Also flagged:SynthesisMed 6Royal Free DiseaseFibromyalgia SyndromesPostviral Fatigue SyndromeFatigue Syndrome, Chronic
Journal Article2020-04-30✓ 2 SnippetsMaksoud R, du Preez S, Eaton-Fitch N, Thapaliya K, Barnden L, Cabanas H, Staines D, Marshall-Gradisnik S.
In-Text Gene Mentions
Results)
…etect serotonin transporters (5-HTT), in the anterior…
Results)
…smaller density of5-HTT[ 28 ].…
Show Full Abstract
<h4>Background</h4>Myalgic encephalomyelitis/ Chronic Fatigue Syndrome (ME/CFS) is a multi-system illness characterised by a diverse range of debilitating symptoms including autonomic and cognitive dysfunction. The pathomechanism remains elusive, however, neurological and cognitive aberrations are consistently described. This systematic review is the first to collect and appraise the literature related to the structural and functional neurological changes in ME/CFS patients as measured by neuroimaging techniques and to investigate how these changes may influence onset, symptom presentation and severity of the illness.<h4>Methods</h4>A systematic search of databases Pubmed, Embase, MEDLINE (via EBSCOhost) and Web of Science (via Clarivate Analytics) was performed for articles dating between December 1994 and August 2019. Included publications report on neurological differences in ME/CFS patients compared with healthy controls identified using neuroimaging techniques such as magnetic resonance imaging, positron emission tomography and electroencephalography. Article selection was further refined based on specific inclusion and exclusion criteria. A quality assessment of included publications was completed using the Joanna Briggs Institute checklist.<h4>Results</h4>A total of 55 studies were included in this review. All papers assessed neurological or cognitive differences in adult ME/CFS patients compared with healthy controls using neuroimaging techniques. The outcomes from the articles include changes in gray and white matter volumes, cerebral blood flow, brain structure, sleep, EEG activity, functional connectivity and cognitive function. Secondary measures including symptom severity were also reported in most studies.<h4>Conclusions</h4>The results suggest widespread disruption of the autonomic nervous system network including morphological changes, white matter abnormalities and aberrations in functional connectivity. However, these findings are not consistent across studies and the origins of these anomalies remain unknown. Future studies are required confirm the potential neurological contribution to the pathology of ME/CFS.
Also flagged:chromosome condensationXVICohesinlocalizationatachromosomes
Journal Article2020-04-30✓ 1 SnippetLamothe R, Costantino L, Koshland DE.
In-Text Gene Mentions
Abstract)
…Condensinmediates chromosome condensati…
Show Full Abstract
Condensin mediates chromosome condensation, which is essential for proper chromosome segregation during mitosis. Prior to anaphase of budding yeast, the ribosomal DNA (RDN) condenses to a thin loop that is distinct from the rest of the chromosomes. We provide evidence that the establishment and maintenance of this RDN condensation requires the regulation of condensin by Cdc5p (polo) kinase. We show that Cdc5p is recruited to the site of condensin binding in the RDN by cohesin, a complex related to condensin. Cdc5p and cohesin prevent condensin from misfolding the RDN into an irreversibly decondensed state. From these and other observations, we propose that the spatial regulation of Cdc5p by cohesin modulates condensin activity to ensure proper RDN folding into a thin loop. This mechanism may be evolutionarily conserved, promoting the thinly condensed constrictions that occur at centromeres and RDN of mitotic chromosomes in plants and animals.
Journal Article2020-04-30✓ 2 SnippetsQadir MMF, Álvarez-Cubela S, Klein D, van Dijk J, Muñiz-Anquela R, Moreno-Hernández YB, Lanzoni G, Sadiq S, Navarro-Rubio B, García MT, Díaz Á, Johnson K, Sant D, Ricordi C, Griswold A, Pastori RL, Domínguez-Bendala J.
In-Text Gene Mentions
I A O 0000326)
…OLFM4…
Results)
…cluster 5 (OLFM4+ ) and…
Show Full Abstract
We have described multipotent progenitor-like cells within the major pancreatic ducts (MPDs) of the human pancreas. They express PDX1, its surrogate surface marker P2RY1, and the bone morphogenetic protein (BMP) receptor 1A (BMPR1A)/activin-like kinase 3 (ALK3), but not carbonic anhydrase II (CAII). Here we report the single-cell RNA sequencing (scRNA-seq) of ALK3<sup>bright+</sup>-sorted ductal cells, a fraction that harbors BMP-responsive progenitor-like cells. Our analysis unveiled the existence of multiple subpopulations along two major axes, one that encompasses a gradient of ductal cell differentiation stages, and another featuring cells with transitional phenotypes toward acinar tissue. A third potential ducto-endocrine axis is revealed upon integration of the ALK3<sup>bright+</sup> dataset with a single-cell whole-pancreas transcriptome. When transplanted into immunodeficient mice, P2RY1<sup>+</sup>/ALK3<sup>bright+</sup> populations (enriched in PDX1<sup>+</sup>/ALK3<sup>+</sup>/CAII<sup>-</sup> cells) differentiate into all pancreatic lineages, including functional β-cells. This process is accelerated when hosts are treated systemically with an ALK3 agonist. We found PDX1<sup>+</sup>/ALK3<sup>+</sup>/CAII<sup>-</sup> progenitor-like cells in the MPDs of types 1 and 2 diabetes donors, regardless of the duration of the disease. Our findings open the door to the pharmacological activation of progenitor cells in situ.
Also flagged:Wntribosomecell cycletumor suppressorcancersynthesis
Journal Article2020-04-30✓ 1 SnippetRaveux A, Stedman A, Coqueran S, Vandormael-Pournin S, Owens N, Romagnolo B, Cohen-Tannoudji M.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Ribosome biogenesis inhibition causes cell cycle arrest and apoptosis through the activation of tumor suppressor-dependent surveillance pathways. These responses are exacerbated in cancer cells, suggesting that targeting ribosome synthesis may be beneficial to patients. Here, we characterize the effect of the loss-of-function of Notchless (Nle), an essential actor of ribosome biogenesis, on the intestinal epithelium undergoing tumor initiation due to acute Apc loss-of-function. We show that ribosome biogenesis dysfunction strongly alleviates Wnt-driven tumor initiation by restoring cell cycle exit and differentiation in Apc-deficient progenitors. Conversely Wnt hyperactivation attenuates the cellular responses to surveillance pathways activation induced by ribosome biogenesis dysfunction, as proliferation was maintained at control-like levels in the stem cells and progenitors of double mutants. Thus, our data indicate that, while ribosome biogenesis inhibition efficiently reduces cancer cell proliferation in the intestinal epithelium, enhanced resistance of Apc-deficient stem and progenitor cells to ribosome biogenesis defects may be an important concern when using a therapeutic strategy targeting ribosome production for the treatment of Wnt-dependent tumorigenesis.
Also flagged:infectionCrohn diseaseimmune responsesvesiclesinflammatory bowel diseasesbacterial infections
Journal Article2020-04-30No SnippetsLarabi A, Barnich N, Nguyen HTT.
Show Full Abstract
To communicate with each other, cells release exosomes that transfer their composition, including lipids, proteins and nucleic acids, to neighboring cells, thus playing a role in various pathophysiological processes. During an infection with pathogenic bacteria, such as adherent-invasive <i>E. coli</i> (AIEC) associated with Crohn disease, exosomes secreted by infected cells can have an impact on the innate immune responses of surrounding cells to infection. Furthermore, inflammation can be amplified via the exosomal shuttle during infection with pathogenic bacteria, which could contribute to the development of the associated disease. Since these vesicles can be released in various biological fluids, changes in exosomal content may provide a means for the identification of non-invasive biomarkers for infectious and inflammatory bowel diseases. Moreover, evidence suggests that exosomes could be used as vaccines to prime the immune system to recognize and kill invading pathogens, and as therapeutic components relieving intestinal inflammation. Here, we summarize the current knowledge on the role of exosomes in bacterial infections and highlight their potential use as biomarkers, vaccines and conveyers of therapeutic molecules in inflammatory bowel diseases.
Multiple myeloma is a hematologic malignancy that classically manifests with hypercalcaemia, renal insufficiency, anaemia and lytic bone lesions. Liver dysfunction in multiple myeloma is a lesser known complication that occurs through biliary obstruction, liver infiltration by plasma cells, amyloid/light chain deposition or due to liver injury from medications. Although transfusion-related hepatic iron overload-leading to significant liver disease-is a recognised complication in certain hematologic malignancies, little is known about transfusional iron overload in patients with multiple myeloma. We present a case of a 49-year-old female with relapsed/refractory multiple myeloma who presented with rapid onset liver failure, due to both iron deposition and malignant plasma cell infiltration of the liver as a terminal event. A review of the literature on hepatic complications in multiple myeloma patients is presented.
Also flagged:RANPeptideneurodegenerative diseasesAmyotrophic Lateral Sclerosispeptidesneuromuscular diseases
Journal Article2020-04-30✓ 2 SnippetsRudich P, Snoznik C, Puleo N, Lamitina T.
In-Text Gene Mentions
Text
…Htt 2…
Text
…Htt…
Show Full Abstract
C. elegans is commonly used to model age-related neurodegenerative diseases caused by repeat expansion mutations, such as Amyotrophic Lateral Sclerosis (ALS) and Huntington's disease. Recently, repeat expansion-containing RNA was shown to be the substrate for a novel type of protein translation called repeat-associated non-AUG-dependent (RAN) translation. Unlike canonical translation, RAN translation does not require a start codon and only occurs when repeats exceed a threshold length. Because there is no start codon to determine the reading frame, RAN translation occurs in all reading frames from both sense and antisense RNA templates that contain a repeat expansion sequence. Therefore, RAN translation expands the number of possible disease-associated toxic peptides from one to six. Thus far, RAN translation has been documented in eight different repeat expansion-based neurodegenerative and neuromuscular diseases. In each case, deciphering which RAN products are toxic, as well as their mechanisms of toxicity, is a critical step towards understanding how these peptides contribute to disease pathophysiology. In this paper, we present strategies to measure the toxicity of RAN peptides in the model system C. elegans. First, we describe procedures for measuring RAN peptide toxicity on the growth and motility of developing C. elegans. Second, we detail an assay for measuring postdevelopmental, age-dependent effects of RAN peptides on motility. Finally, we describe a neurotoxicity assay for evaluating the effects of RAN peptides on neuron morphology. These assays provide a broad assessment of RAN peptide toxicity and may be useful for performing large-scale genetic or small molecule screens to identify disease mechanisms or therapies.
Upon exposure to chronic stressors, how do individuals move from being in a healthy state to a burnout? Strikingly in literature, this has prevailed a categorical view rather than a dimensional one, thus the underlying process that explains the transition from one state to another remains unclear. The aims of the present study are (a) to examine intermediate states between work engagement and burnout using cluster analysis and (b) to examine cortisol differences across these states. Two-hundred and eighty-one Argentine workers completed self-report measures of work engagement and burnout. Salivary cortisol was measured at three time-points: immediately after awakening and 30 and 40min thereafter. Results showed four different states based on the scores in cynicism, exhaustion, vigor, and dedication: engaged, strained, cynical, and burned-out. Cortisol levels were found to be moderate in the engaged state, increased in the strained and cynical states, and decreased in the burned-out state. The increase/decrease in cortisol across the four stages reconciles apparent contradictory findings regarding hypercortisolism and hypocortisolism, and suggests that they may represent different phases in the transition from engagement to burnout. A phase model from engagement to burnout is proposed and future research aimed at evaluating this model is suggested.
Also flagged:Mental DisordersSeveremental illnessesschizophreniabipolar disorderneuropsychiatric disorders
Journal Article2020-04-30No SnippetsZhang Y, Zhao Y, Song X, Luo H, Sun J, Han C, Gu X, Li J, Cai G, Zhu Y, Liu Z, Wei L, Wei ZZ.
Show Full Abstract
Severe mental illnesses (SMI) such as schizophrenia and bipolar disorder affect 2-4% of the world population. Current medications and diagnostic methods for mental illnesses are not satisfying. In animal studies, stem cell therapy is promising for some neuropsychiatric disorders and cognitive/social deficits, not only treating during development (targeting modulation and balancing) but also following neurodegeneration (cell replacement and regenerating support). We believe that novel interventions such as modulation of particular cell populations to develop cell-based treatment can improve cognitive and social functions in SMI. With pathological synaptic/myelin damage, oligodendrocytes seem to play a role. In this review, we have summarized oligodendrogenesis mechanisms and some related calcium signals in neural cells and stem/progenitor cells. The related benefits from endogenous stem/progenitor cells within the brain and exogenous stem cells, including multipotent mesenchymal-derived stromal cells (MSC), fetal neural stem cells (NSC), pluripotent stem cells (PSC), and differentiated progenitors, are discussed. These also include stimulating mechanisms of oligodendrocyte proliferation, maturation, and myelination, responsive to the regenerative effects by both endogenous stem cells and transplanted cells. Among the mechanisms, calcium signaling regulates the neuronal/glial progenitor cell (NPC/GPC)/oligodendrocyte precursor cell (OPC) proliferation, migration, and differentiation, dendrite development, and synaptic plasticity, which are involved in many neuropsychiatric diseases in human. On the basis of numerous protein annotation and protein-protein interaction databases, a total of 119 calcium-dependent/activated proteins that are related to neuropsychiatry in human are summarized in this investigation. One of the advanced methods, the calcium/cation-channel-optogenetics-based stimulation of stem cells and transplanted cells, can take advantage of calcium signaling regulations. Intranasal-to-brain delivery of drugs and stem cells or local delivery with the guidance of brain imaging techniques may provide a unique new approach for treating psychiatric disorders. It is also expected that preconditioning stem cell therapy following precise brain imaging as pathological confirmation has high potential if translated to cell clinic use. Generally, modulable cell transplantation followed by stimulations should provide paracrine protection, synaptic modulation, and myelin repair for the brain in SMI.
…Similarly, in glioblastoma, Suva et al. (2014) identified a core set of neurodevelopmental transcription factors (POU3F2, SOX2, SALL2, and OLIG2) that were sufficient to reprogram differentiated glioblastoma cells to CSCs.…
Intratumoral heterogeneity is a major ongoing challenge in the effective therapeutic targeting of cancer. Accumulating evidence suggests that a fraction of cells within a tumor termed Cancer Stem Cells (CSCs) are primarily responsible for this diversity resulting in therapeutic resistance and metastasis. Adding to this complexity, recent studies have shown that there can be different subpopulations of CSCs with varying biochemical and biophysical traits resulting in varied dissemination and drug-resistance potential. Moreover, cancer cells can exhibit a high level of plasticity or the ability to dynamically switch between CSC and non-CSC states or among different subsets of CSCs. In addition, CSCs also display extensive metabolic plasticity. The molecular mechanisms underlying these different interconnected axes of plasticity has been under extensive investigation and the trans-differentiation process of Epithelial to Mesenchymal transition (EMT) has been identified as a major contributing factor. Besides genetic and epigenetic factors, CSC plasticity is also shaped by non-cell-autonomous effects such as the tumor microenvironment (TME). In this review, we discuss the latest developments in decoding mechanisms and implications of CSC plasticity in tumor progression at biochemical and biophysical levels, and the latest <i>in silico</i> approaches being taken for characterizing cancer cell plasticity. These efforts can help improve existing therapeutic approaches by taking into consideration the contribution of cellular plasticity/heterogeneity in enabling drug resistance.
Also flagged:Breast Cancercancercurcuminpolyethylene glycolsuccinatemethyl
Journal Article2020-04-30No SnippetsHuang C, Chen F, Zhang L, Yang Y, Yang X, Pan W.
Show Full Abstract
<h4>Background</h4>Emerging cancer therapy requires highly sensitive diagnosis in combination with cancer-targeting therapy. In this study, a self-assembled pH-sensitive curcumin (Cur)-loaded nanoparticle of <sup>99m</sup>Tc radiolabeled hyaluronan-cholesteryl hemisuccinate conjugates (HA-CHEMS) and D-a-tocopheryl polyethylene glycol succinate (TPGS) was prepared for breast cancer synergistic theranostics.<h4>Materials and methods</h4>The synthesized amphiphilic HA-CHEMS conjugates and TPGS self-assembled into Cur-loaded nanoparticles (HA-CHEMS-Cur-TPGS NPs) in an aqueous environment. The physicochemical properties of HA-CHEMS-Cur-TPGS NPs were characterized by transmission electron microscopy (TEM) and dynamic lighter scattering (DLS). The in vitro cytotoxicity of HA-CHEMS-Cur-TPGS NPs against breast cancer cells was evaluated by using the methyl thiazolyl tetrazolium (MTT) assay. Moreover, the in vivo animal experiments of HA-CHEMS-Cur-TPGS NPs including SPECT/CT imaging biodistribution and antitumor efficiency were investigated in 4T1 tumor-bearing BALB/c mice; furthermore, pharmacokinetics were investigated in healthy mice.<h4>Results</h4>HA-CHEMS-Cur-TPGS NPs exhibited high curcumin loading, uniform particle size distribution, and excellent stability in vitro. In the cytotoxicity assay, HA-CHEMS-Cur-TPGS NPs showed remarkably higher cytotoxicity to 4T1 cells with an IC50 value at 38 μg/mL, compared with free curcumin (77 μg/mL). Moreover, HA-CHEMS-Cur-TPGS NPs could be effectively and stably radiolabeled with <sup>99m</sup>Tc. The SPECT images showed that <sup>99m</sup>Tc-HA-CHEMS-Cur-TPGS NPs could target the 4T1 tumor up to 4.85±0.24%ID/g at 4 h post-injection in BALB/c mice. More importantly, the in vivo antitumor efficacy studies showed that HA-CHEMS-Cur-TPGS NPs greatly inhibited the tumor growth without resulting in obvious toxicities to major organs.<h4>Conclusion</h4>The results indicated that HA-CHEMS-Cur-TPGS NPs with stable <sup>99m</sup>Tc labeling and high curcumin-loading capacity hold great potential for breast cancer synergistic theranostics.
Also flagged:tumourMalignant gliomasbrain tumourscancergliomascell differentiation
Journal Article2020-04-30No SnippetsFerraris C, Cavalli R, Panciani PP, Battaglia L.
Show Full Abstract
High-grade gliomas are still characterized by a poor prognosis, despite recent advances in surgical treatment. Chemotherapy is currently practiced after surgery, but its efficacy is limited by aspecific toxicity on healthy cells, tumour cell chemoresistance, poor selectivity, and especially by the blood-brain barrier (BBB). Thus, despite the large number of potential drug candidates, the choice of effective chemotherapeutics is still limited to few compounds. Malignant gliomas are characterized by high infiltration and neovascularization, and leaky BBB (the so-called blood-brain tumour barrier); surgical resection is often incomplete, leaving residual cells that are able to migrate and proliferate. Nanocarriers can favour delivery of chemotherapeutics to brain tumours owing to different strategies, including chemical stabilization of the drug in the bloodstream; passive targeting (because of the leaky vascularization at the tumour site); inhibition of drug efflux mechanisms in endothelial and cancer cells; and active targeting by exploiting carriers and receptors overexpressed at the blood-brain tumour barrier. Within this concern, a suitable nanomedicine-based therapy for gliomas should not be limited to cytotoxic agents, but also target the most important pathogenetic mechanisms, including cell differentiation pathways and angiogenesis. Moreover, the combinatorial approach of cell therapy plus nanomedicine strategies can open new therapeutical opportunities. The major part of attempted preclinical approaches on animal models involves active targeting with protein ligands, but, despite encouraging results, a few number of nanomedicines reached clinical trials, and most of them include drug-loaded nanocarriers free of targeting ligands, also because of safety and scalability concerns.
Adult articular cartilage synthesises very little type II collagen in comparison to young cartilage. The age-related difference in collagen II synthesis is poorly understood. This is the first systematic investigation of age-related differences in extracellular matrix synthesis in fresh articular cartilage and following isolation of chondrocytes. A histological comparison of 3-year-old skeletally mature and 6-month-old juvenile porcine cartilage was made. Differences in collagen II, aggrecan, and Sox5, 6, and 9 mRNA and protein expression and mRNA stability were measured. Adult cartilage was found to be thinner than juvenile cartilage but with similar chondrocyte density. Procollagen <i>α</i>1(II) and Sox9 mRNA levels were 10-fold and 3-fold reduced in adult cartilage. Sox9 protein was halved and collagen II protein synthesis was almost undetectable and calculated to be at least 30-fold reduced. Aggrecan expression did not differ. Isolation of chondrocytes caused a drop in procollagen <i>α</i>1(II) and Sox9 mRNA in both adult and juvenile cells along with a marked reduction in Sox9 mRNA stability. Interestingly, juvenile chondrocytes continued to synthesise collagen II protein with mRNA levels similar to those seen in adult articular cartilage. Age-related differences in collagen II protein synthesis are due to both transcriptional and posttranscription regulation. A better understanding of these regulatory mechanisms would be an important step in improving current cartilage regeneration techniques.
Also flagged:hydroxyapatitebone tissue regenerationapatitecalciumphosphorusoxygen
Journal Article2020-04-30No SnippetsSaleem M, Rasheed S, Yougen C.
Show Full Abstract
In recent years remarkable efforts have been made to produce artificial bone through tissue engineering techniques. Silk fibroin (SF) and hydroxyapatite (HA) have been used in bone tissue regeneration as biomaterials due to mechanical properties of SF and biocompatibility of HA. There has been growing interest in developing SF/HA composites to reduce bone defects. In this regard, several attempts have been made to study the biocompatibility and osteoconductive properties of this material. This article overviews the recent advance from last few decades in terms of the preparative methods and application of SF/HA in bone regeneration. Its first part is related to SF that presents the most common sources, preparation methods and comparison of SF with other biomaterials. The second part illustrates the importance of HA by providing information about its production and properties. The third part presents comparative studies of SF/HA composites with different concentrations of HA along with methods of preparation of composites and their applications.
Cerebral venous sinus thrombosis (CVT) is notoriously known for its varied presentations and extremely high risk of mortality, if remains undetected and untreated. On the other hand, life can be saved with full functional recovery if CVT can be identified with high index of clinical suspicion with supportive imaging and treatment with appropriate anticoagulation. It is important for clinicians to be meticulous to screen for both the potential reversible and heritable causes of CVT so that appropriate measures can be taken to prevent such catastrophe. Here we report a case of CVT involving right sigmoid and transverse sinuses presenting with acute onset left sided hemiplegic without antecedent headache or seizures. Patient was successfully treated with anticoagulants with nearly full functional recovery. Multiple predisposing factors were identified. As per our knowledge, this is the first case of CVT with underlying conglomeration of multiple acquired (lactation, folate deficiency, hyperhomocysteinemia, depot medroxyprogesterone acetate injection) and hereditary risk factors (deficiency of protein C, protein S and antithrombin-III) in a single patient.
…CYP2A6 rs28399433, andPTGISrs5629) were different…
Show Full Abstract
<h4>Background</h4>Pharmacogenomics plays a crucial role in individualized therapy, but the variant information of pharmacogenomics in the Dai population is limited. We therefore aimed to screen very important pharmacogenetic (VIP) in the Dai population and compared differences between Dai and other 25 populations.<h4>Methods</h4>In this study, we genotyped 73 VIP variants from the PharmGKB and compared genotype distribution of variants in Dai with other 25 populations by χ2 test. To assess the genetic relationship among 26 populations, we performed the structure analysis. In addition, pair-wise F-statistics (Fst) was calculated to measure the population differentiation.<h4>Results</h4>We found 12, 10, 13, 17, 11, 39, 46, 46, 45, 43, 49, 46, 46, 46, 49, 45, 41, 42, 48, 53, 45, 50, 50, 51, 47, and 50 significantly different variants in Dai compared with other 25 populations. Genetic structure analysis showed Dai had close relationships with CDX (Chinese Dai in Xishuangbanna), CHB (Han Chinese in Beijing), JPT (Japanese in Tokyo), and KHV (Kinh in Ho Chi Minh City, Vietnam). Moreover, Dai is the most similar to KHV according to Fst analysis.<h4>Conclusions</h4>Our study complement the pharmacogenomics information of Dai population from Yunnan province and provide a theoretical basis for personalized medicine.
The serotonin transporter (SERT) functions to regulate the availability of serotonin (5-HT) in the brain and intestine. An intestine-specific mRNA variant arising from a unique transcription start site and alternative promoter in the SERT gene has been identified (iSERT; spanning exon 1C). A decrease in SERT is implicated in several gut disorders, including inflammatory bowel diseases (IBD). However, little is known about mechanisms regulating the iSERT variant, and a clearer understanding is warranted for targeting SERT for the treatment of gut disorders. The current studies examined the expression of iSERT across different human intestinal regions and investigated its regulation by HNF4α (hepatic nuclear factor-4α), a transcription factor important for diverse cellular functions. iSERT mRNA abundance was highest in the human ileum and Caco-2 cell line. iSERT mRNA expression was downregulated by loss of HNF4α (but not HNF1α, HNF1β, or FOXA1) in Caco-2 cells. Overexpression of HNF4α increased iSERT mRNA concomitant with an increase in SERT protein. Progressive promoter deletion and site-directed mutagenesis revealed that the HNF4α response element spans nucleotides -1,163 to -1150 relative to the translation start site. SERT mRNA levels in the intestine were drastically reduced in the intestine-specific HNF4α-knockout mice relative to HNF4α<sup>FL/FL</sup> mice. Both HNF4α and SERT mRNA levels were also downregulated in mouse model of ileitis (SAMP) compared with AKR control mice. These results establish the transcriptional regulation of iSERT at the gut-specific internal promoter (hSERTp2) and have identified HNF4α as a critical modulator of basal SERT expression in the intestine.
Also flagged:PLTDICCoagulationprothrombinVanishing twinHemangioma
Journal Article2020-04-29✓ 1 SnippetGo H, Ohto H, Nollet KE, Kashiwabara N, Ogasawara K, Chishiki M, Hiruta S, Sakuma I, Kawasaki Y, Hosoya M.
In-Text Gene Mentions
Results)
…n = 4),ATIIIinfusion ( n…
Show Full Abstract
<h4>Background</h4>Although disseminated intravascular coagulation (DIC) is a critical disease, there is few gold standard interventions in neonatal medicine. The aim of this study is to reveal factors affecting neonatal DIC at birth and to assess the effectiveness of rTM and FFP for DIC in neonates at birth.<h4>Methods</h4>We retrospectively evaluated DIC score on the first day of life in neonates with underlying conditions associated with DIC. DIC in neonates was diagnosed according to Japan Society of Obstetrical, Gynecological & Neonatal Hematology 2016 neonatal DIC criteria.<h4>Results</h4>Comparing neonates with DIC scores of ≥3 (n = 103) to those < 3 (n = 263), SGA, birth asphyxia, low Apgar score, hemangioma, hydrops, PIH, and PA were statistically increased. Among 55 neonates underwent DIC treatment, 53 had birth asphyxia and 12 had intraventricular hemorrhage. Forty-one neonates received FFP or a combination of FFP and antithrombin (FFP group), while 14 neonates received rTM or a combination of rTM, FFP, and antithrombin (rTM group). DIC score before treatment in the rTM group was significantly higher than in the FFP group (4.7 vs 3.6, P < 0.05). After treatment, DIC scores in both groups were significantly reduced on Day 1 and Day 2 (P < 0.05).<h4>Conclusions</h4>Among various factors associated with DIC in neonates at birth, birth asphyxia is particularly significant. Furthermore, rTM in combination with FFP therapy was effective for neonatal DIC at birth.
Also flagged:PhosphorylationProtein kinase BAKT1cancerstumorpeptide
Journal Article2020-04-29✓ 1 SnippetBalasuriya N, Davey NE, Johnson JL, Liu H, Biggar KK, Cantley LC, Li SS, O'Donoghue P.
In-Text Gene Mentions
Text
…DDX27…
Show Full Abstract
Protein kinase B (AKT1) is a central node in a signaling pathway that regulates cell survival. The diverse pathways regulated by AKT1 are communicated in the cell via the phosphorylation of perhaps more than 100 cellular substrates. AKT1 is itself activated by phosphorylation at Thr-308 and Ser-473. Despite the fact that these phosphorylation sites are biomarkers for cancers and tumor biology, their individual roles in shaping AKT1 substrate selectivity are unknown. We recently developed a method to produce AKT1 with programmed phosphorylation at either or both of its key regulatory sites. Here, we used both defined and randomized peptide libraries to map the substrate selectivity of site-specific, singly and doubly phosphorylated AKT1 variants. To globally quantitate AKT1 substrate preferences, we synthesized three AKT1 substrate peptide libraries: one based on 84 "known" substrates and two independent and larger oriented peptide array libraries (OPALs) of ∼10<sup>11</sup> peptides each. We found that each phospho-form of AKT1 has common and distinct substrate requirements. Compared with pAKT1<sup>T308</sup>, the addition of Ser-473 phosphorylation increased AKT1 activities on some, but not all of its substrates. This is the first report that Ser-473 phosphorylation can positively or negatively regulate kinase activity in a substrate-dependent fashion. Bioinformatics analysis indicated that the OPAL-activity data effectively discriminate known AKT1 substrates from closely related kinase substrates. Our results also enabled predictions of novel AKT1 substrates that suggest new and expanded roles for AKT1 signaling in regulating cellular processes.
The Ser/Thr protein kinase MELK (maternal embryonic leucine zipper kinase) has been considered an attractive therapeutic target for managing cancer since 2005. Studies using expression analysis have indicated that MELK expression is higher in numerous cancer cells and tissues than in their normal, nonneoplastic counterparts. Further, RNAi-mediated MELK depletion impairs proliferation of multiple cancers, including triple-negative breast cancer (TNBC), and these growth defects can be rescued with exogenous WT MELK, but not kinase-dead MELK complementation. Pharmacological MELK inhibition with OTS167 (alternatively called OTSSP167) and NVS-MELK8a, among other small molecules, also impairs cancer cell growth. These collective results led to MELK being classified as essential for cancer proliferation. More recently, in 2017, the proliferation of TNBC and other cancer cell lines was reported to be unaffected by genetic CRISPR/Cas9-mediated MELK deletion, calling into question the essentiality of this kinase in cancer. To date, the requirement of MELK in cancer remains controversial, and mechanisms underlying the disparate growth effects observed with RNAi, pharmacological inhibition, and CRISPR remain unclear. Our objective with this review is to highlight the evidence on both sides of this controversy, to provide commentary on the purported requirement of MELK in cancer, and to emphasize the need for continued elucidation of the functions of MELK.
