Gene Literature Dashboard

Viewing June 2019 — 444 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← May 2019 July 2019 →
Also flagged:mental disordersWntLEF1mental illnessesneuropsychiatric disordersneurogenesis
Journal Article 2019-06-30 No Snippets Bem J, Brożko N, Chakraborty C, Lipiec MA, Koziński K, Nagalski A, Szewczyk ŁM, Wiśniewska MB.
Show Full Abstract

Canonical Wnt signaling, which is transduced by β-catenin and lymphoid enhancer factor 1/T cell-specific transcription factors (LEF1/TCFs), regulates many aspects of metazoan development and tissue renewal. Although much evidence has associated canonical Wnt/β-catenin signaling with mood disorders, the mechanistic links are still unknown. Many components of the canonical Wnt pathway are involved in cellular processes that are unrelated to classical canonical Wnt signaling, thus further blurring the picture. The present review critically evaluates the involvement of classical Wnt/β-catenin signaling in developmental processes that putatively underlie the pathology of mental illnesses. Particular attention is given to the roles of LEF1/TCFs, which have been discussed surprisingly rarely in this context. Highlighting recent discoveries, we propose that alterations in the activity of LEF1/TCFs, and particularly of transcription factor 7-like 2 (TCF7L2), result in defects previously associated with neuropsychiatric disorders, including imbalances in neurogenesis and oligodendrogenesis, the functional disruption of thalamocortical circuitry and dysfunction of the habenula.

Also flagged:Hyaluronic AcidcancertumorHAcluster determinant 44CD44
Journal Article 2019-06-30 No Snippets Kim K, Choi H, Choi ES, Park MH, Ryu JH.
Show Full Abstract

Hyaluronic acid (HA) has been widely investigated in cancer therapy due to its excellent characteristics. HA, which is a linear anionic polymer, has biocompatibility, biodegradability, non-immunogenicity, non-inflammatory, and non-toxicity properties. Various HA nanomedicines (i.e., micelles, nanogels, and nanoparticles) can be prepared easily using assembly and modification of its functional groups such as carboxy, hydroxy and <i>N</i>-acetyl groups. Nanometer-sized HA nanomedicines can selectively deliver drugs or other molecules into tumor sites via their enhanced permeability and retention (EPR) effect. In addition, HA can interact with overexpressed receptors in cancer cells such as cluster determinant 44 (CD44) and receptor for HA-mediated motility (RHAMM) and be degraded by a family of enzymes called hyaluronidase (HAdase) to release drugs or molecules. By interaction with receptors or degradation by enzymes inside cancer cells, HA nanomedicines allow enhanced targeting cancer therapy. In this article, recent studies about HA nanomedicines in drug delivery systems, photothermal therapy, photodynamic therapy, diagnostics (because of the high biocompatibility), colloidal stability, and cancer targeting are reviewed for strategies using micelles, nanogels, and inorganic nanoparticles.

Also flagged:Medulloblastomabrain tumorscancerdegradationcell proliferationcell differentiation
Journal Article 2019-06-30 No Snippets Mollashahi B, Aghamaleki FS, Movafagh A.
Show Full Abstract

Medulloblastoma is considered one of the most threatening malignant brain tumors with an extremely high mortality rate in children. In the medulloblastoma, there are several genes and mutations found to work in an unregulated manner that works together to push the cells into a cancerous state. With the discovery of non-coding RNAs such as microRNAs (miRNAs), it has been shown that a different layer of gene regulations may be disrupted which would cause cancer. This fact led scientists to put their focus on the role of miRNAs in cancer. A mature miRNA contains a seed sequence which gives the miRNA to identify and attach to the interest mRNA; this attachment may lead degradation of mRNA or suppress of translation of the mRNA. The expression of miRNAs in medulloblastoma shows that some of these non-coding RNAs are overexpressed (OncomiRs) which help cells to proliferate and keep their stemness features. On the other hand, there are other forms of these miRNAs which normally inhibit cell proliferation and promote cell differentiation (tumor suppressor). These are down-regulated during cancer progression. In this systematic review, we attempted to gather several important studies on miRNAs' role in medulloblastoma tumors and the importance of these non-coding RNAs in the future study of cancer.

Also flagged:Myeloproliferative neoplasmprimary myelofibrosischemokinesmyelofibrosisMFJAK2
Journal Article 2019-06-30 No Snippets Gleitz HFE, Pritchard JE, Kramann R, Schneider RK.
Show Full Abstract

No abstract available.

Also flagged:iron-regulatory hormoneironerythropoiesisHepcidintoiron-related disorders
Journal Article 2019-06-30 ✓ 1 Snippet Armitage AE, Drakesmith H.
In-Text Gene Mentions

AI = Anemia of Inflammation, CKD = Chronic Kidney Disease, HH = Hereditary Haemochromatosis – (HFE), caused by mutation in the HFE gene; (HJV/TfR2/HAMP), caused by mutations in Hemojuvelin, transferrin receptor 2 and hepcidin respectively, IBD = Inflammatory Bowel Disease, ICU = Intensive Care Unit, ID = Iron deficiency, IDA = Iron deficiency anemia, IRIDA = Iron-refractory iron deficiency anemia, LMIC = Low-/Middle-Income Country, NTDT = Non-transfusion dependent beta-Thalassemia, RA = Rheumatoid Arthritis, TDT = transfusion dependent beta-Thalassemia.

Show Full Abstract

No abstract available.

Also flagged:ironiron deficiencyethylenechronic kidney diseaseNOXoligonucleotide
Journal Article 2019-06-30 No Snippets Bennett C, Pasricha SR.
Show Full Abstract

No abstract available.

Also flagged:Tropomyosin Receptor KinaseNTRKcancerslarotrectinibreversetranscription
Journal Article 2019-06-29 No Snippets Wong D, Yip S, Sorensen PH.
Show Full Abstract

NTRK gene fusions affecting the tropomyosin receptor kinase (TRK) protein family have been found to be oncogenic drivers in a broad range of cancers. Small molecule inhibitors targeting TRK activity, such as the recently Food and Drug Administration-approved agent larotrectinib (Vitrakvi®), have shown promising efficacy and safety data in the treatment of patients with TRK fusion cancers. NTRK gene fusions can be detected using several different approaches, including fluorescent in situ hybridization, reverse transcription polymerase chain reaction, immunohistochemistry, next-generation sequencing, and ribonucleic acid-based multiplexed assays. Identifying patients with cancers that harbor NTRK gene fusions will optimize treatment outcomes by providing targeted precision therapy.

Also flagged:SERPING1platelet degranulationhemostasispost-translational proteinphosphorylationmetabolism
Journal Article 2019-06-29 ✓ 5 Snippets Brzhozovskiy AG, Kononikhin AS, Pastushkova LC, Kashirina DN, Indeykina MI, Popov IA, Custaud MA, Larina IM, Nikolaev EN.
In-Text Gene Mentions

…SERPINA1, SERPINA3, SERPING1,SERPINC1, HP, CFB, TF…

…( ATRN, CFB,SERPINC1, SERPINA1, SERPINA3, AGT,…

…( HP, CFB,SERPINC1, SERPINA1, SERPINA3, A2M,…

…F5, SERPINA1, SERPINA3,SERPINC1, and SERPING1…

…F5, F13A1, F13B,SERPINC1) and internal…

Show Full Abstract

The aim of the study was to compare proteomic data on the effects of spaceflight factors on the human body, including both real space missions and ground-based experiments. LC-MS/MS-based proteomic analysis of blood plasma samples obtained from 13 cosmonauts before and after long-duration (169-199 days) missions on the International Space Station (ISS) and for five healthy men included in 21-day-long head-down bed rest (HDBR) and dry immersion experiments were performed. The semi-quantitative label-free analysis revealed significantly changed proteins: 19 proteins were significantly different on the first (+1) day after landing with respect to background levels; 44 proteins significantly changed during HDBR and 31 changed in the dry immersion experiment. Comparative analysis revealed nine common proteins (<i>A1BG, A2M, SERPINA1, SERPINA3, SERPING1, SERPINC1, HP, CFB, TF</i>), which changed their levels after landing, as well as in both ground-based experiments. Common processes, such as platelet degranulation, hemostasis, post-translational protein phosphorylation and processes of protein metabolism, indicate common pathogenesis in ground experiments and during spaceflight. Dissimilarity in the lists of significantly changed proteins could be explained by the differences in the dynamics of effective development in the ground-based experiments. Data are available via ProteomeXchange using the identifier PXD013305.

Also flagged:2-allylphenolphenyllactic acidestragoleeugenol-allyl
Journal Article 2019-06-29 No Snippets Tabanca N, Masi M, Epsky ND, Nocera P, Cimmino A, Kendra PE, Niogret J, Evidente A.
Show Full Abstract

<i>Ceratitis capitata</i>, the Mediterranean fruit fly, is one of the most serious agricultural pests worldwide responsible for significant reduction in fruit and vegetable yields. Eradication is expensive and often not feasible. Current control methods include the application of conventional insecticides, leading to pesticide resistance and unwanted environmental effects. The aim of this study was to identify potential new attractants for incorporation into more environmentally sound management programs for <i>C. capitata</i>. In initial binary choice bioassays against control, a series of naturally occurring plant and fungal aromatic compounds and their related analogs were screened, identifying phenyllactic acid (<b>7</b>), estragole (<b>24</b>), <i>o</i>-eugenol (<b>21</b>), and 2-allylphenol (<b>23</b>) as promising attractants for male <i>C. capitata.</i> Subsequent binary choice tests evaluated five semisynthetic derivatives prepared from 2-allylphenol, but none of these were as attractive as 2-allylphenol. In binary choice bioassays with the four most attractive compounds, males were more attracted to <i>o</i>-eugenol (<b>21</b>) than to estragole (<b>24</b>), 2-allylphenol (<b>23</b>), or phenyllactic acid (<b>7</b>). In addition, electroantennography (EAG) was used to quantify antennal olfactory responses to the individual compounds (<b>1</b>-<b>29</b>), and the strongest EAG responses were elicited by 1-allyl-4-(trifluoromethyl)benzene (<b>11</b>), estragole (<b>24</b>), 4-allyltoluene (<b>14</b>), <i>tran</i>s-anethole (<b>9</b>), <i>o</i>-eugenol (<b>21</b>), and 2-allylphenol (<b>23</b>). The compounds evaluated in the current investigation provide insight into chemical structure-function relationships and help direct future efforts in the development of improved attractants for the detection and control of invasive <i>C. capitata.</i>

Also flagged:GPCRpsychiatric disordersschizophreniabipolar disorderG-protein coupled receptorsGPCRs
Journal Article 2019-06-29 No Snippets Komatsu H, Fukuchi M, Habata Y.
Show Full Abstract

Tremendous advances have been made recently in the identification of genes and signaling pathways associated with the risks for psychiatric disorders such as schizophrenia and bipolar disorder. However, there has been a marked reduction in the pipeline for the development of new psychiatric drugs worldwide, mainly due to the complex causes that underlie these disorders. G-protein coupled receptors (GPCRs) are the most common targets of antipsychotics such as quetiapine and aripiprazole, and play pivotal roles in controlling brain function by regulating multiple downstream signaling pathways. Progress in our understanding of GPCR signaling has opened new possibilities for selective drug development. A key finding has been provided by the concept of biased ligands, which modulate some, but not all, of a given receptor's downstream signaling pathways. Application of this concept raises the possibility that the biased ligands can provide therapeutically desirable outcomes with fewer side effects. Instead, this application will require a detailed understanding of the mode of action of antipsychotics that drive distinct pharmacologies. We review our current understanding of the mechanistic bases for multiple signaling modes by antipsychotics and the potential of the biased modulators to treat mental disorders.

Also flagged:metalswaterbiopolymerspolymersCellulosemacromolecule
Journal Article 2019-06-29 No Snippets Liu H, Jian R, Chen H, Tian X, Sun C, Zhu J, Yang Z, Sun J, Wang C.
Show Full Abstract

With the continuous increase in the production of electronic devices, large amounts of electronic waste (E-waste) are routinely being discarded into the environment. This causes serious environmental and ecological problems because of the non-degradable polymers, released hazardous chemicals, and toxic heavy metals. The appearance of biodegradable polymers, which can be degraded or dissolved into the surrounding environment with no pollution, is promising for effectively relieving the environmental burden. Additionally, biodegradable polymers are usually biocompatible, which enables electronics to be used in implantable biomedical applications. However, for some specific application requirements, such as flexibility, electric conductivity, dielectric property, gas and water vapor barrier, most biodegradable polymers are inadequate. Recent research has focused on the preparation of nanocomposites by incorporating nanofillers into biopolymers, so as to endow them with functional characteristics, while simultaneously maintaining effective biodegradability and biocompatibility. As such, bionanocomposites have broad application prospects in electronic devices. In this paper, emergent biodegradable and biocompatible polymers used as insulators or (semi)conductors are first reviewed, followed by biodegradable and biocompatible nanocomposites applied in electronics as substrates, (semi)conductors and dielectrics, as well as electronic packaging, which is highlighted with specific examples. To finish, future directions of the biodegradable and biocompatible nanocomposites, as well as the challenges, that must be overcome are discussed.

Also flagged:DLK1NotchDelta-like homologue 1preadipocyte factor 1Sf1Shh
Journal Article 2019-06-29 ✓ 1 Snippet Hadjidemetriou I, Mariniello K, Ruiz-Babot G, Pittaway J, Mancini A, Mariannis D, Gomez-Sanchez CE, Parvanta L, Drake WM, Chung TT, Abdel-Aziz TE, DiMarco A, Palazzo FF, Wierman ME, Kiseljak-Vassiliades K, King PJ, Guasti L.
In-Text Gene Mentions

DCC

Show Full Abstract

The adrenal cortex governs fundamental metabolic processes though synthesis of glucocorticoid, mineralocorticoids and androgens. Studies in rodents have demonstrated that the cortex undergoes a self-renewal process and that capsular/subcapsular stem/progenitor cell pools differentiate towards functional steroidogenic cells supporting the dynamic centripetal streaming of adrenocortical cells throughout life. We previously demonstrated that the Notch atypical ligand Delta-like homologue 1 (DLK1)/preadipocyte factor 1 (PREF1) is expressed in subcapsular Sf1 and Shh-positive, CYP11B1-negative and CYP11B2-partially positive cortical progenitor cells in rat adrenals, and that secreted DLK1 can modulate GLI1 expression in H295R cells. Here we show that the human adrenal cortex remodels with age to generate clusters of relatively undifferentiated cells expressing DLK1. These clusters (named DLK1-expressing cell clusters or DCCs) increased with age in size and were found to be different entities to aldosterone-producing cell clusters, another well-characterized and age-dependent cluster structure. DLK1 was markedly overexpressed in adrenocortical carcinomas but not in aldosterone-producing adenomas. Thus, this data identifies a novel cell population in the human adrenal cortex and might suggest a yet-to be identified role of DLK1 in the pathogenesis of adrenocortical carcinoma in humans.

Also flagged:HDHuntington's diseasemixed movement disorderbehaviouralcognitive declineHuntingtin
Journal Article 2019-06-29 ✓ 5 Snippets Kubera KM, Schmitgen MM, Hirjak D, Wolf RC, Orth M.
In-Text Gene Mentions

Given that for instance striatal volume loss was not evident in very far from onset carriers of the HD mutation the brain structural phenotype of neurodegeneration may take many years, or even decades, to develop from the chronic expression of the HTT mutation (Gorges et al., 2017).

…mutation in theHTTgene causes Huntington's…

…expression of theHTTmutation ( Gorges…

HTTis a large…

HTTseems important in…

Show Full Abstract

<h4>Background</h4>The expression of the HTT CAG repeat expansion mutation causes neurodegeneration in Huntington's disease (HD).<h4>Objectives</h4>In light of the - mainly in-vitro - evidence suggesting an additional role of huntingtin in neurodevelopment we used 3T MRI to test the hypothesis that in CAG-expanded individuals without clinical signs of HD (preHD) there is evidence for neurodevelopmental abnormalities.<h4>Methods</h4>We specifically investigated the complexity of cortical folding, a measure of cortical neurodevelopment, employing a novel method to quantify local fractal dimension (FD) measures that uses spherical harmonic reconstructions.<h4>Results</h4>The complexity of cortical folding differed at a group level between preHD (n = 57) and healthy volunteers (n = 57) in areas of the motor and visual system as well as temporal cortical areas. However, there was no association between the complexity of cortical folding and the loss in putamen volume that was clearly evident in preHD.<h4>Conclusions</h4>Our results suggest that HTT CAG repeat length may have an influence on cortical folding without evidence that this leads to developmental pathology or was clinically meaningful. This suggests that the HTT CAG-repeat expansion mutation may influence the processes governing cortical neurodevelopment; however, that influence seems independent of the events that lead to neurodegeneration.

Also flagged:Macro-aspartate Aminotransferaseaspartate aminotransferaseASTchronic liver diseasenon-alcoholic fatty liver diseasepolyethylene glycol
Journal Article 2019-06-29 ✓ 1 Snippet Sharma N, Darr U, Darr A, Sood GK.
In-Text Gene Mentions

…hepatitis, viral hepatitis,hemochromatosis, autoimmune hepatitis, Wilson…

Show Full Abstract

Persistent elevation of aspartate aminotransferase (AST) activity in serum due to the presence of a macro-enzyme form of AST (macro-AST) may lead to diagnostic confusion in many clinical conditions, particularly in those associated with chronic liver disease. We present a case of macro-AST in a patient with non-alcoholic fatty liver disease in which polyethylene glycol precipitation confirmed the cause of disproportionately elevated AST as macro-AST.

Also flagged:PosaconazoleHemolysincell surfaceoral candidiasistubesdenture stomatitis
Journal Article 2019-06-28 No Snippets Ellepola ANB, Dassanayake RS, Khan Z.
Show Full Abstract

<h4>Objective</h4>Candidal adherence to denture acrylic surfaces (DAS) and oral buccal epithelial cells (BEC), formation of candidal germ tubes (GT), candidal cell surface hydrophobicity (CSH), and hemolysin production are important pathogenic traits of Candida. The antifungal drug-induced post-antifungal effect (PAFE) also impacts the virulence of Candida. Candida dubliniensis isolates are associated with the causation of oral candidiasis which could be managed with posaconazole. Thus far there is no evidence on posaconazole-induced PAFE and its impact on adhesion-related attributes and production of hemolysin by C. dubliniensis isolates. Hence, the PAFE, adhesion to DAS and BEC, formation of GT, CSH, and hemolysin production of 20 oral C. dubliniensis isolates after brief exposure to posaconazole was ascertained.<h4>Materials and methods</h4>The PAFE, adherence to DAS and BEC, formation of GT, candidal CSH, and hemolysin production were investigated by hitherto described in vitro assays.<h4>Results</h4>The mean PAFE (h) induced by posaconazole on C. dubliniensis isolates was 1.66. Exposure to posaconazole suppressed the ability of C. dubliniensis to adhere to DAS, BEC, formation of candidal GT, candidal CSH and to produce hemolysin by a reduction of 44, 33, 34, 36, and 15% (p < 0.005 to p < 0.001), respectively.<h4>Conclusion</h4>Exposure of C. dubliniensis isolates to posaconazole for a brief period induced an antimycotic impact by subduing its growth in addition to suppressing pathogenic adherence-associated attributes, as well as production of hemolysin.

Also flagged:colorectal cancerstumorcolorectal cancercancerantigen presentation-checkpoint
Journal Article 2019-06-28 No Snippets Rospo G, Lorenzato A, Amirouchene-Angelozzi N, Magrì A, Cancelliere C, Corti G, Negrino C, Amodio V, Montone M, Bartolini A, Barault L, Novara L, Isella C, Medico E, Bertotti A, Trusolino L, Germano G, Di Nicolantonio F, Bardelli A.
Show Full Abstract

<h4>Background</h4>Neoantigens that arise as a consequence of tumor-specific mutations can be recognized by T lymphocytes leading to effective immune surveillance. In colorectal cancer (CRC) and other tumor types, a high number of neoantigens is associated with patient response to immune therapies. The molecular processes governing the generation of neoantigens and their turnover in cancer cells are poorly understood. We exploited CRC as a model system to understand how alterations in DNA repair pathways modulate neoantigen profiles over time.<h4>Methods</h4>We performed whole exome sequencing (WES) and RNA sequencing (RNAseq) in CRC cell lines, in vitro and in vivo, and in CRC patient-derived xenografts (PDXs) to track longitudinally genomic profiles, clonal evolution, mutational signatures, and predicted neoantigens.<h4>Results</h4>The majority of CRC models showed remarkably stable mutational and neoantigen profiles; however, those carrying defects in DNA repair genes continuously diversified. Rapidly evolving and evolutionary stable CRCs displayed characteristic genomic signatures and transcriptional profiles. Downregulation of molecules implicated in antigen presentation occurred selectively in highly mutated and rapidly evolving CRC.<h4>Conclusions</h4>These results indicate that CRCs carrying alterations in DNA repair pathways display dynamic neoantigen patterns that fluctuate over time. We define CRC subsets characterized by slow and fast evolvability and link this phenotype to downregulation of antigen-presenting cellular mechanisms. Longitudinal monitoring of the neoantigen landscape could be relevant in the context of precision medicine.

Also flagged:Trigeminal Ganglion NociceptorsNociceptorsgene expressionribosometranslationalmechanistic target of rapamycin
Journal Article 2019-06-28 No Snippets Megat S, Ray PR, Tavares-Ferreira D, Moy JK, Sankaranarayanan I, Wanghzou A, Fang Lou T, Barragan-Iglesias P, Campbell ZT, Dussor G, Price TJ.
Show Full Abstract

Nociceptors located in the trigeminal ganglion (TG) and DRG are the primary sensors of damaging or potentially damaging stimuli for the head and body, respectively, and are key drivers of chronic pain states. While nociceptors in these two tissues show a high degree of functional similarity, there are important differences in their development lineages, their functional connections to the CNS, and recent genome-wide analyses of gene expression suggest that they possess some unique genomic signatures. Here, we used translating ribosome affinity purification to comprehensively characterize and compare mRNA translation in <i>Scn10a</i>-positive nociceptors in the TG and DRG of male and female mice. This unbiased method independently confirms several findings of differences between TG and DRG nociceptors described in the literature but also suggests preferential utilization of key signaling pathways. Most prominently, we provide evidence that translational efficiency in mechanistic target of rapamycin (mTOR)-related genes is higher in the TG compared with DRG, whereas several genes associated with the negative regulator of mTOR, AMP-activated protein kinase, have higher translational efficiency in DRG nociceptors. Using capsaicin as a sensitizing stimulus, we show that behavioral responses are greater in the TG region and this effect is completely reversible with mTOR inhibition. These findings have implications for the relative capacity of these nociceptors to be sensitized upon injury. Together, our data provide a comprehensive, comparative view of transcriptome and translatome activity in TG and DRG nociceptors that enhances our understanding of nociceptor biology.<b>SIGNIFICANCE STATEMENT</b> The DRG and trigeminal ganglion (TG) provide sensory information from the body and head, respectively. Nociceptors in these tissues are critical first neurons in the pain pathway. Injury to peripheral neurons in these tissues can cause chronic pain. Interestingly, clinical and preclinical findings support the conclusion that injury to TG neurons is more likely to cause chronic pain and chronic pain in the TG area is more intense and more difficult to treat. We used translating ribosome affinity purification technology to gain new insight into potential differences in the translatomes of DRG and TG neurons. Our findings demonstrate previously unrecognized differences between TG and DRG nociceptors that provide new insight into how injury may differentially drive plasticity states in nociceptors in these two tissues.

Also flagged:NeuNDARPP32sucroseCFL_valNPR
Journal Article 2019-06-28 ✓ 1 Snippet Jaric I, Rocks D, Greally JM, Suzuki M, Kundakovic M.
In-Text Gene Mentions

…including nuclear chromatin,histone deacetylase complexdeacetylase complex, SWI/SNF…

Show Full Abstract

Male and female brains differ significantly in both health and disease, and yet the female brain has been understudied. Sex-hormone fluctuations make the female brain particularly dynamic and are likely to confer female-specific risks for neuropsychiatric disorders. The molecular mechanisms underlying the dynamic nature of the female brain structure and function are unknown. Here we show that neuronal chromatin organization in the female ventral hippocampus of mouse fluctuates with the oestrous cycle. We find chromatin organizational changes associated with the transcriptional activity of genes important for neuronal function and behaviour. We link these chromatin dynamics to variation in anxiety-related behaviour and brain structure. Our findings implicate an immediate-early gene product, Egr1, as part of the mechanism mediating oestrous cycle-dependent chromatin and transcriptional changes. This study reveals extreme, sex-specific dynamism of the neuronal epigenome, and establishes a foundation for the development of sex-specific treatments for disorders such as anxiety and depression.

Also flagged:salvianic acid Asodiummyocardial infarctionIschemic heart diseasesSalvianic acid A sodiumcardiovascular diseases
Journal Article 2019-06-28 ✓ 4 Snippets Jia D, Zhang CZ, Qiu Y, Chen XF, Jia L, Chen AF, Chai YF, Zhu ZY, Huang J, Zhang C.
In-Text Gene Mentions

Maoa (amine oxidase [flavin-containing] A), Ppic (peptidyl-prolyl cis–trans isomerase C), Anxa2 (annexin A2), Postn (periostin), Uap1 (UDP-N-acetylhexosamine pyrophosphorylase), Fbn1 (fibrillin-1), Anxa1 (annexin A1), Ptgis (prostacyclin synthase), Col1a1 (collagen alpha-1(I) chain), Mfap5 (microfibrillar-associated protein 5), Prelp (prolargin), and Vcan (versican core protein) were upregulated, while Macrod1 (O-acetyl-ADP-ribose deacetylase MACROD1) and Tmod4 (tropomodulin-4) were downregulated in the MI model group compared to the sham group at both the proteome and transcriptome levels.

…Anxa1 (annexin A1),Ptgis(prostacyclin synthase), Col1a…

…Uap1, Fbn1, Anxa1,Ptgis, Col1a1, Mfap5, Prelp,…

…activity of thePtgisgene could be…

Show Full Abstract

Ischemic heart diseases (IHDs) cause great morbidity and mortality worldwide, necessitating effective treatment. Salvianic acid A sodium (SAAS) is an active compound derived from the well-known herbal medicine Danshen, which has been widely used for clinical treatment of cardiovascular diseases in China. This study aimed to confirm the cardioprotective effects of SAAS in rats with myocardial infarction and to investigate the underlying molecular mechanisms based on proteome and transcriptome profiling of myocardial tissue. The results showed that SAAS effectively protected against myocardial injury and improved cardiac function. The differentially expressed proteins and genes included important structural molecules, receptors, transcription factors, and cofactors. Functional enrichment analysis indicated that SAAS participated in the regulation of actin cytoskeleton, phagosome, focal adhesion, tight junction, apoptosis, MAPK signaling, and Wnt signaling pathways, which are closely related to cardiovascular diseases. SAAS may exert its cardioprotective effect by targeting multiple pathways at both the proteome and transcriptome levels. This study has provided not only new insights into the pathogenesis of myocardial infarction but also a road map of the cardioprotective molecular mechanisms of SAAS, which may provide pharmacological evidence to aid in its clinical application.

Also flagged:COL6A1CACNA1Bautoimmune disordersdiabetes type 1viral myocarditisof
Journal Article 2019-06-28 ✓ 1 Snippet Soerensen M, Li W, Debrabant B, Nygaard M, Mengel-From J, Frost M, Christensen K, Christiansen L, Tan Q.
In-Text Gene Mentions

…protein 311 (ZNF311) and spermatogenesis…

Show Full Abstract

Hand grip strength is a measure of muscular strength and is used to study age-related loss of physical capacity. In order to explore the biological mechanisms that influence hand grip strength variation, an epigenome-wide association study (EWAS) of hand grip strength in 672 middle-aged and elderly monozygotic twins (age 55-90 years) was performed, using both individual and twin pair level analyses, the latter controlling the influence of genetic variation. Moreover, as measurements of hand grip strength performed over 8 years were available in the elderly twins (age 73-90 at intake), a longitudinal EWAS was conducted for this subsample. No genome-wide significant CpG sites or pathways were found, however two of the suggestive top CpG sites were mapped to the COL6A1 and CACNA1B genes, known to be related to muscular dysfunction. By investigating genomic regions using the comb-p algorithm, several differentially methylated regions in regulatory domains were identified as significantly associated to hand grip strength, and pathway analyses of these regions revealed significant pathways related to the immune system, autoimmune disorders, including diabetes type 1 and viral myocarditis, as well as negative regulation of cell differentiation. The genes contributing to the immunological pathways were HLA-B, HLA-C, HLA-DMA, HLA-DPB1, MYH10, ERAP1 and IRF8, while the genes implicated in the negative regulation of cell differentiation were IRF8, CEBPD, ID2 and BRCA1. In conclusion, this exploratory study suggests hand grip strength to associate with differentially methylated regions enriched in immunological and cell differentiation pathways, and hence merits further investigations.

Also flagged:Spinal muscular atrophy with respiratory distress type 1SMARD1distal limb muscle atrophymotor neuron diseasesneurodegenerative diseaseMyHC-IIb
Journal Article 2019-06-28 ✓ 1 Snippet Villalón E, Lee NN, Marquez J, Lorson CL.
In-Text Gene Mentions

ABT1

Show Full Abstract

Spinal muscular atrophy with respiratory distress type 1 (SMARD1) is an autosomal recessive disease that causes distal limb muscle atrophy, due to motor neuron degeneration. Similar to other motor neuron diseases, SMARD1 shows differential vulnerability to denervation in various muscle groups, which is recapitulated in the nmd mouse, a model of SMARD1. In multiple neurodegenerative disease models, transcriptomic analysis has identified differentially expressed genes between vulnerable motor neuron populations, but the mechanism leading to susceptibility is largely unknown. To investigate if denervation vulnerability is linked to intrinsic muscle properties, we analyzed muscle fiber-type composition in muscles from motor units that show different degrees of denervation in nmd mice: gastrocnemius, tibialis anterior (TA), and extensor digitorum longus (EDL). Our results revealed that denervation vulnerability correlated with atrophy and loss of MyHC-IIb and MyHC-IIx muscle fiber types. Interestingly, increased vulnerability also correlated with an increased abundance of MyHC-I and MyHC-IIa muscle fibers. These results indicated that MyHC-IIx muscle fibers are the most vulnerable to denervation, followed by MyHC-IIb muscle fibers. Moreover, our data indicate that type MyHC-IIa and MyHC-IIb muscle fibers show resistance to denervation and compensate for the loss of MyHC-IIx and MyHC-IIb muscle fibers in the most vulnerable muscles. Taken together these results provide a basis for the selective vulnerability to denervation of specific muscles in nmd mice and identifies new targets for potential therapeutic intervention.

Also flagged:chronic kidney diseasenephrosisGene expressionNPHS2stomatinactivating transcription factor 3
Journal Article 2019-06-28 ✓ 1 Snippet Guo Y, Ma J, Xiao L, Fang J, Li G, Zhang L, Xu L, Lai X, Pan G, Chen Z.
In-Text Gene Mentions

…TNF-α-induced protein 8,β-1,4-galactosyltransferase 55, serpin family…

Show Full Abstract

Chronic kidney disease (CKD) is a highly heterogeneous nephrosis that occurs when the structure and function of the kidney is damaged. Gene expression studies have been widely used to elucidate various biological processes; however, the gene expression profile of CKD is currently unclear. The present study aimed to identify diagnostic biomarkers and therapeutic targets using renal biopsy sample data from patients with CKD. Gene expression data from 30 patients with CKD and 21 living donors were analyzed by weighted gene co‑expression network analysis (WGCNA), in order to identify gene networks and profiles for CKD, as well as its specific characteristics, and to potentially uncover diagnostic biomarkers and therapeutic targets for patients with CKD. In addition, functional enrichment analysis was performed on co‑expressed genes to determine modules of interest. Four co‑expression modules were constructed from the WGCNA. The number of genes in the constructed modules ranged from 269 genes in the Turquoise module to 60 genes in the Yellow module. All four co‑expression modules were correlated with CKD clinical traits (P<0.05). For example, the Turquoise module, which mostly contained genes that were upregulated in CKD, was positively correlated with CKD clinical traits, whereas the Blue, Brown and Yellow modules were negatively correlated with clinical traits. Functional enrichment analysis revealed that the Turquoise module was mainly enriched in genes associated with the 'defense response', 'mitotic cell cycle' and 'collagen catabolic process' Gene Ontology (GO) terms, implying that genes involved in cell cycle arrest and fibrogenesis were upregulated in CKD. Conversely, the Yellow module was mainly enriched in genes associated with 'glomerulus development' and 'kidney development' GO terms, indicating that genes associated with renal development and damage repair were downregulated in CKD. The hub genes in the modules were acetyl‑CoA carboxylase α, cyclin‑dependent kinase 1, Wilm's tumour 1, NPHS2 stomatin family member, podocin, JunB proto‑oncogene, AP‑1 transcription factor subunit, activating transcription factor 3, forkhead box O1 and v‑abl Abelson murine leukemia viral oncogene homolog 1, which were confirmed to be significantly differentially expressed in CKD biopsies. Combining the eight hub genes enabled a high capacity for discrimination between patients with CKD and healthy subjects, with an area under the receiver operating characteristic curve of 1.00. In conclusion, this study provided a framework for co‑expression modules of renal biopsy samples from patients with CKD and living donors, and identified several potential diagnostic biomarkers and therapeutic targets for CKD.

Also flagged:CopperfestagypsumINSneutronDC1
Journal Article 2019-06-28 No Snippets Festa G, Andreani C, Baldoni M, Cipollari V, Martínez-Labarga C, Martini F, Rickards O, Rolfo MF, Sarti L, Volante N, Senesi R, Stasolla FR, Parker SF, Vassalo AR, Mamede AP, Batista de Carvalho LAE, Marques MPM.
Show Full Abstract

Burned skeletal remains are abundant in archaeological and paleontological sites, the result of fire or of ancient funerary practices. In the burning process, the bone matrix suffers structural and dimensional changes that interfere with the reliability of available osteometric methods. Recent studies showed that these macroscopic changes are accompanied by microscopic variations are reflected in vibrational spectra. An innovative integrated approach to the study of archaeological combusted skeletal remains is reported here, where the application of complementary vibrational spectroscopic techniques-INS (inelastic neutron scattering), FTIR (Fourier transform infrared), and micro-Raman-enables access to the complete vibrational profile and constitutes the first application of neutron spectroscopy to ancient bones. Comparison with data from modern human bones that were subjected to controlled burning allowed identification of specific heating conditions. This pioneering study provides archaeologists and anthropologists with relevant information on past civilizations, including regarding funerary, burial, and cooking practices and environmental settings.

Also flagged:FluorinepositronsynthesisbindingFluorofuranylnorprogesteroneDihydrotestosterone
Journal Article 2019-06-28 No Snippets Basuli F, Zhang X, Blackman B, White ME, Jagoda EM, Choyke PL, Swenson RE.
Show Full Abstract

To further explore the scope of our recently developed "fluorination on Sep-Pak" method, we prepared two well-known positron emission tomography (PET) tracers 21-[<sup>18</sup>F]fluoro-16α,17α-[(R)-(1'-α-furylmethylidene)dioxy]-19-norpregn-4-ene-3,20-dione furanyl norprogesterone ([<sup>18</sup>F]FFNP) and 16β-[<sup>18</sup>F]fluoro-5α-dihydrotestosterone ([<sup>18</sup>F]FDHT). Following the "fluorination on Sep-Pak" method, over 70% elution efficiency was observed with 3 mg of triflate precursor of [<sup>18</sup>F]FFNP. The overall yield of [<sup>18</sup>F]FFNP was 64-72% (decay corrected) in 40 min synthesis time with a molar activity of 37-81 GBq/µmol (1000-2200 Ci/mmol). Slightly lower elution efficiency (~55%) was observed with the triflate precursor of [<sup>18</sup>F]FDHT. Fluorine-18 labeling, reduction, and deprotection to prepare [<sup>18</sup>F]FDHT were performed on Sep-Pak cartridges (PS-HCO<sub>3</sub> and Sep-Pak plus C-18). The overall yield of [<sup>18</sup>F]FDHT was 25-32% (decay corrected) in 70 min. The molar activity determined by using mass spectrometry was 63-148 GBq/µmol (1700-4000 Ci/mmol). Applying this quantitative measure of molar activity to in vitro assays [<sup>18</sup>F]FDHT exhibited high-affinity binding to androgen receptors (K<sub>d</sub>~2.5 nM) providing biological validation of this method.

Also flagged:ATMataxia telangiectasia mutatedcytoplasmicnucleusH2AXhistones
Journal Article 2019-06-28 No Snippets Berthel E, Foray N, Ferlazzo ML.
Show Full Abstract

The evaluation of radiation-induced (RI) risks is of medical, scientific, and societal interest. However, despite considerable efforts, there is neither consensual mechanistic models nor predictive assays for describing the three major RI effects, namely radiosensitivity, radiosusceptibility, and radiodegeneration. Interestingly, the ataxia telangiectasia mutated (ATM) protein is a major stress response factor involved in the DNA repair and signaling that appears upstream most of pathways involved in the three precited RI effects. The rate of the RI ATM nucleoshuttling (RIANS) was shown to be a good predictor of radiosensitivity. In the frame of the RIANS model, irradiation triggers the monomerization of cytoplasmic ATM dimers, which allows ATM monomers to diffuse in nucleus. The nuclear ATM monomers phosphorylate the H2AX histones, which triggers the recognition of DNA double-strand breaks and their repair. The RIANS model has made it possible to define three subgroups of radiosensitivity and provided a relevant explanation for the radiosensitivity observed in syndromes caused by mutated cytoplasmic proteins. Interestingly, hyper-radiosensitivity to a low dose and adaptive response phenomena may be also explained by the RIANS model. In this review, the relevance of the RIANS model to describe several features of the individual response to radiation was discussed.

Also flagged:GM2 gangliosidosisLysosomal Storage DiseasesdeathTay-SachsSandhoffneurogenesis
Journal Article 2019-06-28 ✓ 2 Snippets Morena F, Oikonomou V, Argentati C, Bazzucchi M, Emiliani C, Gritti A, Martino S.
In-Text Gene Mentions

For instance, miR-33, miR-124, and miR-126a control Netrin3 and the netrin-receptor (Dcc) genes within Axon netrin pathway, which meta-analysis correlated with the abnormal dendritic-like growth processes described in feline GM2 gangliosidosis [66,67], and with the impaired neurite outgrowth in the retina documented in SD mice [68].

…and the netrin-receptor (Dcc) genes within Axon…

Show Full Abstract

This work explores for the first time the potential contribution of microRNAs (miRNAs) to the pathophysiology of the GM2 gangliosidosis, a group of Lysosomal Storage Diseases. In spite of the genetic origin of GM2 gangliosidosis, the cascade of events leading from the gene/protein defects to the cell dysfunction and death is not fully elucidated. At present, there is no cure for patients. Taking advantage of the animal models of two forms of GM2 gangliosidosis, Tay-Sachs (TSD) and Sandhoff (SD) diseases, we performed a microRNA screening in the brain subventricular zone (SVZ) and striatum (STR), which feature the neurogenesis and neurodegeneration states, respectively, in adult mutant mice. We found abnormal expression of a panel of miRNAs involved in lipid metabolism, CNS development and homeostasis, and neuropathological processes, highlighting region- and disease-specific profiles of miRNA expression. Moreover, by using a computational analysis approach, we identified a unique disease- (SD or TSD) and brain region-specific (SVZ vs. STR) miRNAs signatures of predicted networks potentially related to the pathogenesis of the diseases. These results may contribute to the understanding of GM2 gangliosidosis pathophysiology, with the aim of developing effective treatments.

Also flagged:chromosomeMC1RSTX17ASIPLCORLNCAPG
Journal Article 2019-06-28 No Snippets Grilz-Seger G, Neuditschko M, Ricard A, Velie B, Lindgren G, Mesarič M, Cotman M, Horna M, Dobretsberger M, Brem G, Druml T.
Show Full Abstract

Intensive artificial and natural selection have shaped substantial variation among European horse breeds. Whereas most equine selection signature studies employ divergent genetic population structures in order to derive specific inter-breed targets of selection, we screened a total of 1476 horses originating from 12 breeds for the loss of genetic diversity by runs of homozygosity (ROH) utilizing a 670,000 single nucleotide polymorphism (SNP) genotyping array. Overlapping homozygous regions (ROH islands) indicating signatures of selection were identified by breed and similarities/dissimilarities between populations were evaluated. In the entire dataset, 180 ROH islands were identified, whilst 100 islands were breed specific, all other overlapped in 36 genomic regions with at least one ROH island of another breed. Furthermore, two ROH hot spots were determined at horse chromosome 3 (ECA3) and ECA11. Besides the confirmation of previously documented target genes involved in selection for coat color (<i>MC1R</i>, <i>STX17</i>, <i>ASIP</i>), body size (<i>LCORL/NCAPG</i>, <i>ZFAT</i>, <i>LASP1</i>, <i>HMGA2</i>), racing ability (<i>PPARGC1A</i>), behavioral traits (<i>GRIN2B</i>, <i>NTM/OP</i><i>C</i><i>ML</i>) and gait patterns (<i>DMRT3</i>), several putative target genes related to embryonic morphogenesis (<i>HOXB</i>), energy metabolism (<i>IGFBP</i><i>-</i><i>1</i>, <i>IGFBP</i>-<i>3</i>), hair follicle morphogenesis (<i>KRT25</i>, <i>KRT27</i>, <i>INTU</i>) and autophagy (<i>RALB</i>) were highlighted. Furthermore, genes were pinpointed which might be involved in environmental adaptation of specific habitats (<i>UVSSA</i>, <i>STXBP4</i>, <i>COX11</i>, <i>HLF</i>, <i>MMD</i>).

Also flagged:MethylationColorectal Cancercolorectal neoplasmscancergene expressionseptin 9
Journal Article 2019-06-28 No Snippets Raut JR, Guan Z, Schrotz-King P, Brenner H.
Show Full Abstract

DNA methylation profiles within whole-blood samples have been reported to be associated with colorectal cancer (CRC) occurrence and might enable risk stratification for CRC. We systematically reviewed and summarized studies addressing the association of whole-blood DNA methylation markers and risk of developing CRC or its precursors. We searched PubMed and ISI Web of Knowledge to identify relevant studies published until 12th November 2018. Two reviewers independently extracted data on study population characteristics, candidate genes, methylation measurement methods, methylation levels of patients in comparison to healthy controls, <i>p</i>-values, and odds ratios of the markers. Overall, 19 studies reporting 102 methylation markers for risk assessment of colorectal neoplasms met our inclusion criteria. The studies mostly used Methylation Specific Polymerase Chain Reaction (MS-PCR) for assessing the methylation status of a defined set of genes. Only two studies applied array-based genome-wide assays to assess the methylation levels. Five studies incorporated panels consisting of 2-10 individual methylation markers to assess their potential for stratifying the risk of developing colorectal neoplasms. However, none of these associations was confirmed in an independent cohort. In conclusion, whole-blood DNA methylation markers may be useful as biomarkers for risk stratification in CRC screening, but reproducible risk prediction algorithms are yet to be established by large scale epigenome-wide studies with thorough validation of results in prospective study cohorts including large screening populations. The possibilities of enhancing predictive power by combining methylation data with polygenetic risk scores and environmental risk factors need to be explored.

Also flagged:carbonbicarbonate transportercarbonic anhydrasesC4mitochondria-photorespiration
Journal Article 2019-06-28 No Snippets Wei L, El Hajjami M, Shen C, You W, Lu Y, Li J, Jing X, Hu Q, Zhou W, Poetsch A, Xu J.
Show Full Abstract

<h4>Background</h4>In industrial oleaginous microalgae such as <i>Nannochloropsis</i> spp., the key components of the carbon concentration mechanism (CCM) machineries are poorly defined, and how they are mobilized to facilitate cellular utilization of inorganic carbon remains elusive.<h4>Results</h4>For <i>Nannochloropsis oceanica</i>, to unravel genes specifically induced by CO<sub>2</sub> depletion which are thus potentially underpinning its CCMs, transcriptome, proteome and metabolome profiles were tracked over 0 h, 3 h, 6 h, 12 h and 24 h during cellular response from high CO<sub>2</sub> level (HC; 50,000 ppm) to very low CO<sub>2</sub> (VLC; 100 ppm). The activity of a biophysical CCM is evidenced based on induction of transcripts encoding a bicarbonate transporter and two carbonic anhydrases under VLC. Moreover, the presence of a potential biochemical CCM is supported by the upregulation of a number of key C4-like pathway enzymes in both protein abundance and enzymatic activity under VLC, consistent with a mitochondria-implicated C4-based CCM. Furthermore, a basal CCM underpinned by VLC-induced upregulation of photorespiration and downregulation of ornithine-citrulline shuttle and the ornithine urea cycles is likely present, which may be responsible for efficient recycling of mitochondrial CO<sub>2</sub> for chloroplastic carbon fixation.<h4>Conclusions</h4><i>Nannochloropsis oceanica</i> appears to mobilize a comprehensive set of CCMs in response to very low CO<sub>2</sub>. Its genes induced by the stress are quite distinct from those of <i>Chlamydomonas reinhardtii</i> and <i>Phaeodactylum tricornutum</i>, suggesting tightly regulated yet rather unique CCMs. These findings can serve the first step toward rational engineering of the CCMs for enhanced carbon fixation and biomass productivity in industrial microalgae.

Also flagged:PIWIspermatogenesiscancercell proliferationcancersgene expression
Journal Article 2019-06-28 ✓ 1 Snippet Yu Y, Xiao J, Hann SS.
In-Text Gene Mentions

The expression of piR-651 was found to be increased in cervical cancer cells.70 FR090905 improved overall survival, while FR027884 was associated with poor patient outcome in cervical cancer, as reported by researchers via analysis of more than 6,000 human piRNA transcriptomes derived from cervical cancer tissues and non-malignant tissue.19 Following the overexpression of HILI, the retrotransposon elements LINE1 and LINE1-associated small RNAs were decreased in HeLa cells.104 piR-49322 was observed to locate in the nucleolus and around the periphery of the nuclear membrane in HeLa cells using an in situ hybridization assay, which was consistent with the report that mature piRNAs were generated in a germline-specific perinuclear structure and then imported into the nucleus in the form of PIWI–piRNA complexes.105 piR-017061 was dramatically reduced in pancreatic ductal adenocarcinoma compared to tissues from normal pancreas.106 piR-52207 and piR-33733 were upregulated in ovarian cancer, and modulated processes and key signaling pathways in ovarian oncogenesis.107 piRNA DQ594040 was the most downregulated piRNA and overexpression of DQ594040 inhibited proliferation and colony formation, and promoted cell apoptosis by increasing the expression of tumor necrosis factor superfamily-4 (TNFSF4) in bladder cancer cells.

Show Full Abstract

PIWI-interacting RNAs (piRNAs) are a type of non-coding RNAs that interact with PIWI proteins, which are members of the argonaute family. Originally described in the germline, piRNAs are also expressed in human somatic cells in a tissue-specific manner. piRNAs are involved in spermatogenesis, germ stem-cell maintenance, silencing of transposon, epigenetic and genomic regulation and rearrangement. A large number of studies have demonstrated that expression of piRNAs is involved in many kinds of disease, including cancer. Abnormal expression of piRNAs is emerging as a critical player in cancer cell proliferation, apoptosis, invasion, and migration in vitro and in vivo. Functionally, piRNAs maintain genomic integrity by repressing the mobilization of transposable elements, and regulate the expression of downstream target genes via transcriptional or post-transcriptional mechanisms. Furthermore, altered expression of piRNAs in cancer is linked to clinical outcome, highlighting the important role that they may play as novel diagnostic and prognostic biomarkers, and as therapeutic targets for cancer therapy. In this review, we focus on the biogenesis and the functional roles of piRNAs in cancers, discuss emerging insights into the roles of piRNAs in the occurrence, progression, and treatment of cancers, reveal various mechanisms underlying piRNAs-mediated gene regulation, and highlight their potential clinical utilities as biomarkers as well as potential targets for cancer treatment.

Also flagged:HuntingtinHDmembraneglutamateneurodegenerative diseasedeath
Journal Article 2019-06-28 No Snippets Garcia VJ, Rushton DJ, Tom CM, Allen ND, Kemp PJ, Svendsen CN, Mattis VB.
Show Full Abstract

In Huntington's disease (HD), while the ubiquitously expressed mutant Huntingtin (mtHTT) protein primarily compromises striatal and cortical neurons, glia also undergo disease-contributing alterations. Existing HD models using human induced pluripotent stem cells (iPSCs) have not extensively characterized the role of mtHTT in patient-derived astrocytes. Here physiologically mature astrocytes are generated from HD patient iPSCs. These human astrocytes exhibit hallmark HD phenotypes that occur in mouse models, including impaired inward rectifying K<sup>+</sup> currents, lengthened spontaneous Ca<sup>2+</sup> waves and reduced cell membrane capacitance. HD astrocytes in co-culture provided reduced support for the maturation of iPSC-derived neurons. In addition, neurons exposed to chronic glutamate stimulation are not protected by HD astrocytes. This iPSC-based HD model demonstrates the critical effects of mtHTT on human astrocytes, which not only broadens the understanding of disease susceptibility beyond cortical and striatal neurons but also increases potential drug targets.

Also flagged:CalciumPhosphorusAlkaline PhosphataseALPmineralmineralization
Journal Article 2019-06-28 ✓ 1 Snippet Reyer H, Oster M, Wittenburg D, Murani E, Ponsuksili S, Wimmers K.
In-Text Gene Mentions

…HIST1H1D , andHMGN4).…

Show Full Abstract

Blood values of calcium (Ca), inorganic phosphorus (IP), and alkaline phosphatase activity (ALP) are valuable indicators for mineral status and bone mineralization. The mineral homeostasis is maintained by absorption, retention, and excretion processes employing a number of known and unknown sensing and regulating factors with implications on immunity. Due to the high inter-individual variation of Ca and P levels in the blood of pigs and to clarify molecular contributions to this variation, the genetics of hematological traits related to the Ca and P balance were investigated in a German Landrace population, integrating both single-locus and multi-locus genome-wide association study (GWAS) approaches. Genomic heritability estimates suggest a moderate genetic contribution to the variation of hematological Ca (<i>N</i> = 456), IP (<i>N</i> = 1049), ALP (<i>N</i> = 439), and the Ca/P ratio (<i>N</i> = 455), with values ranging from 0.27 to 0.54. The genome-wide analysis of markers adds a number of genomic regions to the list of quantitative trait loci, some of which overlap with previous results. Despite the gaps in knowledge of genes involved in Ca and P metabolism, genes like <i>THBS2</i>, <i>SHH</i>, <i>PTPRT</i>, <i>PTGS1</i>, and <i>FRAS1</i> with reported connections to bone metabolism were derived from the significantly associated genomic regions. Additionally, genomic regions included <i>TRAFD1</i> and genes coding for phosphate transporters (<i>SLC17A1</i>-<i>SLC17A4</i>), which are linked to Ca and P homeostasis. The study calls for improved functional annotation of the proposed candidate genes to derive features involved in maintaining Ca and P balance. This gene information can be exploited to diagnose and predict characteristics of micronutrient utilization, bone development, and a well-functioning musculoskeletal system in pig husbandry and breeding.

Also flagged:EDN3BMP7hyperpigmentationchromosomeBPIFB3PCK1
Journal Article 2019-06-28 No Snippets Dong X, Li J, Zhang Y, Han D, Hua G, Wang J, Deng X, Wu C.
Show Full Abstract

Artificial selection is often associated with numerous changes in seemingly unrelated phenotypic traits. The genetic mechanisms of correlated phenotypes probably involve pleiotropy or linkage of genes related to such phenotypes. Dongxiang blue-shelled chicken, an indigenous chicken breed of China, has segregated significantly for the dermal hyperpigmentation phenotype. Two lines of the chicken have been divergently selected with respect to comb color for over 20 generations. The red comb line chicken produces significantly higher number of eggs than the dark comb line chicken. The objective of this study was to explore potential mechanisms involved in the relationship between comb color and egg production among chickens. Based on the genome-wide association study results, we identified a genomic region on chromosome 20 involving <i>EDN3</i> and <i>BMP7</i>, which is associated with hyperpigmentation of chicken comb. Further analyses by selection signatures in the two divergent lines revealed that several candidate genes, including <i>EDN3</i>, <i>BMP7</i>, <i>BPIFB3</i>, and <i>PCK1</i>, closely located on chromosome 20 are involved in the development of neural crest cell and reproductive system. The two genes <i>EDN3</i> and <i>BMP7</i> have known roles in regulating both ovarian function and melanogenesis, indicating the pleiotropic effect on hyperpigmentation and egg production in blue-shelled chickens. Association analysis for egg production confirmed the pleiotropic effect of selected loci identified by selection signatures. The study provides insights into phenotypic evolution due to genetic variation across the genome. The information might be useful in the current breeding efforts to develop improved breeds for egg production.

Also flagged:neuromyelitis optica spectrum disorderAQP4pathogenesisautoimmune diseasesMSsystemic lupus erythematosus
Journal Article 2019-06-28 No Snippets Cook LJ, Rose JW, Alvey JS, Jolley AM, Kuhn R, Marron B, Pederson M, Enriquez R, Yearley J, McKechnie S, Han MH, Tomczak AJ, Levy M, Mealy MA, Coleman J, Bennett JL, Johnson R, Barnes-Garcia M, Traboulsee AL, Carruthers RL, Lee LE, Schubert JJ, McMullen K, Kister I, Rimler Z, Reid A, Sicotte NL, Planchon SM, Cohen JA, Ivancic D, Sedlak JL, Sand IK, Repovic P, Amezcua L, Pruitt A, Amundson E, Chitnis T, Mullin DS, Klawiter EC, Russo AW, Riley CS, Onomichi KB, Levine L, Nelson KE, Nealon NM, Engel C, Kruse-Hoyer M, Marcille M, Tornes L, Rumpf A, Greer A, Kenneally Behne M, Rodriguez RR, Behne DW, Blackway DW, Coords B, Blaschke TF, Sheard J, Smith TJ, Behne JM, Yeaman MR, Guthy-Jackson Charitable Foundation International Clinical Consortium (GJCF–ICC).
Show Full Abstract

<h4>Objective</h4>To develop a resource of systematically collected, longitudinal clinical data and biospecimens for assisting in the investigation into neuromyelitis optica spectrum disorder (NMOSD) epidemiology, pathogenesis, and treatment.<h4>Methods</h4>To illustrate its research-enabling purpose, epidemiologic patterns and disease phenotypes were assessed among enrolled subjects, including age at disease onset, annualized relapse rate (ARR), and time between the first and second attacks.<h4>Results</h4>As of December 2017, the Collaborative International Research in Clinical and Longitudinal Experience Study (CIRCLES) had enrolled more than 1,000 participants, of whom 77.5% of the NMOSD cases and 71.7% of the controls continue in active follow-up. Consanguineous relatives of patients with NMOSD represented 43.6% of the control cohort. Of the 599 active cases with complete data, 84% were female, and 76% were anti-AQP4 seropositive. The majority were white/Caucasian (52.6%), whereas blacks/African Americans accounted for 23.5%, Hispanics/Latinos 12.4%, and Asians accounted for 9.0%. The median age at disease onset was 38.4 years, with a median ARR of 0.5. Seropositive cases were older at disease onset, more likely to be black/African American or Hispanic/Latino, and more likely to be female.<h4>Conclusions</h4>Collectively, the CIRCLES experience to date demonstrates this study to be a useful and readily accessible resource to facilitate accelerating solutions for patients with NMOSD.

Also flagged:Pulmonary Arterial HypertensionPulmonary hypertensionbrain natriuretic peptideBNP-proBNP
Journal Article 2019-06-28 No Snippets Ishak Gabra NB, Mahmoud O, Ishikawa O, Shah V, Altshul E, Oron M, Mina B.
Show Full Abstract

Pulmonary hypertension is an uncommon disease that carries a significant morbidity and mortality. Pulmonary arterial hypertension is a subtype of pulmonary hypertension that describes a group of disease entities that lead to an elevation in precapillary pulmonary artery pressure. Despite advances in the diagnosis and treatment of pulmonary arterial hypertension, it remains a difficult disease to recognize and manage. In this review article, we will discuss the definition and diagnosis of pulmonary arterial hypertension. Additionally, we will discuss the ever-expanding management options, their mechanisms and strategies, including combination therapy and the most recent advances and future directions.

Also flagged:hyaluronic aciddoxorubicingallic acidlipidleukemiapromyelocytic leukemia
Journal Article 2019-06-28 No Snippets Shao Y, Luo W, Guo Q, Li X, Zhang Q, Li J.
Show Full Abstract

<b>Objective:</b> To investigate the hyaluronic acid (HA) modified, doxorubicin (DOX) and gallic acid (GA) co-delivered lipid-polymeric hybrid nano-system for leukemia therapy. <b>Methods:</b> We produced a kind of lipid-polymer hybrid nanoparticle (LPHN) with a core-shell structure in which DOX and GA were co-loaded. In vitro and in vivo leukemia therapeutic effects of the HA modified, DOX and GA co-delivered LPHNs (HA-DOX/GA-LPHNs) were evaluated in DOX resistant human HL-60 promyelocytic leukemia cells (HL-60/ADR cells), DOX resistant human K562 chronic myeloid leukemia cells (K562/ADR cells), and HL-60/ADR cells bearing mouse model. <b>Results:</b> The sizes and zeta potentials of HA modified LPHNs were about 160 nm and -40 mV. HA-DOX/GA-LPHNs showed the most prominent cytotoxicity and the best synergistic effect was obtained when DOX/GA ratio was 2/1. In vivo studies revealed that HA-DOX/GA-LPHNs inhibited tumor growth from 956 mm<sup>3</sup> to 213 mm<sup>3</sup>, with an inhibition rate of 77.7%. <b>Conclusion:</b> In summary, the study showed that HA-DOX/GA-LPHNs can be applied as a promising leukemia therapy system.

Also flagged:EWSR1FLI1CancerFATE1Ewing sarcomatranscription factor
Journal Article 2019-06-27 No Snippets Gallegos ZR, Taus P, Gibbs ZA, McGlynn K, Gomez NC, Davis I, Whitehurst AW.
Show Full Abstract

Ewing sarcoma is characterized by a pathognomonic chromosomal translocation that generates the EWSR1-FLI1 chimeric transcription factor. The transcriptional targets of EWSR1-FLI1 that are essential for tumorigenicity are incompletely defined. Here, we found that EWSR1-FLI1 modulates the expression of cancer/testis (CT) antigen genes, whose expression is biased to the testes but is also activated in cancer. Among these CT antigens, fetal and adult testis expressed 1 (FATE1) is most robustly induced. EWSR1-FLI1 associates with the GGAA repeats in the proximal promoter of <i>FATE1</i>, which exhibits accessible chromatin exclusively in mesenchymal progenitor cells (MPCs) and Ewing sarcoma cells. Expression of EWSR1-FLI1 in non-Ewing sarcoma cells and in MPCs enhances FATE1 mRNA and protein expression. Conversely, depletion of EWSR1-FLI1 in Ewing sarcoma cells leads to a loss of FATE1 expression. Importantly, we found that FATE1 is required for survival and anchorage-independent growth in Ewing sarcoma cells via attenuating the accumulation of BNIP3L, a BH3-only protein that is toxic when stabilized. This action appears to be mediated by the E3 ligase RNF183. We propose that engaging FATE1 function can permit the bypass of cell death mechanisms that would otherwise inhibit tumor progression.

Also flagged:breast cancercancerAPOBECagingGNB5MTCL1
Journal Article 2019-06-27 ✓ 1 Snippet Wang S, Pitt JJ, Zheng Y, Yoshimatsu TF, Gao G, Sanni A, Oluwasola O, Ajani M, Fitzgerald D, Odetunde A, Khramtsova G, Hurley I, Popoola A, Falusi A, Ogundiran T, Obafunwa J, Ojengbede O, Ibrahim N, Barretina J, White KP, Huo D, Olopade OI.
In-Text Gene Mentions

…5, ANXA13 ,DNAJC1, DNAH11 and…

Show Full Abstract

Somatic mutation signatures may represent footprints of genetic and environmental exposures that cause different cancer. Few studies have comprehensively examined their association with germline variants, and none in an indigenous African population. SomaticSignatures was employed to extract mutation signatures based on whole-genome or whole-exome sequencing data from female patients with breast cancer (TCGA, training set, n = 1,011; Nigerian samples, validation set, n = 170), and to estimate contributions of signatures in each sample. Association between somatic signatures and common single nucleotide polymorphisms (SNPs) or rare deleterious variants were examined using linear regression. Nine stable signatures were inferred, and four signatures (APOBEC C>T, APOBEC C>G, aging and homologous recombination deficiency) were highly similar to known COSMIC signatures and explained the majority (60-85%) of signature contributions. There were significant heritable components associated with APOBEC C>T signature (h<sup>2</sup> = 0.575, p = 0.010) and the combined APOBEC signatures (h<sup>2</sup> = 0.432, p = 0.042). In TCGA dataset, seven common SNPs within or near GNB5 were significantly associated with an increased proportion (beta = 0.33, 95% CI = 0.21-0.45) of APOBEC signature contribution at genome-wide significance, while rare germline mutations in MTCL1 was also significantly associated with a higher contribution of this signature (p = 6.1 × 10<sup>-6</sup> ). This is the first study to identify associations between germline variants and mutational patterns in breast cancer across diverse populations and geography. The findings provide evidence to substantiate causal links between germline genetic risk variants and carcinogenesis.

Also flagged:Hepcidinironinfectionmetabolismgenotype 1b infectionLedipasvir
Journal Article 2019-06-27 ✓ 1 Snippet Inomata S, Anan A, Yamauchi E, Yamauchi R, Kunimoto H, Takata K, Tanaka T, Yokoyama K, Morihara D, Takeyama Y, Irie M, Shakado S, Sohda T, Sakisaka S.
In-Text Gene Mentions

…mutation on thehemochromatosisgene because it…

Show Full Abstract

Objective Hepcidin is a master iron regulator hormone produced by the liver, but precise mechanism underlying its involvement in iron overload in hepatitis C virus (HCV) infection remains unclear. We investigated the serum hepcidin levels against iron overload before and after HCV eradication. Methods We prospectively investigated the iron metabolism characteristics in 24 patients with HCV genotype 1b infection before and after treatment. We also assessed the serum erythroferrone (ERFE) levels to investigate its association with iron metabolism changes. Patients were treated with Ledipasvir 90 mg and Sofosbuvir 400 mg once daily for 12 weeks and observed for 12 more weeks in order to evaluate their sustained virological response. Results Serum hepcidin levels at baseline were in the normal range, although serum ferritin levels were increased. After HCV eradication, both serum ferritin and hepcidin levels were significantly decreased at 24 weeks from baseline (p<0.001, p=0.006, respectively). However, the serum hepcidin-to-ferritin ratios were significantly increased (p<0.001). In addition, the serum ERFE levels were significantly decreased (p<0.001). Increases in the serum hepcidin-to-ferritin ratios were correlated with decreases in the serum ERFE levels (ρ=-0.422, p=0.039). Conclusion Serum hepcidin levels were relatively low against ferritin levels in HCV infection. However, after HCV eradication, the serum hepcidin-to-ferritin ratios were increased. These results indicate the improvement of inadequate hepcidin secretion against iron overload after HCV eradication. Downregulation of ERFE may have affected the improvement of iron metabolism.

Also flagged:PACTmovement disordercaspaseIFNRNA-activated protein kinasePKR
Journal Article 2019-06-27 ✓ 1 Snippet Burnett SB, Vaughn LS, Strom JM, Francois A, Patel RC.
In-Text Gene Mentions

HTT

Show Full Abstract

Protein Activator (PACT) activates the interferon (IFN)-induced double-stranded (ds) RNA-activated protein kinase (PKR) in response to stress signals. Oxidative stress and endoplasmic reticulum (ER) stress causes PACT-mediated PKR activation, which leads to phosphorylation of translation initiation factor eIF2α, inhibition of protein synthesis, and apoptosis. A dominantly inherited form of early-onset dystonia 16 (DYT16) has been identified to arise due to a frameshift (FS) mutation in PACT. To examine the effect of the resulting truncated mutant PACT protein on the PKR pathway, we examined the biochemical properties of the mutant protein and its effect on mammalian cells. Our results indicate that the FS mutant protein loses its ability to bind dsRNA as well as its ability to interact with PKR while surprisingly retaining the ability to interact with PACT and PKR-inhibitory protein TRBP. The truncated FS mutant protein, when expressed as a fusion protein with a N-terminal fluorescent mCherry tag aggregates in mammalian cells to induce apoptosis via activation of caspases both in a PKR- and PACT-dependent as well as independent manner. Our results indicate that interaction of FS mutant protein with PKR inhibitor TRBP can dissociate PACT from the TRBP-PACT complex resulting in PKR activation and consequent apoptosis. These findings are relevant to diseases resulting from protein aggregation especially since the PKR activation is a characteristic of several neurodegenerative conditions.

Also flagged:glutamine Gamma-glutamyltransferaseprostate cancercancersandrogenTGM4Prostate-Specific Antigen
Journal Article 2019-06-27 No Snippets Drabovich AP, Saraon P, Drabovich M, Karakosta TD, Dimitromanolakis A, Hyndman ME, Jarvi K, Diamandis EP.
Show Full Abstract

Seminal plasma, because of its proximity to prostate, is a promising fluid for biomarker discovery and noninvasive diagnostics. In this study, we investigated if seminal plasma proteins could increase diagnostic specificity of detecting primary prostate cancer and discriminate between high- and low-grade cancers. To select 147 most promising biomarker candidates, we combined proteins identified through five independent experimental or data mining approaches: tissue transcriptomics, seminal plasma proteomics, cell line secretomics, tissue specificity, and androgen regulation. A rigorous biomarker development pipeline based on selected reaction monitoring assays was designed to evaluate the most promising candidates. As a result, we qualified 76, and verified 19 proteins in seminal plasma of 67 negative biopsy and 152 prostate cancer patients. Verification revealed a prostate-specific, secreted and androgen-regulated protein-glutamine gamma-glutamyltransferase 4 (TGM4), which predicted prostate cancer on biopsy and outperformed age and serum Prostate-Specific Antigen (PSA). A machine-learning approach for data analysis provided improved multi-marker combinations for diagnosis and prognosis. In the independent verification set measured by an in-house immunoassay, TGM4 protein was upregulated 3.7-fold (<i>p</i> = 0.006) and revealed AUC = 0.66 for detecting prostate cancer on biopsy for patients with serum PSA ≥4 ng/ml and age ≥50. Very low levels of TGM4 (120 pg/ml) were detected in blood serum. Collectively, our study demonstrated rigorous evaluation of one of the remaining and not well-explored prostate-specific proteins within the medium-abundance proteome of seminal plasma. Performance of TGM4 warrants its further investigation within the distinct genomic subtypes and evaluation for the inclusion into emerging multi-biomarker panels.

Also flagged:chromosomeDACchromatinmitochondrialtranscription factorsREST
Journal Article 2019-06-27 No Snippets Amemiya HM, Kundaje A, Boyle AP.
Show Full Abstract

Functional genomics assays based on high-throughput sequencing greatly expand our ability to understand the genome. Here, we define the ENCODE blacklist- a comprehensive set of regions in the human, mouse, worm, and fly genomes that have anomalous, unstructured, or high signal in next-generation sequencing experiments independent of cell line or experiment. The removal of the ENCODE blacklist is an essential quality measure when analyzing functional genomics data.

Also flagged:Circadianneurodegenerative disorderHDinclusion bodiescardiovascular dysfunctiondysautonomia
Journal Article 2019-06-27 ✓ 4 Snippets Park S, Colwell CS.
In-Text Gene Mentions

HD is caused by a CAG repeat expansion within the first exon of the huntingtin (HTT) gene which produces a polyglutamine repeat that leads to protein misfolding, soluble aggregates, and inclusion bodies detected [3,4].

HD is caused by a CAG repeat expansion within the first exon of the huntingtin (HTT) gene that produces a polyglutamine repeat that leads to protein misfolding, soluble aggregates, and inclusion bodies detected throughout the body.

…of the huntingtin (HTT) gene that produces…

…of the huntingtin (HTT) gene which produces…

Show Full Abstract

Huntington's disease (HD) patients suffer from a progressive neurodegenerative disorder that inflicts both motor and non-motor symptoms. HD is caused by a CAG repeat expansion within the first exon of the <i>huntingtin</i> (HTT) gene that produces a polyglutamine repeat that leads to protein misfolding, soluble aggregates, and inclusion bodies detected throughout the body. Both clinical and preclinical research indicate that cardiovascular dysfunction should be considered a core symptom in at least a subset of HD patients. There is strong evidence for dysautonomia (dysfunctional autonomic nervous system, ANS) in HD patients that can be detected early in the disease progression. The temporal patterning of ANS function is controlled by the circadian timing system based in the anterior hypothalamus. Patients with neurodegenerative diseases including HD exhibit disrupted sleep/wake cycle and, in preclinical models, there is compelling evidence that the circadian timing system is compromised early in the disease process. Here we review data from preclinical models of HD that explore the intersection between disruption of circadian rhythms and dysautonomia. This work will lead to new therapeutic strategies and standards of care for HD and other neurodegenerative diseases.

Also flagged:cefamandolmidecamycinthiolactomycinprulifloxacinsepsisAcute Diverticulitis
Journal Article 2019-06-27 No Snippets Francis NK, Sylla P, Abou-Khalil M, Arolfo S, Berler D, Curtis NJ, Dolejs SC, Garfinkle R, Gorter-Stam M, Hashimoto DA, Hassinger TE, Molenaar CJL, Pucher PH, Schuermans V, Arezzo A, Agresta F, Antoniou SA, Arulampalam T, Boutros M, Bouvy N, Campbell K, Francone T, Haggerty SP, Hedrick TL, Stefanidis D, Truitt MS, Kelly J, Ket H, Dunkin BJ, Pietrabissa A.
Show Full Abstract

<h4>Background</h4>Acute diverticulitis (AD) presents a unique diagnostic and therapeutic challenge for general surgeons. This collaborative project between EAES and SAGES aimed to summarize recent evidence and draw statements of recommendation to guide our members on comprehensive AD management.<h4>Methods</h4>Systematic reviews of the literature were conducted across six AD topics by an international steering group including experts from both societies. Topics encompassed the epidemiology, diagnosis, management of non-complicated and complicated AD as well as emergency and elective operative AD management. Consensus statements and recommendations were generated, and the quality of the evidence and recommendation strength rated with the GRADE system. Modified Delphi methodology was used to reach consensus among experts prior to surveying the EAES and SAGES membership on the recommendations and likelihood to impact their practice. Results were presented at both EAES and SAGES annual meetings with live re-voting carried out for recommendations with < 70% agreement.<h4>Results</h4>A total of 51 consensus statements and 41 recommendations across all six topics were agreed upon by the experts and submitted for members' online voting. Based on 1004 complete surveys and over 300 live votes at the SAGES and EAES Diverticulitis Consensus Conference (DCC), consensus was achieved for 97.6% (40/41) of recommendations with 92% (38/41) agreement on the likelihood that these recommendations would change practice if not already applied. Areas of persistent disagreement included the selective use of imaging to guide AD diagnosis, recommendations against antibiotics in non-complicated AD, and routine colonic evaluation after resolution of non-complicated diverticulitis.<h4>Conclusion</h4>This joint EAES and SAGES consensus conference updates clinicians on the current evidence and provides a set of recommendations that can guide clinical AD management practice.

Also flagged:nicotinicCapneapathogenesissudden infant death syndromeSerotonin
Journal Article 2019-06-27 ✓ 1 Snippet Zhao L, Gao X, Zhuang J, Wallen M, Leng S, Xu F.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Prenatal nicotinic exposure (PNE) reportedly sensitizes bronchopulmonary C-fibers (PCFs) and prolongs PCF-mediated apnea in rat pups, contributing to the pathogenesis of sudden infant death syndrome. Serotonin, or 5-hydroxytryptamine (5-HT), induces apnea <i>via</i> acting on 5-HT receptor 3 (5-HT<sub>3</sub>R) in PCFs, and among the 5-HT<sub>3</sub>R subunits, 5-HT<sub>3B</sub> is responsible for shortening the decay time of 5-HT<sub>3</sub>R-mediated currents. We examined whether PNE would promote pulmonary 5-HT secretion and prolong the apnea mediated by 5-HT<sub>3</sub>Rs in PCFs <i>via</i> affecting the 5-HT<sub>3B</sub> subunit. To this end, the following variables were compared between the control and PNE rat pups: <i>1</i>) the 5-HT content in bronchoalveolar lavage fluid, <i>2</i>) the apneic response to the right atrial bolus injection of phenylbiguanide (a 5-HT<sub>3</sub>R agonist) before and after PCF inactivation, <i>3</i>) 5-HT<sub>3</sub>R currents and the stimulus threshold of the action currents of vagal pulmonary C-neurons, and <i>4</i>) the immunoreactivity (IR) and mRNA expression of 5-HT<sub>3A</sub> and 5-HT<sub>3B</sub> in these neurons. Our results showed that PNE up-regulated the pulmonary 5-HT concentration and strengthened the PCF 5-HT<sub>3</sub>R-mediated apnea. PNE significantly facilitated neural excitability by shortening the decay time of 5-HT<sub>3</sub>R currents, lowering the stimulus threshold, and increasing 5-HT<sub>3B</sub> IR. In summary, PNE prolongs the apnea mediated by 5-HT<sub>3</sub>Rs in PCFs, likely by increasing 5-HT<sub>3B</sub> subunits to enhance the excitability of 5-HT<sub>3</sub> channels.-Zhao, L., Gao, X., Zhuang, J., Wallen, M., Leng, S., Xu, F. Prolongation of bronchopulmonary C-fiber-mediated apnea by prenatal nicotinic exposure in rat pups: role of 5-HT<sub>3</sub> receptors.

Also flagged:Disulfidebromotyrosinepsammaplin AindolesynthesisA
Journal Article 2019-06-27 No Snippets Jing Q, Hu X, Ma Y, Mu J, Liu W, Xu F, Li Z, Bai J, Hua H, Li D.
Show Full Abstract

Marine natural products are considered to be valuable resources that are furnished with diverse chemical structures and various bioactivities. To date, there are seven compounds derived from marine natural products which have been approved as therapeutic drugs by the U.S. Food and Drug Administration. Numerous bromotyrosine derivatives have been isolated as a type of marine natural products. Among them, psammaplin A, including the oxime groups and carbon-sulfur bonds, was the first identified symmetrical bromotyrosine-derived disulfide dimer. It has been found to have a broad bioactive spectrum, especially in terms of antimicrobial and antiproliferative activities. The highest potential indole-derived psammaplin A derivative, UVI5008, is used as an epigenetic modulator with multiple enzyme inhibitory activities. Inspired by these reasons, psammaplin A has gradually become a research focus for pharmacologists and chemists. To the best of our knowledge, there is no systematic review about the biological activity and structural modification of psammaplin A. In this review, the pharmacological effects, total synthesis, and synthesized derivatives of psammaplin A are summarized.

Also flagged:LactoferrinHydroxyapatiteGellan gumwaterdegradationpore
Journal Article 2019-06-27 No Snippets Bastos AR, da Silva LP, Maia FR, Pina S, Rodrigues T, Sousa F, Oliveira JM, Cornish J, Correlo VM, Reis RL.
Show Full Abstract

The development of bioactive and cell-responsive materials has fastened the field of bone tissue engineering. Gellan gum (GG) spongy-like hydrogels present high attractive properties for the tissue engineering field, especially due to their wide microarchitecture and tunable mechanical properties, as well as their ability to entrap the responsive cells. Lactoferrin (Lf) and Hydroxyapatite (HAp) are bioactive factors that are known to potentiate faster bone regeneration. Thus, we developed an advanced three-dimensional (3D) biomaterial by integrating these bioactive factors within GG spongy-like hydrogels. Lf-HAp spongy-like hydrogels were characterized in terms of microstructure, water uptake, degradation, and concomitant release of Lf along the time. Human adipose-derived stem cells (hASCs) were seeded and the capacity of these materials to support hASCs in culture for 21 days was assessed. Lf addition within GG spongy-like hydrogels did not change the main features of GG spongy-like hydrogels in terms of porosity, pore size, degradation, and water uptake commitment. Nevertheless, HAp addition promoted an increase of the pore wall thickness (from ~13 to 28 µm) and a decrease on porosity (from ~87% to 64%) and mean pore size (from ~12 to 20 µm), as well as on the degradability and water retention capabilities. A sustained release of Lf was observed for all the formulations up to 30 days. Cell viability assays showed that hASCs were viable during the culture period regarding cell-laden spongy-like hydrogels. Altogether, we demonstrate that GG spongy-like hydrogels containing HAp and Lf in high concentrations gathered favorable 3D bone-like microenvironment with an increased hASCs viability with the presented results.

Also flagged:organizationgene expressionneurodegenerative diseaseschizophreniacognitive diseasechromosome
Journal Article 2019-06-27 No Snippets Rajarajan P, Borrman T, Liao W, Espeso-Gil S, Chandrasekaran S, Jiang Y, Weng Z, Brennand KJ, Akbarian S.
Show Full Abstract

The 'non-linear' genome, or the spatial proximity of non-contiguous sequences, emerges as an important regulatory layer for genome organization and function, including transcriptional regulation. Here, we review recent genome-scale chromosome conformation mappings ('Hi-C') in developing and adult human and mouse brain. Neural differentiation is associated with widespread remodeling of the chromosomal contact map, reflecting dynamic changes in cell-type-specific gene expression programs, with a massive (estimated 20-50%) net loss of chromosomal contacts that is specific for the neuronal lineage. Hi-C datasets provided an unexpected link between locus-specific abnormal expansion of repeat sequences positioned at the boundaries of self-associating topological chromatin domains, and monogenic neurodevelopmental and neurodegenerative disease. Furthermore, integrative cell-type-specific Hi-C and transcriptomic analysis uncovered an expanded genomic risk space for sequences conferring liability for schizophrenia and other cognitive disease. We predict that spatial genome exploration will deliver radically new insights into the brain nucleome in health and disease.

Also flagged:cardiomyopathychromosomescardiovascular diseaseADmetabolismmetformin
Journal Article 2019-06-27 ✓ 1 Snippet Machini K, Ceyhan-Birsoy O, Azzariti DR, Sharma H, Rossetti P, Mahanta L, Hutchinson L, McLaughlin H, MedSeq Project, Green RC, Lebo M, Rehm HL.
In-Text Gene Mentions

HFE

Show Full Abstract

Although genome sequencing is increasingly available in clinical and research settings, many questions remain about the interpretation of sequencing data. In the MedSeq Project, we explored how much effort is required to evaluate and report on more than 4,500 genes reportedly associated with monogenic conditions, as well as pharmacogenomic (PGx) markers, blood antigen serotyping, and polygenic risk scores in 100 individuals (50 with cardiomyopathy and 50 healthy) randomized to the sequencing arm. We defined the quality thresholds for determining the need for Sanger confirmation. Finally, we examined the effort needed and new findings revealed by reanalyzing each genome (6-23 months after initial analysis; mean 13 months). Monogenic disease risk and carrier status were reported in 21% and 94% of participants, respectively. Only two participants had no monogenic disease risk or carrier status identified. For the PGx results (18 genotypes in six genes for five drugs), the identified diplotypes prompted recommendation for non-standard dosing of at least one of the analyzed drugs in 95% of participants. For blood antigen studies, we found that 31% of participants had a rare blood antigen genotype. In the cardiomyopathy cohort, an explanation for disease was identified in 48% of individuals. Over the course of the study, 14 variants were reclassified and, upon reanalysis, 18 new variants met criteria for reporting. These findings highlight the quantity of medically relevant findings from a broad analysis of genomic sequencing data as well as the need for periodic reinterpretation and reanalysis of data for both diagnostic indications and secondary findings.

Also flagged:Intestinal Divalent Metal Transporter 1Divalent metal transporter 1DMT1transporterironbinding
Journal Article 2019-06-27 ✓ 1 Snippet Jiang S, Guo S, Li H, Ni Y, Ma W, Zhao R.
In-Text Gene Mentions

…hemochromatosis gene (Hfe), which are…

Show Full Abstract

Divalent metal transporter 1 (DMT1) is a key transporter of iron uptake and delivering in human and animals. However, post-transcriptional regulation of DMT1 is poorly understood. In this study, bioinformatic algorithms (TargetScan, PITA, miRanda, and miRDB) were applied to predict, screen, analyze, and obtain microRNA-16 family members (miR-16, miR-195, miR-497, and miR-15b) targeting DMT1, seed sequence and their binding sites within DMT1 3' untranslated region (3' UTR) region. As demonstrated by dual-luciferase reporter assays, luciferase activity of DMT1 3' UTR reporter was impaired/enhanced when microRNA-16 family member over-expression plasmid/its inhibitor was transfected to HCT116 cells. Corroboratively, co-transfection of microRNA-16 family member over-expression plasmid and DMT1 3' UTR mutant reporter repressed the luciferase activity in HCT116 cells. In addition, over-expression microRNA-16 family member augmented its expression and diminished DMT1 protein expression in HCT116 cells. Interestingly, tail vein injection of miR-16 assay revealed reduced plasma iron levels, higher miR-16 expression, and lower DMT1 protein expression in the duodenum of mice. Taken together, we provide evidence that microRNA-16 family (miR-16, miR-195, miR-497, and miR-15b) is confirmed to repress intestinal DMT1 expression <i>in vitro</i> and <i>in vivo</i>, which will give valuable insight into post-transcriptional regulation of DMT1.

Also flagged:heat shock factor 1squamous cell carcinoma of the cervixHSF1transcription factorsquamous cell carcinomainsulin-like growth factor 1 receptor
Journal Article 2019-06-27 No Snippets Zhang L, Hu Z, Zhang Y, Huang J, Yang X, Wang J.
Show Full Abstract

Protein interactions are crucial for maintaining homeostasis. Heat shock factor 1 (HSF1), a transcription factor that interacts with various proteins, is highly expressed in squamous cell carcinoma (SCC) of the cervix. The aim of the present study was to investigate the protein interaction profile of HSF1 in cervical SCC. Proteins interacting with HSF1 in SCC tissue and non-cancerous control (Ctrl) tissue were obtained by immunoprecipitation, separated by SDS-PAGE, identified by matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry and analyzed using bioinformatics methods. A total of 220 and 241 proteins were identified by mass spectrometry in the tissues of Ctrl and SCC samples, respectively, among which 172 were detected exclusively in SCC (Pro-S), 151 exclusively in Ctrl (Pro-C) and 69 in both groups (Pro-B). The protein interaction profiles were different in each group; the STRING database identified three proteins that interacted with HSF1 directly, including insulin-like growth factor 1 receptor and small nuclear RNA-activating protein complex subunit 4 in Pro-C and small ubiquitin-related modifier 1 in Pro-S. Functional enrichment analysis of Gene Ontology revealed that the top terms were alternative splicing in Pro-S and polymorphism in Pro-C. In Pro-S, more categories were related to protein modification, such as phosphorylation, ubiquitination and acetylation. Therefore, HSF1 may influence the occurrence and development of cervical SCC by interacting with specific proteins.

Also flagged:ULBP1B7-H6ULBP3MICBHLAtumor
Journal Article 2019-06-26 ✓ 1 Snippet Sabry M, Zubiak A, Hood SP, Simmonds P, Arellano-Ballestero H, Cournoyer E, Mashar M, Pockley AG, Lowdell MW.
In-Text Gene Mentions

OLFM4

Show Full Abstract

An emerging cellular immunotherapy for cancer is based on the cytolytic activity of natural killer (NK) cells against a wide range of tumors. Although in vitro activation, or "priming," of NK cells by exposure to pro-inflammatory cytokines, such as interleukin (IL)-2, has been extensively studied, the biological consequences of NK cell activation in response to target cell interactions have not been thoroughly characterized. We investigated the consequences of co-incubation with K562, CTV-1, Daudi RPMI-8226, and MCF-7 tumor cell lines on the phenotype, cytokine expression profile, and transcriptome of human NK cells. We observe the downregulation of several activation receptors including CD16, CD62L, C-X-C chemokine receptor (CXCR)-4, natural killer group 2 member D (NKG2D), DNAX accessory molecule (DNAM)-1, and NKp46 following tumor-priming. Although this NK cell phenotype is typically associated with NK cell dysfunction in cancer, we reveal the upregulation of NK cell activation markers, such as CD69 and CD25; secretion of pro-inflammatory cytokines, including macrophage inflammatory proteins (MIP-1) α /β and IL-1β/6/8; and overexpression of numerous genes associated with enhanced NK cell cytotoxicity and immunomodulatory functions, such as FAS, TNFSF10, MAPK11, TNF, and IFNG. Thus, it appears that tumor-mediated ligation of receptors on NK cells may induce a primed state which may or may not lead to full triggering of the lytic or cytokine secreting machinery. Key signaling molecules exclusively affected by tumor-priming include MAP2K3, MARCKSL1, STAT5A, and TNFAIP3, which are specifically associated with NK cell cytotoxicity against tumor targets. Collectively, these findings help define the phenotypic and transcriptional signature of NK cells following their encounters with tumor cells, independent of cytokine stimulation, and provide insight into tumor-specific NK cell responses to inform the transition toward harnessing the therapeutic potential of NK cells in cancer.

Also flagged:AntibodyconjugationcarboxylantibodiesimmunorecognitionN -hydroxysuccinimide esters
Journal Article 2019-06-26 No Snippets Carl P, Ramos II, Segundo MA, Schneider RJ.
Show Full Abstract

Immunochemical techniques are the workhorse for sample enrichment and detection of a large variety of analytes. In contrast to classical microtiter plate-based assays, microparticles are a next generation solid support, as they promote automation of immunoassays using flow-based techniques. Antibody immobilization is a crucial step, as these reagents are expensive, and inefficient coupling can result in low sensitivities. This paper proposes a general procedure for efficient immobilization of antibodies onto TentaGel particles, via N-hydroxysuccinimide chemistry. The goal was the preparation of solid supports with optimum immunorecognition, while increasing the sustainability of the process. The influence of buffer composition, activation and coupling time, as well as the amount of antibody on the immobilization efficiency was investigated, resorting to fluorophore-labeled proteins and fluorescence imaging. Buffer pH and activation time are the most important parameters for efficient coupling. It is demonstrated, that the hydrolysis of N-hydroxysuccinimide esters occurs at similar rates as in solution, limiting the utilizable time for coupling. Finally, applicability of the generated material for automated affinity extraction is demonstrated on the mesofluidic platform lab-on-valve.

Also flagged:calciumcalcium sensorNCS-1acylhydrazoneRic8aNeuronal
Journal Article 2019-06-26 ✓ 3 Snippets Canal-Martín A, Sastre J, Sánchez-Barrena MJ, Canales A, Baldominos S, Pascual N, Martínez-González L, Molero D, Fernández-Valle ME, Sáez E, Blanco-Gabella P, Gómez-Rubio E, Martín-Santamaría S, Sáiz A, Mansilla A, Cañada FJ, Jiménez-Barbero J, Martínez A, Pérez-Fernández R.
In-Text Gene Mentions

…TheDCCapproach leads us…

…On protein-directedDCCexperiments, one designs…

…19 makes theDCCapproach attractive as…

Show Full Abstract

Dynamic combinatorial chemistry (DCC) has proven its potential in drug discovery speeding the identification of modulators of biological targets. However, the exchange chemistries typically take place under specific reaction conditions, with limited tools capable of operating under physiological parameters. Here we report a catalyzed protein-directed DCC working at low temperatures that allows the calcium sensor NCS-1 to find the best ligands in situ. Ultrafast NMR identifies the reaction intermediates of the acylhydrazone exchange, tracing the molecular assemblies and getting a real-time insight into the essence of DCC processes at physiological pH. Additionally, NMR, X-ray crystallography and computational methods are employed to elucidate structural and mechanistic aspects of the molecular recognition event. The DCC approach leads us to the identification of a compound stabilizing the NCS-1/Ric8a complex and whose therapeutic potential is proven in a Drosophila model of disease with synaptic alterations.

Also flagged:lactate dehydrogenaseneonatal illnessesLDHbirthinfectionsperinatal asphyxia
Journal Article 2019-06-26 No Snippets Halvorsen CP, Olson L, Araújo AC, Karlsson M, Nguyễn TT, Khu DTK, Le HTT, Nguyễn HTB, Winbladh B, Russom A.
Show Full Abstract

There is a growing recognition of the importance of point-of-care tests (POCTs) for detecting critical neonatal illnesses to reduce the mortality rate in newborns, especially in low-income countries, which account for 98 percent of reported neonatal deaths. Lactate dehydrogenase (LDH) is a marker of cellular damage as a result of hypoxia-ischemia in affected organs. Here, we describe and test a POC LDH test direct from whole blood to provide early indication of serious illness in the neonate. The sample-in-result-out POC platform is specifically designed to meet the needs at resource-limited settings. Plasma is separated from whole blood on filter paper with dried-down reagents for colorimetric reaction, combined with software for analysis using a smartphone. The method was clinically tested in newborns in two different settings. In a clinical cohort of newborns of Stockholm (n = 62) and Hanoi (n = 26), the value of R using Pearson's correlation test was 0.91 (p < 0.01) and the R<sup>2</sup> = 0.83 between the two methods. The mean LDH (±SD) for the reference method vs. the POC-LDH was 551 (±280) U/L and 552 (±249) U/L respectively, indicating the clinical value of LDH values measured in minutes with the POC was comparable with standardized laboratory analyses.

Also flagged:ENTPD1CD39sclerosing cholangitisliver fibrosisectonucleotidaseliver injury
Journal Article 2019-06-26 No Snippets Rothweiler S, Feldbrügge L, Jiang ZG, Csizmadia E, Longhi MS, Vaid K, Enjyoji K, Popov YV, Robson SC.
Show Full Abstract

Purinergic signaling is important in the activation and differentiation of macrophages, which play divergent roles in the pathophysiology of liver fibrosis. The ectonucleotidase CD39 is known to modulate the immunoregulatory phenotype of macrophages, but whether this specifically impacts cholestatic liver injury is unknown. Here, we investigated the role of macrophage-expressed CD39 on the development of biliary injury and fibrosis in a mouse model of sclerosing cholangitis. Myeloid-specific CD39-deficient mice (LysMCreCd39<sup>fl/fl</sup>) were generated. Global CD39 null (Cd39<sup>-/-</sup>), wild-type (WT), LysMCreCd39<sup>fl/fl</sup>, and Cd39<sup>fl/fl</sup> control mice were exposed to 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC) to induce biliary fibrosis. Hepatic hydroxyproline levels, liver histology, immunohistochemistry, mRNA expression levels, and serum biochemistry were then assessed. Following 3 weeks of DDC-feeding, Cd39<sup>-/-</sup> mice exhibited more severe fibrosis, when compared to WT mice as reflected by morphology and increased liver collagen content. Myeloid-specific CD39 deletion in LysMCreCd39<sup>fl/fl</sup> mice recapitulated the phenotype of global Cd39<sup>-/-</sup>, after exposure to DDC, and resulted in similar worsening of liver fibrosis when compared to Cd39<sup>fl/fl</sup> control animals. Further, DDC-treated LysMCreCd39<sup>fl/fl</sup> mice exhibited elevated serum levels of transaminases and total bilirubin, as well as increased hepatic expression of the profibrogenic genes Tgf-β1, Tnf-α, and α-Sma. However, no clear differences were observed in the expression of macrophage-elaborated specific cytokines between LysMCreCd39<sup>fl/fl</sup> and Cd39<sup>fl/fl</sup> animals subjected to biliary injury. Our results in the DDC-induced biliary type liver fibrosis model suggest that loss of CD39 expression on myeloid cells largely accounts for the exacerbated sclerosing cholangitis in global CD39 knockouts. These findings indicate that macrophage expressed CD39 protects from biliary liver injury and fibrosis and support a potential therapeutic target for human hepatobiliary diseases.

Also flagged:CapsaicinHepatocellular carcinomacancerssorafenibpathogenesisangiogenesis
Journal Article 2019-06-26 ✓ 2 Snippets Scheau C, Badarau IA, Caruntu C, Mihai GL, Didilescu AC, Constantin C, Neagu M.
In-Text Gene Mentions

Capsaicin can inhibit the activity of tumor-associated NADH oxidase (tNOX) by suppressing the expression of domain transcription factor POU3F2, restricting tumoral growth and inducing apoptosis [104].

…domain transcription factorPOU3F2, restricting tumoral growth…

Show Full Abstract

Hepatocellular carcinoma (HCC) is one of the most frequent cancers, and to date, there have been very few drugs available that can improve survival, the most well-known being sorafenib. The pathogenesis of HCC is complex, involving multiple processes including abnormal cell and tissue regeneration, angiogenesis, genomic instability, cellular proliferation, and signaling pathway alterations. Capsaicin is a substance that holds increasingly high interest and is studied as a therapeutic option in a wide array of diseases. Several studies have investigated capsaicin roles in various stages of HCC oncogenesis. This paper aims to thoroughly detail the available information on the individual effects of capsaicin on the cellular mechanisms and pathways involved in HCC development, as well as investigate their possible cooperation and interferences. The synergistic antitumor effects of capsaicin and sorafenib are also addressed.

Also flagged:Metastatic Associated Protein Anterior Gradient Homologue 2metastatic-linked protein anterior gradient homologue 2AGR2cancercentral nervous systemCNS) tumors
Journal Article 2019-06-26 No Snippets Alsereihi R, Schulten HJ, Bakhashab S, Saini K, Al-Hejin AM, Hussein D.
Show Full Abstract

Effective diagnostic, prognostic and therapeutic biomarkers can help in tracking disease progress, predict patients' survival, and considerably affect the drive for successful clinical management. The present review aims to determine how the metastatic-linked protein anterior gradient homologue 2 (AGR2) operates to affect cancer progression, and to identify associated potential diagnostic, prognostic and therapeutic biomarkers, particularly in central nervous system (CNS) tumors. Studies that show a high expression level of AGR2, and associate the protein expression with the resilience to chemotherapeutic treatments or with poor cancer survival, are reported. The primary protein structures of the seven variants of AGR2, including their functional domains, are summarized. Based on experiments in various biological models, this review shows an orchestra of multiple molecules that regulate AGR2 expression, including a feedback loop with p53. The AGR2-associated molecular functions and pathways including genomic integrity, proliferation, apoptosis, angiogenesis, adhesion, migration, stemness, and inflammation, are detailed. In addition, the mechanisms that can enable the rampant oncogenic effects of AGR2 are clarified. The different strategies used to therapeutically target AGR2-positive cancer cells are evaluated in light of the current evidence. Moreover, novel associated pathways and clinically relevant deregulated genes in AGR2 high CNS tumors are identified using a meta-analysis approach.

