Gene Literature Dashboard

Viewing April 2018 — 408 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← March 2018 May 2018 →
Also flagged:adenomascarcinomas of thecancercolon carcinomacolon adenomaAPC
Journal Article 2018-04-30 ✓ 4 Snippets Wolff RK, Hoffman MD, Wolff EC, Herrick JS, Sakoda LC, Samowitz WS, Slattery ML.
In-Text Gene Mentions

Ten of the 69 genes, APC, TTN, TP53, KRAS, OBSCN, SOX9, PCDH17, SIGLEC10, MYH6, and BRD9, were mutated in ≥11.76% of the adenomas and in two or more (≥12.5%) of the MSS carcinomas.

Of these, 22 genes contained the same mutation in the two MSI tumors, and 18 of the 22 genes (ERRFI1, PHF2, RGL2, RNF43, ACVR2A, ARFGAP3, ARSJ, BRD3, C7orf49, CBX5, DDX27, EFCAB5, GRIN2A, MSH3, PROM1, RBM23, RPL22, and ZNRF3) shared the same location of the frameshift mutation at short mononucleotide repeats (Table 5).

…KRAS, OBSCN, SOX9,PCDH17, SIGLEC10, MYH6, and…

…BRD3, C7orf49, CBX5,DDX27, EFCAB5, GRIN2A, MSH3,…

Show Full Abstract

Colorectal cancer (CRC) accounts for about 8% of all new cancer cases diagnosed in the US. We used whole exome sequence data from triplet samples (colon carcinoma, colon adenoma, and normal tissue) from 18 individuals to assess gene mutation rates. Of the 2 204 genes that were mutated, APC, TTN, TP53, KRAS, OBSCN, SOX9, PCDH17, SIGLEC10, MYH6, and BRD9 were consistent with genes being an early driver of carcinogenesis, in that they were mutated in multiple adenomas and multiple carcinomas. Fifty-two genes were mutated in ≥12.5% of microsatellite stable (MSS) carcinomas but not in any of the adenomas, in line with the profile of a late driver event involved in tumor progression. Thirty-eight genes were sequenced in a larger independent set of 148 carcinoma/normal tissue pairs to obtain more precise mutation frequencies. Eight of the genes, APC, TP53, ATM, CSMD3, LRP1B, RYR2, BIRC6, and MUC17, contained mutations in >20% of the carcinomas. Interestingly, mutations in four genes in addition to APC that are associated with dysregulation of Wnt signaling, were all classified as early driver events. Most of the genes that are commonly associated with colon cancer, including APC, TP53, and KRAS, were all classified as being early driver genes being mutated in both adenomas and carcinomas. Classifying genes as potential early and late driver events points to candidate genes that may help dissect pathways involved in both tumor initiation and progression.

Also flagged:waterhydroxyapatitemembranedepolarizationfermentationphenolic acids
Journal Article 2018-04-30 No Snippets Predoi D, Iconaru SL, Buton N, Badea ML, Marutescu L.
Show Full Abstract

This study presents, for the first-time, the results of a study on the hydrodynamic diameter of essential oils (EOs) of basil and lavender in water, and solutions of EOs of basil (B) and lavender (L) and hydroxyapatite (HAp). The possible influence of basil and lavender EOs on the size of hydroxyapatite nanoparticles was analyzed by Scanning Electron Microscopy (SEM). We also investigated the in vitro antimicrobial activity of plant EOs and plant EOs hydroxyapatite respectively, against Gram-positive bacteria (methicillin-resistant <i>Staphylococcus aureus</i>1144 (MRSA 1144) and <i>S. aureus</i> 1426) and Gram-negative bacteria (<i>Escherichia coli</i> ATCC 25922 and <i>Escherichia coli</i> ESBL 4493). From the autocorrelation function, obtained by Dynamic Light Scattering (DLS) measurements it was observed that basil yielded one peak at an average hydrodynamic diameter of 354.16 nm, while lavender yielded one peak at an average hydrodynamic diameter of 259.76 nm. In the case of HAp nanoparticles coated with basil (HApB) and lavender (HApL) essential oil, the aggregation was minimal. We found that the lavender EO exhibited a very good inhibitory growth activity (MIC values ranging from <0.1% for <i>E. coli</i> reference strain to 0.78% for <i>S. aureus</i> strains). The biological studies indicated that HapL material displayed an enhanced antimicrobial activity, indicating the potential use of HAp as vehicle for low concentrations of lavender EO with antibacterial properties. Flow cytometry analysis (FCM) allowed us to determine some of the potential mechanisms of the antimicrobial activities of EOs, suggesting that lavender EO was active against <i>E. coli</i> by interfering with membrane potential, the membrane depolarization effect being increased by incorporation of the EOs into the microporous structure of HAp. These findings could contribute to the development of new antimicrobial agents that are urgently needed for combating the antibiotic resistance phenomena.

Also flagged:hypertensionAQP4PADI2strokecoronary heart diseasechronic renal failure
Journal Article 2018-04-30 No Snippets Halladay JR, Lenhart KC, Robasky K, Jones W, Homan WF, Cummings DM, Cené CW, Hinderliter AL, Miller CL, Donahue KE, Garcia BA, Keyserling TC, Ammerman AS, Patterson C, DeWalt DA, Johnston LF, Willis MS, Schisler JC.
Show Full Abstract

As part of the Heart Healthy Lenoir Project, we developed a practice level intervention to improve blood pressure control. The goal of this study was: (i) to determine if single nucleotide polymorphisms (SNPs) that associate with blood pressure variation, identified in large studies, are applicable to blood pressure control in subjects from a rural population; (ii) to measure the association of these SNPs with subjects' responsiveness to the hypertension intervention; and (iii) to identify other SNPs that may help understand patient-specific responses to an intervention. We used a combination of candidate SNPs and genome-wide analyses to test associations with either baseline systolic blood pressure (SBP) or change in systolic blood pressure one year after the intervention in two genetically defined ancestral groups: African Americans (AA) and Caucasian Americans (CAU). Of the 48 candidate SNPs, 13 SNPs associated with baseline SBP in our study; however, one candidate SNP, rs592582, also associated with a change in SBP after one year. Using our study data, we identified 4 and 15 additional loci that associated with a change in SBP in the AA and CAU groups, respectively. Our analysis of gene-age interactions identified genotypes associated with SBP improvement within different age groups of our populations. Moreover, our integrative analysis identified <i>AQP4-AS1</i> and <i>PADI2</i> as genes whose expression levels may contribute to the pleiotropy of complex traits involved in cardiovascular health and blood pressure regulation in response to an intervention targeting hypertension. In conclusion, the identification of SNPs associated with the success of a hypertension treatment intervention suggests that genetic factors in combination with age may contribute to an individual's success in lowering SBP. If these findings prove to be applicable to other populations, the use of this genetic variation in making patient-specific interventions may help providers with making decisions to improve patient outcomes. Further investigation is required to determine the role of this genetic variance with respect to the management of hypertension such that more precise treatment recommendations may be made in the future as part of personalized medicine.

Also flagged:chromosomechromosomesmitosis
Journal Article 2018-04-30 ✓ 1 Snippet Maeshima K, Hibino K, Hudson DF.
In-Text Gene Mentions

Condensinsare key players…

Show Full Abstract

Condensins are key players in mitotic chromosome condensation. Using an elegant combination of state-of-the-art imaging techniques, Walther et al. (2018. <i>J. Cell Biol.</i> https://doi.org/10.1083/jcb.201801048) counted the number of Condensins, examined their behaviors on human mitotic chromosomes, and integrated the quantitative data to propose a new mechanistic model for chromosome condensation.

Also flagged:eIF5Aautophagymembranestranslationaleukaryotic translation initiation factor 5Aautophagosome
Journal Article 2018-04-30 ✓ 1 Snippet Lubas M, Harder LM, Kumsta C, Tiessen I, Hansen M, Andersen JS, Lund AH, Frankel LB.
In-Text Gene Mentions

RC3H1

Show Full Abstract

Autophagy is an essential catabolic process responsible for recycling of intracellular material and preserving cellular fidelity. Key to the autophagy pathway is the ubiquitin-like conjugation system mediating lipidation of Atg8 proteins and their anchoring to autophagosomal membranes. While regulation of autophagy has been characterized at the level of transcription, protein interactions and post-translational modifications, its translational regulation remains elusive. Here we describe a role for the conserved eukaryotic translation initiation factor 5A (eIF5A) in autophagy. Identified from a high-throughput screen, we find that eIF5A is required for lipidation of LC3B and its paralogs and promotes autophagosome formation. This feature is evolutionarily conserved and results from the translation of the E2-like ATG3 protein. Mechanistically, we identify an amino acid motif in ATG3 causing eIF5A dependency for its efficient translation. Our study identifies eIF5A as a key requirement for autophagosome formation and demonstrates the importance of translation in mediating efficient autophagy.

Also flagged:colorectal cancerorganizationaxonbehavioralneuropsychiatric disordersaxon guidance molecule receptor
Journal Article 2018-04-30 ✓ 5 Snippets Vosberg DE, Zhang Y, Menegaux A, Chalupa A, Manitt C, Zehntner S, Eng C, DeDuck K, Allard D, Durand F, Dagher A, Benkelfat C, Srour M, Joober R, Lepore F, Rouleau G, Théoret H, Bedell BJ, Flores C, Leyton M.
In-Text Gene Mentions

DCC (deleted in colorectal cancer

…guidance cue receptorDCC(deleted in colorectal…

…Volumetric Alterations inDCCMutation Carriers…

…also collected inDcc-haploinsufficient mice.…

…volunteers were 20DCC+/− mutation carriers,…

Show Full Abstract

The axon guidance cue receptor DCC (deleted in colorectal cancer) plays a critical role in the organization of mesocorticolimbic pathways in rodents. To investigate whether this occurs in humans, we measured (1) anatomical connectivity between the substantia nigra/ventral tegmental area (SN/VTA) and forebrain targets, (2) striatal and cortical volumes, and (3) putatively associated traits and behaviors. To assess translatability, morphometric data were also collected in <i>Dcc</i>-haploinsufficient mice. The human volunteers were 20 <i>DCC</i><sup>+/-</sup> mutation carriers, 16 <i>DCC</i><sup>+/+</sup> relatives, and 20 <i>DCC</i><sup>+/+</sup> unrelated healthy volunteers (UHVs; 28 females). The mice were 11 <i>Dcc</i><sup>+/-</sup> and 16 wild-type C57BL/6J animals assessed during adolescence and adulthood. Compared with both control groups, the human <i>DCC</i><sup>+/-</sup> carriers exhibited the following: (1) reduced anatomical connectivity from the SN/VTA to the ventral striatum [<i>DCC</i><sup>+/+</sup>: <i>p</i> = 0.0005, <i>r</i>(<i>effect size</i>) = 0.60; UHV: <i>p</i> = 0.0029, <i>r</i> = 0.48] and ventral medial prefrontal cortex (<i>DCC</i><sup>+/+</sup>: <i>p</i> = 0.0031, <i>r</i> = 0.53; UHV: <i>p</i> = 0.034, <i>r</i> = 0.35); (2) lower novelty-seeking scores (<i>DCC</i><sup>+/+</sup>: <i>p</i> = 0.034, <i>d</i> = 0.82; UHV: <i>p</i> = 0.019, <i>d</i> = 0.84); and (3) reduced striatal volume (<i>DCC</i><sup>+/+</sup>: <i>p</i> = 0.0009, <i>d</i> = 1.37; UHV: <i>p</i> = 0.0054, <i>d</i> = 0.93). Striatal volumetric reductions were also present in <i>Dcc</i><sup>+/-</sup> mice, and these were seen during adolescence (<i>p</i> = 0.0058, <i>d</i> = 1.09) and adulthood (<i>p</i> = 0.003, <i>d</i> = 1.26). Together these findings provide the first evidence in humans that an axon guidance gene is involved in the formation of mesocorticolimbic circuitry and related behavioral traits, providing mechanisms through which <i>DCC</i> mutations might affect susceptibility to diverse neuropsychiatric disorders.<b>SIGNIFICANCE STATEMENT</b> Opportunities to study the effects of axon guidance molecules on human brain development have been rare. Here, the identification of a large four-generational family that carries a mutation to the axon guidance molecule receptor gene, <i>DCC</i>, enabled us to demonstrate effects on mesocorticolimbic anatomical connectivity, striatal volumes, and personality traits. Reductions in striatal volumes were replicated in <i>DCC</i>-haploinsufficient mice. Together, these processes might influence mesocorticolimbic function and susceptibility to diverse neuropsychiatric disorders.

Also flagged:DLBCLABCpathogenesisDiffuse Large B-cell Lymphomalymphoid malignancyTP53
Journal Article 2018-04-30 ✓ 1 Snippet Chapuy B, Stewart C, Dunford AJ, Kim J, Kamburov A, Redd RA, Lawrence MS, Roemer MGM, Li AJ, Ziepert M, Staiger AM, Wala JA, Ducar MD, Leshchiner I, Rheinbay E, Taylor-Weiner A, Coughlin CA, Hess JM, Pedamallu CS, Livitz D, Rosebrock D, Rosenberg M, Tracy AA, Horn H, van Hummelen P, Feldman AL, Link BK, Novak AJ, Cerhan JR, Habermann TM, Siebert R, Rosenwald A, Thorner AR, Meyerson ML, Golub TR, Beroukhim R, Wulf GG, Ott G, Rodig SJ, Monti S, Neuberg DS, Loeffler M, Pfreundschuh M, Trümper L, Getz G, Shipp MA.
In-Text Gene Mentions

linker histones

Show Full Abstract

Diffuse large B cell lymphoma (DLBCL), the most common lymphoid malignancy in adults, is a clinically and genetically heterogeneous disease that is further classified into transcriptionally defined activated B cell (ABC) and germinal center B cell (GCB) subtypes. We carried out a comprehensive genetic analysis of 304 primary DLBCLs and identified low-frequency alterations, captured recurrent mutations, somatic copy number alterations, and structural variants, and defined coordinate signatures in patients with available outcome data. We integrated these genetic drivers using consensus clustering and identified five robust DLBCL subsets, including a previously unrecognized group of low-risk ABC-DLBCLs of extrafollicular/marginal zone origin; two distinct subsets of GCB-DLBCLs with different outcomes and targetable alterations; and an ABC/GCB-independent group with biallelic inactivation of TP53, CDKN2A loss, and associated genomic instability. The genetic features of the newly characterized subsets, their mutational signatures, and the temporal ordering of identified alterations provide new insights into DLBCL pathogenesis. The coordinate genetic signatures also predict outcome independent of the clinical International Prognostic Index and suggest new combination treatment strategies. More broadly, our results provide a roadmap for an actionable DLBCL classification.

Also flagged:Huntingtinneurodegenerative diseasesynaptic transmissionHDSynaptic vesicle proteins 2synaptic vesicle proteins
Journal Article 2018-04-30 ✓ 5 Snippets Peng C, Zhu G, Liu X, Li H.
In-Text Gene Mentions

Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats.

Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein.

Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt.

These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression.

Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats.

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.

Also flagged:cancerlung adenocarcinomamelanomaimmune responsetumoradenocarcinoma
Journal Article 2018-04-30 No Snippets Lyu GY, Yeh YH, Yeh YC, Wang YC.
Show Full Abstract

The determination of the mutation load, a total number of nonsynonymous point mutations, by whole-exome sequencing was shown to be useful in predicting the treatment responses to cancer immunotherapy. However, this technique is expensive and time-consuming, which hampers its application in clinical practice. Therefore, the objective of this study was to construct a mutation load estimation model for lung adenocarcinoma, using a small set of genes, as a predictor of the immunotherapy treatment response. Using the somatic mutation data downloaded from The Cancer Genome Atlas (TCGA) database, a computational framework was developed. The estimation model consisted of only 24 genes, used to estimate the mutation load in the independent validation cohort precisely (<i>R</i><sup>2</sup> = 0.7626). Additionally, the estimated mutation load can be used to identify the patients with durable clinical benefits, with 85% sensitivity, 93% specificity, and 89% accuracy, indicating that the model can serve as a predictive biomarker for cancer immunotherapy treatment response. Furthermore, our analyses demonstrated the necessity of the cancer-specific models by the constructed melanoma and colorectal models. Since most genes in the lung adenocarcinoma model are not currently included in the sequencing panels, a customized targeted sequencing panel can be designed with the selected model genes to assess the mutation load, instead of whole-exome sequencing or the currently used panel-based methods. Consequently, the cost and time required for the assessment of mutation load may be considerably decreased, which indicates that the presented model is a more cost-effective approach to cancer immunotherapy response prediction in clinical practice.

Also flagged:Serotonin Transporterpsychiatric disordersanxiety5-HTTLPRSLC6A4depression
Journal Article 2018-04-30 ✓ 2 Snippets Klucken T, Tapia León I, Blecker C, Kruse O, Stalder T, Stark R.
In-Text Gene Mentions

…effect with reduced5-HTTavailability and serotonergic…

…s-alleles (i.e., reduced5-HTTavailability; “low-functioning…

Show Full Abstract

Recent work underlines the importance of alterations in white matter (e.g., measured by fractional anisotropy (FA)) as a neural vulnerability marker for psychiatric disorders. In this context, the uncinate fasciculus (UF), which connects the limbic system with prefrontal areas, has repeatedly been linked to psychiatric disorders, fear processing, and anxiety-related traits. Individual differences in FA may partly be genetically determined. Variation in the promoter region of the serotonin transporter gene (serotonin transporter-linked polymorphic region [5-HTTLPR]) is a particularly promising candidate in this context, which has been linked to psychiatric disorders as well as to limbic and prefrontal reactivity. However, findings on the association between the 5-HTTLPR and FA within the UF-tract have been heterogeneous. The present study investigated this relationship and extended previous work by considering different genetic classification approaches as well as sex effects in a human sample (<i>n</i> = 114). All participants were genotyped for the 5-HTTLPR and the rs25531 polymorphism. As a main result, we did not find any significant relationship between the 5-HTTLPR and FA in the UF-tract although power analyses showed an adequate power. In addition, genotype effects were neither found when different classification approaches were used nor when analyses were carried out in males or females only. The present findings suggest that the association of the 5-HTTLPR and FA seems to be a more labile phenomenon than previously assumed. Possible explanations and limitations are discussed.

Also flagged:non-alcoholic fatty liver diseaseNAFLDatherosclerosisCV diseasesLiver DiseaseCV disease
Journal Article 2018-04-30 ✓ 1 Snippet Tarantino G, Barrea L, Capone D, Citro V, Mosca T, Savastano S.
In-Text Gene Mentions

…disease (Wilson disease,hemochromatosis, or antitrypsin deficiency)…

Show Full Abstract

<h4>Background</h4>Literature data suggest with some criticism that full-fledged cardiovascular (CV) events (acute or chronic) are likely predicted by blood components, which are reported to be associated with the presence/severity of non-alcoholic fatty liver disease (NAFLD). This study was aimed at determining which marker(s) derived from blood count, such as white blood cells, neutrophils, neutrophil/lymphocyte ratio, platelet count, hemoglobin, mean corpuscular volume, hematocrit values were associated with ear or subclinical atherosclerosis, in obese patients of various classes suffering from NAFLD.<h4>Methods</h4>One hundred consecutive obese patients presenting NAFLD at ultrasound, with low prevalence of co-morbidities and no history or instrumental features of CV diseases, underwent carotid intima-media thickness (IMT) assessment by Doppler ultrasonography. All of them were studied taking into account anthropometric parameters, the metabolic profile, and inflammatory markers.<h4>Results</h4>White blood cells and neutrophil count showed no statistical association with IMT, which was predicted by the amount of visceral adiposity, as appreciated by ultrasonography. After adjusting for visceral adiposity and smoking status, only age and hematocrit contextually predicted early atherosclerosis, evaluated as IMT. Visceral adiposity was a confounding factor in foreseeing IMT.<h4>Conclusion</h4>Hematocrit values along with the patient's age suggest an initial atherosclerosis, evaluated as IMT, and if this finding is confirmed in larger cohorts, could be added to other canonical CV risk factors. Inferences can be enhanced by future prospective studies that aim to identify the relationships between incident cardio-metabolic cases and this hematologic parameter.

Also flagged:immune responseantiviral responsespattern recognition receptorscytoplasmendosomestype 1 interferons
Journal Article 2018-04-30 No Snippets Said EA, Tremblay N, Al-Balushi MS, Al-Jabri AA, Lamarre D.
Show Full Abstract

The role of the innate immune response in detecting RNA viruses is crucial for the establishment of proper inflammatory and antiviral responses. Different receptors, known as pattern recognition receptors (PRRs), are present in the cytoplasm, endosomes, and on the cellular surface. These receptors have the capacity to sense the presence of viral nucleic acids as pathogen-associated molecular patterns (PAMPs). This recognition leads to the induction of type 1 interferons (IFNs) as well as inflammatory cytokines and chemokines. In this review, we provide an overview of the significant involvement of cellular RNA helicases and Toll-like receptors (TLRs) 3, 7, and 8 in antiviral immune defenses.

Also flagged:deathCVDresponse to nutritionCardiovascular DiseaseFTOACE
Journal Article 2018-04-30 ✓ 1 Snippet Voruganti VS.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Purpose</h4>Cardiovascular disease (CVD) is the leading cause of death in the United States and globally. There is significant evidence implicating genetic and dietary factors in the development and progression of CVD and its risk factors. Nutritional genomics is a comparatively new field of science that focuses on the relationship of individual genetic variation with response to nutrition. The purpose of this review is to summarize recent progress, in the field of nutritional genomics as it relates to cardiovascular disease.<h4>Recent findings</h4>Evidence from recent studies has shown significant effects of gene-diet interactions on CVD biomarkers and the development and progression of CVD. The cardiovascular effects of gene-nutrient interactions with respect to macronutrients and genes such as <i>FTO, ACE, PPARs, TCF7L2, BDNF</i>, <i>MC4R, APOAs</i>, <i>FADS</i>, etc. have shown consistent results across age groups and populations whereas gene-nutrient interaction effects of other genes have only been limited to specific ages, genders or populations and need to validated and confirmed.<h4>Summary</h4>The identification of individual genetic variation influencing diet-related CVD risk is important and may inform future nutritional intervention studies. Although there is ample scientific evidence indicating that the genetic susceptibility to CVD can be modified by diet, we are still not at a stage where this information is easily translated into dietary plans. Thus, there is a need for better approaches to achieve precision in dietary data collection and streamline computational approaches for meaningful and effective nutritional interventions.

Also flagged:APOEANK1hypermethylationhistone-translational
Journal Article 2018-04-29 ✓ 1 Snippet Morris G, Berk M, Maes M, Puri BK.
In-Text Gene Mentions

…major histocompatibility geneHFEare significantly more…

Show Full Abstract

The classical amyloid cascade model for Alzheimer's disease (AD) has been challenged by several findings. Here, an alternative molecular neurobiological model is proposed. It is shown that the presence of the APOE ε4 allele, altered miRNA expression and epigenetic dysregulation in the promoter region and exon 1 of TREM2, as well as ANK1 hypermethylation and altered levels of histone post-translational methylation leading to increased transcription of TNFA, could variously explain increased levels of peripheral and central inflammation found in AD. In particular, as a result of increased activity of triggering receptor expressed on myeloid cells 2 (TREM-2), the presence of the apolipoprotein E4 (ApoE4) isoform, and changes in ANK1 expression, with subsequent changes in miR-486 leading to altered levels of protein kinase B (Akt), mechanistic (previously mammalian) target of rapamycin (mTOR) and signal transducer and activator of transcription 3 (STAT3), all of which play major roles in microglial activation, proliferation and survival, there is activation of microglia, leading to the subsequent (further) production of cytokines, chemokines, nitric oxide, prostaglandins, reactive oxygen species, inducible nitric oxide synthase and cyclooxygenase-2, and other mediators of inflammation and neurotoxicity. These changes are associated with the development of amyloid and tau pathology, mitochondrial dysfunction (including impaired activity of the electron transport chain, depleted basal mitochondrial potential and oxidative damage to key tricarboxylic acid enzymes), synaptic dysfunction, altered glycogen synthase kinase-3 (GSK-3) activity, mTOR activation, impairment of autophagy, compromised ubiquitin-proteasome system, iron dyshomeostasis, changes in APP translation, amyloid plaque formation, tau hyperphosphorylation and neurofibrillary tangle formation.

Also flagged:major depressive disorderADdepressionAPOEDepressive DisorderHSPA1A
Journal Article 2018-04-28 ✓ 5 Snippets Kitzlerová E, Fišar Z, Lelková P, Jirák R, Zvěřová M, Hroudová J, Manukyan A, Martásek P, Raboch J.
In-Text Gene Mentions

Genes for the 5-HTT and serotonin receptors 5-HT1A and 5-HT2A have been implicated in mood and behavior and they have been widely studied in mental disorders, such as MDD and AD [54–60].

Genes associated with the risk for MDD include SLC6A4 for the serotonin transporter (symbolized as 5-HTT, SERT, or SLC6A4), HTR2A for the serotonin 2A receptor (5-HT2A), TPH2 for neuronal tryptophan hydroxylase 2, TH for tyrosine hydroxylase, MAOA for monoamine oxidase A, COMT for catechol-O-methyltransferase, BDNF for brain-derived neurotrophic factor, ACE for angiotensin-converting enzyme, APOE for apolipoprotein E (ApoE), GNB3 for G protein subunit β3, and MTHFR for methylene tetrahydrofolate reductase [21,22].

Sidak-adjusted, as well as FDR-adjusted P-values, remained lower than 0.05 in MDD responders for the interaction between polymorphisms of genes for (1) HSP70, 5-HTT, and BDNF, and (2) HSP70, ApoE, and BDNF (Table 9).

…transporter (symbolized as5-HTT, SERT, or SLC6A4),…

…Genes for the5-HTTand serotonin receptors…

Show Full Abstract

BACKGROUND Several genetic susceptibility loci for major depressive disorder (MDD) or Alzheimer's disease (AD) have been described. Interactions among polymorphisms are thought to explain the differences between low- and high-risk groups. We tested for the contribution of interactions between multiple functional polymorphisms in the risk of MDD or AD. MATERIAL AND METHODS A genetic association case-control study was performed in 68 MDD cases, 84 AD cases (35 of them with comorbid depression), and 90 controls. The contribution of 7 polymorphisms from 5 genes (APOE, HSPA1A, SLC6A4, HTR2A, and BDNF) related to risk of MDD or AD development was analyzed. RESULTS Significant associations were found between MDD and interactions among polymorphisms in HSPA1A, SLC6A4, and BDNF or HSPA1A, BDNF, and APOE genes. For polymorphisms in the APOE gene in AD, significant differences were confirmed on the distributions of alleles and genotype rates compared to the control or MDD. Increased probability of comorbid depression was found in patients with AD who do not carry the ε4 allele of APOE. CONCLUSIONS Assessment of the interactions among polymorphisms of susceptibility loci in both MDD and AD confirmed a synergistic effect of genetic factors influencing inflammatory, serotonergic, and neurotrophic pathways at these heterogenous complex diseases. The effect of interactions was greater in MDD than in AD. A presence of the ε4 allele was confirmed as a genetic susceptibility factor in AD. Our findings indicate a role of APOE genotype in onset of comorbid depression in a subgroup of patients with AD who are not carriers of the APOE ε4 allele.

Also flagged:voltage-gated calcium channelsschizophreniachromosomesmacromoleculeVoltage-gated calcium (Ca v ) channelsorganization
Journal Article 2018-04-28 ✓ 1 Snippet Li W, Fan CC, Mäki-Marttunen T, Thompson WK, Schork AJ, Bettella F, Schizophrenia Working Group of the Psychiatric Genomics Consortium, Djurovic S, Dale AM, Andreassen OA, Wang Y.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Traditional genome-wide association studies (GWAS) have successfully detected genetic variants associated with schizophrenia. However, only a small fraction of heritability can be explained. Gene-set/pathway-based methods can overcome limitations arising from single nucleotide polymorphism (SNP)-based analysis, but most of them place constraints on size which may exclude highly specific and functional sets, like macromolecules. Voltage-gated calcium (Ca<sub>v</sub> ) channels, belonging to macromolecules, are composed of several subunits whose encoding genes are located far away or even on different chromosomes. We combined information about such molecules with GWAS data to investigate how functional channels associated with schizophrenia. We defined a biologically meaningful SNP-set based on channel structure and performed an association study by using a validated method: SNP-set (sequence) kernel association test. We identified eight subtypes of Ca<sub>v</sub> channels significantly associated with schizophrenia from a subsample of published data (N = 56,605), including the L-type channels (Ca<sub>v</sub> 1.1, Ca<sub>v</sub> 1.2, Ca<sub>v</sub> 1.3), P-/Q-type Ca<sub>v</sub> 2.1, N-type Ca<sub>v</sub> 2.2, R-type Ca<sub>v</sub> 2.3, T-type Ca<sub>v</sub> 3.1, and Ca<sub>v</sub> 3.3. Only genes from Ca<sub>v</sub> 1.2 and Ca<sub>v</sub> 3.3 have been implicated by the largest GWAS (N = 82,315). Each subtype of Ca<sub>v</sub> channels showed relatively high chip heritability, proportional to the size of its constituent gene regions. The results suggest that abnormalities of Ca<sub>v</sub> channels may play an important role in the pathophysiology of schizophrenia and these channels may represent appropriate drug targets for therapeutics. Analyzing subunit-encoding genes of a macromolecule in aggregate is a complementary way to identify more genetic variants of polygenic diseases. This study offers the potential of power for discovery the biological mechanisms of schizophrenia.

Also flagged:C9orf72behavioural variant frontotemporal dementiacognitiondementiabehaviouralneurodegenerative syndrome
Journal Article 2018-04-28 ✓ 1 Snippet Devenney E, Swinn T, Mioshi E, Hornberger M, Dawson KE, Mead S, Rowe JB, Hodges JR.
In-Text Gene Mentions

…the ACE-R orACE-III, have preserved basic…

Show Full Abstract

<h4>Background</h4>This study aimed to i) examine the frequency of C9orf72 expansions in a cohort of patients with the behavioural variant frontotemporal dementia (bvFTD) phenocopy syndrome, ii) observe outcomes in a group of phenocopy syndrome with very long term follow-up and iii) compare progression in a cohort of patients with the phenocopy syndrome to a cohort of patients with probable bvFTD.<h4>Methods</h4>Blood was obtained from 16 phenocopy cases. All met criteria for possible bvFTD and were labeled as phenocopy cases if they showed no functional decline, normal cognitive performance on the Addenbrooke's Cognitive Examination-Revised (ACE-R) and a lack of atrophy on brain imaging, over at least 3 years of follow-up. In addition, we obtained very long term follow-up data in 6 cases. A mixed model analysis approach determined the pattern of change in cognition and behaviour over time in phenocopy cases compared to 27 probable bvFTD cases.<h4>Results</h4>All 16 patients were screened for the C9orf72 expansion that was present in only one (6.25%). Of the 6 cases available for very long-term follow-up (13 - 21 years) none showed progression to frank dementia. Moreover, there was a decrease in the caregiver ratings of behavioural symptoms over time. Phenocopy cases showed significantly slower rates of progression compared to probable bvFTD patients (p < 0.006).<h4>Conclusion</h4>The vast majority of patients with the bvFTD phenocopy syndrome remain stable over many years. An occasional patient can harbor the C9orf72 expansion. The aetiology of the remaining cases remains unknown but it appears very unlikely to reflect a neurodegenerative syndrome due to lack of clinical progression or atrophy on imaging.

Also flagged:Fibroblast growth factor receptor 1fibroblast growth factor receptorsFgfFgfr1growth factor receptoraxon
Journal Article 2018-04-28 ✓ 1 Snippet Yang JJ, Bertolesi GE, Hehr CL, Johnston J, McFarlane S.
In-Text Gene Mentions

DCC

Show Full Abstract

Axons sense molecular cues in their environment to arrive at their post-synaptic targets. While many of the molecular cues have been identified, the mechanisms that regulate their spatiotemporal expression remain elusive. We examined here the transcriptional regulation of the guidance gene slit1 both in vitro and in vivo by specific fibroblast growth factor receptors (Fgfrs). We identified an Fgf-responsive 2.3 kb slit1 promoter sequence that recapitulates spatiotemporal endogenous expression in the neural tube and eye of Xenopus embryos. We found that signaling through Fgfr1 is the main regulator of slit1 expression both in vitro in A6 kidney epithelial cells, and in the Xenopus forebrain, even when other Fgfr subtypes are present in cells. These data argue that a specific signaling pathway downstream of Fgfr1 controls in a cell-autonomous manner slit1 forebrain expression and are novel in identifying a specific growth factor receptor for in vivo control of the expression of a key embryonic axon guidance cue.

Also flagged:Cervical cancermethylationCINcancercervical cancersFAM19A4
Journal Article 2018-04-27 ✓ 1 Snippet De Strooper LMA, Berkhof J, Steenbergen RDM, Lissenberg-Witte BI, Snijders PJF, Meijer CJLM, Heideman DAM.
In-Text Gene Mentions

…SOX1 , andDCC.…

Show Full Abstract

DNA methylation analysis of cervical scrapes using FAM19A4 and mir124-2 genes has shown a good clinical performance in detecting cervical cancer and advanced CIN lesions in need of treatment in HPV-positive women. To date, longitudinal data on the cancer risk of methylation test-negative women are lacking. In our study, we assessed the longitudinal outcome of FAM19A4/mir124-2 methylation analysis in an HPV-positive screening cohort with 14 years of follow-up. Archived HPV-positive cervical scrapes of 1,040 women (age 29-61 years), who were enrolled in the POBASCAM screening trial (ISRCTN20781131) were tested for FAM19A4/mir124-2 methylation. By linkage with the nationwide network and registry of histo- and cytopathology in the Netherlands (PALGA), 35 cervical cancers were identified during 14 years of follow-up comprising three screens (baseline, and after 5 and 10 years). The baseline scrape of 36.1% (n = 375) women tested positive for FAM19A4/mir124-2 methylation, including 24 women with cervical cancer in follow-up, and 30.6% (n = 318) had abnormal cytology (threshold borderline dyskaryosis or ASCUS), including 14 women with cervical cancer in follow-up. Within screening round capability of FAM19A4/mir124-2 methylation to detect cervical cancer was 100% (11/11, 95% CI: 71.5-100). Kaplan-Meier estimate of 14-year cumulative cervical cancer incidence was 1.7% (95% CI: 0.66-3.0) among baseline methylation-negative and 2.4% (95% CI: 1.4-3.6) among baseline cytology-negative women (risk difference: 0.71% [95% CI: 0.16-1.4]). In conclusion, a negative FAM19A4/mir124-2 methylation test provides a low cervical cancer risk in HPV-positive women of 30 years and older. FAM19A4/mir124-2 methylation testing merits consideration as an objective triage test in HPV-based cervical screening programs.

Also flagged:serinephosphorylationHSP27Androgen receptorheat shock protein 27apocrine breast cancer
Journal Article 2018-04-27 No Snippets Liu X, Feng C, Liu J, Cao L, Xiang G, Liu F, Wang S, Jiao J, Niu Y.
Show Full Abstract

<h4>Background</h4>The most striking feature of molecular apocrine breast cancer (MABC) is the expression of androgen receptor (AR). We report here the mechanism of the AR in regulating the behavior of MABC.<h4>Methods</h4>The MABC cell line, MDA-MB-453, and the nonMABC cell line, MCF7, were used in this study. The effect of dihydrotestosterone (DHT) and heat shock protein 27 (HSP27) on cell proliferation was quantified using the cell counter kit-8 (CCK8) and clonogenic assays in vitro and by a xenograft tumor model in vivo. The expression of the AR and HSP27 was analyzed using western blot, qPCR, and immunofluorescence assays. Complexes of the AR and HSP27 were detected by co-immunoprecipitation (Co-IP).<h4>Results</h4>In MDA-MB-453 cells, DHT promoted cell proliferation and stimulated AR and HSP27 translocation from the cytoplasm to the nucleus, whereas, it inhibited MCF7 cell growth, and only the AR translocated into the nucleus. HSP27 knock-down decreased the proliferative ability of MDA-MB-453 cells, which could be rescued by DHT, while HSP27 and DHT had synergistic effects on MCF7 cells. HSP27 phosphorylation was a prerequisite for AR translocation into the nucleus, especially phosphorylation on serine 82. In addition, DHT stimulated the tumorigenic and metastatic capacities of MDA-MB-453 cells, while HSP27 knock-down decreased the rate of tumor formation and induced apoptosis in cells.<h4>Conclusions</h4>The results suggest that HSP27 assists the AR in regulating the malignant behavior of MABC, and these findings might be helpful in the treatment of MABC.

Also flagged:Heat shock proteinscancerasdevil facial tumour diseaseDFTDtumour
Journal Article 2018-04-27 ✓ 2 Snippets Tovar C, Patchett AL, Kim V, Wilson R, Darby J, Lyons AB, Woods GM.
In-Text Gene Mentions

Biological processes include: cell cycle progression (14-3-3 proteins), signal transduction (HSP90 and HSP60), cellular bioenergy (aconitate hydratase and ATP synthase), proliferation (14-3-3 proteins, cathepsin B, cellular retinoic acid, gelsolin and proliferating cell nuclear antigen), migration (gelsolin and cathepsin B) and apoptosis (14-3-3 proteins, HSP60 and DCC-interaction protein 13-alpha).

…proteins, HSP60 andDCC-interaction protein 13-alphaprotein 13-alpha).…

Show Full Abstract

The Tasmanian devil (Sarcophilus harrisii), the largest extant carnivorous marsupial and endemic to Tasmania, is at the verge of extinction due to the emergence of a transmissible cancer known as devil facial tumour disease (DFTD). DFTD has spread over the distribution range of the species and has been responsible for a severe decline in the global devil population. To protect the Tasmanian devil from extinction in the wild, our group has focused on the development of a prophylactic vaccine. Although this work has shown that vaccine preparations using whole DFTD tumour cells supplemented with adjuvants can induce anti-DFTD immune responses, alternative strategies that induce stronger and more specific immune responses are required. In humans, heat shock proteins (HSPs) derived from tumour cells have been used instead of whole-tumour cell preparations as a source of antigens for cancer immunotherapy. As HSPs have not been studied in the Tasmanian devil, this study presents the first characterisation of HSPs in this marsupial and evaluates the suitability of these proteins as antigenic components for the enhancement of a DFTD vaccine. We show that tissues and cancer cells from the Tasmanian devil express constitutive and inducible HSP. Additionally, this study suggests that HSP derived from DFTD cancer cells are immunogenic supporting the future development of a HSP-based vaccine against DFTD.

Also flagged:respiratory diseaseintracranial hemorrhageCorticosteroidsANSbetamethasonedexamethasone
Journal Article 2018-04-27 No Snippets Chawla S, Natarajan G, Chowdhury D, Das A, Walsh M, Bell EF, Laptook AR, Van Meurs K, D'Angio CT, Stoll BJ, DeMauro SB, Shankaran S.
Show Full Abstract

<h4>Objective</h4>We aimed to compare the rates of "surfactant treated respiratory disease" and other neonatal morbidities among moderately preterm (MPT) infants exposed to no, partial, or a complete course of antenatal corticosteroids (ANS).<h4>Study design</h4>This observational cohort study evaluated MPT infants (29<sup>0/7</sup>-33<sup>6/7</sup> weeks' gestational age), born between January 2012 and November 2013 and enrolled in the "MPT Registry" of the National Institute of Child Health and Human Development Neonatal Research Network.<h4>Results</h4>Data were available for 5,886 infants, including 676 with no exposure, 1225 with partial, and 3,985 with a complete course of ANS. Among no, partial, and complete ANS groups, respectively, there were significant differences in rates of delivery room resuscitation (4.1, 1.4, and 1.2%), surfactant-treated respiratory disease (26.5, 26.3, and 20%), and severe intracranial hemorrhage (3, 2, and 0.8%). Complete ANS course was associated with lower surfactant-treated respiratory disease, compared with partial ANS (odds ratio [OR] 0.62; 95% confidence interval [CI] 0.52-0.74), and no ANS groups (OR 0.52; 95% CI 0.41-0.66) on adjusted analysis.<h4>Conclusion</h4>In MPT infants, ANS exposure is associated with lower delivery room resuscitation, surfactant-treated respiratory disease, and severe intracranial hemorrhage; with the lowest frequency of morbidities associated with a complete course.

Also flagged:Golgi tethering factorgolgin-97breast cancercancersNF-κBluciferase
Journal Article 2018-04-27 No Snippets Hsu RM, Zhong CY, Wang CL, Liao WC, Yang C, Lin SY, Lin JW, Cheng HY, Li PY, Yu CJ.
Show Full Abstract

<h4>Background</h4>Golgin-97 is a tethering factor in the trans-Golgi network (TGN) and is crucial for vesicular trafficking and maintaining cell polarity. However, the significance of golgin-97 in human diseases such as cancer remains unclear.<h4>Methods</h4>We searched for a potential role of golgin-97 in cancers using Kaplan-Meier Plotter ( http://kmplot.com ) and Oncomine ( www.oncomine.org ) datasets. Specific functions of golgin-97 in migration and invasion were examined in golgin-97-knockdown and golgin-97-overexpressing cells. cDNA microarray, pathway analysis and qPCR were used to identify gene profiles regulated by golgin-97. The role of golgin-97 in NF-κB signaling pathway was examined by using subcellular fractionation, luciferase reporter assay, western blot analysis and immunofluorescence assay (IFA).<h4>Results</h4>We found that low expression of golgin-97 correlated with poor overall survival of cancer patients and was associated with invasiveness in breast cancer cells. Golgin-97 knockdown promoted cell migration and invasion, whereas re-expression of golgin-97 restored the above phenotypes in breast cancer cells. Microarray and pathway analyses revealed that golgin-97 knockdown induced the expression of several invasion-promoting genes that were transcriptionally regulated by NF-κB p65. Mechanistically, golgin-97 knockdown significantly reduced IκBα protein levels and activated NF-κB, whereas neither IκBα levels nor NF-κB activity was changed in TGN46- or GCC185-knockdown cells. Conversely, golgin-97 overexpression suppressed NF-κB activity and restored the levels of IκBα in golgin-97-knockdown cells. Interestingly, the results of Golgi-disturbing agent treatment revealed that the loss of Golgi integrity was not involved in the NF-κB activation induced by golgin-97 knockdown. Moreover, both TGN-bound and cytosolic golgin-97 inhibited NF-κB activation, indicating that golgin-97 functions as an NF-κB suppressor regardless of its subcellular localization.<h4>Conclusion</h4>Our results collectively demonstrate a novel and suppressive role of golgin-97 in cancer invasiveness. We also provide a new avenue for exploring the relationship between the TGN, golgin-97 and NF-κB signaling in tumor progression.

Also flagged:heart failureischemic cardiomyopathychronic ischemic cardiomyopathycoronary artery diseasec-kitmyocardial infarction
Journal Article 2018-04-27 No Snippets Bolli R, Hare JM, March KL, Pepine CJ, Willerson JT, Perin EC, Yang PC, Henry TD, Traverse JH, Mitrani RD, Khan A, Hernandez-Schulman I, Taylor DA, DiFede DL, Lima JAC, Chugh A, Loughran J, Vojvodic RW, Sayre SL, Bettencourt J, Cohen M, Moyé L, Ebert RF, Simari RD, Cardiovascular Cell Therapy Research Network (CCTRN).
Show Full Abstract

<h4>Rationale</h4>Autologous bone marrow mesenchymal stem cells (MSCs) and c-kit<sup>+</sup> cardiac progenitor cells (CPCs) are 2 promising cell types being evaluated for patients with heart failure (HF) secondary to ischemic cardiomyopathy. No information is available in humans about the relative efficacy of MSCs and CPCs and whether their combination is more efficacious than either cell type alone.<h4>Objective</h4>CONCERT-HF (Combination of Mesenchymal and c-kit<sup>+</sup> Cardiac Stem Cells As Regenerative Therapy for Heart Failure) is a phase II trial aimed at elucidating these issues by assessing the feasibility, safety, and efficacy of transendocardial administration of autologous MSCs and CPCs, alone and in combination, in patients with HF caused by chronic ischemic cardiomyopathy (coronary artery disease and old myocardial infarction).<h4>Methods and results</h4>Using a randomized, double-blinded, placebo-controlled, multicenter, multitreatment, and adaptive design, CONCERT-HF examines whether administration of MSCs alone, CPCs alone, or MSCs+CPCs in this population alleviates left ventricular remodeling and dysfunction, reduces scar size, improves quality of life, or augments functional capacity. The 4-arm design enables comparisons of MSCs alone with CPCs alone and with their combination. CONCERT-HF consists of 162 patients, 18 in a safety lead-in phase (stage 1) and 144 in the main trial (stage 2). Stage 1 is complete, and stage 2 is currently randomizing patients from 7 centers across the United States.<h4>Conclusions</h4>CONCERT-HF will provide important insights into the potential therapeutic utility of MSCs and CPCs, given alone and in combination, for patients with HF secondary to ischemic cardiomyopathy.<h4>Clinical trial registration</h4>URL: http://www.clinicaltrials.gov. Unique identifier: NCT02501811.

Also flagged:Gastrokine 1gastric cancerGKN1cell proliferationbindingAGS
Journal Article 2018-04-27 No Snippets Yoon JH, Ham IH, Kim O, Ashktorab H, Smoot DT, Nam SW, Lee JY, Hur H, Park WS.
Show Full Abstract

<h4>Background</h4>Gastrokine 1 (GKN1) plays important roles in maintaining mucosal homeostasis, and in regulating cell proliferation and differentiation. Here, we determined whether GKN1 is a potential theragnostic marker for gastric cancer.<h4>Methods</h4>We identified GKN1 binding proteins using the protein microarray assay and investigated whether GKN1 is one of the exosomal cargo proteins by western blot, immunoprecipitation, and immunofluorescent assays. Cell proliferation and apoptosis were analyzed by MTT, BrdU incorporation, flow cytometry, and western blot assays. We further validated the functional relevance of exosomal GKN1 in MKN1-injected xenograft mice. The possibility of serum GKN1 as a diagnostic marker for gastric cancer was determined by ELISA assay.<h4>Results</h4>In protein microarray assay, GKN1 binding to 27 exosomal proteins was clearly observed. GKN1 was expressed in exosomes derived from HFE-145 gastric epithelial cells by western blot and immunofluorescent assays, but not in exosomes from AGS and MKN1 gastric cancer cells. Exosomes carrying GKN1 inhibited cell proliferation and induced apoptosis in both AGS and MKN1 cells, and exosomes carrying GKN1-treated nude mice-bearing MKN1 xenograft tumors exhibited significantly reduced tumor volume and tumor weight. Silencing of clathrin markedly down-regulated the internalization of exosomal GKN1. Interestingly, serum GKN1 concentrations in patients with gastric cancer were significantly lower than those in healthy individuals and patients with colorectal and hepatocellular carcinomas.<h4>Conclusions</h4>The GKN1 is secreted and internalized in the gastric epithelium by exosome-driven transfer, which inhibits gastric tumorigenesis and supports the clinical application of GKN1 protein in gastric cancer diagnosis and treatment.

Also flagged:autismhistoneH1 histone linker proteinnucleosomechromatinorganization
Journal Article 2018-04-27 ✓ 1 Snippet Duffney LJ, Valdez P, Tremblay MW, Cao X, Montgomery S, McConkie-Rosell A, Jiang YH.
In-Text Gene Mentions

linker histones

Show Full Abstract

Genetic mutations in genes encoding proteins involved in epigenetic machinery have been reported in individuals with autism spectrum disorder (ASD), intellectual disability, congenital heart disease, and other disorders. H1 histone linker protein, the basic component in nucleosome packaging and chromatin organization, has not been implicated in human disease until recently. We report a de novo deleterious mutation of histone cluster 1 H1 family member e (HIST1H1E; c.435dupC; p.Thr146Hisfs*50), encoding H1 histone linker protein H1.4, in a 10-year-old boy with autism and intellectual disability diagnosed through clinical whole exome sequencing. The c.435dupC at the 3' end of the mRNA leads to a frameshift and truncation of the positive charge in the carboxy-terminus of the protein. An expression study demonstrates the mutation leads to reduced protein expression, supporting haploinsufficiency of HIST1H1E protein and loss of function as an underlying mechanism of dysfunction in the brain. Taken together with other recent cases with mutations of HIST1H1E in intellectual disability, the evidence supporting the link to causality in disease is strong. Our finding implicates the deficiency of H1 linker histone protein in autism. The systematic review of candidate genes implicated in ASD revealed that 42 of 215 (19.5%) genes are directly involved in epigenetic regulations and the majority of these genes belong to histone writers, readers, and erasers. While the mechanism of how haploinsufficiency of HIST1H1E causes autism is entirely unknown, our report underscores the importance of further study of the function of this protein and other histone linker proteins in brain development.

Also flagged:ADaxonmitochondrialaxonalpathogenesisAlzheimer
Journal Article 2018-04-27 ✓ 1 Snippet Chen M, Lee HK, Moo L, Hanlon E, Stein T, Xia W.
In-Text Gene Mentions

PRDX6

Show Full Abstract

We established a unique platform for proteomic analysis of cultured three-dimensional (3D) neurons and brain tissue from Alzheimer's disease (AD) patients. We collected peripheral blood mononuclear cells (PBMC), converted PBMC to induced pluripotent stem cell (iPSC) lines, and differentiated the iPSC into human 3D neuro-spheroids. The postmortem brain tissue from the superior frontal cortex, inferior frontal cortex and cerebellum area of the AD patients was compared to the same regions from the control subjects. Proteomic analysis of 3D neuro-spheroids derived from AD subjects revealed the alteration of a number of proteins involved in axon growth, mitochondrial function, and antioxidant defense. Similar analysis of post-mortem AD brain tissue revealed significant alteration in proteins involved in oxidative stress, neuro-inflammation, along with proteins related to axonal injury. These results clearly indicate that the dysfunction of 3D neurons from AD patients in our in vitro environment is comparable to the post-mortem AD brain tissue in vivo. In conclusion, our study revealed a number of candidate proteins that have important implications in AD pathogenesis and supports the notion that the iPSC-derived 3D neuronal system functions as a model to examine novel aspects of AD pathology.<h4>Significance</h4>In this study, we present a unique platform for proteomic analysis of induced pluripotent stem cell-derived three dimensional (3D) neurons and compare the results to those from three regions of post-mortem brain tissue from Alzheimer's disease patients and normal control subjects. Our results show that the dysfunction of 3D neurons from AD patients in our in vitro environment is comparable to the post-mortem AD brain tissue in vivo. Our results revealed several candidate proteins that have important implications in AD pathogenesis.

Also flagged:major depressive disorderdepressiongene expressionRSRC1pathogenesiscomplex mental disorder
Journal Article 2018-04-27 ✓ 5 Snippets Li X, Luo Z, Gu C, Hall LS, McIntosh AM, Zeng Y, Porteous DJ, Hayward C, Li M, Yao YG, Zhang C, Luo XJ, 23andMe Research Team7.
In-Text Gene Mentions

Our study identified three novel risk loci (6q16.2, 12q24.31, and 16p13.3) for MDD and suggested that FBXL4 and RSRC1 may play a role in MDD.

Risk variants on the identified risk loci were associated with gene expression in human brain tissues and mRNA expression analysis showed that FBXL4 and RSRC1 were significantly upregulated in brains of MDD cases compared with controls, suggesting that genetic variants may confer risk of MDD through regulating the expression of these two genes.

…analysis showed thatFBXL4and RSRC1 were…

…and suggested thatFBXL4and RSRC1 may…

NEGR1

Show Full Abstract

Accumulating evidence suggests that genetic factors have a role in major depressive disorder (MDD). However, only limited MDD risk loci have been identified so far. Here we perform a meta-analysis (a total of 90,150 MDD cases and 246,603 controls) through combing three genome-wide association studies of MDD, including 23andMe (cases were self-reported with a clinical diagnosis or treatment of depression), CONVERGE (cases were diagnosed using the Composite International Diagnostic Interview) and PGC (cases were diagnosed using direct structured diagnostic interview (by trained interviewers) or clinician-administered DSM-IV checklists). Genetic variants from two previously unreported loci (rs10457592 on 6q16.2 and rs2004910 on 12q24.31) showed significant associations with MDD (P < 5 × 10<sup>-8</sup>) in a total of 336,753 subjects. SNPs (a total of 171) with a P < 1 × 10<sup>-7</sup> in the meta-analysis were further replicated in an independent sample (GS:SFHS, 2,659 MDD cases (diagnosed with DSM-IV) and 17,237 controls) and one additional risk locus (rs3785234 on 16p13.3, P = 1.57 × 10<sup>-8</sup>) was identified in the combined samples (a total of 92,809 cases and 263,840 controls). Risk variants on the identified risk loci were associated with gene expression in human brain tissues and mRNA expression analysis showed that FBXL4 and RSRC1 were significantly upregulated in brains of MDD cases compared with controls, suggesting that genetic variants may confer risk of MDD through regulating the expression of these two genes. Our study identified three novel risk loci (6q16.2, 12q24.31, and 16p13.3) for MDD and suggested that FBXL4 and RSRC1 may play a role in MDD. Further functional characterization of the identified risk genes may provide new insights for MDD pathogenesis.

Also flagged:sitagliptinnonalcoholic steatohepatitislipogenesisNASHsugarNonalcoholic fatty liver disease
Journal Article 2018-04-27 ✓ 1 Snippet Alam S, Ghosh J, Mustafa G, Kamal M, Ahmad N.
In-Text Gene Mentions

…and patients withhemochromatosis, Wilson’s disease, autoimmune…

Show Full Abstract

<h4>Background/purpose</h4>Dipeptidyl peptidase 4 (DPP-4) expression is directly associated with hepatic lipogenesis and liver injury in nonalcoholic steatohepatitis (NASH). This study has been designed to elucidate the histological improvement of NASH with the DPP-4 inhibitor sitagliptin.<h4>Materials and methods</h4>In this open-label randomized control trial, paired liver biopsy was taken from 40 NASH patients. Sitagliptin 100 mg was given once daily to the SL group and no sitagliptin was given to the L group for 1 year. Patients from both groups were encouraged to exercise moderately and advised to avoid saturated fat, excessive sugar, soft drinks, fast food, and refined carbohydrates to reduce weight.<h4>Results</h4>Steatosis improved in the SL group (from 2.3±0.6 to 1.2±0.8; <i>P</i>=0.000) and the L group (from 2.1±0.6 to 1.6±0.9; <i>P</i>=0.008), ballooning decreased from 1.8±0.6 to 1.3±06 (<i>P</i>=0.002) in the SL group, but not in the L group. Nonalcoholic fatty liver disease activity score (NAS) attenuated in both groups: the SL group (from 5.8±0.9 to 3.9±1.4; <i>P</i>=0.000) and the L group (from 5.3±0.6 to 4.6±1.2; <i>P</i>=0.009). NAS improvement was much higher in the SL group (1.9±1.4) than in the L group (0.7±1.1) (<i>P</i>=0.006), with NAS improving by ≥2 in 13 patients from the SL group and five patients from the L group (<i>P</i>=0.01). Improvement was irrespective of diabetes. Regression analysis explored that sitagliptin had odds of 6.38 and weight reduction had odds of 4.51 for NAS reduction.<h4>Conclusion</h4>Sitagliptin 100 mg once daily for 1 year ameliorates NAS by improving steatosis and ballooning, irrespective of diabetes. Sitagliptin has stronger efficacy than that of weight reduction.

Also flagged:Nucleotideobesitybeta-3 adrenergic receptorADRB3FABP2GHRL
Journal Article 2018-04-27 ✓ 1 Snippet Zaharan NL, Muhamad NH, Jalaludin MY, Su TT, Mohamed Z, Mohamed MNA, A Majid H.
In-Text Gene Mentions

…SNPs such asOLFM4-9568856, GNPDA2-rs10938397, C…

Show Full Abstract

<h4>Background</h4>Several non-synonymous single-nucleotide polymorphisms (nsSNPs) have been shown to be associated with obesity. Little is known about their associations and interactions with physical activity (PA) in relation to adiposity parameters among adolescents in Malaysia.<h4>Methods</h4>We examined whether (a) PA and (b) selected nsSNPs are associated with adiposity parameters and whether PA interacts with these nsSNPs on these outcomes in adolescents from the Malaysian Health and Adolescents Longitudinal Research Team study (<i>n</i> = 1,151). Body mass indices, waist-hip ratio, and percentage body fat (% BF) were obtained. PA was assessed using Physical Activity Questionnaire for Older Children (PAQ-C). Five nsSNPs were included: beta-3 adrenergic receptor (ADRB3) rs4994, FABP2 rs1799883, GHRL rs696217, MC3R rs3827103, and vitamin D receptor rs2228570, individually and as combined genetic risk score (GRS). Associations and interactions between nsSNPs and PAQ-C scores were examined using generalized linear model.<h4>Results</h4>PAQ-C scores were associated with % BF (β = -0.44 [95% confidence interval -0.72, -0.16], <i>p</i> = 0.002). The CC genotype of ADRB3 rs4994 (β = -0.16 [-0.28, -0.05], corrected <i>p</i> = 0.01) and AA genotype of MC3R rs3827103 (β = -0.06 [-0.12, -0.00], <i>p</i> = 0.02) were significantly associated with % BF compared to TT and GG genotypes, respectively. Significant interactions with PA were found between ADRB3 rs4994 (β = -0.05 [-0.10, -0.01], <i>p</i> = 0.02) and combined GRS (β = -0.03 [-0.04, -0.01], <i>p</i> = 0.01) for % BF.<h4>Conclusion</h4>Higher PA score was associated with reduced % BF in Malaysian adolescents. Of the nsSNPs, ADRB3 rs4994 and MC3R rs3827103 were associated with % BF. Significant interactions with PA were found for ADRB3 rs4994 and combined GRS on % BF but not on measurements of weight or circumferences. Targeting body fat represent prospects for molecular studies and lifestyle intervention in this population.

Also flagged:Anti-inflammatory Cytokineanti-inflammatory cytokinesIL-10IL-4transductionaxonal
Journal Article 2018-04-27 ✓ 1 Snippet Park J, Decker JT, Margul DJ, Smith DR, Cummings BJ, Anderson AJ, Shea LD.
In-Text Gene Mentions

Negr1

Show Full Abstract

Trauma to the spinal cord and associated secondary inflammation can lead to permanent loss of sensory and motor function below the injury level, with the resulting environment serving as a barrier that limits regeneration. In this study, we investigate the localized expression of anti-inflammatory cytokines IL-10 and IL-4 via lentiviral transduction in multichannel bridges. Porous multichannel bridges provide physical guidance for axonal outgrowth with the cytokines hypothesized to modulate the neuroinflammatory microenvironment and enhance axonal regeneration. Gene expression analyses indicated that induced IL-10 and IL-4 expression decreased expression of pro-inflammatory genes and increased pro-regenerative genes relative to control. Moreover, these factors led to increased numbers of axons and myelination, with approximately 45% of axons myelinated and the number of oligodendrocyte myelinated axons significantly increased by 3- to 4-fold. Furthermore, the combination of a bridge with IL-10 and IL-4 expression improved locomotor function after injury to an average score of 6 relative to an average score of 3 for injury alone. Collectively, these studies highlight the potential for localized immunomodulation to decrease secondary inflammation and enhance regeneration that may have numerous applications.

Also flagged:Lung squamous cell carcinomaLSCCSOX2stem cell transcription factorcancerbinding
Journal Article 2018-04-27 No Snippets Chyr J, Guo D, Zhou X.
Show Full Abstract

Lung squamous cell carcinoma (LSCC) is a genomically complex malignancy with no effective treatments. Recent studies have found a large number of DNA alterations such as SOX2 amplification in LSCC patients. As a stem cell transcription factor, SOX2 is important for the maintenance of pluripotent cells and may play a role in cancer. To study the downstream mechanisms of SOX2, we employed expression quantitative trait loci (eQTLs) technology to investigate how the presence of SOX2 affects the expression of target genes. We discovered unique eQTLs, such as rs798827-VDAC3 (FDR <i>p</i>-value = 0.0034), that are only found in SOX2-active patients but not in SOX2-inactive patients. SNP rs798827 is within strong linkage disequilibrium (<i>r</i><sup>2</sup> = 1) to rs58163073, where rs58163073 [T] allele increases the binding affinity of SOX2 and allele [TA] decreases it. In our analysis, SOX2 silencing downregulates VDAC3 in two LSCC cell lines. Chromatin conformation capturing data indicates that this SNP is located within the same Topologically Associating Domain (TAD) of VDAC3, further suggesting SOX2's role in the regulation of VDAC3 through the binding of rs58163073. By first subgrouping patients based on SOX2 activity, we made more relevant eQTL discoveries and our analysis can be applied to other diseases.

Also flagged:Breast cancertumorsBRCAnucleotideluminal tumorsluminal breast cancer
Journal Article 2018-04-27 ✓ 5 Snippets Encinas G, Sabelnykova VY, de Lyra EC, Hirata Katayama ML, Maistro S, de Vasconcellos Valle PWM, de Lima Pereira GF, Rodrigues LM, de Menezes Pacheco Serio PA, de Gouvêa ACRC, Geyer FC, Basso RA, Pasini FS, Del Pilar Esteves Diz M, Brentani MM, Guedes Sampaio Góes JC, Chammas R, Boutros PC, Koike Folgueira MAA.
In-Text Gene Mentions

In tumor 402, besides PIK3CA and CIITA, other candidate cancer genes harboring somatic SNVs were CACNA1E, NES, STAB1, HECW2, SMURF2 and ZNF462. In tumor 406, SNVs were detected in three known cancer genes reported in the “Cancer Gene Census” database [19]: PIK3CA, TP53 and PRKAR1A. However, the alteration detected in the latter was considered pathogenic in only one of the five mutation function assessment algorithms (Table 1).

A median of six candidate driver genes was mutated by SNVs in each sample and the most frequently mutated genes were PIK3CA, GATA3, TP53 and MAP2K4. Potential cancer drivers affected in the present non-BRCA tumors include GRHL2, PIK3AP1, CACNA1E, SEMA6D, SMURF2, RSBN1 and MTHFD2. Sixteen out of 37 luminal tumors (43%) harbored SNVs in DNA repair genes, such as ATR, BAP1, ERCC6, FANCD2, FANCL, MLH1, MUTYH, PALB2, POLD1, POLE, RAD9A, RAD51 and TP53, and 54% presented pathogenic mutations (frameshift or nonsense) in at least one gene involved in gene transcription.

Seven genes were relatively frequently mutated (≥1%) in cancer in general or in breast cancer specifically: CACNA1E, HECW2, STAB1, ZNF462, FLG, TTN and NDST4. Finally, using the above ranking system, 20 genes, scoring at least 2, were considered possible cancer drivers (Supplementary Tables 9, 9a), such as PIK3AP1, GRHL2, CACNA1E, SMURF2, SEMA6D, RSBN1, MTHFD2, among others.

CACNA1E, calcium voltage-gated channel subunit alpha-1 E, was shown to be underexpressed in breast cancer compared with normal tissue and was hypothesized to be a tumor suppressor gene in some types of cancer [36].

In addition, SNVs were detected in genes that were previously associated with cancer, such as CACNA1E, PRKD1, NDST4, and were also considered pathogenic/deleterious/not tolerated in at least three mutation function models.

Show Full Abstract

Breast cancer arising in very young patients may be biologically distinct; however, these tumors have been less well studied. We characterized a group of very young patients (≤ 35 years) for BRCA germline mutation and for somatic mutations in luminal (<i>HER2</i> negative) breast cancer. Thirteen of 79 unselected very young patients were <i>BRCA</i>1/2 germline mutation carriers. Of the non-<i>BRCA</i> tumors, eight with luminal subtype (<i>HER2</i> negative) were submitted for whole exome sequencing and integrated with 29 luminal samples from the COSMIC database or previous literature for analysis. We identified C to T single nucleotide variants (SNVs) as the most common base-change. A median of six candidate driver genes was mutated by SNVs in each sample and the most frequently mutated genes were <i>PIK3CA, GATA3, TP53</i> and <i>MAP2K4</i>. Potential cancer drivers affected in the present non-<i>BRCA</i> tumors include <i>GRHL2, PIK3AP1, CACNA1E</i>, <i>SEMA6D</i>, <i>SMURF2</i>, <i>RSBN1</i> and <i>MTHFD2.</i> Sixteen out of 37 luminal tumors (43%) harbored SNVs in DNA repair genes, such as <i>ATR, BAP1, ERCC6, FANCD2, FANCL, MLH1</i>, <i>MUTYH, PALB2, POLD1, POLE</i>, <i>RAD9A, RAD51 and TP53</i>, and 54% presented pathogenic mutations (frameshift or nonsense) in at least one gene involved in gene transcription. The differential biology of luminal early-age onset breast cancer needs a deeper genomic investigation.

Also flagged:ERβluminal breast cancerbreast cancerstumorsp53ER
Journal Article 2018-04-27 ✓ 1 Snippet Bado I, Pham E, Soibam B, Nikolos F, Gustafsson JÅ, Thomas C.
In-Text Gene Mentions

To assess ER activity, breast cancer cells were maintained in 1% DCC-FBS media for 48 hours prior to treatment for 24 hours with 17β-estradiol (E2), diarylpropionitrile (DPN), fulvestrant (ICI182780 or ICI) or 4-hydroxytamoxifen (4-OHT).

Show Full Abstract

Estrogen receptor α (ERα)-positive breast cancers tend to develop resistance to both endocrine therapy and chemotherapy. Despite recent progress in defining molecular pathways that confer endocrine resistance, the mechanisms that regulate chemotherapy response in luminal tumors remain largely elusive. Luminal tumors often express wild-type p53 that is a major determinant of the cellular DNA damage response. Similar to p53, the second ER subtype, ERβ, has been reported to inhibit breast tumorigenesis by acting alone or in collaboration with p53. However, a synergistic mechanism of action has not been described. Here, we suggest that ERβ relies on p53 to elicit its tumor repressive actions in ERα-positive breast cancer cells. Upregulation of ERβ and treatment with ERβ agonists potentiates the tumor suppressor function of p53 resulting in decreased survival. This effect requires molecular interaction between the two proteins that disrupts the inhibitory action of ERα on p53 leading to increased transcriptional activity of p53. In addition, we show that the same interaction alters the chemosensitivity of endocrine-resistant cells including their response to tamoxifen therapy. Our results suggest a collaboration of ERβ and p53 tumor suppressor activity in breast cancer cells that indicates the importance of ligand-regulated ERβ as a tool to target p53 activity and improve the clinical management of resistant disease.

Also flagged:netrin-1metastatic renal cell carcinomaccRCCsunitinibdeathrenal cell carcinoma
Journal Article 2018-04-27 ✓ 5 Snippets Frees S, Zhou B, Han KS, Tan Z, Raven P, Wong A, D'Costa N, Fazli L, Struss W, Moskalev I, Chavez-Munoz C, So A.
In-Text Gene Mentions

As a result, netrin-1 overexpression and/or the decrease in DCC or UNC5H have been described as a mechanism for cancer cells to inhibit proapoptotic signalling pathway, either through the autocrine loop of netrin-1, interaction of netrin-1 with its dependence receptor or through the absence of the dependence receptors, to promote cancer cell survival and thus increase cancer cell viability and migration [19].

Netrin-1 and its receptors, DCC and UNC5H, have been reported to be important factors for tumor development and progression in several tumor entities.

…and its receptors,DCCand UNC5H, have…

…in netrin-1 andDCClevels have been…

…extensively, where theDCCchromosomal region have…

Show Full Abstract

<h4>Introduction</h4>Clear-cell renal cell carcinoma (ccRCC) is the sixth most common malignancy in men in North America. Since ccRCC is a malignancy dependent on neovascularization, current first line systemic therapies like sunitinib, target the formation of new vessels allowing nutrient deprivation and cell death. However, recent studies have shown that patients develop resistance after approximately 1 year of treatment and show disease progression while on therapy. Therefore, we propose to identify the protein(s) responsible for increased migration with the aim of developing a new therapy that will target the identified protein and potentially slow down the progression of the disease.<h4>Material and methods</h4>Human renal cancer cell lines (Caki-1, Caki-2, ACHN) were treated with increasing doses of sunitinib to develop a sunitinib-conditioned renal cell carcinoma cell line. mRNA microarray and qPCR were performed to compare the differences in gene expression between Caki-1 sunitinib-conditioned and non-conditioned cells. NTN1 was assessed in our <i>in vivo</i> sunitinib-conditioned mouse model using immunostaining. xCELLigence and scratch assays were used to evaluate migration and MTS was used to evaluate cell viability.<h4>Results</h4>Human renal cell carcinoma sunitinib-conditioned cell lines showed upregulation of netrin-1 in microarray and q-PCR. Increased migration was demonstrated in Caki-1 sunitinib-conditioned cells when compared to the non-treated ones as well as, increased endothelial cell migration. Silencing of netrin-1 in sunitinib-conditioned Caki-1 cells did not demonstrate a significant reduction in cell migration.<h4>Conclusion</h4>Netrin-1 is highly upregulated in renal cell carcinoma treated with sunitinib, but has no influence on cell viability or cell migration in metastatic RCC.

Also flagged:ironinsulininsulin resistancepathogenesisnonalcoholic fatty liver diseaseNAFLD
Journal Article 2018-04-27 ✓ 5 Snippets Britton L, Bridle K, Reiling J, Santrampurwala N, Wockner L, Ching H, Stuart K, Subramaniam VN, Jeffrey G, St Pierre T, House M, Gummer J, Trengove R, Olynyk J, Crawford D, Adams L.
In-Text Gene Mentions

…a human factors engineering‐hemochromatosisgenotype (C282Y/C282Y or…

…those screened withhemochromatosis‐range hepatic iron concentrat…

…single participant withhemochromatosis‐range HIC (99 mmol/kg)…

…loading below thehemochromatosisrange (less than…

…iron seen inhemochromatosisand insulin resistance…

Show Full Abstract

Rodent and cell-culture models support a role for iron-related adipokine dysregulation and insulin resistance in the pathogenesis of nonalcoholic fatty liver disease (NAFLD); however, substantial human data are lacking. We examined the relationship between measures of iron status, adipokines, and insulin resistance in patients with NAFLD in the presence and absence of venesection. This study forms part of the Impact of Iron on Insulin Resistance and Liver Histology in Nonalcoholic Steatohepatitis (IIRON2) study, a prospective randomized controlled trial of venesection for adults with NAFLD. Paired serum samples at baseline and 6 months (end of treatment) in controls (n = 28) and patients who had venesection (n = 23) were assayed for adiponectin, leptin, resistin, retinol binding protein-4, tumor necrosis factor α, and interleukin-6, using a Quantibody, customized, multiplexed enzyme-linked immunosorbent assay array. Hepatic iron concentration (HIC) was determined using MR FerriScan. Unexpectedly, analysis revealed a significant positive correlation between baseline serum adiponectin concentration and HIC, which strengthened after correction for age, sex, and body mass index (rho = 0.36; <i>P =</i> 0.007). In addition, there were significant inverse correlations between HIC and measures of insulin resistance (adipose tissue insulin resistance (Adipo-IR), serum insulin, serum glucose, homeostasis model assessment of insulin resistance, hemoglobin A1c, and hepatic steatosis), whereas a positive correlation was noted with the insulin sensitivity index. Changes in serum adipokines over 6 months did not differ between the control and venesection groups. <i>Conclusion:</i> HIC positively correlates with serum adiponectin and insulin sensitivity in patients with NAFLD. Further study is required to establish causality and mechanistic explanations for these associations and their relevance in the pathogenesis of insulin resistance and NAFLD. (<i>Hepatology Communications</i> 2018;2:644-653).

Also flagged:RNA AptamerspolyglutamineHDmitochondrialcalciummembrane
Journal Article 2018-04-27 ✓ 5 Snippets Patel KA, Chaudhary RK, Roy I.
In-Text Gene Mentions

The intracellular calcium level of the cells expressing 103Q-htt showed ∼45% increase as compared to uninduced cells, matching the increased level of Ca2+ in HD models reported elsewhere.

These novel inhibitors of 103Q-htt aggregation exhibit the potential to alleviate various mitochondrial dysfunctions, which is a hallmark of HD.

YAC128 HD transgenic mouse (harboring 128Q-htt) showed significantly higher level of mitochondrial matrix Ca2+ level in fibroblasts, which was associated with mtDNA damage.12

…ant huntingtin fragment (103Q-htt).…

…cells not expressing 103Q-htt, suggesting complete recovery…

Show Full Abstract

Huntington's disease (HD) is associated with the misfolding and aggregation of mutant huntingtin harboring an elongated polyglutamine stretch at its N terminus. A distinguishing pathological hallmark of HD is mitochondrial dysfunction. Any strategy that can restore the integrity of the mitochondrial environment should have beneficial consequences for the disease. Specific RNA aptamers were selected that were able to inhibit aggregation of elongated polyglutamine stretch containing mutant huntingtin fragment (103Q-htt). They were successful in reducing the calcium overload, which leads to mitochondrial membrane depolarization in case of HD. In one case, the level of Ca<sup>2+</sup> was restored to the level of cells not expressing 103Q-htt, suggesting complete recovery. The presence of aptamers was able to increase mitochondrial mass in cells expressing 103Q-htt, along with rescuing loss of mitochondrial genome. The oxidative damage to the proteome was prevented, which led to increased viability of cells, as monitored by flow cytometry. Thus, the presence of aptamers was able to inhibit aggregation of mutant huntingtin fragment and restore mitochondrial dysfunction in the HD cell model, confirming the advantage of the strategy in a disease-relevant parameter.

Also flagged:idelalisibnitrodiamidesynthesisfluorophenyl
Journal Article 2018-04-27 No Snippets Mekala N, Buddepu SR, Dehury SK, Moturu KMVR, Indukuri SKV, Vasireddi UR, Parimi AR.
Show Full Abstract

A novel and scalable synthesis of 5-fluoro-3-phenyl-2-[(1<i>S</i>)-1-(9<i>H</i>-purin-6-ylamino)propyl]-4(3<i>H</i>)-quinazolinone, idelalisib 1, has been developed. This strategy controls the desfluoro impurity of 13 during reduction of nitro intermediate 4, and also arrests the formation of the enantiomer during cyclisation of diamide 17, without affecting the neighbouring chiral centre. This process is demonstrated on a larger scale in the laboratory and achieved good chemical and chiral purities coupled with good yields.

Also flagged:Huntington's diseaseHDautosomal dominant neurodegenerative disorderdysfunctiondeathN-methyl-D-aspartate receptor
Journal Article 2018-04-26 No Snippets Saavedra A, García-Díaz Barriga G, Pérez-Navarro E, Alberch J.
Show Full Abstract

<h4>Introduction</h4>Huntington's disease (HD), an autosomal dominant neurodegenerative disorder caused by an expansion of CAG repeats in the huntingtin gene, has long been characterized by the presence of motor symptoms due to the loss of striatal projection neurons. Cognitive dysfunction and neuropsychiatric symptoms are also present and they occur in the absence of cell death in most mouse models, pointing to neuronal dysfunction and abnormal synaptic plasticity as causative mechanisms. Areas covered: Here, we focus on those common mechanisms altered by the presence of mutant huntingtin affecting corticostriatal and hippocampal function as therapeutic targets that could prove beneficial to ameliorate both cognitive and motor function in HD. Specifically, we discuss the importance of reestablishing the balance in (1) synaptic/extrasynaptic N-methyl-D-aspartate receptor signaling, (2) mitochondrial dynamics/trafficking, (3) TrkB/p75<sup>NTR</sup> signaling, and (4) transcriptional activity. Expert opinion: Mutant huntingtin has a broad impact on multiple cellular processes, which makes it very challenging to design a curative therapeutic strategy. As we point out here, novel therapeutic interventions should look for multi-purpose drugs targeting common and early affected processes leading to corticostriatal and hippocampal dysfunction that additionally operate in a feedforward vicious cycle downstream the activation of extrasynaptic N-methyl-D-aspartate receptor.

Also flagged:PPAR-βsepsisperoxisome proliferator-activated receptorPPAR)-βendotoxemiacoagulopathy
Journal Article 2018-04-26 ✓ 1 Snippet Busch D, Kapoor A, Rademann P, Hildebrand F, Bahrami S, Thiemermann C, Osuchowski MF.
In-Text Gene Mentions

…changes occurred in anti-thrombin-III, plasminogen, fibrinogen and…

Show Full Abstract

Activation of peroxisome proliferator-activated receptor (PPAR)-β/δ reduces tissue injury in murine endotoxemia. We hypothesized that the PPAR-β/δ-agonist GW0742 improves long-term outcome after sepsis caused by cecal ligation and puncture (CLP). Fifty-one CD-1 female mice underwent CLP and received either vehicle (control), GW0742 (0.03 mg/kg/injection; five post-CLP i.v. injections), GSK0660 (PPAR-β/δ-antagonist) or both and were monitored for 28 d. Another 20 CLP mice treated with GW0742 and vehicle were sacrificed 24 h post-CLP to assess coagulopathy. Compared to vehicle, survival of CLP-mice treated with GW0742 was higher by 35% at d 7 and by 50% at d 28. CLP mice treated with GW0742 had 60% higher IFN-γ but circulating monocyte chemoattractant protein-1 and chemokine ligand were lower at 48 h post-CLP. Compared to vehicle, CLP mice treated with GW0742 exhibited a 50% reduction in the circulating plasminogen activator inhibitor-1 associated with an increase in platelet number at 24 h post-CLP (but no changes occurred in anti-thrombin-III, plasminogen, fibrinogen and clotting-times). CLP mice treated with GW0742 exhibited a similar increase in most of the biochemical markers of organ injury/dysfunction (lactate dehydrogenase, alanine aminotransferase, creatine kinase, creatinine, blood urea nitrogen, and triglycerides) measured. Treatment with GW0742 consistently improved long-term survival in septic CD-1 mice by partially modulating the post-CLP systemic cytokine response and coagulation systems.

Also flagged:ATG9Ahereditary spastic paraplegiasε-β4-μ4-σ4adaptor protein 4intellectual disabilitymicrocephaly
Journal Article 2018-04-26 No Snippets De Pace R, Skirzewski M, Damme M, Mattera R, Mercurio J, Foster AM, Cuitino L, Jarnik M, Hoffmann V, Morris HD, Han TU, Mancini GMS, Buonanno A, Bonifacino JS.
Show Full Abstract

The hereditary spastic paraplegias (HSP) are a clinically and genetically heterogeneous group of disorders characterized by progressive lower limb spasticity. Mutations in subunits of the heterotetrameric (ε-β4-μ4-σ4) adaptor protein 4 (AP-4) complex cause an autosomal recessive form of complicated HSP referred to as "AP-4 deficiency syndrome". In addition to lower limb spasticity, this syndrome features intellectual disability, microcephaly, seizures, thin corpus callosum and upper limb spasticity. The pathogenetic mechanism, however, remains poorly understood. Here we report the characterization of a knockout (KO) mouse for the AP4E1 gene encoding the ε subunit of AP-4. We find that AP-4 ε KO mice exhibit a range of neurological phenotypes, including hindlimb clasping, decreased motor coordination and weak grip strength. In addition, AP-4 ε KO mice display a thin corpus callosum and axonal swellings in various areas of the brain and spinal cord. Immunohistochemical analyses show that the transmembrane autophagy-related protein 9A (ATG9A) is more concentrated in the trans-Golgi network (TGN) and depleted from the peripheral cytoplasm both in skin fibroblasts from patients with mutations in the μ4 subunit of AP-4 and in various neuronal types in AP-4 ε KO mice. ATG9A mislocalization is associated with increased tendency to accumulate mutant huntingtin (HTT) aggregates in the axons of AP-4 ε KO neurons. These findings indicate that the AP-4 ε KO mouse is a suitable animal model for AP-4 deficiency syndrome, and that defective mobilization of ATG9A from the TGN and impaired autophagic degradation of protein aggregates might contribute to neuroaxonal dystrophy in this disorder.

Also flagged:infectionimmune responsemembraneantibodymaturationantibodies
Journal Article 2018-04-26 No Snippets Deist MS, Gallardo RA, Bunn DA, Kelly TR, Dekkers JCM, Zhou H, Lamont SJ.
Show Full Abstract

Behind each eye of the chicken resides a unique lymph tissue, the Harderian gland, for which RNA sequencing (RNA-seq) analysis is novel. We characterized the response of this tissue to Newcastle disease virus (NDV) in two inbred lines with different susceptibility to NDV across three time points. Three-week-old relatively resistant (Fayoumi) and relatively susceptible (Leghorn) birds were inoculated with a high-titered (10<sup>7</sup>EID<sub>50</sub>) La Sota strain of NDV via an oculonasal route. At 2, 6, and 10 days post infection (dpi) Harderian glands were collected and analyzed via RNA-seq. The Fayoumi had significantly more detectable viral transcripts in the Harderian gland at 2 dpi than the Leghorn, but cleared the virus by 6 dpi. At all three time points, few genes were declared differentially expressed (DE) between the challenged and nonchallenged birds, except for the Leghorns at 6 dpi, and these DE genes were predicted to activate an adaptive immune response. Relative to the Leghorn, the Fayoumi was predicted to activate more immune pathways in both challenged and nonchallenged birds suggesting a more elevated immune system in the Fayoumis under homeostatic conditions. Overall, this study helped characterize the function of this important tissue and its response to NDV.

Also flagged:epithelial-mesenchymal transitionmalignant tumoursclear-cell renal cell carcinomaccRCCCD276OX40
Journal Article 2018-04-26 ✓ 1 Snippet Liang J, Liu Z, Zou Z, Tang Y, Zhou C, Yang J, Wei X, Lu Y.
In-Text Gene Mentions

…model: IL10, CD4,TNFSF4, PDL2, IL6, PDL1,…

Show Full Abstract

Both epithelial-mesenchymal transition (EMT) and immune regulation are important biological process in malignant tumours. The current research aims to comprehensively explore the potential association between the epithelial-mesenchymal transition (EMT) signature and immune checkpoint signature and its role in predicting the prognosis of clear-cell renal cell carcinoma (ccRCC) patients. EMT-related genes were collected from an experiment-based study and then were investigated using data from the Cancer Genome Atlas. A total of 357 genes were included, and 23 of them that were upregulated and correlated with prognosis were analysed further as core EMT genes in ccRCC. Interestingly, the emerging immune checkpoints CD276, OX40 and TGFB1 were found to be significantly co-expressed with core EMT genes, and TGFB1, CXCR4, IL10, and IL6 were the most important molecules potentially interacting with EMT molecules in our model, as determined from mRNA co-expression and protein-protein interaction network analysis. Additionally, an integrated scoring model based on FOXM1, TIMP1 and IL6 was successfully established to distinguish ccRCC patients with different clinical risks. Our results identified core genes in the EMT-immunophenotyping correlation and evaluated their risk assessment capabilities, providing more potential therapeutic targets and prediction approaches regarding the translational research of treatment and prognosis in ccRCC.

Also flagged:Major depressive disordermajor depressionschizophreniapsychiatric disorderspsychiatric disorderbipolar disorder
Journal Article 2018-04-26 ✓ 5 Snippets Wray NR, Ripke S, Mattheisen M, Trzaskowski M, Byrne EM, Abdellaoui A, Adams MJ, Agerbo E, Air TM, Andlauer TMF, Bacanu SA, Bækvad-Hansen M, Beekman AFT, Bigdeli TB, Binder EB, Blackwood DRH, Bryois J, Buttenschøn HN, Bybjerg-Grauholm J, Cai N, Castelao E, Christensen JH, Clarke TK, Coleman JIR, Colodro-Conde L, Couvy-Duchesne B, Craddock N, Crawford GE, Crowley CA, Dashti HS, Davies G, Deary IJ, Degenhardt F, Derks EM, Direk N, Dolan CV, Dunn EC, Eley TC, Eriksson N, Escott-Price V, Kiadeh FHF, Finucane HK, Forstner AJ, Frank J, Gaspar HA, Gill M, Giusti-Rodríguez P, Goes FS, Gordon SD, Grove J, Hall LS, Hannon E, Hansen CS, Hansen TF, Herms S, Hickie IB, Hoffmann P, Homuth G, Horn C, Hottenga JJ, Hougaard DM, Hu M, Hyde CL, Ising M, Jansen R, Jansen R, Jin F, Jorgenson E, Knowles JA, Kohane IS, Kraft J, Kretzschmar WW, Krogh J, Kutalik Z, Lane JM, Li Y, Li Y, Lind PA, Liu X, Lu L, MacIntyre DJ, MacKinnon DF, Maier RM, Maier W, Marchini J, Mbarek H, McGrath P, McGuffin P, Medland SE, Mehta D, Middeldorp CM, Mihailov E, Milaneschi Y, Milani L, Mill J, Mondimore FM, Montgomery GW, Mostafavi S, Mullins N, Nauck M, Ng B, Nivard MG, Nyholt DR, O'Reilly PF, Oskarsson H, Owen MJ, Painter JN, Pedersen CB, Pedersen MG, Peterson RE, Pettersson E, Peyrot WJ, Pistis G, Posthuma D, Purcell SM, Quiroz JA, Qvist P, Rice JP, Riley BP, Rivera M, Saeed Mirza S, Saxena R, Schoevers R, Schulte EC, Shen L, Shi J, Shyn SI, Sigurdsson E, Sinnamon GBC, Smit JH, Smith DJ, Stefansson H, Steinberg S, Stockmeier CA, Streit F, Strohmaier J, Tansey KE, Teismann H, Teumer A, Thompson W, Thomson PA, Thorgeirsson TE, Tian C, Traylor M, Treutlein J, Trubetskoy V, Uitterlinden AG, Umbricht D, Van der Auwera S, van Hemert AM, Viktorin A, Visscher PM, Wang Y, Webb BT, Weinsheimer SM, Wellmann J, Willemsen G, Witt SH, Wu Y, Xi HS, Yang J, Zhang F, eQTLGen, 23andMe, Arolt V, Baune BT, Berger K, Boomsma DI, Cichon S, Dannlowski U, de Geus ECJ, DePaulo JR, Domenici E, Domschke K, Esko T, Grabe HJ, Hamilton SP, Hayward C, Heath AC, Hinds DA, Kendler KS, Kloiber S, Lewis G, Li QS, Lucae S, Madden PFA, Magnusson PK, Martin NG, McIntosh AM, Metspalu A, Mors O, Mortensen PB, Müller-Myhsok B, Nordentoft M, Nöthen MM, O'Donovan MC, Paciga SA, Pedersen NL, Penninx BWJH, Perlis RH, Porteous DJ, Potash JB, Preisig M, Rietschel M, Schaefer C, Schulze TG, Smoller JW, Stefansson K, Tiemeier H, Uher R, Völzke H, Weissman MM, Werge T, Winslow AR, Lewis CM, Levinson DF, Breen G, Børglum AD, Sullivan PF, Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium.
In-Text Gene Mentions
⭐ same-sentence co-mention

For BMI there was some evidence of pleiotropy, as six BMI SNPs were excluded by the HEIDI-outlier test including SNPs near OLFM4 and NEGR1. Thus, these results are consistent with EDY and BMI as either causal risk factors or correlated with causal risk factors for major depression.

In addition to the genes discussed above, other notable and significant genes outside of the MHC include multiple potentially “druggable” targets that suggest connections of the pathophysiology of MDD to neuronal calcium signaling (CACNA1E and CACNA2D1), dopaminergic neurotransmission (DRD2, a principal target of antipsychotics), glutamate neurotransmission (GRIK5 and GRM5), and presynaptic vesicle trafficking (PCLO).