Triple negative breast cancer (TNBC) represents 15-20% of the over one million new breast cancer cases occurring each year. TNBC is an aggressive cancer phenotype, with low 5-year survival rates, high 3-year recurrence rates, and increased risk of metastasis. A lack of three commonly exploited hormone receptors renders TNBC resistant to endocrine therapies and lends to its critical absence of viable therapeutic targets. This necessitates the development of alternate and effective novel therapeutic strategies for TNBC. Towards this, our current work seeks to develop the technique of Electrical pulse (EP)-mediated Turmeric silver nanoparticles (TurNP) therapy, known as Electrochemotherapy (ECT), to effectively target TNBC cells. This technique involves the efficient delivery of natural bioactive molecules with anti-cancer effects via a biophysical means. In these experiments, the bioactive molecules are turmeric, a dried rhizome of Curcuma longa that has been used for centuries, both as a dietary supplement and as a medicine in Ayurveda (science of life) in the Indian subcontinent and in traditional Chinese medicine. Our results reveal the combined effect of TurNP + EP treatment in reducing MDA-MB-231 cell viability to as low as 9% at 12 h. Showing biological selectivity, this combination treatment has a substantially lower effect on non-tumorigenic mammary epithelial MCF10A cells (67% viability). To gain mechanistic insights into the actions of TurNP-based ECT treatment, we performed high-throughput, label-free quantitative proteomics studies. Proteomics results indicate that TurNP + EP treatment significantly influenced expression of a diverse list of proteins, including receptors, transcription factors, structural proteins, kinases, and metabolic enzymes. This include the downregulation of 25 proteins in PI3K-Akt signaling pathway (such as GRB2, EGFR, EPHA2, GNB1, GNB2, 14-3-3 family, and Integrin family proteins), and 12 proteins (AKR1A1, ALDOA, ALDOC, PGK1, PGM1, PGAM1, ENO1, ENO2, GAPDH, TPI1, LDHA, and LDHB) in the glycolytic pathway with concomitant reduction in metabolite levels (glucose uptake, and intracellular- lactate, glutamine, and glutamate). Compared to TurNP alone, TurNP + EP treatment upregulated 66 endoplasmic reticulum and 193 mitochondrial proteins, enhancing several processes and pathways, including Pyruvate Metabolism, Tricarboxylic acid (TCA) cycle, and Oxidative Phosphorylation (OXPHOS), which redirected the TNBC metabolism to mitochondria. This switch in the metabolism caused excessive production of H<sub>2</sub>O<sub>2</sub> reactive oxygen species (ROS) to inflict cell death in MDA-MB-231 cells, demonstrating the potency of this treatment.
TE and 2D-SWE are well-documented in studies performed on adults, but those on pediatric patients are limited. The aim of this study was to establish pediatric reference values for liver stiffness using two elastography methods: 2D-SWE and TE. We performed an observational study on 206 healthy children. All children underwent anamnesis, clinical exam, laboratory tests, US exam, TE and 2D-SWE for liver stiffness assessment. The mean liver stiffness value by 2D-SWE for all children was 3.72 ± 0.48 kPa. The mean values ranged between 3.603 ± 0.2678 kPa (3-5 years of age) and 3.774 ± 0.4038 kPa (9-11 years). The reference values varied between 4.1386 kPa (3-5 years of age) and 4.88 kPa (12-15 years). The mean liver stiffness value by TE was 3.797 ± 0.4859 kPa. The values ranged between 3.638 ± 0.4088 kPa (6-8 years of age) and 3.961 ± 0.5695 kPa (15-18 years). The cutoff values varied from 4.4064 kPa (3-5 years of age) to 5.1 kPa (15-18 years). We found a significant positive correlation between E Median values by TE and age [95% CI: 0.1160 to 0.3798, r = 0.2526, p = 0.0002]. Our findings revealed that the mean values of liver stiffness for all children on 2D-SWE and TE were almost identical, 3.72 ± 0.48 kPa versus 3.797 ± 0.4859 kPa.
Journal Article2020-04-29✓ 1 SnippetSugita D, Nakajima H, Kokubo Y, Takeura N, Yayama T, Matsumine A.
In-Text Gene Mentions
Results)
…of Ihh, Runx2,Sox6, and vascular endothelin…
Show Full Abstract
The pathomechanisms of initiation and progression of ossification of the posterior longitudinal ligament (OPLL) are unclear. Indian hedgehog (Ihh) and related signaling molecules are key factors in normal enchondral ossification. The purpose of this study is to investigate the contribution of mechanical strain to OPLL and the relationship of Ihh with OPLL. Sections of the posterior longitudinal ligament (PLL) were obtained from 49 patients with OPLL and from 7 patients without OPLL. Cultured PLL cells were subjected to 24 hours of cyclic tensile strain. To identify differentially expressed genes associated with cyclic tensile strain, microarray analysis was performed. Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis identified upregulation of various genes, particularly of the Hedgehog signaling pathway; Ihh and related genes had increased expression compared with controls after 24-hour cyclic tensile strain. In immunoblotting analysis, Ihh, Runx2, Sox9, Gli2, Gli3, and smoothened (SMO) had significantly increased expression after 6- or 12-hour cyclic tensile strain. OPLL samples were strongly immunopositive for Ihh, Sox9, Runx2, Gli2, Gli3, and SMO in the ossification front of OPLL. These results suggest that cyclic tensile strain induces abnormal activation of Ihh and related signaling molecules, and this might be important in the ossification process in OPLL.
Also flagged:GPRC6AG-protein coupled receptormetabolismmetabolic syndromeinsulinsecretion
Journal Article2020-04-29✓ 1 SnippetPi M, Xu F, Ye R, Nishimoto SK, Williams RW, Lu L, Darryl Quarles L.
In-Text Gene Mentions
Results)
…that glucose transporter-2 (solute carrier family 2, member A2carrier family 2,…
Show Full Abstract
GPRC6A is a widely expressed G-protein coupled receptor that regulates energy metabolism. Global deletion of Gprc6a in mice is reported to result in a metabolic syndrome-like phenotype and conditional deletion of Gprc6a in pancreatic β-cell and skeletal muscle respectively impair insulin secretion and glucose uptake. In the current study, we explore the hepatic functions of GPRC6A by conditionally deleting Gprc6a in hepatocytes by cross breeding Alb-Cre and Gprc6a<sup>flox/flox</sup> mice to obtain Gprc6a<sup>Liver-cko</sup> mice. Gprc6a<sup>Liver-cko</sup> mice on a normal diet showed excessive hepatic fat accumulation and glycogen depletion. These mice also exhibit impaired glucose and pyruvate tolerance, but normal insulin sensitivity. Decreased circulating FGF-21 levels and FGF-21 message expression in the liver were found in Gprc6a<sup>Liver-cko</sup> mice. Hepatic transcriptome analysis identified alterations in multiple pathways regulating glucose, fat and glycogen metabolism in Gprc6a<sup>Liver-cko</sup> mice. Taken together, our studies suggest that GPRC6A directly regulates hepatic metabolism as well as regulates the production and release of FGF-21 to control systemic energy homeostasis. GPRC6A's unique regulation of β-cell, skeletal muscle and hepatic function may represent a new therapeutic target for treating disordered energy metabolism metabolic syndrome and type 2 diabetes.
Also flagged:malariaglucose-6-phosphate dehydrogenaseinfectionshost cellG6PDG6PD deficiency
Journal Article2020-04-29✓ 1 SnippetGunalan K, Rowley EH, Miller LH.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Trager and Jensen established a method for culturing Plasmodium falciparum, a breakthrough for malaria research worldwide. Since then, multiple attempts to establish Plasmodium vivax in continuous culture have failed. Unlike P. falciparum, which can invade all aged erythrocytes, P. vivax is restricted to reticulocytes. Thus, a constant supply of reticulocytes is considered critical for continuous P. vivax growth in vitro. A critical question remains why P. vivax selectively invades reticulocytes? What do reticulocytes offer to P. vivax that is not present in mature erythrocytes? One possibility is protection from oxidative stress by glucose-6-phosphate dehydrogenase (G6PD). Here, we also suggest supplements to the media and procedures that may reduce oxidative stress and, as a result, establish a system for the continuous culture of P. vivax.
Corpus callosum dysgenesis (CCD) describes a collection of brain malformations in which the main fiber tract connecting the two hemispheres is either absent (complete CCD, or 'agenesis of the corpus callosum') or reduced in size (partial CCD). Humans with these neurodevelopmental disorders have a wide range of cognitive outcomes, including seemingly preserved features of interhemispheric communication in some cases. However, the structural substrates that could underlie this variability in outcome remain to be fully elucidated. Here, for the first time, we characterize the global brain connectivity of a mouse model of complete and partial CCD. We demonstrate features of structural brain connectivity that model those predicted in humans with CCD, including Probst bundles in complete CCD and heterotopic sigmoidal connections in partial CCD. Crucially, we also histologically validate the recently predicted ectopic sigmoid bundle present in humans with partial CCD, validating the utility of this mouse model for fine anatomical studies of this disorder. Taken together, this work describes a mouse model of altered structural connectivity in variable severity CCD and forms a foundation for future studies investigating the function and mechanisms of development of plastic tracts in developmental disorders of brain connectivity.
Also flagged:Gene ExpressionAutism Spectrum DisordersBisphenol Abrain developmentnucleusneurogenesis
Journal Article2020-04-29No SnippetsHenriksen AD, Andrade A, Harris EP, Rissman EF, Wolstenholme JT.
Show Full Abstract
Bisphenol A (BPA) is an endocrine-disrupting compound detected in the urine of more than 92% of humans, easily crosses the placental barrier, and has been shown to influence gene expression during fetal brain development. The purpose of this study was to investigate the effect of in utero BPA exposure on gene expression in the anterior hypothalamus, the basal nucleus of the stria terminalis (BNST), and hippocampus in C57BL/6 mice. Mice were exposed in utero to human-relevant doses of BPA, and then RNA sequencing was performed on male PND 28 tissue from whole hypothalamus (<i>n</i> = 3/group) that included the medial preoptic area (mPOA) and BNST to determine whether any genes were differentially expressed between BPA-exposed and control mice. A subset of genes was selected for further study using RT-qPCR on adult tissue from hippocampus to determine whether any differentially expressed genes (DEGs) persisted into adulthood. Two different RNA-Seq workflows indicated a total of 259 genes that were differentially expressed between BPA-exposed and control mice. Gene ontology analysis indicated that those DEGs were overrepresented in categories relating to mating, cell-cell signaling, behavior, neurodevelopment, neurogenesis, synapse formation, cognition, learning behaviors, hormone activity, and signaling receptor activity, among others. Ingenuity Pathway Analysis was used to interrogate novel gene networks and upstream regulators, indicating the top five upstream regulators as huntingtin, beta-estradiol, alpha-synuclein, <i>Creb1</i>, and estrogen receptor (ER)-alpha. In addition, 15 DE genes were identified that are suspected in autism spectrum disorders.
Also flagged:Gene expressiontranscription factorsPIWIbindingnucleotidesRNA polymerase II
Journal Article2020-04-29No SnippetsChetta M, Di Pietro L, Bukvic N, Lattanzi W.
Show Full Abstract
Gene expression regulation is achieved through an intricate network of molecular interactions, in which trans-acting transcription factors (TFs) and small noncoding RNAs (sncRNAs), including microRNAs (miRNAs) and PIWI-interacting RNAs (piRNAs), play a key role. Recent observations allowed postulating an interplay between TFs and sncRNAs, in that they may possibly share DNA-binding sites. The aim of this study was to analyze the complete subset of miRNA and piRNA sequences stored in the main databases in order to identify the occurrence of conserved motifs and subsequently predict a possible innovative interplay with TFs at a transcriptional level. To this aim, we adopted an original in silico workflow to search motifs and predict interactions within genome-scale regulatory networks. Our results allowed categorizing miRNA and piRNA motifs, with corresponding TFs sharing complementary DNA-binding motifs. The biological interpretation of the gene ontologies of the TFs permitted observing a selective enrichment in developmental pathways, allowing the distribution of miRNA motifs along a topological and chronological frame. In addition, piRNA motifs were categorized for the first time and revealed specific functional implications in somatic tissues. These data might pose experimental hypotheses to be tested in biological models, towards clarifying novel in gene regulatory routes.
Also flagged:MedulloblastomasMedulloblastomabrain tumorbrain tumorstumorslocalization
Journal Article2020-04-29No SnippetsVisani M, Marucci G, Biase D, Giangaspero F, Buttarelli FR, Brandes AA, Franceschi E, Acquaviva G, Ciarrocchi A, Rhoden KJ, Tallini G, Pession A.
Show Full Abstract
Medulloblastoma is a highly aggressive brain tumor that typically affects children, while in adults it represents ~1% of all brain tumors. Little is known about microRNA expression profile of the rare adult medulloblastoma. The main aim of this study was to identify peculiar differences in microRNA expression between childhood and adult medulloblastoma. Medulloblastomas were profiled for microRNA expression using the Exiqon Human miRNome panel (I + II) analyzing 752 microRNAs in a training set of six adult and six childhood cases. Then, the most differentially expressed microRNAs were validated in a total of 21 adult and 19 childhood cases. Eight microRNAs (miR-196b-5p, miR-183-5p, miR-200b-3p, miR-196a-5p, miR-193a-3p, miR-29c-3p, miR-33b-5p, and miR-200a-3p) were differentially expressed in medulloblastoma of adults and children. Analysis of the validation set confirmed that miR-196b-5p and miR-200b-3p were significantly overexpressed in medulloblastoma of adults as compared with those of children. We followed an in silico approach to investigate direct targets and the pathways involved for the two microRNAs (miR-196b and miR-200b) differently expressed between adult and childhood medulloblastoma. Adult and childhood medulloblastoma have different miRNA expression profiles. In particular, the differential dysregulation of miR-196b-5p and miR-200b-3p characterizes the miRNA profile of adult medulloblastoma and suggests potential targets for novel diagnostic, prognostic, or therapeutic strategies.
Also flagged:liver fibrosispathogenesisHepatic Fibrosisextracellularchemokinespeptide
Journal Article2020-04-29No SnippetsWeiskirchen R.
Show Full Abstract
This Special issue contains 48 contributions highlighting novel findings and current concepts in basic and clinical liver fibrosis research. These articles emphasize issues on pathogenesis, cellular mediators, modulators, molecular pathways, disease-specific therapies, scoring systems, as well as novel preclinical animal models for the study of liver fibrogenesis. This editorial aims to briefly summarize the content of these papers.
Also flagged:CelecoxibDoxorubicincancerP-glycoproteinPgpdiffuse large B-cell lymphoma
Journal Article2020-04-29✓ 1 SnippetKarai E, Szebényi K, Windt T, Fehér S, Szendi E, Dékay V, Vajdovich P, Szakács G, Füredi A.
In-Text Gene Mentions
Discussion)
…rely on thechromatin modifiermodifier protein BRD4,…
Show Full Abstract
<h4>Background</h4>Treatment of malignancies is still a major challenge in human and canine cancer, mostly due to the emergence of multidrug resistance (MDR). One of the main contributors of MDR is the overexpression P-glycoprotein (Pgp), which recognizes and extrudes various chemotherapeutics from cancer cells.<h4>Methods</h4>To study mechanisms underlying the development of drug resistance, we established an in vitro treatment protocol to rapidly induce Pgp-mediated MDR in cancer cells. Based on a clinical observation showing that a 33-day-long, unplanned drug holiday can reverse the MDR phenotype of a canine diffuse large B-cell lymphoma patient, our aim was to use the established assay to prevent the emergence of drug resistance in the early stages of treatment.<h4>Results</h4>We showed that an in vitro drug holiday results in the decrease of Pgp expression in MDR cell lines. Surprisingly, celecoxib, a known COX-2 inhibitor, prevented the emergence of drug-induced MDR in murine and canine lymphoma cell lines.<h4>Conclusions</h4>Our findings suggest that celecoxib could significantly improve the efficiency of chemotherapy by preventing the development of MDR in B-cell lymphoma.
Also flagged:terpenoidstanninsalkaloidshydroxycinnamic acidphenylpropanoidschlorogenic acids
Journal Article2020-04-29✓ 4 SnippetsRamabulana AT, Steenkamp P, Madala N, Dubery IA.
In-Text Gene Mentions
Discussion)
…hydroxycinnamoyl transferase (HTT), an enzyme responsible…
Discussion)
…the localization ofHTTin the chloroplast…
Discussion)
…to localization ofHTT.…
Discussion)
…by the enzymeHTTas mentioned above…
Show Full Abstract
<i>Bidens pilosa</i> is an edible herb from the Asteraceae family which is traditionally consumed as a leafy vegetable. <i>B. pilosa</i> has many bioactivities owing to its diverse phytochemicals, which include aliphatics, terpenoids, tannins, alkaloids, hydroxycinnamic acid (HCA) derivatives and other phenylpropanoids. The later include compounds such as chlorogenic acids (CGAs), which are produced as either <i>regio</i>- or geometrical isomers. To profile the CGA composition of <i>B. pilosa</i>, methanol extracts from tissues, callus and cell suspensions were utilized for liquid chromatography coupled to mass spectrometric detection (UHPLC-QTOF-MS/MS). An optimized in-source collision-induced dissociation (ISCID) method capable of discriminating between closely related HCA derivatives of quinic acids, based on MS-based fragmentation patterns, was applied. Careful control of collision energies resulted in fragment patterns similar to MS<sup>2</sup> and MS<sup>3</sup> fragmentation, obtainable by a typical ion trap MS<sup>n</sup> approach. For the first time, an ISCID approach was shown to efficiently discriminate between positional isomers of chlorogenic acids containing two different cinnamoyl moieties, such as a mixed <i>di-</i>ester of feruloyl-caffeoylquinic acid (<i>m/z</i> 529) and coumaroyl-caffeoylquinic acid (<i>m/z</i> 499). The results indicate that tissues and cell cultures of <i>B. pilosa</i> contained a combined total of 30 <i>mono-</i>, <i>di-,</i> and <i>tri-</i>substituted chlorogenic acids with positional isomers dominating the composition thereof. In addition, the tartaric acid esters, caftaric- and chicoric acids were also identified. Profiling revealed that these HCA derivatives were differentially distributed across tissues types and cell culture lines derived from leaf and stem explants.
Also flagged:ccRCCClear-cell renal cell carcinomaRCCtumorcell exhaustioncancer
Journal Article2020-04-29✓ 1 SnippetHu J, Chen Z, Bao L, Zhou L, Hou Y, Liu L, Xiong M, Zhang Y, Wang B, Tao Z, Chen K.
In-Text Gene Mentions
I A O 0000326)
…PLCL1…
Show Full Abstract
Clear-cell renal cell carcinoma (ccRCC) is the most common histological type of RCC. To investigate the intratumoral heterogeneity of ccRCC, we analyzed single-cell RNA-sequencing data and identified 15 major cell types, along with 39 subgroups of cells derived from tumor or non-malignant tissues, and confirmed their presence by immunofluorescence staining in tissue chips. In this study, we verified that T cell exhaustion was the key factor responsible for the immunosuppressive property of ccRCC tissues, which was significantly related to poor prognosis. We also found that abnormal metabolic patterns occurred not only in cancer cells, but also in tumor-infiltrating stromal cells. Based on the fraction of each cell cluster detected by CIBERSORTx, 533 patients from The Cancer Genome Atlas (TCGA) KIRC dataset were divided into three groups. One group, which showed a lesser proportion of activated CD8<sup>+</sup> cells and greater proportion of exhausted CD8<sup>+</sup> cells, was associated with a poor prognosis. Hence, the blockade of immunosuppressive checkpoints, not only PD-1, but also LAG3, TIM-3, and other inhibitory checkpoints, could serve as a potential target for ccRCC immunotherapy. Our work will further the understanding of the heterogeneity among ccRCC tissues and provide novel strategies for treating ccRCC.
γδ T cells are a subset of T cells with attributes of both the innate and adaptive arms of the immune system. These cells have long been an enigmatic and poorly understood component of the immune system and many have viewed them as having limited importance in host defense. This perspective persisted for some time both because of critical gaps in knowledge regarding how the development of γδ T cells is regulated and because of the lack of effective and sophisticated approaches through which the function of γδ T cells can be manipulated. Here, we discuss the recent advances in both of these areas, which have brought the importance of γδ T cells in both productive and pathologic immune function more sharply into focus.
Also flagged:Cystic FibrosisCFCFTRzinc-finger nucleaseschromatinAna
Journal Article2020-04-29✓ 1 SnippetSuzuki S, Crane AM, Anirudhan V, Barillà C, Matthias N, Randell SH, Rab A, Sorscher EJ, Kerschner JL, Yin S, Harris A, Mendel M, Kim K, Zhang L, Conway A, Davis BR.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
There is a strong rationale to consider future cell therapeutic approaches for cystic fibrosis (CF) in which autologous proximal airway basal stem cells, corrected for CFTR mutations, are transplanted into the patient's lungs. We assessed the possibility of editing the CFTR locus in these cells using zinc-finger nucleases and have pursued two approaches. The first, mutation-specific correction, is a footprint-free method replacing the CFTR mutation with corrected sequences. We have applied this approach for correction of ΔF508, demonstrating restoration of mature CFTR protein and function in air-liquid interface cultures established from bulk edited basal cells. The second is targeting integration of a partial CFTR cDNA within an intron of the endogenous CFTR gene, providing correction for all CFTR mutations downstream of the integration and exploiting the native CFTR promoter and chromatin architecture for physiologically relevant expression. Without selection, we observed highly efficient, site-specific targeted integration in basal cells carrying various CFTR mutations and demonstrated restored CFTR function at therapeutically relevant levels. Significantly, Omni-ATAC-seq analysis revealed minimal impact on the positions of open chromatin within the native CFTR locus. These results demonstrate efficient functional correction of CFTR and provide a platform for further ex vivo and in vivo editing.
Also flagged:Cyclooxygenase 2Colorectal cancercancerCOX-2synthesisprostaglandins
Journal Article2020-04-29No SnippetsHidalgo-Estévez AM, Stamatakis K, Jiménez-Martínez M, López-Pérez R, Fresno M.
Show Full Abstract
Colorectal cancer (CRC) is one of the most common and recurrent types of cancer, with high mortality rates. Several clinical trials and meta-analyses have determined that the use of pharmacological inhibitors of cyclooxygenase 2 (COX-2), the enzyme that catalyses the rate-limiting step in the synthesis of prostaglandins (PG) from arachidonic acid, can reduce the incidence of CRC as well as the risk of recurrence of this disease, when used together with commonly used chemotherapeutic agents. These observations suggest that inhibition of COX-2 may be useful in the treatment of CRC, although the current drugs targeting COX-2 are not widely used since they increase the risk of health complications. To overcome this difficulty, a possibility is to identify genes regulated by COX-2 activity that could give an advantage to the cells to form tumors and/or metastasize. The modulation of those genes as effectors of COX-2 may cancel the beneficial effects of COX-2 in tumor transformation and metastasis. A review of the available databases and literature and our own data have identified some interesting molecules induced by prostaglandins or COX-2 that have been also described to play a role in colon cancer, being thus potential pharmacological targets in colon cancer. Among those mPGES-1, DUSP4, and 10, Programmed cell death 4, Trop2, and many from the TGFβ and p53 pathways have been identified as genes upregulated in response to COX-2 overexpression or PGs in colon carcinoma lines and overexpressed in colon tumor tissue. Here, we review the available evidence of the potential roles of those molecules in colon cancer in the context of PG/COX signaling pathways that could be critical mediators of some of the tumor growth and metastasis advantage induced by COX-2. At the end, this may allow defining new therapeutic targets/drugs against CRC that could act specifically against tumor cells and would be effective in the prevention and treatment of CRC, lacking the unwanted side effects of COX-2 pharmacological inhibitors, providing alternative approaches in colon cancer.
Also flagged:neurodegenerative disorderscell cyclebrainAPPGAPDHACTH
Journal Article2020-04-29No SnippetsUeberham U, Arendt T.
Show Full Abstract
Recent evidence indicates that genomic individuality of neurons, characterized by DNA-content variation, is a common if not universal phenomenon in the human brain that occurs naturally but can also show aberrancies that have been linked to the pathomechanism of Alzheimer's disease and related neurodegenerative disorders. Etiologically, this genomic mosaic has been suggested to arise from defects of cell cycle regulation that may occur either during brain development or in the mature brain after terminal differentiation of neurons. Here, we aim to draw attention towards another mechanism that can give rise to genomic individuality of neurons, with far-reaching consequences. This mechanism has its origin in the transcriptome rather than in replication defects of the genome, i.e., somatic gene recombination of RNA. We continue to develop the concept that somatic gene recombination of RNA provides a physiological process that, through integration of intronless mRNA/ncRNA into the genome, allows a particular functional state at the level of the individual neuron to be indexed. By insertion of defined RNAs in a somatic recombination process, the presence of specific mRNA transcripts within a definite temporal context can be "frozen" and can serve as an index that can be recalled at any later point in time. This allows information related to a specific neuronal state of differentiation and/or activity relevant to a memory trace to be fixed. We suggest that this process is used throughout the lifetime of each neuron and might have both advantageous and deleterious consequences.
Also flagged:Long-chain specific acyl-CoA dehydrogenaseACADLtransmembrane protein 251TMEM251dehydrogenase/reductase SDR family protein 7-likeDhrs7
Journal Article2020-04-29✓ 2 SnippetsChen Y, Li Y, Zhan Y, Hu W, Sun J, Zhang W, Song J, Li D, Chang Y.
In-Text Gene Mentions
Abstract)
…protein 7 (IGFBP-7),CDK5 regulatory subunit-associated protein 1regulatory subunit-associated …
Abstract)
…subunit-associated protein 1 (CDK5RAP1), visual pigment-like recepto…
Show Full Abstract
To investigate the adaptability of Apostichopus japonicus (A. japonicus) strain "Anyuan No. 1" in the South China Sea, field monitoring and microRNA-mRNA integrated analyses were conducted between "Anyuan No. 1" and a regular A. japonicus population from Wendeng (Shandong Province, as a control) in the Xiapu farming area in Fujian Province, China. The results showed that "Anyuan No. 1" exhibited greater body weight increase and a higher number of papillae compared to the control during two and a half months of field monitoring. Comparative microRNA (miRNA) and mRNA transcriptome analyses identified 12 differentially expressed miRNAs (DEMs) and 165 differentially expressed genes (DEGs) in "Anyuan No. 1" compared to the control. Long-chain specific acyl-CoA dehydrogenase (ACADL), transmembrane protein 251 (TMEM251), dehydrogenase/reductase SDR family protein 7-like (Dhrs7), insulin-like growth factor-binding protein 7 (IGFBP-7), CDK5 regulatory subunit-associated protein 1 (CDK5RAP1), visual pigment-like receptor peropsin, 39S ribosomal protein, miR-10, miR-153, miR-7, and miR-3529 were identified as gene and miRNA candidates correlated with superior economic traits in "Anyuan No. 1". Collectively, "Anyuan No. 1" is suitable for large-scale cultivation extension due to its better adaptability to the South China Sea area. Furthermore, we identified "miR10-ACADL" as a potential module for further molecular marker-assisted selective breeding of A. japonicus.
Also flagged:mitochondrialDNA depletion syndromeDNA depletion syndrome-13MTDPS13mitochondrial disease
Journal Article2020-04-29✓ 3 SnippetsYuan F, Wang C, Xi J, Wang S, Lin L, Wang Y, Wang A, Wang C, Luo X, Xu Q, Yin R, Cheng H, Zhang Y, Sun X, Chen Y.
In-Text Gene Mentions
Abstract)
…Mitochondrial DNA depletion syndrome-13 (MTDPS13) is a rare autosomal recessive mitochondrial disease caused by mutations in the FBXL4 (F-box and leucine-rich repeat protein 4) gene.…
Abstract)
…mutations in theFBXL4(F-box and leucine-rich…
Abstract)
…in the FBXL4 (F-box and leucine-rich repeat protein 4and leucine-rich repeat…
Show Full Abstract
Mitochondrial DNA depletion syndrome-13 (MTDPS13) is a rare autosomal recessive mitochondrial disease caused by mutations in the FBXL4 (F-box and leucine-rich repeat protein 4) gene. Using Sendai virus-mediated reprogramming, we established an induced pluripotent stem cell (iPSC) line from PBMCs collected from a one-year-old female patient with MTDPS13. The iPSCs were stable during amplification, expressed pluripotent genes, maintained a normal karyotype, and showed characteristics of the three germs layers in an in vitro differentiation assay.
Also flagged:Acute Coronary Syndromeunstable angina pectorisacute myocardial infarctionpathogenesiscardiovascular diseasesnucleus
Journal Article2020-04-29✓ 1 SnippetLin F, Yang Y, Guo Q, Xie M, Sun S, Wang X, Li D, Zhang G, Li M, Wang J, Zhao G.
In-Text Gene Mentions
Discussion)
…UTY, KDM5D, USP9Y,MRPL39, ABCA5, and CCT8…
Show Full Abstract
<h4>Background</h4>With the development of biological technology, biomarkers for the prevention and diagnosis of acute coronary syndrome (ACS) have become increasingly evident. However, the study of novel circular RNAs (circRNAs) in ACS is still in progress. This study aimed to investigate whether the regulation of circRNA-miRNA networks is involved in ACS pathogenesis.<h4>Methods</h4>We used microarray analysis to detect significantly expressed circRNAs and miRNAs in the peripheral blood of patients in the control group (CG) and ACS groups, including an unstable angina pectoris (UAP) group and an acute myocardial infarction (AMI) group. A circRNA-miRNA interaction network analysis was carried out with open-source bioinformatics. The gene ontology (GO), pathway, and disease enrichment analyses for differentially expressed circRNAs were further analysed with hierarchical clustering.<h4>Results</h4>A total of 266 circRNAs (121 upregulated and 145 downregulated, <i>P</i> < 0.05, fold change FC ≥2) and 3 miRNAs (1 upregulated and 2 downregulated, <i>P</i> < 0.05, FC ≥ 1.2) were differentially expressed in the ACS groups compared with those in the CG. In addition, among these expressed circRNAs and miRNAs, a single circRNA could bind to more than 1-100 miRNAs, and vice versa. Next, an AMI-UAP network, an AMI-CG network, a UAP-CG network, and an AMI-CG-UAP network were constructed. The top 30 enriched GO terms among the three groups were emphasized as differentially expressed. Disease enrichment analysis showed that these differentially expressed circRNAs are involved in the pathogenesis of cardiovascular diseases. KEGG pathway analysis was performed to identify pathways associated with circRNAs targeting mRNAs.<h4>Conclusion</h4>CircRNAs are closely related to the pathological process of ACS via a mechanism that may be related to the up- or down-regulation of circRNAs and miRNAs and circRNA-miRNA coexpression. The metabolic pathways, signalling pathways, and diseases affected by these circRNAs can be predicted by enrichment analysis.
Journal Article2020-04-29✓ 3 SnippetsWang H, Yang J, Schneider JA, De Jager PL, Bennett DA, Zhang HY.
In-Text Gene Mentions
Text
…hemochromatosis…
Text
…HFE…
Text
…DCC…
Show Full Abstract
Genome-wide association studies have identified many loci associated with Alzheimer's dementia. However, these variants only explain part of the heritability of Alzheimer's disease (AD). As genetic epistasis can be a major contributor to the "missing heritability" of AD, we conducted genome-wide epistasis screening for AD pathologies in 2 independent cohorts. First, we performed a genome-wide epistasis study of AD-related brain pathologies (N<sub>max</sub> = 1318) in ROS/MAP. Candidate interactions were validated using cerebrospinal fluid biomarkers of AD in ADNI (N<sub>max</sub> = 1128). Further functional analysis tested the association of candidate interactions with neuroimaging phenotypes. For tau and amyloid-β pathology, we identified 2803 and 464 candidate SNP-SNP interactions, respectively. Associations of candidate SNP-SNP interactions with brain volume and white matter changes from neuroimages provides additional insights into their molecular functions. Transcriptional analysis supported possible gene-gene interactions identified by statistical screening through their co-expression in the brain. In summary, we outlined an exhaustive epistasis analysis to identify novel genetic interactions with potential roles in AD pathologies. We further delved into the functional relevance of candidate interactions by association with neuroimaging phenotypes and analysis of co-expression between corresponding gene pairs.