Also flagged:dexamethasonekidney cystsnucleic acidneurological diseaseacidmetabolism
Journal Article 2019-06-26 No Snippets Malkawi AK, Masood A, Shinwari Z, Jacob M, Benabdelkamel H, Matic G, Almuhanna F, Dasouki M, Alaiya AA, Rahman AMA.
Show Full Abstract

Prolonged dexamethasone (Dex) administration leads to serious adverse and decrease brain and heart size, muscular atrophy, hemorrhagic liver, and presence of kidney cysts. Herein, we used an untargeted proteomic approach using liquid chromatography-tandem mass spectrometry (LC-MS/MS) for simultaneous identification of changes in proteomes of the major organs in Sprague-Dawley (SD rats post Dex treatment. The comparative and quantitative proteomic analysis of the brain, heart, muscle, liver, and kidney tissues revealed differential expression of proteins (<i>n</i> = 190, 193, 39, 230, and 53, respectively) between Dex-treated and control rats. Functional network analysis using ingenuity pathway analysis (IPA revealed significant differences in regulation of metabolic pathways within the morphologically changed organs that related to: (i) brain-cell morphology, nervous system development, and function and neurological disease; (ii) heart-cellular development, cellular function and maintenance, connective tissue development and function; (iii) skeletal muscle-nucleic acid metabolism, and small molecule biochemical pathways; (iv) liver-lipid metabolism, small molecular biochemistry, and nucleic acid metabolism; and (v) kidney-drug metabolism, organism injury and abnormalities, and renal damage. Our study provides a comprehensive description of the organ-specific proteomic profilesand differentially altered biochemical pathways, after prolonged Dex treatement to understand the molecular basis for development of side effects.

Also flagged:acute pancreatitisinositol triphosphate receptorIP3Rryanodine receptorRyRPancreatitis
Journal Article 2019-06-26 No Snippets Kim SH, Park Y, Lim JW, Kim H.
Show Full Abstract

Intracellular Ca<sup>2+</sup> homeostasis is commonly disrupted in acute pancreatitis. Sustained Ca<sup>2+</sup> release from internal stores in pancreatic acinar cells (PACs), mediated by inositol triphosphate receptor (IP3R) and the ryanodine receptor (RyR), plays a key role in the initiation and propagation of acute pancreatitis. Pancreatitis induced by cerulein, an analogue of cholecystokinin, causes premature activation of digestive enzymes and enhanced accumulation of cytokines and Ca<sup>2+</sup> in the pancreas and, as such, it is a good model of acute pancreatitis. High concentrations of the omega-3 fatty acid docosahexaenoic acid (DHA) inhibit inflammatory signaling pathways and cytokine expression in PACs treated with cerulein. In the present study, we determined the effect of DHA on key regulators of Ca<sup>2+</sup> signaling in cerulein-treated pancreatic acinar AR42 J cells. The results of RNA-Sequencing (RNA-Seq) analysis showed that cerulein up-regulates the expression of IP3R1 and RyR2 genes, and that pretreatment with DHA blocks these effects. The results of real-time PCR confirmed that DHA inhibits cerulein-induced IP3R1 and RyR2 gene expression, and demonstrated that DHA pre-treatment decreases the expression of the Relb gene, which encodes a component of the nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB) transcriptional activator complex, and the c-fos gene, which encodes a component of activator protein-1 (AP-1) transcriptional activator complex. Taken together, DHA inhibits mRNA expression of IP3R1, RyR2, Relb, and c-fos, which is related to Ca<sup>2+</sup> network in cerulein-stimulated PACs.

Also flagged:pubertycongenital hypogonadotropic hypogonadismpathogenesisGnRHneuronal migrationFGFR1
Journal Article 2019-06-26 No Snippets Howard SR.
Show Full Abstract

Delayed pubertal onset has many etiologies, but on average two-thirds of patients presenting with late puberty have self-limited (or constitutional) delayed puberty. Self-limited delayed puberty often has a strong familial basis. Segregation analyses from previous studies show complex models of inheritance, most commonly autosomal dominant, but also including autosomal recessive, bilineal, and X-linked. Sporadic cases are also observed. Despite this, the neuroendocrine mechanisms and genetic regulation remain unclear in the majority of patients with self-limited delayed puberty. Only rarely have mutations in genes known to cause aberrations of the hypothalamic-pituitary-gonadal axis been identified in cases of delayed puberty, and the majority of these are in relatives of patients with congenital hypogonadotropic hypogonadism (CHH), for example in the <i>FGFR1</i> and <i>GNRHR</i> genes. Using next generation sequencing in a large family with isolated self-limited delayed puberty, a pathogenic mutation in the CHH gene <i>HS6ST1</i> was found as the likely cause for this phenotype. Additionally, a study comparing the frequency of mutations in genes that cause GnRH deficiency between probands with CHH and probands with isolated self-limited delayed puberty identified that a significantly higher proportion of mutations with a greater degree of oligogenicity were seen in the CHH group. Mutations in the gene <i>IGSF10</i> have been implicated in the pathogenesis of familial late puberty in a large Finnish cohort. <i>IGSF10</i> disruption represents a fetal origin of delayed puberty, with dysregulation of GnRH neuronal migration during embryonic development presenting for the first time in adolescence as late puberty. Some patients with self-limited delayed puberty have distinct constitutional features of growth and puberty. Deleterious variants in <i>FTO</i> have been found in families with delayed puberty with extremely low BMI and maturational delay in growth in early childhood. Recent exciting evidence highlights the importance of epigenetic up-regulation of GnRH transcription by a network of miRNAs and transcription factors, including <i>EAP1</i>, during puberty. Whilst a fascinating heterogeneity of genetic defects have been shown to result in delayed and disordered puberty, and many are yet to be discovered, genetic testing may become a realistic diagnostic tool for the differentiation of conditions of delayed puberty.

Also flagged:-factorfibromyalgiatrigeminal neuralgiabrain-derived-neurotrophic-factorBDNFshort-term memory
Journal Article 2019-06-26 No Snippets Beltran Serrano G, Rodrigues LP, Schein B, Souza A, Torres ILS, da Conceição Antunes L, Fregni F, Caumo W.
Show Full Abstract

<b>Objectives:</b> This paper aims to determine if hypnotic analgesia suggestion and transcranial direct-current stimulation (tDCS) have a differential effect on pain perception. We hypothesized that transcranial direct-current stimulation would be more effective than hypnotic analgesia suggestion at changing the descending pain modulating system, whereas the hypnotic suggestion would have a greater effect in quantitative sensory testing. <b>Design:</b> This is a randomized, double blind and crossover trial. <b>Settings:</b> All stages of this clinical trial were performed at the Laboratory of Pain and Neuromodulation of the Hospital de Clínicas de Porto Alegre. <b>Subjects:</b> Were included 24 healthy females aged from 18 to 45 years old, with a high susceptibility to hypnosis, according to the Waterloo-Stanford Group Scale of Hypnotic Susceptibility, Form C (15). <b>Methods:</b> The subjects received a random and crossover transcranial direct-current stimulation over the dorsolateral prefrontal cortex (2 mA for 20 min) and hypnotic analgesia (20 min). <b>Results:</b> Only hypnotic suggestion produced changes that are statistically significant from pre- to post-intervention in the following outcomes measures: heat pain threshold, heat pain tolerance, cold pressure test, and serum brain-derivate-neurotrophic-factor. The analysis showed a significant main effect for treatment (<i>F</i> = 4.32; <i>P</i> = 0.04) when we compared the delta-(Δ) of conditioned pain modulation task between the transcranial direct-current stimulation and hypnotic suggestion groups. Also, the change in the brain-derivate-neurotrophic-factor was positively correlated with the conditioned pain modulation task. <b>Conclusion:</b> The results confirm a differential effect between hypnotic suggestion and transcranial direct-current stimulation on the pain measures. They suggest that the impact of the interventions has differential neural mechanisms, since the hypnotic suggestion improved pain perception, whereas the transcranial direct-current stimulation increased inhibition of the descending pain modulating system. <b>Clinical Trial Registration:</b> www.ClinicalTrials.gov, identifier NCT03744897. <b>Perspective:</b> These findings highlight the effect of hypnotic suggestion on contra-regulating mechanisms involved in pain perception, while the transcranial direct-current stimulation increased inhibition of the descending pain modulating system. They could help clinicians comprehend the mechanisms involved in hypnotic analgesia and transcranial direct-current stimulation and thus may contribute to pain and disability management.

Also flagged:guidance moleculesSemaphorinsEphrinsaxonalinflammatory responsesneurodegenerative diseases
Journal Article 2019-06-26 No Snippets Lee WS, Lee WH, Bae YC, Suk K.
Show Full Abstract

Axon guidance molecules (AGMs), such as Netrins, Semaphorins, and Ephrins, have long been known to regulate axonal growth in the developing nervous system. Interestingly, the chemotactic properties of AGMs are also important in the postnatal period, such as in the regulation of immune and inflammatory responses. In particular, AGMs play pivotal roles in inflammation of the nervous system, by either stimulating or inhibiting inflammatory responses, depending on specific ligand-receptor combinations. Understanding such regulatory functions of AGMs in neuroinflammation may allow finding new molecular targets to treat neurodegenerative diseases, in which neuroinflammation underlies aetiology and progression.

Also flagged:hemorrhagic shockhepatocellular carcinomacapsulecarcinomaMalignant tumors of the liverdeath
Journal Article 2019-06-26 ✓ 1 Snippet Janeiro C, Santos R, Teixeira J, Mesquita P, Eça R, Vale L.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Sometimes, the presentation of some diseases can be fulminating. The authors present the case of a 51-year- old male brought to the emergency department visibly drunk and complaining of abdominal pain. Immediately, the diagnosis of hemorrhagic shock due to an accentuated drop of the hemoglobin level was made. After stabilization, he underwent a computed tomography of the abdomen, revealing a hepatocellular carcinoma with rupture of the Glisson capsule and massive intraperitoneal hemorrhage. With this case, the authors want to bring attention to a rare first presentation of hepatocellular carcinoma with a catastrophic result.

Also flagged:behavioralconduct disorderMAOAdepression5-HTTLPRchromosomes
Journal Article 2019-06-26 No Snippets Tanksley PT, Motz RT, Kail RM, Barnes JC, Liu H.
Show Full Abstract

Recent years have seen a push for the integration of modern genomic methodologies with sociological inquiry. The inclusion of genomic approaches promises to help address long-standing issues in sociology (e.g., selection effects), as well as open up new avenues for future research. This article reviews the substantive findings of behavior genetic/genomic research, both from the recent past (e.g., twin/adoption studies, candidate gene studies) and from contemporary genomic analyses. The article primarily focuses on modern genomic methods available to sociologists (e.g., polygenic score analysis) and their various applications for answering sociological questions. The article concludes by considering a number of areas to which genomic researchers and sociologists should pay close attention if a consilience between genomic methods and sociological research is to be fully realized.

bioRxiv 2019-06-26 Preprint (No Snippets API) Kim E, Kerssemakers J, Shaltiel IA, Haering CH, Dekker C.
Show Full Abstract

Condensin, a key member of the Structure Maintenance of Chromosome (SMC) protein complexes, has recently been shown to be a motor that extrudes loops of DNA 1 . It remains unclear, however, how condensin complexes work together to collectively package DNA into the chromosomal architecture. Here, we use time-lapse single-molecule visualization to study mutual interactions between two DNA-loop-extruding yeast condensins. We find that these one-side-pulling motor proteins are able to dynamically change each other’s DNA loop sizes, even when located large distances apart. When coming into close proximity upon forming a loop within a loop, condensin complexes are, surprisingly, able to traverse each other and form a new type of loop structure, which we term Z loop – three double-stranded DNA helices aligned in parallel with one condensin at each edge. These Z-loops can fill gaps left by single loops and can form symmetric dimer motors that reel in DNA from both sides. These new findings indicate that condensin may achieve chromosomal compaction using a variety of looping structures.

Also flagged:hpdfucKcapsularbexAProtein DMiddle Ear Infections
Journal Article 2019-06-25 ✓ 1 Snippet Sveinsdóttir H, Björnsdóttir JB, Erlendsdóttir H, Hjálmarsdóttir MÁ, Hrafnkelsson B, Haraldsson Á, Kristinsson KG, Haraldsson G.
In-Text Gene Mentions

…When H. influenzae isolates showing different colony morphologies were seen from DCC samples, isolates of each respective form were included in the study.…

Show Full Abstract

Vaccinations with the 10-valent pneumococcal conjugated vaccine (PHiD-CV) started in Iceland in 2011. Protein D (PD) from <i>H. influenzae</i>, which is coded for by the <i>hpd</i> gene, is used as a conjugate in the vaccine and may provide protection against PD-positive <i>H. influenzae</i> We aimed to evaluate the effect of PHiD-CV vaccination on <i>H. influenzae</i> in children, both in carriage and in acute otitis media (AOM). <i>H. influenzae</i> was isolated from nasopharyngeal swabs collected from healthy children attending 15 day care centers in 2009 and from 2012 to 2017 and from middle ear (ME) samples from children with AOM collected from 2012 to 2017. All isolates were identified using PCR for the <i>hpd</i> and <i>fucK</i> genes. Of the 3,600 samples collected from healthy children, 2,465 were culture positive for <i>H. influenzae</i> (68.5% carriage rate); of these, 151 (6.1%) contained <i>hpd</i>-negative isolates. Of the 2,847 ME samples collected, 889 (31.2%) were culture positive for <i>H. influenzae</i>; of these, 71 (8.0%) were <i>hpd</i> negative. Despite the same practice throughout the study, the annual number of ME samples reduced from 660 in 2012 to 330 in 2017. The proportions of <i>hpd</i>-negative isolates in unvaccinated versus vaccinated children were 5.6% and 7.0%, respectively, in healthy carriers, and 5.4% and 7.8%, respectively, in ME samples. The proportion of <i>hpd</i>-negative isolates increased with time in ME samples but not in healthy carriers. The number of ME samples from children with AOM decreased. The PHiD-CV had no effect on the proportion of the <i>hpd</i> gene in <i>H. influenzae</i> from carriage, but there was an increase in <i>hpd</i>-negative <i>H. influenzae</i> in otitis media. The proportions of <i>hpd</i>-negative isolates remained similar in vaccinated and unvaccinated children.

Also flagged:Cytochrome P450 2E1transcription factorsMat1aCYP2E1bindingAlcoholic liver disease
Journal Article 2019-06-25 ✓ 1 Snippet Murray B, Peng H, Barbier-Torres L, Robinson AE, Li TWH, Fan W, Tomasi ML, Gottlieb RA, Van Eyk J, Lu Z, Martínez-Chantar ML, Liangpunsakul S, Skill NJ, Mato JM, Lu SC.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Methionine adenosyltransferase α1 (MATα1, encoded by MAT1A) is responsible for hepatic biosynthesis of S-adenosyl methionine, the principal methyl donor. MATα1 also act as a transcriptional cofactor by interacting and influencing the activity of several transcription factors. Mat1a knockout (KO) mice have increased levels of cytochrome P450 2E1 (CYP2E1), but the underlying mechanisms are unknown. The aims of the current study were to identify binding partners of MATα1 and elucidate how MATα1 regulates CYP2E1 expression. We identified binding partners of MATα1 by coimmunoprecipitation (co-IP) and mass spectrometry. Interacting proteins were confirmed using co-IP using recombinant proteins, liver lysates, and mitochondria. Alcoholic liver disease (ALD) samples were used to confirm relevance of our findings. We found that MATα1 negatively regulates CYP2E1 at mRNA and protein levels, with the latter being the dominant mechanism. MATα1 interacts with many proteins but with a predominance of mitochondrial proteins including CYP2E1. We found that MATα1 is present in the mitochondrial matrix of hepatocytes using immunogold electron microscopy. Mat1a KO hepatocytes had reduced mitochondrial membrane potential and higher mitochondrial reactive oxygen species, both of which were normalized when MAT1A was overexpressed. In addition, KO hepatocytes were sensitized to ethanol and tumor necrosis factor α-induced mitochondrial dysfunction. Interaction of MATα1 with CYP2E1 was direct, and this facilitated CYP2E1 methylation at R379, leading to its degradation through the proteasomal pathway. Mat1a KO livers have a reduced methylated/total CYP2E1 ratio. MATα1's influence on mitochondrial function is largely mediated by its effect on CYP2E1 expression. Patients with ALD have reduced MATα1 levels and a decrease in methylated/total CYP2E1 ratio. Conclusion: Our findings highlight a critical role of MATα1 in regulating mitochondrial function by suppressing CYP2E1 expression at multiple levels.

Also flagged:breast cancerGene Expressionfatty acidfibroblast growth factorCREB1ARF3
Journal Article 2019-06-25 No Snippets Zhang J, Zhou YJ, Yu ZH, Chen AX, Yu Y, Wang X, Cao XC.
Show Full Abstract

More women are delaying child-birth. Thus, the diagnosis of pregnancy-associated breast cancer (PABC) will continue to increase. The aim of this study was to identify core candidate genes of PABC, and the relevance of the genes on the prognosis of PABC. GSE31192 and GSE53031 microarray profile datasets were downloaded from the Gene Expression Omnibus database and differentially expressed genes were analyzed using the R package and GEO2R tool. Then, Gene Ontology and Kyoto Encyclopedia of Gene and Genome pathway enrichment analyses were performed using the Database for Annotation, Visualization, and Integrated Discovery. Moreover, the Search Tool for the Retrieval of Interacting Genes and the Molecular Complex Detection Cytoscape software plug-in were utilized to visualize protein-protein interactions and to screen candidate genes. A total of 239 DEGs were identified in PABC, including 101 up-regulated genes mainly enriched in fatty acid activation and the fibroblast growth factor signaling pathway, while 138 down-regulated genes particularly involved in activation of DNA fragmentation factor and apoptosis-induced DNA fragmentation. Fourteen hub genes with a high degree of connectivity were selected, including CREB1, ARF3, UBA5, SIAH1, KLHL3, HECTD1, MMP9, TRIM69, MEX3C, ASB6, UBE2Q2, FBXO22, EIF4A3, and PXN. Overall survival (OS) analysis of core candidate genes was performed using the Gene Expression Profiling Interactive Analysis and UALCAN websites. High ASB6 expression was associated with worse OS of PABC patients. Molecular subtypes and menopause status were also associated with worse OS for PABC patients. In conclusion, ASB6 could be a potential predictor and therapeutic target in patient with PABC.

Also flagged:hepatocellular carcinomaAFPhepatitis C liver diseaseend-stage liver diseasedeathAlpha Fetoprotein
Journal Article 2019-06-25 ✓ 1 Snippet Mahmud N, John B, Taddei TH, Goldberg DS.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Although liver transplantation may potentially cure hepatocellular carcinoma (HCC), the risk of HCC recurrence is 8%-20% at five years post-transplant. Pre-transplant alpha-fetoprotein (AFP) is a predictor of HCC recurrence, but it is unknown if pre-transplant AFP also predicts survival in patients with recurrence.<h4>Methods</h4>We performed a retrospective cohort study using the United Network for Organ Sharing (UNOS) database between 2002 and 2016. We identified adult transplant recipients with HCC recurrence after liver transplantation for HCC and used Cox regression to compare patient survival among different maximum pre-transplant AFP levels.<h4>Results</h4>The cohort (N = 1164) was primarily male, white, and with hepatitis C liver disease. The median time to HCC recurrence was 11.6 months (interquartile range 6.1-26.3). In Cox regression analysis, increasing pre-transplant AFP was associated with poorer survival when adjusting for age, pre-transplant model for end-stage liver disease (MELD), and time to HCC recurrence. For example, patients with pre-transplant AFP ≥500ng/mL had a 1.6-fold higher risk of death versus those with AFP ≤20ng/mL (P < 0.001).<h4>Conclusion</h4>Pre-transplant AFP is independently associated with survival in patients with HCC recurrence. These findings further contextualize the importance of pre-transplant AFP in liver transplantation and may improve prognostication for patients with HCC recurrence.

Also flagged:lipidcell adhesionPDE4DIL1RAPmetabolismKLHL30
Journal Article 2019-06-25 ✓ 1 Snippet Dos Santos Silva DB, Fonseca LFS, Pinheiro DG, Muniz MMM, Magalhães AFB, Baldi F, Ferro JA, Chardulo LAL, de Albuquerque LG.
In-Text Gene Mentions

…( PDE4D ),kelch-Like family member 30family member 30…

Show Full Abstract

<h4>Background</h4>The aim of this study was to use transcriptome RNA-Seq data from longissimus thoracis muscle of uncastrated Nelore males to identify hub genes based on co-expression network obtained from differentially expressed genes (DEGs) associated with intramuscular fat content.<h4>Results</h4>A total of 30 transcriptomics datasets (RNA-Seq) obtained from longissimus thoracis muscle were selected based on the phenotypic value of divergent intramuscular fat content: 15 with the highest intramuscular fat content (HIF) and 15 with the lowest intramuscular fat content (LIF). The transcriptomics datasets were aligned with a reference genome and 65 differentially expressed genes (DEGs) were identified, including 21 upregulated and 44 downregulated genes in HIF animals. The normalized count data from DEGs was then used for co-expression network construction. From the co-expression network, four modules were identified. The topological properties of the network were analyzed; those genes engaging in the most interactions (maximal clique centrality method) with other DEGs were predicted to be hub genes (PDE4D, KLHL30 and IL1RAP), which consequently may play a role in cellular and/or systemic lipid biology in Nelore cattle. Top modules screened from the gene co-expression network were identify. The two candidate modules had clear associated biological pathways related to fat development, cell adhesion, and muscle differentiation, immune system, among others. The hub genes belonged in top modules and were downregulated in HIF animals. PDE4D and IL1RAP have known effects on lipid metabolism and the immune system through the regulation of cAMP signaling. Given that cAMP is known to play a role in lipid systems, PDE4D and IL1RAP downregulation may contribute to increased levels of intracellular cAMP and thus may have effects on IF content differences in Nelore cattle. KLHL30 may have effects on muscle metabolism. Klhl protein families play a role in protein degradation. However, the downregulation of this gene and its role in lipid metabolism has not yet been clarified.<h4>Conclusions</h4>The results reported in this study indicate candidate genes and molecular mechanisms involved in IF content difference in Nelore cattle.

Also flagged:Endosomesmembranecell growthcancercolorectal cancersRab11
Journal Article 2019-06-25 ✓ 1 Snippet D'Agostino L, Nie Y, Goswami S, Tong K, Yu S, Bandyopadhyay S, Flores J, Zhang X, Balasubramanian I, Joseph I, Sakamori R, Farrell V, Li Q, Yang CS, Gao B, Ferraris RP, Yehia G, Bonder EM, Goldenring JR, Verzi MP, Zhang L, Ip YT, Gao N.
In-Text Gene Mentions

Olfm4

Show Full Abstract

The effects of polarized membrane trafficking in mature epithelial tissue on cell growth and cancer progression have not been fully explored <i>in vivo</i>. A majority of colorectal cancers have reduced and mislocalized Rab11, a small GTPase dedicated to trafficking of recycling endosomes. Patients with low Rab11 protein expression have poor survival rates. Using genetic models across species, we show that intact recycling endosome function restrains aberrant epithelial growth elicited by APC or RAS mutations. Loss of Rab11 protein led to epithelial dysplasia in early animal development and synergized with oncogenic pathways to accelerate tumor progression initiated by carcinogen, genetic mutation, or aging. Transcriptomic analysis uncovered an immediate expansion of the intestinal stem cell pool along with cell-autonomous Yki/Yap activation following disruption of Rab11a-mediated recycling endosomes. Intestinal tumors lacking Rab11a traffic exhibited marked elevation of nuclear Yap, upd3/IL6-Stat3, and amphiregulin-MAPK signaling, whereas suppression of Yki/Yap or upd3/IL6 reduced gut epithelial dysplasia and hyperplasia. Examination of Rab11a function in enteroids or cultured cell lines suggested that this endosome unit is required for suppression of the Yap pathway by Hippo kinases. Thus, recycling endosomes in mature epithelia constitute key tumor suppressors, loss of which accelerates carcinogenesis. SIGNIFICANCE: Recycling endosome traffic in mature epithelia constitutes a novel tumor suppressing mechanism.

Also flagged:CytoskeletonProtein Kinase AMAPKCalpainNucleotideextracellular
Journal Article 2019-06-25 ✓ 3 Snippets Ciano M, Mantellato G, Connolly M, Paul-Clark M, Willis-Owen S, Moffatt MF, Cookson WOCM, Mitchell JA, Polkey MI, Hughes SM, Kemp PR, Natanek SA.
In-Text Gene Mentions

SOX6

…module membership isSOX6(MM 0.77) encoding…

…this, transcripts ofsox6, a suppressor…

Show Full Abstract

A low quadriceps slow-twitch (ST), oxidative (relative to fast-twitch) fiber proportion is prevalent in chronic diseases such Chronic Obstructive Pulmonary Disease (COPD) and is associated with exercise limitation and poor outcomes. Benefits of an increased ST fiber proportion are demonstrated in genetically modified animals. Pathway analysis of published data of differentially expressed genes in mouse ST and FT fibers, mining of our microarray data and a qPCR analysis of quadriceps specimens from COPD patients and controls were performed. ST markers were quantified in C2C12 myotubes with EGF-neutralizing antibody, EGFR inhibitor or an EGFR-silencing RNA added. A zebrafish egfra mutant was generated by genome editing and ST fibers counted. EGF signaling was (negatively) associated with the ST muscle phenotype in mice and humans, and muscle EGF transcript levels were raised in COPD. In C2C12 myotubes, EGFR inhibition/silencing increased ST, including mitochondrial, markers. In zebrafish, egfra depletion increased ST fibers and mitochondrial content. EGF is negatively associated with ST muscle phenotype in mice, healthy humans and COPD patients. EGFR blockade promotes the ST phenotype in myotubes and zebrafish embryos. EGF signaling suppresses the ST phenotype, therefore EGFR inhibitors may be potential treatments for COPD-related muscle ST fiber loss.

Also flagged:immune responsehistonebindingresponse to hypoxiamitochondrionorganelle
Journal Article 2019-06-25 ✓ 1 Snippet Kharrati-Koopaee H, Ebrahimie E, Ebrahimie E, Dadpasand M, Niazi A, Esmailizadeh A.
In-Text Gene Mentions

…DNASE , andMMS22Lwere suggested as…

Show Full Abstract

Native chickens are endangered genetic resources that are kept by farmers for different purposes. Native chickens distributed in a wide range of altitudes, have developed adaptive mechanisms to deal with hypoxia. For the first time, we report variants associated with high-altitude adaptation in Iranian native chickens by whole genome sequencing of lowland and highland chickens. We found that these adaptive variants are involved in DNA repair, organs development, immune response and histone binding. Amazingly, signature selection analysis demonstrated that differential variants are adaptive in response to hypoxia and are not due to other evolutionary pressures. Cellular component analysis of variants showed that mitochondrion is the most important organelle for hypoxia adaptation. A total of 50 variants was detected in mtDNA for highland and lowland chickens. High-altitude associated with variant discovery highlighted the importance of COX3, a gene involved in cell respiration, in hypoxia adaptation. The results of study suggest that MIR6644-2 is involved in hypoxia and high-altitude adaptations by regulation of embryo development. Finally, 3877 novel SNVs including the mtDNA ones, were submitted to EBI (PRJEB24944). Whole-genome sequencing and variant discovery of native chickens provided novel insights about adaptation mechanisms and highlights the importance of valuable genomic variants in chickens.

Also flagged:Cystathionine β-SynthaseIschemic strokesynthase deficiencyCBSmetabolismvascular thromboembolism
Journal Article 2019-06-25 ✓ 5 Snippets Sikora M, Lewandowska I, Kupc M, Kubalska J, Graban A, Marczak Ł, Kaźmierski R, Jakubowski H.
In-Text Gene Mentions

Specifically, the identification of CBS deficiency-responsive proteins that are involved in acute phase response (e.g., SAA1, SERPINA1, ORM2, AHSG), immune response (e.g., IGHD, IGJ, APC, C4BPA, IGHV3-72, IGK, IGKV2D-24), blood coagulation (e.g., FBLN1, KNG, APOH, C1S, C1R, CF1, CBP2, SERPINC1, SERPINF2, SERPIND1, F2, F13B), and lipid/cholesterol transport/metabolism (APOC1, APOC3, APOA1, APOM) supports this conclusion.

Most of the proteins affected by CBS deficiency include those involved in acute phase response (SAA1, SERPINA1, ORM2, AHSG), immune response (IGHD, IGJ, APC, C4BPA, IGHV3-72, IGK, IGKV2D-24), blood coagulation (FBLN1, KNG, APOH, C1S, C1R, CF1, CBP2, SERPINC1, SERPINF2, SERPIND1, F2, F13B), and lipid/cholesterol transport/metabolism (APOC1, APOC3, APOA1, APOM) (Table 3).

…quantified serum SAA1,SERPINC1, and GPX3 using…

…C1R, CF1, CBP2,SERPINC1, SERPINF2, SERPIND1, F2,…

…phase response proteinSERPINC1, downregulated in CBS-deficie…

Show Full Abstract

Ischemic stroke induces brain injury via thrombotic or embolic mechanisms involving large or small vessels. Cystathionine β-synthase deficiency (CBS), an inborn error of metabolism, is associated with vascular thromboembolism, the major cause of morbidity and mortality in affected patients. Because thromboembolism involves the brain vasculature in these patients, we hypothesize that CBS deficiency and ischemic stroke have similar molecular phenotypes. We used label-free mass spectrometry for quantification of changes in serum proteomes in CBS-deficient patients (<i>n</i> = 10) and gender/age-matched unaffected controls (<i>n</i> = 14), as well as in patients with cardioembolic (<i>n</i> = 17), large-vessel (<i>n</i> = 26), or lacunar (<i>n</i> = 25) ischemic stroke subtype. In CBS-deficient patients, 40 differentially expressed serum proteins were identified, of which 18 were associated with elevated homocysteine (Hcy) and 22 were Hcy-independent. We also identified Hcy-independent differentially expressed serum proteins in ischemic stroke patients, some of which were unique to a specific subtype: 10 of 32 for cardioembolic vs. large-vessel, six of 33 for cardioembolic vs. lacunar, and six of 23 for large-vessel vs. lacunar. There were significant overlaps between proteins affected by CBS deficiency and ischemic stroke, particularly the cardioembolic subtype, similar to protein overlaps between ischemic stroke subtypes. Top molecular pathways affected by CBS deficiency and ischemic stroke subtypes included acute phase response signaling and coagulation system. Similar molecular networks centering on NFκB were affected by CBS deficiency and stroke subtypes. These findings suggest common mechanisms involved in the pathologies of CBS deficiency and ischemic stroke subtypes.

Also flagged:neurodegenerative pathologiesageingtight junctioncell adhesionbindingautophagy
Journal Article 2019-06-25 ✓ 1 Snippet Goodall EF, Leach V, Wang C, Cooper-Knock J, Heath PR, Baker D, Drew DR, Saffrey MJ, Simpson JE, Romero IA, Wharton SB.
In-Text Gene Mentions

…), huntingtin (HTT), myocardial infarction…

Show Full Abstract

Functional and structural age-associated changes in the blood-brain barrier (BBB) may affect the neurovascular unit and contribute to the onset and progression of age-associated neurodegenerative pathologies, including Alzheimer's disease. The current study interrogated the RNA profile of the BBB in an ageing human autopsy brain cohort and an ageing mouse model using combined laser capture microdissection and expression profiling. Only 12 overlapping genes were altered in the same direction in the BBB of both ageing human and mouse cohorts. These included genes with roles in regulating vascular tone, tight junction protein expression and cell adhesion, all processes prone to dysregulation with advancing age. Integrated mRNA and miRNA network and pathway enrichment analysis of the datasets identified 15 overlapping miRNAs that showed altered expression. In addition to targeting genes related to DNA binding and/or autophagy, many of the miRNAs identified play a role in age-relevant processes, including BBB dysfunction and regulating the neuroinflammatory response. Future studies have the potential to develop targeted therapeutic approaches against these candidates to prevent vascular dysfunction in the ageing brain.

Also flagged:Fatty Acid Elongase 7ELOVL7SynthesisUnsaturated Fatty Acidslactationtriacylglycerol
Journal Article 2019-06-25 ✓ 1 Snippet Shi H, Wang L, Luo J, Liu J, Loor JJ, Liu H.
In-Text Gene Mentions

…protein L39 (MRPL39), and ribosomal…

Show Full Abstract

In humans, fatty acid elongase 7 (ELOVL7) plays a role in synthesis of long-chain saturated fatty acids. Whether ELOVL7 protein plays a role in ruminants is unclear. The transcript abundance of ELOVL7 in goat mammary tissue was assessed at three stages of lactation. Results showed that ELOVL7 had the highest expression in the dry period compared with peak and late lactation period. Results revealed that ELOVL7 overexpression was correlated with lower expression in diacylglycerol O-acyltransferase 2 (<i>DGAT2</i>) and stearoyl-CoA desaturase 1 (<i>SCD1</i>), and had no significant effect on triacylglycerol concentration. Overexpression of <i>ELOVL7</i> significantly decreased the concentration of palmitoleic (C16:1n7) and oleic (C18:1n9) acid, and increased the concentration of vaccenic (C18:1n7) and linoleic (C18:2) acid. Overexpression of <i>ELOVL7</i> significantly upregulated the elongation index of C16:1 in goat epithelial mammary cells (GMEC), but had a minor effect on that of palmitate (C16:0). Knockdown of ELOVL7 decreased mRNA expression of fatty acid binding protein 3 (FABP3) and fatty acid desaturase 2 (FADS2) and had a minor effect on triacylglycerol concentration; however, it increased concentration of C18:1n9 in GMEC. The elongation indices of C16:0 and C16:1 did not differ due to knockdown of ELOVL7. The minor change for the C16:0 and stearate (C18:0) was observed after activation of ELOVL7, suggesting the two fatty acids are not the preferential substrates of ELOVL7 in cultured GMEC. However, changes in C18:1n9 and C18:2 after overexpression or knockdown of <i>ELOVL7</i> indicated a biological functional role of ELOVL7. Collectively, our data highlighted a role of ELOVL7 in long-chain unsaturated fatty acid elongation in goat mammary epithelial cells.

Also flagged:ovulationpeptidesPI3KAktestrogeninsulin
Journal Article 2019-06-25 No Snippets Hao Q, Zhu Z, Xu D, Liu W, Lyu L, Li P.
Show Full Abstract

<h4>Background</h4>Characterization of molecular factors regulating ovarian follicular development is critical to understanding its functional mechanism of controlling the estrous cycle, determining oocyte competency, and regulating ovulation. In previous studies, we performed next-gene sequencing to investigate the differentially expressed transcripts of bovine follicular granulosa cells (GCs) at the dominant follicle (DF) and subordinate follicle (SF) stages during the first follicular wave. This study aims to investigate the proteomic characterization of GCs of DF and SF in the bovine estrous cycle.<h4>Results</h4>In total, 3409 proteins were identified from 30,321 peptides obtained from liquid chromatograph-mass spectrometer analysis. Two hundred fifty-nine of these proteins were found to be expressed differently in DF and SF. Out of 259, a total of 26 proteins were upregulated (fold change≥2) and 233 proteins were downregulated (fold change≤0.5) in DF. Gene Ontology (GO) analysis of proteome data revealed the biological process, cellular component and molecular function of expressed proteins in DF and SF, while the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis showed important signaling pathways associated with follicular development such as the PI3K-Akt, estrogen, and insulin signaling pathways. Immunoblotting results of OGN, ROR2, and HSPB1 confirmed the accuracy of the data. Bioinformatics analysis showed that 13 proteins may be linked to follicular development.<h4>Conclusions</h4>Findings from this study will provide useful information for exploring follicular development and function.

Also flagged:ACEdepressionage-related cognitive declinecognitionbehaviouraloxygen
Journal Article 2019-06-25 ✓ 3 Snippets Elhakeem A, Elhakeem A, Hannam K, Deere KC, Wong A, Gaysin T, Kuh D, Cooper R, Richards M, Tobias JH.
In-Text Gene Mentions

…to 0.07) andACE-IIIscores (0.04; 95%…

…the validity ofACE-IIIfor diagnosing mild…

…test: 23.0 vs.21.8;ACE-III: 92.4 vs. 91.1).…

Show Full Abstract

<h4>Background</h4>Little is known about how different physical activity (PA) parameters relate to cognitive function in older adults. Using accelerometers calibrated to detect vertical impacts from ground reaction forces we examined the associations of low, medium and higher impact PA with processing speed, verbal memory and cognitive state in older adults.<h4>Methods</h4>Participants were 69-year old British men and women from the Medical Research Council National Survey of Health and Development included in a vertical impacts and bone sub-study (<i>n</i> = 558; 48.2% female). Counts of low (0.5 < <i>g</i> < 1.0 <i>g</i>), medium (1 < <i>g</i> < 1.5 <i>g</i>), or higher (≥1.5 <i>g</i>) magnitude impacts were derived from vertical acceleration peaks recorded over 7 days by hip-worn accelerometers. Processing speed was assessed by a timed visual letter search task, verbal memory by a 15-word list learning test and cognitive state by the Addenbrooke's Cognitive Examination (ACE-III). Potential confounders were childhood cognitive ability, adult socioeconomic position, body mass index and depression.<h4>Results</h4>In initial sex-adjusted models, low magnitude impacts were associated with better performance in all three cognitive function tests; standard deviation differences in test scores per doubling in number of low impacts: letter search speed = 0.10 (95% confidence intervals (CI): 0.03 to 0.16), word learning test = 0.05 (95% CI: 0.00 to 0.11), ACE-III scale = 0.09 (95% CI: 0.03 to 0.14). After adjustment for confounders, differences persisted for letter search speed (0.09; 95% CI: 0.02 to 0.16) but were closer to the null for the word learning test (0.02; 95% CI: - 0.04 to 0.07) and ACE-III scores (0.04; 95% CI: - 0.01 to 0.09). Low impacts remained associated with letter search speed after sensitivity analyses excluding those with functional and musculoskeletal problems, and after adjustment for impacts in higher bands. Modest positive associations between higher magnitude impacts and cognitive test scores were most likely due to chance.<h4>Conclusion</h4>Accelerometer-derived low impact physical activity was associated with better visual processing speed in 69-year old men and women independently of childhood cognitive ability and other measured confounders. Day-to-day low impact physical activity may therefore have the potential to benefit cognitive health in older adults.

Also flagged:glycineserotoninnociception5-hydroxytryptamineglycine receptorssignal transduction
Journal Article 2019-06-25 No Snippets Nguyen HTT, Cho DH, Jang SH, Han SK, Park SJ.
Show Full Abstract

The lamina II, also called the substantia gelatinosa (SG), of the trigeminal subnucleus caudalis (Vc), is thought to play an essential role in the control of orofacial nociception. Glycine and serotonin (5-hydroxytryptamine, 5-HT) are the important neurotransmitters that have the individual parts on the modulation of nociceptive transmission. However, the electrophysiological effects of 5-HT on the glycine receptors on SG neurons of the Vc have not been well studied yet. For this reason, we applied the whole-cell patch clamp technique to explore the interaction of intracellular signal transduction between 5-HT and the glycine receptors on SG neurons of the Vc in mice. In nine of 13 neurons tested (69.2%), pretreatment with 5-HT potentiated glycine-induced current (I<sub>Gly</sub>). Firstly, we examined with a 5-HT<sub>1</sub> receptor agonist (8-OH-DPAT, 5-HT<sub>1/7</sub> agonist, co-applied with SB-269970, 5-HT<sub>7</sub> antagonist) and antagonist (WAY-100635), but 5-HT<sub>1</sub> receptor agonist did not increase I<sub>Gly</sub> and in the presence of 5-HT<sub>1</sub> antagonist, the potentiation of 5-HT on I<sub>Gly</sub> still happened. However, an agonist (α-methyl-5-HT) and antagonist (ketanserin) of the 5-HT<sub>2</sub> receptor mimicked and inhibited the enhancing effect of 5-HT on I<sub>Gly</sub> in the SG neurons, respectively. We also verified the role of the 5-HT<sub>7</sub> receptor by using a 5-HT<sub>7</sub> antagonist (SB-269970) but it also did not block the enhancement of 5-HT on I<sub>Gly</sub>. Our study demonstrated that 5-HT facilitated I<sub>Gly</sub> in the SG neurons of the Vc through the 5-HT<sub>2</sub> receptor. The interaction between 5-HT and glycine appears to have a significant role in modulating the transmission of the nociceptive pathway.

Also flagged:GABA Receptorcognitionsynapseslocalizationprotein synthesisprotein degradation
Journal Article 2019-06-25 No Snippets Schieweck R, Kiebler MA.
Show Full Abstract

Behavior and higher cognition rely on the transfer of information between neurons through specialized contact sites termed synapses. Plasticity of neuronal circuits, a prerequisite to respond to environmental changes, is intrinsically coupled with the nerve cell's ability to form, structurally modulate or remove synapses. Consequently, the synaptic proteome undergoes dynamic alteration on demand in a spatiotemporally restricted manner. Therefore, proper protein localization at synapses is essential for synaptic function. This process is regulated by: (i) protein transport and recruitment; (ii) local protein synthesis; and (iii) synaptic protein degradation. These processes shape the transmission efficiency of excitatory synapses. Whether and how these processes influence synaptic inhibition is, however, widely unknown. Here, we summarize findings on fundamental regulatory processes that can be extrapolated to inhibitory synapses. In particular, we focus on known aspects of posttranscriptional regulation and protein dynamics of the GABA receptor (GABAR). Finally, we propose that local (co)-translational control mechanism might control transmission of inhibitory synapses.

Also flagged:Dyrk2BNPFbxw7Sesn1Btg2Lats2
Journal Article 2019-06-25 ✓ 2 Snippets Wang L, Qin D, Shi H, Zhang Y, Li H, Han Q, Han Q.
In-Text Gene Mentions

Sox6

…SESN1, DYRK2, JARID2,SOX6, FBXW7, TXNIP, LATS2,…

Show Full Abstract

Cardiac hypertrophy mainly predicts heart failure and is highly linked with sudden loss of lives. MicroRNAs (miRNAs) play essential roles in the development of cardiac hypertrophy through binding to corresponding mRNA targets. In this study, in order to investigate the roles of two mature forms of miRNA-195, miR-195-3p, and miR-195-5p, <i>in vitro</i> and <i>in vivo</i> models of cardiac hypertrophy were established by applying angiotensin II (Ang II) to H9c2 cardiomyocytes and infusing chronic Ang II to mice, respectively. We found that miR-195-5p was evidently equally upregulated in the <i>in vitro</i> and <i>in vivo</i> studies of cardiac hypertrophy induced by Ang II. High expressed miR-195-5p could adequately promote hypertrophy, whereas the suppression of miR-195-5p prevented hypertrophy of H9c2 cardiomyocytes under Ang II treatment. Furthermore, the luciferase reporter system demonstrated that MFN2 and FBWX7 were target genes of miR-195-5p, which negatively regulated the expression of these two genes in H9c2 cells. By contrast, in both models, expression of miR-195-3p was only slightly changed without statistical significance. In addition, we observed a trend towards decreased expression of hypertrophic markers by overexpressing miR-195-3p in AngII-treated H9c2 cardiomyocytes <i>in vitro</i>. Taken together, our study indicates that miR-195-5p promotes cardiac hypertrophy via targeting MFN2 and FBXW7 and may provide promising therapeutic strategies for interfering cardiac hypertrophy.

Also flagged:platinummembraneselectronsantibodymembranesilica
Journal Article 2019-06-25 No Snippets Ledden B, Bruton J.
Show Full Abstract

We developed a ring electrode sensor for down-stream electrochemical sensing of microfluidic ELISA assay. The sensor is designed to easily integrate into the flow environment. Noble metal inks on Low Temperature Co-fired Ceramic provide straight forward fabrication at the mesoscale yielding robust sensors with very low sensing volumes. Two different sensor geometries were modeled. The best design was fabricated and tested in both static and flowing solutions. The sensor exhibits both macroelectrode and microelectrode behavior depending on fluid flow rate. Sensors of this type may be ideal for applications where electrochemical detection is desired in a flowing solution since the ring electrode has low propensity for bubble trapping.

Also flagged:erythroid transcription factorKLF1zincbeta thalassemia majortranscription factorBCL11A
Journal Article 2019-06-24 ✓ 2 Snippets Fanis P, Kousiappa I, Phylactides M, Kyrri A, Hadjigavriel M, Christou S, Sitarou M, Kleanthous M.
In-Text Gene Mentions

…as ZBTB7A/LRF andSox6(Norton et al.,…

…γ‐globin expression, andSox6are investigated to…

Show Full Abstract

We describe the identification of a novel missense mutation in the second zinc finger of KLF1 in two siblings who, based on their genotype, are predicted to suffer from beta thalassemia major but are, in fact, transfusion-free and in good health. These individuals, as well as two additional members of the same family also carrying this KLF1 mutation, exhibit high levels of fetal hemoglobin (HbF). KLF1 is an erythroid transcription factor, which plays a critical role in the regulation of the developmental switch between fetal and adult hemoglobin by regulating the expression of a multitude of genes including that of BCL11A. The mutation appears to be the main candidate responsible for the beta thalassemia-ameliorating effect as this segregates with the observed phenotype and also exogenous expression of the KLF1 mutant protein in human erythroid progenitor cells resulted in the induction of γ-globin, without, however, affecting BCL11A levels. This report adds to the weight of evidence that heterozygous KLF1 mutations can ameliorate the severity of the β-thalassemia major phenotype.

Also flagged:SynthesischolesterolhemosiderosisironCyclodextrinsglucose
Journal Article 2019-06-24 ✓ 1 Snippet Gascon JM, Oliveri V, McGown A, Kaya E, Chen YL, Austin C, Walker M, Platt FM, Vecchio G, Spencer J.
In-Text Gene Mentions

…primary and secondaryhemochromatosis.…

Show Full Abstract

Metal dyshomeostasis is central to a number of disorders that result from, inter alia, oxidative stress, protein misfolding, and cholesterol dyshomeostasis. In this respect, metal deficiencies are usually readily corrected by treatment with supplements, whereas metal overload can be overcome by the use of metal-selective chelation therapy. Deferasirox, 4-[(3Z,5E)-3,5-bis(6-oxo-1-cyclohexa-2,4-dienylidene)-1,2,4-triazolidin-1-yl]benzoic acid, Exjade, or ICL670, is used clinically to treat hemosiderosis (iron overload), which often results from multiple blood transfusions. Cyclodextrins are cyclic glucose units that are extensively used in the pharmaceutical industry as formulating agents as well as for encapsulating hydrophobic molecules such as in the treatment of Niemann-Pick type C or for hypervitaminosis. We conjugated deferasirox, via an amide coupling reaction, to both 6<sup>A</sup> -amino-6<sup>A</sup> -deoxy-β-cyclodextrin and 3<sup>A</sup> -amino-3<sup>A</sup> -deoxy-2<sup>A</sup> (S),3<sup>A</sup> (S)-β-cyclodextrin, at the upper and lower rim, respectively, creating hybrid molecules with dual properties, capable of both metal chelation and cholesterol encapsulation. Our findings emphasize the importance of the conjugation of β-cyclodextrin with deferasirox to significantly improve the biological properties and to decrease the cytotoxicity of this drug.

Also flagged:Rho GEFNetringrowth conemicrotubuleaxongrowth cones
Journal Article 2019-06-24 ✓ 5 Snippets Gujar MR, Gujar MR, Stricker AM, Lundquist EA.
In-Text Gene Mentions

…The receptor UNC-40/DCCdrives protrusion dorsally,…

…and its receptors UNC-40/DCCand UNC-5 direct…

… “attractive” receptor UNC-40/DCCor the “repulsive”…

…acts to bias UNC-40/DCCventrally, resulting in…

…UNC-40/DCCdrives growth cone…

Show Full Abstract

UNC-6/Netrin is a conserved axon guidance cue that directs growth cone migrations in the dorsal-ventral axis of C. elegans and in the vertebrate spinal cord. UNC-6/Netrin is expressed in ventral cells, and growth cones migrate ventrally toward or dorsally away from UNC-6/Netrin. Recent studies of growth cone behavior during outgrowth in vivo in C. elegans have led to a polarity/protrusion model in directed growth cone migration away from UNC-6/Netrin. In this model, UNC-6/Netrin first polarizes the growth cone via the UNC-5 receptor, leading to dorsally biased protrusion and F-actin accumulation. UNC-6/Netrin then regulates protrusion based on this polarity. The receptor UNC-40/DCC drives protrusion dorsally, away from the UNC-6/Netrin source, and the UNC-5 receptor inhibits protrusion ventrally, near the UNC-6/Netrin source, resulting in dorsal migration. UNC-5 inhibits protrusion in part by excluding microtubules from the growth cone, which are pro-protrusive. Here we report that the RHO-1/RhoA GTPase and its activator GEF RHGF-1 inhibit growth cone protrusion and MT accumulation in growth cones, similar to UNC-5. However, growth cone polarity of protrusion and F-actin were unaffected by RHO-1 and RHGF-1. Thus, RHO-1 signaling acts specifically as a negative regulator of protrusion and MT accumulation, and not polarity. Genetic interactions are consistent with RHO-1 and RHGF-1 acting with UNC-5, as well as with a parallel pathway, to regulate protrusion. The cytoskeletal interacting molecule UNC-33/CRMP was required for RHO-1 activity to inhibit MT accumulation, suggesting that UNC-33/CRMP might act downstream of RHO-1. In sum, these studies describe a new role of RHO-1 and RHGF-1 in regulation of growth cone protrusion by UNC-6/Netrin.

Also flagged:liver diseasestransductionT antigengene expressionoxygenendothelin-1
Journal Article 2019-06-24 ✓ 1 Snippet Ribera J, Rodríguez-Vita J, Cordoba B, Portolés I, Casals G, Casals E, Jiménez W, Puntes V, Morales-Ruiz M.
In-Text Gene Mentions

…alcoholic liver cirrhosis,hemochromatosis, Wilson's disease, primary…

Show Full Abstract

<h4>Background and aims</h4>The occurrence of endothelial alterations in the liver and in the splanchnic vasculature of cirrhotic patients and experimental models of liver diseases has been demonstrated. However, the pathological role of the portal vein endothelium in this clinical context is scarcely studied and, therefore, deserves attention. In this context, we aimed to investigate whether pathological endothelial activation occurs in the portal vein of cirrhotic rats.<h4>Methods</h4>Cirrhosis was induced in wistar rats by CCl4 inhalation. We generated immortalized endothelial cells from the portal vein of control (CT-iPVEC) and cirrhotic rats (CH-iPVEC) by retroviral transduction of the SV40 T antigen. We assessed differential gene expression and intracellular reactive oxygen species (ROS) levels in iPVECs and in portal veins of control and cirrhotic rats. Finally, we assessed the therapeutic effectiveness of cerium oxide nanoparticles (CeO2NP) on reversing PVEC activation and macrophage polarization.<h4>Results</h4>CH-iPVECs overexpressed collagen-I, endothelin-1, TIMP-1, TIMP-2, IL-6 and PlGF genes. These results were consistent with the differential expression showed by whole portal veins from cirrhotic rats. In addition, CH-iPVECs showed a significant increase in intracellular ROS and the capacity of potentiating M1 polarization in macrophages. The treatment of CH-iPVECs with CeO2NPs blocked intracellular ROS formation and IL-6 and TIMP-2 gene overexpression. In agreement with the in vitro results, the chronic treatment of cirrhotic rats with CeO2NPs also resulted in the blockade of both ROS formation and IL-6 gene overexpression in whole portal veins.<h4>Conclusions</h4>Endothelial cells from portal vein of cirrhotic rats depicted an abnormal phenotype characterized by a differential gene expression and the induction of M1 polarization in macrophages. We identified the excess of intracellular reactive oxygen species (ROS) as a major contributor to this altered phenotype. In addition, we demonstrated the utility of the nanomaterial cerium oxide as an effective antioxidant capable of reverse some of these pathological features associated with the portal vein in the cirrhosis condition.

Also flagged:paragangliomapheochromocytomaneuroendocrine tumorssuccinateSDHdioxygenases
Journal Article 2019-06-24 ✓ 1 Snippet Smestad JA, Maher LJ.
In-Text Gene Mentions

…ARNTL, RXRG, ZIC2,POU3F2, TAL1, EHF, POU3F1,…

Show Full Abstract

<h4>Background</h4>Succinate dehydrogenase (SDH) loss and mastermind-like 3 (MAML3) translocation are two clinically important genetic alterations that correlate with increased rates of metastasis in subtypes of human paraganglioma and pheochromocytoma (PPGL) neuroendocrine tumors. Although hypotheses propose that succinate accumulation after SDH loss poisons dioxygenases and activates pseudohypoxia and epigenomic hypermethylation, it remains unclear whether these mechanisms account for oncogenic transcriptional patterns. Additionally, MAML3 translocation has recently been identified as a genetic alteration in PPGL, but is poorly understood. We hypothesize that a key to understanding tumorigenesis driven by these genetic alterations is identification of the transcription factors responsible for the observed oncogenic transcriptional changes.<h4>Methods</h4>We leverage publicly-available human tumor gene expression profiling experiments (N = 179) to reconstruct a PPGL tumor-specific transcriptional network. We subsequently use the inferred transcriptional network to perform master regulator analyses nominating transcription factors predicted to control oncogenic transcription in specific PPGL molecular subtypes. Results are validated by analysis of an independent collection of PPGL tumor specimens (N = 188). We then perform a similar master regulator analysis in SDH-loss mouse embryonic fibroblasts (MEFs) to infer aspects of SDH loss master regulator response conserved across species and tissue types.<h4>Results</h4>A small number of master regulator transcription factors are predicted to drive the observed subtype-specific gene expression patterns in SDH loss and MAML3 translocation-positive PPGL. Interestingly, although EPAS1 perturbation is detectible in SDH-loss and VHL-loss tumors, it is by no means the most potent factor driving observed patterns of transcriptional dysregulation. Analysis of conserved SDH-loss master regulators in human tumors and MEFs implicated ZNF423, a known modulator of retinoic acid response in neuroblastoma. Subsequent functional analysis revealed a blunted cell death response to retinoic acid in SDH-loss MEFs and blunted differentiation response in SDH-inhibited SH-SY5Y neuroblastoma cells.<h4>Conclusions</h4>The unbiased analyses presented here nominate specific transcription factors that are likely drivers of oncogenic transcription in PPGL tumors. This information has the potential to be exploited for targeted therapy. Additionally, the observation that SDH loss or inhibition results in blunted retinoic acid response suggests a potential developmental etiology for this tumor subtype.

Also flagged:PPP1R3AHeart failuregene expressionmetabolismpressure-overload heart failurepressure overload heart failure
Journal Article 2019-06-24 ✓ 2 Snippets Cordero P, Parikh VN, Chin ET, Erbilgin A, Gloudemans MJ, Shang C, Huang Y, Chang AC, Smith KS, Dewey F, Zaleta K, Morley M, Brandimarto J, Glazer N, Waggott D, Pavlovic A, Zhao M, Moravec CS, Tang WHW, Skreen J, Malloy C, Hannenhalli S, Li H, Ritter S, Li M, Bernstein D, Connolly A, Hakonarson H, Lusis AJ, Margulies KB, Depaoli-Roach AA, Montgomery SB, Wheeler MT, Cappola T, Ashley EA.
In-Text Gene Mentions

…TCF21, GPR22, LIPA,ZNF664, and EIF2B2.…

…TCF21 , andZNF664colocalized in both…

Show Full Abstract

Heart failure is a leading cause of mortality, yet our understanding of the genetic interactions underlying this disease remains incomplete. Here, we harvest 1352 healthy and failing human hearts directly from transplant center operating rooms, and obtain genome-wide genotyping and gene expression measurements for a subset of 313. We build failing and non-failing cardiac regulatory gene networks, revealing important regulators and cardiac expression quantitative trait loci (eQTLs). PPP1R3A emerges as a regulator whose network connectivity changes significantly between health and disease. RNA sequencing after PPP1R3A knockdown validates network-based predictions, and highlights metabolic pathway regulation associated with increased cardiomyocyte size and perturbed respiratory metabolism. Mice lacking PPP1R3A are protected against pressure-overload heart failure. We present a global gene interaction map of the human heart failure transition, identify previously unreported cardiac eQTLs, and demonstrate the discovery potential of disease-specific networks through the description of PPP1R3A as a central regulator in heart failure.

Also flagged:autophagyvacuolar ATPasedegradationinfectious diseasescancerautophagic vacuoles
Journal Article 2019-06-24 No Snippets Paha J, Kanjanasirirat P, Munyoo B, Tuchinda P, Suvannang N, Nantasenamat C, Boonyarattanakalin K, Kittakoop P, Srikor S, Kongklad G, Rangkasenee N, Hongeng S, Utaisincharoen P, Borwornpinyo S, Ponpuak M.
Show Full Abstract

Autophagy is a conserved lysosomal-dependent cellular degradation process and its dysregulation has been linked to numerous diseases including neurodegeneration, infectious diseases, and cancer. Modulation of autophagy is therefore considered as an attractive target for disease intervention. We carried out a high-content image analysis screen of natural product-derived compounds to discover novel autophagy modulating molecules. Our screen identified ECDD-S27 as the most effective compound for increasing the number of autophagic vacuoles inside cells. The structure of ECDD-S27 revealed that it is a derivative of cleistanthin A, a natural arylnaphthalene lignan glycoside found in plants. ECDD-S27 increases the number of autophagic vacuoles by inhibiting the autophagic flux and is able to restrict the survival of different cancer cells at low nanomolar concentrations. Molecular docking and SERS analysis showed that ECDD-S27 may potentially target the V-ATPase. Upon treatment of various cancer cells with ECDD-S27, the V-ATPase activity is potently inhibited thereby resulting in the loss of lysosomal acidification. Taken together, these data indicated that ECDD-S27 retards the autophagy pathway by targeting the V-ATPase and inhibits cancer cell survival. The observed antitumor activity without cytotoxicity to normal cells suggests the therapeutic potential warranting further studies on lead optimization of the compound for cancer treatment.

Also flagged:Transcription factor 7perihilar cholangiocarcinomac-MyccholangiocarcinomaTCF7reverse transcription
Journal Article 2019-06-24 ✓ 2 Snippets Liu Z, Sun R, Zhang X, Qiu B, Chen T, Li Z, Xu Y, Zhang Z.
In-Text Gene Mentions

…of IHCC andDCC, suggesting that IHCC,…

…IHCC, PHCC, andDCCshould be investigated…

Show Full Abstract

<h4>Background</h4>Perihilar cholangiocarcinoma (PHCC) is the most common type of cholangiocarcinoma with the worst prognosis. Radical resection of PHCC is difficult; thus, few effective biomarkers or useful molecular profiles for PHCC have been reported in recent years. Therefore, in this study, we aimed to assess biomarkers for PHCC.<h4>Methods</h4>We screened potential biomarkers for PHCC using exome and transcriptome sequencing with PHCC tissues and paired normal tissues. Transcription factor 7 (TCF7) expression was evaluated using quantitative reverse transcription polymerase chain reaction, western blotting, and immunohistochemistry. The correlations between TCF7 and clinicopathological factors were analyzed with Chi-square test, and the prognostic significance of TCF7 was evaluated with univariate and multivariate analyses. The functions of TCF7 and its main effectors in PHCC cells were investigated in vitro and in vivo.<h4>Findings</h4>TCF7 expression was upregulated in PHCC and was an unfavorable prognostic biomarker. c-Myc was a main effector of TCF7 in PHCC cells and modulated TCF7-induced proliferation, invasion, and migration. FOS-like antigen 1 (FOSL1) was identified as a downstream target of TCF7 and was required in TCF7-induced PHCC proliferation. Triple-positive expression of TCF7, c-Myc, and FOSL1 predicted a much worse prognosis in patients with PHCC than TCF7 expression alone.<h4>Interpretation</h4>Postoperative detection of TCF7, c-Myc, and FOSL1 may be useful for stratifying patients with a high risk of unfavorable prognosis, and suppressing TCF7 or its downstream effectors may be a promising strategy for the treatment of PHCC.

Also flagged:regulationmuscle developmentmyosinsarcomerescellulosefibrils
Journal Article 2019-06-24 No Snippets Razy-Krajka F, Stolfi A.
Show Full Abstract

For more than a century, studies on tunicate muscle formation have revealed many principles of cell fate specification, gene regulation, morphogenesis, and evolution. Here, we review the key studies that have probed the development of all the various muscle cell types in a wide variety of tunicate species. We seize this occasion to explore the implications and questions raised by these findings in the broader context of muscle evolution in chordates.

Also flagged:breast cancerLINC01614TGFβfocal adhesion kinaseinvasive breast cancercancer
Journal Article 2019-06-24 No Snippets Vishnubalaji R, Shaath H, Elkord E, Alajez NM.
Show Full Abstract

Long non-coding RNAs (lncRNAs) represent a class of epigenetic regulators implicated in a number of physiological and pathological conditions. Herein, we characterized the lncRNA expression portrait from 837 patients with invasive breast cancer and 105 normals from the cancer genome atlas (TCGA), which revealed eighteen upregulated and forty-six downregulated lncRNAs. Clustering analysis revealed distinct lncRNA profile for the triple negative breast cancer (TNBC) and normal breast tissue, while less separation was observed among the HER2<sup>+</sup>HR<sup>+</sup>, HER2<sup>+</sup>HR<sup>-</sup>, HER2<sup>-</sup>HR<sup>+</sup> molecular subtypes. LINC01614, and LINC01235 correlated with worse disease-free survival (DFS), while the expression of lnc-LRR1-1, lnc-ODF3B-2, AC015712.5, lnc-LAMB3-1, lnc-SPP2-3, and lnc-MAP9-2 correlated with better DFS. The expression of LINC01235 correlated with worse overall survival (OS), while the expression of MIR205HG, lnc-MAP2K6-5, FGF14-AS2, lnc-SPP2-3 correlated with better OS. Highest expression of LINC01614 was observed in progesterone receptor (PR)<sup>+</sup>, Estrogen receptor (PR)<sup>+</sup>, and HER2<sup>+</sup> tumors, while lowest expression was in TNBC. Concordantly, LINC01614 was highly expressed in the luminalB/HER2<sup>+</sup> subtype from the SRP062132 dataset. Elevated expression of LINC01614 was subsequently validated in primary breast cancer tissue and breast cancer cell lines. Bioinformatics and pathway analyses on LINC01614<sup>high</sup> vs. LINC01614<sup>low</sup> BC tissue revealed TGFβ1 and ECM as the most activated networks in LINC01614<sup>high</sup> tumors. Concordantly, strong correlation between the expression of LINC01614 and COL10A1 (<i>R</i> <sup>2</sup> = 0.6929), SPOCK1 (<i>R</i> <sup>2</sup> = 0.5156), ZEB1 (<i>R</i> <sup>2</sup> = 0.3372), TGFBI (<i>R</i> <sup>2</sup> = 0.2978), TGFB1 (<i>R</i> <sup>2</sup> = 0.1985), ACTA2 (<i>R</i> <sup>2</sup> = 0.1833), and TAGLN (<i>R</i> <sup>2</sup> = 0.1909) was observed. Mechanistically, exogenous TGFB1 induced LINC01614 expression in the BT474 triple positive BC model, while small-molecule inhibition of transforming growth factor β (TGFβ, SB-431542) or focal adhesion kinase (FAK, PF-573228) abrogated LINC01614 expression. Our data revealed the lncRNA transcription landscape in breast cancer and its molecular subtypes. Our data provide novel insight implicating LINC01614 as unfavorable prognostic marker in BC, its association with the HR<sup>+</sup>/HER2<sup>+</sup> BC molecular subtype and its regulation by TGFβ and FAK signaling.

Also flagged:NAFLDnonalcoholic fatty liver diseasealcoholtriglyceridesuric acidlipoprotein
Journal Article 2019-06-24 ✓ 1 Snippet Tang Z, Pham M, Hao Y, Wang F, Patel D, Jean-Baptiste L, Fan L, Wang W, Wang Y, Cheng F.
In-Text Gene Mentions

…lpha-1-antitrypsin deficiency,hemochromatosis, glycogen storage disorders,…

Show Full Abstract

<h4>Objective</h4>Previous studies have shown that some metabolic risk factors are related to nonalcoholic fatty liver disease (NAFLD). This retrospective study was performed to investigate the associations between physical examinations and blood biochemistry parameters and NAFLD status and to identify possible risk factors of NAFLD.<h4>Methods</h4>Study participants underwent general physical examinations, blood biochemistry, and abdominal ultrasound evaluations. In addition, data regarding sex, age, ethnicity, medical history, and alcohol consumption of participants were recorded. Among the study participants (N=1994), 57.8% were male, 41.2% over the age of 50, and 52.6% with BMI≥24. 986 patients had NAFLD and 1008 had no NAFLD. We used effect size analysis and logistic regression to determine which physical examinations and blood biochemistry parameters were significant for the association between these parameters and NAFLD status.<h4>Results</h4>Both the effect size and logistic regression indicated that BMI, diastolic blood pressure (DBP), triglycerides (TG), and serum uric acid (SUA) show a significant association with NAFLD. Females are overall at a higher risk of NAFLD, but factors such as high BMI, DBP, TG, and SUA increase the associated risk for both sexes. Compared with males, females have a higher risk of NAFLD given that they are over 50, overweight and obese (BMI at or over 24), or have high SUA. In terms of age, people older than 50 with high SUA, and people younger than 50 with high DBP and low-density lipoprotein cholesterol (LDL-C) all increase the risk of NAFLD. For BMI, high DBP and low high-density lipoprotein cholesterol (HDL-C) are risk factors for NAFLD in overweight and obese people (BMI at or over 24), whereas in normal weight and underweight people (BMI under 24), elevated LDL-C increases the risk of NAFLD.<h4>Conclusions</h4>Our results revealed sex, age, and BMI modulate the association of physical examinations and blood biochemistry parameters and NAFLD, which may facilitate the development of personalized early warning and prevention strategies of NAFLD for at-risk populations.

Also flagged:CYP3A4Synthesissesamolbenzyloxypropyldiphenyl
Journal Article 2019-06-24 No Snippets Francis Carballo-Arce A, Raina V, Liu S, Liu R, Jackiewicz V, Carranza D, Arnason JT, Durst T.
Show Full Abstract

Synthesis of 50 analogues of the natural insecticide synergists, dillapiol and sesamol, is reported. These were evaluated as potential insecticide synergists based on their inhibition of human CYP3A4. The most potent inhibitors have a relatively large hydrophobic substituent at either position 5 or 6 of these molecules. For example, 5-(benzyloxy)-6-(3-phenylsulfonyl)propyl)benzo[<i>d</i>][1,3]dioxole (<b>18</b>) and the diphenyl acetate of (6,7-dimethoxybenzo[<i>d</i>][1,3]dioxol-5-yl)propan-1-ol (<b>5n</b>) show inhibitory concentrations for 50% activity IC<sub>50</sub> values of 0.086 and 0.2 μM, respectively. These compounds are 106 and 46 times more potent than dillapiol whose IC<sub>50</sub> for the inhibition of CYP3A4 is 9.2 μM. The <i>ortho</i>-chloro analogue (<b>8f</b>), whose activity is 86 times the activity of dillapiol, is the most potent of the fourteen 5-(benzyloxy-6-(2 propenyl)benzo[<i>d</i>][1,3]dioxoles prepared for this study.

Also flagged:salicylatescannabinoidcarboxylic groupcannabinoidsbindingesterases
Journal Article 2019-06-24 No Snippets Cuadari A, Pollastro F, Unciti-Broceta JD, Caprioglio D, Minassi A, Lopatriello A, Muñoz E, Taglialatela-Scafati O, Appendino G.
Show Full Abstract

The renewed interest in dimeric salicylates as broad-spectrum anti-inflammatory and anti-diabetic agents provided a rationale to investigate the dimerization of the substituted salicylate <i>Δ</i> <sup>9</sup>-tetrahydrocannabinolic acid (THCA-A, <b>3a</b>) as a strategy to solve its instability to decarboxylation and to generate analogues and/or pro-drugs of this native pre-cannabinoid. Activation of the carboxylic group with the DCC-HOBt-DMAP protocol afforded a high yield of the OBt ester <b>4</b>, that was next converted into the highly crystalline di-depsidic dimer <b>5</b> upon treatment with DMAP. The mono-depsidic dimer <b>6</b> was also formed when the reaction was carried out with partially decarboxylated THCA-A samples. The structure of the depsidic dimers was established by spectroscopic methods and by aminolysis of <b>5</b> into the pre-cannabinoid amide <b>7</b>. Both dimers showed excellent shelf stability and did not generate significant amounts of <i>Δ</i> <sup>9</sup>-THC upon heating. However, only the didepsidic dimer <b>5</b> activated PPAR-<i>γ</i>, the major target of pre-cannabinoids, but strong binding to serum proteins abolished this activity, also shielding it from the action of esterases.

Also flagged:psoriasisinflammatory skin diseasepathogenesisHLA-Cw6IL12BIL23R
Journal Article 2019-06-24 No Snippets Ran D, Cai M, Zhang X.
Show Full Abstract

Psoriasis is an inflammatory skin disease with a background of polygenic inheritance. Both environmental and genetic factors are involved in the etiology of the disease. In the last two decades, numerous studies have been conducted through linkage analysis, genome-wide association study (GWAS), and direct sequencing to explore the role of genetic variation in disease pathogenesis and progression. To date, >80 psoriasis susceptibility genes have been identified, including <i>HLA-Cw6</i>, <i>IL12B</i>, <i>IL23R</i>, and <i>LCE3B/3C</i>. Some genetic markers have been applied in disease prediction, clinical diagnosis, treatment, and new drug development, which could further explain the pathogenesis of psoriasis and promote the development of precision medicine. This review summarizes related research on genetic variation in psoriasis and explores implications of the findings in clinical application and the promotion of a personalized medicine project.

Also flagged:chromatinnucleotidetranscription factorbindingHBBIRF4
Journal Article 2019-06-23 No Snippets Shigaki D, Adato O, Adhikari AN, Dong S, Hawkins-Hooker A, Inoue F, Juven-Gershon T, Kenlay H, Martin B, Patra A, Penzar DD, Schubach M, Xiong C, Yan Z, Boyle AP, Kreimer A, Kulakovskiy IV, Reid J, Unger R, Yosef N, Shendure J, Ahituv N, Kircher M, Beer MA.
Show Full Abstract

The integrative analysis of high-throughput reporter assays, machine learning, and profiles of epigenomic chromatin state in a broad array of cells and tissues has the potential to significantly improve our understanding of noncoding regulatory element function and its contribution to human disease. Here, we report results from the CAGI 5 regulation saturation challenge where participants were asked to predict the impact of nucleotide substitution at every base pair within five disease-associated human enhancers and nine disease-associated promoters. A library of mutations covering all bases was generated by saturation mutagenesis and altered activity was assessed in a massively parallel reporter assay (MPRA) in relevant cell lines. Reporter expression was measured relative to plasmid DNA to determine the impact of variants. The challenge was to predict the functional effects of variants on reporter expression. Comparative analysis of the full range of submitted prediction results identifies the most successful models of transcription factor binding sites, machine learning algorithms, and ways to choose among or incorporate diverse datatypes and cell-types for training computational models. These results have the potential to improve the design of future studies on more diverse sets of regulatory elements and aid the interpretation of disease-associated genetic variation.

Also flagged:WDR45BPANsynaptic transmissionendoplasmic reticulumERN1IRE1
Journal Article 2019-06-23 ✓ 1 Snippet Wan H, Wang Q, Chen X, Zeng Q, Shao Y, Fang H, Liao X, Li HS, Liu MG, Xu TL, Diao M, Li D, Meng B, Tang B, Zhang Z, Liao L.
In-Text Gene Mentions

HTT

Show Full Abstract

Mutations in the macroautophagy/autophagy gene <i>WDR45</i> cause β-propeller protein-associated neurodegeneration (BPAN); however the molecular and cellular mechanism of the disease process is largely unknown. Here we generated constitutive <i>wdr45</i> knockout (KO) mice that displayed cognitive impairments, abnormal synaptic transmission and lesions in several brain regions. Immunohistochemistry analysis showed loss of neurons in prefrontal cortex and basal ganglion in aged mice, and increased apoptosis in prefrontal cortex, recapitulating a hallmark of neurodegeneration. Quantitative proteomic analysis showed accumulation of endoplasmic reticulum (ER) proteins in KO mouse. At the cellular level, accumulation of ER proteins due to WDR45 deficiency resulted in increased ER stress and impaired ER quality control. The unfolded protein response (UPR) was elevated through ERN1/IRE1 or EIF2AK3/PERK pathway, and eventually led to neuronal apoptosis. Suppression of ER stress or activation of autophagy through MTOR inhibition alleviated cell death. Thus, the loss of WDR45 cripples macroautophagy machinery in neurons and leads to impairment in organelle autophagy, which provides a mechanistic understanding of cause of BPAN and a potential therapeutic strategy to treat this genetic disorder.<b>Abbreviations:</b> 7-ADD: 7-aminoactinomycin D; ASD: autistic spectrum disorder; ATF6: activating transcription factor 6; ATG: autophagy-related; BafA1: bafilomycin A<sub>1</sub>; BCAP31: B cell receptor associated protein 31; BPAN: β-propeller protein-associated neurodegeneration; CCCP: carbonyl cyanide m-chlorophenylhydrazone; CDIPT: CDP-diacylglycerol-inositol 3-phosphatidyltransferase (phosphatidylinositol synthase); DDIT3/CHOP: DNA-damage inducible transcript 3; EIF2A: eukaryotic translation initiation factor 2A; EIF2AK3/PERK: eukaryotic translation initiation factor 2 alpha kinase 3; ER: endoplasmic reticulum; ERN1/IRE1: endoplasmic reticulum to nucleus signaling 1; GFP: green fluorescent protein; HIP: hippocampus; HSPA5/GRP78: heat shock protein family A (HSP70) member 5; KO: knockout; LAMP1: lysosomal-associated membrane 1; mEPSCs: miniature excitatory postsynaptic currents; MG132: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal; MIB: mid-brain; MTOR: mechanistic target of rapamycin kinase; PCR: polymerase chain reaction; PFA: paraformaldehyde; PFC: prefrontal cortex; PRM: parallel reaction monitoring; RBFOX3/NEUN: RNA binding protein, fox-1 homolog [C. elegans] 3; RTN3: reticulon 3; SEC22B: SEC22 homolog B, vesicle trafficking protein; SEC61B: SEC61 translocon beta subunit; SEM: standard error of the mean; SNR: substantia nigra; SQSTM1/p62: sequestosome 1; TH: tyrosine hydroxylase; Tm: tunicamycin; TMT: tandem mass tag; TUDCA: tauroursodeoxycholic acid; TUNEL: terminal deoxynucleotidyl transferase dUTP nick-end labeling; UPR: unfolded protein response; WDR45: WD repeat domain 45; WT: wild type; XBP1: X-box binding protein 1.

Also flagged:carbonthiolgraphenegold nanoparticlessotalolgraphene quantum dots
Journal Article 2019-06-23 No Snippets Roushani M, Jalilian Z, Nezhadali A.
Show Full Abstract

This work, a highly selective and sensitive sensor is described for voltammetric determination of the sotalol (SOT). The dual actions of sotalol lead to reductions in the automaticity of myocardial cells and in conduction through the atrioventricular node. Drug analysis has an extensive impact on public health. The molecularly imprinted sensor was constructed by modifying a screen printed carbon electrode (SPCE) with thiol graphene quantum dots (GQD-SH) and gold nanoparticles (AuNPs). Under optimal conditions the nanotools has a dynamic range that covers the 0.1-250 μM SOT concentration range, and the detection limit is 0.035 μM. This is lower than any of the previously reported methods. The MIP-sensor also exhibited excellent selectivity, good stability and adequate reproducibility for the detection of the SOT over its structural analogs. The prepared sensor was successfully applied to the measurement of SOT in various real samples including tablet and human blood serum.

Also flagged:oxygenretinopathy of prematuritysepsismeningitisnecrotizing enterocolitisPeriventricular leukomalacia
Journal Article 2019-06-22 No Snippets Gantz MG, Carlo WA, Finer NN, Rich W, Faix RG, Yoder BA, Walsh MC, Newman NS, Laptook A, Schibler K, Das A, Higgins RD, SUPPORT Study Group of the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To identify achieved oxygen saturations (SpO<sub>2</sub>) associated with increased risk of severe retinopathy of prematurity (ROP).<h4>Design</h4>This is a secondary analysis of the Surfactant Positive Airway Pressure and Pulse Oximetry Trial (SUPPORT)randomised controlled trial. SpO<sub>2</sub> was recorded up to 36 weeks' postmenstrual age. Saturations through 9 postnatal weeks were explored graphically, and logistic regression models were created to predict severe ROP.<h4>Setting</h4>20 centres of the <i>Eunice Kennedy Shriver</i> National Institute of Child Health and Human Development Neonatal Research Network.<h4>Patients</h4>984 surviving infants of 24-27 weeks' gestational age born in 2005-2009.<h4>Interventions</h4>SUPPORT targeted SpO<sub>2</sub> to a lower (85%-89%) or higher (91%-95%) range through 36 weeks' postmenstrual age or off respiratory support.<h4>Main outcome measures</h4>Severe ROP defined as threshold ROP, ophthalmological surgery or bevacizumab treatment.<h4>Results</h4>There were statistically significant interactions between duration of oxygen supplementation and percentage of time in certain achieved saturation ranges. Specifically, for infants who spent at least 2 weeks on oxygen in postnatal weeks 1-5, a higher percentage of time at 91%-96% SpO<sub>2</sub> was associated with increased odds of severe ROP. For infants who spent at least 3 weeks on oxygen in postnatal weeks 6-9, a higher percentage of time at 97%-100% SpO<sub>2</sub> was associated with increased odds of severe ROP. Other significant risk factors were lower gestational age and birth weight, non-Hispanic white versus black race, prospectively defined severe illness, late-onset sepsis or meningitis, and clinical centre.<h4>Conclusions</h4>Among extremely preterm survivors to discharge, the association between SpO<sub>2</sub> and severe ROP depended on the timing and duration of oxygen supplementation.

Also flagged:PentapeptideAPPPS1intramembraneproteolysisamyloid precursor protein
Journal Article 2019-06-22 No Snippets Szögi T, Schuster I, Borbély E, Gyebrovszki A, Bozsó Z, Gera J, Rajkó R, Sántha M, Penke B, Fülöp L.
Show Full Abstract

Regulated intramembrane proteolysis (RIP) of the amyloid precursor protein (APP) leads to the formation of fragments, among which the intracellular domain of APP (AICD) was also identified to be a causative of early pathological events. AICD-counteracting proteins, such as Fe65, may serve as alternative therapeutic targets of Alzheimer's disease (AD). The detection of elevated levels of Fe65 in the brains of both human patients and APP transgenic mice may further strengthen the hypothesis that influencing the interaction between Fe65 and APP may have a beneficial effect on the course of AD. Based on a PXP motif, proven to bind to the WW domain of Fe65, a new pentapeptide was designed and tested. The impedimental effect of P33 on the production of beta amyloid (Aβ) (soluble fraction and aggregated plaques) and on the typical features of the AD pathology (decreased dendritic spine density, synaptic markers, elevated inflammatory reactions) was also demonstrated. Significant enhancements of both learning ability and memory function were observed in a Morris water maze paradigm. The results led us to formulate the theory that P33 acts by altering the conformation of Fe65 via binding to its WW domain, consequently hindering any interactions between Fe65 and key members involved in APP processing.

Also flagged:FlavonoidsNeurodegenerative Diseasesamyotrophic lateral sclerosisALSagingneurodegenerative disease
Journal Article 2019-06-22 ✓ 2 Snippets Maher P.
In-Text Gene Mentions

…of the humanHTTgene, which contains…

…into the mouseHttgenomic locus […

Show Full Abstract

Neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), and amyotrophic lateral sclerosis (ALS), currently affect more than 6 million people in the United States. Unfortunately, there are no treatments that slow or prevent disease development and progression. Regardless of the underlying cause of the disorder, age is the strongest risk factor for developing these maladies, suggesting that changes that occur in the aging brain put it at increased risk for neurodegenerative disease development. Moreover, since there are a number of different changes that occur in the aging brain, it is unlikely that targeting a single change is going to be effective for disease treatment. Thus, compounds that have multiple biological activities that can impact the various age-associated changes in the brain that contribute to neurodegenerative disease development and progression are needed. The plant-derived flavonoids have a wide range of activities that could make them particularly effective for blocking the age-associated toxicity pathways associated with neurodegenerative diseases. In this review, the evidence for beneficial effects of multiple flavonoids in models of AD, PD, HD, and ALS is presented and common mechanisms of action are identified. Overall, the preclinical data strongly support further investigation of specific flavonoids for the treatment of neurodegenerative diseases.

Also flagged:Triapineirontumorascorbatecervical cancercisplatin
Journal Article 2019-06-22 ✓ 1 Snippet Antholine WE, Myers CR.
In-Text Gene Mentions

…absorption using ahemochromatosiscell line, or…

Show Full Abstract

An electron paramagnetic resonance (EPR) method was used to determine the concentration of the antitumor agent Triapine in BEAS-2B cells when Triapine was bound to iron (Fe). Knowledge of the concentration of Fe-Triapine in tumor cells may be useful to adjust the administration of the drug or to adjust iron uptake in tumor cells. An EPR spectrum is obtained for Fe(3+)-Triapine, Fe(3+)(Tp)<sub>2</sub><sup>+</sup>, in BEAS-2B cells after addition of Fe(3+)(Tp)<sub>2</sub><sup>+</sup>. Detection of the low spin signal for Fe(3+)(Tp)<sub>2</sub><sup>+</sup> shows that the Fe(3+)(Tp)<sub>2</sub><sup>+</sup> complex is intact in these cells. It is proposed that Triapine acquires iron from transferrin in cells including tumor cells. Here, it is shown that iron from purified Fe-transferrin is transferred to Triapine after the addition of ascorbate. To our knowledge, this is the first time that the EPR method has been used to determine the concentration of an iron antitumor agent in cells.

Also flagged:AutophagyMacroautophagydegradationmembranevesicleautophagosome
Journal Article 2019-06-22 No Snippets Zientara-Rytter K, Subramani S.
Show Full Abstract

Macroautophagy (referred to hereafter as autophagy) is an intracellular degradation pathway in which the formation of a double-membrane vesicle called the autophagosome is a key event in the transport of multiple cytoplasmic cargo (e.g., proteins, protein aggregates, lipid droplets or organelles) to the vacuole (lysosome in mammals) for degradation and recycling. During this process, autophagosomes are formed de novo by membrane fusion events leading to phagophore formation initiated at the phagophore assembly site. In yeast, Atg11 and Atg17 function as protein scaffolds, essential for selective and non-selective types of autophagy, respectively. While Atg17 functions in non-selective autophagy are well-defined in the literature, less attention is concentrated on recent findings regarding the roles of Atg11 in selective autophagy. Here, we summarize current knowledge about the Atg11 scaffold protein and review recent findings in the context of its role in selective autophagy initiation and autophagosome formation.

Also flagged:neurocognitive disordersHANDmitochondrialtranscription factorsperoxisome proliferator-activated receptor γ coactivator 1-αtranscription factor A
Journal Article 2019-06-22 No Snippets Swinton MK, Carson A, Telese F, Sanchez AB, Soontornniyomkij B, Rad L, Batki I, Quintanilla B, Pérez-Santiago J, Achim CL, Letendre S, Ellis RJ, Grant I, Murphy AN, Fields JA.
Show Full Abstract

The neuropathogenesis of HIV associated neurocognitive disorders (HAND) involves disruption of mitochondrial homeostasis and increased neuroinflammation. However, it is unknown if alterations in mitochondrial biogenesis in the brain underlie the neuropathogenesis of HAND. In this study, neuropathological and molecular analyses of mitochondrial biogenesis and inflammatory pathways were performed in brain specimens from a well-characterized cohort of HIV+ cases that were on antiretroviral regimens. In vitro investigations using primary human astroglia and neurons were used to probe the underlying mechanisms of mitochondrial alterations. In frontal cortices from HAND brains compared to cognitive normal brains, total levels of transcription factors that regulate mitochondrial biogenesis, peroxisome proliferator-activated receptor γ coactivator 1-α (PGC-1α) and transcription factor A, mitochondrial (TFAM) were decreased. Immunohistochemical analyses revealed that TFAM was decreased in neurons and increased in astroglia. These changes were accompanied by decreased total mitochondrial DNA per cell and increased levels of messenger RNA for the proinflammatory cytokine interleukin (IL)-1β. To determine how IL-1β affects astroglial bioenergetic processes and mitochondrial activity, human astroglial cultures were exposed to recombinant IL-1β. IL-1β induced mitochondrial activity within 30 min of treatment, altered mitochondrial related gene expression, altered mitochondrial morphology, enhanced adenoside triphosphate (ATP) utilization and increased the expression of inflammatory cytokines. WIN55,212-2 (WIN), an aminoalkylindole derivative and cannabinoid receptor agonist, blocked IL-1β-induced bioenergetic fluctuations and inflammatory gene expression in astroglia independent of cannabinoid receptor (CB)1 and peroxisome proliferator-activated receptor (PPAR) γ. A PPARα antagonist reversed the anti-inflammatory effects of WIN in human astroglia. These results show that mitochondrial biogenesis is differentially regulated in neurons and astroglia in HAND brains and that targeting astroglial bioenergetic processes may be a strategy to modulate neuroinflammation.

Also flagged:Scc2WaplcohesinchromosomesSmc3Scc1
Journal Article 2019-06-21 ✓ 1 Snippet Srinivasan M, Petela NJ, Scheinost JC, Collier J, Voulgaris M, B Roig M, Beckouët F, Hu B, Nasmyth KA.
In-Text Gene Mentions

Condensinhas the remarkable…

Show Full Abstract

Cohesin's association with chromosomes is determined by loading dependent on the Scc2/4 complex and release due to Wapl. We show here that Scc2 also actively maintains cohesin on chromosomes during G1 in <i>S. cerevisiae</i> cells. It does so by blocking a Wapl-independent release reaction that requires opening the cohesin ring at its Smc3/Scc1 interface as well as the D loop of Smc1's ATPase. The Wapl-independent release mechanism is switched off as cells activate Cdk1 and enter G2/M and cannot be turned back on without cohesin's dissociation from chromosomes. The latter phenomenon enabled us to show that in the absence of release mechanisms, cohesin rings that have already captured DNA in a Scc2-dependent manner before replication no longer require Scc2 to capture sister DNAs during S phase.

Also flagged:Mi-2Caf1chromatintranscription factorDNA Replication-related Element Factorcell proliferation
Journal Article 2019-06-21 No Snippets Angulo B, Srinivasan S, Bolival BJ, Olivares GH, Spence AC, Fuller MT.
Show Full Abstract

Active adult stem cells maintain a bipotential state with progeny able to either self-renew or initiate differentiation depending on extrinsic signals from the surrounding microenvironment. However, the intrinsic gene regulatory networks and chromatin states that allow adult stem cells to make these cell fate choices are not entirely understood. Here we show that the transcription factor DNA Replication-related Element Factor (DREF) regulates adult stem cell maintenance in the Drosophila male germline. A temperature-sensitive allele of DREF described in this study genetically separated a role for DREF in germline stem cell self-renewal from the general roles of DREF in cell proliferation. The DREF temperature-sensitive allele caused defects in germline stem cell self-renewal but allowed viability and division of germline stem cells as well as cell viability, growth and division of somatic cyst stem cells in the testes and cells in the Drosophila eye. Germline stem cells mutant for the temperature sensitive DREF allele exhibited lower activation of a TGF-beta reporter, and their progeny turned on expression of the differentiation factor Bam prematurely. Results of genetic interaction analyses revealed that Mi-2 and Caf1/p55, components of the Nucleosome Remodeling and Deacetylase (NuRD) complex, genetically antagonize the role of DREF in germline stem cell maintenance. Taken together, these data suggest that DREF contributes to intrinsic components of the germline stem cell regulatory network that maintains competence to self-renew.

Also flagged:TUBB3neurological disordersaxon guidanceneuronal migrationmicrotubulesnetrin receptors
Journal Article 2019-06-21 ✓ 5 Snippets Shao Q, Yang T, Huang H, Majumder T, Khot BA, Khouzani MM, Alarmanazi F, Gore YK, Liu G.
In-Text Gene Mentions

For instance, netrin-1, a classic bifunctional guidance cue, is capable of attracting or repelling axon projection by differentially interacting with its receptors, deleted in colorectal cancer (DCC) [27, 28], neogenin [28, 29], uncoordinated-5 (UNC5) [30, 31], and Down syndrome cell adhesion molecule (DSCAM) [32, 33].

…in colorectal cancer (DCC) [ 27 ,…

…direct interaction ofDCCand DSCAM with…

…the interaction withDCCand perturb netrin-1…

…of netrin receptorsDCC, DSCAM, and UNC5C…

Show Full Abstract

Missense mutations in the human TUBB3 gene cause a variety of neurological disorders associated with defects in axon guidance and neuronal migration, but the underlying molecular mechanisms are not well understood. Recent studies have shown that direct coupling of dynamic TUBB3 in microtubules with netrin receptors is required for netrin-1-mediated axon guidance, and the interaction of netrin-1 repulsive receptor UNC5C with TUBB3 is involved in netrin-1 mediated axonal repulsion. Here, we report that TUBB3 mutations perturb netrin-1/UNC5C repulsive signaling in the developing nervous system. Among twelve mutants reported in previous studies, five of them show significantly reduced interaction with UNC5C in comparison to the wild-type TUBB3. TUBB3 mutants R262C and R62Q exhibit decreased subcellular colocalization with UNC5C in the peripheral area of the growth cone of primary mouse neurons. Netrin-1 reduces the colocalization of UNC5C with wild-type TUBB3, but not TUBB3 mutants R262C or R62Q, in the growth cone. Results from the in vitro cosedimentation assay indicate that netrin-1 inhibits cosedimentation of UNC5C with polymerized microtubules in primary mouse neurons expressing the wild-type TUBB3, but not R262C or R62Q. Expression of either R262C or R62Q not only blocks netrin-1-induced growth cone collapse and axonal repulsion of primary EGL cells in vitro, but also results in axon projections defects of chicken dorsal root ganglion neurons in ovo. Our study reveals that human TUBB3 mutations specifically perturb netrin-1/UNC5C-mediated repulsion.

Also flagged:cancerimmune responsetumorstumorlung cancercell proliferation
Journal Article 2019-06-21 ✓ 2 Snippets Clarke J, Panwar B, Madrigal A, Singh D, Gujar R, Wood O, Chee SJ, Eschweiler S, King EV, Awad AS, Hanley CJ, McCann KJ, Bhattacharyya S, Woo E, Alzetani A, Seumois G, Thomas GJ, Ganesan AP, Friedmann PS, Sanchez-Elsner T, Ay F, Ottensmeier CH, Vijayanand P.
In-Text Gene Mentions

Thus, TIM-3 expression may be a feature of lung tumor TRM cells that is not linked to exhaustion but rather reflects a state of functionality, as the other transcripts that correlated with expression of TIM-3 and cell cycle genes encode molecules that likely confer additional functionality, such as CD39 (encoded by ENTPD1; Pallett et al., 2017), CXCL13 (Bindea et al., 2013), CCL3 (Castellino et al., 2006), TNFSF4 (OX-40 ligand; Croft et al., 2009), and a marker of antigen-specific engagement (4-1BB; Bacher et al., 2016; Fig. 2, E–G).

…al., 2006 ),TNFSF4(OX-40 ligand; Croft…

Show Full Abstract

High numbers of tissue-resident memory T (T<sub>RM</sub>) cells are associated with better clinical outcomes in cancer patients. However, the molecular characteristics that drive their efficient immune response to tumors are poorly understood. Here, single-cell and bulk transcriptomic analysis of T<sub>RM</sub> and non-T<sub>RM</sub> cells present in tumor and normal lung tissue from patients with lung cancer revealed that PD-1-expressing T<sub>RM</sub> cells in tumors were clonally expanded and enriched for transcripts linked to cell proliferation and cytotoxicity when compared with PD-1-expressing non-T<sub>RM</sub> cells. This feature was more prominent in the T<sub>RM</sub> cell subset coexpressing PD-1 and TIM-3, and it was validated by functional assays ex vivo and also reflected in their chromatin accessibility profile. This PD-1<sup>+</sup>TIM-3<sup>+</sup> T<sub>RM</sub> cell subset was enriched in responders to PD-1 inhibitors and in tumors with a greater magnitude of CTL responses. These data highlight that not all CTLs expressing PD-1 are dysfunctional; on the contrary, T<sub>RM</sub> cells with PD-1 expression were enriched for features suggestive of superior functionality.

Also flagged:Butyrophilin 3A1Prenyl Pyrophosphatestumorsisoprenoidpyrophosphateisopentenyl pyrophosphate
Journal Article 2019-06-21 ✓ 4 Snippets Wang H, Nada MH, Nada MH, Tanaka Y, Sakuraba S, Morita CT.
In-Text Gene Mentions

…BTN3A2 andBTN3A3proteins and orthologs…

BTN2A1

BTN2A2

BTN3A3

Show Full Abstract

Vγ2Vδ2 T cells play important roles in human immunity to pathogens and tumors. Their TCRs respond to the sensing of isoprenoid metabolites, such as (<i>E</i>)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate and isopentenyl pyrophosphate, by butyrophilin (BTN) 3A1. BTN3A1 is an Ig superfamily protein with extracellular IgV/IgC domains and intracellular B30.2 domains that bind prenyl pyrophosphates. We have proposed that intracellular α helices form a coiled-coil dimer that functions as a spacer for the B30.2 domains. To test this, five pairs of anchor residues were mutated to glycine to destabilize the coiled-coil dimer. Despite maintaining surface expression, BTN3A1 mutagenesis either abrogated or decreased stimulation by (<i>E</i>)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate. BTN3A2 and BTN3A3 proteins and orthologs in alpacas and dolphins are also predicted to have similar coiled-coil dimers. A second short coiled-coil region dimerizes the B30.2 domains. Molecular dynamics simulations predict that mutation of a conserved tryptophan residue in this region will destabilize the dimer, explaining the loss of stimulation by BTN3A1 proteins with this mutation. The juxtamembrane regions of other BTN/BTN-like proteins with B30.2 domains are similarly predicted to assume α helices, with many predicted to form coiled-coil dimers. An exon at the end of this region and the exon encoding the dimerization region for B30.2 domains are highly conserved. We propose that coiled-coil dimers function as rod-like helical molecular spacers to position B30.2 domains, as interaction sites for other proteins, and as dimerization regions to allow sensing by B30.2 domains. In these ways, the coiled-coil domains of BTN3A1 play critical roles for its function.

