv) against CAPN5 as a potential way to rescue degeneration in ADNIV disease or in neuronal degeneration. We report that overexpression CAPN5 increases the levels of the auto-inflammatory factors toll like receptor 4 (TLR4), interleukin 1 alpha (IL1alpha), tumor necrosis factor alpha (TNFalpha) and activated caspase 3 in 661W photoreceptor-like cells and SHSY5Y neuronal-like cells. Both C4 and C8 scFvs specifically recognize human/mouse CAPN5 in 661W cells and SHSY5Y cells, moreover, both the C4 and C8 scFvs protected cells from CAPN5-induced apoptosis by reducing the levels of activated caspase 3 and caspase 9. The cellular expression C4 scFv reduced levels of the pro-inflammatory factor IL1-alpha activated caspase 3 in cells after CAPN5 overexpression. We suggest that CAPN5 expression has important functional consequences in auto-inflammatory processes, and apoptosis in photoreceptor like cells and neural-like cells. Importantly, the specific intracellular targeting of antibody fragments blocking activation of CAPN5 act as inhibitors of CAPN5 functions in neural like cells, thus, our data provides a novel potential tool for therapy in CAPN5-mediated ADNIV or neurodegenerative diseases.

Also flagged:coagulationH-type hypertensionH- type hypertensionHHacute ischemic strokeCRP
Journal Article 2017-11-01 ✓ 1 Snippet Zhou F, Zhou L, Guo T, Wang N, Hao H, Zhou Y, Yu D.
In-Text Gene Mentions

…The DEPs includedantithrombin-III(AT-3), fibrinogen gamma…

Show Full Abstract

Systematic profiling of a larger portion of circulating plasma proteome provide opportunities for unbiased discovery of novel markers to improve diagnostic, therapeutic, or predictive accuracy. This study aimed to identify differentially expressed proteins (DEPs) in plasma that could provide overall insight into the molecular changes of both H- type hypertension (HH) and HH-related acute ischemic stroke (AIS). This study used an iTRAQ-based LC-MS/MS proteomics approach to screen for plasma DEPs in HH patients with and without AIS, and controls. After excluding highly abundant plasma proteins, more than 600 proteins, and their relative levels, were identified. Of these, 26 DEPs, each showing > 1.2-fold change, were identified in HH and HH-related AIS patients compared with controls. Bioinformatics analysis revealed that these DEPs were enriched in 21 functional gene ontology items; "blood coagulation" was the most predominant pathway showing enrichment. Of these, eight DEPs were located in the hub position of networks involved with protein-protein interactions. AT-3, CRP, ApoB, and AHSG were further validated in each group by enzyme-linked immune sorbent assays. Comparing HH-related AIS with HH, the areas under the curve for AT-3, CRP, ApoB, and AHSG were 0.698, 0.892, 0.626, and 0.847, respectively. This proteomic profiling study provided enhanced pathophysiological understanding of the regulatory processes involved in coagulation, inflammation, and metabolism, and identified a panel of novel biomarkers for detecting HH-related AIS during its pre-stroke stage.

Also flagged:Cardiactransthyretin-related (ATTR) amyloidosiscardiomyopathyATTR amyloidosis
Journal Article 2017-11-01 ✓ 1 Snippet Kollikowski AM, Kahles F, Kintsler S, Hamada S, Reith S, Knüchel R, Röcken C, Mottaghy FM, Marx N, Burgmaier M.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Cardiac transthyretin-related (ATTR) amyloidosis is a severe cardiomyopathy for which therapeutic approaches are currently under development. Because non-invasive imaging techniques such as cardiac magnetic resonance imaging and echocardiography are non-specific, the diagnosis of ATTR amyloidosis is still based on myocardial biopsy. Thus, diagnosis of ATTR amyloidosis is difficult in patients refusing myocardial biopsy. Furthermore, myocardial biopsy does not allow 3D-mapping and quantification of myocardial ATTR amyloid. In this report we describe a <sup>99m</sup>Tc-DPD-based molecular imaging technique for non-invasive single-step diagnosis, three-dimensional mapping and semiquantification of cardiac ATTR amyloidosis in a patient with suspected amyloid heart disease who initially rejected myocardial biopsy. This report underlines the clinical value of SPECT-based nuclear medicine imaging to enable non-invasive diagnosis of cardiac ATTR amyloidosis, particularly in patients rejecting biopsy.

Also flagged:AmintopChe1Colorectal CancerMAFresidual tumor
Journal Article 2017-11-01 ✓ 2 Snippets Liu HE, Triboulet M, Zia A, Vuppalapaty M, Kidess-Sigal E, Coller J, Natu VS, Shokoohi V, Che J, Renier C, Chan NH, Hanft VR, Jeffrey SS, Sollier-Christen E.
In-Text Gene Mentions

…(FLICE), CDC27, CTNNB1,DCC, DMD, EP300, ERBB2…

…including ATM, BRAF,DCC, and SMAD4 were…

Show Full Abstract

Genomic characterization of circulating tumor cells (CTCs) may prove useful as a surrogate for conventional tissue biopsies. This is particularly important as studies have shown different mutational profiles between CTCs and ctDNA in some tumor subtypes. However, isolating rare CTCs from whole blood has significant hurdles. Very limited DNA quantities often can't meet NGS requirements without whole genome amplification (WGA). Moreover, white blood cells (WBC) germline contamination may confound CTC somatic mutation analyses. Thus, a good CTC enrichment platform with an efficient WGA and NGS workflow are needed. Here, Vortex label-free CTC enrichment platform was used to capture CTCs. DNA extraction was optimized, WGA evaluated and targeted NGS tested. We used metastatic colorectal cancer (CRC) as the clinical target, HCT116 as the corresponding cell line, GenomePlex® and REPLI-g as the WGA methods, GeneRead DNAseq Human CRC Panel as the 38 gene panel. The workflow was further validated on metastatic CRC patient samples, assaying both tumor and CTCs. WBCs from the same patients were included to eliminate germline contaminations. The described workflow performed well on samples with sufficient DNA, but showed bias for rare cells with limited DNA input. REPLI-g provided an unbiased amplification on fresh rare cells, enabling an accurate variant calling using the targeted NGS. Somatic variants were detected in patient CTCs and not found in age matched healthy donors. This demonstrates the feasibility of a simple workflow for clinically relevant monitoring of tumor genetics in real time and over the course of a patient's therapy using CTCs.