⭐ same-sentence co-mention

In the Supplementary Note we review four key genes in more detail: OLFM4 and NEGR1 (notable for reported associations with obesity and body mass index29–34), RBFOX1 (notable for independent our associations at both the 5′ and the 3′ ends, a splicing regulator35,36, with a functional role that may be consistent with chronic hypothalamic-pituitary-adrenal axis hyperactivation reported in MDD37), and LRFN5 (notable for its role in pre-synaptic differentiation38,39 and neuroinflammation40).

The latter association has evidence of DNA looping interactions with NEGR1. The association in SOX5 (rs4074723) and the two statistically independent associations in RBFOX1 (rs8063603 and rs7198928, P=6.9×10−9 and 1.0×10−8) had only intragenic associations, suggesting that the genetic variation in the regions of the major depression associations act locally and can be assigned to these genes.

⭐ same-sentence co-mention

…in more detail:OLFM4and NEGR1 (notable…

Show Full Abstract

Major depressive disorder (MDD) is a common illness accompanied by considerable morbidity, mortality, costs, and heightened risk of suicide. We conducted a genome-wide association meta-analysis based in 135,458 cases and 344,901 controls and identified 44 independent and significant loci. The genetic findings were associated with clinical features of major depression and implicated brain regions exhibiting anatomical differences in cases. Targets of antidepressant medications and genes involved in gene splicing were enriched for smaller association signal. We found important relationships of genetic risk for major depression with educational attainment, body mass, and schizophrenia: lower educational attainment and higher body mass were putatively causal, whereas major depression and schizophrenia reflected a partly shared biological etiology. All humans carry lesser or greater numbers of genetic risk factors for major depression. These findings help refine the basis of major depression and imply that a continuous measure of risk underlies the clinical phenotype.

Also flagged:Hemorrhagic StrokeCerebrovascular diseasesstrokemicro strokedeathstress
Journal Article 2018-04-26 ✓ 3 Snippets Sidyakin AA, Kaysheva AL, Kopylov AT, Lobanov AV, Morozov SG.
In-Text Gene Mentions
⭐ same-sentence co-mention

These proteins are involved in the mechanisms of neuroprotection, including compensation of oxidative stress (TXN, SNCA, PRDX6, ENO1), prevention of unwanted protein aggregation and apoptosis (PTMA, SNCA, SNCB), release of neurotransmitters (GAPDH, PEBP1) and assembly of the cytoskeleton (ACTA2, PTMA, TUBA4A, TUBA1D), etc. Also, a group of seven Ras family proteins involved in the regulation of cell proliferation and differentiation was found in the samples taken 24 h following the stroke.

…stress (TXN, SNCA,PRDX6, ENO1), prevention of…

…of neurotransmitters (GAPDH,PEBP1) and assembly of…

Show Full Abstract

Cerebrovascular diseases, including stroke and micro stroke, are the main causes of death in contemporary society. Hemorrhagic stroke is the fast emerging defficiency in the brain function resulting from disturbance of blood supply to the brain caused by the rapture of blood vessels (Lopez et al. in Proteomics Clin Appl 6:190-200, 2012). The influence of a model hemorrhagic stroke on white pigs with the change in the protein profile of their cortical samples 24 h and 2 months after the stroke was examined using mass-spectrometric analysis. Different proteins (n = 30) were identified, and their content was elevated. These proteins are involved in the mechanisms of neuroprotection, including compensation of oxidative stress (TXN, SNCA, PRDX6, ENO1), prevention of unwanted protein aggregation and apoptosis (PTMA, SNCA, SNCB), release of neurotransmitters (GAPDH, PEBP1) and assembly of the cytoskeleton (ACTA2, PTMA, TUBA4A, TUBA1D), etc. Also, a group of seven Ras family proteins involved in the regulation of cell proliferation and differentiation was found in the samples taken 24 h following the stroke. The relative concentrations of most of the proteins in the samples taken 2 months after the stroke demonstrate intermediate values between the control sample and the sample taken in 24 h, indicating the extinction of change in the protein profile with time. During the first 24 h after the stroke, there is an increase in protein fractions participating in exocytosis, synaptic plasticity/signaling, and support of neurotransmitter transport. Such shift in the weight of protein functional clusters can be attributed to activation of compensatory mechanisms in the body focused on neuroprotection.

Also flagged:Malignant pleural mesotheliomamesotheliomapathogenesisnucleotidescancerasbestos
Journal Article 2018-04-26 ✓ 1 Snippet Singh AS, Heery R, Gray SG.
In-Text Gene Mentions

…antisense to theZNFX1protein-coding gene, first…

Show Full Abstract

Malignant pleural mesothelioma (MPM) is a rare malignancy, with extremely poor survival rates. At present, treatment options are limited, with no second line chemotherapy for those who fail first line therapy. Extensive efforts are ongoing in a bid to characterise the underlying molecular mechanisms of mesothelioma. Recent research has determined that between 70⁻90% of our genome is transcribed. As only 2% of our genome is protein coding, the roles of the remaining proportion of non-coding RNA in biological processes has many applications, including roles in carcinogenesis and epithelial⁻mesenchymal transition (EMT), a process thought to play important roles in MPM pathogenesis. Non-coding RNAs can be separated loosely into two subtypes, short non-coding RNAs (<200 nucleotides) or long (>200 nucleotides). A significant body of evidence has emerged for the roles of short non-coding RNAs in MPM. Less is known about the roles of long non-coding RNAs (lncRNAs) in this disease setting. LncRNAs have been shown to play diverse roles in EMT, and it has been suggested that EMT may play a role in the aggressiveness of MPM histological subsets. In this report, using both in vitro analyses on mesothelioma patient material and in silico analyses of existing RNA datasets, we posit that various lncRNAs may play important roles in EMT within MPM, and we review the current literature regarding these lncRNAs with respect to both EMT and MPM.

Also flagged:Type 1 Diabetesdiabetesantibodiessecretionimmunoglobulinspeptides
Journal Article 2018-04-26 ✓ 3 Snippets Pappa E, Vastardis H, Mermelekas G, Gerasimidi-Vazeou A, Zoidakis J, Vougas K.
In-Text Gene Mentions

In our study, among differentially expressed proteins were PLG, SERPING1, SERPINC1, APOA2, FGB, A2M, which are related to endothelial dysfunction, coagulation processes and pro-atherogenic alteration mechanisms.

…were PLG, SERPING1,SERPINC1, APOA2, FGB, A2M,…

…Serin protease inhibitors (SERPINC1, SERPINA1) and A2…

Show Full Abstract

The composition of the salivary proteome is affected by pathological conditions. We analyzed by high resolution mass spectrometry approaches saliva samples collected from children and adolescents with type 1 diabetes and healthy controls. The list of more than 2000 high confidence protein identifications constitutes a comprehensive characterization of the salivary proteome. Patients with good glycemic regulation and healthy individuals have comparable proteomic profiles. In contrast, a significant number of differentially expressed proteins were identified in the saliva of patients with poor glycemic regulation compared to patients with good glycemic control and healthy children. These proteins are involved in biological processes relevant to diabetic pathology such as endothelial damage and inflammation. Moreover, a putative preventive therapeutic approach was identified based on bioinformatic analysis of the deregulated salivary proteins. Thus, thorough characterization of saliva proteins in diabetic pediatric patients established a connection between molecular changes and disease pathology. This proteomic and bioinformatic approach highlights the potential of salivary diagnostics in diabetes pathology and opens the way for preventive treatment of the disease.

Also flagged:IRF3Toll-Like ReceptorNF-κBTRIFimmune responsesdegradation
Journal Article 2018-04-26 ✓ 2 Snippets Zhao X, Huo R, Yan X, Xu T.
In-Text Gene Mentions

TRIM38can negatively regulate…

…6 ), andTRIM38( 35 )…

Show Full Abstract

NF-κB signaling is tightly regulated and essential to innate and adaptive immune responses, its regulatory mechanism remains unclear in various organisms, especially teleosts. In this study, we reported that IRF3 can negatively regulate TRIF-mediated NF-κB signaling pathway. Overexpression of IRF3 can inhibit TRIF-mediated NF-κB signaling pathway. However, knockdown of IRF3 had an opposite effect. IRF3 can promote the degradation of TRIF protein in mammal and fish cells, but this effect could be inhibited by MG132 treatment. Furthermore, we found that the inhibitory effect of IRF3 primary depended on its IRF association domain domain. IRF3 is crucial for the polyubiquitination and proteasomal degradation of TRIF. Our findings indicate that IRF3 negatively regulates TLR-mediated NF-κB signaling pathway by targeting TRIF for ubiquitination and degradation. This study provides a novel evidence on the negative regulation of innate immune signaling pathways in teleost fish and thus might provide new insights into the regulatory mechanisms in mammals.

Also flagged:Gastrointestinal stromal tumourstumourmesenchymal tumourGISTsarcomasKIT
Journal Article 2018-04-26 No Snippets Szucs Z, Jones RL.
Show Full Abstract

Gastrointestinal stromal tumours (GISTs) represent a very exciting tumour entity for the medical oncologist. There has been extensive clinical and preclinical research dissecting the natural behaviour, molecular landscape and therapeutic responsiveness of this rare mesenchymal tumour. Various molecular subtypes of GIST have a differing prognostic and predictive relevance in the state of the art management of the disease. Emerging mature clinical trial data gathered over the last one and half decade provided substantial molecular profiling information in understanding the success and eventual failure of treatment. In our review of the most relevant literature we aim to guide the clinician in tailoring neoadjuvant, adjuvant and palliative treatment of GIST alongside the different, now well established molecular subgroups of GISTs.

Also flagged:cholesterol7-ketocholesterollipidpathogenesisAlzheimer's diseaseAD
Journal Article 2018-04-26 No Snippets Phan HTT, Shimokawa N, Sharma N, Takagi M, Vestergaard MC.
Show Full Abstract

Oxidized cholesterol has been widely reported to contribute to the pathogenesis of Alzheimer's disease (AD). However, the mechanism by which they affect the disease is not fully understood. Herein, we aimed to investigate the effect of 7-ketocholesterol (7keto) on membrane-mediated aggregation of amyloid beta (Aβ-42), one of the critical pathogenic events in AD. We have shown that when cholesterol is present in lipid vesicles, kinetics of Aβ nuclei formation is moderately hindered while that of fibril growth was considerably accelerated. The partial substitution of cholesterol with 7keto slightly enhanced the formation of Aβ-42 nuclei and remarkably decreased fibril elongation, thus maintaining the peptide in protofibrillar aggregates, which are reportedly the most toxic species. These findings add in understanding of how cholesterol and its oxidation can affect Aβ-induced cytotoxicity.

Also flagged:Histone H3Histone modificationshistonemethylationchromatincancers
Journal Article 2018-04-26 No Snippets Wan YCE, Liu J, Chan KM.
Show Full Abstract

Histone modifications are one form of epigenetic information that relate closely to gene regulation. Aberrant histone methylation caused by alteration in chromatin-modifying enzymes has long been implicated in cancers. More recently, recurrent histone mutations have been identified in multiple cancers and have been shown to impede histone methylation. All three histone mutations (H3K27M, H3K36M, and H3G34V/R) identified result in amino acid substitution at/near a lysine residue that is a target of methylation. In the cases of H3K27M and H3K36M, found in pediatric DIPG (diffuse intrinsic pontine glioma) and chondroblastoma respectively, expression of the mutant histone leads to global reduction of histone methylation at the respective lysine residue. These mutant histones are termed "oncohistones" because their expression reprograms the epigenome and shapes an oncogenic transcriptome. Dissecting the mechanism of H3K27M-driven oncogenesis has led to the discovery of promising therapeutic targets in pediatric DIPG. The purpose of this review is to summarize the work done on identifying and dissecting the oncogenic properties of histone H3 mutations.

Also flagged:Sodium halidessynthesiscoppersulfateethanolbromine
Journal Article 2018-04-26 ✓ 1 Snippet Kesharwani T, Kornman C, Tonnaer A, Hayes A, Kim S, Dahal N, Romero R, Royappa A.
In-Text Gene Mentions

5-HTT receptor

Show Full Abstract

A convenient methodology for the synthesis of mono- and di-halogenated benzo[<i>b</i>]thiophenes is described herein, which utilizes copper(II) sulfate pentahydrate and various sodium halides in the presence of substituted 2-alkynylthioanisoles. The proposed method is facile, uses ethanol as a green solvent, and results in uniquely substituted benzo[<i>b</i>]thiophene structures with isolated yields up to 96%. The most useful component of this methodology is the selective introduction of bromine atoms at every available position (2-7) around the benzo[<i>b</i>]thiophene ring, while keeping position 3 occupied by a specific halogen atom such as Cl, Br or I. Aromatic halogens are useful reactive handles; therefore, the selective introduction of halogens at specific positions would be valuable in the targeted synthesis of bioactive molecules and complex organic materials via metal-catalyzed cross coupling reactions. This work is a novel approach towards the synthesis of dihalo substituted benzo[<i>b</i>]thiophene core structures, which provides a superior alternative to the current methods discussed herein.

Also flagged:HemoglobinironcitrateHbthiolheme
Journal Article 2018-04-26 No Snippets Egan JG, Drossis N, Ebralidze II, Fruehwald HM, Laschuk NO, Poisson J, de Haan HW, Zenkina OV.
Show Full Abstract

The ability to form complex 3D architectures using nanoparticles (NPs) as the building blocks and complex macromolecules that direct these assemblies remains a challenging objective for nanotechnology. Here we report results in which the partial substitution of classical Turkevich citrate-capped gold NPs by a novel, heteroaromatic ligand (L) results in NPs able to form coordination-driven assemblies mediated by free or protein-bound iron ions. The morphology of these assemblies can be tuned depending on the source of iron. To prove the concept, classical citrate and novel NPs were reacted with iron-containing protein hemoglobin (Hb). To diminish the influence of possible electrostatic interactions of native Hb and gold NPs, the reaction was performed at the isoelectric point of Hb. Moreover, thiol groups of Hb were protected with <i>p</i>-quinone to exclude thiol-gold bond formation. As expected, citrate-capped gold NPs are well dispersed in functionalized Hb, while L-functionalized NPs form assemblies. The blue shift of the Soret band of the functionalized Hb, when reacted with novel NPs, unambiguously confirms the coordination of a NP-anchored heteroaromatic ligand with the heme moiety of Hb. Coarse-grained molecular dynamics of this system were performed to gain information about aggregation dynamics and kinetics of iron- and hemoglobin-templated assemblies of L-NPs. A multi-scale simulation approach was employed to extend this model to longer time scales. The application of this model towards novel coordination-based assemblies can become a powerful tool for the development of new nanomaterials.

Also flagged:diabetesDiabetes mellituschronic diseasesglucoseatherosclerotic cardiovascular diseasesrenal failure
Journal Article 2018-04-25 ✓ 1 Snippet Xie F, Chan JC, Ma RC.
In-Text Gene Mentions

…J member 11),CACNA1E(calcium voltage‐gated channel…

Show Full Abstract

Diabetes has become a major burden of healthcare expenditure. Diabetes management following a uniform treatment algorithm is often associated with progressive treatment failure and development of diabetic complications. Recent advances in our understanding of the genomic architecture of diabetes and its complications have provided the framework for development of precision medicine to personalize diabetes prevention and management. In the present review, we summarized recent advances in the understanding of the genetic basis of diabetes and its complications. From a clinician's perspective, we attempted to provide a balanced perspective on the utility of genomic medicine in the field of diabetes. Using genetic information to guide management of monogenic forms of diabetes represents the best-known examples of genomic medicine for diabetes. Although major strides have been made in genetic research for diabetes, its complications and pharmacogenetics, ongoing efforts are required to translate these findings into practice by incorporating genetic information into a risk prediction model for prioritization of treatment strategies, as well as using multi-omic analyses to discover novel drug targets with companion diagnostics. Further research is also required to ensure the appropriate use of this information to empower individuals and healthcare professionals to make personalized decisions for achieving the optimal outcome.

Also flagged:Trimethoprimwaterconjugationoligosaccharidesdegradationmaltodextrin
Journal Article 2018-04-25 No Snippets Wang X, Borges CA, Ning X, Rafi M, Zhang J, Park B, Takemiya K, Lo Sterzo C, Taylor WR, Riley L, Murthy N.
Show Full Abstract

Trimethoprim is one of the most widely used antibiotics in the world. However, its efficacy is frequently limited by its poor water solubility and dose limiting toxicity. Prodrug strategies based on conjugation of oligosaccharides to trimethoprim have great potential for increasing the solubility of trimethoprim and lowering its toxicity, but they have been challenging to develop due to the sensitivity of trimethoprim to chemical modifications, and the rapid degradation of oligosaccharides in serum. In this report, we present a trimethoprim conjugate of maltodextrin termed TM-TMP, which increased the water solubility of trimethoprim by over 100 times, was stable to serum enzymes, and was active against urinary tract infections in mice. TM-TMP is composed of thiomaltose conjugated to trimethoprim, via a self-immolative disulfide linkage, and releases 4'-OH-trimethoprim (TMP-OH) after disulfide cleavage, which is a known metabolic product of trimethoprim and is as potent as trimethoprim. TM-TMP also contains a new maltodextrin targeting ligand composed of thiomaltose, which is stable to hydrolysis by serum amylases and therefore has the metabolic stability needed for in vivo use. TM-TMP has the potential to significantly improve the treatment of a wide number of infections given its high water solubility and the widespread use of trimethoprim.

Also flagged:PeptidesGastric CancerPeptidecancermaligntumor
Journal Article 2018-04-25 ✓ 1 Snippet Sahin D, Taflan SO, Yartas G, Ashktorab H, Smoot DT.
In-Text Gene Mentions

gastric cancer cells and HFE

Show Full Abstract

Background: Gastric cancer is the second most common cancer among the malign cancer types. Inefficiency of traditional techniques both in diagnosis and therapy of the disease makes the development of alternative and novel techniques indispensable. As an alternative to traditional methods, tumor specific targeting small peptides can be used to increase the efficiency of the treatment and reduce the side effects related to traditional techniques. The aim of this study is screening and identification of individual peptides specifically targeted to human gastric cancer cells using a phage-displayed peptide library and designing specific peptide sequences by using experimentally-eluted peptide sequences. Methods: Here, MKN-45 human gastric cancer cells and HFE-145 human normal gastric epithelial cells were used as the target and control cells, respectively. 5 rounds of biopannning with a phage display 12-peptide library were applied following subtraction biopanning with HFE-145 control cells. The selected phage clones were established by enzyme-linked immunosorbent assay and immunofluorescence detection. We first obtain random phage clones after five biopanning rounds, determine the binding levels of each individual clone. Then, we analyze the frequencies of each amino acid in best binding clones to determine positively overexpressed amino acids for designing novel peptide sequences. Results: DE532 (VETSQYFRGTLS) phage clone was screened positive, showing specific binding on MKN-45 gastric cancer cells. DE-Obs (HNDLFPSWYHNY) peptide, which was designed by using amino acid frequencies of experimentally selected peptides in the 5th round of biopanning, showed specific binding in MKN-45 cells. Conclusion: Selection and characterization of individual clones may give us specifically binding peptides, but more importantly, data extracted from eluted phage clones may be used to design theoretical peptides with better binding properties than even experimentally selected ones. Both peptides, experimental and designed, may be potential candidates to be developed as useful diagnostic or therapeutic ligand molecules in gastric cancer research.

Also flagged:ubiquitinproteolysisbrassinosteroidsheat shock proteinsgene expressionresponse to short
Journal Article 2018-04-25 No Snippets Wang W, Teng F, Lin Y, Ji D, Xu Y, Chen C, Xie C.
Show Full Abstract

Pyropia haitanensis, a high-yield commercial seaweed in China, is currently undergoing increasing levels of high-temperature stress due to gradual global warming. The mechanisms of plant responses to high temperature stress vary with not only plant type but also the degree and duration of high temperature. To understand the mechanism underlying thermal tolerance in P. haitanensis, gene expression and regulation in response to short- and long-term temperature stresses (SHS and LHS) was investigated by performing genome-wide high-throughput transcriptomic sequencing for a high temperature tolerant strain (HTT). A total of 14,164 differential expression genes were identified to be high temperature-responsive in at least one time point by high-temperature treatment, representing 41.10% of the total number of unigenes. The present data indicated a decrease in the photosynthetic and energy metabolic rates in HTT to reduce unnecessary energy consumption, which in turn facilitated in the rapid establishment of acclimatory homeostasis in its transcriptome during SHS. On the other hand, an increase in energy consumption and antioxidant substance activity was observed with LHS, which apparently facilitates in the development of resistance against severe oxidative stress. Meanwhile, ubiquitin-mediated proteolysis, brassinosteroids, and heat shock proteins also play a vital role in HTT. The effects of SHS and LHS on the mechanism of HTT to resist heat stress were relatively different. The findings may facilitate further studies on gene discovery and the molecular mechanisms underlying high-temperature tolerance in P. haitanensis, as well as allow improvement of breeding schemes for high temperature-tolerant macroalgae that can resist global warming.

Also flagged:bone morphogenetic protein 6hereditary hemochromatosisironBMP6peptideHH
Journal Article 2018-04-25 ✓ 5 Snippets McDonald CJ, Rishi G, Secondes ES, Ostini L, Wallace DF, Crawford DHG, Sia H, Clark P, Subramaniam VN.
In-Text Gene Mentions

Hereditary hemochromatosis (HH) is relatively common in individuals of northern European descent, with the majority of cases caused by mutations in the HFE (hemochromatosis) gene [1, 2].

…mutations in theHFE(hemochromatosis) gene […

…in the HFE (hemochromatosis) gene [ 1…

…Conversely, mutations inHFEare rare in…

…collectively termed non-HFEHH [ 3…

Show Full Abstract

<h4>Background</h4>Atypical iron overload without variation in the five clinically associated hereditary hemochromatosis genes is now recognized; however, their etiology remains unknown. Since the identification of iron overload in the bone morphogenetic protein 6 (Bmp6) knockout mouse, the search has been on for clinically pathogenic variants in the BMP6 gene. A recent report proposes that variants in the pro-peptide region of BMP6 are the underlying cause of several cases of iron overload. We performed targeted next-generation sequencing on three cases of atypical iron overload with Asian ethnicity and identified a p.Q118dup (aka p.E112indelEQ, p.Q115dup, p.Q118_L119insQ) variant in BMP6. The purpose of this study was to characterize the molecular function of the identified BMP6 variant. Molecular characterization by immunofluorescence microscopy and Western blotting of transfected cells, bioinformatics, and population analyses was performed.<h4>Results</h4>In contrast to reports for other BMP6 pro-peptide variants in this region, our data indicates that this variant does not affect the function of the mature BMP6 protein.<h4>Conclusions</h4>Our data suggest that assignment of disease causation in clinical cases of iron overload to pro-peptide variants in BMP6 should thus be treated with caution and requires biological characterization.

Also flagged:KLHL6diffuse large B-cell lymphomaKelch-like protein 6DLBCLcullin-RING ubiquitin ligaseligase
Journal Article 2018-04-25 ✓ 1 Snippet Choi J, Lee K, Ingvarsdottir K, Bonasio R, Saraf A, Florens L, Washburn MP, Tadros S, Green MR, Busino L.
In-Text Gene Mentions

…The RNA‐binding proteinsRC3H1and RC3H2 (from…

Show Full Abstract

Kelch-like protein 6 (KLHL6) is an uncharacterized gene mutated in diffuse large B-cell lymphoma (DLBCL). Here we report that KLHL6 assembles with cullin3 to form a functional cullin-RING ubiquitin ligase. Mutations in KLHL6 inhibit its ligase activity by disrupting the interaction with cullin3. Loss of KLHL6 favours DLBCL growth and survival both in vitro and in xenograft models. We further established that the mRNA decay factor roquin2 is a substrate of KLHL6. Degradation of roquin2 is dependent on B-cell receptor activation, and requires the integrity of the Tyr691 residue in roquin2 that is essential for its interaction with KLHL6. A non-degradable roquin2(Y691F) mutant requires its RNA-binding ability to phenocopy the effect of KLHL6 loss. Stabilization of roquin2 promotes mRNA decay of the tumour suppressor and NF-κB pathway inhibitor, tumour necrosis factor-α-inducible gene 3. Collectively, our findings uncover the tumour suppressing mechanism of KLHL6.

Also flagged:axonalPAR3aPKCkinaselocalizationatypical PKC
Journal Article 2018-04-25 No Snippets Hapak SM, Rothlin CV, Ghosh S.
Show Full Abstract

Polarity is a fundamental feature of cells. Protein complexes, including the PAR3-PAR6-aPKC complex, have conserved roles in establishing polarity across a number of eukaryotic cell types. In neurons, polarity is evident as distinct axonal versus dendritic domains. The PAR3, PAR6, and aPKC proteins also play important roles in neuronal polarization. During this process, either aPKC kinase activity, the assembly of the PAR3-PAR6-aPKC complex or the localization of these proteins is regulated downstream of a number of signaling pathways. In turn, the PAR3, PAR6, and aPKC proteins control various effector molecules to establish neuronal polarity. Herein, we discuss the many signaling mechanisms and effector functions that have been linked to PAR3, PAR6, and aPKC during the establishment of neuronal polarity.

Also flagged:colorectal cancercancergene expressionVDRDNA methyltransferase 3aDNMT3A
Journal Article 2018-04-25 No Snippets Castellano-Castillo D, Morcillo S, Clemente-Postigo M, Crujeiras AB, Fernandez-García JC, Torres E, Tinahones FJ, Macias-Gonzalez M.
Show Full Abstract

<h4>Background</h4>Lack of vitamin D (VD) has been associated with colorectal cancer (CRC). VD has anti-inflammatory effects and regulates several cellular pathways by means of its receptor, including epigenetic modifications. Adipose tissue dysfunction has been related to low-grade inflammation, which is related to diseases like cancer. The aim of this study was to explore the relationship between serum 25-hydroxyvitamin D (25(OH)D), adipose tissue gene expression of VD receptor (VDR), pro-inflammatory markers, and the epigenetic factor DNA methyltransferase 3a (DNMT3A) as well as VDR promoter methylation in CRC.<h4>Methods</h4>Blood and visceral adipose tissue from 57 CRC and 50 healthy control subjects were collected. CRC subjects had lower serum 25(OH)D levels and higher VDR gene expression, and these were negatively correlated in the CRC group.<h4>Results</h4>Adipose tissue <i>NFκB1</i>, <i>IL6</i>, and <i>IL1B</i> gene expression were higher in the CRC subjects than in the control subjects. 25(OH)D correlated negatively with <i>NFκB1</i> and CRP. In turn, CRP correlated positively with <i>NFκB1</i>, <i>IL6</i>, <i>IL1B</i>, and <i>VDR</i> gene expression as well as <i>NFκB1</i> that correlated positively with <i>IL6</i> and <i>IL1B</i>. <i>DNMT3A</i> mRNA was negatively correlated with serum 25(OH)D and positively correlated with <i>VDR</i> DNA methylation. <i>VDR</i> DNA methylation at position 4 had lower levels in the CRC group. Global <i>NFκB1</i> methylation at dinucleotide 3 was lower in the CRC group.<h4>Conclusion</h4>Our results suggest that adipose tissue may be a key factor in CRC development. The low 25(OH)D levels and high adipose tissue <i>VDR</i> expression in CRC may, at least in part, mediate this relationship by modifying adipose tissue DNA methylation and promoting inflammation.

Also flagged:sodium sulfatehydrazide2-oxoethylEthylsodium hydrogen carbonatesodium
Journal Article 2018-04-25 No Snippets Hewitt SH, Wilson AJ.
Show Full Abstract

Dynamic combinatorial chemistry (DCC) represents an approach, whereby traditional supramolecular scaffolds used for protein surface recognition might be exploited to achieve selective high affinity target recognition. Synthesis, in situ screening and amplification under selection pressure allows the generation of ligands, which bear different moieties capable of making multivalent non-covalent interactions with target proteins. Generic tetracarboxyphenyl porphyrin scaffolds bearing four hydrazide moieties have been used to form dynamic combinatorial libraries (DCLs) using aniline-catalyzed reversible hydrazone exchange reactions, in 10 % DMSO, 5 mm NH<sub>4</sub>OAc, at pH 6.75. High resolution mass spectrometry (HRMS) was used to monitor library composition and establish conditions under which equilibria were established.

Also flagged:Non-alcoholic fatty liver diseaseNAFLDnon-alcoholic steatohepatitisNASHpathogenesisalcohol
Journal Article 2018-04-25 ✓ 1 Snippet Dumitrascu DL, Neuman MG.
In-Text Gene Mentions

…chronic liver disease (hemochromatosis, autoimmune liver disease,…

Show Full Abstract

<h4>Background and aim</h4>The non-alcoholic fatty liver disease (NAFLD) and its sub-entity, the non-alcoholic steatohepatitis (NASH) represent a field of a tremendous progress in recent years. Clinicians need to remain updated with new data on pathogenesis and therapy. The present mini review aims to present some new scientific reports on the diagnosis of NAFLD and NASH for clinical practitioners.<h4>Methods</h4>A systematic literature search of the main international databases was performed. We looked for seminal and innovative papers published in main international languages. A narrative review of the topic was consequently written.<h4>Results</h4>This review describes new data on the diagnosis of NAFLD including NASH. Liver punction biopsy remains the gold standard. However many patients and clinicians prefer to use noninvasive methods. We present the serological tests and the imaging methods used to diagnose inflammation and fibrosis occurring in NAFLD and NASH.<h4>Conclusions</h4>NAFLD-NASH are multifaceted entities that have to be diagnosed and treated by skilled and informed practitioners.

Also flagged:dynapeniaupper gastrointestinal cancerAnnexin A1myotrophincancerCancer cachexia
Journal Article 2018-04-25 ✓ 1 Snippet Husi H, MacDonald A, Skipworth RJE, Miller J, Cronshaw A, Greig C, Fearon KCH, Ross JA.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Dynapenia is defined as the age-related loss of muscle strength, and plays a significant role in the loss of physical function and increased risk of disability among older individuals. The need for an early diagnosis supports the search for a biomarker that reflects muscle 'weakening'. This has previously proven difficult due to patient heterogeneity at presentation and lack of understanding of the underlying molecular mechanisms. The aim of the present study was to identify potential urinary biomarkers of dynapenia in patients undergoing potentially curative surgery for upper gastrointestinal cancer. Maximum isometric knee extensor strength (strain gauge) and maximum leg extensor power (Nottingham power rig) measurements were taken. Cut-off values for dynapenia were based on the Allied Dunbar national fitness survey. Values below the 5th percentile for the population matched for age and sex on the Allied Dunbar national fitness survey were used to stratify the cohort into dynapenic or normal. Urine samples taken at induction of anaesthesia were analysed by SELDI-TOF mass spectrometry using CM10 and IMAC30 chip-types to establish statistically significant m/z peak fingerprint patterns, followed by in-gel LC-MS/MS to identify molecular constituents. Statistical analysis of decision-tree calculations using Biomarker Pattern software resulted in models with sensitivities of 86 and 96%, specificities of 81 and 89%, and overall correctness of 84 and 93%, when applied to the entire cohort for power and strength measurement-based stratifications using the IMAC30 chip-type and the CM10 chip-type, respectively. The molecular identities of 10 peaks of interest were further investigated. After subtraction of potentially unrelated proteins, they were identified as fragments of Annexin A1, collagen α-1 (XV), perlecan and myotrophin. These results demonstrate that urinary screening can be used to define cancer-associated muscle weakness, and the identification of potential biomarkers could be invaluable in establishing a rapid test to measure and assess dynapenia in the clinical setting.

Also flagged:nanofibershydroxyapatitePolyelectrolytemicro-nanostructureslactic acid-glycolic acid
Journal Article 2018-04-25 No Snippets Manoukian OS, Aravamudhan A, Lee P, Arul MR, Yu X, Rudraiah S, Kumbar SG.
Show Full Abstract

This Article reports the fabrication and characterization of composite micro-nanostructured spiral scaffolds functionalized with nanofibers and hydroxyapatite (HA) for bone regeneration. The spiral poly(lactic acid-<i>co</i>-glycolic acid) (PLGA) porous microstructure was coated with sparsely spaced PLGA nanofibers and HA to enhance surface area and bioactivity. Polyelectrolyte-based HA coating in a layer-by-layer (LBL) fashion allowed 10-70 <i>μ</i>M Ca<sup>2+</sup>/mm<sup>2</sup> incorporation. These scaffolds provided a controlled release of Ca<sup>2+</sup> ions up to 60 days with varied release kinetics accounting up to 10-50 <i>μ</i>g. Spiral scaffolds supported superior adhesion, proliferation, and osteogenic differentiation of rat bone marrow stromal cells (MSCs) as compared to controls microstructures. Spiral micro-nanostructures supported homogeneous tissue ingrowth and resulted in bone-island formation in the center of the scaffold as early as 3 weeks in a rabbit ulnar bone defect model. In contrast, control cylindrical scaffolds showed tissue ingrowth only at the surface because of limitations in scaffold transport features.

Also flagged:membranevesicleCDGendolysosomessecretionsugars
Journal Article 2018-04-24 No Snippets Blackburn JB, Kudlyk T, Pokrovskaya I, Lupashin VV.
Show Full Abstract

The conserved oligomeric Golgi (COG) complex controls membrane trafficking and ensures Golgi homeostasis by orchestrating retrograde vesicle trafficking within the Golgi. Human COG defects lead to severe multisystemic diseases known as COG-congenital disorders of glycosylation (COG-CDG). To gain better understanding of COG-CDGs, we compared COG knockout cells with cells deficient to 2 key enzymes, Alpha-1,3-mannosyl-glycoprotein 2-beta-N-acetylglucosaminyltransferase and uridine diphosphate-glucose 4-epimerase (GALE), which contribute to proper N- and O-glycosylation. While all knockout cells share similar defects in glycosylation, these defects only account for a small fraction of observed COG knockout phenotypes. Glycosylation deficiencies were not associated with the fragmented Golgi, abnormal endolysosomes, defective sorting and secretion or delayed retrograde trafficking, indicating that these phenotypes are probably not due to hypoglycosylation, but to other specific interactions or roles of the COG complex. Importantly, these COG deficiency specific phenotypes were also apparent in COG7-CDG patient fibroblasts, proving the human disease relevance of our CRISPR knockout findings. The knowledge gained from this study has important implications, both for understanding the physiological role of COG complex in Golgi homeostasis in eukaryotic cells, and for better understanding human diseases associated with COG/Golgi impairment.

Also flagged:colony stimulating factor-1 receptorc-FMSColony stimulating factor-1CSF-1cytokineinflammatory disorders
Journal Article 2018-04-24 ✓ 1 Snippet Kumari A, Silakari O, Singh RK.
In-Text Gene Mentions

Some CSF-1R/c-FMS inhibitors such as ABT-869, Imatinib, AG013736, JNJ-40346527, PLX3397, DCC-3014 and Ki20227 have been successfully used in these disease conditions.

Show Full Abstract

Colony stimulating factor-1 (CSF-1) is one of the most common proinflammatory cytokine responsible for various inflammatory disorders. It has a remarkable role in the development and progression of osteoarthritis, cancer and other autoimmune disease conditions. The CSF-1 acts by binding to the receptor, called colony stimulating factor-1 receptor (CSF-1R) also known as c-FMS resulting in the cascade of signalling pathway causing cell proliferation and differentiation. Interleukin-34 (IL-34), recently identified as another ligand for CSF-IR, is a cytokine protein. Both, CSF-1 and IL-34, although two distinct cytokines, follow the similar signalling pathway on binding to the same receptor, CSF-1R. Like CSF-1, IL-34 promotes the differentiation and survival of monocyte, macrophages and osteoclasts. This CSF-1R/c-FMS is over expressed in many cancers and on tumour associated macrophages, consequently, have been exploited as a drug target for promising treatment for cancer and inflammatory diseases. Some CSF-1R/c-FMS inhibitors such as ABT-869, Imatinib, AG013736, JNJ-40346527, PLX3397, DCC-3014 and Ki20227 have been successfully used in these disease conditions. Many c-FMS inhibitors have been the candidates of clinical trials, but suffer from some side effects like cardiotoxicity, vomiting, swollen eyes, diarrhoea, etc. If selectivity of cFMS inhibition is achieved successfully, side effects can be overruled and this approach may become a novel therapy for treatment of various therapeutic interventions. Thus, successful targeting of c-FMS may result in multifunctional therapy. With this background of information, the present review focuses on the recent developments in the area of CSF-1R/c-FMS inhibitors with emphasis on crystal structure, mechanism of action and various therapeutic implications in which c-FMS plays a pivotal role. The review on structure activity relationship of various compounds acting as the inhibitors of c-FMS which gives the selection criteria for the development of novel molecules is also being presented.

Also flagged:Neutropeniahairy cell leukemiamyelofibrosispolycythemia veramyeloproliferative diseaseleukopenia
Journal Article 2018-04-24 No Snippets Habberstad AH, Tran HTT, Randen U, Spetalen S, Dybedal I, Tjønnfjord GE, Dahm AEA.
Show Full Abstract

<h4>Background</h4>Polycythemia vera is a myeloproliferative disease that sometimes evolves to myelofibrosis, causing splenomegaly and neutropenia. In this case report, we describe a patient with polycythemia vera and unexplained neutropenia who later turned out to also have hairy cell leukemia.<h4>Case presentation</h4>A middle-aged Caucasian man with polycythemia vera presented to our hospital with chronic mouth ulcers. Later he developed leukopenia and pancytopenia. Bone marrow biopsies showed fibrosis. Further morphological analyses of bone marrow and blood smears revealed probable transformation into acute myeloid leukemia. However, there were also cells indicating hairy cell leukemia. Morphological and immunohistochemical analyses later confirmed the presence of hairy cell leukemia in biopsies that had been present for 3 years. Treatment with cladribine temporarily reversed the patient's neutropenia.<h4>Conclusions</h4>Hairy cell leukemia may mimic development to myelofibrosis in patients with polycythemia vera.

Also flagged:SulforaphaneMelanomatumorBSEatypical nevinevus
Journal Article 2018-04-24 No Snippets Tahata S, Singh SV, Lin Y, Hahm ER, Beumer JH, Christner SM, Rao UN, Sander C, Tarhini AA, Tawbi H, Ferris LK, Wilson M, Rose A, Dietz CM, Hughes E, Fahey JW, Leachman SA, Cassidy PB, Butterfield LH, Zarour HM, Kirkwood JM.
Show Full Abstract

Broccoli sprout extract containing sulforaphane (BSE-SFN) has been shown to inhibit ultraviolet radiation-induced damage and tumor progression in skin. This study evaluated the toxicity and potential effects of oral BSE-SFN at three dosages. Seventeen patients who each had at least 2 atypical nevi and a prior history of melanoma were randomly allocated to 50, 100, or 200 μmol oral BSE-SFN daily for 28 days. Atypical nevi were photographed on days 1 and 28, and plasma and nevus samples were taken on days 1, 2, and 28. Endpoints assessed were safety, plasma and skin sulforaphane levels, gross and histologic changes, IHC for phospho-STAT3(Y705), Ki-67, Bcl-2, HMOX1, and TUNEL, plasma cytokine levels, and tissue proteomics. All 17 patients completed 28 days with no dose-limiting toxicities. Plasma sulforaphane levels pooled for days 1, 2, and 28 showed median postadministration increases of 120 ng/mL for 50 μmol, 206 ng/mL for 100 μmol, and 655 ng/mL for 200 μmol. Median skin sulforaphane levels on day 28 were 0.0, 3.1, and 34.1 ng/g for 50, 100, and 200 μmol, respectively. Plasma levels of proinflammatory cytokines decreased from day 1 to 28. The tumor suppressor decorin was increased from day 1 to 28. Oral BSE-SFN is well tolerated at daily doses up to 200 μmol and achieves dose-dependent levels in plasma and skin. A larger efficacy evaluation of 200 μmol daily for longer intervals is now reasonable to better characterize clinical and biological effects of BSE-SFN as chemoprevention for melanoma. <i>Cancer Prev Res; 11(7); 429-38. ©2018 AACR</i>.

Also flagged:CerebellinsSynapseneurexinsCbln1Cbln2Cbln4
Journal Article 2018-04-24 ✓ 1 Snippet Seigneur E, Südhof TC.
In-Text Gene Mentions

DCC

Show Full Abstract

Cerebellins are synaptic organizer molecules that bind to presynaptic neurexins and postsynaptic receptors. They are well studied in the cerebellum, but three of the four cerebellins (Cbln1, Cbln2, and Cbln4) are also broadly expressed outside of the cerebellum, suggesting that they perform general functions throughout the brain. Here, we generated male and female constitutive single (KO), double KO (dKO), and triple KO (tKO) mice of Cbln1, Cbln2, and Cbln4. We found that all constitutive cerebellin-deficient mice were viable and fertile, suggesting that cerebellins are not essential for survival. Cbln1/2 dKO mice exhibited salience-induced seizures that were aggravated in Cbln1/2/4 tKO mice, suggesting that all cerebellins contribute to brain function. As described previously, Cbln1 KO mice displayed major motor impairments that were aggravated by additional KO of Cbln2. Strikingly, the Cbln1/2 dKO did not cause alterations in synapse density in the hippocampus of young adult (1- and 2-month-old) mice, but produced a selective ∼50% decrease in hippocampal synapse density in the stratum lacunosum moleculare of the CA1 region and in the dentate gyrus of aging, 6-month-old mice. A similar decrease in excitatory synapse density was observed in the striatum and retrosplenial cortex. Behaviorally, the Cbln1 KO produced dramatic changes in motor behaviors that were partly aggravated by additional deletion of Cbln2 and/or Cbln4. Our results show that cerebellins are not essential for survival and do not contribute to initial synapse formation, but perform multiple functions throughout the brain; as a consequence, their ablation results in a delayed loss of synapses and in behavioral impairments.<b>SIGNIFICANCE STATEMENT</b> Cerebellins (Cbln1-4) are <i>trans</i>-synaptic cell adhesion molecules. In the cerebellum, Cbln1 functions as a bidirectional organizer of parallel fiber-Purkinje cell synapses by binding to presynaptic neurexins and postsynaptic GluRδ2. Little is known about the function of cerebellins outside of the cerebellum; therefore, the present study used single, double, and triple constitutive KO mice of Cbln1, Cbln2, and Cbln4 to analyze the overall function of cerebellins. We show that cerebellins act as important synaptic organizers in specific subsets of neurons and likely contribute to many different brain functions. We also show that cerebellins are not initially required for synapse formation, but rather for specification and long-term synapse maintenance and demonstrate that all cerebellins, not just Cbln1, contribute to brain function.

Also flagged:Huntington's diseaseHDmembranesynaptic activityactivityautosomal dominant neurodegenerative disorder
Journal Article 2018-04-24 ✓ 1 Snippet Barry J, Akopian G, Cepeda C, Levine MS.
In-Text Gene Mentions

Htt

Show Full Abstract

The present study examined synaptic communication between direct and indirect output pathway striatal medium-sized spiny neurons (MSNs) and their target structures, the substantia nigra pars reticulata (SNr) and the external globus pallidus (GPe) in two mouse models of Huntington's disease (HD). Cre recombination, optogenetics, and whole-cell patch-clamp recordings were used to determine alterations in intrinsic and synaptic properties of SNr and GPe neurons from both male and female symptomatic R6/2 (>60 d) and presymptomatic (2 months) or symptomatic (10-12 months) YAC128 mice. Cell membrane capacitance was decreased, whereas input resistance was increased in SNr neurons from R6/2, but not YAC128 mice. The amplitude of GABAergic responses evoked by optogenetic stimulation of direct pathway terminals was reduced in SNr neurons of symptomatic mice of both models. A decrease in spontaneous GABA synaptic activity, in particular large-amplitude events, in SNr neurons also was observed. Passive membrane properties of GPe neurons were not different between R6/2 or YAC128 mice and their control littermates. Similarly, the amplitude of GABA responses evoked by activation of indirect pathway MSN terminals and the frequency of spontaneous GABA synaptic activity were similar in HD and control animals. In contrast, the decay time of the evoked GABA response was significantly longer in cells from HD mice. Interestingly, activation of indirect pathway MSNs within the striatum evoked larger-amplitude responses in direct pathway MSNs. Together, these results demonstrate differential alterations in responses evoked by direct and indirect pathway terminals in SNr and GPe leading to striatal output imbalance and motor dysfunction.<b>SIGNIFICANCE STATEMENT</b> Previous work on Huntington's disease (HD) focused on striatal medium-sized spiny neurons (MSNs) almost exclusively. Little is known about the effects that alterations in the striatum have on output structures of the direct and indirect pathways, the substantia nigra pars reticulata (SNr) and the external segment of the globus pallidus (GPe), respectively. We combined electrophysiological and optogenetic methods to examine responses evoked by selective activation of terminals of direct and indirect pathway MSNs in SNr and GPe neurons in two mouse models of HD. We show a differential disruption of synaptic communication between the direct and indirect output pathways of the striatum with their target regions leading to an imbalance of striatal output, which will contribute to motor dysfunction.

Also flagged:Galectin-3lupusantibodyGal-3immunoglobulinsIFN-γ
Journal Article 2018-04-24 ✓ 1 Snippet Beccaria CG, Amezcua Vesely MC, Fiocca Vernengo F, Gehrau RC, Ramello MC, Tosello Boari J, Gorosito Serrán M, Mucci J, Piaggio E, Campetella O, Acosta Rodríguez EV, Montes CL, Gruppi A.
In-Text Gene Mentions

…of ROQUIN (Rc3h1) in Roquin…

Show Full Abstract

Germinal centers (GC) are important sites for high-affinity and long-lived antibody induction. Tight regulation of GC responses is critical for maintaining self-tolerance. Here, we show that Galectin-3 (Gal-3) is involved in GC development. Compared with WT mice, Gal-3 KO mice have more GC B cells and T follicular helper cells, increased percentages of antibody-secreting cells and higher concentrations of immunoglobulins and IFN-γ in serum, and develop a lupus-like disease. IFN-γ blockade in Gal-3 KO mice reduces spontaneous GC formation, class-switch recombination, autoantibody production and renal pathology, demonstrating that IFN-γ overproduction sustains autoimmunity. The results from chimeric mice show that intrinsic Gal-3 signaling in B cells controls spontaneous GC formation. Taken together, our data provide evidence that Gal-3 acts directly on B cells to regulate GC responses via IFN-γ and implicate the potential of Gal-3 as a therapeutic target in autoimmunity.

Also flagged:peptidespeptideproteasesynthesisdegradationproteases
Journal Article 2018-04-24 No Snippets Arranz-Gibert P, Ciudad S, Seco J, García J, Giralt E, Teixidó M.
Show Full Abstract

Peptides are experiencing a new era in medical research, finding applications ranging from therapeutics to vaccines. In spite of the promising properties of peptide pharmaceuticals, their development continues to be hindered by three weaknesses intrinsic to their structure, namely protease sensitivity, clearance through the kidneys, and immune system activation. Here we report on two retro-D-peptides (H<sub>2</sub>N-hrpyiah-CONH<sub>2</sub> and H<sub>2</sub>N-pwvpswmpprht-CONH<sub>2</sub>), which are protease-resistant and retain the original BBB shuttle activity of the parent peptide but are much less immunogenic than the parent peptide. Hence, we envisage that retro-D-peptides, which display a similar topological arrangement as their parent peptides, will expand drug design and help to overcome factors that lead to the failure of peptide pharmaceuticals in pre- and clinical trials. Furthermore, we reveal requirements to avoid or elicit specific humoral responses to therapeutic peptides, which might have a strong impact in both vaccine design and peptide therapeutic agents.

Also flagged:Hydroxyapatitecell growthHAp-Bporecalcium phosphateapatite
Journal Article 2018-04-24 No Snippets Predoi D, Groza A, Iconaru SL, Predoi G, Barbuceanu F, Guegan R, Motelica-Heino MS, Cimpeanu C.
Show Full Abstract

The research conducted in this study presented for the first time results of physico-chemical properties and in vitro antimicrobial activity of hydroxyapatite plant essential oil against Gram-positive bacteria (methicillin-resistant <i>Staphylococcus aureus</i> (MRSA) and <i>S. aureus</i> 0364) and Gram-negative bacteria (<i>Escherichia coli</i> ATCC 25922). The samples were studied by scanning electron microscopy (SEM) and Fourier transform infrared (FTIR) spectroscopy to determine the morphology and structure of the nanocomposites of hydroxyapatite coated with basil (HAp-B) and lavender (HAp-L) essential oils (EOs). The values of the BET specific surface area (S<sub>BET</sub>), total pore volume (V<sub>P</sub>) and pore size (D<sub>P</sub>) were determined. The results for the physico-chemical properties of HAp-L and HAp-B revealed that lavender EOs were well adsorbed on the surface of hydroxyapatite, whereas basil EOs showed a poor adsorption on the surface of hydroxyapatite. We found that the lavender EOs hydroxyapatite (HAp-L) exhibited a very good inhibitory growth activity. The value of the minimum inhibitory concentration (MIC) related to growth bacteria was 0.039 mg/mL for MRSA, 0.02 mg/mL for <i>S. aureus</i> and 0.039 mg/mL <i>E. coli</i> ATCC 25922. The basil EO hydroxyapatite (HAp-B) showed poor inhibition of bacterial cell growth. The MIC value was 0.625 mg/mL for the HAp-B sample in the presence of the MRSA bacteria, 0.313 mg/mL in the presence of <i>S. aureus</i> and 0.078 mg/mL for <i>E. coli</i> ATCC 25922.

Also flagged:fibrilsmembrane-associated proteinsviral capsidsmembrane proteinsextracellularpolypeptides
Journal Article 2018-04-24 ✓ 1 Snippet Matlahov I, van der Wel PCA.
In-Text Gene Mentions

Htt

Show Full Abstract

Solid-state nuclear magnetic resonance (ssNMR) spectroscopy enables the structural characterization of a diverse array of biological assemblies that include amyloid fibrils, non-amyloid aggregates, membrane-associated proteins and viral capsids. Such biological samples feature functionally relevant molecular dynamics, which often affect different parts of the sample in different ways. Solid-state NMR experiments' sensitivity to dynamics represents a double-edged sword. On the one hand, it offers a chance to measure dynamics in great detail. On the other hand, certain types of motion lead to signal loss and experimental inefficiencies that at first glance interfere with the application of ssNMR to overly dynamic proteins. Dynamics-based spectral editing (DYSE) ssNMR methods leverage motion-dependent signal losses to simplify spectra and enable the study of sub-structures with particular motional properties.

Also flagged:extracellularchondrogenesiscollagenglycosaminoglycansproteoglycansfibronectin
Journal Article 2018-04-24 No Snippets Sun Y, Yan L, Chen S, Pei M.
Show Full Abstract

Increasing evidence indicates that decellularized extracellular matrices (dECMs) derived from cartilage tissues (T-dECMs) or chondrocytes/stem cells (C-dECMs) can support proliferation and chondrogenic differentiation of cartilage-forming cells. However, few review papers compare the differences between these dECMs when they serve as substrates for cartilage regeneration. In this review, after an introduction of cartilage immunogenicity and decellularization methods to prepare T-dECMs and C-dECMs, a comprehensive comparison focuses on the effects of T-dECMs and C-dECMs on proliferation and chondrogenic differentiation of chondrocytes/stem cells in vitro and in vivo. Key factors within dECMs, consisting of microarchitecture characteristics and micromechanical properties as well as retained insoluble and soluble matrix components, are discussed in-depth for potential mechanisms underlying the functionality of these dECMs in regulating chondrogenesis. With this information, we hope to benefit dECM based cartilage engineering and tissue regeneration for future clinical application.<h4>Statement of significance</h4>The use of decellularized extracellular matrix (dECM) is becoming a promising approach for tissue engineering and regeneration. Compared to dECM derived from cartilage tissue, recently reported dECM from cell sources exhibits a distinct role in cell based cartilage regeneration. In this review paper, for the first time, tissue and cell based dECMs are comprehensively compared for their functionality in cartilage regeneration. This information is expected to provide an update for dECM based cartilage regeneration.

Also flagged:Nitrogenwaternitrous oxidenitrateammoniumacids
Journal Article 2018-04-24 ✓ 1 Snippet Dechorgnat J, Francis KL, Dhugga KS, Rafalski JA, Tyerman SD, Kaiser BN.
In-Text Gene Mentions

…), SIN3 component,histone deacetylase complexdeacetylase complex (…

Show Full Abstract

Maize (<i>Zea mays</i>, L.) yield is strongly influenced by external nitrogen inputs and their availability in the soil solution. Overuse of nitrogen-fertilizers can have detrimental ecological consequences through increased nitrogen pollution of water and the release of the potent greenhouse gas, nitrous oxide. To improve yield and overall nitrogen use efficiency (NUE), a deeper understanding of nitrogen uptake and utilization is required. This study examines the performance of two contrasting maize inbred lines, B73 and F44. F44 was selected in Florida on predominantly sandy acidic soils subject to nitrate leaching while B73 was selected in Iowa on rich mollisol soils. Transcriptional, enzymatic and nitrogen transport analytical tools were used to identify differences in their N absorption and utilization capabilities. Our results show that B73 and F44 differ significantly in their genetic, enzymatic, and biochemical root nitrogen transport and assimilatory pathways. The phenotypes show a strong genetic relationship linked to nitrogen form, where B73 showed a greater capacity for ammonium transport and assimilation whereas F44 preferred nitrate. The contrasting phenotypes are typified by differences in root system architecture (RSA) developed in the presence of both nitrate and ammonium. F44 crown roots were longer, had a higher surface area and volume with a greater lateral root number and density than B73. In contrast, B73 roots (primary, seminal, and crown) were more abundant but lacked the defining features of the F44 crown roots. An F1 hybrid between B73 and F44 mirrored the B73 nitrogen specificity and root architecture phenotypes, indicating complete dominance of the B73 inbred. This study highlights the important link between RSA and nitrogen management and why both variables need to be tested together when defining NUE improvements in any selection program.

Also flagged:nuclear transfer-transferheterochromatinmitochondriaendoplasmic reticulumfertilization
Journal Article 2018-04-24 No Snippets Min B, Park JS, Kang YK.
Show Full Abstract

Somatic cell nuclear transfer (scNT) embryos suffer from damage caused by micro-operation (manipulation) and inefficient genome reprograming that hinder their normal development at different levels and in distinct ways. These two effects are inseparable in the nature of the scNT embryo, although methods to separately measure them are needed to improve scNT technology and evaluate incoming reprogramming tools. As an attempt to meet these demands, we made bovine sham nuclear-transfer (shNT) blastocysts, special embryos made with a standard nuclear-transfer procedure at the zygote stage, while retaining an intact genome. We compared their transcriptomes with those of other blastocysts derived by <i>in-vitro</i> fertilization (IVF) or scNT. Correlation analysis revealed a singularity of shNT blastocysts as they separately gathered from the others. Analysis of developmentally important genes revealed that, in shNTs, the stemness-associated differentially expressed genes (DEGs), including <i>OCT4</i>, were mostly underrepresented. Overrepresented epi-driver genes were largely associated with heterochromatin establishment and maintenance. By multilateral comparisons of their transcriptomes, we classified DEGs into three groups: 561 manipulation-associated DEGs (MADs) common to shNTs and scNTs, 764 donor genome-associated DEGs (DADs) specific to scNTs, and 1743 zygote manipulation-associated DEGs (zMADs) specific to shNTs. GO enrichment analysis generated various terms involving "cell-cell adhesion," "translation," and "transcription" for MADs and "cell differentiation" and "embryo implantation" for DADs. Because of the transcriptomic specificity of shNTs, we studied zMADs in detail. GO enrichment analysis with the 854 zMADs underrepresented in shNTs yielded terms related to protein and mitochondria homeostasis, while GO enrichment analysis of 889 shNT-high zMADs yielded terms related to endoplasmic reticulum stress and protein transport. We summarized the DEGs, which, with further investigation, may help improve our understanding of molecular events occurring in cloned embryos and our ability to control clonal reprogramming.

Also flagged:heart failuredegenerative valve diseasevalve diseasecoagulationcell proliferationextracellular
Journal Article 2018-04-24 No Snippets Nordquist E, LaHaye S, Nagel C, Lincoln J.
Show Full Abstract

Heart valves are organized connective tissues of high mechanical demand. They open and close over 100,000 times a day to preserve unidirectional blood flow by maintaining structure-function relationships throughout life. In affected individuals, structural failure compromises function and often leads to regurgitant blood flow and progressive heart failure. This is most common in degenerative valve disease due to age-related wear and tear, or congenital malformations. At present, the only effective treatment of valve disease is surgical repair or replacement and this is often impermanent and requires anti-coagulation therapy throughout life. Therefore, there is a critical need to discover new alternatives. A promising therapeutic area is tissue regeneration and in non-valvular tissues this requires a tightly regulated genetic "growth program" involving cell proliferation. To explore this in heart valves, we performed RNA-seq analysis to compare transcriptional profiles of aortic valve tissue isolated from mice during stages of growth (postnatal day (PND) 2) and adult maintenance (4 months). Data analysis reveals distinct mRNA profiles at each time point and pathway ontology identifies associated changes in biological functions. The PND2 aortic valve is characterized by extensive cell proliferation and expression of mRNAs related to the extracellular matrix (ECM). At 4 months, proliferation is not significant and a differential set of ECM-related genes are expressed. Interestingly there is enrichment of the defense response biological process at this later time point. Together, these data highlight the unique transcriptome of the postnatal valve during stages of growth and maturation, as well as biological functions associated with adult homeostatic valves. These studies create a platform for future work exploring the molecular programs altered in the onset of heart valve disease after birth and provide insights for the development of mechanistic-based therapies.

Also flagged:neuron developmentFoxOMAPKgene expressionneuronhypoxia-inducible factor
Journal Article 2018-04-24 ✓ 1 Snippet Hung KS, Hsiao CC, Pai TW, Hu CH, Tzou WS, Wang WD, Chen YR.
In-Text Gene Mentions

…which would induceSTAU1-mediated decay (SMD) activiti…

Show Full Abstract

<h4>Background</h4>Differential gene expression analysis using RNA-seq data is a popular approach for discovering specific regulation mechanisms under certain environmental settings. Both gene ontology (GO) and KEGG pathway enrichment analysis are major processes for investigating gene groups that participate in common biological responses or possess related functions. However, traditional approaches based on differentially expressed genes only detect a few significant GO terms and pathways, which are frequently insufficient to explain all-inclusive gene regulation mechanisms.<h4>Methods</h4>Transcriptomes of survivin (birc5) gene knock-down experimental and wild-type control zebrafish embryos were sequenced and assembled, and a differential expression (DE) gene list was obtained for traditional functional enrichment analysis. In addition to including DE genes with significant fold-change levels, we considered additional associated genes near or overlapped with differentially expressed long noncoding RNAs (DE lncRNAs), which may directly or indirectly activate or inhibit target genes and play important roles in regulation networks. Both the original DE gene list and the additional DE lncRNA-associated genes were combined to perform a comprehensive overrepresentation analysis.<h4>Results</h4>In this study, a total of 638 DE genes and 616 DE lncRNA-associated genes (lncGenes) were leveraged simultaneously in searching for significant GO terms and KEGG pathways. Compared to the traditional approach of only using a differential expression gene list, the proposed method of employing DE lncRNA-associated genes identified several additional important GO terms and KEGG pathways. In GO enrichment analysis, 60% more GO terms were obtained, and several neuron development functional terms were retrieved as complete annotations. We also observed that additional important pathways such as the FoxO and MAPK signaling pathways were retrieved, which were shown in previous reports to play important roles in apoptosis and neuron development functions regulated by the survivin gene.<h4>Conclusions</h4>We demonstrated that incorporating genes near or overlapped with DE lncRNAs into the DE gene list outperformed the traditional enrichment analysis method for effective biological functional interpretations. These hidden interactions between lncRNAs and target genes could facilitate more comprehensive analyses.

Also flagged:opioid binding proteincell adhesion moleculegene expressioncell adhesion molecule-likeOPCMLcancer
Journal Article 2018-04-24 ✓ 1 Snippet Zhang N, Xu J, Wang Y, Heng X, Yang L, Xing X.
In-Text Gene Mentions

neuronal growth regulator 1

Show Full Abstract

Previous studies have reported that the expression of the opioid binding protein/cell adhesion molecule-like (OPCML) gene was frequently downregulated in various of types of cancer. However, little is known regarding the expression of the OPCML gene in gastric cancer. The present study identified that OPCML was downregulated in the gastric cancer SGC7901, KATO III, MKN45, MKN74, SNU1, AGS, N87 and a gastric mucosa cell line GES1, compared with normal gastric tissues by reverse transcription-quantitative polymerase chain reaction (RT-qPCR). To investigate whether the downregulation of OPCML was due to promoter hypermethylation, the methylation of the OPCML promoter was assessed by methylation-specific polymerase chain reaction. Hypermethylation of the OPCML promoter was observed in the gastric cancer MKN45 cell lines, but was not as evident in normal gastric tissue. The methylation inhibitor 5-aza-2'-deoxycytidine was used to remove the methylation of the OPCML gene promoter, following which the expression of OPCML was restored. In addition, the function of the OPCML gene was studied <i>in vitro</i>, and it was found that the restoration expression of OPCML could lead to the suppression of cell growth. In conclusion, the present study has shown that OPCML, which acts as a tumor suppressor, was silenced in gastric cancer cell lines via aberrant hypermethylation of the promoter CpG islands, which may provide a novel molecular approach for the early diagnosis of gastric cancer.

Also flagged:Li-Fraumeni Syndromecancer predisposition syndrometumor protein 53TP53colon cancercancer predisposition syndromes
Journal Article 2018-04-24 ✓ 1 Snippet Kumar P, Gill RM, Phelps A, Tulpule A, Matthay K, Nicolaides T.
In-Text Gene Mentions

…Genetic testing forhemochromatosis, given the unclear…

Show Full Abstract

Li-Fraumeni syndrome (LFS) is a rare cancer predisposition syndrome inherited in an autosomal dominant fashion that involves a germline mutation of tumor protein 53 (TP53). With the advent of more accessible and accurate genetic testing methods, along with more widespread knowledge of LFS, asymptomatic carriers can now be more easily identified. No general surveillance protocols were previously recommended other than routine physical exams and breast and colon cancer screening at younger ages, primarily due to questions involving efficacy, cost, and clinical benefits. With more data now available to support the implementation of a surveillance protocol for cancer predisposition syndromes such as LFS, preventative screening has become a national standard of care. However, as surveillance becomes more integrated into patient care, the benefits and risks must be further evaluated. We briefly describe our institutional experience with surveillance screening in LFS and describe two patients in depth where surveillance imaging brought to light false positives that led to increased utilization of resources and concern for new malignancy. Though the benefits of surveillance are clear, it is important to understand the potential for false positives involved with instituting this practice. Continued research of this topic is thus warranted, perhaps with larger prospective studies, to better capture the survival benefits of patients undergoing surveillance screening and more comprehensively understand the incidence of false positives.

Also flagged:TMEM59WntsignalosomecancerbindingWnt receptors
Journal Article 2018-04-24 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:bindingchromatinprotein Xgene-expressiontranscription factorsTF
Journal Article 2018-04-23 No Snippets Mitra S, Biswas A, Narlikar L.
Show Full Abstract

Genome-wide in vivo protein-DNA interactions are routinely mapped using high-throughput chromatin immunoprecipitation (ChIP). ChIP-reported regions are typically investigated for enriched sequence-motifs, which are likely to model the DNA-binding specificity of the profiled protein and/or of co-occurring proteins. However, simple enrichment analyses can miss insights into the binding-activity of the protein. Note that ChIP reports regions making direct contact with the protein as well as those binding through intermediaries. For example, consider a ChIP experiment targeting protein X, which binds DNA at its cognate sites, but simultaneously interacts with four other proteins. Each of these proteins also binds to its own specific cognate sites along distant parts of the genome, a scenario consistent with the current view of transcriptional hubs and chromatin loops. Since ChIP will pull down all X-associated regions, the final reported data will be a union of five distinct sets of regions, each containing binding sites of one of the five proteins, respectively. Characterizing all five different motifs and the corresponding sets is important to interpret the ChIP experiment and ultimately, the role of X in regulation. We present diversity which attempts exactly this: it partitions the data so that each partition can be characterized with its own de novo motif. Diversity uses a Bayesian approach to identify the optimal number of motifs and the associated partitions, which together explain the entire dataset. This is in contrast to standard motif finders, which report motifs individually enriched in the data, but do not necessarily explain all reported regions. We show that the different motifs and associated regions identified by diversity give insights into the various complexes that may be forming along the chromatin, something that has so far not been attempted from ChIP data. Webserver at http://diversity.ncl.res.in/; standalone (Mac OS X/Linux) from https://github.com/NarlikarLab/DIVERSITY/releases/tag/v1.0.0.

Also flagged:TDCDEGADEFATDKTDLKSR
Journal Article 2018-04-23 ✓ 1 Snippet Marín I.
In-Text Gene Mentions

…7/ARFGEF247 ; RSP5/SMURF2…

Show Full Abstract

Ubiquitin ligases (E3s) are basic components of the eukaryotic ubiquitination system. In this work, the emergence and diversification of fungal HECT ubiquitin ligases is described. Phylogenetic and structural data indicate that six HECT subfamilies (RSP5, TOM1, UFD4, HUL4, HUL4A and HUL5) existed in the common ancestor of all fungi. These six subfamilies have evolved very conservatively, with only occasional losses and duplications in particular fungal lineages. However, an early, drastic reduction in the number of HECT genes occurred in microsporidians, in parallel to the reduction of their genomes. A significant correlation between the total number of genes and the number of HECT-encoding genes present in fungi has been observed. However, transitions from unicellularity to multicellularity or vice versa apparently had no effect on the evolution of this family. Likely orthologs or co-orthologs of all fungal HECT genes have been detected in animals. Four genes are deduced to be present in the common ancestor of fungi, animals and plants. Protein-protein interactions detected in both the yeast Saccharomyces cerevisiae and humans suggest that some ancient functions of HECT proteins have been conserved since the animals/fungi split.

Also flagged:mitochondrialmembraneslocalizationneurological diseasesDrp1mitofusin 1
Journal Article 2018-04-23 No Snippets Cid-Castro C, Hernández-Espinosa DR, Morán J.
Show Full Abstract

Mitochondrial dynamics is a complex process, which involves the fission and fusion of mitochondrial outer and inner membranes. These processes organize the mitochondrial size and morphology, as well as their localization throughout the cells. In the last two decades, it has become a spotlight due to their importance in the pathophysiological processes, particularly in neurological diseases. It is known that Drp1, mitofusin 1 and 2, and Opa1 constitute the core of proteins that coordinate this intricate and dynamic process. Likewise, changes in the levels of reactive oxygen species (ROS) lead to modifications in the expression and/or activity of the proteins implicated in the mitochondrial dynamics, suggesting an involvement of these molecules in the process. In this review, we discuss the role of ROS in the regulation of fusion/fission in the nervous system, as well as the involvement of mitochondrial dynamics proteins in neurodegenerative diseases.

Also flagged:chromosomegenetic disorderovarian hyperstimulationfertilizationchromosomal disordersHLA
Journal Article 2018-04-23 ✓ 4 Snippets Volozonoka L, Perminov D, Korņejeva L, Alkšere B, Novikova N, Pīmane EJ, Blumberga A, Kempa I, Miskova A, Gailīte L, Fodina V.
In-Text Gene Mentions

…(genes: ACTA2 ,HTT, KRT14 ),…

HTTgene (OMIM# 613004)…

…HGVS nomenclature—NM_002111.6(HTT):c.53_55[(41_?)] (…

…tosomal dominant (genes-ACTA2,HTT, KRT14), autosomal recessive…

Show Full Abstract

<h4>Purpose</h4>To compare multiple displacement amplification and OmniPlex whole genome amplification technique performance during array comparative genome hybridization (aCGH), Sanger sequencing, SNaPshot and fragment size analysis downstream applications in frame of multifactor embryo preimplantation genetic testing.<h4>Methods</h4>Preclinical workup included linked short tandem repeat (STR) marker selection and primer design for loci of interest. It was followed by a family haplotyping, after which an in vitro fertilization preimplantation genetic testing (IVF-PGT) cycle was carried out. A total of 62 embryos were retrieved from nine couples with a confirmed single gene disorder being transmitted in their family with various inheritance traits-autosomal dominant (genes-ACTA2, HTT, KRT14), autosomal recessive (genes-ALOX12B, TPP1, GLB1) and X-linked (genes-MTM1, DMD). Whole genome amplification (WGA) for the day 5 embryo trophectoderm single biopsies was carried out by multiple displacement amplification (MDA) or polymerase chain reaction (PCR)-based technology OmniPlex and was used for direct (Sanger sequencing, fragment size analysis, SNaPshot) and indirect mutation assessment (STR marker haplotyping), and embryo aneuploidy testing by array comparative genome hybridization (aCGH).<h4>Results</h4>Family haplotyping revealed informative/semi-informative microsatellite markers for all clinical cases for all types of inheritance. Indirect testing gave a persuasive conclusion for all embryos assessed, which was confirmed through direct testing. The overall allele dropout (ADO) rate was higher for PCR-based WGA, and MDA shows a better genomic recovery scale. Five euploid embryos were subjected to elective single embryo transfer (eSET), which resulted in four clinical pregnancies and birth of two healthy children, which proved free of disease causative variants running in the family postnataly.<h4>Conclusions</h4>A developed multifactor PGT protocol can be adapted and applied to virtually any genetic condition and is capable of improving single gene disorder preimplantation genetic testing in a patient-tailored manner thus increasing pregnancy rates, saving costs and increasing patient reliability.

Also flagged:calcium-dependent protein kinase 4Calcium ionscalcium-dependent protein kinasesprotein secretionhost cellsCo-localization
Journal Article 2018-04-23 ✓ 3 Snippets Lv L, Huang B, Zhao Q, Zhao Z, Dong H, Zhu S, Chen T, Yan M, Han H.
In-Text Gene Mentions

…For example,SERPINC1is a rare…

SERPINC1, protease and heparin…

…cofactor, similar toSERPINC1or protein Z,…

Show Full Abstract

<h4>Background</h4>Eimeria tenella is an obligate intracellular apicomplexan protozoan parasite that has a complex life-cycle. Calcium ions, through various calcium-dependent protein kinases (CDPKs), regulate key events in parasite growth and development, including protein secretion, movement, differentiation, and invasion of and escape from host cells. In this study, we identified proteins that interact with EtCDPK4 to lay a foundation for clarifying the role of CDPKs in calcium channels.<h4>Methods</h4>Eimeria tenella merozoites were collected to construct a yeast two-hybrid (Y2H) cDNA library. The Y2H system was used to identify proteins that interact with EtCDPK4. One of interacting proteins was confirmed using bimolecular fluorescence complementation and co-immunoprecipitation in vivo. Co-localization of proteins was performed using immunofluorescence assays.<h4>Results</h4>Eight proteins that interact with EtCDPK4 were identified using the Y2H system. One of the proteins, E. tenella serine protease inhibitor 1 (EtSerpin), was further confirmed.<h4>Conclusion</h4>In this study, we screened for proteins that interact with EtCDPK4. An interaction between EtSerpin and EtCDPK4 was identified that may contribute to the invasion and development of E. tenella in host cells.

Also flagged:NeurotensinLipidPeptideamino acidfatty acidsobesity
Journal Article 2018-04-23 ✓ 1 Snippet Barchetta I, Cimini FA, Capoccia D, Bertoccini L, Ceccarelli V, Chiappetta C, Leonetti F, Di Cristofano C, Silecchia G, Orho-Melander M, Melander O, Cavallo MG.
In-Text Gene Mentions

…iseases (autoimmune hepatitis,hemochromatosis, Wilson’s disease), and…

Show Full Abstract

Neurotensin (NT) is a 13-amino acid peptide localized in the neuroendocrine cells of the small intestine, which promotes fat absorption and fatty acids translocation in response to lipid ingestion. NT-knock-out mice fed with a high-fat diet are protected from obesity, fatty liver, and the development of insulin-resistance. In humans, higher plasma levels of pro-NT, which is the stable circulating precursor of NT, predict obesity, type 2 diabetes (T2D), and cardiovascular disease. In obesity, the presence of visceral adipose tissue (VAT) inflammation leads to unfavorable metabolic outcomes and is associated with the development of T2D and non-alcoholic fatty liver disease (NAFLD). In this study, we investigated the relationship between plasma pro-NT levels and the presence of VAT inflammation in biopsies from 40 morbidly obese subjects undergoing bariatric surgery. We demonstrated that higher proNT levels are significantly associated with greater macrophages infiltration, HIF-1&alpha;, WISP-1, and UNC5B expression in VAT (all <i>p</i> < 0.01) due to the diagnosis of T2D and NAFLD. The overall results show that, in obesity, pro-NT is a biomarker of VAT inflammation and insulin-resistance. Additionally, NT may be involved in the development of dysmetabolic conditions likely mediated by increased gut fat absorption and the presence of a proinflammatory milieu in the adipose tissue.

Also flagged:prostate cancerbladder cancercarbogennicotinamideLocalized Prostate Cancertumours
Journal Article 2018-04-23 ✓ 2 Snippets Yang L, Roberts D, Takhar M, Erho N, Bibby BAS, Thiruthaneeswaran N, Bhandari V, Cheng WC, Haider S, McCorry AMB, McArt D, Jain S, Alshalalfa M, Ross A, Schaffer E, Den RB, Jeffrey Karnes R, Klein E, Hoskin PJ, Freedland SJ, Lamb AD, Neal DE, Buffa FM, Bristow RG, Boutros PC, Davicioni E, Choudhury A, West CML.
In-Text Gene Mentions

Ten genes (ATF3, BHLHE40, SLC2A3, EGR1, KLF10, FOSL2, CYR61, SLC2A14, KLF6, and TIPARP) in the 28-gene signature were previously shown to be hypoxia regulated in different tumour sites (Supplementary Table 12).

…, CYR61 ,SLC2A14, KLF6 ,…

Show Full Abstract

<h4>Background</h4>Hypoxia is associated with a poor prognosis in prostate cancer. This work aimed to derive and validate a hypoxia-related mRNA signature for localized prostate cancer.<h4>Method</h4>Hypoxia genes were identified in vitro via RNA-sequencing and combined with in vivo gene co-expression analysis to generate a signature. The signature was independently validated in eleven prostate cancer cohorts and a bladder cancer phase III randomized trial of radiotherapy alone or with carbogen and nicotinamide (CON).<h4>Results</h4>A 28-gene signature was derived. Patients with high signature scores had poorer biochemical recurrence free survivals in six of eight independent cohorts of prostatectomy-treated patients (Log rank test P < .05), with borderline significances achieved in the other two (P < .1). The signature also predicted biochemical recurrence in patients receiving post-prostatectomy radiotherapy (n = 130, P = .007) or definitive radiotherapy alone (n = 248, P = .035). Lastly, the signature predicted metastasis events in a pooled cohort (n = 631, P = .002). Prognostic significance remained after adjusting for clinic-pathological factors and commercially available prognostic signatures. The signature predicted benefit from hypoxia-modifying therapy in bladder cancer patients (intervention-by-signature interaction test P = .0026), where carbogen and nicotinamide was associated with improved survival only in hypoxic tumours.<h4>Conclusion</h4>A 28-gene hypoxia signature has strong and independent prognostic value for prostate cancer patients.

Also flagged:steroidsCNS diseaseADcomplementimmunoglobulinsmatrix proteins
Journal Article 2018-04-23 No Snippets Blaabjerg M, Hemdrup AL, Drici L, Ruprecht K, Garred P, Höftberger R, Kristensen BW, Kondziella D, Sejbaek T, Hansen SW, Nielsen HH, Jensen P, Meyer M, Paul F, Lassmann H, Larsen MR, Illes Z.
Show Full Abstract

<h4>Objective</h4>Chronic lymphocytic inflammation with pontine perivascular enhancement responsive to steroids (CLIPPERS) is a rare syndrome with relapsing brainstem/cerebellar symptoms. To examine the pathogenic processes and investigate potential biomarkers, we analyzed combined materials of brain and cerebrospinal fluid (CSF) by comprehensive methodologies.<h4>Materials and methods</h4>To identify major pathways of perivascular inflammation in CLIPPERS, we first compared the CSF proteome (<i>n</i> = 5) to a neurodegenerative condition, Alzheimer's disease (AD, <i>n</i> = 5). Activation of complement was confirmed by immunohistochemistry (IHC) on CLIPPERS brain samples (<i>n</i> = 3) and by ELISA in the CSF. For potential biomarkers, we used biomarker arrays, and compared inflammatory and vessel-associated proteins in the CSF of CLIPPERS (<i>n</i> = 5) with another inflammatory relapsing CNS disease, multiple sclerosis (RMS, <i>n</i> = 9) and healthy subjects (HS, <i>n</i> = 7).<h4>Results</h4>Two hundred and seven proteins in the CSF discriminated CLIPPERS from AD. The complement cascade, immunoglobulins, and matrix proteins were among the most frequently represented pathways. Pathway analysis of upstream regulators suggested the importance of vascular cell adhesion protein 1 (VCAM1), IFN-γ, interleukin (IL)-1, and IL-10. Differential regulation of more than 10 complement proteins of the 3 complement pathways in the CSF pointed to the role of complement activation. IHC on brain samples confirmed the perivascular complement activation, i.e., deposition of C3bc, C3d, and the terminal C5b-9 complement complex that partially overlapped with accumulation of IgG in the vessel wall. Besides endothelial cell damage, reactivity to smooth muscle actin was lost in the walls of inflamed vessels, but the glia limitans was preserved. The semi-quantitative array indicated that increased level of IL-8/CXCL8 (<i>p</i> < 0.05), eotaxin/CCL11 (<i>p</i> < 0.01), and granulocyte colony-stimulating factor (<i>p</i> < 0.05) in CSF could distinguish CLIPPERS from HS. The quantitative array confirmed elevated concentration of IL-8/CXCL8 and eotaxin/CCL11 compared to HS (<i>p</i> < 0.05, respectively) besides increased levels of ICAM-1 (<i>p</i> < 0.05) and VCAM-1 (<i>p</i> < 0.001). The increased concentration of VCAM-1 were able to differentiate CLIPPERS from RMS (<i>p</i> < 0.01), and a trend of elevated levels of ICAM-1 and IL-8/CXCL8 compared to RMS was also observed (<i>p</i> = 0.06, respectively).<h4>Conclusion</h4>Complement activation, IgG deposition, and alterations of the extracellular matrix may contribute to inflammation in CLIPPERS. VCAM1, ICAM1, and IL-8 in the CSF may differentiate CLIPPERS from RMS.

Also flagged:Roquin-2RNA-binding proteinsRoquinFoxp3phosphoinositide 3-kinasephosphatidylinositol
Journal Article 2018-04-23 ✓ 1 Snippet Akef A, Muljo SA.
In-Text Gene Mentions

Roquin-1and Roquin-2 are…

Show Full Abstract

Roquin-1 and Roquin-2 are RNA-binding proteins essential for modulating T cell activity. Indeed, Roquin dysfunction has been linked to autoimmunity in mice. Essig and colleagues (2017) determine their functions in Foxp3<sup>+</sup> T regulatory cells and uncover novel mechanisms of Roquin-mediated regulation of its target mRNAs (1).

Also flagged:ribosomeMAPKPRKAG2LEF1C14orf169YLPM1
Journal Article 2018-04-23 ✓ 2 Snippets Tang G, Zhang T, Wang X, Song Z, Liu F, Zhang Q, Huo R.
In-Text Gene Mentions

…KCTD13, UFL1 andZNF322.…

…Besides,ZNF322is a crucial…

Show Full Abstract

The aim of the study was to identify key long non-coding RNAs (lncRNA) and related subpathways following severe burn injuries and research their functions. The miRNA-mRNA and lncRNA-miRNA interactions were downloaded from starBase v2.0 database. In addition, mRNA-miRNA interactions were obtained from TarBase, mirTarBase, mir2Disease, miRecords (V4.0) databases. The relationships of lncRNA-miRNA-mRNA were constructed. Genes of expression profiling were intersected with mRNA and lncRNA in lncRNA-mRNA interaction. Screened mRNAs were enriched into various pathways and screened lncRNAs were embedded into candidate pathways. Wallenius approximation methods were used to calculate the false discovery rate value of each sub-pathway. Based on the results of significant sub-pathways, the related lncRNA-mRNA network was constructed. A total of 18,081 genes were obtained. The lncRNA-mRNA intersections including 835 lncRNAs, 1,749 mRNAs and 7,693 interacting pairs were constructed. The enriched mRNAs were further enriched into various candidate pathways such as ribosome biogenesis in eukaryotes. Several sub-pathways were screened, including ribosome biogenesis in eukaryotes and MAPK signaling pathway. The network of pathway-lncRNA-mRNA was constructed. Hub-genes were identified, including <i>C14orf169</i> and <i>YLPM1</i>. Several hub-lncRNAs were obtained, including PRKAG2 antisense RNA 1 and LEF1 antisense RNA 1. Several hub-lncRNAs including C14orf169, YLPM1, TTTY15, and PCBP1-AS1 were screened. The sub-pathways regulated by these lncRNAs were identified, and functions were predicted.

Also flagged:irongene expressioniron regulatory proteinsmuscle abscesscytokineIL-6
Journal Article 2018-04-23 ✓ 2 Snippets Abbasi MH, Fatima S, Khawar MB, Jahan S, Sheikh N.
In-Text Gene Mentions

…hemojuvelin (Hjv), hereditaryhemochromatosisgene (HFE), divalent…

…editary hemochromatosis gene (HFE), divalent metal transporter…

Show Full Abstract

This study was aimed to find histological changes in the extrahepatic organs, hepatic iron deposition, and gene expression of some iron regulatory proteins in rats after sterile muscle abscess during the acute intoxication of <i>Nerium oleander</i> leaves decoction. 10 ml/kg of the leaves extract was injected intramuscularly in Wistar rats (200-225 g, <i>n</i> = 4). Control animals received saline injection of matched volume. Animals were anesthetized and sacrificed after 3, 6, 12, and 24 h after administration of decoction. Lungs, kidney, spleen, and liver were extracted and processed for histopathological examination while portion of liver tissue was proceeded for iron regulatory gene expression quantification. Sections of all studied organs were found with signs of cellular dysfunction with infiltration of variety of leucocytes. In the lungs section at 3 h time point mononuclear cell infiltrates were observed while in alveolar tissue at 24 h time point dilation and even collapse in some of the alveoli were evident. In kidney sections distortion of renal tubules and epithelial cells with shrinkage of glomeruli was noted at all studied time points. In the splenic section of 12 h time point, degeneration, depopulation, and shrinkage of white pulp have been noted. Distension of the red pulp along with activation of splenic follicles was evident after 24 h onset of APR. Significant changes in the expression of acute phase cytokine and iron regulatory genes were noted. IL-6 and Hepc gene expression were strongly upregulated up to 12 h whereby Tf gene expression showed an early upregulation at 3 h time point followed by downregulation on later points while Hjv gene expression showed an overall downregulation at all study time points compared to control. It is concluded that inherent toxins present in the <i>N. oleander</i> can induce acute phase response and cause severe histological changes in the organs and marked changes in the regulation of iron regulatory proteins thus cannot be practiced routinely.

Also flagged:mitochondrial cytochrome oxidase subunit ICOIethanol
Journal Article 2018-04-23 No Snippets Lee Y, Kanturski M, Lee S.
Show Full Abstract

<b>Yerim Lee, Mariusz Kanturski, and Seunghwan Lee (2018)</b> This study reviewed the aphid genus <i>Mesocallis</i> from the Korean peninsula. A total of five species are recognized using morphological and molecular evidence, including two new species, <i>Mesocallis</i> (<i>Mesocallis</i>) <i>carpinicola</i> sp. nov. and <i>M</i>. (<i>Paratinocallis</i>) <i>occulta</i> sp. nov., one newly recorded species, <i>M</i>. (<i>M</i>.) <i>pteleae</i> Matsumura, 1919, and the two species <i>M</i>. (<i>M</i>.) <i>sawashibae</i> (Matsumura, 1917) and <i>M</i>. (<i>P</i>.) <i>corylicola</i> (Higuchi, 1972). Species description, illustrations and distributional and biological data were provided for all Korean <i>Mesocallis</i> species along with a pictorial key. Pairwise distances, a neighbor-joining tree and a median-joining network are also given.

Also flagged:renβ-TPeptidPeptidedasSec23
Journal Article 2018-04-23 No Snippets Murphy K, Weaver C.
Show Full Abstract

No abstract available.

Anhänge

Also flagged:DasallerufengerPenicillinMineral
Journal Article 2018-04-23 No Snippets Murphy K, Weaver C.
Show Full Abstract

No abstract available.

Also flagged:ILFPPCCapsuleHuntington's diseaseneurodegenerative disorderHuntingtin
Journal Article 2018-04-22 ✓ 3 Snippets Gregory S, Gregory S, Crawford H, Seunarine K, Leavitt B, Durr A, Roos RAC, Scahill RI, Tabrizi SJ, Rees G, Langbehn D, Orth M.
In-Text Gene Mentions

Huntington's disease (HD) is caused by a CAG‐repeat‐expansion in the Huntingtin gene (HTT).

…Huntingtin gene (HTT).…

…9.1) carried theHTTgene with a…

Show Full Abstract

Huntington's disease (HD) is a monogenic neurodegenerative disorder caused by a CAG-repeat expansion in the Huntingtin gene. Presence of this expansion signifies certainty of disease onset, but only partly explains age at which onset occurs. Genome-wide association studies have shown that naturally occurring genetic variability influences HD pathogenesis and disease onset. Investigating the influence of biological traits in the normal population, such as variability in white matter properties, on HD pathogenesis could provide a complementary approach to understanding disease modification. We have previously shown that while white matter diffusivity patterns in the left sensorimotor network were similar in controls and HD gene-carriers, they were more extreme in the HD group. We hypothesized that the influence of natural variation in diffusivity on effects of HD pathogenesis on white matter is not limited to the sensorimotor network but extends to cognitive, limbic, and visual networks. Using tractography, we investigated 32 bilateral pathways within HD-related networks, including motor, cognitive, and limbic, and examined diffusivity metrics using principal components analysis. We identified three independent patterns of diffusivity common to controls and HD gene-carriers that predicted HD status. The first pattern involved almost all tracts, the second was limited to sensorimotor tracts, and the third encompassed cognitive network tracts. Each diffusivity pattern was associated with network specific performance. The consistency in diffusivity patterns across both groups coupled with their association with disease status and task performance indicates that naturally-occurring patterns of diffusivity can become accentuated in the presence of the HD gene mutation to influence clinical brain function.

Also flagged:TFAMmetabolismmitochondrialmitochondrial transcription factortissue developmentShh
Journal Article 2018-04-22 ✓ 1 Snippet Srivillibhuthur M, Warder BN, Toke NH, Shah PP, Feng Q, Gao N, Bonder EM, Verzi MP.
In-Text Gene Mentions

OLFM4

Show Full Abstract

During development, the embryo transitions from a metabolism favoring glycolysis to a metabolism favoring mitochondrial respiration. How metabolic shifts regulate developmental processes, or how developmental processes regulate metabolic shifts, remains unclear. To test the requirement of mitochondrial function in developing endoderm-derived tissues, we genetically inactivated the mitochondrial transcription factor, Tfam, using the Shh-Cre driver. Tfam mutants did not survive postnatally, exhibiting defects in lung development. In the developing intestine, TFAM-loss was tolerated until late fetal development, during which the process of villus elongation was compromised. While progenitor cell populations appeared unperturbed, markers of enterocyte maturation were diminished and villi were blunted. Loss of TFAM was also tested in the adult intestinal epithelium, where enterocyte maturation was similarly dependent upon the mitochondrial transcription factor. While progenitor cells in the transit amplifying zone of the adult intestine remained proliferative, intestinal stem cell renewal was dependent upon TFAM, as indicated by molecular profiling and intestinal organoid formation assays. Taken together, these studies point to critical roles for the mitochondrial regulator TFAM for multiple aspects of intestinal development and maturation, and highlight the importance of mitochondrial regulators in tissue development and homeostasis.