Also flagged:HOPXCrystal violetEIF2αBMI1gene expressiondoxycycline
Journal Article 2019-06-21 ✓ 4 Snippets Spaan CN, Smit WL, van Lidth de Jeude JF, Meijer BJ, Muncan V, van den Brink GR, Heijmans J.
In-Text Gene Mentions

OLFM4

…genes LGR5 andOLFM4and found that…

…genes LGR5 andOLFM4mark crypt base…

…any mRNA ofOLFM4in both these…

Show Full Abstract

The unfolded protein response (UPR) acts through its downstream branches, PERK-eIF2α signaling, IRE1α-XBP1 signaling and ATF6 signaling. In the intestine, activation of the UPR through the kinase PERK results in differentiation of intestinal epithelial stem cells and colon cancer stem cells, whereas deletion of XBP1 results in increased stemness and adenomagenesis. How downstream activation of XBP1 and ATF6 influences intestinal stemness and proliferation remains largely unknown. We generated colorectal cancer cells (LS174T) that harbor doxycycline inducible expression of the active forms of either XBP1(s) or ATF6<sup>1-373</sup>. Activation of either XBP1 or ATF6 resulted in reduced cellular proliferation and reduced expression of markers of intestinal epithelial stemness. Moreover, XBP1 and ATF6 activation reduced global protein synthesis and lowered the threshold for UPR activation. XBP1-mediated loss of stemness and proliferation resulted from crossactivation of PERK-eIF2α signaling and could be rescued by constitutive expression of eIF2α phosphatase GADD34. We thus find that enforced activation of XBP1 and ATF6 results in reduction of stemness and proliferation. We expose a novel interaction between XBP1 and PERK-eIF2α signaling.

Also flagged:biotinylationcell surface proteinsosteoarthritisOAcell surface proteinmembrane
Journal Article 2019-06-21 ✓ 2 Snippets Matta C, Boocock DJ, Fellows CR, Miosge N, Dixon JE, Liddell S, Smith J, Mobasheri A.
In-Text Gene Mentions

…other hand, theleucine-rich repeat-containing protein 7repeat-containing protein 7…

…repeat-containing protein 7 (LRRC7) and four and…

Show Full Abstract

The complement of cell surface proteins, collectively referred to as the surfaceome, is a useful indicator of normal differentiation processes, and the development of pathologies such as osteoarthritis (OA). We employed biochemical and proteomic tools to explore the surfaceome and to define biomarkers in chondrogenic progenitor cells (CPC) derived from human OA knee articular cartilage. These cells have great therapeutic potential, but their unexplored biology limits their clinical application. We performed biotinylation combined with glycocapture and high throughput shotgun proteomics to define the surface proteome of human bone marrow mesenchymal stem cells (MSCs) and human CPCs. We prepared cell surface protein-enriched fractions from MSCs and CPCs, and then a proteomic approach was used to compare and evaluate protein changes between undifferentiated MSCs and CPCs. 1256 proteins were identified in the study, of which 791 (63%) were plasma membrane, cell surface or extracellular matrix proteins. Proteins constituting the surfaceome were annotated and categorized. Our results provide, for the first time, a repository of quantitative proteomic data on the surfaceome of two closely related cell types relevant to cartilage biology and OA. These results may provide novel insights into the transformation of the surfaceome during chondrogenic differentiation and phenotypic changes during OA development.

Also flagged:hearingchoarsenicIronwaterfit
Journal Article 2019-06-21 ✓ 1 Snippet He T, Ohgami N, Li X, Yajima I, Negishi-Oshino R, Kato Y, Ohgami K, Xu H, Ahsan N, Akhand AA, Kato M.
In-Text Gene Mentions

…study indicated thathemochromatosis, which is characterized…

Show Full Abstract

Well water for drinking with increased levels of iron in arsenic-polluted areas has been reported worldwide. Oral exposure to arsenic has been shown to be associated with hearing loss, while there is no evidence for an association between excessive exposure to iron and hearing loss in humans. In this study, we determined iron and arsenic levels in biological samples and hearing levels by pure tone audiometry (PTA) in subjects in a control area and an arsenic-polluted area in Bangladesh. The iron level in well water in the arsenic-polluted area was significantly higher than that in piped supply water in the control area. Subjects in the polluted area (n = 109), who had higher iron and arsenic levels in hair and toenails than those in subjects in the control area (n = 36), had an increased risk of hearing loss at 8 kHz and 12 kHz after adjustments for age, gender, smoking and BMI. Significant associations of the exposure group with hearing loss at 8 kHz and 12 kHz remained after further adjustment for arsenic levels in toenails and hair. Thus, this pilot study showed that excessive exposure to iron via drinking water is a potential risk for hearing loss in humans.

Also flagged:nucleotiderepeat expansion disordersRANpathogenesisorganelleFragile X syndrome
Journal Article 2019-06-21 No Snippets Rodriguez CM, Todd PK.
Show Full Abstract

Tandem microsatellite repeats are common throughout the human genome and intrinsically unstable, exhibiting expansions and contractions both somatically and across generations. Instability in a small subset of these repeats are currently linked to human disease, although recent findings suggest more disease-causing repeats await discovery. These nucleotide repeat expansion disorders (NREDs) primarily affect the nervous system and commonly lead to neurodegeneration through toxic protein gain-of-function, protein loss-of-function, and toxic RNA gain-of-function mechanisms. However, the lines between these categories have blurred with recent findings of unconventional Repeat Associated Non-AUG (RAN) translation from putatively non-coding regions of the genome. Here we review two emerging topics in NREDs: 1) The mechanisms by which RAN translation occurs and its role in disease pathogenesis and 2) How nucleotide repeats as RNA and translated proteins influence liquid-liquid phase separation, membraneless organelle dynamics, and nucleocytoplasmic transport. We examine these topics with a particular eye on two repeats: the CGG repeat expansion responsible for Fragile X syndrome and Fragile X-associated Tremor Ataxia Syndrome (FXTAS) and the intronic GGGGCC repeat expansion in C9orf72, the most common inherited cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Our thesis is that these emerging disease mechanisms can inform a broader understanding of the native roles of microsatellites in cellular function and that aberrations in these native processes provide clues to novel therapeutic strategies for these currently untreatable disorders.

Also flagged:SLNTNF-αa a aResveratrolLipidchain
Journal Article 2019-06-21 No Snippets Serini S, Cassano R, Facchinetti E, Amendola G, Trombino S, Calviello G.
Show Full Abstract

We recently found that the dietary long chain omega-3 polyunsaturated fatty acid (LC-ω-3 PUFA), docosahexaenoic acid (DHA), showed enhanced antineoplastic activity against colon cancer cells if encapsulated in resveratrol-based solid lipid nanoparticles (RV-SLNs). In the present study, we investigated whether the DHA enclosed in RV-SLNs (DHA-RV-SLNs) could have the potential of attenuating irritation and inflammation caused by environmental factors at the skin level. To this aim, we used two keratinocyte lines (HaCaT and NCTC 2544 cells) and exposed them to the cytotoxic action of the surfactant, sodium dodecyl sulfate (SDS), as an in vitro model of irritation, or to the pro-inflammatory activity of the cytokine TNF-α. We found that DHA enclosed in RV-SLNs significantly enhanced its ability to contrast the cytotoxic effect of SDS and to inhibit the SDS- and TNF-α-induced production of the inflammatory cytokines IL-1β, IL-6, and 1 MCP-1, in the two keratinocyte cell lines, as well as the NLRP3 inflammasome activation. Moreover, it more efficiently reduced the upsurge of reactive oxygen species (ROS) levels obtained in the presence of a pro-oxidant (H<sub>2</sub>O<sub>2</sub>). Overall, our findings suggest the possibility that a sustained dietary supplementation with DHA-RV-SLNs could efficiently protect skin from the pro-irritant and pro-inflammatory activity of environmental attacks.

Also flagged:Cervical Cancerpersistent infectiondeathCChrHPV) infectionCervical carcinoma
Journal Article 2019-06-21 ✓ 2 Snippets Olusola P, Banerjee HN, Philley JV, Dasgupta S.
In-Text Gene Mentions

Utilizing pyrosequencing and targeted next generation bisulfite sequencing, a recent study of 167 liquid-based cytology specimens identified a three-gene methylation signature including SOX1, DCC, and EPB41L3 in CC subjects [47] (Figure 3).

…including SOX1 ,DCC, and EPB41L3…

Show Full Abstract

Cervical cancer develops through persistent infection with high-risk human papilloma virus (hrHPV) and is a leading cause of death among women worldwide and in the United States. Periodic surveillance through hrHPV and Pap smear-based testing has remarkably reduced cervical cancer incidence worldwide and in the USA. However, considerable discordance in the occurrence and outcome of cervical cancer in various populations exists. Lack of adequate health insurance appears to act as a major socioeconomic burden for obtaining cervical cancer preventive screening in a timely manner, which results in disparate cervical cancer incidence. On the other hand, cervical cancer is aggressive and often detected in advanced stages, including African American and Hispanic/Latina women. In this context, our knowledge of the underlying molecular mechanism and genetic basis behind the disparate cervical cancer outcome is limited. In this review, we shed light on our current understanding and knowledge of racially disparate outcomes in cervical cancer.

Also flagged:LipoHanCancerPeptideChlorinoxygen
Journal Article 2019-06-21 No Snippets Lim C, Kang JK, Won WR, Park JY, Han SM, Le TN, Kim JC, Her J, Shin Y, Oh KT.
Show Full Abstract

Nanotechnology-based photo-chemo combination therapy has been extensively investigated to improve therapeutic outcomes in anticancer treatment. Specifically, with the help of a singlet oxygen generated by the photosensitizer, the endocytosed nanoparticles are allowed to escape from the endosomal compartment, which is currently an obstacle in nanotechnology-based anticancer therapy. In this study, a liposomal complex system (Lipo (Pep, Ce6)), composed of a chlorin e6-conjugated di-block copolymer (PEG-PLL(-<i>g</i>-Ce6)) and a D-(KLAKLAK)<sub>2</sub> peptide loading liposome (Lipo (Pep)), was developed and evaluated for its anticancer activity. Due to the membrane lytic ability of the D-(KLAKLAK)<sub>2</sub> peptide and the membrane disruptive effect of the singlet oxygen generated from chlorin e6, Lipo (Pep, Ce6) accelerated the disruption of the endosomal compartment, and exhibited strong synergistic anticancer activity in vitro. The prepared liposomal complex system could potentially maximize the efficacy of the nanotechnology-based photo-chemo combination therapy, and can be regarded as a novel, versatile strategy in advanced tumor therapy.

Also flagged:prostate cancerAdenocarcinomaprostate adenocarcinomaPrimary TumorB10Peroxidasin
Journal Article 2019-06-21 ✓ 1 Snippet Dougan J, Hawsawi O, Burton LJ, Edwards G, Jones K, Zou J, Nagappan P, Wang G, Zhang Q, Danaher A, Bowen N, Hinton C, Odero-Marah VA.
In-Text Gene Mentions

…PRDX3, PRDX5 andPRDX6are localized in…

Show Full Abstract

Peroxidasin (PXDN), a human homolog of <i>Drosophila</i> PXDN, belongs to the family of heme peroxidases and has been found to promote oxidative stress in cardiovascular tissue, however, its role in prostate cancer has not been previously elucidated. We hypothesized that PXDN promotes prostate cancer progression via regulation of metabolic and oxidative stress pathways. We analyzed PXDN expression in prostate tissue by immunohistochemistry and found increased PXDN expression with prostate cancer progression as compared to normal tissue or cells. PXDN knockdown followed by proteomic analysis revealed an increase in oxidative stress, mitochondrial dysfunction and gluconeogenesis pathways. Additionally, Liquid Chromatography with tandem mass spectrometry (LC-MS/MS)-based metabolomics confirmed that PXDN knockdown induced global reprogramming associated with increased oxidative stress and decreased nucleotide biosynthesis. We further demonstrated that PXDN knockdown led to an increase in reactive oxygen species (ROS) associated with decreased cell viability and increased apoptosis. Finally, PXDN knockdown decreased colony formation on soft agar. Overall, the data suggest that PXDN promotes progression of prostate cancer by regulating the metabolome, more specifically, by inhibiting oxidative stress leading to decreased apoptosis. Therefore, PXDN may be a biomarker associated with prostate cancer and a potential therapeutic target.

Also flagged:oxygencognitioninflammatory responseNeurodegenerative Diseasessleepaxon
Journal Article 2019-06-21 No Snippets Ballance WC, Qin EC, Chung HJ, Gillette MU, Kong H.
Show Full Abstract

Neurodegenerative diseases and disorders seriously impact memory and cognition and can become life-threatening. Current medical techniques attempt to combat these detrimental effects mainly through the administration of neuromedicine. However, drug efficacy is limited by rapid dispersal of the drugs to off-target sites while the site of administration is prone to overdose. Many neuropathological conditions are accompanied by excessive reactive oxygen species (ROS) due to the inflammatory response. Accordingly, ROS-responsive drug delivery systems have emerged as a promising solution. To guide intelligent and comprehensive design of ROS-responsive drug delivery systems, this review article discusses the two following topics: (1) the biology of ROS in both healthy and diseased nervous systems and (2) recent developments in ROS-responsive, drug delivery system design. Overall, this review article would assist efforts to make better decisions about designing ROS-responsive, neural drug delivery systems, including the selection of ROS-responsive functional groups.

Colonic Cancer and Acromegaly.

Also flagged:Acromegalycolorectal cancerColonic Cancerdiabetes mellituscerebrovascular diseasecancer
Journal Article 2019-06-21 No Snippets Dworakowska D, Grossman AB.
Show Full Abstract

Acromegaly results in a significantly increased morbidity and mortality due to cardiovascular and respiratory complications, as well as malignancies arising mainly from the colon. Furthermore, an increased lifetime risk of malignant transformation of pre-malignant colonic lesions relates to a worse overall prognosis from colorectal cancer, which is currently considered a major disease-related complication. In this review we provide some insight into colonic changes in this condition, summarize current knowledge and evidence on the use of colonoscopic screening in patients with acromegaly, and suggest a recommended screening protocol.

Also flagged:etoposidecisplatinsmall-cell lung cancerSCLCPlatinumCancer
Journal Article 2019-06-21 No Snippets Qiu Z, Lin A, Li K, Lin W, Wang Q, Wei T, Zhu W, Luo P, Zhang J.
Show Full Abstract

<h4>Purpose</h4>Platinum-based chemotherapy, consisting of etoposide and cisplatin (EP), has been the cornerstone of therapy for extensive-stage small-cell lung cancer (ES-SCLC) for decades. Despite the marked initial sensitivity of SCLC to chemotherapy, EP regimens cannot avoid the emergence of drug resistance in clinical practice. With the rise of new chemotherapy regimens in recent years and the primary resistance or insensitivity of ES-SCLC to EP regimens, it is desirable to be able to identify patients with resistant or insensitive ES-SCLC.<h4>Methods</h4>The sequencing and drug sensitivity data of SCLC cell lines were provided by The Genomics of Drug Sensitivity in Cancer Project (GDSC). The data regarding sensitivity to etoposide of 54 SCLC cell lines were analyzed, and etoposide-sensitive cell lines and etoposide-resistant cell lines were differentiated according to the IC50 values defined by the GDSC. ROC curve analysis was performed on all mutations and combinations of mutations to select the optimal panel to predict resistance to etoposide.<h4>Results</h4>ROC analysis of etoposide resistance revealed that the most significant single gene mutation indicating resistance to etoposide was <i>CSMD3</i>, and the accuracy of predicting resistance to etoposide proved to be the highest when there was any mutation in <i>CSMD3/PCLO/RYR1/EPB41L3</i>, area under the curve =0.804 (95% confidence interval: 0.679-0.930,<i>P</i> <i><0.001</i>).<h4>Conclusion</h4>This study found that a panel with four genes (<i>CSMD3, EPB41L3, PCLO, and RYR1</i>) can accurately predict sensitivity to etoposide. These findings provide new insights into the overall treatment for patients with ES-SCLC that is resistant or insensitive to etoposide.

bioRxiv 2019-06-21 Preprint (No Snippets API) Marquilly C, Busto G, Leger BS, Giniger E, Walker JA, Fradkin LG, Dura J.
Show Full Abstract

<h4>ABSTRACT</h4> ABL tyrosine kinase activity controls several aspects of development including axon patterning. Amyloid precursor protein (APP) is linked to Alzheimer’s disease and previous work established that ABL is a downstream effector in an Appl , the Drosophila App ortholog, signaling pathway which modulates axon outgrowth in the mushroom bodies (MBs), the fly memory center. Here we show that Abl is required for the MB neuron axonal growth. Importantly, both Abl overexpression and lack of expression produce a similar phenotype in the MBs indicating the necessity of tightly regulating ABL activity. We find that the fly huntingtin protein (HTT), the homolog of the protein involved in Huntington’s disease, behaves genetically as a repressor of ABL activity. Supporting this, FRET-based measurements of in vivo ABL activity in the MBs reveal a clear increase in its activity when HTT levels are reduced. Thus, in addition to its many other reported roles, HTT acts as a negative regulator of ABL activity, at least in the MBs, to maintain its appropriate physiological levels necessary for axon growth.

Also flagged:antibodytumor necrosis factor receptorTNFRSFcell proliferationOX40DR5
Journal Article 2019-06-20 No Snippets Yang Y, Yeh SH, Madireddi S, Matochko WL, Gu C, Pacheco Sanchez P, Ultsch M, De Leon Boenig G, Harris SF, Leonard B, Scales SJ, Zhu JW, Christensen E, Hang JQ, Brezski RJ, Marsters S, Ashkenazi A, Sukumaran S, Chiu H, Cubas R, Kim JM, Lazar GA.
Show Full Abstract

Agonism of members of the tumor necrosis factor receptor superfamily (TNFRSF) with monoclonal antibodies is of high therapeutic interest due to their role in immune regulation and cell proliferation. A major hurdle for pharmacologic activation of this receptor class is the requirement for high-order clustering, a mechanism that imposes a reliance <i>in vivo</i> on Fc receptor-mediated crosslinking. This extrinsic dependence represents a potential limitation of virtually the entire pipeline of agonist TNFRSF antibody drugs, of which none have thus far been approved or reached late-stage clinical trials. We show that tetravalent biepitopic targeting enables robust intrinsic antibody agonism for two members of this family, OX40 and DR5, that is superior to extrinsically crosslinked native parental antibodies. Tetravalent biepitopic anti-OX40 engagement co-stimulated OX40<sup>low</sup> cells, obviated the requirement for CD28 co-signal for T cell activation, and enabled superior pharmacodynamic activity relative to native IgG in a murine vaccination model. This work establishes a proof of concept for an engineering approach that addresses a major gap for the therapeutic activation of this important receptor class.

Also flagged:Heart FailureAtrial Fibrillation-Strokeatrial fibrillationAFcryptogenic stroke
Journal Article 2019-06-20 ✓ 1 Snippet Kneihsl M, Gattringer T, Bisping E, Scherr D, Raggam R, Mangge H, Enzinger C, Fandler-Höfler S, Eppinger S, Hermetter C, Bucnik B, Poltrum B, Niederkorn K, Fazekas F.
In-Text Gene Mentions

…agulability (D-dimer, AT-III [antithrombin-III]) were associated with…

Show Full Abstract

Background and Purpose- Occult atrial fibrillation (AF) causes a relevant proportion of initially cryptogenic stroke (CS), but prolonged rhythm monitoring is difficult to apply to all such patients. We hypothesized that blood biomarkers indicating heart failure (NT-proBNP [N-terminal pro-brain natriuretic peptide]) and hypercoagulability (D-dimer, AT-III [antithrombin-III]) were associated with AF-related stroke and could serve to predict the likelihood of AF detection in CS patients early on. Methods- Over a 1-year period, we prospectively applied a defined etiologic work-up to all ischemic stroke patients admitted to our stroke unit. If no clear stroke cause was detected (CS), patients underwent extended in-hospital cardiac rhythm monitoring (≥72 hours). Blood to determine biomarker levels was drawn within 24 hours after admission. Results- Of 429 patients, 103 had AF-related stroke. Compared with noncardiac stroke patients (n=171), they had higher NT-proBNP (1867 versus 263 pg/ml) and D-dimer levels (1.1 versus 0.6 µg/ml), and lower AT-III concentration (89% versus 94%). NT-proBNP ≥505 pg/ml distinguished AF-related from noncardiac stroke with a sensitivity of 93% and a specificity of 72%. D-dimer and AT-III cutoffs had lower sensitivities (61% and 53%) and specificities (58% and 69%) for AF-related stroke. Of all initially 143 CS patients, 14 were diagnosed with AF during in-hospital monitoring. The preidentified NT-proBNP cutoff ≥505 pg/ml correctly predicted AF in 12 of them (86%, negative predictive value: 98%), while D-dimer and AT-III cutoffs were noncontributory. Conclusions- This study supports the association of NT-proBNP and to a lesser extent of hypercoagulation markers with AF-related stroke. NT-proBNP seems helpful in selecting CS patients for immediate extended cardiac rhythm monitoring to detect occult AF whereby levels <505 pg/ml seem to have a high-negative predictive value.

Also flagged:Actinnon-muscle myosindendriteNetrinUNC-5Ena
Journal Article 2019-06-20 ✓ 5 Snippets Sundararajan L, Smith CJ, Watson JD, Millis BA, Tyska MJ, Miller DM.
In-Text Gene Mentions

…is captured by UNC-40(DCC) for a short-range…

…in which the UNC-40/DCC receptorreceptor captures the…

…receptors, UNC-5 and UNC-40/DCC, mediate self-avoidance for…

…elf-avoidance in which UNC-40/DCCcaptures UNC-6/Netrin at…

…UNC-40/DCCmay also effect…

Show Full Abstract

Dendrite growth is constrained by a self-avoidance response that induces retraction but the downstream pathways that balance these opposing mechanisms are unknown. We have proposed that the diffusible cue UNC-6(Netrin) is captured by UNC-40(DCC) for a short-range interaction with UNC-5 to trigger self-avoidance in the C. elegans PVD neuron. Here we report that the actin-polymerizing proteins UNC-34(Ena/VASP), WSP-1(WASP), UNC-73(Trio), MIG-10(Lamellipodin) and the Arp2/3 complex effect dendrite retraction in the self-avoidance response mediated by UNC-6(Netrin). The paradoxical idea that actin polymerization results in shorter rather than longer dendrites is explained by our finding that NMY-1 (non-muscle myosin II) is necessary for retraction and could therefore mediate this effect in a contractile mechanism. Our results also show that dendrite length is determined by the antagonistic effects on the actin cytoskeleton of separate sets of effectors for retraction mediated by UNC-6(Netrin) versus outgrowth promoted by the DMA-1 receptor. Thus, our findings suggest that the dendrite length depends on an intrinsic mechanism that balances distinct modes of actin assembly for growth versus retraction.

Also flagged:irontransmembrane protease serine 6anemiairon deficiency anemiainfection of the skincellulitis
Journal Article 2019-06-20 ✓ 5 Snippets Gill D, Benyamin B, Moore LSP, Monori G, Zhou A, Koskeridis F, Evangelou E, Laffan M, Walker AP, Tsilidis KK, Dehghan A, Elliott P, Hyppönen E, Tzoulaki I.
In-Text Gene Mentions

Genome-wide association study (GWAS) summary data obtained from 48,972 European individuals (55% female) across 19 cohorts in the Genetics of Iron Status Consortium were used to identify 3 genetic variants (rs1800562 and rs1799945 in the hemochromatosis gene [HFE] and rs855791 in the transmembrane protease serine 6 gene [TMPRSS6]) that associate with increased serum iron, ferritin, and transferrin saturation and decreased transferrin levels, thus serving as instruments for systemic iron status.

The consistent evidence we identify across two genetic variants of HFE (rs1800562 and rs1799945) and one variant of TMPRSS6 (rs855791) for a causal effect of higher iron status on lowering risk of both hypercholesterolemia and gallbladder cholesterolosis implicates a mechanism in which high iron status more generally affects cholesterol synthesis.

A genome-wide association study (GWAS) performed by the Genetics of Iron Status Consortium on 48,972 European subjects (combined Discovery [N = 23,986] and Replication [N = 24,986] cohorts, 55% female) identified 3 such single-nucleotide polymorphisms (SNPs): rs1800562 and rs1799945 in the hemochromatosis (HFE) gene and rs855791 in the transmembrane protease serine 6 (TMPRSS6) gene [2,8,10].

…rs1799945 in thehemochromatosisgene [ HFE…

…hemochromatosis gene [HFE] and rs855791…

Show Full Abstract

<h4>Background</h4>Iron is integral to many physiological processes, and variations in its levels, even within the normal range, can have implications for health. The objective of this study was to explore the broad clinical effects of varying iron status.<h4>Methods and findings</h4>Genome-wide association study (GWAS) summary data obtained from 48,972 European individuals (55% female) across 19 cohorts in the Genetics of Iron Status Consortium were used to identify 3 genetic variants (rs1800562 and rs1799945 in the hemochromatosis gene [HFE] and rs855791 in the transmembrane protease serine 6 gene [TMPRSS6]) that associate with increased serum iron, ferritin, and transferrin saturation and decreased transferrin levels, thus serving as instruments for systemic iron status. Phenome-wide association study (PheWAS) of these instruments was performed on 424,439 European individuals (54% female) in the UK Biobank who were aged 40-69 years when recruited from 2006 to 2010, with their genetic data linked to Hospital Episode Statistics (HES) from April, 1995 to March, 2016. Two-sample summary data mendelian randomization (MR) analysis was performed to investigate the effect of varying iron status on outcomes across the human phenome. MR-PheWAS analysis for the 3 iron status genetic instruments was performed separately and then pooled by meta-analysis. Correction was made for testing of multiple correlated phenotypes using a 5% false discovery rate (FDR) threshold. Heterogeneity between MR estimates for different instruments was used to indicate possible bias due to effects of the genetic variants through pathways unrelated to iron status. There were 904 distinct phenotypes included in the MR-PheWAS analyses. After correcting for multiple testing, the 3 genetic instruments for systemic iron status demonstrated consistent evidence of a causal effect of higher iron status on decreasing risk of traits related to anemia (iron deficiency anemia: odds ratio [OR] scaled to a standard deviation [SD] increase in genetically determined serum iron levels 0.72, 95% confidence interval [CI] 0.64-0.81, P = 4 × 10-8) and hypercholesterolemia (hypercholesterolemia: OR 0.88, 95% CI 0.83-0.93, P = 2 × 10-5) and increasing risk of traits related to infection of the skin and related structures (cellulitis and abscess of the leg: OR 1.25, 95% CI 1.10-1.42, P = 6 × 10-4). The main limitations of this study relate to possible bias from pleiotropic effects of the considered genetic variants and misclassification of diagnoses in the HES data. Furthermore, this work only investigated participants with European ancestry, and the findings may not be applicable to other ethnic groups.<h4>Conclusions</h4>Our findings offer novel, to our knowledge, insight into previously unreported effects of iron status, highlighting a potential protective effect of higher iron status on hypercholesterolemia and a detrimental role on risk of skin and skin structure infections. Given the modifiable and variable nature of iron status, these findings warrant further investigation.

Also flagged:cysticercosisneglected tropical diseaseNTDcysticercus cystcystcysts
Journal Article 2019-06-20 No Snippets Zou Y, Wang F, Wang HB, Wu WW, Fan CK, Zhang HY, Wang L, Tian XJ, Li W, Huang MJ.
Show Full Abstract

<h4>Background</h4>Cysticercosis is an emerging and neglected tropical disease (NTD) that poses a serious public health concern worldwide. Disseminated cysticercosis (DCC) is an uncommon manifestation of cysticercosis, also found in China.<h4>Case presentation</h4>We report three cases of DCC in patients living in China, with different clinical and radiological presentations. All three patients had DCC with active ocular cysticercosis, including one patient with widespread DCC caused by direct ingestion of Taenia solium eggs. The intravitreal cysticercus cyst in this patient was completely extracted entirely by 23-gauge pars plana vitrectomy, and the cyst was oval in shape on the flat mount preparation.<h4>Conclusion</h4>The clinical presentation of DCC is highly sophisticated. The diagnosis depended on the typical radiological presentations, biopsy and flat mount preparations of the cyst.

Also flagged:acute gastroenteritisPolyacrylamiderotavirus infectionsDiarrhea diseasedeathgastroenteritis
Journal Article 2019-06-20 No Snippets Lorestani N, Moradi A, Teimoori A, Masodi M, Khanizadeh S, Hassanpour M, Javid N, Ardebili A, Tabarraei A, Nikoo HR.
Show Full Abstract

<h4>Background</h4>The pattern and distribution of human rotavirus genotypes in young children in developing countries play an important role in epidemiological studies, as well as providing a strategy for the development of future rotavirus vaccine.<h4>Methods</h4>We evaluated stool samples from 349 children with acute gastroenteritis from Northern Iran (Gorgan city, Golestan province). Polyacrylamide Gel Electrophoresis (PAGE) and Latex Agglutination Test (LAT) were utilized to determine the prevalence of human rotavirus in fecal samples. Moreover semi-multiplex RT-PCR technique was carried out in order to determine the P and G genotypes of human rotavirus in rotavirus-positive samples.<h4>Results</h4>A total of 46 rotavirus-positive samples were G and P genotyped. Whereas 28 (60.8%) fecal specimens contained only one rotavirus strain, 14 (30.4%) were mixed rotavirus infections and 4 (8.8%) was non-typeable. Overall, during the study, 57.82% of strains identified as genotype G1, G2 (18.70%), G3 (4.69%), G4 (3.13%), G8 (3.13%), G9 (6.26%) and non-typeable G (6.26%). From all these mentioned rotavirus strains, 46 were characterized as P [8] (97.80%) and P [4] (2.20%).Our analysis of the G and P genotyping of strains from all 46 rotavirus-infected children has revealed that 4/46(6.26%) of G type strains were non-typeable. The predominant single G/P combination was G1P [8] (57.82%), followed by, G2P [8] (16.98%), G2P [4] (1.72%), G3P [8] (4.69%), G4P [8] (3.13%) G8P [8] (3.13%), G9P [8] (6.26%) and four cases of non-typeable G (6.26%). Rotavirus was detected in 39 specimens (11.17%) by PAGE and in 38 specimens (10.88%) by LAT. Both tests were 100% specific; however, the LAT was 82.61% sensitive compared to the PAGE, which was 84.78% sensitive.<h4>Conclusions</h4>The results suggest that to characterize rotavirus strains as well as design new effective vaccines for children with acute gastroenteritis, a large-scale study is needed in future.

Also flagged:major depressive disordersdepressionmajor depressioncardiovascular diseaseMajor depressive disordersleep
Journal Article 2019-06-20 ✓ 2 Snippets Gerber M, Beck J, Brand S, Cody R, Donath L, Eckert A, Faude O, Fischer X, Hatzinger M, Holsboer-Trachsler E, Imboden C, Lang U, Mans S, Mikoteit T, Oswald A, Pühse U, Rey S, Schreiner AK, Schweinfurth N, Spitzer U, Zahner L.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) gene (5-HTTLPR), which…

…the serotonin transporter (5-HTT) polymorphic promoter region…

Show Full Abstract

<h4>Background</h4>Major depressive disorder (MDD) is a widespread and burdensome psychiatric issue. Physical activity counselling may increase lifestyle physical activity and cardiorespiratory fitness in this specific and particularly vulnerable population, which often suffers from both mental and physical health problems. Therefore, this study will examine the impact of a lifestyle physical activity counselling intervention on physical activity, cardiorespiratory fitness, depression, and cardiovascular health risk markers among in-patients diagnosed with MDD compared to controls. Secondary purposes are to examine the acceptability and perceived usefulness of the intervention among these patients, to find out whether the effectiveness of the intervention is moderated by genetic factors, and to compare baseline values with an age- and gender-matched group of healthy controls.<h4>Methods</h4>The study is designed as a multi-centric two-arm randomized clinical trial including an intervention group and a placebo control group, allocation concealment, single-blinding, and intention-to-treat analysis. Participants (N = 334) will be continuously recruited from four clinics specialized in the treatment of MDD. The intervention builds on a standardized, theory-based, low-cost lifestyle physical activity counselling programme, which was specifically designed for an in-patient rehabilitation setting. The placebo control condition consists of general instructions about health-enhancing physical activity. Data assessments will take place 2-3 weeks after admission to in-patient treatment (baseline), and 6 weeks (post) and 12 months (follow-up) after discharge from in-patient treatment. The primary outcome is objectively assessed physical activity at follow-up.<h4>Discussion</h4>Because regular physical activity has proven to be an important predictor of long-term response and remission in patients with major depression, we believe that our planned study may lay important groundwork by showing how individually tailored lifestyle physical activity counselling can be integrated into given clinical structures. Improving physical activity may have important implications for tackling metabolic and cardiovascular disease and increasing mood and cognitive functioning in this at-risk population, hence limiting the future burden of multiple chronic conditions. Increased physical activity may also reduce the likelihood of future depressive episodes. By moving towards the primary prevention of chronic physical conditions, much can be done to enhance the quality and quantity of life of people with MDD.<h4>Trial registration</h4>ISRCTN, ISRCTN10469580 . Registered on 3 September 2018.

Also flagged:ChromatinMSHmismatch repairhistone chaperonesisterhistone chaperones
Journal Article 2019-06-20 ✓ 1 Snippet Chakraborty U, Mackenroth B, Shalloway D, Alani E.
In-Text Gene Mentions

chromatin modifiers

Show Full Abstract

Recombination between divergent DNA sequences is actively prevented by heteroduplex rejection mechanisms. In baker's yeast, such antirecombination mechanisms can be initiated by the recognition of DNA mismatches in heteroduplex DNA by MSH proteins, followed by recruitment of the Sgs1-Top3-Rmi1 helicase-topoisomerase complex to unwind the recombination intermediate. We previously showed that the repair/rejection decision during single-strand annealing recombination is temporally regulated by MSH (<u>M</u>ut<u>S</u><u>h</u>omolog) protein levels and by factors that excise nonhomologous single-stranded tails. These observations, coupled with recent studies indicating that mismatch repair (MMR) factors interact with components of the histone chaperone machinery, encouraged us to explore roles for epigenetic factors and chromatin conformation in regulating the decision to reject <i>vs.</i> repair recombination between divergent DNA substrates. This work involved the use of an inverted repeat recombination assay thought to measure sister chromatid repair during DNA replication. Our observations are consistent with the histone chaperones CAF-1 and Rtt106, and the histone deacetylase Sir2, acting to suppress heteroduplex rejection and the Rpd3, Hst3, and Hst4 deacetylases acting to promote heteroduplex rejection. These observations, and double-mutant analysis, have led to a model in which nucleosomes located at DNA lesions stabilize recombination intermediates and compete with MMR factors that mediate heteroduplex rejection.

Also flagged:CancerDanaLymphomaAzacitidineHodgkin's DiseaseMDS
Journal Article 2019-06-20 No Snippets Copsel S, Wolf D, Komanduri KV, Levy RB.
Show Full Abstract

CD4<sup>+</sup>FoxP3<sup>+</sup> regulatory T cells (Tregs) are a non-redundant population critical for the maintenance of self-tolerance. Over the past decade, the use of these cells for therapeutic purposes in transplantation and autoimmune disease has emerged based on their capacity to inhibit immune activation. Basic science discoveries have led to identifying key receptors on Tregs that can regulate their proliferation and function. Notably, the understanding that IL-2 signaling is crucial for Treg homeostasis promoted the hypothesis that <i>in vivo</i> IL-2 treatment could provide a strategy to control the compartment. The use of low-dose IL-2 <i>in vivo</i> was shown to selectively expand Tregs <i>versus</i> other immune cells. Interestingly, a number of other Treg cell surface proteins, including CD28, CD45, IL-33R and TNFRSF members, have been identified which can also induce activation and proliferation of this population. Pre-clinical studies have exploited these observations to prevent and treat mice developing autoimmune diseases and graft-<i>versus</i>-host disease post-allogeneic hematopoietic stem cell transplantation. These findings support the development of translational strategies to expand Tregs in patients. Excitingly, the use of low-dose IL-2 for patients suffering from graft-<i>versus</i>-host disease and autoimmune disease has demonstrated increased Treg levels together with beneficial outcomes. To date, promising pre-clinical and clinical studies have directly targeted Tregs and clearly established the ability to increase their levels and augment their function <i>in vivo</i> Here we review the evolving field of <i>in vivo</i> Treg manipulation and its application to allogeneic hematopoietic stem cell transplantation.

Also flagged:Complement Receptor 1CR1malariavivax malariacellReticulocyte Binding Proteins
Journal Article 2019-06-20 ✓ 4 Snippets Prajapati SK, Borlon C, Rovira-Vallbona E, Gruszczyk J, Menant S, Tham WH, Kattenberg JH, Villasis E, De Meulenaere K, Gamboa D, Vinetz J, Fujita R, Xuan XN, Urbano Ferreira M, Niño CH, Patarroyo MA, Spanakos G, Kestens L, Abbeele JVD, Rosanas-Urgell A.
In-Text Gene Mentions

…blood samples fromhemochromatosispatients was obtained…

…blood cells fromhemochromatosispatients…

…collected from 13hemochromatosispatients undergoing therapeuti…

…culocyte-enriched samples fromhemochromatosisdonors.…

Show Full Abstract

Plasmodium vivax parasites preferentially invade reticulocyte cells in a multistep process that is still poorly understood. In this study, we used ex vivo invasion assays and population genetic analyses to investigate the involvement of complement receptor 1 (CR1) in P. vivax invasion. First, we observed that P. vivax invasion of reticulocytes was consistently reduced when CR1 surface expression was reduced through enzymatic cleavage, in the presence of naturally low-CR1-expressing cells compared with high-CR1-expressing cells, and with the addition of soluble CR1, a known inhibitor of P. falciparum invasion. Immuno-precipitation experiments with P. vivax Reticulocyte Binding Proteins showed no evidence of complex formation. In addition, analysis of CR1 genetic data for worldwide human populations with different exposure to malaria parasites show significantly higher frequency of CR1 alleles associated with low receptor expression on the surface of RBCs and higher linkage disequilibrium in human populations exposed to P. vivax malaria compared with unexposed populations. These results are consistent with a positive selection of low-CR1-expressing alleles in vivax-endemic areas. Collectively, our findings demonstrate that CR1 availability on the surface of RBCs modulates P. vivax invasion. The identification of new molecular interactions is crucial to guiding the rational development of new therapeutic interventions against vivax malaria.

Also flagged:pelvic inflammatory diseaseHydrosalpinxinfertilityfertilizationredoxphagocytosis
Journal Article 2019-06-20 ✓ 1 Snippet Yohannes E, Kazanjian AA, Lindsay ME, Fujii DT, Ieronimakis N, Chow GE, Beesley RD, Heitmann RJ, Burney RO.
In-Text Gene Mentions

…TXN, PRDX5, andPRDX6.…

Show Full Abstract

Hydrosalpinx, the blockage of fallopian tubes, can result from pelvic inflammatory disease. Hydrosalpinx is a cause of infertility and negatively impacts in vitro fertilization. To better understand the pathobiology of hydrosalpinx, we compared the proteome of lavages from disease vs. healthy fallopian tubes. Results indicate a disruption of redox homeostasis and activation of the complement system, immune cell infiltration, and phagocytosis; pathways that may drive tubal injury. To our surprise among the most prominent proteins with hydrosalpinx was mesothelin (MSLN), which until now has only been associated with epithelial malignancies. Analogous to mesothelioma and ovarian carcinoma, a significant increase of MSLN was detected in plasma from patients with hydrosalpinx. This finding suggests MSLN may provide clinical diagnosis in lieu of the current approaches that require invasive imaging. Importantly, these findings implicate MSLN in a benign disease, indicating that the activation and role of MSLN is not restricted to cancer.

Also flagged:Docosahexaenoic acidbehaviouraltranslationalspinal cord injuriesspinal cord injurydepression
Journal Article 2019-06-20 No Snippets Marinelli S, Vacca V, De Angelis F, Pieroni L, Orsini T, Parisi C, Soligo M, Protto V, Manni L, Guerrieri R, Pavone F.
Show Full Abstract

Traumatic spinal cord injury has dramatic consequences and a huge social impact. We propose a new mouse model of spinal trauma that induces a complete paralysis of hindlimbs, still observable 30 days after injury. The contusion, performed without laminectomy and deriving from the pressure exerted directly on the bone, mimics more closely many features of spinal injury in humans. Spinal cord was injured at thoracic level 10 (T10) in adult anesthetized female CD1 mice, mounted on stereotaxic apparatus and connected to a precision impactor device. Following severe injury, we evaluated motor and sensory functions, and histological/morphological features of spinal tissue at different time points. Moreover, we studied the effects of early and subchronic administration of Docosahexaenoic acid, investigating functional responses, structural changes proximal and distal to the lesion in primary and secondary injury phases, proteome modulation in injured spinal cord. Docosahexaenoic acid was able i) to restore behavioural responses and ii) to induce pro-regenerative effects and neuroprotective action against demyelination, apoptosis and neuroinflammation. Considering the urgent health challenge represented by spinal injury, this new and reliable mouse model together with the positive effects of docosahexaenoic acid provide important translational implications for promising therapeutic approaches for spinal cord injuries.

Also flagged:male reproductionfertilizationadenosine triphosphatetestosteroneoxygenadenosine monophosphate
Journal Article 2019-06-20 No Snippets Zhang JJ, Chandimali N, Kim N, Kang TY, Kim SB, Kim JS, Wang XZ, Kwon T, Jeong DK.
Show Full Abstract

The sperm quality is a vital economical requisite of poultry production. Our previous study found non-thermal dielectric barrier discharge plasma exposure on fertilized eggs could increase the chicken growth and the male reproduction. However, it is unclear how plasma treatment regulates the reproductive capacity in male chickens. In this study, we used the optimal plasma treatment condition (2.81 W for 2 min) which has been applied on 3.5-day-incubated fertilized eggs in the previous work and investigated the reproductive performance in male chickens aged at 20 and 40 weeks. The results showed that plasma exposure increased sperm count, motility, fertility rate, and fertilization period of male chickens. The sperm quality-promoting effect of plasma treatment was regulated by the significant improvements of adenosine triphosphate production and testosterone level, and by the modulation of reactive oxygen species balance and adenosine monophosphate-activated protein kinase and mammalian target of rapamycin pathway in the spermatozoa. Additionally, the plasma effect suggested that DNA demethylation and microRNA differential expression (a total number of 39 microRNAs were up-regulated whereas 53 microRNAs down-regulated in the testis) regulated the increases of adenosine triphosphate synthesis and testosterone level for promoting the chicken sperm quality. This finding might be beneficial to elevate the fertilization rate and embryo quality for the next generation in poultry breeding.

Also flagged:wsp16S ribosomal16S rRNAef-1α28S rRNA
Journal Article 2019-06-20 ✓ 4 Snippets Mateos M, Silva NO, Ramirez P, Higareda-Alvear VM, Aramayo R, Erickson JW.
In-Text Gene Mentions

…dosage compensation complex (DCC; also known as…

…Secondly, theDCC, which normally acetylates…

…repeats interact withDCCcomplex itself or…

…interact with theDCC, which assembles onto…

Show Full Abstract

Maternally-transmitted endosymbiotic bacteria are ubiquitous in insects. Among other influential phenotypes, many heritable symbionts of arthropods are notorious for manipulating host reproduction through one of four reproductive syndromes, which are generally exerted during early developmental stages of the host: male feminization; parthenogenesis induction; male killing; and cytoplasmic incompatibility (CI). Major advances have been achieved in understanding mechanisms and identifying symbiont factors involved in reproductive manipulation, particularly male killing and cytoplasmic incompatibility. Nonetheless, whether cytoplasmically-transmitted bacteria influence the maternally-loaded components of the egg or early embryo has not been examined. In the present study, we investigated whether heritable endosymbionts that cause different reproductive phenotypes in Drosophila melanogaster influence the mRNA transcriptome of early embryos. We used mRNA-seq to evaluate differential expression in Drosophila embryos lacking endosymbionts (control) to those harbouring the male-killing Spiroplasma poulsonii strain MSRO-Br, the CI-inducing Wolbachia strain wMel, or Spiroplasma poulsonii strain Hyd1; a strain that lacks a reproductive phenotype and is naturally associated with Drosophila hydei. We found no consistent evidence of influence of symbiont on mRNA composition of early embryos, suggesting that the reproductive manipulation mechanism does not involve alteration of maternally-loaded transcripts. In addition, we capitalized on several available mRNA-seq datasets derived from Spiroplasma-infected Drosophila melanogaster embryos, to search for signals of depurination of rRNA, consistent with the activity of Ribosome Inactivating Proteins (RIPs) encoded by Spiroplasma poulsonii. We found small but statistically significant signals of depurination of Drosophila rRNA in the Spiroplasma treatments (both strains), but not in the symbiont-free control or Wolbachia treatment, consistent with the action of RIPs. The depurination signal was slightly stronger in the treatment with the male-killing strain. This result supports a recent report that RIP-induced damage contributes to male embryo death.

Also flagged:calciumparathyroid hormoneprolactinestrogeninsulin-like growth factorcalcium-sensing receptor
Journal Article 2019-06-20 No Snippets Wongdee K, Rodrat M, Teerapornpuntakit J, Krishnamra N, Charoenphandhu N.
Show Full Abstract

Besides the two canonical calciotropic hormones, namely parathyroid hormone and 1,25-dihydroxyvitamin D [1,25(OH)<sub>2</sub>D<sub>3</sub>], there are several other endocrine and paracrine factors, such as prolactin, estrogen, and insulin-like growth factor that have been known to directly stimulate intestinal calcium absorption. Generally, to maintain an optimal plasma calcium level, these positive regulators enhance calcium absorption, which is indirectly counterbalanced by a long-loop negative feedback mechanism, i.e., through calcium-sensing receptor in the parathyroid chief cells. However, several lines of recent evidence have revealed the presence of calcium absorption inhibitors present in the intestinal lumen and extracellular fluid in close vicinity to enterocytes, which could also directly compromise calcium absorption. For example, luminal iron, circulating fibroblast growth factor (FGF)-23, and stanniocalcin can decrease calcium absorption, thereby preventing excessive calcium uptake under certain conditions. Interestingly, the intestinal epithelial cells themselves could lower their rate of calcium uptake after exposure to high luminal calcium concentration, suggesting a presence of an ultra-short negative feedback loop independent of systemic hormones. The existence of neural regulation is also plausible but this requires more supporting evidence. In the present review, we elaborate on the physiological significance of these negative feedback regulators of calcium absorption, and provide evidence to show how our body can efficiently restrict a flood of calcium influx in order to maintain calcium homeostasis.

Also flagged:CancerNucleic acidsacidNucleic acidbindingdegradation
Journal Article 2019-06-20 No Snippets Vaughan HJ, Green JJ, Tzeng SY.
Show Full Abstract

Nucleic acids are a promising type of therapeutic for the treatment of a wide range of conditions, including cancer, but they also pose many delivery challenges. For efficient and safe delivery to cancer cells, nucleic acids must generally be packaged into a vehicle, such as a nanoparticle, that will allow them to be taken up by the target cells and then released in the appropriate cellular compartment to function. As with other types of therapeutics, delivery vehicles for nucleic acids must also be designed to avoid unwanted side effects; thus, the ability of such carriers to target their cargo to cancer cells is crucial. Classes of nucleic acids, hurdles that must be overcome for effective intracellular delivery, types of nonviral nanomaterials used as delivery vehicles, and the different strategies that can be employed to target nucleic acid delivery specifically to tumor cells are discussed. Additonally, nanoparticle designs that facilitate multiplexed delivery of combinations of nucleic acids are reviewed.

Also flagged:Prostacyclin Synthaseplatelet aggregationcytochrome P450 2J2glutathione S-transferaseGSTpeptides
Journal Article 2019-06-20 ✓ 5 Snippets Ershov PV, Mezentsev YV, Kopylov AT, Yablokov EO, Svirid AV, Lushchyk AY, Kaluzhskiy LA, Gilep AA, Usanov SA, Medvedev AE, Ivanov AS.
In-Text Gene Mentions

As for the functional consequences of the complex formation of PTGIS/CYP2J2, we can assume the possible involvement of these proteins in the metabolism of arachidonic acid [44] and prostacyclin as a P450-dependent epoxygenase [45].

Prostacyclin synthase (PTGIS; EC 5.3.99.4), also known as prostaglandin I2 synthase, catalyzes the reaction of prostaglandin H2 isomerization to prostacyclin (or prostaglandin I2, PGI2).

Isolated 14-3-3 proteins, as potential protein partners of PTGIS, can recognize the canonical phosphorylated motifs of PTGIS protein in predicted amino acid positions 24–36, 75–82, 200–206, 223–232 using the online server [36] (http://www.compbio.dundee.ac.uk/1433pred).

Thus, we have shown for the first time that prostacyclin synthase, can form a heterocomplex with the monomeric form of glutathione S-transferase, presumably due to the involvement of amino acid residues in the GST/GST homodimerization interface, whereas PTGIS does not interact with the dimeric form of GST.

The peptide fragments of protein partners with the predicted hot amino acid residues that are critical for complex formation between PTGIS and a protein partner were selected (Table 1).

Show Full Abstract

Prostacyclin synthase (PTGIS; EC 5.3.99.4) catalyzes isomerization of prostaglandin H<sub>2</sub> to prostacyclin, a potent vasodilator and inhibitor of platelet aggregation. At present, limited data exist on functional coupling and possible ways of regulating PTGIS due to insufficient information about protein-protein interactions in which this crucial enzyme is involved. The aim of this study is to isolate protein partners for PTGIS from rat tissue lysates. Using CNBr-activated Sepharose 4B with covalently immobilized PTGIS as an affinity sorbent, we confidently identified 58 unique proteins by mass spectrometry (LC-MS/MS). The participation of these proteins in lysate complex formation was characterized by SEC lysate profiling. Several potential members of the PTGIS subinteractome have been validated by surface plasmon resonance (SPR) analysis. SPR revealed that PTGIS interacted with full-length cytochrome P450 2J2 and glutathione S-transferase (GST). In addition, PTGIS was shown to bind synthetic peptides corresponding to sequences of for GSTA1, GSTM1, aldo-keto reductase (AKR1A1), glutaredoxin 3 (GLRX3) and histidine triad nucleotide binding protein 2 (HINT2). Prostacyclin synthase could potentially be involved in functional interactions with identified novel protein partners participating in iron and heme metabolism, oxidative stress, xenobiotic and drugs metabolism, glutathione and prostaglandin metabolism. The possible biological role of the recognized interaction is discussed in the context of PTGIS functioning.

Also flagged:Inflammatory Bowel Diseasechronic disordermicronutrient deficiencyvitamin Dironvitamin A
Journal Article 2019-06-20 No Snippets Kilby K, Mathias H, Boisvenue L, Heisler C, Jones JL.
Show Full Abstract

Inflammatory Bowel Disease (IBD) is a chronic disorder associated with immune dysregulation and chronic inflammation of the digestive tract. While it is poorly understood, the role of nutrition and nutrient status in the etiology of IBD and its associated outcomes has led to increased research relating to micronutrient deficiency. This review offers an overview of recent literature related to micronutrient absorption and outcomes in adults with IBD. Although the absorption and IBD-related outcomes of some micronutrients (e.g., vitamin D and iron) are well understood, other micronutrients (e.g., vitamin A) require further research. Increased research and clinician knowledge of the relationship between micronutrients and IBD may manifest in improved nutrient screening, monitoring, treatment, and outcomes for people living with IBD.

Also flagged:cardiomyopathymTORcardiomyopathieshypertrophic cardiomyopathyLAMP2Danon disease
Journal Article 2019-06-20 No Snippets Dvornikov AV, Wang M, Yang J, Zhu P, Le T, Lin X, Cao H, Xu X.
Show Full Abstract

Adult zebrafish is an emerging vertebrate model for studying genetic basis of cardiomyopathies; but whether the simple fish heart can model essential features of hypertrophic cardiomyopathy (HCM) remained unknown. Here, we report a comprehensive phenotyping of a lamp2 knockout (KO) mutant. LAMP2 encodes a lysosomal protein and is a causative gene of Danon disease that is characterized by HCM and massive autophagic vacuoles accumulation in the tissues. There is no effective therapy yet to treat this most lethal cardiomyopathy in the young. First, we did find the autophagic vacuoles accumulation in cardiac tissues from lamp2 KO. Next, through employing a set of emerging phenotyping tools, we revealed heart failure phenotypes in the lamp2 KO mutants, including decreased ventricular ejection fraction, reduced physical exercise capacity, blunted β-adrenergic contractile response, and enlarged atrium. We also noted changes of the following indices suggesting cardiac hypertrophic remodeling in lamp2 KO: a rounded heart shape, increased end-systolic ventricular volume and density of ventricular myocardium, elevated actomyosin activation kinetics together with increased maximal isometric tension at the level of cardiac myofibrils. Lastly, we assessed the function of lysosomal-localized mTOR on the lamp2-associated Danon disease. We found that haploinsufficiency of mtor was able to normalize some characteristics of the lamp2 KO, including ejection fraction, β-adrenergic response, and the actomyosin activation kinetics. In summary, we demonstrate the feasibility of modeling the inherited HCM in the adult zebrafish, which can be used to develop potential therapies.

Also flagged:extracellularvesiclesExtracellular vesiclesmembranousbrain diseasesneurodegenerative disorders
Journal Article 2019-06-20 ✓ 1 Snippet You Y, Ikezu T.
In-Text Gene Mentions

HTT

Show Full Abstract

Extracellular vesicles (EVs) are heterogeneous cell-derived membranous vesicles which carry a large diversity of molecules such as proteins and RNA species. They are now considered to be a general mode of intercellular communication by direct transfer of biomolecules. Emerging evidence demonstrates that EVs are involved in multiple pathological processes of brain diseases including neurodegenerative disorders. In this review, we investigate the current knowledge about EV biology. We also provide an overview of the roles of EVs in related brain diseases, particularly in neurodegenerative disorders. Finally, we discuss their potential applications as novel biomarkers as well as the developments of EV-based therapies.

Also flagged:peroxidaseAPEX2localizationorganizationnuclear porecytoplasmic export
Journal Article 2019-06-20 No Snippets Fazal FM, Han S, Parker KR, Kaewsapsak P, Xu J, Boettiger AN, Chang HY, Ting AY.
Show Full Abstract

We introduce APEX-seq, a method for RNA sequencing based on direct proximity labeling of RNA using the peroxidase enzyme APEX2. APEX-seq in nine distinct subcellular locales produced a nanometer-resolution spatial map of the human transcriptome as a resource, revealing extensive patterns of localization for diverse RNA classes and transcript isoforms. We uncover a radial organization of the nuclear transcriptome, which is gated at the inner surface of the nuclear pore for cytoplasmic export of processed transcripts. We identify two distinct pathways of messenger RNA localization to mitochondria, each associated with specific sets of transcripts for building complementary macromolecular machines within the organelle. APEX-seq should be widely applicable to many systems, enabling comprehensive investigations of the spatial transcriptome.

Also flagged:TAOK1neurodevelopmental delayintellectual disabilityneurodevelopmental disordersTAO] amino acid kinase 1serine/threonine-protein kinase
Journal Article 2019-06-20 No Snippets Dulovic-Mahlow M, Trinh J, Kandaswamy KK, Braathen GJ, Di Donato N, Rahikkala E, Beblo S, Werber M, Krajka V, Busk ØL, Baumann H, Al-Sannaa NA, Hinrichs F, Affan R, Navot N, Al Balwi MA, Oprea G, Holla ØL, Weiss MER, Jamra RA, Kahlert AK, Kishore S, Tveten K, Vos M, Rolfs A, Lohmann K.
Show Full Abstract

De novo variants represent a significant cause of neurodevelopmental delay and intellectual disability. A genetic basis can be identified in only half of individuals who have neurodevelopmental disorders (NDDs); this indicates that additional causes need to be elucidated. We compared the frequency of de novo variants in patient-parent trios with (n = 2,030) versus without (n = 2,755) NDDs. We identified de novo variants in TAOK1 (thousand and one [TAO] amino acid kinase 1), which encodes the serine/threonine-protein kinase TAO1, in three individuals with NDDs but not in persons who did not have NDDs. Through further screening and the use of GeneMatcher, five additional individuals with NDDs were found to have de novo variants. All eight variants were absent from gnomAD (Genome Aggregation Database). The variant carriers shared a non-specific phenotype of developmental delay, and six individuals had additional muscular hypotonia. We established a fibroblast line of one mutation carrier, and we demonstrated that reduced mRNA levels of TAOK1 could be increased upon cycloheximide treatment. These results indicate nonsense-mediated mRNA decay. Further, there was neither detectable phosphorylated TAO1 kinase nor phosphorylated tau in these cells, and mitochondrial morphology was altered. Knockdown of the ortholog gene Tao1 (Tao, CG14217) in Drosophila resulted in delayed early development. The majority of the Tao1-knockdown flies did not survive beyond the third instar larval stage. When compared to control flies, Tao1 knockdown flies revealed changed morphology of the ventral nerve cord and the neuromuscular junctions as well as a decreased number of endings (boutons). Furthermore, mitochondria in mutant flies showed altered distribution and decreased size in axons of motor neurons. Thus, we provide compelling evidence that de novo variants in TAOK1 cause NDDs.

Also flagged:genetic disorderscancersinfectionsautoimmune diseasesinfectioncancer
Journal Article 2019-06-20 ✓ 1 Snippet Zhao W, Hou X, Vick OG, Dong Y.
In-Text Gene Mentions

HTT

Show Full Abstract

Genetic and rare diseases (GARDs) affect more than 350 million patients worldwide and remain a significant challenge in the clinic. Hence, continuous efforts have been made to bridge the significant gap between the supply and demand of effective treatments for GARDs. Recent decades have witnessed the impressive progress in the fight against GARDs, with an improved understanding of the genetic origins of rare diseases and the rapid development in gene therapy providing a new avenue for GARD therapy. RNA-based therapeutics, such as RNA interference (RNAi), messenger RNA (mRNA) and RNA-involved genome editing technologies, demonstrate great potential as a therapy tool for treating genetic associated rare diseases. In the meantime, a variety of RNA delivery vehicles were established for boosting the widespread applications of RNA therapeutics. Among all the RNA delivery platforms which enable the systemic applications of RNAs, non-viral RNA delivery biomaterials display superior properties and a few biomaterials have been successfully exploited for achieving the RNA-based gene therapies on GARDs. In this review article, we focus on recent advances in the development of novel biomaterials for delivery of RNA-based therapeutics and highlight their applications to treat GARDs.

Also flagged:SriUNKN10RatCrabsThr
Journal Article 2019-06-20 No Snippets Le TH, Nguyen KT, Nguyen NTB, Doan HTT, Agatsuma T, Blair D.
Show Full Abstract

We present the complete mitochondrial genome of <i>Paragonimus ohirai</i> Miyazaki, 1939 and compare its features with those of previously reported mitochondrial genomes of the pathogenic lung-fluke, <i>Paragonimus westermani</i>, and other members of the genus. The circular mitochondrial DNA molecule of the single fully sequenced individual of <i>P. ohirai</i> was 14,818 bp in length, containing 12 protein-coding, two ribosomal RNA and 22 transfer RNA genes. As is common among trematodes, an <i>atp8</i> gene was absent from the mitogenome of <i>P. ohirai</i> and the 5' end of <i>nad4</i> overlapped with the 3' end of <i>nad4L</i> by 40 bp<i>. Paragonimusohirai</i> and four forms/strains of <i>P. westermani</i> from South Korea and India, exhibited remarkably different base compositions and hence codon usage in protein-coding genes. In the fully sequenced <i>P. ohirai</i> individual, the non-coding region started with two long identical repeats (292 bp each), separated by <i>tRNA<sup>Glu</sup></i> . These were followed by an array of six short tandem repeats (STR), 117 bp each. Numbers of the short tandem repeats varied among <i>P. ohirai</i> individuals. A phylogenetic tree inferred from concatenated mitochondrial protein sequences of 50 strains encompassing 42 species of trematodes belonging to 14 families identified a monophyletic Paragonimidae in the class Trematoda. Characterization of additional mitogenomes in the genus <i>Paragonimus</i> will be useful for biomedical studies and development of molecular tools and mitochondrial markers for diagnostic, identification, hybridization and phylogenetic/epidemiological/evolutionary studies.

Also flagged:MSH3DHFRmyotonic dystrophy type 1autosomal dominant disordersmovement disordercognitive impairment
Journal Article 2019-06-19 ✓ 1 Snippet Flower M, Lomeikaite V, Ciosi M, Cumming S, Morales F, Lo K, Hensman Moss D, Jones L, Holmans P, TRACK-HD Investigators , OPTIMISTIC Consortium , Monckton DG, Tabrizi SJ.
In-Text Gene Mentions

…repeat expansion inHTTexon 1 and…

Show Full Abstract

The mismatch repair gene MSH3 has been implicated as a genetic modifier of the CAG·CTG repeat expansion disorders Huntington's disease and myotonic dystrophy type 1. A recent Huntington's disease genome-wide association study found rs557874766, an imputed single nucleotide polymorphism located within a polymorphic 9 bp tandem repeat in MSH3/DHFR, as the variant most significantly associated with progression in Huntington's disease. Using Illumina sequencing in Huntington's disease and myotonic dystrophy type 1 subjects, we show that rs557874766 is an alignment artefact, the minor allele for which corresponds to a three-repeat allele in MSH3 exon 1 that is associated with a reduced rate of somatic CAG·CTG expansion (P = 0.004) and delayed disease onset (P = 0.003) in both Huntington's disease and myotonic dystrophy type 1, and slower progression (P = 3.86 × 10-7) in Huntington's disease. RNA-Seq of whole blood in the Huntington's disease subjects found that repeat variants are associated with MSH3 and DHFR expression. A transcriptome-wide association study in the Huntington's disease cohort found increased MSH3 and DHFR expression are associated with disease progression. These results suggest that variation in the MSH3 exon 1 repeat region influences somatic expansion and disease phenotype in Huntington's disease and myotonic dystrophy type 1, and suggests a common DNA repair mechanism operates in both repeat expansion diseases.

Also flagged:vortioxetinecitaloprammajor depressive disorderserotonin-5-HT receptors
Journal Article 2019-06-19 ✓ 3 Snippets Yang KC, Stepanov V, Amini N, Martinsson S, Takano A, Bundgaard C, Bang-Andersen B, Sanchez C, Halldin C, Farde L, Finnema SJ.
In-Text Gene Mentions

Initially, the 5-HT transporter (5-HTT) binding of vortioxetine was determined by [<sup>11</sup>C]MADAM PET measurements before and after administration of vortioxetine (0.1-3.0 mg/kg) and data were used to confirm clinically relevant dosing in subsequent PET measurements with [<sup>11</sup>C]AZ10419369.

…the 5-HT transporter (5-HTT) binding of vortioxetine…

5-HTT

Show Full Abstract

Vortioxetine is a multimodal antidepressant approved for treatment of major depressive disorder. Preclinical studies have demonstrated that the mechanism of action of vortioxetine might be different from selective serotonin reuptake inhibitors (SSRIs), including larger serotonin (5-HT) release and direct modulation of several 5-HT receptors. In the current positron emission tomography (PET) study, we evaluated the mechanism of action of vortioxetine by comparing its effect to the SSRI citalopram on the binding of [<sup>11</sup>C]AZ10419369 to the 5-HT<sub>1B</sub> receptor in the nonhuman primate brain. Initially, the 5-HT transporter (5-HTT) binding of vortioxetine was determined by [<sup>11</sup>C]MADAM PET measurements before and after administration of vortioxetine (0.1-3.0 mg/kg) and data were used to confirm clinically relevant dosing in subsequent PET measurements with [<sup>11</sup>C]AZ10419369. The 5-HT<sub>1B</sub> receptor binding was significantly decreased after 0.3 mg/kg of citalopram in the dorsal raphe nucleus (5%), as well as after 0.3 mg/kg of vortioxetine in six brain regions (~25%) or 1.0 mg/kg of vortioxetine in all 12 examined regions (~48%). Moreover, there was no effect of 1.0 mg/kg of vortioxetine on the binding of [<sup>11</sup>C]Cimbi-36 to the 5-HT<sub>2A</sub> receptor, which has comparable sensitivity to 5-HT release as [<sup>11</sup>C]AZ10419369 binding. In conclusion, at clinically relevant doses, vortioxetine induced larger reductions in [<sup>11</sup>C]AZ10419369 binding than citalopram. These observations suggest that vortioxetine binds to the 5-HT<sub>1B</sub> receptor at clinically relevant doses. Future studies are warranted to evaluate the role of the 5-HT<sub>1B</sub> receptor in the therapeutic effects of vortioxetine and as a potential target for the development of novel antidepressant drugs.

Also flagged:NGLY1degradationdevelopmental delaytransaminaseshyperkinetic movement disordersorganization
Journal Article 2019-06-19 ✓ 2 Snippets Cahan EM, Frick SL.
In-Text Gene Mentions

The result may be unregulated cellular necrosis (rather than regulated cellular apoptosis or autophagy): a pathophysiology proposed to resemble other proteinopathies, such as Alzheimer’s disease (due to Tau accumulation) and Huntington’s disease (due to Htt protein accumulation) in animal models [8, 14].

…disease (due toHttprotein accumulation) in…

Show Full Abstract

<h4>Background</h4>NGLY1 deficiency is a rare autosomal recessive disorder caused by loss in enzymatic function of NGLY1, a peptide N-glycanase that has been shown to play a role in endoplasmic reticulum associated degradation (ERAD). ERAD dysfunction has been implicated in other well-described proteinopathies, such as Alzheimer's disease, Parkinson's disease, and Huntington's disease. The classical clinical tetrad includes developmental delay, hypolacrima, transiently elevated transaminases, and hyperkinetic movement disorders. The musculoskeletal system is also commonly affected, but the orthopaedic phenotype has been incompletely characterized. Best practices for orthopaedic clinical care have not been elucidated and considerable variability has resulted from this lack of evidence base. Our study surveyed patients enrolled in an international registry for NGLY1 deficiency in order to characterize the orthopaedic manifestations, sequelae, and management.<h4>Results</h4>Our findings, encompassing the largest cohort for NGLY1 deficiency to date, detail levels of motor milestone achievement; physical exam findings; fracture rates/distribution; frequency of motor skill regression; non-pharmacologic and non-procedural interventions; pharmacologic therapies; and procedural interventions experienced by 29 participants. Regarding the orthopaedic phenotype, at time of survey response, we found that over 40% of patients experienced motor skill regression from their peak. Over 80% of patients had at least one orthopaedic diagnosis, and nearly two-thirds of the total had two or more. More than half of patients older than 6 years had sustained a fracture. Related to orthopaedic non-medical management, we found that 93 and 79% of patients had utilized physical therapy and non-operative orthoses, respectively. In turn, the vast majority took at least one medication (including for bone health and antispasmodic therapy). Finally, nearly half of patients had undergone an invasive procedure. Of those older than 6 years, two-thirds had one or more procedures. Stratification of these analyses by sex revealed distinctive differences in disease natural history and clinical management course.<h4>Conclusions</h4>These findings describing the orthopaedic natural history and standard of care in patients with NGLY1 deficiency can facilitate diagnosis, inform prognosis, and guide treatment recommendations in an evidence-based manner. Furthermore, the methodology is notable for its partnership with a disease-specific advocacy organization and may be generalizable to other rare disease populations. This study fills a void in the existing literature for this population and this methodology offers a precedent upon which future studies for rare diseases can build.

Also flagged:Gastric AdenocarcinomaKRASepithelial-to-mesenchymal transitionE-cadherinvimentinEMT
Journal Article 2019-06-19 No Snippets Yoon C, Till J, Cho SJ, Chang KK, Lin JX, Huang CM, Ryeom S, Yoon SS.
Show Full Abstract

Our previous work showed that in a mouse model of gastric adenocarcinoma with loss of <i>p53</i> and <i>Cdh1</i> that adding oncogenic <i>Kras</i> (a.k.a. Tcon mice) accelerates tumorigenesis and metastasis. Here, we sought to examine KRAS activation in epithelial-to-mesenchymal transition (EMT) and generation of cancer stem-like cells (CSC). Transduction of nontransformed HFE-145 gastric epithelial cells with oncogenic <i>KRAS<sup>G12V</sup></i> significantly decreased expression of the epithelial marker E-cadherin, increased expression of the mesenchymal marker vimentin and the EMT transcription factor Slug, and increased migration and invasion by 15- to 17-fold. <i>KRAS<sup>G12V</sup></i> also increased expression of self-renewal proteins such as Sox2 and increased spheroid formation by 2.6-fold. In tumor-derived organoids from Tcon mice, <i>Kras</i> knockdown decreased spheroid formation, expression of EMT-related proteins, migration, and invasion; similar effects, as well as reversal of chemoresistance, were observed following <i>KRAS</i> knockdown or MEK inhibition in patient tumor-derived gastric adenocarcinoma cell lines (AGS and KATOIII). KRAS inhibition in gastric adenocarcinoma spheroid cells led to reduced AGS flank xenograft growth, loss of the infiltrative tumor border, fewer lung metastases, and increased survival. In a tissue microarray of human gastric adenocarcinomas from 115 patients, high tumor levels of CD44 (a marker of CSCs) and KRAS activation were independent predictors of worse overall survival. In conclusion, KRAS activation in gastric adenocarcinoma cells stimulates EMT and transition to CSCs, thus promoting metastasis. IMPLICATIONS: This study provides rationale for examining inhibitors of KRAS to block metastasis and reverse chemotherapy resistance in gastric adenocarcinoma patients.

Also flagged:16S rRNAV3-V416SnomaMAFACG
Journal Article 2019-06-19 ✓ 3 Snippets Crespo-Piazuelo D, Migura-Garcia L, Estellé J, Criado-Mesas L, Revilla M, Castelló A, Muñoz M, García-Casco JM, Fernández AI, Ballester M, Folch JM.
In-Text Gene Mentions

…gene (protocadherin 17,PCDH17) was proposed.…

…an intron ofPCDH17(Supplementary Table S4…

PCDH17may play a…

Show Full Abstract

The gut microbiota has been evolving with its host along the time creating a symbiotic relationship. In this study, we assess the role of the host genome in the modulation of the microbiota composition in pigs. Gut microbiota compositions were estimated through sequencing the V3-V4 region of the 16S rRNA gene from rectal contents of 285 pigs. A total of 1,261 operational taxonomic units were obtained and grouped in 18 phyla and 101 genera. Firmicutes (45.36%) and Bacteroidetes (37.47%) were the two major phyla obtained, whereas at genus level Prevotella (7.03%) and Treponema (6.29%) were the most abundant. Pigs were also genotyped with a high-throughput method for 45,508 single nucleotide polymorphisms that covered the entire pig genome. Subsequently, genome-wide association studies were made among the genotypes of these pigs and their gut microbiota composition. A total of 52 single-nucleotide polymorphisms distributed in 17 regions along the pig genome were associated with the relative abundance of six genera; Akkermansia, CF231, Phascolarctobacterium, Prevotella, SMB53, and Streptococcus. Our results suggest 39 candidate genes that may be modulating the microbiota composition and manifest the association between host genome and gut microbiota in pigs.

Also flagged:tumorstumorcancerGene expressionPD1peptides
Journal Article 2019-06-19 No Snippets D'Alise AM, Leoni G, Cotugno G, Troise F, Langone F, Fichera I, De Lucia M, Avalle L, Vitale R, Leuzzi A, Bignone V, Di Matteo E, Tucci FG, Poli V, Lahm A, Catanese MT, Folgori A, Colloca S, Nicosia A, Scarselli E.
Show Full Abstract

Neoantigens (nAgs) are promising tumor antigens for cancer vaccination with the potential of inducing robust and selective T cell responses. Genetic vaccines based on Adenoviruses derived from non-human Great Apes (GAd) elicit strong and effective T cell-mediated immunity in humans. Here, we investigate for the first time the potency and efficacy of a novel GAd encoding multiple neoantigens. Prophylactic or early therapeutic vaccination with GAd efficiently control tumor growth in mice. In contrast, combination of the vaccine with checkpoint inhibitors is required to eradicate large tumors. Gene expression profile of tumors in regression shows abundance of activated tumor infiltrating T cells with a more diversified TCR repertoire in animals treated with GAd and anti-PD1 compared to anti-PD1. Data suggest that effectiveness of vaccination in the presence of high tumor burden correlates with the breadth of nAgs-specific T cells and requires concomitant reversal of tumor suppression by checkpoint blockade.

Also flagged:protein 3ribonucleoproteinCBSinterleukin 20 receptor subunit betaUL16inducible T cell costimulator
Journal Article 2019-06-19 No Snippets Gendoo DMA, Zon M, Sandhu V, Manem VSK, Ratanasirigulchai N, Chen GM, Waldron L, Haibe-Kains B.
Show Full Abstract

A wealth of transcriptomic and clinical data on solid tumours are under-utilized due to unharmonized data storage and format. We have developed the MetaGxData package compendium, which includes manually-curated and standardized clinical, pathological, survival, and treatment metadata across breast, ovarian, and pancreatic cancer data. MetaGxData is the largest compendium of curated transcriptomic data for these cancer types to date, spanning 86 datasets and encompassing 15,249 samples. Open access to standardized metadata across cancer types promotes use of their transcriptomic and clinical data in a variety of cross-tumour analyses, including identification of common biomarkers, and assessing the validity of prognostic signatures. Here, we demonstrate that MetaGxData is a flexible framework that facilitates meta-analyses by using it to identify common prognostic genes in ovarian and breast cancer. Furthermore, we use the data compendium to create the first gene signature that is prognostic in a meta-analysis across 3 cancer types. These findings demonstrate the potential of MetaGxData to serve as an important resource in oncology research, and provide a foundation for future development of cancer-specific compendia.

Also flagged:estrogen receptor-alphaaromataselocalized diseaseFulvestrantERsteroid
Journal Article 2019-06-19 No Snippets Márquez-Garbán DC, Deng G, Comin-Anduix B, Garcia AJ, Xing Y, Chen HW, Cheung-Lau G, Hamilton N, Jung ME, Pietras RJ.
Show Full Abstract

Breast cancers (BCs) with expression of estrogen receptor-alpha (ERα) occur in more than 70% of newly-diagnosed patients in the U.S. Endocrine therapy with antiestrogens or aromatase inhibitors is an important intervention for BCs that express ERα, and it remains one of the most effective targeted treatment strategies. However, a substantial proportion of patients with localized disease, and essentially all patients with metastatic BC, become resistant to current endocrine therapies. ERα is present in most resistant BCs, and in many of these its activity continues to regulate BC growth. Fulvestrant represents one class of ERα antagonists termed selective ER downregulators (SERDs). Treatment with fulvestrant causes ERα down-regulation, an event that helps overcome several resistance mechanisms. Unfortunately, full antitumor efficacy of fulvestrant is limited by its poor bioavailability in clinic. We have designed and tested a new generation of steroid-like SERDs. Using ERα-positive BC cells in vitro, we find that these compounds suppress ERα protein levels with efficacy similar to fulvestrant. Moreover, these new SERDs markedly inhibit ERα-positive BC cell transcription and proliferation in vitro even in the presence of estradiol-17β. In vivo, the SERD termed JD128 significantly inhibited tumor growth in MCF-7 xenograft models in a dose-dependent manner (P < 0.001). Further, our findings indicate that these SERDs also interact with ER-positive immune cells in the tumor microenvironment such as myeloid-derived suppressor cells (MDSC), tumor infiltrating lymphocytes and other selected immune cell subpopulations. SERD-induced inhibition of MDSCs and concurrent actions on CD8+ and CD4 + T-cells promotes interaction of immune checkpoint inhibitors with BC cells in preclinical models, thereby leading to enhanced tumor killing even among highly aggressive BCs such as triple-negative BC that lack ERα expression. Since monotherapy with immune checkpoint inhibitors has not been effective for most BCs, combination therapies with SERDs that enhance immune recognition may increase immunotherapy responses in BC and improve patient survival. Hence, ERα antagonists that also promote ER downregulation may potentially benefit patients who are unresponsive to current endocrine therapies.

Also flagged:extrahepatic diseasesironhereditary haemochromatosiscentral obesityhigh blood pressurecirrhosis
Journal Article 2019-06-19 ✓ 5 Snippets Wilman HR, Parisinos CA, Atabaki-Pasdar N, Kelly M, Thomas EL, Neubauer S, IMI DIRECT Consortium, Mahajan A, Hingorani AD, Patel RS, Hemingway H, Franks PW, Bell JD, Banerjee R, Yaghootkar H.
In-Text Gene Mentions

HFE C282Y was associated with higher liver fibrosis/cirrhosis, higher risk of type 2 diabetes, hypertension, alcohol-related liver disease, arthrosis, chronic and degenerative neurological conditions including multiple sclerosis, arthritis and higher height but lower total cholesterol, lower low-density lipoprotein cholesterol (LDL-C) and lower BMI (FDR <5%, Fig. 5, Table S2).

Our PheWAS indicates HFE C282Y is associated with arthrosis, coxarthrosis, osteoarthritis, and gout, and HFE H63D is associated with ankylosing spondylitis and has a suggestive association with dorsalgia.

We further validated the known association between HFE C282Y and type 2 diabetes which could be, at least partly, due to iron accumulation in the pancreas.

A recent study found an association between HFE C282Y and a higher risk of breast cancer, colorectal cancer, hepatocellular carcinoma, and total cancer.44

The association between HFE C282Y and neurological conditions such as multiple sclerosis and epilepsy is consistent with the role of iron in many important processes in the central nervous system, including oxygen transportation, oxidative phosphorylation, myelin production, and the synthesis and metabolism of neurotransmitters.

Show Full Abstract

<h4>Background & aims</h4>Excess liver iron content is common and is linked to the risk of hepatic and extrahepatic diseases. We aimed to identify genetic variants influencing liver iron content and use genetics to understand its link to other traits and diseases.<h4>Methods</h4>First, we performed a genome-wide association study (GWAS) in 8,289 individuals from UK Biobank, whose liver iron level had been quantified by magnetic resonance imaging, before validating our findings in an independent cohort (n = 1,513 from IMI DIRECT). Second, we used Mendelian randomisation to test the causal effects of 25 predominantly metabolic traits on liver iron content. Third, we tested phenome-wide associations between liver iron variants and 770 traits and disease outcomes.<h4>Results</h4>We identified 3 independent genetic variants (rs1800562 [C282Y] and rs1799945 [H63D] in HFE and rs855791 [V736A] in TMPRSS6) associated with liver iron content that reached the GWAS significance threshold (p <5 × 10<sup>-8</sup>). The 2 HFE variants account for ∼85% of all cases of hereditary haemochromatosis. Mendelian randomisation analysis provided evidence that higher central obesity plays a causal role in increased liver iron content. Phenome-wide association analysis demonstrated shared aetiopathogenic mechanisms for elevated liver iron, high blood pressure, cirrhosis, malignancies, neuropsychiatric and rheumatological conditions, while also highlighting inverse associations with anaemias, lipidaemias and ischaemic heart disease.<h4>Conclusion</h4>Our study provides genetic evidence that mechanisms underlying higher liver iron content are likely systemic rather than organ specific, that higher central obesity is causally associated with higher liver iron, and that liver iron shares common aetiology with multiple metabolic and non-metabolic diseases.<h4>Lay summary</h4>Excess liver iron content is common and is associated with liver diseases and metabolic diseases including diabetes, high blood pressure, and heart disease. We identified 3 genetic variants that are linked to an increased risk of developing higher liver iron content. We show that the same genetic variants are linked to higher risk of many diseases, but they may also be associated with some health advantages. Finally, we use genetic variants associated with waist-to-hip ratio as a tool to show that central obesity is causally associated with increased liver iron content.

Also flagged:cancerNOD-like receptorAIM2-like receptorscaspase-1bindingIL-1β
Journal Article 2019-06-19 No Snippets Lee C, Do HTT, Her J, Kim Y, Seo D, Rhee I.
Show Full Abstract

Inflammasomes are the major mechanistic complexes that include members of the NOD-like receptor (NLRs) or AIM2-like receptors (ALRs) families, which are affiliated with the innate immune system. Once NLRs or ALRs are activated by pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs), the caspase-1 or -11 is activated by binding with NLRs or ALRs via its own unique cytosolic domains. As a result, caspase-1 or -11 enhances the production of IL-1β and IL-18, which results in inflammation via the recruitment of immune cells, such as macrophages, and the promotion of programmed cell death mechanisms such as pyroptosis. In addition, the consistent cascades of inflammasomes would precede both minor and severe autoimmune diseases and cancers. The clinical relevance of inflammasomes in multiple forms of cancer highlights their therapeutic promise as molecular targets. To closely analyze the physiological roles of inflammasomes in cancers, here, we describe the fundamental knowledge regarding the current issues of inflammasomes in relevant cancers, and discuss possible therapeutic values in targeting these inflammasomes for the prevention and treatment of cancer.

Also flagged:MethylationType 2 Diabeteschronic diseasesobesitygene expressionmetabolic disease
Journal Article 2019-06-19 No Snippets Parrillo L, Spinelli R, Nicolò A, Longo M, Mirra P, Raciti GA, Miele C, Beguinot F.
Show Full Abstract

A healthy diet improves life expectancy and helps to prevent common chronic diseases such as type 2 diabetes (T2D) and obesity. The mechanisms driving these effects are not fully understood, but are likely to involve epigenetics. Epigenetic mechanisms control gene expression, maintaining the DNA sequence, and therefore the full genomic information inherited from our parents, unchanged. An interesting feature of epigenetic changes lies in their dynamic nature and reversibility. Accordingly, they are susceptible to correction through targeted interventions. Here we will review the evidence supporting a role for nutritional factors in mediating metabolic disease risk through DNA methylation changes. Special emphasis will be placed on the potential of using DNA methylation traits as biomarkers to predict risk of obesity and T2D as well as on their response to dietary and pharmacological (epi-drug) interventions.

Also flagged:ObesityamylaseAMY1digestionstarchchildhood obesity
Journal Article 2019-06-19 ✓ 3 Snippets Venkatapoorna CMK, Ayine P, Parra EP, Koenigs T, Phillips M, Babu JR, Sandey M, Geetha T.
In-Text Gene Mentions

Previous studies have identified variation in the copy number of the candidate regions near the neuronal growth regulator 1 (NEGR1) locus [15], chromosome 10q11.22 [16], 11q11 [17], and 10q26.3 [18] with obesity.

…regions near theneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1) locus [ 15…

Show Full Abstract

Salivary amylase (AMY1) is the most abundant enzyme in human saliva, responsible for the hydrolysis of α-1,4 glycosidic linkages that aids in the digestion of starch. Recently studies have shown that the copy number of AMY1 is associated with obesity; however, the data varies with location. One-third of children are overweight/obese in Alabama. In this study, we aim to determine the relationship between the copy number of <i>AMY1</i> gene and obesity measurements in children from Alabama. One hundred twenty-seven children aged between 6 to 10 years participated in this study. Anthropometric measurements were measured using WHO recommendations. Genomic DNA was extracted from saliva, and the copy number of the <i>AMY1</i> gene was estimated by digital PCR. The association between <i>AMY1</i> copy number and obesity measurements was analyzed by linear regression. The mean <i>AMY1</i> copy number significantly decreased in overweight/obese (6.21 ± 1.48) compared to normal weight (7.97 ± 2.35) children. <i>AMY1</i> copy number inversely associated with the obesity measurements. African Americans had a stronger association between low <i>AMY1</i> copy number and obesity compared to white/European Americans. Our findings suggest that overweight/obese children have a low <i>AMY1</i> copy number and the effect is more prominent in African Americans.

Also flagged:fertilizationasthenozoospermiaspermmetabolismmale infertilityMotility
Journal Article 2019-06-19 ✓ 1 Snippet Moscatelli N, Lunetti P, Braccia C, Armirotti A, Pisanello F, De Vittorio M, Zara V, Ferramosca A.
In-Text Gene Mentions

…cific acyl-CoA dehydrogenase),ECI2(enoyl-CoA delta isomerase…

Show Full Abstract

Sperm motility is the most important parameter involved in the fertilization process and it is strictly required for reproductive success. Although sperm movements are essential for the physiologic fertilization process, the data, deriving from studies focused on the research of altered cell pathways involved in asthenozoospermia, offer only limited information about the molecular mechanism underlying sperm motility. The aim of this study was to identify proteins involved in human sperm motility deficiency by using label-free mass-spectrometry liquid chromatography (LC-MS/MS). For this purpose, we selected sperm samples with three different classes of progressive motility: low, medium (asthenozoospermic samples) and high (normozoospermic samples). We found that several differential expressed proteins in asthenozoospermic samples were related to energetic metabolism, suggesting an interesting link between bioenergetics pathways and the regulation of sperm motility, necessary for the flagellum movement. Therefore, our results provide strong evidence that mass spectrometry-based proteomics represents an integrated approach to detect novel biochemical markers of sperm motility and quality with diagnostic relevance for male infertility and unravel the molecular etiology of idiopathic cases.

Also flagged:transcriptional repressorpolyglutamine (Poly Q) diseasesspinocerebellar ataxiaPolyglutamine DiseasesHDPoly Q) diseases
Journal Article 2019-06-19 ✓ 1 Snippet Dong X, Cong S.
In-Text Gene Mentions

Poly Q expansion of mutant HTT protein can inhibit the interaction between REST and the HTT protein, thereby promoting REST aggregation in the nucleus of HD patients and inhibiting the expression of related genes (Wu and Xie, 2006).

Show Full Abstract

MicroRNAs (miRNAs) are small non-coding molecules that regulate a large amount of post-transcriptional repressor genes by recognizing semi-complementary target sequences that are normally located in the 3' UTR of the mRNA. Altered expression of miRNA has been related to several pathological processes, including polyglutamine (Poly Q) diseases. Specific expression patterns in the circulating fluids and brain parenchyma have been speculated as potential biomarkers for Poly Q disease diagnosis and prognosis. Several miRNAs have been consistently identified in diseases including Huntington's disease (HD) and spinocerebellar ataxia (SCA). In our review, we describe the emerging role of miRNAs in Poly Q diseases and provide an overview on general miRNA biology, implications in pathophysiology, and their potential roles as future biomarkers and applications for therapy.

Also flagged:tissue homeostasisorganogenesisimmune responsesvimentinActa2TGF-β1
Journal Article 2019-06-19 ✓ 2 Snippets Kurashima Y, Tokuhara D, Kamioka M, Inagaki Y, Kiyono H.
In-Text Gene Mentions

…have been characterized:SOX6− CCL8 +…

SOX6− CCL8 +…

Show Full Abstract

The epithelial layer creates a chemical and physical barrier at the forefront of intestinal mucosa, and immune cells beneath the surface epithelium are poised to react to extrinsic factors, to maintain tissue homeostasis. Importantly, the nexus of epithelial-immune responses at mucosal surfaces is dexterously modulated by intrinsic stromal-mesenchymal cells. First, organogenesis of lymphoid tissues, including Peyer's patches, requires dynamic interplay between lymphoid cells and stromal cells, which have become known as "lymphoid organizers." Second, correct spatiotemporal interaction between these cell populations is essential to generate the infrastructure for gut immune responses. Moreover, immune cells at the intestinal barrier are functionally modulated by stromal cells; one such example is the stromal cell-mediated differentiation of innate immune cells, including innate lymphoid cells and mast cells. Ultimately, mucosal stromal cells orchestrate the destinations of epithelial and immune cells to maintain intestinal immune homeostasis.

Also flagged:NeuroglobinNgbglobinmetabolismoxygencell growth
Journal Article 2019-06-19 No Snippets Luyckx E, Van Acker ZP, Ponsaerts P, Dewilde S.
Show Full Abstract

Neuroglobin (Ngb) is an evolutionary conserved member of the globin family with a primary expression in neurons of which the exact functions remain elusive. A plethora of <i>in vivo</i> and <i>in vitro</i> model systems has been generated to this day to determine the functional biological roles of Ngb. Here, we provide a comprehensive overview and discussion of the different Ngb models, covering animal and cellular models of both overexpression and knockout strategies. Intriguingly, an in-depth literature search of available Ngb expression models revealed crucial discrepancies in the outcomes observed in different models. Not only does the level of Ngb expression-either physiologically, overexpressed, or downregulated-alter its functional properties, the experimental setup, being <i>in vitro</i> or <i>in vivo</i>, does impact the functional outcome as well and, hence, whether or not a physiological and/or therapeutic role is ascribed to Ngb. These differences could highlight either technical or biological adaptations and should be considered until elucidation of the Ngb biology.

Also flagged:waterhepatitistheaflavinsdamagepolyphenolsmetabolism
Journal Article 2019-06-19 ✓ 1 Snippet Hadjipanayis A, Efstathiou E, Papaevangelou V.
In-Text Gene Mentions

…fatty liver disease,hemochromatosis, autoimmune hepatitis, Wilson…

Show Full Abstract

Tea is the most widely consumed beverage after water in the world. The consumption of iced tea has increased in Western countries and spiked among teenagers for enjoyment, freshening up and alertness. A teenager presented with symptoms of hepatitis. Liver ultrasound revealed sludge in the gallbladder. Laboratory investigations excluded all known causes of hepatotoxicity. Detail nutritional history revealed that the patient had been drinking 1.5-2 liters of black iced tea per day for the last three months. He was immediately advised to stop drinking any tea. Gradually all symptoms disappeared and two months after discontinuation of the tea, all liver enzymes returned to normal and the sludge in the gallbladder disappeared. This case report underlines the importance of a meticulous assessment of a child's dietary behavior when investigating a case of hepatotoxicity and raises awareness about the potential side effects of tea overconsumption.

Also flagged:non-small cell lung cancerLung cancerlarge-cell lung cancerlung adenocarcinomaLUADlung squamous cell carcinoma
Journal Article 2019-06-19 No Snippets Sun R, Meng X, Wang W, Liu B, Lv X, Yuan J, Zeng L, Chen Y, Yuan B, Yang S.
Show Full Abstract

Lung cancer is one of the most common types of malignancy worldwide. The prognosis of lung cancer is poor, due to the onset of metastases. The aim of the present study was to examine lung cancer metastasis-associated genes. To identify novel metastasis-associated targets, our previous study detected the differentially expressed mRNAs and long non-coding RNAs between the large-cell lung cancer high-metastatic 95D cell line and the low-metastatic 95C cell line by microarray assay. In the present study, these differentially expressed genes (DEGs) were analyzed via bioinformatics methods, including Gene Ontology functional analysis and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analysis. A protein-protein interaction network was subsequently constructed using the Search Tool for the Retrieval of Interacting Genes/Proteins online database and Cytoscape software, and 17 hub genes were screened out on the basis of connectivity degree. These hub genes were further validated in lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) using the online Gene Expression Profiling Interactive Analysis database. A total of seven hub genes were identified to be significantly differentially expressed in LUAD and LUSC. The prognostic information was detected using Kaplan-Meier plotter. As a result, five genes were revealed to be closely associated with the overall survival time of patients with lung cancer, including phosphoinositide-3-kinase regulatory subunit 1, FYN, thrombospondin 1, nonerythrocytic α-spectrin 1 and secreted phosphoprotein 1. In addition, lung cancer and adjacent lung tissue samples were used to validate these hub genes by reverse transcription-quantitative polymerase chain reaction. In conclusion, the results of the present study may provide novel metastasis-associated therapeutic strategies or potential biomarkers in non-small cell lung cancer.

Also flagged:enzalutamidemetastatic prostate cancerPCaantiandrogenandrogen receptorAR
Journal Article 2019-06-19 ✓ 1 Snippet Blatt EB, Raj GV.
In-Text Gene Mentions

Regulators of Sox2, like POU-domain transcription factor BRN2 (POU3F2), drive the emergence of NEPC and enzalutamide resistance[84].

Show Full Abstract

An estimated 30,000 men in the United States will die of metastatic prostate cancer (PCa) each year due to the development of therapy resistance, most notably resistance to second-generation antiandrogen enzalutamide. The vast majority of PCa is driven by the androgen receptor (AR). Enzalutamide is an AR antagonist, which extends patient survival and is widely used in the clinic for the treatment of castration-resistant prostate cancer (CRPC); however, many patients will have primary or develop acquired resistance and continue to progress. Characterization of the molecular mechanisms of enzalutamide resistance provides insight into potentially efficacious therapies for enzalutamide-resistant CRPC (ER-CRPC). Understanding these mechanisms is critical for the identification of biomarkers predictive of therapy resistance and the development of therapeutic strategies to target ER-CRPC.

bioRxiv 2019-06-19 Preprint (No Snippets API) Bernatik O, Pejskova P, Vyslouzil D, Hanakova K, Zdrahal Z, Cajanek L.
Show Full Abstract

Primary cilia (PC) are organelles necessary for proper implementation of developmental and homeostasis processes. To initiate their assembly, coordinated actions of multiple proteins are needed. Tau tubulin kinase 2 (TTBK2) is a key player in the cilium assembly pathway, controlling final step of cilia initiation. The function of TTBK2 in ciliogenesisis is critically dependent on its kinase activity, however, precise mechanism of TTBK2 action is so far incompletely understood, due to very limited information about its relevant substrates. In this study we identify CEP83, CEP89, CCDC92, Rabin8 and DVL3 as substrates of TTBK2 kinase activity. Further, we characterise a set of phosphosites of the newly identified substrates and CEP164, induced by TTBK2 in vitro and in vivo . Intriguingly, we further show that identified TTBK2 phosphosites and consensus sequence delineated from those are distinct from motifs previously assigned to TTBK2. Finally, we address functional relevance of selected phosphorylations of CEP164 and provide evidence that the examined TTBK2-induced phosphorylations of CEP164 are relevant for the process of cilia formation. In summary, our work provides important insight into substrates-TTBK2 kinase relationship and suggests that phosphorylation of substrates on multiple sites by TTBK2 is probably involved in the control of ciliogenesis in human cells.

Also flagged:NAFLDaminotransferasesSCD1stearoyl-coenzyme-A-desaturase-1nonalcoholic-fatty-liver-diseaseNonalcoholic fatty liver disease
Journal Article 2019-06-18 ✓ 1 Snippet Ajmera VH, Cachay E, Ramers C, Vodkin I, Bassirian S, Singh S, Mangla N, Bettencourt R, Aldous JL, Park D, Lee D, Blanchard J, Mamidipalli A, Boehringer A, Aslam S, Leinhard OD, Richards L, Sirlin C, Loomba R.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Aramchol, an oral stearoyl-coenzyme-A-desaturase-1 inhibitor, has been shown to reduce hepatic fat content in patients with primary nonalcoholic fatty liver disease (NAFLD); however, its effect in patients with human immunodeficiency virus (HIV)-associated NAFLD is unknown. The aramchol for HIV-associated NAFLD and lipodystrophy (ARRIVE) trial was a double-blind, randomized, investigator-initiated, placebo-controlled trial to test the efficacy of 12 weeks of treatment with aramchol versus placebo in HIV-associated NAFLD. Fifty patients with HIV-associated NAFLD, defined by magnetic resonance imaging (MRI)-proton density fat fraction (PDFF) ≥5%, were randomized to receive either aramchol 600 mg daily (n = 25) or placebo (n = 25) for 12 weeks. The primary endpoint was a change in hepatic fat as measured by MRI-PDFF in colocalized regions of interest. Secondary endpoints included changes in liver stiffness using magnetic resonance elastography (MRE) and vibration-controlled transient elastography (VCTE), and exploratory endpoints included changes in total-body fat and muscle depots on dual-energy X-ray absorptiometry (DXA), whole-body MRI, and cardiac MRI. The mean (± standard deviation) of age and body mass index were 48.2 ± 10.3 years and 30.7 ± 4.6 kg/m<sup>2</sup> , respectively. There was no difference in the reduction in mean MRI-PDFF between the aramchol group at -1.3% (baseline MRI-PDFF 15.6% versus end-of-treatment MRI-PDFF 14.4%, P = 0.24) and the placebo group at -1.4% (baseline MRI-PDFF 13.3% versus end-of-treatment MRI-PDFF 11.9%, P = 0.26). There was no difference in the relative decline in mean MRI-PDFF between the aramchol and placebo groups (6.8% versus 1.1%, P = 0.68). There were no differences in MRE-derived and VCTE-derived liver stiffness and whole-body (fat and muscle) composition analysis by MRI or DXA. Compared to baseline, end-of-treatment aminotransferases were lower in the aramchol group but not in the placebo arm. There were no significant adverse events. Conclusion: Aramchol, over a 12-week period, did not reduce hepatic fat or change body fat and muscle composition by using MRI-based assessment in patients with HIV-associated NAFLD (clinicaltrials.gov ID:NCT02684591).