Also flagged:Acute Kidney InjurySeptic ShocksepsisalbuminIL-6IL-10
Journal Article 2017-11-01 ✓ 1 Snippet Shum HP, Chan KC, Yan WW, Chan TM.
In-Text Gene Mentions

…albumin (66 kDa),antithrombin-III(60 kDa), protein…

Show Full Abstract

<h4>Introduction</h4>Extracorporeal blood purification therapies have been proposed to improve outcomes of patients with severe sepsis, with or without accompanying acute kidney injury (AKI), by removal of excessive inflammatory mediators.<h4>Materials and methods</h4>We report our experience with EMiC2 high-cutoff continuous venovenous hemofiltration/hemodialysis (HCO-CVVH/HD) in seven patients with AKI complicating septic shock.<h4>Results</h4>The median treatment duration was 71 h, and the procedure was well tolerated. Trough serum albumin level of 20 g/L was observed after 2 h of treatment and none of the patients required albumin supplement. The hospital mortality rate was 29%, which appeared more favorable than the predicted mortality of 60%-78% based on disease severity scores. Circulating levels of interleukin-6 (IL-6), IL-10, and tumor necrosis factor-alpha improved over time.<h4>Conclusion</h4>This case series shows that HCO-CVVH/CVVHD using EMiC2 hemofilter may provide good cytokine modulation, when used along with good quality standard sepsis therapy. A further large-scale prospective randomized controlled trial is recommended.

Also flagged:PPARGbindingtype 2 diabetesobesityinsulin resistancecardiovascular diseases
Journal Article 2017-11-01 No Snippets Kamble PG, Gustafsson S, Pereira MJ, Lundkvist P, Cook N, Lind L, Franks PW, Fall T, Eriksson JW, Ingelsson E.
Show Full Abstract

<h4>Aim</h4>To assess practical implications of genotype-based recall (GBR) studies, an increasingly popular approach for in-depth characterization of genotype-phenotype relationships.<h4>Methods</h4>We genotyped 2500 participants from the Swedish EpiHealth cohort and considered loss-of-function and missense variants in genes with relation to cardiometabolic traits as the basis for our GBR study. Therefore, we focused on carriers and non-carriers of the PPARG Pro12Ala (rs1801282) variant, as it is a relatively common variant with a minor allele frequency (MAF) of 0.14. It has also been shown to affect ligand binding and transcription, and carriage of the minor allele (Ala12) is associated with a reduced risk of type 2 diabetes. We re-invited 39 Pro12Pro, 34 Pro12Ala, and 30 Ala12Ala carriers and performed detailed anthropometric and serological assessments.<h4>Results</h4>The participation rates in the GBR study were 31%, 44%, and 40%, and accordingly we included 12, 15, and 13 individuals with Pro12Pro, Pro12Ala, and Ala12Ala variants, respectively. There were no differences in anthropometric or metabolic variables among the different genotype groups.<h4>Conclusions</h4>Our report highlights that from a practical perspective, GBR can be used to study genotype-phenotype relationships. This approach can prove to be a valuable tool for follow-up findings from large-scale genetic discovery studies by undertaking detailed phenotyping procedures that might not be feasible in large studies. However, our study also illustrates the need for a larger pool of genotyped or sequenced individuals to allow for selection of rare variants with larger effects that can be examined in a GBR study of the present size.

Also flagged:waterpolystyrenesynthesispolymerpolydimethylsiloxaneoxygen
Journal Article 2017-11-01 No Snippets Park K, Park J, Jung JH, Destgeer G, Ahmed H, Sung HJ.
Show Full Abstract

Droplets in microfluidic systems can contain microscale objects such as cells and microparticles. The control of the positions of microscale objects within a microchannel is crucial for practical applications in not only continuous-flow-based but also droplet-based systems. This paper proposes an active method for the separation of microparticles inside moving droplets which uses travelling surface acoustic waves (TSAWs). We demonstrate the preconcentration and separation of 5 and 10 <i>μ</i>m polystyrene microparticles in moving water-in-oil droplets through the application of TSAWs with two different frequencies. The microparticles inside the droplets are affected by the acoustic radiation force induced by the TSAWs to move laterally in the direction of the TSAW propagation and are thereby separated according to their size. In-droplet separation is then demonstrated through droplet splitting at a Y-junction. Compared to our previous studies, this acoustic approach offers the label-free and on-demand separation of different-sized micro-objects in moving droplets. The present method has potential uses such as in-droplet sample purification and enrichment.

Also flagged:heart failurechronic liver diseasecirrhotic cardiomyopathyalcoholic cardiomyopathystresscardiomyopathy
Journal Article 2017-11-01 ✓ 1 Snippet Tandon M, Karna ST, Pandey CK, Chaturvedi R.
In-Text Gene Mentions

…like amylodosis andhemochromatosis(45%).…

Show Full Abstract

Heart failure (HF) following liver transplant (LT) surgery is a distinct clinical entity with high mortality. It is known to occur in absence of obvious risk factors. No preoperative workup including electrocardiogram, echocardiography at rest and on stress, reasonably prognosticates the risk. In patients of chronic liver disease, cirrhotic cardiomyopathy, alcoholic cardiomyopathy, and stress induced cardiomyopathy have each been implicated as a cause for HF after LT. However distinguishing one etiology from another not only is difficult, several etiologies may possibly coexist in a given patient. Diagnostic dilemma is further compounded by the fact that presentation and management of HF irrespective of the possible underlying cause, remains the same. In this case series, 6 cases are presented and in the light of existing literature modification in the preoperative workup are suggested.

Also flagged:AKT3serous ovarian cancerbenign tumorsmalignant tumorbenign tumortumor
Journal Article 2017-11-01 No Snippets Yeganeh PN, Richardson C, Bahrani-Mostafavi Z, Tait DL, Mostafavi MT.
Show Full Abstract

Screening methods of High-Grade Serous Ovarian Cancer (HGSOC) lack specificity and sensitivity, partly due to benign tumors producing false-positive findings. We utilized a differential expression analysis pipeline on malignant tumor (MT) and normal epithelial (NE) samples, and also filtered the results to discriminate between MT and benign tumor (BT). We report that a panel of 26 dysregulated genes stratifies MT from both BT and NE. We further validated our findings by utilizing unsupervised clustering methods on two independent datasets. We show that the 26-genes panel completely distinguishes HGSOC from NE, and produces a more accurate classification between HGSOC and BT. Pathway analysis reveals that AKT3 is of particular significance, because of its high fold change and appearance in the majority of the dysregulated pathways. mRNA patterns of AKT3 suggest essential connections with tumor growth and metastasis, as well as a strong biomarker potential when used with 3 other genes (PTTG1, MND1, CENPF). Our results show that dysregulation of the 26-mRNA signature panel provides an evidence of malignancy and contribute to the design of a high specificity biomarker panel for detection of HGSOC, potentially in an early more curable stage.