Calcaneal tendon injuries are extremely common in the general population and in orthopedics routine care. Its increasing incidence, which is motivated by an aging population, improved access to the health care system, increased prescription of continuous-use medication, erratic participation in sports and other factors, has had a direct impact on society. Consolidated treatment options for tendinopathies lack quality scientific support for many modalities. New therapies have emerged to enhance nonsurgical approach outcomes and to reduce the number of patients requiring surgery. Although these operative procedures provide good pain relief and functional outcomes, they are costly and may lead to complications.
medRxiv2020-04-29Preprint (No Snippets API)Carr E, Bendayan R, Bean D, Stammers M, Wang W, Zhang H, Searle T, Searle T, Kraljevic Z, Shek A, Phan HTT, Muruet W, Gupta RK, Shinton AJ, Wyatt M, Shi T, Zhang X, Pickles A, Stahl D, Zakeri R, Noursadeghi M, O’Gallagher K, Rogers M, Folarin A, Bourdeaux C, McWilliams C, Roguski L, Borca F, Batchelor J, Wu X, Sun J, Pinto A, Guthrie B, Breen C, Douiri A, Wu H, Curcin V, Teo JT, Shah AM, Dobson RJB.
Show Full Abstract
<h4>Background</h4> The National Early Warning Score (NEWS2) is currently recommended in the United Kingdom for risk stratification of COVID outcomes, but little is known about its ability to detect severe cases. We aimed to evaluate NEWS2 for severe COVID outcome and identify and validate a set of routinely-collected blood and physiological parameters taken at hospital admission to improve the score. <h4>Methods</h4> Training cohorts comprised 1276 patients admitted to King’s College Hospital NHS Foundation Trust with COVID-19 disease from 1 st March to 30 th April 2020. External validation cohorts included 5037 patients from four UK NHS Trusts (Guys and St Thomas’ Hospitals, University Hospitals Southampton, University Hospitals Bristol and Weston NHS Foundation Trust, University College London Hospitals), and two hospitals in Wuhan, China (Wuhan Sixth Hospital and Taikang Tongji Hospital). The outcome was severe COVID disease (transfer to intensive care unit or death) at 14 days after hospital admission. Age, physiological measures, blood biomarkers, sex, ethnicity and comorbidities (hypertension, diabetes, cardiovascular, respiratory and kidney diseases) measured at hospital admission were considered in the models. <h4>Results</h4> A baseline model of ‘NEWS2 + age’ had poor-to-moderate discrimination for severe COVID infection at 14 days (AUC in training sample = 0.700; 95% CI: 0.680, 0.722; Brier score = 0.192; 95% CI: 0.186, 0.197). A supplemented model adding eight routinely-collected blood and physiological parameters (supplemental oxygen flow rate, urea, age, oxygen saturation, CRP, estimated GFR, neutrophil count, neutrophil/lymphocyte ratio) improved discrimination (AUC = 0.735; 95% CI: 0.715, 0.757) and these improvements were replicated across five UK and non-UK sites. However, there was evidence of miscalibration with the model tending to underestimate risks in most sites. <h4>Conclusions</h4> NEWS2 score had poor-to-moderate discrimination for medium-term COVID outcome which raises questions about its use as a screening tool at hospital admission. Risk stratification was improved by including readily available blood and physiological parameters measured at hospital admission, but there was evidence of miscalibration in external sites. This highlights the need for a better understanding of the use of early warning scores for COVID. <h4>K ey messages </h4> The National Early Warning Score (NEWS2), currently recommended for stratification of severe COVID-19 disease in the UK, showed poor-to-moderate discrimination for medium-term outcomes (14-day transfer to ICU or death) among COVID-19 patients. Risk stratification was improved by the addition of routinely-measured blood and physiological parameters routinely at hospital admission (supplemental oxygen, urea, oxygen saturation, CRP, estimated GFR, neutrophil count, neutrophil/lymphocyte ratio) which provided moderate improvements in a risk stratification model for 14-day ICU/death. This improvement over NEWS2 alone was maintained across multiple hospital trusts but the model tended to be miscalibrated with risks of severe outcomes underestimated in most sites. We benefited from existing pipelines for informatics at KCH such as CogStack that allowed rapid extraction and processing of electronic health records. This methodological approach provided rapid insights and allowed us to overcome the complications associated with slow data centralisation approaches.
…We separately compared samples with expansions in FXN (FRDA), DMPK (DM1), HTT (HD), or FMR1 (FXS) genes (cases) against a control cohort of 150 unrelated Coriell samples of African, European, and East Asian ancestry [37].…
Results)
…(FRDA), DMPK (DM1),HTT(HD), or FMR1…
Results)
…, DMPK ,HTT, and FMR1…
Show Full Abstract
Repeat expansions are responsible for over 40 monogenic disorders, and undoubtedly more pathogenic repeat expansions remain to be discovered. Existing methods for detecting repeat expansions in short-read sequencing data require predefined repeat catalogs. Recent discoveries emphasize the need for methods that do not require pre-specified candidate repeats. To address this need, we introduce ExpansionHunter Denovo, an efficient catalog-free method for genome-wide repeat expansion detection. Analysis of real and simulated data shows that our method can identify large expansions of 41 out of 44 pathogenic repeats, including nine recently reported non-reference repeat expansions not discoverable via existing methods.
Also flagged:immune responsesmethyladenosinecancerbindingRNA-binding proteinRBP
Journal Article2020-04-28✓ 1 SnippetWu W, Ji P, Zhao F.
In-Text Gene Mentions
Methods)
…datasets, including CIRI2,DCC, find_circ, and CIRCexplorer2…
Show Full Abstract
Existing circular RNA (circRNA) databases have become essential for transcriptomics. However, most are unsuitable for mining in-depth information for candidate circRNA prioritization. To address this, we integrate circular transcript collections to develop the circAtlas database based on 1070 RNA-seq samples collected from 19 normal tissues across six vertebrate species. This database contains 1,007,087 highly reliable circRNAs, of which over 81.3% have been assembled into full-length sequences. We profile their expression pattern, conservation, and functional annotation. We describe a novel multiple conservation score, co-expression, and regulatory networks for circRNA annotation and prioritization. CircAtlas can be accessed at http://circatlas.biols.ac.cn/.
The cyclic GMP-AMP synthase (cGAS) protein is a pattern-recognition receptor of the mammalian innate immune system that is recognized as a main cytosolic sensor of pathogenic or damaged DNA. cGAS DNA binding initiates catalytic production of the second messenger, cyclic GMP-AMP, which activates the STING-TBK1-IRF3 signaling axis to induce cytokine expression. Post-translational modification (PTM) has started to be recognized as a critical component of cGAS regulation, yet the extent of these modifications remains unclear. Here, we report the identification and functional analysis of cGAS phosphorylations and acetylations in several cell types under basal and immune-stimulated conditions. cGAS was enriched by immunoaffinity purification from human primary fibroblasts prior to and after infection with herpes simplex virus type 1 (HSV-1), as well as from immune-stimulated STING-HEK293T cells. Six phosphorylations and eight acetylations were detected, of which eight PTMs were not previously documented. PTMs were validated by parallel reaction monitoring (PRM) mass spectrometry in fibroblasts, HEK293T cells, and THP-1 macrophage-like cells. Primary sequence and structural analysis of cGAS highlighted a subset of PTM sites with elevated surface accessibility and high evolutionary sequence conservation. To assess the functional relevance of each PTM, we generated a series of single-point cGAS mutations. Stable cell lines were constructed to express cGAS with amino acid substitutions that prevented phosphorylation (Ser-to-Ala) and acetylation (Lys-to-Arg) or that mimicked the modification state (Ser-to-Asp and Lys-to-Gln). cGAS-dependent apoptotic and immune signaling activities were then assessed for each mutation. Our results show that acetyl-mimic mutations at Lys384 and Lys414 inhibit the ability of cGAS to induce apoptosis. In contrast, the Lys198 acetyl-mimic mutation increased cGAS-dependent interferon signaling when compared with the unmodified charge-mimic. Moreover, targeted PRM quantification showed that Lys198 acetylation is decreased upon infections with two herpesviruses-HSV-1 and human cytomegalovirus (HCMV), highlighting this residue as a regulatory point during virus infection.
Also flagged:TFGRETPapillary thyroid cancerPTCtumourRAS
Journal Article2020-04-28No SnippetsKrishnan A, Berthelet J, Renaud E, Rosigkeit S, Distler U, Stawiski E, Wang J, Modrusan Z, Fiedler M, Bienz M, Tenzer S, Schad A, Roth W, Thiede B, Seshagiri S, Musholt TJ, Rajalingam K.
Show Full Abstract
Papillary thyroid cancer (PTC) is the most common type of endocrine malignancy. By RNA-seq analysis, we identify a RET rearrangement in the tumour material of a patient who does not harbour any known RAS or BRAF mutations. This new gene fusion involves exons 1-4 from the 5' end of the Trk fused Gene (TFG) fused to the 3' end of RET tyrosine kinase leading to a TFG-RET fusion which transforms immortalized human thyroid cells in a kinase-dependent manner. TFG-RET oligomerises in a PB1 domain-dependent manner and oligomerisation of TFG-RET is required for oncogenic transformation. Quantitative proteomic analysis reveals the upregulation of E3 Ubiquitin ligase HUWE1 and DUBs like USP9X and UBP7 in both tumor and metastatic lesions, which is further confirmed in additional patients. Expression of TFG-RET leads to the upregulation of HUWE1 and inhibition of HUWE1 significantly reduces RET-mediated oncogenesis.
DNA glycosylases are enzymes that initiate the base excision repair pathway, a major biochemical process that protects the genomes of all living organisms from intrinsically and environmentally inflicted damage. Recently, base excision repair inhibition proved to be a viable strategy for the therapy of tumors that have lost alternative repair pathways, such as BRCA-deficient cancers sensitive to poly(ADP-ribose)polymerase inhibition. However, drugs targeting DNA glycosylases are still in development and so far have not advanced to clinical trials. In this review, we cover the attempts to validate DNA glycosylases as suitable targets for inhibition in the pharmacological treatment of cancer, neurodegenerative diseases, chronic inflammation, bacterial and viral infections. We discuss the glycosylase inhibitors described so far and survey the advances in the assays for DNA glycosylase reactions that may be used to screen pharmacological libraries for new active compounds.
Hematopoietic stem cells (HSCs) are responsible for the production of blood cells throughout the human lifespan. Single HSCs can give rise to at least eight distinct blood-cell lineages. Together, hematopoiesis, erythropoiesis, and angiogenesis coordinate several biological processes, i.e., cellular interactions during development and proliferation, guided migration, lineage programming, and reprogramming by transcription factors. Any dysregulation of these processes can result in hematological disorders and/or malignancies. Several studies of the molecular mechanisms governing HSC maintenance have demonstrated that protein regulation by the ubiquitin proteasomal pathway is crucial for normal HSC function. Recent studies have shown that reversal of ubiquitination by deubiquitinating enzymes (DUBs) plays an equally important role in hematopoiesis; however, information regarding the biological function of DUBs is limited. In this review, we focus on recent discoveries about the physiological roles of DUBs in hematopoiesis, erythropoiesis, and angiogenesis and discuss the DUBs associated with common hematological disorders and malignancies, which are potential therapeutic drug targets.
Also flagged:Cancerdeathsplicing factor 3B subunit 1SF3B1p14Splicing
Journal Article2020-04-28No SnippetsSamy A, Suzek BE, Ozdemir MK, Sensoy O.
Show Full Abstract
Cancer is the second leading cause of death worldwide. The etiology of the disease has remained elusive, but mutations causing aberrant RNA splicing have been considered one of the significant factors in various cancer types. The association of aberrant RNA splicing with drug/therapy resistance further increases the importance of these mutations. In this work, the impact of the splicing factor 3B subunit 1 (SF3B1) K700E mutation, a highly prevalent mutation in various cancer types, is investigated through molecular dynamics simulations. Based on our results, K700E mutation increases flexibility of the mutant SF3B1. Consequently, this mutation leads to i) disruption of interaction of pre-mRNA with SF3B1 and p14, thus preventing proper alignment of mRNA and causing usage of abnormal 3' splice site, and ii) disruption of communication in critical regions participating in interactions with other proteins in pre-mRNA splicing machinery. We anticipate that this study enhances our understanding of the mechanism of functional abnormalities associated with splicing machinery, thereby, increasing possibility for designing effective therapies to combat cancer at an earlier stage.
Journal Article2020-04-28No SnippetsKarchuganova E, Bakulina O, Dar'in D, Krasavin M.
Show Full Abstract
A novel approach to indolo[3,2-<i>c</i>]isoquinoline and dibenzo[<i>c</i>,<i>h</i>][1,6]naphthyridine tetracyclic systems was discovered based on switchable reduction of 2-methoxy-3-(2-nitrophenyl)-1-oxo-1,2,3,4-tetrahydroisoquinoline-4-carboxylic acid prepared via Castagnoli-Cushman reaction. Reduction with ammonium formate resulted in the expected selective transformation of the nitro group (thus providing access to substituted dibenzo[<i>c</i>,<i>h</i>][1,6]naphthyridine via cyclization and dehydrogenation). However, attempted reduction with sodium sulfide initiated a previously unknown reaction cascade including double reduction, cyclization, and decarboxylation, leading to formation of indolo[3,2-<i>c</i>]isoquinoline polyheterocycle in one synthetic step.
Also flagged:Gene ExpressiondeathpolymeraseIL1R2CD177RETN
Journal Article2020-04-28✓ 5 SnippetsMartínez-Paz P, Aragón-Camino M, Gómez-Sánchez E, Lorenzo-López M, Gómez-Pesquera E, López-Herrero R, Sánchez-Quirós B, de la Varga O, Tamayo-Velasco Á, Ortega-Loubon C, García-Morán E, Gonzalo-Benito H, Heredia-Rodríguez M, Tamayo E.
In-Text Gene Mentions
Discussion)
…Previous work has reported OLFM4 gene expression as a biomarker for sepsis diagnosis [19]; however, this work compared postsurgical septic patients versus postsurgical control patients, who did not show any signs or symptoms.…
Abstract)
…RETN , andOLFM4genes were upregulated…
Methods)
…microarray analysis, genesOLFM4, CD177 ,…
Results)
…OLFM4, CD177 ,…
Results)
…OLFM4showed the highest…
Show Full Abstract
Nowadays, mortality rates in intensive care units are the highest of all hospital units. However, there is not a reliable prognostic system to predict the likelihood of death in patients with postsurgical shock. Thus, the aim of the present work is to obtain a gene expression signature to distinguish the low and high risk of death in postsurgical shock patients. In this sense, mRNA levels were evaluated by microarray on a discovery cohort to select the most differentially expressed genes between surviving and non-surviving groups 30 days after the operation. Selected genes were evaluated by quantitative real-time polymerase chain reaction (qPCR) in a validation cohort to validate the reliability of data. A receiver-operating characteristic analysis with the area under the curve was performed to quantify the sensitivity and specificity for gene expression levels, which were compared with predictions by established risk scales, such as acute physiology and chronic health evaluation (APACHE) and sequential organ failure assessment (SOFA). <i>IL1R2</i>, <i>CD177</i>, <i>RETN</i>, and <i>OLFM4</i> genes were upregulated in the non-surviving group of the discovery cohort, and their predictive power was confirmed in the validation cohort. This work offers new biomarkers based on transcriptional patterns to classify the postsurgical shock patients according to low and high risk of death. The results present more accuracy than other mortality risk scores.
Also flagged:Neurodegenerative diseasesneurological disordersneurotrophic factorsADPDHD
Journal Article2020-04-28No SnippetsDe Gioia R, Biella F, Citterio G, Rizzo F, Abati E, Nizzardo M, Bresolin N, Comi GP, Corti S.
Show Full Abstract
Neurodegenerative diseases are disabling and fatal neurological disorders that currently lack effective treatment. Neural stem cell (NSC) transplantation has been studied as a potential therapeutic approach and appears to exert a beneficial effect against neurodegeneration via different mechanisms, such as the production of neurotrophic factors, decreased neuroinflammation, enhanced neuronal plasticity and cell replacement. Thus, NSC transplantation may represent an effective therapeutic strategy. To exploit NSCs' potential, some of their essential biological characteristics must be thoroughly investigated, including the specific markers for NSC subpopulations, to allow profiling and selection. Another key feature is their secretome, which is responsible for the regulation of intercellular communication, neuroprotection, and immunomodulation. In addition, NSCs must properly migrate into the central nervous system (CNS) and integrate into host neuronal circuits, enhancing neuroplasticity. Understanding and modulating these aspects can allow us to further exploit the therapeutic potential of NSCs. Recent progress in gene editing and cellular engineering techniques has opened up the possibility of modifying NSCs to express select candidate molecules to further enhance their therapeutic effects. This review summarizes current knowledge regarding these aspects, promoting the development of stem cell therapies that could be applied safely and effectively in clinical settings.
Also flagged:axoncell bodyneuropathygene expressionaxonsspinal cord injuries
Journal Article2020-04-28✓ 3 SnippetsSmith TP, Sahoo PK, Kar AN, Twiss JL.
In-Text Gene Mentions
Text
…DCC…
Text
…DCC receptor…
Text
…HTT…
Show Full Abstract
Traumatic injury to the peripheral and central nervous systems very often causes axotomy, where an axon loses connections with its target resulting in loss of function. The axon segments distal to the injury site lose connection with the cell body and degenerate. Axotomized neurons in the periphery can spontaneously mount a regenerative response and reconnect to their denervated target tissues, though this is rarely complete in humans. In contrast, spontaneous regeneration rarely occurs after axotomy in the spinal cord and brain. Here, we concentrate on the mechanisms underlying this spontaneous regeneration in the peripheral nervous system, focusing on events initiated from the axon that support regenerative growth. We contrast this with what is known for axonal injury responses in the central nervous system. Considering the neuropathy focus of this special issue, we further draw parallels and distinctions between the injury-response mechanisms that initiate regenerative gene expression programs and those that are known to trigger axon degeneration.
Also flagged:Sphingolipidspsychiatric diseasespsychiatric disorderssphingolipidmetabolismMultiple sclerosis
Journal Article2020-04-28✓ 2 Snippetsvan Kruining D, Luo Q, van Echten-Deckert G, Mielke MM, Bowman A, Ellis S, Oliveira TG, Martinez-Martinez P.
In-Text Gene Mentions
S I O 001029)
…Abnormal expansion of a CAG triplet repeat in the Huntingtin (HTT) gene is causative for HD.…
S I O 001029)
…Additionally, in an HD transgenic mouse model (R6/2) expressing exon 1 of the human HTT gene carrying 141–157 CAG repeats [124], an overexpression of ceramide species C20:0, C22:0, C24:0, and C24:1 was seen in the striatum, while ceramide C24:0 was found to be upregulated in the cortex of these mice [118].…
Show Full Abstract
Lipids play an important role in neurodegeneration, neuroinflammation, and psychiatric disorders and an imbalance in sphingolipid levels is associated with disease. Although early diagnosis and intervention of these disorders would clearly have favorable long-term outcomes, no diagnostic tests currently exist that can accurately identify people at risk. Reliable prognostic biomarkers that are easily accessible would be beneficial to determine therapy and treatment response in clinical trials. Recent advances in lipidomic investigation methods have greatly progressed the knowledge of sphingolipids in neurodegenerative and psychiatric disorders over the past decades although more longitudinal studies are needed to understand its exact role in these disorders to be used as potential tools in the clinic. In this review, we give an overview of the current knowledge of sphingolipids in neurodegenerative and psychiatric disorders and explore recent advances in investigation methods. Finally, the potential of sphingolipid metabolism products and signaling molecules as potential biomarkers for diagnosis, prognostic, or surrogate markers of treatment response is discussed.
Also flagged:waterfood allergyADSTSinflammatory responsesS100 proteins
Journal Article2020-04-28No SnippetsGoleva E, Calatroni A, LeBeau P, Berdyshev E, Taylor P, Kreimer S, Cole RN, Leung DYM.
Show Full Abstract
<h4>Background</h4>Atopic dermatitis (AD) and food allergy (FA) are associated with skin barrier dysfunction.<h4>Objective</h4>Skin biomarkers are needed for skin barrier interventions studies.<h4>Methods</h4>In this study, skin tape strip (STS) samples were collected from nonlesional skin of 62 children in AD FA+, AD FA-, and nonatopic groups for mass spectrometry proteomic analysis. transepidermal water loss and allergic sensitization were assessed. STS proteomic analysis results were validated in an independent cohort of 41 adults with AD with and without FA versus nonatopic controls.<h4>Results</h4>A group of 45 proteins was identified as a principal component 1 (PC1) with the highest expression in AD FA+ STSs. This novel set of STS proteins was highly correlative to skin transepidermal water loss and allergic sensitization. PC1 proteins included keratin intermediate filaments; proteins associated with inflammatory responses (S100 proteins, alarmins, protease inhibitors); and glycolysis and antioxidant defense enzymes. Analysis of PC1 proteins expression in an independent adult AD cohort validated differential expression of STS PC1 proteins in the skin of adult patients with AD with the history of clinical reactions to peanut.<h4>Conclusions</h4>STS analysis of nonlesional skin of AD children identified a cluster of proteins with the highest expression in AD FA+ children. The differential expression of STS PC1 proteins was confirmed in a replicate cohort of adult AD patients with FA to peanut, suggesting a unique STS proteomic endotype for AD FA+ that persists into adulthood. Collectively, PC1 proteins are associated with abnormalities in skin barrier integrity and may increase the risk of epicutaneous sensitization to food allergens.
The effective and accurate diagnosis of Alzheimer's disease (AD), especially in the early stage (i.e., mild cognitive impairment (MCI)) remains a big challenge in AD research. So far, multiple biomarkers have been associated with AD diagnosis and progression. However, most of the existing research only utilized single modality data for diagnostic biomarker identification, which did not take the advantages of multi-modal data that provide comprehensive and complementary information at multiple levels into consideration. In this paper, we integrate multi-modal genomic data from postmortem AD brains (i.e., mRNA, miRNA and epigenomic data) and propose a hyper-graph based sparse canonical correlation analysis (HGSCCA) method to extract the most correlated multi-modal biomarkers associated with AD and MCI. Specifically, our model utilizes the sparse canonical correlation analysis framework (SCCA), which aims at finding the best linear projections for each input modality so that the strongest correlation within the selected features of multi-dimensional genomic data can be captured. In addition, with the consideration of high-order relationships among different subjects, we also introduce a hyper-graph-based regularization term that will lead to the selection of more discriminative biomarkers. To evaluate the effectiveness of the proposed method, we conduct the experiments on the well-known AD cohort study, The Religious Orders Study and Memory and Aging Project (ROSMAP) dataset, and the results show that our method can not only identify meaningful biomarkers for the diagnosis AD disease, but also achieve superior classification performance than the comparing methods.
Also flagged:degenerative diseasesgraft versus host diseaseclustered regularly interspaced short palindromic repeatsCRISPRCas9ischemic disorders
Journal Article2020-04-28No SnippetsAl Abbar A, Ngai SC, Nograles N, Alhaji SY, Abdullah S.
Show Full Abstract
The generation of induced pluripotent stem cells (iPSCs) from differentiated mature cells is one of the most promising technologies in the field of regenerative medicine. The ability to generate patient-specific iPSCs offers an invaluable reservoir of pluripotent cells, which could be genetically engineered and differentiated into target cells to treat various genetic and degenerative diseases once transplanted, hence counteracting the risk of graft versus host disease. In this context, we review the scientific research streams that lead to the emergence of iPSCs, the roles of reprogramming factors in reprogramming to pluripotency, and the reprogramming strategies. As iPSCs serve tremendous correction potentials for various diseases, we highlight the successes and challenges of iPSCs in cell replacement therapy and the synergy of iPSCs and <i>clustered regularly interspaced short palindromic repeats</i> (CRISPR)/Cas9 gene editing tools in therapeutics research.
Also flagged:Interleukin 6cytokineIL6cell cyclebindingresponse to
Journal Article2020-04-28✓ 1 SnippetLjungberg LU, Zegeye MM, Kardeby C, Fälker K, Repsilber D, Sirsjö A.
In-Text Gene Mentions
Results)
…for cell adhesion (NEGR1, PDZD2, and LGALS3BP),…
Show Full Abstract
<h4>Background</h4>Interleukin 6 (IL6) is a multifunctional cytokine produced by various cells, including vascular endothelial cells. IL6 has both pro- and non-/anti-inflammatory functions, and the response to IL6 is dependent on whether it acts via the membrane-bound IL6 receptor <i>α</i> (IL6R<i>α</i>) (classic signaling) or the soluble form of the receptor (transsignaling). As human endothelial cells produce IL6 and at the same time express IL6R<i>α</i>, we hypothesized that IL6 may have autocrine functions.<h4>Methods</h4>Knockdown of IL6 in cultured human endothelial cells was performed using siRNA. Knockdown efficiency was evaluated using ELISA. RNA sequencing was employed to characterize the transcriptional consequence of IL6 knockdown, and Ingenuity Pathway Analysis was used to further explore the functional roles of IL6.<h4>Results</h4>Knockdown of IL6 in cultured endothelial cells resulted in a 84-92% reduction in the release of IL6. Knockdown of IL6 resulted in dramatic changes in transcriptional pattern; knockdown of IL6 in the absence of soluble IL6R<i>α</i> (sIL6R<i>α</i>) led to differential regulation of 1915 genes, and knockdown of IL6 in the presence of sIL6R<i>α</i> led to differential regulation of 1967 genes (fold change 1.5, false discovery rate < 0.05). Pathway analysis revealed that the autocrine functions of IL6 in human endothelial cells are mainly related to basal cellular functions such as regulation of cell cycle, signaling, and cellular movement. Furthermore, we found that knockdown of IL6 activates functions related to adhesion, binding, and interaction of endothelial cells, which seem to be mediated mainly via STAT3.<h4>Conclusion</h4>In this study, a large number of novel genes that are under autocrine regulation by IL6 in human endothelial cells were identified. Overall, our data indicate that IL6 acts in an autocrine manner to regulate basal cellular functions, such as cell cycle regulation, signaling, and cellular movement, and suggests that the autocrine functions of IL6 in human endothelial cells are mediated via IL6 classic signaling.
Also flagged:reverse transcriptionsynaptosomesSynthesiscircadian oscillationscytoplasmicdegradation
Journal Article2020-04-28✓ 3 SnippetsGiuditta A, Casalino J.
In-Text Gene Mentions
Results)
…Conversely, the genes closest to the four SCR exclusively present in control mice include COL19A1 which is involved in developmental processes by encoding a collagen protein differently expressed in amyotrophic lateral sclerosis; NECTIN3 which is likewise involved in development and encodes an immunoglobulin-like cell adhesion molecule linking receptor 1 of corticotropin-releasing hormone to stress-induced memory deficits; SUDS3 which modulates cell processes and is member of chromatin remodeling complexes; and GM8179 which is a lncRNA gene.…
…in chromatin remodeling (Suds3) and post-transcriptional reg…
Show Full Abstract
Brain metabolic DNA (BMD) is continuously synthesized by reverse transcription in presynaptic synaptosomes and astroglia, and is partly transferred to nuclei after acquiring the double stranded configuration. Synthesis and turnover of BMD are markedly dependent on brain activity, as shown by circadian oscillations, environmental enrichment and impoverishment, and a variety of learning protocols. In rodents learning a two-way active avoidance task, BMD synthesis doubles, thus raising the possibility that sequences of learning BMD may differ from control BMD. The hypothesis has now been examined by sequencing cytoplasmic BMD. The present data indicate that most high-quality mapped BMD fragments hosting more than seven sequences are present in all mice. Three of them are exclusively present in learning BMD and four in control BMD. In addition, the annotated genes closest to them are mostly involved in modulating synaptic activity. The data support the conclusion that learning BMD sequences encode brain responses to the modified environment.
Also flagged:UbiquitinProteasomeneurodegenerative diseasesmembrane receptorsdegradationneurodegenerative disorders
Journal Article2020-04-28✓ 2 SnippetsMomtaz S, Memariani Z, El-Senduny FF, Sanadgol N, Golab F, Katebi M, Abdolghaffari AH, Farzaei MH, Abdollahi M.
In-Text Gene Mentions
Introduction)
…encodes the huntingtin (HTT) protein, containing a…
Introduction)
…the N-terminus ofHTT, a protein with…
Show Full Abstract
Misfolded proteins are the main common feature of neurodegenerative diseases, thereby, normal proteostasis is an important mechanism to regulate the neural survival and the central nervous system functionality. The ubiquitin-proteasome system (UPS) is a non-lysosomal proteolytic pathway involved in numerous normal functions of the nervous system, modulation of neurotransmitter release, synaptic plasticity, and recycling of membrane receptors or degradation of damaged and regulatory intracellular proteins. Aberrant accumulation of intracellular ubiquitin-positive inclusions has been implicated to a variety of neurodegenerative disorders such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington disease (HD), Amyotrophic Lateral Sclerosis (ALS), and Multiple Myeloma (MM). Genetic mutation in deubiquitinating enzyme could disrupt UPS and results in destructive effects on neuron survival. To date, various agents were characterized with proteasome-inhibitory potential. Proteins of the ubiquitin-proteasome system, and in particular, E3 ubiquitin ligases, may be promising molecular targets for neurodegenerative drug discovery. Phytochemicals, specifically polyphenols (PPs), were reported to act as proteasome-inhibitors or may modulate the proteasome activity. PPs modify the UPS by means of accumulation of ubiquitinated proteins, suppression of neuronal apoptosis, reduction of neurotoxicity, and improvement of synaptic plasticity and transmission. This is the first comprehensive review on the effect of PPs on UPS. Here, we review the recent findings describing various aspects of UPS dysregulation in neurodegenerative disorders. This review attempts to summarize the latest reports on the neuroprotective properties involved in the proper functioning of natural polyphenolic compounds with implication for targeting ubiquitin-proteasome pathway in the neurodegenerative diseases. We highlight the evidence suggesting that polyphenolic compounds have a dose and disorder dependent effects in improving neurological dysfunctions, and so their mechanism of action could stimulate the UPS, induce the protein degradation or inhibit UPS and reduce protein degradation. Future studies should focus on molecular mechanisms by which PPs can interfere this complex regulatory system at specific stages of the disease development and progression.
Also flagged:cGASSTINGcyclic-GMP-AMP synthasestimulator of interferon genestype-I interferonIFN
Journal Article2020-04-28No SnippetsWan D, Jiang W, Hao J.