Also flagged:pancreatic intraepithelial neoplasiaPanINpancreatic ductal adenocarcinomaKRASCDKN2ATP53
Journal Article 2018-04-22 No Snippets Hata T, Suenaga M, Marchionni L, Macgregor-Das A, Yu J, Shindo K, Tamura K, Hruban RH, Goggins M.
Show Full Abstract

To obtain a better understanding of the genetic alterations of high-grade pancreatic intraepithelial neoplasia (HG-PanIN), we performed whole-genome copy number analysis by using single nucleotide polymorphism microarrays and targeted next-generation sequencing of 11 microdissected HG-PanIN and two low-grade PanIN lesions associated with HG-PanIN. HG-PanIN mutation profiles were compared with those of their associated invasive pancreatic ductal adenocarcinoma. All PanIN lesions harbored somatic KRAS mutations. The most common copy number losses in the HG-PanIN were at the CDKN2A (9p21), TP53 (17p13), and SMAD4 (18q21) loci. Chromosomal losses in HG-PanIN were also found at 6p25-p24, 6q11-q27, 12q24, and 17q23-q24. Biallelic inactivation of CDKN2A and TP53 was detected in five of eight and in three of eight evaluable PanIN lesions, respectively. None of the HG-PanIN lesions had SMAD4 mutations or homozygous deletion. Copy number gains were noted at the MYC (8q24) and CCNE1 (19q12) loci and at 1q25-q31. Four HG-PanINs and one low-grade PanIN harbored chromothripsis-like regions. Five of seven pancreatic ductal adenocarcinomas evaluated had additional mutations that were not found in their associated HG-PanIN. HG-PanIN harbors widespread copy number alterations and commonly shows evidence of biallelic inactivation of CDKN2A and TP53 but not SMAD4. Chromothripsis events contribute to the copy number alterations of HG-PanIN.

Also flagged:fibrous tumor of theCalcifying fibrous tumor of the pleuramesenchymal tumorpathogenesisTumorsSTAT6
Journal Article 2018-04-22 ✓ 2 Snippets Mehrad M, LaFramboise WA, Lyons MA, Trejo Bittar HE, Yousem SA.
In-Text Gene Mentions

…family and thehemochromatosis(HFE) gene.…

…and the hemochromatosis (HFE) gene.…

Show Full Abstract

Calcifying fibrous tumor of the pleura (CFTP) is a rare mesenchymal tumor of unknown pathogenesis. The diagnosis often requires exclusion of other common entities. Our aim was to determine if genomic changes were associated with CFTP that could contribute to mechanisms underlying tumorigenesis. Three cases of CFTP with their corresponding uninvolved control lung tissue were identified. Two patients were male, and 1 was female (age range, 21-32 years). Tumors were multifocal in 2 cases and solitary in 1. Immunohistochemistry for STAT6, BCL-2, CD34, cytokeratin AE1/AE3, calretinin, desmin, S100, ALK, and β-catenin was used. All immunohistochemistries were negative in CFTPs. DNA was isolated from all 3 pairs of CFTPs and matching normal lungs for whole-exome sequencing. Damaging, tumor-specific, coding variants were identified in 3 genes including multiple heterozygotic, de novo mutations in the Zinc Finger Protein 717 (ZNF717), fascioscapulohumeral muscular dystrophy-1 (FRG1) and cell division cycle 27 (CDC27) genes. Whole-exome sequencing revealed statistically significant, focal, tumor-specific copy number losses among all CFTPs including a large (302 kb) loss at 6p22.2 comprising 32 genes of the histone cluster 1 family and the hemochromatosis (HFE) gene. This is the first study to evaluate the molecular pathogenesis of CFTP and to identify novel deleterious mutations in ZN717, FRG1, and CDC27 genes as well as significant copy number losses on 8 chromosomes with a large loss common to all samples on chromosome 6. These mutations deleteriously altered coding domains in a manner predicted to be damaging to protein function and may contribute to CFTP tumorigenesis.

Also flagged:betulinic acidleukemianeurological disorderspathogenesistriterpenoidwater
Journal Article 2018-04-21 No Snippets Phillips J, Phillips I, Enya B, Zhao H, Nitta T.
Show Full Abstract

Murine leukemia virus (MuLV) is a retrovirus known causing leukemia and neurological disorders in mice, and its viral life cycle and pathogenesis have been investigated extensively over the past decades. As a natural antiviral agent, betulinic acid is a pentacyclic triterpenoid that can be found in the bark of several species of plants (particularly the white birch). One of the hurdles for betulinic acid to release its antiviral potency is its poor water solubility. In this study, we synthesized more water-soluble ionic derivatives of betulinic acid, and examined their activities against Moloney MuLV (M-MuLV). The mouse fibroblast cells stably infected with M-MuLV, 43D cells, were treated with various doses of betulinic acids and its derivatives, and the viral structural protein Gag in cells and media were detected by western blots. Two ionic derivatives containing the benzalkonium cation were found to inhibit the virus production into media and decreased Gag in cells. However, a cell proliferation assay showed that the benzalkonium cation inhibited the growth of 43D cells, suggesting that our ionic derivatives limited virus production through the inhibition of metabolism in 43D cells. Interestingly, all of these betulinic acid compounds exhibited a minimum impact on the processing and release of Gag from 43D cells, which outlines the differences of viral maturation between MuLV and human immunodeficiency virus.

Also flagged:oxygeninfertilityMAPKsuperoxide dismutasegene expressioncell proliferation
Journal Article 2018-04-21 No Snippets Zhan S, Cao S, Du H, Sun Y, Li L, Ding C, Zheng H, Huang J.
Show Full Abstract

<h4>Background</h4>Hatching is crucial for mammalian embryo implantation, since difficulties during this process can lead to implantation failure, ectopic pregnancy and consequent infertility. Despite years of intensive researches, how internal and external factors affecting embryo hatch are still largely unclear.<h4>Methods</h4>The effects of parental genetic material and oxygen concentration on hatch process were examined. Fertilized and parthenogenetic mouse preimplantation embryos were cultured in vitro under 5 and 20% oxygen for 120 h. Zona pellucida drilling by Peizo micromanipulation were performed to resemble the breach by sperm penetration.<h4>Results</h4>Firstly, parthenogenetic embryos had similarly high blastocyst developmental efficiency as fertilized embryos, but significantly higher hatch ratio than fertilized embryos in both O<sub>2</sub> concentrations. 5% O<sub>2</sub> reduced the hatch rate of fertilized embryos from 58.2 to 23.8%, but increased that of parthenogenetic embryos from 81.2 to 90.8% significantly. Analogously, 5% O<sub>2</sub> decreased the ratio of Oct4-positive cells in fertilized blastocysts, whereas increased that in parthenogenetic blastocysts. Additionally, 5% O<sub>2</sub> increased the total embryonic cell number in both fertilized and parthegenetic embryos, when compared to 20% O<sub>2</sub>, and the total cell number of fertilized embryos was also higher than that of parthegenetic embryos, despite O<sub>2</sub> concentration. Real-time PCR revealed that the expression of key genes involving in MAPK pathway and superoxide dismutase family might contribute to preimplantation development and consequent blastocyst hatch in vitro. Finally, we showed that fertilized and parthenogenetic embryos have diverse hatch dynamics in vitro, although the zona pellucida integrity is not the main reason for their mechanistic differences.<h4>Conclusion</h4>Both parental genetic material and O<sub>2</sub> concentration, as the representative of intrinsic and extrinsic factors respectively, have significant impacts on mouse preimplantation development and subsequent hatch dynamics, probably by regulating the gene expression involving in MAPK pathway and superoxide dismutase family to control embryonic cell proliferation and allocation of ICM cells.

Also flagged:Aminobenzothiazolep53cancercancerstumor suppressor p53binding
Journal Article 2018-04-21 No Snippets Baud MGJ, Bauer MR, Verduci L, Dingler FA, Patel KJ, Horil Roy D, Joerger AC, Fersht AR.
Show Full Abstract

Many cancers have the tumor suppressor p53 inactivated by mutation, making reactivation of mutant p53 with small molecules a promising strategy for the development of novel anticancer therapeutics. The oncogenic p53 mutation Y220C, which accounts for approximately 100,000 cancer cases per year, creates an extended surface crevice in the DNA-binding domain, which destabilizes p53 and causes denaturation and aggregation. Here, we describe the structure-guided design of a novel class of small-molecule Y220C stabilizers and the challenging synthetic routes developed in the process. The synthesized chemical probe MB710, an aminobenzothiazole derivative, binds tightly to the Y220C pocket and stabilizes p53-Y220C in vitro. MB725, an ethylamide analogue of MB710, induced selective viability reduction in several p53-Y220C cancer cell lines while being well tolerated in control cell lines. Reduction of viability correlated with increased and selective transcription of p53 target genes such as BTG2, p21, PUMA, FAS, TNF, and TNFRSF10B, which promote apoptosis and cell cycle arrest, suggesting compound-mediated transcriptional activation of the Y220C mutant. Our data provide a framework for the development of a class of potent, non-toxic compounds for reactivating the Y220C mutant in anticancer therapy.

Also flagged:ribosomegene expressiontumorcancermultipleneoplasm
Journal Article 2018-04-20 No Snippets Bastide A, David A.
Show Full Abstract

The ribosome has long been considered as a consistent molecular factory, with a rather passive role in the translation process. Recent findings have shifted this obsolete view, revealing a remarkably complex and multifaceted machinery whose role is to orchestrate spatiotemporal control of gene expression. Ribosome specialization discovery has raised the interesting possibility of the existence of its malignant counterpart, an 'oncogenic' ribosome, which may promote tumor progression. Here we weigh the arguments supporting the existence of an 'oncogenic' ribosome and evaluate its role in cancer evolution. In particular, we provide an analysis and perspective on how the ribosome may play a critical role in the acquisition and maintenance of cancer stem cell phenotype.

Also flagged:prostaglandincyclooxygenaseCOXprostaglandin (PG)-endoperoxide synthase genes 1COX-2nephrogenesis
Journal Article 2018-04-20 No Snippets Li X, Mazaleuskaya LL, Ballantyne LL, Meng H, FitzGerald GA, Funk CD.
Show Full Abstract

The distinct functions of each cyclooxygenase (COX) isoform in renal homeostasis have been the subject of intense investigation for many years. We took the novel approach of using 3 characterized mouse lines, where the prostaglandin (PG)-endoperoxide synthase genes 1 and 2 ( Ptgs1 and Ptgs2) substitute for one another to delineate distinct roles and the potential for COX isoform substitution. Flipped Ptgs genes generate a reversed COX-expression pattern in the kidney, where the knockin COX-2 is highly expressed. Normal nephrogenesis was sustained in all 3 strains at the postnatal stage d 8 (P8). Knockin COX-1 can temporally restore renal function and delay but not prevent renal pathology consequent to COX-2 deletion. Loss of COX-2 in adult COX-1 > COX-2 mice results in severe nephropathy, which leads to impaired renal function. These defects are partially rescued by the knockin COX-2 in Reversa mice, whereas COX-2 can compensate for the loss of COX-1 in COX-2 > COX-1 mice. Intriguingly, the highly expressed knockin COX-2 enzyme barely makes any PGs or thromboxane in neonatal P8 or adult mice, demonstrating that prostanoid biosynthesis requires native COX-1 and cannot be rescued by the knockin COX-2. In summary, the 2 COX isoforms can preferentially compensate for some renal functions, which appears to be independent of the PG-synthetic capacity.-Li, X., Mazaleuskaya, L. L., Ballantyne, L. L., Meng, H., FitzGerald, G. A., Funk, C. D. Differential compensation of two cyclooxygenases in renal homeostasis is independent of prostaglandin-synthetic capacity under basal conditions.

Also flagged:transcriptional regulatorscell differentiationneurogenesisES cell differentiationE6trans-splicing
Journal Article 2018-04-20 ✓ 1 Snippet Izuogu OG, Alhasan AA, Mellough C, Collin J, Gallon R, Hyslop J, Mastrorosa FK, Ehrmann I, Lako M, Elliott DJ, Santibanez-Koref M, Jackson MS.
In-Text Gene Mentions

…majority of theDCCrepeats known to…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) are predominantly derived from protein coding genes, and some can act as microRNA sponges or transcriptional regulators. Changes in circRNA levels have been identified during human development which may be functionally important, but lineage-specific analyses are currently lacking. To address this, we performed RNAseq analysis of human embryonic stem (ES) cells differentiated for 90 days towards 3D laminated retina.<h4>Results</h4>A transcriptome-wide increase in circRNA expression, size, and exon count was observed, with circRNA levels reaching a plateau by day 45. Parallel statistical analyses, controlling for sample and locus specific effects, identified 239 circRNAs with expression changes distinct from the transcriptome-wide pattern, but these all also increased in abundance over time. Surprisingly, circRNAs derived from long non-coding RNAs (lncRNAs) were found to account for a significantly larger proportion of transcripts from their loci of origin than circRNAs from coding genes. The most abundant, circRMST:E12-E6, showed a > 100X increase during differentiation accompanied by an isoform switch, and accounts for > 99% of RMST transcripts in many adult tissues. The second most abundant, circFIRRE:E10-E5, accounts for > 98% of FIRRE transcripts in differentiating human ES cells, and is one of 39 FIRRE circRNAs, many of which include multiple unannotated exons.<h4>Conclusions</h4>Our results suggest that during human ES cell differentiation, changes in circRNA levels are primarily globally controlled. They also suggest that RMST and FIRRE, genes with established roles in neurogenesis and topological organisation of chromosomal domains respectively, are processed as circular lncRNAs with only minor linear species.

Also flagged:fusCfusBarcCC1qacCarginine
Journal Article 2018-04-20 No Snippets Budri PE, Shore AC, Coleman DC, Kinnevey PM, Humpreys H, Fitzgerald-Hughes D.
Show Full Abstract

<h4>Objective</h4>The aim of this study was to investigate co-located nasal <i>Staphylococcus aureus</i> and coagulase-negative staphylococci (CoNS) (mainly <i>Staphylococcus epidermidis</i>), recovered from healthy medical students in their preclinical year, prior to exposure to the healthcare environment, for the carriage of genes and genetic elements common to both species and that may contribute to <i>S. aureus</i> and methicillin-resistant <i>S. aureus</i> (MRSA) evolution.<h4>Design</h4>Prospective observational cross-sectional study. Carriage of antimicrobial resistance and virulence-associated genes in the absence of significant antibiotic selective pressure was investigated among healthy medical students from geographically diverse origins who were nasally co-colonised with <i>S. aureus</i> and CoNS. Clonal lineages of <i>S. aureus</i> isolates were determined.<h4>Setting/participants</h4>Dublin-based international undergraduate medical students.<h4>Results</h4>Nasal <i>S. aureus</i> carriage was identified in 137/444 (30.8%) students of whom nine (6.6%) carried MRSA (ST59-MRSA-IV (6/9), CC1-MRSA-V-SCC<i>fus</i> (3/9)). The genes <i>mecA</i>, <i>fusB</i>, <i>ileS2, qacA</i>/<i>qacC</i> and the arginine catabolic mobile element-<i>arc</i> were detected among colonising nasal staphylococci and had a significantly greater association with CoNS than <i>S. aureus.</i> The rate of co-carriage of any of these genes in <i>S. aureus</i>/CoNS pairs recovered from the same individual was <1%.<h4>Conclusions</h4>The relatively high prevalence of these genes among CoNS of the healthy human flora in the absence of significant antibiotic selective pressure is of interest. Further research is required to determine what factors are involved and whether these are modifiable to help prevent the emergence and spread of antibiotic resistance among staphylococci.

Also flagged:Antithrombin III) deficiencydeficiencyclottingATIII deficiencyHereditary
Journal Article 2018-04-20 ✓ 5 Snippets Nishimura Y, Takagi Y.
In-Text Gene Mentions

…Antithrombin III (ATIII) deficiency is a…

…Therefore, patients withATIIIdeficiency undergoing cardiova…

…five patients withATIIIdeficiency who underwent…

…were managed withATIIIreplacement.…

…By administration ofATIIIconcentrate, preoperative ATII…

Show Full Abstract

Antithrombin III (ATIII) deficiency is a rare disorder in which thrombosis can be induced by stimuli that do not usually lead to thrombus formation, including minor injuries and surgery. Therefore, patients with ATIII deficiency undergoing cardiovascular surgery that involves heparinization require careful perioperative management. We experienced five patients with ATIII deficiency who underwent cardiovascular surgery and were managed with ATIII replacement. By administration of ATIII concentrate, preoperative ATIII activity was maintained at ≥120% and postoperative ATIII activity at ≥80%. All five patients were treated successfully without postoperative complications such as hemorrhage or thrombosis. In patients with ATIII deficiency undergoing cardiac surgery, it is important to perform ATIII replacement to achieve preoperative ATIII activity ≥120% and postoperative ATIII activity ≥80%, while the activated clotting time (ACT) is maintained at >400 seconds during cardiopulmonary bypass. In addition, long-term postoperative anticoagulant therapy is necessary in hereditary ATIII deficiency patients with a history of thrombosis.

Also flagged:cancerleukemiaheart attackdeathgene expressionstranscription factors
Journal Article 2018-04-20 No Snippets Relator RT, Terada A, Sese J.
Show Full Abstract

<h4>Background</h4>Survival analysis methods have been widely applied in different areas of health and medicine, spanning over varying events of interest and target diseases. They can be utilized to provide relationships between the survival time of individuals and factors of interest, rendering them useful in searching for biomarkers in diseases such as cancer. However, some disease progression can be very unpredictable because the conventional approaches have failed to consider multiple-marker interactions. An exponential increase in the number of candidate markers requires large correction factor in the multiple-testing correction and hide the significance.<h4>Methods</h4>We address the issue of testing marker combinations that affect survival by adapting the recently developed Limitless Arity Multiple-testing Procedure (LAMP), a p-value correction technique for statistical tests for combination of markers. LAMP cannot handle survival data statistics, and hence we extended LAMP for the log-rank test, making it more appropriate for clinical data, with newly introduced theoretical lower bound of the p-value.<h4>Results</h4>We applied the proposed method to gene combination detection for cancer and obtained gene interactions with statistically significant log-rank p-values. Gene combinations with orders of up to 32 genes were detected by our algorithm, and effects of some genes in these combinations are also supported by existing literature.<h4>Conclusion</h4>The novel approach for detecting prognostic markers presented here can identify statistically significant markers with no limitations on the order of interaction. Furthermore, it can be applied to different types of genomic data, provided that binarization is possible.

Also flagged:MHCchromosomesmajor histocompatibility complexmodificationshistonechromosome
Journal Article 2018-04-20 ✓ 1 Snippet Guo J, Chen H, Yang P, Lee YT, Wu M, Przytycka TM, Kwoh CK, Zheng J.
In-Text Gene Mentions

…class I geneHFEcauses haemochromatosis […

Show Full Abstract

<h4>Background</h4>Meiotic recombination happens during the process of meiosis when chromosomes inherited from two parents exchange genetic materials to generate chromosomes in the gamete cells. The recombination events tend to occur in narrow genomic regions called recombination hotspots. Its dysregulation could lead to serious human diseases such as birth defects. Although the regulatory mechanism of recombination events is still unclear, DNA sequence polymorphisms have been found to play crucial roles in the regulation of recombination hotspots.<h4>Method</h4>To facilitate the studies of the underlying mechanism, we developed a database named LDSplitDB which provides an integrative and interactive data mining and visualization platform for the genome-wide association studies of recombination hotspots. It contains the pre-computed association maps of the major histocompatibility complex (MHC) region in the 1000 Genomes Project and the HapMap Phase III datasets, and a genome-scale study of the European population from the HapMap Phase II dataset. Besides the recombination profiles, related data of genes, SNPs and different types of epigenetic modifications, which could be associated with meiotic recombination, are provided for comprehensive analysis. To meet the computational requirement of the rapidly increasing population genomics data, we prepared a lookup table of 400 haplotypes for recombination rate estimation using the well-known LDhat algorithm which includes all possible two-locus haplotype configurations.<h4>Conclusion</h4>To the best of our knowledge, LDSplitDB is the first large-scale database for the association analysis of human recombination hotspots with DNA sequence polymorphisms. It provides valuable resources for the discovery of the mechanism of meiotic recombination hotspots. The information about MHC in this database could help understand the roles of recombination in human immune system. DATABASE URL: http://histone.scse.ntu.edu.sg/LDSplitDB.

Also flagged:Stress-apoptotic Cell Deathdeathneurological diseasesglutathioneoxygen
Journal Article 2018-04-20 ✓ 2 Snippets Lewerenz J, Ates G, Methner A, Conrad M, Maher P.
In-Text Gene Mentions

Although the specific LOX(s) involved likely depend on the cell type, the current data support a model where GSH depletion leads to the activation of LOX, which then interacts with PEBP1 and binds to membranes, especially of intracellular organelles, where the cell death propagating lipid-ROS, oxidized phosphatidylethanolamines containing arachidonic or adrenic acid, are formed.

Ultrastructural analysis of both brain tissue from HD patients, a neurodegenerative disease caused by a CAG repeat expansion in the huntingtin gene (HTT), and mice expressing the first exon of HTT with increased CAG repeats showed shrunken, degenerating neurons, which did not display the nuclear fragmentation typical of apoptosis (Turmaine et al., 2000).

Show Full Abstract

Although nerve cell death is the hallmark of many neurological diseases, the processes underlying this death are still poorly defined. However, there is a general consensus that neuronal cell death predominantly proceeds by regulated processes. Almost 30 years ago, a cell death pathway eventually named oxytosis was described in neuronal cells that involved glutathione depletion, reactive oxygen species production, lipoxygenase activation, and calcium influx. More recently, a cell death pathway that involved many of the same steps was described in tumor cells and termed ferroptosis due to a dependence on iron. Since then there has been a great deal of discussion in the literature about whether these are two distinct pathways or cell type- and insult-dependent variations on the same pathway. In this review, we compare and contrast in detail the commonalities and distinctions between the two pathways concluding that the molecular pathways involved in the regulation of ferroptosis and oxytosis are highly similar if not identical. Thus, we suggest that oxytosis and ferroptosis should be regarded as two names for the same cell death pathway. In addition, we describe the potential physiological relevance of oxytosis/ferroptosis in multiple neurological diseases.

Also flagged:biosynthesisphosphoantigensisopentenyl pyrophosphatebutyrophilin 3A1BTN3A1type I glycoproteins
Journal Article 2018-04-20 ✓ 5 Snippets Boutin L, Scotet E.
In-Text Gene Mentions

While the B30.2 domains of BTN3A1 and BTN3A3 display a strong homology (approximately 87% amino acid identity), the domain of BTN3A3 fails to efficiently bind pAg and to trigger a significant antigenic activation of Vγ9Vδ2 T cells.

Red font highlights the single amino acid difference between pAg-binding pocket, in position 381, H in BTN3A1, and R in BTN3A3 isoforms adapted from Ref.

Close examination of the amino acid differences between these isoforms revealed a single amino acid difference in position 381 within the binding pocket: a histidine in BTN3A1 and an arginine in BTN3A3 (Figure 2).

Amino acid sequence alignment of the B30.2 domains of BTN3A1 (top line) and BTN3A3 (bottom line).

Amino acids sequence alignment of the JTM domains of BTN3A1 (top line) and BTN3A3 (bottom line).

Show Full Abstract

Vγ9Vδ2 T cells represent a major unconventional γδ T cell subset located in the peripheral blood of adults in humans and several non-human primates. Lymphocytes that constitute this transitional subset can sense subtle level changes of intracellular phosphorylated intermediates of the isoprenoid biosynthesis pathway (phosphoantigens, pAg), such as isopentenyl pyrophosphate, during cell stress events. This unique antigenic activation process operates in a rigorous framework that requires the expression of butyrophilin 3A1 (BTN3A1/CD277) molecules, which are type I glycoproteins that belong to the B7 family. Several studies have further shown that pAg specifically bind to the intracellular B30.2 domain of BTN3A1 linked to the antigenic activation of Vγ9Vδ2 T cells. Here, we highlight the recent advances in BTN3A1 dynamics induced upon the binding of pAg and the contribution of the different subunits to this activation process. Recent reports support that conformational modifications of BTN3A1 might represent a key step in the detection of infection or tumorigenesis by Vγ9Vδ2 T cells. A better understanding of this mechanism will help optimize novel immunotherapeutical approaches that target defined functions of this unique γδ T cell subset.

Also flagged:neurogenesisextracellularbone morphogenetic proteinsBMP4epidermal growth factorEGF
Journal Article 2018-04-20 ✓ 1 Snippet Azim K, Akkermann R, Cantone M, Vera J, Jadasz JJ, Küry P.
In-Text Gene Mentions

…Egfl7 , andTnfsf4.…

Show Full Abstract

In the adult central nervous system (CNS), the subventricular zone (SVZ) of the forebrain is the largest and most active source of neural stem cells (NSCs) that generates mainly neurons and few glial cells lifelong. A large body of evidence has shed light on the distinct families of signaling ligands (i.e., morphogens, growth factors, secreted molecules that alter signaling pathways) in regulating NSC biology. However, most of the research has focused on the mRNA expression of individual or few signaling ligands and their pathway components in specific cell types of the CNS in the context of neurogenesis. A single unifying study that underlines the expression of such molecules comprehensively in different cell types in spatial contexts has not yet been reported. By using whole genome transcriptome datasets of individual purified cell specific populations of the adult CNS, the SVZ niche, NSCs, glial cells, choroid plexus, and performing a bioinformatic meta-analysis of signaling ligands, their expression in the forebrain was uncovered. Therein, we report that a large plethora of ligands are abundantly expressed in the SVZ niche, largely from the vasculature than from other sources that may regulate neurogenesis. Intriguingly, this sort of analysis revealed a number of ligands with unknown functions in neurogenesis contexts that warrants further investigations. This study therefore serves as a framework for investigators in the field for understanding the expression patterns of signaling ligands and pathways regulating neurogenesis.

Also flagged:cancerESR1paclitaxelaromataseeverolimusdoxorubicin
Journal Article 2018-04-20 No Snippets Kimura M, Hanamura T, Tsuboi K, Kaneko Y, Yamaguchi Y, Niwa T, Narui K, Endo I, Hayashi SI.
Show Full Abstract

We previously reported the establishment of several types of long-term estrogen-depleted-resistant (EDR) cell lines from MCF-7 breast cancer cells. Type 1 EDR cells exhibited the best-studied mechanism of aromatase inhibitor (AI) resistance, in which estrogen receptor (ER) expression remained positive and PI3K signaling was upregulated. Type 2 EDR cells showed reduced ER activity and upregulated JNK-related signaling. The mTOR inhibitor everolimus reduced growth in cells similar to Type 1 EDR cells. The present study generated everolimus-resistant (EvR) cells from Types 1 and 2 EDR cells following long-term exposure to everolimus <i>in vitro</i>. These EvR cells modeled resistance to AI and everolimus combination therapies following first-line AI treatment failure. In Type 1 EvR cells, everolimus resistance was dependent on MAPK signaling; single agents were not effective, but hormonal therapy combined with a kinase inhibitor effectively reduced cell growth. In Type 2 EvR cells, ER expression remained negative and a JNK inhibitor was ineffective, but a Src inhibitor reduced cell growth. The mechanism of acquired everolimus resistance appears to vary depending on the mechanism of AI resistance. Strategies targeting resistant tumors should be tailored based on the resistance mechanisms, as these mechanisms impact therapeutic efficacy.

Also flagged:MELKcell proliferationtriple-negative breast cancerMaternal embryonic leucine zipper kinasebreast cancerdeath
Journal Article 2018-04-20 No Snippets Li G, Yang M, Zuo L, Wang MX.
Show Full Abstract

Maternal embryonic leucine zipper kinase (MELK) is an important regulator in tumorigenesis of human breast cancer, and if silenced leads to programmed cell death in specific breast cancer cell lines, including MDA-MB-231 cells. In the present study, RNA interference, proliferation assay and semi-quantification of cell cycle relative proteins were performed to determine the effects of MELK in human breast cancer cells. Data demonstrated that the highest level of MELK protein in the MDA-MB-231 cell line among eight breast cancer cell lines. The sensitivity of MELK small interfering-RNA varied in different breast cancer cell lines, but MELK silencing resulted in marked suppression of proliferation of triple-negative breast cancer (TNBC) and non-TNBC cells. Specific silencing of MELK caused G2 arrest in TNBC MDA-MB-231 and HCC1143 cells, and G1 arrest in non-TNBC T47D and MCF7 cells. Notably, the knockdown of MELK did not induce apoptosis in HCC1143 cells, indicated by the lack of caspase-3 expression. In addition, in response to MELK silencing, cyclin B and cyclin D1 were downregulated in four breast cancer cell lines. Furthermore, the silencing of MELK resulted in the upregulation of p21, p27 and phosphorylated (p)-c-Jun N-terminal kinase (JNK) in HCC1143 TNBC cells, and downregulation of p21 and p-JNK in T47D non-TNBC cells. Additionally, MELK protein was markedly suppressed in non-TNBC cells in response to estrogen deprivation. The findings from the present study suggested that MELK may be a potential target in MDA-MB-231 cells, although genetic knockdown of MELK resulted in inhibitory effects on proliferation of TNBC and non-TNBC cells. MELK exert its effect on different breast cancer cells via arrest of different cell cycle phases and therefore mediated by different mediators, which may be involved in the crosstalk with MELK signaling and with the estrogen receptor signaling pathway.

Also flagged:titanretinaviral gene expressionvirionviral latencyviral transformation
Journal Article 2018-04-20 ✓ 1 Snippet De Windt LJ, Giacca M.
In-Text Gene Mentions

…iptional repressors Sox6, Purb, Sp3 and HP-1…

Show Full Abstract

No abstract available.

Also flagged:deathmyelofibrosisPDGFRApathogenesisGli1leptin receptor
Journal Article 2018-04-19 No Snippets Gleitz HF, Kramann R, Schneider RK.
Show Full Abstract

Bone marrow fibrosis is the continuous replacement of blood-forming cells in the bone marrow with excessive scar tissue, leading to failure of the body to produce blood cells and ultimately to death. Myofibroblasts are fibrosis-driving cells and are well characterized in solid organ fibrosis, but their role and cellular origin in bone marrow fibrosis have remained obscure. Recent work has demonstrated that Gli1<sup>+</sup> and leptin receptor<sup>+</sup> mesenchymal stromal cells are progenitors of fibrosis-causing myofibroblasts in the bone marrow. Genetic ablation or pharmacological inhibition of Gli1<sup>+</sup> mesenchymal stromal cells ameliorated fibrosis in mouse models of myelofibrosis. Conditional deletion of the platelet-derived growth factor (PDGF) receptor-α (PDGFRA) gene (Pdgfra) and inhibition of PDGFRA by imatinib in leptin receptor<sup>+</sup> stromal cells suppressed their expansion and ameliorated bone marrow fibrosis. Understanding the cellular and molecular mechanisms in the haematopoietic stem cell niche that govern the mesenchymal stromal cell-to-myofibroblast transition and myofibroblast expansion will be critical to understand the pathogenesis of bone marrow fibrosis in both malignant and non-malignant conditions, and will guide the development of novel therapeutics. In this review, we summarize recent discoveries of mesenchymal stromal cells as part of the haematopoietic niche and as myofibroblast precursors, and discuss potential therapeutic strategies in the specific targeting of fibrotic transformation in bone marrow fibrosis. © 2018 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland.

Also flagged:Thrombinthrombomodulinprotein Chydrogendeuteriumamide
Journal Article 2018-04-19 ✓ 1 Snippet Peacock RB, Davis JR, Markwick PRL, Komives EA.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

Thrombin normally cleaves fibrinogen to promote coagulation; however, binding of thrombomodulin to thrombin switches the specificity of thrombin toward protein C, triggering the anticoagulation pathway. The W215A thrombin mutant was reported to have decreased activity toward fibrinogen without significant loss of activity toward protein C. To understand how mutation of Trp215 may alter thrombin specificity, hydrogen-deuterium exchange experiments (HDXMS), accelerated molecular dynamics (AMD) simulations, and activity assays were carried out to compare the dynamics of Trp215 mutants with those of wild type (WT) thrombin. Variation in NaCl concentration had no detectable effect on the sodium-binding (220s<sub>CT</sub>) loop, but appeared to affect other surface loops. Trp215 mutants showed significant increases in amide exchange in the 170s<sub>CT</sub> loop consistent with a loss of H-bonding in this loop identified by the AMD simulations. The W215A thrombin showed increased amide exchange in the 220s<sub>CT</sub> loop and in the N-terminus of the heavy chain. The AMD simulations showed that a transient conformation of the W215A thrombin has a distorted catalytic triad. HDXMS experiments revealed that mutation of Phe227, which engages in a π-stacking interaction with Trp215, also caused significantly increased amide exchange in the 170s<sub>CT</sub> loop. Activity assays showed that only the F227V mutant had wild type catalytic activity, whereas all other mutants showed markedly lower activity. Taken together, the results explain the reduced pro-coagulant activity of the W215A mutant and demonstrate the allosteric connection between Trp215, the sodium-binding loop, and the active site.

Also flagged:methylationgene expressionto exerciseoxygenacidsynthesis
Journal Article 2018-04-19 No Snippets Fabre O, Ingerslev LR, Garde C, Donkin I, Simar D, Barrès R.
Show Full Abstract

<h4>Aim</h4>To determine the genomic mechanisms by which adipose tissue responds to acute and chronic exercise.<h4>Methods</h4>We profiled the transcriptomic and epigenetic response to acute exercise in human adipose tissue collected before and after endurance training.<h4>Results</h4>Although acute exercises were performed at same relative intensities, the magnitude of transcriptomic changes after acute exercise was reduced by endurance training. DNA methylation remodeling induced by acute exercise was more prominent in trained versus untrained state. We found an overlap between gene expression and DNA methylation changes after acute exercise for 32 genes pre-training and six post-training, notably at adipocyte-specific genes.<h4>Conclusion</h4>Training status differentially affects the epigenetic and transcriptomic response to acute exercise in human adipose tissue.

Also flagged:pancreatic ductal adenocarcinomaPDACGene Expressionribosomal proteinribosomeNUP107
Journal Article 2018-04-19 No Snippets Shen Q, Yu M, Jia JK, Li WX, Tian YW, Xue HZ.
Show Full Abstract

BACKGROUND We aimed to identify pivotal genes and pathways involved in pancreatic ductal adenocarcinoma (PDAC), and explore possible molecular markers for the early diagnosis of the disease. MATERIAL AND METHODS The array data of GSE74629, including 34 PDAC samples and 16 healthy samples, was downloaded from GEO (Gene Expression Omnibus) database. Then, the DEGs (differentially expressed genes) in PDAC samples were compared with healthy samples using limma (linear models for microarray). Gene functional interaction networks were analyzed with Cytoscape and ReactomeFIViz. PPI networks were constructed with Cytoscape software. In addition, PPI (protein-protein interaction) network clustering modules were analyzed with ClusterONE, and the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analyses for modules were performed. RESULTS A total of 630 upregulated and 1,002 downregulated DEGs were identified in PDAC samples compared with healthy samples. Some ribosomal protein genes with higher average correlation in module 0 were enriched in the ribosome pathway. NUP107 (nucleoporin 107 kDa) and NUP160 (nucleoporin 160 kDa) were enriched in module 3. HNRNPU (heterogeneous nuclear ribonucleoprotein U) with higher average correlation in module 8 was enriched in the spliceosome pathway. The ribosome pathway and the spliceosome pathway were significantly enriched in cluster 1 and cluster 2, respectively. CONCLUSIONS Ribosomal protein genes Nup170, Nup160, and HNRNPU, and the ribosome pathway as well as the spliceosome pathway may play important roles in PDAC progression. In addition, ribosomal protein genes Nup170, Nup160, and HNRNPU may be used as possible molecular markers for the early diagnosis of the disease.

Also flagged:polyunsaturated fatty acidsFatty acidssynthesismetabolismbiosynthesisunsaturated fatty acids
Journal Article 2018-04-19 ✓ 1 Snippet Yang S, Wang Y, Wang L, Shi Z, Ou X, Wu D, Zhang X, Hu H, Yuan J, Wang W, Cao F, Liu G.
In-Text Gene Mentions

…, OGN ,CA10, EDA2R ,…

Show Full Abstract

Fatty acids metabolic products determine meat quality in chickens. Identifying genes associated with fatty acids composition could provide valuable information for the complex genetic networks of genes with underlying variations in fatty acids synthesis. RNA sequencing (RNA-Seq) was conducted to explore the chicken transcriptome from the thigh muscle tissue of 6 Huangshan Black Chickens with 3 extremely high and low phenotypic values for percentage of polyunsaturated fatty acids (PUFAs). In total, we obtained 41,139,108-44,901,729 uniquely mapped reads, which covered 74.15% of the current annotated transcripts including 18964 mRNA transcripts, across all the six thigh muscle tissue samples. Of these, we revealed 274 differentially expressed genes (DEGs) with a highly significant correlation with polyunsaturated fatty acids percentage between the comparison groups based on the ratio of PUFA/SFA. Gene ontology and pathway analysis indicated that the DEGs were enriched in particular biological processes affecting fatty acids metabolism, biosynthesis of unsaturated fatty acids (USFAs), and cell junction-related pathways. Integrated interpretation of differential gene expression and formerly reported quantitative trait loci (QTL) demonstrated that FADS2, DCN, FRZB, OGN, PRKAG3, LHFP, CHCHD10, CYTL1, FBLN5, and ADGRD1 are the most promising candidate genes affecting polyunsaturated fatty acids percentage.

Also flagged:APPL2Glucocorticoid ReceptorNeurogenesisCorticosteroneDepressionOlfactory dysfunction
Journal Article 2018-04-19 No Snippets Gao C, Du Q, Li W, Deng R, Wang Q, Xu A, Shen J.
Show Full Abstract

Olfactory dysfunction is often accompanied with anxiety- and depressive-like behaviors in depressive patients. Impaired neurogenesis in hippocampus and subventricular zone (SVZ)-olfactory bulb (OB) contribute to anxiety- and depressive-like behaviors and olfactory dysfunctions. However, the underlying mechanisms of olfactory dysfunction remain unclear. Our previous study indicates that adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2 (APPL2), could affect the activity and sensitivity of glucocorticoid receptor (GR) and mediate impaired hippocampal neurogenesis, which contribute the development of depression. In the present study, we further identified the roles of APPL2 in olfactory functions. APPL2 Tg mice displayed higher GR activity and less capacity of neurogenesis at olfactory system with less olfactory sensitivity than WT mice, indicating that APPL2 could be a potential therapeutic target for depression and olfactory deficits. We then studied the effects of baicalin, a medicinal herbal compound, on modulating APPL2/GR signaling pathway for promoting neurogenesis and antidepressant as well as improving olfactory functions. Baicalin treatment inhibited APPL2/GR signaling pathway and improved neurogenesis at SVZ, OB, and hippocampus in APPL2 Tg mice and chronic corticosterone-induced depression mouse model. Behavioral tests revealed that baicalin attenuated depressive- and anxiety-like behaviors and improve olfactory functions in the chronic depression mouse model and APPL2 Tg mice. Taken together, APPL2 could be a novel therapeutic target for improving depressant-related olfactory dysfunctions and baicalin could inhibit APPL2-mediated GR hyperactivity and promote adult neurogenesis, subsequently releasing depressive and anxiety symptoms and improving olfactory functions for antidepressant therapy.

Also flagged:red blood cell alloimmunizationalloimmunizationalloantibodyantibodyalloantibodiessickle cell disease
Journal Article 2018-04-19 No Snippets Karafin MS, Westlake M, Hauser RG, Tormey CA, Norris PJ, Roubinian NH, Wu Y, Triulzi DJ, Kleinman S, Hendrickson JE, NHLBI Recipient Epidemiology and Donor Evaluation Study-III (REDS-III).
Show Full Abstract

Despite the significance of red blood cell (RBC) alloimmunization, the lack of standardized registries in the US has prevented the completion of large studies. Data from 3·5 years of the Recipient Epidemiology and Donor Evaluation Study-III (REDS-III) recipient database, containing information from 12 hospitals, were studied. A RBC alloantibody responder had an antibody identified at any point during the study, and a non-responder had a negative antibody screen at least 15 days post-RBC transfusion. Demographics, blood type, ICD9/10 codes, and other potential correlates were evaluated. Of 319 177 (2·07%) screened patients, 6597 had a total of 8892 clinically significant RBC alloantibodies identified, with 75% being in the Rh or Kell families. Alloimmunization was more common in females (2·38%) than males (1·68%), and in RhD negative (2·82%) than RhD positive (1·94%) patients. Age, sex, RhD status and race were associated with being a responder, and certain diagnoses (including sickle cell disease or trait, systemic lupus erythematosus, rheumatoid arthritis and myelodysplastic syndrome) were more common among responders than non-responders. Data collected in this multi-centre recipient database provide the largest RBC alloimmunized patient cohort studied in the US, with previously known demographic and disease associations of responder status confirmed, and new associations identified.

Also flagged:gene expressionpolycomb repressive complex 2PRC2histonelysineEZH1
Journal Article 2018-04-19 ✓ 1 Snippet Lee CH, Holder M, Grau D, Saldaña-Meyer R, Yu JR, Ganai RA, Zhang J, Wang M, LeRoy G, Dobenecker MW, Reinberg D, Armache KJ.
In-Text Gene Mentions

deacetylase complex

Show Full Abstract

The maintenance of gene expression patterns during metazoan development is achieved, in part, by the actions of polycomb repressive complex 2 (PRC2). PRC2 catalyzes mono-, di-, and trimethylation of histone H3 at lysine 27 (H3K27), with H3K27me2/3 being strongly associated with silenced genes. We demonstrate that EZH1 and EZH2, the two mutually exclusive catalytic subunits of PRC2, are differentially activated by various mechanisms. Whereas both PRC2-EZH1 and PRC2-EZH2 are able to catalyze mono- and dimethylation, only PRC2-EZH2 is strongly activated by allosteric modulators and specific chromatin substrates to catalyze trimethylation of H3K27 in mouse embryonic stem cells (mESCs). However, we also show that a PRC2-associated protein, AEBP2, can stimulate the activity of both complexes through a mechanism independent of and additive to allosteric activation. These results have strong implications regarding the cellular requirements for and the accompanying adjustments in PRC2 activity, given the differential expression of EZH1 and EZH2 upon cellular differentiation.

Also flagged:obesityghrelinleptinaxonalglutamate receptorsendoplasmic reticulum
Journal Article 2018-04-19 ✓ 1 Snippet Rajamani U, Gross AR, Hjelm BE, Sequeira A, Vawter MP, Tang J, Gangalapudi V, Wang Y, Andres AM, Gottlieb RA, Sareen D.
In-Text Gene Mentions

NEGR1

Show Full Abstract

The hypothalamus contains neurons that integrate hunger and satiety endocrine signals from the periphery and are implicated in the pathophysiology of obesity. The limited availability of human hypothalamic neurons hampers our understanding of obesity disease mechanisms. To address this, we generated human induced pluripotent stem cells (hiPSCs) from multiple normal body mass index (BMI; BMI ≤ 25) subjects and super-obese (OBS) donors (BMI ≥ 50) with polygenic coding variants in obesity-associated genes. We developed a method to reliably differentiate hiPSCs into hypothalamic-like neurons (iHTNs) capable of secreting orexigenic and anorexigenic neuropeptides. Transcriptomic profiling revealed that, although iHTNs maintain a fetal identity, they respond appropriately to metabolic hormones ghrelin and leptin. Notably, OBS iHTNs retained disease signatures and phenotypes of high BMI, exhibiting dysregulated respiratory function, ghrelin-leptin signaling, axonal guidance, glutamate receptors, and endoplasmic reticulum (ER) stress pathways. Thus, human iHTNs provide a powerful platform to study obesity and gene-environment interactions.

Also flagged:tumorcancertumorsmetabolism-NKG2D
Journal Article 2018-04-19 No Snippets Hoeres T, Smetak M, Pretscher D, Wilhelm M.
Show Full Abstract

Increasing immunological knowledge and advances in techniques lay the ground for more efficient and broader application of immunotherapies. gamma delta (γδ) T-cells possess multiple favorable anti-tumor characteristics, making them promising candidates to be used in cellular and combination therapies of cancer. They recognize malignant cells, infiltrate tumors, and depict strong cytotoxic and pro-inflammatory activity. Here, we focus on human Vγ9Vδ2 T-cells, the most abundant γδ T-cell subpopulation in the blood, which are able to inhibit cancer progression in various models <i>in vitro</i> and <i>in vivo</i>. For therapeutic use they can be cultured and manipulated <i>ex vivo</i> and in the following adoptively transferred to patients, as well as directly stimulated to propagate <i>in vivo</i>. In clinical studies, Vγ9Vδ2 T-cells repeatedly demonstrated a low toxicity profile but hitherto only the modest therapeutic efficacy. This review provides a comprehensive summary of established and newer strategies for the enhancement of Vγ9Vδ2 T-cell anti-tumor functions. We discuss data of studies exploring methods for the sensitization of malignant cells, the improvement of recognition mechanisms and cytotoxic activity of Vγ9Vδ2 T-cells. Main aspects are the tumor cell metabolism, antibody-dependent cell-mediated cytotoxicity, antibody constructs, as well as activating and inhibitory receptors like NKG2D and immune checkpoint molecules. Several concepts show promising results <i>in vitro</i>, now awaiting translation to <i>in vivo</i> models and clinical studies. Given the array of research and encouraging findings in this area, this review aims at optimizing future investigations, specifically targeting the unanswered questions.

Also flagged:synthesisamino acidD-cysteineaminopeptideamino-
Journal Article 2018-04-19 No Snippets Kovács AK, Hegyes P, Szebeni GJ, Nagy LI, Puskás LG, Tóth GK.
Show Full Abstract

A general strategy for the synthesis of <i>N</i>-peptide-6-amino-D-luciferin conjugates has been developed. The applicability of the strategy was demonstrated with the preparation of a known substrate, <i>N</i>-Z-Asp-Glu-Val-Asp-6-amino-D-luciferin (<i>N</i>-Z-DEVD-aLuc). <i>N</i>-Z-DEVD-aLuc was obtained via a hybrid liquid/solid phase synthesis method, in which the appropriately protected C-terminal amino acid was coupled to 6-amino-2-cyanobenzothiazole and the resulting conjugate was reacted with D-cysteine in order to get the protected amino acid-6-amino-D-luciferin conjugate, which was then attached to resin. The resulting loaded resin was used for the solid-phase synthesis of the desired <i>N</i>-peptide-6-amino-D-luciferin conjugate without difficulties, which was then attested with NMR spectroscopy and LC-MS, and successfully tested in a bioluminescent system.

Also flagged:synthesiscell growthtetraethyl orthosilicateiron oxidegene expressiongraphene
Journal Article 2018-04-19 No Snippets Jackson RJ, Patrick PS, Page K, Powell MJ, Lythgoe MF, Miodownik MA, Parkin IP, Carmalt CJ, Kalber TL, Bear JC.
Show Full Abstract

We present the synthesis of nylon-12 scaffolds by 3D printing and demonstrate their versatility as matrices for cell growth, differentiation, and biomineral formation. We demonstrate that the porous nature of the printed parts makes them ideal for the direct incorporation of preformed nanomaterials or material precursors, leading to nanocomposites with very different properties and environments for cell growth. Additives such as those derived from sources such as tetraethyl orthosilicate applied at a low temperature promote successful cell growth, due partly to the high surface area of the porous matrix. The incorporation of presynthesized iron oxide nanoparticles led to a material that showed rapid heating in response to an applied ac magnetic field, an excellent property for use in gene expression and, with further improvement, chemical-free sterilization. These methods also avoid changing polymer feedstocks and contaminating or even damaging commonly used selective laser sintering printers. The chemically treated 3D printed matrices presented herein have great potential for use in addressing current issues surrounding bone grafting, implants, and skeletal repair, and a wide variety of possible incorporated material combinations could impact many other areas.

Also flagged:gastric cancerphospholipidvesiclescell-cell communicationGastric cancer tumorcancer
Journal Article 2018-04-19 No Snippets Chen KB, Chen J, Jin XL, Huang Y, Su QM, Chen L.
Show Full Abstract

The prognosis of patients with peritoneal dissemination from gastric cancer is poor, and the underlying molecular mechanism remains unclear. Exosomes, as macromolecular phospholipid bilayer vesicles comprising of proteins, nucleic acids and lipids, serve as mediators of cell-cell communication. Gastric cancer tumor-derived exosomes may be involved in the pathological process of peritoneal dissemination by mediating crosstalk between cancer cells and mesothelial cells, to result in the induction of enhanced tumor growth, migratory, adhesive and invasive abilities, peritoneal fibrosis and apoptosis, mesothelial-to-mesenchymal transition, angiogenesis and chemoresistance. The present review focuses on previous studies addressing the exosome-dependent molecular transfer in peritoneal dissemination in gastric cancer and the potential clinical applications.

Also flagged:myocardial infarctionMIGene ExpressionCX 3 CR 1HSPA 6TPM 3
Journal Article 2018-04-19 No Snippets Wu K, Zhao Q, Li Z, Li N, Xiao Q, Li X, Zhao Q.
Show Full Abstract

Despite significant advances in understanding of the causes of and treatment of myocardial infarction (MI) in recent years, morbidity and mortality is still high. The aim of this study was to identify miRNA and genes potentially associated with MI. mRNA and miRNA expression datasets were downloaded from the Gene Expression Omnibus database (http://www.ncbi.nlm.nih.gov/geo/). Interactions between miRNA and the expression and function of target genes were analyzed, and a protein-protein interaction network was constructed. The diagnostic value of identified miRNA and genes was assessed. Quantitative RT-PCR was applied to validate the results of the bioinformatics analysis. MiR-27a, miR-31*, miR-1291, miR-139-5p, miR-204, miR-375, and target genes including <i>CX3CR1</i>,<i>HSPA6,</i> and <i>TPM3</i> had potential diagnostic value. The genes <i>TFEB</i>,<i>IRS2</i>,<i>GRB2</i>,<i>FASLG</i>,<i>LIMS1</i>,<i>CX3CR1</i>,<i>HSPA6</i>,<i>TPM3</i>,<i>LAT2</i>,<i>CEBPD</i>,<i>AQP9,</i> and <i>MAPKAPK2</i> were associated with recovery from MI. In conclusion, the identified miRNA and genes might be associated with the pathology of MI.

Also flagged:gold nanoparticleslipoic acidfolic acidcancergold nanoparticledoxorubicin
Journal Article 2018-04-19 No Snippets Dzwonek M, Załubiniak D, Piątek P, Cichowicz G, Męczynska-Wielgosz S, Stępkowski T, Kruszewski M, Więckowska A, Bilewicz R.
Show Full Abstract

Modification of ultrasmall gold nanoparticles (AuNPs) with the lipoic acid derivative of folic acid was found to enhance their accumulation in the cancer cell, as compared to AuNPs without addressing units. The application of lipoic acid enabled the control of the gold nanoparticle functionalities leading to enhanced solubility and allowing for attachment of both the folic acid and the cytotoxic drug, doxorubicin. More robust attachment of doxorubicin to the nanoparticle through the amide bond resulted in toxicity comparable with that of the drug alone, opening a new perspective for designing more potent, but less toxic nanopharmaceuticals. The increased uptake was accompanied by pronounced nuclear accumulation and observable cytotoxicity. Doxorubicin binding <i>via</i> covalent amide bonds enhanced stability of the whole drug vehicle and provided much better control over doxorubicin release in the cell environment, as compared to physical adsorption or pH sensitive bonding commonly used for anthracycline carriers. Confocal microscopy revealed that the bond was stable in the cytoplasm for 22 h. The ability to slow down the rate of drug release may be crucial for the application in sustained anticancer drug delivery. Biological analyses performed using MTT assay and confocal microscopy confirmed that the ultrasmall AuNPs with the lipoic acid derivative of folic acid exhibit relatively low cytotoxicity, however when loaded with a chemotherapeutic, they cause a significant reduction in the cell viability.

Also flagged:serotoninsynthesisobsessive-compulsive disorderbehavioralpositronsertraline
Journal Article 2018-04-18 ✓ 5 Snippets Lissemore JI, Sookman D, Gravel P, Berney A, Barsoum A, Diksic M, Nordahl TE, Pinard G, Sibon I, Cottraux J, Leyton M, Benkelfat C.
In-Text Gene Mentions

Furthermore, as reductions in brain 5-HTT expression are associated with increased serotonergic neurotransmission46,47, findings of reduced 5-HTT availability in OCD patients at baseline, and further reductions in 5-HTT availability with clomipramine or escitalopram treatment17,48, are also consistent with a serotonergic braking system.

To our knowledge, only one study has investigated within-subject brain regional changes in the serotonergic system in OCD patients before and after treatment: Zitterl et al. reported a significant reduction in 5-HTT availability in the thalamus/hypothalamus of OCD patients, using SPECT and [123I]β-CIT, following 12 weeks of clomipramine treatment17.

…measuring 5-HT transporter (5-HTT) and receptor binding,…

…baseline abnormalities in5-HTTand 5-HT 2A…

…and blood platelet5-HTTlevels pre–post treatment…

Show Full Abstract

Cognitive behavioral therapy (CBT) and selective serotonin reuptake inhibitors (SSRIs) are both effective treatments for some patients with obsessive-compulsive disorder (OCD), yet little is known about the neurochemical changes related to these treatment modalities. Here, we used positron emission tomography and the α-[<sup>11</sup>C]methyl-L-tryptophan tracer to examine the changes in brain regional serotonin synthesis capacity in OCD patients following treatment with CBT or SSRI treatment. Sixteen medication-free OCD patients were randomly assigned to 12 weeks of either CBT or sertraline treatment. Pre-to-post treatment changes in the α-[<sup>11</sup>C]methyl-L-tryptophan brain trapping constant, K* (ml/g/min), were assessed as a function of symptom response, and correlations with symptom improvement were examined. Responders/partial responders to treatment did not show significant changes in relative regional tracer uptake; rather, in responders/partial responders, 12 weeks of treatment led to serotonin synthesis capacity increases that were brain-wide. Irrespective of treatment modality, baseline serotonin synthesis capacity in the raphe nuclei correlated positively with clinical improvement. These observations suggest that, for some patients, successful remediation of OCD symptoms might be associated with greater serotonergic tone.

Also flagged:BehaviorkeyyouCB2howsegmentation
Journal Article 2018-04-18 No Snippets Dewell RB, Gabbiani F.
Show Full Abstract

Collision avoidance is critical for survival, including in humans, and many species possess visual neurons exquisitely sensitive to objects approaching on a collision course. Here, we demonstrate that a collision-detecting neuron can detect the spatial coherence of a simulated impending object, thereby carrying out a computation akin to object segmentation critical for proper escape behavior. At the cellular level, object segmentation relies on a precise selection of the spatiotemporal pattern of synaptic inputs by dendritic membrane potential-activated channels. One channel type linked to dendritic computations in many neural systems, the hyperpolarization-activated cation channel, HCN, plays a central role in this computation. Pharmacological block of HCN channels abolishes the neuron's spatial selectivity and impairs the generation of visually guided escape behaviors, making it directly relevant to survival. Additionally, our results suggest that the interaction of HCN and inactivating K<sup>+</sup> channels within active dendrites produces neuronal and behavioral object specificity by discriminating between complex spatiotemporal synaptic activation patterns.

Also flagged:Dectin-2spleen tyrosine kinaseSykextracellular signal-regulated kinaseCOX-1COX-2
Journal Article 2018-04-18 No Snippets Kaisar MMM, Ritter M, Del Fresno C, Jónasdóttir HS, van der Ham AJ, Pelgrom LR, Schramm G, Layland LE, Sancho D, Prazeres da Costa C, Giera M, Yazdanbakhsh M, Everts B.
Show Full Abstract

The molecular mechanisms through which dendritic cells (DCs) prime T helper 2 (Th2) responses, including those elicited by parasitic helminths, remain incompletely understood. Here, we report that soluble egg antigen (SEA) from Schistosoma mansoni, which is well known to drive potent Th2 responses, triggers DCs to produce prostaglandin E2 (PGE2), which subsequently-in an autocrine manner-induces OX40 ligand (OX40L) expression to license these DCs to drive Th2 responses. Mechanistically, SEA was found to promote PGE2 synthesis through Dectin-1 and Dectin-2, and via a downstream signaling cascade involving spleen tyrosine kinase (Syk), extracellular signal-regulated kinase (ERK), cytosolic phospholipase A2 (cPLA2), and cyclooxygenase 1 and 2 (COX-1 and COX-2). In addition, this pathway was activated independently of the actions of omega-1 (ω-1), a previously described Th2-priming glycoprotein present in SEA. These findings were supported by in vivo murine data showing that ω-1-independent Th2 priming by SEA was mediated by Dectin-2 and Syk signaling in DCs. Finally, we found that Dectin-2-/-, and to a lesser extent Dectin-1-/- mice, displayed impaired Th2 responses and reduced egg-driven granuloma formation following S. mansoni infection, highlighting the physiological importance of this pathway in Th2 polarization during a helminth infection. In summary, we identified a novel pathway in DCs involving Dectin-1/2-Syk-PGE2-OX40L through which Th2 immune responses are induced.

Also flagged:soft-tissue infectionsenteritistoxic-shock syndromesporulationsodiumhydroxide
Journal Article 2018-04-18 ✓ 1 Snippet Rabi R, Larcombe S, Mathias R, McGowan S, Awad M, Lyras D.
In-Text Gene Mentions

…wild type maleC57BL/six micemice (Walter and…

Show Full Abstract

Bacterial spores play an important role in disease initiation, transmission and persistence. In some species, the exosporium forms the outermost structure of the spore and provides the first point of contact between the spore and the environment. The exosporium may also be involved in spore adherence, protection and germination. Clostridium sordellii is a highly lethal, spore forming pathogen that causes soft-tissue infections, enteritis and toxic-shock syndrome. Despite the importance of C. sordellii spores in disease, spore proteins from this bacterium have not been defined or interrogated functionally. In this study, we identified the C. sordellii outer spore proteome and two of the identified proteins, CsA and CsB, were characterised using a genetic and phenotypic approach. Both proteins were essential for the correct formation and positioning of the C. sordellii spore coat and exosporium. The absence of CsA reduced sporulation levels and increased spore sensitivity to heat, sodium hydroxide and hydrochloric acid. By comparison, CsB was required for normal levels of spore adherence to cervical, but not vaginal, cells, with csB mutant spores having increased adherence properties. The establishment of a mouse infection model of the gastrointestinal tract for C. sordellii allowed the role of CsA and CsB to be interrogated in an infected host. Following the oral administration of spores to mice, the wild-type strain efficiently colonized the gastrointestinal tract, with the peak of bacterial numbers occurring at one day post-infection. Colonization was reduced by two logs at four days post-infection. By comparison, mice infected with the csB mutant did not show a reduction in bacterial numbers. We conclude that C. sordellii outer spore proteins are important for the structural and functional integrity of spores. Furthermore, outer spore proteins are required for wild-type levels of colonization during infection, possibly as a result of the role that the proteins play in spore structure and morphology.

Also flagged:Cx3cr1infectionopsinphotoreceptor ciliumciliumRpgr
Journal Article 2018-04-18 No Snippets Jobling AI, Waugh M, Vessey KA, Phipps JA, Trogrlic L, Greferath U, Mills SA, Tan ZL, Ward MM, Fletcher EL.
Show Full Abstract

Microglia are the resident immune cells of the CNS, and their response to infection, injury and disease is well documented. More recently, microglia have been shown to play a role in normal CNS development, with the fractalkine-Cx3cr1 signaling pathway of particular importance. This work describes the interaction between the light-sensitive photoreceptors and microglia during eye opening, a time of postnatal photoreceptor maturation. Genetic removal of Cx3cr1 (<i>Cx3cr1<sup>GFP/GFP</sup></i> ) led to an early retinal dysfunction soon after eye opening [postnatal day 17 (P17)] and cone photoreceptor loss (P30 onward) in mice of either sex. This dysfunction occurred at a time when fractalkine expression was predominantly outer retinal, when there was an increased microglial presence near the photoreceptor layer and increased microglial-cone photoreceptor contacts. Photoreceptor maturation and outer segment elongation was coincident with increased opsin photopigment expression in wild-type retina, while this was aberrant in the <i>Cx3cr1<sup>GFP/GFP</sup></i> retina and outer segment length was reduced. A beadchip array highlighted Cx3cr1 regulation of genes involved in the photoreceptor cilium, a key structure that is important for outer segment elongation. This was confirmed with quantitative PCR with specific cilium-related genes, <i>Rpgr</i> and <i>Rpgrip1</i>, downregulated at eye opening (P14). While the overall cilium structure was unaffected, expression of Rpgr, Rpgrip1, and centrin were restricted to more proximal regions of the transitional zone. This study highlighted a novel role for microglia in postnatal neuronal development within the retina, with loss of fractalkine-Cx3cr1 signaling leading to an altered distribution of cilium proteins, failure of outer segment elongation and ultimately cone photoreceptor loss.<b>SIGNIFICANCE STATEMENT</b> Microglia are involved in CNS development and disease. This work highlights the role of microglia in postnatal development of the light-detecting photoreceptor neurons within the mouse retina. Loss of the microglial Cx3cr1 signaling pathway resulted in specific alterations in the cilium, a key structure in photoreceptor outer segment elongation. The distribution of key components of the cilium transitional zone, Rpgr, Rpgrip1, and centrin, were altered in retinae lacking Cx3cr1 with reduced outer segment length and cone photoreceptor death observed at later postnatal ages. This work identifies a novel role for microglia in the postnatal maturation of retinal photoreceptors.

Also flagged:retrotransposonscancertransposonsretrotransposontransmissible neoplasiaSteamer -like retrotransposons
Journal Article 2018-04-18 No Snippets Metzger MJ, Paynter AN, Siddall ME, Goff SP.
Show Full Abstract

The LTR retrotransposon <i>Steamer</i> is a selfish endogenous element in the soft-shell clam genome that was first detected because of its dramatic amplification in bivalve transmissible neoplasia afflicting the species. We amplified and sequenced related retrotransposons from the genomic DNA of many other bivalve species, finding evidence of horizontal transfer of retrotransposons from the genome of one species to another. First, the phylogenetic tree of the <i>Steamer</i>-like elements from 19 bivalve species is markedly discordant with host phylogeny, suggesting frequent cross-species transfer throughout bivalve evolution. Second, sequences nearly identical to <i>Steamer</i> were identified in the genomes of Atlantic razor clams and Baltic clams, indicating recent transfer. Finally, a search of the National Center for Biotechnology Information sequence database revealed that <i>Steamer</i>-like elements are present in the genomes of completely unrelated organisms, including zebrafish, sea urchin, acorn worms, and coral. Phylogenetic incongruity, a patchy distribution, and a higher similarity than would be expected by vertical inheritance all provide evidence for multiple long-distance cross-phyla horizontal transfer events. These data suggest that over both short- and long-term evolutionary timescales, <i>Steamer</i>-like retrotransposons, much like retroviruses, can move between organisms and integrate new copies into new host genomes.

Also flagged:Fucoidanfucosefactor Xpolysaccharidecell-wallHeparin Red
Journal Article 2018-04-18 ✓ 5 Snippets Pozharitskaya ON, Shikov AN, Faustova NM, Obluchinskaya ED, Kosman VM, Vuorela H, Makarov VG.
In-Text Gene Mentions

…+ antitrombine III (ATIII) → ATIII–fucoidan (2)…

…III (ATIII) →ATIII–fucoidan (2) ATIII–fucoidan +…

…→ ATIII–fucoidan (2)ATIII–fucoidan + Xa →…

…+ Xa →ATIII–fucoidan–Xa + Xa free…

…μL of anATIIIsolution (activity of…

Show Full Abstract

<i>Fucus vesiculosus</i> L., known as bladderwrack, belongs to the brown seaweeds, which are widely distributed throughout northern Russia, Atlantic shores of Europe, the Baltic Sea, Greenland, the Azores, the Canary Islands, and shores of the Pacific Ocean. Fucoidan is a major fucose-rich sulfated polysaccharide found in <i>Fucus</i> (<i>F.</i>) <i>vesiculosus</i>. The pharmacokinetic profiling of active compounds is essential for drug development and approval. The aim of the study was to evaluate the pharmacokinetics and tissue distribution of fucoidan in rats after a single-dose oral administration. Fucoidan was isolated from <i>F. vesiculosus</i>. The method of measuring anti-activated factor X (anti-Xa) activity by amidolytic assay was used to analyze the plasma and tissue concentrations of fucoidan. The tissue distribution of fucoidan after intragastric administration to the rats was characterized, and it exhibited considerable heterogeneity. Fucoidan preferentially accumulates in the kidneys (AUC<sub>0&ndash;t</sub> = 10.74 &micro;g&middot;h/g; C<sub>max</sub> = 1.23 &micro;g/g after 5 h), spleen (AUC<sub>0&ndash;t</sub> = 6.89 &micro;g&middot;h/g; C<sub>max</sub> = 0.78 &micro;g/g after 3 h), and liver (AUC<sub>0&ndash;t</sub> = 3.26 &micro;g&middot;h/g; C<sub>max</sub> = 0.53 &micro;g/g after 2 h) and shows a relatively long absorption time and extended circulation in the blood, with a mean residence time (MRT) = 6.79 h. The outcome of this study provides additional scientific data for traditional use of fucoidan-containing plants and offers tangible support for the continued development of new effective pharmaceuticals using fucoidan.

Also flagged:resveratrolfolate receptorFRcancers-binding
Journal Article 2018-04-18 No Snippets Singh SK, Lillard JW, Singh R.
Show Full Abstract

The folate receptor (FR) is a valued target that is highly expressed in various cancers, which will expedite the development of ligand-receptor binding based cancer therapeutics. In the present investigation, through tissue microarray analysis, we report higher levels of folate receptor expression in prostate cancer (PCa) tissue derived from patients, which were minimal in normal tissue. For folate-receptor based targeted therapy of PCa, we generated novel planetary ball milled (PBM) nanoparticles (NPs) encapsulated with resveratrol (RES), and in combination with docetaxel (DTX) and conjugated with folic acid (FA) on the surface. The cytotoxic effect of FA-conjugated DTX-nanoparticles was found effectual that reduced the concentration of free drug (DTX) to 28 times. Flow cytometry analysis showed a significant increase in the number of apoptotic cells by 30.92% and 65.9% in the FA-conjugated RES and in combination with DTX nanoparticle formulation respectively. However, only 8.9% apoptotic cells were found with control (empty NP). The expressions of NF-kB p65, COX-2, pro (BAX, BAK) and anti-apoptotic (BCL-2, BCL-XL) genes were significantly reduced after treatment with FA-RES + DTX-NP. In addition, the FA-conjugated DTX formulation exhibited additional cytotoxic effects with the down-regulation of survivin and an increased expression of Cleaved Caspase-3 in PCa cells. Further, we observed that treating DTX resistant PCa cells with FA-RES + DTX-NP exhibited a reversal of the ABC-transporter markers thereby limiting the multidrug resistance phenotype of the cancer cells. Our results strongly suggested that FA conjugated nanoparticle drugs acted as effective inhibitors of drug efflux that effectually enhances the intracellular concentration of the drug to exhibit their cytotoxic effect.

Also flagged:Metal ionsironResponse toenterobactinlipocalin-2lumen
Journal Article 2018-04-18 No Snippets Chieppa M, Giannelli G.
Show Full Abstract

Metal ions are essential for life on Earth, mostly as crucial components of all living organisms; indeed, they are necessary for bioenergetics functions as crucial redox catalysts. Due to the essential role of iron in biological processes, body iron content is finely regulated and is the battlefield of a tug-of-war between the host and the microbiota.

Also flagged:collagenbromideacetic acidPeriodontal diseasechronic bacterial infectionmembranes
Journal Article 2018-04-18 No Snippets Prahasanti C, Wulandari DT, Ulfa N.
Show Full Abstract

<h4>Aim</h4>This study aims to examine the toxicity of collagen extracted from gouramy fish scales (<i>Oshpronemus gouramy</i>) by evaluating its viability against baby hamster kidney fibroblasts-21.<h4>Materials and methods</h4>Collagen was extracted from gouramy fish scales (<i>O. gouramy</i>) with 6% acetic acid. Its results were analyzed using Fourier-transform infrared spectroscopy and freeze-dried technique. Its morphology then was analyzed with scanning electron microscope. Afterward, 3-(4.5-dimethylthiazole-2-yl)2.5-diphenyl tetrazolium bromide assay was conducted to compare cells with and without fish scale collagen treatment.<h4>Results</h4>Collagen extracted from gouramy fish scales had no influence statistically on cultured fibroblast cells with a statistical significance (2-tailed) value of0.754 (p>00025).<h4>Conclusion</h4>Collagen extracted from gouramy fish scales has high viability against BHK21 fibroblast cells.

Also flagged:MAPKmelanomatumorTyrosinaseMelan-ACSPG4
Journal Article 2018-04-18 ✓ 1 Snippet Pieper N, Zaremba A, Leonardelli S, Harbers FN, Schwamborn M, Lübcke S, Schrörs B, Baingo J, Schramm A, Haferkamp S, Seifert U, Sucker A, Lennerz V, Wölfel T, Schadendorf D, Schilling B, Paschen A, Zhao F.
In-Text Gene Mentions

MMS22L

Show Full Abstract

The profound but frequently transient clinical responses to BRAF<sup>V600</sup> inhibitor (BRAFi) treatment in melanoma emphasize the need for combinatorial therapies. Multiple clinical trials combining BRAFi and immunotherapy are under way to further enhance therapeutic responses. However, to which extent BRAF<sup>V600</sup> inhibition may affect melanoma immunogenicity over time remains largely unknown. To support the development of an optimal treatment protocol, we studied the impact of prolonged BRAFi exposure on the recognition of melanoma cells by T cells in different patient models. We demonstrate that autologous CD8<sup>+</sup> tumor-infiltrating lymphocytes (TILs) efficiently recognized short-term (3, 7 days) BRAFi-treated melanoma cells but were less responsive towards long-term (14, 21 days) exposed tumor cells. Those long-term BRAFi-treated melanoma cells showed a non-proliferative dedifferentiated phenotype and were less sensitive to four out of five CD8<sup>+</sup> T cell clones, present in the preexisting TIL repertoire, of which three recognized shared antigens (Tyrosinase, Melan-A and CSPG4) and one being neoantigen-specific. Only a second neoantigen was steadily recognized independent of treatment duration. Notably, in all cases the impaired T cell activation was due to a time-dependent downregulation of their respective target antigens. Moreover, combinatorial treatment of melanoma cells with BRAFi and an inhibitor of its downstream kinase MEK had similar effects on T cell recognition. In summary, MAP kinase inhibitors (MAPKi) strongly alter the tumor antigen expression profile over time, favoring evolution of melanoma variants cross-resistant to both T cells and MAPKi. Our data suggest that simultaneous treatment with MAPKi and immunotherapy could be most effective for tumor elimination.

Also flagged:sickle cell diseaseoxygenhemoglobin Socclusiveglobinurinary tract infections
Journal Article 2018-04-17 No Snippets Ribeil JA, Labopin M, Stanislas A, Deloison B, Lemercier D, Habibi A, Albinni S, Charlier C, Lortholary O, Lefrere F, De Montalembert M, Blanche S, Galactéros F, Tréluyer JM, Gluckman E, Ville Y, Joseph L, Delville M, Benachi A, Cavazzana M.
Show Full Abstract

Sickle cell disease (SCD) in pregnancy can be associated with adverse maternal and perinatal outcomes. Furthermore, complications of SCD can be aggravated by pregnancy. Optimal prenatal care aims to decrease the occurrence of maternal and fetal complications. A retrospective, French, two-center study compared two care strategies for pregnant women with SCD over two time periods. In the first study period (2005-2010), the women were systematically offered prophylactic transfusions. In the second study period (2011-2014), a targeted transfusion strategy was applied whenever possible, and home-based prophylactic nocturnal oxygen therapy was offered to all the pregnant women. The two periods did not differ significantly in terms of the incidence of vaso-occlusive events. Maternal mortality, perinatal mortality, and obstetric complication rates were also similar in the two periods, as was the incidence of post-transfusion complications (6.1% in 2005-2010 and 1.3% in 2011-2014, P = .15), although no de novo alloimmunizations or delayed hemolysis transfusion reactions were observed in the second period. The results of this preliminary, retrospective study indicate that targeted transfusion plus home-based prophylactic nocturnal oxygen therapy is safe and may decrease transfusion requirements and transfusion-associated complications.

Also flagged:neurodevelopmental impairmentcerebral palsyCPlate-onset sepsisintraventricular hemorrhagebilateral blindness
Journal Article 2018-04-17 No Snippets Adams-Chapman I, Heyne RJ, DeMauro SB, Duncan AF, Hintz SR, Pappas A, Vohr BR, McDonald SA, Das A, Newman JE, Higgins RD, Follow-Up Study of the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objectives</h4>Evaluate the spectrum of neurodevelopmental outcome in a contemporary cohort of extremely preterm infants. We hypothesize that the rate of severe neurodevelopmental impairment (NDI) decreases over time.<h4>Methods</h4>Retrospective analysis of neurodevelopmental outcome of preterm infants ≤27 weeks' gestational age (GA) from a Neonatal Research Network center that completed neurodevelopmental follow-up assessments between April 1, 2011, and January 1, 2015. The Bayley Scales of Infant Development-III (BSID III) and a standardized neurosensory examination were performed between 18 and 26 months' adjusted age. Outcome measures were neurologic examination diagnoses, BSID III cognitive and motor scores, sensory impairment, and the composite outcome of NDI, based on the BSID III cognitive score (analyzed by using a cutoff of <85 or <70), BSID III motor score of <70, moderate or severe cerebral palsy (CP), bilateral blindness, and hearing impairment.<h4>Results</h4>Two thousand one hundred and thirteen infants with a mean GA of 25.0 ± 1.0 weeks and mean birth weight of 760 ± 154 g were evaluated. The 11% lost to follow-up were less likely to have private insurance, late-onset sepsis, or severe intraventricular hemorrhage. Neurologic examination results were normal in 59%, suspect abnormal in 19%, and definitely abnormal in 22%. Severe CP decreased 43% whereas mild CP increased 13% during the study. The rate of moderate to severe NDI decreased from 21% to 16% when using the BSID III cognitive cutoff of <70 (<i>P</i> = .07) or from 34% to 31% when using the BSID III cognitive cutoff of <85 (<i>P</i> = .67).<h4>Conclusions</h4>Extremely preterm children are at risk for NDI. Over time, the rate of moderate to severe NDI did not differ, but the rates of severe CP decreased, and mild CP increased.

Also flagged:Ascorbic acidL-ascorbic acidVitamin Cchromatinsesquimagnesiumsalt
Journal Article 2018-04-17 ✓ 1 Snippet Yu XX, Liu YH, Liu XM, Wang PC, Liu S, Miao JK, Du ZQ, Yang CX.
In-Text Gene Mentions

…, Prdx2 ,Prdx6, Sod1 and…

Show Full Abstract

L-ascorbic acid (Vitamin C) can enhance the meiotic maturation and developmental competence of porcine oocytes, but the underlying molecular mechanism remains obscure. Here we show the role of ascorbic acid in regulating epigenetic status of both nucleic acids and chromatin to promote oocyte maturation and development in pigs. Supplementation of 250 μM L-ascorbic acid 2-phosphate sesquimagnesium salt hydrate (AA2P) during in vitro maturation significantly enhanced the nuclear maturation (as indicated by higher rate of first polar body extrusion and increased Bmp15 mRNA level), reduced level of reactive oxygen species, and promoted developmental potency (higher cleavage and blastocyst rates of parthenotes, and decreased Bax and Caspase3 mRNA levels in blastocysts) of pig oocytes. AA2P treatment caused methylation erasure in mature oocytes on nucleic acids (5-methylcytosine (5 mC) and N <sup>6</sup> -methyladenosine (m<sup>6</sup>A)) and histones (Histone H3 trimethylations at lysines 27, H3K27me3), but establishment of histone H3 trimethylations at lysines 4 (H3K4me3) and 36 (H3K36me3). During the global methylation reprogramming process, levels of TET2 (mRNA and protein) and Dnmt3b (mRNA) were significantly elevated, but simultaneously DNMT3A (mRNA and protein), and also Hif-1α, Hif-2α, Tet3, Mettl14, Kdm5b and Eed (mRNA) were significantly inhibited. Our findings support that ascorbic acid can reprogram the methylation status of not only DNA and histone, but also RNA, to improve pig oocyte maturation and developmental competence.

Also flagged:TumorHepatocellular Carcinomasorafenibregorafenibnivolumabcapecitabine
Journal Article 2018-04-17 ✓ 2 Snippets Posadas K, Ankola A, Yang Z, Yee NS.
In-Text Gene Mentions

…viral hepatitis, alcoholism,hemochromatosis, or Wilson’s disease.…

…“liver cancer” andhemochromatosisin his father…

Show Full Abstract

Hepatocellular carcinoma (HCC) is increasing in incidence, and the associated mortality rate remains among the highest. For advanced HCC, sorafenib has been shown to slightly prolong survival, and regorafenib and nivolumab, both recently approved by the United States Food and Drug Administration (FDA), may produce clinical benefits to a limited extent. Systemic chemotherapy has been shown to produce a modest response, but there is no clinically valid biomarker that can be used to predict which patients may benefit. In this case study, we present two patients with metastatic HCC, they received systemic treatment using capecitabine, oxaliplatin, and either bevacizumab or sorafenib. The tumor response to treatment was determined by the progression-free survival (PFS). Molecular profiling of the tumors showed differential expression of biochemical markers and different mutational status of the <i>TP53</i> and &beta;-catenin (<i>CTNNB1</i>) genes. We hypothesize that the PFS correlates with the tumor molecular profiles, which may be predictive of the therapeutic response to systemic chemotherapy. Further investigation is indicated to correlate tumor biomarkers and treatment responses, with the objective of personalizing the therapies for patients with advanced HCC.

Also flagged:Lymphomafolic acidlymphoid tumorB-cell lymphomafolate receptorvincristine
Journal Article 2018-04-17 No Snippets Qiu L, Dong C, Kan X.
Show Full Abstract

<h4>Purpose</h4>B-cell lymphoma is the most frequently diagnosed lymphoid tumor. Folic acid (FA)-decorated systems were found to be preferentially internalized on the B-cell lymphoma cell line which is reported to express the folate receptor. This study was designed to develop an FA-decorated vincristine (VCR)-loaded system for targeted lymphoma treatment.<h4>Methods</h4>FA-decorated lipid was synthesized. VCR-loaded lipid-polymer hybrid nanoparticles (LPNs) were fabricated. In vitro cell lines and an in vivo lymphoma animal model was used to evaluate the anti B-cell lymphoma effect.<h4>Results</h4>FA-decorated, VCR-loaded LPNs (FA-VCR/LPNs) have shown a targeted effect in delivery to B-cell lymphoma cells. FA-VCR/LPNs also showed the highest anti-tumor effect in murine-bearing lymphoma xenografts.<h4>Conclusion</h4>FA-VCR/LPNs can achieve targeted delivery of VCR, bring about an outstanding therapeutic effect to treat lymphoma, and also reduce the systemic toxicity. FA-VCR/LPNs could be an excellent system for lymphoma therapy.

Also flagged:SphingolipidMetabolismNeurodegenerative diseasesbrain disorderspathogenesisBrain Degenerative Disorders
Journal Article 2018-04-17 ✓ 3 Snippets Di Pardo A, Maglione V.
In-Text Gene Mentions

…the protein huntingtin (Htt) (Jimenez-Sanchez et al.,…

…stretch endows mutantHtt(mHtt) with toxic…

…clearance of mutantHttexon-1 construct in…

Show Full Abstract

Neurodegenerative diseases represent a class of fatal brain disorders for which the number of effective therapeutic options remains limited with only symptomatic treatment accessible. Multiple studies show that defects in sphingolipid pathways are shared among different brain disorders including neurodegenerative diseases and may contribute to their complex pathogenesis. In this mini review, we discuss the hypothesis that modulation of sphingolipid metabolism and their related signaling pathways may represent a potential therapeutic approach for those devastating conditions. The plausible "druggability" of sphingolipid pathways is greatly promising and represent a relevant feature that brings real advantage to the development of new therapeutic options for these conditions. Indeed, several molecules that selectively target sphingolipds are already available and many of them currently in clinical trial for human diseases. A deeper understanding of the "sphingolipid scenario" in neurodegenerative disorders would certainly enhance therapeutic perspectives for these conditions, by taking advantage from the already available molecules and by promoting the development of new ones.

Also flagged:IronagingfolateVitamin AVitamin BVitamin D
Journal Article 2018-04-17 ✓ 1 Snippet Watson J, Lee M, Garcia-Casal MN.
In-Text Gene Mentions

…-overloaded states, especiallyhemochromatosis, a disease resulting…

Show Full Abstract

<h4>Purpose of review</h4>This review broadly discusses the consequences of inadequate consumption, by deficit or excess, of selected micronutrients on the quality of life and morbidity during aging, specifically considering increases in life expectancy and the costs of care in the older persons.<h4>Recent findings</h4>A literature review of the periods 2012 to 2018, focusing on vitamins A, B<sub>12</sub>, and D, calcium, iron and folate, was completed as these micronutrients are found to significantly affect the aging process. Causation and application of these micronutrients to disorders related to aging are controversial and mixed. This review highlights research needs and controversial points on the role of these micronutrients.<h4>Summary</h4>Micronutrient deficiencies are a common and avoidable contributor to decreased quality of life and healthcare costs in the older persons. Further research is needed to determine adequate intakes and innovative uses, including appropriate thresholds for improved health outcomes for this population.

Also flagged:colon cancercancertumorsASXL1TSC1IL7R
Journal Article 2018-04-17 ✓ 5 Snippets Oliveira DM, Santamaria G, Laudanna C, Migliozzi S, Zoppoli P, Quist M, Grasso C, Mignogna C, Elia L, Faniello MC, Marinaro C, Sacco R, Corcione F, Viglietto G, Malanga D, Rizzuto A.
In-Text Gene Mentions

Most of the genes that presented CNAs identified in this manuscript, such as TOP1, ASXL1, PTPRD, DCC, NLRP1 and CDH2 have already been directly associated with the development of CC.

PKHD1 and RET were lost predominantly in splenic flexure tumors and descending colon tumors (60% and 29%, respectively) and less frequently in hepatic flexure tumors (12.5%); MDB1 was lost predominantly in tumors from ascending colon and splenic flexure (85% and 60%, respectively) and less frequently in hepatic flexure tumors (12.5%); RNF213 was lost predominantly in descending colon tumors (71%) but also in tumors from hepatic flexure, transverse colon and ascending colon (25%, 25%, 14%); DCC was lost in tumors from 5 different segments: splenic flexure, descending colon, ascending colon, cecum and hepatic flexure (80%, 86%, 14% 17%, 12.5%); UBR5 showed CN gain in tumors from splenic flexure, descending colon, transverse colon, and hepatic flexure (80%, 57%, 50% and 37.5%, respectively).

In particular, CNAs in MBD1, SMAD4, PIK3R1, DCC, WRN, RB1 were significantly associated with tumors originating in descending colon whereas CNAs in NOTCH2 was associated with tumors originating in splenic flexure.

In particular, CNAs in MBD1, SMAD4, PIK3R1, DCC, WRN, RB1 were significantly associated with tumors originating in descending colon whereas CNAs in NOTCH2 was associated with tumors originating in splenic flexure (p-value < 0.05).

…= 10, 27%),DCCat 18q21.2 (…

Show Full Abstract

The objective of this study was to determine the feasibility to detect copy number alterations in colon cancer samples using Next Generation Sequencing data and to elucidate the association between copy number alterations in specific genes and the development of cancer in different colon segments. We report the successful detection of somatic changes in gene copy number in 37 colon cancer patients by analysis of sequencing data through Amplicon CNA Algorithm. Overall, we have found a total of 748 significant copy number alterations in 230 significant genes, of which 143 showed CN losses and 87 showed CN gains. Validation of results was performed on 20 representative genes by quantitative qPCR and/or immunostaining. By this analysis, we have identified 4 genes that were subjected to copy number alterations in tumors arising in all colon segments (defined "common genes") and the presence of copy number alterations in 14 genes that were significantly associated to one specific site (defined "site-associated genes"). Finally, copy number alterations in ASXL1, TSC1 and IL7R turned out to be clinically relevant since the loss of TSC1 and IL7R was associated with advanced stages and/or reduced survival whereas copy number gain of ASXL1 was associated with good prognosis.

Also flagged:1,3-indandionecarboxylic acidAcylation1,3-Indandiones-Acyl
Journal Article 2018-04-17 No Snippets Larsen BJ, Rosano RJ, Ford-Hutchinson TA, Reitz AB, Wrobel JE.
Show Full Abstract

The 1,3-indandione scaffold is an important structural motif used in the preparation of a large number of industrial chemical and pharmaceutical compounds. However, few approaches allow for the direct C2 acylation on these building blocks. A method was developed using DMAP and EDCI, which is mild in reactivity, covers a diverse range of carboxylic acid acylating agents, is compatible with electron releasing and withdrawing substituents on the 1,3-indandione partner, and performs well in a polar aprotic solvent (for solubility reasons) This method cleanly afforded twenty five different products in yields of 32-96%.

Also flagged:C-reactive proteinvWFvon Willebrand FactorFibrinogenProthrombinplasminogen activator inhibitor-1
Journal Article 2018-04-17 ✓ 1 Snippet Cushman M, Larson JC, Rosendaal FR, Heckbert SR, Curb JD, Phillips LS, Baird AE, Eaton CB, Stafford RS.
In-Text Gene Mentions

…Liatest D‐Di, StachromATIII; STA‐R instrument, Diagnostic…

Show Full Abstract

<h4>Background</h4>Oral menopausal hormone therapy causes venous thrombosis but whether biomarkers of thrombosis risk can identify women at risk is unknown.<h4>Methods</h4>We completed a nested case control study in the two Women's Health Initiative hormone trials; 27 347 women aged 50-79 were randomized to hormone therapy (conjugated equine estrogen with or without medroxyprogesterone acetate) or placebo. With 4 years follow-up, biomarkers were measured using stored baseline samples prior to starting treatment, and one-year later, in 215 women who developed thrombosis and 867 controls.<h4>Results</h4>Overall, lower protein C and free protein S, and higher D-dimer, prothrombin fragment 1.2 and plasmin-antiplasmin complex were associated with risk of future thrombosis with odds ratios ranging from 1.9 to 3.2. Compared to women with normal biomarkers assigned to placebo, the risk of thrombosis with hormone therapy was increased among women with abnormal biomarkers, especially elevated D-dimer, elevated plasmin-antiplasmin, and low free protein S; the largest association was for D-dimer: odds ratio 6.0 (95% CI 3.6-9.8). Differences in associations by hormone use were not significant on the multiplicative scale. Considering a multi-marker score of eight biomarkers, women with three or more abnormal biomarkers had 15.5-fold increased odds of VT (95% CI 6.8-35.1). One-year changes in biomarkers were not robustly associated with subsequent thrombosis risk.<h4>Conclusion</h4>Abnormal levels of biomarkers of thrombosis risk identified women at increased risk of future venous thrombosis with oral menopausal hormone therapy. Findings support the potential for clinical use of D-dimer testing in advance of hormone therapy prescription.