Also flagged:Acute Respiratory Distress SyndromeARDScritical illnessoxygeninnate immunityCritical
Journal Article 2019-06-18 ✓ 2 Snippets Lynn H, Sun X, Casanova N, Gonzales-Garay M, Bime C, Bime C, Garcia JGN.
In-Text Gene Mentions

PRDX6

OLFM4

Show Full Abstract

<b><i>Significance:</i></b> Acute respiratory distress syndrome (ARDS) is a severe, highly heterogeneous critical illness with staggering mortality that is influenced by environmental factors, such as mechanical ventilation, and genetic factors. Significant unmet needs in ARDS are addressing the paucity of validated predictive biomarkers for ARDS risk and susceptibility that hamper the conduct of successful clinical trials in ARDS and the complete absence of novel disease-modifying therapeutic strategies. <b><i>Recent Advances:</i></b> The current ARDS definition relies on clinical characteristics that fail to capture the diversity of disease pathology, severity, and mortality risk. We undertook a comprehensive survey of the available ARDS literature to identify genes and genetic variants (candidate gene and limited genome-wide association study approaches) implicated in susceptibility to developing ARDS in hopes of uncovering novel biomarkers for ARDS risk and mortality and potentially novel therapeutic targets in ARDS. We further attempted to address the well-known health disparities that exist in susceptibility to and mortality from ARDS. <b><i>Critical Issues:</i></b> Bioinformatic analyses identified 201 ARDS candidate genes with pathway analysis indicating a strong predominance in key evolutionarily conserved inflammatory pathways, including reactive oxygen species, innate immunity-related inflammation, and endothelial vascular signaling pathways. <b><i>Future Directions:</i></b> Future studies employing a system biology approach that combines clinical characteristics, genomics, transcriptomics, and proteomics may allow for a better definition of biologically relevant pathways and genotype-phenotype connections and result in improved strategies for the sub-phenotyping of diverse ARDS patients <i>via</i> molecular signatures. These efforts should facilitate the potential for successful clinical trials in ARDS and yield a better fundamental understanding of ARDS pathobiology.

Also flagged:Hydroxyapatitepolylactic acidcollagenhyaluronic acidpoly caprolactonepolyglycolic acid
Journal Article 2019-06-18 No Snippets Kaya İ, Şahin MC, Cingöz İD, Aydın N, Atar M, Kızmazoğlu C, Kavuncu S, Aydın HE.
Show Full Abstract

<h4>Background/aim</h4>Application fields of bone tissue engineering studies continue to expand. New biocompatible materials aimed to improve bone repairment and regeneration of implants are being discovered everyday by scientists, engineers, and surgeons. Our objective in this study is to combine polylactic acid which is a polymer with hydroxyapatite in the repairment of bone defects considering the increased need by medical application fields.<h4>Materials and methods</h4>After 750 g of PLA with a diameter of 2.85 mm was granulated into minimum particles, these particles were homogenously mixed with hydroxyapatite prepared in laboratory environment. Using this mixture, HA-PLA filament with a diameter of 2.85 mm was prepared in the extrusion device in Kütahya Medical Sciences University Innovative Technology Laboratory. The temperature was 250 °C and the gearmotor speed was 9 rpm during extrusion. X-ray diffraction (XRD) analysis was made for crystal phase analyses of the produced hydroxyapatite powder, to determine the produced main phase and examine whether a minor phase occurred. Vickers microhardness test was applied on both samples to measure the endurance levels of the samples prepared with HA-PLA filament. A loading force of 10 kg was applied on the samples for 10 s.<h4>Results</h4>Hydroxyapatite peaks in XRD spectrum of the sample presented in figures are concordant with Joint Committee on Powder Diffraction Standards, JCPDS - File Card No. 01-075-9526 and no significant minor phase was observed. For both samples, hardness value was observed to increase between 3 and 5 mm.<h4>Conclusion</h4>Surfacing hydroxyapatite on metallic materials is possible. By similar logic, to increase durability with low cost, characteristics of biomaterials can be improved with combinations such as hydroxyapatite PLA. Thus, we found that while these materials have usage limitations due to present disadvantages when used alone, it is possible to increase their efficiency and availability through different combinations.

Also flagged:MalariapathogenesiserythropoiesisCas9Duffy AntigenReceptor for Chemokines
Journal Article 2019-06-18 ✓ 1 Snippet Scully EJ, Shabani E, Rangel GW, Grüring C, Kanjee U, Clark MA, Chaand M, Kurita R, Nakamura Y, Ferreira MU, Duraisingh MT.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Malaria pathogenesis is caused by the replication of Plasmodium parasites within the red blood cells (RBCs) of the vertebrate host. This selective pressure has favored the evolution of protective polymorphisms in erythrocyte proteins, a subset of which serve as cognate receptors for parasite invasion ligands. Recently, the generation of RBCs from immortalized hematopoietic stem cells (HSCs) has offered a more tractable system for genetic manipulation and long-term in vitro culture, enabling elucidation of the functional determinants of host susceptibility in vitro. Here we report the generation of an immortalized erythroid progenitor cell line (EJ cells) from as few as 100 000 peripheral blood mononuclear cells. It offers a robust method for the creation of customized model systems from small volumes of peripheral blood. The EJ cell differentiation mirrored erythropoiesis of primary HSCs, yielding orthochromatic erythroblasts and enucleated RBCs after eight days (ejRBCs). The ejRBCs supported invasion by both P. vivax and P. falciparum. To demonstrate the genetic tractability of this system, we used CRISPR/Cas9 to disrupt the Duffy Antigen/Receptor for Chemokines (DARC) gene, which encodes the canonical receptor of P. vivax in humans. Invasion of P. vivax into this DARC-knockout cell line was strongly inhibited providing direct genetic evidence that P. vivax requires DARC for RBC invasion. Further, genetic complementation of DARC restored P. vivax invasion. Taken together, the peripheral blood immortalization method presented here offers the capacity to generate biologically representative model systems for studies of blood-stage malaria invasion from the peripheral blood of donors harboring unique genetic backgrounds, or rare polymorphisms.

Also flagged:Autophagydegradationorganelleautoimmune diseasesneurodegenerative disorderscancer
Journal Article 2019-06-18 No Snippets Ceccariglia S, Cargnoni A, Silini AR, Parolini O.
Show Full Abstract

Macroautophagy/autophagy occurs at basal levels in all eukaryotic cells and plays an important role in maintaining bio-energetic homeostasis through the control of molecule degradation and organelle turnover. It can be induced by environmental conditions such as starvation, and is deregulated in many diseases including autoimmune diseases, neurodegenerative disorders, and cancer. Interestingly, the modulation of autophagy in mesenchymal stem cells (MSCs) represents a possible mechanism which, affecting MSC properties, may have an impact on their regenerative, therapeutic potential. Furthermore, the ability of MSCs to modulate autophagy of cells in injured tissues/organs has been recently proposed to be involved in the regeneration of damaged tissues and organs. In particular, MSCs can affect autophagy in immune cells involved in injury-induced inflammation reducing their survival, proliferation, and function and favoring the resolution of inflammation. In addition, MSCs can affect autophagy in endogenous adult or progenitor cells, promoting their survival, proliferation and differentiation supporting the restoration of functional tissue. This review provides, for the first time, an overview of the studies which highlight a possible link between the therapeutic properties of MSCs and their ability to modulate autophagy, and it summarizes examples of disorders where these therapeutic properties have been correlated with such modulation. A better elucidation of the mechanism(s) through which MSCs can modulate the autophagy of target cells and how autophagy can affect MSCs therapeutic properties, can provide a wider perspective for the clinical application of MSCs in the treatment of many diseases.<b>Abbreviations</b>: 3-MA: 3-methyladenine; AD: Alzheimer disease; ATG: autophagy-related; BECN1: beclin 1; BM: bone marrow; CD: cluster of differentiation; EAE: experimental autoimmune encephalomyelitis; IL: interleukin; INF: interferon; LAP: LC3-associated phagocytosis; MAP1LC3/LC3: microtubule associated protein 1 light chain 3; MSCs: mesenchymal stem cells; MTOR: mechanistic target of rapamycin kinase; PD: Parkinson disease; PtdIns3K: class III phosphatidylinositol 3-kinase; ROS: reactive oxygen species; SLE: systemic lupus erythematosus; SQSTM1: sequestosome 1; TBI: traumatic brain injury; TGF: transforming growth factor; TNF: tumor necrosis factor.

Also flagged:NKG2CIFNGIL-15LAG-3PD-1checkpoint inhibitory receptors
Journal Article 2019-06-18 ✓ 1 Snippet Merino A, Zhang B, Dougherty P, Luo X, Wang J, Blazar BR, Miller JS, Cichocki F.
In-Text Gene Mentions

RABGAP1L

Show Full Abstract

A population of Natural Killer (NK) cells expressing the activating receptor NKG2C and the maturation marker CD57 expands in response to human cytomegalovirus (HCMV) infection. CD3-CD56dimCD57+NKG2C+ NK cells are similar to CD8+ memory T cells with rapid and robust effector function upon re-stimulation, persistence, and epigenetic remodeling of the IFNG locus. Chronic antigen stimulation drives CD8+ memory T cell proliferation while also inducing genome-wide epigenetic reprograming and dysfunction. We hypothesized that chronic stimulation could similarly induce epigenetic reprograming and dysfunction in NK cells. Here we show that chronic stimulation of adaptive NK cells through NKG2C using plate-bound agonistic antibodies in combination with IL-15 drove robust proliferation and activation of CD3-CD56dimCD57+NKG2C+ NK cells while simultaneously inducing high expression of the checkpoint inhibitory receptors LAG-3 and PD-1. Marked induction of checkpoint inhibitory receptors was also observed on the surface of adaptive NK cells co-cultured with HCMV-infected endothelial cells. Chronically stimulated adaptive NK cells were dysfunctional when challenged with tumor targets. These cells exhibited a pattern of epigenetic reprograming, with genome-wide alterations in DNA methylation. Our study has important implications for cancer immunotherapy and suggest that exhausted NK cells could be targeted with inhibitory checkpoint receptor blockade.

Also flagged:heparinbindingAcute pancreatitisinflammation of thegallstonesalcohol
Journal Article 2019-06-18 ✓ 2 Snippets Nunes QM, Su D, Brownridge PJ, Simpson DM, Sun C, Li Y, Bui TP, Zhang X, Huang W, Rigden DJ, Beynon RJ, Sutton R, Fernig DG.
In-Text Gene Mentions

Others such as serpin peptidase inhibitor, clade C (antithrombin), member 1 (SERPINC1) have anti-inflammatory properties and have been shown to improve acute pancreatitis in the rat model [57] and may be explored in drug development in AP.

…(antithrombin), member 1 (SERPINC1) have anti-inflammatory prope…

Show Full Abstract

Acute pancreatitis (AP) is acute inflammation of the pancreas, mainly caused by gallstones and alcohol, driven by changes in communication between cells. Heparin-binding proteins (HBPs) play a central role in health and diseases. Therefore, we used heparin affinity proteomics to identify extracellular HBPs in pancreas and plasma of normal mice and in a caerulein mouse model of AP. Many new extracellular HBPs (360) were discovered in the pancreas, taking the total number of HBPs known to 786. Extracellular pancreas HBPs form highly interconnected protein-protein interaction networks in both normal pancreas (NP) and AP. Thus, HBPs represent an important set of extracellular proteins with significant regulatory potential in the pancreas. HBPs in NP are associated with biological functions such as molecular transport and cellular movement that underlie pancreatic homeostasis. However, in AP HBPs are associated with additional inflammatory processes such as acute phase response signalling, complement activation and mitochondrial dysfunction, which has a central role in the development of AP. Plasma HBPs in AP included known AP biomarkers such as serum amyloid A, as well as emerging targets such as histone H2A. Other HBPs such as alpha 2-HS glycoprotein (AHSG) and histidine-rich glycoprotein (HRG) need further investigation for potential applications in the management of AP. Pancreas HBPs are extracellular and so easily accessible and are potential drug targets in AP, whereas plasma HBPs represent potential biomarkers for AP. Thus, their identification paves the way to determine which HBPs may have potential applications in the management of AP.

Also flagged:SIPCacyBPautophagyBRUCEmembrane-associated inhibitor of apoptosis proteinubiquitin
Journal Article 2019-06-18 ✓ 1 Snippet Jiang TX, Zou JB, Zhu QQ, Liu CH, Wang GF, Du TT, Luo ZY, Guo F, Zhou LM, Liu JJ, Zhang W, Shu YS, Yu L, Li P, Ronai ZA, Matsuzawa SI, Goldberg AL, Qiu XB.
In-Text Gene Mentions

Htt

Show Full Abstract

BRUCE/Apollon is a membrane-associated inhibitor of apoptosis protein that is essential for viability and has ubiquitin-conjugating activity. On initiation of apoptosis, the ubiquitin ligase Nrdp1/RNF41 promotes proteasomal degradation of BRUCE. Here we demonstrate that BRUCE together with the proteasome activator PA28γ causes proteasomal degradation of LC3-I and thus inhibits autophagy. LC3-I on the phagophore membrane is conjugated to phosphatidylethanolamine to form LC3-II, which is required for the formation of autophagosomes and selective recruitment of substrates. SIP/CacyBP is a ubiquitination-related protein that is highly expressed in neurons and various tumors. Under normal conditions, SIP inhibits the ubiquitination and degradation of BRUCE, probably by blocking the binding of Nrdp1 to BRUCE. On DNA damage by topoisomerase inhibitors, Nrdp1 causes monoubiquitination of SIP and thus promotes apoptosis. However, on starvation, SIP together with Rab8 enhances the translocation of BRUCE into the recycling endosome, formation of autophagosomes, and degradation of BRUCE by optineurin-mediated autophagy. Accordingly, deletion of SIP in cultured cells reduces the autophagic degradation of damaged mitochondria and cytosolic protein aggregates. Thus, by stimulating proteasomal degradation of LC3-I, BRUCE also inhibits autophagy. Conversely, SIP promotes autophagy by blocking BRUCE-dependent degradation of LC3-I and by enhancing autophagosome formation and autophagic destruction of BRUCE. These actions of BRUCE and SIP represent mechanisms that link the regulation of autophagy and apoptosis under different conditions.

Also flagged:IronType I IFNAIDScryptococcal infectionIFN-γβ-2-microglobulin
Journal Article 2019-06-18 ✓ 3 Snippets Davis MJ, Moyer S, Hoke ES, Sionov E, Mayer-Barber KD, Barber DL, Cai H, Jenkins L, Walter PJ, Chang YC, Kwon-Chung KJ.
In-Text Gene Mentions

B2m is also a cofactor for an iron regulatory protein, called HFE (high iron Fe), resulting in abnormally elevated iron levels, hemochromatosis, in B2m-deficient mice (48, –, 50).

…regulatory protein, calledHFE( h igh…

…elevated iron levels,hemochromatosis, in B2m-deficient mice…

Show Full Abstract

<i>Cryptococcus neoformans</i> causes deadly mycosis primarily in AIDS patients, whereas <i>Cryptococcus gattii</i> infects mostly non-HIV patients, even in regions with high burdens of HIV/AIDS and an established environmental presence of <i>C. gattii</i> As HIV induces type I IFN (t1IFN), we hypothesized that t1IFN would differentially affect the outcome of <i>C. neoformans</i> and <i>C. gattii</i> infections. Exogenous t1IFN induction using stabilized poly(I·C) (pICLC) improved murine outcomes in either cryptococcal infection. In <i>C. neoformans</i><i>-</i>infected mice, pICLC activity was associated with <i>C. neoformans</i> containment and classical Th1 immunity. In contrast, pICLC activity against <i>C. gattii</i> did not require any immune factors previously associated with <i>C. neoformans</i> immunity: T, B, and NK cells, IFN-γ, and macrophages were all dispensable. Interestingly, <i>C. gattii</i> pICLC activity depended on β-2-microglobulin, which impacts iron levels among other functions. Iron supplementation reversed pICLC activity, suggesting <i>C. gattii</i> pICLC activity requires iron limitation. Also, pICLC induced a set of iron control proteins, some of which were directly inhibitory to cryptococcus <i>in vitro</i>, suggesting t1IFN regulates iron availability in the pulmonary air space fluids. Thus, exogenous induction of t1IFN significantly improves the outcome of murine infection by <i>C. gattii</i> and <i>C. neoformans</i> but by distinct mechanisms; the <i>C. gattii</i> effect was mediated by iron limitation, while the effect on <i>C. neoformans</i> infection was through induction of classical T-cell-dependent immunity. Together this difference in types of T-cell-dependent t1IFN immunity for different <i>Cryptococcus</i> species suggests a possible mechanism by which HIV infection may select against <i>C. gattii</i> but not <i>C. neoformans</i><b>IMPORTANCE</b><i>Cryptococcus neoformans</i> and <i>Cryptococcus gattii</i> cause fatal infection in immunodeficient and immunocompetent individuals. While these fungi are sibling species, <i>C. gattii</i> infects very few AIDS patients, while <i>C. neoformans</i> infection is an AIDS-defining illness, suggesting that the host response to HIV selects <i>C. neoformans</i> over <i>C. gattii</i> We used a viral mimic molecule (pICLC) to stimulate the immune response, and pICLC treatment improved mouse outcomes from both species. pICLC-induced action against <i>C. neoformans</i> was due to activation of well-defined immune pathways known to deter <i>C. neoformans</i>, whereas these immune pathways were dispensable for pICLC treatment of <i>C. gattii</i> Since these immune pathways are eventually destroyed by HIV/AIDS, our data help explain why the antiviral immune response in AIDS patients is unable to control <i>C. neoformans</i> infection but is protective against <i>C. gattii</i> Furthermore, pICLC induced tighter control of iron in the lungs of mice, which inhibited <i>C. gattii</i>, thus suggesting an entirely new mode of nutritional immunity activated by viral signals.

Also flagged:gene expressionamino acidsbindingpeptidesamino acidRNA-binding proteins
Journal Article 2019-06-18 ✓ 4 Snippets Panhale A, Richter FM, Ramírez F, Shvedunova M, Manke T, Mittler G, Akhtar A.
In-Text Gene Mentions

…MSN, EZR, RDX,PEBP1, SAP18, CSNK1D, ACADSB,…

…new RBPs, namelyPEBP1/RKIP and CSNKD1.…

PEBP1is a well-established…

…radioactive smear abovePEBP1is specific to…

Show Full Abstract

RNA-protein complexes play essential regulatory roles at nearly all levels of gene expression. Using in vivo crosslinking and RNA capture, we report a comprehensive RNA-protein interactome in a metazoan at four levels of resolution: single amino acids, domains, proteins and multisubunit complexes. We devise CAPRI, a method to map RNA-binding domains (RBDs) by simultaneous identification of RNA interacting crosslinked peptides and peptides adjacent to such crosslinked sites. CAPRI identifies more than 3000 RNA proximal peptides in Drosophila and human proteins with more than 45% of them forming new interaction interfaces. The comparison of orthologous proteins enables the identification of evolutionary conserved RBDs in globular domains and intrinsically disordered regions (IDRs). By comparing the sequences of IDRs through evolution, we classify them based on the type of motif, accumulation of tandem repeats, conservation of amino acid composition and high sequence divergence.

Also flagged:pulmonary diseaseprimary ciliary dyskinesiaBronchiectasislaterality disordersinfectionsnitric oxide
Journal Article 2019-06-18 No Snippets Olm MAK, Marson FAL, Athanazio RA, Nakagawa NK, Macchione M, Loges NT, Omran H, Rached SZ, Bertuzzo CS, Stelmach R, Saldiva PHN, Ribeiro JD, Jones MH, Mauad T.
Show Full Abstract

Primary Ciliary Dyskinesia (PCD) is underdiagnosed in Brazil. We enrolled patients from an adult service of Bronchiectasis over a two-year period in a cross-sectional study. The inclusion criteria were laterality disorders (LD), cough with recurrent infections and the exclusion of other causes of bronchiectasis. Patients underwent at least two of the following tests: nasal nitric oxide, ciliary movement and analysis of ciliary immunofluorescence, and genetic tests (31 PCD genes + CFTR gene). The clinical characterization included the PICADAR and bronchiectasis scores, pulmonary function, chronic Pseudomonas aeruginosa (cPA) colonization, exhaled breath condensate (EBC) and mucus rheology (MR). Forty-nine of the 500 patients were diagnosed with definite (42/49), probable (5/49), and clinical (2/49) PCD. Twenty-four patients (24/47) presented bi-allelic pathogenic variants in a total of 31 screened PCD genes. A PICADAR score > 5 was found in 37/49 patients, consanguinity in 27/49, LD in 28/49, and eight PCD sibling groups. FACED diagnosed 23/49 patients with moderate or severe bronchiectasis; FEV<sub>1</sub> ≤ 50% in 25/49 patients, eight patients had undergone lung transplantation, four had been lobectomized and cPA+ was determined in 20/49. The EBC and MR were altered in all patients. This adult PCD population was characterized by consanguinity, severe lung impairment, genetic variability, altered EBC and MR.

Also flagged:mitochondrionorganellenucleusmetabolismagingDNA polymerase
Journal Article 2019-06-18 ✓ 1 Snippet Li H, Slone J, Fei L, Huang T.
In-Text Gene Mentions

Transgenic overexpression of the PINK1 protein in Drosophila has also been shown to counteract the detrimental effects of mutant HTT on mitochondrial function, ATP production, and neuronal health [29], suggesting that inducing mitophagy may also represent an effective means of treating HD.

Show Full Abstract

The mitochondrion is the only organelle in the human cell, besides the nucleus, with its own DNA (mtDNA). Since the mitochondrion is critical to the energy metabolism of the eukaryotic cell, it should be unsurprising, then, that a primary driver of cellular aging and related diseases is mtDNA instability over the life of an individual. The mutation rate of mammalian mtDNA is significantly higher than the mutation rate observed for nuclear DNA, due to the poor fidelity of DNA polymerase and the ROS-saturated environment present within the mitochondrion. In this review, we will discuss the current literature showing that mitochondrial dysfunction can contribute to age-related common diseases such as cancer, diabetes, and other commonly occurring diseases. We will then turn our attention to the likely role that mtDNA mutation plays in aging and senescence. Finally, we will use this context to develop a mathematical formula for estimating for the accumulation of somatic mtDNA mutations with age. This resulting model shows that almost 90% of non-proliferating cells would be expected to have at least 100 mutations per cell by the age of 70, and almost no cells would have fewer than 10 mutations, suggesting that mtDNA mutations may contribute significantly to many adult onset diseases.

Also flagged:Deoxynivalenoltrichothecenemineralizationcalciumphosphorusmineral
Journal Article 2019-06-18 No Snippets Keçi M, Lucke A, Paulsen P, Zebeli Q, Böhm J, Metzler-Zebeli BU.
Show Full Abstract

Deoxynivalenol (DON) is one of the most abundant and important trichothecene mycotoxins produced by <i>Fusarium</i> species. In chickens, DON intake causes feed refusal, impairs performance, gut barrier function, and immunity, and raises oxidative stress. To determine the effect of DON on bone mineralization and serum calcium and phosphorus, 80 newly-hatched chickens were fed 4 diets with 0, 2.5, 5, and 10 mg DON/kg feed in this pilot study. In week 5, chickens were euthanized, femur and tibiotarsus bones were separated from the meat, and after incineration ash composition, as well as serum calcium and phosphorus, were determined using clinical biochemistry. Dietary DON reduced chicken dry matter, calcium, and phosphorus intake, and subsequently body and leg weight. DON affected bone density and composition of the tibiotarsus more drastically than of the femur. However, lower mineral intake did not solely explain our observations of the quadratically lower tibiotarsus density and ash content, as well as linearly decreased Ca content in the femur and tibiotarsus with increasing DON levels. Linearly decreasing serum phosphorus concentrations with increasing DON levels further supported impaired mineral homeostasis due to DON. In conclusion, already low dietary DON contamination of 2.5 mg/kg feed can compromise bone mineralization in chickens.

Also flagged:SCRSCPDCPocular diseasesretinovascular diseaseseye diseases
Journal Article 2019-06-18 No Snippets Alam M, Le D, Lim JI, Chan RVP, Yao X.
Show Full Abstract

Artificial intelligence (AI) classification holds promise as a novel and affordable screening tool for clinical management of ocular diseases. Rural and underserved areas, which suffer from lack of access to experienced ophthalmologists may particularly benefit from this technology. Quantitative optical coherence tomography angiography (OCTA) imaging provides excellent capability to identify subtle vascular distortions, which are useful for classifying retinovascular diseases. However, application of AI for differentiation and classification of multiple eye diseases is not yet established. In this study, we demonstrate supervised machine learning based multi-task OCTA classification. We sought 1) to differentiate normal from diseased ocular conditions, 2) to differentiate different ocular disease conditions from each other, and 3) to stage the severity of each ocular condition. Quantitative OCTA features, including blood vessel tortuosity (BVT), blood vascular caliber (BVC), vessel perimeter index (VPI), blood vessel density (BVD), foveal avascular zone (FAZ) area (FAZ-A), and FAZ contour irregularity (FAZ-CI) were fully automatically extracted from the OCTA images. A stepwise backward elimination approach was employed to identify sensitive OCTA features and optimal-feature-combinations for the multi-task classification. For proof-of-concept demonstration, diabetic retinopathy (DR) and sickle cell retinopathy (SCR) were used to validate the supervised machine leaning classifier. The presented AI classification methodology is applicable and can be readily extended to other ocular diseases, holding promise to enable a mass-screening platform for clinical deployment and telemedicine.

Also flagged:Synthesisneurodegenerative disorderPDamideaminosulfur
Journal Article 2019-06-18 No Snippets Di Stefano A, Marinelli L, Eusepi P, Ciulla M, Fulle S, Di Filippo ES, Magliulo L, Di Biase G, Cacciatore I.
Show Full Abstract

Parkinson's disease (PD) is a neurodegenerative disorder characterized by loss of dopaminergic neurons at level of <i>substantia</i><i>nigra</i><i>pars compacta</i>. To date, there is no cure for this pathology, except for some drugs able to alleviate the symptoms of PD. In this paper we report the synthesis and biological evaluation of novel sulfur- and selenyl-l-Dopa (LD) derivatives (<b>SP1</b><b>-</b><b>6</b>) obtained through the amide junction between the amino group of LD and carboxylic moiety of sulfur- and selenyl-organic compounds, which are commercially available. Biological activity was evaluated on human undifferentiated and retinoic acid/phorbol myristyl acetate (RA/PMA)-differentiated SY-SH5Y neuroblastoma cell line using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Antioxidant activity against oxidative stress was measured using nitroblue tetrazolium (NBT) and 2',7'-dichlorodihydrofluorescein diacetate (H<sub>2</sub>DCFDA) assays. Finally, physico-chemical characterization and plasma stability studies of <b>SP1</b><b>-</b><b>6</b> were also performed. Biological data revealed that <b>SP6</b> has a significant protective action against the neurotoxic action of 6-hydroxydopamine (6-OHDA) and H<sub>2</sub>O<sub>2</sub> in a RA/PMA-differentiated SY-SH5Y neuroblastoma cell line that proved to be an effective antioxidant and protective compound. <b>SP6</b>, endowed with a lipophilic nature, low molecular weight, and plasma stability, can easily cross biological membranes via passive diffusion such as through the blood-brain barrier. <b>SP6</b> has great potential for developing novel pharmacological approach for neurodegenerative diseases, such as PD. Further studies will help define its exact antioxidant mechanism and determine whether the neuroprotective action is mediated or modulated by glutathione peroxidase (GPx).

Also flagged:HnRNP-Fbladder cancerSnail1cancersactinomycin Dbinding
Journal Article 2019-06-18 ✓ 1 Snippet Li F, Zhao H, Su M, Xie W, Fang Y, Du Y, Yu Z, Hou L, Tan W.
In-Text Gene Mentions

…proteins included LTN1,DCC, AGAP2, MAD1, RAX2…

Show Full Abstract

<h4>Background</h4>Heterogeneous nuclear ribonucleoprotein F (hnRNP-F) has been implicated in multiple cancers, suggesting its role in tumourigenesis, but the potential oncogenic role and mechanism of hnRNP-F in bladder cancer (BC) remain incompletely understood.<h4>Methods</h4>HnRNP-F was identified by proteomic methods. A correlation of hnRNP-F expression with prognosis was analysed in 103 BC patients. Then, we applied in vitro and in vivo methods to reveal the behaviours of hnRNP-F in BC tumourigenesis. Furthermore, the interaction between hnRNP-F and Snail1 mRNA was examined by RNA immunoprecipitation (RIP), and Snail1 mRNA stability was measured after treatment with actinomycin D. Finally, the binding domain between hnRNP-F and Snail1 mRNA was verified by constructing Snail1 mRNA truncations and mutants.<h4>Finding</h4>HnRNP-F is significantly upregulated in BC tissue, and its increased expression is associated with a poor prognosis in BC patients. HnRNP-F is necessary for tumour growth, inducing epithelial-mesenchymal transition (EMT) and metastasis in BC. The changes in Snail1 expression were positively correlated with hnRNP-F at both the mRNA and protein levels when hnRNP-F was silenced or enhanced, suggesting that Snail1 is likely a downstream target of hnRNP-F that mediates its effects on enhancing invasion, metastasis and EMT in BC. The overexpression of hnRNP-F caused an increase in the stability of Snail1 mRNA. Our RNA chip analysis revealed that hnRNP-F could combine with Snail1 mRNA, and we further demonstrated that hnRNP-F could directly bind to the 3' untranslated region (3' UTR) of Snail1 mRNA to enhance its stability.<h4>Interpretation</h4>Our findings suggest that hnRNP-F mediates the stabilization of Snail1 mRNA by binding to its 3' UTR, subsequently regulating EMT.

Also flagged:GlycosylationGlycomeGlycanoligosaccharidesbindingglycans
Journal Article 2019-06-18 ✓ 1 Snippet Narimatsu Y, Joshi HJ, Nason R, Van Coillie J, Karlsson R, Sun L, Ye Z, Chen YH, Schjoldager KT, Steentoft C, Furukawa S, Bensing BA, Sullam PM, Thompson AJ, Paulson JC, Büll C, Adema GJ, Mandel U, Hansen L, Bennett EP, Varki A, Vakhrushev SY, Yang Z, Clausen H.
In-Text Gene Mentions

B4GALT5

Show Full Abstract

The structural diversity of glycans on cells-the glycome-is vast and complex to decipher. Glycan arrays display oligosaccharides and are used to report glycan hapten binding epitopes. Glycan arrays are limited resources and present saccharides without the context of other glycans and glycoconjugates. We used maps of glycosylation pathways to generate a library of isogenic HEK293 cells with combinatorially engineered glycosylation capacities designed to display and dissect the genetic, biosynthetic, and structural basis for glycan binding in a natural context. The cell-based glycan array is self-renewable and reports glycosyltransferase genes required (or blocking) for interactions through logical sequential biosynthetic steps, which is predictive of structural glycan features involved and provides instructions for synthesis, recombinant production, and genetic dissection strategies. Broad utility of the cell-based glycan array is demonstrated, and we uncover higher order binding of microbial adhesins to clustered patches of O-glycans organized by their presentation on proteins.

Also flagged:breast cancerbreast tumorcancerestrogen receptortriple-negative breast cancertumor
Journal Article 2019-06-18 No Snippets Ding W, Li D, Zhang P, Shi L, Dai H, Li Y, Bao X, Wang Y, Zhang H, Deng L.
Show Full Abstract

Breast cancer is a highly heterogeneous disease and numerous secreted factors may differentially contribute to a macrophage phenotype whose extensive infiltration is generally regarded as indicative of an unfavorable outcome. How different breast tumor cells and macrophage cells interplay or influence each other on the alternative splicing (AS) level have not been characterized. Here, we exploited one previous study, which investigated the interplay between macrophages and estrogen receptor‑positive (ER+) breast cancer and triple‑negative breast cancer (TNBC) at the transcriptional level, to investigate the tumor‑macrophage crosstalk at the AS level. In the present study, it was demonstrated that biological processes such as DNA damage and DNA repair were significantly affected both in ER+ breast cancer and TNBC by co‑culturing with macrophages, whereas biological pathways altered in macrophages co‑cultured with tumor cells depended on the breast cancer type. Specifically, biological processes altered in macrophages co‑cultured with ER+ breast cancer were enriched in RNA processing and translation‑related pathways whereas biological processes altered in macrophages co‑cultured with TNBC were mainly enriched in protein transport pathways. We also analyzed the sequence features of skip exons among different conditions. In addition, putative splicing factors which were responsible for the altered AS profile in each condition were identified. The findings of the present study revealed significant tumor‑macrophage crosstalk at the AS level which may facilitate the development of new therapeutic strategies for cancer.

Also flagged:Protease Activated Receptor 4inflammatory responsesinnate receptorsanaphylatoxin receptorsimmune responseProtease-activated receptors
Journal Article 2019-06-18 ✓ 3 Snippets Peng Q, Ratnasothy K, Boardman DA, Jacob J, Tung SL, McCluskey D, Smyth LA, Lechler RI, Dorling A, Lombardi G.
In-Text Gene Mentions

…or anti-thrombin III (ATIII).…

…Similarly,ATIIIadministration prevented hyper…

…) following high-doseATIIIor AAT treatment…

Show Full Abstract

Regulatory T cells (Tregs) are a subpopulation of T cells that maintain immunological tolerance. In inflammatory responses the function of Tregs is tightly controlled by several factors including signaling through innate receptors such as Toll like receptors and anaphylatoxin receptors allowing an effective immune response to be generated. Protease-activated receptors (PARs) are another family of innate receptors expressed on multiple cell types and involved in the pathogenesis of autoimmune disorders. Whether proteases are able to directly modulate Treg function is unknown. Here, we show using two complimentary approaches that signaling through PAR-4 influences the expression of CD25, CD62L, and CD73, the suppressive capacity, and the stability of Tregs<i>, via</i> phosphorylation of FoxO1 and negative regulation of PTEN and FoxP3. Taken together, our results demonstrate an important role of PAR4 in tuning the function of Tregs and open the possibility of targeting PAR4 to modulate immune responses.

Also flagged:Liver InjuryFluticasone-induced liver injuryDILIfluticasone-vilanteroldysfunction
Journal Article 2019-06-18 ✓ 1 Snippet Rishi M, Wagner A, Ulanja M, Beutler BD, Singh K.
In-Text Gene Mentions

…antibody titer, andhemochromatosispanel (ferritin and…

Show Full Abstract

Drug-induced liver injury (DILI) is a rare and potentially lethal condition associated with the use of many commonly-used medications, including inhaled fluticasone-vilanterol. Therefore, a careful review of medications should always be obtained in the setting of acute onset hepatic dysfunction. We present the first reported case of idiosyncratic drug-induced liver injury associated with the use of this medication.

Also flagged:pleural effusionsickle cell crisisbiliary obstructionabscesseshydatid cystic diseaseechinococcosis
Journal Article 2019-06-18 ✓ 1 Snippet Reddy VD, Al-Khateeb A, Hussain M, Patel V, Kadri M, Patel R, Maruboyina SP, Miller RA, DePasquale JR.
In-Text Gene Mentions

…hypothyroidism, and secondaryhemochromatosisdue to multiple…

Show Full Abstract

Bilothorax is a rare cause of an exudative pleural effusion. The diagnosis is confirmed by a pleural fluid to serum bilirubin ratio of greater than 1. Typically, bilothorax presents as a right-sided effusion due to its proximity to the liver and biliary system. Herein, we present a case of isolated left-sided bilothorax in a 43-year-old female admitted with sickle cell crisis. Only one other case of isolated spontaneous left-sided bilothorax has been described in the literature. A thoracentesis performed on admission demonstrated greenish fluid and bilothorax was suspected, with a pleural fluid to serum bilirubin ratio greater than 1 confirming the diagnosis. A magnetic resonance cholangiopancreatography (MRCP) showed an abnormal 90-degree acute angulation in the mid-to-distal common bile duct with proximal common bile duct and intrahepatic bile ducts dilation. This was further confirmed with an endoscopic retrograde cholangiopancreatography (ERCP), which did not reveal any extravasation of contrast into the left pleural space. Ultimately, despite the use of various modalities, no definitive cause of bilothorax was identified. Postthoracentesis imaging revealed evidence of fibrothorax, a direct and permanent complication of bilothorax. The presence of an isolated left-sided bilothorax, along with the lack of a confirmed etiology, makes this case unique.

Also flagged:SIRT1LHPPDAPK1NR2BPKMpeptide
Journal Article 2019-06-18 No Snippets 陆 林.
Show Full Abstract

No abstract available.

bioRxiv 2019-06-18 Preprint (No Snippets API) Caddy JC, Luoma LM, Berry FB.
Show Full Abstract

Bone morphogenetic proteins regulate a diverse range of biological processes through their activation of SMAD1, 5, or 8 proteins that in turn regulate gene expression. These SMAD transcription factors achieve a layer of functional specificity in different cells types largely through actions with additional transcriptional regulatory molecules. In this report we demonstrate that the Forkhead Box C1 (FOXC1) transcription factor can modulate BMP signalling to impair expression of BMP4-responsive genes and prevent efficient osteoblast differentiation. We demonstrate that repression occurs downstream of BMP signalling and impacts the ability SMAD1 or 5 to activate gene expression. Repression of SMAD activity requires FOXC1 DNA-binding capacity and the transcriptional inhibitory domain of FOXC1. We report that FOXC1 inhibits BMP4 induction of Id1 expression and identify a motif in the regulatory region of mouse Id1 gene that FOXC1 binds. We determine that this inhibition by FOXC1 binding does not affect SMAD1, 5, or 8 binding to its target sequence in the Id1 gene. Finally we determine that elevated expression of FOXC1 can reduces expression osteogenic differentiation genes in mouse embryonic stems directed to the osteoblast lineage through BMP4 treatment. Together, these findings indicate that FOXC1 can negative regulate certain aspects of BMP4 signalling required for osteoblast differentiation. We propose that FOXC1 acts to attenuate the initial BMP-activated pathways that establishes osteoblast differentiation and allow for terminal osteoblast differentiation to conclude.

Also flagged:Huntington's diseaseHDpathogenesisoligonucleotideszinc finger proteinsCas9
Journal Article 2019-06-17 No Snippets Bashir H.
Show Full Abstract

<b>Introduction</b>: Huntington's disease (HD) is an inherited neurodegenerative condition for which there are no disease-modifying treatments. The availability of early genetic diagnosis makes HD an ideal candidate for early intervention. Growing understanding of pathogenesis has led to the identification of new therapeutic targets for which some compounds are now in clinical trials. <b>Areas covered</b>: A detailed review of medical databases and clinical trial registries was performed. Recent clinical trials aimed to establish disease-modification were included. Focus was assigned to RNA and DNA-based therapies aimed at lowering mutant huntingtin (mHTT) including antisense oligonucleotides (ASOs), RNA interference (RNAi), zinc finger proteins (ZFPs) and the CRISPR-Cas9 system. Modulation of mHTT and immunotherapies is also covered. <b>Expert opinion</b>: Targeting HD pathogenesis at its most proximal level is under intense investigation. ASOs are the only HTT-lowering strategy in clinical trials of manifest HD. Safety and efficacy of an allele specific vs. allele non-specific approach has yet to be established. Success will extend to premanifest carriers for which development of clinical and imaging biomarkers will be necessary. Scientific and technological advancement will bolster new methods of treatment delivery. Cumulative experience, collaborative research, and platforms such as ENROLL-HD will facilitate efficient and effective clinical trials.

Also flagged:retinoblastomaRB1methylationFGFR4NQO1CLEC7A
Journal Article 2019-06-17 ✓ 1 Snippet Akdeniz D, Tuncer SB, Kebudi R, Celik B, Kuru G, Kilic S, Sukruoglu Erdogan O, Avsar M, Buyukkapu Bay S, Tuncer S, Yazici H.
In-Text Gene Mentions

…( NM_000519.3 );HFE( NM_000410.3 );…

Show Full Abstract

<h4>Background</h4>Retinoblastoma (Rb) is the most prevalent intraocular pediatric malignancy of the retina. Significant genetic factors are known to have a role in the development of Rb.<h4>Methods</h4>Here, we report the mutation status of 4813 clinically significant genes in six patients with noncarrier of RB1 gene mutation and having normal RB1 promoter methylation from three families having higher risk for developing Rb in the study.<h4>Results</h4>A total of 27 variants were detected in the study. Heterozygous missense variants c.1162G > A (p.Gly388Arg) in the FGFR4 gene; c.559C > T (p.Pro187Ser) in the NQO1 gene were identified. The family based evaluation of the variants showed that the variant, c.714T > G (p.Tyr238Ter), in the CLEC7A gene in first family; the variant, c.55C > T (p.Arg19Ter), in the APOC3 gene and the variant, c.1171C > T (p.Gln391Ter), in the MUTYH gene in second family; and the variant, c.211G > A (p.Gly71Arg), in the UGT1A1 gene in the third family, were found statistically significant (p < 0.05).<h4>Conclusion</h4>This study might be an important report on emphazing the mutational status of other genes in patients without RB1 gene mutations and having high risk for developing Rb. The study also indicates the interaction between the retinoic acid pathway and Rb oncogenesis for the first time.

Also flagged:oxygenglucoseangiogenesiscelldeathaging
Journal Article 2019-06-17 No Snippets Bogorad MI, DeStefano JG, Linville RM, Wong AD, Searson PC.
Show Full Abstract

The metabolic demands of the brain are met by oxygen and glucose, supplied by a complex hierarchical network of microvessels (arterioles, capillaries, and venules). Transient changes in neural activity are accommodated by local dilation of arterioles or capillaries to increase cerebral blood flow and hence nutrient availability. Transport and communication between the circulation and the brain is regulated by the brain microvascular endothelial cells that form the blood-brain barrier. Under homeostatic conditions, there is very little turnover in brain microvascular endothelial cells, and the cerebrovascular architecture is largely static. However, changes in the brain microenvironment, due to environmental factors, disease, or trauma, can result in additive or subtractive changes in cerebrovascular architecture. Additions occur by angiogenesis or vasculogenesis, whereas subtractions occur by vascular pruning, injury, or endothelial cell death. Here we review the various processes that lead to changes in the cerebrovascular architecture, including sustained changes in the brain microenvironment, development and aging, and injury, disease, and repair.

Also flagged:HedgehogHhcell segregationcalciumfibronectinextracellular
Journal Article 2019-06-17 ✓ 1 Snippet Wu X, Zhang Y, Chuang KH, Cai X, Ajaz H, Zheng X.
In-Text Gene Mentions

DCC

Show Full Abstract

Hedgehog (Hh) signaling is crucial for establishing complex cellular patterns in embryonic tissues and maintaining homeostasis in adult organs. In <i>Drosophila</i>, Interference hedgehog (Ihog) or its close paralogue Brother of Ihog (Boi) forms a receptor complex with Patched to mediate intracellular Hh signaling. Ihog proteins (Ihog and Boi) also contribute to cell segregation in wing imaginal discs through an unknown mechanism independent of their role in transducing the Hh signal. Here, we report a molecular mechanism by which the Ihog proteins mediate cell-cell interactions. We found that Ihog proteins are enriched at the site of cell-cell contacts and engage in <i>trans</i>-homophilic interactions in a calcium-independent manner. The region that we identified as mediating the <i>trans</i>-Ihog-Ihog interaction overlaps with the Ihog-Hh interface on the first fibronectin repeat of the extracellular domain of Ihog. We further demonstrate that Hh interferes with Ihog-mediated homophilic interactions by competing for Ihog binding. These results, thus, not only reveal a mechanism for Ihog-mediated cell-cell interactions but also suggest a direct Hh-mediated regulation of both intracellular signaling and cell adhesion through Ihog.

Also flagged:adiponectinleptinextracellularvesiclesadipokinesecretion
Journal Article 2019-06-17 ✓ 1 Snippet Funcke JB, Scherer PE.
In-Text Gene Mentions

DNAJC1

Show Full Abstract

The breakthrough discoveries of leptin and adiponectin more than two decades ago led to a widespread recognition of adipose tissue as an endocrine organ. Many more adipose tissue-secreted signaling mediators (adipokines) have been identified since then, and much has been learned about how adipose tissue communicates with other organs of the body to maintain systemic homeostasis. Beyond proteins, additional factors, such as lipids, metabolites, noncoding RNAs, and extracellular vesicles (EVs), released by adipose tissue participate in this process. Here, we review the diverse signaling mediators and mechanisms adipose tissue utilizes to relay information to other organs. We discuss recently identified adipokines (proteins, lipids, and metabolites) and briefly outline the contributions of noncoding RNAs and EVs to the ever-increasing complexities of adipose tissue inter-organ communication. We conclude by reflecting on central aspects of adipokine biology, namely, the contribution of distinct adipose tissue depots and cell types to adipokine secretion, the phenomenon of adipokine resistance, and the capacity of adipose tissue to act both as a source and sink of signaling mediators.

Also flagged:Somatostatinmajor depressive disorderparvalbumin5-HT 3A receptorSOMneurological disorders
Journal Article 2019-06-17 ✓ 2 Snippets Riedemann T.
In-Text Gene Mentions

…fate by promotingSox6expression in MGE…

…continued expression ofSox6during migration of…

Show Full Abstract

Inhibitory interneurons make up around 10-20% of the total neuron population in the cerebral cortex. A hallmark of inhibitory interneurons is their remarkable diversity in terms of morphology, synaptic connectivity, electrophysiological and neurochemical properties. It is generally understood that there are three distinct and non-overlapping interneuron classes in the mouse neocortex, namely, parvalbumin-expressing, 5-HT<sub>3A</sub> receptor-expressing and somatostatin-expressing interneuron classes. Each class is, in turn, composed of a multitude of subclasses, resulting in a growing number of interneuron classes and subclasses. In this review, I will focus on the diversity of somatostatin-expressing interneurons (SOM<sup>+</sup> INs) in the cerebral cortex and elucidate their function in cortical circuits. I will then discuss pathological consequences of a malfunctioning of SOM<sup>+</sup> INs in neurological disorders such as major depressive disorder, and present future avenues in SOM research and brain pathologies.

Also flagged:immune diseasesGPLD1EDNRAAPOBHIST1H2BItransportation
Journal Article 2019-06-17 No Snippets Ma X, Jia C, Fu D, Chu M, Ding X, Wu X, Guo X, Pei J, Bao P, Liang C, Yan P.
Show Full Abstract

Yak (<i>Bos grunniens</i>) is an important domestic animal living in high-altitude plateaus. Due to inadequate disease prevention, each year, the yak industry suffers significant economic losses. The identification of causal genes that affect blood- and immunity-related cells could provide preliminary reference guidelines for the prevention of diseases in the population of yaks. The genome-wide association studies (GWASs) utilizing a single-marker or haplotype method were employed to analyze 15 hematological traits in the genome of 315 unrelated yaks. Single-marker GWASs identified a total of 43 significant SNPs, including 35 suggestive and eight genome-wide significant SNPs, associated with nine traits. Haplotype analysis detected nine significant haplotype blocks, including two genome-wide and seven suggestive blocks, associated with seven traits. The study provides data on the genetic variability of hematological traits in the yak. Five essential genes (<i>GPLD1</i>, <i>EDNRA,</i><i>APOB</i>, <i>HIST1H1E</i>, and <i>HIST1H2BI</i>) were identified, which affect the HCT, HGB, RBC, PDW, PLT, and RDWSD traits and can serve as candidate genes for regulating hematological traits. The results provide a valuable reference to be used in the analysis of blood properties and immune diseases in the yak.

Also flagged:infectioninflammatory diseasesinflammatory responseimmune responsesRNA binding proteinsRBP
Journal Article 2019-06-17 No Snippets Yoshinaga M, Takeuchi O.
Show Full Abstract

Inflammation is the host response against stresses such as infection. Although the inflammation process is required for the elimination of pathogens, uncontrolled inflammation leads to tissue destruction and inflammatory diseases. To avoid this, the inflammatory response is tightly controlled by multiple layers of regulation. Post-transcriptional control of inflammatory mRNAs is increasingly understood to perform critical roles in this process. This is mediated primarily by a set of RNA binding proteins (RBPs) including tristetraprolin, Roquin and Regnase-1, and RNA methylases. These key regulators coordinate the inflammatory response by modulating mRNA pools in both immune and local nonimmune cells. In this review, we provide an overview of the post-transcriptional coordination of immune responses in various tissues and discuss how RBP-mediated regulation of inflammation may be harnessed as a potential class of treatments for inflammatory diseases.

Also flagged:gene expressionCD4antibodiesCXCR5PD1transcription factors
Journal Article 2019-06-17 No Snippets McDavid A, Gottardo R, Simon N, Drton M.
Show Full Abstract

Bulk gene expression experiments relied on aggregations of thousands of cells to measure the average expression in an organism. Advances in microfluidic and droplet sequencing now permit expression profiling in single cells. This study of cell-to-cell variation reveals that individual cells lack detectable expression of transcripts that appear abundant on a population level, giving rise to zero-inflated expression patterns. To infer gene co-regulatory networks from such data, we propose a multivariate Hurdle model. It is comprised of a mixture of singular Gaussian distributions. We employ neighborhood selection with the pseudo-likelihood and a group lasso penalty to select and fit undirected graphical models that capture conditional independences between genes. The proposed method is more sensitive than existing approaches in simulations, even under departures from our Hurdle model. The method is applied to data for T follicular helper cells, and a high-dimensional profile of mouse dendritic cells. It infers network structure not revealed by other methods; or in bulk data sets. An R implementation is available at https://github.com/amcdavid/HurdleNormal.

Also flagged:Magnesiumosteogenesisangiogenesiscell proliferationmagnesium ionscell adhesion
Journal Article 2019-06-17 No Snippets Gu Y, Zhang J, Zhang X, Liang G, Xu T, Niu W.
Show Full Abstract

<h4>Background</h4>Three-dimensional (3D) printed bone tissue engineering scaffolds have been widely used in research and clinical applications. β-TCP is a biomaterial commonly used in bone tissue engineering to treat bone defects, and its multifunctionality can be achieved by co-doping different metal ions. Magnesium doping in biomaterials has been shown to alter physicochemical properties of cells and enhance osteogenesis.<h4>Methods</h4>A series of Mg-doped TCP scaffolds were manufactured by using cryogenic 3D printing technology and sintering. The characteristics of the porous scaffolds, such as microstructure, chemical composition, mechanical properties, apparent porosity, etc., were examined. To further study the role of magnesium ions in simultaneously inducing osteogenesis and angiogenesis, human bone marrow mesenchymal stem cells (hBMSCs) and human umblical vein endothelial cells (HUVECs) were cultured in scaffold extracts to investigate cell proliferation, viability, and expression of osteogenic and angiogenic genes.<h4>Results</h4>The results showed that Mg-doped TCP scaffolds have the advantages of precise design, interconnected porous structure, and similar compressive strength to natural cancellous bone. hBMSCs and HUVECs exhibit high proliferation rate, cell morphology and viability in a certain amount of Mg<sup>2+</sup>. In addition, this concentration of magnesium can also increase the expression levels of osteogenic and angiogenic biomarkers.<h4>Conclusion</h4>A certain concentration of magnesium ions plays an important role in new bone regeneration and reconstruction. It can be used as a simple and effective method to enhance the osteogenesis and angiogenesis of bioceramic scaffolds, and support the development of biomaterials and bone tissue engineering scaffolds.

Also flagged:Neurological diseasesHDADcognitivetauneurodegenerative diseases
Journal Article 2019-06-17 No Snippets Gao F, Wang Y, Zeng D, Alzheimer’s Disease Neüroimaging Initiative.
Show Full Abstract

Neurological diseases are due to the loss of structure or function of neurons that eventually leads to cognitive deficit, neuropsychiatric symptoms, and impaired activities of daily living. Identifying sensitive and specific biological and clinical markers for early diagnosis allows recruiting patients into a clinical trial to test therapeutic intervention. However, many biomarker studies considered a single biomarker at one time that fails to provide precise prediction for disease age at onset. In this paper, we use longitudinally collected measurements from multiple biomarkers and measurement error-corrected clinical diagnosis ages to identify which biomarkers and what features of biomarker trajectories are useful for early diagnosis. Specifically, we assume that the subject-specific biomarker trajectories depend on unobserved states of underlying latent variables with the conditional mean follows a nonlinear sigmoid shape. We show that peak degeneration age of the biomarker trajectory is useful for early diagnosis. We propose an Expectation-Maximization (EM) algorithm to obtain the maximum likelihood estimates of all parameters and conduct extensive simulation studies to examine the performance of the proposed methods. Finally, we apply our methods to studies of Alzheimer's disease and Huntington's disease and identify a few important biomarkers that can be used for early diagnosis.

bioRxiv 2019-06-17 Preprint (No Snippets API) Pandey R, Abel S, Boucher M, Wall RJ, Zeeshan M, Rea E, Freville A, Lu XM, Brady D, Daniel E, Stanway RR, Wheatley S, Batugedara G, Hollin T, Bottrill AR, Gupta D, Holder AA, Le Roch KG, Tewari R.
Show Full Abstract

<h4>Summary</h4> Condensin is a multi-subunit protein complex regulating chromosome condensation and segregation during cell division. In Plasmodium spp., the causative agent of malaria, cell division is atypical and the role of condensin is unclear. Here we examine the role of SMC2 and SMC4, the core subunits of condensin, during endomitosis in schizogony and endoreduplication in male gametogenesis. During early schizogony SMC2/SMC4 localize to a distinct focus, identified as the centromeres by NDC80 fluorescence and ChIP-seq analyses, but do not form condensin I or II complexes. In mature schizonts and during male gametogenesis, there is a diffuse SMC2/SMC4 distribution on chromosomes and in the nucleus, and both condensin I and II complexes form at these stages. Knockdown of smc2 and smc4 gene expression revealed essential roles in parasite proliferation and transmission. The condensin core subunits (SMC2/SMC4) form different complexes and may have distinct functions at various stages of the parasite life cycle.

Also flagged:degradationtumourmelanomaMAPKPI3Kgene expression
Journal Article 2019-06-16 ✓ 1 Snippet Joshi P, Seki T, Kitamura S, Bergano A, Lee B, Perera RJ.
In-Text Gene Mentions

POU3F2

Show Full Abstract

RNA half-life is closely related to its cellular physiological function, so stability determinants may have regulatory functions. Micro(mi)RNAs have primarily been studied with respect to post-transcriptional mRNA regulation and target degradation. Here we study the impact of the tumour suppressive melanoma miRNA miR-211 on transcriptome stability and phenotype in the non-pigmented melanoma cell line, A375. Using 5'-bromouridine IP chase (BRIC)-seq, transcriptome-wide RNA stability profiles revealed highly regulated genes and pathways important in this melanoma cell line. By combining BRIC-seq, RNA-seq and <i>in silico</i> predictions, we identified both existing and novel direct miR-211 targets. We validated <i>DUSP3</i> as one such novel miR-211 target, which itself sustains colony formation and invasion in A375 cells via MAPK/PI3K signalling. miRNAs have the capacity to control RNA turnover as a gene expression mechanism, and RNA stability profiling is an excellent tool for interrogating functionally relevant gene regulatory pathways and miRNA targets when combined with other high-throughput and <i>in silico</i> approaches.

Also flagged:Nicotinetobacco dependencerespiratory diseasesnicotine dependenceglutamateglutamate receptors
Journal Article 2019-06-16 No Snippets Kim J, Yang JH, Ryu IS, Sohn S, Kim S, Choe ES.
Show Full Abstract

Nicotine causes tobacco dependence, which may result in fatal respiratory diseases. The striatum is a key structure of forebrain basal nuclei associated with nicotine dependence. In the striatum, glutamate release is increased when α7 nicotinic acetylcholine receptors expressed in the glutamatergic terminals are exposed to nicotine, and over-stimulates glutamate receptors in gamma amino-butyric acid (GABA)ergic neurons. These receptor over-stimulations in turn potentiate GABAergic outputs to forebrain basal nuclei and contribute to the increase in psychomotor behaviors associated with nicotine dependence. In parallel with glutamate increases, nicotine exposure elevates brain-derived neurotrophic factor (BDNF) release through anterograde and retrograde targeting of the synapses of glutamatergic terminals and GABAergic neurons. This article reviews nicotine-exposure induced elevations of glutamatergic neurotransmission, the bidirectional targeting of BDNF in the striatum, and the potential regulatory role played by BDNF in behavioral responses to nicotine exposure.

Also flagged:Ankyrin Repeat ProteinAnkyrinAnkyrin repeat-containing proteinsankyrin repeat-containingKRAScancer
Journal Article 2019-06-16 ✓ 5 Snippets Kang Y, Xie H, Zhao C.
In-Text Gene Mentions

Although deficiency of Ankrd45 proteins resulted in cell division defects both in KrasG12V-induced liver cells and cultured cancer cells, we did not observe any cell proliferation defects in ankrd45 mutants.

These data suggested that Ankrd45 protein is involved in the KrasG12V-induced liver tumor growth.

These data suggest that loss of ankrd45 results in a large number of apoptotic cells at the expense of proliferating cells in the KrasG12V-induced liver tumor, which leads to the formation of large areas of cystic degeneration and represents the main reason for enlarged livers in the mutants.

Similarly, ANKRD45 is also important for cell proliferation in several cancer cells, including human hepatoma Hep3B cells, which are relatively similar to the KrasG12V-induced liver cells.

First, we analyzed subcellular localization of ANKRD45 using human hepatoma Hep3B cells.

Show Full Abstract

Ankyrin repeats, the most common protein-protein interaction motifs in nature, are widely present in proteins of both eukaryotic and prokaryotic cells. Ankyrin repeat-containing proteins play diverse biological functions. Here, we identified the gene ankrd45, which encodes a novel, two ankyrin repeat-containing protein. Zebrafish ankrd45 displayed a tissue specific expression pattern during early development, with high expression in ciliated tissues, including otic vesicles, Kupffer's vesicles, pronephric ducts, and floor plates. Surprisingly, zebrafish ankrd45 mutants were viable and developed grossly normal cilia. In contrast, mutant larvae developed enlarged livers when induced with liver specific expression of Kras<sup>G12V</sup>, one of the common mutations of KRAS that leads to cancer in humans. Further, histological analysis suggested that multiple cysts developed in the mutant liver due to cell apoptosis. Similarly, knockdown of ANKRD45 expression with either siRNA or CRISPR/Cas9 methods induced apoptosis in cultured cells, similar to those in zebrafish ankrd45 mutant livers after induction. Using different cell lines, we show that the distribution of ANKRD45 protein was highly dynamic during mitosis. ANKRD45 is preferably localized to the midbody ring during cytokinesis. Together, our results suggest that Ankrd45 is a novel ankyrin repeat protein with a conserved role during cell proliferation in both zebrafish embryos and mammalian cells.

Also flagged:ironanemiaintraventricular hemorrhagechronic lung diseasenecrotizing enterocolitislate-onset sepsis
Journal Article 2019-06-15 ✓ 4 Snippets Qian Y, Ying X, Wang P, Lu Z, Hua Y.
In-Text Gene Mentions

DCC in cesarean section has no significant effect on the highest bilirubin after birth, the occurrence of neonatal hyperbilirubinemia or requirement of phototherapy for neonatal jaundice [67, 68].

Compared with ECC, DCC of 5 min or after cord stopped pulsating did not affect total serum bilirubin levels at 24 h, clinical jaundice or plethora and symptomatic polycythemia in term infants born to American mothers [8] and Libyan mothers [9].

…19 ] onDCCwere published in…

…null effect ofDCCon the BP…

Show Full Abstract

<h4>Purpose</h4>Policies for timing of cord clamping varied from early cord clamping (ECC) in the first 30 s after birth, to delayed cord clamping (DCC) in more than 30 s after birth or when cord pulsation has ceased. DCC, an inexpensive method allowed physiological placental transfusion. The aim of this article is to review the benefits and the potential harms of early versus delayed cord clamping.<h4>Methods</h4>Narrative overview, synthesizing the findings of the literature retrieved from searches of computerized databases.<h4>Results</h4>Delayed cord clamping in term and preterm infants had shown higher hemoglobin levels and iron storage, the improved infants' and children's neurodevelopment, the lesser anemia, the higher blood pressure and the fewer transfusions, as well as the lower rates of intraventricular hemorrhage (IVH), chronic lung disease, necrotizing enterocolitis, and late-onset sepsis. DCC was seldom associated with lower Apgar scores, neonatal hypothermia of admission, respiratory distress, and severe jaundice. In addition, DCC was not associated with increased risk of postpartum hemorrhage and maternal blood transfusion whether in cesarean section or vaginal delivery. DCC appeared to have no effect on cord blood gas analysis. However, DCC for more than 60 s reduced drastically the chances of obtaining clinically useful cord blood units (CBUs).<h4>Conclusion</h4>Delayed cord clamping in term and preterm infants was a simple, safe, and effective delivery procedure, which should be recommended, but the optimal cord clamping time remained controversial.

Also flagged:Neurodegenerative diseaseHuntington DiseaseMotor Neuron Diseasesneurodegenerative disordersParkinson's DiseaseNeurodegenerative diseases
Journal Article 2019-06-15 ✓ 2 Snippets Nair RR, Corrochano S, Gasco S, Tibbit C, Thompson D, Maduro C, Ali Z, Fratta P, Fratta P, Arozena AA, Cunningham TJ, Fisher EMC.
In-Text Gene Mentions

Huntington disease, HD HD is an autosomal-dominant neurodegenerative disorder caused by a polyglutamine tract expansion in the HTT gene, characterised by progressive chorea, dystonia, and cognitive and psychiatric symptoms including dementia.

…expansion in theHTTgene, characterised by…

Show Full Abstract

Neurodegenerative disease encompasses a wide range of disorders afflicting the central and peripheral nervous systems and is a major unmet biomedical need of our time. There are very limited treatments, and no cures, for most of these diseases, including Alzheimer's Disease, Parkinson's Disease, Huntington Disease, and Motor Neuron Diseases. Mouse and other animal models provide hope by analysing them to understand pathogenic mechanisms, to identify drug targets, and to develop gene therapies and stem cell therapies. However, despite many decades of research, virtually no new treatments have reached the clinic. Increasingly, it is apparent that human heterogeneity within clinically defined neurodegenerative disorders, and between patients with the same genetic mutations, significantly impacts disease presentation and, potentially, therapeutic efficacy. Therefore, stratifying patients according to genetics, lifestyle, disease presentation, ethnicity, and other parameters may hold the key to bringing effective therapies from the bench to the clinic. Here, we discuss genetic and cellular humanised mouse models, and how they help in defining the genetic and environmental parameters associated with neurodegenerative disease, and so help in developing effective precision medicine strategies for future healthcare.

Also flagged:polyglutamineneurodegenerative diseasesinherited disorderamyloid diseasesneurodegenerative disordersbehavioral
Journal Article 2019-06-15 ✓ 5 Snippets Matlahov I, van der Wel PC.
In-Text Gene Mentions

The nucleation event is therate-limiting step with a positive free energy (ΔG) and very small equilibriumconstant for nucleus formation (Kn*)96 (Figure 3(e)).Once a minimal nucleus is formed, the elongation process is thermodynamicallyfavorable and spontaneous.99,101 For polyglutamine,Kn* increases with longer repeat lengths, leading to ever fasteraggregation of proteins with longer polyglutamine repeats.96 Thus, Htt fragments with very long glutamine repeats nucleate morequickly than those with short repeats.

The connection between HD and mutation of the huntingtin(Htt) protein was identified in the 1990s.6 The age of onset of HD and other polyglutamine expansion diseases isinversely dependent on the length of the CAG repeat (Figure 1(a)).

The flexible regions of Htt harbor a number of caspase cleavage sites withapparent relevance to HD.18 Caspase 3 cleavage products formed in vitro areconsistent with Htt fragments in HD cerebellum, striatum and cortex, includingfragments that map onto HttEx1.19 A notable, but as yet poorly understood aspect of the different-lengthHtt fragments is that they cause different levels of toxicity.

…of the huntingtin (Htt) protein was identified…

…Wild-typeHttis a large…

Show Full Abstract

No abstract available.

Also flagged:Basosquamous carcinomaskin neoplasmbasal cell carcinomasquamous cell carcinomatumorstumor
Journal Article 2019-06-15 ✓ 1 Snippet Chiang A, Tan CZ, Kuonen F, Hodgkinson LM, Chiang F, Cho RJ, South AP, Tang JY, Chang ALS, Rieger KE, Oro AE, Sarin KY.
In-Text Gene Mentions

DCC

Show Full Abstract

Basosquamous carcinoma (BSC) is an aggressive skin neoplasm with the features of both basal cell carcinoma (BCC) and squamous cell carcinoma (SCC). While genetic drivers of BCC and SCC development have been extensively characterized, BSC has not been well studied, and it remains unclear whether these tumors originally derive from BCC or SCC. In addition, it is unknown which molecular pathways mediate the reprogramming of tumor keratinocytes toward basaloid or squamatized phenotypes. We sought to characterize the genomic alterations underlying sporadic BSC to elucidate the derivation of these mixed tumors. We identifed frequent Hedgehog (Hh) pathway mutations in BSCs, implicating Hh deregulation as the primary driving event in BSC. Principal component analysis of BCC and SCC driver genes further demonstrate the genetic similarity between BCC and BSC. In addition, 45% of the BSCs harbor recurrent mutations in the SWI/SNF complex gene, ARID1A, and evolutionary analysis revealed that ARID1A mutations occur after PTCH1 but before SCC driver mutations, indicating that ARID1A mutations may bestow plasticity enabling squamatization. Finally, we demonstrate mitogen-activated protein kinase pathway activation and the loss of Hh signaling associated with the squamatization of BSCs. Overall, these results support the genetic derivation of BSCs from BCCs and highlight potential factors involved in modulating tumor reprogramming between basaloid and squamatized phenotypes.

Also flagged:Monoacylglycerol LipaseMAGLserine hydrolase2-arachidonoylglycerol-endocannabinoid
Journal Article 2019-06-15 ✓ 1 Snippet Miceli M, Casati S, Ottria R, Di Leo S, Eberini I, Palazzolo L, Parravicini C, Ciuffreda P.
In-Text Gene Mentions

DCC (72 mg, 0.35 mmoli) was added to the reaction mixture at 0 °C.…

Show Full Abstract

Monoacylglycerol lipase (MAGL) is a serine hydrolase that has a key regulatory role in controlling the levels of 2-arachidonoylglycerol (2-AG), the main signaling molecule in the endocannabinoid system. Identification of selective modulators of MAGL enables both to provide new tools for investigating pathophysiological roles of 2-AG, and to discover new lead compounds for drug design. The development of sensitive and reliable methods is crucial to evaluate this modulatory activity. In the current study, we report readily synthesized long-wavelength putative fluorogenic substrates with different acylic side chains to find a new probe for MAGL activity. 7-Hydroxyresorufinyl octanoate proved to be the best substrate thanks to the highest rate of hydrolysis and the best Km and Vmax values. In addition, in silico evaluation of substrates interaction with the active site of MAGL confirms octanoate resorufine derivative as the molecule of choice. The well-known MAGL inhibitors URB602 and methyl arachidonylfluorophosphonate (MAFP) were used for the assay validation. The assay was highly reproducible with an overall average Z' value of 0.86. The fast, sensitive and accurate method described in this study is suitable for low-cost high-throughput screening (HTS) of MAGL modulators and is a powerful new tool for studying MAGL activity.

Also flagged:DopamineHuntington diseaseHDimmune responseGFPDARPP-32
Journal Article 2019-06-15 ✓ 5 Snippets Yu-Taeger L, Stricker-Shaver J, Arnold K, Bambynek-Dziuk P, Novati A, Singer E, Lourhmati A, Fabian C, Magg J, Riess O, Schwab M, Stolzing A, Danielyan L, Nguyen HHP.
In-Text Gene Mentions

HD is caused by an expansion of the CAG (coding for glutamine) repeat region in exon 1 of the huntingtin (HTT) gene that encodes the huntingtin protein (HTT) [7].

…the huntingtin (HTT) gene that…

…the huntingtin protein (HTT) [ 7 ].…

…In mutantHTT(mHTT), the polyglutamine…

…of mutant humanHTTgene with approximately…

Show Full Abstract

Intrastriatal administration of mesenchymal stem cells (MSCs) has shown beneficial effects in rodent models of Huntington disease (HD). However, the invasive nature of surgical procedure and its potential to trigger the host immune response may limit its clinical use. Hence, we sought to evaluate the non-invasive intranasal administration (INA) of MSC delivery as an effective alternative route in HD. GFP-expressing MSCs derived from bone marrow were intranasally administered to 4-week-old R6/2 HD transgenic mice. MSCs were detected in the olfactory bulb, midbrain and striatum five days post-delivery. Compared to phosphate-buffered saline (PBS)-treated littermates, MSC-treated R6/2 mice showed an increased survival rate and attenuated circadian activity disruption assessed by locomotor activity. MSCs increased the protein expression of DARPP-32 and tyrosine hydroxylase (TH) and downregulated gene expression of inflammatory modulators in the brain 7.5 weeks after INA. While vehicle treated R6/2 mice displayed decreased Iba1 expression and altered microglial morphology in comparison to the wild type littermates, MSCs restored both, Iba1 level and the thickness of microglial processes in the striatum of R6/2 mice. Our results demonstrate significantly ameliorated phenotypes of R6/2 mice after MSCs administration via INA, suggesting this method as an effective delivering route of cells to the brain for HD therapy.

Also flagged:BiosynthesisBile acidssteroid acidscholesteroldigestioncell-surface receptors
Journal Article 2019-06-15 No Snippets Kiriyama Y, Nochi H.
Show Full Abstract

Bile acids (BA) are amphipathic steroid acids synthesized from cholesterol in the liver. They act as detergents to expedite the digestion and absorption of dietary lipids and lipophilic vitamins. BA are also considered to be signaling molecules, being ligands of nuclear and cell-surface receptors, including farnesoid X receptor and Takeda G-protein receptor 5. Moreover, BA also activate ion channels, including the bile acid-sensitive ion channel and epithelial Na<sup>+</sup> channel. BA regulate glucose and lipid metabolism by activating these receptors in peripheral tissues, such as the liver and brown and white adipose tissue. Recently, 20 different BA have been identified in the central nervous system. Furthermore, BA affect the function of neurotransmitter receptors, such as the muscarinic acetylcholine receptor and γ-aminobutyric acid receptor. BA are also known to be protective against neurodegeneration. Here, we review recent findings regarding the biosynthesis, signaling, and neurological functions of BA.

Also flagged:E3 LigasesDeubiquitinasesubiquitinhypoxia-inducible factorHIFubiquitin E3 ligases
Journal Article 2019-06-15 No Snippets Kubaichuk K, Kietzmann T.
Show Full Abstract

The ubiquitin and hypoxia-inducible factor (HIF) pathways are cellular processes involved in the regulation of a variety of cellular functions. Enzymes called ubiquitin E3 ligases perform protein ubiquitylation. The action of these enzymes can be counteracted by another group of enzymes called deubiquitinases (DUBs), which remove ubiquitin from target proteins. The balanced action of these enzymes allows cells to adapt their protein content to a variety of cellular and environmental stress factors, including hypoxia. While hypoxia appears to be a powerful regulator of the ubiquitylation process, much less is known about the impact of DUBs on the HIF system and hypoxia-regulated DUBs. Moreover, hypoxia and DUBs play crucial roles in many diseases, such as cancer. Hence, DUBs are considered to be promising targets for cancer cell-specific treatment. Here, we review the current knowledge about the role DUBs play in the control of HIFs, the regulation of DUBs by hypoxia, and their implication in cancer progression.

Also flagged:MyHC-IMyHC-IIaMyHC-IIxDJ-1proteolysisCAPN1
Journal Article 2019-06-15 ✓ 1 Snippet Gagaoua M, Terlouw C, Richardson I, Hocquette JF, Picard B.
In-Text Gene Mentions

…oxidative stress (DJ-1,PRDX6) and proteolysis (CAPN1)…

Show Full Abstract

Steaks of 74 animals from 3 young bull breeds (Aberdeen Angus, Limousin and Blond d'Aquitaine) were cooked at two end-point cooking temperatures (55 and 74 °C) and evaluated for tenderness by trained panelists from France (FR) and the United Kingdom (UK). Using principal component regressions, the tenderness scores of each breed, country origin of the panelists and cooking temperature were linked with the abundances of 21 protein biomarkers belonging to five biological pathways. Twelve regression equations were built and explained 68 to 95% of tenderness variability. A high dissimilarity in the retained biomarkers was observed among the equations and differences exist among breeds, cooking temperatures and country origin of the panelists. Among the 21 biomarkers, 6 proteins including structural (MyHC-I, MyHC-IIa, MyHC-IIx), oxidative stress (DJ-1, PRDX6) and proteolysis (CAPN1) were retained robustly in positive or negative directions in the tenderization process of Longissimus thoracis, regardless the breed, the end-point cooking temperature or the country origin of the panelist.

Also flagged:Huntington's diseaseHDgeneticneurodegenerative diseasebehaviouralcytosine
Journal Article 2019-06-15 ✓ 2 Snippets Garcia-Gorro C, Llera A, Martinez-Horta S, Perez-Perez J, Kulisevsky J, Rodriguez-Dechicha N, Vaquer I, Subira S, Calopa M, Muñoz E, Santacruz P, Ruiz-Idiago J, Mareca C, Beckmann CF, de Diego-Balaguer R, Camara E.
In-Text Gene Mentions

Huntington's disease (HD) is a neurodegenerative disease caused by a mutation in the HTT gene that produces an abnormal expansion of a cytosine-adenine-guanine (CAG) trinucleotide repeat.

…mutation in theHTTgene that produces…

Show Full Abstract

Huntington's disease (HD) is a genetic neurodegenerative disease which involves a triad of motor, cognitive and psychiatric disturbances. However, there is great variability in the prominence of each type of symptom across individuals. The neurobiological basis of such variability remains poorly understood but would be crucial for better tailored treatments. Multivariate multimodal neuroimaging approaches have been successful in disentangling these profiles in other disorders. Thus we applied for the first time such approach to HD. We studied the relationship between HD symptom domains and multimodal measures sensitive to grey and white matter structural alterations. Forty-three HD gene carriers (23 manifest and 20 premanifest individuals) were scanned and underwent behavioural assessments evaluating motor, cognitive and psychiatric domains. We conducted a multimodal analysis integrating different structural neuroimaging modalities measuring grey matter volume, cortical thickness and white matter diffusion indices - fractional anisotropy and radial diffusivity. All neuroimaging measures were entered into a linked independent component analysis in order to obtain multimodal components reflecting common inter-subject variation across imaging modalities. The relationship between multimodal neuroimaging independent components and behavioural measures was analysed using multiple linear regression. We found that cognitive and motor symptoms shared a common neurobiological basis, whereas the psychiatric domain presented a differentiated neural signature. Behavioural measures of different symptom domains correlated with different neuroimaging components, both the brain regions involved and the neuroimaging modalities most prominently associated with each type of symptom showing differences. More severe cognitive and motor signs together were associated with a multimodal component consisting in a pattern of reduced grey matter, cortical thickness and white matter integrity in cognitive and motor related networks. In contrast, depressive symptoms were associated with a component mainly characterised by reduced cortical thickness pattern in limbic and paralimbic regions. In conclusion, using a multivariate multimodal approach we were able to disentangle the neurobiological substrates of two distinct symptom profiles in HD: one characterised by cognitive and motor features dissociated from a psychiatric profile. These results open a new view on a disease classically considered as a uniform entity and initiates a new avenue for further research considering these qualitative individual differences.

Also flagged:facilitated glucose transportersSLC2Asglucose transportersfacilitated solute carrier family 2Slc2agene expression
Journal Article 2019-06-15 ✓ 1 Snippet Arhin SK, Zhao J, Ji X, Shi C, Tang J, Gu Y, Xi H, Cheng J, Qu X, Shi H, Jin X, Lv J.
In-Text Gene Mentions

SLC2A14

Show Full Abstract

<h4>Background</h4>Glucose metabolism is an essential energy source for mammalian preimplantation embryonic development. Therefore, we aimed to analyze the expression of all 12 known glucose transporters (facilitated solute carrier family 2, Slc2a) during early mouse embryo development.<h4>Methods</h4>Gene and protein expression of Slc2a transporters in oocytes and embryos were assessed by the TaqMan gene expression assay and confocal immunofluorescence, respectively.<h4>Results</h4>Except for Slc2a2, the other 11 Slc2a transcripts were detected in oocytes. Transcripts of Slc2a1, Slc2a3, Slc2a4, and Slc2a8 were the most enriched and detected in preimplantation embryos. The transcription of other Slc2a isoforms was barely detectable or absent after fertilization; however, they were detected in blastocysts, except for Slc2a10 and Slc2a13. Embryo culture in the simple defined medium caused a reduction in transcription of Slc2a1, Slc2a3, Slc2a4, and Slc2a8 in blastocyst; yet, amino acids partially reversed this impaired transcription of Slc2a1 and Slc2a4. SLC2A1 and SLC2A4 proteins were detected at all embryonic stages with nuclear accumulation in the embryos at the early cleavage stage. SLC2A3 and SLC2A8 were not detected in embryos until the eight-cell stage. The cellular membrane localization of SLC2A1, SLC2A3, and SLC2A8 occurred after compaction and was characterized in blastocysts. SLC2A4 was evenly distributed in the cytoplasm and nuclei without its characteristic membrane localization. Indinavir sulfate (a SLC2A4 inhibitor) decreased the rate of development and prevented glucose utilization in embryos after compaction. These inhibitory activities were partially reversed by exogenous insulin.<h4>Conclusion</h4>The results unveil distinct expression patterns of individual Slc2a glucose transporters during early embryo development. Taken together, they provide novel insights into the understanding and management of glucose metabolic infertility in assisted-reproductive technologies (ART).

Also flagged:pathogenesisatherosclerosisANP32ATULP4PDCD4SNHG7
Journal Article 2019-06-15 No Snippets Pan Z, Fan Z, Ma J, Liu H, Shen L, He B, Zhang M.
Show Full Abstract

<h4>Background</h4>Accumulating studies have demonstrated that some long non-coding RNAs (lncRNAs) play critical roles in the pathogenesis of atherosclerosis. We aimed to identify circulation lncRNAs that are potential biomarkers to evaluate coronary atherosclerotic plaque stability.<h4>Methods and results</h4>The transcriptomes of blood samples of three patients with stable plaque and three patients with unstable plaque were sequenced by RNA-sequencing. A total of 62 lncRNAs were found to be differentially expressed in patients with unstable plaques. The expressions of four candidate lncRNAs (ANP32A-005, TULP4-005, PDCD4-010, and SNHG7-003) were quantified using blood samples from 15 patients with stable plaques and 15 patients with unstable plaques, subsequently. In addition, the expression levels of these four lncRNAs in LPS (lipopolysaccharide)-activated THP-1 monocytes and THP-1-derived macrophages were measured. LncRNA-SNHG7-003 was validated to be significantly down-regulated in blood samples of patients with unstable plaques and LPS-stimulated monocytes and macrophages. Moreover, plasmid-transfection mediated over-expression of SNHG7-003 markedly inhibited the activation of NF-κB pathway, and reduced the secretion of inflammatory mediators (TNF-α, IL-1β, MCP-1 and MMP-9) in LPS-activated THP-1 monocytes and macrophages.<h4>Conclusion</h4>LncRNA-SNHG7-003 inhibits NF-κB activation and regulates inflammatory responses in human monocytes and macrophages. Blood lncRNA-SNHG7-003 is a potential biomarker for evaluating plaque stability in patients with coronary artery diseases.

Also flagged:Patched homolog 1chronic myeloid leukemiaHhpathogenesisCMLBCR-ABL
Journal Article 2019-06-15 No Snippets Abd Elrhman HE, Ebian HF.
Show Full Abstract

<h4>Background</h4>The Hedgehog (Hh) pathway is stimulated by inactivating mutations of Patched Homolog 1 <i>(PTCH1) gene</i>. There is accumulating evidence that Hh signaling plays a critical role in the pathogenesis of various haemopoietic malignancies. Particular interest has focused on the role of Hh signaling in chronic myeloid leukemia (CML). The Hh signaling is increased in BCR-ABL+ve progenitor cells and Hh signaling is further up regulated with disease progression.<h4>Aim</h4>The aim of this study was to determine the frequency and types of PTCH1 gene mutations in Chronic Myeloid Leukemia (CML) patients and to correlate the effect of these mutations on the prognosis and outcome of CML and for predicting the imatinib response in CML patients.<h4>Subjects and methods</h4>The study included fifty newly diagnosed CML patients and ten healthy volunteers (the control group) to verify the presence or absence of PTCH1 gene mutation. The patients were subjected to clinical examination, routine laboratory investigations, bone marrow examination, Cytogenetic evaluations of t(9;22) and molecular study of BCR-ABL fusion gene. All participants in this study were subjected to the assessment for the presence of PTCH1 gene mutation by DNA extraction followed by polymerase chain reaction (PCR) of genomic DNA corresponding to exon 23 of PTCH1 gene, purification of amplified PCR product, followed by sequencing analysis for detection of PTCH1 gene exon 23 mutations and the types of these mutations.<h4>Results</h4>Four types of mutations of PTCH1 gene were detected in 24 CML patients (48%), three types of them were missence while the fourth type was frame shift mutation. There was no significant association between PTCH1 gene mutation and percent of BCR-ABL fusion genes at level less than 10% at 3 months of treatment, complete cytogenetic response (CCyR) at one year, disease free survival and overall survival. However there was significant association between PTCH1 gene mutation and imatinib failure (P=0.03).<h4>Conclusion</h4>PTCH1 gene mutation should be considered a promising molecular marker for predicting the probability of imatinib response in CML patients. Hedgehog pathway activation in CML patients can raise a possibility that combinations of ABL and Hh inhibitors might offer a new treatment strategy in CML and might help to effectively cure this disease.

Also flagged:secretindiffuse pancreatic diseaseautoimmune pancreatitismetabolic diseaseirondeposition
Journal Article 2019-06-14 No Snippets Chouhan MD, Firmin L, Read S, Amin Z, Taylor SA.
Show Full Abstract

MRI plays an important role in the clinical management of pancreatic disorders and interpretation is reliant on qualitative assessment of anatomy. Conventional sequences capturing pancreatic structure can however be adapted to yield quantitative measures which provide more diagnostic information, with a view to increasing diagnostic accuracy, improving patient stratification, providing robust non-invasive outcome measures for therapeutic trials and ultimately personalizing patient care. In this review, we evaluate the use of established techniques such as secretin-enhanced MR cholangiopancreatography, diffusion-weighted imaging, <i>T</i> <sub>1</sub>, <i>T</i> <sub>2</sub>* and fat fraction mapping, but also more experimental methods such as MR elastography and arterial spin labelling, and their application to the assessment of diffuse pancreatic disease (including chronic, acute and autoimmune pancreatitis/IgG4 disease, metabolic disease and iron deposition disorders) and cystic/solid focal pancreatic masses. Finally, we explore some of the broader challenges to their implementation and future directions in this promising area.

Also flagged:CCCTC Binding FactorHeterochromatininsulator proteinCTCFchromatinlatency-associated transcript
Journal Article 2019-06-14 ✓ 1 Snippet Washington SD, Singh P, Johns RN, Edwards TG, Mariani M, Frietze S, Bloom DC, Neumann DM.
In-Text Gene Mentions

corepressive

Show Full Abstract

The cellular insulator protein CTCF plays a role in herpes simplex virus 1 (HSV-1) latency through the establishment and regulation of chromatin boundaries. We previously found that the CTRL2 regulatory element downstream from the latency-associated transcript (LAT) enhancer was bound by CTCF during latency and underwent CTCF eviction at early times postreactivation in mice latently infected with 17<i>syn</i>+ virus. We also showed that CTRL2 was a functional enhancer-blocking insulator in both epithelial and neuronal cell lines. We hypothesized that CTRL2 played a direct role in silencing lytic gene expression during the establishment of HSV-1 latency. To test this hypothesis, we used a recombinant virus with a 135-bp deletion spanning only the core CTRL2 insulator domain (ΔCTRL2) in the 17<i>syn</i>+ background. Deletion of CTRL2 resulted in restricted viral replication in epithelial cells but not neuronal cells. Following ocular infection, mouse survival decreased in the ΔCTRL2-infected cohort, and we found a significant decrease in the number of viral genomes in mouse trigeminal ganglia (TG) infected with ΔCTRL2, indicating that the CTRL2 insulator was required for the efficient establishment of latency. Immediate early (IE) gene expression significantly increased in the number of ganglia infected with ΔCTRL2 by 31 days postinfection relative to the level with 17<i>syn</i>+ infection, indicating that deletion of the CTRL2 insulator disrupted the organization of chromatin domains during HSV-1 latency. Finally, chromatin immunoprecipitation with high-throughput sequencing (ChIP-seq) analyses of TG from ΔCTRL2-infected mice confirmed that the distribution of the repressive H3K27me3 (histone H3 trimethylated at K27) mark on the ΔCTRL2 recombinant genomes was altered compared to that of the wild type, indicating that the CTRL2 site modulates the repression of IE genes during latency.<b>IMPORTANCE</b> It is becoming increasingly clear that chromatin insulators play a key role in the transcriptional control of DNA viruses. The gammaherpesviruses Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) utilize chromatin insulators to order protein recruitment and dictate the formation of three-dimensional DNA loops that spatially control transcription and latency. The contribution of chromatin insulators in alphaherpesvirus transcriptional control is less well understood. The work presented here begins to bridge that gap in knowledge by showing how one insulator site in HSV-1 modulates lytic gene transcription and heterochromatin deposition as the HSV-1 genome establishes latency.

Also flagged:axonsaxonalaxon guidanceRobo3organizationneurogenesis
Journal Article 2019-06-14 ✓ 1 Snippet Tulloch AJ, Teo S, Carvajal BV, Tessier-Lavigne M, Jaworski A.
In-Text Gene Mentions

DCC

Show Full Abstract

The two sides of the nervous system coordinate and integrate information via commissural neurons, which project axons across the midline. Commissural neurons in the spinal cord are a highly heterogeneous population of cells with respect to their birthplace, final cell body position, axonal trajectory, and neurotransmitter phenotype. Although commissural axon guidance during development has been studied in great detail, neither the developmental origins nor the mature phenotypes of commissural neurons have been characterized comprehensively, largely due to lack of selective genetic access to these neurons. Here, we generated mice expressing Cre recombinase from the Robo3 locus specifically in commissural neurons. We used Robo3 <sup>Cre</sup> mice to characterize the transcriptome and various origins of developing commissural neurons, revealing new details about their extensive heterogeneity in molecular makeup and developmental lineage. Further, we followed the fate of commissural neurons into adulthood, thereby elucidating their settling positions and molecular diversity and providing evidence for possible functions in various spinal cord circuits. Our studies establish an important genetic entry point for further analyses of commissural neuron development, connectivity, and function.

Also flagged:cancertumorpeptidesacidglycolic acidmetastatic tumors
Journal Article 2019-06-14 No Snippets Kim KT, Lee JY, Kim DD, Yoon IS, Cho HJ.
Show Full Abstract

Diverse nanosystems for use in cancer imaging and therapy have been designed and their clinical applications have been assessed. Among a variety of materials available to fabricate nanosystems, poly(lactic-<i>co</i>-glycolic acid) (PLGA) has been widely used due to its biocompatibility and biodegradability. In order to provide tumor-targeting and diagnostic properties, PLGA or PLGA nanoparticles (NPs) can be modified with other functional materials. Hydrophobic or hydrophilic therapeutic cargos can be placed in the internal space or adsorbed onto the surface of PLGA NPs. Protocols for the fabrication of PLGA-based NPs for cancer imaging and therapy are already well established. Moreover, the biocompatibility and biodegradability of PLGA may elevate its feasibility for clinical application in injection formulations. Size-controlled NP's properties and ligand-receptor interactions may provide passive and active tumor-targeting abilities, respectively, after intravenous administration. Additionally, the introduction of several imaging modalities to PLGA-based NPs can enable drug delivery guided by in vivo imaging. Versatile platform technology of PLGA-based NPs can be applied to the delivery of small chemicals, peptides, proteins, and nucleic acids for use in cancer therapy. This review describes recent findings and insights into the development of tumor-targeted PLGA-based NPs for use of cancer imaging and therapy.

Also flagged:BIG1BIG2VEGFangiogenesisBrefeldin Aguanine nucleotide-exchange protein
Journal Article 2019-06-14 No Snippets Lu FI, Wang YT, Wang YS, Wu CY, Li CC.
Show Full Abstract

VEGF stimulates the formation of new blood vessels by inducing endothelial cell (EC) proliferation and migration. Brefeldin A (BFA)-inhibited guanine nucleotide-exchange protein (BIG)1 and 2 accelerate the replacement of bound GDP with GTP to activate ADP-ribosylation factor (Arf)1, which regulates vesicular transport between the Golgi and plasma membrane. Although it has been reported that treating cells with BFA interferes with Arf1 activation to inhibit VEGF secretion, the role of BIG1 and BIG2 in VEGF trafficking and expression, EC migration and proliferation, and vascular development remains unknown. Here, we found that inactivation of Arf1 reduced VEGF secretion but did not affect the levels of VEGF protein. Interestingly, however, BIG1 and BIG2 knockdown significantly decreased the levels of VEGF mRNA and protein in glioblastoma U251 cells and HUVECs. Furthermore, depletion of BIG1 and BIG2 inhibited HUVEC angiogenesis by diminishing cell migration. Angioblast migration and intersegmental vessel sprouting were also impaired when the BIG2 homolog, Arf guanine nucleotide exchange factor (<i>arfgef</i>)<i>2</i>, was knocked down in zebrafish with endothelial expression of green fluorescent protein (GFP). Depletion of arfgef2 by clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) also caused defects in vascular development of zebrafish embryos. Taken together, these data reveal that BIG1 and BIG2 participate in endothelial cell angiogenesis.-Lu, F.-I., Wang, Y.-T., Wang, Y.-S., Wu, C.-Y., Li, C.-C. Involvement of BIG1 and BIG2 in regulating VEGF expression and angiogenesis.

Also flagged:Glypican 6metastatic melanomamelanomasgene expressioncutaneous melanomaGPC6
Journal Article 2019-06-14 ✓ 2 Snippets Li Y, Li M, Shats I, Krahn JM, Flake GP, Umbach DM, Li X, Li L.
In-Text Gene Mentions

…NTN1, ODZ2, PVRL4,PCDH17, SEMA3G, SCUBE3, and…

…NRP1, NTM, POSTN,PCDH17, ROR2, TNFAIP6, and…

Show Full Abstract

Due to the poor prognosis of advanced metastatic melanoma, it is crucial to find early biomarkers that help identify which melanomas will metastasize. By comparing the gene expression data from primary and cutaneous melanoma samples from The Cancer Genome Atlas (TCGA), we identified GPC6 among a set of genes whose expression levels can distinguish between primary melanoma and regional cutaneous/subcutaneous metastases. Glypicans are thought to play a role in tumor growth by regulating the signaling pathways of Wnt, Hedgehogs, fibroblast growth factors (FGFs), and bone morphogenetic proteins (BMPs). We showed that GPC6 expression was up-regulated in a melanoma cell line compared to normal melanocytes and in metastatic melanoma compared to primary melanoma. Furthermore, GPC6 expression was positively correlated with genes largely involved in cell adhesion and migration in both melanoma samples and in RNA-seq samples from other TCGA tumors. Our results suggest that GPC6 may play a role in tumor metastatic progression. In TCGA melanoma samples, we also showed that GPC6 expression was negatively correlated with miR-509-3p, which has previously been shown to function as a tumor suppressor in various cancer cell lines. We overexpressed miR-509-3p in A375 melanoma cells and showed that GPC6 expression was significantly suppressed. This result suggested that GPC6 was a putative target of miR-509-3p in melanoma. Together, our findings identified GPC6 as an early biomarker for melanoma metastatic progression, one that can be regulated by miR-509-3p.

Also flagged:gene expressioninfectionmRNAmetabolismcolon cancerenteropathy
Journal Article 2019-06-14 No Snippets Sharma AK, Pafčo B, Vlčková K, Červená B, Kreisinger J, Davison S, Beeri K, Fuh T, Leigh SR, Burns MB, Blekhman R, Petrželková KJ, Gomez A.
Show Full Abstract

<h4>Background</h4>Limited accessibility to intestinal epithelial tissue in wild animals and humans makes it challenging to study patterns of intestinal gene regulation, and hence to monitor physiological status and health in field conditions. To explore solutions to this limitation, we have used a noninvasive approach via fecal RNA-seq, for the quantification of gene expression markers in gastrointestinal cells of free-range primates and a forager human population. Thus, a combination of poly(A) mRNA enrichment and rRNA depletion methods was used in tandem with RNA-seq to quantify and compare gastrointestinal gene expression patterns in fecal samples of wild Gorilla gorilla gorilla (n = 9) and BaAka hunter-gatherers (n = 10) from The Dzanga Sangha Protected Areas, Central African Republic.<h4>Results</h4>Although only a small fraction (< 4.9%) of intestinal mRNA signals was recovered, the data was sufficient to detect significant functional differences between gorillas and humans, at the gene and pathway levels. These intestinal gene expression differences were specifically associated with metabolic and immune functions. Additionally, non-host RNA-seq reads were used to gain preliminary insights on the subjects' dietary habits, intestinal microbiomes, and infection prevalence, via identification of fungi, nematode, arthropod and plant RNA.<h4>Conclusions</h4>Overall, the results suggest that fecal RNA-seq, targeting gastrointestinal epithelial cells can be used to evaluate primate intestinal physiology and gut gene regulation, in samples obtained in challenging conditions in situ. The approach used herein may be useful to obtain information on primate intestinal health, while revealing preliminary insights into foraging ecology, microbiome, and diet.

Also flagged:KLRG1NKp46CD117CD127CRTH2NKp44
Journal Article 2019-06-14 ✓ 1 Snippet Nagasawa M, Heesters BA, Kradolfer CMA, Krabbendam L, Martinez-Gonzalez I, de Bruijn MJW, Golebski K, Hendriks RW, Stadhouders R, Spits H, Bal SM.
In-Text Gene Mentions

…, CD2 ,TNFSF4(OX40L), and TNFSF10…

Show Full Abstract

Recently, human ILCs that express CD117 and CD127 but lack CRTH2 and NKp44 have been shown to contain precursors of ILC1, ILC2, and ILC3. However, these ILCs have not been extensively characterized. We performed an unbiased hierarchical stochastic neighbor embedding (HSNE) analysis of the phenotype of peripheral blood CD117<sup>+</sup> ILCs, which revealed the presence of three major subsets: the first expressed NKp46, the second expressed both NKp46 and CD56, and the third expressed KLRG1, but not NKp46 or CD56. Analysis of their cytokine production profiles and transcriptome revealed that NKp46<sup>+</sup> ILCs predominantly develop into ILC3s; some of them can differentiate into ILC1/NK-like cells, but they are unable to develop into ILC2s. In contrast, KLRG1<sup>+</sup> ILCs predominantly differentiate into ILC2s. Single-cell cultures demonstrate that KLRG1<sup>+</sup> ILCs can also differentiate into other ILC subsets depending on the signals they receive. Epigenetic profiling of KLRG1<sup>+</sup> ILCs is consistent with the broad differentiation potential of these cells.