Show Full Abstract
Double-stranded DNA (dsDNA) sensor cyclic-GMP-AMP synthase (cGAS) along with the downstream stimulator of interferon genes (STING) acting as essential immune-surveillance mediators have become hot topics of research. The intrinsic function of the cGAS-STING pathway facilitates type-I interferon (IFN) inflammatory signaling responses and other cellular processes such as autophagy, cell survival, senescence. cGAS-STING pathway interplays with other innate immune pathways, by which it participates in regulating infection, inflammatory disease, and cancer. The therapeutic approaches targeting this pathway show promise for future translation into clinical applications. Here, we present a review of the important previous works and recent advances regarding the cGAS-STING pathway, and provide a comprehensive understanding of the modulatory pattern of the cGAS-STING pathway under multifarious pathologic states.
Also flagged:Systemic lupus erythematosusSLEautoimmune diseaselupusantibodyIgG
Journal Article2020-04-28✓ 2 SnippetsHidalgo Y, Núñez S, Fuenzalida MJ, Flores-Santibáñez F, Sáez PJ, Dorner J, Lennon-Dumenil AM, Martínez V, Zorn E, Rosemblatt M, Sauma D, Bono MR.
In-Text Gene Mentions
Results)
…Among the genes that were downregulated in thymic B cells from diseased-BWF1 mice, we found Hif1a, Blk, and Btn2a2, whose low expression has been associated with the induction or development of several autoimmune diseases such as collagen-induced arthritis, experimental autoimmune encephalomyelitis and SLE (36–39).…
Results)
…Hif1a, Blk, andBtn2a2, whose low expression…
Show Full Abstract
Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the activation of autoreactive T and B cells, autoantibody production, and immune complex deposition in various organs. Previous evidence showed abnormal accumulation of B cells in the thymus of lupus-prone mice, but the role of this population in the progression of the disease remains mostly undefined. Here we analyzed the spatial distribution, function, and properties of this thymic B cell population in the BWF1 murine model of SLE. We found that in diseased animals, thymic B cells proliferate, and cluster in structures that resemble ectopic germinal centers. Moreover, we detected antibody-secreting cells in the thymus of diseased-BWF1 mice that produce anti-dsDNA IgG autoantibodies. We also found that thymic B cells from diseased-BWF1 mice induced the differentiation of thymocytes to follicular helper T cells (T<sub>FH</sub>). These data suggest that the accumulation of B cells in the thymus of BWF1 mice results in the formation of germinal center-like structures and the expansion of a T<sub>FH</sub> population, which may, in turn, activate and differentiate B cells into autoreactive plasma cells. Therefore, the thymus emerges as an important niche that supports the maintenance of the pathogenic humoral response in the development of murine SLE.
Also flagged:MASP-2Heparin-Binding Proteaseheparinglycosaminoglycanscomplement activationC4
Journal Article2020-04-28✓ 4 SnippetsTalsma DT, Poppelaars F, Dam W, Meter-Arkema AH, Vivès RR, Gál P, Boons GJ, Chopra P, Naggi A, Seelen MA, Berger SP, Daha MR, Stegeman CA, van den Born J, COMBAT Consortium.
In-Text Gene Mentions
Discussion)
…to recognize C1inh,ATIIIand other members…
Discussion)
…e.g., heparin andATIIIhave shown to…
Discussion)
…inhibitors like C1inh,ATIII, and tissue factor…
Discussion)
…however unlikely sinceATIIIneeds minimally a…
Show Full Abstract
It is well-known that heparin and other glycosaminoglycans (GAGs) inhibit complement activation. It is however not known whether fractionation and/or modification of GAGs might deliver pathway-specific inhibition of the complement system. Therefore, we evaluated a library of GAGs and their derivatives for their functional pathway specific complement inhibition, including the MASP-specific C4 deposition assay. Interaction of human MASP-2 with heparan sulfate/heparin was evaluated by surface plasmon resonance, ELISA and in renal tissue. <i>In vitro</i> pathway-specific complement assays showed that highly sulfated GAGs inhibited all three pathways of complement. Small heparin- and heparan sulfate-derived oligosaccharides were selective inhibitors of the lectin pathway (LP). These small oligosaccharides showed identical inhibition of the ficolin-3 mediated LP activation, failed to inhibit the binding of MBL to mannan, but inhibited C4 cleavage by MASPs. Hexa- and pentasulfated tetrasaccharides represent the smallest MASP inhibitors both in the functional LP assay as well in the MASP-mediated C4 assay. Surface plasmon resonance showed MASP-2 binding with heparin and heparan sulfate, revealing high Kon and Koff rates resulted in a Kd of ~2 μM and confirmed inhibition by heparin-derived tetrasaccharide. In renal tissue, MASP-2 partially colocalized with agrin and heparan sulfate, but not with activated C3, suggesting docking, storage, and potential inactivation of MASP-2 by heparan sulfate in basement membranes. Our data show that highly sulfated GAGs mediated inhibition of all three complement pathways, whereas short heparin- and heparan sulfate-derived oligosaccharides selectively blocked the lectin pathway via MASP-2 inhibition. Binding of MASP-2 to immobilized heparan sulfate/heparin and partial co-localization of agrin/heparan sulfate with MASP, but not C3b, might suggest that <i>in vivo</i> heparan sulfate proteoglycans act as a docking platform for MASP-2 and possibly prevent the lectin pathway from activation.
Also flagged:SLC40A1cisplatinovarian cancercancersluciferaseHEPH
Journal Article2020-04-28✓ 2 SnippetsWu J, Zhang L, Wu S, Yi X, Liu Z.
In-Text Gene Mentions
Abstract)
…homeostatic iron regulator (HFE).…
Abstract)
…that HEPH andHFEwere associated with…
Show Full Abstract
<h4>Background</h4>miR-194-5p has been associated with drug resistance in many cancers. However, the role of miR-194-5p in cisplatin resistance in ovarian cancer is still unclear.<h4>Materials and methods</h4>To study the role and mechanism of miR-194-5p in cisplatin resistance, qRT-PCR was performed to determine the expression of miR-194-5p and SLC40A1 in ovarian cancer. Cell Counting Kit-8 (CCK8) assay was used to analyse cell viability after cisplatin treatment. Dual-luciferase reporter gene assay was performed to examine the relationship between miR-194-5p and SLC40A1. The genes downstream of SLC40A1 were investigated through bioinformatics analysis.<h4>Results</h4>Compared to cisplatin-sensitive ovarian cancer cells, higher miR-194-5p expression and lower SLC40A1 expression were found in cisplatin-resistant ovarian cancer cells. Moreover, this study demonstrated that over-expression of miR-194-5p inhibited SLC40A1 expression, and knockdown of miR-194-5p promoted SLC40A1 expression. In addition, dual-luciferase reporter gene assay further confirmed the negative correlation between miR-194-5p and SLC40A1. Furthermore, we found that over-expression of miR-194-5p resulted in cisplatin resistance. When miR-194-5p and SLC40A1 were simultaneously up-regulated, cisplatin sensitivity increased, while down-regulation of miR-194-5p sensitised ovarian cancer cells to cisplatin. However, when miR-194-5p and SLC40A1 were simultaneously down-regulated, cisplatin sensitivity was decreased. These data suggested that miR-194-5p inhibited SLC40A1 expression to induce cisplatin resistance. In addition, bioinformatics analysis indicated a positive correlation of SLC40A1 with hephaestin (HEPH), and homeostatic iron regulator (HFE). However, we found that HEPH and HFE were associated with cisplatin resistance, suggesting that their role in drug resistance is induced by miR-194-5p/SLC40A1.<h4>Conclusion</h4>In conclusion, we found that miR-194-5p inhibited SLC40A1 expression to induce cisplatin resistance in ovarian cancer. This study suggests that miR-194-5p could be a potential therapeutic target and a prognostic biomarker for ovarian cancer, with important implications for future research.
Also flagged:portal vein system thrombosisheparinveinvein system thrombosisinflammatory splenic diseaseshypersplenism
Journal Article2020-04-27✓ 1 SnippetYang M, Liu J.
In-Text Gene Mentions
Discussion)
…only two usedATIII.…
Show Full Abstract
<h4>Background</h4>The aim of this study was to evaluate the safety and efficacy of low-molecular weight heparin (LMWH) in the prevention of portal vein system thrombosis (PVST) after splenectomy.<h4>Methods</h4>A systematic search was performed using PubMed, EMBASE, Springer and Cochrane Library databases to screen out studies comparing the prognoses between post-splenectomy patients treated with and without LMWH. The incidences of PVST and bleeding complications were used as parameters to assess the effect of LMWH.<h4>Results</h4>Six articles met the selection criteria and were included in this study. A total of 740 patients were involved in these six articles, including 336 patients treated with LMWH (LMWH group) and 385 patients not treated with LMWH (control group). The incidence of PVST in the LMWH group was significantly lower than that in the control group (relative risk 1.782 (1.449-2.192); P = 0.285; I<sup>2</sup> = 19.7%), while the incidence of post-operative bleeding in the LMWH group was significantly higher (relative risk 0.592 (0.195-1.799); P = 0.817; I<sup>2</sup> = 0.0%).<h4>Conclusion</h4>LMWH might decrease the incidence of PVST after splenectomy without a potential risk of bleeding.
Also flagged:transforming growth factor beta-1TGF-β1TGF-β2TGF-β3knee OATGF-β
Journal Article2020-04-27✓ 1 SnippetHan AJ, Alexander LC, Huebner JL, Reed AB, Kraus VB.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Objective</h4>To evaluate effects of physical activity and food consumption on plasma concentrations of free and total transforming growth factor beta-1 (TGF-β1), beta-2 (TGF-β2), and beta-3 (TGF-β3) in individuals with knee osteoarthritis (OA).<h4>Methods</h4>Participants (<i>n</i> = 40 in 2 cohorts of 20; mean age 70 years) with radiographic knee OA were admitted overnight for serial blood sampling. Cohorts 1 and 2 assessed the impacts of food intake and activity, respectively, on TGF-β concentrations. Cohort 1 blood draws included 2 hours postprandial the evening of day 1 (T3), fasting before rising on day 2 (T0), nonfasting 1 hour after rising (T1B), and 4 hours after rising (T2). Cohort 2 blood draws included T3, T0, fasting 1 hour after rising and performing activities of daily living (T1A), and nonfasting 2 hours after rising (T1B). By sandwich ELISAs, we quantified plasma free and total TGF-β1 concentrations in all samples, and plasma total TGF-β2 and TGF-β3 in cohort 2.<h4>Results</h4>Free TGF-β1 represented a small fraction of the total systemic concentration (mean 0.026%). In cohort 2, free and total TGF-β1 and total TGF-β2 concentration significantly increased in fasting samples collected after an hour (T1A) of activities of daily living (free TGF-β1: <i>P</i> = 0.006; total TGF-β1: <i>P</i> < 0.001; total TGF-β2: <i>P</i> = 0.001). Total TGF-β3 increased nonsignificantly following activity (<i>P</i> = 0.590) and decreased (<i>P</i> = 0.035) after food consumption while resting (T1B).<h4>Conclusions</h4>Increased plasma concentrations of TGF-β with physical activity suggests activity should be standardized prior to TGF-β1 analyses.
Also flagged:cancerimmune responseepigenetic modificationsmethylationhistonechromatin
Journal Article2020-04-27No SnippetsLu Y, Chan YT, Tan HY, Li S, Wang N, Feng Y.
Show Full Abstract
Epigenetics is dynamic and heritable modifications to the genome that occur independently of DNA sequence. It requires interactions cohesively with various enzymes and other molecular components. Aberrant epigenetic alterations can lead to inappropriate onset of genetic expressions and promote tumorigenesis. As the epigenetic modifiers are susceptible to extrinsic factors and reversible, they are becoming promising targets in multiple cancer therapies. Recently, various epi-drugs have been developed and implicated in clinical use. The use of epi-drugs alone, or in combination with chemotherapy or immunotherapy, has shown compelling outcomes, including augmentation of anti-tumoral effects, overcoming drug resistance, and activation of host immune response.
…in synaptic signaling (Unc13c) and synaptic assembly…
Discussion)
…including Nrxn1 andUnc13c(see Table S3…
Show Full Abstract
The vomeronasal organ (VNO) contains two main types of vomeronasal sensory neurons (VSNs) that express distinct vomeronasal receptor (VR) genes and localize to specific regions of the neuroepithelium. Morphogenic signals are crucial in defining neuronal identity and network formation; however, if and what signals control maturation and homeostasis of VSNs is largely unexplored. Here, we found transforming growth factor β (TGFβ) and bone morphogenetic protein (BMP) signal transduction in postnatal mice, with BMP signaling being restricted to basal VSNs and at the marginal zones of the VNO: the site of neurogenesis. Using different Smad4 conditional knockout mouse models, we disrupted canonical TGFβ/BMP signaling in either maturing basal VSNs (bVSNs) or all mature VSNs. Smad4 loss of function in immature bVSNs compromises dendritic knob formation, pheromone induced activation, correct glomeruli formation in the accessory olfactory bulb (AOB) and survival. However, Smad4 loss of function in all mature VSNs only compromises correct glomeruli formation in the posterior AOB. Our results indicate that Smad4-mediated signaling drives the functional maturation and connectivity of basal VSNs.
Also flagged:-traumatic osteonecrosis of the femoral headcell adhesion-related CD41FAKAktRunx2glucocorticoid
Journal Article2020-04-27No SnippetsZhu W, Guo M, Yang W, Tang M, Chen T, Gan D, Zhang D, Ding X, Zhao A, Zhao P, Yan W, Zhang J.
Show Full Abstract
Non-traumatic osteonecrosis of the femoral head (ONFH) is clinically a devastating and progressive disease without an effective treatment. Mesenchymal stem cells (MSCs) transplantation has been used to treat ONFH in early stage, but the failure rate of this therapy is high due to the reduced osteogenic differentiation and migration of the transplanted MSCs related with pathological bone tissues. However, the mechanism responsible for this decrease is still unclear. Therefore, we assume that the implanted MSCs might be influenced by signals delivered from pathological bone tissue, where the exosomes might play a critical role in this delivery. This study showed that exosomes from ONFH bone tissues (ONFH-exos) were able to induce GC-induced ONFH-like damage, in vivo and impair osteogenic differentiation and migration of MSCs, in vitro. Then, we analyzed the differentially expressed proteins (DEPs) in ONFH-exos using proteomic technology and identified 842 differentially expressed proteins (DEPs). On the basis of gene ontology (GO) enrichment analysis of DEPs, fold-changes and previous report, cell adhesion-related CD41 (integrin α2b) was selected for further investigation. Our study showed that the CD41 (integrin α2b) was distinctly decreased in ONFH-exos, compared to NOR-exos, and downregulation of CD41 could impair osteogenic differentiation and migration of the MSCs, where CD41-integrin β3-FAK-Akt-Runx2 pathway was involved. Finally, our study further suggested that CD41-affluent NOR-exos could restore the glucocorticoid-induced decline of osteogenic differentiation and migration in MSCs, and prevent GC-induced ONFH-like damage in rat models. Taken together, our study results revealed that in the progress of ONFH, exosomes from the pathological bone brought about the failure of MSCs repairing the necrotic bone for lack of some critical proteins, like integrin CD41, and prompted the progression of experimentally induced ONFH-like status in the rat. CD41 could be considered as the target of early diagnosis and therapy in ONFH.
Also flagged:cutaneous melanomaacral melanomapigmentationpathogenesismelanomanevus
Journal Article2020-04-27No SnippetsLandi MT, Bishop DT, MacGregor S, Machiela MJ, Stratigos AJ, Ghiorzo P, Brossard M, Calista D, Choi J, Fargnoli MC, Zhang T, Rodolfo M, Trower AJ, Menin C, Martinez J, Hadjisavvas A, Song L, Stefanaki I, Scolyer R, Yang R, Goldstein AM, Potrony M, Kypreou KP, Pastorino L, Queirolo P, Pellegrini C, Cattaneo L, Zawistowski M, Gimenez-Xavier P, Rodriguez A, Elefanti L, Manoukian S, Rivoltini L, Smith BH, Loizidou MA, Del Regno L, Massi D, Mandala M, Khosrotehrani K, Akslen LA, Amos CI, Andresen PA, Avril MF, Azizi E, Soyer HP, Bataille V, Dalmasso B, Bowdler LM, Burdon KP, Chen WV, Codd V, Craig JE, Dębniak T, Falchi M, Fang S, Friedman E, Simi S, Galan P, Garcia-Casado Z, Gillanders EM, Gordon S, Green A, Gruis NA, Hansson J, Harland M, Harris J, Helsing P, Henders A, Hočevar M, Höiom V, Hunter D, Ingvar C, Kumar R, Lang J, Lathrop GM, Lee JE, Li X, Lubiński J, Mackie RM, Malt M, Malvehy J, McAloney K, Mohamdi H, Molven A, Moses EK, Neale RE, Novaković S, Nyholt DR, Olsson H, Orr N, Fritsche LG, Puig-Butille JA, Qureshi AA, Radford-Smith GL, Randerson-Moor J, Requena C, Rowe C, Samani NJ, Sanna M, Schadendorf D, Schulze HJ, Simms LA, Smithers M, Song F, Swerdlow AJ, van der Stoep N, Kukutsch NA, Visconti A, Wallace L, Ward SV, Wheeler L, Sturm RA, Hutchinson A, Jones K, Malasky M, Vogt A, Zhou W, Pooley KA, Elder DE, Han J, Hicks B, Hayward NK, Kanetsky PA, Brummett C, Montgomery GW, Olsen CM, Hayward C, Dunning AM, Martin NG, Evangelou E, Mann GJ, Long G, Pharoah PDP, Easton DF, Barrett JH, Cust AE, Abecasis G, Duffy DL, Whiteman DC, Gogas H, De Nicolo A, Tucker MA, Newton-Bishop JA, GenoMEL Consortium, Q-MEGA and QTWIN Investigators, ATHENS Melanoma Study Group, 23andMe, SDH Study Group, IBD Investigators, Essen-Heidelberg Investigators, AMFS Investigators, MelaNostrum Consortium, Peris K, Chanock SJ, Demenais F, Brown KM, Puig S, Nagore E, Shi J, Iles MM, Law MH.
Show Full Abstract
Most genetic susceptibility to cutaneous melanoma remains to be discovered. Meta-analysis genome-wide association study (GWAS) of 36,760 cases of melanoma (67% newly genotyped) and 375,188 controls identified 54 significant (P < 5 × 10<sup>-8</sup>) loci with 68 independent single nucleotide polymorphisms. Analysis of risk estimates across geographical regions and host factors suggests the acral melanoma subtype is uniquely unrelated to pigmentation. Combining this meta-analysis with GWAS of nevus count and hair color, and transcriptome association approaches, uncovered 31 potential secondary loci for a total of 85 cutaneous melanoma susceptibility loci. These findings provide insights into cutaneous melanoma genetic architecture, reinforcing the importance of nevogenesis, pigmentation and telomere maintenance, together with identifying potential new pathways for cutaneous melanoma pathogenesis.
Also flagged:cancerpeptideoxytocincell deathmucusNestin
Journal Article2020-04-27✓ 1 Snippetvon Erlach T, Saxton S, Shi Y, Minahan D, Reker D, Javid F, Lee YL, Schoellhammer C, Esfandiary T, Cleveland C, Booth L, Lin J, Levy H, Blackburn S, Hayward A, Langer R, Traverso G.
In-Text Gene Mentions
I A O 0000326)
…OLFM4…
Show Full Abstract
Monolayers of cancer-derived cell lines are widely used in the modelling of the gastrointestinal (GI) absorption of drugs and in oral drug development. However, they do not generally predict drug absorption in vivo. Here, we report a robotically handled system that uses large porcine GI tissue explants that are functionally maintained for an extended period in culture for the high-throughput interrogation (several thousand samples per day) of whole segments of the GI tract. The automated culture system provided higher predictability of drug absorption in the human GI tract than a Caco-2 Transwell system (Spearman's correlation coefficients of 0.906 and 0.302, respectively). By using the culture system to analyse the intestinal absorption of 2,930 formulations of the peptide drug oxytocin, we discovered an absorption enhancer that resulted in a 11.3-fold increase in the oral bioavailability of oxytocin in pigs in the absence of cellular disruption of the intestinal tissue. The robotically handled whole-tissue culture system should help advance the development of oral drug formulations and might also be useful for drug screening applications.
Also flagged:microtubulestubulindevelopmental disordersneurodegenerative diseasescancermicrotubule
Journal Article2020-04-27No SnippetsGasic I, Groendyke BJ, Nowak RP, Yuan JC, Kalabathula J, Fischer ES, Gray NS, Mitchison TJ.
Show Full Abstract
Dysregulation of microtubules and tubulin homeostasis has been linked to developmental disorders, neurodegenerative diseases, and cancer. In general, both microtubule-stabilizing and destabilizing agents have been powerful tools for studies of microtubule cytoskeleton and as clinical agents in oncology. However, many cancers develop resistance to these agents, limiting their utility. We sought to address this by developing a different kind of agent: tubulin-targeted small molecule degraders. Degraders (also known as proteolysis-targeting chimeras (PROTACs)) are compounds that recruit endogenous E3 ligases to a target of interest, resulting in the target's degradation. We developed and examined several series of α- and β-tubulin degraders, based on microtubule-destabilizing agents. Our results indicate, that although previously reported covalent tubulin binders led to tubulin degradation, in our hands, cereblon-recruiting PROTACs were not efficient. In summary, while we consider tubulin degraders to be valuable tools for studying the biology of tubulin homeostasis, it remains to be seen whether the PROTAC strategy can be applied to this target of high clinical relevance.
Also flagged:GlioblastomaCentral nervous system tumorskidney diseasediabetesneurodegenerative disorderarthritis
Journal Article2020-04-27No SnippetsMazurek M, Grochowski C, Litak J, Osuchowska I, Maciejewski R, Kamieniak P.
Show Full Abstract
Central nervous system tumors are a significant problem for modern medicine because of their location. The explanation of the importance of microRNA (miRNA) in the development of cancerous changes plays an important role in this respect. The first papers describing the presence of miRNA were published in the 1990s. The role of miRNA has been pointed out in many medical conditions such as kidney disease, diabetes, neurodegenerative disorder, arthritis and cancer. There are several miRNAs responsible for invasiveness, apoptosis, resistance to treatment, angiogenesis, proliferation and immunology, and many others. The research conducted in recent years analyzing this group of tumors has shown the important role of miRNA in the course of gliomagenesis. These particles seem to participate in many stages of the development of cancer processes, such as proliferation, angiogenesis, regulation of apoptosis or cell resistance to cytostatics.
Also flagged:Vascular Adhesion Protein 1VAP-1Gliomabrain tumortumorVascular adhesion protein
Journal Article2020-04-27No SnippetsChang SJ, Tu HP, Lai YC, Luo CW, Nejo T, Tanaka S, Chai CY, Kwan AL.
Show Full Abstract
Glioma is characterized by a high heterogeneity in the brain tumor. Abundant tumor-associated macrophages (TAMs) exist as neoplastic tissues, implicating tumor plasticity and thus leading to therapeutic challenges. Vascular adhesion protein (VAP-1) potentially serves as a mediator for TAM immunity in tumor milieu. We previously demonstrated that VAP-1 could contribute to tumor malignancy, but its characteristics in TAM immunity of glioma progression are still unclear. This study explored the association of VAP-1 expression with TAM distribution as well as the resulting clinical significance and prognostic value in human gliomas. An in-depth analysis of <i>AOC3</i> (VAP-1) gene expression was performed using 695 glioma samples derived from the cancer genome atlas (TCGA)-lower grade glioma and glioblastoma (GBMLGG) cohort. Bioinformatic analysis confirmed that VAP-1 expression is associated with poor prognosis of glioma patients (<i>p</i> = 0.0283). VAP-1 and TAM biomarkers (CD68, iNOS, and CD163) were evaluated by immunohistochemistry in 108 gliomas from Kaohsiung Medical University Hospital. VAP-1+ was expressed in 56 (51.85%) cases and this phenotype revealed a significant association with overall survival in Kaplan-Meier analysis (<i>p</i> < 0.0001). Immunohistochemical double staining showed that VAP-1 immunoreactivity was present around CD163+ M2 infiltration location, including aggressive lesions and neighboring neovasculature. We demonstrated that high VAP-1 expression levels positively correlated with CD163+ M2 activation and coexpression of these two proteins was associated with worse survival in gliomas (<i>p</i> < 0.0001). Multivariate analysis indicated that VAP-1 alone and co-expressed with CD163 were the significantly independent indicators (both <i>p</i> < 0.0001). Furthermore, VAP-1/CD163 coexpression exhibited excellent diagnostic accuracy in gliomas (AUC = 0.8008). In conclusion, VAP-1 and TAM CD163 M2 coexpression was found in glioma tissues belonging to a highly malignant subgroup that was associated with poor prognosis. These results implied VAP-1 abundance is closely linked to alternative M2 activation during glioma progression. From the aforementioned data, a reasonable inference is that VAP-1 combined with targeting M2 immunity might be an effective therapeutic target for human gliomas.
Also flagged:penicillinstreptomycinHAMPIL-6photonluciferase
Journal Article2020-04-27✓ 3 SnippetsZanella I, Paiardi G, Di Lorenzo D, Biasiotto G.
In-Text Gene Mentions
S I O 001029)
…Two of these modifier genes are HFE (H= high FE = Fe, iron homestasis regulator) related with type 1 hemochromatosis [67] and TMPRSS6 (transmembrane serine protease 6) coding for the matriptase 2 and causative of iron refractory iron deficiency anemia (IRIDA) [68].…
S I O 001029)
…The effects of the HFE mutations H63D and C282Y and of the TMPRSS6 A736V variant were further studied in two cohorts of CeD patients with and without persistent iron deficiency anemia after diagnosis and after being on a gluten free diet for one year.…
S I O 001029)
…HFE mutations showed a protective role against iron deficiency anemia, while the presence of the TMPRSS6 variant could help to predict oral iron response in anemic patients.…
Show Full Abstract
Anemia is the main extra-gastrointestinal symptom in inflammatory bowel diseases (IBDs). Interleukin-6 (IL-6) and other cytokines are secreted and act in the microenvironment of the small intestine mucous membrane of IBD patients. Iron is essential for multiple cell functions and its homeostasis is regulated by the hepcidin-ferroportin axis. Hepcidin (HEPC) is mainly produced by the liver in response to iron needs but is also an acute phase protein. During inflammation, hepcidin is upregulated by IL-6 and is responsible for iron compartmentalization within cells, in turn causing anemia of inflammation. Tissues other than liver can produce hepcidin in response to inflammatory stimuli, in order to decrease iron efflux at a local level, then acting in an autocrine-paracrine manner. In IBDs and, in particular, in celiac disease (CeD), IL-6 might trigger the expression, upregulation and secretion of hepcidin in the small intestine, reducing iron efflux and exacerbating defective iron absorption. 7-Hydroxymatairesinol (7-HMR) belongs to the family of lignans, polyphenolic compounds produced by plants, and has nutraceutical antioxidant, anti-inflammatory and estrogenic properties. In this mini-review we revise the role of inflammation in IBDs and in particular in CeD, focusing our attention on the close link among inflammation, anemia and iron metabolism. We also briefly describe the anti-inflammatory and estrogenic activity of 7-HMR contained in foods that are often consumed by CeD patients. Finally, considering that HEPC expression is regulated by iron needs, inflammation and estrogens, we explored the hypothesis that 7-HMR consumption could ameliorate anemia in CeD using Caco-2 cells as bowel model. Further studies are needed to verify the regulation pathway through which 7-HMR may interfere with the local production of HEPC in bowel.
Also flagged:calciummagnesiumcarbonatedapatitesaltstroke
Journal Article2020-04-27No SnippetsJasielec JJ, Filipek R, Dołowy K, Lewenstam A.
Show Full Abstract
In the mitochondrial matrix there are insoluble, osmotically inactive complexes that maintain constant pH and calcium concentration. In the present paper we examine the properties of insoluble calcium and magnesium salts, namely phosphates, carbonates and polyphosphates which might play this role. We find that non-stoichiometric, magnesium-rich carbonated apatite, with very low crystallinity, precipitates in the matrix under physiological conditions. Precipitated salt acts as pH buffer, and hence can contribute in maintaining ATP production in ischemic conditions, delaying irreversible damages to heart and brain cells after stroke.
Also flagged:spike (S)TMPRSS2mRNAcDNAmitochondrialHBA
Journal Article2020-04-27✓ 2 SnippetsZiegler CGK, Allon SJ, Nyquist SK, Mbano IM, Miao VN, Tzouanas CN, Cao Y, Yousif AS, Bals J, Hauser BM, Feldman J, Muus C, Wadsworth MH, Kazer SW, Hughes TK, Doran B, Gatter GJ, Vukovic M, Taliaferro F, Mead BE, Guo Z, Wang JP, Gras D, Plaisant M, Ansari M, Angelidis I, Adler H, Sucre JMS, Taylor CJ, Lin B, Waghray A, Mitsialis V, Dwyer DF, Buchheit KM, Boyce JA, Barrett NA, Laidlaw TM, Carroll SL, Colonna L, Tkachev V, Peterson CW, Yu A, Zheng HB, Gideon HP, Winchell CG, Lin PL, Bingle CD, Snapper SB, Kropski JA, Theis FJ, Schiller HB, Zaragosi LE, Barbry P, Leslie A, Kiem HP, Flynn JL, Fortune SM, Berger B, Finberg RW, Kean LS, Garber M, Schmidt AG, Lingwood D, Shalek AK, Ordovas-Montanes J, HCA Lung Biological Network. Electronic address: lung-network@humancellatlas.org, HCA Lung Biological Network.
In-Text Gene Mentions
Results)
…ACE2+TMPRSS2+ goblet cells during influenza infection exhibited enrichment for canonical ISGs such as the CXCL9/CXCL10/CXCL11 gene cluster; correspondence with ACE2+TMPRSS2+ goblet cells in healthy and allergic nasal scrapings; and a shared overlap in ISGs including GBP2, ZNFX1, ADAR, and ACE2 (significantly differentially expressed gene lists) (Table S6).…
Results)
…including GBP2 ,ZNFX1, ADAR ,…
Show Full Abstract
There is pressing urgency to understand the pathogenesis of the severe acute respiratory syndrome coronavirus clade 2 (SARS-CoV-2), which causes the disease COVID-19. SARS-CoV-2 spike (S) protein binds angiotensin-converting enzyme 2 (ACE2), and in concert with host proteases, principally transmembrane serine protease 2 (TMPRSS2), promotes cellular entry. The cell subsets targeted by SARS-CoV-2 in host tissues and the factors that regulate ACE2 expression remain unknown. Here, we leverage human, non-human primate, and mouse single-cell RNA-sequencing (scRNA-seq) datasets across health and disease to uncover putative targets of SARS-CoV-2 among tissue-resident cell subsets. We identify ACE2 and TMPRSS2 co-expressing cells within lung type II pneumocytes, ileal absorptive enterocytes, and nasal goblet secretory cells. Strikingly, we discovered that ACE2 is a human interferon-stimulated gene (ISG) in vitro using airway epithelial cells and extend our findings to in vivo viral infections. Our data suggest that SARS-CoV-2 could exploit species-specific interferon-driven upregulation of ACE2, a tissue-protective mediator during lung injury, to enhance infection.