Also flagged:small round cell sarcomasarcomatumoursCREB1CRTC1SS18
Journal Article 2018-04-16 No Snippets Alholle A, Karanian M, Brini AT, Morris MR, Kannappan V, Niada S, Niblett A, Ranchère-Vince D, Pissaloux D, Delfour C, Maran-Gonzalez A, Antonescu CR, Sumathi V, Tirode F, Latif F.
Show Full Abstract

In recent years, undifferentiated small round cell sarcomas (USRCSs) have been divided into a variety of new, rare, sarcoma subtypes, including the group of Ewing-like sarcomas, which have the morphological appearance of Ewing sarcomas, but carry CIC-DUX4, BCOR-CCNB3 and other gene fusions different from the classic EWSR1-ETS gene fusion. Using high-throughput RNA-sequencing (RNA-seq) analyses, we identified a novel recurrent gene fusion, CRTC1-SS18, in two cases of USRCS that lacked any known translocation. RNA-seq results were confirmed by reverse transcription polymerase chain reaction, long-range polymerase chain reaction, and fluorescence in situ hybridization. In vitro, we showed that the cells expressing the gene fusion were morphologically distinct and had enhanced oncogenic potential as compared with control cells. Expression profile comparisons with tumours of other sarcoma subtypes demonstrated that both cases clustered close to EWSR1-CREB1-positive tumours. Moreover, these analyses indicated enhanced NTRK1 expression in CRTC1-SS18-positive tumours. We conclude that the novel gene fusion identified in this study adds a new subtype to the USRCSs with unique gene signatures, and may be of therapeutic relevance. Copyright © 2018 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Also flagged:serotonin5-HTacrosome5-HT1B5-HT2A5-HT₃ receptors
Journal Article 2018-04-16 ✓ 2 Snippets Jiménez-Trejo F, Coronado-Mares I, Boeta M, González-Santoyo I, Vigueras-Villaseñor R, Arriaga-Canon C, Herrera LA, Tapia-Rodríguez M.
In-Text Gene Mentions

Therefore, using both immunofluorescence and western blot techniques, we searched for and found some serotonin markers such as 5-HT, 5-HT1B, 5-HT2A, 5-HT3 receptors, both TPH1 and MAOA enzymes, and serotonin transporter (5-HTT) in stallion sperm.

…and serotonin transporter (5-HTT) in stallion sperm.…

Show Full Abstract

Assisted reproductive techniques have been used on several domestic animals to preserve desirable traits in strains of high genetic and commercial value; however in equines its efficiency rate is relatively low. To increase the conception ratio in stallions, some research groups have used pharmacological treatments which promote sperm hyperactivation in order to increase male's fertility rates. In this way, our previous work suggests that serotonin (5-HT) could be a good pharmacological candidate that facilitates conception rate in domestic horses. 5-HT is a neurohormone involved in several reproductive processes, i.e., it enhances hyperactivation, motility, and promotes the acrosome reaction in mammalian sperm, but it has not been described in the stallion sperm yet. Therefore, using both immunofluorescence and western blot techniques, we searched for and found some serotonin markers such as 5-HT, 5-HT1B, 5-HT2A, 5-HT₃ receptors, both TPH1 and MAOA enzymes, and serotonin transporter (5-HTT) in stallion sperm. In addition, we found a non-neuroendocrine cell, V-MAT₁ transporter, which has not been previously reported in mammalian sperm. Our results suggest that serotoninergic system is present in stallion sperm, which could be a pharmacological target to increase the conception rates in domestic horses.

Also flagged:pigmentationTilapiagene expressioncolorationfoxd3synthesis
Journal Article 2018-04-16 ✓ 2 Snippets Wang L, Zhu W, Dong Z, Song F, Dong J, Fu J.
In-Text Gene Mentions

Previous observations have suggested that miR-107b was differentially expressed in the brain tissue of rainbow trout and found to target sox6 [20], which might act as a transcription factor indirectly regulating embryonic development and melanin biosynthesis by modulating sox10 in B16 melanoma cells [21].

…found to targetsox6[ 20 ],…

Show Full Abstract

Differentiation and variation in body color has been a growing limitation to the commercial value of red tilapia. Limited microRNA (miRNA) information is available on skin color differentiation and variation in fish so far. In this study, a high-throughput Illumina sequencing of sRNAs was conducted on three color varieties of red tilapia and 81,394,491 raw reads were generated. A total of 158 differentially expressed miRNAs (|log₂(fold change)| &ge; 1 and <i>q</i>-value &le; 0.001) were identified. Target prediction and functional analysis of color-related miRNAs showed that a variety of putative target genes&mdash;including <i>slc7a11</i>, <i>mc1r</i> and <i>asip</i>&mdash;played potential roles in pigmentation. Moreover; the miRNA-mRNA regulatory network was illustrated to elucidate the pigmentation differentiation, in which miR-138-5p and miR-722 were predicted to play important roles in regulating the pigmentation process. These results advance our understanding of the molecular mechanisms of skin pigmentation differentiation in red tilapia.

Also flagged:ironmetabolismanemiaoxygenimmune responsechronic kidney disease
Journal Article 2018-04-16 ✓ 2 Snippets Sarkar J, Potdar AA, Saidel GM.
In-Text Gene Mentions

…regulatory proteins (e.g.HFE, ceruloplasmin), but here…

…surface proteins likeHFE[ 14 ,…

Show Full Abstract

Iron plays vital roles in the human body including enzymatic processes, oxygen-transport via hemoglobin and immune response. Iron metabolism is characterized by ~95% recycling and minor replenishment through diet. Anemia of chronic kidney disease (CKD) is characterized by a lack of synthesis of erythropoietin leading to reduced red blood cell (RBC) formation and aberrant iron recycling. Treatment of CKD anemia aims to normalize RBC count and serum hemoglobin. Clinically, the various fluxes of iron transport and accumulation are not measured so that changes during disease (e.g., CKD) and treatment are unknown. Unwanted iron accumulation in patients is known to lead to adverse effects. Current whole-body models lack the mechanistic details of iron transport related to RBC maturation, transferrin (Tf and TfR) dynamics and assume passive iron efflux from macrophages. Hence, they are not predictive of whole-body iron dynamics and cannot be used to design individualized patient treatment. For prediction, we developed a mechanistic, multi-scale computational model of whole-body iron metabolism incorporating four compartments containing major pools of iron and RBC generation process. The model accounts for multiple forms of iron in vivo, mechanisms involved in iron uptake and release and their regulation. Furthermore, the model is interfaced with drug pharmacokinetics to allow simulation of treatment dynamics. We calibrated our model with experimental and clinical data from peer-reviewed literature to reliably simulate CKD anemia and the effects of current treatment involving combination of epoietin-alpha and iron dextran. This in silico whole-body model of iron metabolism predicts that a year of treatment can potentially lead to 90% downregulation of ferroportin (FPN) levels, 15-fold increase in iron stores with only a 20% increase in iron flux from the reticulo-endothelial system (RES). Model simulations quantified unmeasured iron fluxes, previously unknown effects of treatment on FPN-level and iron stores in the RES. This mechanistic whole-body model can be the basis for future studies that incorporate iron metabolism together with related clinical experiments. Such an approach could pave the way for development of effective personalized treatment of CKD anemia.

Also flagged:SOX9GLIFOXAchondrocyte proliferationchondrocyte maturationbinding
Journal Article 2018-04-16 ✓ 5 Snippets Tan Z, Niu B, Tsang KY, Melhado IG, Ohba S, He X, Huang Y, Wang C, McMahon AP, Jauch R, Chan D, Zhang MQ, Cheah KSE.
In-Text Gene Mentions

…, Sox5 ,Sox6, Col2a1 ,…

…the SOX (SOX5,SOX6and SOX9)[ 7…

…with SOX5 andSOX6to activate the…

…(SOX9, SOX5 andSOX6) controls sequential differen…

…, Sox5 ,Sox6and Col2a1 )…

Show Full Abstract

The growth plate mediates bone growth where SOX9 and GLI factors control chondrocyte proliferation, differentiation and entry into hypertrophy. FOXA factors regulate hypertrophic chondrocyte maturation. How these factors integrate into a Gene Regulatory Network (GRN) controlling these differentiation transitions is incompletely understood. We adopted a genome-wide whole tissue approach to establish a Growth Plate Differential Gene Expression Library (GP-DGEL) for fractionated proliferating, pre-hypertrophic, early and late hypertrophic chondrocytes, as an overarching resource for discovery of pathways and disease candidates. De novo motif discovery revealed the enrichment of SOX9 and GLI binding sites in the genes preferentially expressed in proliferating and prehypertrophic chondrocytes, suggesting the potential cooperation between SOX9 and GLI proteins. We integrated the analyses of the transcriptome, SOX9, GLI1 and GLI3 ChIP-seq datasets, with functional validation by transactivation assays and mouse mutants. We identified new SOX9 targets and showed SOX9-GLI directly and cooperatively regulate many genes such as Trps1, Sox9, Sox5, Sox6, Col2a1, Ptch1, Gli1 and Gli2. Further, FOXA2 competes with SOX9 for the transactivation of target genes. The data support a model of SOX9-GLI-FOXA phasic GRN in chondrocyte development. Together, SOX9-GLI auto-regulate and cooperate to activate and repress genes in proliferating chondrocytes. Upon hypertrophy, FOXA competes with SOX9, and control toward terminal differentiation passes to FOXA, RUNX, AP1 and MEF2 factors.

Also flagged:phospholipase ApldAouter membrane phospholipase AmembraneQ feversynthesis
Journal Article 2018-04-16 No Snippets Stead CM, Cockrell DC, Beare PA, Miller HE, Heinzen RA.
Show Full Abstract

<h4>Background</h4>Many gram-negative bacteria produce an outer membrane phospholipase A (PldA) that plays an important role in outer membrane function and is associated with virulence.<h4>Results</h4>In the current study, we characterized a pldA mutant of Coxiella burnetii, an intracellular gram-negative pathogen and the agent of human Q fever. The C. burnetti pldA open reading frame directs synthesis of a protein with conserved PldA active site residues. A C. burnetii ΔpldA deletion mutant had a significant growth defect in THP-1 macrophages, but not axenic medium, that was rescued by complementation. Thin layer chromatography was employed to assess whether pldA plays a role in remodeling membrane lipids during C. burnetii morphological differentiation. Extracted lipids were analyzed from replicating, logarithmic phase large cell variants (LCVs), non-replicating, stationary phase small cell variants (SCVs), and a mixture of LCVs and SCVs. Similar to Escherichia coli, all three forms contained cardiolipin (CL), phosphatidylglycerol (PG) and phosphatidylethanolamine (PE). However, PE and PG were present in lower quantities in the SCV while three additional lipid species were present in higher quantities. Co-migration with standards tentatively identified two of the three SCV-enriched lipids as lyso-phosphatidylethanolamine, a breakdown product of PE, and free fatty acids, which are generally toxic to bacteria. Developmental form lipid modifications required the activity of PldA.<h4>Conclusions</h4>Collectively, these results indicate developmentally-regulated lipid synthesis by C. burnetii contributes to colonization of macrophages and may contribute to the environmental stability and the distinct biological properties of the SCV.

Also flagged:OX40ovarian carcinomafemale cancerplatinumTNF receptorCD4
Journal Article 2018-04-16 No Snippets Ramser M, Eichelberger S, Däster S, Weixler B, Kraljević M, Mechera R, Tampakis A, Delko T, Güth U, Stadlmann S, Terracciano L, Droeser RA, Singer G.
Show Full Abstract

<h4>Background</h4>Ovarian carcinoma (OC) is the fifth most common female cancer and mostly diagnosed at an advanced stage. Surgical debulking is usually followed by adjuvant platinum-based chemotherapy. Only few biomarkers are known to be related to chemosensitivity. OX40 is a TNF receptor member and expressed on activated CD4+ and CD8+ T cells. It is known that OX40 signaling promotes survival and responds to various immune cells of the innate and adaptive immune system. Therefore we investigated the indicative value of OX40 expression for recurrence and survival in OC.<h4>Methods</h4>A tissue microarray of biopsies of mostly high-grade primary serous OC and matched recurrences of 47 patients was stained with OX40. Recurrence within 6 months of the completion of platinum-based chemotherapy was defined as chemoresistance.<h4>Results</h4>Chemosensitivity correlated significantly with high OX40 positive immune cell density in primary cancer biopsies (p = 0.027). Furthermore patients with a higher OX40 expression in recurrent cancer biopsies showed a better outcome in recurrence free survival (RFS) (p = 0.017) and high OX40 expression was associated with chemosensitivity (p = 0.008). OX40 positive TICI in recurrent carcinomas significantly correlated with IL-17 positive tumor infiltrating immune cells in primary carcinomas (r <sub>s</sub>  = 0.34; p = 0.023). Univariate cox regression analysis revealed a significant longer RFS and higher numbers of chemotherapy cycles for high OX40 tumor cell expression in recurrent cancer biopsies (HR 0.39, 95%CI 0.16-0.94, p = 0.036 and 1.28, 95%CI 1.05-1.55; p = 0.013).<h4>Conclusion</h4>High OX40 expression in OC is correlated with chemosensitivity and improved RFS in OC. Patients might therefore benefit from a second line therapy.

Also flagged:aggressionserotonin receptorHTR1AHTR2A55 HTR2A
Journal Article 2018-04-16 ✓ 5 Snippets Butovskaya ML, Butovskaya PR, Vasilyev VA, Sukhodolskaya JM, Fekhredtinova DI, Karelin DV, Fedenok JN, Mabulla AZP, Ryskov AP, Lazebny OE.
In-Text Gene Mentions

The goals of current study were to assess the association of sex and three genes of the serotoninergic system (serotonin transporter, 5-HTT, and two receptors of serotonin, 5HTR1A and 5HTR2A) with total aggression based on self-ratings on BPAQ in representatives of three human populations: two rural traditional African groups, Hadza and Datoga, and one urban sample from Russia, represented by Russian students.

…the serotonin transporter (5-HTT) was selected as…

…The reduced5-HTTavailability in the…

…polymorphism in the5-HTTgene, but not…

…system (serotonin transporter,5-HTT, and two…

Show Full Abstract

<h4>Background</h4>Current knowledge on genetic basis of aggressive behavior is still contradictory. This may be due to the fact that the majority of studies targeting associations between candidate genes and aggression are conducted on industrial societies and mainly dealing with various types of psychopathology and disorders. Because of that, our study was carried on healthy adult individuals of both sex (n = 853).<h4>Methods</h4>Three populations were examined: two traditional (Hadza and Datoga) and one industrial (Russians), and the association of aggression with the following polymorphisms 5-HTTLPR, rs6295 (5HTR1A gene), and rs6311 (5HTR2A gene) were tested. Aggression was measured as total self-ratings on Buss-Perry Aggression Questionnaire.<h4>Results</h4>Distributions of allelic frequencies of 5-HTTLPR and 5HTR1A polymorphisms were significantly different among the three populations. Consequently, the association analyses for these two candidate genes were carried out separately for each population, while for the 5HTR2A polymorphism, it was conducted on the pooled data that made possible to introduce ethnic factor in the ANOVA model. The traditional biometrical approach revealed no sex differences in total aggression in all three samples. The three-way ANOVA (μ + 5-HTTLPR + 5HTR1A + 5HTR2A +ε) with measures of self-reported total aggression as dependent variable revealed significant effect of the second serotonin receptor gene polymorphism for the Hadza sample. For the Datoga, the interaction effect between 5-HTTLPR and 5HTR1A was significant. No significant effects of the used polymorphisms were obtained for Russians. The results of two-way ANOVA with ethnicity and the 5HTR2A polymorphism as main effects and their interactions revealed the highly significant effect of ethnicity, 5HTR2A polymorphism, and their interaction on total aggression.<h4>Conclusions</h4>Our data provided obvious confirmation for the necessity to consider the population origin, as well as cultural background of tested individuals, while searching for associations between genes and behavior, and demonstrated the role of cultural attitudes towards the use of in-group aggression. Our data partly explained the reasons for disagreement in results of different teams, searching for candidate-gene associations with behavior without considerations of culturally desirable norms. Previous studies suggested that the 5HTR2A gene polymorphism associates with aggression and criminality. Our data extended these findings, demonstrating the role of rs6311 (5HTR2A gene) in aggression in adult healthy men and women from our samples. We found that G-allele carriers were rated higher on total aggression.

Also flagged:depressionmajor depressive disordersynapsespinedendriteanxiety
Journal Article 2018-04-16 ✓ 2 Snippets Howard DM, Adams MJ, Shirali M, Clarke TK, Marioni RE, Davies G, Coleman JRI, Alloza C, Shen X, Barbu MC, Wigmore EM, Gibson J, 23andMe Research Team, Hagenaars SP, Lewis CM, Ward J, Smith DJ, Sullivan PF, Haley CS, Breen G, Deary IJ, McIntosh AM.
In-Text Gene Mentions

depression include the Neural Growth Regulator 1 (NEGR1), the glutamate metabotropic receptor 5 (GRM5

…Regulator 1 (NEGR1), the glutamate…

Show Full Abstract

Depression is a polygenic trait that causes extensive periods of disability. Previous genetic studies have identified common risk variants which have progressively increased in number with increasing sample sizes of the respective studies. Here, we conduct a genome-wide association study in 322,580 UK Biobank participants for three depression-related phenotypes: broad depression, probable major depressive disorder (MDD), and International Classification of Diseases (ICD, version 9 or 10)-coded MDD. We identify 17 independent loci that are significantly associated (P < 5 × 10<sup>-8</sup>) across the three phenotypes. The direction of effect of these loci is consistently replicated in an independent sample, with 14 loci likely representing novel findings. Gene sets are enriched in excitatory neurotransmission, mechanosensory behaviour, post synapse, neuron spine and dendrite functions. Our findings suggest that broad depression is the most tractable UK Biobank phenotype for discovering genes and gene sets that further our understanding of the biological pathways underlying depression.

Also flagged:Netrin-1wound healingaxon guidancecell migrationinflammationnerve fiber
Journal Article 2018-04-16 ✓ 3 Snippets Zhang Y, Chen P, Di G, Qi X, Zhou Q, Gao H.
In-Text Gene Mentions

…in colorectal cancer (DCC) 8 .…

…reported previously, includingDCCand neogenin (DCC…

…DCC and neogenin (DCCfamily), uncoordinated family…

Show Full Abstract

Netrins are secreted chemoattractants with the roles in axon guidance, cell migration and epithelial plasticity. In the present study, we investigated the roles of netrin-1 in the regulation of corneal epithelial wound healing, inflammation response and nerve fiber regeneration in diabetic mice and cultured corneal epithelial cells. In diabetic mice, the expression of netrin-1 was decreased when compared with that of normal mice. Furthermore, high glucose blocked the wounding-induced up-regulation of netrin-1 expression in corneal epithelial cells. Exogenous netrin-1 promoted the corneal epithelial wound healing in diabetic mice, and facilitated the proliferation and migration by reactivating the phosphorylation of ERK and EGFR in high-glucose treated corneal epithelial cells. Moreover, netrin-1 decreased the neutrophil infiltration and promoted M2 macrophage transition, accompanied with the attenuated expression of pro-inflammatory factors in diabetic mouse corneal epithelium. The promotions of netrin-1 on corneal epithelial wound healing and inflammation resolution were mediated at least through the adenosine 2B receptor. In addition, netrin-1 promoted the regeneration of corneal nerve fibers that was impaired in diabetic mice. Taken together, netrin-1 regulates corneal epithelial wound healing, inflammation response and nerve fiber regeneration in diabetic mice, indicating the potential application for the therapy of diabetic keratopathy.

Also flagged:G2P1NSP4VP1VP3amino acid
Journal Article 2018-04-16 No Snippets Thanh HD, Tran VT, Lim I, Kim W.
Show Full Abstract

After the introduction of two global rotavirus vaccines, RotaTeq in 2007 and Rotarix in 2008 in South Korea, G1[P8] rotavirus was the major rotavirus genotype in the country until 2012. However, in this study, an emergence of G2P[4] as the dominant genotype during the 2013 to 2015 season has been reported. Genetic analysis revealed that these viruses had typical DS-1-like genotype constellation and showed evidence of re-assortment in one or more genome segments, including the incorporation of NSP4 genes from strains B-47/2008 from a cow and R4/Haryana/2007 from a buffalo in India, and the VP1 and VP3 genes from strain GO34/1999 from a goat in Bangladesh. Compared to the G2 RotaTeq vaccine strain, 17-24 amino acid changes, specifically A87T, D96N, S213D, and S242N substitutions in G2 epitopes, were observed. These results suggest that multiple interspecies re-assortment events might have contributed to the emergence of G2P[4] rotaviruses in the post-vaccination era in South Korea.

Also flagged:Autophagytrehalosesynthesisdegradationneurodegenerative diseasescancer
Journal Article 2018-04-16 No Snippets Hosseinpour-Moghaddam K, Caraglia M, Sahebkar A.
Show Full Abstract

The balance between synthesis and degradation is crucial to maintain cellular homeostasis and different mechanisms are known to keep this balance. In this review, we will provide a short overview on autophagy as an intracellular homeostatic degradative machinery. We will also describe the involvement of downregulation of autophagy in numerous diseases including neurodegenerative diseases, cancer, aging, metabolic disorders, and other infectious diseases. Therefore, modulation of autophagic processes can represent a promising way of intervention in different diseases including neurodegeneration and cancer. Trehalose, also known as mycose, is a natural disaccharide found extensively but not abundantly among several organisms. It is described that trehalose can work as an important autophagy modulator and can be proficiently used in the control several diseases in which autophagy plays an important role. On these bases, we describe here the role of trehalose as an innovative drug in the treatment of neurodegenerative diseases and other illnesses opening a new scenario of intervention in conditions difficult to be treated.

Also flagged:Nuclear exportcytosolnucleusubiquitin-associated (UBA) domain-containing proteinCRM1UBIN binding protein
Journal Article 2018-04-16 ✓ 2 Snippets Hirayama S, Sugihara M, Morito D, Iemura SI, Natsume T, Murata S, Nagata K.
In-Text Gene Mentions

…the mutant huntingtin (Htt) protein and its…

…as the mutantHttprotein, through hsp110-mediat…

Show Full Abstract

Although mechanisms for protein homeostasis in the cytosol have been studied extensively, those in the nucleus remain largely unknown. Here, we identified that a protein complex mediates export of polyubiquitinated proteins from the nucleus to the cytosol. UBIN, a ubiquitin-associated (UBA) domain-containing protein, shuttled between the nucleus and the cytosol in a CRM1-dependent manner, despite the lack of intrinsic nuclear export signal (NES). Instead, the UBIN binding protein polyubiquitinated substrate transporter (POST) harboring an NES shuttled UBIN through nuclear pores. UBIN bound to polyubiquitin chain through its UBA domain, and the UBIN-POST complex exported them from the nucleus to the cytosol. Ubiquitinated proteins accumulated in the cytosol in response to proteasome inhibition, whereas cotreatment with CRM1 inhibitor led to their accumulation in the nucleus. Our results suggest that ubiquitinated proteins are exported from the nucleus to the cytosol in the UBIN-POST complex-dependent manner for the maintenance of nuclear protein homeostasis.

Also flagged:aryl hydrocarbon receptorAhRbone developmentgene expressiontartrate-resistant acid phosphataseTRAP
Journal Article 2018-04-16 ✓ 1 Snippet Fader KA, Nault R, Raehtz S, McCabe LR, Zacharewski TR.
In-Text Gene Mentions

Cacna1e

Show Full Abstract

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) and other aryl hydrocarbon receptor (AhR) agonists have been shown to regulate bone development and remodeling in a species-, ligand-, and age-specific manner, however the underlying mechanisms remain poorly understood. In this study, we characterized the effect of 0.01-30 μg/kg TCDD on the femoral morphology of male and female juvenile mice orally gavaged every 4 days for 28 days and used RNA-Seq to investigate gene expression changes associated with the resultant phenotype. Micro-computed tomography revealed that TCDD dose-dependently increased trabecular bone volume fraction (BVF) 2.9- and 3.3-fold in male and female femurs, respectively. Decreased serum tartrate-resistant acid phosphatase (TRAP) levels, combined with a reduced osteoclast surface to bone surface ratio and repression of femoral proteases (cathepsin K, matrix metallopeptidase 13), suggests that TCDD impaired bone resorption. Increased osteoblast counts at the trabecular bone surface were consistent with a reciprocal reduction in the number of bone marrow adipocytes, suggesting AhR activation may direct mesenchymal stem cell differentiation towards osteoblasts rather than adipocytes. Notably, femoral expression of transmembrane glycoprotein NMB (Gpnmb; osteoactivin), a positive regulator of osteoblast differentiation and mineralization, was dose-dependently induced up to 18.8-fold by TCDD. Moreover, increased serum levels of 1,25-dihydroxyvitamin D<sub>3</sub> were in accordance with the renal induction of 1α-hydroxylase Cyp27b1 and may contribute to impaired bone resorption. Collectively, the data suggest AhR activation tipped the bone remodeling balance towards bone formation, resulting in increased bone mass with reduced marrow adiposity.

Also flagged:COPDGene Expressioncell differentiationcell proliferationimmune responsep53
Journal Article 2018-04-16 ✓ 1 Snippet Liu X, Qu J, Xue W, He L, Wang J, Xi X, Liu X, Yin Y, Qu Y.
In-Text Gene Mentions

…(MARCKS, YWHAG, SLC4A4,ARFGEF2, BIR3BP, etc) for…

Show Full Abstract

<h4>Objectives</h4>MicroRNAs (miRNAs) play essential roles in the development of COPD. In this study, we aimed to identify and validate potential miRNA biomarkers in frequent and non-frequent exacerbators of COPD patients using bioinformatic analysis.<h4>Materials and methods</h4>The candidate miRNA biomarkers in COPD were screened from Gene Expression Omnibus (GEO) dataset and identified using GEO2R online tool. Then, we performed bioinformatic analyses including target prediction, gene ontology (GO), pathway enrichment analysis and construction of protein-protein interaction (PPI) network. Furthermore, the expression of the identified miRNAs in peripheral blood monocular cells (PBMCs) of COPD patients was validated using quantitative real-time polymerase chain reaction (qRT-PCR).<h4>Results</h4>MiR-23a, miR-25, miR-145 and miR-224 were identified to be significantly downregulated in COPD patients compared with healthy controls. GO analysis showed the four miRNAs involved in apoptotic, cell differentiation, cell proliferation and innate immune response. Pathway analysis showed that the targets of these miRNAs were associated with p53, TGF-β, Wnt, VEGF and MAPK signal pathway. In healthy controls, the miR-25 and miR-224 levels were significantly decreased in smokers compared with nonsmokers (<i>P</i><0.001 and <i>P</i><0.05, respectively). In COPD patients, the levels of miR-23a, miR-25, miR-145 and miR-224 were associated with Global Initiative for Chronic Obstructive Lung Disease (GOLD) stages. Notably, miR-23a and miR-145 were significantly elevated in non-frequent exacerbators compared with frequent exacerbators (<i>P</i><0.05), and miR-23a showed higher area under the receiver-operator characteristic curve (AUROC) than miR-145 (0.707 vs 0.665, <i>P</i><0.05).<h4>Conclusion</h4>MiR-23a, miR-25, miR-145 and miR-224 were associated with the development of COPD, and miR-23a might be a potential biomarker for discriminating the frequent exacerbators from non-frequent exacerbators.

Also flagged:placental abruptionKCNJ11ADAM12endocrine system disorderscardiovascular diseasesABCC8
Journal Article 2018-04-16 No Snippets Workalemahu T, Enquobahrie DA, Gelaye B, Sanchez SE, Garcia PJ, Tekola-Ayele F, Hajat A, Thornton TA, Ananth CV, Williams MA.
Show Full Abstract

<h4>Introduction</h4>Accumulating epidemiological evidence points to strong genetic susceptibility to placental abruption (PA). However, characterization of genes associated with PA remains incomplete. We conducted a genome-wide association study (GWAS) of PA and a meta-analysis of GWAS.<h4>Methods</h4>Participants of the Placental Abruption Genetic Epidemiology (PAGE) study, a population based case-control study of PA conducted in Lima, Peru, were genotyped using the Illumina HumanCore-24 BeadChip platform. Genotypes were imputed using the 1000 genomes reference panel, and >4.9 million SNPs that passed quality control were analyzed. We performed a GWAS in PAGE participants (507 PA cases and 1090 controls) and a GWAS meta-analysis in 2512 participants (959 PA cases and 1553 controls) that included PAGE and the previously reported Peruvian Abruptio Placentae Epidemiology (PAPE) study. We fitted population stratification-adjusted logistic regression models and fixed-effects meta-analyses using inverse-variance weighting.<h4>Results</h4>Independent loci (linkage-disequilibrium<0.80) suggestively associated with PA (P-value<5e-5) included rs4148646 and rs2074311 in ABCC8, rs7249210, rs7250184, rs7249100 and rs10401828 in ZNF28, rs11133659 in CTNND2, and rs2074314 and rs35271178 near KCNJ11 in the PAGE GWAS. Similarly, independent loci suggestively associated with PA in the GWAS meta-analysis included rs76258369 near IRX1, and rs7094759 and rs12264492 in ADAM12. Functional analyses of these genes showed trophoblast-like cell interaction, as well as networks involved in endocrine system disorders, cardiovascular diseases, and cellular function.<h4>Conclusions</h4>We identified several genetic loci and related functions that may play a role in PA risk. Understanding genetic factors underlying pathophysiological mechanisms of PA may facilitate prevention and early diagnostic efforts.

Also flagged:nitrogenlipiddegradationpoly unsaturated fatty acidswaterprotein denaturation
Journal Article 2018-04-16 No Snippets Dang HTT, Gudjonsdóttir M, Karlsdóttir MG, Van Nguyen M, Tómasson T, Arason S.
Show Full Abstract

Physicochemical changes of Icelandic golden redfish (<i>Sebastes marinus</i>) as affected by seasonal variation (June and November) and raw material freshness (processed 4 and 9 days postcatch) during frozen storage (at -25°C for 20 months) were studied to find optimal conditions for production of high-quality frozen products. Thawing loss, cooking yield, and color of the fillets as well as chemical composition, water holding capacity, pH, total volatile basic nitrogen, lipid oxidation, and hydrolysis of the light and dark muscle were analyzed every 4 months of frozen storage. Lipid hydrolysis was the main degradation process in the light muscle, while the dark muscle was more affected by lipid oxidation. Fish caught in November showed greater instability in the analyzed parameters during storage than fish caught in June, which could be linked to differences in individual poly unsaturated fatty acids between the two seasons. The quality attributes of fish processed on day 9 were similar to fish processed 4 days postcatch, except slightly higher thawing loss and yellowness, were observed in fish processed 9 days postcatch. Stability of golden redfish through frozen storage was higher in the fish caught in June than in November.

Also flagged:liveracute fatty liverAcute fatty liver of pregnancymitochondriamitochondrial hepatopathiessodium valproate
Journal Article 2018-04-16 ✓ 1 Snippet Morton A, Laurie J.
In-Text Gene Mentions

ATIII

Show Full Abstract

The Swansea criteria are used to assess the likelihood of acute fatty liver of pregnancy. There are significant physiological changes in normal pregnancy in several of the pathology parameters used in the Swansea criteria. This may impact the sensitivity and specificity of the Swansea criteria. Five of the 11 case series reporting laboratory values in acute fatty liver of pregnancy used values divergent from the Swansea criteria. When using the Swansea criteria for diagnosis of acute fatty liver of pregnancy, using pregnancy-specific and/or laboratory-specific reference intervals is recommended. Simpler diagnostic criteria using parameters of hepatocellular damage and hepatic synthetic dysfunction may be an alternative to the Swansea criteria, and further studies investigating the sensitivity and specificity of these parameters would be useful.

Also flagged:gastric cancertumorp53fibroblast growth factor receptor 4tumorsN
Journal Article 2018-04-15 No Snippets Yamamoto M, Nomura S, Hosoi A, Nagaoka K, Iino T, Yasuda T, Saito T, Matsushita H, Uchida E, Seto Y, Goldenring JR, Kakimi K, Tatematsu M, Tsukamoto T.
Show Full Abstract

Previously no mouse gastric cancer cell lines have been available for transplantation into C57BL/6 mice. However, a gastric cancer model in immunocompetent mice would be useful for analyzing putative therapies. N-Methyl-N-nitrosourea (MNU) was given in drinking water to C57BL/6 mice and p53 heterozygous knockout mice. Only 1 tumor from a p53 knockout mouse could be cultured and the cells s.c. transplanted into a C57BL/6 mouse. We cultured this s.c. tumor, and subcloned it. mRNA expression in the most aggressive YTN16 subline was compared to the less aggressive YTN2 subline by microarray analysis, and fibroblast growth factor receptor 4 (FGFR4) in YTN16 cells was knocked out with a CRISPR/Cas9 system and inhibited by an FGFR4 selective inhibitor, BLU9931. These transplanted cell lines formed s.c. tumors in C57BL/6 mice. Four cell lines (YTN2, YTN3, YTN5, YTN16) were subcloned and established. Their in vitro growth rates were similar. However, s.c. tumor establishment rates, metastatic rates, and peritoneal dissemination rates of YTN2 and YTN3 were lower than for YTN5 and YTN16. YTN16 established 8/8 s.c. tumors, 7/8 with lung metastases, 3/8 with lymph node metastases and 5/5 with peritoneal dissemination. FGFR4 expression by YTN16 was 121-fold higher than YTN2. FGFR4-deleted YTN16 cells failed to form s.c. tumors and showed lower rates of peritoneal dissemination. BLU9931 significantly inhibited the growth of peritoneal dissemination of YTN16. These studies present the first transplantable mouse gastric cancer lines. Our results further indicate that FGFR4 is an important growth signal receptor in gastric cancer cells with high FGFR4 expression.

Also flagged:RNA binding proteinscytoplasmgene expressionnucleuslocalizationDscam
Journal Article 2018-04-14 ✓ 1 Snippet Wilusz JE.
In-Text Gene Mentions

DCC

Show Full Abstract

The first circular RNA (circRNA) was identified more than 40 years ago, but it was only recently appreciated that circRNAs are common outputs of many eukaryotic protein-coding genes. Some circRNAs accumulate to higher levels than their associated linear mRNAs, especially in the nervous system, and have clear regulatory functions that result in organismal phenotypes. The pre-mRNA splicing machinery generates circRNAs via backsplicing reactions, which are often facilitated by intronic repeat sequences that base pair to one another and bring the intervening splice sites into close proximity. When spliceosomal components are limiting, circRNAs can become the preferred gene output, and backsplicing reactions are further controlled by exon skipping events and the combinatorial action of RNA binding proteins. This allows circRNAs to be expressed in a tissue- and stage-specific manner. Once generated, circRNAs are highly stable transcripts that often accumulate in the cytoplasm. The functions of most circRNAs remain unknown, but some can regulate the activities of microRNAs or be translated to produce proteins. Circular RNAs can further interface with the immune system as well as control gene expression events in the nucleus, including alternative splicing decisions. Circular RNAs thus represent a large class of RNA molecules that are tightly regulated, and it is becoming increasingly clear that they likely impact many biological processes. This article is categorized under: RNA Processing > Splicing Mechanisms RNA Structure and Dynamics > Influence of RNA Structure in Biological Systems RNA Evolution and Genomics > RNA and Ribonucleoprotein Evolution RNA Evolution and Genomics > Computational Analyses of RNA.

Also flagged:IL-6ironiron overloadIO(IL)-6
Journal Article 2018-04-14 ✓ 5 Snippets Tetzlaff WF, Meroño T, Botta EE, Martín ME, Sorroche PB, Boero LE, Castro M, Frechtel GD, Rey J, Daruich J, Cerrone GE, Brites F.
In-Text Gene Mentions

In conclusion, CC homozygosis in the SNP - 174 G&gt;C gene promoter of IL-6 can be proposed as one of the gene variants influencing iron accumulation in male adults with HFE mutations.

hereditary hemochromatosis gene (HFE

…in the hereditaryhemochromatosisgene (HFE).…

…editary hemochromatosis gene (HFE).…

…of IO beyondHFEmutations.…

Show Full Abstract

Primary iron overload (IO) is commonly associated with mutations in the hereditary hemochromatosis gene (HFE). Nonetheless, other genetic variants may influence the development of IO beyond HFE mutations. There is a single nucleotide polymorphism (SNP) at - 174 G>C of the interleukin (IL)-6 gene which might be associated with primary IO. Our aim was to study the association between the SNP - 174 G>C gene promoter of IL-6 and primary IO in middle-aged male patients. We studied 37 men with primary IO diagnosed by liver histology. Controls were age-matched male volunteers (n = 37). HFE mutations and the SNP - 174 G>C gene promoter of IL-6 were evaluated by PCR-RFLP. Logistic regression was used to evaluate the association between primary IO and SNP - 174 G>C gene promoter of IL-6. Patients and control subjects were in Hardy-Weinberg equilibrium for the SNP - 174 G>C gene promoter of IL-6 (p = 0.17). Significantly different genotype frequencies were observed between patients (43% CC, 43% CG, and 14% GG) and control subjects (10% CC, 41% CG, and 49% GG) (OR = 4.09, 95% CI = 2.06-8.13; p < 0.0001). The multiple logistic regression analysis showed that IO was significantly associated with CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 (OR = 6.3, 95% CI = 1.9-21.4; p < 0.005) in a model adjusted by age and body mass index. In conclusion, CC homozygosis in the SNP - 174 G>C gene promoter of IL-6 can be proposed as one of the gene variants influencing iron accumulation in male adults with HFE mutations. Studies in larger cohorts are warranted.

Also flagged:huntingtincognitionHuntington's diseasecognitive changesdevelopmental disorderbrain development
Journal Article 2018-04-14 ✓ 5 Snippets Hannan AJ.
In-Text Gene Mentions

… in the huntingtin (HTT) gene and specific …

…The HTT gene first came to prominence 25 y…

…sociated TRP in the HTT gene is a modulator…

…ciation between the HTT CAG repeat length p…

…nes (independent of HTT) to depression, sug…

Show Full Abstract

No abstract available.

Also flagged:laryngeal granulomasrecurrent laryngeal granulomassteroidszincsulfategranulomas
Journal Article 2018-04-14 No Snippets Rimoli CF, Martins RHG, Catâneo DC, Imamura R, Catâneo AJM.
Show Full Abstract

<h4>Introduction</h4>Laryngeal granulomas post intubation are benign but recurrent lesions. There is no consensus for its treatment.<h4>Objective</h4>To describe the effectiveness of different treatment modalities for primary or recurrent laryngeal granulomas resulting from endotracheal intubation.<h4>Methods</h4>Systematic review and proportional meta-analysis. Eligibility criteria - experimental or observational studies with at least five subjects. Outcomes studied - granuloma resolution, recurrence, and time for resolution. Databases used - Pubmed, Embase, Lilacs, and Cochrane. The Stats Direct 3.0.121 program was used.<h4>Results</h4>Six studies were selected, with 85 patients. The treatments registered were: antireflux therapy, speech therapy, anti-inflammatory drugs, steroids, antibiotics, zinc sulfate and surgery. 85 patients from six studies had primary treatment: surgery±associations (41 patients), resolution chance 75% (95% CI: 0.3-100%, I<sup>2</sup>=90%), absolute relapse risk 25% (95% CI: 0.2-71%); medical treatment (44 patients), resolution chance 86% (95% CI: 67-97%); and absolute relapse risk 14% (95% CI: 3-33%). There was no significant difference between groups. Three studies, encompassing 19 patients, analyzed secondary treatment (failure or recurrence after primary treatment); three subjects presented new recurrence. The time needed to resolve the lesions varied from immediate, after surgery, to 23 months, for inhaled steroid.<h4>Conclusion</h4>There is no evidence of high quality that proves the efficacy of any treatment for laryngeal granulomas resulting from endotracheal intubation.

Also flagged:synthesismembrane proteinspolydimethylsiloxaneorganizationrhodamine Bfluorescein
Journal Article 2018-04-14 No Snippets Hayat Z, El Abed AI.
Show Full Abstract

Droplet optofluidics technology aims at manipulating the tiny volume of fluids confined in micro-droplets with light, while exploiting their interaction to create "digital" micro-systems with highly significant scientific and technological interests. Manipulating droplets with light is particularly attractive since the latter provides wavelength and intensity tunability, as well as high temporal and spatial resolution. In this review study, we focus mainly on recent methods developed in order to monitor real-time analysis of droplet size and size distribution, active merging of microdroplets using light, or to use microdroplets as optical probes.

Also flagged:Lactic AcidcancercancersB-cell lymphomalactate dehydrogenase ALDH-A
Journal Article 2018-04-13 No Snippets Mo X, Wei F, Tong Y, Ding L, Zhu Q, Du S, Tan F, Zhu C, Wang Y, Yu Q, Liu Y, Robertson ES, Yuan Z, Cai Q.
Show Full Abstract

High plasma lactate is associated with poor prognosis of many malignancies, but its role in virally mediated cancer progression and underlying molecular mechanisms are unclear. Epstein-Barr virus (EBV), the first human oncogenic virus, causes several cancers, including B-cell lymphoma. Here, we report that lactate dehydrogenase A (LDH-A) expression and lactate production are elevated in EBV-immortalized B lymphoblastic cells, and lactic acid (LA; acidic lactate) at low concentration triggers EBV-infected B-cell adhesion, morphological changes, and proliferation <i>in vitro</i> and <i>in vivo</i> Moreover, LA-induced responses of EBV-infected B cells uniquely occurs in viral latency type III, and it is dramatically associated with the inhibition of global viral microRNAs, particularly the miR-BHRF1 cluster, and the high expression of <i>SMAD3</i>, <i>JUN</i>, and <i>COL1A</i> genes. The introduction of miR-BHRF1-1 blocks the LA-induced effects of EBV-infected B cells. Thus, this may be a novel mechanism to explain EBV-immortalized B lymphoblastic cell malignancy in an LA microenvironment.<b>IMPORTANCE</b> The tumor microenvironment is complicated, and lactate, which is created by cell metabolism, contributes to an acidic microenvironment that facilitates cancer progression. However, how LA operates in virus-associated cancers is unclear. Thus, we studied how EBV (the first tumor virus identified in humans; it is associated with many cancers) upregulates the expression of LDH-A and lactate production in B lymphoma cells. Elevated LA induces adhesion and the growth of EBV-infected B cells by inhibiting viral microRNA transcription. Thus, we offer a novel understanding of how EBV utilizes an acidic microenvironment to promote cancer development.

Also flagged:Colorectal cancertumorColon cancercancertumorsadenomatous polyp
Journal Article 2018-04-13 No Snippets Testa U, Pelosi E, Castelli G.
Show Full Abstract

Colon cancer is the third most common cancer worldwide. Most colorectal cancer occurrences are sporadic, not related to genetic predisposition or family history; however, 20-30% of patients with colorectal cancer have a family history of colorectal cancer and 5% of these tumors arise in the setting of a Mendelian inheritance syndrome. In many patients, the development of a colorectal cancer is preceded by a benign neoplastic lesion: either an adenomatous polyp or a serrated polyp. Studies carried out in the last years have characterized the main molecular alterations occurring in colorectal cancers, showing that the tumor of each patient displays from two to eight driver mutations. The ensemble of molecular studies, including gene expression studies, has led to two proposed classifications of colorectal cancers, with the identification of four/five non-overlapping groups. The homeostasis of the rapidly renewing intestinal epithelium is ensured by few stem cells present at the level of the base of intestinal crypts. Various experimental evidence suggests that colorectal cancers may derive from the malignant transformation of intestinal stem cells or of intestinal cells that acquire stem cell properties following malignant transformation. Colon cancer stem cells seem to be involved in tumor chemoresistance, radioresistance and relapse.

Also flagged:chromosomeheterochromatinDicertelomeresDNA polymerasechromosomes
Journal Article 2018-04-13 No Snippets Begnis M, Apte MS, Masuda H, Jain D, Wheeler DL, Cooper JP.
Show Full Abstract

The identification of telomerase-negative HAATI (heterochromatin amplification-mediated and telomerase-independent) cells, in which telomeres are superseded by nontelomeric heterochromatin tracts, challenged the idea that canonical telomeres are essential for chromosome linearity and raised crucial questions as to how such tracts translocate to eroding chromosome ends and confer end protection. Here we show that HAATI arises when telomere loss triggers a newly recognized illegitimate translocation pathway that requires RNAi factors. While RNAi is necessary for the translocation events that mobilize ribosomal DNA (rDNA) tracts to all chromosome ends (forming "HAATI<sup>rDNA</sup>" chromosomes), it is dispensable for HAATI<sup>rDNA</sup> maintenance. Surprisingly, Dicer (Dcr1) plays a separate, RNAi-independent role in preventing formation of the rare HAATI subtype in which a different repetitive element (the subtelomeric element) replaces telomeres. Using genetics and fusions between shelterin components and rDNA-binding proteins, we mapped the mechanism by which rDNA loci engage crucial end protection factors-despite the absence of telomere repeats-and secure end protection. Sequence analysis of HAATI<sup>rDNA</sup> genomes allowed us to propose RNA and DNA polymerase template-switching models for the mechanism of RNAi-triggered rDNA translocations. Collectively, our results reveal unforeseen roles for noncoding RNAs (ncRNAs) in assembling a telomere-free chromosome end protection device.

Also flagged:Gene SilencingBrain TumorsGlioblastomaGBMbrain tumortumor
Journal Article 2018-04-13 ✓ 1 Snippet Osborn MF, Coles AH, Golebiowski D, Echeverria D, Moazami MP, Watts JK, Sena-Esteves M, Khvorova A.
In-Text Gene Mentions

HTT

Show Full Abstract

Glioblastoma (GBM) is the most common and lethal form of primary brain tumor with dismal median and 2-year survivals of 14.5 months and 18%, respectively. The paucity of new therapeutic agents stems from the complex biology of a highly adaptable tumor that uses multiple survival and proliferation mechanisms to circumvent current treatment approaches. Here, we investigated the potency of a new generation of siRNAs to silence gene expression in orthotopic brain tumors generated by transplantation of human glioma stem-like cells in athymic nude mice. We demonstrate that cholesterol-conjugated, nuclease-resistant siRNAs (Chol-hsiRNAs) decrease mRNA and silence luciferase expression by 90% <i>in vitro</i> in GBM neurospheres. Furthermore, Chol-hsiRNAs distribute broadly in brain tumors after a single intratumoral injection, achieving sustained and potent (>45% mRNA and >90% protein) tumor-specific gene silencing. This readily available platform is sequence-independent and can be adapted to target one or more candidate GBM driver genes, providing a straightforward means of modulating GBM biology <i>in vivo</i><i>Mol Cancer Ther; 17(6); 1251-8. ©2018 AACR</i>.

Also flagged:Amyloid fibrilsfibrilspathogenesisneurodegenerative disordersAlzheimer's diseaseParkinson's disease
Journal Article 2018-04-13 ✓ 2 Snippets Chuang E, Hori AM, Hesketh CD, Shorter J.
In-Text Gene Mentions

In HD, a CAG-repeat expansion in exon 1 of the Huntingtin gene encodes a polyglutamine (polyQ) repeat expansion in the N-terminal region of mutant huntingtin protein (Htt), accelerating amyloidogenesis (Scherzinger et al., 1997).

Glutamine repeat expansions readily form cross-β structures, as seen with polyQ expansions in Htt or in the ataxin 1 PrLD (Banfi et al., 1994; March et al., 2016; Perutz et al., 1994; Scherzinger et al., 1997).

Show Full Abstract

Amyloid fibrils are protein homopolymers that adopt diverse cross-β conformations. Some amyloid fibrils are associated with the pathogenesis of devastating neurodegenerative disorders, including Alzheimer's disease and Parkinson's disease. Conversely, functional amyloids play beneficial roles in melanosome biogenesis, long-term memory formation and release of peptide hormones. Here, we showcase advances in our understanding of amyloid assembly and structure, and how distinct amyloid strains formed by the same protein can cause distinct neurodegenerative diseases. We discuss how mutant steric zippers promote deleterious amyloidogenesis and aberrant liquid-to-gel phase transitions. We also highlight effective strategies to combat amyloidogenesis and related toxicity, including: (1) small-molecule drugs (e.g. tafamidis) to inhibit amyloid formation or (2) stimulate amyloid degradation by the proteasome and autophagy, and (3) protein disaggregases that disassemble toxic amyloid and soluble oligomers. We anticipate that these advances will inspire therapeutics for several fatal neurodegenerative diseases.

Also flagged:protein synthesisaxonsneurological diseasesneurological disordersLocalizationcell body
Journal Article 2018-04-13 No Snippets Sahoo PK, Smith DS, Perrone-Bizzozero N, Twiss JL.
Show Full Abstract

Localization and translation of mRNAs within different subcellular domains provides an important mechanism to spatially and temporally introduce new proteins in polarized cells. Neurons make use of this localized protein synthesis during initial growth, regeneration and functional maintenance of their axons. Although the first evidence for protein synthesis in axons dates back to 1960s, improved methodologies, including the ability to isolate axons to purity, highly sensitive RNA detection methods and imaging approaches, have shed new light on the complexity of the transcriptome of the axon and how it is regulated. Moreover, these efforts are now uncovering new roles for locally synthesized proteins in neurological diseases and injury responses. In this Cell Science at a Glance article and the accompanying poster, we provide an overview of how axonal mRNA transport and translation are regulated, and discuss their emerging links to neurological disorders and neural repair.

Also flagged:transferrin receptor 1TfR1degradationironbindingantibody
Journal Article 2018-04-13 ✓ 1 Snippet Leoh LS, Kim YK, Candelaria PV, Martínez-Maza O, Daniels-Wells TR, Penichet ML.
In-Text Gene Mentions

HFE

Show Full Abstract

The transferrin receptor 1 (TfR1) is an attractive target for Ab-mediated cancer therapy. We previously developed a mouse/human chimeric IgG3 Ab (ch128.1) targeting human TfR1, which exhibits direct in vitro cytotoxicity against certain human malignant B cells through TfR1 degradation and iron deprivation. ch128.1 also demonstrates exceptional antitumor activity against the B cell malignancy multiple myeloma (MM) in xenograft models of SCID-Beige mice bearing either disseminated ARH-77 or KMS-11 cells in an early disease setting. Interestingly, this activity is observed even against KMS-11 cells, which show no sensitivity to the direct cytotoxic activity of ch128.1 in vitro. To understand the contributions of the Fc fragment, we generated a ch128.1 mutant with impaired binding to FcγRs and to the complement component C1q, which retains binding to the neonatal Fc receptor. We now report that this mutant Ab does not show antitumor activity in these two MM models, indicating a crucial role of the Fc fragment in the antitumor activity of ch128.1, which can be attributed to effector functions (Ab-dependent cell-mediated cytotoxicity, Ab-dependent cell-mediated phagocytosis, and/or complement-dependent cytotoxicity). Interestingly, in the KMS-11 model, complement depletion does not affect protection, whereas macrophage depletion does. Consistent with this observation, we found that ch128.1 induces Ab-dependent cell-mediated cytotoxicity and Ab-dependent cell-mediated phagocytosis against KMS-11 cells in the presence of murine bone marrow-derived macrophages. Finally, we found that ch128.1 therapy effectively increases survival in a late MM disease setting. Our results suggest that macrophages play a major role in ch128.1-mediated antitumor protection in our models and that ch128.1 can be effective against human B cell malignancies such as MM.

Also flagged:ribosomal proteinsIL-10TNF-αimmune responseanti-inflammatory cytokinepro-inflammatory cytokine
Journal Article 2018-04-13 ✓ 3 Snippets Okamura Y, Makita N, Hizukuri Y, Hayashi Y.
In-Text Gene Mentions

…including Cnot1 andRc3h1, components of…

Rc3h1

Roquin-1

Show Full Abstract

Macrophages play a central role in the immune response, and their diverse functions are attributed to the spectrum of their functional states. To elucidate molecules involved in modulating the balance between the anti-inflammatory cytokine IL-10 and the pro-inflammatory cytokine TNF-α, we conducted genome-wide siRNA screening. First, we established an siRNA screening system using mouse bone marrow-derived macrophages, which are a suitable model for studying functional states of macrophages in vitro. In the primary screen and the subsequent reproducibility assay, 112 siRNA pools demonstrated enhancement of IL-10 production and 497 siRNA pools suppressed IL-10 production. After a deconvolution assay for IL-10-up-regulating siRNA pools, 8 genes were identified as IL-10 repressors, including Cnot1 and Rc3h1, components of the CCR4-NOT complex known to degrade cytokine mRNAs. On the other hand, siRNA pools targeting ribosomal proteins were frequently found among those that down-regulated IL-10 production and up-regulated TNF-α production. Four pools were assayed using deconvoluted siRNAs and identified as high-confidence hits. Thus, we found that the genome-wide knockdown of 19 ribosomal proteins resulted in decreased IL-10 and increased TNF-α production.

Also flagged:nicotinemetabolismgene expressionoral diseasesperiodontitisbone formation
Journal Article 2018-04-13 No Snippets Liang D, Wang KJ, Tang ZQ, Liu RH, Zeng F, Cheng MY, Lian QS, Wu HK.
Show Full Abstract

Smoking is a risk factor associated with bone and oral diseases, particularly periodontitis. Nicotine, the major toxic component of tobacco, is able to affect the quality and quantity of bone. Osteoblasts serve an important role in bone formation. Thus far, the effects of nicotine on metabolism‑associated gene and protein expression in osteoblasts have been controversial and the mechanisms remain unclear. The present study assessed alterations in osteogenic activity by performing a Cell Counting kit‑8 assay to investigate proliferation, Annexin V‑fluorescein isothiocyanate/propidium iodide staining to investigate apoptosis, alizarin red staining to investigate the formation of mineralized nodules, reverse transcription‑quantitative polymerase chain reaction and western blotting to investigate the mRNA and protein levels of collagen I, alkaline phosphatase, bone osteocalcin, bone sialoprotein and osteopontin; and mRNA microarray expression analysis, Kyoto Encyclopedia of Genes and Genomes and Gene Ontology analysis to investigate the whole genome expression profile of Sprague‑Dawley (SD) rat primary osteoblasts following treatment with different concentrations of nicotine. The results demonstrated that nicotine inhibited proliferation, promoted early apoptosis and inhibited mineralized nodule formation in a dose‑dependent manner by regulating alkaline phosphatase activity and the expression of osteoblast metabolism‑associated genes and proteins. According to microarray analysis, several genes associated with bone metabolism and genes in the Hedgehog and Notch signaling pathways were downregulated significantly in nicotine‑treated osteoblasts. The results of the present study indicated that nicotine may serve an inhibitory, dose‑dependent role in SD rat primary osteoblasts that may be caused by the perturbation of genes and signaling pathways associated with bone formation. These results may provide a theoretical basis for future research regarding bone metabolism and targeted treatment of oral diseases associated with smoking.

Also flagged:ProtonFibrosisnonalcoholic fatty liver diseaseNAFLDhepatic steatosisalcohol
Journal Article 2018-04-13 ✓ 1 Snippet Ajmera V, Park CC, Caussy C, Singh S, Hernandez C, Bettencourt R, Hooker J, Sy E, Behling C, Xu R, Middleton MS, Valasek MA, Faulkner C, Rizo E, Richards L, Sirlin CB, Loomba R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Markers are needed to predict progression of nonalcoholic fatty liver disease (NAFLD). The proton density fat fraction, measured by magnetic resonance imaging (MRI-PDFF), provides an accurate, validated marker of hepatic steatosis; however, it is not clear whether the PDFF identifies patients at risk for NAFLD progression. We performed a follow-up study of 95 well-characterized patients with biopsy-proven NAFLD and examined the association between liver fat content and fibrosis progression. MRI-PDFF measurements were made at study entry (baseline). Biopsies were collected from patients at baseline and after a mean time period of 1.75 years. Among patients with no fibrosis at baseline, a higher proportion of patients in the higher liver fat group (MRI-PDFF ≥15.7%) had fibrosis progression (38.1%) than in the lower liver fat group (11.8%) (P = .067). In multivariable-adjusted logistic regression models (adjusted for age, sex, ethnicity, and body mass index), patients in the higher liver fat group had a significantly higher risk of fibrosis progression (multivariable-adjusted odds ratio 6.7; 95% confidence interval 1.01-44.1; P = .049). Our findings associate higher liver fat content, measured by MRI-PDFF, with fibrosis progression.

Also flagged:schizophreniaIL-1βIL-6IL-8TNF-αbrain-derived neurotrophic factor
Journal Article 2018-04-13 ✓ 2 Snippets Mohammadi A, Rashidi E, Amooeian VG.
In-Text Gene Mentions

The levels of dopamine, tyrosine hydroxylase (TH), serotonin or 5-hydroxytryptamine (5-HT) receptor 1A and B (5-HTR1A and 5-HTR1B), and 5-HT1B were significantly increased in Scz patients, while the levels of gamma-aminobutyric acid (GABA), 5-HT transporter (5-HTT), and 5-HT receptor 2A (5-HTR2A) were decreased.

…(GABA), 5-HT transporter (5-HTT), and 5-HT receptor…

Show Full Abstract

Over the last decade, finding a reliable biomarker for the early detection of schizophrenia (Scz) has been a topic of interest. The main goal of the current review is to provide a comprehensive view of the brain, blood, cerebrospinal fluid (CSF), and serum biomarkers of Scz disease. Imaging studies have demonstrated that the volumes of the corpus callosum, thalamus, hippocampal formation, subiculum, parahippocampal gyrus, superior temporal gyrus, prefrontal and orbitofrontal cortices, and amygdala-hippocampal complex were reduced in patients diagnosed with Scz. It has been revealed that the levels of interleukin 1β (IL-1β), IL-6, IL-8, and TNF-α were increased in patients with Scz. Decreased mRNA levels of brain-derived neurotrophic factor (BDNF), tropomyosin receptor kinase B (TrkB), neurotrophin-3 (NT-3), nerve growth factor (NGF), and vascular endothelial growth factor (VEGF) genes have also been reported in Scz patients. Genes with known strong relationships with this disease include BDNF, catechol-O-methyltransferase (COMT), regulator of G-protein signaling 4 (RGS4), dystrobrevin-binding protein 1 (DTNBP1), neuregulin 1 (NRG1), Reelin (RELN), Selenium-binding protein 1 (SELENBP1), glutamic acid decarboxylase 67 (GAD 67), and disrupted in schizophrenia 1 (DISC1). The levels of dopamine, tyrosine hydroxylase (TH), serotonin or 5-hydroxytryptamine (5-HT) receptor 1A and B (5-HTR1A and 5-HTR1B), and 5-HT1B were significantly increased in Scz patients, while the levels of gamma-aminobutyric acid (GABA), 5-HT transporter (5-HTT), and 5-HT receptor 2A (5-HTR2A) were decreased. The increased levels of SELENBP1 and Glycogen synthase kinase 3 subunit α (GSK3α) genes in contrast with reduced levels of B-cell translocation gene 1 (BTG1), human leukocyte antigen DRB1 (HLA-DRB1), heterogeneous nuclear ribonucleoprotein A3 (HNRPA3), and serine/arginine-rich splicing factor 1 (SFRS1) genes have also been reported. This review covers various dysregulation of neurotransmitters and also highlights the strengths and weaknesses of studies attempting to identify candidate biomarkers.

Also flagged:brain diseasegene expressionextracellularorganizationsynapsesaxons
Journal Article 2018-04-13 ✓ 2 Snippets Grégoire CA, Tobin S, Goldenstein BL, Samarut É, Leclerc A, Aumont A, Drapeau P, Fulton S, Fernandes KJL.
In-Text Gene Mentions

…transporters ( Trpm3,Cacna1e, Atp2b4 ), the…

…Dgki, Dgkh, Atp2b4,Cacna1e) and cGMP/PKG…

Show Full Abstract

Environmental enrichment (EE) is a powerful stimulus of brain plasticity and is among the most accessible treatment options for brain disease. In rodents, EE is modeled using multi-factorial environments that include running, social interactions, and/or complex surroundings. Here, we show that running and running-independent EE differentially affect the hippocampal dentate gyrus (DG), a brain region critical for learning and memory. Outbred male CD1 mice housed individually with a voluntary running disk showed improved spatial memory in the radial arm maze compared to individually- or socially-housed mice with a locked disk. We therefore used RNA sequencing to perform an unbiased interrogation of DG gene expression in mice exposed to either a voluntary running disk (RUN), a locked disk (LD), or a locked disk plus social enrichment and tunnels [i.e., a running-independent complex environment (CE)]. RNA sequencing revealed that RUN and CE mice showed distinct, non-overlapping patterns of transcriptomic changes versus the LD control. Bio-informatics uncovered that the RUN and CE environments modulate separate transcriptional networks, biological processes, cellular compartments and molecular pathways, with RUN preferentially regulating synaptic and growth-related pathways and CE altering extracellular matrix-related functions. Within the RUN group, high-distance runners also showed selective stress pathway alterations that correlated with a drastic decline in overall transcriptional changes, suggesting that excess running causes a stress-induced suppression of running's genetic effects. Our findings reveal stimulus-dependent transcriptional signatures of EE on the DG, and provide a resource for generating unbiased, data-driven hypotheses for novel mediators of EE-induced cognitive changes.

Also flagged:DNA MethyltranferasesUrological cancerscancermethylationtumorstumor
Journal Article 2018-04-13 ✓ 1 Snippet Marques-Magalhães Â, Graça I, Henrique R, Jerónimo C.
In-Text Gene Mentions

TRAMP C1C1 cells exposure…

Show Full Abstract

Urological cancers are a heterogeneous group of malignancies accounting for a considerable proportion of cancer-related morbidity and mortality worldwide. Aberrant epigenetic traits, especially altered DNA methylation patterns constitute a hallmark of these tumors. Nonetheless, these alterations are reversible, and several efforts have been carried out to design and test several epigenetic compounds that might reprogram tumor cell phenotype back to a normal state. Indeed, several DNMT inhibitors are currently under evaluation for therapeutic efficacy in clinical trials. This review highlights the critical role of DNA methylation in urological cancers and summarizes the available data on pre-clinical assays and clinical trials with DNMT inhibitors in bladder, kidney, prostate, and testicular germ cell cancers.

Also flagged:colon cancerproteasecolorectal tumorsCancertumorprimary tumors
Journal Article 2018-04-13 ✓ 1 Snippet Trumpi K, Frenkel N, Peters T, Korthagen NM, Jongen JMJ, Raats D, van Grevenstein H, Backes Y, Moons LM, Lacle MM, Koster J, Zwijnenburg D, Borel Rinkes IHM, Kranenburg O.
In-Text Gene Mentions

…markers OCT4 andOLFM4, and decreased expression…

Show Full Abstract

Primary human colorectal tumors with a high stromal content have an increased capacity to metastasize. Cancer-associated fibroblasts (CAFs) promote metastasis, but the contribution of other stromal cell types is unclear. Here we searched for additional stromal cell types that contribute to aggressive tumor cell behavior. By making use of the 'immunome compendium'-a collection of gene signatures reflecting the presence of specific immune cell-types-we show that macrophage signatures are most strongly associated with a high CAF content and with poor prognosis in multiple large cohorts of primary tumors and liver metastases. Co-culturing macrophages with patient-derived colonospheres promoted 'budding' of small clusters of tumor cells from the bulk. Immunohistochemistry showed that budding tumor clusters in stroma-rich areas of T1 colorectal carcinomas were surrounded by macrophages. <i>In vitro</i> budding was accompanied by reduced levels of the tight junction protein occludin, but <i>OCLN</i> mRNA levels did not change, nor did markers of epithelial mesenchymal transition. Budding was accompanied by nuclear accumulation of β-catenin, which was also observed in budding tumor cell clusters <i>in situ</i>. The NFκB inhibitor Sanguinarine resulted in a decrease in MMP7 protein expression and both NFκB inhibitor Sanguinarine and MMP inhibitor Batimastat prevented occludin degradation and budding. We conclude that macrophages contribute to the aggressive nature of stroma-rich colon tumors by promoting an MMP-dependent pathway that operates in parallel to classical EMT and leads to tight junction disruption.

Also flagged:Endoplasmic reticulumorganellelipidprotein biosynthesiscalciumdetoxification
Journal Article 2018-04-13 ✓ 1 Snippet Fregno I, Molinari M.
In-Text Gene Mentions

…SEC62, RTN3, andCCPG1) ER-phagy receptors and…

Show Full Abstract

The endoplasmic reticulum (ER) is a highly dynamic organelle in eukaryotic cells. It is deputed to lipid and protein biosynthesis, calcium storage, and the detoxification of various exogenous and endogenous harmful compounds. ER activity and size must be adapted rapidly to environmental and developmental conditions or biosynthetic demand. This is achieved on induction of thoroughly studied transcriptional/translational programs defined as "unfolded protein responses" that increase the ER volume and the expression of ER-resident proteins regulating the numerous ER functions. Less understood are the lysosomal catabolic processes that maintain ER size at steady state, that prevent excessive ER expansion during ER stresses, or that ensure return to physiologic ER size during recovery from ER stresses. These catabolic processes may also be activated to remove ER subdomains where proteasome-resistant misfolded proteins or damaged lipids have been segregated. Insights into these catabolic mechanisms have only recently emerged with the identification of so-called ER-phagy receptors, which label specific ER subdomains for selective lysosomal delivery for clearance. Here, in eight chapters and one addendum, we comment on recent advances in ER turnover pathways induced by ER stress, nutrient deprivation, misfolded proteins, and live bacteria. We highlight the role of yeast (Atg39 and Atg40) and mammalian (FAM134B, SEC62, RTN3, and CCPG1) ER-phagy receptors and of autophagy genes in selective and non-selective catabolic processes that regulate cellular proteostasis by controlling ER size, turnover, and function.

Also flagged:cardiovascular diseaseCFTRagingLPPLPcancer
Journal Article 2018-04-13 ✓ 3 Snippets Butler Iii RR, Gejman PV.
In-Text Gene Mentions

…Hereditary hemochromatosis,” “Hemochromatosis type 1type 1,” “Hemochromatosis…

…“Hemochromatosis type 1,” “Hemochromatosis type 1type 1 (Autosomal…

…mal recessive inheritance),” “Hemochromatosisjuvenile digenic,” and…

Show Full Abstract

While ClinVar has become an indispensable resource for clinical variant interpretation, its sophisticated structure provides it with a daunting learning curve. Often the sheer depth of types of information provided can make it difficult to analyze variant information with high throughput. Clinotator is a fast and lightweight tool to extract important aspects of criteria-based clinical assertions; it uses that information to generate several metrics to assess the strength and consistency of the evidence supporting the variant clinical significance. Clinical assertions are weighted by significance type, age of submission and submitter expertise category to filter outdated or incomplete assertions that otherwise confound interpretation. This can be accomplished in batches: either lists of Variation IDs or dbSNP rsIDs, or with vcf files that are additionally annotated. Using sample sets ranging from 15,000-50,000 variants, we slice out problem variants in minutes without extensive computational effort (using only a personal computer) and corroborate recently reported trends of discordance hiding amongst the curated masses. With the rapidly growing body of variant evidence, most submitters and researchers have limited resources to devote to variant curation. Clinotator provides efficient, systematic prioritization of discordant variants in need of reclassification. The hope is that this tool can inform ClinVar curation and encourage submitters to keep their clinical assertions current by focusing their efforts. Additionally, researchers can utilize new metrics to analyze variants of interest in pursuit of new insights into pathogenicity.

F1000Res 2018-04-13 Preprint (No Snippets API) Fregno I, Molinari M.
Show Full Abstract

The endoplasmic reticulum (ER) is a highly dynamic organelle in eukaryotic cells. It is deputed to lipid and protein biosynthesis, calcium storage, and the detoxification of various exogenous and endogenous harmful compounds. ER activity and size must be adapted rapidly to environmental and developmental conditions or biosynthetic demand. This is achieved on induction of thoroughly studied transcriptional/translational programs defined as “unfolded protein responses” that increase the ER volume and the expression of ER-resident proteins regulating the numerous ER functions. Less understood are the lysosomal catabolic processes that maintain ER size at steady state, that prevent excessive ER expansion during ER stresses, or that ensure return to physiologic ER size during recovery from ER stresses. These catabolic processes may also be activated to remove ER subdomains where proteasome-resistant misfolded proteins or damaged lipids have been segregated. Insights into these catabolic mechanisms have only recently emerged with the identification of so-called ER-phagy receptors, which label specific ER subdomains for selective lysosomal delivery for clearance. Here, in eight chapters and one addendum, we comment on recent advances in ER turnover pathways induced by ER stress, nutrient deprivation, misfolded proteins, and live bacteria. We highlight the role of yeast (Atg39 and Atg40) and mammalian (FAM134B, SEC62, RTN3, and CCPG1) ER-phagy receptors and of autophagy genes in selective and non-selective catabolic processes that regulate cellular proteostasis by controlling ER size, turnover, and function.

Also flagged:colon cancercancertumorcolon tumorschromosomeCD44
Journal Article 2018-04-12 ✓ 1 Snippet Liu M, Di J, Liu Y, Su Z, Jiang B, Wang Z, Su X.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Cancer stem cells (CSCs) are considered to be responsible for tumorigenesis and cancer relapse. EpCAM<sup>high</sup>CD44<sup>+</sup> tumor cells are putative colorectal CSCs that express high levels of stem cell genes, while the EpCAM<sup>high</sup>CD44<sup>-</sup> population mostly contains differentiated tumor cells (DTCs). This study aims to determine whether single CSC (EpCAM<sup>high</sup>CD44<sup>+</sup>) and DTC (EpCAM<sup>high</sup>CD44<sup>-</sup>) can be distinguished in terms of somatic copy number alterations (SCNAs). We applied fluorescence-activated cell sorting to isolate the CD45<sup>-</sup>EpCAM<sup>high</sup>CD44<sup>+</sup> and CD45<sup>-</sup>EpCAM<sup>high</sup>CD44<sup>-</sup> populations from two primary colon tumors, on which low-coverage single-cell whole-genome sequencing (WGS) was then performed ∼0.1x depth. We compared the SCNAs of the CSCs and DTCs at single-cell resolution. In total, 47 qualified single cells of the two populations underwent WGS. The single-cell SCNA profiles showed that there were obvious SCNAs in both the CSCs and DTCs of each patient, and each patient had a specific copy number alteration pattern. Hierarchical clustering and correlation analysis both showed that the SCNA profiles of CSCs and DTCs from the same patient had similar SCNA pattern, while there were regional differences in the CSCs and DTCs in certain patient. SCNAs of CSCs in the same patient were highly reproducible. Our data suggest that major SCNAs occurred at an early stage and were inherited steadily. The similarity of ubiquitous SCNAs between the CSCs and DTCs might have arisen from lineage differentiation. CSCs from the same patient had reproducible SCNA profiles, indicating that gain or loss in certain chromosome is required for colon cancer development.

Also flagged:DISC1EN-1SynapsinIsl1BACE1BACE2
Journal Article 2018-04-12 ✓ 5 Snippets Srikanth P, Lagomarsino VN, Muratore CR, Ryu SC, He A, Taylor WM, Zhou C, Arellano M, Young-Pearse TL.
In-Text Gene Mentions

POU3F2

…to neuronal development,POU3F2/BRN2 and CALB1 .…

…rse, gcccatactgatccacaaaagtt),POU3F2/BRN2 (forward, cggcggatcaaact…

…II–V neuronal marker BRN2/POU3F2, which has been…

…of BRN2 /POU3F2, Calretinin (…

Show Full Abstract

The development of three-dimensional culture methods has allowed for the study of developing cortical morphology in human cells. This provides a new tool to study the neurodevelopmental consequences of disease-associated mutations. Here, we study the effects of isogenic DISC1 mutation in cerebral organoids. DISC1 has been implicated in psychiatric disease based on genetic studies, including its interruption by a balanced translocation that increases the risk of major mental illness. Isogenic wild-type and DISC1-disrupted human-induced pluripotent stem cells were used to generate cerebral organoids, which were then examined for morphology and gene expression. We show that DISC1-mutant cerebral organoids display disorganized structural morphology and impaired proliferation, which is phenocopied by WNT agonism and rescued by WNT antagonism. Furthermore, there are many shared changes in gene expression with DISC1 disruption and WNT agonism, including in neural progenitor and cell fate markers, regulators of neuronal migration, and interneuron markers. These shared gene expression changes suggest mechanisms for the observed morphologic dysregulation with DISC1 disruption and points to new avenues for future studies. The shared changes in three-dimensional cerebral organoid morphology and gene expression with DISC1 interruption and WNT agonism further strengthens the link between DISC1 mutation, abnormalities in WNT signaling, and neuropsychiatric disease.

Also flagged:SynthesisHydroxyapatiteCalcium PhosphateCurcuminalkaline phosphatasebone remodeling
Journal Article 2018-04-12 No Snippets Xidaki D, Agrafioti P, Diomatari D, Kaminari A, Tsalavoutas-Psarras E, Alexiou P, Psycharis V, Tsilibary EC, Silvestros S, Sagnou M.
Show Full Abstract

The successful synthesis of hydroxyapatite (HA), β-Tricalcium phosphate (β-TCP) and two biphasic mixtures (BCPs) of the two was performed by means of wet precipitation. The resulting crystals were characterized and the BCP composition was analyzed and identified as 13% HA-87% TCP and 41% HA-59% TCP. All samples were treated with curcumin solutions, and the degree of curcumin loading and release was found to be proportional to the TCP content of the ceramic. No further cytotoxicity was observed upon MG-63 treatment with the curcumin-loaded ceramics. Finally, the alkaline phosphatase activity of the cells was found to increase with increasing content of TCP, which provides an encouraging proof of concept for the use of curcumin-loaded synthetic biomaterials in bone remodeling.

Also flagged:EstrogenTriclosanestrogen receptorERaromatasegene expression
Journal Article 2018-04-12 ✓ 1 Snippet Serra H, Brion F, Porcher JM, Budzinski H, Aït-Aïssa S.
In-Text Gene Mentions

Briefly, ZELH-zfERs cells were seeded in 96-well white opaque culture plates (Greiner CellStarTM, Dominique Dutscher, Brumath, France) at 25,000 cells per well in phenol red free LDF-DCC medium (containing 50% of L-15, 35% of DMEM HG, 15% of Ham’s F12, 15 mM of HEPES, 0.15 g/L of sodium bicarbonate, 0.01 mg/mL of insulin, 50 ng/mL of EGF, 50 U/mL of penicillin and streptomycin antibiotics, and 5% v/v stripped FCS).

Show Full Abstract

Triclosan (TCS), an antimicrobial agent widely found in the aquatic environment, is suspected to act as an endocrine disrupting compound, however mechanistic information is lacking in regards to aquatic species. This study assessed the ability of TCS to interfere with estrogen receptor (ER) transcriptional activity, in zebrafish-specific in vitro and in vivo reporter gene assays. We report that TCS exhibits a lack of either agonistic or antagonistic effects on a panel of ER-expressing zebrafish (ZELH-zfERα and -zfERβ) and human (MELN) cell lines. At the organism level, TCS at concentrations of up to 0.3 µM had no effect on ER-regulated brain aromatase gene expression in transgenic cyp19a1b-GFP zebrafish embryos. At a concentration of 1 µM, TCS interfered with the E2 response in an ambivalent manner by potentializing a low E2 response (0.625 nM), but decreasing a high E2 response (10 nM). Altogether, our study suggests that while modulation of ER-regulated genes by TCS may occur in zebrafish, it does so irrespective of a direct binding and activation of zfERs.

Also flagged:epilepsygene expressionDNase Ineurological disorderSCN1Ageneralized epilepsy
Journal Article 2018-04-12 No Snippets Monlong J, Girard SL, Meloche C, Cadieux-Dion M, Andrade DM, Lafreniere RG, Gravel M, Spiegelman D, Dionne-Laporte A, Boelman C, Hamdan FF, Michaud JL, Rouleau G, Minassian BA, Bourque G, Cossette P.
Show Full Abstract

Epilepsy will affect nearly 3% of people at some point during their lifetime. Previous copy number variants (CNVs) studies of epilepsy have used array-based technology and were restricted to the detection of large or exonic events. In contrast, whole-genome sequencing (WGS) has the potential to more comprehensively profile CNVs but existing analytic methods suffer from limited accuracy. We show that this is in part due to the non-uniformity of read coverage, even after intra-sample normalization. To improve on this, we developed PopSV, an algorithm that uses multiple samples to control for technical variation and enables the robust detection of CNVs. Using WGS and PopSV, we performed a comprehensive characterization of CNVs in 198 individuals affected with epilepsy and 301 controls. For both large and small variants, we found an enrichment of rare exonic events in epilepsy patients, especially in genes with predicted loss-of-function intolerance. Notably, this genome-wide survey also revealed an enrichment of rare non-coding CNVs near previously known epilepsy genes. This enrichment was strongest for non-coding CNVs located within 100 Kbp of an epilepsy gene and in regions associated with changes in the gene expression, such as expression QTLs or DNase I hypersensitive sites. Finally, we report on 21 potentially damaging events that could be associated with known or new candidate epilepsy genes. Our results suggest that comprehensive sequence-based profiling of CNVs could help explain a larger fraction of epilepsy cases.

Also flagged:idiopathic pulmonary fibrosischronic lung diseaseinterstitial fibrosispulmonary hypertensionironmacrophage activation
Journal Article 2018-04-12 ✓ 1 Snippet Lee J, Arisi I, Puxeddu E, Mramba LK, Amicosante M, Swaisgood CM, Pallante M, Brantly ML, Sköld CM, Saltini C.
In-Text Gene Mentions

…variant of theHFE hemochromatosishemochromatosis gene […

Show Full Abstract

Idiopathic pulmonary fibrosis (IPF) is a chronic lung disease of unknown cause characterized by alveolar epithelial damage, patchy interstitial fibrosis and diffuse microvascular abnormalities. In IPF, alveolar clustering of iron-laden alveolar macrophages-a common sign of microhemorrhage, has been associated with vascular abnormalities and worsening of pulmonary hypertension. As iron-dependent ROS generation has been shown to induce unrestrained macrophage activation in disease models of vascular damage, we explored alveolar macrophage activation phenotype in IPF patients (n = 16) and healthy controls (CTR, n = 7) by RNA sequencing of bronchoalveolar lavage (BAL) cells. The frequencies of macrophages in BAL cells were 86+4% and 83.4+8% in IPF and CTR groups, respectively (p-value = 0.41). In IPF patients, BAL cells showed increased iron-dependent ROS generation (p-value<0.05 vs CTR). Gene expression analysis showed overrepresentation of Gene Ontology processes/functions and KEGG pathways enriched in upregulated M1-type inflammatory (p-value<0.01), M2-type anti-inflammatory/tissue remodeling (p-value<0.0001), and MTPP-type chronic inflammatory/angiogenic (p-value<0.0001) chemokine and cytokine genes. The ex vivo finding was confirmed by the induction of iron-dependent ROS generation and chemokine/cytokine overexpression of Ccl4, Cxcl10 (M1), Il1rn (M2), Cxcl2, and Cxcl7 (MTPP) in MH-S murine immortalized alveolar macrophages exposed to ferric ammonium citrate in culture (p-value<0.05 vs CTR). The data show alveolar macrophage expression of a pro-inflammatory, tissue remodeling and angiogenic complex activation pattern, suggesting that iron accumulation may play a role in macrophage activation.

Also flagged:HMGB1coagulationthrombophiliapreeclampsiaPEhigh-mobility group box 1
Journal Article 2018-04-12 ✓ 1 Snippet Hu Y, Yan R, Zhang C, Zhou Z, Liu M, Wang C, Zhang H, Dong L, Zhou T, Wu Y, Dong N, Wu Q.
In-Text Gene Mentions

ATIII

Show Full Abstract

<h4>Objective</h4>Thrombophilia is a major complication in preeclampsia, a disease associated with placental hypoxia and trophoblast inflammation. Preeclampsia women are known to have increased circulating microparticles that are procoagulant, but the underlying mechanisms remain unclear. In this study, we sought to understand the mechanism connecting placental hypoxia, circulating microparticles, and thrombophilia.<h4>Approach and results</h4>We analyzed protein markers on plasma microparticles from preeclampsia women and found that the increased circulating microparticles were mostly from endothelial cells. In proteomic studies, we identified HMGB1 (high-mobility group box 1), a proinflammatory protein, as a key factor from hypoxic trophoblasts in stimulating microparticle production in human umbilical vein endothelial cells. Immunodepletion or inhibition of HMGB1 in the conditioned medium from hypoxic human trophoblasts abolished the endothelial microparticle-stimulating activity. Conversely, recombinant HMGB1 stimulated microparticle production in cultured human umbilical vein endothelial cells. The microparticles from recombinant HMGB1-stimulated human umbilical vein endothelial cells promoted blood coagulation and neutrophil activation in vitro. Injection of recombinant HMGB1 in pregnant mice increased plasma endothelial microparticles and promoted blood coagulation. In preeclampsia women, elevated placental HMGB1 expression was detected and high levels of plasma HMGB1 correlated with increased plasma endothelial microparticles.<h4>Conclusions</h4>Our results indicate that placental hypoxia-induced HMGB1 expression and release from trophoblasts are important mechanism underlying increased circulating endothelial microparticles and thrombophilia in preeclampsia.

Also flagged:cell differentiationSTAT3Tripartite motif containing 28cytokineautoimmune diseasesTRIM28
Journal Article 2018-04-12 ✓ 1 Snippet Jiang Y, Liu Y, Lu H, Sun SC, Jin W, Wang X, Dong C.
In-Text Gene Mentions

…protein to recruitchromatin modifiersmodifiers like CHD3/Mi2…

Show Full Abstract

Epigenetic regulation is important for T-cell fate decision. Although STAT3 is known to initiate Th17 differentiation program, the downstream mechanism is unclear. Here we show that Tripartite motif containing 28 (Trim28) expression in Th17 cells is required for Th17-mediated cytokine production and experimental autoimmune diseases. Genome-wide occupancy analysis reveals that TRIM28-bound regions overlap with almost all Th17-specific super-enhancers (SE), and that those SEs are impaired by the deficiency of STAT3 or TRIM28, but not of RORγt. Importantly, IL-6-STAT3 signaling facilitates TRIM28 binding to the Il17-Il17f locus, and this process is required for epigenetic activation and high-order chromosomal interaction. TRIM28 also forms a complex with STAT3 and RORγt, and promotes the recruitment of RORγt to its target cytokine genes. Our study thus suggests TRIM28 to be important for the epigenetic activation during Th17 cell differentiation, and prompts the potential use of epigenetic interventions for Th17-related autoimmune diseases.

Also flagged:infectionpathogenesisgene transfersmallfumarylacetoacetate hydrolaseantibiotic biosynthesis
Journal Article 2018-04-12 ✓ 1 Snippet Zhang N, Cai G, Price DC, Crouch JA, Gladieux P, Hillman B, Khang CH, LeBrun MH, Lee YH, Luo J, Qiu H, Veltri D, Wisecaver JH, Zhu J, Bhattacharya D.
In-Text Gene Mentions

…capping , GO:0000118histone deacetylase complexdeacetylase complex, GO:005156…

Show Full Abstract

The rice blast fungus Pyricularia oryzae (syn. Magnaporthe oryzae, Magnaporthe grisea), a member of the order Magnaporthales in the class Sordariomycetes, is an important plant pathogen and a model species for studying pathogen infection and plant-fungal interaction. In this study, we generated genome sequence data from five additional Magnaporthales fungi including non-pathogenic species, and performed comparative genome analysis of a total of 13 fungal species in the class Sordariomycetes to understand the evolutionary history of the Magnaporthales and of fungal pathogenesis. Our results suggest that the Magnaporthales diverged ca. 31 millon years ago from other Sordariomycetes, with the phytopathogenic blast clade diverging ca. 21 million years ago. Little evidence of inter-phylum horizontal gene transfer (HGT) was detected in Magnaporthales. In contrast, many genes underwent positive selection in this order and the majority of these sequences are clade-specific. The blast clade genomes contain more secretome and avirulence effector genes, which likely play key roles in the interaction between Pyricularia species and their plant hosts. Finally, analysis of transposable elements (TE) showed differing proportions of TE classes among Magnaporthales genomes, suggesting that species-specific patterns may hold clues to the history of host/environmental adaptation in these fungi.

Also flagged:metabolismOAdegradationsodiumfluorideosteoarthritis
Journal Article 2018-04-12 No Snippets Kogan F, Fan AP, Monu U, Iagaru A, Hargreaves BA, Gold GE.
Show Full Abstract

<h4>Objective</h4>To investigate changes in bone metabolism by positron emission tomography (PET), as well as spatial relationships between bone metabolism and magnetic resonance imaging (MRI) quantitative markers of early cartilage degradation, in anterior cruciate ligament (ACL)-reconstructed knees.<h4>Design</h4>Both knees of 15 participants with unilateral reconstructed ACL tears and unaffected contralateral knees were scanned using a simultaneous 3.0T PET-MRI system following injection of <sup>18</sup>F-sodium fluoride (<sup>18</sup>F-NaF). The maximum pixel standardized uptake value (SUV<sub>max</sub>) in the subchondral bone and the average T<sub>2</sub> relaxation time in cartilage were measured in each knee in eight knee compartments. We tested differences in SUV<sub>max</sub> and cartilage T<sub>2</sub> relaxation times between the ACL-injured knee and the contralateral control knee as well as spatial relationships between these bone and cartilage changes.<h4>Results</h4>Significantly increased subchondral bone <sup>18</sup>F-NaF SUV<sub>max</sub> and cartilage T<sub>2</sub> times were observed in the ACL-reconstructed knees (median [inter-quartile-range (IQR)]: 5.0 [5.8], 36.8 [3.6] ms) compared to the contralateral knees (median [IQR]: 1.9 [1.4], 34.4 [3.8] ms). A spatial relationship between the two markers was also seen. Using the contralateral knee as a control, we observed a significant correlation of r = 0.59 between the difference in subchondral bone SUV<sub>max</sub> (between injured and contralateral knees) and the adjacent cartilage T<sub>2</sub> (between the two knees) [P < 0.001], with a slope of 0.49 ms/a.u. This correlation and slope were higher in deep layers (r = 0.73, slope = 0.60 ms/a.u.) of cartilage compared to superficial layers (r = 0.40, slope = 0.43 ms/a.u.).<h4>Conclusions</h4><sup>18</sup>F-NaF PET-MR imaging enables detection of increased subchondral bone metabolism in ACL-reconstructed knees and may serve as an important marker of early osteoarthritis (OA) progression. Spatial relationships observed between early OA changes across bone and cartilage support the need to study whole-joint disease mechanisms in OA.