Also flagged:mineralmineralscell wallcarbohydratescellulosehemicelluloses
Journal Article 2017-11-01 No Snippets Otegbayo BO, Oguniyan DJ, Olunlade BA, Oroniran OO, Atobatele OE.
Show Full Abstract

The aim of this study was to characterize 43 genotypes from five yam species [<i>Dioscorea rotundata</i> (Poir), <i>Dioscorea alata</i> (Linn), <i>Dioscorea bulbifera</i> (Linn), <i>Dioscorea cayenensis</i> (Lam) and <i>Dioscorea dumetorum</i> (Kunith) Pax] which are major land races in Nigeria in terms of their chemical composition, nutritional, anti-nutritional and mineral bioavailability. Findings showed that there was genotypic variation in terms of chemical composition, mineral profile and bioavailability of the minerals among the germplasm. <i>D. bulbifera</i> had the highest cell wall carbohydrates, (cellulose: 3.2%, hemicelluloses, 2.1%, lignin, 1.1%, acid detergent fibre (ADF) 3.2%, neutral detergent fibre (NDF) 6.4%), <i>D. rotundata</i> had the highest oxalate (606 mg/kg). In conclusion, intra and inter-species variations exist among the yam germplasm in terms of their chemical composition, anti-nutritional and mineral bioavailability. Phytate content of the yam genotypes did not affect the bioavailability of Zn but Ca was affected significantly. The Ox:Ca ratio in most of the yam varieties were below one, thus bioavailability of Ca in yam by oxalate is variety dependent.

Also flagged:Wilson diseaseWDosteoarthritisATP7Bgenetic disordercopper
Journal Article 2017-11-01 ✓ 1 Snippet Ye S, Dai T, Leng B, Tang L, Jin L, Cao L.
In-Text Gene Mentions

…WD, ochronosis, orhemochromatosistake up an…

Show Full Abstract

<h4>Rationale</h4>Premature osteoarthritis (POA) is a rare condition in Wilson disease (WD). Particularly, when POA is the only complaint of a WD patient for a long time, there would be misdiagnosis or missed diagnosis and then treatment delay.<h4>Patient concerns and diagnosis</h4>Two Chinese Han siblings were diagnosed as WD by corneal K-F rings, laboratory test, and mutation analysis. They presented with isolated POA during the first 2 decades or more of their disease course, and were of missed diagnosis during that long time. The older affected sib became disabled due to his severe osteoarthritis when he was as young as 38 years old. Two compound heterozygous pathogenic variants c.2790_2792del and c.2621C>T were revealed in the ATP7B gene through targeted next-generation sequencing (NGS).<h4>Lessons</h4>Adolescent-onset POA could be the only complaint of WD individual for at least 2 decades. Long delay in the treatment of WD's POA could lead to disability in early adulthood. Detailed physical examination, special biochemical test, and genotyping through targeted NGS should greatly reduce diagnosis delay in atypical WD patients with isolated POA phenotype.

Also flagged:ADgenetic diseasesgene expressionAlzheimer DiseaseAPOEEGFR
Journal Article 2017-11-01 No Snippets Liu Q, Chen C, Gao A, Tong HH, Xie L, Alzheimer’s Disease Neuroimaging Initiative.
Show Full Abstract

It is a grand challenge to reveal the causal effects of DNA variants in complex phenotypes. Although statistical techniques can establish correlations between genotypes and phenotypes in Genome-Wide Association Studies (GWAS), they often fail when the variant is rare. The emerging Network-based Association Studies aim to address this shortcoming in statistical analysis, but are mainly applied to coding variations. Increasing evidences suggest that non-coding variants play critical roles in the etiology of complex diseases. However, few computational tools are available to study the effect of rare non-coding variants on phenotypes. Here we have developed a multiscale modeling variant-to-function-to-network framework VariFunNet to address these challenges. VariFunNet first predict the functional variations of molecular interactions, which result from the non-coding variants. Then we incorporate the genes associated with the functional variation into a tissue-specific gene network, and identify subnetworks that transmit the functional variation to molecular phenotypes. Finally, we quantify the functional implication of the subnetwork, and prioritize the association of the non-coding variants with the phenotype. We have applied VariFunNet to investigating the causal effect of rare non-coding variants on Alzheimer's disease (AD). Among top 21 ranked causal non-coding variants, 16 of them are directly supported by existing evidences. The remaining 5 novel variants dysregulate multiple downstream biological processes, all of which are associated with the pathology of AD. Furthermore, we propose potential new drug targets that may modulate diverse pathways responsible for AD. These findings may shed new light on discovering new biomarkers and therapies for the prevention, diagnosis, and treatment of AD. Our results suggest that multiscale modeling is a potentially powerful approach to studying causal genotype-phenotype associations.

Also flagged:immune responseasthmaOX40 ligandluciferaseOX40LOX40
Journal Article 2017-11-01 ✓ 1 Snippet Huang L, Wang M, Chen Z, Yan Y, Gu W, Zhang X, Tan J, Sun H, Ji W.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

<h4>Objective</h4>The aim of this study was to investigate the mechanisms of miR-138 in regulating Th2 type immune response by targeting OX40 ligand (Ox40L) in vitro.<h4>Methods</h4>Serum samples of patients were used to explore the clinical parameter. Wistar rats were used to establish a murine model of asthma. The dual-luciferase report assay was used to detect the regulation of miR-138 on the expression of OX40L. RT-PCR was used to detect miR-138 and OX40L mRNA expression. Mixed lymphocyte reaction (MLR) and Western blot were used to analyze target protein expression. Enzyme linked immune sorbent assay (ELISA) and flow cytometry (FCM) were used to cytokines detection.<h4>Results</h4>The level of miR-138 was found to be negatively correlated with the expression of OX40L (<i>P</i> < 0.05) and positively correlated with FEV1 (<i>P</i> < 0.05). Higher miR-138 and reduced expression of OX40L were observed in dendritic cells (DCs) separated from rat bone marrow. Typically, OX40 and OX40L in asthma group were determined and the results indicated that the two parameters upregulated in compared with healthy control, while the expressions of them were suppressed by over-expression of miR-138. Furthermore, the up-regulation of Th1 cytokines (IL-2 and IFN-γ) and the down-regulation of Th2 cytokines (IL-4 and IL-10) were induced by over-expression miR-138 and meanwhile the decrease of Th1/Th2 was reversed by overexpression of miR-138.<h4>Conclusion</h4>In this study, we revealed that miR-138 might regulate Th2-type immune response by down-regulating the OX40L expression in asthma.