Also flagged:Amyotrophic Lateral SclerosisALSmotor neuron diseasesdeathbullous pemphigoidcollagen
Journal Article2020-04-27✓ 3 SnippetsQazi A, Malik F, Shafi L, Basar S, Qazi A.
In-Text Gene Mentions
Introduction)
…Addison's disease orhemochromatosis.…
Discussion)
…as Addison’s disease,hemochromatosis, and less commonly…
Discussion)
…pigmentation due tohemochromatosis[ 15 ].…
Show Full Abstract
Amyotrophic lateral sclerosis (ALS) is one of the most common motor neuron diseases (MND), which presents as muscle weakness, atrophy, spasticity, and, in extreme cases, may result in death due to respiratory failure. ALS has been reported with dermatological conditions such as bullous pemphigoid and decreased collagen. Hyperpigmentation usually occurs due to underlying adrenal or metabolic disorder, but no case of hyperpigmentation has been associated with MND. We report a case of a 25-year-old man who presented with signs of young-onset ALS (progressive weakness of both upper limbs) with hyperpigmentation of limbs. The patient did not have any other underlying etiology, which could have led to the development of hyperpigmentation Biopsy was negative for polymyositis and dermatomyositis. The patient was counseled about the nature of the disease and was advised regular follow-ups.
Also flagged:methylationgastric cancerstomach cancercancerdeathstomach adenocarcinoma
Journal Article2020-04-27✓ 3 SnippetsMa X, Chen H, Wang G, Li L, Tao K.
In-Text Gene Mentions
Discussion)
…Higher levels of 2-DNA methylation (ZNF644, cg10471794) were associated with better survival, while, higher level of 13 DNA methylation was associated with worse survival (MGC16121, KIAA1026, FBXO11, BDP1, CCDC126, XPO7, STX2, IPO5, cg12094029) in patients with STAD.…
Discussion)
…of 2-DNA methylation (ZNF644, cg10471794) were associated…
Discussion)
…the expression ofZNF644was changed in…
Show Full Abstract
DNA methylation has been reported to serve an important role in the carcinogenesis and development of gastric cancer. Our aim was to systematically develop an individualized prediction model of the survival risk combing clinical and methylation factors in gastric cancer. A univariate Cox proportional risk regression analysis was used to identify the prognosis-associated methylation sites based on the differentially expressed methylation sites between early and advanced gastric cancer group, then we applied least absolute shrinkage and selection operator (LASSO) Cox regression model to screen candidate methylation sites. Subsequently, multivariate Cox proportional risk regression analysis was conducted to identify predictive signature according to the candidate sites. Relative operating characteristic curve (ROC) analysis manifested that an 11-methylation signature exhibited great predictive efficiency for 1-, 3-, 5-year survival events. Patients in the low-risk group classified according to 11-methylation signature-based risk score yield significantly better survival than that in high-risk group. Moreover, Cox regression analysis combing methylation-based risk score and other clinical factors indicated that 11-methylation signature served as an independent risk factor. The predictive value of risk score was validated in the testing dataset. In addition, a nomogram was constructed and the ROC as well as calibration plots analysis demonstrated the good performance and clinical application of the nomogram. In conclusion, the result suggested the 11-DNA methylation signature may be potentially independent prognostic marker and functioned as a significant tool for guiding the clinical prediction of gastric cancer patients' overall survival.
Also flagged:acanthocytosisatrophydopaminergicN-acetylaspartatecreatinecholine
Journal Article2020-04-27✓ 1 SnippetNiemelä V, Salih A, Solea D, Lindvall B, Weinberg J, Miltenberger G, Granberg T, Tzovla A, Nordin L, Danfors T, Savitcheva I, Dahl N, Paucar M.
In-Text Gene Mentions
Methods)
…the huntingtin (HTT) gene.…
Show Full Abstract
<h4>Objective</h4>To perform a comprehensive characterization of a cohort of patients with chorea-acanthocytosis (ChAc) in Sweden.<h4>Methods</h4>Clinical assessments, targeted genetic studies, neuroimaging with MRI, [<sup>18</sup>F]-fluorodeoxyglucose (FDG) PET, and dopamine transporter with <sup>123</sup>I FP-CIT (DaTscan) SPECT. One patient underwent magnetic resonance spectroscopy (MRS).<h4>Results</h4>Four patients living in Sweden but with different ethnical backgrounds were included. Their clinical features were variable. Biallelic <i>VPS13A</i> mutations were confirmed in all patients, including 3 novel mutations. All tested patients had either low or absent chorein levels. One patient had progressive caudate atrophy. Investigation using FDG-PET revealed severe bilateral striatal hypometabolism, and DaTscan SPECT displayed presynaptic dopaminergic deficiency in 3 patients. MRS demonstrated reduced N-acetylaspartate/creatine (Cr) ratio and mild elevation of both choline/Cr and combined glutamate and glutamine/Cr in the striatum in 1 case. One patient died during sleep, and another was treated with deep brain stimulation, which transiently attenuated feeding dystonia but not his gait disorder or chorea.<h4>Conclusions</h4>Larger longitudinal neuroimaging studies with different modalities, particularly MRS, are needed to determine their potential role as biomarkers for ChAc.
Mitochondrial disorders (MDs) are genetic ailments affecting all age groups. Epidemiological data and frequencies of gene mutations in pediatric patients in China are scarce. This retrospective study assessed 101 patients with suspected MDs treated at the Neurology Department of Children's Hospital, Fudan University, in 2011-2017. Mitochondrial (mtDNA) and nuclear (nDNA) samples were assessed by long-range polymerase chain reaction (PCR)-based whole mtDNA sequencing and whole exome sequencing (WES) for identifying pathogenic mutations. Muscle samples underwent various staining protocols and immunofluorescence for detecting selected proteins. Seventeen mutations in the MT-TL1, MT-COX2, MT-ND4, MT, tRNA TRNE, MT-TN, MT-TK, MT-ATP6, MT-ND6, MT-ND3 and MT-CO3 genes were identified in 39 patients, of which m.3243A > G, m.3303C > T, m.8993T > C/G, m.9176T > C, and m.10191T > C were most common. Mitochondrial myopathy and MELAS were most common for m.3243A > G mutation. Four novel mutations were detected, including m.9478insT, m.5666T > C, m.8265T > C, and m.8380-13600 deletion mutations related to Leigh syndrome, mitochondrial myopathy and KSS, respectively. Thirty-three mutations in the TK2, POLG, IBA57, HADHB, FBXL4, ALDH5A1, FOXRED1, TPK1, NDUFAF5, NDUFAF7, NDUFV1, CARS2, PDHA1, and HIBCH genes were identified in 19 patients, including 23 currently unknown. Higher rates of TK2, POLG, IBA57, and HADHB mutations were found in nDNA-mutated MD compared with the remaining individuals. Besides, IBA57 c.286T > C (p.Y96H), TK2 c.497A > T (p.D166V) founder mutations critically contributed to MDs. Comprehensive genomic analysis plays a critical role in pediatric MD diagnosis. These data summarize the relative frequencies of different gene mutations in a large Chinese population, and identified 23 novel MD-associated nDNA and 4 novel mtDNA mutations.
Also flagged:nifedipinecalciumHPPPhosphataseHypophosphatasiaCytoplasm
Journal Article2020-04-26No SnippetsLi B, He X, Dong Z, Xuan K, Sun W, Gao L, Liu S, Liu W, Hu C, Zhao Y, Shi S, Jin Y.
Show Full Abstract
The loss-of-function mutations in the ALPL result in hypophosphatasia (HPP), an inborn metabolic disorder that causes skeletal mineralization defects. In adults, the main clinical features are early loss of primary or secondary teeth, osteoporosis, bone pain, chondrocalcinosis, and fractures. However, guidelines for the treatment of adults with HPP are not available. Here, we show that ALPL deficiency caused a reduction in intracellular Ca<sup>2+</sup> influx, resulting in an osteoporotic phenotype due to downregulated osteogenic differentiation and upregulated adipogenic differentiation in both human and mouse bone marrow mesenchymal stem cells (BMSCs). Increasing the intracellular level of calcium in BMSCs by ionomycin treatment rescued the osteoporotic phenotype in <i>alpl</i><sup>+/-</sup> mice and BMSC-specific (<i>Prrx1-alpl</i><sup>-<i>/</i>-</sup>) conditional alpl knockout mice. Mechanistically, ALPL was found to be required for the maintenance of intracellular Ca<sup>2+</sup> influx, which it achieves by regulating L-type Ca<sup>2+</sup> channel trafficking via binding to the α2δ subunits to regulate the internalization of the L-type Ca<sup>2+</sup> channel. Decreased Ca<sup>2+</sup> flux inactivates the Akt/GSK3β/β-catenin signaling pathway, which regulates lineage differentiation of BMSCs. This study identifies a previously unknown role of the ectoenzyme ALPL in the maintenance of calcium channel trafficking to regulate stem cell lineage differentiation and bone homeostasis. Accelerating Ca<sup>2+</sup> flux through L-type Ca<sup>2+</sup> channels by ionomycin treatment may be a promising therapeutic approach for adult patients with HPP.
Also flagged:hydroxylhemisuccinatesstanozololmethylchlorosodium
Journal Article2020-04-26No SnippetsCasati S, Ottria R, Ciuffreda P.
Show Full Abstract
The use of doping in sports is a global problem that affects athletes around the world. Among the different methods developed to detect doping agents in biological samples, there are antibody-based methods that need an appropriate hapten design. Steroids with a hydroxyl group can be converted to the corresponding hemisuccinates. A novel approach to the synthesis of 17β-<i>O</i>-hemisuccinate of the common doping agent stanozolol is described here. Acylation of stanozolol with methyl 4-chloro-4-oxobutyrate/4-dimethylaminopyridine, followed by mild alkaline hydrolysis with methanolic sodium hydroxide at room temperature, gave the simultaneous protection and deprotection of pyrazole-nitrogen atoms. The proposed new synthetic method allows the desired hemisuccinate derivative to be obtained in only two steps, and with a good total yield starting from stanozolol.
Also flagged:Cognitive Dysfunctiondementiacognitionbehavioral disorderscognitive declinetransporter
Journal Article2020-04-26✓ 1 SnippetCacabelos R.
In-Text Gene Mentions
S I O 001029)
…mRNA expression levels of SORCS3 and OAT are differentially expressed in AD brain tissues, and 13 MDD risk genes may interact with core AD genes such as HACE1, NEGR1, and SLC6A15 [223].…
Show Full Abstract
Symptomatic interventions for patients with dementia involve anti-dementia drugs to improve cognition, psychotropic drugs for the treatment of behavioral disorders (BDs), and different categories of drugs for concomitant disorders. Demented patients may take >6-10 drugs/day with the consequent risk for drug-drug interactions and adverse drug reactions (ADRs >80%) which accelerate cognitive decline. The pharmacoepigenetic machinery is integrated by pathogenic, mechanistic, metabolic, transporter, and pleiotropic genes redundantly and promiscuously regulated by epigenetic mechanisms. CYP2D6, CYP2C9, CYP2C19, and CYP3A4/5 geno-phenotypes are involved in the metabolism of over 90% of drugs currently used in patients with dementia, and only 20% of the population is an extensive metabolizer for this tetragenic cluster. ADRs associated with anti-dementia drugs, antipsychotics, antidepressants, anxiolytics, hypnotics, sedatives, and antiepileptic drugs can be minimized by means of pharmacogenetic screening prior to treatment. These drugs are substrates, inhibitors, or inducers of 58, 37, and 42 enzyme/protein gene products, respectively, and are transported by 40 different protein transporters. <i>APOE</i> is the reference gene in most pharmacogenetic studies. <i>APOE-3</i> carriers are the best responders and <i>APOE-4</i> carriers are the worst responders; likewise, CYP2D6-normal metabolizers are the best responders and CYP2D6-poor metabolizers are the worst responders. The incorporation of pharmacogenomic strategies for a personalized treatment in dementia is an effective option to optimize limited therapeutic resources and to reduce unwanted side-effects.
…Much of the variation in Drosophila models of HD is based on which segments of the Htt protein are expressed.…
Introduction)
…in the Huntingtin (Htt) protein [ 137…
Introduction)
…segments of theHttprotein are expressed.…
Introduction)
…reduction in mutantHttaggregation by promoting…
Show Full Abstract
<i>Drosophila melanogaster</i> provides a powerful genetic model system in which to investigate the molecular mechanisms underlying neurodegenerative diseases. In this review, we discuss recent progress in <i>Drosophila</i> modeling Alzheimer's Disease, Parkinson's Disease, Amyotrophic Lateral Sclerosis (ALS), Huntington's Disease, Ataxia Telangiectasia, and neurodegeneration related to mitochondrial dysfunction or traumatic brain injury. We close by discussing recent progress using <i>Drosophila</i> models of neural regeneration and how these are likely to provide critical insights into future treatments for neurodegenerative disorders.
Also flagged:CannabidiolCannabinoidsGastrointestinal DisordersPhytocannabinoidsendocannabinoidsynthesis
Journal Article2020-04-26No SnippetsMartínez V, Iriondo De-Hond A, Borrelli F, Capasso R, Del Castillo MD, Abalo R.
Show Full Abstract
<i>Cannabis sativa</i> is an aromatic annual flowering plant with several botanical varieties, used for different purposes, like the production of fibers, the production of oil from the seeds, and especially for recreational or medical purposes. Phytocannabinoids (terpenophenolic compounds derived from the plant), include the well-known psychoactive cannabinoid Δ<sup>9</sup>-tetrahydrocannabinol, and many non-psychoactive cannabinoids, like cannabidiol. The endocannabinoid system (ECS) comprises of endocannabinoid ligands, enzymes for synthesis and degradation of such ligands, and receptors. This system is widely distributed in the gastrointestinal tract, where phytocannabinoids exert potent effects, particularly under pathological (i.e., inflammatory) conditions. Herein, we will first look at the hemp plant as a possible source of new functional food ingredients and nutraceuticals that might be eventually useful to treat or even prevent gastrointestinal conditions. Subsequently, we will briefly describe the ECS and the general pharmacology of phytocannabinoids. Finally, we will revise the available data showing that non-psychoactive phytocannabinoids, particularly cannabidiol, may be useful to treat different disorders and diseases of the gastrointestinal tract. With the increasing interest in the development of functional foods for a healthy life, the non-psychoactive phytocannabinoids are hoped to find a place as nutraceuticals and food ingredients also for a healthy gastrointestinal tract function.
Calcium is chelated by phytic acid and forms phytate-mineral complexes reducing Ca availability and the ability of phytase to hydrolyze phytate. An increased Ca concentration in the gut favors the activity of Clostridium perfringens (C. perfringens). Therefore, it was hypothesized that high dietary calcium with high dietary phytase would decrease serum Ca and P and bone mineralization during necrotic enteritis occurrence. A total of 768 one-day-old Ross 308 male chicks were randomly allocated to 8 treatments with 6 replicate pens, each housing 16 birds. A 2 × 2 × 2 factorial arrangement of treatments was applied: dietary Ca (0.6 or 1.0%), phytase (500 or 1,500 FTU/kg), and challenge (no or yes). Half of the birds (384) were challenged with Eimeria spp. on day 9 and C. perfringens strain EHE-NE18 on day 14 and 15. Blood was collected from 2 birds per pen to determine Ca, P, and parathyroid hormone in the serum. The middle toe, tibia, and femur were excised from 2 birds per pen on day 16 and 29 for determination of ash, breaking strength (BS), and mineral concentration. The challenge decreased (P < 0.05) serum Ca<sup>+</sup> in birds regardless of dietary Ca level (day 16). There was a challenge × Ca interaction (P < 0.05) for tibial BS (day 16), with challenge being more severe in birds fed high Ca than low Ca diets. A challenge × phytase interaction (P < 0.05) was present for femur ash (day 16), with high phytase only increasing ash in challenged birds. The challenge decreased (P < 0.05) the BS of femur and tibia at each time point. Birds fed high dietary Ca had lower tibial Mg (P < 0.001), Fe (P < 0.001), Na (P < 0.001), and Zn (P < 0.05) concentrations (day 29). Altogether, high dietary Ca and phytase improved bone mineralization showing that attention to Ca and P nutrition and phytase matrix values is warranted when high levels of phytase are used.
Iron plays an essential role in normal biological processes: The generation of cellular energy, oxygen transport, DNA synthesis and repair are all processes that require iron-coordinated proteins, either as elemental iron, heme or iron-sulfur clusters. As a transition metal with two major biological oxidation states, iron is also a critical intermediate in the generation of reactive oxygen species that can damage cellular structures and contribute to both aging and cancer. In this review, we focus on experimental and epidemiologic evidence that links iron and cancer, as well as strategies that have been proposed to either reduce or increase cellular iron for cancer therapy.
Also flagged:cirrhosisportal hypertensive complicationschronic diseasesLiverchronic diseasedeath
Journal Article2020-04-25✓ 1 SnippetMazumder NR, Celaj S, Atiemo K, Daud A, Jackson KL, Kho A, Levitsky J, Ladner DP.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background & aims</h4>Sex-based differences are known to significantly contribute to outcomes in patients with chronic liver diseases; however, the role of patient sex in cirrhosis is unclear. We aimed to study the relationship between patient sex and cirrhosis.<h4>Methods</h4>We analyzed a cohort of 20,045 patients with cirrhosis using a Chicago-wide electronic health record database that was linked with the United Network for Organ Sharing and cause of death data from the state death registry. Adjusted Cox survival analyses and competing risk analyses were performed to obtain subdistribution hazard ratios (HRs) for liver-related cause of death.<h4>Results</h4>Female and male patients had similar age, racial distribution, insurance status, and comorbidity status by Elixhauser score. Females had higher rates of cholestatic liver disease (17.1% vs. 6.2%, p <0.001) and non-alcoholic steatohepatitis (29.8% vs. 21.2%, p <0.001) than males. They were less likely to have portal hypertensive complications and had lower peak MELD-Na scores during follow-up. Female sex was associated with a decreased hazard of all-cause mortality (adjusted HR 0.85; 95% CI 0.80-0.90). This effect was attenuated when liver-related mortality was examined (subdistribution HR 0.93; 95% CI 0.87-1.00). No significant difference was noted for women who were 'ever-listed' in competing risk analyses for either all-cause mortality (subdistribution HR 1.09; 95% CI 0.88-1.35) or liver-related death (subdistribution HR 1.12; 95% CI 0.87-1.43), despite lower rates of listing (7.5% vs. 9.8%; p <0.001) and transplant (3.5% vs. 5.2%; p <0.001).<h4>Conclusions</h4>In this longitudinal study of patients with cirrhosis, female sex was associated with a survival advantage likely driven by lower rates of non-liver-related death. Women were not at an increased risk of liver-related death despite lower rates of listing and transplantation.<h4>Lay summary</h4>Patient sex is an important contributor in many chronic diseases, including cirrhosis. Prior studies have suggested that female sex is associated with worse outcomes. We analyzed a cohort of 20,045 patients with cirrhosis using a Chicago-wide electronic health record database. Using multivariate competing risk analyses, we found that female sex in cirrhosis is actually associated with a lower risk of all-cause mortality and has no association with liver-related mortality. Our findings are novel because we show that women with cirrhosis have a similar risk of liver-related death as their male counterparts, despite lower rates of listing and transplantation.
Also flagged:brain dysembryoplastic neuroepithelial tumorEPHA6KLF13UBR3NFIAATP7A
Journal Article2020-04-25✓ 5 SnippetsMurcia Pienkowski V, Kucharczyk M, Rydzanicz M, Poszewiecka B, Pachota K, Młynek M, Stawiński P, Pollak A, Kosińska J, Wojciechowska K, Lejman M, Cieślikowska A, Wicher D, Stembalska A, Matuszewska K, Materna-Kiryluk A, Gambin A, Chrzanowska K, Krajewska-Walasek M, Płoski R.
De novo balanced chromosomal aberrations (BCAs), such as reciprocal translocations and inversions, are genomic aberrations that, in approximately 25% of cases, affect the human phenotype. Delineation of the exact structure of BCAs may provide a precise diagnosis and/or point to new disease loci. We report on six patients with de novo balanced chromosomal translocations (BCTs) and one patient with a de novo inversion, in whom we mapped breakpoints to a resolution of 1 bp, using shallow whole-genome mate pair sequencing. In all seven cases, a disruption of at least one gene was found. In two patients, the phenotypic impact of the disrupted genes is well known (<i>NFIA, ATP7A</i>). In five patients, the aberration damaged genes: <i>PARD3, EPHA6, KLF13, STK24, UBR3, MLLT10</i> and <i>TLE3</i>, whose influence on the human phenotype is poorly understood. In particular, our results suggest novel candidate genes for retinal degeneration with anophthalmia (<i>EPHA6</i>), developmental delay with speech impairment (<i>KLF13</i>), and developmental delay with brain dysembryoplastic neuroepithelial tumor (<i>UBR3</i>). In conclusion, identification of the exact structure of symptomatic BCTs using next generation sequencing is a viable method for both diagnosis and finding novel disease candidate genes in humans.
Also flagged:pyronemineralhydroxyapatitebiofilm formationrpfclp
Journal Article2020-04-25No SnippetsPapaianni M, Ricciardelli A, Fulgione A, d'Errico G, Zoina A, Lorito M, Woo SL, Vinale F, Capparelli R.
Show Full Abstract
Biofilm protects bacteria against the host's immune system and adverse environmental conditions. Several studies highlight the efficacy of lytic phages in the prevention and eradication of bacterial biofilms. In this study, the lytic activity of Xccφ1 (<i>Xanthomonas campestris</i> pv. <i>campestris</i>-specific phage) was evaluated in combination with 6-pentyl-α-pyrone (a secondary metabolite produced by <i>Trichoderma atroviride</i> P1) and the mineral hydroxyapatite. Then, the antibiofilm activity of this interaction, called a φHA6PP complex, was investigated using confocal laser microscopy under static and dynamic conditions. Additionally, the mechanism used by the complex to modulate the genes (<i>rpf, gumB, clp</i> and <i>manA</i>) involved in the biofilm formation and stability was also studied. Our results demonstrated that Xccφ1, alone or in combination with 6PP and HA, interfered with the gene pathways involved in the formation of biofilm. This approach can be used as a model for other biofilm-producing bacteria.
Also flagged:Presynapsesgrowth conesaxonsaxonalsynaptic vesiclessynapses
Journal Article2020-04-25✓ 3 SnippetsSasaki Y.
In-Text Gene Mentions
Introduction)
…the netrin receptorDCC(deleted in colorectal…
Introduction)
…the netrin-1 receptorDCCand Sema3A co-receptor…
Introduction)
…BothDCCand Nrp1 also…
Show Full Abstract
During neural development, growth cones, very motile compartments of tips of axons, lead axonal extension to the correct targets. Subsequently, presynapses, another axonal compartment with vigorous trafficking of synaptic vesicles, emerge to form functional synapses with postsynapses. In response to extracellular stimuli, the immediate supply of proteins by local translation within these two axonal compartments far from cell bodies confers high motility of growth cones and active vesicle trafficking in presynapses. Although local translation in growth cones and presynapses occurs at a very low level compared with cell bodies and even dendrites, recent progress in omics and visualization techniques with subcellular fractionation of these compartments has revealed the actual situation of local translation within these two axonal compartments. Here, the increasing evidence for local protein synthesis in growth cones and presynapses for axonal and synaptic functions has been reviewed. Furthermore, the mechanisms regulating local translation in these two compartments and pathophysiological conditions caused by dysregulated local translation are highlighted.
Also flagged:Carbonnicotinelipidquinolinatehemechronic obstructive pulmonary disease
Journal Article2020-04-25✓ 1 SnippetTitz B, Szostak J, Sewer A, Phillips B, Nury C, Schneider T, Dijon S, Lavrynenko O, Elamin A, Guedj E, Tsin Wong E, Lebrun S, Vuillaume G, Kondylis A, Gubian S, Cano S, Leroy P, Keppler B, Ivanov NV, Vanscheeuwijck P, Martin F, Peitsch MC, Hoeng J.
In-Text Gene Mentions
Results)
…the abundance ofPrdx6, which acts as…
Show Full Abstract
Cigarette smoke (CS) causes adverse health effects and, for smoker who do not quit, modified risk tobacco products (MRTPs) can be an alternative to reduce the risk of developing smoking-related diseases. Standard toxicological endpoints can lack sensitivity, with systems toxicology approaches yielding broader insights into toxicological mechanisms. In a 6-month systems toxicology study on ApoE<sup>-/-</sup> mice, we conducted an integrative multi-omics analysis to assess the effects of aerosols from the Carbon Heated Tobacco Product (CHTP) 1.2 and Tobacco Heating System (THS) 2.2-a potential and a candidate MRTP based on the heat-not-burn (HnB) principle-compared with CS at matched nicotine concentrations. Molecular exposure effects in the lungs were measured by mRNA/microRNA transcriptomics, proteomics, metabolomics, and lipidomics. Integrative data analysis included Multi-Omics Factor Analysis and multi-modality functional network interpretation. Across all five data modalities, CS exposure was associated with an increased inflammatory and oxidative stress response, and lipid/surfactant alterations. Upon HnB aerosol exposure these effects were much more limited or absent, with reversal of CS-induced effects upon cessation and switching to CHTP 1.2. Functional network analysis revealed CS-induced complex immunoregulatory interactions across the investigated molecular layers (e.g., itaconate, quinolinate, and miR-146) and highlighted the engagement of the heme-Hmox-bilirubin oxidative stress axis by CS. This work exemplifies how multi-omics approaches can be leveraged within systems toxicology studies and the generated multi-omics data set can facilitate the development of analysis methods and can yield further insights into the effects of toxicological exposures on the lung of mice.
Ensconsin is encoded by the MAP7 gene and belongs to the microtubule-associated proteins. This study aimed to explore its functional roles and partners in cell-cycle progression in cervical cancer. Data from the Cancer Genome Atlas-Cervical & Endocervical Cancer (TCGA-CESC) and the Genotype-Tissue Expression project were used for bioinformatic analysis. SiHa cells were used for in-vitro and in-vivo analysis. Co-immunoprecipitation (Co-IP) assay was conducted to explore the proteins interacted with MAP7. Results showed that MAP7 mRNA expression might serve as an independent biomarker of shorter survival. MAP7 overexpression elevated cyclin D1/cyclin B1 expression, facilitated cell-cycle progression and promoted SiHa cell growth in a xenograft tumor model. Co-IP experiments confirmed a novel interaction between MAP7 and RC3H1. Knockdown of either RC3H1 or MAP7 significantly attenuated cyclin D1/cyclin B1 upregulation, and cell-cycle progression induced by the other partner. MAP7 overexpression led to increased expression of P-IKK (Ser176/177) and P-p65 (Ser536). RC3H1 inhibition abrogated MAP7 induced upregulation of P-IKK and P-p65. Data in TCGA-CESC showed that MAP7 expression was positively correlated with its copy number segments, but was negatively correlated with the methylation level of three CpG sites within the gene locus. Demethylation treatment by 5-Aza-dC elevated both MAP7 mRNA and protein expression in a dose-dependent manner. In conclusion, this study revealed a novel interaction between MAP7 and RC3H1 in cervical cancer cells, which cooperatively enhanced cyclin D1/cyclin B1 expression and facilitated cell-cycle progression. These effects were at least partly mediated by activated canonical IKK/NF-kB signaling.
Also flagged:hydroxyapatitecollagencalcium phosphateβ-tricalcium phosphatecalciumsilicate
Journal Article2020-04-25No SnippetsBigham A, Kermani S, Saudi A, Aghajanian AH, Rafienia M.
Show Full Abstract
<h4>Background</h4>For a new biomaterial which is going to be applied in bone tissue regeneration, bioactivity (bone bonding ability) and desirable mechanical properties are very essential parameters to take into consideration. In the present study, the gehlenite's mechanical properties and bioactivity are assessed and compared with hydroxyapatite (HA) for bone tissue regeneration.<h4>Method</h4>Gehlenite and HA nanoparticles are synthesized through sol-gel method and coprecipitation technique, respectively, and their physical and chemical properties are characterized through X-ray diffraction, Fourier transform infrared spectroscopy, and transmission electron microscopy.<h4>Results</h4>The results prove that the gehlenite and HA phases without any undesirable phase are obtained, and the particles of both compounds are in the nanometer range with spherical morphology. The compressive strength of both compounds are assessed, and the values for gehlenite and HA disks are 144 ± 5 and 150 ± 4.8 MPa, respectively. Next, their bioactivity potential is assessed into simulated body fluid (SBF) up to 21 days, and the results show that after 14 days, gehlenite disk's surface is completely covered with newly formed Ca-P particles. However, some sporadic precipitations after 21 days soaking into SBF are formed onto the HA disk's surface.<h4>Conclusion</h4>This comparative study shows that nanostructured gehlenite disk with desirable mechanical properties and faster bioactivity kinetic than HA can be considered as a promising bioceramic for bone tissue regeneration.
A convenient methodology for constructing 6,6-difluorospiro[3.3]heptane scaffold - a conformationally restricted isostere of <i>gem</i>-difluorocycloalkanes - is developed. Alarge array of novel 2-mono- and 2,2-bifunctionalized difluorospiro[3.3]heptane building blocks was obtained through the convergent synthesis strategy using a common synthetic precursor - 1,1-bis(bromomethyl)-3,3-difluorocyclobutane. The target compounds and intermediates were prepared by short reaction sequences (6-10 steps) on multigram scale (up to 0.47 kg).
…were compatible withhemochromatosis, and there were…
Show Full Abstract
BACKGROUND Juvenile hemochromatosis is a rare genetic disease that leads to intense iron accumulation. The disease onset usually occurs before the third decade of life and causes severe dysfunction in various organs. The most classical clinical findings are hypogonadotropic hypogonadism, cardiomyopathy, liver fibrosis, glycemic changes, arthropathy and skin pigmentation. However, secondary hypothyroidism is not reported in these patients. Juvenile hemochromatosis has an autosomal recessive inheritance and might be type 2A or type 2B, due to mutation in either the hemojuvelin gene (HJV) or hepcidin antimicrobial peptide (HAMP) gene. CASE REPORT A 26-year-old female patient was admitted with a recent history of diabetic ketoacidosis. Three months after that admission, she presented with arthralgia, diffuse abdominal pain, adynamia, hair loss, darkening of the skin and amenorrhea. Severe iron overload was found and findings in the hepatic biopsy were compatible with hemochromatosis. An upper abdominal magnetic resonance imaging (MRI) showed iron deposition in the liver and pancreas and pituitary MRI exhibited accumulation on the anterior pituitary. After 16 months the patient presented with dyspnea and lower limb edema, and cardiac MRI indicated iron deposition in the myocardium. The patient was diagnosed with juvenile hemochromatosis presenting with hypogonadotropic hypogonadism, cardiomyopathy, insulin-dependent diabetes mellitus, and secondary hypothyroidism. A novel homozygous mutation, c.697delC, in the HJV gene was detected. CONCLUSIONS We describe for the first time a severe and atypical case of juvenile hemochromatosis type 2A presenting classical clinical features, as well as secondary hypothyroidism resulting from a novel mutation in the HJV gene.