Also flagged:NAA15Autism Spectrum Disorderco-translational proteinN-terminal acetyltransferase AbindingNAA10
Journal Article 2018-04-12 No Snippets Cheng H, Dharmadhikari AV, Varland S, Ma N, Domingo D, Kleyner R, Rope AF, Yoon M, Stray-Pedersen A, Posey JE, Crews SR, Eldomery MK, Akdemir ZC, Lewis AM, Sutton VR, Rosenfeld JA, Conboy E, Agre K, Xia F, Walkiewicz M, Longoni M, High FA, van Slegtenhorst MA, Mancini GMS, Finnila CR, van Haeringen A, den Hollander N, Ruivenkamp C, Naidu S, Mahida S, Palmer EE, Murray L, Lim D, Jayakar P, Parker MJ, Giusto S, Stracuzzi E, Romano C, Beighley JS, Bernier RA, Küry S, Nizon M, Corbett MA, Shaw M, Gardner A, Barnett C, Armstrong R, Kassahn KS, Van Dijck A, Vandeweyer G, Kleefstra T, Schieving J, Jongmans MJ, de Vries BBA, Pfundt R, Kerr B, Rojas SK, Boycott KM, Person R, Willaert R, Eichler EE, Kooy RF, Yang Y, Wu JC, Lupski JR, Arnesen T, Cooper GM, Chung WK, Gecz J, Stessman HAF, Meng L, Lyon GJ.
Show Full Abstract

N-alpha-acetylation is a common co-translational protein modification that is essential for normal cell function in humans. We previously identified the genetic basis of an X-linked infantile lethal Mendelian disorder involving a c.109T>C (p.Ser37Pro) missense variant in NAA10, which encodes the catalytic subunit of the N-terminal acetyltransferase A (NatA) complex. The auxiliary subunit of the NatA complex, NAA15, is the dimeric binding partner for NAA10. Through a genotype-first approach with whole-exome or genome sequencing (WES/WGS) and targeted sequencing analysis, we identified and phenotypically characterized 38 individuals from 33 unrelated families with 25 different de novo or inherited, dominantly acting likely gene disrupting (LGD) variants in NAA15. Clinical features of affected individuals with LGD variants in NAA15 include variable levels of intellectual disability, delayed speech and motor milestones, and autism spectrum disorder. Additionally, mild craniofacial dysmorphology, congenital cardiac anomalies, and seizures are present in some subjects. RNA analysis in cell lines from two individuals showed degradation of the transcripts with LGD variants, probably as a result of nonsense-mediated decay. Functional assays in yeast confirmed a deleterious effect for two of the LGD variants in NAA15. Further supporting a mechanism of haploinsufficiency, individuals with copy-number variant (CNV) deletions involving NAA15 and surrounding genes can present with mild intellectual disability, mild dysmorphic features, motor delays, and decreased growth. We propose that defects in NatA-mediated N-terminal acetylation (NTA) lead to variable levels of neurodevelopmental disorders in humans, supporting the importance of the NatA complex in normal human development.

Also flagged:SynthesisPhosphatidylserinecoagulationtissue factorTFphosphatidylcholine
Journal Article 2018-04-12 No Snippets Mallik S, Prasad R, Bhattacharya A, Sen P.
Show Full Abstract

Natural phosphatidylserine (PS), which contains two chiral centers, enhances blood coagulation. However, the process by which PS enhanced blood coagulation is not completely understood. An efficient and flexible synthetic route has been developed to synthesize all of the possible stereoisomers of PS. In this study, we examined the role of PS chiral centers in modulating the activity of the tissue factor (TF)-factor VIIa coagulation initiation complex. Full length TF was relipidated with phosphatidylcholine, and the synthesized PS isomers were individually used to estimate the procoagulant activity of the TF-FVIIa complex via a FXa generation assay. The results revealed that the initiation complex activity was stereoselective and had increased sensitivity to the configuration of the PS glycerol backbone due to optimal protein-lipid interactions.

Also flagged:polysaccharidepropylene glycolalginatesodiumsulfatehyperlipidemia
Journal Article 2018-04-12 ✓ 1 Snippet Xue YT, Li S, Liu WJ, Xin M, Li HH, Yu GL, Guan HS, He XX, Li CX.
In-Text Gene Mentions

…by anti-thrombin III (ATIII) to induce bleeding…

Show Full Abstract

Propylene glycol alginate sodium sulfate (PSS), a sulfated polysaccharide derivative, has been used as a heparinoid drug to prevent and treat hyperlipidemia and ischemic cardio-cerebrovascular diseases in China for 30 years. But its bleeding risk should not be overlooked. Here we clarified the reasons and mechanism leading to bleeding side effect of PSS. It was found that PSS fractions with low mannuronic acid (M)/guluronic acid (G) ratio and high molecular weight (Mw) can excessively extend activated partial thromboplastin time (APTT) and thrombin time (TT), over-inhibit the thrombin (FIIa) activity mediated by anti-thrombin III (ATIII) to induce bleeding risk. In addition, the fraction of low M/G ratio can suppress platelet aggregation mediated by adenosine diphosphate (ADP) and induce platelet reduction by improving platelet antibody (PA)-IgA/G in serum and by inhibiting or damaging the bone marrow hematopoietic function. And the fraction of high Mw can restrain the reticulated platelet (RP) production, then reduce mean platelet volume (MPV) and platelet-large cell counts or ratio, and finally decrease platelet amount by inhibiting or damaging the bone marrow hematopoietic function. In brief, PSS fractions with low M/G ratio and high Mw were the main reasons to bring about bleeding by excessively suppressing coagulant factors activities and weakening platelet function. Our results suggested that it is very necessary to control the M/G ratio and the range of Mw of PSS to guarantee its safety and effectiveness in clinical.

Also flagged:to oxidative stressautophagyoxygensignal transductiontranscription factorsdegradation
Journal Article 2018-04-12 No Snippets Engedal N, Žerovnik E, Rudov A, Galli F, Olivieri F, Procopio AD, Rippo MR, Monsurrò V, Betti M, Albertini MC.
Show Full Abstract

Oxidative stress can alter the expression level of many microRNAs (miRNAs), but how these changes are integrated and related to oxidative stress responses is poorly understood. In this article, we addressed this question by using in silico tools. We reviewed the literature for miRNAs whose expression is altered upon oxidative stress damage and used them in combination with various databases and software to predict common gene targets of oxidative stress-modulated miRNAs and affected pathways. Furthermore, we identified miRNAs that simultaneously target the predicted oxidative stress-modulated miRNA gene targets. This generated a list of novel candidate miRNAs potentially involved in oxidative stress responses. By literature search and grouping of pathways and cellular responses, we could classify these candidate miRNAs and their targets into a larger scheme related to oxidative stress responses. To further exemplify the potential of our approach in free radical research, we used our explorative tools in combination with ingenuity pathway analysis to successfully identify new candidate miRNAs involved in the ubiquitination process, a master regulator of cellular responses to oxidative stress and proteostasis. Lastly, we demonstrate that our approach may also be useful to identify novel candidate connections between oxidative stress-related miRNAs and autophagy. In summary, our results indicate novel and important aspects with regard to the integrated biological roles of oxidative stress-modulated miRNAs and demonstrate how this type of in silico approach can be useful as a starting point to generate hypotheses and guide further research on the interrelation between miRNA-based gene regulation, oxidative stress signaling pathways, and autophagy.

Also flagged:Cas9MycHAoligodeoxynucleotidebrain-tumorOlig2
Journal Article 2018-04-11 ✓ 3 Snippets Dewari PS, Southgate B, Mccarten K, Monogarov G, O'Duibhir E, Quinn N, Tyrer A, Leitner MC, Plumb C, Kalantzaki M, Blin C, Finch R, Bressan RB, Morrison G, Jacobi AM, Behlke MA, von Kriegsheim A, Tomlinson S, Krijgsveld J, Pollard SM.
In-Text Gene Mentions

…neural-specific TFs Sox9,Pou3f2, and Pou3f3 in…

…TFs ( Sox9,Pou3f2, and Pou3f3 )…

…11.8% for Sox9,Pou3f2, and Pou3f3, respectively…

Show Full Abstract

CRISPR/Cas9 can be used for precise genetic knock-in of epitope tags into endogenous genes, simplifying experimental analysis of protein function. However, Cas9-assisted epitope tagging in primary mammalian cell cultures is often inefficient and reliant on plasmid-based selection strategies. Here, we demonstrate improved knock-in efficiencies of diverse tags (V5, 3XFLAG, Myc, HA) using co-delivery of Cas9 protein pre-complexed with two-part synthetic modified RNAs (annealed crRNA:tracrRNA) and single-stranded oligodeoxynucleotide (ssODN) repair templates. Knock-in efficiencies of ~5-30%, were achieved without selection in embryonic stem (ES) cells, neural stem (NS) cells, and brain-tumor-derived stem cells. Biallelic-tagged clonal lines were readily derived and used to define Olig2 chromatin-bound interacting partners. Using our novel web-based design tool, we established a 96-well format pipeline that enabled V5-tagging of 60 different transcription factors. This efficient, selection-free and scalable epitope tagging pipeline enables systematic surveys of protein expression levels, subcellular localization, and interactors across diverse mammalian stem cells.

Also flagged:Dementiacognitioncholinesteraseagingcognitive impairmentmemantine
Journal Article 2018-04-11 No Snippets Nguyen TA, Pham T, Vu HTT, Nguyen TX, Vu TT, Nguyen BTT, Nguyen NQ, Nguyen BT, Nguyen BT, Nguyen TN, Phan SV, Nguyen AT, Pham TL, Dang HT, Kalisch-Ellett L, Gillam M, Pratt N, Qiang S, Wang H, Kanjanarach T, Hassali MAA, Babar ZU, Razak AA, Chinwong D, Roughead EE.
Show Full Abstract

This study examined the use of potentially inappropriate medicines that may affect cognition (PIMcog) in people with dementia and its associated factors. Medical records of all outpatients with dementia attending a tertiary hospital in Vietnam between January 1, 2015, and December 31, 2016, were examined. Medicine use was assessed against a list of PIMcog. Variables associated with having a PIMcog were assessed using a multiple logistic regression. Of the 128 patients, 41% used a PIMcog, 39.1% used cholinesterase inhibitors (CEIs) concomitantly with anticholinergics, and 18% used antipsychotics. The number of hospital visits (adjusted odds ratio [OR]: 1.08; 95% confidence interval [CI]: 1.02-1.16) and number of treating specialists (adjusted OR: 0.61; 95% CI: 0.45-0.83) were associated with PIMcog use. This study highlights a high-level use of medicines that can further impair cognition or reduce the effectiveness of CEIs in people with dementia. Efforts to improve quality use of medicines for this population are warranted.

Also flagged:SP1SPRY4EZH2LSD1DNMT1cancer
Journal Article 2018-04-11 ✓ 2 Snippets Xu Y, Yao Y, Jiang X, Zhong X, Wang Z, Li C, Kang P, Leng K, Ji D, Li Z, Huang L, Qin W, Cui Y.
In-Text Gene Mentions

…DNMT1, CoREST, SIRT1,STAU1and TDP43 (with…

…EZH2, SUZ12, LSD1,STAU1, DNMT1 et al.…

Show Full Abstract

<h4>Background</h4>Accumulating evidence has indicated that long non-coding RNAs (lncRNAs) behave as a novel class of transcription products during multiple cancer processes. However, the mechanisms responsible for their alteration in cholangiocarcinoma (CCA) are not fully understood.<h4>Methods</h4>The expression of SPRY4-IT1 in CCA tissues and cell lines was determined by RT-qPCR, and the association between SPRY4-IT1 transcription and clinicopathologic features was analyzed. Luciferase reporter and chromatin immunoprecipitation (ChIP) assays were performed to explore whether SP1 could bind to the promoter region of SPRY4-IT1 and activate its transcription. The biological function of SPRY4-IT1 in CCA cells was evaluated both in vitro and in vivo. ChIP, RNA binding protein immunoprecipitation (RIP) and luciferase reporter assays were performed to determine the molecular mechanism of SPRY4-IT1 in cell proliferation, apoptosis and invasion.<h4>Results</h4>SPRY4-IT1 was abnormally upregulated in CCA tissues and cells, and this upregulation was correlated with tumor stage and tumor node metastasis (TNM) stage in CCA patients. SPRY4-IT1 overexpression was also an unfavorable prognostic factor for patients with CCA. Additionally, SP1 could bind directly to the SPRY4-IT1 promoter region and activate its transcription. Furthermore, SPRY4-IT1 silencing caused tumor suppressive effects via reducing cell proliferation, migration and invasion; inducing cell apoptosis and reversing the epithelial-to-mesenchymal transition (EMT) process in CCA cells. Mechanistically, enhancer of zeste homolog 2 (EZH2) along with the lysine specific demethylase 1 (LSD1) or DNA methyltransferase 1 (DNMT1) were recruited by SPRY4-IT1, which functioned as a scaffold. Importantly, SPRY4-IT1 positively regulated the expression of EZH2 through sponging miR-101-3p.<h4>Conclusions</h4>Our data illustrate how SPRY4-IT1 plays an oncogenic role in CCA and may offer a potential therapeutic target for treating CCA.

Also flagged:Asxl1hematopoiesisanemiathrombocytosisChromatinCHIP
Journal Article 2018-04-11 ✓ 3 Snippets Nagase R, Inoue D, Pastore A, Fujino T, Hou HA, Yamasaki N, Goyama S, Saika M, Kanai A, Sera Y, Horikawa S, Ota Y, Asada S, Hayashi Y, Kawabata KC, Takeda R, Tien HF, Honda H, Abdel-Wahab O, Kitamura T.
In-Text Gene Mentions

…and 5′-GCCGCTCGGAAAAGGACAA-3′;Sox6, 5′-ACCAGTGACTTCTGGGTGCT-3′ a…

…were identified atSox6, inhibitor of…

…at Id3 andSox6, which play important…

Show Full Abstract

<i>Additional sex combs like 1</i> (<i>ASXL1</i>) is frequently mutated in myeloid malignancies and clonal hematopoiesis of indeterminate potential (CHIP). Although loss of ASXL1 promotes hematopoietic transformation, there is growing evidence that <i>ASXL1</i> mutations might confer an alteration of function. In this study, we identify that physiological expression of a C-terminal truncated Asxl1 mutant in vivo using conditional knock-in (KI) results in myeloid skewing, age-dependent anemia, thrombocytosis, and morphological dysplasia. Although expression of mutant Asxl1 altered the functions of hematopoietic stem cells (HSCs), it maintained their survival in competitive transplantation assays and increased susceptibility to leukemic transformation by co-occurring <i>RUNX1</i> mutation or viral insertional mutagenesis. KI mice displayed substantial reductions in H3K4me3 and H2AK119Ub without significant reductions in H3K27me3, distinct from the effects of Asxl1 loss. Chromatin immunoprecipitation followed by next-generation sequencing analysis demonstrated opposing effects of wild-type and mutant Asxl1 on H3K4me3. These findings reveal that <i>ASXL1</i> mutations confer HSCs with an altered epigenome and increase susceptibility for leukemic transformation, presenting a novel model for CHIP.

Also flagged:cancerdeathmetastatic cancercell migrationProhibitinspseudopodia
Journal Article 2018-04-11 ✓ 1 Snippet Choi S, Bhagwat AM, Al Mismar R, Goswami N, Ben Hamidane H, Sun L, Graumann J.
In-Text Gene Mentions

…(#07-1458), anti- IQGAP1 (Ras GTPase-activating-like protein 1GTPase-activating-like protein…

Show Full Abstract

Cancer metastasis causes approximately 90% of all cancer-related death and independent of the advancement of cancer therapy, a majority of late stage patients suffers from metastatic cancer. Metastasis implies cancer cell migration and invasion throughout the body. Migration requires the formation of pseudopodia in the direction of movement, but a detailed understanding of this process and accordingly strategies of prevention remain elusive. Here, we use quantitative proteomic profiling of human cancer pseudopodia to examine this mechanisms essential to metastasis formation, and identify potential candidates for pharmacological interference with the process. We demonstrate that Prohibitins (PHBs) are significantly enriched in the pseudopodia fraction derived from cancer cells, and knockdown of PHBs, as well as their chemical inhibition through Rocaglamide (Roc-A), efficiently reduces cancer cell migration.

Also flagged:PPM1Bresponse to chemicalMYD88TAP1capviral infection
Journal Article 2018-04-11 ✓ 2 Snippets El-Sherbiny YM, Psarras A, Md Yusof MY, Hensor EMA, Tooze R, Doody G, Mohamed AAA, McGonagle D, Wittmann M, Emery P, Vital EM.
In-Text Gene Mentions

TRIM38

…SP100, NT5C3B, UNC93B1,TRIM38, STAT1, TAP1, BST2,…

Show Full Abstract

Measurement of type I interferon (IFN-I) has potential to diagnose and stratify autoimmune diseases, but existing results have been inconsistent. Interferon-stimulated-gene (ISG) based methods may be affected by the modularity of the ISG transcriptome, cell-specific expression, response to IFN-subtypes and bimodality of expression. We developed and clinically validated a 2-score system (IFN-Score-A and -B) using Factor Analysis of 31 ISGs measured by TaqMan selected from 3-IFN-annotated modules. We evaluated these scores using in-vitro IFN stimulation as well as in sorted cells then clinically validated in a cohort of 328 autoimmune disease patients and healthy controls. ISGs varied in response to IFN-subtypes and both scores varied between cell subsets. IFN-Score-A differentiated Systemic Lupus Erythematosus (SLE) from both Rheumatoid Arthritis (RA) and Healthy Controls (HC) (both p < 0.001), while IFN-Score-B differentiated SLE and RA from HC (both p < 0.001). In SLE, both scores were associated with cutaneous and hematological (all p < 0.05) but not musculoskeletal disease activity. Comparing with bimodal (IFN-high/low) classification, significant differences in IFN-scores were found between diagnostic groups within the IFN-high group. Our continuous 2-score system is more clinically relevant than a simple bimodal classification of IFN status. This system should allow improvement in diagnosis, stratification, and therapy in IFN-mediated autoimmunity.

Also flagged:Cd200Epha3gene expressionNR1D1Oprk1Vinculin
Journal Article 2018-04-11 ✓ 5 Snippets Novati A, Hentrich T, Wassouf Z, Weber JJ, Yu-Taeger L, Déglon N, Nguyen HP, Schulze-Hentrich JM.
In-Text Gene Mentions

HTT

Huntington disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by a polyglutamine expansion in exon 1 of the huntingtin gene (HTT)1.

Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by a mutation in the huntingtin (HTT) gene which results in progressive neurodegeneration in the striatum, cortex, and eventually most brain areas.

…the huntingtin (HTT) gene which…

…suggest that mutantHTT( mHTT )…

Show Full Abstract

Huntington disease (HD) is an autosomal dominant neurodegenerative disorder caused by a mutation in the huntingtin (HTT) gene which results in progressive neurodegeneration in the striatum, cortex, and eventually most brain areas. Despite being a monogenic disorder, environmental factors influence HD characteristics. Both human and mouse studies suggest that mutant HTT (mHTT) leads to gene expression changes that harbor potential to be modulated by the environment. Yet, the underlying mechanisms integrating environmental cues into the gene regulatory program have remained largely unclear. To better understand gene-environment interactions in the context of mHTT, we employed RNA-seq to examine effects of maternal separation (MS) and environmental enrichment (EE) on striatal gene expression during development of BACHD rats. We integrated our results with striatal consensus modules defined on HTT-CAG length and age-dependent co-expression gene networks to relate the environmental factors with disease progression. While mHTT was the main determinant of expression changes, both MS and EE were capable of modulating these disturbances, resulting in distinctive and in several cases opposing effects of MS and EE on consensus modules. This bivalent response to maternal separation and environmental enrichment may aid in explaining their distinct effects observed on disease phenotypes in animal models of HD and related neurodegenerative disorders.

Also flagged:EtidronateBeta-ActinCardiovascular calcificationvascular diseaseM-CSFRANKL
Journal Article 2018-04-11 ✓ 5 Snippets Bauer C, le Saux O, Pomozi V, Aherrahrou R, Kriesen R, Stölting S, Liebers A, Kessler T, Schunkert H, Erdmann J, Aherrahrou Z.
In-Text Gene Mentions

Variants of ABCC6 were recently identified as causative for pseudoxanthoma elasticum (PXE)8 and some cases of generalized arterial calcification of infancy (GACI) in humans9, as well as DCC in mice10,11.

Etidronate prevents but does not completely reverse DCC

…as well asDCCin mice 10…

…are susceptible toDCC13 , 14…

…MN cells inDCCremains unclear.…

Show Full Abstract

Cardiovascular calcification is associated with high risk of vascular disease. This involves macrophage infiltration of injured vascular tissue and osteoclast-related processes. Splenic monocytes from mice, that are predisposed (C3H) or resistant (B6) to calcification, were isolated and differentiated in vitro with M-CSF to generate macrophages, which aggregate to form multinucleated (MN) cells in the presence of RANKL. MN cell formation was significantly decreased in monocytes from resistant compared with calcifying mice. Conditioned media from C3H macrophages strongly induced calcification in vitro. However, medium from B6 macrophages inhibited calcification. An increase in ICAM-1 was detected in conditioned media from C3H macrophages compared with B6, suggesting a key role for this molecule in calcification processes. Due to natural genetic loss of Abcc6, the causal gene for cardiac calcification, C3H mice have reduced plasma levels of inorganic pyrophosphate (PPi), a potential calcification inhibitor. Supplementation of C3H mice with PPi or Etidronate prevented but did not completely reverse cardiac calcification. Our data provide strong evidence of the pathogenesis of macrophages and MNs during tissue calcification and suggest PPi or its analogue Etidronate as a potential inhibitor of MN formation and calcification. Furthermore, the adhesion molecule ICAM-1 was shown to play a key role in calcification.

Also flagged:Aspmmicrocephalyprimary microcephalyintellectual disabilityspindlelike microcephaly-associated
Journal Article 2018-04-11 No Snippets Johnson MB, Sun X, Kodani A, Borges-Monroy R, Girskis KM, Ryu SC, Wang PP, Patel K, Gonzalez DM, Woo YM, Yan Z, Liang B, Smith RS, Chatterjee M, Coman D, Papademetris X, Staib LH, Hyder F, Mandeville JB, Grant PE, Im K, Kwak H, Engelhardt JF, Walsh CA, Bae BI.
Show Full Abstract

The human cerebral cortex is distinguished by its large size and abundant gyrification, or folding. However, the evolutionary mechanisms that drive cortical size and structure are unknown. Although genes that are essential for cortical developmental expansion have been identified from the genetics of human primary microcephaly (a disorder associated with reduced brain size and intellectual disability) <sup>1</sup> , studies of these genes in mice, which have a smooth cortex that is one thousand times smaller than the cortex of humans, have provided limited insight. Mutations in abnormal spindle-like microcephaly-associated (ASPM), the most common recessive microcephaly gene, reduce cortical volume by at least 50% in humans<sup>2-4</sup>, but have little effect on the brains of mice<sup>5-9</sup>; this probably reflects evolutionarily divergent functions of ASPM<sup>10,11</sup>. Here we used genome editing to create a germline knockout of Aspm in the ferret (Mustela putorius furo), a species with a larger, gyrified cortex and greater neural progenitor cell diversity<sup>12-14</sup> than mice, and closer protein sequence homology to the human ASPM protein. Aspm knockout ferrets exhibit severe microcephaly (25-40% decreases in brain weight), reflecting reduced cortical surface area without significant change in cortical thickness, as has been found in human patients<sup>3,4</sup>, suggesting that loss of 'cortical units' has occurred. The cortex of fetal Aspm knockout ferrets displays a very large premature displacement of ventricular radial glial cells to the outer subventricular zone, where many resemble outer radial glia, a subtype of neural progenitor cells that are essentially absent in mice and have been implicated in cerebral cortical expansion in primates<sup>12-16</sup>. These data suggest an evolutionary mechanism by which ASPM regulates cortical expansion by controlling the affinity of ventricular radial glial cells for the ventricular surface, thus modulating the ratio of ventricular radial glial cells, the most undifferentiated cell type, to outer radial glia, a more differentiated progenitor.

Also flagged:Transcription Factorsgene expressionTFbindingBACH1AR
Journal Article 2018-04-11 ✓ 1 Snippet Omrani MR, Yaqubi M, Mohammadnia A.
In-Text Gene Mentions

…the role ofPOU3F2, BACH1, AR, PBX1,…

Show Full Abstract

Direct reprogramming of non-fibroblastic cells to the neuronal cell types including induced neurons (iNs) and induced neural stem cells (iNSCs) has provided an alternative approach for the direct reprogramming of fibroblasts to those cells. However, to increase the efficiency of the reprogramming process the underlying mechanisms should be clarified. In the current study, we analyzed the gene expression profiles of five different cellular conversions to understand the most significant molecular mechanisms and transcription factors (TFs) underlying each conversion. For each conversion, we found the list of differentially expressed genes (DEGs) and the list of differentially expressed TFs (DE-TFs) which regulate expression of DEGs. Moreover, we constructed gene regulatory networks based on the TF-binding sites' data and found the most central regulators and the most active part of the networks. Furthermore, protein complexes were identified from constructed protein-protein interaction networks for DE-TFs. Finally, we proposed a list of main regulators for each conversion; for example, in the direct conversion of epithelial-like cells (ECs) to iNSCs, combination of centrality with active modules or protein complex analyses highlighted the role of POU3F2, BACH1, AR, PBX1, SOX2 and NANOG genes in this conversion. To the best of our knowledge, this study is the first one that analyzed the direct conversion of non-fibroblastic cells toward iNs and iNSCs and we believe that the expression manipulation of identified genes may increase efficiency of these processes.

Also flagged:fluoxetinelactationwateracetylcholinesodiumnitroprusside
Journal Article 2018-04-11 No Snippets Higashi CM, Sartoretto SM, Echem C, Lucchetti BFC, Carvalho MHC, Pelosi GG, Pinge-Filho P, Gerardin DCC, Moreira EG, Akamine EH, Ceravolo GS.
Show Full Abstract

The study aimed to evaluate if maternal exposure to fluoxetine (FLX) during pregnancy and lactation would result in altered aortic reactivity in adult offspring. We also sought to understand the role of endothelium derived relaxing factors in aortic response. Wistar rats (75–80 days old), whose progenitors had received FLX (5 mg/kg, FLX offspring) or tap water (control offspring) during pregnancy and lactation were anesthetized, after which the aorta was removed and cut into two rings, one with (Endo+) and the other without (Endo-) endothelium. Concentration-effect curves for acetylcholine (ACh), sodium nitroprusside (SNP), and phenylephrine (Phe) were performed. The vasodilation to ACh and SNP was similar between control and FLX groups in both male and female offspring. In male rats, the response to Phe was similar between the FLX and control groups on Endo+ and Endo- rings. The response to Phe was reduced on Endo+ rings from female FLX when compared with the control group. The endothelium removal, as well as L-NAME, indomethacin, and tranylcypromine incubation corrected the reduced Phe-induced contraction in the aorta from the female FLX group. On the other hand, catalase, NS-398, and L-NIL did not interfere with the vasoconstriction. The aortic level of nitric oxide (NO) was higher in the female FLX than the control group. Although endothelial NO synthase isoform and cyclooxygenase (COX)-1 expressions were similar between the groups, there was a notable increment in neuronal NO synthase expression in the aorta of FLX-exposed female rats, suggesting an important role of this enzyme in the higher levels of NO. Our results show that developmental exposure to FLX causes sex-specific alteration in aortic function through a mechanism involving endothelial factors, probably NO and COX-1 products.

Also flagged:pathogenesiscolorectal cancertumorUTP3UTP14UTP20
Journal Article 2018-04-11 ✓ 2 Snippets Sun LC, Qian HX.
In-Text Gene Mentions

…) demonstrated thatDDX27is upregulated in…

…(DCAF13, KRR1, HEATR1,DDX27and GTPBP4) have,…

Show Full Abstract

To identify biologically relevant genes associated with the pathogenesis of colorectal cancer (CRC), genome wide expression profiles of 17 pairs of CRC tumor and adjacent tissues, previously published in a DNA microarray study, were analyzed. Cytoscape, String tools and DAVID tools were used to investigate the biological pathways encoded by the genes identified as being either upregulated or downregulated in CRC, to determine protein‑protein interactions and to identify potential hub genes associated with CRC. As a result, a total of 3,264 genes were identified as being differentially expressed in CRC and adjacent tissues, including 1,594 downregulated and 1,670 upregulated genes. Furthermore, 306 genes were revealed to be clustered in a complex interaction network, and the top 20 hub genes in this network were determined by application of the Matthews Correlation Coefficient algorithm. In addition, the patterns of the expression levels of the 20 hub genes were investigated using reverse transcription‑quantitative polymerase chain reaction. Gene Ontology analysis revealed that four of the 20 hub genes encoded small subunit processome components (UTP3 small subunit processome component; UTP14 small subunit processome component; UTP 18 small subunit processome component; and UTP20 small subunit processome component) and a further four encoded WD repeat domains (WD repeat‑containing protein 3, WD repeat domain 12, WD repeat‑containing protein 43 and WD repeat‑containing protein 75). In conclusion, the present DNA microarray study identified genes involved in the pathogenesis of CRC. Furthermore, it was revealed that hub genes identified from among the total identified upregulated and downregulated genes in CRC encoding subunit processome components and WD repeat domains may represent novel target molecules for future treatments of CRC.

Also flagged:hepatocellular carcinomadeathcancerα-fetoproteinAFPliver diseases
Journal Article 2018-04-11 ✓ 1 Snippet Guo W, Tan HY, Wang N, Wang X, Feng Y.
In-Text Gene Mentions

…-antitrypsin deficiency, andhemochromatosis, can lead to…

Show Full Abstract

Hepatocellular carcinoma (HCC) is the third most common cause of death from cancer, with increasing prevalence worldwide. The mortality rate of HCC is similar to its incidence rate, which reflects its poor prognosis. At present, the diagnosis of HCC is still mostly dependent on invasive biopsy, imaging methods, and serum α-fetoprotein (AFP) testing. Because of the asymptomatic nature of early HCC, biopsy and imaging methods usually detect HCC at the middle-late stages. AFP has limited sensitivity and specificity, as many other nonmalignant liver diseases can also result in a very high serum level of AFP. Therefore, better biomarkers with higher sensitivity and specificity at earlier stages are greatly needed. Since metabolic reprogramming is an essential hallmark of cancer and the liver is the metabolic hub of living systems, it is useful to investigate HCC from a metabolic perspective. As a noninvasive and nondestructive approach, metabolomics provides holistic information on dynamically metabolic responses of living systems to both endogenous and exogenous factors. Therefore, it would be conducive to apply metabolomics in investigating HCC. In this review, we summarize recent metabolomic studies on HCC cellular, animal, and clinicopathologic models with attention to metabolomics as a biomarker in cancer diagnosis. Recent applications of metabolomics with respect to therapeutic and prognostic evaluation of HCC are also covered, with emphasis on the potential of treatment by drugs from natural products. In the last section, the current challenges and trends of future development of metabolomics on HCC are discussed. Overall, metabolomics provides us with novel insight into the diagnosis, prognosis, and therapeutic evaluation of HCC.

Also flagged:IL-6tenascin-Cfollistatin-like 1frizzled-related protein 3IGF-1LIF
Journal Article 2018-04-11 No Snippets Segers VFM, Brutsaert DL, De Keulenaer GW.
Show Full Abstract

The heart is a highly structured organ consisting of different cell types, including myocytes, endothelial cells, fibroblasts, stem cells, and inflammatory cells. This pluricellularity provides the opportunity of intercellular communication within the organ, with subsequent optimization of its function. Intercellular cross-talk is indispensable during cardiac development, but also plays a substantial modulatory role in the normal and failing heart of adults. More specifically, factors secreted by cardiac microvascular endothelial cells modulate cardiac performance and either positively or negatively affect cardiac remodeling. The role of endothelium-derived small molecules and peptides-for instance NO or endothelin-1-has been extensively studied and is relatively well defined. However, endothelial cells also secrete numerous larger proteins. Information on the role of these proteins in the heart is scattered throughout the literature. In this review, we will link specific proteins that modulate cardiac contractility or cardiac remodeling to their expression by cardiac microvascular endothelial cells. The following proteins will be discussed: IL-6, periostin, tenascin-C, thrombospondin, follistatin-like 1, frizzled-related protein 3, IGF-1, CTGF, dickkopf-3, BMP-2 and-4, apelin, IL-1β, placental growth factor, LIF, WISP-1, midkine, and adrenomedullin. In the future, it is likely that some of these proteins can serve as markers of cardiac remodeling and that the concept of endothelial function and dysfunction might have to be redefined as we learn more about other factors secreted by ECs besides NO.

Also flagged:BCRBAFFNotch2NotchDelta-like 1ADAM10
Journal Article 2018-04-11 ✓ 5 Snippets Hwang IY, Boularan C, Harrison K, Kehrl JH.
In-Text Gene Mentions

…the study ofTaok3−/− mice (…

…ADAM10 expression onTaok3−/− T0 and…

…and S177 inTAOK3(Figure 4 E).…

…previous study ofTaok3−/− mice, the…

…loss in theTaok3−/− mice that…

Show Full Abstract

The follicular (FO) versus marginal zone (MZ) B cell fate decision in the spleen depends upon BCR, BAFF, and Notch2 signaling. Whether or how G<sub>i</sub> signaling affects this fate decision is unknown. Here, we show that direct contact with Notch ligand expressing stromal cells (OP9-Delta-like 1) cannot promote normal MZ B cell development when progenitor B cells lack Gα<sub>i</sub> proteins, or if Gi signaling is disabled. Consistent with faulty ADAM10-dependent Notch2 processing, Gα<sub>i</sub>-deficient transitional B cells had low ADAM10 membrane expression levels and reduced Notch2 target gene expression. Immunoblotting Gα<sub>i</sub>-deficient B cell lysates revealed a reduction in mature, processed ADAM10. Suggesting that Gα<sub>i</sub> signaling promotes ADAM10 membrane expression, stimulating normal transitional B cells with CXCL12 raised it, while inhibiting Gα<sub>i</sub> nucleotide exchange blocked its upregulation. Surprisingly, inhibiting Gα<sub>i</sub> nucleotide exchange in transitional B cells also impaired the upregulation of ADAM10 that occurs following antigen receptor crosslinking. These results indicate that Gα<sub>i</sub> signaling supports ADAM10 maturation and activity in transitional B cells, and ultimately Notch2 signaling to promote MZ B cell development.

Also flagged:coagulationclottingfibrinogendeathcoagulopathythrombin
Journal Article 2018-04-11 No Snippets Stettler GR, Moore EE, Nunns GR, Chandler J, Peltz E, Silliman CC, Banerjee A, Sauaia A.
Show Full Abstract

<h4>Background</h4>Goal-directed hemostatic resuscitation based on thrombelastography has a survival benefit compared to conventional coagulation assays. While thrombelastography transfusion thresholds for patients at risk for massive transfusion (MT) have been defined, similar cutoffs do not exist for the other commonly used viscoelastic assay, rotational thromboelastometry (ROTEM). The purpose of this study was to develop ROTEM blood product thresholds in patients at risk for MT.<h4>Methods</h4>ROTEM was assessed in trauma activation patients admitted from 2010 to 2016 (n = 222). Receiver operating characteristic curve analyses were performed to test the predictive performance of ROTEM measurements in patients requiring MT. The Youden Index defined optimal thresholds for ROTEM-based resuscitation.<h4>Results</h4>Patients who required MT (n = 37, 17%) were more severely injured. EXTEM clotting time (CT) was longer in patients with MT compared to non-MT (87 versus 64 s, P < 0.0001). EXTEM angle was shallower in MT patients compared to non-MT (54° versus 69°, P < 0.0001). Clot amplitude after 10 min (CA10) was less in MT compared to non-MT patients (30.5 versus 50 mm, P < 0.0001). Clot lysis index 60 min (CLI60) was lower in patients who had MT than non-MT (47 versus 94%, P = 0.0006). EXTEM CT yielded an area under the receiver operating characteristic curve (AUROC) = 0.7116 and a cut point of >78.5 s. EXTEM angle had an AUROC = 0.865 and a cut point of <64.5°. EXTEM CA10 had an AUROC = 0.858, with a cut point of <40.5 mm. CLI60 had an AUROC = 0.6788 with a cut point at <74%.<h4>Conclusions</h4>We have identified ROTEM thresholds for transfusion of blood components in severely injured patients requiring an MT. Based on our analysis, we propose plasma transfusion for EXTEM CT > 78.5 s, fibrinogen for angle <64.5°, platelet transfusion for CA10 < 40.5 mm, and antifibrinolytics for CLI60 < 74%.

Also flagged:nucleaseexonucleaseendonucleaseinterspaced shortclustered regularly interspaced short palindromic repeatsCRISPR
Journal Article 2018-04-11 ✓ 1 Snippet Dou C, Yu M, Gu Y, Wang J, Yin K, Nie C, Zhu X, Qi S, Wei Y, Cheng W.
In-Text Gene Mentions

…Reveal a UniqueCas4-like ProteinProtein in the…

Show Full Abstract

A clustered regularly interspaced short palindromic repeats (CRISPR)-like "mimivirus virophage resistance element" (MIMIVIRE) system, which contains specific cascade genes and a CRISPR array against virophages, was reported in mimiviruses. An essential component of the MIMIVIRE system is R354, encoding a nuclease and a likely functional homolog of Cas4. Here we show that R354 is a dual nuclease with both exonuclease and endonuclease activities. Structural analysis revealed that the catalytic core domain of R354 is similar to those of Cas4 and ? exonuclease despite their low sequence identity. R354 forms a homodimer that is important for its exonuclease but not endonuclease activity. Structural comparisons between the active and semi-active states of R354 demonstrated that an activation loop adjacent to the catalytic site is critical for enzymatic activity. Overall, the results suggest that R354 belongs to a novel MIMIVIRE system involved in innate virus immunity and provides a template for the identification of new CRISPR systems in other species.

Also flagged:antibodyantiviral responsesimmune responsestype I interferonIFNscancers
Journal Article 2018-04-10 ✓ 1 Snippet Fournier N, Jacque E, Fontayne A, Derache D, Dupont G, Verhaeghe L, Baptista L, Dehenne A, Dezetter AS, Terrier A, Longue A, Pochet-Beghin V, Beghin C, Chtourou S, de Romeuf C.
In-Text Gene Mentions

…or patients withhemochromatosis(EFS Nord de…

Show Full Abstract

Plasmacytoid dendritic cells (pDCs) play a central role for both innate and adaptive antiviral responses, as they direct immune responses through their unique ability to produce substantial concentrations of type I interferon (IFNs) upon viral encounter while also activating multiple immune cells, including macrophages, DCs, B, natural killer and T cells. Recent evidence clearly indicates that pDCs also play a crucial role in some cancers and several auto-immune diseases. Although treatments are currently available to patients with such pathologies, many are not fully efficient. We are proposing here, as a new targeted-based therapy, a novel chimeric monoclonal antibody (mAb) that mediates a strong cellular cytotoxicity directed against a specific human pDC marker, CD303. This antibody, ch122A2 mAb, is characterized by low fucose content in its human IgG1 constant (Fc) region, which induces strong in vitro and in vivo activity against human pDCs. We demonstrated that this effect relates in part to its specific Fc region glycosylation pattern, which increased affinity for CD16/FcγRIIIa. Importantly, ch122A2 mAb induces the down-modulation of CpG-induced IFN-α secretion by pDCs. Additionally, ch122A2 mAb shows in vitro high pDC depletion mediated by antibody-dependent cell-mediated cytotoxicity and antibody-dependent cellular phagocytosis. Remarkably, in vivo ch122A2 mAb efficacy is also demonstrated in humanized mice, resulting in significant pDC depletion in bloodstream and secondary lymphoid organs such as spleen. Together, our data indicates that ch122A2 mAb could represent a promising cytotoxic mAb candidate for pathologies in which decreasing type I IFNs or pDCs depleting may improve patient prognosis.

Also flagged:FARSBAminoacyl-tRNA synthetasesamino acidsFARSAphenylalanyl-tRNA synthetaseaminoacyl-tRNA synthetase
Journal Article 2018-04-10 No Snippets Antonellis A, Oprescu SN, Griffin LB, Heider A, Amalfitano A, Innis JW.
Show Full Abstract

Aminoacyl-tRNA synthetases (ARSs) are ubiquitously expressed enzymes that ligate amino acids onto tRNA molecules. Genes encoding ARSs have been implicated in phenotypically diverse dominant and recessive human diseases. The charging of tRNA<sup>PHE</sup> with phenylalanine is performed by a tetrameric enzyme that contains two alpha (FARSA) and two beta (FARSB) subunits. To date, mutations in the genes encoding these subunits (FARSA and FARSB) have not been implicated in any human disease. Here, we describe a patient with a severe, lethal, multisystem, developmental phenotype who was compound heterozygous for FARSB variants: p.Thr256Met and p.His496Lysfs*14. Expression studies using fibroblasts isolated from the proband revealed a severe depletion of both FARSB and FARSA protein levels. These data indicate that the FARSB variants destabilize total phenylalanyl-tRNA synthetase levels, thus causing a loss-of-function effect. Importantly, our patient shows strong phenotypic overlap with patients that have recessive diseases associated with other ARS loci; these observations strongly support the pathogenicity of the identified FARSB variants and are consistent with the essential function of phenylalanyl-tRNA synthetase in human cells. In sum, our clinical, genetic, and functional analyses revealed the first FARSB variants associated with a human disease phenotype and expand the locus heterogeneity of ARS-related human disease.

Also flagged:oligodendrogliomasbrain tumorstumorgliomaIDHchromosome
Journal Article 2018-04-10 ✓ 2 Snippets Lauber C, Klink B, Seifert M.
In-Text Gene Mentions

…SOX genes (SOX6, SOX8 ,…

SOX6regulates different stages…

Show Full Abstract

<h4>Background</h4>Molecular data of histologically classified oligodendrogliomas are available offering the possibility to stratify these human brain tumors into clinically relevant molecular subtypes.<h4>Methods</h4>Gene copy number, mutation, and expression data of 193 histologically classified oligodendrogliomas from The Cancer Genome Atlas (TCGA) were analyzed by well-established computational approaches (unsupervised clustering, statistical testing, network inference).<h4>Results</h4>We applied hierarchical clustering to tumor gene copy number profiles and revealed three molecular subgroups within histologically classified oligodendrogliomas. We further screened these subgroups for molecular glioma markers (1p/19q co-deletion, IDH mutation, gain of chromosome 7 and loss of chromosome 10) and found that our subgroups largely resemble known molecular glioma subtypes. We excluded glioblastoma-like tumors (7a10d subgroup) and derived a gene expression signature distinguishing histologically classified oligodendrogliomas with concurrent 1p/19q co-deletion and IDH mutation (1p/19q subgroup) from those with predominant IDH mutation alone (IDHme subgroup). Interestingly, many signature genes were part of signaling pathways involved in the regulation of cell proliferation, differentiation, migration, and cell-cell contacts. We further learned a gene regulatory network associated with the gene expression signature revealing novel putative major regulators with functions in cytoskeleton remodeling (e.g. APBB1IP, VAV1, ARPC1B), apoptosis (CCNL2, CREB3L1), and neural development (e.g. MYTIL, SCRT1, MEF2C) potentially contributing to the manifestation of differences between both subgroups. Moreover, we revealed characteristic expression differences of several HOX and SOX transcription factors suggesting the activity of different glioma stemness programs in both subgroups.<h4>Conclusions</h4>We show that gene copy number profiles alone are sufficient to derive molecular subgroups of histologically classified oligodendrogliomas that are well-embedded into general glioma classification schemes. Moreover, our revealed novel putative major regulators and characteristic stemness signatures indicate that different developmental programs might be active in these subgroups, providing a basis for future studies.

Also flagged:asthmadehydroepiandrosterone sulfateestrogenprogesteroneDHEA-Scorticosteroids
Journal Article 2018-04-10 No Snippets DeBoer MD, Phillips BR, Mauger DT, Zein J, Erzurum SC, Fitzpatrick AM, Gaston BM, Myers R, Ross KR, Chmiel J, Lee MJ, Fahy JV, Peters M, Ly NP, Wenzel SE, Fajt ML, Holguin F, Moore WC, Peters SP, Meyers D, Bleecker ER, Castro M, Coverstone AM, Bacharier LB, Jarjour NN, Sorkness RL, Ramratnam S, Irani AM, Israel E, Levy B, Phipatanakul W, Gaffin JM, Gerald Teague W.
Show Full Abstract

<h4>Background</h4>Although pre-puberty asthma is more prevalent in males, after puberty through middle-age, asthma is more prevalent in females. The surge of sex hormones with puberty might explain this gender switch.<h4>Methods</h4>To examine the effects of sex hormones on lung function and symptoms with puberty, Tanner stage was assessed in 187 children 6-18 years of age (59% severe) enrolled in the NIH/NHLBI Severe Asthma Research Program (SARP). The effects of circulating sex hormones (n = 68; testosterone, dehydroepiandrosterone sulfate (DHEA-S), estrogen, and progesterone) on lung function and 4 week symptom control (ACQ6) in cross-section were tested by linear regression.<h4>Results</h4>From pre-/early to late puberty, lung function did not change significantly but ACQ6 scores improved in males with severe asthma. By contrast females had lower post-BD FEV<sub>1</sub>% and FVC% and worse ACQ6 scores with late puberty assessed by breast development. In males log DHEA-S levels, which increased by Tanner stage, associated positively with pre- and post-BD FEV<sub>1</sub>%, pre-BD FVC %, and negatively (improved) with ACQ6. Patients treated with high-dose inhaled corticosteroids had similar levels of circulating DHEA-S. In females, estradiol levels increased by Tanner stage, and associated negatively with pre-BD FEV<sub>1</sub>% and FVC %.<h4>Conclusions</h4>These results support beneficial effects of androgens on lung function and symptom control and weak deleterious effects of estradiol on lung function in children with asthma. Longitudinal data are necessary to confirm these cross-sectional findings and to further elucidate hormonal mechanisms informing sex differences in asthma features with puberty.<h4>Trial registration</h4>ClinicalTrials.gov registration number: NCT01748175 .

Also flagged:Pioglitazonemitochondrialinsulin resistancenonalcoholic steatohepatitisNASHmetabolism
Journal Article 2018-04-10 ✓ 1 Snippet Kalavalapalli S, Bril F, Koelmel JP, Abdo K, Guingab J, Andrews P, Li WY, Jose D, Yost RA, Frye RF, Garrett TJ, Cusi K, Sunny NE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Pioglitazone is effective in improving insulin resistance and liver histology in patients with nonalcoholic steatohepatitis (NASH). Because dysfunctional mitochondrial metabolism is a central feature of NASH, we hypothesized that an important target of pioglitazone would be alleviating mitochondrial oxidative dysfunction. To this end, we studied hepatic mitochondrial metabolism in mice fed high-fructose high-transfat diet (TFD) supplemented with pioglitazone for 20 wk, using nuclear magnetic resonance-based <sup>13</sup>C isotopomer analysis. Pioglitazone improved whole body and adipose insulin sensitivity in TFD-fed mice. Furthermore, pioglitazone reduced intrahepatic triglyceride content and fed plasma ketones and hepatic TCA cycle flux, anaplerosis, and pyruvate cycling in mice with NASH. This was associated with a marked reduction in most intrahepatic diacylglycerol classes and, to a lesser extent, some ceramide species (C22:1, C23:0). Considering the cross-talk between mitochondrial function and branched-chain amino acid (BCAA) metabolism, pioglitazone's impact on plasma BCAA profile was determined in a cohort of human subjects. Pioglitazone improved the plasma BCAA concentration profile in patients with NASH. This appeared to be related to an improvement in BCAA degradation in multiple tissues. These results provide evidence that pioglitazone-induced changes in NASH are related to improvements in hepatic mitochondrial oxidative dysfunction and changes in whole body BCAA metabolism.

Also flagged:cell adhesionnucleotideresponse to abiotic stressestranslationalhistonemethylation
Journal Article 2018-04-10 ✓ 1 Snippet Jiang P, Hou Y, Fu W, Tao X, Luo J, Lu H, Xu Y, Han B, Zhang J.
In-Text Gene Mentions

…9A) and negr1 (neuronal growth regulator 1growth regulator 1)…

Show Full Abstract

Long non-coding RNAs (lncRNAs) are increasingly regarded as a key role in regulating diverse biological processes in various tissues and species. Although the cold responsive lncRNAs have been reported in plants, no data is available on screening and functional prediction of lncRNAs in cold acclimation in fish so far. Here we compared the expression profile of lncRNAs in cold acclimated zebrafish embryonic fibroblast cells (ZF4) cultured at 18°C for 30 days with that of cells cultured at 28°C as control by high-throughput sequencing. Totally 8,363 novel lncRNAs were identified. Including known and novel lncRNAs, there are 347 lncRNAs up-regulated and 342 lncRNAs down-regulated in cold acclimated cells. Among the differentially expressed lncRNAs, 74 and 61 were detected only in control cells or cold-acclimated cells, respectively. The Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analyses of adjacent genes to the differentially expressed lncRNAs showed that the enriched genes are involved in electron transport, cell adhesion, oxidation-reduction process, and so on. We also predicted the target genes of the differentially expressed lncRNAs by looking for interactions between lncRNAs and mRNAs, and constructed an interaction network. In summary, our genome-wide systematic identification and functional prediction of cold responsive lncRNAs in zebrafish cells suggests a crucial role of lincRNAs in cold acclimation in fish.

Also flagged:Morphineion channelimmune responseG protein-linked receptorsToll-like receptorscancer
Journal Article 2018-04-10 No Snippets Shao J, Wang J, Huang J, Liu C, Pan Y, Guo Q, Zou W.
Show Full Abstract

Morphine tolerance is a challenging clinical problem that limits the use of morphine in pain treatment, but the mechanisms of morphine tolerance remain unclear. Recent research indicates that long noncoding RNAs (lncRNAs) might be a novel and promising target in the pathogeneses of diseases. Therefore, we hypothesized that lncRNAs might play a role in the development of morphine tolerance. Male Sprague-Dawley rats were intrathecally injected with 10 μg morphine twice daily for 7 consecutive days. The animals were then sacrificed for lncRNA microarray tests, and the results were validated by RT-qPCR. Next, functional predictions for the differentially expressed mRNAs (DEmRNAs) were made with the Gene Ontology/Kyoto Encyclopedia of Genes and Genomes (GO/KEGG), and predictions for the differentially expressed lncRNAs (DElncRNAs) were made based on competitive endogenous RNA (ceRNA) analyses. The rats successfully developed morphine tolerance. LncRNA microarray analysis revealed that, according to the criteria of a log2 (fold change) > 1.5 and a P-value < 0.05, 136 lncRNAs and 278 mRNAs were differentially expressed in the morphine tolerance group (MT) compared with the normal saline group (NS). The functions of the DEmRNAs likely involve in the processes of the ion channel transport, pain transmission and immune response. The ceRNA analysis indicated that several possible interacting networks existed, including (MRAK150340, MRAK161211)/miR-219b/Tollip.Further annotations of the potential target mRNAs of the miRNAs according to the gene database suggested that the possible functions of these mRNAs primarily involved the regulation of ubiquitylation, G protein-linked receptors, and Toll-like receptors, which play roles in the development of morphine tolerance. Our findings revealed the profiles of differentially expressed lncRNAs in morphine tolerance conditions, and among these lncRNAs, some DElncRNAs might be new therapeutic targets for morphine tolerance.

Also flagged:Calciumcolon adenomasadenomaE-cadherincell surfacemineral
Journal Article 2018-04-10 No Snippets McClintock SD, Colacino JA, Attili D, Dame MK, Richter A, Reddy AR, Basrur V, Rizvi AH, Turgeon DK, Varani J, Aslam MN.
Show Full Abstract

Previous murine studies have demonstrated that dietary Aquamin, a calcium-rich, multi-mineral natural product, suppressed colon polyp formation and transition to invasive tumors more effectively than calcium alone when provided over the lifespan of the animals. In the current study, we compared calcium alone to Aquamin for modulation of growth and differentiation in human colon adenomas in colonoid culture. Colonoids established from normal colonic tissue were examined in parallel. Both calcium alone at 1.5 mmol/L and Aquamin (provided at 1.5 mmol/L calcium) fostered differentiation in the adenoma colonoid cultures as compared with control (calcium at 0.15 mmol/L). When Aquamin was provided at an amount delivering 0.15 mmol/L calcium, adenoma differentiation also occurred, but was not as complete. Characteristic of colonoids undergoing differentiation was a reduction in the number of small, highly proliferative buds and their replacement by fewer but larger buds with smoother surface. Proliferation marker (Ki67) expression was reduced and markers of differentiation (CK20 and occludin) were increased along with E-cadherin translocalization to the cell surface. Additional proteins associated with differentiation/growth control [including histone-1 family members, certain keratins, NF2 (merlin), olfactomedin-4 and metallothioneins] were altered as assessed by proteomics. Immunohistologic expression of NF2 was higher with Aquamin as compared with calcium at either concentration. These findings support the conclusions that (i) calcium (1.5 mmol/L) has the capacity to modulate growth and differentiation in large human colon adenomas and (ii) Aquamin delivering 0.15 mmol/L calcium has effects on proliferation and differentiation not observed when calcium is used alone at this concentration. <i>Cancer Prev Res; 11(7); 413-28. ©2018 AACR</i>.

Also flagged:nuclear importmethylationchromosome segregation 1 likedemethylationhistone deacetylaseGene silencing
Journal Article 2018-04-10 ✓ 5 Snippets Dong Q, Li X, Wang CZ, Xu S, Yuan G, Shao W, Liu B, Zheng Y, Wang H, Lei X, Zhang Z, Zhu B.
In-Text Gene Mentions

…Roles of theCSE1L-mediated nuclear import pathw…

…We identifiedCSE1L(chromosome segregation 1…

CSE1Ldepletion did not…

…genes derepressed byCSE1Ldepletion largely overlapped…

…defects observed uponCSE1Ldepletion were linked…

Show Full Abstract

Epigenetic silencing can be mediated by various mechanisms, and many regulators remain to be identified. Here, we report a genome-wide siRNA screening to identify regulators essential for maintaining gene repression of a CMV promoter silenced by DNA methylation. We identified CSE1L (chromosome segregation 1 like) as an essential factor for the silencing of the reporter gene and many endogenous methylated genes. CSE1L depletion did not cause DNA demethylation. On the other hand, the methylated genes derepressed by CSE1L depletion largely overlapped with methylated genes that were also reactivated by treatment with histone deacetylase inhibitors (HDACi). Gene silencing defects observed upon CSE1L depletion were linked to its nuclear import function for certain protein cargos because depletion of other factors involved in the same nuclear import pathway, including KPNAs and KPNB1 proteins, displayed similar derepression profiles at the genome-wide level. Therefore, CSE1L appears to be critical for the nuclear import of certain key repressive proteins. Indeed, NOVA1, HDAC1, HDAC2, and HDAC8, genes known as silencing factors, became delocalized into cytosol upon CSE1L depletion. This study suggests that the cargo specificity of the protein nuclear import system may impact the selectivity of gene silencing.

Also flagged:Extracellularenterococcal infectionsendocarditisurinary tract infectionssurgical site infectionsdevice-associated
Journal Article 2018-04-10 ✓ 1 Snippet Keogh D, Lam LN, Doyle LE, Matysik A, Pavagadhi S, Umashankar S, Low PM, Dale JL, Song Y, Ng SP, Boothroyd CB, Dunny GM, Swarup S, Williams RBH, Marsili E, Kline KA.
In-Text Gene Mentions

…states such ashemochromatosisand thalassemia disrupt…

Show Full Abstract

Enterococci are important human commensals and significant opportunistic pathogens. Biofilm-related enterococcal infections, such as endocarditis, urinary tract infections, wound and surgical site infections, and medical device-associated infections, often become chronic upon the formation of biofilm. The biofilm matrix establishes properties that distinguish this state from free-living bacterial cells and increase tolerance to antimicrobial interventions. The metabolic versatility of the enterococci is reflected in the diversity and complexity of environments and communities in which they thrive. Understanding metabolic factors governing colonization and persistence in different host niches can reveal factors influencing the transition to biofilm pathogenicity. Here, we report a form of iron-dependent metabolism for <i>Enterococcus faecalis</i> where, in the absence of heme, extracellular electron transfer (EET) and increased ATP production augment biofilm growth. We observe alterations in biofilm matrix depth and composition during iron-augmented biofilm growth. We show that the <i>ldh</i> gene encoding l-lactate dehydrogenase is required for iron-augmented energy production and biofilm formation and promotes EET.<b>IMPORTANCE</b> Bacterial metabolic versatility can often influence the outcome of host-pathogen interactions, yet causes of metabolic shifts are difficult to resolve. The bacterial biofilm matrix provides the structural and functional support that distinguishes this state from free-living bacterial cells. Here, we show that the biofilm matrix can immobilize iron, providing access to this growth-promoting resource which is otherwise inaccessible in the planktonic state. Our data show that in the absence of heme, <i>Enterococcus faecalis</i> l-lactate dehydrogenase promotes EET and uses matrix-associated iron to carry out EET. Therefore, the presence of iron within the biofilm matrix leads to enhanced biofilm growth.

Also flagged:PIK3CAPIK3R1phosphoinositide 3-kinasePI3KtumorsAKT3
Journal Article 2018-04-10 No Snippets Chen L, Yang L, Yao L, Kuang XY, Zuo WJ, Li S, Qiao F, Liu YR, Cao ZG, Zhou SL, Zhou XY, Yang WT, Shi JX, Huang W, Hu X, Shao ZM.
Show Full Abstract

Deregulation of the phosphoinositide 3-kinase (PI3K) pathway contributes to the development and progression of tumors. Here, we determine that somatic mutations in PIK3CA (44%), PIK3R1 (17%), AKT3 (15%), and PTEN (12%) are prevalent and diverse in Chinese breast cancer patients, with 60 novel mutations identified. A high proportion of tumors harbors multiple mutations, especially PIK3CA plus PIK3R1 mutations (9.0%). Next, we develop a recombination-based mutation barcoding (ReMB) library for impactful mutations conferring clonal advantage in proliferation and drug responses. The highest-ranking PIK3CA and PIK3R1 mutations include previously reported deleterious mutations, as well as mutations with unknown significance. These PIK3CA and PIK3R1 impactful mutations exhibit a mutually exclusive pattern, leading to oncogenesis and hyperactivity of PI3K pathway. The PIK3CA impactful mutations are tightly associated with hormone receptor positivity. Collectively, these findings advance our understanding of PI3K impactful mutations in breast cancer and have important implications for PI3K-targeted therapy in precision oncology.

Also flagged:Pnpla2Cpt1acarbon dioxideCebpaIronhepcidin
Journal Article 2018-04-10 ✓ 3 Snippets Folgueras AR, Freitas-Rodríguez S, Ramsay AJ, Garabaya C, Rodríguez F, Velasco G, López-Otín C.
In-Text Gene Mentions

…mutations in theHFEgene result in…

…mice deficient inHfefed a HFD…

…Conversely,Hfe−/ − mice,…

Show Full Abstract

Alterations in iron status have frequently been associated with obesity and other metabolic disorders. The hormone hepcidin stands out as a key regulator in the maintenance of iron homeostasis by controlling the main iron exporter, ferroportin. Here we demonstrate that the deficiency in the hepcidin repressor matriptase-2 (Tmprss6) protects from high-fat diet-induced obesity. Tmprss6 <sup>-/-</sup> mice show a significant decrease in body fat, improved glucose tolerance and insulin sensitivity, and are protected against hepatic steatosis. Moreover, these mice exhibit a significant increase in fat lipolysis, consistent with their dramatic reduction in adiposity. Rescue experiments that block hepcidin up-regulation and restore iron levels in Tmprss6<sup>-/-</sup> mice via anti-hemojuvelin (HJV) therapy, revert the obesity-resistant phenotype of Tmprss6<sup>-/-</sup> mice. Overall, this study describes a role for matritpase-2 and hepcidin in obesity and highlights the relevance of iron regulation in the control of adipose tissue function.

Also flagged:tumorgliomatumorscancergliomascentral nervous system
Journal Article 2018-04-10 No Snippets Johnson E, Dickerson KL, Connolly ID, Hayden Gephart M.
Show Full Abstract

<h4>Purpose of review</h4>In this review, we seek to summarize the literature concerning the use of single-cell RNA-sequencing for CNS gliomas.<h4>Recent findings</h4>Single-cell analysis has revealed complex tumor heterogeneity, subpopulations of proliferating stem-like cells and expanded our view of tumor microenvironment influence in the disease process. Although bulk RNA-sequencing has guided our initial understanding of glioma genetics, this method does not accurately define the heterogeneous subpopulations found within these tumors. Single-cell techniques have appealing applications in cancer research, as diverse cell types and the tumor microenvironment have important implications in therapy. High cost and difficult protocols prevent widespread use of single-cell RNA-sequencing; however, continued innovation will improve accessibility and expand our of knowledge gliomas.

Also flagged:TitaniumosteogenesiskryptonfluoridehydroxyapatiteCalcium
Journal Article 2018-04-10 No Snippets Chen L, Komasa S, Hashimoto Y, Hontsu S, Okazaki J.
Show Full Abstract

To enhance biocompatibility, osteogenesis, and osseointegration, we coated titanium implants, by krypton fluoride (KrF) pulsed laser deposition, with a thin film of fluoridated hydroxyapatite (FHA). Coating was confirmed by scanning electron microscopy (SEM) and scanning probe microscopy (SPM), while physicochemical properties were evaluated by attenuated reflectance Fourier transform infrared spectroscopy (ATR-FTIR). Calcium deposition, osteocalcin production, and expression of osteoblast genes were significantly higher in rat bone marrow mesenchymal stem cells seeded on FHA-coated titanium than in cells seeded on uncoated titanium. Implantation into rat femurs also showed that the FHA-coated material had superior osteoinductive and osseointegration activity in comparison with that of traditional implants, as assessed by microcomputed tomography and histology. Thus, titanium coated with FHA holds promise as a dental implant material.

Also flagged:Depressionanxietymenopauseagingmenstruationestrogens
Journal Article 2018-04-10 ✓ 5 Snippets Grochans E, Szkup M, Kotwas A, Kopeć J, Karakiewicz B, Jurczak A.
In-Text Gene Mentions

Excessive 5-HTT activity can result in abnormally low extracellular serotonin levels, and so contribute to mood disorders and other psychiatric problems, including depression [29].

…Excessive5-HTTactivity can result…

…6A4 , encoding5-HTT.…

…The5-HTTgene polymorphism emerges…

…allele of the5-HTTgene polymorphism can…

Show Full Abstract

Depressive symptoms that are faced by women in the pre-, peri-, and postmenopausal periods are determined by a wide array of sociodemographic, psychological, and biological variables. The aim of our study was to identify factors that contribute to depressive problems at this stage of life. The study included 815 healthy Polish women aged 45-60 years. The survey part was conducted using the Beck Depression Inventory (BDI), the State-Trait Anxiety Inventory (STAI), the Neuroticism-Extroversion-Openness Five Factor Inventory (NEO-FFI), and a self-developed questionnaire. Genetic analysis was also performed. Depressive symptoms were observed in 25.5% of participants. 70% of the women were postmenopausal. No statistically significant differences in the severity of depressive symptoms were demonstrated with regard to genetic variables (<i>p</i> > 0.05). Reproductive capacity (<i>p</i> < 0.001), employment (<i>p</i> < 0.001), and being married (<i>p</i> < 0.018) were found to reduce the incidence of depressive symptoms. The contribution of personality and anxiety as a trait to depressive symptoms varied.<h4>Conclusions</h4>The factors predisposing pre-, peri-, and postmenopausal women to depressive symptoms include lower education, lack of a life partner, unemployment, high anxiety, and neurotic personality. No evidence was found for the contribution of genetic factors to depressive symptoms in the examined women.

Also flagged:17β-Hydroxysteroid Dehydrogenase Type 2AndrogenEndometrial cancerfemale pelvic cancerscancer17β-HSD2
Journal Article 2018-04-10 No Snippets Hashimoto C, Miki Y, Tanaka S, Takagi K, Fue M, Doe Z, Li B, Yaegashi N, Suzuki T, Ito K.
Show Full Abstract

Endometrial cancer is one of the most common female pelvic cancers and has been considered an androgen-related malignancy. Several studies have demonstrated the anti-cell proliferative effect of androgen on endometrial cancer cells; however, the mechanisms of the anti-cancer effect of androgen remain largely unclear. 17β-hydroxysteroid dehydrogenase type 2 (17β-HSD2), which catalyzes the conversion of E2 to E1, is known to be upregulated by androgen treatment in breast cancer cells. In this study, we therefore focused on the role of androgen on estrogen dependence in endometrial cancer. Dihydrotestosterone (DHT) was found to induce <i>17β-HSD2</i> mRNA and protein expression in HEC-1B endometrial cancer cells. DHT could also inhibit cell proliferation of HEC-1B when induced by estradiol treatment. In 19 endometrioid endometrial adenocarcinoma (EEA) tissues, intratumoral DHT concentration was measured by liquid chromatography/electrospray tandem mass spectrometry and was found to be significantly correlated with 17β-HSD2 immunohistochemical status. We further examined the correlations between 17β-HSD2 immunoreactivity and clinicopathological parameters in 53 EEA tissues. 17β-HSD2 status was inversely associated with the histological grade, clinical stage, and cell proliferation marker Ki-67, and positively correlated with progesterone receptor expression. 17β-HSD2 status tended to be positively associated with androgen receptor status. In 53 EEA cases, the 17β-HSD2-positive group tended to have better prognosis than that for the negative group with respect to progression-free survival and endometrial cancer-specific survival. These findings suggest that androgen suppresses the estrogen dependence of endometrial cancer through the induction of 17β-HSD2 in endometrial cancer.

Also flagged:nuclear factor κBNF-κBcell growthtransformationubiquitinsignal transduction
Journal Article 2018-04-10 No Snippets Courtois G, Fauvarque MO.
Show Full Abstract

The nuclear factor κB (NF-κB) signaling pathway ubiquitously controls cell growth and survival in basic conditions as well as rapid resetting of cellular functions following environment changes or pathogenic insults. Moreover, its deregulation is frequently observed during cell transformation, chronic inflammation or autoimmunity. Understanding how it is properly regulated therefore is a prerequisite to managing these adverse situations. Over the last years evidence has accumulated showing that ubiquitination is a key process in NF-κB activation and its resolution. Here, we examine the various functions of ubiquitin in NF-κB signaling and more specifically, how it controls signal transduction at the molecular level and impacts in vivo on NF-κB regulated cellular processes.

Also flagged:hemorrhageSriDeathPPHsmhPreeclampsia
Journal Article 2018-04-10 No Snippets Wanigaratne S, Shakya Y, Gagnon AJ, Cole DC, Rashid M, Blake J, Dastoori P, Moineddin R, Ray JG, Urquia ML.
Show Full Abstract

<h4>Objectives</h4>Immigrants are thought to be healthier than their native-born counterparts, but less is known about the health of refugees or forced migrants. Previous studies often equate refugee status with immigration status or country of birth (COB) and none have compared refugee to non-refugee immigrants from the same COB. Herein, we examined whether: (1) a refugee mother experiences greater odds of adverse maternal and perinatal health outcomes compared with a similar non-refugee mother from the same COB and (2) refugee and non-refugee immigrants differ from Canadian-born mothers for maternal and perinatal outcomes.<h4>Design</h4>This is a retrospective population-based database study. We implemented two cohort designs: (1) 1:1 matching of refugees to non-refugee immigrants on COB, year and age at arrival (±5 years) and (2) an unmatched design using all data.<h4>Setting and participants</h4>Refugee immigrant mothers (n=34 233), non-refugee immigrant mothers (n=243 439) and Canadian-born mothers (n=615 394) eligible for universal healthcare insurance who had a hospital birth in Ontario, Canada, between 2002 and 2014.<h4>Primary outcomes</h4>Numerous adverse maternal and perinatal health outcomes.<h4>Results</h4>Refugees differed from non-refugee immigrants most notably for HIV, with respective rates of 0.39% and 0.20% and an adjusted OR (AOR) of 1.82 (95% CI 1.19 to 2.79). Other elevated outcomes included caesarean section (AOR 1.04, 95% CI 1.00 to 1.08) and moderate preterm birth (AOR 1.08, 95% CI 0.99 to 1.17). For the majority of outcomes, refugee and non-refugee immigrants experienced similar AORs when compared with Canadian-born mothers.<h4>Conclusions</h4>Refugee status was associated with a few adverse maternal and perinatal health outcomes, but the associations were not strong except for HIV. The definition of refugee status used herein may not sensitively identify refugees at highest risk. Future research would benefit from further refining refugee status based on migration experiences.

Also flagged:serotonin transportersautism spectrum disordertransporterbindingbrain development5-HT transporter
Journal Article 2018-04-10 ✓ 2 Snippets Ellegood J, Yee Y, Kerr TM, Muller CL, Blakely RD, Henkelman RM, Veenstra-VanderWeele J, Lerch JP.
In-Text Gene Mentions

…(serotonin transporter, SERT;5-HTT) gene, Slc6a4 ,…

…erotonin transporter, SERT; 5-HTT) gene ( SLC6A4…

Show Full Abstract

<h4>Background</h4>The serotonin (5-HT) system has long been implicated in autism spectrum disorder (ASD) as indicated by elevated whole blood and platelet 5-HT, altered platelet and brain receptor and transporter binding, and genetic linkage and association findings. Based upon work in genetically modified mice, 5-HT is known to influence several aspects of brain development, but systematic neuroimaging studies have not previously been reported. In particular, the 5-HT transporter (serotonin transporter, SERT; 5-HTT) gene, <i>Slc6a4</i>, has been extensively studied.<h4>Methods</h4>Using a 7-T MRI and deformation-based morphometry, we assessed neuroanatomical differences in an <i>Slc6a4</i> knockout mouse on a C57BL/6 genetic background, along with an <i>Slc6a4</i> Ala56 knockin mouse on two different genetic backgrounds (129S and C57BL/6).<h4>Results</h4>Individually (same sex, same background, same genotype), the only differences found were in the female <i>Slc6a4</i> knockout mouse; all the others had no significant differences. However, an analysis of variance across the whole study sample revealed a significant effect of <i>Slc6a4</i> on the amygdala, thalamus, dorsal raphe nucleus, and lateral and frontal cortices.<h4>Conclusions</h4>This work shows that an increase or decrease in SERT function has a significant effect on the neuroanatomy in 5-HT relevant regions, particularly the raphe nuclei. Notably, the <i>Slc6a4</i> Ala56 knockin alone appears to have an insignificant, but suggestive, effect compared to the KO, which is consistent with <i>Slc6a4</i> function. Despite the small number of 5-HT neurons and their localization to the brainstem, it is clear that 5-HT plays an important role in neuroanatomical organization.

Also flagged:hydroxyethyl starchflavonoidflavonoidswaterhyperuricemiadeoxycholic acid
Journal Article 2018-04-10 No Snippets Li J, Yang Y, Lu L, Ma Q, Zhang J.
Show Full Abstract

<h4>Background</h4>Morin, one of the most widely distributed flavonoids in plants, has been identified as a potent antihyperuricemic agent. Its poor water solubility and fast in vivo clearance, however, have limited its application in the treatment of hyperuricemia. In this study, a novel amphiphilic polymer (hydroxyethyl starch-deoxycholic acid [HES-DOCA]) was synthesized to overcome these limitations.<h4>Methods</h4>HES-DOCA conjugates with various substitution degrees were prepared by chemical grafting DOCA to HES through ester formation. The structures of the conjugates were confirmed by infrared spectroscopy and <sup>1</sup>H-NMR. Physicochemical characterizations of HES-DOCA nanoparticles-loaded Morin (Morin/HES-DOCA-NPs) were studied using dynamic light scattering and transmission electron microscopy (TEM). In vitro release studies were performed to evaluate the release properties of Morin from the NPs. Subsequently, in vivo pharmacokinetic parameters of Morin/HES-DOCA-NPs were investigated in Wistar rats through intravenous administration (2 mg/kg, equivalent to Morin). Antihyperuricemic efficacy of the NPs was evaluated in a rat hyperuricemic model.<h4>Results</h4>The optimized HES-based amphiphilic polymer contained approximately 10 DOCA groups per 100 anhydroglucose units of HES, which can spontaneously self-assemble to form spherical NPs as demonstrated by TEM images. Morin/HES-DOCA-NPs were monodispersed (polydispersity index = 0.05) with a mean diameter of 197 nm and exhibited a zeta potential of -14 mV. The use of DOCA as the polymer's hydrophobic segment enabled high drug loading efficiency (15.6%). After systemic administration, Morin/HES-DOCA-NPs exhibited significantly longer half-life and higher systemic exposure (elimination half-life and area under the plasma concentration-time curve) compared with free drug Morin. In a rat hyperuricemic model, treatment with Morin/HES-DOCA-NPs demonstrated superior therapeutic efficacy over Morin in decreasing serum uric acid level, increasing the uricosuric action, as well as attenuating hyperuricemia-associated inflammation in kidney of rats.<h4>Conclusion</h4>Collectively, these findings suggest that the novel HES-based NP formulation of Morin may have great potential for clinical treatment of hyperuricemia.

Also flagged:Purinergic ReceptorsNeurological Diseasesadenosine triphosphateneurological disordersParkinson's diseasePD
Journal Article 2018-04-10 ✓ 1 Snippet Oliveira-Giacomelli Á, Naaldijk Y, Sardá-Arroyo L, Gonçalves MCB, Corrêa-Velloso J, Pillat MM, de Souza HDN, Ulrich H.
In-Text Gene Mentions

HD is an inherited neurological disorder caused by a mutation in IT15 gene that encodes huntingtin protein (Htt) predominantly found in neurons.

Show Full Abstract

Since proving adenosine triphosphate (ATP) functions as a neurotransmitter in neuron/glia interactions, the purinergic system has been more intensely studied within the scope of the central nervous system. In neurological disorders with associated motor symptoms, including Parkinson's disease (PD), motor neuron diseases (MND), multiple sclerosis (MS), amyotrophic lateral sclerosis (ALS), Huntington's Disease (HD), restless leg syndrome (RLS), and ataxias, alterations in purinergic receptor expression and activity have been noted, indicating a potential role for this system in disease etiology and progression. In neurodegenerative conditions, neural cell death provokes extensive ATP release and alters calcium signaling through purinergic receptor modulation. Consequently, neuroinflammatory responses, excitotoxicity and apoptosis are directly or indirectly induced. This review analyzes currently available data, which suggests involvement of the purinergic system in neuro-associated motor dysfunctions and underlying mechanisms. Possible targets for pharmacological interventions are also discussed.

Also flagged:EGFRNSCLCnon-small cell lung cancercancerCXCR4Afatinib
Journal Article 2018-04-10 ✓ 1 Snippet Lüke F, Blazquez R, Yamaci RF, Lu X, Pregler B, Hannus S, Menhart K, Hellwig D, Wester HJ, Kropf S, Heudobler D, Grosse J, Moosbauer J, Hutterer M, Hau P, Riemenschneider MJ, Bayerlová M, Bleckmann A, Polzer B, Beißbarth T, Klein CA, Pukrop T.
In-Text Gene Mentions

…For enrichment ofDCCfrom CSF we…

Show Full Abstract

Brain and leptomeningeal metastasis (LMM) of non-small cell lung cancer is still associated with poor prognosis. Moreover, the current diagnostic standard for LMM often yields false negative results and the scientific progress in this field is still unsatisfying. We present a case of a 71-year old patient with an isolated LMM. While standard diagnostics could only diagnose a cancer of unknown primary, the use of [<sup>68</sup>Ga]-Pentixafor-PET/CT (CXCR4-PET/CT, a radiotracer targeting CXCR4) and a liquid biopsy of the cerebrospinal fluid revealed the primary NSCLC. The detection of L858R-EGFR, a common driver mutation in NSCLC, enabled us to treat the patient with Afatinib and monitor treatment using [<sup>68</sup>Ga]-Pentixafor PET/CT. To estimate the impact of CXCR4 signaling and its ligands in NSCLC brain metastasis we looked at their expression and correlation with EGFR mutations in a primary and brain metastasis data set and investigated the previously described binding of extracellular ubiquitin to CXCR4. In conclusion, we describe a novel approach to improve diagnostics towards LMM and underline the impact of the CXCL12/CXCR4 axis in brain metastasis in a subset of NSCLC patients. We cannot confirm a correlation of CXCR4 expression with EGFR mutations or the binding of extracellular ubiquitin as previously reported.

Also flagged:Hepatic LymphomaHepatocellular Carcinomaliver tumorstumorsalcohol cirrhosiscirrhosis
Journal Article 2018-04-10 ✓ 4 Snippets Bohlok A, De Grez T, Bouazza F, De Wind R, El-Khoury M, Repullo D, Donckier V.
In-Text Gene Mentions

…cirrhotic patient withhemochromatosiswho presented a…

…alcohol cirrhosis andhemochromatosis.…

…the diagnosis ofhemochromatosis.…

…male patient withhemochromatosisand Child A…

Show Full Abstract

<h4>Introduction</h4>Primary hepatic lymphomas (PHLs) are rare liver tumors, frequently misdiagnosed preoperatively. As these tumors could be successfully treated with chemotherapy, their early recognition is essential, potentially, to avoid useless surgery. We report on the case of a cirrhotic patient with hemochromatosis who presented a PHL, initially diagnosed as a hepatocellular carcinoma (HCC), and we analyze recent data from the literature on this subject.<h4>Case presentation and review of the literature</h4>A 45 mm liver tumor was found is a 68-year-old man with alcohol cirrhosis and hemochromatosis. At imaging, the diagnosis of HCC was suspected according to vascular characteristics and the presence of cirrhosis. FDG PET scan showed a solitary hypermetabolic liver tumor. Tumor markers were negative. Surgery consisted in left lateral hepatectomy. At pathology, the diagnosis of the primary hepatic marginal zone B cell lymphoma of mucosa-associated lymphoid tissue (MALT) type was demonstrated. Twenty-two articles reporting 33 cases of true PHL of MALT type were found. Presentation lacked specific symptoms (70% asymptomatic). Half of patients were suspected to have other etiologies of liver mass (HCC, intrahepatic cholangiocarcinoma), and thus diagnosis was established postoperatively. In the patient, diagnosis was made by preoperative biopsy, and chemotherapy was first-line treatment.<h4>Discussion</h4>Preoperative diagnosis of PHL, and particularly of primary hepatic MALT lymphoma, is challenging. This case illustrates that PHL remains to be considered among the differential diagnosis of isolated solid liver tumors. Further, it indicates that biopsy could be still indicated in case of suspected HCC in cirrhotic patients, particularly in the presence of unusual findings such as the combination of a FDG PET scan positive tumor in the absence of elevated alpha-fetoprotein.

Also flagged:Depressionpsychiatric syndromemethylationhistonemodificationsorganization
Journal Article 2018-04-10 No Snippets Peña CJ, Nestler EJ.
Show Full Abstract

Depression is a prevalent and complex psychiatric syndrome. Epigenetic mechanisms bridge the genetic and environmental factors that contribute to the pathophysiology of depression. A surge of research over the last decade has identified changes in DNA methylation, histone modifications, histone organization, and noncoding RNAs associated with depression and stress-induced depression-like behavior in animal models. We focus here on associations of epigenetic factors concurrent with depression and depression-like behavior, although risk for depression and some of the associated epigenetic changes are known to have developmental origins. Finally, emerging technology may enable breakthroughs in the ability to rescue depression-associated epigenetic modifications at specific genes, greatly enhancing specificity of future potential therapeutic treatments.

Also flagged:Leucinesynaptic adhesion moleculescell-surfaceadhesion moleculessynapsesLRR
Journal Article 2018-04-09 No Snippets Schroeder A, de Wit J.
Show Full Abstract

The brain harbors billions of neurons that form distinct neural circuits with exquisite specificity. Specific patterns of connectivity between distinct neuronal cell types permit the transfer and computation of information. The molecular correlates that give rise to synaptic specificity are incompletely understood. Recent studies indicate that cell-surface molecules are important determinants of cell type identity and suggest that these are essential players in the specification of synaptic connectivity. Leucine-rich repeat (LRR)-containing adhesion molecules in particular have emerged as key organizers of excitatory and inhibitory synapses. Here, we discuss emerging evidence that LRR proteins regulate the assembly of specific connectivity patterns across neural circuits, and contribute to the diverse structural and functional properties of synapses, two key features that are critical for the proper formation and function of neural circuits.

Also flagged:MFNGGFPHES5CHGAJAG1DLL1
Journal Article 2018-04-09 No Snippets Kadur Lakshminarasimha Murthy P, Srinivasan T, Bochter MS, Xi R, Varanko AK, Tung KL, Semerci F, Xu K, Maletic-Savatic M, Cole SE, Shen X.
Show Full Abstract

Notch signalling maintains stem cell regeneration at the mouse intestinal crypt base and balances the absorptive and secretory lineages in the upper crypt and villus. Here we report the role of Fringe family of glycosyltransferases in modulating Notch activity in the two compartments. At the crypt base, RFNG is enriched in the Paneth cells and increases cell surface expression of DLL1 and DLL4. This promotes Notch activity in the neighbouring <i>Lgr5</i>+ stem cells assisting their self-renewal. Expressed by various secretory cells in the upper crypt and villus, LFNG promotes DLL surface expression and suppresses the secretory lineage . Hence, in the intestinal epithelium, Fringes are present in the ligand-presenting 'sender' secretory cells and promote Notch activity in the neighbouring 'receiver' cells. Fringes thereby provide for targeted modulation of Notch activity and thus the cell fate in the stem cell zone, or the upper crypt and villus.

Also flagged:cell cycleskin developmentTGF-βvisionneural tubecytoskeleton
Journal Article 2018-04-09 No Snippets Acharya A, Brungs S, Henry M, Rotshteyn T, Singh Yaduvanshi N, Wegener L, Jentzsch S, Hescheler J, Hemmersbach R, Boeuf H, Sachinidis A.
Show Full Abstract

Embryonic developmental studies under microgravity conditions in space are very limited. To study the effects of short-term altered gravity on embryonic development processes, we exposed mouse embryonic stem cells (mESCs) to phases of hypergravity and microgravity and studied the differentiation potential of the cells using wide-genome microarray analysis. During the 64th European Space Agency's parabolic flight campaign, mESCs were exposed to 31 parabolas. Each parabola comprised phases lasting 22 s of hypergravity, microgravity, and a repeat of hypergravity. On different parabolas, RNA was isolated for microarray analysis. After exposure to 31 parabolas, mESCs (P31 mESCs) were further differentiated under normal gravity (1 g) conditions for 12 days, producing P31 12-day embryoid bodies (EBs). After analysis of the microarrays, the differentially expressed genes were analyzed using different bioinformatic tools to identify developmental and nondevelopmental biological processes affected by conditions on the parabolic flight experiment. Our results demonstrated that several genes belonging to GOs associated with cell cycle and proliferation were downregulated in undifferentiated mESCs exposed to gravity changes. However, several genes belonging to developmental processes, such as vasculature development, kidney development, skin development, and to the TGF-β signaling pathway, were upregulated. Interestingly, similar enriched and suppressed GOs were obtained in P31 12-day EBs compared with ground control 12-day EBs. Our results show that undifferentiated mESCs exposed to alternate hypergravity and microgravity phases expressed several genes associated with developmental/differentiation and cell cycle processes, suggesting a transition from the undifferentiated pluripotent to a more differentiated stage of mESCs.

Also flagged:ASB7endoplasmic reticulumcalciumlipidbiosynthesiscell growth
Journal Article 2018-04-09 No Snippets Anasa VV, Manickam M, Talwar P, Ravanan P.
Show Full Abstract

The endoplasmic reticulum (ER) not only performs its basic function of regulating calcium homeostasis, lipid biosynthesis, folding, modifying and transporting proteins but also plays a decisive role in regulating multiple cellular processes ranging from cell growth and differentiation to apoptosis and autophagy. Disturbances in ER homeostasis initiate the unfolded protein response (UPR) implicated in the pathogenesis of many human diseases. Drugging the UPR components for therapeutic interventions has received considerable attention. The purpose of this study is to identify genes that are previously unsuspected to be regulated under ER stress. Because ER stress-inducible gene expression is majorly regulated under ERSE elements, we screened human genome by adopting an in silico approach using ERSE elements (I, II, III) as probes and identified 337 candidate genes. Having knowledge of the importance of E3 ubiquitin ligase in the ERAD machinery; we validated our preliminary search by focusing on one of the hits i.e. ASB7 gene that encodes E3 ubiquitin ligase. In HeLa cells, we found that pharmacological induction of ER stress led to an increase in the expression of ASB7 with simultaneous activation of UPR pathways. Although knockdown of ASB7 expression leads to significant reduction in GRP78 and CHOP mRNA levels, it did not protect cells from ER stress-induced cell death. Also, an up-regulation in the expression of pro-inflammatory genes like TNF-α and IL-1β in ASB7 knockdown cells was observed under ER stress. Collectively, our findings suggest that ASB7 is regulated under ER stress and this study also identifies several other genes that could apparently be regulated under ER stress.

Also flagged:SegmentationextracellularprophasechromosomesDextranGFP
Journal Article 2018-04-09 ✓ 5 Snippets Walther N, Hossain MJ, Politi AZ, Koch B, Kueblbeck M, Ødegård-Fougner Ø, Lampe M, Ellenberg J.
In-Text Gene Mentions

…The twoCondensincomplexes in human…

…The twoCondensinsrarely colocalize at…

…3D map ofCondensinsin mitosis…

…fluorescently tag endogenousCondensinsubunits and map…

Condensinsconsist of two…

Show Full Abstract

The two Condensin complexes in human cells are essential for mitotic chromosome structure. We used homozygous genome editing to fluorescently tag Condensin I and II subunits and mapped their absolute abundance, spacing, and dynamic localization during mitosis by fluorescence correlation spectroscopy (FSC)-calibrated live-cell imaging and superresolution microscopy. Although ∼35,000 Condensin II complexes are stably bound to chromosomes throughout mitosis, ∼195,000 Condensin I complexes dynamically bind in two steps: prometaphase and early anaphase. The two Condensins rarely colocalize at the chromatid axis, where Condensin II is centrally confined, but Condensin I reaches ∼50% of the chromatid diameter from its center. Based on our comprehensive quantitative data, we propose a three-step hierarchical loop model of mitotic chromosome compaction: Condensin II initially fixes loops of a maximum size of ∼450 kb at the chromatid axis, whose size is then reduced by Condensin I binding to ∼90 kb in prometaphase and ∼70 kb in anaphase, achieving maximum chromosome compaction upon sister chromatid segregation.

Also flagged:Neddylationleft ventricular noncompaction cardiomyopathyheart failureposttranslationalubiquitin-like proteinNEDD8
Journal Article 2018-04-09 ✓ 1 Snippet Zou J, Ma W, Li J, Littlejohn R, Zhou H, Kim IM, Fulton DJR, Chen W, Weintraub NL, Zhou J, Su H.
In-Text Gene Mentions

Cdk5rap1

Show Full Abstract

During development, ventricular chamber maturation is a crucial step in the formation of a functionally competent postnatal heart. Defects in this process can lead to left ventricular noncompaction cardiomyopathy and heart failure. However, molecular mechanisms underlying ventricular chamber development remain incompletely understood. Neddylation is a posttranslational modification that attaches ubiquitin-like protein NEDD8 to protein targets via NEDD8-specific E1-E2-E3 enzymes. Here, we report that neddylation is temporally regulated in the heart and plays a key role in cardiac development. Cardiomyocyte-specific knockout of NAE1, a subunit of the E1 neddylation activating enzyme, significantly decreased neddylated proteins in the heart. Mice lacking NAE1 developed myocardial hypoplasia, ventricular noncompaction, and heart failure at late gestation, which led to perinatal lethality. NAE1 deletion resulted in dysregulation of cell cycle-regulatory genes and blockade of cardiomyocyte proliferation in vivo and in vitro, which was accompanied by the accumulation of the Hippo kinases Mst1 and LATS1/2 and the inactivation of the YAP pathway. Furthermore, reactivation of YAP signaling in NAE1-inactivated cardiomyocytes restored cell proliferation, and YAP-deficient hearts displayed a noncompaction phenotype, supporting an important role of Hippo-YAP signaling in NAE1-depleted hearts. Mechanistically, we found that neddylation regulates Mst1 and LATS2 degradation and that Cullin 7, a NEDD8 substrate, acts as the ubiquitin ligase of Mst1 to enable YAP signaling and cardiomyocyte proliferation. Together, these findings demonstrate a role for neddylation in heart development and, more specifically, in the maturation of ventricular chambers and also identify the NEDD8 substrate Cullin 7 as a regulator of Hippo-YAP signaling.