Also flagged:fluorlocalizationK27SaltMg2+nuclei
Journal Article 2019-06-14 ✓ 1 Snippet Gonzalez-Munoz E, Arboleda-Estudillo Y, Chanumolu SK, Otu HH, Cibelli JB.
In-Text Gene Mentions

…Sox2, Sox3 Sox4a,Sox6, Sox7, Sox9b, Sox10).…

Show Full Abstract

Mouse and cell-based studies have shown that macroH2A histone variants predominantly associate with heterochromatin. Functional studies found that macroH2As are involved in gene repression, inhibiting the acquisition of pluripotency and preserving cell differentiation. However, only a few studies have analysed the role of macroH2A during early embryo development. We report the development of transgenic zebrafish lines expressing macroH2A isoforms (mH2A1 and mH2A2) fusion proteins (with GFP) under identified endogenous promoters. We found that mH2A1 and mH2A2 have different spatial and temporal expression patterns during embryonic development. mH2A1 is expressed mostly in the extraembryonic Yolk Syncytial Layer (YSL) starting before shield stage and decreasing once morphogenesis is completed. mH2A2 expression lags behind mH2A1, becoming evident at 24 hpf, within the whole body of the embryo proper. Our ChIP-seq analysis showed that mH2A1 and mH2A2 bind to different DNA regions, changing dramatically after gastrulation. We further analysed RNA-seq data and showed that there is not a general/unspecific repressing function of mH2A1 or mH2A2 associated with heterochromatin but a fine regulation depending on cell types and stage of development. mH2A1 downregulates DNA expression in specific cells and embryo stages and its effect is independent of heterochromatin formation but it is correlated with nucleus quiescence instead. Whereas mH2A2 DNA association correlates with upregulation of differentially expressed genes between 75% epiboly and 24 hpf stages. Our data provide information for underlying molecules that participate in crucial early developmental events, and open new venues to explore mH2A related mechanisms that involve cell proliferation, differentiation, migration and metabolism.

Also flagged:Spinocerebellar ataxia type 3SCA3MJDpathogenesisataxin-3phosphoproteins
Journal Article 2019-06-14 ✓ 2 Snippets Wiatr K, Piasecki P, Marczak Ł, Wojciechowski P, Kurkowiak M, Płoski R, Rydzanicz M, Handschuh L, Jungverdorben J, Brüstle O, Figlerowicz M, Figiel M.
In-Text Gene Mentions

…Kif5b, Lzts1, Pak1,Plcl1, Ppfia3, Rab3gap1, Rims1,…

…mitophagy (Atg4b, Cttn,Htt, Tom1l2, Vdac1 (all…

Show Full Abstract

Spinocerebellar ataxia type 3 (SCA3/MJD) is a polyQ neurodegenerative disease where the presymptomatic phase of pathogenesis is unknown. Therefore, we investigated the molecular network of transcriptomic and proteomic triggers in young presymptomatic SCA3/MJD brain from Ki91 knock-in mouse. We found that transcriptional dysregulations resulting from mutant ataxin-3 are not occurring in young Ki91 mice, while old Ki91 mice and also postmitotic patient SCA3 neurons demonstrate the late transcriptomic changes. Unlike the lack of early mRNA changes, we have identified numerous early changes of total proteins and phosphoproteins in 2-month-old Ki91 mouse cortex and cerebellum. We discovered the network of processes in presymptomatic SCA3 with three main groups of disturbed processes comprising altered proteins: (I) modulation of protein levels and DNA damage (Pabpc1, Ddb1, Nedd8), (II) formation of neuronal cellular structures (Tubb3, Nefh, p-Tau), and (III) neuronal function affected by processes following perturbed cytoskeletal formation (Mt-Co3, Stx1b, p-Syn1). Phosphoproteins downregulate in the young Ki91 mouse brain and their phosphosites are associated with kinases that interact with ATXN3 such as casein kinase, Camk2, and kinases controlled by another Atxn3 interactor p21 such as Gsk3, Pka, and Cdk kinases. We conclude that the onset of SCA3 pathology occurs without altered transcript level and is characterized by changed levels of proteins responsible for termination of translation, DNA damage, spliceosome, and protein phosphorylation. This disturbs global cellular processes such as cytoskeleton and transport of vesicles and mitochondria along axons causing energy deficit and neurodegeneration also manifesting in an altered level of transcripts at later ages.

Also flagged:hepatitis C) infectionimmune responsesHCV infectionfatty acidsextracellular
Journal Article 2019-06-14 ✓ 1 Snippet Brochado-Kith Ó, Gómez Sanz A, Real LM, Crespo García J, Ryan Murúa P, Macías J, Cabezas González J, Troya J, Pineda JA, Arias Loste MT, Díez Viñas V, Jiménez-Sousa MÁ, Medrano de Dios LM, Cuesta De la Plaza I, Monzón Fernández S, Resino García S, Fernández-Rodríguez A.
In-Text Gene Mentions

…ropathies, autoimmune disease,hemochromatosis, cryoglobulinemia, primary bi…

Show Full Abstract

Factors involved in the spontaneous cleareance of a hepatitis C (HCV) infection are related to both HCV and the interaction with the host immune system, but little is known about the consequences after a spontaneous resolution. The main HCV extrahepatic reservoir is the peripheral blood mononuclear cells (PBMCs), and their transcriptional profile provides us information of innate and adaptive immune responses against an HCV infection. MicroRNAs regulate the innate and adaptive immune responses, and they are actively involved in the HCV cycle. High Throughput sequencing was used to analyze the miRNA profiles from PBMCs of HCV chronic naïve patients (CHC), individuals that spontaneously clarified HCV (SC), and healthy controls (HC). We did not find any differentially expressed miRNAs between SC and CHC. However, both groups showed similar expression differences (21 miRNAs) with respect to HC. This miRNA signature correctly classifies HCV-exposed (CHC and SC) vs. HC, with the has-miR-21-3p showing the best performance. The potentially targeted molecular pathways by these 21 miRNAs mainly belong to fatty acids pathways, although hippo signaling, extracellular matrix (ECM) interaction, proteoglycans-related, and steroid biosynthesis pathways were also altered. These miRNAs target host genes involved in an HCV infection. Thus, an HCV infection promotes molecular alterations in PBMCs that can be detected after an HCV spontaneous resolution, and the 21-miRNA signature is able to identify HCV-exposed patients (either CHC or SC).

Also flagged:Programmed Death Ligand 1antibodieshematologic tumorsprogrammed cell death protein 1PD-1PDCD1
Journal Article 2019-06-14 No Snippets Shen X, Zhang L, Li J, Li Y, Wang Y, Xu ZX.
Show Full Abstract

With the recent approvals for the application of monoclonal antibodies that target the well-characterized immune checkpoints, immune therapy shows great potential against both solid and hematologic tumors. The use of these therapeutic monoclonal antibodies elicits inspiring clinical results with durable objective responses and improvements in overall survival. Agents targeting programmed cell death protein 1 (PD-1; also known as PDCD1) and its ligand (PD-L1) achieve a great success in immune checkpoints therapy. However, the majority of patients fail to respond to PD-1/PD-L1 axis inhibitors. Expression of PD-L1 on the membrane of tumor and immune cells has been shown to be associated with enhanced objective response rates to PD-1/PD-L1 inhibition. Thus, an improved understanding of how PD-L1 expression is regulated will enable us to better define its role as a predictive marker. In this review, we summarize recent findings in the regulation of PD-L1 expression.

Also flagged:PEO Syndromeprogressive external ophthalmoplegiaribonuclease H1ethidium bromidemitochondrial myopathyRNASEH1
Journal Article 2019-06-14 ✓ 1 Snippet Carreño-Gago L, Blázquez-Bermejo C, Díaz-Manera J, Cámara Y, Gallardo E, Martí R, Torres-Torronteras J, García-Arumí E.
In-Text Gene Mentions

…( DGUOK, DNA2,FBXL4, MGME1, MFN2, MPV17,…

Show Full Abstract

Mitochondrial DNA (mtDNA) depletion and deletion syndrome encompasses a group of disorders caused by mutations in genes involved in mtDNA replication and maintenance. The clinical phenotype ranges from fatal infantile hepatocerebral forms to mild adult onset progressive external ophthalmoplegia (PEO). We report the case of a patient with PEO and multiple mtDNA deletions, with two new homozygous mutations in <i>RNASEH1</i>. The first mutation (c.487T>C) is located in the same catalytic domain as the four previously reported mutations, and the second (c.258_260del) is located in the connection domain, where no mutations have been reported. <i>In silico</i> study of the mutations predicted only the first mutation as pathogenic, but functional studies showed that both mutations cause loss of ribonuclease H1 activity. mtDNA replication dysfunction was demonstrated in patient fibroblasts, which were unable to recover normal mtDNA copy number after ethidium bromide-induced mtDNA depletion. Our results demonstrate the pathogenicity of two new <i>RNASEH1</i> variants found in a patient with PEO syndrome, multiple deletions, and mild mitochondrial myopathy.

Also flagged:melanomafolate aciddextranlauryl alcoholNF-κBtumor
Journal Article 2019-06-14 No Snippets Liu C, Chen W, Chen Z, Yan Y, Wang Q, Xie H, Chen X, Wang A, Tang S, Zhou J.
Show Full Abstract

<b>Background:</b> IMD-0354 is a kind of hydrophobic small molecule inhibitor of IKKβ, which can effectively inhibit the NF-κB pathway. Besides, IMD-0354 can inhibit a variety of tumor cells in culture, but its poor water solubility and low utilization have limited its clinical application. <b>Methods:</b> In this study, IMD-0354 was synthesized through esterifying the folate acid (FA) conjugated dextran (Dex) as well as the lauryl alcohol (LA). <b>Results:</b>The particle (IMD/FA-Dex-LA) size was 212.13±10.62nm, the encapsulation efficiency was 89.27±6.51%, and the drug loading was 4.25±0.42%. Cell viability studies indicated that the IMD/FA-Dex-LA effectively inhibited survival of B16F10 cells in culture. Meanwhile, Western Blotting results showed that the nuclear transport of NF-κB was reduced after blocking the IKK pathway, which would thereby suppress melanoma cell division and proliferation. Moreover, subcutaneous tumor implantation experiment revealed that, the drug-loading complex had an obvious effect on suppressing melanoma cells. Findings of this study demonstrated that the IMD-0354 loaded FA-Dex-LA was more effective than IMD-0354 alone. <b>Conclusion:</b> In summary, FA-Dex-LA has been successfully synthesized in this study, which can serve as a carrier for hydrophobic drug. Further, it is believed the FA-Dex-LA can potentially applied in cancer treatment.

Also flagged:lung adenocarcinomaLUADtranscription factorsdeathnucleosomemicrotubule
Journal Article 2019-06-14 ✓ 1 Snippet Zhai Y, Chen Y, Li Q, Zhang L.
In-Text Gene Mentions

…the role ofMMS22L-TONSL in DNA recombination.…

Show Full Abstract

In order to investigate the oncogenic mechanisms of lung adenocarcinoma (LUAD), hub genes can be identified by constructing co-expression networks, and the potential linkages between hub genes, transcription factors (TFs) and microRNAs (miRNAs/miRs) can be visualized and identified. In the present study, a total of 12 co-expressed modules were constructed, and 9 of these were significantly correlated with clinical traits in LUAD. The differentially expressed genes and differentially expressed miRNAs were determined, and the targets of differentially expressed miRNA were identified from the hub genes or TFs. The results of the present study demonstrated that 10 hub genes and 12 TFs are the predicted targets for the 5 and 8 differentially expressed miRNAs, respectively. Genes in pink and red modules, which have a high correlation with the clinical trait of days to death, are significantly enriched in 'nucleosome assembly' and 'microtubule-based process', respectively. These results indicated that miR-206, miR-137, miR-153, hub genes and enriched TFs in the pink and red modules exert a potentially pivotal function in the development of LUAD.

Also flagged:hydroxyapatitebone formationaragoniteosteoporosiscell proliferationsynthesis
Journal Article 2019-06-14 No Snippets Aminatun A, Handayani FDE, Widiyanti P, Winarni D, Siswanto S.
Show Full Abstract

<h4>Background</h4>Hydroxyapatite (HA) from bovine bone has been widely used as bone filler in many fractures cases. HA can also be made from cuttlefish bone (<i>Sepia</i> spp.) that has abundant availability in Indonesia and contains 84% CaCO<sub>3</sub>, which is a basic ingredient of HA. However, research on the effects of HA from cuttlefish bone on bone regeneration parameters has not been done yet.<h4>Aim</h4>This study aimed to determine femur bone regeneration of white rats (<i>Rattus norvegicus</i>) through the use of HA from cuttlefish bone (<i>Sepia</i> spp.) as bone filler.<h4>Materials and methods</h4>HA was made using the hydrothermal method by mixing 1M aragonite (CaCO<sub>3</sub>) from cuttlefish bone and 0.6 M NH<sub>4</sub>H<sub>2</sub>PO<sub>4</sub> at 200°C for 12 h followed by sintering at 900°C for 1 h. <i>In vivo</i> test was carried out in three groups, including control group, bovine bone-derived HA group, and cuttlefish bone-derived HA group. The generation of femur bone was observed through the number of osteoblasts, osteoclasts, woven bone, lamellar bone, havers system, and repair bone through anatomical pathology test for 28 days and 56 days.<h4>Results</h4>Anatomical pathology test results are showed that administration of bovine bone-derived HA and cuttlefish bone-derived HA increased the number of osteoblasts, osteoclasts, woven bone, lamellar bone, havers system, and bone repair at recuperation of 56 days. Statistical test using Statistical Package for the Social Sciences with Kruskal-Wallis and Mann-Whitney U-test was resulted in significant differences between the bovine bone-derived HA control group and the cuttlefish-derived HA control group. There was no significant difference toward the indication of bone formation through the growth of osteoblasts, osteoclasts, woven bone, lamellar bone, havers system, and bone repair in the bovine bone-derived HA and cuttlefish bone-derived HA groups.<h4>Conclusion</h4>It can be concluded that cuttlefish bone-derived HA has the potential as bone filler based on the characteristics of bone regeneration through <i>in vivo</i> test.

Also flagged:Polymerpolymerspolyisocyanopeptidescopolymerazidealkyne
Journal Article 2019-06-13 No Snippets Voerman D, Schluck M, Weiden J, Joosten B, Eggermont LJ, van den Eijnde T, Ignacio B, Cambi A, Figdor CG, Kouwer PHJ, Verdoes M, Hammink R, Rowan AE.
Show Full Abstract

Polymer brushes are extensively used for the preparation of bioactive surfaces. They form a platform to attach functional (bio)molecules and control the physicochemical properties of the surface. These brushes are nearly exclusively prepared from flexible polymers, even though much stiffer brushes from semiflexible polymers are frequently found in nature, which exert bioactive functions that are out of reach for flexible brushes. Synthetic semiflexible polymers, however, are very rare. Here, we use polyisocyanopeptides (PICs) to prepare high-density semiflexible brushes on different substrate geometries. For bioconjugation, we developed routes with two orthogonal click reactions, based on the strain-promoted azide-alkyne cycloaddition reaction and the (photoactivated) tetrazole-ene cycloaddition reaction. We found that for high brush densities, multiple bonds between the polymer and the substrate are necessary, which was achieved in a block copolymer strategy. Whether the desired biomolecules are conjugated to the PIC polymer before or after brush formation depends on the dimensions and required densities of the biomolecules and the curvature of the substrate. In either case, we provide mild, aqueous, and highly modular reaction strategies, which make PICs a versatile addition to the toolbox for generating semiflexible bioactive polymer brush surfaces.

Also flagged:dopamineamphetaminebehavioralNetrin-1nucleusaxons
Journal Article 2019-06-13 ✓ 5 Snippets Cuesta S, Restrepo-Lozano JM, Popescu C, He S, Reynolds LM, Israel S, Hernandez G, Rais R, Slusher BS, Flores C.
In-Text Gene Mentions

In contrast to the high doses, the low amphetamine regimen does not alter Dcc mRNA or miR-218 expression; instead, it upregulates DCC protein levels.

Repeated exposure to an amphetamine regimen of 4 mg/kg during early adolescence induces, in male mice, downregulation of DCC expression in dopamine neurons by recruiting the Dcc microRNA repressor, microRNA-218 (miR-218).

…guidance cue receptorDCCcontrols mesocortical dopamine…

…mice, downregulation ofDCCexpression in dopamine…

…by recruiting theDccmicroRNA repressor, microRNA-2…

Show Full Abstract

The guidance cue receptor DCC controls mesocortical dopamine development in adolescence. Repeated exposure to an amphetamine regimen of 4 mg/kg during early adolescence induces, in male mice, downregulation of DCC expression in dopamine neurons by recruiting the Dcc microRNA repressor, microRNA-218 (miR-218). This adolescent amphetamine regimen also disrupts mesocortical dopamine connectivity and behavioral control in adulthood. Whether low doses of amphetamine in adolescence induce similar molecular and developmental effects needs to be established. Here, we quantified plasma amphetamine concentrations in early adolescent mice following a 4 or 0.5 mg/kg dose and found peak levels corresponding to those seen in humans following recreational and therapeutic settings, respectively. In contrast to the high doses, the low amphetamine regimen does not alter Dcc mRNA or miR-218 expression; instead, it upregulates DCC protein levels. Furthermore, high, but not low, drug doses downregulate the expression of the DCC receptor ligand, Netrin-1, in the nucleus accumbens and prefrontal cortex. Exposure to the low-dose regimen did not alter the expanse of mesocortical dopamine axons or their number/density of presynaptic sites in adulthood. Strikingly, adolescent exposure to the low-dose drug regimen does not impair behavioral inhibition in adulthood; instead, it induces an overall increase in performance in a go/no-go task. These results show that developmental consequences of exposure to therapeutic- versus abused-like doses of amphetamine in adolescence have dissimilar molecular signatures and opposite behavioral effects. These findings have important clinical relevance since amphetamines are widely used for therapeutic purposes in youth.

Also flagged:Clear Cell Renal Cell CarcinomaccRCCOTX1MATN4PI3ERVV-2
Journal Article 2019-06-13 No Snippets Pan Q, Wang L, Zhang H, Liang C, Li B.
Show Full Abstract

BACKGROUND Although the mortality rates of clear cell renal cell carcinoma (ccRCC) have decreased in recent years, the clinical outcome remains highly dependent on the individual patient. Therefore, identifying novel biomarkers for ccRCC patients is crucial. MATERIAL AND METHODS In this study, we obtained RNA sequencing data and clinical information from the TCGA database. Subsequently, we performed integrated bioinformatic analysis that includes differently expressed genes analysis, gene ontology and KEGG pathway analysis, protein-protein interaction analysis, and survival analysis. Moreover, univariate and multivariate Cox proportional hazards regression models were constructed. RESULTS As a result, we identified a total of 263 dysregulated genes that may participate in the metastasis of ccRCC, and established a predictive signature relying on the expression of OTX1, MATN4, PI3, ERVV-2, and NFE4, which could serve as significant progressive and prognostic biomarkers for ccRCC. CONCLUSIONS We identified differentially expressed genes that may be involved in the metastasis of ccRCC. Moreover, a predictive signature based on the expression of OTX1, MATN4, PI3, ERVV-2, and NFE4 could be an independent prognostic factor for ccRCC.

Also flagged:ChronicMCPneurogenesiscell-cyclemajor depressive disorderasthma
Journal Article 2019-06-13 ✓ 5 Snippets Johnston KJA, Adams MJ, Nicholl BI, Ward J, Strawbridge RJ, Ferguson A, McIntosh AM, Bailey MES, Smith DJ.
In-Text Gene Mentions
⭐ same-sentence co-mention

DCC and SOX5 (which jointly functions with SOX6 in chondrogenesis) have been associated with chronic back pain [92], GABRB3 (encoding one of three beta subunits of the GABA A receptor along with GABRB2) has been associated with migraine and fibromyalgia [10], and ASTN2 and SLC24A3 have been associated with migraine [10,93]

…and synaptic plasticity,DCC-mediated attractive signallin…

…interesting genes includedDCC(Deleted in Colorectal…

…receptor) which encodesDCC, the receptor for…

SOX6(SRY-Box 6) is…

Show Full Abstract

Chronic pain is highly prevalent worldwide and represents a significant socioeconomic and public health burden. Several aspects of chronic pain, for example back pain and a severity-related phenotype 'chronic pain grade', have been shown previously to be complex heritable traits with a polygenic component. Additional pain-related phenotypes capturing aspects of an individual's overall sensitivity to experiencing and reporting chronic pain have also been suggested as a focus for investigation. We made use of a measure of the number of sites of chronic pain in individuals within the UK general population. This measure, termed Multisite Chronic Pain (MCP), is a complex trait and its genetic architecture has not previously been investigated. To address this, we carried out a large-scale genome-wide association study (GWAS) of MCP in ~380,000 UK Biobank participants. Our findings were consistent with MCP having a significant polygenic component, with a Single Nucleotide Polymorphism (SNP) heritability of 10.2%. In total 76 independent lead SNPs at 39 risk loci were associated with MCP. Additional gene-level association analyses identified neurogenesis, synaptic plasticity, nervous system development, cell-cycle progression and apoptosis genes as enriched for genetic association with MCP. Genetic correlations were observed between MCP and a range of psychiatric, autoimmune and anthropometric traits, including major depressive disorder (MDD), asthma and Body Mass Index (BMI). Furthermore, in Mendelian randomisation (MR) analyses a causal effect of MCP on MDD was observed. Additionally, a polygenic risk score (PRS) for MCP was found to significantly predict chronic widespread pain (pain all over the body), indicating the existence of genetic variants contributing to both of these pain phenotypes. Overall, our findings support the proposition that chronic pain involves a strong nervous system component with implications for our understanding of the physiology of chronic pain. These discoveries may also inform the future development of novel treatment approaches.

Also flagged:menopauseacetylcholinesterasebindingadrenergic alpha 2Amuscarinic M3 receptorsserotonin transporter
Journal Article 2019-06-13 ✓ 1 Snippet Tober C, Schoop R.
In-Text Gene Mentions

…The5-HTTserotonin transporter binding…

Show Full Abstract

<h4>Background</h4>Salvia officinalis has been used successfully for the treatment of hot flushes and excessive sweating during menopause. However, modes of actions have not been elucidated conclusively. We explored its pharmacology beyond any hormonal activity with a focus on neurologic impulse transmission.<h4>Methods</h4>A hydroalcoholic, thujone-free extract from freshly harvested Salvia officinalis leaves (A.Vogel Menosan®) was investigated in an acetylcholinesterase enzyme assay and several receptor binding assays (adrenergic alpha 2A, GABA (benzodiazepine site), GABA<sub>B</sub>; muscarinic M3, μ-opioid, serotonin 5-HT<sub>1A</sub>, serotonin 5-HT<sub>2B</sub>, serotonin 5-HT<sub>2C</sub> and serotonin transporter). The influence of the manufacturing process on additional extracts from different fresh or dry plant parts was studied.<h4>Results</h4>The Salvia officinalis extract replaced 50% of specific ligand binding to GABA<sub>A</sub> and GABA<sub>B</sub> receptors at an inhibitory concentration (IC<sub>50</sub>) of 89 and 229 μg/ml, respectively. Strong binding affinity was observed for the adrenergic α<sub>2A</sub> receptor, μ-opioid receptors, muscarinic M3 receptors, and serotonin 5-HT<sub>1A</sub> receptors, with IC<sub>50</sub> values of 15 μg/ml, 20 μg/ml, 25 μg/ml and 19 μg/ml, respectively. Moderate interference with 5-HT<sub>2B</sub>, 5-HT<sub>2C</sub> receptors, and the human serotonin transporter was found, all with IC<sub>50</sub> values above 32 μg/ml. Receptor binding data of Salvia extract were confirmed in native female hypothalamic tissue from two women (51 and 37 years old). Use of freshly harvested Salvia leaves resulted in 2- to 4-fold higher activity/lower IC<sub>50</sub> values compared to extracts from dried plants or stipes.<h4>Conclusion</h4>Our results suggest potent modulation of neuro-receptors and of serotonin transporters as mode of action for Salvia officinalis alcoholic extract, which may normalize thermoregulation and possibly also mental impairment during menopause.

Also flagged:PD-1mitochondrialPD-L1cancerCD3CD28
Journal Article 2019-06-13 ✓ 1 Snippet Ogando J, Sáez ME, Santos J, Nuevo-Tapioles C, Gut M, Esteve-Codina A, Heath S, González-Pérez A, Cuezva JM, Lacalle RA, Mañes S.
In-Text Gene Mentions

…translation ( POP7,MRPL39, MRPS12 ), protein…

Show Full Abstract

<h4>Background</h4>Binding of the programmed death-1 (PD-1) receptor to its ligands (PD-L1/2) transduces inhibitory signals that promote exhaustion of activated T cells. Blockade of the PD-1 pathway is widely used for cancer treatment, yet the inhibitory signals transduced by PD-1 in T cells remain elusive.<h4>Methods</h4>Expression profiles of human CD8<sup>+</sup> T cells in resting, activated (CD3 + CD28) and PD-1-stimulated cells (CD3 + CD28 + PD-L1-Fc) conditions were evaluated by RNA-seq. Bioinformatic analyses were used to identify signaling pathways differentially regulated in PD-1-stimulated cells. Metabolic analyses were performed with SeaHorse technology, and mitochondrial ultrastructure was determined by transmission electron microscopy. PD-1-regulated mitochondrial genes were silenced using short-hairpin RNA in primary cells. Blue native gel electrophoresis was used to determine respiratory supercomplex assembly.<h4>Results</h4>PD-1 engagement in human CD8<sup>+</sup> T cells triggers a specific, progressive genetic program different from that found in resting cells. Gene ontology identified metabolic processes, including glycolysis and oxidative phosphorylation (OXPHOS), as the main pathways targeted by PD-1. We observed severe functional and structural alterations in the mitochondria of PD-1-stimulated cells, including a reduction in the number and length of mitochondrial cristae. These cristae alterations were associated with reduced expression of CHCHD3 and CHCHD10, two proteins that form part of the mitochondrial contact site and cristae organizing system (MICOS). Although PD-1-stimulated cells showed severe cristae alterations, assembly of respiratory supercomplexes was unexpectedly greater in these cells than in activated T cells. CHCHD3 silencing in primary CD8<sup>+</sup> T cells recapitulated some effects induced by PD-1 stimulation, including reduced mitochondrial polarization and interferon-γ production following T cell activation with anti-CD3 and -CD28 activating antibodies.<h4>Conclusions</h4>Our results suggest that mitochondria are the main targets of PD-1 inhibitory activity. PD-1 reprograms CD8<sup>+</sup> T cell metabolism for efficient use of fatty acid oxidation; this mitochondrial phenotype might explain the long-lived phenotype of PD-1-engaged T cells.

Also flagged:Knl1microcephalyspindle assembly checkpointchromosomechromosomesp53
Journal Article 2019-06-13 ✓ 2 Snippets Shi L, Qalieh A, Lam MM, Keil JM, Kwan KY.
In-Text Gene Mentions

…(Abcam, 1:500), goat anti-POU3F2(BRN2) (Santa Cruz…

…However,POU3F2-expressing L2–5 neurons were…

Show Full Abstract

The brain is a genomic mosaic shaped by cellular responses to genome damage. Here, we manipulate somatic genome stability by conditional Knl1 deletion from embryonic mouse brain. KNL1 mutations cause microcephaly and KNL1 mediates the spindle assembly checkpoint, a safeguard against chromosome missegregation and aneuploidy. We find that following Knl1 deletion, segregation errors in mitotic neural progenitor cells give rise to DNA damage on the missegregated chromosomes. This triggers rapid p53 activation and robust apoptotic and microglial phagocytic responses that extensively eliminate cells with somatic genome damage, thus causing microcephaly. By leaving only karyotypically normal progenitors to continue dividing, these mechanisms provide a second safeguard against brain somatic aneuploidy. Without Knl1 or p53-dependent safeguards, genome-damaged cells are not cleared, alleviating microcephaly, but paradoxically leading to total pre-weaning lethality. Thus, mitotic genome damage activates robust responses to eliminate somatic mutant cells, which if left unpurged, can impact brain and organismal fitness.

Also flagged:ion channelstransportersgene expressionIon Channels and TransporterscancerFollicular Lymphoma
Journal Article 2019-06-13 ✓ 3 Snippets Magi A, Masselli M, Sala C, Guerriero A, Laise P, Puccini B, Rigacci L, Breschi C, Crociani O, Pillozzi S, Arcangeli A.
In-Text Gene Mentions

The seven ICT DE genes not overlapping between the DLBCL and the FC-46-ICT signature (reported in bold in Table 3) were the followings: ANXA8, ATP9A, CACNA1E, CACNA1I, SLC26A1, SLC27A1, SLC7A4. This is apparently a DLBCL-specific ICT signature.

…, ATP9A ,CACNA1E, CACNA1I ,…

…(and the correlatedCACNA1E) which encodes…

Show Full Abstract

The definition of the gene expression profile of genes encoding Ion Channels and Transporters (ICT-GEP) represents a novel and attracting aspect in cancer. We determined the ICT-GEP of Follicular Lymphoma (FL), and compared it with that of the more aggressive Diffuse Large B Cell Lymphoma (DLBCL). cDNA microarray data were collected both from patients enrolled for this study, and from public datasets. In FL the ICT-GEP indicated the overexpression of both the K<sup>+</sup> channel encoding gene KCNN4, and SLC2A1, which encodes the Glut1 glucose transporter. SLC2A1 turned out to represent the hub of a functional network, connecting channels and transporters in FL. Relapsed FL patients were characterised by 38 differentially expressed ICT genes, among which ATP9A, SLC2A1 and KCNN4 were under-expressed, indicating a down-regulation of both excitability and glycolysis. A completely different profile of K<sup>+</sup> channel encoding genes emerged in DLBCL accompanied by the over-expression of the fatty acid transporter-encoding gene SLC27A1 as well as of the metabolism regulator NCoR1. This indicates a change in excitability and a shift towards an oxidative metabolism in DLBCL. Overall, the ICT-GEP may contribute to identifying novel lymphoma biomarkers related to excitability and metabolic pathways, with particular relevance for drug resistant, relapsed FL.

Also flagged:organizationoxygenmetabolismhypertensioncardiovascular diseasehatching
Journal Article 2019-06-13 ✓ 2 Snippets Alderman SL, Crossley DA, Elsey RM, Gillis TE.
In-Text Gene Mentions

hypoxia, we found increased abundances of proteins associated with fatty acid oxidation (e.g. acyl-CoA dehydrogenase family member 10, ACAD10; acyl-CoA thioesterase 2, ACOT2, and enoyl-CoA delta isomerase 1, ECI2 in juvenile hearts), the TCA cycle (e.g. aconitase 1 and 2), and oxidative phosphorylation (e.g. cytochrome oxidase subunit II, COX2; cytochrome C somatic, CYCS

…delta isomerase 1,ECI2in juvenile hearts),…

Show Full Abstract

Hypoxic exposure during development can have a profound influence on offspring physiology, including cardiac dysfunction, yet many reptile embryos naturally experience periods of hypoxia in buried nests. American alligators experimentally exposed to developmental hypoxia demonstrate morphological and functional changes to the heart that persist into later life stages; however, the molecular bases of these changes remain unknown. We tested if targeted and persistent changes in steady-state protein expression underlie this hypoxic heart phenotype, using isobaric tags for relative and absolute quantitation (iTRAQ) proteomics. Alligator eggs were reared under normoxia or 10% hypoxia, then either sampled (embryo) or returned to normoxia for 2 years (juvenile). Three salient findings emerge from the integrated analysis of the 145 differentially expressed proteins in hypoxia-reared animals: (1) significant protein-protein interaction networks were identified only in up-regulated proteins, indicating that the effects of developmental hypoxia are stimulatory and directed; (2) the up-regulated proteins substantially enriched processes related to protein turnover, cellular organization, and metabolic pathways, supporting increased resource allocation towards building and maintaining a higher functioning heart; and (3) the juvenile cardiac proteome retained many of the signature changes observed in embryonic hearts, supporting long-term reprogramming of cardiac myocytes induced by hypoxia during critical periods of development.

Also flagged:extracellularproteoglycanssynapsematrix metalloproteinasesdendritesbehavioral
Journal Article 2019-06-13 No Snippets Krishnaswamy VR, Benbenishty A, Blinder P, Sagi I.
Show Full Abstract

The extracellular matrix (ECM) plays diverse roles in several physiological and pathological conditions. In the brain, the ECM is unique both in its composition and in functions. Furthermore, almost all the cells in the central nervous system contribute to different aspects of this intricate structure. Brain ECM, enriched with proteoglycans and other small proteins, aggregate into distinct structures around neurons and oligodendrocytes. These special structures have cardinal functions in the normal functioning of the brain, such as learning, memory, and synapse regulation. In this review, we have compiled the current knowledge about the structure and function of important ECM molecules in the brain and their proteolytic remodeling by matrix metalloproteinases and other enzymes, highlighting the special structures they form. In particular, the proteoglycans in brain ECM, which are essential for several vital functions, are emphasized in detail.

Also flagged:Metalloproteinasesage-neurodegenerative diseasesmatrix metalloproteinasesMMPa disintegrin and metalloproteinase
Journal Article 2019-06-13 ✓ 1 Snippet Rivera S, García-González L, Khrestchatisky M, Baranger K.
In-Text Gene Mentions

Htt

Show Full Abstract

As life expectancy increases worldwide, age-related neurodegenerative diseases will increase in parallel. The lack of effective treatment strategies may soon lead to an unprecedented health, social and economic crisis. Any attempt to halt the progression of these diseases requires a thorough knowledge of the pathophysiological mechanisms involved to facilitate the identification of new targets and the application of innovative therapeutic strategies. The metzincin superfamily of metalloproteinases includes matrix metalloproteinases (MMP), a disintegrin and metalloproteinase (ADAM) and ADAM with thrombospondin motifs (ADAMTS). These multigenic and multifunctional proteinase families regulate the functions of an increasing number of signalling and scaffolding molecules involved in neuroinflammation, blood-brain barrier disruption, protein misfolding, synaptic dysfunction or neuronal death. Metalloproteinases and their physiological inhibitors, the tissue inhibitors of metalloproteinases (TIMPs), are therefore, at the crossroads of molecular and cellular mechanisms that support neurodegenerative processes, and emerge as potential new therapeutic targets. We provide an overview of current knowledge on the role and regulation of metalloproteinases and TIMPs in four major neurodegenerative diseases: Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis and Huntington's disease.

Also flagged:cyclic iminecyclic iminesInfectious diseasesinfluenzahepatitis Binfection
Journal Article 2019-06-13 No Snippets Hermawan I, Higa M, Hutabarat PUB, Fujiwara T, Akiyama K, Kanamoto A, Haruyama T, Kobayashi N, Higashi M, Suda S, Tanaka J.
Show Full Abstract

On our quest for new bioactive molecules from marine sources, two cyclic imines (<b>1</b>, <b>2</b>) were isolated from a dinoflagellate extract, inhibiting the growth of the respiratory syncytial virus (RSV). Compound <b>1</b> was identified as a known molecule portimine, while <b>2</b> was elucidated to be a new cyclic imine, named kabirimine. The absolute stereochemistry of <b>1</b> was determined by crystallographic work and chiral derivatization, whereas the structure of <b>2</b> was elucidated by means of spectroscopic analysis and computational study on all the possible isomers. Compound <b>1</b> showed potent cytotoxicity (CC<sub>50</sub> < 0.097 µM) against HEp2 cells, while <b>2</b> exhibited moderate antiviral activity against RSV with IC<sub>50</sub> = 4.20 µM (95% CI 3.31-5.33).

Also flagged:Thyroid DisordersAnaplastic thyroid cancerB-Rafrapidly accelerated fibrosarcomadeoxyribonucleic acidthyroid cancer
Journal Article 2019-06-13 No Snippets Grimm D.
Show Full Abstract

The thyroid is a hormone gland involved in metabolism, regulatory functions, growth, and development of the human organism [...].

Also flagged:Rac1G proteininsulinsecretionhyperglycemiaGPCR
Journal Article 2019-06-13 No Snippets Damacharla D, Thamilselvan V, Zhang X, Mestareehi A, Yi Z, Kowluru A.
Show Full Abstract

Rac1, a small G protein, regulates physiological insulin secretion from the pancreatic β-cell. Interestingly, Rac1 has also been implicated in the onset of metabolic dysfunction of the β-cell under the duress of hyperglycemia (HG). This study is aimed at the identification of interaction partners of Rac1 in β-cells under basal and HG conditions. Using co-immunoprecipitation and UPLC-ESI-MS/MS, we identified 324 Rac1 interaction partners in INS-1832/13 cells, which represent the largest Rac1 interactome to date. Furthermore, we identified 27 interaction partners that exhibited increased association with Rac1 in β-cells exposed to HG. Western blotting (INS-1832/13 cells, rat islets and human islets) and co-immunoprecipitation (INS-1832/13 cells) further validated the identity of these Rac1 interaction partners including regulators of GPCR-G protein-effector coupling in the islet. These data form the basis for future investigations on contributory roles of these Rac1-specific signaling pathways in islet β-cell function in health and diabetes.

Also flagged:serotonin5-HTaffective disordersnucleusVGluT3-
Journal Article 2019-06-13 ✓ 1 Snippet Sengupta A, Holmes A.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Despite a wealth of clinical and preclinical data implicating the serotonin (5-HT) system in fear-related affective disorders, a precise definition of this neuromodulator's role in fear remains elusive. Using convergent anatomical and functional approaches, we interrogate the contribution to fear of basal amygdala (BA) 5-HT inputs from the dorsal raphe nucleus (DRN). We show the DRN→BA 5-HT pathway is engaged during fear memory formation and retrieval, and activity of these projections facilitates fear and impairs extinction. The DRN→BA 5-HT pathway amplifies fear-associated BA neuronal firing and theta power and phase-locking. Although fear recruits 5-HT and VGluT3 co-expressing DRN neurons, the fear-potentiating influence of the DRN→BA 5-HT pathway requires signaling at BA 5-HT1A/2A receptors. Input-output mapping illustrates how the DRN→BA 5-HT pathway is anatomically distinct and connected with other brain regions that mediate fear. These findings reveal how a discrete 5-HT circuit orchestrates a broader neural network to calibrate aversive memory.

Also flagged:spc1spc3gpc3-BPcpc2
Journal Article 2019-06-13 ✓ 1 Snippet Hendrickx C, Abdala F, Choiniere JN.
In-Text Gene Mentions

…al accessory ridge; dcc, distal cingular cu…

Show Full Abstract

Gomphodont cynodonts were close relatives of mammals and one of the Mesozoic lineages of cynodont therapsids that became extinct at the end of the Triassic. Gomphodonts were omnivorous to herbivorous animals characterized by labiolingually expanded postcanines, which allowed tooth-to-tooth occlusion. The morphology of the upper and lower postcanines presents important means of distinguishing among major lineages within Gomphodontia, that is, Diademodontidae, Trirachodontidae, and Traversodontidae, but the dentition of most Diademodontidae and Trirachodontidae remain poorly documented. Here, we present a comprehensive description of the dentition of each diademodontid and trirachodontid species, as well as detailed illustrations of each dental unit, after firsthand examination of material and 3D reconstructions of postcanine teeth. Based on dental morphology, <i>Trirachodon berryi</i> and "<i>Trirachodon kannemeyeri</i>," considered as separate taxa by some authors are here interpreted as representing different ontogenetic stages of the same species. Likewise, <i>Sinognathus</i> and <i>Beishanodon</i>, thought to belong to non-cynognathian cynodonts and traversodontids by some authors, are referred to Trirachodontidae and Gomphodontia based on dental characters, respectively. Finally, we propose a standardized list of terms and abbreviations for incisors, canines, and postcanines anatomical entities, with the goal of facilitating future descriptions and communication between researchers studying the gomphodont dentition.

Also flagged:Natural killer/T-cell lymphomanon-Hodgkin's lymphomagene expressionPI3KAKTNF-κB
Journal Article 2019-06-13 ✓ 1 Snippet Mei M, Zhang M.
In-Text Gene Mentions

ZNFX1antisense RNA 1…

Show Full Abstract

Natural killer/T-cell lymphoma (NKTCL) is a rare and aggressive subtype of non-Hodgkin's lymphoma that is associated with a poor outcome. Non-coding RNAs (ncRNAs), which account for 98% of human RNAs, lack the function of encoding proteins but instead have the important function of regulating gene expression, including transcription, translation, RNA splicing, editing, and turnover. However, the roles and mechanisms of aberrantly expressed ncRNAs in NKTCL are not fully clear. Aberrant expressions of microRNA (miRNAs) affect the PI3K/AKT signaling pathways (miRNA-21, miRNA-155, miRNA-150, miRNA-142, miRNA-494), NF-κB (miRNA-146a, miRNA-155) and cell cycle signaling pathways to regulate cell function. Moreover, Epstein-Barr virus (EBV) encoded miRNAs and EBV oncoprotein LMP-1 regulated the expression of cellular genes that induce invasion, metastasis, cell cycle progression and cellular transformation. In addition, NKTCL-associated Long non-coding RNA (lncRNA) <i>ZFAS1</i> regulated certain pathways and lncRNA <i>MALAT1</i> acted as a predictive marker. This review article provides an overview of ncRNAs associated with NKTCL, summarizes the function of significantly differentially expressed hotspot non-coding RNAs that contribute to the pathogenesis, diagnoses, treatment and prognosis of NKTCL and discusses the relevance of these ncRNAs to clinical practice.

Also flagged:biarylsamidealdehydehemiaminalalcoholsthiols
Journal Article 2019-06-13 No Snippets Zheng H, Ni C, Chen H, Zha D, Hai Y, Ye H, You L.
Show Full Abstract

A strategy of dynamic covalent chemistry within constrained biaryls was developed for the modulation of axial chirality. The ring fusion partners of amide and aldehyde allowed the manipulation of ring/chain equilibrium and chirality transfer within cyclic diastereomeric hemiaminal. Dynamic covalent reactions (DCRs) with alcohols, thiols, and secondary amines further enabled the reversal of chirality relay and thereby regulation of axial chirality. Moreover, a combination of NMR, X-ray, and density functional theory results shed light on the structural basis of chirality transfer, exhibiting modest to excellent diastereoselectivity under thermodynamic control. The critical role of the amide unit in the modulation of axial chirality was also corroborated. Finally, the chiroptical signal was controlled through changing solvents, DCRs, and stimuli-responsive switching of DCRs.

bioRxiv 2019-06-13 Preprint (No Snippets API) Schlauch KA, Read RW, Lombardi VC, Elhanan G, Metcalf WJ, Slonim AD, the 23andMe Research Team, Grzymski JJ.
Show Full Abstract

The aggregation of Election Health Records (EHR) and personalized genetics leads to powerful discoveries relevant to population health. Here we perform genome-wide association studies (GWAS) and accompanying phenome-wide association studies (PheWAS) to validate phenotype-genotype associations of BMI, and to a greater extent, severe Class 2 obesity, using comprehensive diagnostic and clinical data from the EHR database of our cohort. Three GWASs of 500,000 variants on the Illumina platform of 6,645 Healthy Nevada participants identified several published and novel variants that affect BMI and obesity. Each GWAS was followed with two independent PheWASs to examine associations between extensive phenotypes (incidence of diagnoses, condition, or disease), significant SNPs, BMI, and incidence of extreme obesity. The first GWAS excludes DM2-diagnosed individuals and focuses on associations with BMI exclusively. The second GWAS examines the interplay between Type 2 Diabetes (DM2) and BMI. The intersection of significant variants of these two studies is surprising. The third complementary case-control GWAS, with cases defined as extremely obese (Class 2 or 3 obesity), identifies strong associations with extreme obesity, including established variants in the FTO and NEGR1 genes, as well as loci not yet linked to obesity. The PheWASs validate published associations between BMI and extreme obesity and incidence of specific diagnoses and conditions, yet also highlight novel links. This study emphasizes the importance of our extensive longitudinal EHR database to validate known associations and identify putative novel links with BMI and obesity.

Also flagged:breast cancersEstrogensbreast cancertranscription factorshistone deacetylasesHDACs
Journal Article 2019-06-12 No Snippets Linares A, Assou S, Lapierre M, Thouennon E, Duraffourd C, Fromaget C, Boulahtouf A, Tian G, Ji J, Sahin O, Badia E, Boulle N, Cavaillès V.
Show Full Abstract

Estrogens play a pivotal role in breast cancer etiology, and endocrine therapy remains the main first line treatment for estrogen receptor-alpha (ERα)-positive breast cancer. ER are transcription factors whose activity is finely regulated by various regulatory complexes, including histone deacetylases (HDACs). Here, we investigated the role of HDAC9 in ERα signaling and response to antiestrogens in breast cancer cells. Various Michigan Cancer Foundation-7 (MCF7) breast cancer cell lines that overexpress class IIa HDAC9 or that are resistant to the partial antiestrogen 4-hydroxy-tamoxifen (OHTam) were used to study phenotypic changes in response to ER ligands by using transcriptomic and gene set enrichment analyses. Kaplan-Meier survival analyses were performed using public transcriptomic datasets from human breast cancer biopsies. In MCF7 breast cancer cells, HDAC9 decreased ERα mRNA and protein expression and inhibited its transcriptional activity. Conversely, HDAC9 mRNA was strongly overexpressed in OHTam-resistant MCF7 cells and in ERα-negative breast tumor cell lines. Moreover, HDAC9-overexpressing cells were less sensitive to OHTam antiproliferative effects compared with parental MCF7 cells. Several genes (including MUC1, SMC3 and S100P) were similarly deregulated in OHTam-resistant and in HDAC9-overexpressing MCF7 cells. Finally, HDAC9 expression was positively associated with genes upregulated in endocrine therapy-resistant breast cancers and high HDAC9 levels were associated with worse prognosis in patients treated with OHTam. These results demonstrate the complex interactions of class IIa HDAC9 with ERα signaling in breast cancer cells and its effect on the response to hormone therapy.

Also flagged:irondiabetic nephropathyDNrenal diseasediabetesrenin
Journal Article 2019-06-12 ✓ 4 Snippets Chaudhary K, Chilakala A, Ananth S, Mandala A, Veeranan-Karmegam R, Powell FL, Ganapathy V, Gnana-Prakasam JP.
In-Text Gene Mentions

Induction of diabetes in HFE knockout mice using streptozotocin caused a much higher accumulation of renal iron and accelerated the progression of nephropathy compared with diabetic wild-type mice.

…nephropathy in theHFEgene knockout mouse…

…the kidneys ofHFEknockout mice was…

…of diabetes inHFEknockout mice using…

Show Full Abstract

Diabetic nephropathy (DN) is the most common cause of end-stage renal disease associated with high mortality worldwide. Increases in iron levels have been reported in diabetic rat kidneys as well as in human urine of patients with diabetes. In addition, a low-iron diet or iron chelators delay the progression of DN in patients with diabetes and in animal models of diabetes. Possible maladaptive mechanisms of organ damage by tissue iron accumulation have not been well studied. We recently reported that iron induced the retinal renin-angiotensin system (RAS) and accelerated the progression of diabetic retinopathy. However, whether iron regulates the systemic RAS is unknown. To explore if iron alters the expression of intrarenal RAS and its role in the progression of DN, we used the high Fe iron (HFE) knockout mouse, a genetic model of systemic iron overload. We found that diabetes upregulated the expression of iron regulatory proteins and augmented tissue iron accumulation in the kidneys of both type 1 and type 2 diabetic mouse models. Iron accumulation in the kidneys of HFE knockout mice was associated with increase in serum and intrarenal renin expression. Induction of diabetes in HFE knockout mice using streptozotocin caused a much higher accumulation of renal iron and accelerated the progression of nephropathy compared with diabetic wild-type mice. Treatment of diabetic mice with the iron chelator deferiprone reversed the renin upregulation and reduced kidney injury. Thus, our results establish a new link between renal iron and RAS activity. Exploring the mechanisms of iron-induced RAS activation further may have a significant therapeutic impact on hypertension and DN.

Also flagged:gene expressionZfamino acidnucleotideserotoninbiosynthesis
Journal Article 2019-06-12 No Snippets Balik-Meisner MR, Mav D, Phadke DP, Everett LJ, Shah RR, Tal T, Shepard PJ, Merrick BA, Paules RS.
Show Full Abstract

Sentinel gene sets have been developed with the purpose of maximizing the information from targeted transcriptomic platforms. We recently described the development of an S1500+ sentinel gene set, which was built for the human transcriptome, utilizing a data- and knowledge-driven hybrid approach to select a small subset of genes that optimally capture transcriptional diversity, correlation with other genes based on large-scale expression profiling, and known pathway annotation within the human genome. While this detailed bioinformatics approach for gene selection can in principle be applied to other species, the reliability of the resulting gene set depends on availability of a large body of transcriptomics data. For the model organism zebrafish, we aimed to create a similar sentinel gene set (Zf S1500+ gene set); however, there is insufficient standardized expression data in the public domain to train the gene correlation model. Therefore, our strategy was to use human-zebrafish ortholog mapping of the human S1500+ genes and nominations from experts in the zebrafish scientific community. In this study, we present the bioinformatics curation and refinement process to produce the final Zf S1500+ gene set, explore whole transcriptome extrapolation using this gene set, and assess pathway-level inference. This gene set will add value to targeted high-throughput transcriptomics in zebrafish for toxicogenomic screening and other research domains.

Also flagged:sltclutermyouFGDgfd
Journal Article 2019-06-12 No Snippets Rana N, Brunell O, Målqvist M.
Show Full Abstract

<h4>Aim</h4>To explore delivery care staff's perceptions and attitudes towards changes in practice of umbilical cord clamping in order to identify work culture barriers and enablers for improved clinical practice and implementation of the new guidelines on cord clamping.<h4>Method</h4>A purposive sampling strategy was used to include delivery staff at two major hospitals in Kathmandu, Nepal for focus group discussions. Key informant interviews were conducted with the ward in-charges and skilled birth attendant trainers at the respective hospitals. Data were analyzed using qualitative content analysis.<h4>Result</h4>Eight focus group discussions altogether with 34 delivery care staff working in the labor room and birthing units, and 12 key informant interviews with skilled birth attendant trainers/supervisors and ward in-charges from both hospitals participated in the study. Participants had positive attitudes towards delayed cord clamping as it was not perceived to be a difficult task and as they perceived it to be beneficial for mother and child. The "will to do good", and a high level of trust both in the hierarchical system as well as in scientific evidence were identified as promoters of change. Several barriers were mentioned, such as maternal or fetal medical conditions and physical settings, as constraints to perform delayed cord clamping. They also mentioned difficulties in adopting new guidelines due to habitual practice, lack of formal training and poor coherence within the work team. In order to bring change to the practice, participants highlighted that officially approved national and institutional protocols and regular training are crucial.<h4>Conclusion</h4>Due to poor coherence within the health system and lack of national or institutional protocols, delivery staff has to rely on their own initiative to develop skills and are left to informal decision making, and are therefore hesitant to apply new routines. In order to change cord clamping practices to align with evidence and policies health-care staff needs to be better supported by the governance structures of the health system, with clear and approved guidelines made available and coherent training and support.

Also flagged:Skint8Immune responsesB7CD4CD8cell proliferation
Journal Article 2019-06-12 ✓ 1 Snippet Lin Y, Cui C, Su M, Tian X, Huang Y, Zhao J, Lai L.
In-Text Gene Mentions

BTN2A2

Show Full Abstract

Immune responses are tightly controlled by T cell costimulatory and coinhibitory molecules. In this study, we identify Skint8 as a new member of the T cell coinhibitory group, whose extracellular domains share significant homology with existing B7 family members. Skint8 mRNA is expressed in resting and activated B cells, monocytes, and CD4 T cells. The Skint8 putative receptor is expressed on activated CD4 and CD8 T cells, B cells, monocytes and dendritic cells. Recombinant Skint8-IgG Fc fusion protein inhibits T cell proliferation, activation, and cytokine production in vitro. In vivo administration of Skint8-IgG Fc reduces T cell activation and alleviates experimental autoimmune encephalomyelitis in mice. The findings broaden our understanding of the regulation of immune responses and may have implications for treating immune-related diseases.

Also flagged:β-ActinRNA-binding proteinsbiotin ligaseMS2coat proteinlocalization
Journal Article 2019-06-12 ✓ 1 Snippet Mukherjee J, Hermesh O, Eliscovich C, Nalpas N, Franz-Wachtel M, Maček B, Jansen RP.
In-Text Gene Mentions

STAU1

Show Full Abstract

The molecular function and fate of mRNAs are controlled by RNA-binding proteins (RBPs). Identification of the interacting proteome of a specific mRNA in vivo remains very challenging, however. Based on the widely used technique of RNA tagging with MS2 aptamers for RNA visualization, we developed a RNA proximity biotinylation (RNA-BioID) technique by tethering biotin ligase (BirA*) via MS2 coat protein at the 3' UTR of endogenous MS2-tagged β-actin mRNA in mouse embryonic fibroblasts. We demonstrate the dynamics of the β-actin mRNA interactome by characterizing its changes on serum-induced localization of the mRNA. Apart from the previously known interactors, we identified more than 60 additional β-actin-associated RBPs by RNA-BioID. Among these, the KH domain-containing protein FUBP3/MARTA2 has been shown to be required for β-actin mRNA localization. We found that FUBP3 binds to the 3' UTR of β-actin mRNA and is essential for β-actin mRNA localization, but does not interact with the characterized β-actin zipcode element. RNA-BioID provides a tool for identifying new mRNA interactors and studying the dynamic view of the interacting proteome of endogenous mRNAs in space and time.

Also flagged:metabolismironmitochondriadeathPDCas9
Journal Article 2019-06-12 No Snippets Artyukhova MA, Tyurina YY, Chu CT, Zharikova TM, Bayır H, Kagan VE, Timashev PS.
Show Full Abstract

Loss of dopaminergic neurons in the substantia nigra is one of the pathogenic hallmarks of Parkinson's disease, yet the underlying molecular mechanisms remain enigmatic. While aberrant redox metabolism strongly associated with iron dysregulation and accumulation of dysfunctional mitochondria is considered as one of the major contributors to neurodegeneration and death of dopaminergic cells, the specific anomalies in the molecular machinery and pathways leading to the PD development and progression have not been identified. The high efficiency and relative simplicity of a new genome editing tool, CRISPR/Cas9, make its applications attractive for deciphering molecular changes driving PD-related impairments of redox metabolism and lipid peroxidation in relation to mishandling of iron, aggregation and oligomerization of alpha-synuclein and mitochondrial injury as well as in mechanisms of mitophagy and programs of regulated cell death (apoptosis and ferroptosis). These insights into the mechanisms of PD pathology may be used for the identification of new targets for therapeutic interventions and innovative approaches to genome editing, including CRISPR/Cas9.

Also flagged:E-cadherinmetastatic cancerfactorsWntRho GTPaseEGF
Journal Article 2019-06-12 No Snippets Bure IV, Nemtsova MV, Zaletaev DV.
Show Full Abstract

The epithelial-mesenchymal transition (EMT) is thought to be at the root of invasive and metastatic cancer cell spreading. E-cadherin is an important player in this process, which forms the structures that establish and maintain cell-cell interactions. A partial or complete loss of E-cadherin expression in the EMT is presumably mediated by mechanisms that block the expression of E-cadherin regulators and involve the E-cadherin-associated transcription factors. The protein is involved in several oncogenic signaling pathways, such as the Wnt/β-catenin, Rho GTPase, and EGF/EGFR, whereby it plays a role in many tumors, including gastric cancer. Such noncoding transcripts as microRNAs and long noncoding RNAs-critical components of epigenetic control of gene expression in carcinogenesis-contribute to regulation of the E-cadherin function by acting directly or through numerous factors controlling transcription of its gene, and thus affecting not only cancer cell proliferation and metastasis, but also the EMT. This review focuses on the role of E-cadherin and the non-coding RNAs-mediated mechanisms of its expressional control in the EMT during stomach carcinogenesis.

Also flagged:heparansulfatecancercancerstumorHS3ST2
Journal Article 2019-06-12 ✓ 1 Snippet Denys A, Allain F.
In-Text Gene Mentions

…HS/heparin sequences forantithrombin-III, while HS3ST2, HS3ST3A,…

Show Full Abstract

Alteration in the expression of heparan sulfate (HS)-modifying enzymes has been frequently observed in cancer. Consequently, dysregulation of the HS biosynthetic machinery results in dramatic changes in the HS structure, thereby impacting a range of pivotal cellular processes involved in tumorigenesis and cancer progression including proliferation, migration, apoptosis, and immune escape. HS 3-<i>O</i>-sulfotransferases (HS3STs) catalyse the maturation step of glucosaminyl 3-<i>O</i>-sulfation within HS chains. Although seven HS3ST isozymes have been described in human, 3-<i>O</i>-sulfation is a rare modification and only a few biological processes have been described to be influenced by 3-<i>O</i>-sulfated HS. An aberrant expression of HS3STs has been reported in a variety of cancers. Thus, it was suggested that changes in the expression of these enzymes as a result of tumorigenesis or tumor growth may critically influence cancer cell behavior. In accordance with this assumption, a number of studies have documented the epigenetic repression of HS3ST2 and HS3ST3A in many cancers. However, the situation is not so clear, and there is accumulating evidence that HS3ST2, HS3ST3A, HS3ST3B, and HS3ST4 may also act as tumor-promoting enzymes in a number of cancer cells depending on their phenotypes and molecular signatures. In this mini-review, we focus on the recent insights regarding the abnormal expression of HS3STs in cancer and discuss the functional consequences on tumor cell behavior. In term of clinical outcome, further investigations are needed to explore the potential value of HS3STs and/or their 3-<i>O</i>-sulfated products as targets for therapeutic strategies in cancer treatment.

Also flagged:Vascular Disordersmacrovascular diseasesaortic aneurysmaortic dissectionpathogenesisvascular diseases
Journal Article 2019-06-12 No Snippets Peng GY, Lin Y, Li JJ, Wang Y, Huang HY, Shen ZY.
Show Full Abstract

Vascular disorders are complex diseases with high morbidity and mortality. Among them, the dilated macrovascular diseases (MVD), such as aortic aneurysm and aortic dissection, have presented a huge threat to human health. The pathogenesis of vascular diseases is mostly associated with property alteration of vascular endothelial cells (VECs) and vascular smooth muscle cells (VSMCs). Studies have confirmed that induced pluripotent stem cells (iPSCs) can be proliferated and differentiated into other somatic cells, such as VECs and VSMCs. And patient-specific cells could provide detailed human-associated information in regard to pathogenesis or drug responses. In addition, differentiated ECs from iPSC have been widely used in disease modeling as a cell therapy. In this review, we mainly discussed the application of hiPSCs in investigating the pathological mechanism of different inherited vascular diseases and provide a comprehensive understanding of hiPSCs in the field of clinical diagnosis and gene therapy.

Also flagged:CAbicarbonatesecretionlactatemonocarboxylate transportersMCT
Journal Article 2019-06-11 ✓ 1 Snippet Aspatwar A, Tolvanen MEE, Schneider HP, Becker HM, Narkilahti S, Parkkila S, Deitmer JW.
In-Text Gene Mentions

…for CA8 ,CA10, CA11 ,…

Show Full Abstract

Carbonic anhydrases (CA) catalyze the reversible hydration of CO<sub>2</sub> to protons and bicarbonate and thereby play a fundamental role in the epithelial acid/base transport mechanisms serving fluid secretion and absorption for whole-body acid/base regulation. The three carbonic anhydrase-related proteins (CARPs) VIII, X, and XI, however, are catalytically inactive. Previous work has shown that some CA isoforms noncatalytically enhance lactate transport through various monocarboxylate transporters (MCT). Therefore, we examined whether the catalytically inactive CARPs play a role in lactate transport. Here, we report that CARP VIII, X, and XI enhance transport activity of the MCT MCT1 when coexpressed in Xenopus oocytes, as evidenced by the rate of rise in intracellular H+ concentration detected using ion-sensitive microelectrodes. Based on previous studies, we suggest that CARPs may function as a 'proton antenna' for MCT1, to drive proton-coupled lactate transport across the cell membrane.

Also flagged:alcoholdrug dependenceAlcoholismchromosomeschromosomealcohol dependence
Journal Article 2019-06-11 ✓ 2 Snippets Wetherill L, Lai D, Johnson EC, Anokhin A, Bauer L, Bucholz KK, Dick DM, Hariri AR, Hesselbrock V, Kamarajan C, Kramer J, Kuperman S, Meyers JL, Nurnberger JI, Schuckit M, Scott DM, Taylor RE, Tischfield J, Porjesz B, Goate AM, Edenberg HJ, Foroud T, Bogdan R, Agrawal A.
In-Text Gene Mentions

RABGAP1L

SERPINC1

Show Full Abstract

Genetic influences on alcohol and drug dependence partially overlap, however, specific loci underlying this overlap remain unclear. We conducted a genome-wide association study (GWAS) of a phenotype representing alcohol or illicit drug dependence (ANYDEP) among 7291 European-Americans (EA; 2927 cases) and 3132 African-Americans (AA: 1315 cases) participating in the family-based Collaborative Study on the Genetics of Alcoholism. ANYDEP was heritable (h <sup>2</sup> in EA = 0.60, AA = 0.37). The AA GWAS identified three regions with genome-wide significant (GWS; P < 5E-08) single nucleotide polymorphisms (SNPs) on chromosomes 3 (rs34066662, rs58801820) and 13 (rs75168521, rs78886294), and an insertion-deletion on chromosome 5 (chr5:141988181). No polymorphisms reached GWS in the EA. One GWS region (chromosome 1: rs1890881) emerged from a trans-ancestral meta-analysis (EA + AA) of ANYDEP, and was attributable to alcohol dependence in both samples. Four genes (AA: CRKL, DZIP3, SBK3; EA: P2RX6) and four sets of genes were significantly enriched within biological pathways for hemostasis and signal transduction. GWS signals did not replicate in two independent samples but there was weak evidence for association between rs1890881 and alcohol intake in the UK Biobank. Among 118 AA and 481 EA individuals from the Duke Neurogenetics Study, rs75168521 and rs1890881 genotypes were associated with variability in reward-related ventral striatum activation. This study identified novel loci for substance dependence and provides preliminary evidence that these variants are also associated with individual differences in neural reward reactivity. Gene discovery efforts in non-European samples with distinct patterns of substance use may lead to the identification of novel ancestry-specific genetic markers of risk.

Also flagged:borneolaminoApsC1sSevere edemaeschar
Journal Article 2019-06-11 No Snippets Xu J, Zhao H, Xie Z, Ruppel S, Zhou X, Chen S, Liang JF, Wang X.
Show Full Abstract

Microbial contamination on cotton textiles (CT) negatively affects people's health as well as the textile itself during use and storage. Using antimicrobial CT in a body-safe manner is currently still a challenge because it is difficult to balance killing microbes and protecting skin flora. Herein, a borneol-decorated CT (BDCT) through coupling of borneol 4-formylbenzoate molecules onto the amino-modified CT is reported. This BDCT shows strong and broad-spectrum microbially antiadhesive activities against gram-positive bacteria (Staphylococcus aureus and S. epidermidis), gram-negative bacteria (Escherichia coli and Pseudomonas aeruginosa), and fungi (Aspergillus niger, Mucor racemosus, and Candida albicans). Because of its unique stereochemical microbial antiadhesion mechanism, BDCT is harmless to skin flora. In addition, BDCT exhibits prominent durability of microbially antiadhesive capability by bearing 50 times of accelerated laundering. Therefore, this stereochemical BDCT strategy shows great potential for applications in the new generation of textiles, food packaging, and medical protection.

Also flagged:HuntingtinOligonucleotidesHuntington's Diseaseneurodegenerative disorderpolyglutaminecognitive impairments
Journal Article 2019-06-11 ✓ 2 Snippets Imbert M, Blandel F, Leumann C, Garcia L, Goyenvalle A.
In-Text Gene Mentions

Huntington's disease is a neurodegenerative disorder caused by a CAG repeat expansion in the first exon of huntingtin gene (<i>HTT</i>) encoding for a toxic polyglutamine protein.

…the huntingtin protein (HTT) using antisense oligonucleot…

Show Full Abstract

Huntington's disease is a neurodegenerative disorder caused by a CAG repeat expansion in the first exon of huntingtin gene (<i>HTT</i>) encoding for a toxic polyglutamine protein. This disease is characterized by motor, psychiatric, and cognitive impairments. Currently, there is no disease modifying treatment. However, reducing the expression of the huntingtin protein (HTT) using antisense oligonucleotides (ASOs) has been shown as a promising therapeutic strategy. In this study, we explore the therapeutic potential of ASO made of tricyclo-DNA (tcDNA), a conformationally constrained DNA analog, to silence HTT. We used a gapmer ASO, containing central DNA nucleotides flanked by tcDNA modifications on 5' and 3' ends, allowing the recruitment of RNAse H and subsequent degradation of the messenger RNA. After transfection of tcDNA-ASO in patient-derived fibroblast cell lines, we show a strong decrease of HTT mRNA and protein levels. As a control, 2'<i>O</i>-methyl-RNA targeting the same region of <i>HTT</i> was also tested and did not induce a significant effect. tcDNA-ASO were also evaluated <i>in vivo</i> in the YAC128 mice, containing the full-length human <i>HTT</i> gene with 128 CAG repeat expansion. Single intracerebroventricular (ICV) injections of tcDNA induce a significant decrease of HTT messenger and protein levels in the cortex, hippocampus, striatum, and cerebellum of treated mice. tcDNA-ASO were found well distributed in the central nervous system (CNS) and show long lasting effect with protein levels still low, 12 weeks after a single ICV injection. This proof of concept study suggests the therapeutic potential of gapmer tcDNA ASO to downregulate huntingtin <i>in vitro</i> and <i>in vivo</i>.

Also flagged:RH5CyRPARIPRMalariaPfRH5BSG
Journal Article 2019-06-11 ✓ 2 Snippets Knuepfer E, Wright KE, Kumar Prajapati S, Rawlinson TA, Mohring F, Koch M, Lyth OR, Howell SA, Villasis E, Snijders AP, Moon RW, Draper SJ, Rosanas-Urgell A, Higgins MK, Baum J, Holder AA.
In-Text Gene Mentions

…blood samples fromhemochromatosispatients was obtained…

…blood samples ofhemochromatosispatients within 48…

Show Full Abstract

Malaria is caused by Plasmodium parasites, which invade and replicate in erythrocytes. For Plasmodium falciparum, the major cause of severe malaria in humans, a heterotrimeric complex comprised of the secreted parasite proteins, PfCyRPA, PfRIPR and PfRH5 is essential for erythrocyte invasion, mediated by the interaction between PfRH5 and erythrocyte receptor basigin (BSG). However, whilst CyRPA and RIPR are present in most Plasmodium species, RH5 is found only in the small Laverania subgenus. Existence of a complex analogous to PfRH5-PfCyRPA-PfRIPR targeting BSG, and involvement of CyRPA and RIPR in invasion, however, has not been addressed in non-Laverania parasites. Here, we establish that unlike P. falciparum, P. knowlesi and P. vivax do not universally require BSG as a host cell invasion receptor. Although we show that both PkCyRPA and PkRIPR are essential for successful invasion of erythrocytes by P. knowlesi parasites in vitro, neither protein forms a complex with each other or with an RH5-like molecule. Instead, PkRIPR is part of a different trimeric protein complex whereas PkCyRPA appears to function without other parasite binding partners. It therefore appears that in the absence of RH5, outside of the Laverania subgenus, RIPR and CyRPA have different, independent functions crucial for parasite survival.

Also flagged:ANKRD12cancerCell cycleOxygenovarian cancersRNase R
Journal Article 2019-06-11 ✓ 1 Snippet Karedath T, Ahmed I, Al Ameri W, Al-Dasim FM, Andrews SS, Samuel S, Al-Azwani IK, Mohamoud YA, Rafii A, Malek JA.
In-Text Gene Mentions

…D1 (CCND1), CBX5,STAU1, and AK4 were…

Show Full Abstract

<h4>Background</h4>Circular RNAs (circRNAs) that form through non-canonical backsplicing events of pre-mRNA transcripts are evolutionarily conserved and abundantly expressed across species. However, the functional relevance of circRNAs remains a topic of debate.<h4>Methods</h4>We identified one of the highly expressed circRNA (circANKRD12) in cancer cell lines and characterized it validated it by Sanger sequencing, Real-Time PCR. siRNA mediated silencing of the circular junction of circANKRD12 was followed by RNA Seq analysis of circANKRD12 silenced cells and control cells to identify the differentially regulated genes. A series of cell biology and molecular biology techniques (MTS assay, Migration analysis, 3D organotypic models, Real-Time PCR, Cell cycle analysis, Western blot analysis, and Seahorse Oxygen Consumption Rate analysis) were performed to elucidate the function, and underlying mechanisms involved in circANKRD12 silenced breast and ovarian cancer cells.<h4>Results</h4>In this study, we identified and characterized a circular RNA derived from Exon 2 and Exon 8 of the ANKRD12 gene, termed here as circANKRD12. We show that this circRNA is abundantly expressed in breast and ovarian cancers. The circANKRD12 is RNase R resistant and predominantly localized in the cytoplasm in contrast to its source mRNA. We confirmed the expression of this circRNA across a variety of cancer cell lines and provided evidence for its functional relevance through downstream regulation of several tumor invasion genes. Silencing of circANKRD12 induces a strong phenotypic change by significantly regulating cell cycle, increasing invasion and migration and altering the metabolism in cancer cells. These results reveal the functional significance of circANKRD12 and provide evidence of a regulatory role for this circRNA in cancer progression.<h4>Conclusions</h4>Our study demonstrates the functional relevance of circANKRD12 in various cancer cell types and, based on its expression pattern, has the potential to become a new clinical biomarker.

Also flagged:AKT3TP53GLSKRASHK2SLC2A3
Journal Article 2019-06-11 No Snippets Park AK, Lee JY, Cheong H, Ramaswamy V, Park SH, Kool M, Phi JH, Choi SA, Cavalli F, Taylor MD, Kim SK.
Show Full Abstract

<h4>Background</h4>Using a pathway-focused approach, we aimed to provide a subgroup-specific basis for finding novel therapeutic strategies and further refinement of the risk stratification in pediatric medulloblastoma.<h4>Method</h4>Based on genome-wide Cox regression and Gene Set Enrichment Analysis, we investigated prognosis-related signaling pathways and core genes in pediatric medulloblastoma subgroups using 530 patient data from Medulloblastoma Advanced Genomic International Consortium (MAGIC) project. We further examined the relationship between expression of the prognostic core genes and frequent chromosome aberrations using broad range copy number change data.<h4>Results</h4>In SHH subgroup, relatively high expression of the core genes involved in p53, PLK1, FOXM1, and Aurora B signaling pathways are associated with poor prognosis, and their average expression synergistically increases with co-occurrence of losses of 17p, 14q, or 10q, or gain of 17q. In Group 3, in addition to high MYC expression, relatively elevated expression of PDGFRA, IGF1R, and FGF2 and their downstream genes in PI3K/AKT and MAPK/ERK pathways are related to poor survival outcome, and their average expression is increased with the presence of isochromosome 17q [i(17q)] and synergistically down-regulated with simultaneous losses of 16p, 8q, or 4q. In Group 4, up-regulation of the genes encoding various immune receptors and those involved in NOTCH, NF-κB, PI3K/AKT, or RHOA signaling pathways are associated with worse prognosis. Additionally, the expressions of Notch genes correlate with those of the prognostic immune receptors. Besides the Group 4 patients with previously known prognostic aberration, loss of chromosome 11, those with loss of 8q but without i(17q) show excellent survival outcomes and low average expression of the prognostic core genes whereas those harboring 10q loss, 1q gain, or 12q gain accompanied by i(17q) show bad outcomes. Finally, several metabolic pathways known to be reprogrammed in cancer cells are detected as prognostic pathways including glutamate metabolism in SHH subgroup, pentose phosphate pathway and TCA cycle in Group 3, and folate-mediated one carbon-metabolism in Group 4.<h4>Conclusions</h4>The results underscore several subgroup-specific pathways for potential therapeutic interventions: SHH-GLI-FOXM1 pathway in SHH subgroup, receptor tyrosine kinases and their downstream pathways in Group 3, and immune and inflammatory pathways in Group 4.

Also flagged:methylationcongenital heart defectsCardiac diseaseheart diseasecongenital heart diseasescongenital heart disease
Journal Article 2019-06-11 ✓ 1 Snippet Hoff K, Lemme M, Kahlert AK, Runde K, Audain E, Schuster D, Scheewe J, Attmann T, Pickardt T, Caliebe A, Siebert R, Kramer HH, Milting H, Hansen A, Ammerpohl O, Hitz MP.
In-Text Gene Mentions

…, WISP1 ,TNFSF4, FGFR2 ,…

Show Full Abstract

<h4>Background</h4>Cardiac disease modelling using human-induced pluripotent stem cell-derived cardiomyocytes (hiPSC-CM) requires thorough insight into cardiac cell type differentiation processes. However, current methods to discriminate different cardiac cell types are mostly time-consuming, are costly and often provide imprecise phenotypic evaluation. DNA methylation plays a critical role during early heart development and cardiac cellular specification. We therefore investigated the DNA methylation pattern in different cardiac tissues to identify CpG loci for further cardiac cell type characterization.<h4>Results</h4>An array-based genome-wide DNA methylation analysis using Illumina Infinium HumanMethylation450 BeadChips led to the identification of 168 differentially methylated CpG loci in atrial and ventricular human heart tissue samples (n = 49) from different patients with congenital heart defects (CHD). Systematic evaluation of atrial-ventricular DNA methylation pattern in cardiac tissues in an independent sample cohort of non-failing donor hearts and cardiac patients using bisulfite pyrosequencing helped us to define a subset of 16 differentially methylated CpG loci enabling precise characterization of human atrial and ventricular cardiac tissue samples. This defined set of reproducible cardiac tissue-specific DNA methylation sites allowed us to consistently detect the cellular identity of hiPSC-CM subtypes.<h4>Conclusion</h4>Testing DNA methylation of only a small set of defined CpG sites thus makes it possible to distinguish atrial and ventricular cardiac tissues and cardiac atrial and ventricular subtypes of hiPSC-CMs. This method represents a rapid and reliable system for phenotypic characterization of in vitro-generated cardiomyocytes and opens new opportunities for cardiovascular research and patient-specific therapy.

Also flagged:mineralcalciumhydroxylhydroxyapatitecalcium phosphatehydrogen
Journal Article 2019-06-11 No Snippets Von Euw S, Wang Y, Laurent G, Drouet C, Babonneau F, Nassif N, Azaïs T.
Show Full Abstract

Some compositional and structural features of mature bone mineral particles remain unclear. They have been described as calcium-deficient and hydroxyl-deficient carbonated hydroxyapatite particles in which a fraction of the PO<sub>4</sub><sup>3-</sup> lattice sites are occupied by HPO<sub>4</sub><sup>2-</sup> ions. The time has come to revise this description since it has now been proven that the surface of mature bone mineral particles is not in the form of hydroxyapatite but rather in the form of hydrated amorphous calcium phosphate. Using a combination of dedicated solid-state nuclear magnetic resonance techniques, the hydrogen-bearing species present in bone mineral and especially the HPO<sub>4</sub><sup>2-</sup> ions were closely scrutinized. We show that these HPO<sub>4</sub><sup>2-</sup> ions are concentrated at the surface of bone mineral particles in the so-called amorphous surface layer whose thickness was estimated here to be about 0.8 nm for a 4-nm thick particle. We also show that their molar proportion is much higher than previously estimated since they stand for about half of the overall amount of inorganic phosphate ions that compose bone mineral. As such, the mineral-mineral and mineral-biomolecule interfaces in bone tissue must be driven by metastable hydrated amorphous environments rich in HPO<sub>4</sub><sup>2-</sup> ions rather than by stable crystalline environments of hydroxyapatite structure.

Also flagged:UbiquitinRibosomesamino acidcell divisionribosomalribosome
Journal Article 2019-06-11 No Snippets An H, Harper JW.
Show Full Abstract

Ribosomes are central to the life of a cell, as they translate the genetic code into the amino acid language of proteins. Moreover, ribosomal abundance within the cell is coordinated with protein production required for cell function or processes such as cell division. As such, it is not surprising that these elegant machines are both highly regulated at the level of both their output of newly translated proteins but also at the level of ribosomal protein expression, ribosome assembly, and ribosome turnover. In this review, we focus on mechanisms that regulate ribosome abundance through both the ubiquitin-proteasome system and forms of autophagy referred to as "ribophagy." We discussed mechanisms employed in both yeast and mammalian cells, including the various machineries that are important for recognition and degradation of ribosomal components. In addition, we discussed controversies in the field and how the development of new approaches for examining flux through the proteasomal and autophagic systems in the context of a systematic inventory of ribosomal components is necessary to fully understand how ribosome abundance is controlled under various physiological conditions.

Also flagged:chromosomeATPasesbindingSmcchromosomescohesin
Journal Article 2019-06-11 ✓ 1 Snippet Vazquez Nunez R, Ruiz Avila LB, Gruber S.
In-Text Gene Mentions

Condensin

Show Full Abstract

Multi-subunit SMC ATPases control chromosome superstructure and DNA topology, presumably by DNA translocation and loop extrusion. Chromosomal DNA is entrapped within the tripartite SMCkleisin ring. Juxtaposed SMC heads ("J heads") or engaged SMC heads ("E heads") split the SMCkleisin ring into "S" and "K" sub-compartments. Here, we map a DNA-binding interface to the S compartment of E heads SmcScpAB and show that head-DNA association is essential for efficient DNA translocation and for traversing highly transcribed genes in Bacillus subtilis. We demonstrate that in J heads, SmcScpAB chromosomal DNA resides in the K compartment but is absent from the S compartment. Our results imply that the DNA occupancy of the S compartment changes during the ATP hydrolysis cycle. We propose that DNA translocation involves DNA entry into and exit out of the S compartment, possibly by DNA transfer between compartments and DNA segment capture.

Also flagged:SynthesisPasireotideHexapeptidesomatostatincyclicpeptide
Journal Article 2019-06-11 No Snippets Ma C, Chen M, Chu W, Tao J, Kong D, Zhang M, Feng W.
Show Full Abstract

Pasireotide is a multi-receptor ligand somatostatin analogue approved for medical treatment of Cushing's disease and acromegaly. The liquid-phase total synthesis of pasireotide-a 18-membered cyclic hexapeptide-was achieved by the 3 + 2 + 1 strategy, and the Pro<sup>1</sup>-Phe<sup>6</sup> peptide bond was selected as the final cyclization position. Two key fragments were simply synthesized using <i>N</i>,<i>O</i>-bis(trimethylsilyl)acetamide/<i>N</i>-hydroxysuccinimide ester (BSA/NHS) as coupling agents, and processes of the two key fragments were simple without any chromatographic purification. The current synthesis method is easily scalable and produces the target peptide with an overall yield of 15%.

Also flagged:Vitamin B5D-Pantothenic Acidneurodegenerative disorderHDmetabolismpantothenate deficiency
Journal Article 2019-06-11 ✓ 5 Snippets Patassini S, Begley P, Xu J, Church SJ, Kureishy N, Reid SJ, Waldvogel HJ, Faull RLM, Snell RG, Unwin RD, Cooper GJS.
In-Text Gene Mentions

HTT CAG size was not significantly related to vitamin B5 levels in controls or cases in any brain region examined (Supplementary Table S3); nor were vitamin B5 concentrations in any brain region significantly related to the Vonsattel grade, consistent with the view that the magnitude of cell loss or overall neurodegeneration does not contribute to the altered vitamin B5 levels observed in HD cases (Supplementary Table S3).

Alterations in numerous molecular processes, in the brain as well as other organs, have been implicated in the pathogenesis of HD, but how these might relate to underlying mutations in the HTT gene remains to be determined [14,15].

It is caused by an expanded unstable (CAG)n repeat at chromosome 4p16.3 in exon 1 of the HTT gene [3,4,5], which encodes an altered form of the huntingtin protein containing an elongated polyglutamine tract, comprising 37 or more glutamine residues [6].

We also investigated whether the number of HTT CAG repeats had any effect on the regional levels of vitamin B5 in controls and HD brains by Spearman’s correlation analysis.

…1 of theHTTgene.…

Show Full Abstract

Huntington's disease (HD) is a neurodegenerative disorder caused by an expanded CAG repeat in exon 1 of the <i>HTT</i> gene. HD usually manifests in mid-life with loss of GABAergic projection neurons from the striatum accompanied by progressive atrophy of the putamen followed by other brain regions, but linkages between the genetics and neurodegeneration are not understood. We measured metabolic perturbations in HD-human brain in a case-control study, identifying pervasive lowering of vitamin B5, the obligatory precursor of coenzyme A (CoA) that is essential for normal intermediary metabolism. Cerebral pantothenate deficiency is a newly-identified metabolic defect in human HD that could potentially: (i) impair neuronal CoA biosynthesis; (ii) stimulate polyol-pathway activity; (iii) impair glycolysis and tricarboxylic acid cycle activity; and (iv) modify brain-urea metabolism. Pantothenate deficiency could lead to neurodegeneration/dementia in HD that might be preventable by treatment with vitamin B5.

Also flagged:m-calpainHsp40Hsp70-8heat shock proteinsmetabolismproteolysis
Journal Article 2019-06-11 No Snippets Ellies-Oury MP, Lorenzo H, Denoyelle C, Saracco J, Picard B.
Show Full Abstract

For several years, studies conducted for discovering tenderness biomarkers have proposed a list of 20 candidates. The aim of the present work was to develop an innovative methodology to select the most predictive among this list. The relative abundance of the proteins was evaluated on five muscles of 10 Holstein cows: <i>gluteobiceps</i>, <i>semimembranosus</i>, <i>semitendinosus</i>, <i>Triceps brachii</i> and <i>Vastus lateralis</i>. To select the most predictive biomarkers, a multi-block model was used: The Data-Driven Sparse Partial Least Square. <i>Semimembranosus</i> and <i>Vastus lateralis</i> muscles tenderness could be well predicted (<i>R</i><sup>2</sup> = 0.95 and 0.94 respectively) with a total of 7 out of the 5 times 20 biomarkers analyzed. An original result is that the predictive proteins were the same for these two muscles: µ-calpain, m-calpain, h2afx and Hsp40 measured in m. <i>gluteobiceps</i> and µ-calpain, m-calpain and Hsp70-8 measured in m. <i>Triceps brachii</i>. Thus, this method is well adapted to this set of data, making it possible to propose robust candidate biomarkers of tenderness that need to be validated on a larger population.

Also flagged:negative breast tumorsEstrogen-receptorbreast cancerbreast tumorsmetabolismbiosynthesis
Journal Article 2019-06-11 ✓ 1 Snippet Barupal DK, Gao B, Budczies J, Phinney BS, Perroud B, Denkert C, Fiehn O.
In-Text Gene Mentions

…ITPK1, SORD, HACD3,B4GALT5, CDS2, PPIP5K2, PDSS1,…

Show Full Abstract

Estrogen-receptor negative (ERneg) breast cancer is an aggressive breast cancer subtype in the need for new therapeutic options. We have analyzed metabolomics, proteomics and transcriptomics data for a cohort of 276 breast tumors (MetaCancer study) and nine public transcriptomics datasets using univariate statistics, meta-analysis, Reactome pathway analysis, biochemical network mapping and text mining of metabolic genes. In the MetaCancer cohort, a total of 29% metabolites, 21% proteins and 33% transcripts were significantly different (raw <i>p</i> <0.05) between ERneg and ERpos breast tumors. In the nine public transcriptomics datasets, on average 23% of all genes were significantly different (raw <i>p</i> <0.05). Specifically, up to 60% of the metabolic genes were significantly different (meta-analysis raw <i>p</i> <0.05) across the transcriptomics datasets. Reactome pathway analysis of all omics showed that energy metabolism, and biosynthesis of nucleotides, amino acids, and lipids were associated with ERneg status. Text mining revealed that several significant metabolic genes and enzymes have been rarely reported to date, including PFKP, GART, PLOD1, ASS1, NUDT12, FAR1, PDE7A, FAHD1, ITPK1, SORD, HACD3, CDS2 and PDSS1. Metabolic processes associated with ERneg tumors were identified by multi-omics integration analysis of metabolomics, proteomics and transcriptomics data. Overall results suggested that TCA anaplerosis, proline biosynthesis, synthesis of complex lipids and mechanisms for recycling substrates were activated in ERneg tumors. Under-reported genes were revealed by text mining which may serve as novel candidates for drug targets in cancer therapies. The workflow presented here can also be used for other tumor types.

Also flagged:Neurodegenerative disordersamyotrophic lateral sclerosisALSfrontotemporal dementiaTAR DNA binding protein of 43 kDaTDP-43
Journal Article 2019-06-11 No Snippets Hedl TJ, San Gil R, Cheng F, Rayner SL, Davidson JM, De Luca A, Villalva MD, Ecroyd H, Walker AK, Lee A.
Show Full Abstract

Neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) are increasing in prevalence but lack targeted therapeutics. Although the pathological mechanisms behind these diseases remain unclear, both ALS and FTD are characterized pathologically by aberrant protein aggregation and inclusion formation within neurons, which correlates with neurodegeneration. Notably, aggregation of several key proteins, including TAR DNA binding protein of 43 kDa (TDP-43), superoxide dismutase 1 (SOD1), and tau, have been implicated in these diseases. Proteomics methods are being increasingly applied to better understand disease-related mechanisms and to identify biomarkers of disease, using model systems as well as human samples. Proteomics-based approaches offer unbiased, high-throughput, and quantitative results with numerous applications for investigating proteins of interest. Here, we review recent advances in the understanding of ALS and FTD pathophysiology obtained using proteomics approaches, and we assess technical and experimental limitations. We compare findings from various mass spectrometry (MS) approaches including quantitative proteomics methods such as stable isotope labeling by amino acids in cell culture (SILAC) and tandem mass tagging (TMT) to approaches such as label-free quantitation (LFQ) and sequential windowed acquisition of all theoretical fragment ion mass spectra (SWATH-MS) in studies of ALS and FTD. Similarly, we describe disease-related protein-protein interaction (PPI) studies using approaches including immunoprecipitation mass spectrometry (IP-MS) and proximity-dependent biotin identification (BioID) and discuss future application of new techniques including proximity-dependent ascorbic acid peroxidase labeling (APEX), and biotinylation by antibody recognition (BAR). Furthermore, we explore the use of MS to detect post-translational modifications (PTMs), such as ubiquitination and phosphorylation, of disease-relevant proteins in ALS and FTD. We also discuss upstream technologies that enable enrichment of proteins of interest, highlighting the contributions of new techniques to isolate disease-relevant protein inclusions including flow cytometric analysis of inclusions and trafficking (FloIT). These recently developed approaches, as well as related advances yet to be applied to studies of these neurodegenerative diseases, offer numerous opportunities for discovery of potential therapeutic targets and biomarkers for ALS and FTD.

Also flagged:Sleepneurodegenerative diseasesADagingprotein aggregationprotein
Journal Article 2019-06-11 ✓ 2 Snippets Hafycz JM, Naidoo NN.
In-Text Gene Mentions

BiP and CHOP are upregulated in HD patient brains (Carnemolla et al., 2009) Soluble oligomers of htt activate ER stress (Leitman et al., 2013)

…Soluble oligomers ofhttactivate ER stress…

Show Full Abstract

Many neurodegenerative diseases manifest in an overall aged population, the pathology of which is hallmarked by abnormal protein aggregation. It is known that across aging, sleep quality becomes less efficient and protein homeostatic regulatory mechanisms deteriorate. There is a known relationship between extended wakefulness and poorly consolidated sleep and an increase in cellular stress. In an aged population, when sleep is chronically poor, and proteostatic regulatory mechanisms are less efficient, the cell is inundated with misfolded proteins and suffers a collapse in homeostasis. In this review article, we explore the interplay between aging, sleep quality, and proteostasis and how these processes are implicated in the development and progression of neurodegenerative diseases like Alzheimer's disease (AD). We also present data suggesting that reducing cellular stress and improving proteostasis and sleep quality could serve as potential therapeutic solutions for the prevention or delay in the progression of these diseases.

Also flagged:Olfactory KinaseADamyloid plaquesamyloid precursor proteinAPPextracellular signal-regulated kinase
Journal Article 2019-06-11 ✓ 1 Snippet Lachen-Montes M, González-Morales A, Palomino M, Ausin K, Gómez-Ochoa M, Zelaya MV, Ferrer I, Pérez-Mediavilla A, Fernández-Irigoyen J, Santamaría E.
In-Text Gene Mentions

…MT-ND3, MAPK10, ACTG1,PRDX6, RNF24, NDUFA8, ARC,…

Show Full Abstract

The olfactory bulb (OB) is the first processing station in the olfactory pathway. Despite smell impairment, which is considered an early event in Alzheimer's disease (AD), little is known about the initial molecular disturbances that accompany the AD development at olfactory level. We have interrogated the time-dependent OB molecular landscape in Tg2576 AD mice prior to the appearance of neuropathological amyloid plaques (2-, and 6-month-old), using combinatorial omics analysis. The metabolic modulation induced by overproduction of human mutated amyloid precursor protein (APP) clearly differs between both time points. Besides the progressive perturbation of the APP interactome, functional network analysis unveiled an inverse regulation of downstream extracellular signal-regulated kinase (ERK1/2), and p38 mitogen-activated protein kinase (MAPK) routes in 2-month-old Tg2576 mice with respect to wild-type (WT) mice. In contrast, Akt and MAPK kinase 4 (SEK1)/ stress-activated protein kinase (SAPK) axis were parallel activated in the OB of 6-months-old-Tg2576 mice. Furthermore, a survival kinome profiling performed during the aging process (2-, 6-, and 18-month-old) revealed that olfactory APP overexpression leads to changes in the activation dynamics of protein kinase A (PKA), and SEK1/MKK4-SAPK/JNK between 6 and 18 months of age, when memory deficits appear and AD pathology is well established in transgenic mice. Interestingly, both olfactory pathways were differentially activated in a stage-dependent manner in human sporadic AD subjects with different neuropathological grading. Taken together, our data reflect the early impact of mutated APP on the OB molecular homeostasis, highlighting the progressive modulation of specific signaling pathways during the olfactory amyloidogenic pathology.

Also flagged:BehaviorproOrcoGAPDHRPS18behavioral
Journal Article 2019-06-11 ✓ 5 Snippets Sun P, Yu S, Merchant A, Lei C, Zhou X, Huang Q.
In-Text Gene Mentions

HTT

Multiple amino acid sequence alignments and evolutionary analysis suggested that the 5-HTT gene was highly conserved across different insect species but was distinct from that in mammal species.

…of Orco and5-HTTAlters Nestmate Discrimination…

…genes, Orco and5-HTT, associated with…

…of Orco and5-HTT, respectively, (2)…

Show Full Abstract

Nestmate discrimination allows social insects to recognize nestmates from non-nestmates using colony-specific chemosensory cues, which typically evoke aggressive behavior toward non-nestmates. Functional analysis of genes associated with nestmate discrimination has been primarily focused on inter-colonial discrimination in Hymenopterans, and parallel studies in termites, however, are grossly lacking. To fill this gap, we investigated the role of two genes, <i>Orco</i> and <i>5-HTT</i>, associated with chemosensation and neurotransmission respectively, in nestmate discrimination in a highly eusocial subterranean termite, <i>Odontotermes formosanus</i> (Shiraki). We hypothesized that knocking down of these genes will compromise the nestmate recognition and lead to the antagonistic behavior. To test this hypothesis, we carried out (1) an <i>in vivo</i> RNAi to suppress the expression of <i>Orco</i> and <i>5-HTT</i>, respectively, (2) a validation study to examine the knockdown efficiency, and finally, (3) a behavioral assay to document the phenotypic impacts/behavioral consequences. As expected, the suppression of either of these two genes elevated stress level (e.g., vibrations and retreats), and led to aggressive behaviors (e.g., biting) in <i>O. formosanus</i> workers toward their nestmates, suggesting both <i>Orco</i> and <i>5-HTT</i> can modulate nestmate discrimination in termites. This research links chemosensation and neurotransmission with nestmate discrimination at the genetic basis, and lays the foundation for functional analyses of nestmate discrimination in termites.

Also flagged:infectionscarbapenemmetallo-beta lactamasesMBLCeftazidime-avibactammeropenem
Journal Article 2019-06-11 ✓ 3 Snippets Karaiskos I, Lagou S, Pontikis K, Rapti V, Poulakou G.
In-Text Gene Mentions

In the single study employing a case control approach, 48 patients receiving DCC were compared to 96 control patients who were administered standard treatment (i.e., colistin, tigecycline, aminoglycoside) for documented infections by CPKP.

Further randomized controlled trials are needed to assess DCC as salvage treatment in infections by XDR pathogens exhibiting various mechanisms of resistance to carbapenems.

Finally, two kidney transplant recipients were reportedly cured with DCC plus oral fosfomycin from urinary tract infections caused by NDM-harboring Enterobacteriaceae (135).

Show Full Abstract

The recent expansion of multidrug resistant and pan-drug-resistant pathogens poses significant challenges in the treatment of healthcare associated infections. An important advancement, is a handful of recently launched new antibiotics targeting some of the current most problematic Gram-negative pathogens, namely carbapenem-producing Enterobacteriaceae (CRE) and carbapenem-resistant <i>P. aeruginosa</i> (CRPA). Less options are available against carbapenem-resistant <i>Acinetobacter baumannii</i> (CRAB) and strains producing metallo-beta lactamases (MBL). Ceftazidime-avibactam signaled a turning point in the treatment of KPC and partly OXA- type carbapenemases, whereas meropenem-vaborbactam was added as a potent combination against KPC-producers. Ceftolozane-tazobactam could be seen as an ideal beta-lactam backbone for the treatment of CRPA. Plazomicin, an aminoglycoside with better pharmacokinetics and less toxicity compared to other class members, will cover important proportions of multi-drug resistant pathogens. Eravacycline holds promise in the treatment of infections by CRAB, with a broad spectrum of activity similar to tigecycline, and improved pharmacokinetics. Novel drugs and combinations are not to be considered "panacea" for the ongoing crisis in the therapy of XDR Gram-negative bacteria and colistin will continue to be considered as a fundamental companion drug for the treatment of carbapenem-resistant Enterobacteriaceae (particularly in areas where MBL predominate), for the treatment of CRPA (in many cases being the only <i>in vitro</i> active drug) as well as CRAB. Aminoglycosides are still important companion antibiotics. Finally, fosfomycin as part of combination treatment for CRE infections and <i>P. aeruginosa</i>, deserves a greater attention. Optimal conditions for monotherapy and the "when and how" of combination treatments integrating the novel agents will be discussed.