Also flagged:mitochondriaTie2photonmitochondriallocalizationRhodamine B
Journal Article2020-04-24No SnippetsRutkai I, Evans WR, Bess N, Salter-Cid T, Čikić S, Chandra PK, Katakam PVG, Mostany R, Busija DW.
Show Full Abstract
Mitochondria are important regulators of cerebral vascular function in health and disease, but progress in understanding their roles has been hindered by methodological limitations. We report the first in vivo imaging of mitochondria specific to the cerebral endothelium in real time in the same mouse for extended periods. Mice expressing Dendra2 fluorescent protein in mitochondria (mito-Dendra2) in the cerebral vascular endothelium were generated by breeding PhAM-floxed and Tie2-Cre mice. We used mito-Dendra2 expression, cranial window implantation, and two-photon microscopy to visualize mitochondria in the cerebral vascular endothelium of mice. Immunohistochemistry and mitochondrial staining were used to confirm the localization of the mitochondrial signal to endothelial cells and the specificity of mito-Dendra2 to mitochondria. Mito-Dendra2 and Rhodamine B-conjugated dextran allowed simultaneous determinations of mitochondrial density, vessel diameters, area, and mitochondria-to-vessel ratio in vivo, repeatedly, in the same mouse. Endothelial expression of mito-Dendra2 was confirmed in vitro on brain slices and aorta. In addition, we observed an overlapping mito-Dendra2 and Chromeo mitochondrial staining of cultured brain microvascular endothelial cells. Repeated imaging of the same location in the cerebral microcirculation in the same mouse demonstrated stability of mito-Dendra2. While the overall mitochondrial signal was stable over time, mitochondria within the same endothelial cell were mobile. In conclusion, our results indicate that the mito-Dendra2 signal and vascular parameters are suitable for real-time and longitudinal examination of mitochondria in vivo in the cerebral vasculature of mice.<b>NEW & NOTEWORTHY</b> We introduce an innovative in vivo approach to study mitochondria in the cerebral circulation in their physiological environment by demonstrating the feasibility of long-term imaging and three-dimensional reconstruction. We postulate that the appropriate combination of Cre/Lox system and two-photon microscopy will contribute to a better understanding of the role of mitochondria in not only endothelium but also the different cell types of the cerebral circulation.
Also flagged:Autophagythiostreptonimmune responsesdeathcytoplasmicadenosine triphosphate
Journal Article2020-04-24No SnippetsKepp O, Kroemer G.
Show Full Abstract
Macroautophagy/autophagy induction by caloric restriction mimetics (CRMs) is a strategy to stimulate anticancer immune responses of immunogenic cell death (ICD)-inducing chemotherapeutics. We designed a phenotypic screening campaign in which we identified pharmacological agents that have CRM properties (i.e., non-cytotoxic induction of autophagic flux that reduces cytoplasmic protein acetylation) and simultaneously act as ICD amplifiers (i.e. with the capacity to enhance the release of adenosine triphosphate, ATP, from stressed and dying cancer cells). This approach led to the identification of thiostrepton, a natural cyclic oligopeptide antibiotic, as an agent that enhances chemotherapy-induced anticancer immune responses in vivo, in immunocompetent mice bearing syngeneic tumors. Interestingly, both the pro-autophagic and the anticancer effects of thiostrepton rely on the activation of TFEB (transcription factor EB) and TFE3 (transcription factor E3). In summary, thiostrepton represents a novel CRM and ICD amplifier that may be useful for cancer therapy.
Also flagged:neuropsychiatric diseasescancerXRCC4p53brain developmentneurological diseases
Journal Article2020-04-24✓ 1 SnippetTena A, Zhang Y, Kyritsis N, Devorak A, Zurita J, Wei PC, Alt FW.
In-Text Gene Mentions
Text
…Dcc…
Show Full Abstract
Mild replication stress enhances appearance of dozens of robust recurrent genomic break clusters, termed RDCs, in cultured primary mouse neural stem and progenitor cells (NSPCs). Robust RDCs occur within genes ("RDC-genes") that are long and have roles in neural cell communications and/or have been implicated in neuropsychiatric diseases or cancer. We sought to develop an in vitro approach to determine whether specific RDC formation is associated with neural development. For this purpose, we adapted a system to induce neural progenitor cell (NPC) development from mouse embryonic stem cell (ESC) lines deficient for XRCC4 plus p53, a genotype that enhances DNA double-strand break (DSB) persistence to enhance detection. We tested for RDCs by our genome-wide DSB identification approach that captures DSBs via their ability to join to specific genomic Cas9/single-guide RNA-generated bait DSBs. In XRCC4/p53-deficient ESCs, we detected seven RDCs, all of which were in genes and two of which were robust. In contrast, in NPCs derived from these ESC lines we detected 29 RDCs, a large fraction of which were robust and associated with long, transcribed neural genes that were also robust RDC-genes in primary NSPCs. These studies suggest that many RDCs present in NSPCs are developmentally influenced to occur in this cell type and indicate that induced development of NPCs from ESCs provides an approach to rapidly elucidate mechanistic aspects of NPC RDC formation.
Also flagged:LuciferaseTNFGCN1L1Laccase2DSEmandibular disorders
Journal Article2020-04-24No SnippetsZhu H, Hu Y, Wang C, Zhang X, He D.
Show Full Abstract
Altered expression of circular RNAs (circRNAs) has been identified in various human diseases. In this study, we investigated whether circRNAs function as competing endogenous RNAs to regulate the pathological process of temporomandibular joint osteoarthritis (TMJOA). High-throughput sequencing of mRNA (RNA seq) was performed to detect the expression of circRNAs in TMJOA and control synovial tissues isolated from humans. The differentially upregulated circGCN1L1 (hsa_circ_0000448) in synoviocyte was validated in vitro and in vivo. Here we demonstrate the interactions between circGCN1L1 and both miR-330-3p and tumor necrosis factor-α (TNF-α) through bioinformatics predictions, luciferase report assays, and fluorescence in situ hybridization. mRNA expression profiles of TNF-α-stimulated synoviocyte showed that circGCN1L1 and p65 expressions were upregulated by TNF-α. Moreover, miR-330-3p was negatively correlated with TNF-α secretion. Further, we found that miR-330-3p directly targeted TNF and restrained the production of matrix-degrading enzymes (MMP3, MMP13, and ADAMTS4). Mechanistic studies unveiled that circGCN1L1 in TMJOA synovial tissues and cells may be associated with condylar chondrocyte apoptosis and synoviocyte hyperplasia. Moreover, intra-articular injection of shcircGCN1L1 alleviated TMJOA progression in rat models. Altogether, we elucidated the important roles of a novel circRNA, namely, circGCN1L1, which induced inflammation in TMJ synoviocytes and decreased anabolism of the extracellular matrix (ECM) through miR-330-3p and TNF-α gene. This circRNA may represent a potentially effective therapeutic strategy against TMJOA progression at an early stage.
Also flagged:CCFcolorectal cancerCRCprimary tumorMSSlymphatic metastases
Journal Article2020-04-24✓ 1 SnippetZhang C, Zhang L, Xu T, Xue R, Yu L, Zhu Y, Wu Y, Zhang Q, Li D, Shen S, Tan D, Bai F, Zhang H.
In-Text Gene Mentions
Results)
…Neoantigens derived fromDNAH10, GRIN2A ,…
Show Full Abstract
Lymphatic metastases are closely associated with tumor relapse and reduced survival in colorectal cancer (CRC). How tumor cells disseminate within the lymphatic network remains largely unknown. Here, we analyze the subclonal structure of 94 tumor samples, covering the primary tumors, lymph node metastases (LNMs), and liver metastases from 10 CRC patients. We portray a high-resolution lymphatic metastatic map for CRC by dividing LNMs into paracolic, intermediate, and central subgroups. Among the 61 metastatic routes identified, 38 (62.3%) are initiated from the primary tumors, 22 (36.1%) from LNMs, and 1 from liver metastasis (1.6%). In 5 patients, we find 6 LNMs that reseed 2 or more LNMs. We summarize 3 diverse modes of metastasis in CRC and show that skip spreading of tumor cells within the lymphatic network is common. Our study sheds light on the complicated metastatic pattern in CRC and has great clinical implications.
…Ongoing efforts in our laboratory are focused on creating an AAV-mediated model of HD via delivery of the disease-causing gene, mutant HTT (mHTT), into the caudate and putamen of adult rhesus macaques.…
Abstract)
…We then evaluated the capability of AAV2.retro to deliver disease-related gene cargo to biologically-relevant NHP brain circuits by packaging a fragment of human mutant HTT, the causative gene mutation in Huntington’s disease.…
Show Full Abstract
Recently, AAV2.retro, a new capsid variant capable of efficient retrograde transport in brain, was generated in mice using a directed evolution approach. However, it remains unclear to what degree transport will be recapitulated in the substantially larger and more complex nonhuman primate (NHP) brain. Here, we compared the biodistribution of AAV2.retro with its parent serotype, AAV2, in adult macaques following delivery into the caudate and putamen, brain regions which comprise the striatum. While AAV2 transduction was primarily limited to the injected brain regions, AAV2.retro transduced cells in the striatum and in dozens of cortical and subcortical regions with known striatal afferents. We then evaluated the capability of AAV2.retro to deliver disease-related gene cargo to biologically-relevant NHP brain circuits by packaging a fragment of human mutant HTT, the causative gene mutation in Huntington's disease. Following intra-striatal delivery, pathological mHTT-positive protein aggregates were distributed widely among cognitive, motor, and limbic cortico-basal ganglia circuits. Together, these studies demonstrate strong retrograde transport of AAV2.retro in NHP brain, highlight its utility in developing novel NHP models of brain disease and suggest its potential for querying circuit function and delivering therapeutic genes in the brain, particularly where treating dysfunctional circuits, versus single brain regions, is warranted.
Also flagged:extracellularvesiclesmalignant ascitescell communicationnucleotidesmetabolism
Journal Article2020-04-24No SnippetsLin D, Chen T, Xie M, Li M, Zeng B, Sun R, Zhu Y, Ye D, Wu J, Sun J, Xi Q, Jiang Q, Zhang Y.
Show Full Abstract
Breast milk is the most important nutrient source for newborn mammals. Studies have reported that milk contains microRNAs (miRNAs), which are potential regulatory components. Currently, existing functional and nutritional two competing hypotheses in milk field though little date have been provided for nutritional hypothesis. In this study, we used the qRT-PCR method to evaluated whether milk miRNAs can be absorbed by newborn piglets by feeding them porcine or bovine milk. The result showed that miRNA levels (miR-2284×, 2291, 7134, 1343, 500, 223) were significantly different between bovine and porcine milk. Four miRNAs (miR-2284×, 2291, 7134, 1343) were significantly different in piglet serum after feeding porcine or bovine milk. After separated milk exosomes by ultracentrifugation, the results showed the selected milk miRNAs (miR-2284×, 2291, 7134, 1343) were present in both exosomes and supernatants, and the miRNAs showed the coincidental expression in IPEC-J2 cells. All our founding suggested that the milk miRNAs can be absorbed both in vivo and in vitro, which will building the foundation for understanding whether these sort of miRNAs exert physiological functions after being absorbed and provided additional evidence for the nutritional hypotheses.
Also flagged:GroamiodaroneTNCiodineliver steatosisdamage
Journal Article2020-04-24✓ 1 SnippetLaukamp KR, Lennartz S, Hashmi A, Obmann M, Ho V, Große Hokamp N, Graner FP, Gilkeson R, Persigehl T, Gupta A, Ramaiya N.
Amiodarone accumulates in the liver, where it increases x-ray attenuation due to its iodine content. We evaluated liver attenuation in patients treated and not treated with amiodarone using true-non-contrast (TNC) and virtual-non-contrast (VNC) images acquired with spectral-detector-CT (SDCT). 142 patients, of which 21 have been treated with amiodarone, receiving SDCT-examinations (unenhanced-chest CT [TNC], CT-angiography of chest and abdomen [CTA-Chest, CTA-Abdomen]) were included. TNC, CTA-Chest, CTA-Abdomen, and corresponding VNC-images (VNC-Chest, VNC-Abdomen) were reconstructed. Liver-attenuation-index (LAI) was calculated as difference between liver- and spleen-attenuation. Liver-attenuation and LAI derived from TNC-images of patients receiving amiodarone were higher. Contrary to TNC, liver-attenuation and LAI were not higher in amiodarone patients in VNC-Chest and in VNC-Abdomen. To verify these initial results, a phantom scan was performed and an additional patient cohort included, both confirming that VNC is viable of accurately subtracting iodine of hepatic amiodarone-deposits. This might help to monitor liver-attenuation more accurately and thereby detect liver steatosis as a sign of liver damage earlier as well as to verify amiodarone accumulation in the liver.
Also flagged:MembranePhospholipidsPolyphosphatesserine proteaseglucoseinsulin
Journal Article2020-04-24✓ 3 SnippetsTindall CA, Dommel S, Riedl V, Ulbricht D, Hanke S, Sträter N, Heiker JT.
In-Text Gene Mentions
Introduction)
…In contrast to other serpins such as heparin cofactor II (SERPIND1) [27], plasminogen activator inhibitor 1 (PAI, SERPINE1) [28] or antithrombin (AT3, SERPINC1) [29], which bind heparin at the opposite side of the serpin molecule (in helix D), heparin binds to vaspin at a unique positively charged patch located in the central β-sheet A. Residues Arg211 and Lys359 are key residues mediating high-affinity heparin binding by vaspin (KD: 21.6 ± 2.5 nM) [25].…
Introduction)
…or antithrombin (AT3,SERPINC1) [ 29 ],…
Discussion)
…and antithrombin (AT3,SERPINC1) do not bind…
Show Full Abstract
Visceral adipose tissue derived serine protease inhibitor (vaspin) is a member of the serpin family and has been shown to have beneficial effects on glucose tolerance, insulin stability as well as adipose tissue inflammation, parameters seriously affected by obesity. Some of these effects require inhibition of target proteases such as kallikrein 7(KLK7) and many studies have demonstrated vaspin-mediated activation of intracellular signaling cascades in various cells and tissues. So far, little is known about the exact mechanism how vaspin may trigger these intracellular signaling events. In this study, we investigated and characterized the interaction of vaspin with membrane lipids and polyphosphates as well as their potential regulatory effects on serpin activity using recombinant vaspin and KLK7 proteins and functional protein variants thereof. Here, we show for the first time that vaspin binds to phospholipids and polyphosphates with varying effects on KLK7 inhibition. Vaspin binds strongly to monophosphorylated phosphatidylinositol phosphates (PtdInsP) with no effect on vaspin activation. Microscale thermophoresis (MST) measurements revealed high-affinity binding to polyphosphate 45 (K<sub>D</sub>: 466 ± 75 nM) and activation of vaspin in a heparin-like manner. Furthermore, we identified additional residues in the heparin binding site in β-sheet A by mutating five basic residues resulting in complete loss of high-affinity heparin binding. Finally, using lipid overlay assays, we show that these residues are additionally involved in PtdInsP binding. Phospholipids play a major role in membrane trafficking and signaling whereas polyphosphates are procoagulant and proinflammatory agents. The identification of phospholipids and polyphosphates as binding partners of vaspin will contribute to the understanding of vaspins involvement in membrane trafficking, signaling and beneficial effects associated with obesity.
Also flagged:Flashetheracetic anhydridesilicaTryptophanLys
Journal Article2020-04-24No SnippetsHeidari A, Ghorbani-Choghamarani A, Hajjami M, Hudson RHE.
Show Full Abstract
There has been much effort to exploit fluorescence techniques in the detection of nucleic acids. Canonical nucleic acids are essentially nonfluorescent; however, the modification of the nucleobase has proved to be a fruitful way to engender fluorescence. Much of the chemistry used to prepare modified nucleobases relies on expensive transition metal catalysts. In this work, we describe the synthesis of biaryl quinazolinone-uracil nucleobase analogs prepared by the condensation of anthranilamide derivatives and 5-formyluracil using inexpensive copper salts. A selection of modified nucleobases were prepared, and the effect of methoxy- or nitro- group substitution on the photophysical properties was examined. Both the dihydroquinazolinone and quinazolinone modified uracils have much larger molar absorptivity (~4-8×) than natural uracil and produce modest blue fluorescence. The quinazolinone-modified uracils display higher quantum yields than the corresponding dihydroquinazolinones and also show temperature and viscosity dependent emission consistent with molecular rotor behavior. Peptide nucleic acid (PNA) monomers possessing quinazolinone modified uracils were prepared and incorporated into oligomers. In the sequence context examined, the nitro-substituted, methoxy-substituted and unmodified quinazolinone inserts resulted in a stabilization (∆T<sub>m</sub> = +4.0/insert; +2.0/insert; +1.0/insert, respectively) relative to control PNA sequence upon hybridization to complementary DNA. All three derivatives responded to hybridization by the "turn-on" of fluorescence intensity by ca. 3-to-4 fold and may find use as probes for complementary DNA sequences.
Also flagged:mammary tumorsCMTalbuminS100A4breast cancerkallikrein-1
Journal Article2020-04-24No SnippetsFranco-Martínez L, Gelemanović A, Horvatić A, Contreras-Aguilar MD, Dąbrowski R, Mrljak V, Cerón JJ, Martínez-Subiela S, Tvarijonaviciute A.
Show Full Abstract
The aim of this study was to evaluate changes in serum and saliva proteomes in canine mammary tumors (CMT) using a high-throughput quantitative proteomic analysis in order to potentially discover possible biomarkers of this disease. Proteomes of paired serum and saliva samples from healthy controls (HC group, <i>n</i> = 5) and bitches with CMT (CMT group, <i>n</i> = 5) were analysed using a Tandem Mass Tags-based approach. Twenty-five dogs were used to validate serum albumin as a candidate biomarker in an independent sample set. The proteomic analysis quantified 379 and 730 proteins in serum and saliva, respectively. Of those, 35 proteins in serum and 49 in saliva were differentially represented. The verification of albumin in serum was in concordance with the proteomic data, showing lower levels in CMT when compared to the HC group. Some of the modulated proteins found in the present study such as haptoglobin or S100A4 have been related to CMT or human breast cancer previously, while others such as kallikrein-1 and immunoglobulin gamma-heavy chains A and D are described here for the first time. Our results indicate that saliva and serum proteomes can reflect physiopathological changes that occur in CMT in dogs and can be a potential source of biomarkers of the disease.
Also flagged:Circadian Rhythmcircadian rhythmstype 2 diabetes mellitusmetabolic syndromesleepmetabolic disorders
Journal Article2020-04-24✓ 1 SnippetHudec M, Dankova P, Solc R, Bettazova N, Cerna M.
In-Text Gene Mentions
Introduction)
…(HDACs), ubiquitin ligase:F-box and leucine-rich repeat protein 3and leucine-rich repeat…
Show Full Abstract
This review aims to summarize the knowledge about the relationship between circadian rhythms and their influence on the development of type 2 diabetes mellitus (T2DM) and metabolic syndrome. Circadian rhythms are controlled by internal molecular feedback loops that synchronize the organism with the external environment. These loops are affected by genetic and epigenetic factors. Genetic factors include polymorphisms and mutations of circadian genes. The expression of circadian genes is regulated by epigenetic mechanisms that change from prenatal development to old age. Epigenetic modifications are influenced by the external environment. Most of these modifications are affected by our own life style. Irregular circadian rhythm and low quality of sleep have been shown to increase the risk of developing T2DM and other metabolic disorders. Here, we attempt to provide a wide description of mutual relationships between epigenetic regulation, circadian rhythm, aging process and highlight new evidences that show possible therapeutic advance in the field of chrono-medicine which will be more important in the upcoming years.
Also flagged:SepsisC5acoagulationThrombin-activatable fibrinolysisTAFIcomplement anaphylatoxin C5a
Journal Article2020-04-24✓ 2 SnippetsVollrath JT, Marzi I, Herminghaus A, Lustenberger T, Relja B.
In-Text Gene Mentions
Discussion)
…to restore plasmaATIIIlevels were promising,…
Discussion)
…the use ofATIIIin the updated…
Show Full Abstract
<h4>Background</h4>Sepsis frequently occurs after major trauma and is closely associated with dysregulations in the inflammatory/complement and coagulation system. Thrombin-activatable fibrinolysis inhibitor (TAFI) plays a dual role as an anti-fibrinolytic and anti-inflammatory factor by downregulating complement anaphylatoxin C5a. The purpose of this study was to investigate the association between TAFI and C5a levels and the development of post-traumatic sepsis. Furthermore, the predictive potential of both TAFI and C5a to indicate sepsis occurrence in polytraumatized patients was assessed.<h4>Methods</h4>Upon admission to the emergency department (ED) and daily for the subsequent ten days, circulating levels of TAFI and C5a were determined in 48 severely injured trauma patients (injury severity score (ISS) ≥ 16). Frequency matching according to the ISS in septic vs. non-septic patients was performed. Trauma and physiologic characteristics, as well as outcomes, were assessed. Statistical correlation analyses and cut-off values for predicting sepsis were calculated.<h4>Results</h4>Fourteen patients developed sepsis, while 34 patients did not show any signs of sepsis (no sepsis). Overall injury severity, as well as demographic parameters, were comparable between both groups (ISS: 25.78 ± 2.36 no sepsis vs. 23.46 ± 2.79 sepsis). Septic patients had significantly increased C5a levels (21.62 ± 3.14 vs. 13.40 ± 1.29 ng/mL; <i>p</i> < 0.05) and reduced TAFI levels upon admission to the ED (40,951 ± 5637 vs. 61,865 ± 4370 ng/mL; <i>p</i> < 0.05) compared to the no sepsis group. Negative correlations between TAFI and C5a (<i>p</i> = 0.0104) and TAFI and lactate (<i>p</i> = 0.0423) and positive correlations between C5a and lactate (<i>p</i> = 0.0173), as well as C5a and the respiratory rate (<i>p</i> = 0.0266), were found. In addition, correlation analyses of both TAFI and C5a with the sequential (sepsis-related) organ failure assessment (SOFA) score have confirmed their potential as early sepsis biomarkers. Cut-off values for predicting sepsis were 54,857 ng/mL for TAFI with an area under the curve (AUC) of 0.7550 (<i>p</i> = 0.032) and 17 ng/mL for C5a with an AUC of 0.7286 (<i>p</i> = 0.034).<h4>Conclusion</h4>The development of sepsis is associated with early decreased TAFI and increased C5a levels after major trauma. Both elevated C5a and decreased TAFI may serve as promising predictive factors for the development of sepsis after polytrauma.
Also flagged:PalbociclibERcyclin-dependent kinases 4CDK4estrogen receptorbreast cancer
Journal Article2020-04-24No SnippetsLanceta L, O'Neill C, Lypova N, Li X, Rouchka E, Waigel S, Gomez-Gutierrez JG, Chesney J, Imbert-Fernandez Y.
Show Full Abstract
Acquired resistance to cyclin-dependent kinases 4 and 6 (CDK4/6) inhibition in estrogen receptor-positive (ER+) breast cancer remains a significant clinical challenge. Efforts to uncover the mechanisms underlying resistance are needed to establish clinically actionable targets effective against resistant tumors. In this study, we sought to identify differentially expressed genes (DEGs) associated with acquired resistance to palbociclib in ER+ breast cancer. We performed next-generation transcriptomic RNA sequencing (RNA-seq) and pathway analysis in ER+ MCF7 palbociclib-sensitive (MCF7/pS) and MCF7 palbociclib-resistant (MCF7/pR) cells. We identified 2183 up-regulated and 1548 down-regulated transcripts in MCF7/pR compared to MCF7/pS cells. Functional analysis of the DEGs using Gene Ontology (GO) and the Kyoto Encyclopedia of Genes and Genomes (KEGG) database identified several pathways associated with breast cancer, including 'cell cycle', 'DNA replication', 'DNA repair' and 'autophagy'. Additionally, Ingenuity Pathway Analysis (IPA) revealed that resistance to palbociclib is closely associated with deregulation of several key canonical and metabolic pathways. Further studies are needed to determine the utility of these DEGs and pathways as therapeutics targets against ER+ palbociclib-resistant breast cancer.
Also flagged:Neurodegenerative DiseaseNeurodegenerative diseasesagingALSspinocerebellar atrophyZika virus infection
Journal Article2020-04-24No SnippetsChang CY, Ting HC, Liu CA, Su HL, Chiou TW, Lin SZ, Harn HJ, Ho TJ.
Show Full Abstract
Neurodegenerative diseases represent a significant unmet medical need in our aging society. There are no effective treatments for most of these diseases, and we know comparatively little regarding pathogenic mechanisms. Among the challenges faced by those involved in developing therapeutic drugs for neurodegenerative diseases, the syndromes are often complex, and small animal models do not fully recapitulate the unique features of the human nervous system. Human induced pluripotent stem cells (iPSCs) are a novel technology that ideally would permit us to generate neuronal cells from individual patients, thereby eliminating the problem of species-specificity inherent when using animal models. Specific phenotypes of iPSC-derived cells may permit researchers to identify sub-types and to distinguish among unique clusters and groups. Recently, iPSCs were used for drug screening and testing for neurologic disorders including Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), spinocerebellar atrophy (SCA), and Zika virus infection. However, there remain many challenges still ahead, including how one might effectively recapitulate sporadic disease phenotypes and the selection of ideal phenotypes and for large-scale drug screening. Fortunately, quite a few novel strategies have been developed that might be combined with an iPSC-based model to solve these challenges, including organoid technology, single-cell RNA sequencing, genome editing, and deep learning artificial intelligence. Here, we will review current applications and potential future directions for iPSC-based neurodegenerative disease models for critical drug screening.
Also flagged:Motor Neuron DiseaseMitochondriaagingagemotor neuron diseasesamyotrophic lateral sclerosis
Journal Article2020-04-24No SnippetsKodavati M, Wang H, Hegde ML.
Show Full Abstract
Mitochondria plays privotal role in diverse pathways that regulate cellular function and survival, and have emerged as a prime focus in aging and age-associated motor neuron diseases (MNDs), such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). Accumulating evidence suggests that many amyloidogenic proteins, including MND-associated RNA/DNA-binding proteins fused in sarcoma (FUS) and TAR DNA binding protein (TDP)-43, are strongly linked to mitochondrial dysfunction. Animal model and patient studies have highlighted changes in mitochondrial structure, plasticity, replication/copy number, mitochondrial DNA instability, and altered membrane potential in several subsets of MNDs, and these observations are consistent with the evidence of increased excitotoxicity, induction of reactive oxygen species, and activation of intrinsic apoptotic pathways. Studies in MND rodent models also indicate that mitochondrial abnormalities begin prior to the clinical and pathological onset of the disease, suggesting a causal role of mitochondrial dysfunction. Our recent studies, which demonstrated the involvement of specific defects in DNA break-ligation mediated by DNA ligase 3 (LIG3) in FUS-associated ALS, raised a key question of its potential implication in mitochondrial DNA transactions because LIG3 is essential for both mitochondrial DNA replication and repair. This question, as well as how wild-type and mutant MND-associated factors affect mitochondria, remain to be elucidated. These new investigation avenues into the mechanistic role of mitochondrial dysfunction in MNDs are critical to identify therapeutic targets to alleviate mitochondrial toxicity and its consequences. In this article, we critically review recent advances in our understanding of mitochondrial dysfunction in diverse subgroups of MNDs and discuss challenges and future directions.
Also flagged:Macrophage migration inhibitory factorMIFcytokineneurodegenerative disordersamyotrophic lateral sclerosisALS
Journal Article2020-04-24No SnippetsBasile MS, Battaglia G, Bruno V, Mangano K, Fagone P, Petralia MC, Nicoletti F, Cavalli E.
Show Full Abstract
Macrophage migration inhibitory factor (MIF) is a pleiotropic cytokine expressed by different cell types and exerting multiple biological functions. It has been shown that MIF may be involved in several disorders, including neurodegenerative disorders such as amyotrophic lateral sclerosis (ALS), Parkinson disease (PD), and Huntington disease (HD), that represent an unmet medical need. Therefore, further studies are needed to identify novel pathogenetic mechanisms that may translate into tailored therapeutic approaches so to improve patients' survival and quality of life. Here, we reviewed the preclinical and clinical studies investigating the role of MIF in ALS, PD, and HD. The emerging results suggest that MIF might play a dichotomic role in these disorders, exerting a protective action in ALS, a pathogenetic action in HD, and a yet undefined and debated role in PD. The better understanding of the role of MIF in these diseases could allow its use as a novel diagnostic and therapeutic tool for the monitoring and treatment of the patients and for eventual biomarker-driven therapeutic approaches.
Also flagged:corticogenesisBASP1HUBtranscription factorTCF12dyslexia
Journal Article2020-04-24✓ 2 SnippetsPrajapati B, Fatima M, Fatma M, Maddhesiya P, Arora H, Naskar T, Devasenapathy S, Seth P, Sinha S.
In-Text Gene Mentions
Methods)
…(markers—EMX2, TBR1, CTIP2,CACNA1E, PRSS12, and CARTPT).…
Results)
…formation), and CTIP2,CACNA1E, PRSS12, and CARTPT…
Show Full Abstract
lncRNA genes can be genic or "intergenic". "Genic" RNAs can be further divided into six biotypes. Through genome-wide analysis of a publicly available data set on corticogenesis, we found that the divergent lncRNA (XH) biotype, comprising the lncRNA and the coding gene being in opposite directions in a head-to-head manner, was most prominent during neural commitment. Within this biotype, a coding gene/divergent RNA pair of the BASP1 gene and the uncharacterized RNA loc285696 (hitherto referred as BASP1-AS1) formed a major HUB gene during neuronal differentiation. Experimental validation during the in vitro differentiation of human neural progenitor cells (hNPCs) showed that BASP1-AS1 regulates the expression of its adjacent coding gene, BASP1. Both transcripts increased sharply on the first day of neuronal differentiation of hNPCs, to fall steadily thereafter, reaching very low levels in differentiated neurons. BASP1-AS1 RNA and the BASP1 gene formed a molecular complex that also included the transcription factor TCF12. TCF12 is coded by the DYX1 locus, associated with inherited dyslexia and neurodevelopmental defects. Knockdown of BASP1-AS1, BASP1, or TCF12 impaired the neuronal differentiation of hNPCs, as seen by reduction in DCX and TUJ1-positive cells and by reduced neurite length. There was also increased cell proliferation. A common set of critical genes was affected by the three molecules in the complex. Our study thus identified the role of the XH biotype and a novel mediator of neuronal differentiation-the complex of BASP1-AS1, BASP1, and TCF12. It also linked a neuronal differentiation pathway to inherited dyslexia.
Also flagged:methylationhistoneschromatingene expressionmental disordersdepressive disorders
Journal Article2020-04-24No SnippetsTalarowska M.