Also flagged:KITGBMgliomaskinasestumoranaplastic astrocytoma
Journal Article 2017-11-01 No Snippets de Groot J, George S, Razak A, Gordon M, Janku F, Ligon K, Wen P, Friedlander S, Flynn D, Kaufman M, Pitman J, Ruiz-Soto R, Smith B, Westwood D, Rosen O, Reardon D.
Show Full Abstract

Abstract <h4>BACKGROUND</h4> Non-clinical data suggest that PDGFRa plays an important role in the development and progression of human gliomas. To date, few PDGFRa inhibitors with CNS activity have been available. DCC-2618 was designed to potently inhibit the broadest range of mutations (mut) in KIT & PDGFRa kinases that emerge during tumor progession or on treatment. <h4>METHODS</h4> In a dose-escalation study (NCT# 02571036) of oral DCC-2618 (QD or BID q28 days), pts with advanced malignancies with a molecular rationale for activity were eligible. MRI scans were performed initially every 2 cycles then every 3 cycles. <h4>RESULTS</h4> We enrolled 4 GBM pts and 1 anaplastic astrocytoma (AA) pt with PDGFRa muts/ amplifications who had progressed after standard temozolomide chemoradiation (GBM) or temozolomide only (AA) and had received 0 to 5 salvage therapies. Three pts (2 GBM and 1 AA) had a triple amplification of PDGFRa, KIT and KDR (4q12 amplicon). Two GBM pts had activating PDGFRa mutations. Pts were treated at 20 mg (1 pt), 50 mg BID (2 pts) or 100 mg QD (2 pts). The per-protocol population (N=48) received doses up to 200 mg BID and DCC-2618 was well tolerated. One GBM pt with mut PDGFRa progressed after 6 weeks and one stopped treatment due to a tumor-related hemaorrhage on C1D12. Two of the three pts with triple amplifications progressed after 2 cycles while the third pt (GBM, 20 mg BID) achieved a PR per RANO after 9 cycles. This pt is currently in cycle 20 with a remarkable 94% tumor reduction. <h4>CONCLUSIONS</h4> The durable partial response of >18 months in a GBM patient (94% tumor reduction) warrants further evaluation of DCC-2618 in gliomas. An expansion cohort for pts with KIT- and PDGFRa driven tumors was initiated to be able to better select the patient population with a likely benefit.

Also flagged:childhood medulloblastomaWntmetastatic diseasebenigntumorbeta-catenin
Journal Article 2017-11-01 No Snippets Manoranjan B, Venugopal C, Kameda-Smith M, Bakhshinyan D, Subapanditha M, Doble B, Singh S.
Show Full Abstract

Abstract Current molecular subgroups of childhood medulloblastoma (MB) recognize distinct disease entities of which activated Wnt signaling is associated with a distinct subgroup and the best overall outcome. In contrast, non-Wnt MBs are characterized by metastatic disease, increased rate of recurrence, and poor overall survivorship. Given the excellent clinical outcome in Wnt-driven MB, we aimed to convert treatment-resistant MB subgroups 3 and 4 into an ostensibly benign tumor. Activated Wnt signaling by way of Wnt agonists decreased in vitro self-renewal of primary MB cells. Comparative RNA-sequencing of control and transgenic lines containing a stabilized beta-catenin mutant demonstrated a reduction in self-renewal genes following beta-catenin overexpression, including Sox2 and Bmi1. In order to validate the therapy-sensitive nature of Wnt-activated cells, we developed stable human Group 3 and 4 patient-derived lines containing a 7XTOPFlash reporter to determine the presence of endogenous Wnt signaling. Rare subclonal Wnt-active cells demonstrated a reduced self-renewal and tumor-initiating capacity through in vivo limiting dilution assays when compared to bulk Wnt-inactive cells from Group 3 and 4 MBs. The therapeutic relevance of these findings were demonstrated with an in vivo survival advantage in mice with orthotopic injections of cells containing stabilized beta-catenin overexpression or endogenous Wnt-active cells. Resulting xenograft tumors were smaller in size, maintained a lower rate of proliferation, and reduction in MB self-renewal genes. To develop a rationale clinical therapeutic, we used a novel substrate-competitive peptide inhibitor for GSK. Treatment with our peptide inhibitor showed a significant reduction in tumor burden and metastatic disease with a corresponding increase in survival of patient-derived Group 3 and 4 tumors that were otherwise treatment-resistant. Our work establishes activated Wnt signaling as a novel treatment paradigm in childhood MB, identifies a rationale therapeutic approach for recurrent MB, and provides evidence for the context-specific tumor suppressive function of the canonical Wnt pathway.

Also flagged:GlioblastomaangiogenesisgliomaGliomastumorglioblastomas
Journal Article 2017-11-01 ✓ 2 Snippets Nilsen M, Leiss L, Enger P.
In-Text Gene Mentions

…factors SOX2 andPOU3F2.…

…of SOX2 andPOU3F2.…

Show Full Abstract

Abstract Glioblastoma is a highly heterogeneous disease, characterized by high invasion, florid angiogenesis and poor prognosis. Data from recent years introduces the microenvironmental involvement in glioma biology. Still the involvement of astrocytes in Gliomas is not completely understood. We have previously shown that tumor associated astrocytes isolated from mouse models of primary glioblastomas undergo a change in gene expression profile compared to control astrocytes. Suggesting an epigenetic shift of the stroma of glioblastoma. Furthermore, co-implantation of different ratios of normal human astrocytes with a glioma cell line revealed a shortened survival in correlation with increased number of normal astrocytes, suggesting an astrocytic involvement in glioma growth. The aim of the study is therefore to increase our knowledge of how the astrocytic involvement facilitates tumor growth. We have created an in vitro co-culture 3D model system to understand the shift in transcriptional factors of human astrocytes when cultured with primary glioblastoma cell lines created from patient biopsies as well as commercially available cell lines. Using FACS sorting we have been able to separate DsRed normal human astrocytes and glioma cells from the 3D model, thus being able to investigate changes in the two cell types on a transcriptional level using qRT-PCR and microarray. We have found an upregulation in astrocytes of the reprogramming factors SOX2 and POU3F2. This led to establishment of a normal human astrocyte cell line with dual knock down of SOX2 and POU3F2. Current work aims to further understand the expression profile of human glioblastoma-associated astrocytes, and map key factors contributing to the growth promoting effect astrocytes have on glioblastoma cells, potentially leading to a new therapeutic targets.

Also flagged:glioblastomacell cyclegliomatumorsoligodendrogliomaGBM
Journal Article 2017-11-01 ✓ 1 Snippet Simonds E, Cayanan G, Park J, Bendall S, Nolan G, Weiss W.
In-Text Gene Mentions

…factors (i.e. Sox2,POU3F2) were common in…

Show Full Abstract

Abstract <h4>RATIONALE</h4> Human glioblastoma (GBM) tumors harbor a subpopulation of glioma stem cells (GSCs) with the unique capacity to re-establish tumors as xenografts. While GSCs were recently shown to be the predominant cycling population in oligodendroglioma (Tirosh et al. Nature 2016), this relationship has not yet been rigorously examined in GBM biopsies. A variety of surface and intracellular proteins are proposed to mark GSCs, although concordance among these markers is unclear. We hypothesize that the GSC compartment contains distinct subpopulations, including cycling GSCs, that can be distinguished with highly multiplexed single-cell approaches. <h4>METHODS</h4> We used CyTOF mass cytometry to perform simultaneous single-cell measurements of 36 protein targets on dissociated human GBM pre-treatment biopsies (n = 8). The antibody panel included markers of cell cycle and intracellular signaling, as well as 15 previously reported markers of GSCs: A2B5, Bmi1, c-Myc, CD15, CD44, CD49f, CD133, EGFR, FOXM1, L1CAM, Musashi-1, nestin, Olig2, podoplanin, and Sox2. Clustering, dimensionality reduction, and correlation analyses were performed to compare subpopulations of tumor cells and quantify the degree of GSC marker co-expression. <h4>RESULTS</h4> The 16 previously published GSC markers exhibited complex overlapping patterns of expression. Cells expressing GSC-associated transcription factors (i.e. Sox2, POU3F2) were common in tumors, but only a subset of those cells co-expressed GSC-associated surface markers (i.e. CD133, podoplanin). Markers of G2/M cell cycle state (i.e. Cyclin B1) or global Polycomb-mediated epigenetic silencing (i.e. H3K27me3) were associated with different subsets of the GSC compartment. <h4>CONCLUSIONS</h4> Single-cell phenotyping by mass cytometry produced rich phenotypic profiles of the GSC compartment in human GBM biopsies. Subpopulations of GSCs co-exist in GBM and exhibit distinct epigenetic and cell cycle states. Improved surface immunophenotypes and functional understanding of these primitive cells will aid targeting them with small molecule and/or immunotherapeutic approaches.