Also flagged:colorectal cancercancerhyperplastic polypsadenomareverse transcriptionadenomas
Journal Article 2019-06-11 ✓ 1 Snippet Ardila HJ, Sanabria-Salas MC, Meneses X, Rios R, Huertas-Salgado A, Serrano ML.
In-Text Gene Mentions

DCC

Show Full Abstract

Colorectal cancer (CRC) is one of the prominent causes of cancer related deaths because, in part, there is not an early, non-invasive, effective detection strategy. Circulating microRNAs (miRNAs) have been proposed as potential non-invasive biomarkers for CRC. In this study, we evaluated the miRNA profile in sixteen CRC tissues by Next-Generation-Sequencing and compared the circulating expression levels of 22 miRNAs among 45 CRC, 14 hyperplastic polyps, 11 advanced adenoma patients and 45 control subjects, by reverse transcription-quantitative PCR, to search for miRNAs which could be potential biomarkers. In total, nine of them represented 70% of total read counts (miR-10a-5p, miR-192-5p, miR-10b-5p, miR-22-3p, miR-26a-5p, miR-148a-3p, miR-181a-5p, miR-92a-3p and miR-143-5p). <i>In silico</i> analysis found eight candidates to mature miRNAs. With respect to circulating miRNA, we found higher serum expression levels of miR-143-3p, miR-141-3p and miR-200c-3p in the CRC and adenoma groups compared with controls (P<0.002), and we also found significant higher levels of miR-141-3p and miR-200c-3p in serum of adenoma patients compared with the CRC group. In conclusion, the measurement of miRNAs in the blood could complement current screening methods for CRC and might provide new insights into mechanisms of tumorigenesis. miR-143-3p, miR-141-3p and miR-200c-3p could be interesting miRNAs to study as potential biomarkers for CRC.

Also flagged:endoplasmic reticulummetabolismorganizationautophagydegradationlipid
Journal Article 2019-06-10 ✓ 1 Snippet Wilkinson S.
In-Text Gene Mentions

CCPG1 has a substantial (> 450 amino acid) lumenal domain that could hypothetically participate in recognition of specific lumenal cargoes.

Show Full Abstract

The endoplasmic reticulum (ER) network has central roles in metabolism and cellular organization. The ER undergoes dynamic alterations in morphology, molecular composition and functional specification. Remodelling of the network under fluctuating conditions enables the continual performance of ER functions and minimizes stress. Recent data have revealed that selective autophagy-mediated degradation of ER fragments, or ER-phagy, fundamentally contributes to this remodelling. This review provides a perspective on established views of selective autophagy, comparing these with emerging mechanisms of ER-phagy and related processes. The text discusses the impact of ER-phagy on the function of the ER- and the cell, both in normal physiology and when dysregulated within disease settings. Finally, unanswered questions regarding the mechanisms and significance of ER-phagy are highlighted.

Also flagged:Di(2-ethylhexyl)phthalateSHPtesticular dysgenesis syndromeestrogen receptor 1bindingFOXA1
Journal Article 2019-06-10 No Snippets Stenz L, Rahban R, Prados J, Nef S, Paoloni-Giacobino A.
Show Full Abstract

Di(2-ethylhexyl)phthalate (DEHP) interferes with sex hormones signaling pathways (SHP). C57BL/6J mice prenatally exposed to 300 mg/kg/day DEHP develop a testicular dysgenesis syndrome (TDS) at adulthood, but similarly-exposed FVB/N mice are not affected. Here we aim to understand the reasons behind this drastic difference that should depend on the genome of the strain. In both backgrounds, pregnant female mice received per os either DEHP or corn oil vehicle and the male filiations were examined. Computer-assisted sperm analysis showed a DEHP-induced decreased sperm count and velocities in C57BL/6J. Sperm RNA sequencing experiments resulted in the identification of the 62 most differentially expressed RNAs. These RNAs, mainly regulated by hormones, produced strain-specific transcriptional responses to prenatal exposure to DEHP; a pool of RNAs was increased in FVB, another pool of RNAs was decreased in C57BL/6J. In FVB/N, analysis of non-synonymous single nucleotide polymorphisms (SNP) impacting SHP identified rs387782768 and rs29315913 respectively associated with absence of the Forkhead Box A3 (Foxa3) RNA and increased expression of estrogen receptor 1 variant 4 (NM_001302533) RNA. Analysis of the role of SNPs modifying SHP binding sites in function of strain-specific responses to DEHP revealed a DEHP-resistance allele in FVB/N containing an additional FOXA1-3 binding site at rs30973633 and four DEHP-induced beta-defensins (Defb42, Defb30, Defb47 and Defb48). A DEHP-susceptibility allele in C57BL/6J contained five SNPs (rs28279710, rs32977910, rs46648903, rs46677594 and rs48287999) affecting SHP and six genes (Svs2, Svs3b, Svs4, Svs3a, Svs6 and Svs5) epigenetically silenced by DEHP. Finally, targeted experiments confirmed increased methylation in the Svs3ab promoter with decreased SEMG2 persisting across generations, providing a molecular explanation for the transgenerational sperm velocity decrease found in C57BL/6J after DEHP exposure. We conclude that the existence of SNP-dependent mechanisms in FVB/N inbred mice may confer resistance to transgenerational endocrine disruption.

Also flagged:NHLlymphomaimmune disordersinfectiondiffuse large B-cell lymphomaDLBCL
Journal Article 2019-06-10 No Snippets Melenotte C, Mezouar S, Ben Amara A, Benatti S, Chiaroni J, Devaux C, Costello R, Kroemer G, Mege JL, Raoult D.
Show Full Abstract

Coxiella burnetii, the agent causing Q fever, has been associated with B-cell non-Hodgkin lymphoma (NHL). To better clarify this link, we analysed the genetic transcriptomic profile of peripheral blood leukocytes from patients with C. burnetii infection to identify possible links to lymphoma. Microarray analyses revealed that 1189 genes were expressed differently (p <.001 and fold change ≥4) in whole blood of patients with C. burnetii infection compared to controls. In addition, 95 genes expressed in patients with non-Hodgkin lymphoma (NHL) and in patients with C. burnetii persistent infection have allowed us to establish the 'C. burnetii-associated NHL signature'. Among these, 33 genes previously found modulated in C. burnetii-associated -NHL by the microarray analysis were selected and their mRNA expression levels were measured in distinct C. burnetii-induced pathologies, namely, acute Q fever, focalized persistent infection, lymphadenitis and C.burnetii-associated NHL. Specific genes involved in anti-apoptotic process were found highly expressed in leukocytes from patients with C. burnetii associated-NHL: MIR17HG, REL and SP100. This signature differed from that found for NHL-control group. Patients with C. burnetii lymphadenitis presented significant elevated levels of BCL2 and ETS1 mRNAs. Altogether, we identified a specific transcriptionnal signature for NHL during C. burnetii infection reflecting the up-regulation of anti-apoptotic processes and the fact that lymphadenitis might constitute a critical step towards lymphomagenesis.

Also flagged:tumorhepatocellular carcinomaLiver lesionscancerhepatic cancerschronic viral hepatitis
Journal Article 2019-06-10 ✓ 1 Snippet Rennert J, Wiesinger I, Schicho A, Beyer LP, Wiggermann P, Stroszczynski C, Jung EM.
In-Text Gene Mentions

…diseases such ashemochromatosisor alpha-1-antitrypsin deficie…

Show Full Abstract

<h4>Aim</h4>Evaluation of an external color coded perfusion quantification software with CEUS for the post-interventional success control following TACE in patients with HCC.<h4>Material and methods</h4>31 patients (5 females, 26 males, age range 34-82 years, mean 66.8 years) with 59 HCC lesions underwent superselective TACE using DSM Beads between 01/2015 and 06/2018. All patients underwent CEUS by an experienced examiner using a convex multifrequency probe (1-6 MHz) within 24 hours following TACE to detect residual tumor tissue. Retrospective evaluation using a perfusion quantification software regarding pE, TTP, mTT, Ri and WiAUC in the center of the lesion, the margin and surrounding liver.<h4>Results</h4>In all lesions, a post-interventional visual reduction of the tumor microvascularization was observed. Significant differences between center of the lesion vs. margin and surrounding liver were found regarding peak enhancement (867.8 ± 2416 center vs 2028 ± 3954 margin p<0.005) and center 867.8 ± 2416 vs 2824 ± 4290 surrounding liver, p<0.0001)). However, no significant differences were found concerning Ri, WiAuC, mTT and TTP.<h4>Conclusion</h4>CEUS with color- coded perfusion imaging is a valuable supporting tool for post-interventional success control following TACE of liver lesions. Peak enhancement seems to be the most valuable parameter.

Also flagged:TNF-αglucocorticoid receptorgene expressionGlucocorticoid resistanceglucocorticoidsGR
Journal Article 2019-06-10 ✓ 1 Snippet Dendoncker K, Timmermans S, Vandewalle J, Eggermont M, Lempiäinen J, Paakinaho V, Van Hamme E, Dewaele S, Vandevyver S, Ballegeer M, Souffriau J, Van Wyngene L, Van Looveren K, Vanderhaeghen T, Beyaert R, De Bosscher K, Palvimo JJ, Van Montagu M, Libert C.
In-Text Gene Mentions

Eci2

Show Full Abstract

Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital as well as acquired. The strong proinflammatory cytokine TNF-alpha (TNF) induces an acute form of GCR, not only in mice, but also in several cell lines: e.g., in the hepatoma cell line BWTG3, as evidenced by impaired Dexamethasone (Dex)-stimulated direct GR-dependent gene up- and down-regulation. We report that TNF has a significant and broad impact on this transcriptional performance of GR, but no impact on nuclear translocation, dimerization, or DNA binding capacity of GR. Proteome-wide proximity-mapping (BioID), however, revealed that the GR interactome was strongly modulated by TNF. One GR cofactor that interacted significantly less with the receptor under GCR conditions is p300. NFκB activation and p300 knockdown both reduced direct transcriptional output of GR whereas p300 overexpression and NFκB inhibition reverted TNF-induced GCR, which is in support of a cofactor reshuffle model. This hypothesis was supported by FRET studies. This mechanism of GCR opens avenues for therapeutic interventions in GCR diseases.

Also flagged:EPOIL-6Hemoglobininterleukin-6anemiaFerritin
Journal Article 2019-06-10 ✓ 1 Snippet Jiang Y, Jiang FQ, Kong F, An MM, Jin BB, Cao D, Gong P.
In-Text Gene Mentions

…iron-related diseases (e.g.,hemochromatosis), immunologic diseases or…

Show Full Abstract

<h4>Background</h4>Anemia is one of the most common complications of sepsis. Sepsis-related anemia is associated mainly with inflammation. We aimed to observe the changes in the inflammatory anemia-associated parameters of patients with sepsis in the early stage of intensive care unit (ICU) admission and to evaluate their association with 28-day mortality.<h4>Methods</h4>A total of 198 patients with sepsis were divided into survivor (n = 110) and non-survivor (n = 88) groups on the basis of 28-day survival. Healthy volunteers (n = 20) were enrolled as a control group. Plasma levels of iron, ferritin, erythropoietin (EPO), soluble transferrin receptor (sTfR), hepcidin, interleukin-6 (IL-6), hemoglobin and the red blood cell distribution width (RDW) were measured on days 1, 3 and 7 of ICU admission. Clinical data and laboratory findings were collected, and the Sequential Organ Failure Assessment (SOFA) score was calculated.<h4>Results</h4>Patients with sepsis showed significant decreases in hemoglobin, plasma iron and sTfR/log ferritin and significant increases in plasma EPO, sTfR, hepcidin, ferritin and IL-6 on days 1, 3 and 7 of ICU admission compared with healthy volunteers. Hemoglobin was correlated negatively with plasma IL-6 and hepcidin. In patients with sepsis, non-survivors had significantly lower plasma iron, EPO and sTfR/log ferritin, but higher plasma hepcidin, ferritin and IL-6 than survivors on days 1, 3 and 7 of ICU admission. Plasma EPO, hepcidin, ferritin, IL-6, sTfR/log ferritin, the RDW and SOFA score were associated significantly with 28-day mortality but to a varying extent. In particular, in predicting 28-day mortality, plasma hepcidin had an area under the receiver operating curve of 0.808 and 87.3% specificity, which was the highest among the inflammatory anemia-associated parameters tested.<h4>Conclusions</h4>Inflammatory anemia-associated parameters changed significantly in patients with sepsis in the first week of ICU admission. Plasma EPO, hepcidin, ferritin, IL-6, sTfR/log ferritin, the RDW and SOFA score were associated significantly with 28-day mortality. Plasma hepcidin might have a superior predictive value, with high specificity, compared with other inflammatory anemia-associated parameters for 28-day mortality of sepsis patients in the ICU.

Also flagged:Mitosiscyclin-dependent kinaseCDKcell cyclingreproductionGametogenesis
Journal Article 2019-06-10 No Snippets Wang JH, Li Y, Deng SL, Liu YX, Lian ZX, Yu K.
Show Full Abstract

Mitosis is a highly sophisticated and well-regulated process during the development and differentiation of mammalian gametogenesis. The regulation of mitosis plays an essential role in keeping the formulation in oogenesis and gametogenesis. In the past few years, substantial research progress has been made by showing that cyclins/cyclin-dependent kinase (CDK) have roles in the regulation of meiosis. In addition, more functional signaling molecules have been discovered in mitosis. Growing evidence has also indicated that miRNAs influence cell cycling. In this review, we focus on specific genes, cyclins/Cdk, signaling pathways/molecules, and miRNAs to discuss the latest achievements in understanding their roles in mitosis during gametogenesis. Further elucidation of mitosis during gametogenesis may facilitate delineating all processes of mammalian reproduction and the development of disease treatments.

Also flagged:tumorhematopoietic malignancieshematological neoplasmsHematological Malignanciesoligonucleotideacute lymphoblastic leukemia
Journal Article 2019-06-10 ✓ 1 Snippet Sánchez R, Ayala R, Martínez-López J, Martínez-López J.
In-Text Gene Mentions

…yeloid neoplasms (e.g., KMT2A-MLLT10, RUNX1 -…

Show Full Abstract

Ultra-deep next-generation sequencing has emerged in recent years as an important diagnostic tool for the detection and follow-up of tumor burden in most of the known hematopoietic malignancies. Meticulous and high-throughput methods for the lowest possible quantified disease are needed to address the deficiencies of more classical techniques. Precision-based approaches will allow us to correctly stratify each patient based on the minimal residual disease (MRD) after a treatment cycle. In this review, we consider the most prominent ways to approach next-generation sequencing methodologies to follow-up MRD in hematological neoplasms.

Also flagged:Vitamin DObesityTrimethylamineVitamin D deficiencynon-alcoholic fatty liver diseaseNAFLD
Journal Article 2019-06-10 ✓ 1 Snippet Barrea L, Muscogiuri G, Annunziata G, Laudisio D, de Alteriis G, Tenore GC, Colao A, Savastano S.
In-Text Gene Mentions

…viral hepatitis patients,hemochromatosis, hepatic malignancy (13…

Show Full Abstract

<b>A</b><b>bstract:</b> Vitamin D deficiency and obesity are two public health problems extensively exacerbated over the last years. Among the several mechanisms proposed to account for the complex interplay between vitamin D and obesity, one that has gained particular attention is related to the emerging role of obesity-related changes in gut microbiota and gut-derived metabolites, such as Trimethylamine-N-oxide (TMAO). Vitamin D deficiency and high circulating TMAO levels are associated with body weight and the severity of non-alcoholic fatty liver disease (NAFLD). Considering the link of obesity with vitamin D on the one hand and obesity with TMAO on the other hand, and the central role of the liver in both the vitamin D and TMAO metabolism, the aim of this cross-sectional observational study was first, to confirm the possible inverse association between vitamin D and TMAO across different body mass index (BMI) classes and second, to investigate if this association could be influenced by the presence of NAFLD. One hundred and four adult subjects (50 males and 54 females; 35.38 ± 7.49 years) were enrolled. The fatty liver index (FLI) was used as a proxy for the diagnosis of NAFLD. Vitamin D deficiency was found in 65 participants (62.5%), while 33 subjects (31.7%) had insufficient levels, and the remaining subjects had sufficient levels of vitamin D. Subjects with both vitamin D deficiency and FLI-NAFLD had the highest TMAO levels (<i>p</i> < 0.001). By stratifying the sample population according to the BMI classes, vitamin D levels decreased significantly along with the increase of plasma TMAO concentrations, with the lowest vitamin D levels and highest TMAO, respectively, in class III obesity. Vitamin D levels showed significant opposite associations with circulating levels of TMAO (<i>r</i> = -0.588, <i>p</i> < 0.001), but this association was no longer significant after the adjustment for FLI values. The highest values of TMAO were significantly associated with the severity of obesity (OR 7.92; <i>p</i> < 0.001), deficiency of vitamin D (OR 1.62; <i>p</i> < 0.001), and FLI-NAFLD (OR 3.79; <i>p</i> < 0.001). The most sensitive and specific cut-off for vitamin D to predict the circulating levels of TMAO was ≤19.83 ng/mL (<i>p</i> < 0.001). In conclusion, our study suggests that high TMAO levels are associated with vitamin D deficiency and NAFLD. Further studies are required to investigate if there is a causality link or whether all of them are simply the consequence of obesity.

Also flagged:myosin heavy chainantibodyMYH6MYH7antibodiesMYH2
Journal Article 2019-06-10 ✓ 1 Snippet López-Unzu MA, Durán AC, Soto-Navarrete MT, Sans-Coma V, Fernández B.
In-Text Gene Mentions

…to interact withSox6to regulate the…

Show Full Abstract

<h4>Background</h4>Immunohistochemical studies of hearts from the lesser spotted dogfish, <i>Scyliorhinus canicula</i> (Chondrichthyes) revealed that the pan-myosin heavy chain (pan-MyHC) antibody MF20 homogeneously labels all the myocardium, while the pan-MyHC antibody A4.1025 labels the myocardium of the inflow (sinus venosus and atrium) but not the outflow (ventricle and conus arteriosus) cardiac segments, as opposed to other vertebrates. We hypothesized that the conventional pattern of cardiac MyHC isoform distribution present in most vertebrates, i.e. MYH6 in the inflow and MYH7 in the outflow segments, has evolved from a primitive pattern that persists in Chondrichthyes. In order to test this hypothesis, we conducted protein detection techniques to identify the MyHC isoforms expressed in adult dogfish cardiac segments and to assess the pan-MyHC antibodies reactivity against the cardiac segments of representative species from different vertebrate groups.<h4>Results</h4>Western and slot blot results confirmed the specificity of MF20 and A4.1025 for MyHC in dogfish and their differential reactivity against distinct myocardial segments. HPLC-ESI-MS/MS and ESI-Quadrupole-Orbitrap revealed abundance of MYH6 and MYH2 in the inflow and of MYH7 and MYH7B in the outflow segments. Immunoprecipitation showed higher affinity of A4.1025 for MYH2 and MYH6 than for MYH7 and almost no affinity for MYH7B. Immunohistochemistry showed that A4.1025 signals are restricted to the inflow myocardial segments of elasmobranchs, homogeneous in all myocardial segments of teleosts and acipenseriforms, and low in the ventricle of polypteriforms.<h4>Conclusions</h4>The cardiac inflow and outflow segments of the dogfish show predominance of fast- and slow-twitch MyHC isoforms respectively, what can be considered a synapomorphy of gnathostomes. The myocardium of the dogfish contains two isomyosins (MYH2 and MYH7B) not expressed in the adult heart of other vertebrates. We propose that these isomyosins lost their function in cardiac contraction during the evolution of gnathostomes, the later acquiring a regulatory role in myogenesis through its intronic miRNA. Loss of MYH2 and MYH7B expression in the heart possibly occurred before the origin of Osteichthyes, being the latter reacquired in polypteriforms. We raise the hypothesis that the slow tonic MYH7B facilitates the peristaltic contraction of the conus arteriosus of fish with a primitive cardiac anatomical design and of the vertebrate embryo.

Also flagged:polyphenolsflavonoidsascorbic acidwateralanine transaminasealkaline phosphatase
Journal Article 2019-06-10 ✓ 1 Snippet Ali MY, Rumpa NN, Paul S, Hossen MS, Tanvir EM, Hossan T, Saha M, Alam N, Karim N, Khalil MI, Gan SH.
In-Text Gene Mentions

…sickle cell anemia,hemochromatosis, and chronic liver…

Show Full Abstract

The aim of this study was to investigate the antioxidant potentials, subacute toxicity, and beneficiary effects of methanolic extract of pomelo (<i>Citrus grandis</i> L. Osbeck) in rats. Long Evans rats were divided into four groups of eight animals each. The rats were orally treated with three doses of pomelo (250, 500, and 1000 mg/kg) once daily for 21 days. Pomelo extract contained high concentrations of polyphenols, flavonoids, and ascorbic acid while exhibiting high 1,1-diphenyl-2-picrylhydrazyl radical scavenging activity and ferric reducing antioxidant power values. There was no significant change in the body weight, percentage water content, and relative organ weight at any administered doses. In addition, no significant alterations in the hematological parameters were also observed. However, rats which received 1000 mg/kg dose had a significant reduction in some serum parameters, including alanine transaminase (15.29%), alkaline phosphatase (2.5%), lactate dehydrogenase (15.5%), <i>γ</i>-glutamyltransferase (20%), creatinine (14.47%), urea (18.50%), uric acid (27.14%), total cholesterol (5.78%), triglyceride (21.44%), low-density lipoprotein cholesterol (40.74%), glucose (2.48%), and all atherogenic indices including cardiac risk ratio (24.30%), Castelli's risk index-2 (45.71%), atherogenic coefficient (42%), and atherogenic index of plasma (25%) compared to control. In addition, the highest dose (1000 mg/kg) caused a significant increase in iron (12.07%) and high-density lipoprotein cholesterol (8.87%) levels. Histopathological findings of the vital organs did not indicate any pathological changes indicating that pomelo is nontoxic, safe, and serves as an important source of natural antioxidants. In addition, the fruit extract has the potential to ameliorate hepato- and nephrotoxicities and cardiovascular diseases as well as iron deficiency anemia.

Also flagged:Glutathionereduced glutathioneoxidized glutathionesynthesismetabolismcancer
Journal Article 2019-06-10 No Snippets Lv H, Zhen C, Liu J, Yang P, Hu L, Shang P.
Show Full Abstract

Glutathione is the principal intracellular antioxidant buffer against oxidative stress and mainly exists in the forms of reduced glutathione (GSH) and oxidized glutathione (GSSG). The processes of glutathione synthesis, transport, utilization, and metabolism are tightly controlled to maintain intracellular glutathione homeostasis and redox balance. As for cancer cells, they exhibit a greater ROS level than normal cells in order to meet the enhanced metabolism and vicious proliferation; meanwhile, they also have to develop an increased antioxidant defense system to cope with the higher oxidant state. Growing numbers of studies have implicated that altering the glutathione antioxidant system is associated with multiple forms of programmed cell death in cancer cells. In this review, we firstly focus on glutathione homeostasis from the perspectives of glutathione synthesis, distribution, transportation, and metabolism. Then, we discuss the function of glutathione in the antioxidant process. Afterwards, we also summarize the recent advance in the understanding of the mechanism by which glutathione plays a key role in multiple forms of programmed cell death, including apoptosis, necroptosis, ferroptosis, and autophagy. Finally, we highlight the glutathione-targeting therapeutic approaches toward cancers. A comprehensive review on the glutathione homeostasis and the role of glutathione depletion in programmed cell death provide insight into the redox-based research concerning cancer therapeutics.

Also flagged:autophagydiabetic cardiomyopathyGFPLC3luciferaseglucose
Journal Article 2019-06-10 ✓ 5 Snippets Feng Y, Xu W, Zhang W, Wang W, Liu T, Zhou X.
In-Text Gene Mentions

PCDH17, which belongs to the protocadherin gene family, has been shown to be associated with the activation of autophagy in cancer cells 13,14.

The results revealed that high glucose could increase PCDH17 expression and induce cardiomyocyte autophagy, while DCRF knockdown was associated with reduced PCDH17 expression and cardiomyocyte autophagy.

Cardiomyocytes were exposed to high glucose following transfection with DCRF-siRNA and/or pcDNA-PCDH17, and the expression of LC3 was detected by Western blotting.

Furthermore, DCRF knockdown decreased PCDH17 expression and suppressed autophagy in cardiomyocytes treated with high glucose.

Moreover, DCRF-siRNA and pcDNA-PCDH17 co-transfection promoted autophagy in cardiomyocytes treated with high glucose (Figure 7A-C).

Show Full Abstract

<b>Background</b>: We generated a rat model of diabetic cardiomyopathy (DCM) and reported significant upregulation of the long non-coding RNA DCRF. This study was designed to determine the molecular mechanisms of DCRF in the development of DCM. <b>Methods</b>: Real-time PCR and RNA fluorescent in situ hybridization were conducted to detect the expression pattern of DCRF in cardiomyocytes. Histological and echocardiographic analyses were used to assess the effect of DCRF knockdown on cardiac structure and function in diabetic rats. mRFP-GFP-LC3 fluorescence microscopy, transmission electron microscopy, and Western blotting were carried out to determine cardiomyocyte autophagy. RNA immunoprecipitation and luciferase reporter assays were performed to elucidate the regulatory role of DCRF/miR-551b-5p/PCDH17 pathway in cardiomyocyte autophagy. <b>Results</b>: Our findings showed that DCRF knockdown reduced cardiomyocyte autophagy, attenuated myocardial fibrosis, and improved cardiac function in diabetic rats. High glucose increased DCRF expression and induced autophagy in cardiomyocytes. RNA immunoprecipitation and luciferase reporter assays indicated that DCRF was targeted by miR-551b-5p in an AGO2-dependent manner and PCDH17 was the direct target of miR-551b-5p. Forced expression of DCRF was found to attenuate the inhibitory effect of miR-551b-5p on PCDH17. Furthermore, DCRF knockdown decreased PCDH17 expression and suppressed autophagy in cardiomyocytes treated with high glucose. <b>Conclusion</b>: Our study suggests that DCRF can act as a competing endogenous RNA to increase PCDH17 expression by sponging miR-551b-5p, thus contributing to increased cardiomyocyte autophagy in DCM.

Also flagged:extracellularimmune responsegrowthAminohydroxylosteogenesis
Journal Article 2019-06-10 No Snippets Goonoo N, Bhaw-Luximon A.
Show Full Abstract

The primary aim of tissue engineering scaffolds is to mimic the <i>in vivo</i> environment and promote tissue growth. In this quest, a number of strategies have been developed such as enhancing cell-material interactions through modulation of scaffold physico-chemical parameters. However, more is required for scaffolds to relate to the cell natural environment. Growth factors (GFs) secreted by cells and extracellular matrix (ECM) are involved in both normal repair and abnormal remodeling. The direct use of GFs on their own or when incorporated within scaffolds represent a number of challenges such as release rate, stability and shelf-life. Small molecules have been proposed as promising alternatives to GFs as they are able to minimize or overcome many shortcomings of GFs, in particular immune response and instability. Despite the promise of small molecules in various TE applications, their direct use is limited by nonspecific adverse effects on non-target tissues and organs. Hence, they have been incorporated within scaffolds to localize their actions and control their release to target sites. However, scanty rationale is available which links the chemical structure of these molecules with their mode of action. We herewith review various small molecules either when used on their own or when incorporated within polymeric carriers/scaffolds for bone, cartilage, neural, adipose and skin tissue regeneration.

Also flagged:platelet disordersbleeding disordersvon Willebrand diseasehemophiliaF8F9
Journal Article 2019-06-09 No Snippets Megy K, Downes K, Simeoni I, Bury L, Morales J, Mapeta R, Bellissimo DB, Bray PF, Goodeve AC, Gresele P, Lambert M, Reitsma P, Ouwehand WH, Freson K, Subcommittee on Genomics in Thrombosis and Hemostasis.
Show Full Abstract

No abstract available.

Also flagged:Hydroxyapatitemonoterpenesmonoterpenoidsphenylpropanoidsulcersobesity
Journal Article 2019-06-09 No Snippets Badea ML, Iconaru SL, Groza A, Chifiriuc MC, Beuran M, Predoi D.
Show Full Abstract

This study aimed at developing an antimicrobial material based on hydroxyapatite (HAp) and peppermint essential oil (P-EO) in order to stimulate the antimicrobial activity of hydroxyapatite. The molecular spectral features and morphology of the P-EO, HAp and hydroxyapatite coated with peppermint essential oil (HAp-P) were analyzed using Fourier-transform infrared (FTIR) spectroscopy and scanning electron microscopy (SEM). The coating of the HAp with the P-EO did not affect the ellipsoidal shape of the nanoparticles. The overlapping of IR bands of P-EO and HAp in the HAp-P spectrum determined the formation of the broad molecular bands that were observed in the spectral regions of 400-1000 cm<sup>-1</sup> and 1000-1200 cm<sup>-1</sup>. The antibacterial activity of the P-EO, HAp and HAp-P were also tested against different Gram-positive bacteria (methicillin-resistant <i>Staphylococcus aureus</i> (MRSA) 388, <i>S. aureus</i> ATCC 25923, <i>S. aureus</i> ATCC 6538, <i>E. faecium</i> DSM 13590), Gram-negative bacteria (<i>Escherichia coli</i> ATCC 25922, <i>E. coli</i> C5, <i>P. aeruginosa</i> ATCC 27853, <i>P. aeruginosa</i> ATCC 9027) and a fungal strain of <i>Candida parapsilosis</i>. The results of the present study revealed that the antimicrobial activity of HAp-P increased significantly over that of HAp.

Also flagged:disulfidepolycarboxybetaine methacrylatedoxorubicintumordiolcystamine
Journal Article 2019-06-09 No Snippets Jiang J, Li J, Zhou B, Niu C, Wang W, Wu W, Liang J.
Show Full Abstract

To achieve a high stability in physiological environment and rapid intracellular drug release, a biodegradable zwitterionic triblock copolymer with a disulfide-linked poly-ε-caprolactone and polycarboxybetaine methacrylate (PCBMA-SS-PCL-SS-PCBMA) was prepared for micellar carrier to delivery doxorubicin (DOX) into tumor cells. PCBMA-SS-PCL-SS-PCBMA was obtained by following steps: i) introducing disulfide bonds through end-group modification of PCL diol with cystamine dihydrochloride; ii) preparing PCL-RAFT macromolecular chain transfer agent by EDC/NHS chemistry; iii) RAFT polymerization of zwitterionic monomer. Self-assembling from PCBMA-SS-PCL-SS-PCBMA, polymeric micelles had many advantages, such as ultra-low protein absorption in serum and obvious reduction-responsiveness in the presence of DTT. Furthermore, DOX-loaded micelles exhibited high stability upon centrifugation and lyophilization, a fast intracellular drug release and enhanced drug efficacy due to GSH-triggered PCBMA shell shedding and micellar reassembling. Thus, the polymeric micelles integrated several functions and properties could be prospectively utilized as valuable nanocarriers in cancer chemotherapeutics.

Also flagged:BMP4glioblastomatumorGBMextracellularmechanotransduction
Journal Article 2019-06-09 ✓ 1 Snippet Hughes JH, Ewy JM, Chen J, Wong SY, Tharp KM, Stahl A, Kumar S.
In-Text Gene Mentions

POU3F2

Show Full Abstract

The poor prognosis of glioblastoma (GBM) is associated with a highly invasive stem-like subpopulation of tumor-initiating cells (TICs), which drive recurrence and contribute to intra-tumoral heterogeneity through differentiation. These TICs are better able to escape extracellular matrix-imposed mechanical restrictions on invasion than their more differentiated progeny, and sensitization of TICs to extracellular matrix mechanics extends survival in preclinical models of GBM. However, little is known about the molecular basis of the relationship between TIC differentiation and mechanotransduction. Here we explore this relationship through a combination of transcriptomic analysis and studies with defined-stiffness matrices. We show that TIC differentiation induced by bone morphogenetic protein 4 (BMP4) suppresses expression of proteins relevant to extracellular matrix signaling and sensitizes TIC spreading to matrix stiffness. Moreover, our findings point towards a previously unappreciated connection between BMP4-induced differentiation, mechanotransduction, and metabolism. Notably, stiffness and differentiation modulate oxygen consumption, and inhibition of oxidative phosphorylation influences cell spreading in a stiffness- and differentiation-dependent manner. Our work integrates bioinformatic analysis with targeted molecular measurements and perturbations to yield new insight into how morphogen-induced differentiation influences how GBM TICs process mechanical inputs.

Also flagged:hepatocellular carcinomacancerdeathsulfatidecell migration5-fluorouracil
Journal Article 2019-06-09 ✓ 1 Snippet Kang CL, Qi B, Cai QQ, Fu LS, Yang Y, Tang C, Zhu P, Chen QW, Pan J, Chen MH, Wu XZ.
In-Text Gene Mentions

…core histones, thelinker histoneshistones (H1) help…

Show Full Abstract

<b>Rationale</b>: Tumor metastasis is the main cause for cancer-related death. However, the driving molecules of metastasis remain largely unknown. Here, we aim to identify long non-coding RNAs (lncRNAs) critical for human hepatocellular carcinoma (HCC) metastasis. <b>Methods</b>: Microarrays were used to screen a comprehensive set of lncRNAs with differential expression profiles in sulfatide-treated cells. Mass spectrometry, protein arrays, and RNA pull-down experiments were used to identify proteins that interacted with lncRNA. Epigenetic analysis was used to study lncRNA-mediated regulation mechanisms. <b>Results</b>: We identified lncRNA AY927503 (AY) as a metastasis-associated molecule that was highly expressed in human hepatocellular carcinoma (HCC) and correlated with metastatic events and poor prognosis in patients with HCC. AY promoted HCC cell migration, stemness, 5-fluorouracil resistance, and metastasis in mice. However, knockdown of integrin αV (ITGAV) abolished AY-stimulated migration, cell viability in HCC cells or tube formation. AY strongly promoted <i>ITGAV</i> transcription and αVβ3 expression by interacting with the <i>ITGAV</i> promoter specifically and stimulating its activity. AY was identified to interact with histone 1FX (H1FX), but deletion of the central domain of AY (AY∆371-522) abolished H1FX binding and <i>ITGAV</i> promoter stimulation. AY significantly enriched H3K4Me3 and acH3K9/14 but reduced H3K27Me3 and H1FX occupancy on the <i>ITGAV</i> promoter, which remodeled chromatin structures for RNA polymerase II recruitment. Knockdown of H1FX abrogated <i>ITGAV</i> transcription stimulated by AY. <b>Conclusions</b>: Our findings suggested that lncRNA AY promoted HCC metastasis via induction of chromatin modification for <i>ITGAV</i> transcription as a pioneer factor and was a potential molecular signature for metastasis or poor prognosis in patients with HCC.

Also flagged:phenylenemacrocyclesimidazolezincGP1binding
Journal Article 2019-06-08 ✓ 3 Snippets Yoneyama K, Suzuki R, Kuramochi Y, Satake A.
In-Text Gene Mentions

…are desirable forDCC, and the present…

…ligand discovery inDCCusing this system.…

…be beneficial forDCC, and the present…

Show Full Abstract

Multifunctionalized materials are expected to be versatile probes to find specific interactions between a ligand and a target biomaterial. Thus, efficient methods to prepare possible combinations of the functionalities is desired. The concept of dynamic combinatorial chemistry (DCC) is ideal for the generation of any possible combination, as well as screening for target biomaterials. Here, we propose a new molecular design of multitopic probes for ligand discovery in DCC. We synthesized a new Gable Porphyrin, <b>GP1</b>, having prop-2-yne groups as a scaffold to introduce various functional groups. <b>GP1</b> is a bis(imidazolylporphyrinatozinc) compound connected through a 1,3-phenylene moiety, and it gives macrocycles spontaneously and quantitatively by strong imidazole-to-zinc complementary coordination. Some different types of functional groups were introduced into <b>GP1</b> in high yields. Formation of heterogeneous macrocycles composed of GP1 derivatives having different types of substituents was accomplished under equilibrium conditions. These results promise that enormous numbers of macrocycles having various functional groups can be provided when the kinds of GP components increase. These features are desirable for DCC, and the present system using <b>GP1</b> is a potential candidate to provide a dynamic combinatorial library of multitopic probes to discover specific interactions between a ligand and a biomaterial.

Also flagged:nucleasesmeganucleaseszinc finger nucleasestranscription activator-like effector nucleasesCas9nuclease
Journal Article 2019-06-08 No Snippets Li Q, Qin Z, Wang Q, Xu T, Yang Y, He Z.
Show Full Abstract

Genome editing technology is a technique for targeted genetic modifications, enabling the knockout and addition of specific DNA fragments. This technology has been widely used in various types of biomedical research, clinics and agriculture. In terms of disease research, constructing appropriate animal models is necessary. Combining reproductive technology with genome editing, many animal disease models have been generated for basic and clinical research. In addition, precisely targeted modifications allow genome editing to flourish in the field of gene therapy. Many mutations refractory to traditional gene therapy could be permanently corrected at the DNA level. Thus, genome editing is undoubtedly a promising technology for gene therapy. In this review, we mainly introduce the applications of genome editing in constructing animal disease models and gene therapies, as well as its future prospects and challenges.

Also flagged:Peptidespeptidefood allergyovalbuminpepsinIl33
Journal Article 2019-06-07 ✓ 1 Snippet Lozano-Ojalvo D, Martínez-Blanco M, Pérez-Rodríguez L, Molina E, López-Fandiño R.
In-Text Gene Mentions

…(BM)-DCs to expressTnfsf4and produce pro-inflammatory…

Show Full Abstract

<h4>Scope</h4>The mechanism through which peptide-based immunotherapy provides effective desensitization toward food allergy is investigated.<h4>Methods and results</h4>Ex vivo experiments are conducted with intestinal epithelial cells (IECs), dendritic cells (DCs), and T cells from mice sensitized to egg white (EW) and either left untreated or tolerized by the oral administration of a hydrolysate of ovalbumin with pepsin (OP). IECs from EW-sensitized mice upregulate Il33 and Tslp to a higher extent than those from tolerized mice and induce bone marrow (BM)-DCs to express Tnfsf4 and produce pro-inflammatory cytokines. On the other hand, incubation with OP upregulates Aldh1a1 in IEC cultures and BM-DCs conditioned with supernatants of OP-pulsed IECs also overexpress Aldh1a2 and Tgfb1. DCs from tolerized mice, in co-culture with CD4<sup>+</sup> T cells from sensitized mice, reduce the secretion of IL-5, IFN-γ, and IL-17, following stimulation with EW, to a level similar than DCs from sham-sensitized mice. Furthermore, incubation with OP of DCs and CD4<sup>+</sup> T cells, regardless of the mouse sentitization status, promotes the secretion of TGF-β and the generation of Foxp3<sup>+</sup> RORγt<sup>+</sup> cells.<h4>Conclusion</h4>OP induces the expression of aldehyde dehydrogenase enzymes in cells of the innate immune system and the development of Foxp3<sup>+</sup> RORγt<sup>+</sup> T cells.

Also flagged:wspgene expressionmatingmetabolisminfectionreproduction
Journal Article 2019-06-07 No Snippets Baião GC, Schneider DI, Miller WJ, Klasson L.
Show Full Abstract

<h4>Background</h4>The Neotropical fruit fly Drosophila paulistorum (Diptera: Drosophilidae) is a species complex in statu nascendi comprising six reproductively isolated semispecies, each harboring mutualistic Wolbachia strains. Although wild type flies of each semispecies are isolated from the others by both pre- and postmating incompatibilities, mating between semispecies and successful offspring development can be achieved once flies are treated with antibiotics to reduce Wolbachia titer. Here we use RNA-seq to study the impact of Wolbachia on D. paulistorum and investigate the hypothesis that the symbiont may play a role in host speciation. For that goal, we analyze samples of heads and abdomens of both sexes of the Amazonian, Centro American and Orinocan semispecies of D. paulistorum.<h4>Results</h4>We identify between 175 and 1192 differentially expressed genes associated with a variety of biological processes that respond either globally or according to tissue, sex or condition in the three semispecies. Some of the functions associated with differentially expressed genes are known to be affected by Wolbachia in other species, such as metabolism and immunity, whereas others represent putative novel phenotypes involving muscular functions, pheromone signaling, and visual perception.<h4>Conclusions</h4>Our results show that Wolbachia affect a large number of biological functions in D. paulistorum, particularly when present in high titer. We suggest that the significant metabolic impact of the infection on the host may cause several of the other putative and observed phenotypes. We also speculate that the observed differential expression of genes associated with chemical communication and reproduction may be associated with the emergence of pre- and postmating barriers between semispecies, which supports a role for Wolbachia in the speciation of D. paulistorum.

Also flagged:STAT5BT-cell leukemialymphomaSH2dephosphorylationT-cell neoplasia
Journal Article 2019-06-07 No Snippets de Araujo ED, Erdogan F, Neubauer HA, Meneksedag-Erol D, Manaswiyoungkul P, Eram MS, Seo HS, Qadree AK, Israelian J, Orlova A, Suske T, Pham HTT, Boersma A, Tangermann S, Kenner L, Rülicke T, Dong A, Ravichandran M, Brown PJ, Audette GF, Rauscher S, Dhe-Paganon S, Moriggl R, Gunning PT.
Show Full Abstract

Hyper-activated STAT5B variants are high value oncology targets for pharmacologic intervention. STAT5B<sup>N642H</sup>, a frequently-occurring oncogenic driver mutation, promotes aggressive T-cell leukemia/lymphoma in patient carriers, although the molecular origins remain unclear. Herein, we emphasize the aggressive nature of STAT5B<sup>N642H</sup> in driving T-cell neoplasia upon hematopoietic expression in transgenic mice, revealing evidence of multiple T-cell subset organ infiltration. Notably, we demonstrate STAT5B<sup>N642H</sup>-driven transformation of γδ T-cells in in vivo syngeneic transplant models, comparable to STAT5B<sup>N642H</sup> patient γδ T-cell entities. Importantly, we present human STAT5B and STAT5B<sup>N642H</sup> crystal structures, which propose alternative mutation-mediated SH2 domain conformations. Our biophysical data suggests STAT5B<sup>N642H</sup> can adopt a hyper-activated and hyper-inactivated state with resistance to dephosphorylation. MD simulations support sustained interchain cross-domain interactions in STAT5B<sup>N642H</sup>, conferring kinetic stability to the mutant anti-parallel dimer. This study provides a molecular explanation for the STAT5B<sup>N642H</sup> activating potential, and insights into pre-clinical models for targeted intervention of hyper-activated STAT5B.

Also flagged:watermycoplasmasegmentationESPreproductioneee
Journal Article 2019-06-07 ✓ 5 Snippets Takata A, Nakashima M, Saitsu H, Mizuguchi T, Mitsuhashi S, Takahashi Y, Okamoto N, Osaka H, Nakamura K, Tohyama J, Haginoya K, Takeshita S, Kuki I, Okanishi T, Goto T, Sasaki M, Sakai Y, Miyake N, Miyatake S, Tsuchida N, Iwama K, Minase G, Sekiguchi F, Fujita A, Imagawa E, Koshimizu E, Uchiyama Y, Hamanaka K, Ohba C, Itai T, Aoi H, Saida K, Sakaguchi T, Den K, Takahashi R, Ikeda H, Yamaguchi T, Tsukamoto K, Yoshitomi S, Oboshi T, Imai K, Kimizu T, Kobayashi Y, Kubota M, Kashii H, Baba S, Iai M, Kira R, Hara M, Ohta M, Miyata Y, Miyata R, Takanashi JI, Matsui J, Yokochi K, Shimono M, Amamoto M, Takayama R, Hirabayashi S, Aiba K, Matsumoto H, Nabatame S, Shiihara T, Kato M, Matsumoto N.
In-Text Gene Mentions

CACNA1E

While we did not observe exome-wide significant enrichment of damaging DNMs in these genes, partly due to limited availability of the DNA samples of the parents, we confirmed that two CD missense URVs in CACNA1E, a gene recently reported as a EE/DEE/neurodevelopmental disorder gene9,29, are DNMs.

…HUWE1 , andCACNA1E).…

…HUWE1 , andCACNA1E; all of…

…missense URVs inCACNA1E, a gene…

Show Full Abstract

Although there are many known Mendelian genes linked to epileptic or developmental and epileptic encephalopathy (EE/DEE), its genetic architecture is not fully explained. Here, we address this incompleteness by analyzing exomes of 743 EE/DEE cases and 2366 controls. We observe that damaging ultra-rare variants (dURVs) unique to an individual are significantly overrepresented in EE/DEE, both in known EE/DEE genes and the other non-EE/DEE genes. Importantly, enrichment of dURVs in non-EE/DEE genes is significant, even in the subset of cases with diagnostic dURVs (P = 0.000215), suggesting oligogenic contribution of non-EE/DEE gene dURVs. Gene-based analysis identifies exome-wide significant (P = 2.04 × 10<sup>-6</sup>) enrichment of damaging de novo mutations in NF1, a gene primarily linked to neurofibromatosis, in infantile spasm. Together with accumulating evidence for roles of oligogenic or modifier variants in severe neurodevelopmental disorders, our results highlight genetic complexity in EE/DEE, and indicate that EE/DEE is not an aggregate of simple Mendelian disorders.

Also flagged:tyrosinePTP1BtermphosphorylationRHBDL4phosphatase
Journal Article 2019-06-07 ✓ 2 Snippets Ikeda KN, Freeman M.
In-Text Gene Mentions

VRK2

…LAP2B, VAPB, FND3A,VRK2, AL3A2, STX5, and…

Show Full Abstract

Rhomboid-like proteins are evolutionarily conserved, ubiquitous polytopic membrane proteins, including the canonical rhomboid intramembrane serine proteases and also others that have lost protease activity during evolution. We still have much to learn about their cellular roles, and evidence suggests that some may have more than one function. For example, RHBDL4 (rhomboid-like protein 4) is an endoplasmic reticulum (ER)-resident protease that forms a ternary complex with ubiquitinated substrates and p97/VCP (valosin-containing protein), a major driver of ER-associated degradation (ERAD). RHBDL4 is required for ERAD of some substrates, such as the pre-T-cell receptor α chain (pTα) and has also been shown to cleave amyloid precursor protein to trigger its secretion. In another case, RHBDL4 enables the release of full-length transforming growth factor α in exosomes. Using the proximity proteomic method BioID, here we screened for proteins that interact with or are in close proximity to RHBDL4. Bioinformatics analyses revealed that BioID hits of RHBDL4 overlap with factors related to protein stress at the ER, including proteins that interact with p97/VCP. PTP1B (protein-tyrosine phosphatase nonreceptor type 1, also called PTPN1) was also identified as a potential proximity factor and interactor of RHBDL4. Analysis of RHBDL4 peptides highlighted the presence of tyrosine phosphorylation at the cytoplasmic RHBDL4 C terminus. Site-directed mutagenesis targeting these tyrosine residues revealed that their phosphorylation modifies binding of RHBDL4 to p97/VCP and Lys<sup>63</sup>-linked ubiquitinated proteins. Our work lays a critical foundation for future mechanistic studies of the roles of RHBDL4 in ERAD and other important cellular pathways.

Also flagged:CFIm25cancergene expressionandCyclin D1tumor
Journal Article 2019-06-07 No Snippets Jafari Najaf Abadi MH, Shafabakhsh R, Asemi Z, Mirzaei HR, Sahebnasagh R, Mirzaei H, Hamblin MR.
Show Full Abstract

Alternative polyadenylation (APA) is now widely recognized to regulate gene expression. APA is an RNA-processing mechanism that generates distinct 3' termini on mRNAs, producing mRNA isoforms. Different factors influence the initiation and development of this process. CFIm25 (among others) is a cleavage and polyadenylation factor that plays a key role in the regulation of APA. Shortening of the 3'UTRs on mRNAs leads to enhanced cellular proliferation and tumorigenicity. One reason may be the up-regulation of growth promoting factors, such as Cyclin D1. Different studies have reported a dual role of CFIm25 in cancer (both oncogenic and tumor suppressor). microRNAs (miRNAs) may be involved in CFIm25 function as well as competing endogenous RNAs (ceRNAs). The present review focuses on the role of CFIm25 in cancer, cancer treatment, and possible involvement in other human diseases. We highlight the involvement of miRNAs and ceRNAs in the function of CFIm25 to affect gene expression. The lack of understanding of the mechanisms and regulation of CFIm25 and APA has underscored the need for further research regarding their role in cancer and other diseases.

Also flagged:Adipocytes Differentiationadipocyte differentiationlipidmetabolismfatty acidLuciferase
Journal Article 2019-06-07 No Snippets Sun G, Li F, Ma X, Sun J, Jiang R, Tian Y, Han R, Li G, Wang Y, Li Z, Kang X, Li W.
Show Full Abstract

Intramuscular fat (IMF) is the most important evaluating indicator of chicken meat quality, the content of which is positively correlated with tenderness, flavor, and succulence of the meat. Chicken IMF deposition process is regulated by many factors, including genetic, nutrition, and environment. Although large number of omics' studies focused on the IMF deposition process, the molecular mechanism of chicken IMF deposition is still poorly understood. In order to study the role of miRNAs in chicken intramuscular adipogenesis, the intramuscular adipocyte differentiation model (IMF-preadipocytes and IMF-adipocytes) was established and subject to miRNA-Seq. A total of 117 differentially expressed miRNAs between two groups were obtained. Target genes prediction and functional enrichment analysis revealed that eight pathways involved in lipid metabolism related processes, such as fatty acid metabolism and fatty acid elongation. Meanwhile a putative miRNA, gga-miR-18b-3p, was identified be served a function in the intramuscular adipocyte differentiation. Luciferase assay suggested that the gga-miR-18b-3p targeted to the 3'UTR of <i>ACOT13</i>. Subsequent functional experiments demonstrated that gga-miR-18b-3p acted as an inhibitor of intramuscular adipocyte differentiation by targeting <i>ACOT13</i>. Our findings laid a new theoretical foundation for the study of lipid metabolism, and also provided a potential target to improve the meat quality in the poultry industry.

Also flagged:ADP-Ribosylationage-related neurodegenerative diseaselocalizationcancerage-related neurological diseasetranslational
Journal Article 2019-06-07 No Snippets McGurk L, Rifai OM, Bonini NM.
Show Full Abstract

A central and causative feature of age-related neurodegenerative disease is the deposition of misfolded proteins in the brain. To devise novel approaches to treatment, regulatory pathways that modulate these aggregation-prone proteins must be defined. One such pathway is post-translational modification by the addition of poly(ADP-ribose) (PAR), which promotes protein recruitment and localization in several cellular contexts. Mounting evidence implicates PAR in seeding the abnormal localization and accumulation of proteins that are causative of neurodegenerative disease. Inhibitors of PAR polymerase (PARP) activity have been developed as cancer therapeutics, raising the possibility that they could be used to treat neurodegenerative disease. We focus on pathways regulated by PAR in neurodegenerative disease, with emphasis on amyotrophic lateral sclerosis (ALS) and frontotemporal degeneration (FTD).

Also flagged:ubiquitinproteasomeNeurodegenerative disordersHuntington's diseaseHDautophagy
Journal Article 2019-06-07 ✓ 5 Snippets Zhang L, Wei PF, Song YH, Dong L, Wu YD, Hao ZY, Fan S, Tai S, Meng JL, Lu Y, Xue J, Liang CZ, Wen LP.
In-Text Gene Mentions

Herein, we have synthesized biocompatible MnFe<sub>2</sub>O<sub>4</sub> nanoparticles (NPs) and demonstrated their unique effect in accelerating the clearance of mutant huntingtin (Htt) protein exhibiting 74 glutamine repeats [Htt(Q74)].

…of mutant huntingtin (Htt) protein exhibiting 74…

…74 glutamine repeats [Htt(Q74)].…

…-linked ubiquitination of GFP-Htt(Q74).…

…enhanced degradation ofHtt(Q74) by MnFe<sub>2</sub>O<sub…

Show Full Abstract

Neurodegenerative disorders such as Huntington's disease (HD) are fundamentally caused by accumulation of misfolded aggregate-prone proteins. Previous investigations have shown that these toxic protein aggregates could be degraded through autophagy induced by small molecules as well as by nanomaterials. However, whether engineered nanomaterials have the capacity to degrade these protein aggregates via the ubiquitin-proteasome system (UPS), the other major pathway for intracellular protein turnover, was unknown. Herein, we have synthesized biocompatible MnFe<sub>2</sub>O<sub>4</sub> nanoparticles (NPs) and demonstrated their unique effect in accelerating the clearance of mutant huntingtin (Htt) protein exhibiting 74 glutamine repeats [Htt(Q74)]. UPS, rather than autophagy, was responsible for the efficient Htt(Q74) degradation facilitated by MnFe<sub>2</sub>O<sub>4</sub> NPs. Meanwhile, we demonstrated that MnFe<sub>2</sub>O<sub>4</sub> NPs enhanced K48-linked ubiquitination of GFP-Htt(Q74). Moreover, ubiqinlin-1, but not p62/SQSTM1, served as the ubiquitin receptor that mediated the enhanced degradation of Htt(Q74) by MnFe<sub>2</sub>O<sub>4</sub> NPs. Our findings may have implications for developing novel nanomedicine for the therapy of HD and other polyglutamine expansion diseases.

Also flagged:colorectal cancergene expressiontranscription factorsTFextracellularhumoral response
Journal Article 2019-06-07 No Snippets Ju Q, Zhao YJ, Dong Y, Cheng C, Zhang S, Yang Y, Li P, Ge D, Sun B.
Show Full Abstract

Lymph node metastasis is an important step in the progression of colorectal cancer (CRC); however, the underlying mechanisms are still unknown. The aim of the present study was to identify the gene expression pattern during lymph node metastasis in CRC and to identify upstream microRNAs (miRNAs) to explore the underlying mechanisms in detail. A total of 305 differently expressed genes (DEGs) were identified, including 227 upregulated genes and 78 downregulated genes in lymph node metastasis. Pathway and process enrichment analysis demonstrated that DEGs were significantly enriched in 'NABA CORE MATRISOME', 'extracellular matrix assembly', 'antimicrobial humoral response' and 'Toll-like receptor signaling' pathways. The top 10 hub genes were identified by protein-protein interaction network, and sub-networks revealed that these genes were involved in significant pathways, including 'neutrophil chemotaxis' and 'Smooth Muscle Contraction'. In addition, 73 mature differently expressed miRNAs associated with lymph node metastasis were identified, of which 48 were upregulated and 25 were downregulated. Six miRNAs were identified to regulate DEGs. Additionally, based on the relationship between miRNAs and transcription factors, a miRNA-TF-mRNA network was constructed. In conclusion, DEGs, miRNAs and their interactions and pathways were identified in lymph node metastasis in CRC, which provided insight into the mechanism of CRC metastasis and may be used to develop novel targets for CRC treatment.

Also flagged:idiopathic trigeminal neuralgiatrigeminal neuralgiagabapentinpregabalincarbamazepinearterial hypertension
Journal Article 2019-06-07 ✓ 1 Snippet Somaza S, Montilla EM, Mora MC.
In-Text Gene Mentions

…= 1), andhemochromatosis( n =…

Show Full Abstract

<h4>Background</h4>In the present study, we evaluate the results of gamma knife surgery (GKS) for the treatment of trigeminal neuralgia (TN) using the trigeminal ganglion (TG') and the adjacent fibers of trigeminal nerve as a target.<h4>Methods</h4>From February 2013 to July 2017, we treated 30 cases of TN with GKS. In this group, all patients had an idiopathic typical TN. The radiosurgical target was conformed through two isocenters, 8 and 4 mm at the cavum de Meckel. The maximum dose was 86 Gy using the isodose line of 50%. The median age of the patients was 58.5 (range 28-94) years old, and the median time from diagnosis to GKS was 94 months (range 13-480 months). The median follow-up was 28.5 (range 12-49) months. Clinical outcomes were analyzed. Univariate and multivariate analyses were performed to evaluate factors that correlated with a favorable, pain-free outcome.<h4>Results</h4>The mean time to relief of pain was 7 (range 1-40) days. The percentage of patients with significant pain relief was 93.3%. Relapse in pain was noted in four patients at 3, 16, 19, and 36 months. Nine patients were treated in acute status. Fourteen patients had intense pain between 1 and 7 days before the procedure. Among those with the recurrence of their symptoms, one patient had a microvascular decompression. Multivariate regression adjusted for age and sex suggests that, by 40 months, 70% of the patients treated with radiosurgery will remain pain free. At the last follow-up, GKS resulted in pain relief in 86.6% of patients. Our analysis suggests that, using this technique, we can expect that approximately 70% of patients with TN will have some degree of pain improvement at 3 years' post radiosurgery.<h4>Conclusions</h4>GKS on TG appears to be a reasonable treatment option with short latency period, minor collateral effects, and high percentage of pain control. The mechanism of action of radiosurgery could be related to the inactivation of the satellite glial cells in the TG.

Also flagged:agingRapamycinoxygenECSITUNC13SKAP2
Journal Article 2019-06-06 ✓ 5 Snippets Timmons JA, Volmar CH, Crossland H, Phillips BE, Sood S, Janczura KJ, Törmäkangas T, Kujala UM, Kraus WE, Atherton PJ, Wahlestedt C.
In-Text Gene Mentions

UNC13C and SKAP2 are particularly interesting as both are regulated by exercise training (unlike the majority of Group 1 or 2 age genes, Figure S8 and Appendix S8); however, ECSIT–UNC13C–SKAP2 represent a core of Group 1 age genes that do not respond to Rapamycin treatment in vitro, while protein–protein interaction analysis (Xia, Benner, & Hancock, 2014) indicates they can be associated with “neuron apoptotic processes” (Figure S9, FDR = 2.4%, Appendix S9).

…network included CADM2,UNC13Cand ST3GAL3 genes,…

…“ age‐switch” model (UNC13C, MAPKAP1, SIN3A, PRKAR2A,…

UNC13Cand SKAP2 are…

…S8 ); however, ECSIT–UNC13C–SKAP2 represent a core…

Show Full Abstract

Emerging evidence indicates that molecular aging may follow nonlinear or discontinuous trajectories. Whether this occurs in human neuromuscular tissue, particularly for the noncoding transcriptome, and independent of metabolic and aerobic capacities, is unknown. Applying our novel RNA method to quantify tissue coding and long noncoding RNA (lncRNA), we identified ~800 transcripts tracking with age up to ~60 years in human muscle and brain. In silico analysis demonstrated that this temporary linear "signature" was regulated by drugs, which reduce mortality or extend life span in model organisms, including 24 inhibitors of the IGF-1/PI3K/mTOR pathway that mimicked, and 5 activators that opposed, the signature. We profiled Rapamycin in nondividing primary human myotubes (n = 32 HTA 2.0 arrays) and determined the transcript signature for reactive oxygen species in neurons, confirming that our age signature was largely regulated in the "pro-longevity" direction. Quantitative network modeling demonstrated that age-regulated ncRNA equaled the contribution of protein-coding RNA within structures, but tended to have a lower heritability, implying lncRNA may better reflect environmental influences. Genes ECSIT, UNC13, and SKAP2 contributed to a network that did not respond to Rapamycin, and was associated with "neuron apoptotic processes" in protein-protein interaction analysis (FDR = 2.4%). ECSIT links inflammation with the continued age-related downwards trajectory of mitochondrial complex I gene expression (FDR < 0.01%), implying that sustained inhibition of ECSIT may be maladaptive. The present observations link, for the first time, model organism longevity programs with the endogenous but temporary genome-wide responses to aging in humans, revealing a pattern that may ultimately underpin personalized rates of health span.

Also flagged:gene expressionmetabolismhibernationtranslational repressionmetabolic depressionoxygen
Journal Article 2019-06-06 ✓ 1 Snippet Capraro A, O'Meally D, Waters SA, Patel HR, Georges A, Waters PD.
In-Text Gene Mentions

…NQO1 , andOLFM4) during hibernation…

Show Full Abstract

<h4>Background</h4>Hibernation is a physiological state exploited by many animals exposed to prolonged adverse environmental conditions associated with winter. Large changes in metabolism and cellular function occur, with many stress response pathways modulated to tolerate physiological challenges that might otherwise be lethal. Many studies have sought to elucidate the molecular mechanisms of mammalian hibernation, but detailed analyses are lacking in reptiles. Here we examine gene expression in the Australian central bearded dragon (Pogona vitticeps) using mRNA-seq and label-free quantitative mass spectrometry in matched brain, heart and skeletal muscle samples from animals at late hibernation, 2 days post-arousal and 2 months post-arousal.<h4>Results</h4>We identified differentially expressed genes in all tissues between hibernation and post-arousal time points; with 4264 differentially expressed genes in brain, 5340 differentially expressed genes in heart, and 5587 differentially expressed genes in skeletal muscle. Furthermore, we identified 2482 differentially expressed genes across all tissues. Proteomic analysis identified 743 proteins (58 differentially expressed) in brain, 535 (57 differentially expressed) in heart, and 337 (36 differentially expressed) in skeletal muscle. Tissue-specific analyses revealed enrichment of protective mechanisms in all tissues, including neuroprotective pathways in brain, cardiac hypertrophic processes in heart, and atrophy protective pathways in skeletal muscle. In all tissues stress response pathways were induced during hibernation, as well as evidence for gene expression regulation at transcription, translation and post-translation.<h4>Conclusions</h4>These results reveal critical stress response pathways and protective mechanisms that allow for maintenance of both tissue-specific function, and survival during hibernation in the central bearded dragon. Furthermore, we provide evidence for multiple levels of gene expression regulation during hibernation, particularly enrichment of miRNA-mediated translational repression machinery; a process that would allow for rapid and energy efficient reactivation of translation from mature mRNA molecules at arousal. This study is the first molecular investigation of its kind in a hibernating reptile, and identifies strategies not yet observed in other hibernators to cope stress associated with this remarkable state of metabolic depression.

Also flagged:apoferritinAdenocarcinomaIronFerritinABSferrum
Journal Article 2019-06-06 ✓ 2 Snippets Chang VC, Cotterchio M, Khoo E.
In-Text Gene Mentions

For example, mutations in the HFE gene underlying hereditary hemochromatosis (iron overload) have been implicated in several cancers, including breast cancer [99].

…mutations in theHFEgene underlying hereditary…

Show Full Abstract

<h4>Background</h4>Iron has been shown to promote breast carcinogenesis in animal models through generation of oxidative stress and interaction with estrogen. Heme iron, which is found exclusively in animal-sourced foods, is suggested to have a more detrimental effect. Epidemiological evidence of the association between iron and breast cancer risk remains inconclusive and has not been comprehensively summarized. This systematic review and meta-analysis evaluated associations between both iron intake and body iron status and breast cancer risk.<h4>Methods</h4>Four electronic databases (MEDLINE, EMBASE, CINAHL, and Scopus) were searched up to December 2018 for studies assessing iron intake and/or biomarkers of iron status in relation to breast cancer risk. Using random-effects meta-analyses, pooled relative risks (RRs) and 95% confidence intervals (CIs) were calculated comparing the highest vs. lowest category of each iron measure. Dose-response meta-analyses were also performed to investigate linear and nonlinear associations.<h4>Results</h4>A total of 27 studies were included in the review, of which 23 were eligible for meta-analysis of one or more iron intake/status measures. Comparing the highest vs. lowest category, heme iron intake was significantly associated with increased breast cancer risk, with a pooled RR of 1.12 (95% CI: 1.04-1.22), whereas no associations were found for dietary (1.01, 95% CI: 0.89-1.15), supplemental (1.02, 95% CI: 0.91-1.13), or total (0.97, 95% CI: 0.82-1.14) iron intake. Associations of iron status indicators with breast cancer risk were generally in the positive direction; however, a significant pooled RR was found only for serum/plasma levels (highest vs. lowest) of iron (1.22, 95% CI: 1.01-1.47), but not for ferritin (1.13, 95% CI: 0.78-1.62), transferrin saturation (1.16, 95% CI: 0.91-1.47), or total iron-binding capacity (1.10, 95% CI: 0.97-1.25). In addition, a nonlinear dose-response was observed for heme iron intake and serum iron (both P<sub>nonlinearity</sub> < 0.05).<h4>Conclusions</h4>Heme iron intake and serum iron levels may be positively associated with breast cancer risk. Although associations were modest, these findings may have public health implications given the widespread consumption of (heme) iron-rich foods. In light of methodological and research gaps identified, further research is warranted to better elucidate the relationship between iron and breast cancer risk.

Also flagged:cognitionbrain developmentautism spectrum disordersAnaemiazincVitamin A
Journal Article 2019-06-06 No Snippets Sindhu KN, Ramamurthy P, Ramanujam K, Henry A, Bondu JD, John SM, Babji S, Koshy B, Bose A, Kang G, Mohan VR.
Show Full Abstract

<h4>Background</h4>Stunting in developing countries continues to be a major public health problem. Measuring head circumference (HC) during clinical anthropometric assessment can help predict stunting. The aim of this study was to assess burden and determine the predictors of low HC (<- 2 SD) at birth and during first 2 years of life in a semi- urban settlement of Vellore.<h4>Methods</h4>The study uses baseline data and serial HC measurements from the birth cohort of MAL-ED study, where 228 children from Vellore completed follow-up between March 2010 to February 2014. Analysis of baseline, maternal and paternal characteristics, micro-nutrient status and cognition with HC measurements was performed using STATA version 13.0 software.<h4>Results</h4>The mean HC (±SD) at 1st, 12th and 24th month were 33.37 (1.29) cm, 42.76 (1.23) cm and 44.9 (1.22) cm respectively. A third of the infants (75/228) had HC less than - 2 SD at first month of life, and on follow-up, 50% of the cohort had HC ≤ -2 SD both at 12th and 24th month. Low HC measurements at all three time-points were observed for 21.6% (46/222) infants. Low HC was significantly associated with stunting in 37.3% (OR = 10.8), 57.3% (OR = 3.1) and 44.4% (OR = 2.6) children at 1st, 12th and 24th month respectively. Bivariate analysis of low HC (<- 2 SD) at 12th month showed a statistically significant association with lower socioeconomic status, low paternal and maternal HC and low maternal IQ. Multivariable logistic regression analysis showed maternal (AOR = 0.759, 95% CI = 0.604 to 0.954) and paternal (AOR = 0.734, 95% CI = 0.581 to 0.930) HC to be significantly associated with HC attained by the infant at the end of 12 months.<h4>Conclusions</h4>One-third of the children in our cohort had low head circumference (HC) at birth, with one-fifth recording low HC at all time-points until 2 years of age. Low HC was significantly associated with stunting. Paternal and maternal HC predicted HC in children. HC measurement, often less used, can be a simple tool that can be additionally used by clinicians as well as parents/caregivers to monitor child growth.

Also flagged:degenerative diseaseosteoporosisOSpathogenesismetabolismmineral
Journal Article 2019-06-06 No Snippets Guo L, Han J, Guo H, Lv D, Wang Y.
Show Full Abstract

As a common degenerative disease, osteoporosis (OS) is characterized by reduced bone mass and microarchitectural deterioration of bone tissue. Both genetic and environmental factors are involved in OS development. To date, ~300 genes have been confirmed to be involved in the pathogenesis of OS, a large majority of which have been independently investigated. As OS is a polygenetic disease, a comprehensive analysis focusing on the biological functions and interactions of OS‑related genes would provide valuable information. In this study, OS related research deposited in PubMed was retrieved and genes related to OS were catalogued. Pathways with an enriched biological function for these genes were extracted, and the crosstalk between the enriched pathways was analyzed. A comprehensive network was constructed, and a minimal network was extracted using the Steiner minimal network algorithm. In this study, a total of 294 genes in were retrieved from PubMed. Biological processes found to be enriched included those related to bone metabolism and the immune system. In total, 58 pathways were enriched. Furthermore, the comprehensive network consisting of 3,943 nodes and 7,976 edges was constructed, among which 631 nodes and 2,581 edges contributed to the OS‑specific molecular network. In this network, in excess of 300 potential genes associated with OS and two modules were identified. Thus, this study provides a mechanistic insight into OS and suggests more than 300 potential OS‑related genes for future research.

Also flagged:Male Infertilityprimary ciliary dyskinesiagenetic diseasechronicrespiratory-tract infectionsasthenozoospermia
Journal Article 2019-06-06 No Snippets Whitfield M, Thomas L, Bequignon E, Schmitt A, Stouvenel L, Montantin G, Tissier S, Duquesnoy P, Copin B, Chantot S, Dastot F, Faucon C, Barbotin AL, Loyens A, Siffroi JP, Papon JF, Escudier E, Amselem S, Mitchell V, Touré A, Legendre M.
Show Full Abstract

Motile cilia and sperm flagella share an evolutionarily conserved axonemal structure. Their structural and/or functional defects are associated with primary ciliary dyskinesia (PCD), a genetic disease characterized by chronic respiratory-tract infections and in which most males are infertile due to asthenozoospermia. Among the well-characterized axonemal protein complexes, the outer dynein arms (ODAs), through ATPase activity of their heavy chains (HCs), play a major role for cilia and flagella beating. However, the contribution of the different HCs (γ-type: DNAH5 and DNAH8 and β-type: DNAH9, DNAH11, and DNAH17) in ODAs from both organelles is unknown. By analyzing five male individuals who consulted for isolated infertility and displayed a loss of ODAs in their sperm cells but not in their respiratory cells, we identified bi-allelic mutations in DNAH17. The isolated infertility phenotype prompted us to compare the protein composition of ODAs in the sperm and ciliary axonemes from control individuals. We show that DNAH17 and DNAH8, but not DNAH5, DNAH9, or DNAH11, colocalize with α-tubulin along the sperm axoneme, whereas the reverse picture is observed in respiratory cilia, thus explaining the phenotype restricted to sperm cells. We also demonstrate the loss of function associated with DNAH17 mutations in two unrelated individuals by performing immunoblot and immunofluorescence analyses on sperm cells; these analyses indicated the absence of DNAH17 and DNAH8, whereas DNAH2 and DNALI, two inner dynein arm components, were present. Overall, this study demonstrates that mutations in DNAH17 are responsible for isolated male infertility and provides information regarding ODA composition in human spermatozoa.

Also flagged:Adiponectinobesitylipidadipocyte differentiationPRKAR2APTH1R
Journal Article 2019-06-06 ✓ 2 Snippets Spracklen CN, Karaderi T, Yaghootkar H, Schurmann C, Fine RS, Kutalik Z, Preuss MH, Lu Y, Wittemans LBL, Adair LS, Allison M, Amin N, Auer PL, Bartz TM, Blüher M, Boehnke M, Borja JB, Bork-Jensen J, Broer L, Chasman DI, Chen YI, Chirstofidou P, Demirkan A, van Duijn CM, Feitosa MF, Garcia ME, Graff M, Grallert H, Grarup N, Guo X, Haesser J, Hansen T, Harris TB, Highland HM, Hong J, Ikram MA, Ingelsson E, Jackson R, Jousilahti P, Kähönen M, Kizer JR, Kovacs P, Kriebel J, Laakso M, Lange LA, Lehtimäki T, Li J, Li-Gao R, Lind L, Luan J, Lyytikäinen LP, MacGregor S, Mackey DA, Mahajan A, Mangino M, Männistö S, McCarthy MI, McKnight B, Medina-Gomez C, Meigs JB, Molnos S, Mook-Kanamori D, Morris AP, de Mutsert R, Nalls MA, Nedeljkovic I, North KE, Pennell CE, Pradhan AD, Province MA, Raitakari OT, Raulerson CK, Reiner AP, Ridker PM, Ripatti S, Roberston N, Rotter JI, Salomaa V, Sandoval-Zárate AA, Sitlani CM, Spector TD, Strauch K, Stumvoll M, Taylor KD, Thuesen B, Tönjes A, Uitterlinden AG, Venturini C, Walker M, Wang CA, Wang S, Wareham NJ, Willems SM, Willems van Dijk K, Wilson JG, Wu Y, Yao J, Young KL, Langenberg C, Frayling TM, Kilpeläinen TO, Lindgren CM, Loos RJF, Mohlke KL.
In-Text Gene Mentions

DNAH10

CCDC92

Show Full Abstract

Circulating levels of adiponectin, an adipocyte-secreted protein associated with cardiovascular and metabolic risk, are highly heritable. To gain insights into the biology that regulates adiponectin levels, we performed an exome array meta-analysis of 265,780 genetic variants in 67,739 individuals of European, Hispanic, African American, and East Asian ancestry. We identified 20 loci associated with adiponectin, including 11 that had been reported previously (p < 2 × 10<sup>-7</sup>). Comparison of exome array variants to regional linkage disequilibrium (LD) patterns and prior genome-wide association study (GWAS) results detected candidate variants (r<sup>2</sup> > .60) spanning as much as 900 kb. To identify potential genes and mechanisms through which the previously unreported association signals act to affect adiponectin levels, we assessed cross-trait associations, expression quantitative trait loci in subcutaneous adipose, and biological pathways of nearby genes. Eight of the nine loci were also associated (p < 1 × 10<sup>-4</sup>) with at least one obesity or lipid trait. Candidate genes include PRKAR2A, PTH1R, and HDAC9, which have been suggested to play roles in adipocyte differentiation or bone marrow adipose tissue. Taken together, these findings provide further insights into the processes that influence circulating adiponectin levels.

Also flagged:Calciummembranecalcium efflux pumpsTET2calpain proteasesTET
Journal Article 2019-06-06 No Snippets Luchsinger LL, Strikoudis A, Danzl NM, Bush EC, Finlayson MO, Satwani P, Sykes M, Yazawa M, Snoeck HW.
Show Full Abstract

The specific cellular physiology of hematopoietic stem cells (HSCs) is underexplored, and their maintenance in vitro remains challenging. We discovered that culture of HSCs in low calcium increased their maintenance as determined by phenotype, function, and single-cell expression signature. HSCs are endowed with low intracellular calcium conveyed by elevated activity of glycolysis-fueled plasma membrane calcium efflux pumps and a low-bone-marrow interstitial fluid calcium concentration. Low-calcium conditions inhibited calpain proteases, which target ten-eleven translocated (TET) enzymes, of which TET2 was required for the effect of low calcium conditions on HSC maintenance in vitro. These observations reveal a physiological feature of HSCs that can be harnessed to improve their maintenance in vitro.

Also flagged:gene expressioncoronary artery diseasepathogenesisTWF1deathdyslipidemia
Journal Article 2019-06-06 No Snippets Miao L, Yin RX, Zhang QH, Hu XJ, Huang F, Chen WX, Cao XL, Wu JZ.
Show Full Abstract

<h4>Background</h4>Long non-coding RNAs (lncRNAs) are involved in numerous physiological functions. Yet, their mechanisms in coronary artery disease (CAD) are not well understood.<h4>Methods</h4>The expression profile of genes associated to CAD was reannotated into the lncRNA-mRNA biphasic profile. The target microRNA data were used to design a global CAD triple network. Thereafter, we conducted a functional enrichment analysis and clustering using the triple network from the level of topology analyses. The expression of four non-coding RNAs (ncRNAs) was measured by qRT-PCR and the risk of CAD was calculated by nomogram. The prognostic value of three ncRNAs was evaluated using receiver operating characteristic (ROC) curve.<h4>Results</h4>A CAD lncRNA-miRNA-mRNA network was constructed which included 15 mRNAs, 3 miRNAs, 19 edges and one lncRNA. Nomogram showed that four ncRNAs were the risk of CAD. After RT-PCR validation in four ncRNAs between CAD and non-CAD samples, only three ncRNAs had significant meaning for further analysis. ROC curve showed that <i>TWF1</i> presented an area under curve (AUC) of 0.862, the AUC of hsa -miR-142-3p was 0.856 and hsa -miR126-5p was 0.822. After the pairwise comparison, we found that <i>TWF1</i> had significant statistical significance (<i>P</i> <sub>TWF1-142</sub> < 0.05 and <i>P</i> <sub>TWF1-126</sub> < 0.01<b>)</b>. The results of functional enrichment analysis of interacting gene and microRNA showed that the shared lncRNA <i>TWF1</i> may be a new factor for CAD.<h4>Conclusions</h4>This investigation on the regulatory networks of lncRNA-miRNA-mRNA in CAD suggests that a novel lncRNA, lncRNA <i>TWF1</i> is a risk factor for CAD, and expands our understanding into the mechanisms involved in the pathogenesis of CAD.

Also flagged:oxygenprotein synthesisglutathione-carbonmetabolismprotease
Journal Article 2019-06-06 No Snippets D'Alessandro A, Hansen KC, Eisenmesser EZ, Zimring JC.
Show Full Abstract

Red blood cells (RBCs) have been historically regarded as a critical model to investigate cellular and oxidant stress biology. First of all, they are constantly exposed to oxidant stress, as their main function is to transport and deliver oxygen to tissues. Second, they are devoid of de novo protein synthesis capacity, which prevents RBCs from replacing irreversibly oxidised proteins with newly synthesised ones. As such, RBCs have evolved to (i) protect themselves from oxidant stress, in order to prevent oxidant damage from reactive species; (ii) repair oxidatively damaged proteins, through mechanisms that involve glutathione and one-carbon metabolism; (iii) destroy irreversibly oxidised proteins through proteasomal or protease-dependent degradation; and (iv) sacrifice membrane portions through mechanism of vesiculation. In this brief review we will summarize these processes and their relevance to RBC redox biology (within the context of blood storage), with a focus on how polymorphisms in RBC antioxidant responses could contribute to explaining the heterogeneity in the progression and severity of the RBC storage lesion that can be observed across the healthy donor population.

Also flagged:congenital heart diseasesheart diseasesHLHSaortic valve stenosisleft ventricular hypoplasiapulmonary atresia
Journal Article 2019-06-06 No Snippets Pedra SRFF, Zielinsky P, Binotto CN, Martins CN, Fonseca ESVBD, Guimarães ICB, Corrêa IVDS, Pedrosa KLM, Lopes LM, Nicoloso LHS, Barberato MFA, Zamith MM.
Show Full Abstract

No abstract available.

Also flagged:distal cholangiocarcinomatumorlymph nodeprimary tumorcholangiocarcinomascancer
Journal Article 2019-06-06 ✓ 5 Snippets Suzuki S, Shimoda M, Shimazaki J, Maruyama T, Oshiro Y, Nishida K, Kuroda J, Miyoshi K, Koike N, Harada N.
In-Text Gene Mentions

Hernandez et al concluded that aggressive operative resection and application of adjuvant therapy should be used to treat all patients with cholangiocarcinoma without evidence of distant disease, even when an R0 resection has been performed.23 Evaluating a randomized trial with 108 perihilar cases and 117 distal cases, Ebata et al reported that the survival probability was not significantly different between a gemcitabine adjuvant chemotherapy group and an observation group.24 In a systematic review, a beneficial effect of adjuvant therapy was not evident in the overall analysis, but was observed in subgroups formed according to lymph node involvement and recommended adjuvant chemotherapy in node-positive disease following resection.25 The review reported that adjuvant chemotherapy was beneficial for patients with LN-positive or R1 disease.25 Adequate lymph node dissection may, therefore, improve prognosis in DCC patients.

…in patients withDCC.…

…prognostic factors forDCC.…

…long-term survival ofDCCpatients.…

…early recurrence ofDCCresults in a…

Show Full Abstract

<b>Background:</b> Early recurrence of distal cholangiocarcinoma (DCC) may result in a poorer prognosis. This study aimed to evaluate the clinicopathological factors that predict survival and recurrence in patients with DCC. <b>Methods:</b> Fifty-five patients with DCC who underwent pancreaticoduodenectomy between 2005 and 2015 were studied retrospectively. The following clinicopathological parameters were analyzed as predictors of disease-free survival (DFS) and overall survival (OS): sex, age, body mass index, presence of biliary tract decompression, macroscopic type, histological type, tumor size, TNM classification, lymph node metastasis ratio, number of positive lymph nodes (PLNs), lymphatic invasion, venous invasion, perineural invasion, proximal bile duct margin, dissected margin, portal system invasion, arterial system invasion, stage, and residual tumor. <b>Results:</b> Univariate analysis showed that contiguous extension of the primary tumor, PLN, lymphatic invasion, venous invasion, perineural invasion, and stage were significant prognostic factors for DFS and OS. Multivariate analysis revealed that PLN and lymphatic invasion were prognostic for DFS and OS (<i>P</i><0.001). Significant differences in OS and DFS were found in analyses stratified by PLN (0, 1, 2 vs ≥3) and lymphatic invasion (0 vs 1, 2, 3). <b>Conclusion:</b> Among the clinicopathological parameters analyzed, PLN and lymphatic invasion were confirmed as prognostic factors for DCC.

Also flagged:epigenetic modificationscolorectal cancercancermethylationhistone modificationschromatin
Journal Article 2019-06-06 ✓ 2 Snippets Patnaik S, Anupriya.
In-Text Gene Mentions

The DCC (Deleted in CRC) gene has repressive histone-tail marks, trimethylated lysine at the 9th and 27th position of H3 marked (H3K9me3 and H3K27me3) (Derks et al., 2009).

…TheDCC(Deleted in CRC)…

Show Full Abstract

Genetic variations along with epigenetic modifications of DNA are involved in colorectal cancer (CRC) development and progression. CRC is the fourth leading cause of cancer-related deaths worldwide. Initiation and progression of CRC is the cumulation of a variety of genetic and epigenetic changes in colonic epithelial cells. Colorectal carcinogenesis is associated with epigenetic aberrations including DNA methylation, histone modifications, chromatin remodeling, and non-coding RNAs. Recently, epigenetic modifications have been identified like association of hypermethylated gene Claudin11 (CLDN11) with metastasis and prognosis of poor survival of CRC. DNA methylation of genes CMTM3, SSTR2, MDF1, NDRG4 and TGFB2 are potential epigenetic biomarkers for the early detection of CRC. Tumor suppressor candidate 3 (TUSC3) mRNA expression is silenced by promoter methylation, which promotes epidermal growth factor receptor (EGFR) signaling and rescues the CRC cells from apoptosis and hence leading to poor survival rate. Previous scientific evidences strongly suggest epigenetic modifications that contribute to anticancer drug resistance. Recent research studies emphasize development of drugs targeting histone deacetylases (HDACs) and DNA methyltransferase inhibitors as an emerging anticancer strategy. This review covers potential epigenetic modification targeting chemotherapeutic drugs and probable implementation for the treatment of CRC, which offers a strong rationale to explore therapeutic strategies and provides a basis to develop potent antitumor drugs.

Also flagged:HIF-1αPreeclampsiaHIF1αNDUFA4SDHDISCU
Journal Article 2019-06-06 No Snippets Anton L, DeVine A, Polyak E, Olarerin-George A, Brown AG, Falk MJ, Elovitz MA.
Show Full Abstract

Preeclampsia is associated with first trimester placental dysfunction. miR-210, a small non-coding RNA, is increased in the preeclamptic placenta. The effects of elevated miR-210 on placental function remain unclear. The objectives of this study were to identify targets of miR-210 in first trimester primary extravillous trophoblasts (EVTs) and to investigate functional pathways altered by elevated placental miR-210 during early pregnancy. EVTs isolated from first trimester placentas were exposed to cobalt chloride (CoCl<sub>2</sub>), a HIF-1α stabilizer and hypoxia mimetic, and miR-210 expression by qPCR, HIF1α protein levels by western blot and cell invasion were assessed. A custom TruSeq RNA array, including all known/predicted miR-210 targets, was run using miR-210 and miR-negative control transfected EVTs. Mitochondrial function was assessed by high resolution respirometry in transfected EVTs. EVTs exposed to CoCl<sub>2</sub> showed a dose and time-dependent increase in miR-210 and HIF1α and reductions in cell invasion. The TruSeq array identified 49 altered genes in miR-210 transfected EVTs with 27 genes repressed and 22 enhanced. Three of the top six significantly repressed genes, NDUFA4, SDHD, and ISCU, are associated with mitochondrial function. miR-210 transfected EVTs had decreased maximal, complex II and complex I+II mitochondrial respiration. This study suggests that miR-210 alters first trimester trophoblast function. miR-210 overexpression alters EVT mitochondrial function in early pregnancy. Mitochondrial dysfunction may lead to increased reactive oxygen species, trophoblast cell damage and likely contributes to the pathogenesis of preeclampsia.

Also flagged:HEPFTONonalcoholic Liver Diseasehuman leukocyte antigennonalcoholic fatty liver diseaseNAFLD
Journal Article 2019-06-06 No Snippets Bonkovsky HL, Severson T, Nicoletti P, Barnhart H, Serrano J, Chalasani N, Fontana RJ, Watkins PB, Navarro V, Stolz A, Daly AK, Aithal GP, Odin J, US DILIN Investigators.
Show Full Abstract

With the application of genetic testing to contemporary medical diagnostics and practice, it has become apparent that the phenotypes of many disorders are modulated by host genetic factors. The aim of the current study was to determine whether selected single nucleotide polymorphisms (SNPs) unrelated to the human leukocyte antigen region or other immune pathways, including those associated with nonalcoholic fatty liver disease (NAFLD), may influence development, severity, or outcomes of drug-induced liver injury (DILI). Thirteen variants previously associated with NAFLD and/or selected other liver diseases were tested in 832 Caucasian DILI cases and 10,397 Caucasian population controls. DILI cases were attributed to multiple agents (177 individual drugs), with 56 cases due to herbal/dietary supplement products. Allele frequencies were imputed from recent genome-wide association studies and compared to those for European control samples from the Gnomad database. Significance was tested by linear regression or logistic regression, depending on the nature of the trait. Any variant that passed the Bonferroni threshold of <i>P</i> < 0.0004 ( 0.0513 ) was considered a significant association. None of the variants proved to be significantly associated with DILI as phenotype nor with any of the selected severity traits. Among the variants studied, rs1421085, found in the fat mass and obesity associated (<i>FTO</i>) gene, showed a marginal protective effect (odds ratio, 0.8; 95% confidence interval, 0.77-0.95; <i>P</i> = 0.005). None of the genetic polymorphisms tested were significantly associated with the risk of development, severity, or outcome of DILI. <i>Conclusion</i>: SNPs implicated in common liver diseases, such as NAFLD, do not play a substantial role in DILI pathogenesis across agents. It remains possible that these variants could be involved with DILI due to single agents, but this will require the evaluation of larger numbers of <i>bona fide</i> cases.

bioRxiv 2019-06-06 Preprint (No Snippets API) Paul S, Dansithong W, Gandelman M, Figueroa KP, Zu T, Ranum LP, Scoles DR, Pulst SM.
Show Full Abstract

<h4>Objective</h4> The mechanistic target of rapamycin (mTOR) kinase is one of the master coordinators of cellular stress responses, regulating metabolism, autophagy, and apoptosis. We recently reported that Staufen1 (STAU1), a stress granule (SG) protein, was overabundant in fibroblast cell lines from patients with spinocerebellar ataxia type 2 (SCA2), amyotrophic lateral sclerosis, frontotemporal degeneration, Huntington’s, Alzheimer’s, and Parkinson’s diseases as well as animal models, and patient tissues. STAU1 overabundance is associated with mTOR hyperactivation and links SG formation with autophagy. Our objective was to determine the mechanism of mTOR regulation by STAU1. <h4>Methods</h4> We determined STAU1 abundance with disease- and chemical-induced cellular stressors in patient cells and animal models. We also used RNA binding assays to contextualize STAU1 interaction with MTOR mRNA. <h4>Results</h4> STAU1 and mTOR were overabundant in BAC- C9orf72, ATXN2 Q127 , and Thy1 -TDP-43 transgenic mouse models. Reducing STAU1 levels in these mice normalized mTOR levels and activity and autophagy-related marker proteins. We also saw increased STAU1 levels in HEK293 cells transfected to express C9orf72-relevant dipeptide repeats (DPRs). Conversely, DPR accumulations were not observed in cells treated by STAU1 RNAi. Overexpression of STAU1 in HEK293 cells increased mTOR levels through direct MTOR mRNA interaction, activating downstream targets and impairing autophagic flux. Targeting mTOR by rapamycin or RNAi normalized STAU1 abundance in a SCA2 cellular model. <h4>Interpretation</h4> STAU1 interaction with mTOR drives its hyperactivation and inhibits autophagic flux in multiple models of neurodegeneration. Staufen, therefore, constitutes a novel target to modulate mTOR activity, autophagy, and for the treatment of neurodegenerative diseases.

Also flagged:GlycosidediabetesglycosidessynthesisglycosylC -glycosides
Journal Article 2019-06-05 No Snippets Pałasz A, Cież D, Trzewik B, Miszczak K, Tynor G, Bazan B.
Show Full Abstract

This review is an effort to summarize recent developments in synthesis of O-glycosides and N-, C-glycosyl molecules with promising antidiabetic potential. Articles published after 2000 are included. First, the O-glycosides used in the treatment of diabetes are presented, followed by the N-glycosides and finally the C-glycosides constituting the largest group of antidiabetic drugs are described. Within each group of glycosides, we presented how the structure of compounds representing potential drugs changes and when discussing chemical compounds of a similar structure, achievements are presented in the chronological order. C-Glycosyl compounds mimicking O-glycosides structure, exhibit the best features in terms of pharmacodynamics and pharmacokinetics. Therefore, the largest part of the article is concerned with the description of the synthesis and biological studies of various C-glycosides. Also N-glycosides such as N-(β-D-glucopyranosyl)-amides, N-(β-D-glucopyranosyl)-ureas, and 1,2,3-triazolyl derivatives belong to the most potent classes of antidiabetic agents. In order to indicate which of the compounds presented in the given sections have the best inhibitory properties, a list of the best inhibitors is presented at the end of each section. In summary, the best inhibitors were selected from each of the summarizing figures and the results of the ranking were placed. In this way, the reader can learn about the structure of the compounds having the best antidiabetic activity. The compounds, whose synthesis was described in the article but did not appear on the figures presenting the structures of the most active inhibitors, did not show proper activity as inhibitors. Thus, the article also presents studies that have not yielded the desired results and show directions of research that should not be followed. In order to show the directions of the latest research, articles from 2018 to 2019 are described in a separate Sect. 5. In Sect. 6, biological mechanisms of action of the glycosides and patents of marketed drugs are described.

Also flagged:MetforminHuntington diseaseAMP-activated protein kinasebrain-derived neurotrophic factorpolyglutamineDiabetes
Journal Article 2019-06-05 ✓ 5 Snippets Sanchis A, García-Gimeno MA, Cañada-Martínez AJ, Sequedo MD, Millán JM, Sanz P, Vázquez-Manrique RP.
In-Text Gene Mentions

When HTT has 35 or more CAG triplet repeats, the protein contains abnormally long glutamine tracts (polyQ), resulting in a mutant huntingtin (mHtt), which shows toxic gain-of-function properties.

The presence of inflammation in HD raises the still unresolved question of whether this process is the response of surrounding cells to a neuron-autonomous degenerative process and/or due to glia-autonomous immune activation resulting from the expression of mutant Htt.

Patients with HD have an abnormal CAG expansion within the first exon of the huntingtin gene, HTT. This gene encodes a cytosolic protein, huntingtin (Htt), the function of which is unclear.

…the huntingtin gene,HTT.…

…ytosolic protein, huntingtin (Htt), the function of…

Show Full Abstract

Huntington disease is a neurodegenerative condition for which there is no cure to date. Activation of AMP-activated protein kinase has previously been shown to be beneficial in in vitro and in vivo models of Huntington's disease. Moreover, a recent cross-sectional study demonstrated that treatment with metformin, a well-known activator of this enzyme, is associated with better cognitive scores in patients with this disease. We performed a preclinical study using metformin to treat phenotypes of the zQ175 mouse model of Huntington disease. We evaluated behavior (motor and neuropsychiatric function) and molecular phenotypes (aggregation of mutant huntingtin, levels of brain-derived neurotrophic factor, neuronal inflammation, etc.). We also used two models of polyglutamine toxicity in Caenorhabditis elegans to further explore potential mechanisms of metformin action. Our results provide strong evidence that metformin alleviates motor and neuropsychiatric phenotypes in zQ175 mice. Moreover, metformin intake reduces the number of nuclear aggregates of mutant huntingtin in the striatum. The expression of brain-derived neurotrophic factor, which is reduced in mutant animals, is partially restored in metformin-treated mice, and glial activation in mutant mice is reduced in metformin-treated animals. In addition, using worm models of polyglutamine toxicity, we demonstrate that metformin reduces polyglutamine aggregates and restores neuronal function through mechanisms involving AMP-activated protein kinase and lysosomal function. Our data indicate that metformin alleviates the progression of the disease and further supports AMP-activated protein kinase as a druggable target against Huntington's disease.

Also flagged:ironcolitisiron exporterToll-like receptorinflammatory responsesdeferoxamine
Journal Article 2019-06-05 ✓ 1 Snippet Verma S, Prescott R, Cherayil BJ.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The intestinal microbiota has several effects on host physiology. Previous work from our laboratory demonstrated that the microbiota influences systemic iron homeostasis in mouse colitis models by altering inflammation-induced expression of the iron-regulating hormone hepcidin. In the present study, we examined the impact of the gut commensal bacterium Bacteroides fragilis on the expression of the iron exporter ferroportin, the target of hepcidin action, in macrophages, the cell type that plays a pivotal role in iron recycling. Mouse bone marrow-derived macrophages were exposed to B. fragilis and were analyzed by quantitative real-time polymerase chain reaction and Western blotting. We found that B. fragilis down-regulated ferroportin transcription independently of bacterial viability. Medium conditioned by the bacteria also reduced ferroportin expression, indicating the involvement of soluble factors, possibly Toll-like receptor ligands. Consistent with this idea, several of these ligands were able to down-regulate ferroportin. The B. fragilis-induced decrease in ferroportin was functionally important since it produced a significant increase in intracellular iron concentrations that prevented the effects of the iron chelator deferoxamine on Salmonella-induced IL-6 and IL-1β production. Our results thus reveal that B. fragilis can influence macrophage iron handling and inflammatory responses by modulating ferroportin expression.

Also flagged:small-cell lung carcinomalarge-cell neuroendocrine lung carcinomaSCLCLCNEClung neuroendocrine tumorsNET
Journal Article 2019-06-05 No Snippets Nakamura H, Fujii K, Gupta V, Hata H, Koizumu H, Hoshikawa M, Naruki S, Miyata Y, Takahashi I, Miyazawa T, Sakai H, Tsumoto K, Takagi M, Saji H, Nishimura T.
Show Full Abstract

Small-cell lung carcinoma (SCLC) and large-cell neuroendocrine lung carcinoma (LCNEC) are high-grade lung neuroendocrine tumors (NET). However, comparative protein expression within SCLC and LCNEC remains unclear. Here, protein expression profiles were obtained via mass spectrometry-based proteomic analysis. Weighted gene co-expression network analysis (WGCNA) identified co-expressed modules and hub genes. Of 34 identified modules, six were significant and selected for protein-protein interaction (PPI) network analysis and pathway enrichment. Within the six modules, the activation of cellular processes and complexes, such as alternative mRNA splicing, translation initiation, nucleosome remodeling and deacetylase (NuRD) complex, SWItch/Sucrose Non-Fermentable (SWI/SNF) superfamily-type complex, chromatin remodeling pathway, and mRNA metabolic processes, were significant to SCLC. Modules enriched in processes, including signal recognition particle (SRP)-dependent co-translational protein targeting to membrane, nuclear-transcribed mRNA catabolic process of nonsense-mediated decay (NMD), and cellular macromolecule catabolic process, were characteristically activated in LCNEC. Novel high-degree hub genes were identified for each module. Master and upstream regulators were predicted via causal network analysis. This study provides an understanding of the molecular differences in tumorigenesis and malignancy between SCLC and LCNEC and may help identify potential therapeutic targets.