Show Full Abstract
The genome (genes), epigenome, and environment work together from the earliest stages of human life to produce a phenotype of human health or disease. Epigenetic modifications, including among other things: DNA methylation, modifications of histones and chromatin structure, as well as functions of noncoding RNA, are coresponsible for specific patterns of gene expression. This refers also to mental disorders, including depressive disorders. Early childhood experiences accompanied by severe stressors (considered a risk factor for depression in adult life) are linked with changes in gene expression. They include genes involved in a response to stress (hypothalamic-pituitary-adrenal axis, HPA), associated with autonomic nervous system hyperactivity and with cortical, and subcortical processes of neuroplasticity and neurodegeneration. These are, among others: gene encoding glucocorticoid receptor, FK506 binding protein 5 gene (FKBP5), gene encoding arginine vasopressin and oestrogen receptor alpha, 5-hydroxy-tryptamine transporter gene (SLC6A4), and gene encoding brain-derived neurotrophic factor. How about personality? Can the experiences unique to every human being, the history of his or her development and gene-environment interactions, through epigenetic mechanisms, shape the features of our personality? Can we pass on these features to future generations? Hence, is the risk of depression inherent in our biological nature? Can we change our destiny?
Also flagged:pulmonary arterial hypertensioncell proliferationhypoxia-inducible factors(HIF)-1αHIF-1αPFKP
Journal Article2020-04-24No SnippetsChen S, Xu H, Hu F, Wang T.
Show Full Abstract
<h4>Background</h4>The proliferation of human pulmonary artery smooth muscle cells (HPASMCs) induced by hypoxia was considered as the main cause of pulmonary arterial hypertension (PAH). This study aimed to explore potential genes and long non-coding RNAs (lncRNAs) involved in the mechanism of hypoxia-induced PAH.<h4>Methods</h4>CoCl<sub>2</sub> was utilized to induce hypoxia in HPASMCs, and then cell proliferation, apoptosis, and expression of hypoxia-inducible factors (HIF)-1α were determined. Meanwhile, the RNA isolated from CoCl<sub>2</sub>-treated cells and control cells were sequenced and differentially expressed genes/lncRNA (DEGs/DELs) were screened, followed by protein-protein interaction (PPI) construction, functional enrichment analyses, and lncRNA-target prediction. Finally, the expression of key genes and lncRNAs were validated using quantitative real-time PCR and western blotting.<h4>Results</h4>CoCl<sub>2</sub> treatment could significantly increase the expression of HIF-1α and the proliferation of HPASMCs. A total of 360 DEGs and 57 DELs were identified between CoCl<sub>2</sub> treated and control cells. Functional enrichment analysis showed that up-regulated DEGs and DELs' targets, including LDHA, PFKP, and VEGFA, were significantly enriched in biological processes related to hypoxia or oxygen levels, and the downregulated DEGs and DELs' targets were significantly enriched in extracellular-matrix-related biological processes. In addition, LDHA, PFKP, and VEGFA exhibited a strong relationship with miR-100HG and TSPEAR-AS2 in lncRNA-target network. The protein level of LDHA, PFKP, and VEGFA were all increased.<h4>Conclusion</h4>LDHA, PFKP, VEGFA, and lncRNA miR-100HG and TSPEAR-AS2 probably played crucial roles in the pathogenesis of CoCl<sub>2</sub> hypoxia-induced-HAP, which might serve as promising therapeutic targets for PAH.
Also flagged:Catecholcardiovascular diseasesinflammatory responsecopperamineglutathione peroxidase
Journal Article2020-04-24✓ 2 SnippetsYang Y, Gao P, Wang J, Tu Q, Bai L, Xiong K, Qiu H, Zhao X, Maitz MF, Wang H, Li X, Zhao Q, Xiao Y, Huang N, Yang Z.
In-Text Gene Mentions
Methods)
…binding efficiency ofATIIIto Fxa […
Methods)
…heparin, the formed heparin-ATIIIcomplexes bind with…
Show Full Abstract
Stenting is currently the major therapeutic treatment for cardiovascular diseases. However, the nonbiogenic metal stents are inclined to trigger a cascade of cellular and molecular events including inflammatory response, thrombogenic reactions, smooth muscle cell hyperproliferation accompanied by the delayed arterial healing, and poor reendothelialization, thus leading to restenosis along with late stent thrombosis. To address prevalence critical problems, we present an endothelium-mimicking coating capable of rapid regeneration of a competently functioning new endothelial layer on stents through a stepwise metal (copper)-catechol-(amine) (MCA) surface chemistry strategy, leading to combinatorial endothelium-like functions with glutathione peroxidase-like catalytic activity and surface heparinization. Apart from the stable nitric oxide (NO) generating rate at the physiological level (2.2 × 10<sup>-10</sup> mol/cm<sup>2</sup>/min lasting for 60 days), this proposed strategy could also generate abundant amine groups for allowing a high heparin conjugation efficacy up to ∼1 <i>μ</i>g/cm<sup>2</sup>, which is considerably higher than most of the conventional heparinized surfaces. The resultant coating could create an ideal microenvironment for bringing in enhanced anti-thrombogenicity, anti-inflammation, anti-proliferation of smooth muscle cells, re-endothelialization by regulating relevant gene expressions, hence preventing restenosis in vivo. We envision that the stepwise MCA coating strategy would facilitate the surface endothelium-mimicking engineering of vascular stents and be therefore helpful in the clinic to reduce complications associated with stenosis.
Also flagged:Methylationlung cancerofgene expressioncancerlung adenocarcinoma
Journal Article2020-04-24✓ 1 SnippetDong YM, Li M, He QE, Tong YF, Gao HZ, Zhang YZ, Wu YM, Hu J, Zhang N, Song K.
In-Text Gene Mentions
Results)
…cg26076054, and cg00976097),ANKRD45(cg13990746 and cg15680620),…
Show Full Abstract
Tobacco exposure is one of the major risks for the initiation and progress of lung cancer. The exact corresponding mechanisms, however, are mainly unknown. Recently, a growing body of evidence has been collected supporting the involvement of DNA methylation in the regulation of gene expression in cancer cells. The identification of tobacco-related signature methylation probes and the analysis of their regulatory networks at different molecular levels may be of a great help for understanding tobacco-related tumorigenesis. Three independent lung adenocarcinoma (LUAD) datasets were used to train and validate the tobacco exposure pattern classification model. A deep selecting method was proposed and used to identify methylation signature probes from hundreds of thousands of the whole epigenome probes. Then, BIMC (biweight midcorrelation coefficient) algorithm, SRC (Spearman's rank correlation) analysis, and shortest path tracing method were explored to identify associated genes at gene regulation level and protein-protein interaction level, respectively. Afterwards, the KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis and GO (Gene Ontology) enrichment analysis were used to analyze their molecular functions and associated pathways. 105 probes were identified as tobacco-related DNA methylation signatures. They belong to 95 genes which are involved in hsa04512, hsa04151, and other important pathways. At gene regulation level, 33 genes are uncovered to be highly related to signature probes by both BIMC and SRC methods. Among them, FARSB and other eight genes were uncovered as Hub genes in the gene regulatory network. Meanwhile, the PPI network about these 33 genes showed that MAGOH, FYN, and other five genes were the most connected core genes among them. These analysis results may provide clues for a clear biological interpretation in the molecular mechanism of tumorigenesis. Moreover, the identified signature probes may serve as potential drug targets for the precision medicine of LUAD.
Also flagged:Folic AcidHyaluronic AcidVitamin Etumorspaclitaxelvitamin E succinate
Journal Article2020-04-24No SnippetsYang Y, Li Y, Chen K, Zhang L, Qiao S, Tan G, Chen F, Pan W.
Show Full Abstract
<h4>Purpose</h4>Poor site-specific delivery and insufficient intracellular drug release in tumors are inherent disadvantages to successful chemotherapy. In this study, an extraordinary polymeric micelle nanoplatform was designed for the efficient delivery of paclitaxel (PTX) by combining dual receptor-mediated active targeting and stimuli response to intracellular reduction potential.<h4>Methods</h4>The dual-targeted redox-sensitive polymer, folic acid-hyaluronic acid-SS-vitamin E succinate (FHSV), was synthesized via an amidation reaction and characterized by <sup>1</sup>H-NMR. Then, PTX-loaded FHSV micelles (PTX/FHSV) were prepared by a dialysis method. The physiochemical properties of the micelles were explored. Moreover, in vitro cytological experiments and in vivo animal studies were carried out to evaluate the antitumor efficacy of polymeric micelles.<h4>Results</h4>The PTX/FHSV micelles exhibited a uniform, near-spherical morphology (148.8 ± 1.4 nm) and a high drug loading capacity (11.28% ± 0.25). Triggered by the high concentration of glutathione, PTX/FHSV micelles could quickly release their loaded drug into the release medium. The in vitro cytological evaluations showed that, compared with Taxol or single receptor-targeted micelles, FHSV micelles yielded higher cellular uptake by the dual receptor-mediated endocytosis pathway, thus leading to significantly superior cytotoxicity and apoptosis in tumor cells but less cytotoxicity in normal cells. More importantly, in the in vivo antitumor experiments, PTX/FHSV micelles exhibited enhanced tumor accumulation and produced remarkable tumor growth inhibition with minimal systemic toxicity.<h4>Conclusion</h4>Our results suggest that this well-designed FHSV polymer has promising potential for use as a vehicle of chemotherapeutic drugs for precise cancer therapy.
Also flagged:Transferrin Receptor 1ironmitochondrialgene expressiontransdifferentiationtransmembrane
Journal Article2020-04-24✓ 1 SnippetLi J, Pan X, Pan G, Song Z, He Y, Zhang S, Ye X, Yang X, Xie E, Wang X, Mai X, Yin X, Tang B, Shu X, Chen P, Dai X, Tian Y, Yao L, Han M, Xu G, Zhang H, Sun J, Chen H, Wang F, Min J, Xie L.
In-Text Gene Mentions
Discussion)
…could interact withHFEto modulate hepcidin…
Show Full Abstract
Iron homeostasis is essential for maintaining cellular function in a wide range of cell types. However, whether iron affects the thermogenic properties of adipocytes is currently unknown. Using integrative analyses of multi-omics data, transferrin receptor 1 (Tfr1) is identified as a candidate for regulating thermogenesis in beige adipocytes. Furthermore, it is shown that mice lacking <i>Tfr1</i> specifically in adipocytes have impaired thermogenesis, increased insulin resistance, and low-grade inflammation accompanied by iron deficiency and mitochondrial dysfunction. Mechanistically, the cold treatment in beige adipocytes selectively stabilizes hypoxia-inducible factor 1-alpha (HIF1α), upregulating the <i>Tfr1</i> gene, and thermogenic adipocyte-specific <i>Hif1α</i> deletion reduces thermogenic gene expression in beige fat without altering core body temperature. Notably, <i>Tfr1</i> deficiency in interscapular brown adipose tissue (iBAT) leads to the transdifferentiation of brown preadipocytes into white adipocytes and muscle cells; in contrast, long-term exposure to a low-iron diet fails to phenocopy the transdifferentiation effect found in <i>Tfr1</i>-deficient mice. Moreover, mice lacking transmembrane serine protease 6 (Tmprss6) develop iron deficiency in both inguinal white adipose tissue (iWAT) and iBAT, and have impaired cold-induced beige adipocyte formation and brown fat thermogenesis. Taken together, these findings indicate that Tfr1 plays an essential role in thermogenic adipocytes via both iron-dependent and iron-independent mechanisms.
Also flagged:immune responsesparturitionimmune responseinfectious diseaseCD4antibody
Journal Article2020-04-24✓ 1 SnippetZheng T, Moustafa Y, Finn C, Scott S, Haase CJ, Carpinelli NA, Osorio JS, McKinstry KK, Strutt TM, Huo Q.
In-Text Gene Mentions
Results)
…score of eachDCCgroup.…
Show Full Abstract
The immune health of a farm animal can have significant impact on its overall health, welfare and productivity. One of the most vulnerable physiological states for both humans and animals is pregnancy. Many systemic changes correlate with the gravid state, including shifts in the immune system that may impact the ability to respond optimally to pathogen challenge. Because of this, it would be beneficial to be able to monitor the immune health of the pregnant animals closely. Recently, we developed a new nanoparticle-enabled rapid blood test that can detect ongoing immune responses from both laboratory and farm animals. Here, we report that this novel test reveals highly repeatable and acute changes associated with pregnancy and peri-parturition period in laboratory mice and in cattle. We hypothesize that the test score change reflects changes in the immune status of the gravid females related to the humoral immune response. The test is easy to conduct, of low cost, with results obtained in less than 20 min. This rapid test could be potentially used as an onsite test in local farms and small clinics for animal health management.
bioRxiv2020-04-24Preprint (No Snippets API)Bruyère J, Abada Y, Vitet H, Fontaine G, Deloulme J, Cès A, Denarier E, Pernet-Gallay K, Andrieux A, Humbert S, Potier MC, Delatour B, Saudou F.
Show Full Abstract
Studies have suggested that amyloid precursor protein (APP) regulates synaptic homeostasis, but the evidence has not been consistent. In particular, signaling pathways controlling APP transport to the synapse in axons and dendrites remain to be identified. Having previously shown that Huntingtin (HTT), the scaffolding protein involved in Huntington’s disease, regulates neuritic transport of APP, we used a microfluidic corticocortical neuronal network-on-a-chip to examine APP transport and localization to the pre- and post-synaptic compartments. We found that HTT, upon phosphorylation by the Ser/Thr kinase Akt, regulates APP transport in axons but not dendrites. Expression of an unphosphorylatable HTT decreased axonal anterograde transport of APP, reduced presynaptic APP levels, and increased synaptic density. Ablating in vivo HTT phosphorylation in APPPS1 mice, which overexpress APP, reduced presynaptic APP levels, restored synapse number and improved learning and memory. The Akt-HTT pathway and axonal transport of APP thus regulate APP presynaptic levels and synapse homeostasis.
bioRxiv2020-04-24Preprint (No Snippets API)Singleton KS, Silva-Rodriguez P, Silva EM.
Show Full Abstract
Sox11, a member of the SoxC family of transcription factors, has distinct functions at different times in neural development. Studies in mouse, frog, chick and zebrafish show that Sox11 promotes neural fate, neural differentiation, and neuron maturation in the central nervous system. These diverse roles are controlled in part by spatial and temporal-specific protein interactions. However, the partner proteins and Sox11-interaction domains underlying these diverse functions are not well defined. Here, we identify partner proteins and the domains of Xenopus Sox11(xSox11) required for protein interaction and function during neurogenesis. Our data show that Sox11 co-localizes and interacts with Pou3f2 and Ngn2 in the anterior neural plate and in early neurons, respectively. We also demonstrate that xSox11 does not interact with Ngn1, a high affinity partner of Sox11 in the mouse cortex, suggesting that Sox11 has species-specific partner proteins. Additionally, we determined that the N-terminus including the HMG domain of xSox11 is necessary for interaction with Pou3f2 and Ngn2, and established a novel role for the N-terminal 46 amino acids in the establishment of placodal progenitors. This is the first identification of partner proteins for Xenopus Sox11 and of domains required for partner protein interactions and distinct roles in neurogenesis.
bioRxiv2020-04-24Preprint (No Snippets API)Stanifer ML, Kee C, Cortese M, Triana S, Mukenhirn M, Kraeusslich H, Alexandrov T, Bartenschlager R, Boulant S.
Show Full Abstract
<h4>Summary</h4> SARS-CoV-2 is an unprecedented worldwide health problem that requires concerted and global approaches to better understand the virus in order to develop novel therapeutic approaches to stop the COVID-19 pandemic and to better prepare against potential future emergence of novel pandemic viruses. Although SARS-CoV-2 primarily targets cells of the lung epithelium causing respiratory infection and pathologies, there is growing evidence that the intestinal epithelium is also infected. However, the importance of the enteric phase of SARS-CoV-2 for virus-induced pathologies, spreading and prognosis remains unknown. Here, using both colon-derived cell lines and primary non-transformed colon organoids, we engage in the first comprehensive analysis of SARS-CoV-2 lifecycle in human intestinal epithelial cells. Our results demonstrate that human intestinal epithelial cells fully support SARS-CoV-2 infection, replication and production of infectious de-novo virus particles. Importantly, we identified intestinal epithelial cells as the best culture model to propagate SARS-CoV-2. We found that viral infection elicited an extremely robust intrinsic immune response where, interestingly, type III interferon mediated response was significantly more efficient at controlling SARS-CoV-2 replication and spread compared to type I interferon. Taken together, our data demonstrate that human intestinal epithelial cells are a productive site of SARS-CoV-2 replication and suggest that the enteric phase of SARS-CoV-2 may participate in the pathologies observed in COVID-19 patients by contributing in increasing patient viremia and by fueling an exacerbated cytokine response.
The human serotonin transporter (hSERT) terminates serotonergic signaling through reuptake of neurotransmitter into presynaptic neurons and is a target for many antidepressant drugs. We describe here the development of a photoswitchable hSERT inhibitor, termed azo-escitalopram, that can be reversibly switched between <i>trans</i> and <i>cis</i> configurations using light of different wavelengths. The dark-adapted <i>trans</i> isomer was found to be significantly less active than the <i>cis</i> isomer, formed upon irradiation.
Also flagged:Atherosclerotic Cardiovascular DiseaseASCVDcoronary artery diseasecholesterollipidmyocardial infarction
Journal Article2020-04-23✓ 1 SnippetAragam KG, Natarajan P.
In-Text Gene Mentions
Text
…CCDC92…
Show Full Abstract
An individual's susceptibility to atherosclerotic cardiovascular disease is influenced by numerous clinical and lifestyle factors, motivating the multifaceted approaches currently endorsed for primary and secondary cardiovascular disease prevention. With growing knowledge of the genetic basis of atherosclerotic cardiovascular disease-in particular, coronary artery disease-and its contribution to disease pathogenesis, there is increased interest in understanding the potential clinical utility of a genetic predictor that might further refine the assessment and management of atherosclerotic cardiovascular disease risk. Rapid scientific and technological advances have enabled widespread genotyping efforts and dynamic research in the field of coronary artery disease genetic risk prediction. In this review, we describe how genomic analyses of coronary artery disease have been leveraged to create polygenic risk scores. We then discuss evaluations of the clinical utility of these scores, pertinent mechanistic insights gleaned, and practical considerations relevant to the implementation of polygenic risk scores in the health care setting.
Also flagged:tuberculosisTBpulmonary TBHIV infectionco-infection-communicable diseases
Journal Article2020-04-23No SnippetsNguyen HV, Tiemersma EW, Nguyen HB, Cobelens FGJ, Finlay A, Glaziou P, Dao CH, Mirtskhulava V, Nguyen HV, Pham HTT, Khieu NTT, de Haas P, Do NH, Nguyen PD, Cung CV, Nguyen NV.
Show Full Abstract
<h4>Introduction</h4>Tuberculosis (TB) remains a significant cause of morbidity and mortality in Vietnam. The current TB burden is unknown as not all individuals with TB are diagnosed, recorded and notified. The second national TB prevalence survey was conducted in 2017-2018 to assess the current burden of TB disease in the country.<h4>Method</h4>Eighty-two clusters were selected using a multistage cluster sampling design. Adult (≥15 years of age) residents having lived for 2 weeks or more in the households of the selected clusters were invited to participate in the survey. The survey participants were screened for TB by a questionnaire and digital chest X-ray after providing written informed consent. Individuals with a positive symptom screen and/or chest X-ray suggestive of TB were asked to provide sputum samples to test for Mycobacterium tuberculosis by Ziehl-Neelsen direct light microscopy, Xpert MTB/RIF G4, BACTEC MGIT960 liquid culture and Löwenstein-Jensen solid culture. Bacteriologically confirmed TB cases were defined by an expert panel following a standard decision tree.<h4>Result</h4>Of 87,207 eligible residents, 61,763 (70.8%) participated, and 4,738 (7.7%) screened positive for TB. Among these, 221 participants were defined as bacteriologically confirmed TB cases. The estimated prevalence of bacteriologically confirmed adult pulmonary TB was 322 (95% CI: 260-399) per 100,000, and the male-to-female ratio was 4.0 (2.8-5.8, p<0.001). In-depth interviews with the participants with TB disease showed that only 57.9% (95% CI: 51.3-64.3%) reported cough for 2 weeks or more and 32.1% (26.3-38.6%) did not report any symptom consistent with TB, while their chest X-ray results showed that 97.7% (95% CI: 94.6-99.1) had abnormal chest X-ray images suggesting TB.<h4>Conclusion</h4>With highly sensitive diagnostics applied, this survey showed that the TB burden in Vietnam remains high. Half of the TB cases were not picked up by general symptom-based screening and were identified by chest X-ray only. Our results indicate that improving TB diagnostic capacity and access to care, along with reducing TB stigma, need to be top priorities for TB control and elimination in Vietnam.
Also flagged:iron deficiencyIDironcirrhosisdiabeteshypogonadism
Journal Article2020-04-23✓ 5 SnippetsBarton JC, Wiener HH, Acton RT, Adams PC, Eckfeldt JH, Gordeuk VR, Harris EL, McLaren CE, Harrison H, McLaren GD, Reboussin DM.
In-Text Gene Mentions
Introduction)
…The hemochromatosis gene HFE ("high-iron") is linked to the major histocompatibility complex on chromosome 6p [11].…
Abstract)
…serum ferritin; andHFEp.C282Y and p.H63D…
Introduction)
…Hemochromatosisis a group…
Introduction)
…Thehemochromatosisgene HFE ("high-iron")…
Introduction)
…The hemochromatosis geneHFE("high-iron") is linked…
Show Full Abstract
<h4>Background</h4>Few cross-sectional studies report iron deficiency (ID) prevalence in women of different race/ethnicity and ages in US or Canada.<h4>Materials and methods</h4>We evaluated screening observations on women who participated between 2001-2003 in a cross-sectional, primary care-based sample of adults ages ≥25 y whose observations were complete: race/ethnicity; age; transferrin saturation; serum ferritin; and HFE p.C282Y and p.H63D alleles. We defined ID using a stringent criterion: combined transferrin saturation <10% and serum ferritin <33.7 pmol/L (<15 μg/L). We compared ID prevalence in women of different race/ethnicity subgrouped by age and determined associations of p.C282Y and p.H63D to ID overall, and to ID in women ages 25-44 y with or without self-reported pregnancy.<h4>Results</h4>These 62,685 women included 27,079 whites, 17,272 blacks, 8,566 Hispanics, 7,615 Asians, 449 Pacific Islanders, 441 Native Americans, and 1,263 participants of other race/ethnicity. Proportions of women with ID were higher in Hispanics and blacks than whites and Asians. Prevalence of ID was significantly greater in women ages 25-54 y of all race/ethnicity groups than women ages ≥55 y of corresponding race/ethnicity. In women ages ≥55 y, ID prevalence did not differ significantly across race/ethnicity. p.C282Y and p.H63D prevalence did not differ significantly in women with or without ID, regardless of race/ethnicity, age subgroup, or pregnancy.<h4>Conclusions</h4>ID prevalence was greater in Hispanic and black than white and Asian women ages 25-54 y. p.C282Y and p.H63D prevalence did not differ significantly in women with or without ID, regardless of race/ethnicity, age subgroup, or pregnancy.
Also flagged:PERKPKR-like endoplasmic reticulum kinaseneurodegenerative diseasesdephosphorylationphosphorylationHuntington's disease
Journal Article2020-04-23✓ 5 SnippetsGanz J, Shacham T, Kramer M, Shenkman M, Eiger H, Weinberg N, Iancovici O, Roy S, Simhaev L, Da'adoosh B, Engel H, Perets N, Barhum Y, Portnoy M, Offen D, Lederkremer GZ.
In-Text Gene Mentions
Introduction)
…HD is a neurodegenerative disease arising from an expanded CAG repeat in the exon 1 of the huntingtin gene, which translates into a polyglutamine (polyQ) tract in the huntingtin (Htt) protein 1,2.…
Introduction)
…The expansion of the polyQ repeats causes mutant Htt (mHtt) to aggregate in HD tissues when it includes above 35 glutamine residues, with a consequent induction of cellular stress, toxicity and cell death especially in the brain striatum and extending later to the cortex.…
Introduction)
…in the huntingtin (Htt) protein 1 ,…
Introduction)
…repeats causes mutantHtt(mHtt) to aggregate…
Results)
…counterpart expressing WTHtt(ST Hdh Q7/7…
Show Full Abstract
One of the pathways of the unfolded protein response, initiated by PKR-like endoplasmic reticulum kinase (PERK), is key to neuronal homeostasis in neurodegenerative diseases. PERK pathway activation is usually accomplished by inhibiting eIF2α-P dephosphorylation, after its phosphorylation by PERK. Less tried is an approach involving direct PERK activation without compromising long-term recovery of eIF2α function by dephosphorylation. Here we show major improvement in cellular (STHdh<sup>Q111/111</sup>) and mouse (R6/2) Huntington's disease (HD) models using a potent small molecule PERK activator that we developed, MK-28. MK-28 showed PERK selectivity in vitro on a 391-kinase panel and rescued cells (but not PERK-/- cells) from ER stress-induced apoptosis. Cells were also rescued by the commercial PERK activator CCT020312 but MK-28 was significantly more potent. Computational docking suggested MK-28 interaction with the PERK activation loop. MK-28 exhibited remarkable pharmacokinetic properties and high BBB penetration in mice. Transient subcutaneous delivery of MK-28 significantly improved motor and executive functions and delayed death onset in R6/2 mice, showing no toxicity. Therefore, PERK activation can treat a most aggressive HD model, suggesting a possible approach for HD therapy and worth exploring for other neurodegenerative disorders.
Also flagged:Interleukin-4Interleukin(IL)-4cytokineallergyIL-4
Journal Article2020-04-23✓ 2 SnippetsSaito Y, Iwatsuki K, Inaba A, Sato M, Tadaishi M, Shimizu M, Kobayashi-Hattori K.
In-Text Gene Mentions
Abstract)
…and olfactomedin 4 (Olfm4), and Lgr5-positive cells…
I A O 0000326)
…Olfm4…
Show Full Abstract
Interleukin (IL)-4 is known as a cytokine mainly involved in allergy and inflammation, but recent studies have suggested that IL-4 plays a part in the differentiation process of various cells. Since the effect of IL-4 on intestinal epithelial cells, particularly cryptic cells including stem cells, is poorly understood, we investigated IL-4-induced changes in intestinal epithelial cells using mouse jejunal organoids called enteroids. IL-4 treatment decreased cell proliferation, the expression of the stem cell markers leucine-rich repeat-containing G protein-coupled receptor 5 (Lgr5) and olfactomedin 4 (Olfm4), and Lgr5-positive cells in enteroids. Among the differentiation markers, IL-4 significantly decreased the gene expression levels of the Paneth cell markers lysozyme 1 (Lyz1) and regenerating islet-derived protein 3 gamma (Reg3γ). A fluorescent immunostaining showed that IL-4 attenuated the emission and fluorescence intensity derived from lysozyme, which is enriched in Paneth cells. These results suggest that functional changes in Paneth cells caused by IL-4 may contribute to the reduction in Lgr5-positive cells and proliferative activity. IL-4 may affects gut function by altering the proliferation and the gene expression in enteroids.
…Both molecules appear to be essential but not sufficient on their own, and only coexpression of BTN2A1 and BTN3A1 elicits Vγ9/Vδ2 T‐cell responses to HMB‐PP or zoledronate.…
S I O 001029)⭐ same-sentence co-mention
…Specific knockdown of BTN2A1 but not BTN2A2 numbed Vγ9/Vδ2 TCR responses to HMB‐PP and zoledronate, whereas re‐expression of BTN2A1 restored binding of soluble Vγ9/Vδ2 TCR tetramers to BTN2−/− cells, thereby corroborating and extending the findings of Rigau and colleagues.…
S I O 001029)
…In support, knockdown and re‐expression experiments together with the use of anti‐BTN2A1 monoclonal antibodies confirmed a crucial role of BTN2A1 in mediating binding of the Vγ9/Vδ2 TCR tetramer, and in driving responses to HMB‐PP and zoledronate.…
S I O 001029)
…Finally, given the strong translational and applied interest in Vγ9/Vδ2 T cells, BTN2A1 is a highly relevant target candidate for the development of agonistic and/or antagonistic miracle drugs in the context of microbial infection, autoimmunity and tumor immunotherapy.…
Abstract)
…butyrophilin family membersBTN2A1and BTN3A1.…
Show Full Abstract
Sensing of self and non-self phosphoantigens by human Vγ9/Vδ2 T cells in the context of the butyrophilin family members BTN2A1 and BTN3A1.
…We have developed a new human neuronal cell model of HD, using neural stem cells (ReNcell VM NSCs) stably transduced to express exon 1 huntingtin (HTT) fragments with variable length polyglutamine (polyQ) tracts.…
Introduction)
…The “exon 1 fragment” of mutant HTT has long been postulated as a key driver of neurotoxicity in HD.…
Methods)
…The monoclonal antibodies PHP1 and PHP2 (1:1000), raised against the proline‐rich domain (PRD) of HTT were a kind gift from Professor A. Khoshnan.18…
Introduction)
…the huntingtin protein (HTT), which leads to…
Show Full Abstract
Robust cellular models are key in determining pathological mechanisms that lead to neurotoxicity in Huntington's disease (HD) and for high throughput pre-clinical screening of potential therapeutic compounds. Such models exist but mostly comprise non-human or non-neuronal cells that may not recapitulate the correct biochemical milieu involved in pathology. We have developed a new human neuronal cell model of HD, using neural stem cells (ReNcell VM NSCs) stably transduced to express exon 1 huntingtin (HTT) fragments with variable length polyglutamine (polyQ) tracts. Using a system with matched expression levels of exon 1 HTT fragments, we investigated the effect of increasing polyQ repeat length on HTT inclusion formation, location, neuronal survival, and mitochondrial function with a view to creating an in vitro screening platform for therapeutic screening. We found that expression of exon 1 HTT fragments with longer polyQ tracts led to the formation of intra-nuclear inclusions in a polyQ length-dependent manner during neurogenesis. There was no overt effect on neuronal viability, but defects of mitochondrial function were found in the pathogenic lines. Thus, we have a human neuronal cell model of HD that may recapitulate some of the earliest stages of HD pathogenesis, namely inclusion formation and mitochondrial dysfunction.
…HFE variant (c.845G>A :p.Cys282Tyr) which is classified as pathogenic/likely pathogenic for hereditary hemochromatosis…
Abstract)
…for the C282YHFEvariant (c.845G>A :p.…
Abstract)
…for the C282YHFEvariant on direct…
Discussion)
…than 10% ofHFEC282Y homozygotes develop…
Show Full Abstract
<h4>Background</h4>A 61-year-old woman underwent direct to consumer genetic testing and was found to be homozygous for the C282Y HFE variant (c.845G>A :p.Cys282Tyr) which is classified as pathogenic/likely pathogenic for hereditary hemochromatosis. However, no action was taken by the individual.<h4>Methods</h4>The individual took part in the Mayo Clinic Return of Actionable Variants Empiric (RAVE) study and the actionable finding was confirmed and results disclosed in person by a genetic counselor with subsequent referral to a hepatologist.<h4>Results</h4>Further testing revealed iron overload with an elevated ferritin level (560 ng/ml) and increased ferritin saturation (74%). Phlebotomy was initiated with subsequent normalization of the ferritin levels (252 ng/ml).<h4>Conclusion</h4>This case highlights that actionable genetic results may not be acted on after direct to consumer testing and the need for effective genetic counseling after such testing.