Also flagged:tryptophanmetabolismkynureninebrain tumorsKPgliomas
Journal Article 2017-11-01 No Snippets Guastella A, Kiousis S, Klinger N, Fadel H, Kupsky W, Michelhaugh S, Mittal S.
Show Full Abstract

Abstract <h4>BACKGROUND</h4> There is a mounting body of data supporting the role of tryptophan metabolism via the kynurenine pathway (KP) in the pathophysiology of primary brain tumors. In the current study, we examined the differences in KP protein expression, as well as pharmacological inhibition of the KP in WHO grade II-IV gliomas, as well as WHO grade I-III meningiomas. <h4>METHODS</h4> Active tumor tissue was acquired immediately following microsurgical resection, and the tumor was dissociated into a single-cell suspension for performance of in vitro experiments. Immunohistochemical and immunocytochemical staining was performed with antibodies specific for: human indoleamine 2,3-dioxygenase (IDO) 1; IDO2; tryptophan 2,3-dioxygenase (TDO2); and the aryl hydrocarbon receptor (AhR), formerly known as the dioxin receptor, a transcription factor associated with carcinogenesis that is activated by KP metabolites. Tissue sections were scored from 0-3 based on staining intensity. Primary patient-derived cell cultures were treated with commercially available small molecule inhibitors for IDO1 (epacadostat), IDO2 (tenatoprazole), TDO2 (680C91), and AhR (CH-223191). Cell viability was measured via MTT assay, while cell killing was measured via colony formation assay. <h4>RESULTS</h4> For both primary brain tumor types, TDO2 and AhR had the highest intensity staining. Moreover, WHO grade IV gliomas showed significantly (p<0.001, ANOVA) higher levels of KP enzymes than any other primary brain tumor type. Nevertheless, MTT data showed markedly diminished cell viability in response to CH-223191 (AhR), regardless of tumor type or grade. Furthermore, colony formation assay revealed that inhibition of AhR lead to the greatest amount of cell death in both tumor types, again regardless of histopathologic grade. <h4>CONCLUSIONS</h4> These results suggest that inhibition of AhR, and not the rate-limiting enzymes of the KP, may offer a novel therapeutic target for a patient population with highly limited treatment options.

Also flagged:oxygenglucosesolid tumorsbrain tumorglioblastomachromodomain helicase DNA binding protein 7
Journal Article 2017-11-01 No Snippets Boyd N, Walker K, Mobley J, Hackney J, Jiao K, Bar E, Hjelmeland A.
Show Full Abstract

Abstract The ischemic microenvironment characterized by low oxygen and glucose due to poor blood supply occurs in both solid tumors and non-neoplastic tissue injury. Ischemia occurs in regions of pseudopalisading necrosis, a hallmark of the most common and deadly primary brain tumor in adults, glioblastoma. Modeling physiologic low oxygen and glucose in glioblastoma in vitro, we identified chromodomain helicase DNA binding protein 7 (CHD7) as a novel ischemia-regulated gene. CHD7 is an epigenetic modifier regulating neural stem cell maintenance and mutated in CHARGE syndrome, a developmental disorder associated with cranial nerve abnormalities. Microenvironment-mediated decreases in CHD7 protein and mRNA levels were observed in glioblastoma and neural progenitor cells in vitro, and CHD7 levels were reduced in the perinecrotic niche of GBM patient and xenograft sections. Genetic targeting of CHD7 increased angiogenesis in vitro in association with differential regulation of angiogenesis associated genes as determined in RNA sequencing analysis. Further suggesting the importance of CHD7 levels in glioblastoma, patient gene expression datasets show a correlation between down regulation of CHD7 and increasing glioma grade and worse patient outcomes. Together, our data provide insight into the molecular responses to ischemia that regulate angiogenesis.

Also flagged:tumorsGlioblastoma MultiformeGBMtumorOsteopontincancers
Journal Article 2017-11-01 No Snippets Marisetty A, Wei J, Gabrusiewicz K, Hashimoto Y, Kong L, Ott M, Heimberger A.
Show Full Abstract

Abstract <h4>INTRODUCTION</h4> MicroRNAs can silence a broad gene set of interest such as multiple immune checkpoints efficiently which may benefit heterogeneous tumors like Glioblastoma Multiforme (GBM). GBM-associated macrophages constitute the largest immune cell population within the tumor microenvironment and are recruited to the tumor through specific signals. Osteopontin has been shown to have an oncogenic role in a variety of cancers and may have immune modulatory effects on macrophages. The current study focuses on using miRNAs that target osteopontin in tumor microenvironment to modulate immune cells to target CNS tumors. <h4>METHODS</h4> Quantitative real time PCR and ELISA were used to determine the expression levels of microRNAs and Osteopontin. Over expression of microRNAs in non-polarized and polarized monocytes was achieved by transfecting microRNA mimics. Luciferase assays were performed to confirm the binding potential of microRNAs to Osteopontin. Nanostring was performed to profile non polarized and polarized macrophages with overexpression of the microRNA. Gene Set Enrichment Analysis (GSEA) was done to identify differences in biological states of control and microRNA overexpression sets. <h4>RESULTS</h4> Microarray analysis from our lab have shown that secreted phosphoprotein 1 (SPP1/Osteopontin) was the most significantly upregulated gene in glioblastoma-associated infiltrating macrophages (GIMs) originating from circulating monocytes (CM) relative to the precursor in the blood of matched patients, further validated by qPCR. Based on the 3`UTR sequence of osteopontin, using bioinformatics tools we identified 5 microRNAs that are conserved and would be able to modulate osteopontin expression. We have validated and found that miR-181 family target osteopontin. Over expression of miR-181 family through mimics significantly downregulated upon overexpression in both non-polarized and polarized monocytes. GSEA analysis of control and overexpression of miR-181 family members identified the genes that modulate immune cells to target tumor cells.