Also flagged:peptidecoagulation factor XIIIAP-F13A1cancerdeathFXIII
Journal Article 2018-04-09 ✓ 1 Snippet Peltier J, Roperch JP, Audebert S, Borg JP, Camoin L.
In-Text Gene Mentions

…PROC, SERPINA1, SERPINA5,SERPINC1, VWF) highlighted a…

Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) remains a major cause of cancer fatalities in developed countries. The risk of death is correlated to the stage of CRC during the primary diagnosis. Early diagnosis is closely associated with enhanced survival rate. We therefore investigated the AP-F13A1 as a potential protein marker of CRC.<h4>Methods</h4>The protein expression of FXIII in 40 serum samples was evaluated by enzyme-linked immunosorbent assays. Additionally, targeted proteomic assays (LC-PRM) were used to evaluate the expression of the activation peptide of F13A1 (AP-F13A1) in a further 113 serum samples. Results were analyzed by the Wilcoxon test and receiver operating characteristic curves generated to assess statistical differences and diagnostic factors between CRC patients and controls.<h4>Results</h4>AP-F13A1 was quantified in human serum samples using calibration curves with excellent linearity. AP-F13A1 was reduced in CRC patients using PRM assays from two distinct biobanks. The AUC for AP-F13A1 were 0.95 and 0.93. Sensitivity/specificity values for the two sets of patients were 75%/95% and 71%/95% respectively.<h4>Conclusion</h4>We have presented the proof of principle that in vivo release of AP-F13A1 can be measured by PRM-based strategies in CRC serum samples. AP-F13A1 may be an effective serological biomarker as part of a screening program of CRC detection.

Also flagged:cancerhepatocellular carcinomaHemophilia Ableeding disordercoagulation factor VIIIHD
Journal Article 2018-04-09 ✓ 2 Snippets Li C, Liu L, Dinu V.
In-Text Gene Mentions

Huntington’s disease (HD) is an autosomal dominant progressive neurodegenerative disorder with a distinct phenotype characterized by chorea, dystonia, incoordination, cognitive decline, and behavioral difficulties, which is caused by a heterozygous expanded trinucleotide repeat (CAG)n, encoding glutamine, in the gene encoding huntingtin (HTT) on chromosome 4p16 (Walker, 2007; Dayalu & Albin, 2015).

…gene encoding huntingtin (HTT) on chromosome 4p16…

Show Full Abstract

Complex diseases such as cancer are usually the result of a combination of environmental factors and one or several biological pathways consisting of sets of genes. Each biological pathway exerts its function by delivering signaling through the gene network. Theoretically, a pathway is supposed to have a robust topological structure under normal physiological conditions. However, the pathway's topological structure could be altered under some pathological condition. It is well known that a normal biological network includes a small number of well-connected hub nodes and a large number of nodes that are non-hubs. In addition, it is reported that the loss of connectivity is a common topological trait of cancer networks, which is an assumption of our method. Hence, from normal to cancer, the process of the network losing connectivity might be the process of disrupting the structure of the network, namely, the number of hub genes might be altered in cancer compared to that in normal or the distribution of topological ranks of genes might be altered. Based on this, we propose a new PageRank-based method called Pathways of Topological Rank Analysis (PoTRA) to detect pathways involved in cancer. We use PageRank to measure the relative topological ranks of genes in each biological pathway, then select hub genes for each pathway, and use Fisher's exact test to test if the number of hub genes in each pathway is altered from normal to cancer. Alternatively, if the distribution of topological ranks of gene in a pathway is altered between normal and cancer, this pathway might also be involved in cancer. Hence, we use the Kolmogorov-Smirnov test to detect pathways that have an altered distribution of topological ranks of genes between two phenotypes. We apply PoTRA to study hepatocellular carcinoma (HCC) and several subtypes of HCC. Very interestingly, we discover that all significant pathways in HCC are cancer-associated generally, while several significant pathways in subtypes of HCC are HCC subtype-associated specifically. In conclusion, PoTRA is a new approach to explore and discover pathways involved in cancer. PoTRA can be used as a complement to other existing methods to broaden our understanding of the biological mechanisms behind cancer at the system-level.

Also flagged:Crocinhepatocellular carcinomacancerdeathautophagyLC3
Journal Article 2018-04-09 ✓ 1 Snippet Yao C, Liu BB, Qian XD, Li LQ, Cao HB, Guo QS, Zhou GF.
In-Text Gene Mentions

…drinking, obesity, andhemochromatosis, etc, are the…

Show Full Abstract

<h4>Background</h4>Autophagy induction is a common mechanism for antitumor chemicals in induction of cancer cell death. However, the role of autophagy in crocin-induced apoptosis is barely studied in hepatocellular carcinoma (HCC).<h4>Materials and methods</h4>The influence of crocin on growth, apoptosis, and autophagy and its mutual relations were analyzed by Cell Counting Kit-8 assay, flow cytometer, EGFP-LC3 puncta analysis, and Western blot in HCC cells. The activities of Akt/mTOR axis and its roles in autophagy regulation were also detected by Western blot in HCC cells treated with crocin. Finally, the roles of Akt/mTOR axis in crocin-induced autophagic apoptosis were analyzed by Western blot and flow cytometer in HCC cells.<h4>Results</h4>The results showed that crocin can induce growth inhibition in a does- and time-dependent pattern by apoptosis. Increased LC3 puncta and upregulated LC3-II accumulation was observed as early as at 6 hours in HepG2 and HCCLM3 cells treated with 3 mg/mL crocin. Moreover, apoptosis analysis using flow cytometer and cleaved poly (ADP-ribose) polymerase detection revealed that autophagy initiation was prior to apoptosis activation in HCC cells treated with crocin. When autophagy was blocked with 3-methyladenine, crocin-induced apoptosis was inhibited in HCC cells. Furthermore, crocin treatment constrained the activities of key proteins in Akt/mTOR signaling, such as p-Akt (S473), p-mTOR (S2448), and p-p70S6K (T389), suggesting that crocin could induce autophagic apoptosis in HCC cells in an Akt/mTOR-dependent mechanism. Indeed, when autophagy was suppressed by forced expression of Akt, the crocin-induced apoptosis was also impaired in HCC cells.<h4>Conclusion</h4>The results suggested that crocin could induce autophagic apoptosis in HCC cells by inhibiting Akt/mTOR activity. This study originally revealed that autophagic apoptosis is a novel cytotoxic function of crocin, which lays the theoretical foundation for clinical application of crocin in HCC.

Also flagged:Theissenolactone CUveitisocular inflammationanterior uveitistumor necrosis factor(TNF)-α
Journal Article 2018-04-09 ✓ 1 Snippet Lin FL, Ho JD, Cheng YW, Chiou GCY, Yen JL, Chang HM, Lee TH, Hsiao G.
In-Text Gene Mentions

…not similar toTRIM38-mediated lysosomal-dependent …

Show Full Abstract

The aim of this study was to investigate the effects of a natural component, theissenolactone C (LC53), on the ocular inflammation of experimental endotoxin-induced uveitis (EIU) and its related mechanisms in microglia. Evaluation of the severity of anterior uveitis indicated that LC53 treatment significantly decreased iridal hyperemia and restored the clinical scores. Additionally, the deficient retina functions of electroretinography were improved by LC53. LC53 significantly reduced levels of tumor necrosis factor (TNF)-α, monocyte chemoattractant protein-1, protein leakage and activation of matrix metalloproteinases in the anterior section during EIU. Moreover, LC53 treatment decreased the oxidative stress as well as neuroinflammatory reactivities of GFAP and Iba-1 in the posterior section. Furthermore, LC53 decreased the phosphorylation of p65, expression of HSP90, Bax, and cleaved-caspase-3 in EIU. According to the microglia studies, LC53 significantly abrogated the productions of TNF-α, PGE<sub>2</sub>, NO and ROS, as well as inducible NO synthase and cyclooxygenase-2 expression in LPS-stimulated microglial BV2 cells. The microglial activation of IKKβ, p65 phosphorylation and nuclear phosphorylated p65 translocation were strongly attenuated by LC53. On the other hand, LC53 exhibited the inhibitory effects on JNK and ERK MAPKs activation. Our findings indicated that LC53 exerted the ocular-protective effect through its inhibition on neuroinflammation, glial activation, and apoptosis in EIU, suggesting a therapeutic potential with down-regulation of the NF-κB signaling for uveitis and retinal inflammatory diseases.

Also flagged:fatty acidbiosynthesisimmune responsesignaling transductionACACAMECR
Journal Article 2018-04-09 ✓ 1 Snippet Wang K, Wu P, Yang Q, Chen D, Zhou J, Jiang A, Ma J, Tang Q, Xiao W, Jiang Y, Zhu L, Li X, Tang G.
In-Text Gene Mentions

…gene and theUNC13Cgene were overlapped…

Show Full Abstract

The domestic pigs have been undergone intense selection pressures for these development of interested traits following domestication and modern breeding. This has altered many traits in most of pig breeds, such as growth rate, body weight, fertility, and immunity. Thus, the objectives of this study were to (1) detect these selection signatures and identify the candidate genes that show evidences of recent artificial selection at the level of whole genome, (2) be beneficial to understand the relationship between genomic structure and phenotypic diversity, and (3) highlight the key roles of these candidate genes in growth and development in the two breeds. The data consisted of total raw number of 345570 single nucleotide polymorphisms (SNPs) in 1200 individuals from the Chinese Landrace pigs (L, <i>n</i> = 600) and Yorkshire pigs (Y, <i>n</i> = 600). Based on these SNPs data, two complementary methods, population differentiation (Fst) and composite likelihood ratio test (CLR), were carried out to detect the selection signatures in this study. A total of 540 potential selection regions (50 kb) which contained 111 candidate genes were detected for Landrace-Yorkshire pair (L-Y) by Fst. In addition, 73 and 125 candidate genes were found for Landrace pigs and Yorkshire pigs by CLR test based on 321 and 628 potential selection regions, respectively. Some candidate genes are associated with important traits and signaling pathways including the <i>ACACA</i>, <i>MECR</i>, <i>COL11A1</i>, <i>GHR</i>, <i>IGF1R</i>, <i>IGF2R</i>, <i>IFNG</i>, and <i>MTOR</i> gene. The <i>ACACA</i> and <i>MECR</i> gene are related to fatty acid biosynthesis. The <i>COL11A1</i> gene is essential for the development of the normal differentiation. The <i>GHR</i>, <i>IGF1R</i>, and <i>IGF2R</i> gene are significant candidate genes which play major roles in the growth and development in animals. The <i>IFNG</i> gene is associated with some aspects of immune response. The <i>MTOR</i> gene regulates many signaling pathways and signaling transduction pathway.

Also flagged:Phenol redMg2+VASCa2+Glucosemagnesium
Journal Article 2018-04-09 No Snippets Kim YK, Lee KB, Kim SY, Bode K, Jang YS, Kwon TY, Jeon MH, Lee MH.
Show Full Abstract

Magnesium alloys are biodegradable metals receiving increasing attention, but the clinical applications of these materials are delayed by concerns over the rapid corrosion rate and gas formation. Unlike corrosion, which weakens mechanical properties, the gas formation issue has received little attention. Therefore, we evaluated the gas formation and biological effects for Mg implants through preclinical (immersed in Earle's balanced salt solution and <i>in vivo</i>) and clinical studies. The immersion test examined the gas volume and composition. The <i>in vivo</i> study also examined gas volume and histological analysis. The clinical study examined the gas volume and safety after Mg screw metatarsal fixation. Gas was mainly composed of H<sub>2</sub>, CO and CO<sub>2</sub>. Maximum volumes of gas formed after 5 days for <i>in vivo</i> and 7 days in clinical study. Within the clinical examination, two superficial wound complications healed with local wound care. Osteolytic lesions in the surrounding metaphysis of the Mg screw insertion developed in all cases and union occurred at 3 months. Mg implants released gas with variable volumes and composition (H<sub>2</sub>, CO, and CO<sub>2</sub>), with no long-term toxic effects on the surrounding tissue. The implants enabled bone healing, although complications of wound breakdown and osteolytic lesions developed.

Also flagged:Paclitaxelpeptidealbuminbreast cancerBCL-2P-glycoprotein
Journal Article 2018-04-08 No Snippets Gupta D, Kumar M, Tyagi P, Kapoor S, Tyagi A, Barman TK, Kharbanda S, Kufe D, Singh H.
Show Full Abstract

Paclitaxel (PTX) is a microtubule inhibitor administered as an albumin-bound nanoformulation for the treatment of breast cancer. However, the effectiveness of PTX is limited by resistance mechanisms mediated in part by upregulation of the anti-apoptotic BCL-2 and P-glycoprotein (P-gp). Present investigation was designed to study the synergistic potential of NuBCP-9 and PTX loaded polymeric nanoparticles to minimize the dose and improve the efficacy and safety. PTX and NuBCP-9 loaded polylactic acid-polyethylene glycol-polypropylene glycol-polyethylene glycol [PLA-(PEG-PPG-PEG)] nanoparticles were prepared by double emulsion solvent evaporation method. PTX and NuBCP-9 loaded NPs displayed an average size of 90 nm with spherical morphology. PTX and NuBCP-9 dual loaded NPs reducedIC<sub>50</sub> by ~40-fold and acted synergistically. Treatment of the syngeneic EAT mice with PTX-NuBCP-9/NPs resulted in improved efficacy than that alone treated mice. Overall, the concomitant delivery PTX and NuBCP-9 loaded NPs showed superior activity than that of PTX and NuBCP-9 alone treated mice.

Also flagged:Semaphorin 3CCancerSemaphorinssemaphorintumorsangiogenesis
Journal Article 2018-04-08 ✓ 1 Snippet Hao J, Yu JS.
In-Text Gene Mentions

…[ 4 ], Netrin/DCC/UNC5 [ 5 ,…

Show Full Abstract

Neurodevelopmental programs are frequently dysregulated in cancer. Semaphorins are a large family of guidance cues that direct neuronal network formation and are also implicated in cancer. Semaphorins have two kinds of receptors, neuropilins and plexins. Besides their role in development, semaphorin signaling may promote or suppress tumors depending on their context. Sema3C is a secreted semaphorin that plays an important role in the maintenance of cancer stem-like cells, promotes migration and invasion, and may facilitate angiogenesis. Therapeutic strategies that inhibit Sema3C signaling may improve cancer control. This review will summarize the current research on the Sema3C pathway and its potential as a therapeutic target.

Also flagged:SynthesisHydrogenGrapheneHydrogen titanate nanotubeoxidebenzylic alcohols
Journal Article 2018-04-08 No Snippets Yang J, You J, Dai J, Chen Y, Li Y.
Show Full Abstract

Hydrogen titanate nanotube (HTT)/graphene nanocomposites are synthesized by hydrothermal reduction of graphene oxide (GO) and simultaneous preparation of nanotubular HTT via an alkaline hydrothermal process. By using this facile in-situ compositing strategy, HTT are densely supported upon the surface of graphene sheets with close interface contacts. The as-prepared HTT/graphene nanocomposites possess significantly enhanced visible light catalytic activity for the partial oxidation of benzylic alcohols. The amount of graphene has significant influence on catalytic activity and the optimal content of graphene is 1.0 wt %, giving a normalized rate constant <i>k</i> of 1.71 × 10<sup>-3</sup> g/m²·h, which exceeds that of pure HTT and HTT/graphene-1.0% mixed by a factor of 7.1 or 5.2. Other than the general role of graphene as a high-performance electron acceptor or transporter, the observed enhancement in photocatalytic activity over HTT/graphene can be ascribed to the improved interfacial charge migration from enhanced chemical bonding (Ti-C bonds) during the in-situ compositing process. The formation of Ti-C bonds is confirmed by XPS analysis and the resulting enhanced separation of photoinduced charge carriers is demonstrated by electrochemical impedance spectra and transient photocurrent response.

Also flagged:amino acid transportersamino acidsprotein synthesislactationmembraneamino acid
Journal Article 2018-04-08 No Snippets Chen F, Zhang S, Deng Z, Zhou Q, Cheng L, Kim SW, Chen J, Guan W.
Show Full Abstract

<h4>Background</h4>Milk protein is crucial for milk quality in sows and health of newborn piglets. Plasma amino acids (AA) in sows are important precursors for milk protein synthesis in the mammary gland. In order to study the regulation of AA transported in sow mammary glands and possible underlying mechanisms, we measured the expression of genes coding for milk proteins, AA transporter expressions, and plasma AA concentrations in sows at three different physiological stages (D-17, D1 and D17 of lactation), and then further investigated the regulation of AA transport across the cell membrane by adaptive mechanisms using pig mammary epithelial cells (PMEC) as an in vitro model. PMEC were cultured in DMEM:F12 with 4 amino acid concentrations (0 × AA complex, 1 × AA complex, 5 × AA complex, and 25 × AA complex). Classes of AA complexes evaluated in this study included neutral AAs (<i>L</i>-Ala + <i>L</i>-Ser + <i>L</i>-Cys), acidic AAs (<i>L</i>-Asp, <i>L</i>-Glu) and neutral + basic AAs (<i>L</i>-Ala + <i>L</i>-Ser + <i>L</i>-Cys + <i>L</i>-Lys).<h4>Results</h4>Our results indicated that mRNA expression of genes coding for milk protein (αs1-casein, αs2-casein, β-casein and κ-casein) increased significantly with the advance of physiological stage (<i>P</i> < 0.05), and plasma concentrations of most AAs including threonine, serine, glutamate, alanine, valine, cysteine, methionine, isoleucine and tyrosine were greater at D1 of lactation compared with D-17 and D17 of lactation (<i>P</i> < 0.05). Additionally, protein and gene expressions of AA transporters including excitatory AA transporter 3 (EAAT3), alanine/serine/cysteine/threonine transporter (ASCT1) and sodium-coupled neutral AA transporter 1 (SNAT2) were greater in lactating sow mammary glands compared with sow mammary glands in late pregnancy (<i>P</i> < 0.05). The mRNA expressions of <i>SLC38A2</i>, <i>SLC1A1, SLC6A14</i> increased significantly in the cell mediums supplemented with 5 × and 25 × of AA complexes compared with those cells cultured in DMEM/F12 cell medium (<i>P</i> < 0.05). The mRNA expressions of <i>SLC38A, SLC1A4</i>, and <i>SLC6A14</i> also increased in EBSS cell medium compared to DMEM/F12. However, only mRNA expression of <i>SLC38A</i> decreased when AA complex was added into EBSS (<i>P</i> < 0.05).<h4>Conclusion</h4>AA transportation was positively regulated in sow mammary glands with the advance of physiological stage from late pregnancy to peak of lactation and AA transporters in PMECs were adaptively regulated by changed AA concentrations.

Also flagged:Netrin-1nerve injuryaxonalfluoresceindeleted in colorectal canceraxonal growth
Journal Article 2018-04-07 ✓ 5 Snippets Liu M, Yin C, Jia Z, Li K, Zhang Z, Zhao Y, Gong X, Liu X, Li P, Fan Y.
In-Text Gene Mentions

colorectal cancer (DCC

Netrin-1/DCC Expression Against Mechanical Stretch-Induced Injury

Netrin-1 and deleted in colorectal cancer (DCC) receptor expression compared with the stretch-injury

DCC Expression Against Mechanical Stretch-Induced Injury

DCC) receptor expression compared with the stretch-injury

Show Full Abstract

Nerve cells detect and respond to electric field stimulation and extrinsic chemical guidance cues during development and regeneration; therefore, the development and optimization of an approach for functional neuronal regeneration are necessary for a nerve injury. In this study, we proposed using electric field stimulation to repair a nerve injury triggered by serious mechanical stretch loading. A device that provides continuous mechanical stretch and constant electric field stimulation was designed. Primary dissociated spinal cord neurons were stimulated by mechanical stretch (tensile strain 2.5-10%) at different times (1, 4, 8, and 12 h) to set up a moderate nerve injury model. Stimulated samples were evaluated with respect to cell viability, density, and axonal elongation by the MTT and immunofluorescence assays. The results indicated that mechanical stretch (S, 5% tensile strain, 4 h) caused moderate axonal injury, resulting in significant loss of cell viability and a decrease in cell density. However, injured spinal cord neurons became viable after electric field stimulation (E, 33 mA/m<sup>2</sup>, 4 h) in the fluorescein diacetate assay. In addition, neuronal viability, density, and elongation increased significantly after electric field stimulation compared with those of stretch-injured neurons. Moreover, electric field stimulation significantly activated the axonal guidance cues Netrin-1 and deleted in colorectal cancer (DCC) receptor expression compared with the stretch-injury group. These results indicate that electric stimulation activates synergistic guidance cues of expression to improve axonal growth relevant to nerve injuries. Our study provides new insight into neuronal regeneration.

Also flagged:PolyglutaminepathogenesisHuntingtin
Journal Article 2018-04-07 ✓ 1 Snippet Feng X, Luo S, Lu B.
In-Text Gene Mentions

…focus on Huntingtin (HTT), the most extensively…

Show Full Abstract

Expanded polyglutamine (polyQ) stretches within endogenous proteins cause at least nine human diseases. The structural basis of polyQ pathogenesis is the key to understanding fundamental mechanisms of these diseases, but it remains unclear and controversial due to a lack of polyQ protein structures at the single-atom level. Various hypotheses have been proposed to explain the structure-cytotoxicity relationship of pathogenic proteins with polyQ expansion, largely based on indirect evidence. Here we review these hypotheses and their supporting evidence, along with additional insights from recent structural biology and chemical biology studies, with a focus on Huntingtin (HTT), the most extensively studied polyQ disease protein. Lastly, we propose potential novel strategies that may further clarify the conformation-cytotoxicity relationship of polyQ proteins.

Also flagged:Acute Lymphoblastic LeukemiapathogenesisALLTP53cell cycleRAS
Journal Article 2018-04-07 No Snippets Montaño A, Forero-Castro M, Marchena-Mendoza D, Benito R, Hernández-Rivas JM.
Show Full Abstract

The identification and study of genetic alterations involved in various signaling pathways associated with the pathogenesis of acute lymphoblastic leukemia (ALL) and the application of recent next-generation sequencing (NGS) in the identification of these lesions not only broaden our understanding of the involvement of various genetic alterations in the pathogenesis of the disease but also identify new therapeutic targets for future clinical trials. The present review describes the main deletions, amplifications, sequence mutations, epigenetic lesions, and new structural DNA rearrangements detected by NGS in B-ALL and T-ALL and their clinical importance for therapeutic procedures. We reviewed the molecular basis of pathways including transcriptional regulation, lymphoid differentiation and development, TP53 and the cell cycle, RAS signaling, JAK/STAT, NOTCH, PI3K/AKT/mTOR, Wnt/β-catenin signaling, chromatin structure modifiers, and epigenetic regulators. The implementation of NGS strategies has enabled important mutated genes in each pathway, their associations with the genetic subtypes of ALL, and their outcomes, which will be described further. We also discuss classic and new cryptic DNA rearrangements in ALL identified by mRNA-seq strategies. Novel cooperative abnormalities in ALL could be key prognostic and/or predictive biomarkers for selecting the best frontline treatment and for developing therapies after the first relapse or refractory disease.

Also flagged:neurodegenerative diseasesneurodegenerative disordershistone deacetylaseHDACpost-translational modificationsHDACs
Journal Article 2018-04-06 No Snippets Thomas EA, D'Mello SR.
Show Full Abstract

By their ability to shatter quality of life for both patients and caregivers, neurodegenerative diseases are the most devastating of human disorders. Unfortunately, there are no effective or long-terms treatments capable of slowing down the relentless loss of neurons in any of these diseases. One impediment is the lack of detailed knowledge of the molecular mechanisms underlying the processes of neurodegeneration. While some neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, and amyotrophic lateral sclerosis, are mostly sporadic in nature, driven by both environment and genetic susceptibility, many others, including Huntington's disease, spinocerebellar ataxias, and spinal-bulbar muscular atrophy, are genetically inherited disorders. Surprisingly, given their different roots and etiologies, both sporadic and genetic neurodegenerative disorders have been linked to disease mechanisms involving histone deacetylase (HDAC) proteins, which consists of 18 family members with diverse functions. While most studies have implicated certain HDAC subtypes in promoting neurodegeneration, a substantial body of literature suggests that other HDAC proteins can preserve neuronal viability. Of particular interest, however, is the recent realization that a single HDAC subtype can have both neuroprotective and neurotoxic effects. Diverse mechanisms, beyond transcriptional regulation have been linked to these effects, including deacetylation of non-histone proteins, protein-protein interactions, post-translational modifications of the HDAC proteins themselves and direct interactions with disease proteins. The roles of these HDACs in both sporadic and genetic neurodegenerative diseases will be discussed in the current review.

Also flagged:serotonin transporterSLC6A4SERTserotoninextracellularre-uptake
Journal Article 2018-04-06 No Snippets Amador MHB, McDonald MD.
Show Full Abstract

The serotonin transporter (SERT) functions in the uptake of the neurotransmitter serotonin (5-HT) from the extracellular milieu and is the molecular target of the selective serotonin re-uptake inhibitors (SSRIs), a common group of anti-depressants. The current study comprehensively assesses the sequence, tissue distribution, transport kinetics and physiological function of a teleost SERT. The 2022 bp toadfish SERT sequence encodes a protein of 673 amino acids, which shows 83% similarity to zebrafish SERT and groups with SERT of other teleosts in phylogenetic analysis. SERT mRNA is ubiquitous in tissues and is expressed at high levels in the heart and, within the brain, in the cerebellum. SERT cRNA expressed in <i>Xenopus laevis</i> oocytes demonstrates a <i>K</i><sub>m</sub> value of 2.08±0.45 μmol l<sup>-1</sup>, similar to previously reported <i>K</i><sub>m</sub> values for zebrafish and human SERT. Acute systemic blockade of SERT by intraperitoneal administration of the SSRI fluoxetine (FLX) produces a dose-dependent increase in plasma 5-HT, indicating effective inhibition of 5-HT uptake from the circulation. As teleosts lack platelets, which are important 5-HT sequestration sites in mammals, the FLX-induced increase in plasma 5-HT suggests that toadfish tissues may normally be responsible for maintaining low 5-HT concentrations in the bloodstream.

Also flagged:tumorlaryngeal squamous cell carcinomamethylationProtocadherinscell-cell adhesion moleculesprotocadherin
Journal Article 2018-04-06 ✓ 5 Snippets Byzia E, Soloch N, Bodnar M, Szaumkessel M, Kiwerska K, Kostrzewska-Poczekaj M, Jarmuz-Szymczak M, Szylberg L, Wierzbicka M, Bartochowska A, Kalinowicz E, Grenman R, Szyfter K, Marszalek A, Giefing M.
In-Text Gene Mentions

In light of these findings and recent reports showing that PCDH17 methylation is detectable in serum of cancer patients we suggest that testing PCDH17 DNA methylation might serve as a potential biomarker in LSCC.

Moreover, we analyzed primary LSCC samples by immunohistochemistry for PCDH17 protein loss.

We used bisulfite pyrosequencing to analyze a cohort of primary LSCC tumors for alterations in PCDH17 promoter DNA methylation as an alternative gene inactivation mechanism to the homozygous deletions reported earlier.

Importantly, DNA demethylation by decitabine has restored low level PCDH17 expression in LSCC cell lines.

In this study we have further corroborated our previous findings on the involvement of PCDH17 in laryngeal squamous cell carcinoma (LSCC).

Show Full Abstract

Protocadherins are cell-cell adhesion molecules encoded by a large family of genes. Recent reports demonstrate recurrent silencing of protocadherin genes in tumors and provide strong arguments for their tumor supresor functionality. Loss of protocadherins may contribute to cancer development not only by altering cell-cell adhesion, that is a hallmark of cancer, but also by enhancing proliferation and epithelial mesenchymal transition of cells via deregulation of the WNT signaling pathway. In this study we have further corroborated our previous findings on the involvement of PCDH17 in laryngeal squamous cell carcinoma (LSCC). We used bisulfite pyrosequencing to analyze a cohort of primary LSCC tumors for alterations in PCDH17 promoter DNA methylation as an alternative gene inactivation mechanism to the homozygous deletions reported earlier. Moreover, we analyzed primary LSCC samples by immunohistochemistry for PCDH17 protein loss. We identified recurrent elevation of PCDH17 promoter DNA methylation in 32/81 (40%) primary tumors (P < 0.001) and therein hypermethylation of 12 (15%) cases in contrast to no tumor controls (n = 24) that were all unmethylated. Importantly, DNA demethylation by decitabine has restored low level PCDH17 expression in LSCC cell lines. In conclusion, we provide a mechanistic explanation of recurrently observed PCDH17 silencing in LSCC by demonstrating the role of promoter methylation in this process. In light of these findings and recent reports showing that PCDH17 methylation is detectable in serum of cancer patients we suggest that testing PCDH17 DNA methylation might serve as a potential biomarker in LSCC.

Also flagged:liver diseases(Cx) 26reverse transcriptionCx26membranecholestatic liver diseases
Journal Article 2018-04-06 ✓ 1 Snippet Bowe A, Zweerink S, Mück V, Kondylis V, Schulte S, Goeser T, Nierhoff D.
In-Text Gene Mentions

DCC

Show Full Abstract

There is a medical need of biomarkers for disease stratification in cholestatic liver diseases that come along with changes in hepatocyte polarity. Neighbor of Punc E11 (Nope) is an oncofetal marker that is lost after final differentiation and polarization of hepatocytes. We analyzed the expression pattern of Nope and connexin (Cx) 26 as markers of hepatocyte polarization during murine liver development as well as in adult liver with or without bile duct ligation (BDL) by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR), western blotting (WB), and immunohistochemistry. Nope is highly expressed in fetal and postnatal liver but barely detectable thereafter. Cx26, however, is much higher expressed in adult than in fetal liver. Postnatally, Nope is directed to the sinusoidal membrane of early hepatocytes while Cx26 remains distributed over the whole membrane indicating limited polarization. In the adult liver, only Cx26 is detectable and restricted to the bile canalicular domain indicating fully polarized hepatocytes. After BDL, Nope is again >300-fold upregulated while Cx26 is reduced rapidly. By immunohistochemistry, Nope identifies a subset of hepatocytes with randomly distributed Cx26. In summary, Nope identifies depolarized adult hepatocytes after cholestatic liver injury resembling early postnatal hepatocytes. Therefore, Nope might be a valuable histochemical biomarker allowing stage-specific stratifications in cholestatic liver diseases.

Also flagged:growth hormoneGHinsulin-like growth factormetabolismsomatomedinIGF
Journal Article 2018-04-06 No Snippets Yakar S, Werner H, Rosen CJ.
Show Full Abstract

The discovery of the growth hormone (GH)-mediated somatic factors (somatomedins), insulin-like growth factor (IGF)-I and -II, has elicited an enormous interest primarily among endocrinologists who study growth and metabolism. The advancement of molecular endocrinology over the past four decades enables investigators to re-examine and refine the established somatomedin hypothesis. Specifically, gene deletions, transgene overexpression or more recently, cell-specific gene-ablations, have enabled investigators to study the effects of the <i>Igf1</i> and <i>Igf2</i> genes in temporal and spatial manners. The GH/IGF axis, acting in an endocrine and autocrine/paracrine fashion, is the major axis controlling skeletal growth. Studies in rodents have clearly shown that IGFs regulate bone length of the appendicular skeleton evidenced by changes in chondrocytes of the proliferative and hypertrophic zones of the growth plate. IGFs affect radial bone growth and regulate cortical and trabecular bone properties via their effects on osteoblast, osteocyte and osteoclast function. Interactions of the IGFs with sex steroid hormones and the parathyroid hormone demonstrate the significance and complexity of the IGF axis in the skeleton. Finally, IGFs have been implicated in skeletal aging. Decreases in serum IGFs during aging have been correlated with reductions in bone mineral density and increased fracture risk. This review highlights many of the most relevant studies in the IGF research landscape, focusing in particular on IGFs effects on the skeleton.

Also flagged:Pancreatic cancercancerdeathECT2NR5A2NRP2
Journal Article 2018-04-06 No Snippets Liu B, Yang H, Taher L, Denz A, Grützmann R, Pilarsky C, Weber GF.
Show Full Abstract

Pancreatic cancer is the fourth leading cause for cancer-related death, and early diagnosis is one key to improve the survival rate of this disease. Molecular biomarkers are an important method for diagnostic use in pancreatic cancer. We used data from three mRNA microarray datasets and a microRNA dataset (GSE16515, GSE15471, GSE28735, and GSE41372) to identify potential key genes. Differentially expressed genes (DEGs) and microRNAs (DEMs) were identified. Functional, pathway enrichment, and protein-protein interaction analyses were performed on common DEGs across all datasets. The target genes of the DEMs were identified. DEMs targets that were also DEGs were further scrutinized using overall survival analysis. A total of 236 DEGs and 21 DEMs were identified. There were a total of four DEGs (ECT2, NR5A2, NRP2, and TGFBI), which were also predicted target genes of DEMs. Overall survival analysis showed that high expression levels of three of these genes (ECT2, NRP2, and TGFBI) were associated with poor overall survival for pancreatic cancer patients. The basic expression of DEGs in pancreas stood lower level in various organ tissues. The expression of ECT2 and NRP2 was higher in different pancreatic cancer cell lines than normal pancreas cell line. Knockout of ECT2 by Crispr Cas9 gene editing system decreased proliferation and migration ability in pancreatic cancer cell line MiaPaCa2. In conclusion, we think that data mining method can do well in biomarker screening, and ECT2 and NRP2 can play as potential biomarker or therapy target by Crispr Cas9 in pancreatic cancer.

Also flagged:vesiclesecretionEpimcell proliferationcellWnt4
Journal Article 2018-04-06 ✓ 1 Snippet Vishy CE, Swietlicki EA, Gazit V, Amara S, Heslop G, Lu J, Levin MS, Rubin DC.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Stem cell therapy is a potential therapeutic approach for disorders characterized by intestinal injury or loss of functional surface area. Stem cell function and proliferation are mediated by the stem cell niche. Stromal cells such as intestinal subepithelial myofibroblasts (ISEMFs) are important but poorly studied components of the stem cell niche. To examine the role of ISEMFs, we have previously generated mice with deletion of epimorphin ( Epim), an ISEMF protein and member of the syntaxin family of intracellular vesicle docking proteins that regulate cell secretion. Herein we explore the mechanisms for previous observations that Epim deletion increases gut crypt cell proliferation, crypt fission, and small bowel length in vivo. Stem cell-derived crypt culture techniques were used to explore the interaction between enteroids and myofibroblasts from Epim<sup>-/-</sup> and WT mice. Enteroids cocultured with ISEMFS had increased growth and crypt-like budding compared with enteroids cultured without stromal support. Epim deletion in ISEMFs resulted in increased enteroid budding and surface area compared with cocultures with wild-type (WT) ISEMFs. In primary crypt cultures, Epim<sup>-/-</sup> enteroids had significantly increased surface area and budding compared with WTs. However, stem cell assays comparing the number of Epim<sup>-/-</sup> vs. WT colony-forming units after first passage showed no differences in the absence of ISEMF support. Epim<sup>-/-</sup> vs. WT ISEMFs had increased Wnt4 expression, and addition of Wnt4 to WT cocultures enhanced budding. We conclude that ISEMFs play an important role in the stem cell niche. Epim regulates stem cell proliferation and differentiation via stromal contributions to the niche microenvironment. NEW & NOTEWORTHY The role of subepithelial intestinal myofibroblasts (ISEMFs) in the gut stem cell niche is controversial. We provide novel evidence supporting ISEMFs as important niche contributors. We show that the in vivo intestinal effects of deletion of myofibroblast Epim can be recapitulated in crypt stem cell cultures in vitro. ISEMFs support cocultured stem cell proliferation and enteroid growth, and these effects are augmented by deletion of Epim, a syntaxin that regulates myofibroblast cell secretion.

Also flagged:pigmentationorganic acidsethanolsecretionoxygencyclic adenosine monophosphate
Journal Article 2018-04-06 No Snippets Nair RB, Gmoser R, Lennartsson PR, Taherzadeh MJ.
Show Full Abstract

The effect of second messenger cAMP on the physiological aspects of fungal cells such as pigmentation has been reported previously. However, their actual role in the cellular biochemical cascade that eventually affects the fungal growth morphology, such as mycelial pellet formation, is unclear. This article intends to open up the detailed study on the possible correlative effect of cAMP on the morphological and physiological growth aspects of filamentous fungi, with special emphasis on the industrial metabolite production.

Also flagged:chromosomeTurner syndromeregulation ofgene expressionmethylationchromosomes
Journal Article 2018-04-06 No Snippets Álvarez-Nava F, Lanes R.
Show Full Abstract

<h4>Background</h4>Monosomy of the X chromosome is the most frequent genetic abnormality in human as it is present in approximately 2% of all conceptions, although 99% of these embryos are spontaneously miscarried. In postnatal life, clinical features of Turner syndrome may include typical dysmorphic stigmata, short stature, sexual infantilism, and renal, cardiac, skeletal, endocrine and metabolic abnormalities.<h4>Main text</h4>Turner syndrome is due to a partial or total loss of the second sexual chromosome, resulting in the development of highly variable clinical features. This phenotype may not merely be due to genomic imbalance from deleted genes but may also result from additive influences on associated genes within a given gene network, with an altered regulation of gene expression triggered by the absence of the second sex chromosome. Current studies in human and mouse models have demonstrated that this chromosomal abnormality leads to epigenetic changes, including differential DNA methylation in specific groups of downstream target genes in pathways associated with several clinical and metabolic features, mostly on autosomal chromosomes. In this article, we begin exploring the potential involvement of both genetic and epigenetic factors in the origin of X chromosome monosomy. We review the dispute between the meiotic and post-zygotic origins of 45,X monosomy, by mainly analyzing the findings from several studies that compare gene expression of the 45,X monosomy to their euploid and/or 47,XXX trisomic cell counterparts on peripheral blood mononuclear cells, amniotic fluid, human fibroblast cells, and induced pluripotent human cell lines. From these studies, a profile of epigenetic changes seems to emerge in response to chromosomal imbalance. An interesting finding of all these studies is that methylation-based and expression-based pathway analyses are complementary, rather than overlapping, and are correlated with the clinical picture displayed by TS subjects.<h4>Conclusions</h4>The clarification of these possible causal pathways may have future implications in increasing the life expectancy of these patients and may provide informative targets for early pharmaceutical intervention.

Also flagged:hepatocellular carcinomatumorcell adhesion moleculespolymerasegene expressionGraft Injury
Journal Article 2018-04-06 ✓ 5 Snippets Lee NP, Wu H, Ng KTP, Luo R, Lam TW, Lo CM, Man K.
In-Text Gene Mentions

Taken together, it is convincing to believe that HFE down-regulation in liver grafts, as observed in this study, can lead to iron overload and eventually post-transplant tumor recurrence.

In contrary to HFE, we have demonstrated a high intragraft gene expression level of CD274 from recipients with post-transplant tumor recurrence.

Collectively, our results revealed that the involvement of HFE and CD274 and their related molecules in acute phase liver graft injury and their concurrent involvement in post-transplant tumor recurrence.

…cell adhesion moleculesHFE(hemochromatosis) and CD274…

…adhesion molecules HFE (hemochromatosis) and CD274 and…

Show Full Abstract

<h4>Background</h4>Liver transplantation remains the treatment of choice for a selected group of hepatocellular carcinoma (HCC) patients. However, the long-term benefit is greatly hampered by post-transplant HCC recurrence. Our previous studies have identified liver graft injury as an acute phase event leading to post-transplant tumor recurrence.<h4>Methods</h4>To re-examine this acute phase event at the molecular level and in an unbiased way, RNA sequencing (RNA-Seq) was performed on liver graft biopsies obtained from the transplant recipients two hours after portal vein reperfusion with an aim to capture frequently altered pathways that account for post-transplant tumor recurrence. Liver grafts from recurrent recipients (<i>n</i> = 6) were sequenced and compared with those from recipients without recurrence (<i>n</i> = 5).<h4>Results</h4>RNA expression profiles comparison pointed to several frequently altered pathways, among which pathways related to cell adhesion molecules were the most involved. Subsequent validation using quantitative polymerase chain reaction confirmed the differential involvement of two cell adhesion molecules <i>HFE</i> (hemochromatosis) and <i>CD274</i> and their related molecules in the acute phase event.<h4>Conclusion</h4>This whole transcriptome strategy unravels the molecular landscape of liver graft gene expression alterations, which can identify key pathways and genes that are involved in acute phase liver graft injury that may lead to post-transplant tumor recurrence.

Also flagged:Metabolic SyndromeCardiovascular Diseasestype 2 Diabetes Mellituscarbohydrateinsulinhypertension
Journal Article 2018-04-06 No Snippets Ayoub HM, McDonald MR, Sullivan JA, Tsao R, Meckling KA.
Show Full Abstract

Metabolic Syndrome (MetS) is a complex disorder that predisposes an individual to Cardiovascular Diseases and type 2 Diabetes Mellitus. Proteomics and bioinformatics have proven to be an effective tool to study complex diseases and mechanisms of action of nutrients. We previously showed that substitution of the majority of carbohydrate in a high fat diet by purple potatoes (PP) or purple carrots (PC) improved insulin sensitivity and hypertension in an animal model of MetS (obese Zucker rats) compared to a control sucrose-rich diet. In the current study, we used TMT 10plex mass tag combined with LC-MS/MS technique to study proteomic modulation in the liver (<i>n</i> = 3 samples/diet) and adipose tissue (<i>n</i> = 3 samples/diet) of high fat diet-fed rats with or without substituting sucrose for purple vegetables, followed by functional enrichment analysis, in an attempt to elucidate potential molecular mechanisms responsible for the phenotypic changes seen with purple vegetable feeding. Protein folding, lipid metabolism and cholesterol efflux were identified as the main modulated biological themes in adipose tissue, whereas lipid metabolism, carbohydrate metabolism and oxidative stress were the main modulated themes in liver. We propose that enhanced protein folding, increased cholesterol efflux and higher free fatty acid (FFA) re-esterification are mechanisms by which PP and PC positively modulate MetS pathologies in adipose tissue, whereas, decreased <i>de novo</i> lipogenesis, oxidative stress and FFA uptake, are responsible for the beneficial effects in liver. In conclusion, we provide molecular evidence for the reported metabolic health benefits of purple carrots and potatoes and validate that these vegetables are good choices to replace other simple carbohydrate sources for better metabolic health.

Also flagged:Rothmund-Thomson SyndromeRothmund-Thomson type-II syndromecancerhelicaseosteosarcomaRECQL4
Journal Article 2018-04-06 ✓ 1 Snippet Colombo EA, Locatelli A, Cubells Sánchez L, Romeo S, Elcioglu NH, Maystadt I, Esteve Martínez A, Sironi A, Fontana L, Finelli P, Gervasini C, Pecile V, Larizza L.
In-Text Gene Mentions

…yperferritinemia with negativehemochromatosisgenetic test, hypercholesterol…

Show Full Abstract

Biallelic mutations in <i>RECQL4</i> gene, a caretaker of the genome, cause Rothmund-Thomson type-II syndrome (RTS-II) and confer increased cancer risk if they damage the helicase domain. We describe five families exemplifying clinical and allelic heterogeneity of RTS-II, and report the effect of pathogenic <i>RECQL4</i> variants by <i>in silico</i> predictions and transcripts analyses. Complete phenotype of patients #39 and #42 whose affected siblings developed osteosarcoma correlates with their c.[1048_1049del], c.[1878+32_1878+55del] and c.[1568G>C;1573delT], c.[3021_3022del] variants which damage the helicase domain. Literature survey highlights enrichment of these variants affecting the helicase domain in patients with cancer outcome raising the issue of strict oncological surveillance. Conversely, patients #29 and #19 have a mild phenotype and carry, respectively, the unreported homozygous c.3265G>T and c.3054A>G variants, both sparing the helicase domain. Finally, despite matching several criteria for RTS clinical diagnosis, patient #38 is heterozygous for c.2412_2414del; no pathogenic CNVs out of those evidenced by high-resolution CGH-array, emerged as contributors to her phenotype.

Also flagged:agingage-related diseasescentrosomeextracellular signal-regulated kinaseERKepidermal growth factor receptor
Journal Article 2018-04-06 ✓ 5 Snippets Pyo JH, Jeon HJ, Park JS, Lee JS, Chung HY, Yoo MA.
In-Text Gene Mentions

Five-day-old OR flies, or Myo1Ats>+ and Myo1Ats>PEBP1 flies after induction of 5 days at 29° C were starved for 2 h and exposed to 10 mM paraquat (Sigma-Aldrich) in 1% sucrose media for 18 h.

Loss or reduced expression of PEBP1/RKIP has been reported in aggressive cancer cells such as gastrointestinal tumor [32].

The decreased expression of PEBP1/RKIP has been reported in many types of cancer cells and malignant tissues [32, 53–55].

The reduction in PEBP1/RKIP was also reported in aged neuron and skin [56, 57], although increased PEBP1/RKIP expression in inflammatory bowel disease was recently reported [58].

…binding protein 1 (PEBP1) in ISC regenerative…

Show Full Abstract

The intestine is a high cellular turnover tissue largely dependent on the regenerative function of stem cell throughout life, and a signaling center for the health and viability of organisms. Therefore, better understanding of the mechanisms underlying the regulation of intestinal stem cell (ISC) regenerative potential is essential for the possible intervention of aging process and age-related diseases. <i>Drosophila</i> midgut is a well-established model system for studying the mechanisms underlying ISC regenerative potential during aging. Here, we report the requirement of <i>Drosophila</i> phosphatidylethanolamine binding protein 1 (PEBP1) in ISC regenerative potential. We showed that PEBP1 was strongly expressed in enterocytes (ECs) of guts and its decrease with age and oxidative stress. Furthermore, the downregulation of PEBP1 in ECs accelerates ISC aging, as evidenced by ISC hyper-proliferation, γH2AX accumulation, and centrosome amplification, and intestinal hyperplasia. The decrease in PEBP1 expression was associated with increased extracellular signal-regulated kinase (ERK) activity in ECs. All these phenotypes by EC-specific depletion of PEBP1 were rescued by the concomitant inhibition of ERK signaling. Our findings evidence that the age-related downregulation of PEBP1 in ECs is a novel cause accelerating ISC aging and that PEBP1 is an EC-intrinsic suppressor of epidermal growth factor receptor (EGFR)/ERK signaling. Our study provides molecular insights into the tight regulation of EGFR/ERK signaling in niches for stem cell regenerative potential.

Also flagged:Breast cancercancerEstrogenepidermal growth factor receptor 2ERBB2HER2
Journal Article 2018-04-06 ✓ 2 Snippets Nagaprashantha LD, Singhal J, Li H, Warden C, Liu X, Horne D, Awasthi S, Salgia R, Singhal SS.
In-Text Gene Mentions

…LPCAT1, DTL, GNAZ,ECI2, MELK, NMU, NUSAP1…

…MCM6, DCK, GNAZ,ECI2, DTL, MELK, NUSAP,…

Show Full Abstract

Breast cancer (BC) is the most common cancer in women. Estrogen, epidermal growth factor receptor 2 (ERBB2, HER2), and oxidative stress represent critical mechanistic nodes associated with BC. RLIP76 is a major mercapturic acid pathway transporter whose expression is increased in BC. In the quest of a novel molecule with chemopreventive and chemotherapeutic potential, we evaluated the effects of 2'-Hydroxyflavanone (2HF) in BC. 2HF enhanced the inhibitory effects of RLIP76 depletion and also inhibited RLIP76-mediated doxorubicin transport in BC cells. RNA-sequencing revealed that 2HF induces strong reversal of the gene expression pattern in ER<sup>+</sup>MCF7, HER2<sup>+</sup> SKBR3 and triple-negative MDA-MB-231 BC cells with minimal effects on MCF10A normal breast epithelial cells. 2HF down regulated ERα and enhanced inhibitory effects of imatinib mesylate/Gleevec in MCF7 cells. 2HF also down regulated ERα and HER2 gene networks in MCF7 and SKBR3 cells, respectively. 2HF activated TP53 and inhibited TGFβ1 canonical pathway in MCF7 and MDA-MB-231 BC cells. 2HF also regulated the expression of a number of critical prognostic genes of MammaPrint panel and their upstream targets including TP53, CDKN2A and MYC. The collective findings from this study provide a comprehensive, direct and integrated evidence for the benefits of 2HF in targeting major and clinically relevant mechanistic regulators of BC.

Also flagged:tumorsquamous cell cervical cancerpeptidescervical cancerMCMcancer
Journal Article 2018-04-06 No Snippets Güzel C, Govorukhina NI, Wisman GBA, Stingl C, Dekker LJM, Klip HG, Hollema H, Guryev V, Horvatovich PL, van der Zee AGJ, Bischoff R, Luider TM.
Show Full Abstract

Laser capture microdissection (LCM) allows the capture of cell types or well-defined structures in tissue. We compared in a semi-quantitative way the proteomes from an equivalent of 8,000 tumor cells from patients with squamous cell cervical cancer (SCC, <i>n</i> = 22) with healthy epithelial and stromal cells obtained from normal cervical tissue (<i>n</i> = 13). Proteins were enzymatically digested into peptides which were measured by high-resolution mass spectrometry and analyzed by "all-or-nothing" analysis, Bonferroni, and Benjamini-Hochberg correction for multiple testing. By comparing LCM cell type preparations, 31 proteins were exclusively found in early stage cervical cancer (<i>n</i> = 11) when compared with healthy epithelium and stroma, based on criteria that address specificity in a restrictive "all-or-nothing" way. By Bonferroni correction for multiple testing, 30 proteins were significantly up-regulated between early stage cervical cancer and healthy control, including six members of the MCM protein family. MCM proteins are involved in DNA repair and expected to be participating in the early stage of cancer. After a less stringent Benjamini-Hochberg correction for multiple testing, we found that the abundances of 319 proteins were significantly different between early stage cervical cancer and healthy controls. Four proteins were confirmed in digests of whole tissue lysates by Parallel Reaction Monitoring (PRM). Ingenuity Pathway Analysis using correction for multiple testing by permutation resulted in two networks that were differentially regulated in early stage cervical cancer compared with healthy tissue. From these networks, we learned that specific tumor mechanisms become effective during the early stage of cervical cancer.

Also flagged:TRPV2membranecation channelnervous system disordersneoplasmsglioblastoma multiforme
Journal Article 2018-04-06 ✓ 5 Snippets Doñate-Macián P, Gómez A, Dégano IR, Perálvarez-Marín A.
In-Text Gene Mentions

The TRPV2 interactome showed a high association with early glia-related neoplasms, especially glioma/glioblastoma, being ABR, FGF1, KCNJ10, PEBP1, PLP1, SDC3, and TRPV2, the genes associated to these brain neoplasms.

The most associated diseases with the TRPV2 interactome were neoplasms and diseases from the nervous system, and ABR, FGF1, KNJ10, PEBP1, PLP1, SOC3, and TRPV2 were found to be associated with brain neoplasms.

This analysis identified neoplasms and nervous system diseases as the most associated diseases with the TRPV2 interactome, and highlighted a set of genes previously associated to brain neoplasms, such as: ABR, FGF1, KCNJ10, PEBP1, PLP1, SDC3 and TRPV2.

…ABR, FGF1, KCNJ10,PEBP1, PLP1, SDC3, and…

…ABR, FGF1, KNJ10,PEBP1, PLP1, SOC3, and…

Show Full Abstract

Proteomics aids to the discovery and expansion of protein-protein interaction networks, which are key to understand molecular mechanisms in physiology and physiopathology, but also to infer protein function in a guilt-by-association fashion. In this study we use a systematic protein-protein interaction membrane yeast two-hybrid method to expand the interactome of TRPV2, a cation channel related to nervous system development. After validation of the interactome <i>in silico</i>, we define a TRPV2-interactome signature combining proteomics with the available physio-pathological data in Disgenet to find interactome-disease associations, highlighting nervous system disorders and neoplasms. The TRPV2-interactome signature against available experimental data is capable of discriminating overall risk in glioblastoma multiforme prognosis, progression, recurrence, and chemotherapy resistance. Beyond the impact on glioblastoma physiopathology, this study shows that combining systematic proteomics with <i>in silico</i> methods and available experimental data is key to open new perspectives to define novel biomarkers for diagnosis, prognosis and therapeutics in disease.

Also flagged:B-cell receptorsB-cellB-cell developmentB-cell receptorBCRmaturation
Journal Article 2018-04-06 No Snippets Yam-Puc JC, Zhang L, Zhang Y, Toellner KM.
Show Full Abstract

B-cell development is characterized by a number of tightly regulated selection processes. Signals through the B-cell receptor (BCR) guide and are required for B-cell maturation, survival, and fate decision. Here, we review the role of the BCR during B-cell development, leading to the emergence of B1, marginal zone, and peripheral follicular B cells. Furthermore, we discuss BCR-derived signals on activated B cells that lead to germinal center and plasma cell differentiation.

Also flagged:WaterhydrogensphenylamidePolymerssulfonium
Journal Article 2018-04-06 No Snippets Albernaz VL, Bach M, Weber A, Southan A, Tovar GEM.
Show Full Abstract

Functional surface active monomers (surfmers) are molecules that combine the functionalities of surface activity, polymerizability, and reactive groups. This study presents an improved pathway for the synthesis of the active ester containing surfmer <i>p</i>-(11-acrylamido)undecanoyloxyphenyl dimethylsulfonium methyl sulfate (AUPDS). Further, the preparation of poly(methyl methacrylate) and polystyrene nanoparticles (NPs) by mini-emulsion polymerization using AUPDS is investigated, leading to NPs with active ester groups on their surface. By systematically varying reaction parameters and reagent concentrations, it was found that AUPDS feed concentrations between 2⁻4 mol% yielded narrowly distributed and stable spherical particles with average sizes between 83 and 134 nm for non-cross-linked NPs, and up to 163 nm for cross-linked NPs. By basic hydrolysis of the active ester groups in aqueous dispersion, the positive ζ-potential (ZP) was converted into a negative ZP and charge quantities determined by polyelectrolyte titrations before and after hydrolysis were in the same range, indicating that the active ester groups were indeed accessible in aqueous suspension. Increasing cross-linker amounts over 10 mol% also led to a decrease of ZP of NPs, probably due to internalization of the AUPDS during polymerization. In conclusion, by using optimized reaction conditions, it is possible to prepare active ester functionalized NPs in one stage using AUPDS as a surfmer in mini-emulsion polymerization.

Also flagged:synthesiscopperazidealkynethiolglycerol
Journal Article 2018-04-06 No Snippets Scanga R, Chrastecka L, Mohammad R, Meadows A, Quan PL, Brouzes E.
Show Full Abstract

We report the novel and simplified synthesis of fluorinated surfactants for droplet microfluidics. The range of applications of droplet microfluidics has greatly expanded during the last decade thanks to its ability to manipulate and process tiny amount of sample and reagents at high throughput in independent reactors. A critical component of the technology is the formulation of the immiscible oil phase that contains surfactants to stabilize droplets. The success of droplet microfluidics relies mostly on a single fluorinated formulation that uses a PFPE-PEG tri-block surfactant. The synthesis of this surfactant is laborious and requires skills in synthetic chemistry preventing the wider community to explore the synthesis of alternate surfactants. We sought to provide a simplified synthesis for novel PFPE-PEG surfactants based on click chemistry approaches such as copper-catalyzed azide-alkyne cycloaddition (CuAAC) and UV-activated thiol-yne reactions. Our strategy is based on converting a moisture sensitive intermediate typically used in the synthesis of the tri-block PFPE-PEG surfactant into a stable and click ready molecule. We successfully combined that fluorinated tail with differently functionalized PEG and glycerol ethoxylate molecules to generate surfactants with diverse structures <i>via</i> CuACC and thiol-yne reactions. We report the characterization, biocompatibility and ability to stabilize emulsions of those surfactants, as well as the unique advantages and challenges of the strategy.

Also flagged:camptothecinamino estermethyl etherpolyethylene glycolmethylethylene glycol
Journal Article 2018-04-06 No Snippets Fattahi A, Karimi N, Rahmati F, Shokoohinia Y, Sadrjavadi K.
Show Full Abstract

In the present study, camptothecin grafted poly amino ester-methyl ether polyethylene glycol (CPT-PEA-MPEG) as a novel copolymer was synthesized by Michael reaction at different ratios of MPEG and CPT (60 : 40 and 80 : 20). The microemulsion was used to prepare nanomicelles, and <i>in vitro</i> cytotoxicity was performed on the HT29 cell line, and cell survival was measured by MTT assay. The syntheses were confirmed by <sup>1</sup>H NMR and FT-IR. Several characterization methods including CMC, particle size, size distribution, and transmission electron microscopy were performed to evaluate features of prepared nanomicelles. Low critical micelle concentration, small particle size and IC<sub>50</sub> of 0.1 mg ml<sup>-1</sup> at MPEG to CPT ratio of 60 : 40 make this micelle a promising drug delivery carrier. CPT-PAE-MPEG nanomicelles at a MPEG : CPT ratio of 60 : 40 can be a suitable choice to improve the physiochemical properties of CPT and its therapeutic effect, while it can be potentially used as a nano-carrier for other anticancer drugs to purpose a dual drug delivery.

Also flagged:ProteostasisHuntington's diseaseneurodegenerative diseasesproteasomeautophagyexocytosis
Journal Article 2018-04-05 ✓ 1 Snippet Harding RJ, Tong YF.
In-Text Gene Mentions

HTT

Show Full Abstract

Many neurodegenerative diseases are characterized by impairment of protein quality control mechanisms in neuronal cells. Ineffective clearance of misfolded proteins by the proteasome, autophagy pathways and exocytosis leads to accumulation of toxic protein oligomers and aggregates in neurons. Toxic protein species affect various cellular functions resulting in the development of a spectrum of different neurodegenerative proteinopathies, including Huntington's disease (HD). Playing an integral role in proteostasis, dysfunction of the ubiquitylation system in HD is progressive and multi-faceted with numerous biochemical pathways affected, in particular, the ubiquitin-proteasome system and autophagy routes for protein aggregate degradation. Unravelling the molecular mechanisms involved in HD pathogenesis of proteostasis provides new insight in disease progression in HD as well as possible therapeutic avenues. Recent developments of potential therapeutics are discussed in this review.

Haemochromatosis.

Also flagged:Haemochromatosissystemicironoverloadiron regulatory hormonebinding
Journal Article 2018-04-05 ✓ 5 Snippets Brissot P, Pietrangelo A, Adams PC, de Graaff B, McLaren CE, Loréal O.
In-Text Gene Mentions

…Non-HFEforms of haemochromatosis…

…C282Y mutation) inHFE, which encodes…

…iron excess inHFEand non- HFE…

…HFE and non-HFEforms of haemochromatosis…

HFE

Show Full Abstract

Haemochromatosis is defined as systemic iron overload of genetic origin, caused by a reduction in the concentration of the iron regulatory hormone hepcidin, or a reduction in hepcidin-ferroportin binding. Hepcidin regulates the activity of ferroportin, which is the only identified cellular iron exporter. The most common form of haemochromatosis is due to homozygous mutations (specifically, the C282Y mutation) in HFE, which encodes hereditary haemochromatosis protein. Non-HFE forms of haemochromatosis due to mutations in HAMP, HJV or TFR2 are much rarer. Mutations in SLC40A1 (also known as FPN1; encoding ferroportin) that prevent hepcidin-ferroportin binding also cause haemochromatosis. Cellular iron excess in HFE and non-HFE forms of haemochromatosis is caused by increased concentrations of plasma iron, which can lead to the accumulation of iron in parenchymal cells, particularly hepatocytes, pancreatic cells and cardiomyocytes. Diagnosis is noninvasive and includes clinical examination, assessment of plasma iron parameters, imaging and genetic testing. The mainstay therapy is phlebotomy, although iron chelation can be used in some patients. Hepcidin supplementation might be an innovative future approach.

Also flagged:Sox5Sox10transcription factorCas9pigment cell developmentSry-related high-mobility group (HMG) transcription factor
Journal Article 2018-04-05 ✓ 3 Snippets Nagao Y, Takada H, Miyadai M, Adachi T, Seki R, Kamei Y, Hara I, Taniguchi Y, Naruse K, Hibi M, Kelsh RN, Hashimoto H.
In-Text Gene Mentions

…SoxD subgroup (Sox5,Sox6and Sox13), is…

…melanoblasts, Sox5 and/orSox6counteract transcriptional act…

…future investigation (ZFIN,sox6; https://zfin.org/ZDB-GENE-08…

Show Full Abstract

Mechanisms generating diverse cell types from multipotent progenitors are fundamental for normal development. Pigment cells are derived from multipotent neural crest cells and their diversity in teleosts provides an excellent model for studying mechanisms controlling fate specification of distinct cell types. Zebrafish have three types of pigment cells (melanocytes, iridophores and xanthophores) while medaka have four (three shared with zebrafish, plus leucophores), raising questions about how conserved mechanisms of fate specification of each pigment cell type are in these fish. We have previously shown that the Sry-related transcription factor Sox10 is crucial for fate specification of pigment cells in zebrafish, and that Sox5 promotes xanthophores and represses leucophores in a shared xanthophore/leucophore progenitor in medaka. Employing TILLING, TALEN and CRISPR/Cas9 technologies, we generated medaka and zebrafish sox5 and sox10 mutants and conducted comparative analyses of their compound mutant phenotypes. We show that specification of all pigment cells, except leucophores, is dependent on Sox10. Loss of Sox5 in Sox10-defective fish partially rescued the formation of all pigment cells in zebrafish, and melanocytes and iridophores in medaka, suggesting that Sox5 represses Sox10-dependent formation of these pigment cells, similar to their interaction in mammalian melanocyte specification. In contrast, in medaka, loss of Sox10 acts cooperatively with Sox5, enhancing both xanthophore reduction and leucophore increase in sox5 mutants. Misexpression of Sox5 in the xanthophore/leucophore progenitors increased xanthophores and reduced leucophores in medaka. Thus, the mode of Sox5 function in xanthophore specification differs between medaka (promoting) and zebrafish (repressing), which is also the case in adult fish. Our findings reveal surprising diversity in even the mode of the interactions between Sox5 and Sox10 governing specification of pigment cell types in medaka and zebrafish, and suggest that this is related to the evolution of a fourth pigment cell type.

Also flagged:Hepatitis C Virus Infectioninfectiontype 2 diabetes mellitustype 2 DMsugaralanine transaminase
Journal Article 2018-04-05 ✓ 1 Snippet Farshadpour F, Taherkhani R, Ravanbod MR, Eghbali SS.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Objective</h4>This study was conducted to determine the prevalence and genotype distribution of hepatitis C virus (HCV) infection among patients with type 2 diabetes mellitus (DM).<h4>Subjects and methods</h4>We included 556 consecutive patients with confirmed type 2 DM attending the Diabetic Clinic of the Bushehr University of Medical Sciences and 733 nondiabetic subjects as controls. Serum levels of fasting blood sugar (FBS), alanine transaminase (ALT), aspartate transaminase (AST), total cholesterol (TCH), and triglycerides (TG) were measured by enzymatic colorimetric methods, and the presence of anti-HCV antibodies was determined by enzyme-linked immunosorbent assay. Semi-nested reverse transcriptase-polymerase chain reaction (RT-PCR) followed by sequencing was performed on all anti-HCV-seropositive samples. Data were analyzed using the Statistical Package for the Social Sciences 17, and descriptive statistics, χ2 test, Fisher exact test, and the Student t test were used for analysis.<h4>Results</h4>The seroprevalence of HCV in the diabetic patients was 1.98% (11/556), which was higher than HCV prevalence among the nondiabetic controls (4/733, 0.54%) (p = 0.032). No significant differences in ALT, AST, FBS, TG, and TCH levels were found between the HCV-seropositive and HCV-seronegative diabetic patients, although HCV-seropositive diabetic patients tended to have higher ALT, AST, and TCH levels, but lower TG and FBS levels than HCV-seronegative patients. In logistic regression analysis, only AST levels were significantly associated with HCV seropositivity among diabetic patients. The AST level of 41-80 IU/L was the only significant predictive variable for HCV seropositivity in the diabetic patients (odds ratio, 4.89; 95% CI: 1.06-22.49; p = 0.041). Of the 11 HCV-seropositive diabetic patients, 10 (91%) had HCV viremia with genotype 3a.<h4>Conclusion</h4>Patients with type 2 DM had a higher prevalence of HCV infection than controls, and HCV seropositivity was independent of biochemical parameters.

Also flagged:Chromosomeirritable bowel syndromeIBSelongator complex protein 1autonomic dysfunctionELP1
Journal Article 2018-04-05 No Snippets Bonfiglio F, Zheng T, Garcia-Etxebarria K, Hadizadeh F, Bujanda L, Bresso F, Agreus L, Andreasson A, Dlugosz A, Lindberg G, Schmidt PT, Karling P, Ohlsson B, Simren M, Walter S, Nardone G, Cuomo R, Usai-Satta P, Galeazzi F, Neri M, Portincasa P, Bellini M, Barbara G, Latiano A, Hübenthal M, Thijs V, Netea MG, Jonkers D, Chang L, Mayer EA, Wouters MM, Boeckxstaens G, Camilleri M, Franke A, Zhernakova A, D'Amato M.
Show Full Abstract

<h4>Background & aims</h4>Genetic factors are believed to affect risk for irritable bowel syndrome (IBS), but there have been no sufficiently powered and adequately sized studies. To identify DNA variants associated with IBS risk, we performed a genome-wide association study (GWAS) of the large UK Biobank population-based cohort, which includes genotype and health data from 500,000 participants.<h4>Methods</h4>We studied 7,287,191 high-quality single nucleotide polymorphisms in individuals who self-reported a doctor's diagnosis of IBS (cases; n = 9576) compared to the remainder of the cohort (controls; n = 336,499) (mean age of study subjects, 40-69 years). Genome-wide significant findings were further investigated in 2045 patients with IBS from tertiary centers and 7955 population controls from Europe and the United States, and a small general population sample from Sweden (n = 249). Functional annotation of GWAS results was carried out by integrating data from multiple biorepositories to obtain biological insights from the observed associations.<h4>Results</h4>We identified a genome-wide significant association on chromosome 9q31.2 (single nucleotide polymorphism rs10512344; P = 3.57 × 10<sup>-8</sup>) in a region previously linked to age at menarche, and 13 additional loci of suggestive significance (P < 5.0×10<sup>-6</sup>). Sex-stratified analyses revealed that the variants at 9q31.2 affect risk of IBS in women only (P = 4.29 × 10<sup>-10</sup> in UK Biobank) and also associate with constipation-predominant IBS in women (P = .015 in the tertiary cohort) and harder stools in women (P = .0012 in the population-based sample). Functional annotation of the 9q31.2 locus identified 8 candidate genes, including the elongator complex protein 1 gene (ELP1 or IKBKAP), which is mutated in patients with familial dysautonomia.<h4>Conclusions</h4>In a sufficiently powered GWAS of IBS, we associated variants at the locus 9q31.2 with risk of IBS in women. This observation may provide additional rationale for investigating the role of sex hormones and autonomic dysfunction in IBS.

Also flagged:hydrogendeuteriumamideprolinepolyglutamineHD
Journal Article 2018-04-05 ✓ 3 Snippets Newcombe EA, Ruff KM, Sethi A, Ormsby AR, Ramdzan YM, Fox A, Purcell AW, Gooley PR, Pappu RV, Hatters DM.
In-Text Gene Mentions

Htt

Pebp1

Prdx6

Show Full Abstract

Soluble huntingtin exon 1 (Httex1) with expanded polyglutamine (polyQ) engenders neurotoxicity in Huntington's disease. To uncover the physical basis of this toxicity, we performed structural studies of soluble Httex1 for wild-type and mutant polyQ lengths. Nuclear magnetic resonance experiments show evidence for conformational rigidity across the polyQ region. In contrast, hydrogen-deuterium exchange shows absence of backbone amide protection, suggesting negligible persistence of hydrogen bonds. The seemingly conflicting results are explained by all-atom simulations, which show that Httex1 adopts tadpole-like structures with a globular head encompassing the N-terminal amphipathic and polyQ regions and the tail encompassing the C-terminal proline-rich region. The surface area of the globular domain increases monotonically with polyQ length. This stimulates sharp increases in gain-of-function interactions in cells for expanded polyQ, and one of these interactions is with the stress-granule protein Fus. Our results highlight plausible connections between Httex1 structure and routes to neurotoxicity.

Also flagged:cancercell proliferationcancersextracellulartumortumors
Journal Article 2018-04-05 ✓ 1 Snippet Thorsson V, Gibbs DL, Brown SD, Wolf D, Bortone DS, Ou Yang TH, Porta-Pardo E, Gao GF, Plaisier CL, Eddy JA, Ziv E, Culhane AC, Paull EO, Sivakumar IKA, Gentles AJ, Malhotra R, Farshidfar F, Colaprico A, Parker JS, Mose LE, Vo NS, Liu J, Liu Y, Rader J, Dhankani V, Reynolds SM, Bowlby R, Califano A, Cherniack AD, Anastassiou D, Bedognetti D, Mokrab Y, Newman AM, Rao A, Chen K, Krasnitz A, Hu H, Malta TM, Noushmehr H, Pedamallu CS, Bullman S, Ojesina AI, Lamb A, Zhou W, Shen H, Choueiri TK, Weinstein JN, Guinney J, Saltz J, Holt RA, Rabkin CS, Cancer Genome Atlas Research Network, Lazar AJ, Serody JS, Demicco EG, Disis ML, Vincent BG, Shmulevich I.
In-Text Gene Mentions

TNFSF4

Show Full Abstract

We performed an extensive immunogenomic analysis of more than 10,000 tumors comprising 33 diverse cancer types by utilizing data compiled by TCGA. Across cancer types, we identified six immune subtypes-wound healing, IFN-γ dominant, inflammatory, lymphocyte depleted, immunologically quiet, and TGF-β dominant-characterized by differences in macrophage or lymphocyte signatures, Th1:Th2 cell ratio, extent of intratumoral heterogeneity, aneuploidy, extent of neoantigen load, overall cell proliferation, expression of immunomodulatory genes, and prognosis. Specific driver mutations correlated with lower (CTNNB1, NRAS, or IDH1) or higher (BRAF, TP53, or CASP8) leukocyte levels across all cancers. Multiple control modalities of the intracellular and extracellular networks (transcription, microRNAs, copy number, and epigenetic processes) were involved in tumor-immune cell interactions, both across and within immune subtypes. Our immunogenomics pipeline to characterize these heterogeneous tumors and the resulting data are intended to serve as a resource for future targeted studies to further advance the field.

Also flagged:Huntington diseaseneurological disorderHDsynaptichost cellsaction potential
Journal Article 2018-04-05 ✓ 3 Snippets Adil MM, Gaj T, Rao AT, Kulkarni RU, Fuentes CM, Ramadoss GN, Ekman FK, Miller EW, Schaffer DV.
In-Text Gene Mentions

HD is caused by the expansion of a CAG trinucleotide repeat within exon 1 of the huntingtin (HTT) gene, which leads to the production of a toxic mutant protein that kills striatal medium spiny neurons (MSNs) and also affects the surrounding regions of the brain (Ehrlich, 2012).

…of the huntingtin (HTT) gene, which leads…

…of the humanHTTgene containing ∼120…

Show Full Abstract

Huntington disease (HD) is an inherited, progressive neurological disorder characterized by degenerating striatal medium spiny neurons (MSNs). One promising approach for treating HD is cell replacement therapy, where lost cells are replaced by MSN progenitors derived from human pluripotent stem cells (hPSCs). While there has been remarkable progress in generating hPSC-derived MSNs, current production methods rely on two-dimensional culture systems that can include poorly defined components, limit scalability, and yield differing preclinical results. To facilitate clinical translation, here, we generated striatal progenitors from hPSCs within a fully defined and scalable PNIPAAm-PEG three-dimensional (3D) hydrogel. Transplantation of 3D-derived striatal progenitors into a transgenic mouse model of HD slowed disease progression, improved motor coordination, and increased survival. In addition, the transplanted cells developed an MSN-like phenotype and formed synaptic connections with host cells. Our results illustrate the potential of scalable 3D biomaterials for generating striatal progenitors for HD cell therapy.

Also flagged:type II collagencollagen type IIchondrogenesisTGF-β3extracellularcollagens
Journal Article 2018-04-05 ✓ 1 Snippet Zuliani CC, Bombini MF, Andrade KC, Mamoni R, Pereira AH, Coimbra IB.
In-Text Gene Mentions

…, Sox5 andSox6, which regulate the…

Show Full Abstract

<h4>Objectives</h4>Articular cartilage is vulnerable to injuries and undergoes an irreversible degenerative process. The use of amniotic fluid mesenchymal stromal stem cells for the reconstruction of articular cartilage is a promising therapeutic alternative. The aim of this study was to investigate the chondrogenic potential of amniotic fluid mesenchymal stromal stem cells from human amniotic fluid from second trimester pregnant women in a micromass system (high-density cell culture) with TGF-β3 for 21 days.<h4>Methods</h4>Micromass was performed using amniotic fluid mesenchymal stromal stem cells previously cultured in a monolayer. Chondrocytes from adult human normal cartilage were used as controls. After 21 days, chondrogenic potential was determined by measuring the expression of genes, such as SOX-9, type II collagen and aggrecan, in newly differentiated cells by real-time PCR (qRT-PCR). The production of type II collagen protein was observed by western blotting. Immunohistochemistry analysis was also performed to detect collagen type II and aggrecan. This study was approved by the local ethics committee.<h4>Results</h4>SOX-9, aggrecan and type II collagen were expressed in newly differentiated chondrocytes. The expression of SOX-9 was significantly higher in newly differentiated chondrocytes than in adult cartilage. Collagen type II protein was also detected.<h4>Conclusion</h4>We demonstrate that stem cells from human amniotic fluid are a suitable source for chondrogenesis when cultured in a micromass system. amniotic fluid mesenchymal stromal stem cells are an extremely viable source for clinical applications, and our results suggest the possibility of using human amniotic fluid as a source of mesenchymal stem cells.

Also flagged:RSEgene expressionNOSCo-expressionAlcoholethanol
Journal Article 2018-04-05 ✓ 4 Snippets Luo J, Xu P, Cao P, Wan H, Lv X, Xu S, Wang G, Cook MN, Jones BC, Lu L, Wang X.
In-Text Gene Mentions

…genes, seven (Prdx6, Grp ,…

…ThePrdx6gene, which is…

…have shown thatPrdx6plays a role…

…postulate that Ebp,Prdx6, and Aldh6a1 are…

Show Full Abstract

Although the link between stress and alcohol is well recognized, the underlying mechanisms of how they interplay at the molecular level remain unclear. The purpose of this study is to identify molecular networks underlying the effects of alcohol and stress responses, as well as their interaction on anxiety behaviors in the hippocampus of mice using a systems genetics approach. Here, we applied a gene co-expression network approach to transcriptomes of 41 BXD mouse strains under four conditions: stress, alcohol, stress-induced alcohol and control. The co-expression analysis identified 14 modules and characterized four expression patterns across the four conditions. The four expression patterns include up-regulation in no restraint stress and given an ethanol injection (NOE) but restoration in restraint stress followed by an ethanol injection (RSE; pattern 1), down-regulation in NOE but rescue in RSE (pattern 2), up-regulation in both restraint stress followed by a saline injection (RSS) and NOE, and further amplification in RSE (pattern 3), and up-regulation in RSS but reduction in both NOE and RSE (pattern 4). We further identified four functional subnetworks by superimposing protein-protein interactions (PPIs) to the 14 co-expression modules, including γ-aminobutyric acid receptor (GABA) signaling, glutamate signaling, neuropeptide signaling, cAMP-dependent signaling. We further performed module specificity analysis to identify modules that are specific to stress, alcohol, or stress-induced alcohol responses. Finally, we conducted causality analysis to link genetic variation to these identified modules, and anxiety behaviors after stress and alcohol treatments. This study underscores the importance of integrative analysis and offers new insights into the molecular networks underlying stress and alcohol responses.

Also flagged:cytoplasmmitochondriaKARSearlyencephalopathyperipheral neuropathy
Journal Article 2018-04-04 ✓ 4 Snippets Ardissone A, Tonduti D, Legati A, Lamantea E, Barone R, Dorboz I, Boespflug-Tanguy O, Nebbia G, Maggioni M, Garavaglia B, Moroni I, Farina L, Pichiecchio A, Orcesi S, Chiapparini L, Ghezzi D.
In-Text Gene Mentions

With our report we define the molecular basis of the previously described Leukoencephalopathy with Brainstem and Spinal cord Calcification, that we propose to call LBSC similarly to DARS and DARS2 related leukodystrophies, widening the spectrum of KARS related disorders, particularly in childhood onset disease suggestive for mitochondrial impairment.

It is interesting to note that the presence of cerebral WM and spinal cord signal abnormalities is a pretty rare association of neuroradiological features and it is typically observed in other aaRSs deficiencies, notably in DARS and DARS2 related leukodystrophies [27, 28].

…in DARS andDARS2related leukodystrophies […

…to DARS andDARS2related leukodystrophies, wide…

Show Full Abstract

<h4>Background</h4>KARS encodes lysyl- transfer ribonucleic acid (tRNA) synthetase, which catalyzes the aminoacylation of tRNA-Lys in the cytoplasm and mitochondria. Eleven families/sporadic patients and 16 different mutations in KARS have been reported to date. The associated clinical phenotype is heterogeneous ranging from early onset encephalopathy to isolated peripheral neuropathy or nonsyndromic hearing impairment. Recently additional presentations including leukoencephalopathy as predominant cerebral involvement or cardiomyopathy, isolated or associated with muscular and cerebral involvement, have been reported. A progressive Leukoencephalopathy with brainstem and spinal cord calcifications was previously described in a singleton patient and in two siblings, without the identification of the genetic cause. We reported here about a new severe phenotype associated with biallelic KARS mutations and sharing some common points with the other already reported phenotypes, but with a distinct clinical and neuroimaging picture. Review of KARS mutant patients published to date will be also discussed.<h4>Results</h4>Herein, we report the clinical, biochemical and molecular findings of 2 unreported Italian patients affected by developmental delay, acquired microcephaly, spastic tetraparesis, epilepsy, sensory-neural hypoacusia, visual impairment, microcytic hypochromic anaemia and signs of hepatic dysfunction. MRI pattern in our patients was characterized by progressive diffuse leukoencephalopathy and calcifications extending in cerebral, brainstem and cerebellar white matter, with spinal cord involvement. Genetic analysis performed on these 2 patients and in one subject previously described with similar MRI pattern revealed the presence of biallelic mutations in KARS in all 3 subjects.<h4>Conclusions</h4>With our report we define the molecular basis of the previously described Leukoencephalopathy with Brainstem and Spinal cord Calcification widening the spectrum of KARS related disorders, particularly in childhood onset disease suggestive for mitochondrial impairment. The review of previous cases does not suggest a strict and univocal genotype/phenotype correlation for this highly heterogeneous entity. Moreover, our cases confirm the usefulness of search for common brain and spine MR imaging pattern and of broad genetic screening, in syndromes clinically resembling mitochondrial disorders in spite of normal biochemical assay.

Also flagged:tyrosine kinasescancerstropomyosin receptor kinasetyrosine receptor kinasescancerTRKA
Journal Article 2018-04-04 No Snippets Lange AM, Lo HW.
Show Full Abstract

Gene rearrangements resulting in the aberrant activity of tyrosine kinases have been identified as drivers of oncogenesis in a variety of cancers. The tropomyosin receptor kinase (TRK) family of tyrosine receptor kinases is emerging as an important target for cancer therapeutics. The TRK family contains three members, TRKA, TRKB, and TRKC, and these proteins are encoded by the genes NTRK1, NTRK2, and NTRK3, respectively. To activate TRK receptors, neurotrophins bind to the extracellular region stimulating dimerization, phosphorylation, and activation of downstream signaling pathways. Major known downstream pathways include RAS/MAPK/ERK, PLC&gamma;, and PI3K/Akt. While being rare in most cancers, TRK fusions with other proteins have been well-established as oncogenic events in specific malignancies, including glioblastoma, papillary thyroid carcinoma, and secretory breast carcinomas. TRK protein amplification as well as alternative splicing events have also been described as contributors to cancer pathogenesis. For patients harboring alterations in TRK expression or activity, TRK inhibition emerges as an important therapeutic target. To date, multiple trials testing TRK-inhibiting compounds in various cancers are underway. In this review, we will summarize the current therapeutic trials for neoplasms involving NTKR gene alterations, as well as the promises and setbacks that are associated with targeting gene fusions.

Also flagged:HydroxyapatiteCalcium Phosphatessaltcarbonatecalcitewater
Journal Article 2018-04-04 No Snippets Sassoni E.
Show Full Abstract

The present paper reviews the methods and the performance of in situ formation of calcium phosphates (CaP) for the conservation of materials belonging to cultural heritage. The core idea is to form CaP (ideally hydroxyapatite, HAP, the most stable CaP at pH > 4) by reaction between the substrate and an aqueous solution of a phosphate salt. Initially proposed for the conservation of marble and limestone, the treatment has been explored for a variety of different substrates, including sandstones, sulphated stones, gypsum stuccoes, concrete, wall paintings, archaeological bones and paper. First, the studies aimed at identifying the best treatment conditions (e.g., nature and concentration of the phosphate precursor, solution pH, treatment duration, ionic and organic additions to the phosphate solution, mineralogical composition of the new CaP phases) are summarized. Then, the treatment performance on marble and limestone is reviewed, in terms of protective and consolidating effectiveness, compatibility (aesthetic, microstructural and physical) and durability. Some pilot applications in real case studies are also reported. Recent research aimed at extending the phosphate treatment to other substrates is then illustrated. Finally, the strengths of the phosphate treatment are summarized, in comparison with alternative products, and some aspects needing future research are outlined.

Also flagged:Brain TumoraxonaxonsFraNetrinlocalization
Journal Article 2018-04-04 ✓ 4 Snippets Arbeille E, Bashaw GJ.
In-Text Gene Mentions

Midline and ventricular zone-derived Netrin and its receptor DCC (Deleted in Colorectal Carcinoma) or Fra (Frazzled) in Drosophila, are a highly conserved chemoattractive guidance pathway [3–5].

…TheDCCfamily receptor Frazzled…

…and its receptorDCC(Deleted in Colorectal…

…Loss ofDCCleads to profound…

Show Full Abstract

Commissural axons must cross the midline to establish reciprocal connections between the two sides of the body. This process is highly conserved between invertebrates and vertebrates and depends on guidance cues and their receptors to instruct axon trajectories. The DCC family receptor Frazzled (Fra) signals chemoattraction and promotes midline crossing in response to its ligand Netrin. However, in Netrin or fra mutants, the loss of crossing is incomplete, suggesting the existence of additional pathways. Here, we identify Brain Tumor (Brat), a tripartite motif protein, as a new regulator of midline crossing in the Drosophila CNS. Genetic analysis indicates that Brat acts independently of the Netrin/Fra pathway. In addition, we show that through its B-Box domains, Brat acts cell autonomously to regulate the expression and localization of Adenomatous polyposis coli-2 (Apc2), a key component of the Wnt canonical signaling pathway, to promote axon growth across the midline. Genetic evidence indicates that the role of Brat and Apc2 to promote axon growth across the midline is independent of Wnt and Beta-catenin-mediated transcriptional regulation. Instead, we propose that Brat promotes midline crossing through directing the localization or stability of Apc2 at the plus ends of microtubules in navigating commissural axons. These findings define a new mechanism in the coordination of axon growth and guidance at the midline.

Also flagged:type 2 diabetesType 2 Diabetes MellitusLPLAPOBdiabetesgene expression
Journal Article 2018-04-04 No Snippets Cirillo E, Kutmon M, Gonzalez Hernandez M, Hooimeijer T, Adriaens ME, Eijssen LMT, Parnell LD, Coort SL, Evelo CT.
Show Full Abstract

Genome-wide association studies (GWAS) have become a common method for discovery of gene-disease relationships, in particular for complex diseases like Type 2 Diabetes Mellitus (T2DM). The experience with GWAS analysis has revealed that the genetic risk for complex diseases involves cumulative, small effects of many genes and only some genes with a moderate effect. In order to explore the complexity of the relationships between T2DM genes and their potential function at the process level as effected by polymorphism effects, a secondary analysis of a GWAS meta-analysis is presented. Network analysis, pathway information and integration of different types of biological information such as eQTLs and gene-environment interactions are used to elucidate the biological context of the genetic variants and to perform an analysis based on data visualization. We selected a T2DM dataset from a GWAS meta-analysis, and extracted 1,971 SNPs associated with T2DM. We mapped 580 SNPs to 360 genes, and then selected 460 pathways containing these genes from the curated collection of WikiPathways. We then created and analyzed SNP-gene and SNP-gene-pathway network modules in Cytoscape. A focus on genes with robust connections to pathways permitted identification of many T2DM pertinent pathways. However, numerous genes lack literature evidence of association with T2DM. We also speculate on the genes in specific network structures obtained in the SNP-gene network, such as gene-SNP-gene modules. Finally, we selected genes relevant to T2DM from our SNP-gene-pathway network, using different sources that reveal gene-environment interactions and eQTLs. We confirmed functions relevant to T2DM for many genes and have identified some-LPL and APOB-that require further validation to clarify their involvement in T2DM.

Also flagged:High mobility group A1HMGA1chromatin remodelingcancersWntcolon cancer
Journal Article 2018-04-04 No Snippets Resar L, Chia L, Xian L.
Show Full Abstract

High mobility group A1 (HMGA1) chromatin remodeling proteins are enriched in aggressive cancers and stem cells, although their common function in these settings has remained elusive until now. Recent work in murine intestinal stem cells (ISC) revealed a novel role for Hmga1 in enhancing self-renewal by amplifying Wnt signaling, both by inducing genes expressing Wnt agonist receptors and Wnt effectors. Surprisingly, Hmga1 also "builds" a stem cell niche by upregulating <i>Sox9</i>, a factor required for differentiation to Paneth cells; these cells constitute an epithelial niche by secreting Wnt and other factors to support ISCs. <i>HMGA1</i> is also highly upregulated in colon cancer compared with nonmalignant epithelium and <i>SOX9</i> becomes overexpressed during colon carcinogenesis. Intriguingly, <i>HMGA1</i> is overexpressed in diverse cancers with poor outcomes, where it regulates developmental genes. Similarly, HMGA1 induces genes responsible for pluripotency and self-renewal in embryonic stem cells. These findings demonstrate that HMGA1 maintains Wnt and other developmental transcriptional networks and suggest that <i>HMGA1</i> overexpression fosters carcinogenesis and tumor progression through dysregulation of these pathways. Studies are now needed to determine more precisely how HMGA1 modulates chromatin structure to amplify developmental genes and how to disrupt this process in cancer therapy. <i>Cancer Res; 78(8); 1890-7. ©2018 AACR</i>.