Also flagged:HuntingtinHuntington's diseaseHDneurodegenerative disorderbehaviouralcyclin B1
Journal Article 2019-06-05 No Snippets Smatlikova P, Askeland G, Vaskovicova M, Klima J, Motlik J, Eide L, Ellederová Z.
Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a devastating neurodegenerative disorder caused by CAG triplet expansions in the huntingtin gene. Oxidative stress is linked to HD pathology, although it is not clear whether this is an effect or a mediator of disease. The transgenic (TgHD) minipig expresses the N-terminal part of human-mutated huntingtin and represents a unique model to investigate therapeutic strategies towards HD. A more detailed characterization of this model is needed to fully utilize its potential.<h4>Methods</h4>In this study, we focused on the molecular and cellular features of fibroblasts isolated from TgHD minipigs and the wild-type (WT) siblings at different ages, pre-symptomatic at the age of 24-36 months and with the onset of behavioural symptoms at the age of 48 months. We measured oxidative stress, the expression of oxidative stress-related genes, proliferation capacity along with the expression of cyclin B1 and D1 proteins, cellular permeability, and the integrity of the nuclear DNA (nDNA) and mitochondrial DNA in these cells.<h4>Results</h4>TgHD fibroblasts isolated from 48-month-old animals showed increased oxidative stress, which correlated with the overexpression of SOD2 encoding mitochondrial superoxide dismutase 2, and the NEIL3 gene encoding DNA glycosylase involved in replication-associated repair of oxidized DNA. TgHD cells displayed an abnormal proliferation capacity and permeability. We further demonstrated increased nDNA damage in pre-symptomatic TgHD fibroblasts (isolated from animals aged 24-36 months).<h4>Conclusions</h4>Our results unravel phenotypic alterations in primary fibroblasts isolated from the TgHD minipig model at the age of 48 months. Importantly, nDNA damage appears to precede these phenotypic alterations. Our results highlight the impact of fibroblasts from TgHD minipigs in studying the molecular mechanisms of HD pathophysiology that gradually occur with age.

Also flagged:ObesityDiabetesMetabolic Disorderstype 2 diabetesSLC30A10TMEM18
Journal Article 2019-06-05 ✓ 1 Snippet Kong X, Xing X, Zhang X, Hong J, Yang W.
In-Text Gene Mentions

NEGR1

Show Full Abstract

<h4>Background</h4>Obesity is more prevalent in men than in women in China, especially within the middle-aged population.<h4>Objectives</h4>The present study aims to determine the contribution of sexual dimorphisms to obesity and related traits in terms of the mechanisms involving the obesity-related genetic variants among patients of Chinese Han ancestry with type 2 diabetes.<h4>Method</h4>In the Chinese National Diabetes and Metabolic Disorders Study, 2,555 out of 4,036 patients with type 2 diabetes were treatment naive, including 1,142 men and 1,413 women. Single-nucleotide polymorphisms (SNP) from 18 genomic loci previously found to be associated with obesity-related traits were successfully genotyped, and a genetic risk score (GRS) was constructed by summing the risk alleles for obesity.<h4>Results</h4>Single SNP analysis showed that genetic variants in SLC30A10, TMEM18, GNPDA2, PRL, TFAP2B, BDNF, MTCH2, FTO, and MC4R were nominally associated with waist circumference (WC), BMI, and risk for abdominal or general obesity in the untreated patients with type 2 diabetes, as well as in the total group of patients with type 2 diabetes (untreated and treated) (p < 0.05). Interactions between sex and SNP in PRL, MTCH2,and FTO were detected (p < 0.05). In the untreated patients with diabetes, the GRS was nominally associated with WC (β = 0.0032, SE = 0.0011; p = 0.003), BMI (β = 0.0030, SE = 0.0013; p = 0.027), and increased risk for abdominal (OR = 1.08; 95% CI 1.02-1.13; p = 0.004) or general obesity (OR = 1.07; 95% CI 1.02-1.13; p = 0.011) in men but not in women. GRS-sex interactions were detected in the determinant of WC (p = 0.019) and abdominal obesity (p = 0.016). Among patients aged 30-60 years, GRS was found to be significantly associated with WC (β = 0.0050, SE = 0.0016; p = 0.002) and abdominal obesity (OR = 1.10; 95% CI 1.04-1.17; p = 0.001) and nominally associated with BMI (β = 0.0057, SE = 0.0020; p = 0.005) and general obesity (OR = 1.07; 95% CI 1.01-1.14; p = 0.027) in men, whereas in women none of the associations were detected. GRS-sex interactions were present in the determinant of WC (p = 0.015), BMI (p = 0.032), and abdominal obesity (p = 0.012). Among patients aged 60 years or older, neither an association of GRS with obesity-related traits nor GRS-sex interactions were detected.<h4>Conclusions</h4>Genetic factors contribute to obesity-related traits in a sex-dependent pattern among middle-aged Chinese, and men tend to be more susceptible to the genetic risk of obesity.

Also flagged:psychiatric disordersmental illnessmood instabilityMajor Depressive DisorderBipolar DisorderPTSD
Journal Article 2019-06-05 ✓ 5 Snippets Ward J, Tunbridge EM, Sandor C, Lyall LM, Ferguson A, Strawbridge RJ, Lyall DM, Cullen B, Graham N, Johnston KJA, Webber C, Escott-Price V, O'Donovan M, Pell JP, Bailey MES, Harrison PJ, Smith DJ.
In-Text Gene Mentions

NEGR1 was identified by 23andMe within their GWAS of MDD39 and increased levels of NEGR1 protein in spinal fluid have been identified in both MDD and BD40.

PLCL1 and PLCL2 are involved in GABA signalling24 and melatonin signalling respectively, and RAPSN assists in anchoring nicotinic acetylcholine receptors at synaptic sites25.

PLCL1and PLCL2 are…

PLCL1has already been…

…BothDCC(identified in the…

Show Full Abstract

Genome-wide association studies (GWAS) of psychiatric phenotypes have tended to focus on categorical diagnoses, but to understand the biology of mental illness it may be more useful to study traits which cut across traditional boundaries. Here, we report the results of a GWAS of mood instability as a trait in a large population cohort (UK Biobank, n = 363,705). We also assess the clinical and biological relevance of the findings, including whether genetic associations show enrichment for nervous system pathways. Forty six unique loci associated with mood instability were identified with a SNP heritability estimate of 9%. Linkage Disequilibrium Score Regression (LDSR) analyses identified genetic correlations with Major Depressive Disorder (MDD), Bipolar Disorder (BD), Schizophrenia, anxiety, and Post Traumatic Stress Disorder (PTSD). Gene-level and gene set analyses identified 244 significant genes and 6 enriched gene sets. Tissue expression analysis of the SNP-level data found enrichment in multiple brain regions, and eQTL analyses highlighted an inversion on chromosome 17 plus two brain-specific eQTLs. In addition, we used a Phenotype Linkage Network (PLN) analysis and community analysis to assess for enrichment of nervous system gene sets using mouse orthologue databases. The PLN analysis found enrichment in nervous system PLNs for a community containing serotonin and melatonin receptors. In summary, this work has identified novel loci, tissues and gene sets contributing to mood instability. These findings may be relevant for the identification of novel trans-diagnostic drug targets and could help to inform future stratified medicine innovations in mental health.

Also flagged:16S rRNArepetitive intergenicgastrointestinal diseasebacteremiareproduction disordersmastitis
Journal Article 2019-06-05 No Snippets Mizutani Y, Iehata S, Mori T, Oh R, Fukuzaki S, Tanaka R.
Show Full Abstract

Arcobacter have been frequently detected in and isolated from bivalves, but there is very little information on the genus Arcobacter in the abalone, an important fishery resource. This study aimed to investigate the genetic diversity and abundance of bacteria from the genus Arcobacter in the Japanese giant abalone, Haliotis gigantea, using molecular methods such as Arcobacter-specific clone libraries and fluorescence in situ hybridization (FISH). Furthermore, we attempted to isolate the Arcobacter species detected. Twelve genotypes of clones were obtained from Arcobacter-specific clone libraries. These sequences are not classified with any other known Arcobacter species including pathogenic Arcobacter spp., A. butzleri, A. skirrowii, and A. cryaerophilus, commonly isolated or detected from bivalves. From the FISH analysis, we observed that ARC94F-positive cells, presumed to be Arcobacter, accounted for 6.96 ± 0.72% of all EUB338-positive cells. In the culture method, three genotypes of Arcobacter were isolated from abalones. One genotype had a similarity of 99.2%-100.0% to the 16S rRNA gene of Arcobacter marinus, while the others showed only 93.3%-94.3% similarity to other Arcobacter species. These data indicate that abalones carry Arcobacter as a common bacterial genus which includes uncultured species.

Also flagged:extracellularvesiclessynthesisceramidevesicleEndosomal Sorting
Journal Article 2019-06-05 No Snippets Kołat D, Hammouz R, Bednarek AK, Płuciennik E.
Show Full Abstract

Long non‑coding RNAs (lncRNAs) comprise a sizeable class of non‑coding RNAs with a length of over 200 base pairs. Little is known about their biological function, although over 20,000 lncRNAs have been annotated in the human genome. Through a diverse range of mechanisms, their primary function is in the regulation of the transcription of protein‑coding genes. lncRNA transcriptional activation can result from a group of nucleus‑retained and chromatin‑associated lncRNAs, which function as scaffolds in the cis/trans recruitment of transcription factors, co‑activators or chromatin remodelers, and/or promoter enhancers. Exosomes are released as extracellular vesicles and they are produced by endocytic pathways. Their synthesis is initiated by various processes including ceramide synthesis, release of intracellular Ca2+ or acid‑base balance disorders. Prior to vesicle creation, selective cargo loading occurs in the Endosomal Sorting Complex Required for Transport. Participation of endosomal sorting proteins such as tetraspanins or specific sumoylated proteins required for transport has been indicated in research. The endosomal‑sorting complex consists of four components, these induce the formation of multivesicular bodies and the induction of membrane deformation to form exosomes. Nanovesicles could be formed inside multivesicular bodies to allow transport outside the cell or digestion in lysosomes. The molecular content of exosomes is more heterogenic than its synthesis process, with different cargoes being examined inside vesicles with regard to the type or stage of cancers. This paper will review the importance of lncRNAs as crucial molecular content of exosomes, indicating its involvement in tumour suppression, pro‑tumorigenic events and the development of novel therapeutic approaches in the near future. Further studies of their mechanisms of function are essential, as well as overcoming several challenges to gain a clearer insight to the approaches for the best clinical application.

Also flagged:camptothecindegradationTopotecanbelotecanirinotecanpentacyclic
Journal Article 2019-06-05 No Snippets Yan L, Nan X, Zhang C, Wang H, Huang X, Hu J, Liu Y.
Show Full Abstract

The use of camptothecin and its analogues has increased in clinical settings and in agriculture. Therefore, camptothecins and their derivatives, metabolites and degradation products are frequently found in the environment. Therefore, it is important to develop an ELISA for the quantification of camptothecins in human plasma, plants, animal tissues and other matrices. The present study developed a novel competitive indirect ELISA for camptothecin using a monoclonal antibody (MAb). In total, two haptens and various carrier proteins were tested to select the most suitable immunogen for the production of MAbs against camptothecin. Hapten 1 conjugated with keyhole limpet hemocyanin was selected for the preparation of MAb 5A3, and was used to establish a competitive indirect ELISA for camptothecin. A total of three derivatives of camptothecin used in clinical practice were examined. Topotecan showed an IC50 value of 0.68 µg/ml with a detection limit of 0.19 µg/ml, belotecan showed an IC50 value of 0.87 µg/ml with a detection limit of 0.22 µg/ml and irinotecan showed an IC50 value of 2.85 µg/ml with a detection limit of 0.47 µg/ml. The cross‑reactivity results suggested that the assay developed in the present study possessed a high sensitivity to camptothecin. Therefore, this immunoassay technique may be suitable for monitoring the levels of camptothecin in compound analysis, clinical applications, and analyses of food and environmental samples.

Also flagged:Insulinendoplasmic reticulumchaperoneGrp170autophagyRTN3
Journal Article 2019-06-05 ✓ 1 Snippet Cunningham CN, Williams JM, Knupp J, Arunagiri A, Arvan P, Tsai B.
In-Text Gene Mentions

CCPG1

Show Full Abstract

Insulin gene coding sequence mutations are known to cause mutant INS-gene-induced diabetes of youth (MIDY), yet the cellular pathways needed to prevent misfolded proinsulin accumulation remain incompletely understood. Here, we report that Akita mutant proinsulin forms detergent-insoluble aggregates that entrap wild-type (WT) proinsulin in the endoplasmic reticulum (ER), thereby blocking insulin production. Two distinct quality-control mechanisms operate together to combat this insult: the ER luminal chaperone Grp170 prevents proinsulin aggregation, while the ER membrane morphogenic protein reticulon-3 (RTN3) disposes of aggregates via ER-coupled autophagy (ER-phagy). We show that enhanced RTN-dependent clearance of aggregated Akita proinsulin helps to restore ER export of WT proinsulin, which can promote WT insulin production, potentially alleviating MIDY. We also find that RTN3 participates in the clearance of other mutant prohormone aggregates. Together, these results identify a series of substrates of RTN3-mediated ER-phagy, highlighting RTN3 in the disposal of pathogenic prohormone aggregates.

Also flagged:SynthesisCoumarintriazole2,3-triazolecoumarins2,3-furocoumarin
Journal Article 2019-06-05 No Snippets Lipeeva AV, Zakharov DO, Burova LG, Frolova TS, Baev DS, Shirokikh IV, Evstropov AN, Sinitsyna OI, Tolsikova TG, Shults EE.
Show Full Abstract

Synthesis of 1,2,3-triazole-substituted coumarins and also 1,2,3-triazolyl or 1,2,3-triazolylalk-1-inyl-linked coumarin-2,3-furocoumarin hybrids was performed by employing the cross-coupling and copper catalyzed azide-alkyne cycloaddition reaction approaches. The synthesized compounds were evaluated for their in vitro antibacterial activity against <i>Staphylococcus</i> <i>aureus</i>, <i>Bacillius</i> <i>subtilis</i>, <i>Actinomyces</i> <i>viscosus</i> and <i>Escherichia</i> <i>coli</i> bacterial strains. Coumarin-benzoic acid hybrids <b>4с</b>, <b>42с</b> and 3-((4-acetylamino-3-(methoxycarbonyl)phenyl)ethynyl)coumarin (<b>29</b>) showed promising activity against <i>S</i>. <i>aureus</i> strains, and the 1,2,3-triazolyloct-1-inyl linked coumarin-2,3-furocoumarin hybrid <b>37c</b> was endowed with high selectivity against <i>B. subtilis</i> and <i>E. coli</i> species. The in vitro antibacterial activity of <b>4с</b>, <b>29</b>, <b>37c</b> and <b>42с</b> can potentially be compared with that of a number of modern antibiotic drugs used in the clinic, suggesting promising prospects for further research. A detailed study of the molecular interactions with the targeted protein MurB was performed using docking simulations and the obtained results are quite promising.

Also flagged:Oestrogenbreast cancertumoursSrcPI3Kbreast cancers
Journal Article 2019-06-05 No Snippets Poulard C, Jacquemetton J, Trédan O, Cohen PA, Vendrell J, Ghayad SE, Treilleux I, Marangoni E, Le Romancer M.
Show Full Abstract

Endocrine therapies targeting oestrogen signalling have significantly improved breast cancer management. However, their efficacy is limited by intrinsic and acquired resistance to treatment, which remains a major challenge for oestrogen receptor α (ERα)-positive tumours. Though many studies using in vitro models of endocrine resistance have identified putative actors of resistance, no consensus has been reached. We demonstrated previously that oestrogen non-genomic signalling, characterized by the formation of the ERα/Src/PI3K complex, is activated in aggressive breast cancers (BC). We wondered herein whether the activation of this pathway is also involved in resistance to endocrine therapies. We studied the interactions between ERα and Src or PI3K by proximity ligation assay (PLA) in in-vitro and in-vivo endocrine therapy-resistant breast cancer models. We reveal an increase in ERα/Src and ERα/PI3K interactions in patient-derived xenografts (PDXs) with acquired resistance to tamoxifen, as well as in tamoxifen-resistant MCF-7 cells compared to parental counterparts. Moreover, no interactions were observed in breast cancer cells resistant to other endocrine therapies. Finally, the use of a peptide inhibiting the ERα-Src interaction partially restored tamoxifen sensitivity in resistant cells, suggesting that such components could constitute promising targets to circumvent resistance to tamoxifen in BC.

Also flagged:Androgencancerprostate cancerandrogen receptorARcastration-resistant prostate cancer
Journal Article 2019-06-05 ✓ 4 Snippets Cui L, Liu M, Lai S, Hou H, Diao T, Zhang D, Wang M, Zhang Y, Wang J.
In-Text Gene Mentions

Studies have proved the presence of aberrant palmitoylation in Huntington disease, caused by a CAG expansion in the huntingtin (HTT) gene.

…the huntingtin (HTT) gene.…

…palmitoyl acyltransferases forHTTare disturbed, resulting…

…reduced palmitoylation ofHTTand exhibiting itself…

Show Full Abstract

<b>Background:</b> Prostate cancer is the second leading cause of cancer-related deaths in Western countries. Most patients diagnosed with advanced prostate cancer can be treated with the main treatment: androgen deprivation therapy (ADT). The androgen receptor (AR) signaling axis plays a pivotal role in the progression of prostate cancer. However, most patients can ultimately progress to the castration-resistant prostate cancer (CRPC) stage within 2 years. At this stage, drugs targeting the AR signaling axis, including enzalutamide and abiraterone acetate, cannot prevent the progression of prostate cancer, thus predicting a poor prognosis. The molecular mechanism lies in the aberrant AR reactivation, which exhibits an adaptive response to ADT, such as the presence of AR splice variants. Thus, CRPC treatment remains a challenge. <b>Purpose:</b> In addition to the AR axis, a mechanism leading to this progression should be determined. The present study mainly compared palmitoylated proteins between androgen-treated LNCaP cells and non-treated LNCaP cells by palmitoylome profiling, to illustrate the changes at proteomic levels. <b>Materials and methods:</b> To screen the androgen-induced palmitoylated proteins, we conducted proteomic experiments using clickable palmitate probe (Alk-C16) between three individual pairs of androgen-treated and non-treated LNCaP cells. <b>Results:</b> We identified 4351 unique peptides corresponding to 835 proteins, among them a number of these identified proteins were palmitoylated proteins, particularly eIF3L. Androgen treatment significantly increased the palmitoylation level of eIF3L, an individual subunit of eIF3. As an initiation factor, eIF3L plays a pivotal role in the translation of mRNAs encoding growth-promoting proteins by enhancing translation rates, thus controlling cell proliferation. <b>Conclusion:</b> In this study, we demonstrated that the regulation of eIF3L palmitoylation may provide new directions for the therapy of prostate cancer. Moreover, the increased level of androgen-induced eIF3L may be used as a biomarker for the diagnosis of early-stage prostate cancer.

Also flagged:c-MYCoral squamous cell carcinomatumorOSCCoral cancercancer
Journal Article 2019-06-05 No Snippets Lin SH, Wang HK, Yeh KT, Tai HC, Wang HY, Huang LR, Chiu CW, Chung CM, Velmurugan BK.
Show Full Abstract

<b>Purpose: </b>c-MYC has been noted in many tumor types, but its functional significance and clinical utility in oral squamous cell carcinoma (OSCC) are not well known. Here we studied the expression of c-MYC in correlation to clinical outcome in patients with oral squamous cell carcinoma. <b>Methods:</b> The current study, using immunohistochemical staining, first examined c-MYC expression in OSCC patients and further correlated its expression with clinicopathological parameters. <b>Results:</b> c-MYC was expressed in the majority of OSCC patients (n=133). The c-MYC expression is associated with histological grade (<i>P</i>=0.0205) of patients with oral squamous cell carcinoma. Multivariate Cox regression analysis revealed that TN stage (<i>P</i><0.001), American Joint Committee on Cancer (AJCC) stage (<i>P</i><0.0001), and tumor differentiation (<i>P</i>=0.0025) were independent factors for overall survival in patients with OSCC except for c-MYC expression (<i>P</i>>0.05). Multiplicative-scale interaction between T stage (III/IV) and low c-MYC expression on mortality risk was identified (<i>P</i>=0.0233). Kaplan-Meier survival analysis demonstrated that oral cancer patients (T III/IV stage) with high c-MYC expression had better survival than those with low and medium c-MYC expression (<i>P</i>=0.0270). <b>Conclusion:</b> Our data indicate that c-MYC is a potential biomarker that can be used as a therapeutic target for treating OSCC patients with T stage (III/IV).

Also flagged:alcohol dependenceADdependenceAlcoholismADH1Bchromosome
Journal Article 2019-06-04 ✓ 1 Snippet Lai D, Wetherill L, Bertelsen S, Carey CE, Kamarajan C, Kapoor M, Meyers JL, Anokhin AP, Bennett DA, Bucholz KK, Chang KK, De Jager PL, Dick DM, Hesselbrock V, Kramer J, Kuperman S, Nurnberger JI, Raj T, Schuckit M, Scott DM, Taylor RE, Tischfield J, Hariri AR, Edenberg HJ, Agrawal A, Bogdan R, Porjesz B, Goate AM, Foroud T.
In-Text Gene Mentions

RABGAP1L

Show Full Abstract

Genome-wide association studies (GWAS) of alcohol dependence (AD) have reliably identified variation within alcohol metabolizing genes (eg, ADH1B) but have inconsistently located other signals, which may be partially attributable to symptom heterogeneity underlying the disorder. We conducted GWAS of DSM-IV AD (primary analysis), DSM-IV AD criterion count (secondary analysis), and individual dependence criteria (tertiary analysis) among 7418 (1121 families) European American (EA) individuals from the Collaborative Study on the Genetics of Alcoholism (COGA). Trans-ancestral meta-analyses combined these results with data from 3175 (585 families) African-American (AA) individuals from COGA. In the EA GWAS, three loci were genome-wide significant: rs1229984 in ADH1B for AD criterion count (P = 4.16E-11) and Desire to cut drinking (P = 1.21E-11); rs188227250 (chromosome 8, Drinking more than intended, P = 6.72E-09); rs1912461 (chromosome 15, Time spent drinking, P = 1.77E-08). In the trans-ancestral meta-analysis, rs1229984 was associated with multiple phenotypes and two additional loci were genome-wide significant: rs61826952 (chromosome 1, DSM-IV AD, P = 8.42E-11); rs7597960 (chromosome 2, Time spent drinking, P = 1.22E-08). Associations with rs1229984 and rs18822750 were replicated in independent datasets. Polygenic risk scores derived from the EA GWAS of AD predicted AD in two EA datasets (P < .01; 0.61%-1.82% of variance). Identified novel variants (ie, rs1912461, rs61826952) were associated with differential central evoked theta power (loss - gain; P = .0037) and reward-related ventral striatum reactivity (P = .008), respectively. This study suggests that studying individual criteria may unveil new insights into the genetic etiology of AD liability.

Also flagged:Radiation-induced fibrosispathogenesisgene expressionCD14CD16extracellular
Journal Article 2019-06-04 ✓ 1 Snippet Michalson KT, Macintyre AN, Sempowski GD, Bourland JD, Howard TD, Hawkins GA, Dugan GO, Cline JM, Register TC.
In-Text Gene Mentions

PLCL1

Show Full Abstract

Radiation-induced fibrosis (RIF) is a common delayed effect of acute ionizing radiation exposure (DEARE) affecting diverse tissues including the heart, lungs, liver and skin, leading to reduced tissue function and increased morbidity. Monocytes, which may be classified into classical (CD14<sup>++</sup>, CD16<sup>-</sup>), intermediate (CD14<sup>++</sup>, CD16<sup>+</sup>) and non-classical (CD14<sup>+/low</sup>, CD16<sup>++</sup>) subtypes in humans and non-human primates (NHPs), and monocyte-derived macrophages may play an integral role in the pathogenesis of RIF. We tested the hypothesis that moderate to high levels of total-body exposure to radiation would alter monocyte polarization and produce phenotypes that could promote multi-organ fibrosis in a wellestablished NHP model of DEARE. Subjects were 16 young adult male rhesus macaques, ten of which were exposed to high-energy, 4 Gy X-ray total-body irradiation (TBI) and six that received sham irradiation (control). Total monocytes assessed by complete blood counts were 89% depleted in TBI animals by day 9 postirradiation (<i>P</i> < 0.05), but recovered by day 30 postirradiation and did not differ from control levels thereafter. Monocytes were isolated from peripheral blood mononuclear cells (PBMCs) and sorted into classical, intermediate and non-classical subsets using fluorescence-activated cell sorting (FACS) prior to and at 6 months post-TBI. At 6 months postirradiation, monocyte polarization shifted towards lower classical (92% → 86%) and higher intermediate (7% → 12%) and non-classical monocyte subsets (0.6% → 2%) (all <i>P</i> < 0.05) in TBI animals compared to baseline. No change in monocyte subsets was observed in control animals. Transcriptional profiles in classical and intermediate monocyte subsets were assessed using RNAseq. Classical monocyte gene expression did not change significantly over time or differ cross-sectionally between TBI and control groups. In contrast, significant numbers of differentially expressed genes (DEGs) were detected in intermediate monocyte comparisons between the TBI animals and all animals at baseline (304 DEGs), and in the TBI versus control animals at 6 months postirradiation (67 DEGs). Intermediate monocytes also differed between baseline and 6 months in control animals (147 DEGs). Pathway analysis was used to identify genes within significant canonical pathways, yielding 52 DEGs that were specific to irradiated intermediate monocytes. These DEGs and significant canonical pathways were associated with pro-fibrotic and anti-inflammatory signaling pathways that have been noted to induce M2 macrophage polarization. These findings support the hypothesis that TBI may alter monocyte programming and polarization towards a profibrotic phenotype, providing a novel target opportunity for therapies to inhibit or prevent RIF.

Also flagged:Netrin-1embryogenesisocular colobomaproteinlocalisationcoloboma
Journal Article 2019-06-04 ✓ 1 Snippet Hardy H, Prendergast JG, Patel A, Dutta S, Trejo-Reveles V, Kroeger H, Yung AR, Goodrich LV, Brooks B, Sowden JC, Rainger J.
In-Text Gene Mentions

…datasets (e.g. UNC5,DCCor Neogenin; Figure…

Show Full Abstract

Epithelial fusion underlies many vital organogenic processes during embryogenesis. Disruptions to these cause a significant number of human birth defects, including ocular coloboma. We provide robust spatial-temporal staging and unique anatomical detail of optic fissure closure (OFC) in the embryonic chick, including evidence for roles of apoptosis and epithelial remodelling. We performed complementary transcriptomic profiling and show that <i>Netrin</i>-1 (<i>NTN1</i>) is precisely expressed in the chick fissure margin during fusion but is immediately downregulated after fusion. We further provide a combination of protein localisation and phenotypic evidence in chick, humans, mice and zebrafish that Netrin-1 has an evolutionarily conserved and essential requirement for OFC, and is likely to have an important role in palate fusion. Our data suggest that <i>NTN1</i> is a strong candidate locus for human coloboma and other multi-system developmental fusion defects, and show that chick OFC is a powerful model for epithelial fusion research.

Also flagged:cell proliferationlung cancermalignant tumorscancersreverse transcriptionpolymerase
Journal Article 2019-06-04 ✓ 2 Snippets Wang R, Li G, Zhuang G, Sun S, Song Z.
In-Text Gene Mentions

For instance, miR-1269a acts as an onco-miRNA in non-small cell lung cancer (NSCLC) and promotes cancer cell growth by downregulating the expression of SOX6 [26].

…the expression ofSOX6[ 26 ].…

Show Full Abstract

<h4>Background</h4>Lung cancer is one of the common malignant tumors worldwide with high incidence and mortality. MicroRNA-423-3p (miR-423-3p) acts as an oncogene in several types of cancers. The aim of this study is to reveal the clinical significance and biological function of miR-423-3p in lung cancer.<h4>Methods</h4>The expression of miR-423-3p was detected in lung cancer specimens by reverse transcription-quantitative polymerase chain reaction (qRT-PCR) assay. Kaplan-Meier survival and Cox regression analyses were used to investigate the prognostic significance of miR-423-3p in lung cancer. CCK-8 and Transwell assays were used to determine the functional role of miR-423-3p in lung cancer.<h4>Results</h4>We observed that miR-423-3p was significantly upregulated in lung cancer tissues and cell lines. Overexpression of miR-423-3p was significantly associated with lymph node metastasis, TNM stage, and poor prognosis. Multivariate Cox regression analysis results showed that miR-423-3p was an independent prognostic indicator for lung cancer patients. Results of functional analyses revealed that overexpression of miR-423-3p promoted cell proliferation, migration, and invasion in lung cancer cells.<h4>Conclusions</h4>These results indicated that miR-423-3p acts as an oncogene and promotes cell proliferation migration, and invasion of lung cancer. And miR-423-3p may serve as a potential prognostic biomarker and therapeutic target for the treatment of lung cancer.

Also flagged:tumorsepithelial cancerscancersgastrointestinal cancerstumormelanoma
Journal Article 2019-06-04 No Snippets Parkhurst MR, Robbins PF, Tran E, Prickett TD, Gartner JJ, Jia L, Ivey G, Li YF, El-Gamil M, Lalani A, Crystal JS, Sachs A, Groh E, Ray S, Ngo LT, Kivitz S, Pasetto A, Yossef R, Lowery FJ, Goff SL, Lo W, Cafri G, Deniger DC, Malekzadeh P, Ahmadzadeh M, Wunderlich JR, Somerville RPT, Rosenberg SA.
Show Full Abstract

Immunotherapies can mediate regression of human tumors with high mutation rates, but responses are rarely observed in patients with common epithelial cancers. This raises the question of whether patients with these common cancers harbor T lymphocytes that recognize mutant proteins expressed by autologous tumors that may represent ideal targets for immunotherapy. Using high-throughput immunologic screening of mutant gene products identified via whole-exome sequencing, we identified neoantigen-reactive tumor-infiltrating lymphocytes (TIL) from 62 of 75 (83%) patients with common gastrointestinal cancers. In total, 124 neoantigen-reactive TIL populations were identified, and all but one of the neoantigenic determinants were unique. The results of <i>in vitro</i> T-cell recognition assays demonstrated that 1.6% of the gene products encoded by somatic nonsynonymous mutations were immunogenic. These findings demonstrate that the majority of common epithelial cancers elicit immune recognition and open possibilities for cell-based immunotherapies for patients bearing these cancers. SIGNIFICANCE: TILs cultured from 62 of 75 (83%) patients with gastrointestinal cancers recognized neoantigens encoded by 1.6% of somatic mutations expressed by autologous tumor cells, and 99% of the neoantigenic determinants appeared to be unique and not shared between patients.<i>This article is highlighted in the In This Issue feature, p. 983</i>.

Also flagged:cancerTP53tumorsmemorycarcinomaPIK3CA
Journal Article 2019-06-04 ✓ 5 Snippets Pansare K, Gardi N, Kamat S, Dange P, Previn R, Gera P, Kowtal P, Amin K, Sarin R.
In-Text Gene Mentions

Of the 15 most recurrently mutated HNSCC or GB-SCC genes, 8 genes (PCLO, SYNE2, FAT3, EP300, KMT2B, SMG1, TRPM3 and UNC13C) were mutated in >10% of smokeless tobacco associated GB-SCC tumours of ICGC6 but not in the cigarette smoking associated HNSCC of TCGA study13 and may be considered as smokeless tobacco associated genes (Fig. 5A,B).

Of the 15 most recurrently mutated genes in ≥10% of HNSCC or GB-SCC tumours as reported in the TCGA and ICGC database (TP53, FAT1, CASP8, NOTCH1, KMT2B, PCLO, UNC13C, SMG1, FAT3, EP300, KMT2D, SYNE2, TRPM3, PIK3CA and NSD1), 12 were mutated in one or more of the ITOC cell lines (Fig. 5A,B and Supplementary Table S5).

…NOTCH1, KMT2B, PCLO,UNC13C, SMG1, FAT3, EP300,…

…PLA2G3, PLA2G4E, PLA2G4F,PTGIS, TBXAS1, CYP2U1, CYP2C19,…

…SMG1, TRPM3 andUNC13C) were mutated…

Show Full Abstract

Smokeless tobacco associated Gingivobuccal squamous cell carcinoma (GB-SCC) is a major public health problem but available oral cancer cell lines are mostly from smoking associated tongue SCC raising the need for pertinent GB-SCC cell line models. As part of the International Cancer Genome Consortium (ICGC) Project, 4 novel cell lines, namely, Indian Tata Memorial Centre Oral Cancer (ITOC) -01 to -04 were established and characterized with conventional methods, karyotyping, ultrastructure, in vivo tumourigenicity, Whole exome sequencing (WES) and RNA sequencing. These hyperploid cell lines form xenografts in mice and show metabolically active and necrotic areas on fluorodeoxyglucose-positron emission tomography (FDG-PET) imaging. WES of ITOC cell lines recapitulate the genomic tumor profile of ICGC GB-SCC database. We further identified smokeless tobacco associated genetic alterations (PCLO, FAT3 and SYNE2) and oncogenic PIK3CA mutation in GB-SCC cell lines. Transcriptome profiling identified deregulation of pathways commonly altered in cancer and down-regulation of arachidonic acid metabolism pathway, implying its possible role in GB-SCC. Clinical application of high throughput sequencing data depends on relevant cell line models to validate potential targets. Extensively characterized, these oral SCC cell lines are particularly suited for mechanistic studies and pre-clinical drug development for smokeless tobacco associated oral cancer.

Also flagged:malevoltage-gated proton channelsmembrane transporterscarbonic anhydrasesHCO 3solute carrier 4
Journal Article 2019-06-04 No Snippets Bernardino RL, Carrageta DF, Sousa M, Alves MG, Oliveira PF.
Show Full Abstract

In the male reproductive tract, ionic equilibrium is essential to maintain normal spermatozoa production and, hence, the reproductive potential. Among the several ions, HCO<sub>3</sub><sup>-</sup> and H<sup>+</sup> have a central role, mainly due to their role on pH homeostasis. In the male reproductive tract, the major players in pH regulation and homeodynamics are carbonic anhydrases (CAs), HCO<sub>3</sub><sup>-</sup> membrane transporters (solute carrier 4-SLC4 and solute carrier 26-SLC26 family transporters), Na<sup>+</sup>-H<sup>+</sup> exchangers (NHEs), monocarboxylate transporters (MCTs) and voltage-gated proton channels (Hv1). CAs and these membrane transporters are widely distributed throughout the male reproductive tract, where they play essential roles in the ionic balance of tubular fluids. CAs are the enzymes responsible for the production of HCO<sub>3</sub><sup>-</sup> which is then transported by membrane transporters to ensure the maturation, storage, and capacitation of the spermatozoa. The transport of H<sup>+</sup> is carried out by NHEs, Hv1, and MCTs and is essential for the electrochemical balance and for the maintenance of the pH within the physiological limits along the male reproductive tract. Alterations in HCO<sub>3</sub><sup>-</sup> production and transport of ions have been associated with some male reproductive dysfunctions. Herein, we present an up-to-date review on the distribution and role of the main intervenient on pH homeodynamics in the fluids throughout the male reproductive tract. In addition, we discuss their relevance for the establishment of the male reproductive potential.

Also flagged:toll-like receptor 7TLR7Resiquimodcutaneous cancerstumorα-tocopherol
Journal Article 2019-06-04 No Snippets Lu R, Groer C, Kleindl PA, Moulder KR, Huang A, Hunt JR, Cai S, Aires DJ, Berkland C, Forrest ML.
Show Full Abstract

The toll-like receptor 7 and 8 (TLR7/8) agonist Resiquimod (R848) has been recognized as a promising immunostimulator for the treatment of cutaneous cancers in multiple clinical trials. However, systemic administration of R848 often results in strong immune-related toxicities while having limited therapeutic effects to the tumor. In the present study, a prodrug-based nanocarrier delivery system was developed that exhibited high therapeutic efficiency. R848 was conjugated to α-tocopherol to constitute an R848-Toco prodrug, followed by formulating with a tocopherol-modified hyaluronic acid (HA-Toco) as a polymeric nano-suspension. In vitro evaluation showed that the delivery system prolonged the release kinetics while maintaining TLR agonist activities. When administered subcutaneously, the nano-suspension formed a depot at the injection site, inducing localized immune responses without systemic expansion. This formulation also suppressed tumor growth and recruited immune cells to the tumor in a murine model of head and neck cancer. In a preclinical canine study of spontaneous mast cell tumors, the treatment led to a 67% response rate (three partial remissions and one complete remission).

Also flagged:Polarityorganellescytoskeletonmembranecytoplasmicaxons
Journal Article 2019-06-04 ✓ 1 Snippet Hakanen J, Ruiz-Reig N, Tissir F.
In-Text Gene Mentions

ARFGEF2 mutations produce a rare form of PVH linked with severe developmental delay and microcephaly (Lian and Sheen, 2015; Yilmaz et al., 2016).

Show Full Abstract

Cell polarity refers to the asymmetric distribution of signaling molecules, cellular organelles, and cytoskeleton in a cell. Neural progenitors and neurons are highly polarized cells in which the cell membrane and cytoplasmic components are compartmentalized into distinct functional domains in response to internal and external cues that coordinate polarity and behavior during development and disease. In neural progenitor cells, polarity has a prominent impact on cell shape and coordinate several processes such as adhesion, division, and fate determination. Polarity also accompanies a neuron from the beginning until the end of its life. It is essential for development and later functionality of neuronal circuitries. During development, polarity governs transitions between multipolar and bipolar during migration of postmitotic neurons, and directs the specification and directional growth of axons. Once reaching final positions in cortical layers, neurons form dendrites which become compartmentalized to ensure proper establishment of neuronal connections and signaling. Changes in neuronal polarity induce signaling cascades that regulate cytoskeletal changes, as well as mRNA, protein, and vesicle trafficking, required for synapses to form and function. Hence, defects in establishing and maintaining cell polarity are associated with several neural disorders such as microcephaly, lissencephaly, schizophrenia, autism, and epilepsy. In this review we summarize the role of polarity genes in cortical development and emphasize the relationship between polarity dysfunctions and cortical malformations.

Also flagged:MembraneFerric-Chelate ReductaseironAmino acidtransmembraneGFP
Journal Article 2019-06-04 No Snippets Li L, Ye L, Kong Q, Shou H.
Show Full Abstract

Ferric reductase oxidase (<i>FRO</i>), the enzyme that reduced ferric iron [Fe (III)] into ferrous iron [Fe (II)], is known to play important roles in Fe absorption and homeostasis in plants that utilize a strategy I mechanism to obtain iron. Rice can use both strategies I and II for Fe uptake depending on the growth conditions. FRO is encoded by two genes in rice genome. Amino acid sequence alignment shows that Os<i>FRO1</i> contains all necessary predicted motifs for a functional FRO enzyme, whereas Os<i>FRO2</i> lacks a complete transmembrane domain at the N-terminal. Transient expression of OsFRO1: GFP protein fusion revealed that OsFRO1 is localized to the vacuolar membrane in rice protoplast. Os<i>FRO1</i> is primarily expressed in leaves and transcript abundance was decreased under excess Fe conditions. Transgenic plants overexpressing Os<i>FRO1</i> were more sensitive to Fe toxicity, in contrast RNA interference lines showed more tolerance to Fe excess stress. Furthermore, RNAi lines showed decreased Fe concentrations compared to wild type plants under Fe excess condition. Together these data show that OsFRO1 is involved in reducing ferric Fe into ferrous Fe in the vacuole, and makes the vacuolar stored Fe available to the cytoplasm through Fe (II) or chelated Fe (II) transporters. Under Fe excess condition, the downregulation of <i>OsFRO1</i> in the RNAi plants reduced the amount of Fe (II) available for cytoplasm, to alleviate Fe excess toxicity. This indicates that OsFRO1 plays an important role to maintain Fe homeostasis between the cytoplasm and vacuole in rice.

Also flagged:copperenzyme activitieslipidmetallothioneingene expressionglutathione-S-transferase
Journal Article 2019-06-04 No Snippets Mlouka R, Cachot J, Boukadida K, Clérandeau C, Gourves PY, Banni M.
Show Full Abstract

This study investigates the combined effects of increased temperatures and copper on the early live stages of the Mediterranean mussel Mytilus galloprovincialis and the blue mussel Mytilus edulis as well as their hybrids. For this purpose, developmental abnormalities was measured after 48 h of exposure as well as a battery of oxidative stress markers such as, antioxidant enzyme activities, lipid peroxidation measured as malondialdehyde accumulation (MDA) and metallothionein contents (MT) and related gene expression pattern. Embryotoxicity and metal accumulation in tissues of mussel larvae exposed to a sublethal concentration of copper (10 μg/L) along with a slight temperature increase from 18 °C to22 °C were significantly increased after 48 h of exposure. Co-exposure to Cu and elevated temperatures significantly increased the antioxidant enzyme activities termed as, glutathione-S-transferase (GST), catalase (CAT), superoxide dismutase (SOD) and being maintained at 22 °C only in pure M. galloprovincialis (PG) larvae and female galloprovincialis x male edulis hybrid larvae (HFG). A significant decrease in mRNA abundance of cat, sod, gst gene transcription levels was showed in the same species. Furthermore, metallothionein accumulation increased significantly in PG D-larvae exposed to copper at 22 °C. The same pattern was observed in term of gene expression of MTs cognates (mt-10 and mt-20). Significant increase of MDA levels in pure M. edulis (PE) larvae and their female M. edulis x male M. galloprovincialis hybrid larvae (HFE) combined with a low MTs content were observed. Overall, this study provides clues about the relatively higher resistance and resilience of M. galloprovincialis species compared to M. edulis species under environmental pollution and future climate change scenarios.

Also flagged:hepatitis Cinfectionhepatitis C antibodyviral hepatitis Csofosbuvirledipasvir
Journal Article 2019-06-04 No Snippets Kim J, Haacker M, Keshavjee S, Atun R.
Show Full Abstract

<h4>Background</h4>The prices and the coverage of effective direct-acting antivirals (DAAs) to treat hepatitis C vary across countries. South Korea expanded DAAs coverage through national health insurance. This study aims to analyse the cost-effectiveness of scale-up of hepatitis C screening and treatment with DAAs in South Korea, a high-income country.<h4>Methods</h4>This study uses a compartmental age-sex structured model of progression of hepatitis C to analyse effects of different policy choices for the scale up of screening and treatment with DAAs on hepatitis C disease burden and costs from 2017 to 2050. Policy scenarios considered in our study are (1) no treatment, (2) status quo, (3) screening population aged over 60 years, (4) screening population over 40 years and (5) screening population aged over 20 years.<h4>Results</h4>The continuation of current policy with the expansion of DAAs coverage is estimated to reduce the prevalence of hepatitis C antibody from 0.6% in 2015 to 0.25% in 2050 of the adult population. Status quo policy, screening from age 60, screening from age 40 and screening from age 20 are cost-effective in terms of averted infection at estimated incremental cost-effective ratio of US$101 208, US$111 770, US$107 909 and US$229 604.<h4>Conclusions</h4>The expansion of DAAs coverage by the national health insurance is highly effective in alleviating hepatitis C disease burden. The scale-up of screening and treatment with DAAs for targeted adult population with high prevalence of hepatitis C is cost-effective. This study provides a case for policy-makers to invest in rapid expansion of hepatitis C comprehensive screening and treatment with DAAs.

Also flagged:cardiac arrestacute-phase responseplatelet degranulationcomplexcomplementventricular tachycardia
Journal Article 2019-06-04 No Snippets Oda T, Yamaguchi A, Ishida R, Nikai T, Shimizu K, Matsumoto KI.
Show Full Abstract

Hypothermia is used for several h during cardiac and aortic surgery to protect ischemic organs. Therapeutic hypothermia (TH) is used for ≤24 h as a treatment for comatose patients after the return of spontaneous circulation (ROSC) following cardiac arrest. The proteomic approach may provide unbiased data on alterations in the abundance of proteins during TH. The objective of this study was to assess the effects of cooling/rewarming on the plasma proteome during TH after ROSC and to identify the mechanism underlying its therapeutic effects. A total of nine comatose adult patients, resuscitated shortly after cardiac arrest, were cooled to 34°C for 24 h and slowly rewarmed to 36°C. A quantitative gel-free proteomic analysis was performed using the isobaric tag for relative and absolute quantification labeling tandem mass spectrometry. Plasma samples were obtained prior to cooling and rewarming, and immediately after rewarming, from all patients during TH after ROSC. A total of 92 high-confidence proteins were identified. Statistically significant alterations were observed (>1.2-fold increase or <0.833-fold decrease) in the levels of 15 of those proteins (P=0.003-0.047), mainly proteins belonging to the acute-phase response or platelet degranulation. Unexpectedly, the levels of free hemoglobin (hemoglobin subunits α and β) were significantly downregulated during TH (P<0.05). The level of the terminal complement complex (SC5b-9) showed significant reduction after cooling (P=0.023). Although the acute-phase response proteins were upregulated, the abundance of complement proteins did not change, and the levels of SC5b-9 and free hemoglobin decreased during TH in patients after ROSC.

Also flagged:methylationlung adenocarcinomascancerlunggene expressionhypomethylation
Journal Article 2019-06-04 No Snippets Yan P, Yang X, Wang J, Wang S, Ren H.
Show Full Abstract

The lack of clinically useful biomarkers compromise the personalized management of lung adenocarcinomas (ADCs); epigenetic events and DNA methylation in particular have exhibited potential value as biomarkers. By comparing genome-wide DNA methylation data of paired lung ADCs and normal tissues from 6 public datasets, cancer-specific CpG island (CGI) methylation changes were identified with a pre-specified criterion. Correlations between DNA methylation and expression data for each gene were assessed by Pearson correlation analysis. A prognostically relevant CGI methylation signature was constructed by risk-score analysis, and was validated using a training-validation approach. Survival data were analyzed by log-rank test and Cox regression model. In total, 134 lung ADC-specific CGI CpGs were identified, among which, a panel of 9 CGI loci were selected as prognostic candidates, and were used to construct a risk-score signature. The novel CGI methylation signature was identified to classify distinct prognostic subgroups across different datasets, and was demonstrated to be a potent independent prognostic factor for overall survival time of patients with lung ADCs. In addition, it was identified that cancer-specific CGI hypomethylation of <i>RPL39L</i>, along with the corresponding gene expression, provided optimized prognostication of lung ADCs. In summary, cancer-specific CGI methylation aberrations are optimal candidates for novel biomarkers of lung ADCs; the 9-CpG methylation panel and hypomethylation of <i>RPL39L</i> exhibited particularly promising significance.

Also flagged:antibodyovarian cancerOCautoantibodiestumorimmunoglobulins
Journal Article 2019-06-04 ✓ 2 Snippets Antony F, Deantonio C, Cotella D, Soluri MF, Tarasiuk O, Raspagliesi F, Adorni F, Piazza S, Ciani Y, Santoro C, Macor P, Mezzanzanica D, Sblattero D.
In-Text Gene Mentions

…BCOR, HMGN2, HIP1R,OLFM4, and KIAA1755.…

OLFM4

Show Full Abstract

The identification of effective biomarkers for early diagnosis, prognosis, and response to treatments remains a challenge in ovarian cancer (OC) research. Here, we present an unbiased high-throughput approach to profile ascitic fluid autoantibodies in order to obtain a tumor-specific antigen signature in OC. We first reported the reactivity of immunoglobulins (Igs) purified from OC patient ascites towards two different OC cell lines. Using a discovery set of Igs, we selected tumor-specific antigens from a phage display cDNA library. After biopanning, 700 proteins were expressed as fusion protein and used in protein array to enable large-scale immunoscreening with independent sets of cancer and noncancerous control. Finally, the selected antigens were validated by ELISA. The initial screening identified eight antigenic clones: CREB3, MRPL46, EXOSC10, BCOR, HMGN2, HIP1R, OLFM4, and KIAA1755. These antigens were all validated by ELISA in a study involving ascitic Igs from 153 patients (69 with OC, 34 with other cancers and 50 without cancer), with CREB3 showing the highest sensitivity (86.95%) and specificity (98%). Notably, we were able to identify an association between the tumor-associated (TA) antibody response and the response to a first-line tumor treatment (platinum-based chemotherapy). A stronger association was found by combining three antigens (BCOR, CREB3, and MRLP46) as a single antibody signature. Measurement of an ascitic fluid antibody response to multiple TA antigens may aid in the identification of new prognostic signatures in OC patients and shift attention to new potentially relevant targets.

Also flagged:PI3-kinaseRASLeukemiaphosphatidylinositol 3-kinasePI3KKMT2A
Journal Article 2019-06-04 ✓ 2 Snippets Esposito MT.
In-Text Gene Mentions

In these models, human cord blood-derived HSC are retro- or lentivirally transduced with a KMT2A-fusion gene and then transplanted into immunodeficient mice, such as NOD/SCID, that lack mature B and T cells, or NSG mice that lack mature NK, B, and T cells.81 Barabe et al showed that KMT2A-MLLT1 and KMT2A-MLLT3 induce AML in NOD/SCID mice in which the NK cells were depleted by an anti-NK cell antibody.21 Likewise Wei et al showed that KMT2A-MLLT3 induces AML in NOD/SCID mice that express transgenic human SCF, GM-CSF, and IL-3 genes suggesting that human cytokines may provide the KMT2A-MLLT3-transdused HSCs with additional signals for cell growth and survival, acting as oncogenic promoters.16 Interestingly, although KMT2A-MLLT10 does not induce leukemia on its own, mice transplanted with HSC expressing KMT2A-MLLT10 and KRASG12V developed AML and died within 10 weeks from transplantation (Table 1).73 In this contest, expression of KRASG12V can mimic the signaling stimulated by the cytokines reported in the study by Wei et al since stimulation with SCF and IL-3 directly activates the RAS signaling pathway in leukemogenesis.73 By contrast, the enforced expression of KMT2A-AFF1 in human HSCs does not induce leukemia,82 even in cooperation with KRASG12V83.

…( MLL-AF9 ), KMT2A-MLLT10( MLL-AF10 ),…

Show Full Abstract

Leukemia is an evolutionary disease and evolves by the accrual of mutations within a clone. Those mutations that are systematically found in all the patients affected by a certain leukemia are called "drivers" as they are necessary to drive the development of leukemia. Those ones that accumulate over time but are different from patient to patient and, therefore, are not essential for leukemia development are called "passengers." The first studies highlighting a potential cooperating role of phosphatidylinositol 3-kinase (PI3K)/RAS pathway mutations in the phenotype of <i>KMT2A</i>-rearranged leukemia was published 20 years ago. The recent development in more sensitive sequencing technologies has contributed to clarify the contribution of these mutations to the evolution of <i>KMT2A</i>-rearranged leukemia and suggested that these mutations might confer clonal fitness and enhance the evolvability of <i>KMT2A</i>-leukemic cells. This is of particular interest since this pathway can be targeted offering potential novel therapeutic strategies to <i>KMT2A</i>-leukemic patients. This review summarizes the recent progress on our understanding of the role of PI3K/RAS pathway mutations in initiation, maintenance, and relapse of <i>KMT2A</i>-rearranged leukemia.

Also flagged:Acute lymphoblastic leukemiaALLpediatric cancerpolymeraseB-cell Acute Lymphoblastic LeukemiaKMT2A
Journal Article 2019-06-04 ✓ 3 Snippets Grioni A, Fazio G, Rigamonti S, Bystry V, Daniele G, Dostalova Z, Quadri M, Saitta C, Silvestri D, Songia S, Storlazzi CT, Biondi A, Darzentas N, Cazzaniga G.
In-Text Gene Mentions

The OP identified fusion genes in 12 out of 24 samples of the RL group (∼50%) (Fig. 2c): t(9;9)/NUP214-ABL1 (n = 1), del(X)/P2RY8-CRLF2 (n = 2), t(10;11)/MLLT10-KMT2A (n = 1), t(21;21)/RUNX1-DYRK1A (n = 1), and t(3;9)/PAX5-MBLN1 (n = 1) fusion genes were associated with ALL and of clinical relevance for the patients and were hence immediately validated by RT-PCR.

…(n = 2), t(10;11)/MLLT10-KMT2A (n = 1),…

…-DDC, P2RY8-CRLF2, KMT2A-UPS2,MLLT10-KMT2A) that are prone…

Show Full Abstract

Acute lymphoblastic leukemia (ALL) is the most frequent pediatric cancer. Fusion genes are hallmarks of ALL, and they are used as biomarkers for risk stratification as well as targets for precision medicine. Hence, clinical diagnostics pursues broad and comprehensive strategies for accurate discovery of fusion genes. Currently, the gold standard methodologies for fusion gene detection are fluorescence in situ hybridization and polymerase chain reaction; these, however, lack sensitivity for the identification of new fusion genes and breakpoints. In this study, we implemented a simple operating procedure (OP) for detecting fusion genes. The OP employs RNA CaptureSeq, a versatile and effortless next-generation sequencing assay, and an in-house as well as a purpose-built bioinformatics pipeline for the subsequent data analysis. The OP was evaluated on a cohort of 89 B-cell precursor ALL (BCP-ALL) pediatric samples annotated as negative for fusion genes by the standard techniques. The OP confirmed 51 samples as negative for fusion genes, and, more importantly, it identified known (<i>KMT2A</i> rearrangements) as well as new fusion events (<i>JAK2</i> rearrangements) in the remaining 38 investigated samples, of which 16 fusion genes had prognostic significance. Herein, we describe the OP and its deployment into routine ALL diagnostics, which will allow substantial improvements in both patient risk stratification and precision medicine.

Also flagged:estradiolsteroidreverse transcriptionreverse transcriptaseRBPRNA binding protein
Journal Article 2019-06-03 No Snippets Robic A, Faraut T, Djebali S, Weikard R, Feve K, Maman S, Kuehn C.
Show Full Abstract

To investigate the dynamics of circRNA expression in pig testes, we designed specific strategies to individually study circRNA production from intron lariats and circRNAs originating from back-splicing of two exons. By applying these methods on seven Total-RNA-seq datasets sampled during the testicular puberty, we detected 126 introns in 114 genes able to produce circRNAs and 5,236 exonic circRNAs produced by 2,516 genes. Comparing our RNA-seq datasets to datasets from the literature (embryonic cortex and postnatal muscle stages) revealed highly abundant intronic and exonic circRNAs in one sample each in pubertal testis and embryonic cortex, respectively. This abundance was due to higher production of circRNA by the same genes in comparison to other testis samples, rather than to the recruitment of new genes. No global relationship between circRNA and mRNA production was found. We propose ExoCirc-9244 (<i>SMARCA5</i>) as a marker of a particular stage in testis, which is characterized by a very low plasma estradiol level and a high abundance of circRNA in testis. We hypothesize that the abundance of testicular circRNA is associated with an abrupt switch of the cellular process to overcome a particular challenge that may have arisen in the early stages of steroid production. We also hypothesize that, in certain circumstances, isoforms and circular transcripts from different genes share functions and that a global regulation of circRNA production is established. Our data indicate that this massive production of circRNAs is much more related to the structure of the genes generating circRNAs than to their function. <b>Abbreviations:</b> PE: Paired Ends; CR: chimeric Read; SR: Split Read; circRNA: circular RNA; NC: non conventional; ExoCirc-RNA: exonic circular RNA; IntroLCirc-: name of a porcine intronic lariat circRNA; ExoCirc-: name of a porcine exonic circRNA; IntronCircle-: name of a porcine intron circle; sisRNA: stable intronic sequence RNA; P: porcine breed Pietrain; LW: porcine breed Large White; RT: reverse transcription/reverse transcriptase; Total-RNA-seq: RNA-seq obtained from total RNA after ribosomal depletion; mRNA-seq: RNA-seq of poly(A) transcripts; TPM: transcripts per million; CR-PM: chimeric reads per million; RBP: RNA binding protein; miRNA: micro RNA; E2: estradiol; DHT: dihydrotestesterone.

Also flagged:EPAS1oxygenacute altitude sicknesscerebral oedemapulmonary hypertensionpre-eclampsia
Journal Article 2019-06-03 No Snippets Witt KE, Huerta-Sánchez E.
Show Full Abstract

Humans and their domestic animals have lived and thrived in high-altitude environments worldwide for thousands of years. These populations have developed a number of adaptations to survive in a hypoxic environment, and several genomic studies have been conducted to identify the genes that drive these adaptations. Here, we discuss the various adaptations and genetic variants that have been identified as adaptive in human and domestic animal populations and the ways in which convergent evolution has occurred as these populations have adapted to high-altitude environments. We found that human and domesticate populations have adapted to hypoxic environments in similar ways. Specific genes and biological pathways have been involved in high-altitude adaptation for multiple populations, although the specific variants differ between populations. Additionally, we found that the gene EPAS1 is often a target of selection in hypoxic environments and has been involved in multiple adaptive introgression events. High-altitude environments exert strong selective pressures, and human and animal populations have evolved in convergent ways to cope with a chronic lack of oxygen. This article is part of the theme issue 'Convergent evolution in the genomics era: new insights and directions'.

Also flagged:APOBIGF1IGFBP2ZNF423matrilinhyperglycemia
Journal Article 2019-06-03 No Snippets Almeida OAC, Moreira GCM, Rezende FM, Boschiero C, de Oliveira Peixoto J, Ibelli AMG, Ledur MC, de Novais FJ, Coutinho LL, Coutinho LL.
Show Full Abstract

<h4>Background</h4>Natural and artificial selection leads to changes in certain regions of the genome resulting in selection signatures that can reveal genes associated with the selected traits. Selection signatures may be identified using different methodologies, of which some are based on detecting contiguous sequences of homozygous identical-by-descent haplotypes, called runs of homozygosity (ROH), or estimating fixation index (F<sub>ST</sub>) of genomic windows that indicates genetic differentiation. This study aimed to identify selection signatures in a paternal broiler TT line at generations 7th and 16th of selection and to investigate the genes annotated in these regions as well as the biological pathways involved. For such purpose, ROH and F<sub>ST</sub>-based analysis were performed using whole genome sequence of twenty-eight chickens from two different generations.<h4>Results</h4>ROH analysis identified homozygous regions of short and moderate size. Analysis of ROH patterns revealed regions commonly shared among animals and changes in ROH abundance and size between the two generations. Results also suggest that whole genome sequencing (WGS) outperforms SNPchip data avoiding overestimation of ROH size and underestimation of ROH number; however, sequencing costs can limited the number of animals analyzed. F<sub>ST</sub>-based analysis revealed genetic differentiation in several genomic windows. Annotation of the consensus regions of ROH and F<sub>ST</sub> windows revealed new and previously identified genes associated with traits of economic interest, such as APOB, IGF1, IGFBP2, POMC, PPARG, and ZNF423. Over-representation analysis of the genes resulted in biological terms of skeletal muscle, matrilin proteins, adipose tissue, hyperglycemia, diabetes, Salmonella infections and tyrosine.<h4>Conclusions</h4>Identification of ROH and F<sub>ST</sub>-based analyses revealed selection signatures in TT line and genes that have important role in traits of economic interest. Changes in the genome of the chickens were observed between the 7th and 16th generations showing that ancient and recent selection in TT line may have acted over genomic regions affecting diseases and performance traits.

Also flagged:statinglucoseHMG-CoA reductasestatinsdiabetesobesity
Journal Article 2019-06-03 ✓ 1 Snippet Margerie D, Lefebvre P, Raverdy V, Schwahn U, Ruetten H, Larsen P, Duhamel A, Labreuche J, Thuillier D, Derudas B, Gheeraert C, Dehondt H, Dhalluin Q, Alexandre J, Caiazzo R, Nesslany P, Verkindt H, Pattou F, Staels B.
In-Text Gene Mentions

…evidence of genetichemochromatosis, and age <…

Show Full Abstract

<h4>Background</h4>Clinical data identified an association between the use of HMG-CoA reductase inhibitors (statins) and incident diabetes in patients with underlying diabetes risk factors such as obesity, hypertension and dyslipidemia. The molecular mechanisms however are unknown.<h4>Methods</h4>An observational cross-sectional study included 910 severely obese patients, mean (SD) body mass index (BMI) 46.7 (8.7), treated with or without statins (ABOS cohort: a biological atlas of severe obesity). Data and sample collection took place in France between 2006 and 2016. Transcriptomic signatures of statin treatment in human liver obtained from genome-wide transcriptomic profiling of five different statin drugs using microarrays were correlated to clinico-biological phenotypes and also assigned to biological pathways and mechanisms. Patients from the non-statin-users group were matched to patients in the statin users group by propensity score analysis to minimize confounding effects from age, gender, parental familial history of diabetes, BMI, waist circumference, systolic and diastolic blood pressure and use of anti-hypertensive drugs as pre-specified covariates.<h4>Results</h4>We determined the hepatic, statin-related gene signature from genome-wide transcriptomic profiling in severely obese patients with varying degrees of glucose tolerance and cardio-metabolic comorbidities. One hundred and fifty seven patients on statin treatment in the matched cohort showed higher diabetes prevalence (OR = 2.67; 95%CI, 1.60-4.45; P = 0.0002) and impairment of glucose homeostasis. This phenotype was associated with molecular signatures of increased hepatic de novo lipogenesis (DNL) via activation of sterol regulatory element-binding protein 1 (SREBP1) and concomitant upregulation of the expression of key genes in both fatty acid and triglyceride metabolism.<h4>Conclusions</h4>A DNL gene activation profile in response to statins is associated with insulin resistance and the diabetic status of the patients. Identified molecular signatures thus suggest that statin treatment increases the risk for diabetes in humans at least in part via induction of DNL.<h4>Trial registration</h4>NCT01129297 . Registered May 242,010 (retrospectively registered).

Also flagged:cell surfacenuclear membraneneurogenesisheparan sulfate proteoglycandorsal/ventral pattern formationlearning or memory
Journal Article 2019-06-03 ✓ 2 Snippets Won H, Huang J, Opland CK, Hartl CL, Geschwind DH.
In-Text Gene Mentions

…, CUX1 ,POU3F2, POU3F3 ,…

…, PAX6 ,POU3F2, GLI3 ,…

Show Full Abstract

Modern genetic studies indicate that human brain evolution is driven primarily by changes in gene regulation, which requires understanding the biological function of largely non-coding gene regulatory elements, many of which act in tissue specific manner. We leverage chromatin interaction profiles in human fetal and adult cortex to assign three classes of human-evolved elements to putative target genes. We find that human-evolved elements involving DNA sequence changes and those involving epigenetic changes are associated with human-specific gene regulation via effects on different classes of genes representing distinct biological pathways. However, both types of human-evolved elements converge on specific cell types and laminae involved in cerebral cortical expansion. Moreover, human evolved elements interact with neurodevelopmental disease risk genes, and genes with a high level of evolutionary constraint, highlighting a relationship between brain evolution and vulnerability to disorders affecting cognition and behavior. These results provide novel insights into gene regulatory mechanisms driving the evolution of human cognition and mechanisms of vulnerability to neuropsychiatric conditions.

Also flagged:cancerleukemialymphomamyeloidtranscription factorNKL homeobox
Journal Article 2019-06-03 ✓ 1 Snippet Quentmeier H, Pommerenke C, Dirks WG, Eberth S, Koeppel M, MacLeod RAF, Nagel S, Steube K, Uphoff CC, Drexler HG.
In-Text Gene Mentions

…variants of LIMS1,RABGAP1Land TFEC are…

Show Full Abstract

For many years, immortalized cell lines have been used as model systems for cancer research. Cell line panels were established for basic research and drug development, but did not cover the full spectrum of leukemia and lymphoma. Therefore, we now developed a novel panel (LL-100), 100 cell lines covering 22 entities of human leukemia and lymphoma including T-cell, B-cell and myeloid malignancies. Importantly, all cell lines are unequivocally authenticated and assigned to the correct tissue. Cell line samples were proven to be free of mycoplasma and non-inherent virus contamination. Whole exome sequencing and RNA-sequencing of the 100 cell lines were conducted with a uniform methodology to complement existing data on these publicly available cell lines. We show that such comprehensive sequencing data can be used to find lymphoma-subtype-characteristic copy number aberrations, mRNA isoforms, transcription factor activities and expression patterns of NKL homeobox genes. These exemplary studies confirm that the novel LL-100 panel will be useful for understanding the function of oncogenes and tumor suppressor genes and to develop targeted therapies.

Also flagged:HydrationcopeptinAVPureanitrogenlipid
Journal Article 2019-06-03 No Snippets Chang DC, Basolo A, Piaggi P, Votruba SB, Krakoff J.
Show Full Abstract

<h4>Background/objective</h4>Evidence from non-human species indicate that hydration and arginine vasopressin (AVP) influence fuel selection, energy expenditure (EE), and food intake, but these relationships are unclear in humans. We sought to assess whether hydration biomarkers [24-h urine volume (UVol) and urine urea nitrogen concentration (UUN)] and copeptin (a surrogate for AVP) are associated with 24-h EE, respiratory quotient (RQ), and daily energy intake (DEI).<h4>Subjects/methods</h4>In a secondary analysis of collected data, we selected healthy adults (Group 1, n = 177) who had 24-h whole-room indirect calorimetry measurements in energy balance with 24-h urine collection and fasting copeptin measurements (n = 117), followed by 3 days ad libitum food intake. A separate group (Group 2, n = 284) with hydration markers and calorimetry measurements was also studied. The main outcome measures were 24-h RQ, 24-h EE, DEI, substrate oxidation.<h4>Results</h4>In Group 1, lower 24-h UVol and higher 24-h UUN, indicating lower hydration, were correlated with lower 24-h RQ (r = 0.35, p < 0.0001, and r = -0.29, p = 0.0001, respectively; results similar in Group 2) and predicted subsequent reduced DEI (r = 0.20, p = 0.01, and r = -0.27, p = 0.0003, respectively), adjusted for confounders. Copeptin was independently associated with 24-h lipid oxidation (r = -0.23, p = 0.01). In Group 2, lower hydration was associated with reduced 24-h EE (24-h UVol: r = 0.29, p < 0.0001; 24-h UUN: r = -0.25, p < 0.0001).<h4>Conclusions</h4>Hydration biomarkers were associated with metabolic differences characterized by altered food intake, fuel selection, and possibly EE. Independently, copeptin was associated with higher lipid oxidation.

Also flagged:methylationovarian cancerBRCA1BRCA2Bloom Syndromewarfarin
Journal Article 2019-06-03 No Snippets Crawford DC, Cooke Bailey JN, Briggs FBS.
Show Full Abstract

Most genotype-phenotype studies have historically lacked population diversity, impacting the generalizability of findings and thereby limiting the ability to equitably implement precision medicine. This well-documented problem has generated much interest in the ascertainment of new cohorts with an emphasis on multiple dimensions of diversity, including race/ethnicity, gender, age, socioeconomic status, disability, and geography. The most well known of these new cohort efforts is arguably All of Us, formerly known as the Precision Medicine Cohort Initiative Program. All of Us intends to ascertain at least one million participants in the United States representative of the multiple dimensions of diversity. As an incentive to participate, All of Us is offering the return of research results, including whole genome sequencing data, as well as the opportunity to contribute to the scientific process as non-scientists. The scale and scope of the proposed return of research results are unprecedented. Here, we briefly review possible return of genetic data models, including the likely data file formats and modes of data transfer or access. We also review the resources required to access and interpret the genetic or genomic data once received by the average participant, highlighting the nuanced anticipated barriers that will challenge both the digitally, computationally literate and illiterate participant alike. This inventory of resources required to receive, process, and interpret return of research results exposes the potential for access disparities and warns the scientific community to mind the gap so that all participants have equal access and understanding of the benefits of human genetic research.

Also flagged:steatosisnonalcoholic steatohepatitisNASHsimple steatosisnonalcoholic fatty liver diseaseNAFLD
Journal Article 2019-06-03 ✓ 1 Snippet Culafic M, Vezmar Kovacevic S, Dopsaj V, Stulic M, Vlaisavljevic Z, Miljkovic B, Culafic D.
In-Text Gene Mentions

…and overlap syndromes,hemochromatosis, Wilson’s disease, α1-antitry…

Show Full Abstract

<i>Background and objectives:</i> Data suggests that nearly 30% of the general population have steatosis and up to 5% of this population develops nonalcoholic steatohepatitis (NASH). Liver biopsy is still considered to be the gold standard for the diagnosis of NASH. Great effort is being made toward the identification of sensitive diagnostic tests that do not involve invasive procedures to address a common concern in patients with the nonalcoholic fatty liver disease-whether they have NASH or simple steatosis. We aimed to investigate the independent predictors and develop a non-invasive, easy-to-perform, low-cost set of parameters that may be used in clinical practice to differentiate simple steatosis from NASH. Methods: А cross-sectional study of nonalcoholic fatty liver disease (NAFLD) patients divided into two groups: group I-simple steatosis (SS) and group II-biopsy-proven NASH. Strict inclusion criteria and stepwise analysis allowed the evaluation of a vast number of measured/estimated parameters. <i>Results:</i> One hundred and eleven patients were included-82 with simple steatosis and 29 with biopsy-proven NASH. The probability of NASH was the highest when homeostatic model assessment of insulin resistance (HOMA-IR) was above 2.5, uric acid above 380 µmol/L, ferritin above 100 µg/L and ALT above 45 U/L. An acronym of using first letters was created and named the HUFA index. This combined model resulted in an area under the receiver operator characteristic curve (AUROC) of 0.94, provided sensitivity, specificity, positive predictive value and a negative predictive value for NASH of 70.3%, 95.1%, 83.1% and 90.0%, respectively. <i>Conclusion</i>: We suggest a simple non-invasive predictive index HUFA that encompasses four easily available parameters (HOMA-IR, uric acid, ferritin and ALT) to identify patients with NASH, which may reduce the need for a liver biopsy on a routine basis in patients with NAFLD.

Also flagged:diabetesInsulinglucosemetabolismwaterglucose intolerance
Journal Article 2019-06-03 No Snippets Gong Y, Liu J, Xue Y, Zhuang Z, Qian S, Zhou W, Li X, Qian J, Ding G, Sun Z.
Show Full Abstract

<h4>Background</h4>Inorganic arsenic (iAs) is a widespread environmental toxin. In addition to being a human carcinogen, its effect on diabetes has started to gain recognition recently. Insulin is the key hormone regulating systemic glucose metabolism. The in vivo effect of iAs on insulin sensitivity has not been directly addressed.<h4>Objectives</h4>Here we use mouse models to dissect the dose-dependent effects of iAs on glucose metabolism in vivo.<h4>Methods</h4>We performed hyperinsulinemic-euglycemic clamp, the gold standard analysis of systemic insulin sensitivity. We also performed dynamic metabolic testings and RNA-seq analysis.<h4>Results</h4>We found that a low-dose exposure (0.25 ppm iAs in drinking water) caused glucose intolerance in adult male C57BL/6 mice, likely by disrupting glucose-induced insulin secretion without affecting peripheral insulin sensitivity. However, a higher-dose exposure (2.5 ppm iAs) had diminished effects on glucose tolerance despite disrupted pancreatic insulin secretion. Insulin Clamp analysis showed that 2.5 ppm iAs actually enhanced systemic insulin sensitivity by simultaneously enhancing insulin-stimulated glucose uptake in skeletal muscles and improved insulin-mediated suppression of endogenous glucose production. RNA-seq analysis of skeletal muscles revealed that 2.5 ppm iAs regulated expression of many genes involved in the metabolism of fatty acids, pyruvate, and amino acids.<h4>Conclusion</h4>These findings suggest that iAs has opposite glycemic effects on distinct metabolic tissues at different dose thresholds. Such non-monotonic dose-response effects of iAs on glucose tolerance shed light on the complex interactions between iAs and the systemic glucose metabolism, which could potentially help reconcile some of the conflicting results in human epidemiological studies.

Also flagged:Colorectal cancermalignant tumorscancerpiwinucleotidesbinding
Journal Article 2019-06-03 ✓ 1 Snippet Wang JJ, Wang X, Song YX, Zhao JH, Sun JX, Shi JX, Wu ZH, Wang ZN.
In-Text Gene Mentions

ZNFX1 antisense RNA1 (ZFAS1) has been reported to be overexpressed and involved in cell proliferation and metastasis in many cancers [65–67].

Show Full Abstract

Colorectal cancer (CRC) is one of the most common malignant tumors worldwide, causing a large number of cancer-related deaths each year. Patients are usually diagnosed at advanced and incurable stages due to the lack of suitable screening methods for early detection. Noncoding RNAs (ncRNAs), including small and long noncoding RNAs (lncRNA), are known to have significant regulatory functions, and accumulating evidence suggests that circulating ncRNAs have potential applications as noninvasive biomarkers for diagnosing CRC, evaluating its prognosis, or predicting chemosensitivity in the general population. In this review, we summarize the origins of circulating ncRNAs and provide details of single and multiple circulating ncRNAs that might have roles as diagnostic and prognostic biomarkers in CRC. We end by discussing circulating ncRNAs that may distinguish patients with resistance to chemotherapy.

Also flagged:centrosomescentriolecentrosomeciliogenesispolypeptidesmicrotubules
Journal Article 2019-06-03 ✓ 2 Snippets Gheiratmand L, Coyaud E, Gupta GD, Laurent EM, Hasegan M, Prosser SL, Gonçalves J, Gonçalves J, Raught B, Pelletier L.
In-Text Gene Mentions

…proteins (CCDC57 andCCDC92) partially colocalized with…

…to centriolar satellites,CCDC92was previously shown…

Show Full Abstract

Centriolar satellites are small electron-dense granules that cluster in the vicinity of centrosomes. Satellites have been implicated in multiple critical cellular functions including centriole duplication, centrosome maturation, and ciliogenesis, but their precise composition and assembly properties have remained poorly explored. Here, we perform in vivo proximity-dependent biotin identification (BioID) on 22 human satellite proteins, to identify 2,113 high-confidence interactions among 660 unique polypeptides. Mining this network, we validate six additional satellite components. Analysis of the satellite interactome, combined with subdiffraction imaging, reveals the existence of multiple unique microscopically resolvable satellite populations that display distinct protein interaction profiles. We further show that loss of satellites in PCM1-depleted cells results in a dramatic change in the satellite interaction landscape. Finally, we demonstrate that satellite composition is largely unaffected by centriole depletion or disruption of microtubules, indicating that satellite assembly is centrosome-independent. Together, our work offers the first systematic spatial and proteomic profiling of human centriolar satellites and paves the way for future studies aimed at better understanding the biogenesis and function(s) of these enigmatic structures.

Also flagged:axonsmyelintranscription factorsSoxdemyelinating diseasesSox10
Journal Article 2019-06-02 ✓ 1 Snippet Wittstatt J, Reiprich S, Küspert M.
In-Text Gene Mentions

…proteins Sox5 andSox6, showed redundant functions…

Show Full Abstract

In the central nervous system, oligodendrocytes wrap axons with myelin sheaths, which is essential for rapid transfer of electric signals and their trophic support. In oligodendroglia, transcription factors of the Sox protein family are pivotal regulators of a variety of developmental processes. These include specification, proliferation, and migration of oligodendrocyte precursor cells as well as terminal differentiation to mature myelinating oligodendrocytes. Sox proteins are further affected in demyelinating diseases and are involved in remyelination following damage of the central nervous system. Here we summarize and discuss latest findings on transcriptional regulation of Sox proteins, their function, target genes, and interaction with other transcription factors and chromatin remodelers in oligodendroglia with physiological and pathophysiological relevance.

Also flagged:myogenesislocomotiongastrulationsegmentationinnervationfibre differentiation
Journal Article 2019-06-02 No Snippets Keenan SR, Currie PD.
Show Full Abstract

The development and growth of vertebrate axial muscle have been studied for decades at both the descriptive and molecular level. The zebrafish has provided an attractive model system for investigating both muscle patterning and growth due to its simple axial musculature with spatially separated fibre types, which contrasts to complex muscle groups often deployed in amniotes. In recent years, new findings have reshaped previous concepts that define how final teleost muscle form is established and maintained. Here, we summarise recent findings in zebrafish embryonic myogenesis with a focus on fibre type specification, followed by an examination of the molecular mechanisms that control muscle growth with emphasis on the role of the dermomyotome-like external cell layer. We also consider these data sets in a comparative context to gain insight into the evolution of axial myogenic patterning systems within the vertebrate lineage.

Also flagged:reverse transcriptionActbGapdhTbpPgk1Sdha
Journal Article 2019-06-02 No Snippets Moysés-Oliveira M, Cabral V, Gigek CO, Corrêa DCC, Di-Battista A, Stumpp T, Melaragno MI.
Show Full Abstract

qRT-PCR requires reliable internal control genes stably expressed in different samples and experimental conditions. The stability of reference genes is rarely tested experimentally, especially in developing tissues given the singularity of these samples. Here we evaluated the suitability of a set of reference genes (Actb, Gapdh, Tbp, Pgk1 and Sdha) using samples from early mouse embryo tissues that are widely used in research (somites, prosencephalon and heart) at different developmental stages. The comparative ΔCq method and five software packages (NormFinder, geNorm, BestKeeper, DataAssist and RefFinder) were used to rank the most stable genes while GenEx and GeNorm programs determined the optimal total number of reference genes for a reliable normalization. The ranking of most reliable reference genes was different for each tissue evaluated: (1) in somite from embryos with 16-18 somite pairs stage, the combination of Pgk1 and Actb provided the best normalization and Actb also presented high stability levels at an earlier developmental stage; (2) Gapdh is the most stable gene in prosencephalon in the two developmental stages tested; and (3) in heart samples, Sdha, Gapdh and Actb were the best combination for qPCR normalization. The analysis of these three tissues simultaneously indicated the combination of Gapdh, Actb and Tbp as the most reliable internal control. This study highlights the importance of appropriate reference genes according to the cell type and/or tissue of interest. The data here described can be applied in future research using mouse embryos as a model for mammalian development.

Also flagged:Robo receptorsaxon guidanceangiogenesisinflammatory cell chemotaxistumorcell migration
Journal Article 2019-06-02 ✓ 1 Snippet Tong M, Jun T, Nie Y, Hao J, Fan D.
In-Text Gene Mentions

…Slits and potentiatingDCC-mediated midline attraction t…

Show Full Abstract

The Slit family is a family of secreted proteins that play important roles in various physiologic and pathologic activities via interacting with Robo receptors. Slit/Robo signaling was first identified in the nervous system, where it functions in neuronal axon guidance; nevertheless, an increasing number of studies have shown that Slit/Robo signaling even regulates other activities, such as angiogenesis, inflammatory cell chemotaxis, tumor cell migration and metastasis. Although the precise role of the ligand-receptor in organisms has been obscure and the conclusions drawn are sometimes paradoxical, tremendous advances in understanding the Slit/Robo signaling pathway have been made. As such, our review summarizes the characteristics of the Slit/Robo signaling pathway and its role in various cell types.

Also flagged:Glutathione Transferase P1heart failureGSTcoronary artery diseaseidiopathic dilated cardiomyopathyICAM-1
Journal Article 2019-06-02 ✓ 2 Snippets Simeunovic D, Odanovic N, Pljesa-Ercegovac M, Radic T, Radovanovic S, Coric V, Milinkovic I, Matic M, Djukic T, Ristic A, Risimic D, Seferovic P, Simic T, Simic D, Savic-Radojevic A.
In-Text Gene Mentions

…of peroxiredoxin VI (Prdx6), a member of…

…differentially interposes thePrdx6activity, implying that…

Show Full Abstract

Disturbed redox balance in heart failure (HF) might contribute to impairment of cardiac function, by oxidative damage, or by regulation of cell signaling. The role of polymorphism in glutathione transferases (<i>GSTs</i>), involved both in antioxidant defense and in regulation of apoptotic signaling pathways in HF, has been proposed. We aimed to determine whether GST genotypes exhibit differential risk effects between coronary artery disease (CAD) and idiopathic dilated cardiomyopathy (IDC) in HF patients. <i>GSTA1</i>, <i>GSTM1</i>, <i>GSTP1</i>, and <i>GSTT1</i> genotypes were determined in 194 HF patients (109 CAD, 85 IDC) and 274 age- and gender-matched controls. No significant association was found for <i>GSTA1</i>, <i>GSTM1</i>, and <i>GSTT1</i> genotypes with HF occurrence due to either CAD or IDC. However, carriers of at least one variant <i>GSTP1</i>∗Val (rs1695) allele were at 1.7-fold increased HF risk than <i>GSTP1</i>∗Ile/Ile carriers (<i>p</i> = 0.031), which was higher when combined with the variant <i>GSTA1</i>∗B allele (OR = 2.2, <i>p</i> = 0.034). In HF patients stratified based on the underlying cause of disease, an even stronger association was observed in HF patients due to CAD, who were carriers of a combined <i>GSTP1</i>(rs1695)/<i>GSTA1</i> "risk-associated" genotype (OR = 2.8, <i>p</i> = 0.033) or a combined <i>GSTP1</i>∗Ile/Val+Val/Val (rs1695)/<i>GSTP1</i>∗AlaVal+∗ValVal (rs1138272) genotype (OR = 2.1, <i>p</i> = 0.056). Moreover, these patients exhibited significantly decreased left ventricular end-systolic diameter compared to <i>GSTA1</i>∗AA/<i>GSTP1</i>∗IleIle carriers (<i>p</i> = 0.021). Higher values of ICAM-1 were found in carriers of the <i>GSTP1</i>∗IleVal+∗ValVal (rs1695) (<i>p</i> = 0.041) genotype, whereas higher TNF<i>α</i> was determined in carriers of the <i>GSTP1</i>∗AlaVal+∗ValVal genotype (rs1138272) (<i>p</i> = 0.041). In conclusion, <i>GSTP1</i> polymorphic variants may determine individual susceptibility to oxidative stress, inflammation, and endothelial dysfunction in HF.

Also flagged:Gastric CancerCTF1ADAD2Gene ExpressionCancerCell
Journal Article 2019-06-02 ✓ 5 Snippets Pan J, Dai Q, Xiang Z, Liu B, Li C.
In-Text Gene Mentions

Jeon, Y. J demonstrated that BTN3A3 acted as a cancer suppressor gene promoting cellular apoptosis of non-small cell lung cancer 19.

The tumor-suppressing biological effect of BTN3A3 also implies BTN3A3 may promote the tumor susceptibility to chemotherapeutic drugs.

Based on Cancer Cell Line Encyclopedia (CCLE, http://portals.broadinstitute.org/) 8, GSE62254 dataset from Gene Expression Omnibus database (GEO) 9 and Cancer Therapeutics Response Portal (CTRP) 10, we had screened three potential genes including CTF1, BTN3A3 and ADAD2 to establish the predictive model.

For the 144 patients accepted fluorouracil-based chemotherapy with survival time in this study, we further applied nomogram to visualize the predictive model as follows, risk score = -2.02586739 * e-12 * (expression level of CTF1)2 + 153.962828321946 * (expression level of CTF1) - 71.4285714285714 * (expression level of BTN3A3) + 4.0660291 * e-13 * (expression level of ADAD2)2 -221.671172109573 * (expression level of ADAD2) + 390.603007 (Fig. 3D).

We found each selected gene was significantly correlated with the DFS and Overall survival (OS) of GC patients treated with fluorouracil-based chemotherapy while none of these genes were significantly correlated with the DFS of untreated GC patients and only ADAD2 and BTN3A3 correlated with the OS of non-treated patients, indicating the specificity of the model (Fig. 4B and 4C, Fig. 5B and 5C).

Show Full Abstract

<b>Background</b>: Fluorouracil-based chemotherapy is recommended by the main clinical guidelines for post-operative gastric cancer (GC) patient's chemotherapy treatment, this study aim to establish relate model to predict patients' susceptibility to fluorouracil-based chemotherapy to prevent patients' unnecessary exposure to chemotherapy treatments and improve patients' treatment. <b>Methods</b>: Data from Gene Expression Omnibus (GEO) database, Cancer Cell Line Encyclopedia (CCLE) database, Cancer Therapeutics Response Portal (CTRP) and The Cancer Genome Atlas (TCGA) were used. A predictive model was built based on univariate and multivariate Cox analysis and visualized by nomogram. Survival analysis was performed using Kaplan-Meier and log-rank test. <b>Results</b>: A total of 514 differentially expressed genes (DEGs) were identified between fluorouracil-resistant cell lines and fluorouracil-sensitive cell lines based on CCLE database. A total of 300 patients who had radical gastrectomy were recruited, of which 144 received fluorouracil-based chemotherapy and 156 were untreated. Three biomarkers (CTF1, BTN3A3, ADAD2) were finally selected by univariate and multivariate Cox regression analysis to establish the predictive models visualized by nomogram. This model could precisely predict both the Disease free survival (DFS) and Overall survival (OS) of patients treated with fluorouracil-based chemotherapy after surgery compared to untreated GC patients validated by both GEO database and TCGA database. <b>Conclusion</b>: Our data established three genes-based predictive model which might predict GC patients' susceptibility to fluorouracil and help clinicians develop personalized treatment.

Also flagged:EstradiolProgesteroneGene Expressionepithelial ovarian cancerReverse transcriptionhormone receptors
Journal Article 2019-06-02 ✓ 5 Snippets Chang YH, Ding DC, Chu TY.
In-Text Gene Mentions

All stemness genes related to the Wnt (OLFM4, AXIN2, and LGR6) and Notch (HES1) signaling pathways, ES cell markers (SSEA3 and SSEA4), Aldh1, and Lgr5 had significantly increased expression after progesterone treatment (Fig. 7).

In our study, we found that OLFM4 exhibited increased expression following progesterone treatment.

…LGR5, LGR6, andOLFM4) and Notch (Hes1)…

…gene, olfactomedin 4 (OLFM4), in the FTE…

…for stemness markers (OLFM4[forward: 5'-A​C​T​G​T​C​C​G​A…

Show Full Abstract

Fallopian tube epithelial cells (FTECs) are thought to be the origin of epithelial ovarian cancer. However, the effect of the hormones on FTECs is unknown, and therefore, this study explored this effect. We successfully derived FTECs from the fallopian tube epithelial layer and treated them with estradiol and progesterone. Reverse transcription polymerase chain reaction was used to evaluate the gene expression of the FTECs' hormone receptors. Confocal and electron microscopy were used to evaluate the morphology of the FTECs after they were treated with hormones. Finally, quantitative PCR was used to evaluate the gene expression of the hormone-treated FTECs. The results showed that the FTECs exhibited cuboidal cell morphology and could be maintained at a constant proliferation rate. Furthermore, flow cytometry revealed that the FTECs expressed stem cell markers, such as SSEA3, SSEA4, and Lgr5. Moreover, the FTECs could express both estrogen and progesterone receptors. In a culture treated with 400 nM estrogen, the FTECs differentiated toward ciliated cells, whereas in a culture treated with estradiol or progesterone, the FTECs increased their expression of certain stem cell markers (SSEA3, SSEA4, and Aldh1) and stemness genes [Wnt (AXIN2, LGR5, LGR6, and OLFM4) and Notch (Hes1) signaling]. In conclusion, hormones may alter the gene expressions of FTECs, and these cells may provide new insights into how FTECs regenerate in response to hormones.

Also flagged:Netrin-1gastric cancerNTN1axonmalignant tumortumor
Journal Article 2019-06-02 ✓ 3 Snippets Yin K, Wang L, Xia Y, Dang S, Zhang X, He Z, Xu J, Shang M, Xu Z.
In-Text Gene Mentions

…in colorectal cancer (DCC), its orthologue neogenin,…

…e, 5'‑CATGGAAGTCCTCCACCTGT‑3';DCC, forward, 5'‑GCCACAAACCAACAGA…

…including UNC5A-D, neogenin,DCCand DSCAM in…

Show Full Abstract

Neural invasion (NI) is one of the important routes for local spread of gastric cancer (GC) correlated with poor prognosis. However, the exact cellular characteristics and molecular mechanisms of NI in GC are still unclear. Netrin-1(NTN1) as an axon guidance molecule was firstly found during neural system development. Importantly, NTN1 has an essential role in the progression of malignant tumor and specifically mediates the induction of invasion. In this study, we found NTN1 expression was significantly increased in 97 tumor tissues from GC patients and positively correlated with NI (p<0.05). In addition, we detected NTN1 knockdown significantly suppressed GC cells migration and invasion. Moreover, our results showed that reciprocity was observed between GC cells and neurites colonies in dorsal root ganglia (DRG)-GC cells co-culture vitro model. GC cells with NTN1 silencing could suppress their abilities to navigate along surrounding neuritis and this effect was depended on its receptor neogenin. In vivo, NTN1 inhibition also decreased GC cells sciatic nerve invasion. Taken together, our findings argue that NTN1 and its receptor neogenin might act synergistically in promoting GC cells neural invasion. Inhibiting the activity of NTN1 could be a potential strategy targeting NI in GC therapy.

Also flagged:arrestin domain-containing protein 3non-alcoholic fatty liver diseaseNAFLDnon-alcoholic steatohepatitisNASHARRDC3
Journal Article 2019-06-02 No Snippets Ogawa M, Kanda T, Higuchi T, Takahashi H, Kaneko T, Matsumoto N, Nirei K, Yamagami H, Matsuoka S, Kuroda K, Moriyama M.
Show Full Abstract

The prevalence of non-alcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH) is increasing worldwide. Several effective drugs for these diseases are now in development and under clinical trials. It is important to reveal the mechanism of the development of NAFLD and NASH. We investigated the role of arrestin domain-containing protein 3 (ARRDC3), which is linked to obesity in men and regulates body mass, adiposity and energy expenditure, in the progression of NAFLD and NASH. We performed knockdown of endogenous ARRDC3 in human hepatocytes and examined the inflammasome-associated gene expression by real-time PCR-based array. We also examined the effect of conditioned medium from endogenous ARRDC3-knockdown-hepatocytes on the apoptosis of hepatic stellate cells. We observed that free acids enhanced the expression of ARRDC3 in hepatocytes. Knockdown of ARRDC3 could lead to the inhibition of inflammasome-associated gene expression in hepatocytes. We also observed that conditioned medium from endogenous ARRDC3-knockdown-hepatocytes enhances the apoptosis of hepatic stellate cells. ARRDC3 has a role in the progression of NAFLD and NASH and is one of the targets for the development of the effective treatment of NAFLD and NASH.

Also flagged:Sp9transcription factortranscription factorsEpha3parvalbuminPV
Journal Article 2019-06-01 ✓ 1 Snippet Liu Z, Zhang Z, Lindtner S, Li Z, Xu Z, Wei S, Liang Q, Wen Y, Tao G, You Y, Chen B, Wang Y, Rubenstein JL, Yang Z.
In-Text Gene Mentions

Sox6

Show Full Abstract

Immature neurons generated by the subpallial MGE tangentially migrate to the cortex where they become parvalbumin-expressing (PV+) and somatostatin (SST+) interneurons. Here, we show that the Sp9 transcription factor controls the development of MGE-derived cortical interneurons. SP9 is expressed in the MGE subventricular zone and in MGE-derived migrating interneurons. Sp9 null and conditional mutant mice have approximately 50% reduction of MGE-derived cortical interneurons, an ectopic aggregation of MGE-derived neurons in the embryonic ventral telencephalon, and an increased ratio of SST+/PV+ cortical interneurons. RNA-Seq and SP9 ChIP-Seq reveal that SP9 regulates MGE-derived cortical interneuron development through controlling the expression of key transcription factors Arx, Lhx6, Lhx8, Nkx2-1, and Zeb2 involved in interneuron development, as well as genes implicated in regulating interneuron migration Ackr3, Epha3, and St18. Thus, Sp9 has a central transcriptional role in MGE-derived cortical interneuron development.

Also flagged:parathyroid hormonevascular calcificationchronic kidney diseasePTHphosphoruscalcium
Journal Article 2019-06-01 No Snippets Carrillo-López N, Panizo S, Alonso-Montes C, Martínez-Arias L, Avello N, Sosa P, Dusso AS, Cannata-Andía JB, Naves-Díaz M.
Show Full Abstract

<h4>Background</h4>In chronic kidney disease (CKD), increases in serum phosphate and parathyroid hormone (PTH) aggravate vascular calcification (VC) and bone loss. This study was designed to discriminate high phosphorus (HP) and PTH contribution to VC and bone loss.<h4>Methods</h4>Nephrectomized rats fed a HP diet underwent either sham operation or parathyroidectomy and PTH 1-34 supplementation to normalize serum PTH.<h4>Results</h4>In uraemic rats fed a HP diet, parathyroidectomy with serum PTH 1-34 supplementation resulted in (i) reduced aortic calcium (80%) by attenuating osteogenic differentiation (higher α-actin; reduced Runx2 and BMP2) and increasing the Wnt inhibitor Sclerostin, despite a similar degree of hyperphosphataemia, renal damage and serum Klotho; (ii) prevention of bone loss mostly by attenuating bone resorption and increases in Wnt inhibitors; and (iii) a 70% decrease in serum calcitriol levels despite significantly reduced serum Fgf23, calcium and renal 24-hydroxylase, which questions that Fgf23 is the main regulator of renal calcitriol production. Significantly, when vascular smooth muscle cells (VSMCs) were exposed exclusively to high phosphate and calcium, high PTH enhanced while low PTH attenuated calcium deposition through parathyroid hormone 1 receptor (PTH1R) signalling.<h4>Conclusions</h4>In hyperphosphataemic CKD, a defective suppression of high PTH exacerbates HP-mediated osteogenic VSMC differentiation and reduces vascular levels of anti-calcifying sclerostin.

Also flagged:Metabolic SyndromeMitochondriapreproteinsmitochondrionmitochondrialtransporters
Journal Article 2019-06-01 No Snippets Aghajani Nargesi A, Zhu XY, Hickson LJ, Conley SM, van Wijnen AJ, Lerman LO, Eirin A.
Show Full Abstract

Mesenchymal stem cells (MSCs) are currently being tested in several clinical trials. Mitochondria regulate many aspects of MSC function. Mitochondrial preproteins are rapidly translated and trafficked into the mitochondrion for assembly in their final destination, but whether coexisting cardiovascular risk factors modulate this process is unknown. We hypothesized that metabolic syndrome (MetS) modulates mitochondrial protein import in porcine MSCs. MSCs were isolated from porcine abdominal adipose tissue after 16 weeks of Lean or MetS diet (n = 5 each). RNA-sequencing was performed and differentially expressed mitochondrial mRNAs and microRNAs were identified and validated. Protein expression of transporters of mitochondrial proteins (presequences and precursors) and their respective substrates were measured. Mitochondrial homeostasis was assessed by Western blot and function by cytochrome-c oxidase-IV activity. Forty-five mitochondrial mRNAs were upregulated and 25 downregulated in MetS-MSCs compared to Lean-MSCs. mRNAs upregulated in MetS-MSCs encoded for precursor proteins, whereas those downregulated encoded for presequences. Micro-RNAs upregulated in MetS-MSCs primarily target mRNAs encoding for presequences. Transporters of precursor proteins and their substrates were also upregulated, associated with changes in mitochondrial homeostasis and dysfunction. MetS interferes with mitochondrial protein import, favoring upregulation of precursor proteins, which might be linked to post-transcriptional regulation of presequences. This in turn alters mitochondrial homeostasis and impairs energy production. Our observations highlight the importance of mitochondria in MSC function and provide a molecular framework for optimization of cell-based strategies as we move towards their clinical application.