Also flagged:glioblastomaOPNtumorcell proliferationCD31PDGFRβ
Journal Article 2017-11-01 No Snippets Szulzewsky F, Schwendinger N, Güneykaya D, Cimino P, Hambardzumyan D, Synowitz M, Holland E, Kettenmann H.
Show Full Abstract

Abstract <h4>BACKGROUND</h4> Microglia and periphery-derived monocytes infiltrate human and mouse glioblastoma and their density is positively correlated with malignancy. Using microarray and RNA sequencing we have previously shown that glioblastoma-associated microglia/monocytes (GAMs) express osteopontin/OPN. <h4>METHODS</h4> We used qRT-PCR, immunofluorescence stainings, western blot, and flow cytometry to identify the various sources of OPN expression in human and mouse glioblastoma. We implanted wild type GL261 glioblastoma cells, which do not express significant levels of OPN, into wild-type and OPN-/- mice to investigate the role of microenvironment-derived OPN on glioblastoma progression. <h4>RESULTS</h4> Our data indicates that GAMs are the predominant source of OPN in both human and mouse glioblastoma and only express the secreted form of OPN. Loss of microenvironment-derived OPN enhanced tumor progression. Ki67 and TUNEL staining showed no difference in overall cell proliferation but a decreased apoptosis rate in tumors in OPN-/- mice. CD31 staining showed a significantly decreased number of microvessels in tumors in OPN-/- mice, accompanied by reduced coverage of vessels with PDGFRβ-positive pericytes. Flow cytometry analysis revealed a significant increase of CD11b+/CD45low microglia but not of CD11b+/CD45high macrophages/monocytes in tumors in OPN-/- mice. Sorted CD11b+ cells from wild type and OPN-/- naïve brains and tumors did not show a significant difference in the expression pattern of activation marker genes. <h4>CONCLUSION</h4> Our results show that in human and mouse glioblastoma OPN is predominantly expressed and secreted by GAMs and that – in contrast to OPN expression in the tumor cells per se – loss of stroma-derived OPN creates a glioblastoma-promoting microenvironment.

Also flagged:brain tumorsCytokinesgranulocyte macrophage colony-stimulating factorGM-CSFcancertumor
Journal Article 2017-11-01 No Snippets Guimaraes F.
Show Full Abstract

Abstract <h4>INTRODUCTION</h4> Cancer immunotherapy using immunomodulatory agents can potentially meet clear and urgent need for effective therapeutics for invasive malignant brain tumors. Cytokines such as granulocyte macrophage colony-stimulating factor (GM-CSF) have been applied as an adjuvant in cancer immunotherapy in attempt to potentiate anti-tumor immunity and overcome the robust immunosuppressive tumor microenvironment. Although this approach has proven efficacy, systemically delivered immunomodulatory agents to brain tumors have limited access to the central nervous system (CNS) due to the blood brain barrier (BBB). Furthermore, it may require high dose regimens to reach therapeutic concentrations at the tumor site, increasing the risk of systemic side effects and induction of potentially counterproductive immune responses. To overcome these limitations, we investigate the HYPOTHESIS that RNA-modified T cells can deliver immunomodulatory molecules directly to brain tumor microenvironment. The ability of T cells to cross the BBB and specifically lyse tumor cells make them an attractive tool for cancer cell therapy. <h4>METHODS</h4> Using mRNA electroporation (EP) approach, we evaluated GM-CSF secretion in vitro and in vivo following intravenous injection of GM-CSF RNA-modified T cells. In addition, we further tested anti-tumor efficacy of GM-CSF RNA modified T cells in a murine brain tumor model. <h4>RESULTS</h4> Murine and human activated T cells can be modified to secrete GM-CSF protein in vitro, while retaining effector T cell functions. Moreover, our results demonstrated the capacity for GM-CSF RNA-modified T cell to deliver enhanced cytokine concentrations to intracranial tumors in vivo. Finally, we demonstrated that GM-CSF RNA-modified T cell potentiated antigen-specific T cell expansion and prolonged overall survival in a murine brain tumor model. <h4>CONCLUSIONS</h4> Our findings suggest that activated RNA-modified T cells cross the BBB, and can be used as an effective cellular vehicle to deliver therapeutic molecules effectively to invasive brain tumors.

Also flagged:transcription factorTCF12cell proliferationneurogenesisglioblastomacancer
Journal Article 2017-11-01 No Snippets Taiwo R, Mao D, Mahlokozera T, Kim A.
Show Full Abstract

Abstract The basic helix-loop-helix (bHLH) transcription factor, TCF12, has been implicated in precursor cell proliferation during embryogenic neurogenesis and continues to be expressed postnatally in mitotically active regions of the brain. TCF12 has been shown to be preferentially expressed in glioblastoma stem-like cells (GSCs), a key subpopulation of cancer cells thought to underlie tumor therapy resistance and recurrence. But the exact role of TCF12 in gliomagenesis has remained unclear since it has been shown to be both a proto-oncogene and tumor suppressor depending on the cellular context. We therefore investigated the potential role of TCF12 in regulating the biology of GSCs. Using microarray analysis of 24 patient-derived GSCs, we find that TCF12 is highly expressed in proneural GSCs relative to normal human astrocytes, and differentiation of proneural GSCs in culture markedly downregulated TCF12 mRNA. To test the role of TCF12 in GSC function, we first overexpressed TCF12 in GSCs using a lentiviral approach. TCF12 overexpression increased GSC self-renewal capacity, a key measure of stem-like cell identity, relative to control infection. Mechanistically, a mini-screen of candidates known to regulate GSC self-renewal revealed that TCF12 overexpression increased the expression of the bHLH transcription factor, OLIG2 and the helix-loop-helix protein, ID-1. Furthermore, loss-of-function approaches using both RNA interference and CRISPR-Cas9-mediated knockout demonstrated reduced expression of OLIG2 and ID1. Bioinformatic analysis of the genomic regions upstream of OLIG2 ID-1 and ID1transcription start sites revealed the presence of evolutionarily conserved TCF12 binding sites, suggesting that both OLIG2 and ID1 are direct transcriptional targets of TCF12. Taken together, these findings suggest that TCF12 controls the stem-like identity of proneural GSCs by stimulating expression of transcriptional regulators, OLIG2 and ID-1.