Also flagged:nucleotidediabetescancerheart diseaseamylasestarch
Journal Article 2018-04-04 No Snippets Kim J, Weber JA, Jho S, Jang J, Jun J, Cho YS, Kim HM, Kim H, Kim Y, Chung O, Kim CG, Lee H, Kim BC, Han K, Koh I, Chae KS, Lee S, Edwards JS, Bhak J.
Show Full Abstract

High-coverage whole-genome sequencing data of a single ethnicity can provide a useful catalogue of population-specific genetic variations, and provides a critical resource that can be used to more accurately identify pathogenic genetic variants. We report a comprehensive analysis of the Korean population, and present the Korean National Standard Reference Variome (KoVariome). As a part of the Korean Personal Genome Project (KPGP), we constructed the KoVariome database using 5.5 terabases of whole genome sequence data from 50 healthy Korean individuals in order to characterize the benign ethnicity-relevant genetic variation present in the Korean population. In total, KoVariome includes 12.7M single-nucleotide variants (SNVs), 1.7M short insertions and deletions (indels), 4K structural variations (SVs), and 3.6K copy number variations (CNVs). Among them, 2.4M (19%) SNVs and 0.4M (24%) indels were identified as novel. We also discovered selective enrichment of 3.8M SNVs and 0.5M indels in Korean individuals, which were used to filter out 1,271 coding-SNVs not originally removed from the 1,000 Genomes Project when prioritizing disease-causing variants. KoVariome health records were used to identify novel disease-causing variants in the Korean population, demonstrating the value of high-quality ethnic variation databases for the accurate interpretation of individual genomes and the precise characterization of genetic variations.

Also flagged:mitochondrialIronHDmitochondriamitoferrin 2-sulfur cluster synthesis
Journal Article 2018-04-04 ✓ 1 Snippet Agrawal S, Fox J, Thyagarajan B, Fox JH.
In-Text Gene Mentions

HTT

Show Full Abstract

Mitochondrial bioenergetic dysfunction is involved in neurodegeneration in Huntington's disease (HD). Iron is critical for normal mitochondrial bioenergetics but can also contribute to pathogenic oxidation. The accumulation of iron in the brain occurs in mouse models and in human HD. Yet the role of mitochondria-related iron dysregulation as a contributor to bioenergetic pathophysiology in HD is unclear. We demonstrate here that human HD and mouse model HD (12-week R6/2 and 12-month YAC128) brains accumulated mitochondrial iron and showed increased expression of iron uptake protein mitoferrin 2 and decreased iron-sulfur cluster synthesis protein frataxin. Mitochondria-enriched fractions from mouse HD brains had deficits in membrane potential and oxygen uptake and increased lipid peroxidation. In addition, the membrane-permeable iron-selective chelator deferiprone (1 μM) rescued these effects ex-vivo, whereas hydrophilic iron and copper chelators did not. A 10-day oral deferiprone treatment in 9-week R6/2 HD mice indicated that deferiprone removed mitochondrial iron, restored mitochondrial potentials, decreased lipid peroxidation, and improved motor endurance. Neonatal iron supplementation potentiates neurodegeneration in mouse models of HD by unknown mechanisms. We found that neonatal iron supplementation increased brain mitochondrial iron accumulation and potentiated markers of mitochondrial dysfunction in HD mice. Therefore, bi-directional manipulation of mitochondrial iron can potentiate and protect against markers of mouse HD. Our findings thus demonstrate the significance of iron as a mediator of mitochondrial dysfunction and injury in mouse models of human HD and suggest that targeting the iron-mitochondrial pathway may be protective.

Also flagged:late-onset Alzheimer diseaseLOADADAlzheimer DiseasePTK2BCHRD
Journal Article 2018-04-04 No Snippets Fernández MV, Budde J, Del-Aguila JL, Ibañez L, Deming Y, Harari O, Norton J, Morris JC, Goate AM, NIA-LOAD family study group, NCRAD, Cruchaga C.
Show Full Abstract

Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (<i>N</i> = 1,235) with late-onset Alzheimer disease (LOAD). After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified <i>PTK2B</i>, a GWAS candidate gene for sporadic AD, along with six novel genes (<i>CHRD, CLCN2, HDLBP, CPAMD8, NLRP9</i>, and <i>MAS1L</i>) as candidate genes for familial LOAD.

Also flagged:familial amyotrophic lateral sclerosisALSsporadic ALSCharcot-Marie-Tooth neuropathy-typeCMT2Mcentronuclear myopathy
Journal Article 2018-04-04 ✓ 1 Snippet Vrabec K, Boštjančič E, Koritnik B, Leonardis L, Dolenc Grošelj L, Zidar J, Rogelj B, Glavač D, Ravnik-Glavač M.
In-Text Gene Mentions

…as Hes5 andSox6and inhibiting genes…

Show Full Abstract

Genetic studies have managed to explain many cases of familial amyotrophic lateral sclerosis (ALS) through mutations in several genes. However, the cause of a majority of sporadic cases remains unknown. Recently, epigenetics, especially miRNA studies, show some promising aspects. We aimed to evaluate the differential expression of 10 miRNAs, including miR-9, miR-338, miR-638, miR-663a, miR-124a, miR-143, miR-451a, miR-132, miR-206, and let-7b, for which some connection to ALS was shown previously in ALS culture cells, animal models or patients, and in three miRNA host genes, including <i>C1orf61</i> (miR-9), <i>AATK</i> (miR-338), and <i>DNM2</i> (miR-638), in leukocyte samples of 84 patients with sporadic ALS. We observed significant aberrant dysregulation across our patient cohort for miR-124a, miR-206, miR-9, let-7b, and miR-638. Since we did not use neurological controls we cannot rule out that the revealed differences in expression of investigated miRNAs are specific for ALS. Nevertheless, the group of these five miRNAs is worth of additional research in leukocytes of larger cohorts from different populations in order to verify their potential association to ALS disease. We also detected a significant up-regulation of the <i>AAKT</i> gene and down-regulation of the <i>DNM2</i> gene, and thus, for the first time, we connected these with sporadic ALS cases. These findings open up new research toward miRNAs as diagnostic biomarkers and epigenetic processes involved in ALS. The detected significant deregulation of <i>AAKT</i> and <i>DNM2</i> in sporadic ALS also represents an interesting finding. The <i>DNM2</i> gene was previously found to be mutated in Charcot-Marie-Tooth neuropathy-type CMT2M and centronuclear myopathy (CNM). In addition, as recent studies connected <i>AATK</i> and frontotemporal dementia (FTD) and <i>DNM2</i> and hereditary spastic paraplegia (HSP), these two genes together with our results genetically connect, at least in part, five diseases, including FTD, HSP, Charcot-Marie-Tooth (type CMT2M), CNM, and ALS, thus opening future research toward a better understanding of the cell biology involved in these partly overlapping pathologies.

Also flagged:BTN3A1pyrophosphateisoprenoidisopentenyl pyrophosphateHLAIFN-γ
Journal Article 2018-04-04 ✓ 5 Snippets Rhodes DA, Chen HC, Williamson JC, Hill A, Yuan J, Smith S, Rhodes H, Trowsdale J, Lehner PJ, Herrmann T, Eberl M.
In-Text Gene Mentions

…BTN3A2 NM_007047 ,BTN3A3NM_006994 ) (data…

…BTN3A2 andBTN3A3nucleotide sequences showed…

BTN2A1transcripts did not…

…BTN3A1, BTN3A2, andBTN3A3, significant surface CD277…

…contrast, BTN3A2 andBTN3A3, but not BTN3A1,…

Show Full Abstract

Activation of human Vγ9/Vδ2 T cells by "phosphoantigens" (pAg), the microbial metabolite (<i>E</i>)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP) and the endogenous isoprenoid intermediate isopentenyl pyrophosphate, requires expression of butyrophilin BTN3A molecules by presenting cells. However, the precise mechanism of activation of Vγ9/Vδ2 T cells by BTN3A molecules remains elusive. It is not clear what conformation of the three BTN3A isoforms transmits activation signals nor how externally delivered pAg accesses the cytosolic B30.2 domain of BTN3A1. To approach these problems, we studied two HLA haplo-identical HeLa cell lines, termed HeLa-L and HeLa-M, which showed marked differences in pAg-dependent stimulation of Vγ9/Vδ2 T cells. Levels of IFN-γ secretion by Vγ9/Vδ2 T cells were profoundly increased by pAg loading, or by binding of the pan-BTN3A specific agonist antibody CD277 20.1, in HeLa-M compared to HeLa-L cells. IL-2 production from a murine hybridoma T cell line expressing human Vγ9/Vδ2 T cell receptor (TCR) transgenes confirmed that the differential responsiveness to HeLa-L and HeLa-M was TCR dependent. By tissue typing, both HeLa lines were shown to be genetically identical and full-length transcripts of the three BTN3A isoforms were detected in equal abundance with no sequence variation. Expression of BTN3A and interacting molecules, such as periplakin or RhoB, did not account for the functional variation between HeLa-L and HeLa-M cells. Instead, the data implicate a checkpoint controlling BTN3A1 stability and protein trafficking, acting at an early time point in its maturation. In addition, plasma membrane profiling was used to identify proteins upregulated in HMB-PP-treated HeLa-M. ABCG2, a member of the ATP-binding cassette (ABC) transporter family was the most significant candidate, which crucially showed reduced expression in HeLa-L. Expression of a subset of ABC transporters, including ABCA1 and ABCG1, correlated with efficiency of T cell activation by cytokine secretion, although direct evidence of a functional role was not obtained by knockdown experiments. Our findings indicate a link between members of the ABC protein superfamily and the BTN3A-dependent activation of γδ T cells by endogenous and exogenous pAg.

Also flagged:Cancergene expressionmetabolismglyceraldehyde-3-phosphate dehydrogenaseLeukemiasABC transporters
Journal Article 2018-04-04 No Snippets Vidal RS, Quarti J, Rodrigues MF, Rumjanek FD, Rumjanek VM.
Show Full Abstract

Cancer outcome has improved since introduction of target therapy. However, treatment success is still impaired by the same drug resistance mechanism of classical chemotherapy, known as multidrug resistance (MDR) phenotype. This phenotype promotes resistance to drugs with different structures and mechanism of action. Recent reports have shown that resistance acquisition is coupled to metabolic reprogramming. High-gene expression, increase of active transport, and conservation of redox status are one of the few examples that increase energy and substrate demands. It is not clear if the role of this metabolic shift in the MDR phenotype is related to its maintenance or to its induction. Apart from the nature of this relation, the metabolism may represent a new target to avoid or to block the mechanism that has been impairing treatment success. In this mini-review, we discuss the relation between metabolism and MDR resistance focusing on the multiple non-metabolic functions that enzymes of the glycolytic pathway are known to display, with emphasis with the diverse activities of glyceraldehyde-3-phosphate dehydrogenase.

Also flagged:homocysteineHyperhomocysteinemiacardiovascular diseaseCVDmetabolismelectron transport chain complex
Journal Article 2018-04-04 No Snippets Cueto R, Zhang L, Shan HM, Huang X, Li X, Li YF, Lopez J, Yang WY, Lavallee M, Yu C, Ji Y, Yang X, Wang H.
Show Full Abstract

Hyperhomocysteinemia (HHcy) is an independent risk factor for cardiovascular disease (CVD) which has been implicated in matochondrial (Mt) function impairment. In this study, we characterized Hcy metabolism in mouse tissues by using LC-ESI-MS/MS analysis, established tissue expression profiles for 84 nuclear-encoded Mt electron transport chain complex (nMt-ETC-Com) genes in 20 human and 19 mouse tissues by database mining, and modeled the effect of HHcy on Mt-ETC function. Hcy levels were high in mouse kidney/lung/spleen/liver (24-14 nmol/g tissue) but low in brain/heart (~5 nmol/g). S-adenosylhomocysteine (SAH) levels were high in the liver/kidney (59-33 nmol/g), moderate in lung/heart/brain (7-4 nmol/g) and low in spleen (1 nmol/g). S-adenosylmethionine (SAM) was comparable in all tissues (42-18 nmol/g). SAM/SAH ratio was as high as 25.6 in the spleen but much lower in the heart/lung/brain/kidney/liver (7-0.6). The nMt-ETC-Com genes were highly expressed in muscle/pituitary gland/heart/BM in humans and in lymph node/heart/pancreas/brain in mice. We identified 15 Hcy-suppressive nMt-ETC-Com genes whose mRNA levels were negatively correlated with tissue Hcy levels, including 11 complex-I, one complex-IV and two complex-V genes. Among the 11 Hcy-suppressive complex-I genes, 4 are complex-I core subunits. Based on the pattern of tissue expression of these genes, we classified tissues into three tiers (high/mid/low-Hcy responsive), and defined heart/eye/pancreas/brain/kidney/liver/testis/embryonic tissues as tier 1 (high-Hcy responsive) tissues in both human and mice. Furthermore, through extensive literature mining, we found that most of the Hcy-suppressive nMt-ETC-Com genes were suppressed in HHcy conditions and related with Mt complex assembly/activity impairment in human disease and experimental models. We hypothesize that HHcy inhibits Mt complex I gene expression leading to Mt dysfunction.

Also flagged:Lipidextracellularvesiclescholesterolgene silencingVitamin-E
Journal Article 2018-04-04 ✓ 1 Snippet Biscans A, Haraszti RA, Echeverria D, Miller R, Didiot MC, Nikan M, Roux L, Aronin N, Khvorova A.
In-Text Gene Mentions

Htt

Show Full Abstract

Small extracellular vesicles (sEVs) show promise as natural nano-devices for delivery of therapeutic RNA, but efficient loading of therapeutic RNA remains a challenge. We have recently shown that the attachment of cholesterol to small interfering RNAs (siRNAs) enables efficient and productive loading into sEVs. Here, we systematically explore the ability of lipid conjugates-fatty acids, sterols, and vitamins-to load siRNAs into sEVs and support gene silencing in primary neurons. Hydrophobicity of the conjugated siRNAs defined loading efficiency and the silencing activity of siRNA-sEVs complexes. Vitamin-E-conjugated siRNA supported the best loading into sEVs and productive RNA delivery to neurons.

Also flagged:BIG1Arfgef1Arf1membranesaxonsmyelin sheaths
Journal Article 2018-04-04 ✓ 1 Snippet Miyamoto Y, Torii T, Tago K, Tanoue A, Takashima S, Yamauchi J.
In-Text Gene Mentions

On the other hand, the mutation of the big2 (also known as arfgef2) gene is linked to periventricular heterotopia with microcephaly, which involves a severe developmental defect of the cerebral cortex in the central nervous system (35).

Show Full Abstract

During development of the peripheral nervous system in mammals, Schwann cells wrap their plasma membranes around neuronal axons, forming multiple myelin sheaths. A mature myelin sheath insulates axons and increases nerve conduction velocity while protecting nerve fibers from various stresses such as physical ones. Despite this functional importance, the molecular units that underlie dynamic morphological changes in formation of myelin sheaths are not sufficiently understood. Arf1 is a small guanosine triphosphate-binding protein that plays multiple roles in intracellular trafficking and related signaling, both of which are processes involved in cell morphogenesis. We demonstrate that the Arf1 guanine nucleotide exchange factor, brefeldin A-inhibited guanine nucleotide-exchange protein 1 (BIG1)/Arfgef1, and the effector Arf1 regulate the initiation of myelination of axons by Schwann cells. Schwann cell-specific BIG1 conditional knockout mice, which have been generated here, exhibit reduced myelin thickness and decreased localization of myelin protein zero in the myelin membrane, compared with their littermate controls. BIG1 knockout mouse nerves specifically decrease the amounts of Arf1 in the AP1 clathrin adaptor protein subunits but not the Arf1 binding to GGA1 (Golgi-localized, gamma-adaptin ear-containing, Arf-binding protein 1) transporting proteins. The amounts of Arf1 in the COPI coatomer protein subunits were comparable in the knockout mice and controls. Similar results in myelin thickness are observed in Arf1 conditional knockout mice, which have also been generated here. Thus, the BIG1 and Arf1 unit plays a key role in Schwann cell myelination, newly adding it to the list of molecular units controlling myelination.

Also flagged:waterglyceroldeoxycollagenbrain injurylipid
Journal Article 2018-04-04 No Snippets Cortese L, Presti GL, Pagliazzi M, Contini D, Mora AD, Pifferi A, Sekar SKV, Spinelli L, Taroni P, Zanoletti M, Weigel UM, de Fraguier S, Nguyen-Dihn A, Rosinski B, Durduran T.
Show Full Abstract

We present the recipe and characterization for preparing liquid phantoms that are suitable for both near-infrared spectroscopy and diffuse correlation spectroscopy. The phantoms have well-defined and tunable optical and dynamic properties, and consist of a solution of water and glycerol with fat emulsion as the scattering element. The recipe takes into account the effect of bulk refractive index changes due to the addition of glycerol, which is commonly used to alter the sample viscosity.

Also flagged:cAncernonischemic cardiomyopathyheart failureanthracycline-induced cardiomyopathyNT-proBNPLV systolic dysfunction
Journal Article 2018-04-04 No Snippets Bolli R, Hare JM, Henry TD, Lenneman CG, March KL, Miller K, Pepine CJ, Perin EC, Traverse JH, Willerson JT, Yang PC, Gee AP, Lima JA, Moyé L, Vojvodic RW, Sayre SL, Bettencourt J, Cohen M, Ebert RF, Simari RD, Cardiovascular Cell Therapy Research Network (CCTRN).
Show Full Abstract

<h4>Objectives</h4>SENECA (StEm cell iNjECtion in cAncer survivors) is a phase I, randomized, double-blind, placebo-controlled study to evaluate the safety and feasibility of delivering allogeneic mesenchymal stromal cells (allo-MSCs) transendocardially in subjects with anthracycline-induced cardiomyopathy (AIC).<h4>Background</h4>AIC is an incurable and often fatal syndrome, with a prognosis worse than that of ischemic or nonischemic cardiomyopathy. Recently, cell therapy with MSCs has emerged as a promising new approach to repair damaged myocardium.<h4>Methods</h4>The study population is 36 cancer survivors with a diagnosis of AIC, left ventricular (LV) ejection fraction ≤40%, and symptoms of heart failure (NYHA class II-III) on optimally-tolerated medical therapy. Subjects must be clinically free of cancer for at least two years with a ≤ 30% estimated five-year risk of recurrence. The first six subjects participated in an open-label, lead-in phase and received 100 million allo-MSCs; the remaining 30 will be randomized 1:1 to receive allo-MSCs or vehicle via 20 transendocardial injections. Efficacy measures (obtained at baseline, 6 months, and 12 months) include MRI evaluation of LV function, LV volumes, fibrosis, and scar burden; assessment of exercise tolerance (six-minute walk test) and quality of life (Minnesota Living with Heart Failure Questionnaire); clinical outcomes (MACE and cumulative days alive and out of hospital); and biomarkers of heart failure (NT-proBNP).<h4>Conclusions</h4>This is the first clinical trial using direct cardiac injection of cells for the treatment of AIC. If administration of allo-MSCs is found feasible and safe, SENECA will pave the way for larger phase II/III studies with therapeutic efficacy as the primary outcome.

Also flagged:silicaS21S26S24S28atom
Journal Article 2018-04-03 No Snippets Reiné P, Justicia J, Morcillo SP, Abbate S, Vaz B, Ribagorda M, Orte Á, Álvarez de Cienfuegos L, Longhi G, Campaña AG, Miguel D, Cuerva JM.
Show Full Abstract

In this manuscript, we report the first synthesis of an organic monomolecular emitter, which behaves as a circularly polarized luminescence (CPL)-based ratiometric probe. The enantiopure helical ortho-oligo(phenylene)ethynylene ( o-OPE) core has been prepared by a new and efficient macrocyclization reaction. The combination of such o-OPE helical skeleton and a pyrene couple leads to two different CPL emission features in a single structure whose ratio linearly responds to silver(I) concentration.

Also flagged:antioxidant activitiesEugenoldtlNMRsynthesiscarboxylic acids
Journal Article 2018-04-03 No Snippets da Silva FFM, Monte FJQ, de Lemos TLG, do Nascimento PGG, de Medeiros Costa AK, de Paiva LMM.
Show Full Abstract

Eugenol is the major component of clove essential oil and has demonstrated relevant biological potential with well-known antimicrobial and antioxidant action. Therefore, this work carried out the synthesis, purification, characterization, and evaluation of the antioxidant and antibacterial potential of 19 eugenol derivatives. The derivatives were produced by esterification reactions in the hydroxyl group (-OH) of eugenol with different carboxylic acids and also by addition reactions in the double bond of the allyl group. The derivatives had a promising antibacterial potential, including a lower minimum inhibitory concentration of 500 μg/mL than eugenol (1000 μg/mL). In addition, the derivatives were active against bacterial strains (Escherichia coli, Staphylococcus aureus) that eugenol itself showed no activity, thus increasing the spectrum of antibacterial action. As for the antioxidant activity, it was observed that the derivatives that involved esterification reactions in the hydroxyl group (-OH) of the eugenol molecule's phenol resulted in a significant reduction of the antioxidant action (IC<sub>50</sub> > 100 μg/mL) when compared with the eugenol precursor molecule (IC<sub>50</sub> = 4.38 μg/mL). On the other hand, the structural changes located in the double bond affected much more smoothly the capacity of capturing radicals than the starting molecule, also being obtained derivatives with proximal antioxidant capacity (IC<sub>50</sub> = 19.30 μg/mL) to commercial standards such as Trolox (IC<sub>50</sub> = 16.00 μg/mL).

Also flagged:axonalorganizationnucleussex steroidsgene expressionsteroid receptors
Journal Article 2018-04-03 ✓ 1 Snippet Lovell PV, Huizinga NA, Friedrich SR, Wirthlin M, Mello CV.
In-Text Gene Mentions

DCC), which has been…

Show Full Abstract

<h4>Background</h4>The ability to imitate the vocalizations of other organisms, a trait known as vocal learning, is shared by only a few organisms, including humans, where it subserves the acquisition of speech and language, and 3 groups of birds. In songbirds, vocal learning requires the coordinated activity of a set of specialized brain nuclei referred to as the song control system. Recent efforts have revealed some of the genes that are expressed in these vocal nuclei, however a thorough characterization of the transcriptional specializations of this system is still missing. We conducted a rigorous and comprehensive analysis of microarrays, and conducted a separate analysis of 380 genes by in situ hybridizations in order to identify molecular specializations of the major nuclei of the song system of zebra finches (Taeniopygia guttata), a songbird species.<h4>Results</h4>Our efforts identified more than 3300 genes that are differentially regulated in one or more vocal nuclei of adult male birds compared to the adjacent brain regions. Bioinformatics analyses provided insights into the possible involvement of these genes in molecular pathways such as cellular morphogenesis, intrinsic cellular excitability, neurotransmission and neuromodulation, axonal guidance and cela-to-cell interactions, and cell survival, which are known to strongly influence the functional properties of the song system. Moreover, an in-depth analysis of specific gene families with known involvement in regulating the development and physiological properties of neuronal circuits provides further insights into possible modulators of the song system.<h4>Conclusion</h4>Our study represents one of the most comprehensive molecular characterizations of a brain circuit that evolved to facilitate a learned behavior in a vertebrate. The data provide novel insights into possible molecular determinants of the functional properties of the song control circuitry. It also provides lists of compelling targets for pharmacological and genetic manipulations to elucidate the molecular regulation of song behavior and vocal learning.

Also flagged:TINCRSP1breast cancertissue differentiationcancerbinding
Journal Article 2018-04-03 ✓ 1 Snippet Liu Y, Du Y, Hu X, Zhao L, Xia W.
In-Text Gene Mentions

…that E2F1 stimulated TINCR/STAU1/CDKN2B signaling axis exacerb…

Show Full Abstract

<h4>Background</h4>Assembling evidences suggested that aberrant expression of tissue differentiation-inducing non-protein coding RNA (TINCR) intimately associated with variety of human cancer. However, the expression pattern and involvement of TINCR in breast cancer has not been fully investigated. Here we set out to analyze expression of TINCR in breast cancer and elucidate its mechanistic involvement in tumor incidence and progression.<h4>Methods</h4>The expression of TINCR was determined by q-PCR. SP1 binding sites were analyzed by ChIP-qPCR. The relative transcription activity was measured with luciferase reporter assay. Cell viability was measured with CCK-8 method. Clonogenic capacity was evaluated by soft agar assay. Cell apoptosis was analyzed by Annexin V/7-AAD staining. The migration and invasion were determined by trans-well assay and wound healing. The tumor growth in vivo was evaluated in xenograft mice model. Protein expression was quantified by immunoblotting.<h4>Results</h4>TINCR was aberrantly up-regulated by SP1, which in turn stimulated cell proliferation, anchorage-independent growth and suppressed cell apoptosis in breast cancer. TINCR silencing significantly suppressed migration and invasion in vitro and xenograft tumor growth in vivo. Mechanistically, TINCR modulated KLF4 expression via competing with miR-7, which consequently contributed to its oncogenic potential. MiR-7 inhibition severely compromised TINCR silencing-elicited tumor repressive effects.<h4>Conclusion</h4>Our data uncovered a crucial role of TINCR-miR-7-KLF4 axis in human breast cancer.

Also flagged:RETRASmedullary thyroid carcinomaMTClymph node metastasistumor
Journal Article 2018-04-03 No Snippets Vuong HG, Odate T, Ngo HTT, Pham TQ, Tran TTK, Mochizuki K, Nakazawa T, Katoh R, Kondo T.
Show Full Abstract

There are ongoing debates with respect to the prognostic roles of molecular biomarkers in sporadic medullary thyroid carcinoma (MTC). In this study, we aimed at investigating the prognostic value of <i>RET</i> and <i>RAS</i> mutations - the two most common mutations in sporadic MTCs. A search was conducted in four electronic databases. Relevant data were extracted and pooled into odds ratios (OR), mean differences (MD) and corresponding 95% confidence intervals (CI) using the random-effect model. We used Egger's regression test and visual of funnel plots to assess the publication bias. From 2581 studies, we included 23 studies with 964 MTCs for meta-analysis. Overall, the presence of <i>RET</i> mutation was associated with an elevated risk for lymph node metastasis (OR = 3.61; 95% CI = 2.33-5.60), distant metastasis (OR = 2.85; 95% CI = 1.64-4.94), advanced tumor stage (OR = 3.25; 95% CI = 2.02-5.25), tumor recurrence (OR = 3.01; 95% CI = 1.65-5.48) and patient mortality (OR = 2.43; 95% CI = 1.06-5.57). <i>RAS</i> mutation had no significant prognostic value in predicting tumor aggressiveness. To summarize, our results affirmed that <i>RET</i> mutation is a reliable molecular biomarker to identify a group of highly aggressive sporadic MTCs. It can help clinicians better assess patient prognosis and select appropriate treatment decisions.

Also flagged:tumortumorsesophageal squamous cell carcinomaESCCβ2-MicroglobulinB2M
Journal Article 2018-04-03 ✓ 4 Snippets Wang J, Yang W, Wang T, Chen X, Wang J, Zhang X, Cai C, Zhong B, Wu J, Chen Z, Xiang AP, Huang W.
In-Text Gene Mentions

Josson et al. reported that hemochromatosis (HFE) protein, a non-classical MHC class I member, interacts with B2M to regulate iron homeostasis and control EMT of cancer cells via interaction with TFRC 1 (transferrin receptor complex 1) and suggested that B2M/HFE interactions are important for the secreted B2M-mediated EMT16.

…reported thathemochromatosis(HFE) protein, a…

…eported that hemochromatosis (HFE) protein, a non-classical…

…and suggested that B2M/HFEinteractions are important…

Show Full Abstract

Mesenchymal stromal cells (MSCs) have been considered as one of the pivotal type of cells composing the tumor microenvironment. Although contact-dependent mechanisms and paracrine factors are thought to collaborate in governing the MSCs-based effects on tumors progression, the underlying mechanisms remain largely unknown. In particular, the involvement of MSCs-derived cytokines in the epithelial-mesenchymal transition (EMT) of esophageal squamous cell carcinoma (ESCC) has not been clarified. In this study, we observed that β2-Microglobulin (B2M) is highly expressed in MSCs but scarcely in ESCC cells. Based on the previously described EMT promoting effect of B2M, we investigated the in vitro effect of MSCs-derived B2M on the EMT of ESCC cells, and discovered its subsequent enhancing effects on cell mobility and tumor-initiation. Further xenograft transplantation experiments confirmed the in vivo induction of tumor-initiation by MSCs-derived B2M. Noteworthy, we showed that the B2M expression positively correlated with poor prognosis. The fact that B2M is primarily expressed by the stroma of the ESCC tissue strengthens our hypothesis that in ESCC, MSCs-derived B2M promotes tumor-initiation and invasion via enhancing EMT, resulting in an adverse prognosis for the patients. Our results will be valuable for the prediction of the development and treatment of ESCC.

Also flagged:nucleosomeeuchromatinheterochromatinbindingchromatincell nucleus
Journal Article 2018-04-03 ✓ 3 Snippets Oh I, Choi S, Jung Y, Kim JS.
In-Text Gene Mentions

…tails 23 andlinker histoneshistones 24 ,…

…tails 23 andlinker histoneshistones 24 .…

…histone tails andlinker histoneshistones in inter-nucleosome…

Show Full Abstract

Sharp increase in macromolecular crowding induces abnormal chromatin compaction in the cell nucleus, suggesting its non-negligible impact on chromatin structure and function. However, the details of the crowding-induced chromatin compaction remain poorly understood. In this work, we present a computer simulation study on the entropic effect of macromolecular crowding on the interaction between chromatin structural units called nucleosome clutches. Nucleosome clutches were modeled by a chain of nucleosomes collapsed by harmonic restraints implicitly mimicking the nucleosome association mediated by histone tails and linker histones. The nucleosome density of the clutches was set close to either that of high-density heterochromatin or that of low-density euchromatin. The effective interactions between these nucleosome clutches were calculated in various crowding conditions, and it was found that the increase in the degree of macromolecular crowding induced attractive interaction between two clutches with high nucleosome density. Interestingly, the increased degree of macromolecular crowding did not induce any attraction between two clutches with low nucleosome density. Our results suggest that the entropic effect of macromolecular crowding can enhance binding between nucleosome clutches in heterochromatin, but not in euchromatin, as a result of the difference in nucleosome packing degrees.

Also flagged:waterADFtransportationAral SeaDeltasalt
Journal Article 2018-04-03 No Snippets Karimzadeh S, Matsuoka M, Ogushi F.
Show Full Abstract

We present deformation patterns in the Lake Urmia Causeway (LUC) in NW Iran based on data collected from four SAR sensors in the form of interferometric synthetic aperture radar (InSAR) time series. Sixty-eight images from Envisat (2004-2008), ALOS-1 (2006-2010), TerraSAR-X (2012-2013) and Sentinel-1 (2015-2017) were acquired, and 227 filtered interferograms were generated using the small baseline subset (SBAS) technique. The rate of line-of-sight (LOS) subsidence of the LUC peaked at 90 mm/year between 2012 and 2013, mainly due to the loss of most of the water in Lake Urmia. Principal component analysis (PCA) was conducted on 200 randomly selected time series of the LUC, and the results are presented in the form of the three major components. The InSAR scores obtained from the PCA were used in a hydro-thermal model to investigate the dynamics of consolidation settlement along the LUC based on detrended water level and temperature data. The results can be used to establish a geodetic network around the LUC to identify more detailed deformation patterns and to help plan future efforts to reduce the possible costs of damage.

Also flagged:breast cancerMalignant breast cancermethylationcancerstumorhyperplasia
Journal Article 2018-04-03 ✓ 1 Snippet Cai Y, Lin JR, Zhang Q, O'Brien K, Montagna C, Zhang ZD.
In-Text Gene Mentions

…stage ( Barhl2,Cacna1e, Cntfr, Col4a6, Dkk2,…

Show Full Abstract

Malignant breast cancer remains a major health threat to women of all ages worldwide and epigenetic variations on DNA methylation have been widely reported in cancers of different types. We profiled DNA methylation with ERRBS (Enhanced Reduced Representation Bisulfite Sequencing) across four main stages of tumor progression in the MMTV-PyMT mouse model (hyperplasia, adenoma/mammary intraepithelial neoplasia, early carcinoma and late carcinoma), during which malignant transition occurs. We identified a large number of differentially methylated cytosines (DMCs) in tumors relative to age-matched normal mammary glands from FVB mice. Despite similarities, the methylation differences of the premalignant stages were distinct from the malignant ones. Many differentially methylated loci were preserved from the first to the last stage throughout tumor progression. Genes affected by methylation gains were enriched in Polycomb repressive complex 2 (PRC2) targets, which may present biomarkers for early diagnosis and targets for treatment.

Also flagged:gestationmetabolismcytoskeletonorganizationaldolasefatty acid binding proteins
Journal Article 2018-04-03 ✓ 5 Snippets Gondret F, Guével B, Père MC, Quesnel H, Billon Y, Com E, Canario L, Louveau I, Liaubet L.
In-Text Gene Mentions

Among them, several proteins participating in hexose metabolic process [aldolase (ALDOC), lactate dehydrogenase (LDHB), aldo-keto reductase (AKR1B1), galactose mutarotase (GALM), galactokinase (GALK1)], pyruvate metabolism [pyruvate dehydrogenase (PDHB), malate dehydrogenase (MDH1)] and oxidation reduction [acyl-CoA dehydrogenase (ACADS), prostaglandin reductase (PTGR2), aldehyde dehydrogenase (ALDH9A1), periredoxins (PRDX1, PRDX6)] were more abundant in the subcutaneous adipose tissue of 110-day-old fetuses than in that of 90-day-old fetuses.

…ALDH9A1), periredoxins (PRDX1,PRDX6)] were more abundant…

…an anti-oxidative capacity (PRDX6) and participating in…

…mRNA levels ofPRDX6increased with advancing…

…three redox proteins (PRDX6, PDIA3, and PDIA6)…

Show Full Abstract

<h4>Background</h4>The degree of adipose tissue development at birth may influence neonatal survival and subsequent health outcomes. Despite their lower birth weights, piglets from Meishan sows (a fat breed with excellent maternal ability) have a higher survival rate than piglets from Large White sows (a lean breed). To identify the main pathways involved in subcutaneous adipose tissue maturation during the last month of gestation, we compared the proteome and the expression levels of some genes at d 90 and d 110 of gestation in purebred and crossbred Large White or Meishan fetuses gestated by sows of either breed.<h4>Results</h4>A total of 52 proteins in fetal subcutaneous adipose tissue were identified as differentially expressed over the course of gestation. Many proteins involved in energy metabolism were more abundant, whereas some proteins participating in cytoskeleton organization were reduced in abundance on d 110 compared with d 90. Irrespective of age, 24 proteins differed in abundance between fetal genotypes, and an interaction effect between fetal age and genotype was observed for 13 proteins. The abundance levels of proteins known to be responsive to nutrient levels such as aldolase and fatty acid binding proteins, as well as the expression levels of <i>FASN,</i> a key lipogenic enzyme, and <i>MLXIPL</i>, a pivotal transcriptional mediator of glucose-related stimulation of lipogenic genes, were elevated in the adipose tissue of pure and crossbred fetuses from Meishan sows. These data suggested that the adipose tissue of these fetuses had superior metabolic functionality, whatever their paternal genes. Conversely, proteins participating in redox homeostasis and apoptotic cell clearance had a lower abundance in Meishan than in Large White fetuses. Time-course differences in adipose tissue protein abundance were revealed between fetal genotypes for a few secreted proteins participating in responses to organic substances, such as alpha-2-HS-glycoprotein, transferrin and albumin.<h4>Conclusions</h4>These results underline the importance of not only fetal age but also maternal intrauterine environment in the regulation of several proteins in subcutaneous adipose tissue. These proteins may be used to estimate the maturity grade of piglet neonates.

Also flagged:Ketamineestrogen receptorcytochrome P450AMPA glutamate receptorMajor depressive disorderpsychiatric illness
Journal Article 2018-04-03 No Snippets Ho MF, Correia C, Ingle JN, Kaddurah-Daouk R, Wang L, Kaufmann SH, Weinshilboum RM.
Show Full Abstract

Major depressive disorder (MDD) is the most common psychiatric illness worldwide, and it displays a striking sex-dependent difference in incidence, with two thirds of MDD patients being women. Ketamine treatment can produce rapid antidepressant effects in MDD patients, effects that are mediated-at least partially-through glutamatergic neurotransmission. Two active metabolites of ketamine, (2R,6R)-hydroxynorketamine (HNK) and (2S,6S)-HNK, also appear to play a key role in ketamine's rapid antidepressant effects through the activation of α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (AMPA) glutamate receptors. In the present study, we demonstrated that estrogen plus ketamine or estrogen plus active ketamine metabolites displayed additive effects on the induction of the expression of AMPA receptor subunits. In parallel, the expression of estrogen receptor alpha (ERα) was also significantly upregulated. Even more striking, radioligand binding assays demonstrated that [<sup>3</sup>H]-ketamine can directly bind to ERα (K<sub>D</sub>: 344.5 ± 13 nM). Furthermore, ketamine and its (2R,6R)-HNK and (2S,6S)-HNK metabolites displayed similar affinity for ERα (IC<sub>50</sub>: 2.31 ± 0.1, 3.40 ± 0.2, and 3.53 ± 0.2 µM, respectively) as determined by [<sup>3</sup>H]-ketamine displacement assays. Finally, induction of AMPA receptors by either estrogens or ketamine and its metabolites was lost when ERα was knocked down or silenced pharmacologically. These results suggest a positive feedback loop by which estrogens can augment the effects of ketamine and its (2R,6R)-HNK and (2S,6S)-HNK metabolites on the ERα-induced transcription of CYP2A6 and CYP2B6, estrogen inducible enzymes that catalyze ketamine's biotransformation to form the two active metabolites. These observations provide novel insight into ketamine's molecular mechanism(s) of action and have potential implications for the treatment of MDD.

Also flagged:spermatogenesismembranecytokinesisretinoic acidRecombinasemitotic division
Journal Article 2018-04-03 No Snippets Lord T, Oatley JM.
Show Full Abstract

Historically, research in spermatogonial biology has been hindered by a lack of validated approaches to identify and isolate pure populations of the various spermatogonial subsets for in-depth analysis. In particular, although a number of markers of the undifferentiated spermatogonial population have now been characterized, standardized methodology for assessing their specificity to the spermatogonial stem cell (SSC) and transit amplifying progenitor pools has been lacking. To date, SSC content within an undefined population of spermatogonia has been inferred using either lineage tracing or spermatogonial transplantation analyses which generate qualitative and quantitative data, respectively. Therefore, these techniques are not directly comparable, and are subject to variable interpretations as to a readout that is representative of a 'pure' SSC population. We propose standardization across the field for determining the SSC purity of a population via use of a limiting dilution transplantation assay that would eliminate subjectivity and help to minimize the generation of inconsistent data on 'SSC' populations. In the limiting dilution transplantation assay, a population of LacZ-expressing spermatogonia are selected based on a putative SSC marker, and a small, defined number of cells (i.e. 10 cells) are microinjected into the testis of a germ cell-deficient recipient mouse. Using colony counts and an estimated colonization efficiency of 5%; a quantitative value can be calculated that represents SSC purity in the starting population. The utilization of this technique would not only be useful to link functional relevance to novel markers that will be identified in the future, but also for providing validation of purity for marker-selected populations of spermatogonia that are commonly considered to be SSCs by many researchers in the field of spermatogenesis and stem cell biology.

Also flagged:Neurodegenerative DiseasesCasschizophrenianeuropsychiatric diseaseneuropsychiatric diseasesPD
Journal Article 2018-04-03 ✓ 1 Snippet LaMarca EA, Powell SK, Akbarian S, Brennand KJ.
In-Text Gene Mentions

…(also known asPou3f2), Ascl1 ,…

Show Full Abstract

Human-induced pluripotent stem cells (hiPSCs) have revolutionized our ability to model neuropsychiatric and neurodegenerative diseases, and recent progress in the field is paving the way for improved therapeutics. In this review, we discuss major advances in generating hiPSC-derived neural cells and cutting-edge techniques that are transforming hiPSC technology, such as three-dimensional "mini-brains" and clustered, regularly interspersed short palindromic repeats (CRISPR)-Cas systems. We examine specific examples of how hiPSC-derived neural cells are being used to uncover the pathophysiology of schizophrenia and Parkinson's disease, and consider the future of this groundbreaking research.

Also flagged:CRLNEDD8cullin-RING ligasecell cycleautophagysignal transduction
Journal Article 2018-04-03 ✓ 4 Snippets Liu S, Wan J, Kong Y, Zhang Y, Wan L, Zhang Z.
In-Text Gene Mentions

…F-box proteins (Skp2,KLHL20, βTrCP) and up-regulated…

…(USA); anti-Beclin1 andKLHL20were produced by…

…cullin3 adaptor proteinKLHL20in NB4 cells…

…shown that the cul3-KLHL20E3 ligase regulated…

Show Full Abstract

The cullin-RING ligase (CRL)-NEDD8 pathway maintains essential cellular processes, including cell cycle progression, apoptosis, autophagy, DNA repair, antigen processing and signal transduction. Growing evidence demonstrates that the alteration of the CRL-NEDD8 pathway in some cancers constitutes an attractive target for therapeutic intervention, but the roles of CRL-NEDD8 pathway in acute promyelocytic leukemia (APL) is still unclear. In the present study, we found that ATRA could decrease the expression of NEDD8-activating enzyme E1 (NAE1) and inhibit the neddylation of cullin1 and cullin3 in the APL cell line NB4. Inactivation of cullin neddylation promoted self-degradation of F-box proteins (Skp2, KLHL20, βTrCP) and up-regulated the protein expression of p27<sup>kip</sup>, DEPTOR and DAPK1. MLN4924, a novel inhibitor of NAE1, significantly suppressed cell growth and enhanced apoptosis of APL cells by blocking cullin neddylation and subsequent accumulation of CRL E3 substrates. Furthermore, MLN4924 effectively enhanced ATRA-induced differentiation of APL cells by promoting autophagy. Our findings not only provide further insights into the mechanism of the CRL-NEDD8 axis, but also provide a better understanding of this pathway as a potential target for therapeutic intervention in APL.

Also flagged:mineralslocalizationacute kidney injurychronic kidney diseaselumencholesterol
Journal Article 2018-04-03 ✓ 1 Snippet Mulay SR, Shi C, Ma X, Anders HJ.
In-Text Gene Mentions

Type 1 crystal nephropathies1 crystal nephropathies…

Show Full Abstract

<h4>Background</h4>The entity of crystal nephropathies encompasses a spectrum of different kidney injuries induced by crystal-formed intrinsic minerals, metabolites, and proteins or extrinsic dietary components and drug metabolites. Depending on the localization and dynamics of crystal deposition, the clinical presentation can be acute kidney injury, progressive chronic kidney disease, or renal colic.<h4>Summary</h4>The molecular mechanisms involving crystal-induced injury are diverse and remain poorly understood. Type 1 crystal nephropathies arise from crystals in the vascular lumen (cholesterol embolism) or the vascular wall (atherosclerosis) and involve kidney infarcts or chronic ischemia, respectively. Type 2 crystal nephropathies arise from intratubular crystal deposition causing obstruction, interstitial inflammation, and tubular cell injury. NLRP3 inflammasome and necroptosis drive renal necroinflammation in acute settings. Type 3 is represented by crystal and stone formation in the draining urinary tract, i.e., urolithiasis, causing renal colic and chronic obstruction.<h4>Key messages</h4>Dissecting the types of injury is the first step towards a better understanding of the pathophysiology of crystal nephropathies. Crystal-induced acti-vation of the inflammasome and necroptosis, crystal adhesion, crystallization inhibitors, extratubulation, and granulo-ma formation are only a few of certainly many involved pathomechanisms that deserve further studies to eventually form the basis for innovative cures for these diseases.

Also flagged:Flp1endonucleasehelicasetopoisomeraseTop3Rmi1
Journal Article 2018-04-03 No Snippets Phung HTT, Nguyen HLH, Nguyen DH.
Show Full Abstract

<i>Saccharomyces cerevisiae</i> Mus81 is a structure-selective endonuclease which constitutes an alternative pathway in parallel with the helicase-topoisomerase Sgs1-Top3-Rmi1 complex to resolve a number of DNA intermediates during DNA replication, repair, and homologous recombination. Previously, it was showed that the N-terminal region of Mus81 was required for its <i>in vivo</i> function in a redundant manner with Sgs1; <i>mus81<sub>Δ120N</sub></i> mutant that lacks the first 120 amino acid residues at the N-terminus exhibited synthetic lethality in combination with the loss of <i>SGS1</i>. In this study, the physiologically important role of the N-terminal region of Mus81 in processing toxic intermediates was further investigated. We examined the cellular defect of <i>sgs1Δmus81<sub>Δ100N</sub></i> cells and observed that although viable, the cells became very sensitive to DNA damaging agents. A single-copy suppressor screening to seek for a factor(s) that could rescue the drug sensitivity of <i>sgs1Δmus81<sub>Δ100N</sub></i> cells was performed and revealed that Flp1, a site-specific recombinase 1 encoded on the 2-micron plasmid was a suppressor. Moreover, Flp1 overexpression could partially suppress the drug sensitivity of <i>mus81Δ</i> cells at 37 °C. Our findings suggest a possible function of Flp1 in coordination with Mus81 and Sgs1 to jointly resolve the branched-DNA structures generated in cells attempting to repair DNA damages.

Also flagged:gadoliniumneutrontumorpolyacrylic acidrhodamine Bnanoparticle
Journal Article 2018-04-03 No Snippets Ho SL, Cha H, Oh IT, Jung KH, Kim MH, Lee YJ, Miao X, Tegafaw T, Ahmad MY, Chae KS, Chang Y, Lee GH.
Show Full Abstract

Monodisperse and ultrasmall gadolinium oxide (Gd<sub>2</sub>O<sub>3</sub>) nanoparticle colloids (<i>d</i> <sub>avg</sub> = 1.5 nm) (nanoparticle colloid = nanoparticle coated with hydrophilic ligand) were synthesized and their performance as a multifunctional tumor theragnostic agent was investigated. The aqueous ultrasmall nanoparticle colloidal suspension was stable and non-toxic owing to hydrophilic polyacrylic acid (PAA) coating that was partly conjugated with rhodamine B (Rho) for an additional functionalization (mole ratio of PAA : Rho = 5 : 1). First, the ultrasmall nanoparticle colloids performed well as a powerful T<sub>1</sub> magnetic resonance imaging (MRI) contrast agent: they exhibited a very high longitudinal water proton relaxivity (<i>r</i> <sub>1</sub>) of 22.6 s<sup>-1</sup> mM<sup>-1</sup> (<i>r</i> <sub>2</sub>/<i>r</i> <sub>1</sub> = 1.3, <i>r</i> <sub>2</sub> = transverse water proton relaxivity), which was ∼6 times higher than those of commercial Gd-chelates, and high positive contrast enhancements in T<sub>1</sub> MR images in a nude mouse after intravenous administration. Second, the ultrasmall nanoparticle colloids were applied to gadolinium neutron capture therapy (GdNCT) <i>in vitro</i> and exhibited a significant U87MG tumor cell death (28.1% net value) after thermal neutron beam irradiation, which was 1.75 times higher than that obtained using commercial Gadovist. Third, the ultrasmall nanoparticle colloids exhibited stronger fluorescent intensities in tumor cells than in normal cells owing to conjugated Rho, proving their pH-sensitive fluorescent tumor cell detection ability. All these results together demonstrate that ultrasmall Gd<sub>2</sub>O<sub>3</sub> nanoparticle colloids are the potential multifunctional tumor theragnostic agent.

bioRxiv 2018-04-03 Preprint (No Snippets API) Gujar MR, Sundararajan L, Stricker A, Lundquist EA.
Show Full Abstract

Many axon guidance ligands and their receptors have been identified, but it is still unclear how these ligand-receptor interactions regulate events in the growth cone, such as protrusion and cytoskeletal arrangement, during directed outgrowth in vivo . In this work, we dissect the multiple and complex effects of UNC-6/Netrin on the growth cone. Previous studies showed that in C. elegans , the UNC-6/Netrin receptor UNC-5 regulates growth cone polarity, as evidenced by loss of asymmetric dorsal F-actin localization and protrusion in unc-5 mutants. UNC-5 and another UNC-6/Netrin receptor UNC-40/DCC also regulate the extent of protrusion, with UNC-40/DCC driving protrusion and UNC-5 inhibiting protrusion. In this work we analyze the roles of UNC-6/Netrin, UNC-40/DCC, and UNC-5 in coordinating growth cone F-actin localization, microtubule organization, and protrusion that results in directed outgrowth away from UNC-6/Netrin. We find that a previously-described pathway involving the UNC-73/Trio Rac GEF and UNC-33/CRMP that acts downstream of UNC-5, regulates growth cone dorsal asymmetric F-actin accumulation and protrusion. unc-5 and unc-33 mutants also display excess EBP-2::GFP puncta, suggesting that MT + end accumulation is important in growth cone polarity and/or protrusion. unc-73 Rac GEF mutants did not display excess EBP-2::GFP puncta despite larger and more protrusive growth cones, indicating a MT-independent mechanism to polarize the growth cone and to inhibit protrusion, possibly via actin. Finally, we show that UNC-6/Netrin and UNC-40/DCC are required for excess protrusion in unc-5 mutants, but not for loss of F-actin asymmetry or MT + end accumulation, indicating that UNC-6/Netrin and UNC-40/DCC are required for protrusion downstream of F-actin asymmetry and MT + end entry. Our data suggest a model in which UNC-6/Netrin polarizes the growth cone via UNC-5, and then regulates a balance of pro- and anti-protrusive forces driven by UNC-40 and UNC-5, respectively, that result in directed protrusion and outgrowth.

Also flagged:cancertoplatinumcisplatinnon-small cell lung cancerovarian cancer
Journal Article 2018-04-02 No Snippets Vera O, Rodriguez-Antolin C, de Castro J, Karreth FA, Sellers TA, Ibanez de Caceres I.
Show Full Abstract

Long noncoding RNAs (lncRNAs) are critical regulators of cell biology whose alteration can lead to the development of diseases such as cancer. The potential role of lncRNAs and their epigenetic regulation in response to platinum treatment are largely unknown. We analyzed four paired cisplatin-sensitive/resistant non-small cell lung cancer and ovarian cancer cell lines. The epigenetic landscape of overlapping and cis-acting lncRNAs was determined by combining human microarray data on 30,586 lncRNAs and 20,109 protein coding mRNAs with whole-genome bisulfite sequencing. Selected candidate lncRNAs were further characterized by PCR, gene-ontology analysis, and targeted bisulfite sequencing. Differential expression in response to therapy was observed more frequently in cis-acting than in overlapping lncRNAs (78% vs. 22%, fold change ≥1.5), while significantly altered methylation profiles were more commonly associated with overlapping lncRNAs (29% vs. 8%; P value <0.001). Moreover, overlapping lncRNAs contain more CpG islands (CGIs) (25% vs. 17%) and the majority of CGI-containing overlapping lncRNAs share these CGIs with their associated coding genes (84%). The differences in expression between sensitive and resistant cell lines were replicated in 87% of the selected candidates (P<0.05), while our bioinformatics approach identifying differential methylation was confirmed in all of the selected lncRNAs (100%). Five lncRNAs under epigenetic regulation appear to be involved in cisplatin resistance (AC091814.2, AC141928.1, RP11-65J3.1-002, BX641110, and AF198444). These novel findings provide new insights into epigenetic mechanisms and acquired resistance to cisplatin that highlight specific lncRNAs, some with unknown function, that may signal strategies in epigenetic therapies.

Also flagged:skin photoagingmatrix metalloproteinasesdegradationcollagenphenylethanoid glycosidesacteoside
Journal Article 2018-04-02 No Snippets Gao W, Wang YS, Qu ZY, Hwang E, Ngo HTT, Wang YP, Bae J, Yi TH.
Show Full Abstract

UV radiation is the primary cause of skin photoaging, which results in an increase in matrix metalloproteinases and degradation of collagen. Developing new natural antioxidant as photoprotective agents has become a popular area of research. Orobanche cernua Loefling is a parasitic plant that is rich in phenylethanoid glycosides (PhGs). This study investigated the photoprotective effects of the ethanolic extract of Orobanche cernua Loefling (OC) and its principal component acteoside on UVB-induced photoaging as well as their underlying molecular mechanisms in normal human dermal fibroblasts (NHDFs). Biological testing demonstrated that OC and acteoside possessed significant photoprotective activities, reducing MMP and IL-6 levels while improving type-I procollagen synthesis in UVB-irradiated NHDFs. Further study showed that the protective mechanisms were the improvement of transcription factor Nrf2-mediated antioxidant defensive system, suppression of MAPK/AP-1 and activation of the TGF-β/Smad pathway. Together, our results suggested that OC might be a promising antiphotoaging agent against UV radiation-induced skin damage.

Also flagged:meristem differentiationnitrogenmetabolismpolymerasehistoneubiquitin
Journal Article 2018-04-02 No Snippets Chen S, Chen J, Hou F, Feng Y, Zhang R.
Show Full Abstract

<h4>Background</h4>Spike architecture mutants in tetraploid wheat (Triticum turgidum L., 2n = 28, AABB) have a distinct morphology, with parts of the rachis node producing lateral meristems that develop into ramified spikelete (RSs) or four-rowed spikelete (FRSs). The genetic basis of RSs and FRSs has been analyzed, but little is known about the underlying developmental mechanisms of the lateral meristem. We used isobaric tags for relative and absolute quantitation (iTRAQ) to perform a quantitative proteomic analysis of immature spikes harvested from tetraploid near-isogenic lines of wheat with normal spikelete (NSs), FRSs, and RSs and investigated the molecular mechanisms of lateral meristem differentiation and development. This work provides valuable insight into the underlying functions of the lateral meristem and how it can produce differences in the branching of tetraploid wheat spikes.<h4>Results</h4>Using an iTRAQ-based shotgun quantitation approach, 104 differential abundance proteins (DAPs) with < 1% false discovery rate (FDR) and a 1.5-fold change (> 1.50 or < 0.67) were identified by comparing FRS with NS and RS with NS genotypes. To determine the functions of the proteins, 38 co-expressed DAPs from the two groups were annotated using the Gene Ontology and Kyoto Encyclopedia of Genes and Genomes analytical tools. We discovered that proteins involved in "post-embryonic development" and "metabolic pathways" such as carbohydrate and nitrogen metabolism could be used to construct a developmentally associated network. Additionally, 6 out of 38 DAPs in the network were analyzed using quantitative real-time polymerase chain reaction, and the correlation coefficient between proteomics and qRT-PCR was 0.7005. These key genes and proteins were closely scrutinized and discussed.<h4>Conclusions</h4>Here, we predicted that DAPs involved in "post-embryonic development" and "metabolic pathways" may be responsible for the spikelete architecture changes in FRS and RS. Furthermore, we discussed the potential function of several vital DAPs from GO and KEGG analyses that were closely related to histone modification, ubiquitin-mediated protein degradation, transcription factors, carbohydrate and nitrogen metabolism and heat shock proteins (HSPs). This work provides valuable insight into the underlying functions of the lateral meristem in the branching of tetraploid wheat spikes.

Also flagged:CDC42BPAUTRNLHX61041RAP1GDS1CA IX
Journal Article 2018-04-02 ✓ 2 Snippets Bowler E, Porazinski S, Uzor S, Thibault P, Durand M, Lapointe E, Rouschop KMA, Hancock J, Wilson I, Ladomery M.
In-Text Gene Mentions

BTN2A2

…SYNE2, CDC42BPA, FGFR10P,BTN2A2, UTRN, RAP1GDS1, PTPN13,…

Show Full Abstract

<h4>Background</h4>Mounting evidence suggests that one of the ways that cells adapt to hypoxia is through alternative splicing. The aim of this study was firstly to examine the effect of hypoxia on the alternative splicing of cancer associated genes using the prostate cancer cell line PC3 as a model. Secondly, the effect of hypoxia on the expression of several regulators of splicing was examined.<h4>Methods</h4>PC3 cells were grown in 1% oxygen in a hypoxic chamber for 48 h, RNA extracted and sent for high throughput PCR analysis at the RNomics platform at the University of Sherbrooke, Canada. Genes whose exon inclusion rate PSI (ψ) changed significantly were identified, and their altered exon inclusion rates verified by RT-PCR in three cell lines. The expression of splice factors and splice factor kinases in response to hypoxia was examined by qPCR and western blotting. The splice factor kinase CLK1 was inhibited with the benzothiazole TG003.<h4>Results</h4>In PC3 cells the exon inclusion rate PSI (ψ) was seen to change by > 25% in 12 cancer-associated genes; MBP, APAF1, PUF60, SYNE2, CDC42BPA, FGFR10P, BTN2A2, UTRN, RAP1GDS1, PTPN13, TTC23 and CASP9 (caspase 9). The expression of the splice factors SRSF1, SRSF2, SRSF3, SAM68, HuR, hnRNPA1, and of the splice factor kinases SRPK1 and CLK1 increased significantly in hypoxia. We also observed that the splice factor kinase CLK3, but not CLK2 and CLK4, was also induced in hypoxic DU145 prostate, HT29 colon and MCF7 breast cancer cell lines. Lastly, we show that the inhibition of CLK1 in PC3 cells with the benzothiazole TG003 increased expression of the anti-apoptotic isoform caspase 9b.<h4>Conclusions</h4>Significant changes in alternative splicing of cancer associated genes occur in prostate cancer cells in hypoxic conditions. The expression of several splice factors and splice factor kinases increases during hypoxia, in particular the Cdc-like splice factor kinases CLK1 and CLK3. We suggest that in hypoxia the elevated expression of these regulators of splicing helps cells adapt through alternative splicing of key cancer-associated genes. We suggest that the CLK splice factor kinases could be targeted in cancers in which hypoxia contributes to resistance to therapy.

Also flagged:obesitytriglycerideCHST8CLIP1C6orf106KAT8
Journal Article 2018-04-02 No Snippets Baranski TJ, Kraja AT, Fink JL, Feitosa M, Lenzini PA, Borecki IB, Liu CT, Cupples LA, North KE, Province MA.
Show Full Abstract

Human GWAS of obesity have been successful in identifying loci associated with adiposity, but for the most part, these are non-coding SNPs whose function, or even whose gene of action, is unknown. To help identify the genes on which these human BMI loci may be operating, we conducted a high throughput screen in Drosophila melanogaster. Starting with 78 BMI loci from two recently published GWAS meta-analyses, we identified fly orthologs of all nearby genes (± 250KB). We crossed RNAi knockdown lines of each gene with flies containing tissue-specific drivers to knock down (KD) the expression of the genes only in the brain and the fat body. We then raised the flies on a control diet and compared the amount of fat/triglyceride in the tissue-specific KD group compared to the driver-only control flies. 16 of the 78 BMI GWAS loci could not be screened with this approach, as no gene in the 500-kb region had a fly ortholog. Of the remaining 62 GWAS loci testable in the fly, we found a significant fat phenotype in the KD flies for at least one gene for 26 loci (42%) even after correcting for multiple comparisons. By contrast, the rate of significant fat phenotypes in RNAi KD found in a recent genome-wide Drosophila screen (Pospisilik et al. (2010) is ~5%. More interestingly, for 10 of the 26 positive regions, we found that the nearest gene was not the one that showed a significant phenotype in the fly. Specifically, our screen suggests that for the 10 human BMI SNPs rs11057405, rs205262, rs9925964, rs9914578, rs2287019, rs11688816, rs13107325, rs7164727, rs17724992, and rs299412, the functional genes may NOT be the nearest ones (CLIP1, C6orf106, KAT8, SMG6, QPCTL, EHBP1, SLC39A8, ADPGK /ADPGK-AS1, PGPEP1, KCTD15, respectively), but instead, the specific nearby cis genes are the functional target (namely: ZCCHC8, VPS33A, RSRC2; SPDEF, NUDT3; PAGR1; SETD1, VKORC1; SGSM2, SRR; VASP, SIX5; OTX1; BANK1; ARIH1; ELL; CHST8, respectively). The study also suggests further functional experiments to elucidate mechanism of action for genes evolutionarily conserved for fat storage.

Also flagged:NACγ-tubulinβ-actinALKSTAT3Wnt
Journal Article 2018-04-02 ✓ 1 Snippet Wu C, Gupta N, Huang YH, Zhang HF, Alshareef A, Chow A, Lai R.
In-Text Gene Mentions

…euronal development, includingPOU3F2, SOX2 ,…

Show Full Abstract

<h4>Background</h4>The phenomenon that malignant cells can acquire stemness under specific stimuli, encompassed under the concept of cancer cell plasticity, has been well-described in epithelial malignancies. To our knowledge, cancer cell plasticity has not yet been described in hematopoietic cancers. To illustrate and study cancer cell plasticity in hematopoietic cancers, we employed an in-vitro experimental model of ALK-positive anaplastic large-cell lymphoma (ALK+ALCL) that is based on the phenotypic and functional dichotomy of these cells, with cells responsive to a Sox2 reporter (i.e. RR cells) being significantly more stem-like than those unresponsive to the reporter (i.e. RU cells).<h4>Methods</h4>H<sub>2</sub>O<sub>2</sub> was employed to trigger oxidative stress. GFP expression and luciferase activity, readouts of the Sox2 reporter activity, were quantified by using flow cytometry and luciferase activity assay, respectively. Doxorubicin-resistance and clonogenicity were assessed by using the MTS, methylcellulose colony formation and limiting dilution assays. Western blotting and quantitative PCR were used to assess the expression of various members of the Wnt/β-catenin pathway. Pull-down studies using a Sox2 binding consensus sequence were used to assess Sox2-DNA binding. Quercetin and 10074-G5 were used to inhibit β-catenin and MYC, respectively. siRNA was used to downregulate Sox2.<h4>Results</h4>Under H<sub>2</sub>O<sub>2</sub>-induced oxidative stress, a substantial fraction of RU cells was found to convert to RR cells, as evidenced by their acquisition of GFP expression and luciferase activity. Compared to the native RU cells, converted RR cells had significantly higher levels of doxorubicin-resistance, clonogenicity and sphere formation. Converted RR cells were characterized by an upregulation of the Wnt/β-catenin/MYC/Sox2 signaling axis, previously found to be the key regulator of the RU/RR dichotomy in ALK+ALCL. Furthermore, Sox2 was found to bind to DNA efficiently in converted RR cells but not RU cells, and this finding correlated with significant elevations of several Sox2 downstream targets such as WNT2B and BCL9. Lastly, inhibition of β-catenin, MYC or Sox2 in RU cells significantly abrogated the H<sub>2</sub>O<sub>2</sub>-induced RU/RR conversion.<h4>Conclusions</h4>We have demonstrated that cancer cell plasticity exists in ALK+ALCL, a type of hematopoietic cancer. In this cancer type, the Wnt/β-catenin/MYC/Sox2 axis is an important regulator of cancer cell plasticity.

Also flagged:hexanucleotidehereditary diseasesmyotonic dystrophy type 2Fuchs endothelial corneal dystrophyALSC9
Journal Article 2018-04-02 No Snippets Sznajder ŁJ, Thomas JD, Carrell EM, Reid T, Reid T, McFarland KN, Cleary JD, Oliveira R, Nutter CA, Bhatt K, Sobczak K, Ashizawa T, Thornton CA, Ranum LPW, Swanson MS.
Show Full Abstract

Expansions of simple sequence repeats, or microsatellites, have been linked to ∼30 neurological-neuromuscular diseases. While these expansions occur in coding and noncoding regions, microsatellite sequence and repeat length diversity is more prominent in introns with eight different trinucleotide to hexanucleotide repeats, causing hereditary diseases such as myotonic dystrophy type 2 (DM2), Fuchs endothelial corneal dystrophy (FECD), and <i>C9orf72</i> amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we test the hypothesis that these GC-rich intronic microsatellite expansions selectively trigger host intron retention (IR). Using DM2, FECD, and C9-ALS/FTD as examples, we demonstrate that retention is readily detectable in affected tissues and peripheral blood lymphocytes and conclude that IR screening constitutes a rapid and inexpensive biomarker for intronic repeat expansion disease.

Also flagged:synapsesynapsessynaptosomedegradationsynthesisisoflurane
Journal Article 2018-04-02 No Snippets Heo S, Diering GH, Na CH, Nirujogi RS, Bachman JL, Pandey A, Huganir RL.
Show Full Abstract

Memory formation is believed to result from changes in synapse strength and structure. While memories may persist for the lifetime of an organism, the proteins and lipids that make up synapses undergo constant turnover with lifetimes from minutes to days. The molecular basis for memory maintenance may rely on a subset of long-lived proteins (LLPs). While it is known that LLPs exist, whether such proteins are present at synapses is unknown. We performed an unbiased screen using metabolic pulse-chase labeling in vivo in mice and in vitro in cultured neurons combined with quantitative proteomics. We identified synaptic LLPs with half-lives of several months or longer. Proteins in synaptic fractions generally exhibited longer lifetimes than proteins in cytosolic fractions. Protein turnover was sensitive to pharmacological manipulations of activity in neuronal cultures or in mice exposed to an enriched environment. We show that synapses contain LLPs that may underlie stabile long-lasting changes in synaptic structure and function.

Also flagged:E2Ftranscription factorscell cycle checkpointcell cycleDNA repairSNI1
Journal Article 2018-04-02 ✓ 1 Snippet Wang L, Chen H, Chen H, Wang C, Hu Z, Yan S.
In-Text Gene Mentions

Condensin

Show Full Abstract

DNA damage poses a serious threat to genome integrity and greatly affects growth and development. To maintain genome stability, all organisms have evolved elaborate DNA damage response mechanisms including activation of cell cycle checkpoints and DNA repair. Here, we show that the DNA repair protein SNI1, a subunit of the evolutionally conserved SMC5/6 complex, directly links these two processes in <i>Arabidopsis</i> SNI1 binds to the activation domains of E2F transcription factors, the key regulators of cell cycle progression, and represses their transcriptional activities. In turn, E2Fs activate the expression of <i>SNI1</i>, suggesting that E2Fs and SNI1 form a negative feedback loop. Genetically, overexpression of SNI1 suppresses the phenotypes of E2F-overexpressing plants, and loss of E2F function fully suppresses the <i>sni1</i> mutant, indicating that SNI1 is necessary and sufficient to inhibit E2Fs. Altogether, our study revealed that SNI1 is a negative regulator of E2Fs and plays dual roles in DNA damage responses by linking cell cycle checkpoint and DNA repair.

Also flagged:liposarcomaWDmesenchymal tumorDDtumorsneochromosomes
Journal Article 2018-04-02 ✓ 2 Snippets Beird HC, Wu CC, Ingram DR, Wang WL, Alimohamed A, Gumbs C, Little L, Song X, Feig BW, Roland CL, Zhang J, Benjamin RS, Hwu P, Lazar AJ, Futreal PA, Somaiah N.
In-Text Gene Mentions

…TPTE2, KL, STARD13,PCDH17, SOX1, RB1, TSC22D1,…

…INTS6, PCDH9, andOLFM4, although this…

Show Full Abstract

Well-differentiated (WD) liposarcoma is a low-grade mesenchymal tumor with features of mature adipocytes and high propensity for local recurrence. Often, WD patients present with or later progress to a higher-grade nonlipogenic form known as dedifferentiated (DD) liposarcoma. These DD tumors behave more aggressively and can metastasize. Both WD and DD liposarcomas harbor neochromosomes formed from amplifications and rearrangements of Chr 12q that encode oncogenes (<i>MDM2</i>, <i>CDK4</i>, and <i>YEATS2)</i> and adipocytic differentiation factors (<i>HMGA2</i> and <i>CPM)</i> However, genomic changes associated with progression from WD to DD have not been well-defined. Therefore, we selected patients with matched WD and DD tumors for extensive genomic profiling in order to understand their clonal relationships and to delineate any defining alterations for each entity. Exome and transcriptomic sequencing was performed for 17 patients with both WD and DD diagnoses. Somatic point and copy-number alterations were integrated with transcriptional analyses to determine subtype-associated genomic features and pathways. The results were, on average, that only 8.3% of somatic mutations in WD liposarcoma were shared with their cognate DD component. DD tumors had higher numbers of somatic copy-number losses, amplifications involving Chr 12q, and fusion transcripts than WD tumors. <i>HMGA2</i> and <i>CPM</i> rearrangements occur more frequently in DD components. The shared somatic mutations indicate a clonal origin for matched WD and DD tumors and show early divergence with ongoing genomic instability due to continual generation and selection of neochromosomes. Stochastic generation and subsequent expression of fusion transcripts from the neochromosome that involve adipogenesis genes such as <i>HMGA2</i> and <i>CPM</i> may influence the differentiation state of the subsequent tumor.

Also flagged:Grnsex-chromosomeDMRF IIbinChromosome
Journal Article 2018-04-02 No Snippets Wei Y, Liang J, Zhang R, Guo Y, Shen S, Su L, Lin X, Moran S, Helland Å, Bjaanæs MM, Karlsson A, Planck M, Esteller M, Fleischer T, Staaf J, Zhao Y, Chen F, Christiani DC.
Show Full Abstract

<h4>Background</h4><i>KDM</i> lysine demethylase family members are related to lung cancer clinical outcomes and are potential biomarkers for chemotherapeutics. However, little is known about epigenetic alterations in <i>KDM</i> genes and their roles in lung cancer survival.<h4>Methods</h4>Tumor tissue samples of 1230 early-stage non-small cell lung cancer (NSCLC) patients were collected from the five independent cohorts. The 393 methylation sites in <i>KDM</i> genes were extracted from epigenome-wide datasets and analyzed by weighted random forest (Ranger) in discovery phase and validation dataset, respectively. The variable importance scores (VIS) for the sites in top 5% of both discovery and validation sets were carried forward for Cox regression to further evaluate the association with patient's overall survival. TCGA transcriptomic data were used to evaluate the correlation with the corresponding DNA methylation.<h4>Results</h4>DNA methylation at sites cg11637544 in <i>KDM2A</i> and cg26662347 in <i>KDM1A</i> were in the top 5% of VIS in both discovery phase and validation for squamous cell carcinomas (SCC), which were also significantly associated with SCC survival (<i>HR</i><sub>cg11637544</sub> = 1.32, 95%CI, 1.16-1.50, <i>P</i> = 1.1 × 10<sup>-4</sup>; <i>HR</i><sub>cg26662347</sub> = 1.88, 95%CI, 1.37-2.60, <i>P</i> = 3.7 × 10<sup>-3</sup>), and correlated with corresponding gene expression (cg11637544 for <i>KDM2A</i>, <i>P</i> = 1.3 × 10<sup>-10</sup>; cg26662347 for <i>KDM1A P</i> = 1.5 × 10<sup>-5</sup>). In addition, by using flexible criteria for Ranger analysis followed by survival classification tree analysis, we identified four clusters for adenocarcinomas and five clusters for squamous cell carcinomas which showed a considerable difference of clinical outcomes with statistical significance.<h4>Conclusions</h4>These findings highlight the association between somatic DNA methylation in <i>KDM</i> genes and early-stage NSCLC patient survival, which may reveal potential epigenetic therapeutic targets.

Also flagged:chromosomecancerscancerTP53squamous cancerschromosomes
Journal Article 2018-04-02 No Snippets Taylor AM, Shih J, Ha G, Gao GF, Zhang X, Berger AC, Schumacher SE, Wang C, Hu H, Liu J, Lazar AJ, Cancer Genome Atlas Research Network, Cherniack AD, Beroukhim R, Meyerson M.
Show Full Abstract

Aneuploidy, whole chromosome or chromosome arm imbalance, is a near-universal characteristic of human cancers. In 10,522 cancer genomes from The Cancer Genome Atlas, aneuploidy was correlated with TP53 mutation, somatic mutation rate, and expression of proliferation genes. Aneuploidy was anti-correlated with expression of immune signaling genes, due to decreased leukocyte infiltrates in high-aneuploidy samples. Chromosome arm-level alterations show cancer-specific patterns, including loss of chromosome arm 3p in squamous cancers. We applied genome engineering to delete 3p in lung cells, causing decreased proliferation rescued in part by chromosome 3 duplication. This study defines genomic and phenotypic correlates of cancer aneuploidy and provides an experimental approach to study chromosome arm aneuploidy.

Also flagged:EPIC1tumorscancerhypermethylationhypomethylationbreast cancer
Journal Article 2018-04-02 No Snippets Wang Z, Yang B, Zhang M, Guo W, Wu Z, Wang Y, Jia L, Li S, Cancer Genome Atlas Research Network, Xie W, Yang D.
Show Full Abstract

We characterized the epigenetic landscape of genes encoding long noncoding RNAs (lncRNAs) across 6,475 tumors and 455 cancer cell lines. In stark contrast to the CpG island hypermethylation phenotype in cancer, we observed a recurrent hypomethylation of 1,006 lncRNA genes in cancer, including EPIC1 (epigenetically-induced lncRNA1). Overexpression of EPIC1 is associated with poor prognosis in luminal B breast cancer patients and enhances tumor growth in vitro and in vivo. Mechanistically, EPIC1 promotes cell-cycle progression by interacting with MYC through EPIC1's 129-283 nt region. EPIC1 knockdown reduces the occupancy of MYC to its target genes (e.g., CDKN1A, CCNA2, CDC20, and CDC45). MYC depletion abolishes EPIC1's regulation of MYC target and luminal breast cancer tumorigenesis in vitro and in vivo.

Also flagged:cancerMLH1POLETumorshypermethylationGastrointestinal Adenocarcinomas
Journal Article 2018-04-02 ✓ 1 Snippet Liu Y, Sethi NS, Hinoue T, Schneider BG, Cherniack AD, Sanchez-Vega F, Seoane JA, Farshidfar F, Bowlby R, Islam M, Kim J, Chatila W, Akbani R, Kanchi RS, Rabkin CS, Willis JE, Wang KK, McCall SJ, Mishra L, Ojesina AI, Bullman S, Pedamallu CS, Lazar AJ, Sakai R, Cancer Genome Atlas Research Network, Thorsson V, Bass AJ, Laird PW.
In-Text Gene Mentions

OLFM4

Show Full Abstract

We analyzed 921 adenocarcinomas of the esophagus, stomach, colon, and rectum to examine shared and distinguishing molecular characteristics of gastrointestinal tract adenocarcinomas (GIACs). Hypermutated tumors were distinct regardless of cancer type and comprised those enriched for insertions/deletions, representing microsatellite instability cases with epigenetic silencing of MLH1 in the context of CpG island methylator phenotype, plus tumors with elevated single-nucleotide variants associated with mutations in POLE. Tumors with chromosomal instability were diverse, with gastroesophageal adenocarcinomas harboring fragmented genomes associated with genomic doubling and distinct mutational signatures. We identified a group of tumors in the colon and rectum lacking hypermutation and aneuploidy termed genome stable and enriched in DNA hypermethylation and mutations in KRAS, SOX9, and PCBP1.

Also flagged:GadoliniumCancertumorpositronsolid tumorsdeoxy
Journal Article 2018-04-01 ✓ 1 Snippet Muehe AM, Theruvath AJ, Lai L, Aghighi M, Quon A, Holdsworth SJ, Wang J, Luna-Fineman S, Marina N, Advani R, Rosenberg J, Daldrup-Link HE.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Purpose</h4>To provide clinically useful gadolinium-free whole-body cancer staging of children and young adults with integrated positron emission tomography/magnetic resonance (PET/MR) imaging in less than 1 h.<h4>Procedures</h4>In this prospective clinical trial, 20 children and young adults (11-30 years old, 6 male, 14 female) with solid tumors underwent 2-deoxy-2-[<sup>18</sup>F]fluoro-D-glucose ([<sup>18</sup>F]FDG) PET/MR on a 3T PET/MR scanner after intravenous injection of ferumoxytol (5 mg Fe/kg) and [<sup>18</sup>F]FDG (2-3 MBq/kg). Time needed for patient preparation, PET/MR image acquisition, and data processing was compared before (n = 5) and after (n = 15) time-saving interventions, using a Wilcoxon test. The ferumoxytol-enhanced PET/MR images were compared with clinical standard staging tests regarding radiation exposure and tumor staging results, using Fisher's exact tests.<h4>Results</h4>Tailored workflows significantly reduced scan times from 36 to 24 min for head to mid thigh scans (p < 0.001). These streamlined PET/MR scans were obtained with significantly reduced radiation exposure (mean 3.4 mSv) compared to PET/CT with diagnostic CT (mean 13.1 mSv; p = 0.003). Using the iron supplement ferumoxytol "off label" as an MR contrast agent avoided gadolinium chelate administration. The ferumoxytol-enhanced PET/MR scans provided equal or superior tumor staging results compared to clinical standard tests in 17 out of 20 patients. Compared to PET/CT, PET/MR had comparable detection rates for pulmonary nodules with diameters of equal or greater than 5 mm (94 vs. 100 %), yet detected significantly fewer nodules with diameters of less than 5 mm (20 vs 100 %) (p = 0.03). [<sup>18</sup>F]FDG-avid nodules were detected with slightly higher sensitivity on the PET of the PET/MR compared to the PET of the PET/CT (59 vs 49 %).<h4>Conclusion</h4>Our streamlined ferumoxytol-enhanced PET/MR protocol provided cancer staging of children and young adults in less than 1 h with equivalent or superior clinical information compared to clinical standard staging tests. The detection of small pulmonary nodules with PET/MR needs to be improved.

Also flagged:GliomaGliomasbrain tumorstumorstumorcytosine
Journal Article 2018-04-01 No Snippets Malta TM, de Souza CF, Sabedot TS, Silva TC, Mosella MS, Kalkanis SN, Snyder J, Castro AVB, Noushmehr H.
Show Full Abstract

Gliomas are a heterogeneous group of brain tumors with distinct biological and clinical properties. Despite advances in surgical techniques and clinical regimens, treatment of high-grade glioma remains challenging and carries dismal rates of therapeutic success and overall survival. Challenges include the molecular complexity of gliomas, as well as inconsistencies in histopathological grading, resulting in an inaccurate prediction of disease progression and failure in the use of standard therapy. The updated 2016 World Health Organization (WHO) classification of tumors of the central nervous system reflects a refinement of tumor diagnostics by integrating the genotypic and phenotypic features, thereby narrowing the defined subgroups. The new classification recommends molecular diagnosis of isocitrate dehydrogenase (IDH) mutational status in gliomas. IDH-mutant gliomas manifest the cytosine-phosphate-guanine (CpG) island methylator phenotype (G-CIMP). Notably, the recent identification of clinically relevant subsets of G-CIMP tumors (G-CIMP-high and G-CIMP-low) provides a further refinement in glioma classification that is independent of grade and histology. This scheme may be useful for predicting patient outcome and may be translated into effective therapeutic strategies tailored to each patient. In this review, we highlight the evolution of our understanding of the G-CIMP subsets and how recent advances in characterizing the genome and epigenome of gliomas may influence future basic and translational research.

Also flagged:PICALMAcute Lymphoblastic LeukemiaALL
Journal Article 2018-04-01 ✓ 5 Snippets Cannata E, Samperi P, Cimino C, Marino S, Sullo F, Mirabile E, Di Cataldo A, Russo G, Lo Nigro L.
In-Text Gene Mentions

We report on a young adult with a very late isolated extramedullary relapse of PICALM-MLLT10 positive T-ALL, successfully treated with a chemotherapy-based and radiotherapy-based pediatric protocol.

Successful Treatment of a Very Late Isolated Relapse in an Adolescent With a PICALM-MLLT10 Positive T-lineage Acute Lymphoblastic Leukemia.

We demonstrate that relapse can occur in T-ALL although a SR-MRD behavior treated with a high-risk protocol; specific molecular diagnostic aberrations, as PICALM-MLLT10, are still conserved at very late relapse; a second-line treatment based on pediatric protocol can be effective.

…Adolescent With a PICALM-MLLT10Positive T-lineage Acute…

…ramedullary relapse of PICALM-MLLT10positive T-ALL, successfully…

Show Full Abstract

T-lineage ALL is an aggressive disease that needs to be treated with intensive treatment schedules. A late relapse rarely occurs and a clear choice for second-line treatment is on debate. We report on a young adult with a very late isolated extramedullary relapse of PICALM-MLLT10 positive T-ALL, successfully treated with a chemotherapy-based and radiotherapy-based pediatric protocol. We demonstrate that relapse can occur in T-ALL although a SR-MRD behavior treated with a high-risk protocol; specific molecular diagnostic aberrations, as PICALM-MLLT10, are still conserved at very late relapse; a second-line treatment based on pediatric protocol can be effective.

Also flagged:chronic diseasesobesitycolorectal cancergoutkidney stonetype 2 diabetes
Journal Article 2018-04-01 ✓ 1 Snippet Song M, Zheng Y, Qi L, Hu FB, Chan AT, Giovannucci EL.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Background</h4>The genetic associations with trajectories of body fatness over the life course remain unknown.<h4>Methods</h4>We used a group-based modelling approach to identify trajectories of body fatness from age 5 years up to 65 for 7277 women from the Nurses' Health Study and 4645 men from the Health Professionals Follow-up Study. We created a genetic risk score (GRS) based on 97 variants associated with adulthood body mass index (BMI) and estimated its association with trajectories using logistic regression.<h4>Results</h4>We identified four distinct trajectories: lean-medium, medium-medium, lean-heavy and medium-heavy. The GRS increased across the four groups in that order (P < 0.001); 47% of women and 45% of men in the first decile of the GRS were in the lean-medium group, and these proportions reduced to 26% and 28%, respectively, for the highest decile. The corresponding proportions in the medium-heavy group were 8% and 5%, increasing to 21% and 14%, respectively. For women, compared with the odds of being in the lean-medium group, a 10-allele increment in the GRS was associated with a 40% [95% confidence interval (CI), 27-54%], 43% (30-58%), and 115% (91-143%) increase in the odds of being in the medium-medium, lean-heavy and medium-heavy groups, respectively. For men, the corresponding increases in the odds were 26% (12-42%), 27% (13-43%), and 81% (53-115%), respectively.<h4>Conclusions</h4>Individuals with genetic variants for adulthood BMI were more likely to maintain a heavy body shape and gain weight throughout life. These findings support a persistent effect of genetic variants on body fatness across the lifespan.

Also flagged:gene expressioncell growthcell differentiationdeathextracellularLgr5
Journal Article 2018-04-01 No Snippets Otsuka K, Suzuki K, Fujimichi Y, Tomita M, Iwasaki T.
Show Full Abstract

We previously found that high-dose-rate radiation induced a replenishment of the colonic Lgr5+ stem cell pool, whereas low-dose-rate radiation did not. To identify key molecules that determine the dose-rate effects on this stem cell pool, we harvested colonic Lgr5+ stem cells by cell sorting at 2 weeks after exposure to 1 Gy of high-dose-rate (30 Gy/h) or low-dose-rate (0.003 Gy/h) radiation and analyzed their gene expression profiles using RNA-Seq. We found that pathways related to DNA damage response, cell growth, cell differentiation and cell death were upregulated in Lgr5+ stem cells irradiated with high dose rates, whereas pathways related to apical junctions and extracellular signaling were upregulated in low-dose-rate-irradiated colonic Lgr5+ stem cells. Interestingly, biological events involving apical junctions are known to play an important role in the exclusion of transformed cells that are surrounded by normal epithelial cells through 'cell competition'. We speculated that cell competition, through apical junctions and extracellular ligands, might contribute to the dose-rate effect on Lgr5+ cell replenishment. To understand this mechanism, we focused on 69 genes that were significantly upregulated in low-dose-rate-irradiated cells, which we named DREDGE (Dose-Rate Effect Determining GEnes). Based on these findings, we propose a possible mechanism underlying the dose-rate effect observed in the colonic stem cell pool.

Also flagged:Crohn's diseaseRASGRP1SULF2XPO1ZBTB44HLA
Journal Article 2018-04-01 ✓ 2 Snippets Pernat Drobež C, Repnik K, Gorenjak M, Ferkolj I, Weersma RK, Potočnik U.
In-Text Gene Mentions

…near the geneCACNA1Eprogressed to the…

…near the geneCACNA1Ewith time to…

Show Full Abstract

<h4>Objective</h4>Most patients with Crohn's disease (CD) are diagnosed with the uncomplicated inflammatory form of the disease (Montreal stage B1). However, the majority of them will progress to complicated stricturing (B2) and penetrating (B3) CD during their lifetimes. The aim of our study was to identify the genetic factors associated with time to progression from uncomplicated to complicated CD.<h4>Patients and methods</h4>Patients with an inflammatory phenotype at diagnosis were followed up for 10 years. Genotyping was carried out using Illumina ImmunoChip. After quality control, association analyses, Bonferroni's adjustments, linear and Cox's regression, and Kaplan-Meier analysis were carried out for 111 patients and Manhattan plots were constructed.<h4>Results</h4>Ten years after diagnosis, 39.1% of the patients still had the inflammatory form and 60.9% progressed to complicated disease, with an average time to progression of 5.91 years. Ileal and ileocolonic locations were associated with the complicated CD (P=1.08E-03). We found that patients with the AA genotype at single-nucleotide polymorphism rs16857259 near the gene CACNA1E progressed to the complicated form later (8.80 years) compared with patients with the AC (5.11 years) or CC (2.00 years) genotypes (P=3.82E-07). In addition, nine single-nucleotide polymorphisms (near the genes RASGRP1, SULF2, XPO1, ZBTB44, HLA DOA/BRD2, HLA DRB1/HLA DQA1, PPARA, PUDP, and KIAA1614) showed a suggestive association with disease progression (P<10). Multivariate Cox's regression analysis on the basis of clinical and genetic data confirmed the association of the selected model with disease progression (P=5.73E-16).<h4>Conclusion</h4>Our study confirmed the association between the locus on chromosome 1 near the gene CACNA1E with time to progression from inflammatory to stricturing or penetrating CD. Predicting the time to progression is useful to the clinician in terms of individualizing patients' management.

Also flagged:ParaquatNeurotoxicityParkinson's diseaseironneurodegenerative diseasestyrosine hydroxylase
Journal Article 2018-04-01 ✓ 5 Snippets Nixon AM, Meadowcroft MD, Neely EB, Snyder AM, Purnell CJ, Wright J, Lamendella R, Nandar W, Huang X, Connor JR.
In-Text Gene Mentions

HFE Genotype Restricts the Response to Paraquat in a Mouse Model of Neurotoxicity.

Our results clearly demonstrate that the HFE genotype impacts the expression of tyrosine hydroxylase in the substantia nigra, the gut microbiome and the response to paraquat providing additional support that the HFE genotype is a disease modifier for Parkinson's disease.