Also flagged:asthmasecretionsacidrespiratory illnessantibodychronic respiratory disease
Journal Article 2019-06-01 ✓ 4 Snippets Gern JE, Lee WM, Swenson CA, Nakagome K, Lee I, Wolff M, Grindle K, Sigelman S, Liggett SB, Togias A, Evans M, Denlinger L, Gangnon R, Bochkov YA, Crisafi G.
In-Text Gene Mentions

…Production of RecombinantRhinovirus-A16

…Analysis of Reverse Genetics-Rhinovirus-A16Compared to Two…

…nsmission of Reverse Genetics-Rhinovirus-A16Colds to Household…

…e-Genetics Versus ConventionalRhinovirus-A16Inocula…

Show Full Abstract

<h4>Background</h4>Experimental inoculation is an important tool for common cold and asthma research. Producing rhinovirus (RV) inocula from nasal secretions has required prolonged observation of the virus donor to exclude extraneous pathogens. We produced a RV-A16 inoculum using reverse genetics and determined the dose necessary to cause moderate colds in seronegative volunteers.<h4>Methods</h4>The consensus sequence of RV-A16 from a previous inoculum was cloned, and inoculum virus was produced using reverse genetics techniques. After safety testing, volunteers were inoculated with either RV-A16 (n = 26) or placebo (n = 10), Jackson cold scores were recorded, and nasal secretions were tested for shedding of RV-A16 ribonucleic acid.<h4>Results</h4>The reverse genetics process produced infectious virus that was neutralized by specific antisera and had a mutation rate similar to conventional virus growth techniques. The 1000 median tissue culture infectious dose (TCID50) dose produced moderate colds in most individuals with effects similar to that of a previously tested conventional RV-A16 inoculum.<h4>Conclusions</h4>Reverse genetics techniques produced a RV-A16 inoculum that can cause clinical colds in seronegative volunteers, and they also serve as a stable source of virus for laboratory use. The recombinant production procedures eliminate the need to derive seed virus from nasal secretions, thus precluding introduction of extraneous pathogens through this route.

Also flagged:Pulmonary Arterial Hypertensionright heart failuredeathgene expressionTNFtransforming growth factor
Journal Article 2019-06-01 No Snippets Stearman RS, Bui QM, Speyer G, Handen A, Cornelius AR, Graham BB, Kim S, Mickler EA, Tuder RM, Chan SY, Geraci MW.
Show Full Abstract

Pulmonary arterial hypertension (PAH) is characterized by increased pulmonary artery pressure and vascular resistance, typically leading to right heart failure and death. Current therapies improve quality of life of the patients but have a modest effect on long-term survival. A detailed transcriptomics and systems biology view of the PAH lung is expected to provide new testable hypotheses for exploring novel treatments. We completed transcriptomics analysis of PAH and control lung tissue to develop disease-specific and clinical data/tissue pathology gene expression classifiers from expression datasets. Gene expression data were integrated into pathway analyses. Gene expression microarray data were collected from 58 PAH and 25 control lung tissues. The strength of the dataset and its derived disease classifier was validated using multiple approaches. Pathways and upstream regulators analyses was completed with standard and novel graphical approaches. The PAH lung dataset identified expression patterns specific to PAH subtypes, clinical parameters, and lung pathology variables. Pathway analyses indicate the important global role of TNF and transforming growth factor signaling pathways. In addition, novel upstream regulators and insight into the cellular and innate immune responses driving PAH were identified. Finally, WNT-signaling pathways may be a major determinant underlying the observed sex differences in PAH. This study provides a transcriptional framework for the PAH-diseased lung, supported by previously reported findings, and will be a valuable resource to the PAH research community. Our investigation revealed novel potential targets and pathways amenable to further study in a variety of experimental systems.

Also flagged:cysteamine bitartratenephropathic cystinosisglutathionebiosynthesismitochondrial respiratory chainhydrogen
Journal Article 2019-06-01 ✓ 3 Snippets Guha S, Konkwo C, Lavorato M, Mathew ND, Peng M, Ostrovsky J, Kwon YJ, Polyak E, Lightfoot R, Seiler C, Xiao R, Bennett M, Zhang Z, Nakamaru-Ogiso E, Falk MJ.
In-Text Gene Mentions

At 10 to 100 μm concentrations, cysteamine bitartrate improved multiple RC complex disease FBXL4 human fibroblast survival, and protected both complex I (rotenone) and complex IV (azide) Danio rerio vertebrate zebrafish disease models from brain death.

…RC complex diseaseFBXL4human fibroblast survival,…

FBXL4

Show Full Abstract

Cysteamine bitartrate is a US Food and Drug Administration-approved therapy for nephropathic cystinosis also postulated to enhance glutathione biosynthesis. We hypothesized this antioxidant effect may reduce oxidative stress in primary mitochondrial respiratory chain (RC) disease, improving cellular viability and organismal health. Here, we systematically evaluated the therapeutic potential of cysteamine bitartrate in RC disease models spanning three evolutionarily distinct species. These pre-clinical studies demonstrated the narrow therapeutic window of cysteamine bitartrate, with toxicity at millimolar levels directly correlating with marked induction of hydrogen peroxide production. Micromolar range cysteamine bitartrate treatment in Caenorhabditis elegans gas-1(fc21) RC complex I (NDUFS2-/-) disease invertebrate worms significantly improved mitochondrial membrane potential and oxidative stress, with corresponding modest improvement in fecundity but not lifespan. At 10 to 100 μm concentrations, cysteamine bitartrate improved multiple RC complex disease FBXL4 human fibroblast survival, and protected both complex I (rotenone) and complex IV (azide) Danio rerio vertebrate zebrafish disease models from brain death. Mechanistic profiling of cysteamine bitartrate effects showed it increases aspartate levels and flux, without increasing total glutathione levels. Transcriptional normalization of broadly dysregulated intermediary metabolic, glutathione, cell defense, DNA, and immune pathways was greater in RC disease human cells than in C. elegans, with similar rescue in both models of downregulated ribosomal and proteasomal pathway expression. Overall, these data suggest cysteamine bitartrate may hold therapeutic potential in RC disease, although not through obvious modulation of total glutathione levels. Careful consideration is required to determine safe and effective cysteamine bitartrate concentrations to further evaluate in clinical trials of human subjects with primary mitochondrial RC disease.

Also flagged:CPSF1myopiablindnesshigh myopiaearly-onset high myopiagenetic eye diseases
Journal Article 2019-06-01 ✓ 1 Snippet Ouyang J, Sun W, Xiao X, Li S, Jia X, Zhou L, Wang P, Zhang Q.
In-Text Gene Mentions

…dominant eoHM [ZNF644(OMIM 614159) (…

Show Full Abstract

High myopia is a severe form of nearsightedness, which can result in blindness due to its associated complications. While both genetic and environmental factors can cause high myopia, early-onset high myopia (eoHM), which is defined as high myopia that occurs before school age, is considered to be caused mainly by genetic variations, with minimal environmental involvement. Here we report six rare heterozygous loss-of-function (LoF) variants in CPSF1 that were identified in six of 623 probands with eoHM but none of 2657 probands with other forms of genetic eye diseases; this difference was statistically significant (P = 4.60 × 10-5, Fisher's exact test). The six variants, which were confirmed by Sanger sequencing, were c.3862_3871dup (p.F1291*), c.2823_2824del (p.V943Lfs*65), c.1858C>T (p.Q620*), c.15C>G (p.Y5*), c.3823G>T (p.D1275Y) and c.4146-2A>G. Five of these six variants were absent in existing databases, including gnomAD, 1000G and EVS. The remaining variant, c.4146-2A>G, was present in gnomAD with a frequency of 1/229918. Clinical data demonstrated eoHM in the six probands with these mutations. Knockdown of cpsf1 by morpholino oligonucleotide (MO) injection in zebrafish eggs resulted in small eye size in 84.38% of the injected larvae, and this phenotype was rescued in 61.39% of the zebrafish eggs when the cpsf1 MO and the cpsf1 mRNA were co-injected. The projection of retinal ganglion cell (RGC) towards the tectum was abnormal in cpsf1 morphants. Thus, we demonstrated that heterozygous LoF mutations in CPSF1 are associated with eoHM and that CPSF1 may play an important role in the development of RGC axon projection.

Also flagged:TLR4Non-alcoholic Steatohepatitisliver disorderNASHsaroglitazarPPAR-α
Journal Article 2019-06-01 No Snippets Hassan NF, Nada SA, Hassan A, El-Ansary MR, Al-Shorbagy MY, Abdelsalam RM.
Show Full Abstract

The most epidemic liver disorder non-alcoholic steatohepatitis (NASH) is characterized by hepatic steatosis and inflammation with hepatocellular damage. Recently, it is predictable to be the extensive cause for liver transplantation. The absence of an approved therapeutic agent for NASH is the reason for investigating saroglitazar (SAR) which showed promising effects as a dual PPAR-α/γ agonist in recent studies on NASH. Here, we aimed to investigate the effect of SAR on NASH induced in rats by the administration of high-fat emulsion (HFE) and small doses of lipopolysaccharides (LPS) for 5 weeks. Rats were divided into three groups: negative control group (saline and standard rodent chow), model group (HFE(10 ml/kg/day, oral gavage) + LPS(0.5 mg/kg/week, i.p)), and SAR-treated group (HFE(10 ml/kg/day, oral gavage) + LPS(0.5 mg/kg/week, i.p.) + SAR(4 mg/kg/day, oral gavage) starting at week 3.Treatment with SAR successfully ameliorated the damaging effects of HFE with LPS, by counteracting body weight gain and biochemically by normalization of liver function parameters activity, glucose, insulin, homeostasis model of assessment (HOMA-IR) score, lipid profile levels, and histopathological examination. Significant changes in adipokine levels were perceived, resulting in a significant decline in serum leptin and tumor necrosis factor-α (TNF-α) level concurrent with adiponectin normalization. The positive effects observed for SAR on NASH are due to the downregulation of the LPS/TLR4 pathway, as indicated by the suppression of hepatic Toll-like receptor 4 (TLR4), NF-κB, TNF-α, and transforming growth factor-β1 (TGF-β1) expression. In conclusion, this work verified that SAR ameliorates NASH through deactivation of the hepatic LPS/TLR4 pathway and inhibition of adipocyte dysfunction.

Also flagged:BPpathogenesisdepressionneuroticismsleepSPOCK2
Journal Article 2019-06-01 No Snippets Freidin MB, Tsepilov YA, Palmer M, Karssen LC, Suri P, Aulchenko YS, Williams FMK, CHARGE Musculoskeletal Working Group.
Show Full Abstract

Back pain (BP) is a common condition of major social importance and poorly understood pathogenesis. Combining data from the UK Biobank and CHARGE consortium cohorts allowed us to perform a very large genome-wide association study (total N = 509,070) and examine the genetic correlation and pleiotropy between BP and its clinical and psychosocial risk factors. We identified and replicated 3 BP-associated loci, including one novel region implicating SPOCK2/CHST3 genes. We provide evidence for pleiotropic effects of genetic factors underlying BP, height, and intervertebral disk problems. We also identified independent genetic correlations between BP and depression symptoms, neuroticism, sleep disturbance, overweight, and smoking. A significant enrichment for genes involved in the central nervous system and skeletal tissue development was observed. The study of pleiotropy and genetic correlations, supported by the pathway analysis, suggests at least 2 strong molecular axes of BP genesis, one related to structural/anatomical factors such as intervertebral disk problems and anthropometrics, and another related to the psychological component of pain perception and pain processing. These findings corroborate with the current biopsychosocial model as a paradigm for BP. Overall, the results demonstrate BP to have an extremely complex genetic architecture that overlaps with the genetic predisposition to its biopsychosocial risk factors. The work sheds light on pathways of relevance in the prevention and management of low BP.

Also flagged:kinaseAPPpeptideamyloid beta precursor proteinAlzheimer's diseaseneurodegenerative diseases
Journal Article 2019-06-01 No Snippets Huichalaf CH, Al-Ramahi I, Park KW, Grunke SD, Lu N, de Haro M, El-Zein K, Gallego-Flores T, Perez AM, Jung SY, Botas J, Zoghbi HY, Jankowsky JL.
Show Full Abstract

An early hallmark of Alzheimer's disease is the accumulation of amyloid-β (Aβ), inspiring numerous therapeutic strategies targeting this peptide. An alternative approach is to destabilize the amyloid beta precursor protein (APP) from which Aβ is derived. We interrogated innate pathways governing APP stability using a siRNA screen for modifiers whose own reduction diminished APP in human cell lines and transgenic Drosophila. As proof of principle, we validated PKCβ-a known modifier identified by the screen-in an APP transgenic mouse model. PKCβ was genetically targeted using a novel adeno-associated virus shuttle vector to deliver microRNA-adapted shRNA via intracranial injection. In vivo reduction of PKCβ initially diminished APP and delayed plaque formation. Despite persistent PKCβ suppression, the effect on APP and amyloid diminished over time. Our study advances this approach for mining druggable modifiers of disease-associated proteins, while cautioning that prolonged in vivo validation may be needed to reveal emergent limitations on efficacy.

Also flagged:neurodegenerative diseasesneurodegenerative diseasegeneMetachromatic Leukodystrophylysosomal disorderarylsulfatase A
Journal Article 2019-06-01 No Snippets Qu Y, Liu Y, Noor AF, Tran J, Li R.
Show Full Abstract

Common neurodegenerative diseases of the central nervous system are characterized by progressive damage to the function of neurons, even leading to the permanent loss of function. Gene therapy via gene replacement or gene correction provides the potential for transformative therapies to delay or possibly stop further progression of the neurodegenerative disease in affected patients. Adeno-associated virus has been the vector of choice in recent clinical trials of therapies for neurodegenerative diseases due to its safety and efficiency in mediating gene transfer to the central nervous system. This review aims to discuss and summarize the progress and clinical applications of adeno-associated virus in neurodegenerative disease in central nervous system. Results from some clinical trials and successful cases of central neurodegenerative diseases deserve further study and exploration.

Also flagged:WntAgingStem celltumorscystsAPC
Journal Article 2019-06-01 ✓ 1 Snippet Cui H, Tang D, Garside GB, Zeng T, Wang Y, Tao Z, Zhang L, Tao S.
In-Text Gene Mentions

…cell markers, includingOlfm4, Bmi1 and Hopx…

Show Full Abstract

Stem cell aging underlies aging-associated disorders, such as steeply increased incidences of tumors and impaired regeneration capacity upon stress. However, whether and how the intestinal stem cells age remains largely unknown. Here we show that intestinal stem cells derived from 24-month-old mice hardly form typical organoids with crypt-villus structures, but rather mainly form big, rounded cysts devoid of differentiated cell types, which mimics the culturing of heterozygous APC-deficient cells from the APC<sup>min</sup> mouse line. Further analysis showed that cultured crypts derived from aged mice exhibited reduced expression levels of differentiation genes and higher expression of Wnt target genes. Lowering the concentration of R-spondin-1 in the culture system significantly reduced formation of rounded cysts, accompanied by an increased formation of organoids from crypts derived from old mice. We are the first to uncover that intestinal stem cells derived from old mice harbor significant deficiency in differentiation that can be partially rescued through a reduction in R-spondin-1 exposure. This could be highly relevant to intestinal tumor development and the reduced regeneration potential observed in the aged population. Our study provides the first experimental evidence that an over-responsiveness to Wnt/beta-catenin signaling of aged intestinal stem cells mediates the aging-induced deficiency in differentiation, and could serve as a potential target to ameliorate aging-associated intestinal pathologies.

Also flagged:ALDH2sleepPAX8alcohol
Journal Article 2019-06-01 ✓ 2 Snippets Nishiyama T, Nakatochi M, Goto A, Iwasaki M, Hachiya T, Sutoh Y, Shimizu A, Wang C, Tanaka H, Watanabe M, Hosono A, Tamai Y, Yamada T, Yamaji T, Sawada N, Fukumoto K, Otsuka K, Tanno K, Tomita H, Kojima K, Nagasaki M, Hozawa A, Hishida A, Sasakabe T, Nishida Y, Hara M, Ito H, Oze I, Nakamura Y, Mikami H, Ibusuki R, Takezaki T, Koyama T, Kuriyama N, Endoh K, Kuriki K, Turin TC, Naoyuki T, Katsuura-Kamano S, Uemura H, Okada R, Kawai S, Naito M, Momozawa Y, Kubo M, Sasaki M, Yamamoto M, Tsugane S, Wakai K, Suzuki S.
In-Text Gene Mentions

…only PAX8 andVRK2have been replicated…

…the PAX8 andVRK2.…

Show Full Abstract

Usual sleep duration has substantial heritability and is associated with various physical and psychiatric conditions as well as mortality. However, for its genetic locus, only PAX8 and VRK2 have been replicated in previous genome-wide association studies (GWAS). We conducted a GWAS meta-analysis of self-reported usual sleep duration using three population-based cohorts totaling 31 230 Japanese individuals. A genome-wide significant locus was identified at 12q24 (p-value < 5.0 × 10-8). Subsequently, a functional variant in the ALDH2 locus, rs671, was replicated in an independent sample of 5140 Japanese individuals (p-value = 0.004). The association signal, however, disappeared after adjusting for alcohol consumption, indicating the possibility that the rs671 genotype modifies sleep duration via alcohol consumption. This hypothesis explained a modest genetic correlation observed between sleep duration and alcohol consumption (rG = 0.23). A Mendelian randomization analysis using rs671 and other variants as instrumental variables confirmed this by showing a causal effect of alcohol consumption, but not of coffee consumption on sleep duration. Another genome-wide significant locus was identified at 5q33 after adjusting for drinking frequency. However, this locus was not replicated, nor was the PAX8 and VRK2. Our study has confirmed that a functional ALDH2 variant, rs671, most strongly influences on usual sleep duration possibly via alcohol consumption in the Japanese population, and presumably in East Asian populations. This highlights the importance of considering the involvement of alcohol consumption in future GWAS of usual sleep duration, even in non-East Asian populations, where rs671 is monomorphic.

Also flagged:mild traumatic brain injuryconcussionglutamatebrain injurysleeptranslational
Journal Article 2019-06-01 ✓ 1 Snippet Romeu-Mejia R, Giza CC, Goldman JT.
In-Text Gene Mentions

CACNA1E

Show Full Abstract

<h4>Purpose of review</h4>The concussion public health burden has increased alongside our knowledge of the pathophysiology of mild traumatic brain injury (mTBI). The purpose of this review is to summarize our current understanding of mTBI pathophysiology and biomechanics and how these underlying principles correlate with clinical manifestations of mTBI.<h4>Recent findings</h4>Changes in post-mTBI glutamate and GABA concentrations seem to be region-specific and time-dependent. Genetic variability may predict recovery and symptom severity while gender differences appear to be associated with the neuroinflammatory response and neuroplasticity. Ongoing biomechanical research has shown a growing body of evidence in support of an "individual-specific threshold" for mTBI that varies based on individual intrinsic factors. The literature demonstrates a well-characterized timeframe for mTBI pathophysiologic changes in animal models while work in this area continues to grow in humans. Current human research shows that these underlying post-mTBI effects are multifactorial and may correlate with symptomatology and recovery. While wearable sensor technology has advanced biomechanical impact research, a definitive concussion threshold remains elusive.

Also flagged:Liver Injurytrovafloxacintroglitazonedrug metabolizing enzymecyclophosphamidebenzo(a)pyrene
Journal Article 2019-06-01 No Snippets Ramaiahgari SC, Auerbach SS, Saddler TO, Rice JR, Dunlap PE, Sipes NS, DeVito MJ, Shah RR, Bushel PR, Merrick BA, Paules RS, Ferguson SS.
Show Full Abstract

Prediction of human response to chemical exposures is a major challenge in both pharmaceutical and toxicological research. Transcriptomics has been a powerful tool to explore chemical-biological interactions, however, limited throughput, high-costs, and complexity of transcriptomic interpretations have yielded numerous studies lacking sufficient experimental context for predictive application. To address these challenges, we have utilized a novel high-throughput transcriptomics (HTT) platform, TempO-Seq, to apply the interpretive power of concentration-response modeling with exposures to 24 reference compounds in both differentiated and non-differentiated human HepaRG cell cultures. Our goals were to (1) explore transcriptomic characteristics distinguishing liver injury compounds, (2) assess impacts of differentiation state of HepaRG cells on baseline and compound-induced responses (eg, metabolically-activated), and (3) identify and resolve reference biological-response pathways through benchmark concentration (BMC) modeling. Study data revealed the predictive utility of this approach to identify human liver injury compounds by their respective BMCs in relation to human internal exposure plasma concentrations, and effectively distinguished drug analogs with varied associations of human liver injury (eg, withdrawn therapeutics trovafloxacin and troglitazone). Impacts of cellular differentiation state (proliferated vs differentiated) were revealed on baseline drug metabolizing enzyme expression, hepatic receptor signaling, and responsiveness to metabolically-activated toxicants (eg, cyclophosphamide, benzo(a)pyrene, and aflatoxin B1). Finally, concentration-response modeling enabled efficient identification and resolution of plausibly-relevant biological-response pathways through their respective pathway-level BMCs. Taken together, these findings revealed HTT paired with differentiated in vitro liver models as an effective tool to model, explore, and interpret toxicological and pharmacological interactions.

Also flagged:dermatansulfateheparin cofactor IIthrombinheparindermatan sulfate
Journal Article 2019-06-01 ✓ 3 Snippets Tykesson E, Maccarana M, Thorsson H, Liu J, Malmström A, Ellervik U, Westergren-Thorsson G.
In-Text Gene Mentions

…Antithrombin (ATIII) and heparin cofactor…

…inhibition via bothATIIIand HCII, DS…

…HCII, and notATIII(Figure 2 A),…

Show Full Abstract

The glycosaminoglycan dermatan sulfate (DS) is a well-known activator of heparin cofactor II-dependent inactivation of thrombin. In contrast to heparin, dermatan sulfate has never been prepared recombinantly from material of non-animal origin. Here we report on the enzymatic synthesis of structurally well-defined DS with high anticoagulant activity. Using a microbial K4 polysaccharide and the recombinant enzymes DS-epimerase 1, dermatan 4-O-sulfotransferase 1, uronyl 2-O-sulfotransferase and N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase, several new glycostructures have been prepared, such as a homogenously sulfated IdoA-GalNAc-4S polymer and its 2-O-, 6-O- and 2,6-O-sulfated derivatives. Importantly, the recombinant highly 2,4-O-sulfated DS inhibits thrombin via heparin cofactor II, approximately 20 times better than heparin, enabling manipulation of vascular and extravascular coagulation. The potential of this method can be extended to preparation of specific structures that are of importance for binding and activation of cytokines, and control of inflammation and metastasis, involving extravasation and migration.

Also flagged:neurological diseasesmigrainehemiplegic migrainedepressionaurapathogenesis
Journal Article 2019-06-01 No Snippets de Boer I, van den Maagdenberg AMJM, Terwindt GM.
Show Full Abstract

<h4>Purpose of review</h4>Migraine is a primary headache disorder and one of the most common and disabling neurological diseases worldwide. Genome-wide association studies have identified ≈40 genetic loci associated with migraine. How these and other genetic findings are used to expand our knowledge on the pathophysiological mechanism of common migraine and rare migraine variants will be discussed.<h4>Recent findings</h4>The genetic load, based on common polygenic variation, is higher in familial migraine cases than in nonfamilial cases, and higher for migraine with aura and hemiplegic migraine. Migraine shares common genetic variant risks with depression. Specific clinical features of common migraine seem to be determined by genetic factors. A stronger family history of migraine is associated with lower age-at-onset, higher frequency and number of medication days and the migraine with aura subtype. Mild hemiplegic migraine is likely caused by complex polygenic interaction of multiple gene variants and environmental factors, like in common migraine subtypes. Phenotypical features in hemiplegic migraine patients may guide physicians in providing adequate genetic counseling.<h4>Summary</h4>Integration of genetic, phenotypic and epigenetic data will help to identify the biological mechanisms by which genetic factors contribute to migraine pathogenesis. Recent studies show the impact of genetics on clinical features and comorbidities in migraine and may guide clinicians to an adequate genetic advice for patients.

Also flagged:breast cancerangiogenesisdeferoxaminetriple-negative breast cancerironcell proliferation
Journal Article 2019-06-01 ✓ 1 Snippet Lynn JV, Urlaub KM, Ranganathan K, Donneys A, Nelson NS, Subramanian C, Cohen MS, Buchman SR.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Background</h4>Radiotherapy plays an essential role in the oncologic management of breast cancer. However, patients who undergo radiotherapy experience significantly more wound complications during the reconstructive process. Deferoxamine has immense potential to up-regulate angiogenesis and improve reconstructive outcomes. The purpose of this study was to determine the impact of deferoxamine on breast cancer cell proliferation in vitro, to delineate oncologic safety concerns regarding the use of deferoxamine as a regenerative therapeutic.<h4>Methods</h4>The dose-dependent effect of radiation and deferoxamine on two triple-negative breast cancer cell lines (MDA-MB-231 and MDA-MB-468) was determined by means of MTS (percentage cell viability) and tumorsphere (sphere number) analysis. Radiation therapy and deferoxamine were delivered both individually and in combination, and all experiments were completed in triplicate. Intracellular iron, nuclear factor-κB localization, and apoptosis/necrosis assays were performed to delineate mechanism. Analysis of variance statistical analysis was performed using SPSS (p < 0.05).<h4>Results</h4>For both cell lines, percentage viability and sphere number significantly decreased following exposure to 10 Gy of radiation. Surprisingly, the administration of 25 µM deferoxamine also significantly decreased each metric. The administration of deferoxamine (100 µM) in combination with radiation (10 Gy) resulted in significantly reduced percentage viability and sphere number compared with the administration of radiation alone. Deferoxamine treatment decreased intracellular iron, suppressed nuclear factor-κB activation, and induced apoptosis.<h4>Conclusion</h4>Radiation and deferoxamine significantly decrease breast cancer proliferation when delivered independently and in combination, suggesting deferoxamine may be safely used to facilitate improved reconstructive outcomes among triple-negative breast cancer survivors.<h4>Clinical question/level of evidence</h4>Therapeutic, V.

Also flagged:polyglutamine diseasesHuntington diseasespinocerebellar ataxiasSCA1SCA2SCA3
Journal Article 2019-06-01 ✓ 2 Snippets Gardiner SL, Boogaard MW, Trompet S, de Mutsert R, Rosendaal FR, Gussekloo J, Jukema JW, Roos RAC, Aziz NA.
In-Text Gene Mentions

…, TBP ,HTT, ATN1 ,…

HTT

Show Full Abstract

<h4>Importance</h4>Nine hereditary neurodegenerative diseases are known as polyglutamine diseases, including Huntington disease, 6 spinocerebellar ataxias (SCAs) (SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17), dentatorubral-pallidoluysion atrophy, and spinal bulbar muscular atrophy.<h4>Objective</h4>To determine the prevalence of carriers of intermediate and pathological polyglutamine disease-associated alleles among the general population.<h4>Design, setting, and participants</h4>This observational cross-sectional study included data from 5 large European population-based cohorts that were compiled between 1997 and 2012, and the analyses were conducted in 2018. In total, 16 547 DNA samples were obtained from participants of the 5 cohorts. Individuals with a lifetime diagnosis of major depression were excluded (n = 2351). In the remaining 14 196 participants without an established polyglutamine disease diagnosis, the CAG repeat size in both alleles of all 9 polyglutamine disease-associated genes (PDAGs) (ie, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, TBP, HTT, ATN1, and AR) was determined.<h4>Exposure</h4>The number of CAG repeats in the alleles of the 9 PDAGs.<h4>Main outcomes and measures</h4>The number of individuals with alleles within the intermediate or pathological range per PDAG, as well as differences in sex, age, and body mass index between individuals carrying alleles within the normal or intermediate range and individuals carrying alleles within the pathological range of PDAGs.<h4>Results</h4>In the 14 196 analyzed participants (age range, 18-99 years; 56.3% female), 10.7% had a CAG repeat number within the intermediate range of at least 1 PDAG. Moreover, up to 1.3% of the participants had a CAG repeat number within the disease-causing range, predominantly in the lower pathological range associated with elderly onset. No differences in sex, age, or body mass index were found between individuals with CAG repeat numbers within the pathological range and individuals with CAG repeat numbers within the normal or intermediate range.<h4>Conclusions and relevance</h4>These results indicate a high prevalence of individuals carrying intermediate and pathological ranges of polyglutamine disease-associated alleles among the general population. Therefore, a substantially larger proportion of individuals than previously estimated may be at risk of developing a polyglutamine disease later in life or bearing children with a de novo mutation.

Also flagged:membrane-boundsubcellular organelleslamellar bodiessecretionHermansky-Pudlak syndromeslysosome-related
Journal Article 2019-06-01 No Snippets Bowman SL, Bi-Karchin J, Le L, Marks MS.
Show Full Abstract

Lysosome-related organelles (LROs) comprise a diverse group of cell type-specific, membrane-bound subcellular organelles that derive at least in part from the endolysosomal system but that have unique contents, morphologies and functions to support specific physiological roles. They include: melanosomes that provide pigment to our eyes and skin; alpha and dense granules in platelets, and lytic granules in cytotoxic T cells and natural killer cells, which release effectors to regulate hemostasis and immunity; and distinct classes of lamellar bodies in lung epithelial cells and keratinocytes that support lung plasticity and skin lubrication. The formation, maturation and/or secretion of subsets of LROs are dysfunctional or entirely absent in a number of hereditary syndromic disorders, including in particular the Hermansky-Pudlak syndromes. This review provides a comprehensive overview of LROs in humans and model organisms and presents our current understanding of how the products of genes that are defective in heritable diseases impact their formation, motility and ultimate secretion.

Also flagged:oleate hydrataseHSAcollagen type Icollagen type IIIp53pore
Journal Article 2019-06-01 No Snippets Schütz R, Rawlings AV, Wandeler E, Jackson E, Trevisan S, Monneuse JM, Bendik I, Massironi M, Imfeld D.
Show Full Abstract

<h4>Introduction</h4>We report on the preparation and efficacy of 10-hydroxystearic acid (HSA) that improves facial age spots and conspicuous pores.<h4>Methods</h4>The hydration of oleic acid into HSA was catalyzed by the oleate hydratase from Escherichia coli. Following treatment with HSA, collagen type I and type III was assessed in primary human dermal fibroblasts together with collagen type III, p53 protein levels and sunburn cells (SBC) after UVB irradiation (1 J cm<sup>-2</sup> ) by immunohistochemistry on human ex vivo skin. UVB-induced expression of matrix metalloprotease-1 (MMP-1) was determined from full thickness skin by RT-qPCR. Modification of the fibroblast secretome by HSA was studied by mass-spectrometry-based proteomics. In a full-face, double blind, vehicle-controlled trial HSA was assessed for its effects on conspicuous facial pore size and degree of pigmentation of age spots in Caucasian women over an 8-week period.<h4>Results</h4>HSA was obtained in enantiomeric pure, high yield (≥80%). Collagen type I and type III levels were dose-dependently increased (96% and 244%; P < 0.01) in vitro and collagen type III in ex vivo skin by +57% (P < 0.01) by HSA. HSA also inhibited UVB-induced MMP-1 gene expression (83%; P < 0.01) and mitigated SBC induction (-34% vs. vehicle control) and reduced significantly UV-induced p53 up-regulation (-46% vs. vehicle control; P < 0.01) in irradiated skin. HSA modified the fibroblast secretome with significant increases in proteins associated with the WNT pathway that could reduce melanogenesis and proteins that could modify dermal fibroblast activity and keratinocyte differentiation to account for the alleviation of conspicuous pores. Docking studies in silico and EC50 determination in reporter gene assays (EC50 5.5 × 10<sup>-6</sup>  M) identified HSA as a peroxisomal proliferator activated receptor-α (PPARα) agonist. Clinically, HSA showed a statistically significant decrease of surface and volume of skin pores (P < 0.05) after 8 weeks of application and age spots became significantly less pigmented than the surrounding skin (contrast, P < 0.05) after 4 weeks.<h4>Conclusion</h4>HSA acts as a PPARα agonist to reduce the signs of age spots and conspicuous pores by significantly modulating the expression of p53, SBC, MMP-1 and collagen together with major changes in secreted proteins that modify keratinocyte, melanocyte and fibroblast cell behavior.

Also flagged:histonebindinglinker histoneLHchromatinnucleosome
Journal Article 2019-06-01 ✓ 1 Snippet Perišić O, Portillo-Ledesma S, Schlick T.
In-Text Gene Mentions

…proteins, most prominentlylinker histoneshistones (LHs), are…

Show Full Abstract

The complex role of linker histone (LH) on chromatin compaction regulation has been highlighted by recent discoveries of the effect of LH binding variability and isoforms on genome structure and function. Here we examine the effect of two LH variants and variable binding modes on the structure of chromatin fibers. Our mesoscale modeling considers oligonucleosomes with H1C and H1E, bound in three different on and off-dyad modes, and spanning different LH densities (0.5-1.6 per nucleosome), over a wide range of physiologically relevant nucleosome repeat lengths (NRLs). Our studies reveal an LH-variant and binding-mode dependent heterogeneous ensemble of fiber structures with variable packing ratios, sedimentation coefficients, and persistence lengths. For maximal compaction, besides dominantly interacting with parental DNA, LHs must have strong interactions with nonparental DNA and promote tail/nonparental core interactions. An off-dyad binding of H1E enables both; others compromise compaction for bendability. We also find that an increase of LH density beyond 1 is best accommodated in chromatosomes with one on-dyad and one off-dyad LH. We suggest that variable LH binding modes and concentrations are advantageous, allowing tunable levels of chromatin condensation and DNA accessibility/interactions. Thus, LHs add another level of epigenetic regulation of chromatin.

Also flagged:Coronary Artery Diseasecardiovascular diseaseagingsystolic hypertensioncollagenelastin
Journal Article 2019-06-01 ✓ 1 Snippet Zekavat SM, Aragam K, Emdin C, Khera AV, Klarin D, Zhao H, Natarajan P.
In-Text Gene Mentions

HFE

Show Full Abstract

Objective- Arterial stiffness index (ASI) is independently associated with blood pressure (BP) and coronary artery disease (CAD) epidemiologically. However, it is unknown whether these associations represent causal relationships. Here, we assess whether genetic predisposition to increased ASI is associated with elevated BP and CAD risk. Approach and Results- We first performed a large-scale epidemiological association of finger photoplethysmography-derived ASI in the UK Biobank, finding significant associations with systolic BP (β=0.55 mm Hg; [95% CI, 0.45-0.65]; P=5.77×10<sup>-24</sup>; N=137 858), diastolic BP (β=1.05 mm Hg; [95% CI, 0.99-1.11]; P=7.27×10<sup>-272</sup>; N=137 862), and incident CAD (hazard ratio, 1.08; [95% CI, 1.04-1.11]; P=1.5×10<sup>-6</sup>; N=3692 cases, 126 615 controls) in multivariable models. We then performed an ASI genome-wide association study analysis in 131 686 participants from the UK Biobank. Across participants not in the ASI genome-wide association study, a 6-variant ASI polygenic risk score was calculated. Each SD increase in genetic ASI was associated with systolic BP (β=4.63 mm Hg; [95% CI, 2.1-7.2]; P=3.37×10<sup>-4</sup>; N=208 897), and diastolic BP (β=2.61 mm Hg; [95% CI, 1.2-4.0]; P=2.85×10<sup>-4</sup>; N=208 897); however, no association was observed with incident CAD (hazard ratio, 1.12; [95% CI, 0.55-2.3]; P=0.75; N=223 061; 7534 cases). The lack of CAD association observed was replicated among 184 305 participants (60 810 cases) from the CARDIOGRAMplusC4D (Coronary Artery Disease Genetics Consortium; odds ratio, 0.56; [95% CI, 0.26-1.24]; P=0.15). Conclusions- Our data support the conclusion that finger photoplethysmography-derived ASI is an independent, genetically causal risk factor for BP, but do not support the notion that ASI is a suitable surrogate for CAD risk.

Also flagged:KinaseschizophreniaProtein kinasessignal transductionsynaptic transmissionneurological disorders
Journal Article 2019-06-01 No Snippets Bentea E, Depasquale EAK, O'Donovan SM, Sullivan CR, Simmons M, Meador-Woodruff JH, Zhou Y, Xu C, Bai B, Peng J, Song H, Ming GL, Meller J, Wen Z, McCullumsmith RE.
Show Full Abstract

Protein kinases orchestrate signal transduction pathways involved in central nervous system functions ranging from neurodevelopment to synaptic transmission and plasticity. Abnormalities in kinase-mediated signaling are involved in the pathophysiology of neurological disorders, including neuropsychiatric disorders. Here, we expand on the hypothesis that kinase networks are dysregulated in schizophrenia. We investigated changes in serine/threonine kinase activity in cortical excitatory neurons differentiated from induced pluripotent stem cells (iPSCs) from a schizophrenia patient presenting with a 4 bp mutation in the disrupted in schizophrenia 1 (DISC1) gene and a corresponding control. Using kinome peptide arrays, we demonstrate large scale abnormalities in DISC1 cells, including a global depression of serine/threonine kinase activity, and changes in activity of kinases, including AMP-activated protein kinase (AMPK), extracellular signal-regulated kinases (ERK), and thousand-and-one amino acid (TAO) kinases. Using isogenic cell lines in which the DISC1 mutation is either introduced in the control cell line, or rescued in the schizophrenia cell line, we ascribe most of these changes to a direct effect of the presence of the DISC1 mutation. Investigating the gene expression signatures downstream of the DISC1 kinase network, and mapping them on perturbagen signatures obtained from the Library of Integrated Network-based Cellular Signatures (LINCS) database, allowed us to propose novel drug targets able to reverse the DISC1 kinase dysregulation gene expression signature. Altogether, our findings provide new insight into abnormalities of kinase networks in schizophrenia and suggest possible targets for disease intervention.

Also flagged:bicyclictetramatesbicyclic tetramatescysteinegyraseRNA polymerase
Journal Article 2019-06-01 No Snippets Panduwawala TD, Iqbal S, Thompson AL, Genov M, Pretsch A, Pretsch D, Liu S, Ebright RH, Howells A, Maxwell A, Moloney MG.
Show Full Abstract

Routes to bicyclic tetramates derived from cysteine permitting ready incorporation of functionality at two different points around the periphery of a heterocyclic skeleton are reported. This has enabled the identification of systems active against Gram-positive bacteria, some of which show gyrase and RNA polymerase inhibitory activity. In particular, tetramates substituted with glycosyl side chains, chosen to impart polarity and aqueous solubility, show high antibacterial activity coupled with modest gyrase/polymerase activity in two cases. An analysis of physicochemical properties indicates that the antibacterially active tetramates generally occupy physicochemical space with MW of 300-600, clog D7.4 of -2.5 to 4 and rel. PSA of 11-22%. This work demonstrates that biologically active 3D libraries are readily available by manipulation of a tetramate skeleton.

Also flagged:pigmentationHERC2CCR5Glycophorin AGlycophorin Bmalaria
Journal Article 2019-06-01 ✓ 3 Snippets Saitou M, Gokcumen O.
In-Text Gene Mentions

…esv3631000, which containsZNF664.…

…contains the geneZNF664located on chromosome…

ZNF664is classified as…

Show Full Abstract

Polymorphic duplications in humans have been shown to contribute to phenotypic diversity. However, the evolutionary forces that maintain variable duplications across the human genome are largely unexplored. We developed a linkage-disequilibrium based method to detect insertion sites of polymorphic duplications not represented in reference genomes. This method also allows resolution of haplotypes harboring the duplications. Using this approach, we conducted genome-wide analyses and identified the insertion sites of 22 common polymorphic duplications. We found that the majority of these duplications is intrachromosomal and only one of them is an interchromosomal insertion. Further characterization of these duplications revealed significant associations to blood and skin phenotypes. On the basis of population genetics analyses, we found that the duplication of a well-characterized pigmentation-related region, including the HERC2 gene, may be selected against in European populations. We further demonstrated that the haplotype harboring this duplication significantly affects the expression of the HERC2P9 gene in multiple tissues. Our study sheds light onto the evolutionary impact of understudied polymorphic duplications in human populations and presents methodological insights for future studies.

Also flagged:hepcidinironerythropoiesisdefense responseinfectionsingular
Journal Article 2019-06-01 ✓ 1 Snippet Sangkhae V, Nemeth E.
In-Text Gene Mentions

Hfe

Show Full Abstract

No abstract available.

Lithium for acute mania.

Also flagged:Lithiumbipolar disorderacute maniamaniacarbamazepineolanzapine
Journal Article 2019-06-01 No Snippets McKnight RF, de La Motte de Broöns de Vauvert SJGN, Chesney E, Amit BH, Geddes J, Cipriani A.
Show Full Abstract

<h4>Background</h4>Bipolar disorder is a common condition associated with high morbidity; developing efficacious, safe treatments is therefore essential. Lithium is an effective maintenance treatment for bipolar disorder. It acts as mood stabiliser and reduces the risk of suicide. However, evidence assessing the efficacy of lithium in the treatment of acute mania is less robust. Current evidence-based guidelines cite multiple anti-dopaminergic and mood-stabilising agents as initial treatments: more definite evidence is needed to decide if lithium should be the first-line therapy.<h4>Objectives</h4>1. To assess the effects of lithium in comparison with placebo or other active treatment in alleviating the acute symptoms of a manic or mixed episode in people with bipolar disorder.2. To review the acceptability and tolerability of treatment with lithium in comparison with placebo or other active treatments in alleviating the acute symptoms of a manic or mixed episode in people with bipolar disorder.<h4>Search methods</h4>We searched the Cochrane Common Mental Disorders Controlled Trials Register, CENTRAL, MEDLINE, Embase, and PsycINFO. We also searched the World Health Organization trials portal (ICTRP) and ClinicalTrials.gov. We checked the reference lists of all included studies and relevant systematic reviews. We have incorporated studies from searches to 18 May 2018 into the current analyses.<h4>Selection criteria</h4>Prospective randomised controlled studies comparing lithium with placebo or alternative drug treatment in treatment of acute mania. We included anyone with bipolar disorder, male and female, of any age.<h4>Data collection and analysis</h4>At least two review authors independently extracted data and assessed methodological quality. We used odds ratios (ORs) to analyse binary efficacy outcomes, and mean differences (MDs) or standardised mean differences (SMDs) for continuously distributed outcomes. We used a fixed-effect model unless heterogeneity was moderate or substantial, in which case we used a random-effects model. We used Review Manager 5 to analyse data. We assessed the certainty of evidence for individual outcomes using the GRADE approach.<h4>Main results</h4>We found 36 randomised controlled studies comparing lithium with placebo, one of 12 drugs, or electroconvulsive therapy for treatment of acute mania. Studies included male and female participants (n = 4220), of all ages, who all fitted criteria for a manic episode within the context of a diagnosis of bipolar disorder.Risk of bias was variable; 12 studies had a high risk of bias in one domain and 27 gave inadequate information on randomisation leading to an 'unclear' rating for selection bias.Lithium versus placeboHigh-certainty evidence found that lithium was an effective treatment for acute mania and was more effective than placebo at inducing a response (OR 2.13, 95% confidence interval (CI) 1.73 to 2.63; participants = 1707; studies = 6; I<sup>2</sup> = 16%; high-certainty evidence), or remission (OR 2.16, 95% CI 1.73 to 2.69; participants = 1597; studies = 5; I<sup>2</sup> = 21%; high-certainty evidence).Lithium was more likely than placebo to cause tremor (OR 3.25, 95% CI 2.10 to 5.04; participants = 1241; studies = 6; I<sup>2</sup> = 0%; high-certainty evidence), and somnolence (OR 2.28, 95% CI 1.46 to 3.58; participants = 1351; studies = 7; I<sup>2</sup> = 0%; high-certainty evidence).There was insufficient evidence to determine the effect of lithium for all-cause dropouts (OR 0.76; 95% CI 0.46 to 1.25; participants = 1353; studies = 7; I<sup>2</sup> = 75%; moderate-certainty evidence), and weight gain (OR 1.48, 95% CI 0.56 to 3.92; participants = 735, studies = 3; I<sup>2</sup>= 51%; moderate-certainty evidence).Lithium versus antipsychotics or mood stabilisersFor the outcome of inducing a response, there was only very low-certainty evidence regarding lithium compared to haloperidol (MD -2.40, 95% CI -6.31 to 1.50; participants = 80; studies = 3; I<sup>2</sup> = 95%), quetiapine (OR 0.66, 95% CI 0.28 to 1.55; participants = 335; studies = 2; I<sup>2</sup> = 71%), and carbamazepine (SMD 0.21, 95% CI -0.18 to 0.60; participants = 102; studies = 3; I<sup>2</sup> = 0%).Lithium was probably less likely to induce a response than olanzapine (OR 0.44, 95% CI 0.20 to 0.94; participants = 180; studies = 2; I<sup>2</sup> = 0%; moderate-certainty evidence).Lithium may be less likely to induce a response than risperidone (MD 7.28, 95% CI 5.22 to 9.34; participants = 241; studies = 3; I<sup>2</sup> = 49%; low-certainty evidence).There was no evidence of a difference between lithium and valproate (OR 1.22, 95% CI 0.87 to 1.70; participants = 607; studies = 5; I<sup>2</sup> = 22%; moderate-certainty evidence).There was moderate-certainty evidence that lithium was more effective than topiramate at treating acute mania (OR 2.28, 95% CI 1.63 to 3.20; participants = 660; studies = 1).Data on adverse events for these comparisons contained too few studies to provide high-certainty evidence.<h4>Authors' conclusions</h4>This systematic review indicates that lithium is more effective than placebo as a treatment for acute mania but increases the risk for somnolence and tremor. Limited evidence suggests little or no difference between lithium and other mood stabilisers (valproate, carbamazepine) or antipsychotics (risperidone, quetiapine, haloperidol). Olanzapine may be an exception, as it is probably slightly more effective than lithium. There is uncertain evidence that risperidone may also be more effective than lithium. Lithium is probably more effective at treating acute mania than topiramate. When compared to placebo, lithium was more likely to cause adverse events. However, when compared to other drugs, too few studies provided data on adverse effects to provide high-certainty evidence. More, rigorously designed, large-scale studies are needed to definitively conclude if lithium is superior to other interventions in treating acute mania.

Also flagged:chromosomesAFlone atrial fibrillationatrial fibrillationCAV 1CAV 2
Journal Article 2019-06-01 ✓ 1 Snippet Seifert MB, Olesen MS, Christophersen IE, Nielsen JB, Carlson J, Holmqvist F, Tveit A, Haunsø S, Svendsen JH, Platonov PG.
In-Text Gene Mentions

SOX6

Show Full Abstract

<h4>Background</h4>Abnormal P-wave morphology (PWM) has been associated with a history of atrial fibrillation (AF) in earlier studies. Although lone AF is believed to have substantial genetic basis, studies on associations between single nucleotide polymorphisms (SNP) linked to lone AF and PWM have not been reported. We aimed to assess whether SNPs previously associated with lone AF (rs2200733, rs13376333, rs3807989, and rs11047543) are also linked to P-wave abnormalities.<h4>Methods</h4>Four SNPs were studied in 176 unrelated individuals with early-onset lone AF (age at onset <50 years), median age 38 years (19-63 years), 149 men. Using sinus rhythm ECG, orthogonal PWM was classified as Type 1-positive in leads X and Y and negative in lead Z, Type 2-positive in leads X and Y and biphasic (-/+) in lead Z, Type 3-positive in lead X and biphasic in lead Y (+/-), and the remaining as atypical.<h4>Results</h4>Two SNPs were found to be significantly associated with altered P-wave morphology distribution: rs3807989 near the gene CAV1/CAV2 and rs11047543 near the gene SOX5. Both SNPs were associated with a higher risk of non-Type 1 P-wave morphology (rs3807989: OR = 4.8, 95% CI = 2.3-10.2, p < 0.001; rs11047543: OR = 4.7, 95% CI = 1.1-20.5, p = 0.04). No association was observed for rs2200733 and rs13376333.<h4>Conclusion</h4>In this study, the two variants rs3807989 and rs11047543, previously associated with PR interval and lone AF, were associated with altered P-wave morphology distribution in patients with early-onset lone AF. These findings suggest that common genetic variants may modify atrial conduction properties.

Also flagged:serotonin transporterbindingsegmentationmenstrual cyclecortisolsynthesis
Journal Article 2019-06-01 ✓ 2 Snippets Nørgaard M, Ganz M, Svarer C, Frokjaer VG, Greve DN, Strother SC, Knudsen GM.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) radioligand [ 11…

5-HTT

Show Full Abstract

Positron Emission Tomography (PET) is an important neuroimaging tool to quantify the distribution of specific molecules in the brain. The quantification is based on a series of individually designed data preprocessing steps (pipeline) and an optimal preprocessing strategy is per definition associated with less noise and improved statistical power, potentially allowing for more valid neurobiological interpretations. In spite of this, it is currently unclear how to design the best preprocessing pipeline and to what extent the choice of each preprocessing step in the pipeline minimizes subject-specific errors. To evaluate the impact of various preprocessing strategies, we systematically examined 384 different pipeline strategies in data from 30 healthy participants scanned twice with the serotonin transporter (5-HTT) radioligand [<sup>11</sup>C]DASB. Five commonly used preprocessing steps with two to four options were investigated: (1) motion correction (MC) (2) co-registration (3) delineation of volumes of interest (VOI's) (4) partial volume correction (PVC), and (5) kinetic modeling. To quantitatively compare and evaluate the impact of various preprocessing strategies, we used the performance metrics: test-retest bias, within- and between-subject variability, the intraclass-correlation coefficient, and global signal-to-noise ratio. We also performed a power analysis to estimate the required sample size to detect either a 5% or 10% difference in 5-HTT binding as a function of preprocessing pipeline. The results showed a complex downstream dependency between the various preprocessing steps on the performance metrics. The choice of MC had the most profound effect on 5-HTT binding, prior to the effects caused by PVC and kinetic modeling, and the effects differed across VOI's. Notably, we observed a negative bias in 5-HTT binding across test and retest in 98% of pipelines, ranging from 0 to 6% depending on the pipeline. Optimization of the performance metrics revealed a trade-off in within- and between-subject variability at the group-level with opposite effects (i.e. minimization of within-subject variability increased between-subject variability and vice versa). The sample size required to detect a given effect size was also compromised by the preprocessing strategy, resulting in up to 80% increases in sample size needed to detect a 5% difference in 5-HTT binding. This is the first study to systematically investigate and demonstrate the effect of choosing different preprocessing strategies on the outcome of dynamic PET studies. We provide a framework to show how optimal and maximally powered neuroimaging results can be obtained by choosing appropriate preprocessing strategies and we provide recommendations depending on the study design. In addition, the results contribute to a better understanding of methodological uncertainty and variability in preprocessing decisions for future group- and/or longitudinal PET studies.

Also flagged:ERKchronic liver diseaseinflammatory responsewound healingextracellular signal-regulated kinaseRas
Journal Article 2019-06-01 ✓ 1 Snippet Foglia B, Cannito S, Bocca C, Parola M, Novo E.
In-Text Gene Mentions

…genetic variants ofhemochromatosis.…

Show Full Abstract

Fibrogenic progression of chronic liver disease, whatever the etiology, is characterized by persistent chronic parenchymal injury, chronic activation of inflammatory response, and sustained activation of liver fibrogenesis, and of pathological wound healing response. A critical role in liver fibrogenesis is played by hepatic myofibroblasts (MFs), a heterogeneous population of α smooth-muscle actin-positive cells that originate from various precursor cells through a process of activation and transdifferentiation. In this review, we focus the attention on the role of extracellular signal-regulated kinase (ERK) signaling pathway as a critical one in modulating selected profibrogenic phenotypic responses operated by liver MFs. We will also analyze major therapeutic antifibrotic strategies developed in the last two decades in preclinical studies, some translated to clinical conditions, designed to interfere directly or indirectly with the Ras/Raf/MEK/ERK signaling pathway in activated hepatic MFs, but that also significantly increased our knowledge on the biology and pathobiology of these fascinating profibrogenic cells.

Also flagged:histone modificationsHistonehistone modifying enzymeshistone deacetylasesHDACsribonucleoprotein
Journal Article 2019-06-01 No Snippets Rahhal R, Seto E.
Show Full Abstract

Histone modifications and RNA splicing, two seemingly unrelated gene regulatory processes, greatly increase proteome diversity and profoundly influence normal as well as pathological eukaryotic cellular functions. Like many histone modifying enzymes, histone deacetylases (HDACs) play critical roles in governing cellular behaviors and are indispensable in numerous biological processes. While the association between RNA splicing and histone modifications is beginning to be recognized, a lack of knowledge exists regarding the role of HDACs in splicing. Recent studies however, reveal that HDACs interact with spliceosomal and ribonucleoprotein complexes, actively control the acetylation states of splicing-associated histone marks and splicing factors, and thereby unexpectedly could modulate splicing. Here, we review the role of histone/protein modifications and HDACs in RNA splicing and discuss the convergence of two parallel fields, which supports the argument that HDACs, and perhaps most histone modifying enzymes, are much more versatile and far more complicated than their initially proposed functions. Analogously, an HDAC-RNA splicing connection suggests that splicing is regulated by additional upstream factors and pathways yet to be defined or not fully characterized. Some human diseases share common underlying causes of aberrant HDACs and dysregulated RNA splicing and, thus, further support the potential link between HDACs and RNA splicing.

Also flagged:Tumorcancershepatocellular carcinomaepithelial-mesenchymal transitionluciferaseneurofascin
Journal Article 2019-06-01 ✓ 2 Snippets Wu J, Huang WJ, Xi HL, Liu LY, Wang ST, Fan WZ, Peng BG.
In-Text Gene Mentions

…neurofascin (NFASC) andneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1).…

Show Full Abstract

In recent years, a growing body of evidence has provided support for the important role of microRNAs (miRNAs) in the progression of human cancers. A recent study showed that a novel miRNA miR-3650 expression was significantly decreased in hepatocellular carcinoma (HCC). However, the precise role of miR-3650 in HCC have remained poorly understood. In this study, we found that miR-3650 expression was frequently decreased in HCC tissues. Low expression of miR-3650 is positively associated with tumor metastasis and poor survival of HCC patients. Forced expression of miR-3650 significantly inhibited the migration and epithelial-mesenchymal transition (EMT) of HCC cells. Through bioinformatic analysis and luciferase assays, we confirmed that neurofascin (NFASC) is a directly target mRNA of miR-3650. Rescue experiment demonstrated that NAFSC overexpression could partially counteracted the inhibitory effect of miR-3650 in HCC metastasis and EMT. In conclusion, our findings are the first time to demonstrate that reduced expression of miR-3650 in HCC was correlated with tumor metastasis and poor survival. MiR-3650 repressed HCC migration and EMT by directly targeting NFASC. Our findings suggested that miR-3650 may serve as a potential prognostic marker and promising application in HCC therapy.

Also flagged:dosage compensationsex determinationdsxixXchromosomes
Journal Article 2019-06-01 ✓ 1 Snippet Andrew DJ, Chen EH, Manoli DS, Ryner LC, Arbeitman MN.
In-Text Gene Mentions

DCC

Show Full Abstract

Bruce Baker, a preeminent <i>Drosophila</i> geneticist who made fundamental contributions to our understanding of the molecular genetic basis of sex differences, passed away July 1, 2018 at the age of 72. Members of Bruce's laboratory remember him as an intensely dedicated, rigorous, creative, deep-thinking, and fearless scientist. His trainees also remember his strong commitment to teaching students at every level. Bruce's career studying sex differences had three major epochs, where the laboratory was focused on: (1) sex determination and dosage compensation, (2) the development of sex-specific structures, and (3) the molecular genetic basis for sex differences in behavior. Several members of the Baker laboratory have come together to honor Bruce by highlighting some of the laboratory's major scientific contributions in these areas.

Organoids-on-a-chip.

Also flagged:organizationtissueorganogenesisneuralsonic hedgehogShh
Journal Article 2019-06-01 No Snippets Park SE, Georgescu A, Huh D.
Show Full Abstract

Recent studies have demonstrated an array of stem cell-derived, self-organizing miniature organs, termed organoids, that replicate the key structural and functional characteristics of their in vivo counterparts. As organoid technology opens up new frontiers of research in biomedicine, there is an emerging need for innovative engineering approaches for the production, control, and analysis of organoids and their microenvironment. In this Review, we explore organ-on-a-chip technology as a platform to fulfill this need and examine how this technology may be leveraged to address major technical challenges in organoid research. We also discuss emerging opportunities and future obstacles for the development and application of organoid-on-a-chip technology.

Also flagged:Synthesismicrotubulecombretastatin ApiperazineMicrotubulescancers
Journal Article 2019-06-01 No Snippets O'Boyle NM, Ana G, Kelly PM, Nathwani SM, Noorani S, Fayne D, Bright SA, Twamley B, Zisterer DM, Meegan MJ.
Show Full Abstract

Microtubules are a validated clinical target for the treatment of many cancers. We describe the design, synthesis, biochemical evaluation, and molecular modelling studies of a series of analogues of the microtubule-destabilising agent, combretastatin A-4 (CA-4). Our series of 33 novel compounds contain the CA-4 core structure with modifications to the stilbene linking group, and are predominantly piperazine derivatives. Synthesis was achieved in a two-step process by firstly obtaining the acrylic acid via a Perkin reaction using microwave enhanced synthesis, followed by coupling using either DCC or Mukaiyama's reagent. All target compounds were screened for antiproliferative activity in MCF-7 breast cancer cells. Hydroxyl derivative (E)-3-(4-hydroxy-3-methoxyphenyl)-1-(4-phenylpiperazin-1-yl)-2-(3,4,5-trimethoxyphenyl) propenone (4m) displayed potent antiproliferative activity (IC50 = 190 nM). Two amino-containing derivatives, (E)-3-(3-amino-4-methoxyphenyl)-1-(4-phenylpiperazin-1-yl)-2-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (4q) and (E)-3-(3-amino-4-methoxyphenyl)-1-(4-(p-tolyl)piperazin-1-yl)-2-(3,4,5-trimethoxyphenyl)prop-2-en-1-one (4x), were the most potent with IC50 values of 130 nM and 83 nM respectively. Representative compounds were shown to depolymerise tubulin, induce G2/M arrest and apoptosis in MCF-7 cells but not peripheral blood mononuclear cells, and induce cleavage of the DNA repair enzyme poly ADP ribose polymerase (PARP) in MCF-7 cells. Modelling studies predict that the compounds bind to tubulin within the colchicine-binding site. These compounds are a valuable addition to the library of CA-4 analogues and 4m, 4q and 4x will be developed further as novel, water-soluble molecules targeting microtubules.

Also flagged:mental disorderschizophreniatranscription factorsbindingchromatinpost-translational modifications
Journal Article 2019-06-01 No Snippets Liang X, Wang S, Liu L, Du Y, Cheng B, Wen Y, Zhao Y, Ding M, Cheng S, Ma M, Zhang L, Qi X, Li P, Guo X, Zhang F.
Show Full Abstract

<h4>Background</h4>Schizophrenia is a complex mental disorder. The genetic mechanism of schizophrenia remains elusive now.<h4>Methods</h4>We conducted a large-scale integrative analysis of two genome-wide association studies of schizophrenia with functional annotation datasets of regulatory single-nucleotide polymorphism (rSNP). The significant SNPs identified by the two genome-wide association studies were first annotated to obtain schizophrenia associated rSNPs and their target genes and proteins, respectively. We then compared the integrative analysis results to identify the common rSNPs and their target regulatory genes and proteins, shared by the two genome-wide association studies of schizophrenia. Finally, DAVID tool was used to conduct gene ontology and pathway enrichment analysis of the identified targets genes and proteins.<h4>Results</h4>We detected 53 schizophrenia-associated target genes for rSNP, such as FOS (<i>P value</i> = 2.18×10<sup>-20</sup>), ATXN1 (<i>P value</i> = 5.22×10<sup>-21</sup>) and HLA-DQA1 (<i>P value</i> = 1.98×10<sup>-10</sup>). Pathway enrichment analysis identified 24 pathways for transcription factors binding regions, chromatin interacting regions, long non-coding RNAs, topologically associated domains, circular RNAs and post-translational modifications, such as hsa05034:Alcoholism (<i>P value</i> = 2.57×10<sup>-7</sup>) and hsa04612:Antigen processing and presentation (<i>P value</i> = 6.82×10<sup>-8</sup>).<h4>Conclusion</h4>We detected multiple candidate genes, gene ontology terms and pathways for schizophrenia, supporting the functional importance of rSNPs, and providing novel clues for understanding the genetic architecture of schizophrenia.

Also flagged:TumorCisplatinlung cancerSCLCMyclCDH1
Journal Article 2019-06-01 ✓ 2 Snippets Böttger F, Semenova EA, Song JY, Ferone G, van der Vliet J, Cozijnsen M, Bhaskaran R, Bombardelli L, Piersma SR, Pham TV, Jimenez CR, Berns A.
In-Text Gene Mentions

Moreover, a wide set of neuronal differentiation and migration-associated genes such as Ncam1, Zeb1 (both RNA and protein level), drebrin/Dbn1, Ephb2, Rufy3 (protein), netrin-1 receptor/Dcc, neuroligin-1/Nlgn1, Robo1, contactins Cntn3 and Cntn4, and semaphorins Sema5b and Sema6d (RNA) were significantly less abundant in the cisplatin-treated lung tumors (Figures S4D and S4E), suggesting that cisplatin causes tumors to shift toward less pronounced neuronal phenotype.

…(protein), netrin-1 receptor/Dcc, neuroligin-1/ Nlgn1…

Show Full Abstract

Small-cell lung cancer is the most aggressive type of lung cancer, characterized by a remarkable response to chemotherapy followed by development of resistance. Here, we describe SCLC subtypes in Mycl- and Nfib-driven GEMM that include CDH1-high peripheral primary tumor lesions and CDH1-negative, aggressive intrapulmonary metastases. Cisplatin treatment preferentially eliminates the latter, thus revealing a striking differential response. Using a combined transcriptomic and proteomic approach, we find a marked reduction in proliferation and metabolic rewiring following cisplatin treatment and present evidence for a distinctive metabolic and structural profile defining intrinsically resistant populations. This offers perspectives for effective combination therapies that might also hold promise for treating human SCLC, given the very similar response of both mouse and human SCLC to cisplatin.

Also flagged:obesitymetabolisminsulin resistanceIRtryptophaninsulin
Journal Article 2019-06-01 ✓ 2 Snippets Virtue AT, McCright SJ, Wright JM, Jimenez MT, Mowel WK, Kotzin JJ, Joannas L, Basavappa MG, Spencer SP, Clark ML, Eisennagel SH, Williams A, Levy M, Manne S, Henrickson SE, Wherry EJ, Thaiss CA, Elinav E, Henao-Mejia J.
In-Text Gene Mentions

Negr1

Sox6

Show Full Abstract

The gut microbiota is a key environmental determinant of mammalian metabolism. Regulation of white adipose tissue (WAT) by the gut microbiota is a process critical to maintaining metabolic fitness, and gut dysbiosis can contribute to the development of obesity and insulin resistance (IR). However, how the gut microbiota regulates WAT function remains largely unknown. Here, we show that tryptophan-derived metabolites produced by the gut microbiota controlled the expression of the <i>miR-181</i> family in white adipocytes in mice to regulate energy expenditure and insulin sensitivity. Moreover, dysregulation of the gut microbiota-<i>miR-181</i> axis was required for the development of obesity, IR, and WAT inflammation in mice. Our results indicate that regulation of <i>miR-181</i> in WAT by gut microbiota-derived metabolites is a central mechanism by which host metabolism is tuned in response to dietary and environmental changes. As we also found that <i>MIR-181</i> expression in WAT and the plasma abundance of tryptophan-derived metabolites were dysregulated in a cohort of obese human children, the <i>MIR-181</i> family may represent a potential therapeutic target to modulate WAT function in the context of obesity.

Also flagged:cysteineFlashetherCancersucroseazide
Journal Article 2019-06-01 No Snippets Nogueira JCF, Greene MK, Richards DA, Furby AO, Steven J, Porter A, Barelle C, Scott CJ, Chudasama V.
Show Full Abstract

Herein we report the construction of a nanoparticle-based drug delivery system which targets a key regulator in tumour angiogenesis. We exploit a Variable New Antigen Receptor (VNAR) domain, conjugated using site-specific chemistry, to direct poly lactic acid-co-glycolic acid-polyethylene glycol (PLGA-PEG) nanoparticles to delta like canonical Notch ligand 4 (DLL4). The importance of site-specific chemistry is demonstrated.

Also flagged:HLA Class IDR3autoimmune hepatitisHLAHLA-Abinding
Journal Article 2019-06-01 ✓ 1 Snippet Lammert C, McKinnon EJ, Chalasani N, Phillips EJ.
In-Text Gene Mentions

…alcoholic steatohepatitis, andhemochromatosis, etc.).…

Show Full Abstract

<h4>Introduction</h4>HLA class II allele, DRB1*03:01, is the most common genetic risk factor for autoimmune hepatitis (AIH), but other unrecognized HLA related risks exist.<h4>Methods</h4>We compared the HLA class I (A, B, C) and class II (DR, DQ, DP) typing between patients with well-characterized AIH and healthy controls by high resolution sequencing of the HLA region. Seventy-three patients with AIH and 87 healthy controls were included. Association between HLA alleles and AIH was considered singly and in clusters and adjusted for age, gender, and DRB1*03:01.<h4>Results</h4>DRB1*03:01 was singly associated with AIH among whites (odds ratio [OR]: 3.09, P = 0.002) and carriers of DRB1*03:01 also carried DQA*05:01 and DQB1*02:01. Significant HLA class I alleles were associated with AIH including those belonging to the A03 (OR: 0.4, P = 0.01) and B44 supertype (OR: 0.44, P = 0.03). Further refinement of HLA-A by binding pocket structure revealed that the sequence Y(F/T)AVMENV(H/Q)Y, corresponding to HLA-A alleles A*03:01-02; *31:01; *32:02, was protective for AIH (OR: 0.3, P = 0.002). A protective association also existed for alleles belonging to the HLA-B binding pocket structure Y(H/Y)TVKEISNY (OR: 0.35, P = 0.01), corresponding to HLA-B alleles: B*40:01-02; *41:02; *44:02-03; *45:01; *49:01; *50:01-02. Associations with specific class I alleles belonging to the 8.1 ancestral haplotype (HLA-A*01:01, HLA-B*08:01, HLA-C*07:01) were not significant when considered jointly with DRB1*03:01 and reported protective class I alleles.<h4>Discussion</h4>Our study identified novel supertypes and HLA-A and B peptide binding structures protective against AIH. Further risk assessment of class I molecules remains important in AIH as they are key mediators of adaptive immunity.

Also flagged:transcription factorsTFtranscription factorMyoD1transductionSox2
Journal Article 2019-06-01 ✓ 1 Snippet Duan J, Li B, Bhakta M, Xie S, Zhou P, Munshi NV, Hon GC.
In-Text Gene Mentions

Sox6

Show Full Abstract

Ectopic expression of transcription factors (TFs) can reprogram cell state. However, because of the large combinatorial space of possible TF cocktails, it remains difficult to identify TFs that reprogram specific cell types. Here, we develop Reprogram-Seq to experimentally screen thousands of TF cocktails for reprogramming performance. Reprogram-Seq leverages organ-specific cell-atlas data with single-cell perturbation and computational analysis to predict, evaluate, and optimize TF combinations that reprogram a cell type of interest. Focusing on the cardiac system, we perform Reprogram-Seq on MEFs using an undirected library of 48 cardiac factors and, separately, a directed library of 10 epicardial-related TFs. We identify a combination of three TFs, which efficiently reprogram MEFs to epicardial-like cells that are transcriptionally, molecularly, morphologically, and functionally similar to primary epicardial cells. Reprogram-Seq holds promise to accelerate the generation of specific cell types for regenerative medicine.

Also flagged:GRLSD1KDM1Aglucocorticoid receptordemethylationbinding
Journal Article 2019-06-01 No Snippets Clark EA, Wu F, Chen Y, Kang P, Kaiser UB, Fang R, Shi YG.
Show Full Abstract

KDM1A-mediated H3K4 demethylation is a well-established mechanism underlying transcriptional gene repression, but its role in gene activation is less clear. Here, we report a critical function and mechanism of action of KDM1A in glucocorticoid receptor (GR)-mediated gene transcription. Biochemical purification of the nuclear GR complex revealed KDM1A as an integral component. In cell-free assays, GR modulates KDM1A-catalyzed H3K4 progressive demethylation by limiting the loss of H3K4me1. Similarly, in cells, KDM1A binds to most GR binding sites in the genome, where it removes preprogrammed H3K4me2 but leaves H3K4me1 untouched. Blocking KDM1A catalytic activity prevents H3K4me2 removal, severely impairs GR binding to chromatin, and dysregulates GR-targeted genes. Taken together, these data suggest KDM1A-mediated H3K4me2 demethylation at GRBSs promotes GR binding and plays an important role in glucocorticoid-induced gene transcription, broadening the mechanisms that contribute to nuclear receptor-mediated gene activation.

Also flagged:organizationATPasechromosomebindingSmc4Smc2
Journal Article 2019-06-01 ✓ 1 Snippet Hassler M, Shaltiel IA, Kschonsak M, Simon B, Merkel F, Thärichen L, Bailey HJ, Macošek J, Bravo S, Metz J, Hennig J, Haering CH.
In-Text Gene Mentions

Condensin

Show Full Abstract

The condensin protein complex plays a key role in the structural organization of genomes. How the ATPase activity of its SMC subunits drives large-scale changes in chromosome topology has remained unknown. Here we reconstruct, at near-atomic resolution, the sequence of events that take place during the condensin ATPase cycle. We show that ATP binding induces a conformational switch in the Smc4 head domain that releases its hitherto undescribed interaction with the Ycs4 HEAT-repeat subunit and promotes its engagement with the Smc2 head into an asymmetric heterodimer. SMC head dimerization subsequently enables nucleotide binding at the second active site and disengages the Brn1 kleisin subunit from the Smc2 coiled coil to open the condensin ring. These large-scale transitions in the condensin architecture lay out a mechanistic path for its ability to extrude DNA helices into large loop structures.

Also flagged:prothrombinantithrombin-IIIserum albuminhemopexinTTRtransthyretin
Journal Article 2019-06-01 ✓ 2 Snippets Li P, Wu Y, Zhang Z, Lin D, Wang D, Huang X, Zhang Y.
In-Text Gene Mentions

SERPINC1

…(ALBU), vitronectin (VTNC),antithrombin-III(ANT3), and apolipoprotein…

Show Full Abstract

The study aimed to find novel effect biomarkers for occupational benzene exposure and chronic benzene poisoning (CBP), which might also provide clues to the mechanism of benzene toxicity.We performed a comparative serological proteome analysis between healthy control workers with no benzene exposure, workers with short-term benzene exposure, workers with long-term benzene exposure, and CBP patients using 2D-DIGE and MALDI-TOF-MS. Two of the differentially expressed proteins were then selected to be validated by immune turbidimetric analysis.A total of 10 proteins were found to be significantly altered between different groups. The identified deferentially expressed proteins were classified according to their molecular functions, biological processes, and protein classes. The alteration of 2 important serum proteins among them, apolipoprotein A-I and transthyretin, were further confirmed.Our findings suggest that the identified differential proteins could be used as biomarkers for occupational benzene exposure and CBP, and they may also help elucidate the mechanisms of benzene toxicity.

Also flagged:Peroxiredoxin 6GlucoseCytokinesdiabetes mellitusinsulinomadiabetes
Journal Article 2019-06-01 No Snippets Novoselova EG, Glushkova OV, Parfenuyk SB, Khrenov MO, Lunin SM, Novoselova TV, Sharapov MG, Shaev IA, Novoselov VI.
Show Full Abstract

Taking into account a special role of pancreatic β-cells in the development of diabetes mellitus, the effects of peroxiredoxin 6 (Prx6) on the viability and functional activity of rat insulinoma RIN-m5F β-cells were studied under diabetes-simulating conditions. For this purpose, the cells were cultured at elevated glucose concentrations or in the presence of pro-inflammatory cytokines (TNF-α and IL-1) known for their special role in the cytotoxic autoimmune response in diabetes. It was found that the increased glucose concentration of 23-43 mM caused death of 20-60% β-cells. Prx6 added to cells significantly reduced the level of reactive oxygen species and protected the RIN-m5F β-cells from hyperglycemia, reducing the death of these cells by several fold. A measurement of insulin secretion by the RIN-m5F β-cells showed a significant stimulatory effect of Prx6 on the insulin-producing activity of pancreatic β-cells. It should be noted that the stimulatory activity of Prx6 was detected during culturing the cells under both normal and unfavorable conditions. The regulation of the NF-κB signaling cascade could be one of the mechanisms of Prx6 action on β-cells, in particular, through activation of RelA/p65 phosphorylation at Ser536.

Also flagged:Peucedanocoumarin IIIneurodegenerative diseasestetracyclineTettranslationalfibrils
Journal Article 2019-06-01 No Snippets Ham S, Kim H, Hwang S, Kang H, Yun SP, Kim S, Kim D, Kwon HS, Lee YS, Cho M, Shin HM, Choi H, Chung KY, Ko HS, Lee GH, Lee Y.
Show Full Abstract

Aggregates of disease-causing proteins dysregulate cellular functions, thereby causing neuronal cell loss in diverse neurodegenerative diseases. Although many in vitro or in vivo studies of protein aggregate inhibitors have been performed, a therapeutic strategy to control aggregate toxicity has not been earnestly pursued, partly due to the limitations of available aggregate models. In this study, we established a tetracycline (Tet)-inducible nuclear aggregate (β23) expression model to screen potential lead compounds inhibiting β23-induced toxicity. Highthroughput screening identified several natural compounds as nuclear β23 inhibitors, including peucedanocoumarin III (PCIII). Interestingly, PCIII accelerates disaggregation and proteasomal clearance of both nuclear and cytosolic β23 aggregates and protects SH-SY5Y cells from toxicity induced by β23 expression. Of translational relevance, PCIII disassembled fibrils and enhanced clearance of cytosolic and nuclear protein aggregates in cellular models of huntingtin and α-synuclein aggregation. Moreover, cellular toxicity was diminished with PCIII treatment for polyglutamine (PolyQ)-huntingtin expression and α-synuclein expression in conjunction with 6-hydroxydopamine (6-OHDA) treatment. Importantly, PCIII not only inhibited α-synuclein aggregation but also disaggregated preformed α-synuclein fibrils in vitro . Taken together, our results suggest that a Tet-Off β23 cell model could serve as a robust platform for screening effective lead compounds inhibiting nuclear or cytosolic protein aggregates. Brain-permeable PCIII or its derivatives could be beneficial for eliminating established protein aggregates.

Also flagged:BMPanodontia
Journal Article 2019-06-01 No Snippets Joseph A, Sundareswaran S, Srinivas S.
Show Full Abstract

<h4>Objective</h4>A frontal evaluation of the lips could provide important information during a routine clinical evaluation of facial aesthetics. There is a lack of ample evidence in the literature regarding variations in the vermilion height and lip area in various sagittal discrepancies when assessing facial aesthetics. The aim of this cross-sectional study was to evaluate and compare the vermilion height and lip area in dentoskeletal Class I, Class II, and Class III malocclusions.<h4>Methods</h4>Subjects included female patients divided into four groups (Angle's Class I bimaxillary proclination [Class I BMP], Class II Division I [Class II Div 1], Class III and Class I normal [Class I N]) with 36 samples each. Standardized frontal facial photographs were taken at rest and during a posed smile. Thirty-five landmarks on the upper and lower lips were identified for measurements of the vermilion height and lip area. A one-way analysis of variance was used to identify overall differences, and the post-hoc Bonferroni test was applied for multiple comparisons.<h4>Results</h4>Class III showed a significantly smaller upper-lip area and significantly higher ratios of the upper-to-lower lip vermilion height/area. The ratios displayed an increasing trend from the midline to the corners of the mouth. Class I BMP and Class II Div 1 had significantly larger upper and lower-lip areas.<h4>Conclusion</h4>Morphology of the lips is significantly correlated with underlying anteroposterior dentoskeletal discrepancies. During a clinical examination, a critical frontal evaluation of the lips is important as it is apparently indicative of the underlying sagittal discrepancy, especially in skeletal Class III malocclusions.

Also flagged:clubfootextracellulartransforming growth factor betaTGF-βperoxisomal matrix proteinsproteoglycans
Journal Article 2019-06-01 No Snippets Sadler B, Gurnett CA, Dobbs MB.
Show Full Abstract

<h4>Purpose</h4>Congenital clubfoot is a serious birth defect that affects nearly 0.1% of all births. Though there is strong evidence for a genetic basis of isolated clubfoot, aside from a handful of associations, much of the heritability remains unexplained.<h4>Methods</h4>By systematically examining the genes involved in syndromic clubfoot, we may find new candidate genes and pathways to investigate in isolated clubfoot.<h4>Results</h4>In addition to the expected enrichment of extracellular matrix and transforming growth factor beta (TGF-β) signalling genes, we find many genes involved in syndromic clubfoot encode peroxisomal matrix proteins, as well as enzymes necessary for sulfation of proteoglycans, an important part of connective tissue. Further, the association of Filamin B with isolated clubfoot as well as syndromic clubfoot is an encouraging finding.<h4>Conclusion</h4>We should examine these categories for enrichment in isolated clubfoot patients to increase our understanding of the underlying biology and pathophysiology of this deformity. Understanding the spectrum of syndromes that have clubfoot as a feature enables a better understanding of the underlying pathophysiology of the disorder and directs future genetic screening efforts toward certain genes and genetic pathways.<h4>Level of evidence</h4>V.

Also flagged:Fulminant liver failureheat strokeliver failureacute liver failuremetabolismmulti-organ failure
Journal Article 2019-06-01 ✓ 1 Snippet Figiel W, Morawski M, Grąt M, Kornasiewicz O, Niewiński G, Raszeja-Wyszomirska J, Krasnodębski M, Kowalczyk A, Hołówko W, Patkowski W, Zieniewicz K.
In-Text Gene Mentions

…autoimmune hepatitis, andhemochromatosis.…

Show Full Abstract

<h4>Background</h4>The growing popularity of marathon and half-marathon runs has led to an increased number of patients presenting with exertion-induced heat stroke. Mild hepatic involvement is often observed in these patients; however, fulminant liver failure may occur in approximately 5% of all cases. Liver transplantation is a potentially curative approach for exertion-induced liver failure, although there is a lack of consensus regarding the criteria and optimal timing of this intervention.<h4>Case summary</h4>This paper describes 5 patients (4 men and 1 woman) who were referred to the department where this study was performed with the diagnosis of exertion-induced acute liver failure. Three patients underwent liver transplantation, 1 recovered spontaneously, and 1 patient died on day 11 following the exertion.<h4>Conclusion</h4>Exertion-induced heat stroke may present as fulminant liver failure. These patients may recover with conservative treatment, may require liver transplantation, or may die. No definitive criteria are available to determine patient suitability for a conservative <i>vs</i> surgical approach.

Also flagged:MyocarditisQ feveranginaacute coronary syndromeheart failureacute
Journal Article 2019-06-01 ✓ 1 Snippet Jacobson A, Sutthiwan P.
In-Text Gene Mentions

HFE

Show Full Abstract

Myocarditis is a rare disease manifestation of acute Q fever caused by infection with <i>Coxiella burnetii</i>, an infectious Gram-negative proteobacteria. <i>C. burnetii</i> has a large animal reservoir and is often transmitted to humans during animal birth. Acute Q fever has a nonspecific disease presentation leading to delayed treatment and potentially worsened clinical outcomes. We describe a case of an otherwise healthy adult man with angina, ST elevations, and positive cardiac troponins-all findings suggestive of acute coronary syndrome. Cardiac catheterization revealed no significant coronary blockages or abnormalities. On echocardiography he was found to have heart failure with reduced ejection fraction. The patient's social history included several risk factors for Q fever. Serologic testing returned positive for anti-<i>C. burnetii</i> antibodies, and a diagnosis of acute Q fever myocarditis was made. The patient was appropriately treated with a course of doxycycline and clinically improved. <<b>Learning objective:</b> Q fever has a nonspecific presentation often leading to a delayed or missed diagnosis, resulting in worsened morbidity and mortality. Patients with angina-like chest pain and risk factors for Q fever should promptly be tested for infection with <i>C. burnetii</i>. Cardiac magnetic resonance imaging is a useful tool to improve diagnostic accuracy, with positive serology confirming the diagnosis. Treatment includes a course of antibiotics-often doxycycline.>.

Also flagged:RNA binding proteinsautoimmune diseasesAutoimmune diseaseimmune responsesimmune responseIL-6
Journal Article 2019-06-01 No Snippets Yoshinaga M, Takeuchi O.
Show Full Abstract

Autoimmune disease is induced by the breakdown of immune tolerance to self-antigens. This is brought about by an imbalance between the activation and the repression of immune responses. Dysregulation of the immune response is driven by the excess of proinflammatory cytokines such as IL-6 and TNF, which play a central role in the pathogenesis of a set of autoimmune diseases. The expression of proinflammatory mediator genes is tightly controlled by post-transcriptional regulation, which is mediated by a set of immune-related RNA binding proteins, such as tristetraprolin, Roquin, and Regnase-1. These proteins coordinately control the stability of proinflammatory mRNAs to regulate aberrant immune reactions. In this review, we discuss the roles of RNA binding proteins which are associated with the immune regulation and autoimmune pathogenesis.

Also flagged:Systemic lupus erythematosusSLEautoimmune syndromeIgGcytoplasmicmembrane
Journal Article 2019-06-01 No Snippets Luo H, Wang L, Bao D, Wang L, Zhao H, Lian Y, Yan M, Mohan C, Li QZ.
Show Full Abstract

Systemic lupus erythematosus (SLE) is a complex autoimmune syndrome characterized by various co-existing autoantibodies (autoAbs) in patients' blood. However, the full spectrum of autoAbs in SLE has not been comprehensively elucidated. In this study, a commercial platform bearing 9400 antigens (ProtoArray) was used to identify autoAbs that were significantly elevated in the sera of SLE patients. By comparing the autoAb profiles of SLE patients with those of healthy controls, we identified 437 IgG and 1213 IgM autoAbs that the expression levels were significantly increased in SLE (P < 0.05). Use of the ProtoArray platform uncovered over 300 novel autoAbs targeting a broad range of nuclear, cytoplasmic, and membrane antigens. Molecular interaction network analysis revealed that the antigens targeted by the autoAbs were most significantly enriched in cell death, cell cycle, and DNA repair pathways. A group of autoAbs associated with cell apoptosis and DNA repair function, including those targeting APEX1, AURKA, POLB, AGO1, HMGB1, IFIT5, MAPKAPK3, PADI4, RGS3, SRP19, UBE2S, and VRK1, were further validated by ELISA and Western blot in a larger cohort. In addition, the levels of autoAbs against APEX1, HMGB1, VRK1, AURKA, PADI4, and SRP19 were positively correlated with the level of anti-dsDNA in SLE patients. Comprehensive autoAb screening has identified novel autoAbs, which may shed light on potential pathogenic pathways leading to lupus.

Also flagged:autophagytamoxifenestrogen receptorbreast cancerLC3Beclin-1
Journal Article 2019-06-01 No Snippets Liu J, Yue W, Chen H.
Show Full Abstract

Tamoxifen is recommended as a first line treatment for estrogen receptor positive breast cancer. However, the acquisition of endocrine resistance remains the biggest hurdle to achieving treatment success. We, therefore, designed the present study to disclose the relationship between autophagy and endocrine resistance and to provide some insight into overcoming tamoxifen resistance. Experiments were performed using TAM-sensitive (MCF-7) cell lines and TAM-resistant (TAM-R) cell lines. Western blot, real-time PCR, and immunofluorescence analyses were conducted to detect autophagy and apoptosis related proteins and to evaluate pathways that stimulated autophagy in the two targeted cell lines. Higher LC3 and Beclin-1 levels were found in the TAM-R cell lines compared with the MCF-7 cell lines, suggesting that the degree of autophagy was higher in the TAM-R cells. Other proteins kinases such as pAMPK, BAX, and p-p70S6K also proved the involvement of autophagy in the process of developing tamoxifen resistance. Lower levels of microRNA-101 were detected in the TAM-R cells, indicating a negative correlation between microRNA-101 and autophagy. Based on the findings presented in this study, autophagy is a major cause of tamoxifen resistance in breast cancer patients. Inhibiting autophagy could improve the therapeutic efficacy of TAM by overcoming endocrine resistance in estrogen receptor positive breast cancers.

Also flagged:synthesisamino1,2,4-triazolescholinesterase3-amino-acyl
Journal Article 2019-06-01 No Snippets Santos SN, Alves de Souza G, Pereira TM, Franco DP, de Nigris Del Cistia C, Sant'Anna CMR, Lacerda RB, Kümmerle AE.
Show Full Abstract

Herein we describe the development of an efficient one-pot regioselective synthesis protocol to obtain <i>N</i>-protected or <i>N</i>-deprotected 1,5-diaryl-3-amino-1,2,4-triazoles from <i>N</i>-acyl-<i>N</i>-Boc-carbamidothioates. This improved protocol using microwave irradiation and low reaction times (up to 1 h) furnished desired compounds in yields ranging from 50 to 84%. This chemistry is useful for a variety of aromatic groups with electronically diverse substituents. The design and correct derivation of the amino group led to compounds able to inhibit cholinesterases with good IC<sub>50</sub> of up to 1 μM. Also, the mode of action (mixed-type) and SAR analysis for this series of compounds was described by means of kinetic and molecular modelling evaluations, showing potential for this class of compounds as new scaffolds for this biological activity.

Also flagged:PullulannanofiberspeptidewaterPalantimicrobial peptide
Journal Article 2019-06-01 No Snippets Román JT, Fuenmayor CA, Zuluaga Dominguez CM, Clavijo-Grimaldo D, Acosta M, García-Castañeda JE, Fierro-Medina R, Rivera-Monroy ZJ.
Show Full Abstract

Electrospinning technology is useful for making ultrafine drug-eluting fibers for the clinical treatment of wounds. We show the incorporation of an antimicrobial LfcinB-derived peptide into Pullulan nanofibers. The palindromic peptide LfcinB (21-25)<sub>Pal</sub>: RWQWRWQWR was synthesized, purified, and characterized by means of the RP-HPLC and MALDI-TOF MS methods. The peptide's antibacterial activity against the <i>E. coli</i> ATCC 25922 strain was evaluated, and the peptide LfcinB (20-25)<sub>Pal</sub> exhibited significant antibacterial activity. Nanofibers were obtained by electrospinning a Pullulan or Pullulan-LfcinB (21-25)<sub>Pal</sub> solution. The obtained nanofibers were characterized <i>via</i> microscopy (AFM and SEM) and RP-HPLC chromatography. The peptide incorporation efficiency was 31%. The Pullulan-LfcinB (21-25)<sub>Pal</sub> nanofibers were soluble in water, and the peptide was liberated immediately. The Pullulan-LfcinB (21-25)<sub>Pal</sub> nanofibers exhibited the same antibacterial activity against <i>E. coli</i> strain as the free peptide LfcinB (21-25)<sub>Pal</sub>. The results suggest that Pullulan-LfcinB (21-25)<sub>Pal</sub> nanofibers could be considered for designing and developing antibacterial wound dressings.

Also flagged:Hereditary HemochromatosisPancreatic Ductal Adenocarcinomaironchronic diseaseshepatocellular carcinomatype 2 diabetes mellitus
Journal Article 2019-06-01 ✓ 4 Snippets Julián-Serrano S, Yu K, Yuan F, Wheeler W, Karimi P, Amundadottir L, Jacobs E, Kraft P, Li D, Petersen G, Risch H, Wolphin B, Klein A, Stolzenberg-Solomon R.
In-Text Gene Mentions

Hemochromatosishas been associated…

…genetic susceptibility tohemochromatosisas determined by…

…genetic susceptibility ofhemochromatosisand PDAC risk.…

…hemochromatosis genes (HFE, BMP2 ,…

Show Full Abstract

Abstract <h4>Objectives</h4> Hereditary primary hemochromatosis is characterized by dysregulation of iron homeostasis and is caused by a genetic predisposition to absorb too much iron from foods. Hemochromatosis has been associated with some chronic diseases, including hepatocellular carcinoma and type 2 diabetes mellitus. Type 2 diabetes is an established risk factor and high red meat intake has been associated with pancreatic ductal adenocarcinoma (PDAC). We hypothesize that genetic susceptibility to hemochromatosis as determined by known hereditary hemochromatosis-related genes will be associated with PDAC. <h4>Methods</h4> We conducted a pathway analysis of genes known to contribute to hereditary hemochromatosis using the summary-based adaptive rank truncated product (sARTP) method on GWAS summary statistics derived from 9038 PDAC cases and 12,389 controls of European descent collected by the Pancreatic Cancer Cohort Consortium (PanScan) and the Pancreatic Cancer Case-Control Consortium (PANC4).Our analysis included 7 hereditary hemochromatosis genes (HFE, BMP2, HJV, HAMP, TFR2, SLC40A1, and FTH1) and close genomic regions (20 kb upstream and 20 kb downstream) with a total of 176 single nucleotide polymorphisms (SNPs). The sARTP method combines SNP-level associations across SNPs in a gene or a pathway. <h4>Results</h4> The hereditary hemochromatosis pathway was significantly associated with PDAC (P-value = 0.011). HJV and TFR2 genes contributed the most to the association with PDAC risk (gene level P-values = 0.003 and 0.013, respectively). <h4>Conclusions</h4> This study supports the hypothesis that genetic susceptibility related to hereditary hemochromatosis genes are associated with PDAC. Further studies should evaluate the modifying effect of iron-rich foods and genetic susceptibility of hemochromatosis and PDAC risk. <h4>Funding Sources</h4> This work was supported by the Intramural Research Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, National Institutes of Health.

Also flagged:Ironsubclinical deficiency
Journal Article 2019-06-01 No Snippets Momčilović B, Prejac J, Mimica N.
Show Full Abstract

Abstract <h4>Objectives</h4> Iron is the essential trace element (TE) in human nutrition, but also the most frequently observed deficient element in the human nutrition. The aim of this study was to assess human iron nutritional status by assessing its frequency distribution in the hair with a median derivatives bioassay. <h4>Methods</h4> In this prospective, observational, cross-sectional, exploratory, and epidemiological study we have analyzed hair Fe (HFe) in 1073 apparently healthy adults (339 men M and, 734 women, W) from Zagreb, Croatia. Whole blood iron (WBFe) was assessed in a subsample of this population in 143 Women and 91 Men. Both hair and whole blood samples were analyzed for iron with the ICP MS at the Center for Biotic Medicine, Moscow, Russia. Hair Fe natural frequency distribution was analyzed with the median derivatives bioassay logistic sigmoid curve for men and women separately. The range of values below the linear segment of the sigmoid curve (adequate intake) was considered to reflect Fe deficiency, whereas values above that range indicate Fe dietary excess. <h4>Results</h4> Women and men have almost identical amount of HFe (median ♂12.72 µg·g-1 vs median ♀ 12.428 µg·g-1). The physiologically adequate HFe linear segment range of the sigmoid curve was 6.09–32.19 µg·g-1 for Men and 6.11 - 28.23 µg·g-1 for Women. Similarly, both women and men have very similar amount of WBFe (median ♂535.6 µg∙g-1 vs median ♀4880 µg∙g-1). The physiologically adequate WBFe linear range of the sigmoid curve was 386.4–606.1 µg∙g-1 for ♀ and 470.4–631.0 µg∙g-1 for ♂. <h4>Conclusions</h4> Human nutritional status of Fe may be reliably assessed by analyzing its frequency distribution in the hair with median derivatives bioassay. Hair iron is a rare case between the bioelements we have tested thusafar where wholeblood concentrations were higher than that in the hair. Our exploration indicates that the so called iron subclinical deficiency may be adequately quantified. Indeed, continuous subliminal iron supplementation may be a better therapeutic option than current supplementation with high doses associated with the unwanted side effects. <h4>Funding Sources</h4> Institute for Research and Development of Sustainable Ecosystems, Zagreb, Croatia.

Also flagged:guanine nucleotidemethylationmetabolismFOXA2RORAglucose
Journal Article 2019-06-01 ✓ 1 Snippet Leet R, Whitsel E, Staimez L, Horvath S, Assimes T, Bhatti P, Jordahl K, Narayan K, Conneely K.
In-Text Gene Mentions

…in the SLC18A2,SLC2A14, and SLC16A3…

Show Full Abstract

Abstract <h4>Objectives</h4> This study examined the influence of diet on the methylome by analyzing 428,019 cytosine-guanine nucleotide pair (CpG) sites and assessing whether diet quality was associated with differential methylation patterns. <h4>Methods</h4> The study population included 4529 women from the Women's Health Initiative (WHI) observation and clinical trial from three ancillary studies: EMPC, BAA23, and AS311. DNA methylation was measured from whole blood samples using the Illumina Infinium HumanMethylation450 Beadchip. Diet quality was assessed using the Alternative Healthy Eating Index 2010 (AHEI-2010). An epigenome-wide association study (EWAS) meta-analysis, stratified by study cohort, was done using generalized linear models by regressing methylation β values (β = Methylated probes/[Methylated + Unmethylated probes]) for each CpG site on the primary exposure, AHEI, adjusting for cell composition, chip number and location, study characteristics, principle components of genetic relatedness, age, ethnicity and BMI. Significance was set at Holm-Bonferroni P < 0.05. <h4>Results</h4> Demographic characteristics are described by quartile of AHEI with Quartile 4 equivalent to the healthiest diet (highest score) and Quartile 1 equivalent to the poorest diet (lowest score) in Table 1. We found diet quality was significantly associated with 340 CpG sites after false discovery correction (Figure 1). While statistically significant, effect sizes were small (∼0.0003). These findings suggest that, on average, as AHEI increases by one SD (10.1 units), methylation changes by only ±0.003 in associated CpG sites. When examining the top 20 CpG sites (Table 2), several sites were located in genes critical to metabolism, including cg26137868 in the FOXA2 gene and cg20006924 in the RORA gene, both related to the regulation of glucose and fat metabolism and 3 CpG sites in the SLC18A2, SLC2A14, and SLC16A3 genes related to nutrient transport. <h4>Conclusions</h4> This is the first reported EWAS examining the relationship between diet quality and methylation in humans. While diet quality was statistically associated with many CpG sites, the effect sizes were small. Further investigation is required to understand the relationship between diet quality and the methylome. <h4>Funding Sources</h4> NA. <h4>Supporting Tables, Images and/or Graphs</h4>