Also flagged:Medulloblastomabrain tumorSHHtumortumorsangiogenesis
Journal Article 2017-11-01 No Snippets Maximov V, Chen Z, Wei Y, Robinson M, Hambardzumyan D, Kenney A.
Show Full Abstract

Abstract Medulloblastoma (MB), the most common pediatric brain tumor, has a 70% survival rate but standard treatments often lead to devastating life-long side effects, and recurrence is fatal. MB was classified based on molecular and genetic profiles and resulted in four distinct subgroups. The most common subclass of MB is SHH, which accounts for approximately 30% of cases. This class has been successfully modeled in vivo in murine models, which closely recapitulate human disease, providing a convenient and relevant model system for analyzing the SHH MB subclass in vivo. To better understand the mechanisms of tumor growth and recurrence, recent attention has been focused on determining the composition and role of non-tumor cells comprising the tumor microenvironment (TME). Tumor-associated macrophages (TAM) are a key component of the TME that could have two opposite effects on tumor. TAMs can help tumors to evade the immune system by suppressing other immune cell functions, and contribute to tumor growth by promoting angiogenesis. On the other hand, they could suppress tumor growth and delay tumor development. Recently, it was reported that of the subgroups, human SHH MB has the greatest number of TAMs, as well as increased expression of macrophage-associated genes. However, to date, there are no studies addressing the functional role of TAMs in SHH MB. In this work, we demonstrate a functional role of TAMs in both in vitro and in vivo models. We show that reduction of macrophage numbers leads to increased animal mortality in a murine model of SHH MB. Further investigation of the TME and TAMs in MB has the potential to elucidate immune system involvement in the disease and lead to development of novel treatment options.

Also flagged:GlioblastomaGBMbrain tumortumortranscription factorsSall2
Journal Article 2017-11-01 ✓ 2 Snippets Ross J, Chau M, Miller B, Mukherjee S, Zhang C, Kong J, Kaissi E, Newsam A, Mahboubi D, Berry J, Tucker-Burden C, Brat D.
In-Text Gene Mentions

…factors (Sall2, Sox2,Pou3f2, Olig2), Olig2 was…

…markers Sall2, Sox2,Pou3f2, and migratory markers…

Show Full Abstract

Abstract Glioblastoma (GBM) is the most malignant primary brain tumor and GBM stem cells (GSCs) are thought to drive its behavior and resistance to therapy. GSCs are self-renewing and reside in supportive microenvironmental niches such as perinecrotic zones composed of pseudopalisades. Pseudopalisades are a wave of hypoxic tumor cells migrating away from central necrosis. The mechanisms of GSC accumulation within pseudopalisades are poorly understood but could be related to their enhanced survival, proliferation, or active migration. Interestingly, the majority of GBM tumor cells show a mass migration radially outward from the necrotic core away from hypoxia, yet GSCs within pseudopalisades are maintained centrally. We hypothesized that GSCs home towards hypoxic microenvironments to benefit from the hypoxia-induced factors that support stemness and survival. We treated human-derived GBM stem and non-stem cells with hypoxia in vitro and found that hypoxia enhanced the expression of stem cell, pro-survival and migratory factors and also accelerated their migration capacity. Of the four induced tumor propagating stem cell (iTPC) transcription factors (Sall2, Sox2, Pou3f2, Olig2), Olig2 was most upregulated by hypoxia and preferentially expressed in the severely hypoxic pseudopalisading cells in human GBM specimens. We found that the expression of Olig2 was associated with enhanced hypoxia-induced migration in an in vitro transwell migration assay and in an in vivo mouse model of hypoxia. Our data demonstrate that Olig2 expression is induced by hypoxia and that Olig2 knockdown correlates with reduced expression of iTPC markers Sall2, Sox2, Pou3f2, and migratory markers FAK, Rho-A, Rock1, and CXCR4. This data suggests that OLIG2 may be responsible for the homing of GSCs to the hypoxic-perinecrotic niche and represents a novel mechanism potentially responsible for glioma progression following the onset of necrosis.

Also flagged:CTLA-4cancercytosine deaminase5-fluorocytosine5-fluorouraciltumor
Journal Article 2017-11-01 No Snippets Jolly D, Mitchell L, Yagiz K, Espinoza F, Mendoza D, Munday A, Gruber H.
Show Full Abstract

Abstract Toca 511 (vocimagene amiretrorepvec) is a gamma retroviral replicating vector that selectively infects cancer cells in vivo and encodes cytosine deaminase. In combination with the prodrug, 5-fluorocytosine (5-FC), Toca 511 produces 5-fluorouracil (5-FU) locally in the tumor microenvironment. This work aimed to determine if the addition of a checkpoint inhibitor, αCTLA-4 would provide therapeutic benefit to Toca 511 and 5-FC in a mouse model of glioma. Initially, we noted that Toca 511 and 5-FC was highly efficacious and that it provided little room for improvement and therefore combination with αCTLA-4 was not able to show additive benefit against the primary cancer. Further examination revealed that tumor associated Regulatory T cells were significantly reduced with αCTLA-4 treatment and long term memory was shown to be significantly improved with the combination. Adoptive transfer of immune cells from animals that cleared their primary tumor through Toca 511, 5-FC, and αCTLA-4 showed 100% survival benefit to animals bearing orthotopic gliomas; significantly greater than the ~50% survival seen with transfer from animals that cleared primary tumor through Toca 511 and 5-FC alone. Further, αCTLA-4 treatment during clearance of primary tumors resulted in a marked reduction of memory T regulatory cells in secondary tumors. Finally, we wanted to determine if αCTLA-4 in combination with Toca 511 and 5-FC significantly reduced tumor burden in a model using a submaximal infection level of Toca 511. Specifically, restricting Toca 511 infection to only 2% of tumor cells limited the activity of 5-FC in a subcutaneous setting and the loss of efficacy with 2% infection was rescued when 5-FC treatment was combined with αCTLA-4. These data suggest that αCTLA-4, and other compounds that target T regulatory cells, should be evaluated in patients receiving Toca 511 and Toca FC to determine if the combination confers additional clinical benefits.

Also flagged:Glioblastomatumorglioblastoma multiformeGBMamino acidpeptide
Journal Article 2017-11-01 No Snippets Kim J, Xie Q, Rich J, Liu J.
Show Full Abstract

Abstract Glioblastoma stem cells (GSCs) are tumor-initiating cells and contribute to chemo-radiation resistance of glioblastoma multiforme (GBM) with poor prognosis. Cell-cell interactions in GBM niche regulate and maintain GSCs leading to tumor progression. Secretory molecules from different cell types in GBM niche play significant roles in intercellular communications. Therefore, we utilized phage screening technology to identify the secretory molecules regulating GSCs-microenvironment interactions and target their communications. Phage display library consisting of 109 different combinations of 7-amino acid-length peptide sequences was screened for binding to GSCs both in vitro and in vivo. In vitro screening was performed against GSCs isolated from patient GBM tumors grown in culture following negative selection on non-GSCs. In vivo screening was performed by intravenous injections of the phage library into immunocompromised mice with intracranial primary GBM xenograft. Phage peptides that preferentially bound to the GSC population were recovered. BLAST analysis of the recovered peptides identified angiotensin I converting enzyme (ACE), a key protein in renin-angiotensin system (RAS). RT-qPCR, RNA-seq, ChIP-seq, and in silico data showed that GSCs highly expressed renin and angiotensinogen, components of RAS, and differentiated cancer cells and endothelial cells expressed ACE. TCGA and histologic analysis were also consistent with these findings. High expression of these RAS components correlated with poor patient survivals. To study the effect of RAS inhibitors on GSC proliferation, GSCs were treated with captopril, ramipril, lisinopril, and telmisartan, respectively. Interestingly, RAS inhibitors stimulated cell proliferation and tumorsphere formation. In conclusion, this study demonstrates that renin-angiotensin system as a potential therapeutic target for the treatment of glioblastoma.