…TheHFEprotein is critical…

…variant of theHFEgene as a…

…role of H63DHFEgenotype, we generated…

Show Full Abstract

Parkinson's disease is marked clinically by motor dysfunction and pathologically by dopaminergic cell loss in the substantia nigra and iron accumulation in the substantia nigra. The driver underlying iron accumulation remains unknown and could be genetic or environmental. The HFE protein is critical for the regulation of cellular iron uptake. Mutations within this protein are associated with increased iron accumulation including in the brain. We have focused on the commonly occurring H63D variant of the HFE gene as a disease modifier in a number of neurodegenerative diseases. To investigate the role of H63D HFE genotype, we generated a mouse model in which the wild-type (WT) HFE gene is replaced by the H67D gene variant (mouse homolog of the human H63D gene variant). Using paraquat toxicity as the model for Parkinson's disease, we found that WT mice responded as expected with significantly greater motor function, loss of tyrosine hydroxylase staining and increase microglial staining in the substantia nigra, and an increase in R<sub>2</sub> relaxation rate within the substantia nigra of the paraquat-treated mice compared to their saline-treated counterparts. In contrast, the H67D mice showed a remarkable resistance to paraquat treatment; specifically differing from the WT mice with no changes in motor function or changes in R<sub>2</sub> relaxation rates following paraquat exposure. At baseline, there were differences between the H67D HFE mice and WT mice in gut microbiome profile and increased L-ferritin staining in the substantia nigra that could account for the resistance to paraquat. Of particular note, the H67D HFE mice regardless of whether or not they were treated with paraquat had significantly less tyrosine hydroxylase immunostaining than WT. Our results clearly demonstrate that the HFE genotype impacts the expression of tyrosine hydroxylase in the substantia nigra, the gut microbiome and the response to paraquat providing additional support that the HFE genotype is a disease modifier for Parkinson's disease. Moreover, the finding that the HFE mutant mice are resistant to paraquat may provide a model in which to study resistant mechanisms to neurotoxicants.

Also flagged:Lhx8autophagytranscription factorextracellular matrix proteinsgene expressionestrus cycles
Journal Article 2018-04-01 No Snippets D'Ignazio L, Michel M, Beyer M, Thompson K, Forabosco A, Schlessinger D, Pelosi E.
Show Full Abstract

Following proliferation of oogonia in mammals, great numbers of germ cells are discarded, primarily by apoptosis, while the remainder form primordial follicles (the ovarian reserve) that determine fertility and reproductive lifespan. More massive, rapid, and essentially total loss of oocytes, however, occurs when the transcription factor Lhx8 is ablated-though the cause and mechanism of germ cell loss from the Lhx8-/- ovaries has been unknown. We found that Lhx8-/- ovaries maintain the same number of germ cells throughout embryonic development; rapid decrease in the pool of oocytes starts shortly before birth. The loss results from activation of autophagy, which becomes overwhelming within the first postnatal week, with extracellular matrix proteins filling the space previously occupied by follicles to produce a fibrotic ovary. Associated with this process, as early as a few days before birth, Lhx8-/- oocytes failed to repair DNA damage-which normally occurs when meiosis is initiated during embryonic development; and DNA damage repair genes were downregulated throughout the oocyte short lifespan. Based on gene expression analyses and morphological changes, we propose a model in which lineage-restricted failure of DNA repair triggers germ cell autophagy, causing premature depletion of the ovarian reserve in Lhx8-/- mice.

Also flagged:extracellularmetabolismexcretionactivitiesCYPsbosentan
Journal Article 2018-04-01 ✓ 1 Snippet Bell CC, Dankers ACA, Lauschke VM, Sison-Young R, Jenkins R, Rowe C, Goldring CE, Park K, Regan SL, Walker T, Schofield C, Baze A, Foster AJ, Williams DP, van de Ven AWM, Jacobs F, Houdt JV, Lähteenmäki T, Snoeys J, Juhila S, Richert L, Ingelman-Sundberg M.
In-Text Gene Mentions

…42-fold downregulation), andPRDX6(12- and 53-fold…

Show Full Abstract

Primary human hepatocytes (PHHs) are commonly used for in vitro studies of drug-induced liver injury. However, when cultured as 2D monolayers, PHH lose crucial hepatic functions within hours. This dedifferentiation can be ameliorated when PHHs are cultured in sandwich configuration (2Dsw), particularly when cultures are regularly re-overlaid with extracellular matrix, or as 3D spheroids. In this study, the 6 participating laboratories evaluated the robustness of these 2 model systems made from cryopreserved PHH from the same donors considering both inter-donor and inter-laboratory variability and compared their suitability for use in repeated-dose toxicity studies using 5 different hepatotoxins with different toxicity mechanisms. We found that expression levels of proteins involved in drug absorption, distribution, metabolism, and excretion, as well as catalytic activities of 5 different CYPs, were significantly higher in 3D spheroid cultures, potentially affecting the exposure of the cells to drugs and their metabolites. Furthermore, global proteomic analyses revealed that PHH in 3D spheroid configuration were temporally stable whereas proteomes from the same donors in 2Dsw cultures showed substantial alterations in protein expression patterns over the 14 days in culture. Overall, spheroid cultures were more sensitive to the hepatotoxic compounds investigated, particularly upon long-term exposures, across testing sites with little inter-laboratory or inter-donor variability. The data presented here suggest that repeated-dosing regimens improve the predictivity of in vitro toxicity assays, and that PHH spheroids provide a sensitive and robust system for long-term mechanistic studies of drug-induced hepatotoxicity, whereas the 2Dsw system has a more dedifferentiated phenotype and lower sensitivity to detect hepatotoxicity.

Also flagged:Serotonin5-hydroxytryptaminetryptophan hydroxylase 1TPH1serotonin transporterSERT
Journal Article 2018-04-01 ✓ 1 Snippet Kliman HJ, Quaratella SB, Setaro AC, Siegman EC, Subha ZT, Tal R, Milano KM, Steck TL.
In-Text Gene Mentions

…porter (serotonin transporter,5-HTT/SERT/SLC6A); other transporte…

Show Full Abstract

Serotonin [5-hydroxytryptamine (5-HT)] is essential to intrauterine development, but its source is debated. We used immunocytochemistry to gauge 5-HT, its biosynthetic enzyme tryptophan hydroxylase 1 (TPH1); an importer (serotonin transporter, 5-HTT/SERT/SLC6A); other transporters [P-glycoprotein 1 (P-gp/ABCB1), OCT3/SLC22A3, and gap junction connexin-43]; and the 5-HT degradative enzyme monoamine oxidase A (MAOA) in sections of placentas. In humans, 5-HT was faintly stained only in first-trimester trophoblasts, whereas TPH1 was not seen at any stage. SERT was expressed in syncytiotrophoblasts and, more strongly, in cytotrophoblasts. MAOA was prominent in syncytiotrophoblasts, OCT3 and gap junctions were stained in cytotrophoblasts, and P-gp was present at the apical surfaces of both epithelia. 5-HT added to cultured placental explants accumulated in the trophoblast epithelium and reached the villus core vessels. Trophoblast uptake was blocked by the SERT inhibitor escitalopram. Inhibition of gap junctions with heptanol prevented the accumulation of 5-HT in cytotrophoblasts, whereas blocking OCT3 with decynium-22 and P-gp with mitotane led to its accumulation in cytotrophoblasts. Reducing 5-HT destruction by inhibiting MAOA with clorgyline increased the accumulation of 5-HT throughout the villus. In the mouse fetus, intravascular platelets stained prominently for 5-HT at day 13.5, whereas the placenta and yolk sac endoderm were both negative. TPH1 was not detected, but SERT was prominent in these mouse tissues. We conclude that serotonin is conveyed from the maternal blood stream through syncytiotrophoblasts, cytotrophoblasts and the villus core to the fetus through a physiological pathway that involves at least SERT, gap junctions, P-gp, OCT3, and MAOA.

Also flagged:response to uprightspondylolysispathogenesisScoliosisphotonto
Journal Article 2018-04-01 No Snippets Gilsanz V, Wren TAL, Ponrartana S, Mora S, Rosen CJ.
Show Full Abstract

Recent observations indicate that the cross-sectional area (CSA) of vertebral bodies is on average 10% smaller in healthy newborn girls than in newborn boys, a striking difference that increases during infancy and puberty and is greatest by the time of sexual and skeletal maturity. The smaller CSA of female vertebrae is associated with greater spinal flexibility and could represent the human adaptation to fetal load in bipedal posture. Unfortunately, it also imparts a mechanical disadvantage that increases stress within the vertebrae for all physical activities. This review summarizes the potential endocrine, genetic, and environmental determinants of vertebral cross-sectional growth and current knowledge of the association between the small female vertebrae and greater risk for a broad array of spinal conditions across the lifespan.

Also flagged:FANCD2aphidicolinchromatinlocalizationRPAAPH
Journal Article 2018-04-01 No Snippets Okamoto Y, Iwasaki WM, Kugou K, Takahashi KK, Oda A, Sato K, Kobayashi W, Kawai H, Sakasai R, Takaori-Kondo A, Yamamoto T, Kanemaki MT, Taoka M, Isobe T, Kurumizaka H, Innan H, Ohta K, Ishiai M, Takata M.
Show Full Abstract

During mild replication stress provoked by low dose aphidicolin (APH) treatment, the key Fanconi anemia protein FANCD2 accumulates on common fragile sites, observed as sister foci, and protects genome stability. To gain further insights into FANCD2 function and its regulatory mechanisms, we examined the genome-wide chromatin localization of FANCD2 in this setting by ChIP-seq analysis. We found that FANCD2 mostly accumulates in the central regions of a set of large transcribed genes that were extensively overlapped with known CFS. Consistent with previous studies, we found that this FANCD2 retention is R-loop-dependent. However, FANCD2 monoubiquitination and RPA foci formation were still induced in cells depleted of R-loops. Interestingly, we detected increased Proximal Ligation Assay dots between FANCD2 and R-loops following APH treatment, which was suppressed by transcriptional inhibition. Collectively, our data suggested that R-loops are required to retain FANCD2 in chromatin at the middle intronic region of large genes, while the replication stress-induced upstream events leading to the FA pathway activation are not triggered by R-loops.

Also flagged:GATA4TCF7L2chromatinheart failureWntcell cycling
Journal Article 2018-04-01 ✓ 1 Snippet Iyer LM, Nagarajan S, Woelfer M, Schoger E, Khadjeh S, Zafiriou MP, Kari V, Herting J, Pang ST, Weber T, Rathjens FS, Fischer TH, Toischer K, Hasenfuss G, Noack C, Johnsen SA, Zelarayán LC.
In-Text Gene Mentions

…Smad3, Myom2, Sox4,Sox6, Tbx20, Ror2, Tead1…

Show Full Abstract

Chromatin remodelling precedes transcriptional and structural changes in heart failure. A body of work suggests roles for the developmental Wnt signalling pathway in cardiac remodelling. Hitherto, there is no evidence supporting a direct role of Wnt nuclear components in regulating chromatin landscapes in this process. We show that transcriptionally active, nuclear, phosphorylated(p)Ser675-β-catenin and TCF7L2 are upregulated in diseased murine and human cardiac ventricles. We report that inducible cardiomyocytes (CM)-specific pSer675-β-catenin accumulation mimics the disease situation by triggering TCF7L2 expression. This enhances active chromatin, characterized by increased H3K27ac and TCF7L2 occupancies to cardiac developmental and remodelling genes in vivo. Accordingly, transcriptomic analysis of β-catenin stabilized hearts shows a strong recapitulation of cardiac developmental processes like cell cycling and cytoskeletal remodelling. Mechanistically, TCF7L2 co-occupies distal genomic regions with cardiac transcription factors NKX2-5 and GATA4 in stabilized-β-catenin hearts. Validation assays revealed a previously unrecognized function of GATA4 as a cardiac repressor of the TCF7L2/β-catenin complex in vivo, thereby defining a transcriptional switch controlling disease progression. Conversely, preventing β-catenin activation post-pressure-overload results in a downregulation of these novel TCF7L2-targets and rescues cardiac function. Thus, we present a novel role for TCF7L2/β-catenin in CMs-specific chromatin modulation, which could be exploited for manipulating the ubiquitous Wnt pathway.

Also flagged:erythropoiesisγ-globinβ-globinsickle cell diseaseβ-thalassemiagenetic disorders
Journal Article 2018-04-01 ✓ 1 Snippet Lessard S, Beaudoin M, Orkin SH, Bauer DE, Lettre G.
In-Text Gene Mentions

SOX6

Show Full Abstract

In humans, fetal erythropoiesis takes place in the liver whereas adult erythropoiesis occurs in the bone marrow. Fetal and adult erythroid cells are not only produced at different sites, but are also distinguished by their respective transcriptional program. In particular, whereas fetal erythroid cells express γ-globin chains to produce fetal hemoglobin (HbF), adult cells express β-globin chains to generate adult hemoglobin. Understanding the transcriptional regulation of the fetal-to-adult hemoglobin switch is clinically important as re-activation of HbF production in adult erythroid cells would represent a promising therapy for the hemoglobin disorders sickle cell disease and β-thalassemia. We used RNA-sequencing to measure global gene and microRNA (miRNA) expression in human erythroblasts derived ex vivo from fetal liver (n = 12 donors) and bone marrow (n = 12 donors) hematopoietic stem/progenitor cells. We identified 7829 transcripts and 402 miRNA that were differentially expressed (false discovery rate <5%). The miRNA expression patterns were replicated in an independent collection of human erythroblasts using a different technology. By combining gene and miRNA expression data, we developed transcriptional networks which show substantial differences between fetal and adult human erythroblasts. Our analyses highlighted the miRNAs at the imprinted 14q32 locus in fetal erythroblasts and the let-7 miRNA family in adult erythroblasts as key regulators of stage-specific erythroid transcriptional programs. Altogether, our results provide a comprehensive resource to prioritize genes that may modify clinical severity in red blood cell (RBC) disorders, or genes that might be implicated in erythropoiesis by genome-wide association studies of RBC traits.

Also flagged:transcription factorsgene expressionmusculoskeletal disordersfracture healingdiabetessteroid
Journal Article 2018-04-01 ✓ 1 Snippet Roberts JL, Paglia DN, Drissi H.
In-Text Gene Mentions

Sox6

Show Full Abstract

<h4>Purpose of review</h4>Growing evidence supports the critical role of transcriptional mechanisms in promoting the spatial and temporal progression of bone healing. In this review, we evaluate and discuss new transcriptional and post-transcriptional regulatory mechanisms of secondary bone repair, along with emerging evidence for epigenetic regulation of fracture healing.<h4>Recent findings</h4>Using the candidate gene approach has identified new roles for several transcription factors in mediating the reactive, reparative, and remodeling phases of fracture repair. Further characterization of the different epigenetic controls of fracture healing and fracture-driven transcriptome changes between young and aged fracture has identified key biological pathways that may yield therapeutic targets. Furthermore, exogenously delivered microRNA to post-transcriptionally control gene expression is quickly becoming an area with great therapeutic potential. Activation of specific transcriptional networks can promote the proper progression of secondary bone healing. Targeting these key factors using small molecules or through microRNA may yield effective therapies to enhance and possibly accelerate fracture healing.

Also flagged:serotoninpulmonary hypertensionsynthesispulmonary arterial hypertensionaminorexfenfluramine
Journal Article 2018-04-01 ✓ 2 Snippets MacLean MMR.
In-Text Gene Mentions

The serotonin transporter (SERT or 5-HTT) is a monoamine transporter protein that transports serotonin into cells.

…transporter (SERT or5-HTT) is a monoamine…

Show Full Abstract

Increased synthesis of serotonin and/or activity of serotonin in pulmonary arteries has been implicated in the pathobiology of pulmonary arterial hypertension (PAH). The incidence of PAH associated with diet pills such as aminorex, fenfluramine, and chlorphentermine initially led to the "serotonin hypothesis of pulmonary hypertension." Over the last couple of decades there has been an accumulation of convincing evidence that targeting serotonin synthesis or signaling is a novel and promising approach to the development of novel therapies for PAH. Pulmonary endothelial serotonin synthesis via tryptophan hydroxlase 1 (TPH1) is increased in patients with PAH and serotonin can act in a paracrine fashion on underlying pulmonary arterial smooth muscle cells (PASMCs), In humans, serotonin can enter PASMCs via the serotonin transporter (SERT) or activate the 5-HT1B receptor; 5-HT1B activation and SERT activity cooperate to induce PASMC contraction and proliferation via activation of downstream proliferative and contractile signaling pathways. Here we will review the current status of the serotonin hypothesis and discuss potential and novel therapeutic targets.

Also flagged:Macular EdemaVEGFRetinal Vein OcclusioncentralbevacizumabVascular Endothelial Growth Factor
Journal Article 2018-04-01 No Snippets Scott IU, VanVeldhuisen PC, Ip MS, Blodi BA, Oden NL, Altaweel M, Berinstein DM, SCORE2 Investigator Group.
Show Full Abstract

<h4>Importance</h4>Comparisons of monthly vs treat-and-extend anti-vascular endothelial growth factor (anti-VEGF) regimens for macular edema from central retinal vein occlusion or hemiretinal vein occlusion is needed.<h4>Objective</h4>To compare visual acuity letter score and central subfield thickness outcomes of participants in the Study of Comparative Treatments for Retinal Vein Occlusion 2 (SCORE2) trial who then received either monthly injections or treat-and-extend (TAE) regimens of aflibercept or bevacizumab after a good response at month 6.<h4>Design, setting, and participants</h4>This randomized clinical trial enrolled participants from 66 private practice or academic centers in the United States. All participants had macular edema associated with central retinal vein occlusion or hemiretinal vein occlusion, had enrolled in the SCORE2 trial, and had a protocol-defined good response to monthly injections in the first 6 months of the trial. Participants initially assigned to receive monthly aflibercept were randomized to aflibercept on a monthly or TAE schedule, and participants initially assigned to receive monthly injections of bevacizumab were randomized to receive bevacizumab on a monthly or TAE schedule. The first participant was randomized in the SCORE2 trial on September 17, 2014, and the last month 12 visit occurred on October 24, 2016.<h4>Main outcomes and measures</h4>Change from month 6 to month 12 in best-corrected electronic visual acuity letter score (per the Early Treatment Diabetic Retinopathy Study).<h4>Results</h4>The 293 participants had a mean (SD) age of 68.9 (11.9) years; 127 (43.3%) were female. Of these, 79 were randomized to aflibercept on a monthly schedule, 80 to aflibercept on a TAE schedule, 67 to monthly bevacizumab, and 67 to bevacizumab on a TAE schedule. Mean treatment group difference (the change in visual acuity letter score in the monthly group minus the change in the TAE group) from month 6 to month 12 was 1.88 (97.5% CI, -1.07 to 4.83; P = .15) for aflibercept and 1.98 (97.5% CI, -1.08 to 5.03; P = .15) for bevacizumab. In the aflibercept arm, the mean number of injections between months 6 and 11 was 5.8 in the monthly injection group (95% CI, 5.6 to 5.9) and 3.8 in the TAE group (95% CI, 3.5 to 4.1; P < .001); in the bevacizumab arm, the mean number of injections was 5.8 (95% CI, 5.6 to 5.9) in the monthly group and 4.5 in the TAE group (95% CI, 4.2 to 4.8; P < .001).<h4>Conclusions and relevance</h4>One to 2 fewer injections of aflibercept or bevacizumab were given to the TAE groups than the monthly groups in months 6 to 12 for macular edema associated with central retinal or hemiretinal vein occlusion. Because of wide confidence intervals on the differences between the groups, caution is warranted before concluding that the regimens are associated with similar vision outcomes.<h4>Trial registration</h4>www.clinicaltrials.gov identifier: NCT01969708.

Also flagged:transporterpsychiatric disordersschizophreniadepressiondopamineserotonin
Journal Article 2018-04-01 No Snippets Farde L, Plavén-Sigray P, Borg J, Cervenka S.
Show Full Abstract

Positron emission tomography has, for 30 years, been used in numerous case-control studies searching for hypothesized differences in the density of neuroreceptor or transporter proteins in psychiatric disorders such as schizophrenia and depression. In most cases, the results have not been conclusive. One reason could be the sizeable interindividual variability in biochemical markers, which in twin studies have shown to emanate from both environmental and genetic factors, leading to low statistical power for the detection of group effects. On the other hand, the same interindividual variability has served as an opportunity for correlative studies on the biological underpinning of behaviour. Using this approach, a series of studies has linked markers for the dopamine and serotonin system to personality traits associated with psychiatric conditions. Based on increasing evidence for the view that many psychopathological states represent extremes of a continuum rather than distinct categories, this research strategy may lead to new biological insights about the vulnerability to and pathophysiology of major psychiatric disorders.This article is part of the theme issue 'Diverse perspectives on diversity: multi-disciplinary approaches to taxonomies of individual differences'.

Also flagged:gene expressionCNE19MEF2Cβ-globinβ-thalassemia
Journal Article 2018-04-01 ✓ 5 Snippets Madelaine R, Notwell JH, Skariah G, Halluin C, Chen CC, Bejerano G, Mourrain P.
In-Text Gene Mentions

…meis2a andsox6ORFs were cloned…

…and CNE18 (SOX6) ( Supplementary…

…known domains ofsox6expression (brain, retina…

…the trunk, wheresox6mRNA is also…

…LBX1 and CNE18/SOX6).…

Show Full Abstract

Thousands of human disease-associated single nucleotide polymorphisms (SNPs) lie in the non-coding genome, but only a handful have been demonstrated to affect gene expression and human biology. We computationally identified risk-associated SNPs in deeply conserved non-exonic elements (CNEs) potentially contributing to 45 human diseases. We further demonstrated that human CNE1/rs17421627 associated with retinal vasculature defects showed transcriptional activity in the zebrafish retina, while introducing the risk-associated allele completely abolished CNE1 enhancer activity. Furthermore, deletion of CNE1 led to retinal vasculature defects and to a specific downregulation of microRNA-9, rather than MEF2C as predicted by the original genome-wide association studies. Consistent with these results, miR-9 depletion affects retinal vasculature formation, demonstrating MIR-9-2 as a critical gene underpinning the associated trait. Importantly, we validated that other CNEs act as transcriptional enhancers that can be disrupted by conserved non-coding SNPs. This study uncovers disease-associated non-coding mutations that are deeply conserved, providing a path for in vivo testing to reveal their cis-regulated genes and biological roles.

Also flagged:Pancreatic Neuroendocrine TumorPanNETtumorspathogenesistumorDAXX
Journal Article 2018-04-01 ✓ 1 Snippet Martin DR, LaBauve E, Pomo JM, Chiu VK, Hanson JA, Gullapalli RR.
In-Text Gene Mentions

RABGAP1L

Show Full Abstract

The major categories of pancreatic neuroendocrine tumor (PanNET) are well-differentiated NET and poorly differentiated neuroendocrine carcinoma. Sequencing of these tumors has identified multiple important genes in the pathogenesis of PanNETs, such as DAXX/ATRX, MEN1, TP53, RB, and mTOR pathway genes. We identified a case of well-differentiated PanNET with high-grade progression with simultaneous low- and high-grade histologic regions containing variable genomic profiles. We performed tumor microdissection and analyzed both regions using a 409-gene comprehensive cancer panel using next-generation sequencing in addition to immunohistochemical and morphologic studies. The low-grade region showed a change in the DAXX gene as a copy number variant (CNV) deletion. The high-grade region showed CNV deletion changes in the DAXX gene as well as the MEN1 gene. We observed additional mutational changes in the PTEN gene and SMAD4 gene in the high-grade region. Our data support that high-grade progression in PanNETs may be the result of the progressive accumulation of genetic changes (CNVs and point mutational changes) within the body of the tumor. Next generation sequencing may provide pathologists and clinicians with ancillary information to accurately characterize and treat these tumors.

Also flagged:cardiomyopathiesinfiltrative cardiomyopathiesextracardiac diseasesFriedreich Ataxianeurodegenerative disorderhearing
Journal Article 2018-04-01 No Snippets Sweet ME, Mestroni L, Taylor MRG.
Show Full Abstract

Infiltrative cardiomyopathies are characterized by abnormal accumulation or deposition of substances in cardiac tissue leading to cardiac dysfunction. These can be inherited, resulting from mutations in specific genes, which engender a diverse array of extracardiac features but overlapping cardiac phenotypes. This article provides an overview of each inherited infiltrative cardiomyopathy, describing the causative genes, the pathologic mechanisms involved, the resulting cardiac manifestations, and the therapies currently offered or being developed.

Also flagged:lactatemetabolismHuntington's diseaseHDmonocarboxylatesascorbic acid
Journal Article 2018-04-01 ✓ 1 Snippet Solís-Maldonado M, Miró MP, Acuña AI, Covarrubias-Pinto A, Loaiza A, Mayorga G, Beltrán FA, Cepeda C, Levine MS, Concha II, Bátiz LF, Carrasco MA, Castro MA.
In-Text Gene Mentions

Htt

Show Full Abstract

<h4>Aims</h4>Huntington's disease (HD) is a neurodegenerative disorder characterized by progressive abnormalities in cognitive function, mental state, and motor control. HD is characterized by a failure in brain energy metabolism. It has been proposed that monocarboxylates, such as lactate, support brain activity. During neuronal synaptic activity, ascorbic acid released from glial cells stimulates lactate and inhibits glucose transport. The aim of this study was to evaluate the expression and function of monocarboxylate transporters (MCTs) in two HD models.<h4>Methods</h4>Using immunofluorescence, qPCR, and Western blot analyses, we explored mRNA and protein levels of MCTs in the striatum of R6/2 animals and HdhQ7/111 cells. We also evaluated MCT function in HdhQ7/111 cells using radioactive tracers and the fluorescent lactate sensor Laconic.<h4>Results</h4>We found no significant differences in the mRNA or protein levels of neuronal MCTs. Functional analyses revealed that neuronal MCT2 had a high catalytic efficiency in HD cells. Ascorbic acid did not stimulate lactate uptake in HD cells. Ascorbic acid was also unable to inhibit glucose transport in HD cells because they exhibit decreased expression of the neuronal glucose transporter GLUT3.<h4>Conclusion</h4>We demonstrate that stimulation of lactate uptake by ascorbic acid is a consequence of inhibiting glucose transport. Supporting this, lactate transport stimulation by ascorbic acid in HD cells was completely restored by overexpressing GLUT3. Therefore, alterations in GLUT3 expression could be responsible for inefficient use of lactate in HD neurons, contributing to the metabolic failure observed in HD.

Also flagged:γ-globintranscriptional repressorsHPFHbindingBCL11AZBTB7A
Journal Article 2018-04-01 No Snippets Wang X, Thein SL.
Show Full Abstract

No abstract available.

Also flagged:genetic disordershereditary hemochromatosisnucleotidemalignant hyperthermiamultiple endocrine neoplasia type 1hereditary paraganglioma-pheochromocytoma syndrome
Journal Article 2018-04-01 ✓ 1 Snippet Shah N, Hou YC, Yu HC, Sainger R, Caskey CT, Venter JC, Telenti A.
In-Text Gene Mentions

HFE

Show Full Abstract

There is a significant interest in the standardized classification of human genetic variants. We used whole-genome sequence data from 10,495 unrelated individuals to contrast population frequency of pathogenic variants to the expected population prevalence of the disease. Analyses included the ACMG-recommended 59 gene-condition sets for incidental findings and 463 genes associated with 265 OrphaNet conditions. A total of 25,505 variants were used to identify patterns of inflation (i.e., excess genetic risk and misclassification). Inflation increases as the level of evidence supporting the pathogenic nature of the variant decreases. We observed up to 11.5% of genetic disorders with inflation in pathogenic variant sets and up to 92.3% for the variant set with conflicting interpretations. This improved to 7.7% and 57.7%, respectively, after filtering for disease-specific allele frequency. The patterns of inflation were replicated using public data from more than 138,000 genomes. The burden of rare variants was a main contributing factor of the observed inflation, indicating collective misclassified rare variants. We also analyzed the dynamics of re-classification of variant pathogenicity in ClinVar over time, which indicates progressive improvement in variant classification. The study shows that databases include a significant proportion of wrongly ascertained variants; however, it underscores the critical role of ClinVar to contrast claims and foster validation across submitters.

Also flagged:CancertumortumorsPD-1PD-L1Cancers
Journal Article 2018-04-01 ✓ 1 Snippet Bailey MH, Tokheim C, Porta-Pardo E, Sengupta S, Bertrand D, Weerasinghe A, Colaprico A, Wendl MC, Kim J, Reardon B, Ng PK, Jeong KJ, Cao S, Wang Z, Gao J, Gao Q, Wang F, Liu EM, Mularoni L, Rubio-Perez C, Nagarajan N, Cortés-Ciriano I, Zhou DC, Liang WW, Hess JM, Yellapantula VD, Tamborero D, Gonzalez-Perez A, Suphavilai C, Ko JY, Khurana E, Park PJ, Van Allen EM, Liang H, MC3 Working Group, Cancer Genome Atlas Research Network, Lawrence MS, Godzik A, Lopez-Bigas N, Stuart J, Wheeler D, Getz G, Chen K, Lazar AJ, Mills GB, Karchin R, Ding L.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

Identifying molecular cancer drivers is critical for precision oncology. Multiple advanced algorithms to identify drivers now exist, but systematic attempts to combine and optimize them on large datasets are few. We report a PanCancer and PanSoftware analysis spanning 9,423 tumor exomes (comprising all 33 of The Cancer Genome Atlas projects) and using 26 computational tools to catalog driver genes and mutations. We identify 299 driver genes with implications regarding their anatomical sites and cancer/cell types. Sequence- and structure-based analyses identified >3,400 putative missense driver mutations supported by multiple lines of evidence. Experimental validation confirmed 60%-85% of predicted mutations as likely drivers. We found that >300 MSI tumors are associated with high PD-1/PD-L1, and 57% of tumors analyzed harbor putative clinically actionable events. Our study represents the most comprehensive discovery of cancer genes and mutations to date and will serve as a blueprint for future biological and clinical endeavors.

Also flagged:RAB11AmembranedautophagosomesLC3membranesphosphatidylinositol
Journal Article 2018-04-01 No Snippets Puri C, Vicinanza M, Ashkenazi A, Gratian MJ, Zhang Q, Bento CF, Renna M, Menzies FM, Rubinsztein DC.
Show Full Abstract

Autophagy is a critical pathway that degrades intracytoplasmic contents by engulfing them in double-membraned autophagosomes that are conjugated with LC3 family members. These membranes are specified by phosphatidylinositol 3-phosphate (PI3P), which recruits WIPI2, which, in turn, recruits ATG16L1 to specify the sites of LC3-conjugation. Conventionally, phosphatidylinositides act in concert with other proteins in targeting effectors to specific membranes. Here we describe that WIPI2 localizes to autophagic precursor membranes by binding RAB11A, a protein that specifies recycling endosomes, and that PI3P is formed on RAB11A-positive membranes upon starvation. Loss of RAB11A impairs the recruitment and assembly of the autophagic machinery. RAB11A-positive membranes are a primary direct platform for canonical autophagosome formation that enables autophagy of the transferrin receptor and damaged mitochondria. While this compartment may receive membrane inputs from other sources to enable autophagosome biogenesis, RAB11A-positive membranes appear to be a compartment from which autophagosomes evolve.

Also flagged:MethylationGliomaglioblastomasglioblastomaIDHdiffuse gliomas
Journal Article 2018-04-01 ✓ 1 Snippet de Souza CF, Sabedot TS, Malta TM, Stetson L, Morozova O, Sokolov A, Laird PW, Wiznerowicz M, Iavarone A, Snyder J, deCarvalho A, Sanborn Z, McDonald KL, Friedman WA, Tirapelli D, Poisson L, Mikkelsen T, Carlotti CG, Kalkanis S, Zenklusen J, Salama SR, Barnholtz-Sloan JS, Noushmehr H.
In-Text Gene Mentions

…enrichment = 1.49),SOX6(geometric test, q…

Show Full Abstract

Glioma diagnosis is based on histomorphology and grading; however, such classification does not have predictive clinical outcome after glioblastomas have developed. To date, no bona fide biomarkers that significantly translate into a survival benefit to glioblastoma patients have been identified. We previously reported that the IDH mutant G-CIMP-high subtype would be a predecessor to the G-CIMP-low subtype. Here, we performed a comprehensive DNA methylation longitudinal analysis of diffuse gliomas from 77 patients (200 tumors) to enlighten the epigenome-based malignant transformation of initially lower-grade gliomas. Intra-subtype heterogeneity among G-CIMP-high primary tumors allowed us to identify predictive biomarkers for assessing the risk of malignant recurrence at early stages of disease. G-CIMP-low recurrence appeared in 9.5% of all gliomas, and these resembled IDH-wild-type primary glioblastoma. G-CIMP-low recurrence can be characterized by distinct epigenetic changes at candidate functional tissue enhancers with AP-1/SOX binding elements, mesenchymal stem cell-like epigenomic phenotype, and genomic instability. Molecular abnormalities of longitudinal G-CIMP offer possibilities to defy glioblastoma progression.

Also flagged:Ironiron oxidecarbon dioxidewaterisofluranecarprofen
Journal Article 2018-04-01 ✓ 1 Snippet Gorman AW, Deh KM, Schwiedrzik CM, White JR, Groman EV, Fisher CA, Gillen KM, Spincemaille P, Rasmussen S, Prince MR, Voss HU, Freiwald WA, Wang Y.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The purpose of this study is to determine the effects of high cumulative doses of ultra-small paramagnetic iron oxide (USPIO) used in neuroimaging studies. We intravenously administered 8 mg/kg of 2 USPIO compounds daily for 4 wk to male Sprague-Dawley rats (Crl:SD). Multiecho gradient-echo MRI, serum iron levels, and histology were performed at the end of dosing and after a 7-d washout period. R2* maps and quantitative susceptibility maps (QSM) were generated from multiecho gradient-echo data. R2* maps and QSM showed iron accumulation in brain ventricles on MR images acquired at the 4- and 5-wk time points. Estimates from QSM data showed ventricular iron concentration was equal to or higher than serum iron concentration. Histologic analysis revealed choroid plexus hemosiderosis and midbrain vacuolation, without iron deposition in brain parenchyma. Serum iron levels increased with administration of both compounds, and a 7-d washout period effectively reduced serum iron levels of one but not both of the compounds. High cumulative doses from multiple, frequent administrations of USPIO can lead to iron deposition in brain ventricles, resulting in persistent signal loss on T2*-weighted images. Techniques such as QSM are helpful in quantifying iron biodistribution in this situation.

Also flagged:Huntington diseaseHDcognitive impairmenttranslationalpolyubiquitin Cketamine
Journal Article 2018-04-01 ✓ 1 Snippet Hunter CE, Pongos AL, Chi TY, Payne C, Stroud FC, Chan AWS.
In-Text Gene Mentions

HTT

Show Full Abstract

The neurodegeneration associated with Huntington disease (HD) leads to the onset of motor and cognitive impairment and their advancement with increased age in humans. In children at risk for HD, body measurement growth abnormalities include a reduction in BMI, weight, height, and head circumference. The transgenic HD NHP model was first reported in 2008, and progressive decline in cognitive behaviors and motor impairment have been reported. This study focuses on longitudinal body measurements in HD macaques from infancy through adulthood. The growth of HD macaques was assessed through head circumference, sagittal and transverse head, and crown-to-rump ('height') measurements and BMI. The animals were measured monthly from 0 to 72 mo of age and every 3 mo from 72 mo of age onward. A mixed-effect model was used to assess subject-specific effects in our nonlinear serial data. Compared with WT controls, HD macaques displayed different developmental trajectories characterized by increased BMI, head circumference, and sagittal head measurements beginning around 40 mo of age. The physiologic comparability between NHP and humans underscores the translational utility of our HD macaques to evaluate growth and developmental patterns associated with HD.

Also flagged:RXFP2matingagarosepolymerasenucleotidephenol
Journal Article 2018-04-01 ✓ 1 Snippet Pan Z, Li S, Liu Q, Wang Z, Zhou Z, Di R, Miao B, Hu W, Wang X, Hu X, Xu Z, Wei D, He X, Yuan L, Guo X, Liang B, Wang R, Li X, Cao X, Dong X, Xia Q, Shi H, Hao G, Yang J, Luosang C, Zhao Y, Jin M, Zhang Y, Lv S, Li F, Ding G, Chu M, Li Y.
In-Text Gene Mentions

…(2) SMNDC1 andSOX6involved in muscle…

Show Full Abstract

<h4>Background</h4>Animal domestication has been extensively studied, but the process of feralization remains poorly understood.<h4>Results</h4>Here, we performed whole-genome sequencing of 99 sheep and identified a primary genetic divergence between 2 heterogeneous populations in the Tibetan Plateau, including 1 semi-feral lineage. Selective sweep and candidate gene analysis revealed local adaptations of these sheep associated with sensory perception, muscle strength, eating habit, mating process, and aggressive behavior. In particular, a horn-related gene, RXFP2, showed signs of rapid evolution specifically in the semi-feral breeds. A unique haplotype and repressed horn-related tissue expression of RXFP2 were correlated with higher horn length, as well as spiral and horizontally extended horn shape.<h4>Conclusions</h4>Semi-feralization has an extensive impact on diverse phenotypic traits of sheep. By acquiring features like those of their wild ancestors, semi-feral sheep were able to regain fitness while in frequent contact with wild surroundings and rare human interventions. This study provides a new insight into the evolution of domestic animals when human interventions are no longer dominant.

Also flagged:schizophreniapsychosisruminationpsychotic disordersanxietydepression
Journal Article 2018-04-01 No Snippets Pelletier-Baldelli A, Andrews-Hanna JR, Mittal VA.
Show Full Abstract

Clarifying dynamic fluctuations in resting-state connectivity in individuals at risk for psychosis (termed clinical high risk [CHR]) may inform understanding of psychotic disorders, such as schizophrenia, which have been associated with dysconnectivity and aberrant salience processing. Dynamic functional connectivity (DFC) investigations provide insight into how neural networks exchange information over time. Currently, there are no published DFC studies involving CHR individuals. This is notable, because understanding how networks may come together and disassociate over time could lend insight into the neural communication that underlies psychosis development and symptomatology. A sliding-window analysis was utilized to examine DFC (defined as the standard deviation over a series of sliding windows) in resting-state scans in a total of 31 CHR individuals and 28 controls. Clinical assessments at baseline and 12 months later were conducted. CHR participants exhibited less DFC (lower standard deviation) in connectivity involving areas of both the salience network (SN) and default mode network (DMN) with regions involved in sensory, motor, attention, and internal cognitive functions relative to controls. Within CHR participants, this pattern was associated with greater positive symptoms 12 months later, possibly reflecting a mechanism behind aberrant salience processing. Higher SN-DMN internetwork DFC related to elevated baseline negative symptoms, anxiety, and depression in CHR participants, which may indicate neurological processes underlying worry and rumination. Overall, through highlighting unique DFC properties within CHR individuals and detecting informative links with clinically relevant symptomatology, results support dysconnectivity and aberrant salience processing models of psychosis. (PsycINFO Database Record

Also flagged:gliomashistonemethioninegliomatumorPDGFRA
Journal Article 2018-04-01 No Snippets Filbin MG, Tirosh I, Hovestadt V, Shaw ML, Escalante LE, Mathewson ND, Neftel C, Frank N, Pelton K, Hebert CM, Haberler C, Yizhak K, Gojo J, Egervari K, Mount C, van Galen P, Bonal DM, Nguyen QD, Beck A, Sinai C, Czech T, Dorfer C, Goumnerova L, Lavarino C, Carcaboso AM, Mora J, Mylvaganam R, Luo CC, Peyrl A, Popović M, Azizi A, Batchelor TT, Frosch MP, Martinez-Lage M, Kieran MW, Bandopadhayay P, Beroukhim R, Fritsch G, Getz G, Rozenblatt-Rosen O, Wucherpfennig KW, Louis DN, Monje M, Slavc I, Ligon KL, Golub TR, Regev A, Bernstein BE, Suvà ML.
Show Full Abstract

Gliomas with histone H3 lysine27-to-methionine mutations (H3K27M-glioma) arise primarily in the midline of the central nervous system of young children, suggesting a cooperation between genetics and cellular context in tumorigenesis. Although the genetics of H3K27M-glioma are well characterized, their cellular architecture remains uncharted. We performed single-cell RNA sequencing in 3321 cells from six primary H3K27M-glioma and matched models. We found that H3K27M-glioma primarily contain cells that resemble oligodendrocyte precursor cells (OPC-like), whereas more differentiated malignant cells are a minority. OPC-like cells exhibit greater proliferation and tumor-propagating potential than their more differentiated counterparts and are at least in part sustained by <i>PDGFRA</i> signaling. Our study characterizes oncogenic and developmental programs in H3K27M-glioma at single-cell resolution and across genetic subclones, suggesting potential therapeutic targets in this disease.

Also flagged:Autoimmune diseasesIIMMyositisidiopathic inflammatory myopathyHLA 8immune-mediated diseases
Journal Article 2018-04-01 No Snippets Miller FW, Lamb JA, Schmidt J, Nagaraju K.
Show Full Abstract

Autoimmune diseases develop as a result of chronic inflammation owing to interactions between genes and the environment. However, the mechanisms by which autoimmune diseases evolve remain poorly understood. Newly discovered risk factors and pathogenic processes in the various idiopathic inflammatory myopathy (IIM) phenotypes (known collectively as myositis) have illuminated innovative approaches for understanding these diseases. The HLA 8.1 ancestral haplotype is a key risk factor for major IIM phenotypes in some populations, and several genetic variants associated with other autoimmune diseases have been identified as IIM risk factors. Environmental risk factors are less well studied than genetic factors but might include viruses, bacteria, ultraviolet radiation, smoking, occupational and perinatal exposures and a growing list of drugs (including biologic agents) and dietary supplements. Disease mechanisms vary by phenotype, with evidence of shared innate and adaptive immune and metabolic pathways in some phenotypes but unique pathways in others. The heterogeneity and rarity of the IIMs make advancements in diagnosis and treatment cumbersome. Novel approaches, better-defined phenotypes, and international, multidisciplinary consensus have contributed to progress, and it is hoped that these methods will eventually enable therapeutic intervention before the onset or major progression of disease. In the future, preemptive strategies for IIM management might be possible.

Also flagged:autoimmune hepatitischronic liver diseaseschronic viral hepatitisnon-alcoholic fatty liver diseasechronic immune mediated liver diseaseliver cirrhosis
Journal Article 2018-04-01 ✓ 1 Snippet Dong Y, Potthoff A, Klinger C, Barreiros AP, Pietrawski D, Dietrich CF.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, Wilson’s disease and…

Show Full Abstract

Ultrasound findings in autoimmune hepatitis (AIH) have not been reported systematically so far. The use of reliable and accurate noninvasive methods for determining fibrosis stage is important in evaluation of treatment efficacy and fibrosis regression in AIH. Imaging plays an important role in detection of complications and ruling out other possible causes of chronic liver diseases. Ultrasound elastography cut-off values in AIH patients are not the same as those in patients with chronic viral hepatitis or non-alcoholic fatty liver disease. AIH is characterized by wide fluctuations in inflammatory activity. Here we report on current knowledge of ultrasound findings in AIH.

Also flagged:nonalcoholic fatty liver diseaseNAFLDpathogenesisnonalcoholic steatohepatitisliver cancerchronic liver disease
Journal Article 2018-04-01 ✓ 1 Snippet Pirola CJ, Sookoian S.
In-Text Gene Mentions

There are similar proposals - though restricted to the prediction of NAFLD but not NASH - based on OMICs-derived data, including genetic information (rs738409), clinical variables, and measurement of different proteins (ACY1, SHBG, CTSZ, MET, GNS, LGALS3BP, CHL1, SERPINC1), which - if combined - seem to be quite reliable in disease risk identification (AUROC for steatosis 0.935)[40].

Show Full Abstract

This review intends to uncover how information from large-scale genetic profiling (whole genome sequencing, and whole exome sequencing) of nonalcoholic fatty liver disease (NAFLD), as well as information from circulating transcriptomics (cell-free miRNAs) and metabolomics, contributes to the understanding of NAFLD pathogenesis. A further aim is to address the question of whether OMICs information is ready to be implemented in the clinics. The available evidence suggests that any new knowledge pertaining to molecular signatures associated with NAFLD and nonalcoholic steatohepatitis should be promptly translated into the clinical setting. Nevertheless, rigorous steps that must include validation and replication are mandatory before utilizing OMICs biomarkers in diagnostics to identify patients at risk of advanced disease, including liver cancer.

Also flagged:myosin IIRac1morphogenesisconstrictionlumenembryogenesis
Journal Article 2018-04-01 ✓ 1 Snippet Sumigray KD, Terwilliger M, Lechler T.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The adult mammalian intestine is composed of two connected structures, the absorptive villi and the crypts, which house progenitor cells. Mouse crypts develop postnatally and are the architectural unit of the stem cell niche, yet the pathways that drive their formation are not known. Here, we combine transcriptomic, quantitative morphometric, and genetic analyses to identify mechanisms of crypt development. We uncover the upregulation of a contractility gene network at the earliest stage of crypt formation, which drives myosin II-dependent apical constriction and invagination of the crypt progenitor cells. Subsequently, hinges form, compartmentalizing crypts from villi. Hinges contain basally constricted cells, and this cell shape change was inhibited by increased hemidesmosomal adhesion in Rac1 null mice. Loss of hinges resulted in reduced villar spacing, revealing an unexpected role for crypts in tissue architecture and physiology. These studies provide a framework for studying crypt morphogenesis and identify essential regulators of niche formation.

Also flagged:Rab GTPasesmembraneneuropathiesRab GTPaseMembrane Traffickingendomembrane
Journal Article 2018-04-01 ✓ 3 Snippets Kiral FR, Kohrs FE, Jin EJ, Hiesinger PR.
In-Text Gene Mentions

HD is caused by mutant variants of the huntingtin (htt) gene that contain at least 36–40 residues of elongated glutamine repeats [152].

Finally, HD is also associated with alterations in both anterograde and retrograde axonal transport through disrupted interaction of mutant Htt with the dynein/dynactin complex and Kinesin-1 [158, 159].

In HD, Htt-HAP40 complex formation is disrupted, resulting in an upregulation of HAP40 and a decline in early endosome motility [156].

Show Full Abstract

Defects in membrane trafficking are hallmarks of neurodegeneration. Rab GTPases are key regulators of membrane trafficking. Alterations of Rab GTPases, or the membrane compartments they regulate, are associated with virtually all neuronal activities in health and disease. The observation that many Rab GTPases are associated with neurodegeneration has proven a challenge in the quest for cause and effect. Neurodegeneration can be a direct consequence of a defect in membrane trafficking. Alternatively, changes in membrane trafficking may be secondary consequences or cellular responses. The secondary consequences and cellular responses, in turn, may protect, represent inconsequential correlates or function as drivers of pathology. Here, we attempt to disentangle the different roles of membrane trafficking in neurodegeneration by focusing on selected associations with Alzheimer's disease, Parkinson's disease, Huntington's disease and selected neuropathies. We provide an overview of current knowledge on Rab GTPase functions in neurons and review the associations of Rab GTPases with neurodegeneration with respect to the following classifications: primary cause, secondary cause driving pathology or secondary correlate. This analysis is devised to aid the interpretation of frequently observed membrane trafficking defects in neurodegeneration and facilitate the identification of true causes of pathology.

Also flagged:Polyglutamine (polyQ) diseasesHuntingtinglutaminesGlutamineneurodegenerative disorderspolyQ diseases
Journal Article 2018-04-01 ✓ 1 Snippet Yushchenko T, Deuerling E, Hauser K.
In-Text Gene Mentions

Htt

Show Full Abstract

Polyglutamine (polyQ) diseases, including Huntington's disease, result from the aggregation of an abnormally expanded polyQ repeat in the affected protein. The length of the polyQ repeat is essential for the disease's onset; however, the molecular mechanism of polyQ aggregation is still poorly understood. Controlled conditions and initiation of the aggregation process are prerequisites for the detection of transient intermediate states. We present an attenuated total reflection Fourier-transform infrared spectroscopic approach combined with protein immobilization to study polyQ aggregation dependent on the polyQ length. PolyQ proteins were engineered mimicking the mammalian N-terminus fragment of the Huntingtin protein and containing a polyQ sequence with the number of glutamines below (Q11), close to (Q38), and above (Q56) the disease threshold. A monolayer of the polyQ construct was chemically immobilized on the internal reflection element of the attenuated total reflection cell, and the aggregation was initiated via enzymatic cleavage. Structural changes of the polyQ sequence were monitored by time-resolved infrared difference spectroscopy. We observed faster aggregation kinetics for the longer sequences, and furthermore, we could distinguish β-structured intermediates for the different constructs, allowing us to propose aggregation mechanisms dependent on the repeat length. Q11 forms a β-structured aggregate by intermolecular interaction of stretched monomers, whereas Q38 and Q56 undergo conformational changes to various β-structured intermediates, including intramolecular β-sheets.

Also flagged:mTORC1neurological disorderneurological diseaseheart diseaseHDRheb
Journal Article 2018-04-01 ✓ 5 Snippets Child DD, Lee JH, Pascua CJ, Chen YH, Mas Monteys A, Davidson BL.
In-Text Gene Mentions

A recent review on peripheral HD phenotypes presents data that identifies HTT mRNA expression within the heart but suggests no HTT protein expression (Carroll et al., 2015).

Huntington’s disease (HD) is a dominantly inherited neurological disorder caused by CAG-repeat expansion in exon 1 of Huntingtin (HTT).

But in addition to the neurological disease, mutant HTT (mHTT), which is ubiquitously expressed, impairs other organ systems.

…neurological disease, mutantHTT(mHTT), which is…

…of Huntingtin (HTT).…

Show Full Abstract

Huntington's disease (HD) is a dominantly inherited neurological disorder caused by CAG-repeat expansion in exon 1 of Huntingtin (HTT). But in addition to the neurological disease, mutant HTT (mHTT), which is ubiquitously expressed, impairs other organ systems. Indeed, epidemiological and animal model studies suggest higher incidence of and mortality from heart disease in HD. Here, we show that the protein complex mTORC1 is dysregulated in two HD mouse models through a mechanism that requires intrinsic mHTT expression. Moreover, restoring cardiac mTORC1 activity with constitutively active Rheb prevents mortality and relieves the mHTT-induced block to hypertrophic adaptation to cardiac stress. Finally, we show that chronic mTORC1 dysregulation is due in part to mislocalization of endogenous Rheb. These data provide insight into the increased cardiac-related mortality of HD patients, with cardiac mHTT expression inhibiting mTORC1 activity, limiting heart growth, and decreasing the heart's ability to compensate to chronic stress.

Also flagged:CD4HDagingtelomeregene expressiondeath
Journal Article 2018-04-01 ✓ 5 Snippets Min B, Park M, Jeon K, Park JS, Seo H, Jeong S, Kang YK.
In-Text Gene Mentions

There are several HD model mice with different genetic constitution of HTT/Htt mutation in the mouse genome [55,56].

HD is considered as mainly a central nervous system (CNS) disorder but ubiquitous expression of both normal and mutant Huntingtin (HTT) in the whole body [9] has attracted attention toward peripheral dysfunctions the study of which has increased knowledge of HD etiology and has aided the identification of new biomarkers [10,11].

…and mutant Huntingtin (HTT) in the whole…

…of the humanHTTgene [ 47…

…expressed the endogenousHttgene strongly, two-fold…

Show Full Abstract

This study addressed the question of how well the quantitative transcriptome structure established in early life is maintained and how consistently it appears with increasing age, and if there is age-associated alteration of gene expression (A<sub>3</sub>GE), how much influence the Huntington's disease (HD) genotype exerts on it. We examined 285 exonic sequences of 175 genes using targeted PCR sequencing in skeletal muscle, brain, and splenic CD4+ T cells of wild-type and HD mice. In contrast to the muscle and brain, T cells exhibited large A<sub>3</sub>GE, suggesting a strong contribution to functional decline of the organism. This A<sub>3</sub>GE was markedly intensified in age-matched HD T cells, which exhibited accelerated aging as determined by reduced telomere length. Regression analysis suggested that gene expression levels change at a rate of approximately 3% per month with age. We found a bimodal relationship in A<sub>3</sub>GE in T cells in that weakly expressed genes in young mice were increasingly transcribed in older animals whereas highly expressed genes in the young were decreasingly expressed with age. This bimodal transcriptional drift in the T cell transcriptome data causes the differences in transcription rate between genes to progressively reduce with age.

Also flagged:lymphocyte activationtumorbrain developmentagingmigrainecalcitonin gene-related peptides
Journal Article 2018-04-01 ✓ 1 Snippet Ehlers MD.
In-Text Gene Mentions

htt

Show Full Abstract

No abstract available.

Also flagged:Huntington's diseaseγ-Aminobutyric acidmembrane receptorsdeathneurodegenerative disorderdopamine
Journal Article 2018-04-01 ✓ 2 Snippets Rosas-Arellano A, Estrada-Mondragón A, Mantellero CA, Tejeda-Guzmán C, Castro MA.
In-Text Gene Mentions

…of the huntingtin (Htt) protein, producing a…

…of this mutantHtt(mHtt) (No authors…

Show Full Abstract

γ-Aminobutyric acid (GABA), plays a key role in all stages of life, also is considered the main inhibitory neurotransmitter. GABA activates two kind of membrane receptors known as GABA<sub>A</sub> and GABA<sub>B</sub>, the first one is responsible to render tonic inhibition by pentameric receptors containing α4-6, β3, δ, or ρ1-3 subunits, they are located at perisynaptic and/or in extrasynaptic regions. The biophysical properties of GABA<sub>A</sub> tonic inhibition have been related with cellular protection against excitotoxic injury and cell death in presence of excessive excitation. On this basis, GABA<sub>A</sub> tonic inhibition has been proposed as a potential target for therapeutic intervention of Huntington's disease. Huntington's disease is a neurodegenerative disorder caused by a genetic mutation of the huntingtin protein. For experimental studies of Huntington's disease mouse models have been developed, such as R6/1, R6/2, HdhQ92, HdhQ150, as well as YAC128. In all of them, some key experimental reports are focused on neostriatum. The neostriatum is considered as the most important connection between cerebral cortex and basal ganglia structures, its cytology display two pathways called direct and indirect constituted by medium sized spiny neurons expressing dopamine D1 and D2 receptors respectively, they display strong expression of many types of GABA<sub>A</sub> receptors, including tonic subunits. The studies about of GABA<sub>A</sub> tonic subunits and Huntington's disease into the neostriatum are rising in recent years, suggesting interesting changes in their expression and localization which can be used as a strategy to delay the cellular damage caused by the imbalance between excitation and inhibition, a hallmark of Huntington's disease.

Also flagged:pathogenesismitochondrial disorderstransverse syndromemultisystemdiseasemitochondrial multi-organ disorder syndrome
Journal Article 2018-04-01 ✓ 3 Snippets Finsterer J, Zarrouk-Mahjoub S.
In-Text Gene Mentions

Leukoencephalopathy, brain stem and spinal cord involvement and lactic acidosis (LBSL) is a rare specific MID due to mutations in the DARS2 gene encoding mitochondrial aspartyl-tRNA synthetase.[26] Clinically, patients present with childhood or juvenile-onset intellectual decline (learning dysfunction), slowly progressive ataxia, pyramidal signs (spasticity), and dorsal column dysfunction.[27] MRI of the spine shows inhomogeneous T2-hyperintensities in the spinal tract.[28] Proton-magnetic resonance spectroscopy (MRS) of the frontal and cerebellar white matter shows elevated lactate, reduced N-acetyl-aspartate, increased myoinositol, and mildly elevated choline.[29] Neuropathological investigations typically show vacuolar changes in the white matter of the cerebrum and spinal cord.[30] MRI does not necessarily reflect clinical presentation and the histological findings why it should not be used to assess disease severity or prognosis.[31] In a 1-year-old male with psychomotor delay, quadruplegia, deafness, and anemia due to a mutation in the DARS2 gene, spinal MRI revealed calcifications of the spinal cord.[32] A 35-year-old female with mild balance impairment since her early teenage years, developed slowly progressive unsteady gait with lower limb weakness and stiffness since age 20 years.[33] Neurological examination revealed spastic paraparesis with marked impairment of vibration and position perceptions and waddling gait.[33] Spinal MRI in this patient showed T2-hyperintensities in the posterior columns, anterior and posterior spinocerebellar tracts, and lateral corticospinal tracts [Figure 2], indicating continuous involvement of the corresponding pathways in the brainstem.[33]

…mutations in theDARS2gene encoding mitochondrial…

…mutation in theDARS2gene, spinal MRI…

Show Full Abstract

This review aims at summarising and discussing the current status concerning the clinical presentation, pathogenesis, diagnosis, and treatment of spinal cord affection in mitochondrial disorders (MIDs). A literature search using the database Pubmed was carried out by application of appropriate search terms and their combinations. Involvement of the spinal cord in MIDs is more frequent than anticipated. It occurs in specific and non-specific MIDs. Among the specific MIDs it has been most frequently described in LBSL, LS, MERRF, KSS, IOSCA, MIRAS, and PCH and only rarely in MELAS, CPEO, and LHON. Clinically, spinal cord involvement manifests as monoparesis, paraparesis, quadruparesis, sensory disturbances, hypotonia, spasticity, urinary or defecation dysfunction, spinal column deformities, or as transverse syndrome. Diagnosing spinal cord involvement in MIDs requires a thoroughly taken history, clinical exam, and imaging studies. Additionally, transcranial magnetic stimulation, somato-sensory-evoked potentials, and cerebro-spinal fluid can be supportive. Treatment is generally not at variance compared to the underlying MID but occasionally surgical stabilisation of the spinal column may be necessary. It is concluded that spinal cord involvement in MIDs is more frequent than anticipated but may be missed if cerebral manifestations prevail. Spinal cord involvement in MIDs may strongly determine the mobility of these patients.

Also flagged:cancerGene expressionnucleasegastric cancerBCAS1P53
Journal Article 2018-04-01 ✓ 1 Snippet McFarlane M, Brettschneider J, Gelsthorpe A, James S, Snead D, Gopalakrishnan K, Mehenna H, Jankowski J, Arasaradnam R, Nwokolo C.
In-Text Gene Mentions

PEBP1

Show Full Abstract

<h4>Background</h4>Gastric cancer (GC) is the fourth commonest cancer worldwide, with the second highest mortality rate. Its poor mortality is linked to delayed presentation. There is a drive towards non-invasive biomarker screening and monitoring of many different types of cancer, although with limited success so far. We aimed to determine if any genes from a 32-gene panel could be used to determine GC prognosis.<h4>Methods</h4>We carried out a retrospective study on the expression of 32 genes, selected for their proven or potential links to GC, on historic formalin fixed paraffin-embedded (FFPE) GC specimens from our unit. Gene expression was measured using quantitative nuclease protection assays (qNPA) technology. Following statistical analysis of the results, immunohistochemical staining for eight genes, both discriminating and non-discriminating, was conducted in seven age and sex matched non-metastatic: metastatic GC pairings. The stained samples were reviewed by two blinded consultant histopathologists.<h4>Results</h4>Multivariate Cox analysis of the gene expression data revealed metastatic status, age, sex and five genes appeared to influence GC survival. Genes negatively influencing survival included <i>BCAS1, P53</i> and <i>HSP90AA1</i> (relative risks 2.20, 3.73 and 7.53 respectively). Genes conveying survival benefit included <i>CASP3</i> and <i>TERT</i> (relative risks 0.10 and 0.24 respectively). Immunohistochemical staining of seven age and sex matched non-metastatic: metastatic pairs revealed no association between gene expression and protein expression.<h4>Conclusions</h4>Our study found several genes whose expression may affect GC prognosis. However, immunohistochemical analysis revealed no association between gene expression and protein expression. It remains to be determined whether gene expression or protein expression are reliable means of assessing GC prognosis.

Also flagged:solitary pulmonary nodulestumourlung cancercancerlocalizedCEA
Journal Article 2018-04-01 No Snippets Ye M, Li S, Huang W, Wang C, Liu L, Liu J, Liu J, Pan H, Deng Q, Tang H, Jiang L, Huang W, Chen X, Shao D, Peng Z, Wu R, Zhong J, Wang Z, Zhang X, Kristiansen K, Wang J, Yin Y, Mao M, He J, Liang W.
Show Full Abstract

<h4>Background</h4>A non-invasive method to predict the malignancy of surgery-candidate solitary pulmonary nodules (SPN) is urgently needed.<h4>Methods</h4>Super-depth next generation sequencing (NGS) of 35 paired tissues and plasma DNA was performed as an attempt to develop an early diagnosis approach.<h4>Results</h4>Only ~6% of malignant nodule patients had driver mutations in the circulating tumour DNA (ctDNA) with >10,000-fold sequencing depth, and the concordance of mutation between tDNA and ctDNA was 3.9%. The first innovative whole mutation scored model in this study predicted 33.3% of malignant SPN with 100% specificity.<h4>Conclusions</h4>These results showed that lung cancer gene-targeted deep capture sequencing is not efficient enough to achieve ideal sensitivity by simply increasing the sequencing depth of ctDNA from early candidates. The sequencing could not be evaluated hotspot mutations in the early tumour stage. Nevertheless, a larger cohort is required to optimize this model, and more techniques may be incorporated to benefit the SPN high-risk population.

Also flagged:Sleeptype 2 diabetessleep-disordered breathingDiabetesdiabetes mellitusaging
Journal Article 2018-04-01 ✓ 1 Snippet Kroner T, Arzt M, Rheinberger M, Gorski M, Heid IM, Böger CA, Stadler S.
In-Text Gene Mentions

…affecting kidney function,hemochromatosis, known pancreoprivic or…

Show Full Abstract

In patients with type 2 diabetes, sleep-disordered breathing is a widespread cause of deteriorated quality of life. However, robust prevalence estimates for sleep-disordered breathing in patients with type 2 diabetes are limited due to scarce data. We investigated sex differences in sleep-disordered breathing prevalence and its modulators in the DIACORE SDB substudy, a sample of outpatient type 2 diabetes. 721 participants were tested for sleep-disordered breathing using a two-channel sleep apnoea monitoring device. Patients were stratified according to the severity of sleep-disordered breathing, defined as an apnoea-hypopnoea index < 15, ≥15 to 29, and ≥30 events per hour as no/mild, moderate, and severe sleep-disordered breathing, respectively. In the 679 analysed patients (39% women, age 66 ± 9 years, body mass index 31.0 ± 5.4 kg/m<sup>2</sup>), the prevalence of sleep-disordered breathing was 34%. The prevalence of sleep-disordered breathing was higher in men than in women (41% versus 22%, <i>p</i> < 0.001) and increased with age (15%, 21%, and 30% in women and 35%, 40%, and 47% in men in those aged 18-59, 60-69, or ≥70, respectively; age trend <i>p</i> = 0.064 in women and <i>p</i> = 0.15 in men). In linear regression analysis, age, BMI, and waist-hip ratio were associated with apnoea-hypopnoea index. Modulators for higher apnoea-hypopnoea index seem to be similar in men and women.

Also flagged:Lung cancercancertumormethylationtumorsdeath
Journal Article 2018-04-01 No Snippets Lerner L, Winn R, Hulbert A.
Show Full Abstract

Lung cancer is the most prominent cause of cancer-related mortality. Significant disparities in incidence and outcome characterize the disease's manifestations among ethnically and racially diverse populations. Complete surgical resection is the most effective curative treatment. However, success relies on early tumor detection. The National Lung Cancer Screening trial showed that lung cancer related mortality can be reduced by the use of low-dose CT (LDCT) screening. However, this test is plagued by a high false positive rate of 97% and the device itself is limited to designated cancer centers due to its expense and size. This restriction makes it difficult for underserved groups to access LDCT screening, the current standard of care. Highly sensitive and specific epigenetic DNA methylation-based biomarkers have the potential to work independently or in conjunction with LDCT screening to identify early-stage tumors. These tests could reduce unnecessary invasive confirmatory diagnostic tests and their associated morbidity and mortality. These tests also have the opportunity to bring lung cancer screening to the community thereby reducing unequal accessibility. However, epigenetic alterations are closely linked to the interplay between hereditary and environmental factors such as diet, lifestyle, ethnic ancestry, toxin exposure, residential segregation, and disparate community support structures. Despite this, the overwhelming number of early detection DNA methylation biomarker studies to date have either failed to control for ethnicity or have employed heavily Caucasian-biased patient cohorts. This review seeks to summarize the literature related to the early detection of lung cancer through molecular biomarkers among different ethnicities. Ethnical specific epigenetic biomarkers have the potential to be the first step towards an accessible, available personalized medicine approach to cancer through liquid biopsy.

ASNTR 2018 Abstracts.

Also flagged:Injuryneurological diseaseimmune responseacute ischemic strokestrokecytokine
Journal Article 2018-04-01 ✓ 4 Snippets Unknown Authors
In-Text Gene Mentions

…Huntingtin gene (mHTT), which codes…

…the Huntingtin protein (HTT), whereby the polyglutamine…

…having the normalHTTgene and also…

…also the mHTT.…

Show Full Abstract

No abstract available.

Also flagged:neurological diseasesneuropsychiatric disordersautismAlzheimer'ParkinsonHuntington's disease
Journal Article 2018-04-01 ✓ 5 Snippets Farah R, Haraty H, Salame Z, Fares Y, Ojcius DM, Said Sadier N.
In-Text Gene Mentions

Additionally, salivary concentration of mutant Htt was significantly increased in pre-manifest HD patients when compared to healthy controls.

Knowing that testing CSF and blood for Htt protein for diagnostic confirmation of HD can be performed, it is still an impractical measure due to the invasiveness of the testing procedure and because of low Htt concentrations in the acquired samples.

Here we present Htt protein as a promising candidate for the diagnosis of HD.

There was a significant increase in total Htt protein concentration in saliva samples obtained from HD patients when compared to controls.

Huntington's disease (HD) is an autosomal dominant neurodegenerative disorder caused by an expansion of N-terminal (CAG)n trinucleotide repeat of the huntingtin gene (Htt) with locus 4p16.3.

Show Full Abstract

Current research efforts on neurological diseases are focused on identifying novel disease biomarkers to aid in diagnosis, provide accurate prognostic information and monitor disease progression. With advances in detection and quantification methods in genomics, proteomics and metabolomics, saliva has emerged as a good source of samples for detection of disease biomarkers. Obtaining a sample of saliva offers multiple advantages over the currently tested biological fluids as it is a non-invasive, painless and simple procedure that does not require expert training or harbour undesirable side effects for the patients. Here, we review the existing literature on salivary biomarkers and examine their validity in diagnosing and monitoring neurodegenerative and neuropsychiatric disorders such as autism and Alzheimer's, Parkinson's and Huntington's disease. Based on the available research, amyloid beta peptide, tau protein, lactoferrin, alpha-synuclein, DJ-1 protein, chromogranin A, huntingtin protein, DNA methylation disruptions, and micro-RNA profiles provide display a reliable degree of consistency and validity as disease biomarkers.

Also flagged:membraneshockstress-induced cardiomyopathyTakotsubo-like syndromeCoronary syndromeacute myocarditis
Journal Article 2018-04-01 ✓ 1 Snippet Biondi RS, Barzilai VS, Watanabe ALC, Ferreira GSA, Atik FA.
In-Text Gene Mentions

…dysfunction associated withhemochromatosis.…

Show Full Abstract

We report the case of a female patient, 58 years of age, without known heart disease, who underwent liver transplantation without complications. On the second postoperative day, the patient developed cardiogenic shock secondary to stress-induced cardiomyopathy (Takotsubo-like syndrome). The patient was successfully managed with veno-arterial peripheral extracorporeal membrane oxygenation for 6 days, with complete recovery of cardiac function and of the hepatic graft. Coronary syndrome and acute myocarditis were excluded as the causes of the shock. The use of extracorporeal membrane oxygenation in this scenario is possible and safe, considering its specialized protocols and treatment.

Also flagged:sertralinecognitionmetabolismcorticosteronematingserotonin
Journal Article 2018-04-01 ✓ 5 Snippets Rawat A, Guo J, Renoir T, Pang TY, Hannan AJ.
In-Text Gene Mentions

However, despite having found no differences in htr1a or sert expression within the dorsal and ventral aspects of the hippocampus that correlated with a male-specific anxiety phenotype, it is possible that there are post-transcriptional changes in 5-HT1AR and/or 5-HTT protein levels, ligand binding, and signalling activity.

…1A R and5-HTTgene expression changes…

…1A R and5-HTTin the offspring…

…1A R and5-HTTexpression in the…

…1A R and/or5-HTTprotein levels, ligand…

Show Full Abstract

The male germ line is capable of transmitting a legacy of stress exposure to the next generation of offspring. This transgenerational process manifests by altering offspring affective behaviours, cognition and metabolism. Paternal early life trauma causes hippocampal serotonergic dysregulation in male offspring. We previously showed a transgenerational modification to male offspring anxiety-like behaviours by treatment of adult male breeders with corticosterone (CORT) prior to mating. In the present study, we used offspring from our paternal CORT model and characterised offspring serotonergic function by examining their responses to the 5HT<sub>1A</sub>R agonist, 8-OH-DPAT, and the selective serotonin reuptake inhibitor, sertraline. We also examined whether post-weaning environmental enrichment, a paradigm well-known to modulate serotonergic signalling in the brain, had the capacity to normalise the anxiety phenotype of male offspring. Finally, we assessed gene expression levels of 5HT<sub>1A</sub>R and serotonin transporter in the offspring hippocampus to determine whether deficits in gene transcription contributed to the male-only anxiety phenotype. We report that male and female offspring of CORT-treated fathers are hypersensitive to sertraline but have normal hypothermic responses to 8-OH-DPAT. No deficits in <i>htr1a</i> and <i>sert</i> were found in association with paternal CORT treatment, and environmental enrichment did not rescue the anxiety phenotype of male offspring on the elevated-plus maze. These findings indicate that varying forms of paternal stress exert different effects on offspring brain serotonergic function.

Also flagged:chromosomesACEPDAngiotensin converting enzymeOxytocin receptorCytochrome P450
Journal Article 2018-04-01 No Snippets LaRue KM, McKernan MP, Bass KM, Wray CG.
Show Full Abstract

Teaching the Genome Generation (TtGG) is a teacher professional development program and set of high school biology lessons that support interwoven classroom instruction of molecular genetics, bioinformatics, and bioethics. Participating teachers from across New England implement the modular elements of program at a high rate in a variety of biology classrooms. Evaluation data collected over three academic years (2014/15 to 2016/17) indicate that TtGG has increased teachers' abilities to integrate complex concepts of genomics and bioethics into their high school classes.

Also flagged:NucleolusCX-5461cancerPol IRPA135RPA12
Journal Article 2018-04-01 ✓ 1 Snippet Baserga SJ, DiMario PJ.
In-Text Gene Mentions

ddx27 is a nucleolar DEAD-box RNA helicase required for rRNA maturation but is down-regulated in Duchenne muscular dystrophy.

Show Full Abstract

No abstract available.

Also flagged:antibodiestryptaminescarboxylic groupalbuminBSAtryptamine
Journal Article 2018-04-01 No Snippets Maryška M, Fojtíková L, Jurok R, Holubová B, Lapčík O, Kuchař M.
Show Full Abstract

Tryptamines are a group of hallucinogenic drugs whose detection in body fluids could be simplified by immunochemical assay kits. Antibodies for these assays are obtained by the immunization of laboratory animals with conjugates of a hapten similar to the target analyte and a suitable protein. Therefore we synthesized novel haptens derived from tryptamine-based drugs, with <i>N</i>,<i>N</i>-dimethyltryptamine (DMT), 5-methoxy-<i>N</i>,<i>N</i>-dimethyltryptamine (5-MeO-DMT) and <i>N</i>,<i>N</i>-diisopropyltryptamine (DiPT) selected as the target analytes. Their structures were modified with a short linker ended with a carboxylic group. The haptens were conjugated with bovine serum albumin (BSA) and rabbits were immunized with the conjugates. The obtained polyclonal antibodies showed good reactivity and the LOD of the constructed ELISAs was in the range 0.006-0.254 ng mL<sup>-1</sup>. Thus, they are suitable for the development of immunochemical assay kits.

Also flagged:psychiatric disorderscognitive dysfunctiondopamineaxonsaxonnucleus
Journal Article 2018-04-01 ✓ 5 Snippets Flores C.
In-Text Gene Mentions

…guidance cue receptor,DCC, and its microRNA…

…the role thatDCCand miR-218 play…

…in adolescence alter miR-218/DCCsignaling, thereby disrupting…

…We discovered thatDCC receptorsreceptors control the…

…to disruption ofDCC-dependent adolescent targetin…

Show Full Abstract

Abstract <h4>Background</h4> Adolescence is an age of heightened vulnerability to develop psychiatric disorders that involve alterations in prefrontal cortex circuitry and cognitive dysfunction. The maturation of prefrontal cortex function is linked to the establishment of dopamine connectivity in this region. Development of mesocortical dopamine is a gradual process that continues until early adulthood. Because of its extended maturational course, this system is particularly susceptible to environmental influences. Yet there is a significant gap in our knowledge about the cellular and molecular mechanisms underlying adolescent prefrontal cortex dopamine development and how they are influenced by experience. <h4>Methods</h4> We examined the role of the Netrin-1 guidance cue receptor, DCC, and its microRNA repressor, miR-218, on adolescent mouse prefrontal cortex development. We used axon-initiated recombination and cell-specific knock-down techniques to characterize the spatiotemporal growth of mesocortical dopamine axons and the role that DCC and miR-218 play in this process. Next, we assessed whether stimulant drugs in adolescence alter miR-218/DCC signaling, thereby disrupting mesocortical dopamine axon growth. Finally, we determined whether altered dopamine axon growth influences prefrontal cortex development by quantifying pyramidal neuron morphology and cognitive performance in adulthood. <h4>Results</h4> Here we show, for the first time, that dopamine axons continue to grow from the nucleus accumbens to the prefrontal cortex during adolescence. We discovered that DCC receptors control the extent of this protracted growth by determining where and when dopamine axons recognize their innervation target. Exposure to stimulant drugs or to stress leads to disruption of DCC-dependent adolescent targeting events, causing dopamine axons that should innervate the nucleus accumbens, to grow ectopically to the prefrontal cortex. This effect profoundly changes prefrontal cortex structural and functional development, producing alterations in cognitive processes known to be impaired across psychiatric conditions, including schizophrenia. Importantly, miR-218 controls DCC receptor expression in dopamine neurons across postnatal development and acts as a molecular mediator of the effects of stimulant drugs on prefrontal cortex development. <h4>Discussion</h4> The prolonged growth of dopamine axons during adolescence represents an extraordinary period for experience to influence their growth and predispose to or protect against psychopathology. MicroRNA control of DCC receptor in dopamine neurons is a molecular link where genetic and environmental factors seem to interact in adolescence to influence the development and function of the prefrontal cortex.

Also flagged:neurological diseasesschizophreniacognitive impairments associated with schizophreniaADGs-coupled orphan g-protein coupled receptorGs-coupled D1 receptor
Journal Article 2018-04-01 ✓ 5 Snippets Grottick A, Grayson B, Podda G, Idris N, Dorner-Ciossek C, Neill J, Hobson S.
In-Text Gene Mentions

GPR52is a Gs-coupled…

…In cortex,GPR52is expressed primarily…

…in the striatum,GPR52is almost exclusively…

…Based onGPR52’s functional coupling and…

…Thus,GPR52agonists have the…

Show Full Abstract

Abstract <h4>Background</h4> There are currently no treatment options for key symptom domains in certain psychiatric and neurological diseases. For example, antipsychotics effectively treat the positive symptoms of schizophrenia, however both the cognitive impairments associated with schizophrenia (CIAS) and negative symptoms, both key predictors of functional outcome, are not treated by current therapies. Additionally, psychotic symptoms associated with neurological diseases such as Alzheimer’s Disease (AD) are not adequately treated with current antipsychotics. Therefore, novel mechanisms to address these unmet medical needs are urgently required and are under investigation. GPR52 is a Gs-coupled orphan g-protein coupled receptor which has an intriguing pattern of brain expression. In cortex, GPR52 is expressed primarily on glutamatergic neurons and co-localized with the Gs-coupled D1 receptor (D1R). Deficiencies in D1R activation are associated with both cognitive deficit and negative symptoms of schizophrenia. In contrast, in the striatum, GPR52 is almost exclusively co-expressed with the Gi-coupled D2 receptor (D2R), which mediates the reduction in positive symptoms by antipsychotics. Based on GPR52’s functional coupling and co-localization, agonists may be predicted to resemble D1R agonists in cortical regions, thus treating cognitive or negative symptoms, while resembling D2R antagonists in striatal regions. Thus, GPR52 agonists have the potential to provide a novel therapeutic strategy for the currently untreated CIAS and negative symptom domains in addition to the psychotic symptoms of AD. <h4>Methods</h4> To assess the antipsychotic potential of GPR52 agonists, they were tested for their ability to decrease psychostimulant-induced hyperlocomotion. The efficacy of GPR52 agonists for CIAS and sociability, an aspect of negative symptoms, was assessed in the sub-chronic phencyclidine (scPCP) model for schizophrenia, known to induce long-lasting cognitive and social behaviour deficits, in addition to a reduction in parvalbumin-positive GABAergic interneurons in hippocampus and pre-frontal cortex. Rats were treated with PCP twice daily for 7 days followed by 7 days washout and then tested in the attentional set shifting task (ASST) for executive function and the social interaction test for sociability respectively following treatment with a GPR52 agonist. <h4>Results</h4> GPR52 agonist 1 dose-dependently reversed psychostimulant-induced hyperlocomotion in rats at doses which were behaviorally quiescent when administered alone. Additionally, GPR52 agonist 2 showed a robust, dose-dependent rescue of scPCP induced deficits in the extra dimensional shift phase of the ASST, achieving significance after a 4 mg/kg p.o. application. Likewise, GPR52 agonist 2 significantly rescued scPCP induced deficits in social interaction at identical doses as in ASST without effects on object exploration or locomotor activity. <h4>Discussion</h4> GPR52 agonists were efficacious in animal models assessing the three main symptoms domains associated with schizophrenia. Efficacy in ASST and SI demonstrate both pro-cognitive efficacy and restoration of an aspect of negative symptoms, respectively, in a well-established model inducing behavioral and neuropathological deficits associated with schizophrenia. Furthermore, GPR52 agonists reduced psychostimulant-induced hyperlocomotion, an effect associated with antipsychotic efficacy. Taken together, these data demonstrate the potential of this innovative mechanism to simultaneously treat the three core symptoms domains of schizophrenia as well as potentially treat the psychotic symptoms associated with other neurological disorders.

Also flagged:schizophreniaaminobutyric acidsynapsesdendritic spinesParvalbumincholecystokinin
Journal Article 2018-04-01 No Snippets Webster M, Weickert C.
Show Full Abstract

Abstract <h4>Background</h4> The predominant neurodevelopmental theory of schizophrenia posits that there is a failure of normal synaptic loss believed to occur during normal adolescence. However, the most consistent neuropathology in the cortex of people with schizophrenia is a deficit in the γ–aminobutyric acid (GABA) inhibitory interneurons, not a reduction in presynaptic and postsynaptic elements. Thus, disruption to the normal development of cortical interneurons may lead to interneuron deficiency in schizophrenia. However, to understand if pathological changes in the brain of an adult with schizophrenia would be consistent with aberrant development, the known neuropathology must be placed in the context of normal human cortical development. <h4>Methods</h4> We examined the molecular changes that occur in the synapses, interneurons and the neurotransmitter systems during normal development of the human prefrontal cortex of 68 brains from healthy individuals (1 month - 49 years). <h4>Results</h4> Contrary to the prevailing view that synaptic pruning predominates during adolescent brain development, we found presynaptic mRNA and protein levels generally peak between 5–12 years of age and then remain stable through adolescence and into adulthood. Likewise, markers for dendritic spines peak in infancy and while mRNA levels then decline, protein levels are maintained throughout development. The various interneuron markers show three very distinct patterns of expression over development. Parvalbumin and cholecystokinin increase from infancy, whereas somatostatin, calretinin and neuropeptide Y decrease from infancy. Calbindin and vasoactive intestinal peptide peak in the toddlers and then decrease in adults in an inverted U shaped-pattern. Levels of mRNA for the GABA synthesizing enzymes GAD65 (GAD2) and GAD67 (GAD1) peak around 1 year of age and stay consistent through to adulthood. The postsynaptic GABAA receptor α1, β2 and γ subunits increase over the postnatal period to peak in adolescent/young adulthood whereas the α2 subunit shows the inverse pattern and decreases over the postnatal period. The dopamine receptor, D1, increase expression throughout the postnatal period to peak in early adulthood, whereas D2 and D5 show a continual decline throughout life. The NMDA receptors are highest in the first year of life and while subunits GRIN 2B, 2D and 3A all decrease throughout life, GRIN1 remains stable and GRIN 2A decreases after childhood. More recently data supporting the neuroinflammatory hypothesis of schizophrenia has merged with the neurodevelopmental hypothesis and posits that the strongest signal from GWAS studies in schizophrenia is in the C4 gene, which is a component of the complement cascade involved in normal synaptic development. We have initiated an examination of the various components of the complement cascade to determine if/when they are expressed in the human cortex and how they could be impacting the developing circuitry. Preliminary data shows C4 mRNA expressed at very low, but constant levels throughout postnatal life. In contrast, C3 mRNA is expressed at higher levels than C4, peaks in infancy and remains stable into adulthood. MAC protein (CD-59) mRNA which protects cells from complement mediated damage, is expressed at very low levels at birth but then increases significantly with age and is highest in adulthood, suggesting that significant changes in complement may occur after brain maturation is complete. <h4>Discussion</h4> Together these findings show very dynamic and complex patterns of expression from birth to adulthood, with the most active growth phase and dynamic changes occurring in the early years before adolescence. Thus, an insult during these early years could profoundly affect the developmental trajectory.

Also flagged:N-methyl-D-aspartate receptorNMDA-Rschizophreniaketamineepisode psychosiscognitive dysfunctions
Journal Article 2018-04-01 No Snippets Grent-’t-Jong T, Rivolta D, Gross J, Gajwani R, Lawrie S, Schwannauer M, Heidegger T, Wibral M, Singer W, Sauer A, Scheller B, Uhlhaas P.
Show Full Abstract

Abstract <h4>Background</h4> Hypofunction of the N-methyl-D-aspartate receptor (NMDA-R) has been implicated as a possible mechanism underlying cognitive deficits and aberrant neuronal dynamics in schizophrenia (ScZ). <h4>Methods</h4> In a single-blind cross-over design, 14 participants received either a subanaesthetic dose of S-ketamine (0.006 mg/Kg) or saline while Magnetoencephalographic (MEG) data were recorded during a visual task. In addition, MEG-data were obtained in a sample of unmedicated first-episode psychosis (FEP) patients (n = 10) and in patients with chronic ScZ (n = 16). MEG-data were analyzed at source-level in the 1–90 Hz frequency range in occipital and thalamic regions of interest (ROIs). In addition, directed functional connectivity analysis was performed using Granger Causality (GC). Psychopathology was assessed by the Positive and Negative Syndrome Scale (PANSS). <h4>Results</h4> Behavioral impairments were accompanied by increased amplitude and frequency of gamma-power (63–80 Hz) in occipital regions during Ketamine administration, while low-frequency (~5–30 Hz) activity was upregulated. Moreover, Ketamine disrupted feedforward (FF) and feedback (FB) signaling at high and low frequencies leading to hypoconnectivity in thalamo-cortical (TC) networks. In contrast, FEP and chronic ScZ patients showed a different pattern of MEG-activity, characterized by decreased task-induced high-gamma band oscillations and increased FF/FB-mediated GC-connectivity. <h4>Discussion</h4> The effects of Ketamine on high-frequency oscillations and their connectivity profile are not consistent with observations in FEP and chronic ScZ-patients. Accordingly, the current data have implications for theories of cognitive dysfunctions and circuit impairments in the disorder, suggesting that the effects of acute NMDA-R hypofunction are not consistent with impairments in visuo-perceptual oscillations in ScZ-patients.

Also flagged:PDE10AdopamineD2D1schizophreniabehavioral
Journal Article 2018-04-01 No Snippets Umbricht D, Dukart J, Abt M, Tamburri P, Chatham C, Frank M, Collins A, Walling D, Mofsen R, Gruener D, Gertsik L, Sevigny J.
Show Full Abstract

Abstract <h4>Background</h4> The enzyme phosphodiesterase 10A (PDE10A) is highly expressed in the striatum where it modulates both dopamine D2 and D1 dependent signaling. Its inhibition leads to a suppression of D2 mediated signaling –similar to effects of D2 antagonists - and an enhancement of D1 dependent signaling. D1-dependent signaling has been implicated in reward based learning. Its deficient activation may be a key factor underlying deficient reward functions including reward anticipation and reward based learning that have been implicated as major drivers of negative symptoms of schizophrenia. Therefore, inhibition of PDE10 could be a way to ameliorate such deficits and consequently negative symptoms. In healthy volunteers the PDE10 inhibitor RG7203 indeed enhanced performance in tasks that probed reward functioning suggestive of its potential utility to treat negative symptoms in schizophrenia. We therefore tested the hypothesis that it should enhance imaging and behavioral markers of reward functions in patients with moderate negative symptoms in order to establish mechanistic proof of its utility as treatment of negative symptoms. <h4>Methods</h4> In a three-way cross-over study we investigated the effects of two doses of RG7203 (5 mg and 15 mg) and placebo given as adjunctive treatment to stable background antipsychotic treatment on reward functioning and reward-based effortful behavior using the monetary incentive delay (MID) task during fMRI and the effort choice task in patients with chronic schizophrenia and moderate levels of negative symptoms (PANSS negative symptom factor score ≥ 18 points). Each treatment period lasted three weeks followed by a 2 week washout period. fMRI and behavioral tasks were administered at the end of each treatment period. Key outcome measures were the differential BOLD during reward anticipation and overall BOLD activity during the MID task and the percentage of high-effort high-reward choices when the probability of reward was 100% during the effort choice task. <h4>Results</h4> Thirty-three patients with schizophrenia (30 male; 21 B, 9 W, 3 A; mean age 36.6 ± 7 y; PANSS NSFS = 22.8 (±1.4) at screening) were recruited at three study centers in the US. Twenty-four subjects finished the entire study. RG7203 at 5 mg significantly increased differential BOLD activity during reward anticipation in the MID task. However, this enhancement occurred in the context of a significant decrease of BOLD activity across all conditions during the MID task under treatment with RG7203. RG7203 significantly worsened reward-based effortful behavior in the effort choice task (the high-effort high-reward choice: 67% for both doses of RG7203 versus 73% for placebo). Multiple regression revealed that the decrease in effortful behavior was significantly related to the decrease in overall BOLD activity during the MID task and not related to the difference of BOLD activity during reward anticipation versus the control condition. <h4>Discussion</h4> In contrast to our expectation and previous results in healthy volunteers, RG7203 worsened indices of reward functions which we hypothesize may be due to a further enhancement of D2 antagonistic activity. The results do not support the utility of a PDE10 inhibitor as adjunctive treatment for negative symptoms in patients with schizophrenia. Given the previous observation that RG7203 enhanced reward functions in healthy volunteers who were not treated with D2 antagonist, the results of our study point to potentially deleterious effects of D2 blockade on reward functions and by extension on negative symptoms of schizophrenia. They raise the question if the presence of D2 antagonistic treatment curtails the potential effects of any adjunctive treatment for negative symptoms.

Also flagged:group II metabotropic glutamate receptor 3mGlu3schizophreniaGRM3cognitive impairmentsmGlu5
Journal Article 2018-04-01 No Snippets Stansley B, Joffe M, Yohn S, Lindsley C, Niswender C, Jeffrey Conn P.
Show Full Abstract

No abstract available.

Also flagged:CD34regenerationgene expressionVEGF-Avasculogenesistissue regeneration
Journal Article 2018-04-01 No Snippets Hagiwara H, Higashibata A, Ogawa S, Kanazawa S, Mizuno H, Tanaka R.
Show Full Abstract

No abstract available.