Also flagged:gliomagliomasmethioninemalignant gliomaIDH1IDH
Journal Article 2017-11-01 No Snippets Ikuta S, Maruyama T, Nitta M, Okamoto S, Fukuya Y, Yasuda T, Komori T, Kawamata T, Muragaki Y.
Show Full Abstract

Abstract Low-grade glioma patients have relatively long life expectancy for gliomas, but once they recur in malign, their prognosis can be poor. We analyzed factors corresponding to malignant recurrence by uni- and multi-variate analysis applying their treatment backgrounds. SUBJECTS: 261 newly diagnosed WHO grade 2 adults gliomas in 2004 to 2014. Malignant recurrence was determined by pathological diagnosis if the patient had a surgery (69% of the recurrent patients), otherwise contrast T1WI or 11C- methionine PET images if the patient was unable to undergo any surgery or biopsy. <h4>RESULTS</h4> Age average 41 years old, the 10-year survival rate in all patients was 75%, and the mean of progression-free survival time was 7.8 years. Relapse event occurred in 115 cases (44%), and 67 % of them developed malignant glioma sometime. The 10-year survival rate for the patients who relapsed in malign was 37%, on the contrary, the patients who had recurrence but staying in low grade was 71% (p=0.0389). When they were categorized by 1p19q deletion and IDH1 mutation status, IDH wild type diffuse astrocytoma patients had significantly developed malignant glioma compared to oligodendroglioma and IDH mutant type diffuse astrocytoma (p<0.0001). The factors related to malignant progression were extracted as; recurrence in 2 years, 6% and over in MIB-1 index, no intervention longer than 18 months since the disease revealed, 1p19q non-co-deletion, less than 90% of tumor resection rate, and IDH wild type. In the 1p19q non-deletion patients, who were provisionally defined as diffuse astrocytoma patients here, the factors were resection rate, MIB-1 index, and duration between discovered the disease and the first surgery, but not the IDH mutant status (p<0.0001, p=0.0015, p=0.0478 respectively). <h4>CONCLUSION</h4> Recurrence in malign form low-grade glioma can be avoided by early intervention in 18 months from diagnosis and resection over 90% of volume of the tumor.

Also flagged:Ion channelsmembrane proteinscancergliomatumorGlioblastoma multiforme
Journal Article 2017-11-01 No Snippets Iwata R, Ofune K, Hayashi M, Yoshimura K, Nonaka M, Matsuda H, Asai A.
Show Full Abstract

Abstract <h4>BACKGROUND</h4> Glioblastoma multiforme are refractory diseases and it is necessary to develop new therapies. Ion channels are membrane proteins that permeate ions and are involved in proliferation, metastasis and invasion in cancer. To date, functional analysis of ion channels in glioma cancer stem cells (GSCs) has not been done much.However, there is limited evidence regarding the ion channels in glioma cancer stem cells. <h4>PURPOSE</h4> Ion channels in GSCs are identified and the anti-tumor effect by inhibitors against them is verified. <h4>METHOD</h4> Cancer stem cell lines were established from patients with Glioblastoma multiforme. The whole current of cancer stem cells was measured using patch clamp technique, and electrophysiological properties and pharmacological properties were analyzed. We analyzed the effects of ion channel inhibitors on proliferation, cell death and invasion of cancer stem cells. <h4>RESULTS</h4> Nonselective cationic current was observed in GSCs. This current was blocked in a concentration dependent manner by lanthanum which is a trivalent cation. Lanthanum inhibited the growth and invasion of GSCs. <h4>CONCLUSION</h4> It is suggested that lanthanum inhibits cell proliferation and invasion by blocking nonselective cation channel current of GSCs.

Also flagged:abuseanxietydepressionneglectnucleushabituation
Journal Article 2017-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Gene Expressionbipolar disorderMood DisorderInterferon-AlphaTNFInterferon-α
Journal Article 2017-11-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions

PCDH17

Show Full Abstract

No abstract available.

Also flagged:BDNFNeurogenesisSynaptogenesisTatNeurotoxicityneurodegenerative disorders
Journal Article 2017-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:Anxiety DisordersserotoninNorepinephrineReuptakeanxietysocial anxiety disorder
Journal Article 2017-11-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:P14P28P29P31P34P48
Journal Article 2017-11-01 ✓ 1 Snippet Eisenhofer G, Masjkur J, Peitzsch M, Di Dalmazi G, Bidlingmaier M, Grüber M, Fazel J, Osswald A, Bornstein S, Beuschlein F, Reincke M, Pope J, Black M, Drummer O, Schneider H, Swenson R, McWhinney B, Ungerer J, Stowasser M, Pope J, Choy K, Drummer O, Schneider H, Bittar I, Nahavandi S, Ekinci E, Milne M, Crinis N, Lam Q, McFarlane R, Budge C, Ashford J, Rathnayake G, Zhu K, Knuiman M, Divitini M, Murray K, Lim E, St John A, Walsh J, Hung J, Rathnayake G, Budge C, Ashford J, McFarlane R, Gautam A, Subedi B, Awasthi J, Gupta A, Koirala N, Willson C, Badrick T, Gay S, Badrick T, Sikaris K, Ali M, Shaari F, Masiman A, Rahim H, Maznan M, Dawi N, Inn C, Othman H, Clausen D, Koe L, Dove J, Shepherd S, Jones G, Graham P, Nouri-Girones F, Newton S, Simpson A, Hickman P, Adams C, McDonald L, Gomez G, Rogers J, Weston D, Chesher D, Chung J, Constantine D, Kouzios D, Nguyen T, Umaharan J, Ward P, Williams P, Doliba A, Jones G, Strazdins E, Ende J, Jones G, Nadaraja D, Sthaneshwar P, Razali N, Thomas M, Wynveen P, Carollo-Neumann C, Holland M, Hausmann S, Rooney M, Dilanthi H, Choy K, Doery J, Waller K, Hughes D, Challen N, Apparow S, Sthaneshwar P, bt Zainuddin N, Yunus P, Hughes D, Doery J, Flatman R, Reed M, Koetsier S, Choy K, Choy K, Doery J, Flatman R, Reed M, Koetsier S, Hughes D, Pope J, Black M, Karastamatis R, Schneider H, Pope J, Black M, Drummer O, Schneider H, Pope J, Schneider H, Pope J, Black M, Drummer O, Schneider H, Ellis A, Zeglinski P, Coleman K, Whiting M, Zakaria R, Allen K, Koplin J, Roche P, Crinis N, Greaves R, Patel B, Kugel M, Baehring G, Ammit A, Lam L, Woollard G, Kyle C, Potter J, Salib M, Simpson A, Oakman C, Hickman P.
In-Text Gene Mentions

HFE

Show Full Abstract

No abstract available.