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the absolute abundances of 103 TFs and co-factors during the course of human erythropoiesis, we provide a dynamic and quantitative scale for TFs in the nucleus. Furthermore, we establish the first gene regulatory network of cell fate commitment that integrates temporal protein stoichiometry data with mRNA measurements. The model revealed quantitative imbalances in TFs' cross-antagonistic relationships that underlie lineage determination. Finally, we made the surprising discovery that, in the nucleus, co-repressors are dramatically more abundant than co-activators at the protein level, but not at the RNA level, with profound implications for understanding transcriptional regulation. These analyses provide a unique quantitative framework to understand transcriptional regulation of cell differentiation in a dynamic context.
Also flagged:Cell-CycleCell ProliferationE2F1Cell cycleRNA-binding protein Staufen1RPE1
Journal Article2020-04-23✓ 5 SnippetsGhram M, Bonnet-Magnaval F, Hotea DI, Doran B, Ly S, DesGroseillers L.
In-Text Gene Mentions
Abstract)
…Our results indicate that a STAU1-mediatedpost-transcriptional mechanism of gene regulation controls an mRNA regulon involved in decision making during cell-cycle phase transitions and that this mechanism is essential for cell-cycle progression in non-tumor cells.…
Abstract)
…RNA-binding protein Staufen1 (STAU1) are essential for…
Abstract)
…or down-regulated followingSTAU1depletion.…
Abstract)
…is decreased inSTAU1depleted cells, dependent…
Abstract)
…dependent on aSTAU1-binding site in the…
Show Full Abstract
Cell cycle is a highly regulated process that is finely coordinated by a plethora of interconnected regulators. In this paper, we report that post-transcriptional mechanisms mediated by the RNA-binding protein Staufen1 (STAU1) are essential for the proliferation of non-transformed cells (hTERT-RPE1 and IMR90). Cell sorting quantification and time-lapse video microscopy using FUCCI-hTERT-RPE1 cells identified the G<sub>1</sub>/S and G<sub>2</sub>/M phase transitions of the cell cycle as crucial steps for STAU1 functions. The level of expression of 35 transcripts coding for cell-cycle regulators is up- or down-regulated following STAU1 depletion. Among others, expression of E2F1, a transcription factor essential for the G<sub>1</sub>/S transition, is decreased in STAU1 depleted cells, dependent on a STAU1-binding site in the 3' untranslated region of E2F1 mRNA. Interestingly, E2F1, in turn, increases STAU1 transcription, highlighting a regulatory loop that enhances expression of both STAU1 and E2F1. Our results indicate that a STAU1-mediatedpost-transcriptional mechanism of gene regulation controls an mRNA regulon involved in decision making during cell-cycle phase transitions and that this mechanism is essential for cell-cycle progression in non-tumor cells.
Also flagged:waterphosphoruszinccalciummineralchewing
Journal Article2020-04-23No SnippetsWang B, Kim K, Srirangapatanam S, Ustriyana P, Wheelis SE, Fakra S, Kang M, Rodrigues DC, Ho SP.
Show Full Abstract
Spatiotemporal implant-bone biomechanics and mechanoadaptive strains in peri-implant tissue are poorly understood. Physical and chemical characteristics of an implant-bone complex (IBC) were correlated in three-dimensional space (along the length and around a dental implant) to gather insights into time related integration of the implant with the cortical portion of a jaw bone in a rat. Rats (N = 9) were divided into three experimental groups with three rats per time point; 3-, 11-, and 24-day. All rats were fed crumbled hard pellets mixed with water (soft-food diet) for the first 3 days followed by a hard-food diet with intact hard-food pellets (groups of 11- and 24-day only). Biomechanics of the IBCs harvested from rats at each time point was evaluated by performing mechanical testing in situ in tandem with X-ray imaging. The effect of physical association (contact area) of a loaded implant with adapting peri-implant tissue, and resulting strain within was mapped by using digital volume correlation (DVC) technique. The IBC stiffness at respective time points was correlated with mechanical strain in peri-implant tissue. Results illustrated that IBC stiffness at 11-day was lower than that observed at 3-day. However, at 24-day, IBC stiffness recovered to that which was observed at 3-day. Correlative microscopy and spectroscopy illustrated that the lower IBC stiffness was constituted by softer and less mineralized peri-implant tissue that contained varying expressions of osteoconductive elements. Lower IBC stiffness observed at 11-day was constituted by less mineralized peri-implant tissue with osteoconductive elements that included phosphorus (P) which was co-localized with higher expression of zinc (Zn), and lower expression of calcium (Ca). Higher IBC stiffness at 24-day was constituted by mineralized peri-implant tissue with higher expressions of osteoconductive elements including Ca and P, and lower expressions of Zn. These spatiotemporal correlative maps of peri-implant tissue architecture, heterogeneous distribution of mineral density, and elemental colocalization underscore mechanoadaptive physicochemical properties of peri-implant tissue that facilitate functional osseointegration of an implant. These results provided insights into 1) plausible "prescription" of mechanical loads as an osteoinductive "therapeutic dose" to encourage osteoconductive elements in the peri-implant tissue that would facilitate functional osseointegration of the implant; 2) a "critical temporal window" between 3 and 11 days, and perhaps it is this acute phase during which key candidate regenerative molecules can be harnessed to accelerate osseointegration of an implant under load.
Also flagged:Nonalcoholic fatty liver diseaseNAFLDobesitytype 2 diabetesMetabolic Syndromesteatosis
Journal Article2020-04-23✓ 2 SnippetsMeroni M, Longo M, Rustichelli A, Dongiovanni P.
In-Text Gene Mentions
Methods)
…However, several genetic variants affecting nutrient utilization that are penetrated in the population through positive selection are to date considered inherited risk factors for metabolic disorders (i.e., C282Y variant in HFE gene) [25].…
Methods)
…C282Y variant inHFEgene) [ 25…
Show Full Abstract
Nonalcoholic fatty liver disease (NAFLD) represents a global healthcare burden since it is epidemiologically related to obesity, type 2 diabetes (T2D) and Metabolic Syndrome (MetS). It embraces a wide spectrum of hepatic injuries, which include simple steatosis, nonalcoholic steatohepatitis (NASH), fibrosis, cirrhosis and hepatocellular carcinoma (HCC). The susceptibility to develop NAFLD is highly variable and it is influenced by several cues including environmental (i.e., dietary habits and physical activity) and inherited (i.e., genetic/epigenetic) risk factors. Nonetheless, even intestinal microbiota and its by-products play a crucial role in NAFLD pathophysiology. The interaction of dietary exposure with the genome is referred to as <i>'nutritional genomics,'</i> which encompasses both <i>'nutrigenetics'</i> and <i>'nutriepigenomics.'</i> It is focused on revealing the biological mechanisms that entail both the acute and persistent genome-nutrient interactions that influence health and it may represent a promising field of study to improve both clinical and health nutrition practices. Thus, the premise of this review is to discuss the relevance of personalized nutritional advices as a novel therapeutic approach in NAFLD tailored management.
Also flagged:Lung Squamous Cell CarcinomaLUSCpathogenesisGene ExpressionCCNA2AURKA
Journal Article2020-04-23✓ 5 SnippetsGao M, Kong W, Huang Z, Xie Z.
In-Text Gene Mentions
Discussion)
…Prostaglandin I2 synthase (PTGIS) is a rate–limiting enzyme for Epoprostenol (PGI2) [42].…
Results)
…namely MYEOV, LCE3E,PTGIS, OR2W3, RALGAPA2 (…
Results)
…+ (0.0223 ×PTGIS) + (0.180 ×…
Results)
…6 C), MYOEV,PTGIS, OR2W3, and RALGAPA2…
Results)
…PTGISexpression was positively…
Show Full Abstract
Lung squamous cell carcinoma (LUSC) is often diagnosed at the advanced stage with poor prognosis. The mechanisms of its pathogenesis and prognosis require urgent elucidation. This study was performed to screen potential biomarkers related to the occurrence, development and prognosis of LUSC to reveal unknown physiological and pathological processes. Using bioinformatics analysis, the lung squamous cell carcinoma microarray datasets from the Gene Expression Omnibus (GEO) and The Cancer Genome Atlas (TCGA) databases were analyzed to identify differentially expressed genes (DEGs). Furthermore, PPI and WGCNA network analysis were integrated to identify the key genes closely related to the process of LUSC development. In addition, survival analysis was performed to achieve a prognostic model that accomplished good prediction accuracy. Three hundred and thirty-seven up-regulated and 119 down-regulated genes were identified, in which four genes have been found to play vital roles in LUSC development, namely CCNA2, AURKA, AURKB, and FEN1. The prognostic model contained 5 genes, which were all detrimental to prognosis. The AUC of the established prognostic model for predicting the survival of patients at 1, 3, and 5 years was 0.692, 0.722, and 0.651 in the test data, respectively. In conclusion, this study identified several biomarkers of significant interest for additional investigation of the therapies and methods of prognosis of lung squamous cell carcinoma.
Also flagged:RNA-binding proteinsmetabolismdegradationcancerneurodegenerative diseasesneuromuscular disorders
Journal Article2020-04-23No SnippetsZhu S, Rooney S, Michlewski G.
Show Full Abstract
RNA-binding proteins (RBPs) are involved in regulating all aspects of RNA metabolism, including processing, transport, translation, and degradation. Dysregulation of RNA metabolism is linked to a plethora of diseases, such as cancer, neurodegenerative diseases, and neuromuscular disorders. Recent years have seen a dramatic shift in the knowledge base, with RNA increasingly being recognised as an attractive target for precision medicine therapies. In this article, we are going to review current RNA-targeted therapies. Furthermore, we will scrutinise a range of drug discoveries targeting protein-RNA interactions. In particular, we will focus on the interplay between Lin28 and let-7, splicing regulatory proteins and survival motor neuron (SMN) pre-mRNA, as well as HuR, Musashi, proteins and their RNA targets. We will highlight the mechanisms RBPs utilise to modulate RNA metabolism and discuss current high-throughput screening strategies. This review provides evidence that we are entering a new era of RNA-targeted medicine.
Hard tissue regeneration and regrowth have continued to be a challenge in the field of conventional medicine in this 21<sup>st</sup> century. Over the years, the regrowth of broken bones and diseased hard tissue has remained a major concern in medical research. Since the discovery of hydroxyapatite (HA), a bioceramic compound that possesses the ability to activate bone regrowth and bond directly with regenerated bone, it has subsequently become an indispensable biomaterial. Currently, it is being used across the medical fields due to its exceptional biocompatibility. This became plausible because the main mineral phase of mammalian bones is HA. It has found application in various medical fields like medical instruments, drug delivery, bone and tooth fillers, prosthetics, orthotics, and in-vitro implants. As the importance of HA geometrically increases, it is necessary to critically evaluate and propose the most economic process of synthesizing and manufacturing this important bioceramic material. This review, therefore, highlights the different sources of HA and the synthesis/production methods for each source with a strong emphasis on the environment. Thus, the appraisal was carried out based on the properties of the derived HA. Such properties include but are not limited to geometry, particle size, morphology, thermal stability, and stoichiometry to suggest the most economic and environmentally sustainable sources and processing routes.
Also flagged:bindingproteolysisdegradationlysosomeextracellularglycan
Journal Article2020-04-23✓ 2 SnippetsDing Y, Fei Y, Lu B.
In-Text Gene Mentions
I A O 0000615)
…targeting the mutantHTTprotein (mHTT), the…
I A O 0000615)
…to the wild-typeHTTprotein (wtHTT), the…
Show Full Abstract
Traditional drug discovery focuses on identifying direct inhibitors of target proteins. This typically relies on a measurable biochemical readout and accessible binding sites whose occupancy influences the function of the target protein. These requirements preclude many disease-causing proteins from being 'druggable' targets, and these proteins are categorized as 'undruggable'. The proteolysis-targeting chimera (PROTAC) technology provides powerful tools to degrade these undruggable targets and has become a promising approach for drug discovery. However, the PROTAC technology has some limitations, and emerging new degrader technologies may greatly broaden the spectrum of targets that could be selectively degraded by harnessing a second major degradation pathway in cells. We review key emerging technologies that exploit the lysosomal degradation pathway and discuss their potential applications and limitations.
Also flagged:Waldenström Macroglobulinaemiamyeloproliferative neoplasmsplasma cell dyscrasiaETthrombocytosisimmunoglobulin
Journal Article2020-04-23✓ 1 SnippetLu N, Neoh CL, Ruan Z, Zhao L, Ying L, Zhang X, Chen S, Xu L.
In-Text Gene Mentions
Discussion)
…that a peroxidasePRDX6was most under-expressed…
Show Full Abstract
Essential thrombocythaemia (ET) and Waldenström macroglobulinaemia (WM) are two distinct disorders. Studies have reported several cases of myeloproliferative neoplasms (MPNs) with concomitant plasma cell dyscrasia. However, there were no reported cases of ET with concomitant WM to date. Here, we present a 55-year-old Chinese man with thrombocytosis and raised immunoglobulin level. Further investigations led to a diagnosis of ET and coexistent WM. Next-generation sequencing (NGS) of his bone marrow identified 3 mutated genes: JAK2 V617F, MYD88 L265P, and ATM F1036L. After being treated with pegylated interferon and low-dose aspirin, his platelet count normalized and immunoglobulin M (IgM) level reduced. To the best of our knowledge, this is the first reported case of dual pathology ET with WM.
…While deposition diseases (hemochromatosis/amyloidosis) can cause DCM,…
Show Full Abstract
<h4>Introduction</h4>Dyspnea is a common presenting complaint for many patients in the emergency department.<h4>Case presentation</h4>A 55-year-old man with type I diabetes presented to the emergency department with one month of intermittent palpitations and dyspnea. His lungs were clear to auscultation, and his chest radiograph was normal.<h4>Discussion</h4>This case takes the reader through the differential diagnosis and systematic work-up of dyspnea with discussion of the diagnostic study, which ultimately led to this patient's diagnosis and successful treatment.
Also flagged:genetic diseasescancertumorcancersclustered regularly interspaced shortzinc finger nucleases
Journal Article2020-04-23✓ 1 SnippetDai X, Blancafort P, Wang P, Sgro A, Thompson EW, Ostrikov KK.
In-Text Gene Mentions
S I O 001029)
…Existing examples include correcting the heterozygous MYBPC3 mutation in human preimplantation embryos to prevent hypertrophic cardiomyopathy (HCM),[74] replacing mutations in HTT genes with the correct sequence to reverse Huntington's disease immune dysfunction,[78] editing mutant APP in human fibroblasts to reduce the risk of developing early‐onset Alzheimer's diseases,[79] and coding a mutation in CCR5 in human embryos to prevent cholera, smallpox, and acquired immunodeficiency syndrome (AIDS).[80] Though the CRISPR technique has not been applied to prevent cancers, a hypothetical example would be to edit cancer predisposition genes BRCA1/2 in human embryos to prevent breast and ovarian cancers once ethically permitted, and a clinical trial screening mutations in p53 using CRISPR‐Duplex sequencing with the aim of identifying women with high risk of developing ovarian cancers for early diagnosis was initiated in 2018 and is ongoing (NCT03606486).…
Show Full Abstract
The development of clustered regularly interspaced short palindromic repeats (CRISPR) has spurred a successive wave of genome-engineering following zinc finger nucleases and transcription activator-like effector nucleases, and made gene-editing a promising strategy in the prevention and treatment of genetic diseases. However, gene-editing is not widely adopted in clinics due to some technical issues that challenge its safety and efficacy, and the lack of appropriate clinical regulations allowing them to advance toward improved human health without impinging on human ethics. By systematically examining the oncological applications of gene-editing tools and critical factors challenging their medical translation, genome-editing has substantial contributions to cancer driver gene discovery, tumor cell epigenome normalization, targeted delivery, cancer animal model establishment, and cancer immunotherapy and prevention in clinics. Gene-editing tools, epitomized by CRISPR, are predicted to represent a promising strategy toward the precise control of cancer initiation and development. However, some technical problems and ethical concerns are serious issues that need to be appropriately addressed before CRISPR can be incorporated into the next generation of molecular precision medicine. In this light, new technical developments to limit off-target effects are discussed herein, and the use of gene-editing approaches for treating otherwise incurable cancers is brought into focus.
Also flagged:cancerpaclitaxelconjugationfolic acidglucosepolyethyleneimine
Journal Article2020-04-23No SnippetsNasab SH, Amani A, Ebrahimi HA, Hamidi AA.
Show Full Abstract
Drug resistance is a great challenge in cancer therapy using chemotherapeutic agents. Administration of these drugs with siRNA is an efficacious strategy in this battle. Here, the present study tried to incorporate siRNA and paclitaxel (PTX) simultaneously into a novel nanocarrier. The selectivity of carrier to target cancer tissues was optimized through conjugation of folic acid (FA) and glucose (Glu) onto its surface. The structure of nanocarrier was formed from ternary magnetic copolymers based on FeCo-polyethyleneimine (FeCo-PEI) nanoparticles and polylactic acid-polyethylene glycol (PLA-PEG) gene delivery system. Biocompatibility of FeCo-PEI-PLA-PEG-FA(NPsA), FeCo-PEI-PLA-PEG-Glu (NPsB) and FeCo-PEI-PLA-PEG-FA/Glu (NPsAB) nanoparticles and also influence of PTX-loaded nanoparticles on in vitro cytotoxicity were examined using MTT assay. Besides, siRNA-FAM internalization was investigated by fluorescence microscopy. The results showed the blank nanoparticles were significantly less cytotoxic at various concentrations. Meanwhile, siRNA-FAM/PTX encapsulated nanoparticles exhibited significant anticancer activity against MCF-7 and BT-474 cell lines. NPsAB/siRNA/PTX nanoparticles showed greater effects on MCF-7 and BT-474 cells viability than NPsA/siRNA/PTX and NPsB/siRNA/PTX. Also, they induced significantly higher anticancer effects on cancer cells compared with NPsA/siRNA/PTX and NPsB/siRNA/PTX due to their multi-targeted properties using FA and Glu. We concluded that NPsAB nanoparticles have a great potential for co-delivery of both drugs and genes for use in gene therapy and chemotherapy.
Also flagged:oligonucleotidessilicasynthesisoligonucleotideamino acidssalt
Journal Article2020-04-23No SnippetsStudzińska S, Skoczylas M, Bocian S, Dembska A, Buszewski B.
Show Full Abstract
The main aim of the present study was the synthesis of an oligonucleotide-based material with high chemical stability, repeatability and specificity to complementary oligonucleotides. The oligonucleotides were attached to a silica gel surface modified with amino acids during one-step synthesis. The amount of the oligonucleotides immobilized on the support surface had an impact on adsorption effectiveness, due to steric interference. The adsorption capacity corresponds to 4.7 μg of complementary oligonucleotide per 1 mg of material, which reflects 50% of immobilized oligonucleotides. The presented results contain comprehensive studies on hybridization and release of fully complementary, partially complementary, non-complementary and antisense oligonucleotides from the newly synthesized adsorbent. The salt concentration and time period were the most influential parameters in the case of adsorption, while high temperature and low salt content were indispensable for effective desorption. Selectivity studies revealed that the adsorption percentage increases with the decreasing number of base mismatches. Consequently, the desorption of low complementarity oligonucleotides was always greater in comparison with the fully complementary sequence. Furthermore, it was shown that oligonucleotide-based materials may be successfully used for the extraction of antisense oligonucleotides and their metabolites from serum samples with recoveries ranging between 65 and 73%.
Research Square2020-04-23Preprint (No Snippets API)NALLUR G.
Show Full Abstract
The novel coronavirus SARS-CoV-2, the causative agent of COVID-19 respiratory disease, has infected 2,029,930 people worldwide and caused 136,320 deaths. Consequently, the hunt for drugs showing efficacy against this deadly disease, or vaccines for prevention, are being intensely investigated. Unfortunately, there is a scarcity of research data on the molecular mechanisms of SARS-CoV-2 infection for quickly finding effective therapies, or repurposing existing drugs approved by the US FDA. This report models existing knowledge of SARS-COV2 viral proteins and the cellular proteins they interact with by comparisons with BRD4 interacting proteins identified from B cells, with or without BET inhibition. The E protein of SARS-COV2 interacts with BRD4, and the Spike (S) protein with CANX. Extensive similarities were observed with published cellular interactants of 13 SARS-COV2 proteins resulting in 47 BRD4-interacting protein candidates, with or without BET inhibition. 61 cellular protein targets and 132 FDA approved drugs which use these proteins as targets are proposed, which can be investigated for efficacy against SARS-COV2 infections. The implications to SARS-COV2 disease diagnosis, therapy and vaccine creation are discussed.
Journal Article2020-04-22✓ 5 SnippetsSkuodas S, Clemons A, Hayes M, Goll A, Zora B, Weeks DL, Phillips BT, Fassler JS.
In-Text Gene Mentions
I A O 0000326)
…Htt…
Methods)
…Htt-Q 9797 amyloid disaggregation…
Methods)
…expressed P TDH3 -Htt-Q 97 -GFP fusion…
Methods)
…L-Luciferase-GFP detection andHtt-Q 97 -GFP was…
Methods)
…Htt-Q 9797 -GFP extracts…
Show Full Abstract
Protein aggregation, once believed to be a harbinger and/or consequence of stress, age, and pathological conditions, is emerging as a novel concept in cellular regulation. Normal versus pathological aggregation may be distinguished by the capacity of cells to regulate the formation, modification, and dissolution of aggregates. We find that <i>Caenorhabditis elegans</i> aggregates are observed in large cells/blastomeres (oocytes, embryos) and in smaller, further differentiated cells (primordial germ cells), and their analysis using cell biological and genetic tools is straightforward. These observations are consistent with the hypothesis that aggregates are involved in normal development. Using cross-platform analysis in <i>Saccharomyces cerevisiae, C. elegans</i>, and <i>Xenopus laevis</i>, we present studies identifying a novel disaggregase family encoded by animal genomes and expressed embryonically. Our initial analysis of yeast Arb1/Abcf2 in disaggregation and animal ABCF proteins in embryogenesis is consistent with the possibility that members of the ABCF gene family may encode disaggregases needed for aggregate processing during the earliest stages of animal development.
Also flagged:peptideshand, foot, and mouth diseaseinfectionEV71 infectionscapsid proteinantibodies
Journal Article2020-04-22✓ 1 SnippetLiu J, Zhao B, Xue L, Wu J, Xu Y, Liu Y, Qin C.
In-Text Gene Mentions
Introduction)
…such as CA16,CA10and CA6, multivalent…
Show Full Abstract
<h4>Background</h4>Prophylactic vaccines are critical in preventing hand, foot, and mouth disease (HFMD) primarily caused by human enterovirus 71 (EV71) infection. Children aged less than 5 years are especially susceptible to EV71 infections. In addition to the development of vaccines containing the inactivated virus, those containing virus-like particles (VLPs) with repeated antigens also constitute an effective preventive strategy for EV71 infections, with safety and productivity advantages. We previously developed a fusion protein composed with truncated peptides of the EV71 capsid protein, which assembled into spherical particles. This study aimed to assess the immunoprotective effects of this fusion protein as a vaccine candidate in a mouse model of EV71 infection.<h4>Methods</h4>To evaluate the protective effect of fusion protein vaccine candidate, neonatal mice born by immunized female mice, as well as normal neonatal mice immunized twice were infected with EV71 virus. Whereafter, the survival rates, clinical scores and viral loads were measured.<h4>Results</h4>The high dosage and booster immunization helped induce specific serum antibodies with high neutralization titers, which were transferred to neonatal mice, thereby facilitating effective resistance towards EV71 infection. An active immune response was also observed in neonatal mice which generated following immunization.<h4>Conclusions</h4>The present results suggest that this fusion protein is a suitable vaccine candidate in treating EV71 infections.
Also flagged:transcription factorlipoproteinresponse tolinoleic acidOAosteoarthritis
Journal Article2020-04-22No SnippetsJiang L, Sun X, Kong H.
Show Full Abstract
<h4>Background</h4>The study aimed to identify the targeting genes and miRNAs using the microarray expression profile dataset for Osteoarthritis (OA) patients. Differentially expressed genes (DEGs) between OA and control samples were identified using Bayes method of limma package. Subsequently, a protein-protein interaction (PPI) network was constructed. miRNAs and transcription factor (TFs) based on DEGs in PPI network were identified using Webgestalt and ENCODE, respectively. Finally, MCODE, Gene Ontology (GO) function, and Kyoto Encyclopedia of Genes and Genomes (KEGG) were performed. The expressions of several DEGs and predicted miRNAs in OA rats were detected by RT-PCR.<h4>Results</h4>A total of 594 DEGs were identified. In PPI network, there were 313 upregulated DEGs and 22 downregulated DEGs. Besides, the regulatory relationships included 467 upregulated interactions and 85 downregulated interactions (miR-124A → QKI and MAP 1B) between miRNA and DEGs in PPI network. The module from downregulated DEGs-TFs-miRNA networks was mainly enriched to low-density lipoprotein particle clearance, response to linoleic acid, and small molecule metabolic process BP terms. Moreover, QKI, MAP 1B mRNA and miR-9 expressions were significantly reduced in OA rats.<h4>Conclusion</h4>miR-9 might be a protective factor for OA patients via inhibiting proliferation and differentiation of cartilage progenitor cells. miR-124A might play an important role in progression of OA through targeting QKI and MAP 1B.
<h4>Purpose</h4>Despite adjuvant endocrine therapy for patients with estrogen receptor alpha (ER)-positive breast cancer, dormant residual disease can persist for years and eventually cause tumor recurrence. We sought to deduce mechanisms underlying the persistence of dormant cancer cells to identify therapeutic strategies.<h4>Experimental design</h4>Mimicking the aromatase inhibitor-induced depletion of estrogen levels used to treat patients, we developed preclinical models of dormancy in ER<sup>+</sup> breast cancer induced by estrogen withdrawal in mice. We analyzed tumor xenografts and cultured cancer cells for molecular and cellular responses to estrogen withdrawal and drug treatments. Publicly available clinical breast tumor gene expression datasets were analyzed for responses to neoadjuvant endocrine therapy.<h4>Results</h4>Dormant breast cancer cells exhibited upregulated 5' adenosine monophosphate-activated protein kinase (AMPK) levels and activity, and upregulated fatty acid oxidation. While the antidiabetes AMPK-activating drug metformin slowed the estrogen-driven growth of cells and tumors, metformin promoted the persistence of estrogen-deprived cells and tumors through increased mitochondrial respiration driven by fatty acid oxidation. Pharmacologic or genetic inhibition of AMPK or fatty acid oxidation promoted clearance of dormant residual disease, while dietary fat increased tumor cell survival.<h4>Conclusions</h4>AMPK has context-dependent effects in cancer, cautioning against the widespread use of an AMPK activator across disease settings. The development of therapeutics targeting fat metabolism is warranted in ER<sup>+</sup> breast cancer.
Also flagged:SETDB1Neuropsychiatric disordersSET domain, bifurcate 1histone H3K9 specific methyltransferasesilencingheterochromatin
Journal Article2020-04-22No SnippetsZhu Y, Sun D, Jakovcevski M, Jiang Y.
Show Full Abstract
Neuropsychiatric disorders are a collective of cerebral conditions with a multifactorial and polygenetic etiology. Dysregulation of epigenetic profiles in the brain is considered to play a critical role in the development of neuropsychiatric disorders. SET domain, bifurcate 1 (SETDB1), functioning as a histone H3K9 specific methyltransferase, is not only critically involved in transcriptional silencing and local heterochromatin formation, but also affects genome-wide neuronal epigenetic profiles and is essential for 3D genome integrity. Here, we provide a review of recent advances towards understanding the role of SETDB1 in the central nervous system during early neurodevelopment as well as in the adult brain, with a particular focus on studies that link its functions to neuropsychiatric disorders and related behavioral changes, and the exploration of novel therapeutic strategies targeting SETDB1.
Also flagged:heat shock proteinschaperonesneurodegenerative disordersHSPB1HSPB3HSPB8
Journal Article2020-04-22No SnippetsVendredy L, Adriaenssens E, Timmerman V.
Show Full Abstract
Small heat shock proteins are ubiquitously expressed chaperones, yet mutations in some of them cause tissue-specific diseases. Here, we will discuss how small heat shock proteins give rise to neurodegenerative disorders themselves while we will also highlight how these proteins can fulfil protective functions in neurodegenerative disorders caused by protein aggregation. The first half of this paper will be focused on how mutations in HSPB1, HSPB3, and HSPB8 are linked to inherited peripheral neuropathies like Charcot-Marie-Tooth (CMT) disease and distal hereditary motor neuropathy (dHMN). The second part of the paper will discuss how small heat shock proteins are linked to neurodegenerative disorders like Alzheimer's, Parkinson's, and Huntington's disease.
Also flagged:APOC3ESR2MMP1PPARGlipodystrophylipoatrophy
Journal Article2020-04-22✓ 4 Snippetsda Silva AS, Carvalho TL, do Ó KP, da Nóbrega DN, Dos Santos Souza R, da Silva Lima VF, Farias ICC, de Mendonça Belmont TF, de Mendonça Cavalcanti MDS, de Barros Miranda-Filho D.
In-Text Gene Mentions
Title)
…Association of the polymorphisms of the genes APOC3 (rs2854116), ESR2 (rs3020450), HFE (rs1799945), MMP1 (rs1799750) and PPARG (rs1801282) with lipodystrophy in people living with HIV on antiretroviral therapy: a systematic review.…
Abstract)
…The aim of this study was to perform a systematic review to identify data reported in the literature concerning the association of APOC3 (rs2854116), ESR2 (rs3020450), HFE (rs1799945), MMP1 (rs1799750) and PPARG (rs1801282) polymorphisms with lipodystrophy in people living with HIV (PLWHIV) on antirretroviral therapy.…
The aim of this study was to perform a systematic review to identify data reported in the literature concerning the association of APOC3 (rs2854116), ESR2 (rs3020450), HFE (rs1799945), MMP1 (rs1799750) and PPARG (rs1801282) polymorphisms with lipodystrophy in people living with HIV (PLWHIV) on antirretroviral therapy. The research was conducted in six databases and the studies were selected in two steps. First, a search was undertaken in the following electronic databases: PubMed, Science Direct, Medline, World Wide Science, Directory of Open Access Journals, Scielo, Lilacs and Medcarib. The titles and abstracts of 24,859 articles were read to select those that match the elegibilty criteria. Five papers that addressed the association of HAART, lipodystrophy and polymorphisms were selected for the review. There was no association between the polymorphisms of the genes APOC3 and PPARG and lipodystrophy. Another study described an association between the variant allele (G) of HFE and protection concerning the development of lipoatrophy (0.02) when compared with the reference allele (C). On the other hand, the variant allele (T) of the ESR2 gene was associated with the development of lipoatrophy (p = 0.007) when compared with the reference allele (C). In addition, the genotype and the variant allele of the gene MMP1 (2G) were associated with lipodystrophy in PLWHIV on HAART (p = 0.0002 and p = 0.0008, respectively). Therefore, further studies with other populations, involving PLWHIV on HAART are necessary to better understand the role of genetic markers, which may be involved in a predisposition to lipodystrophy.
Also flagged:nanowiresnucleic acidsorganizationelectron transfercapsidnanostructures
Journal Article2020-04-22No SnippetsSurin M, Ulrich S.
Show Full Abstract
DNA-templated self-assembly represents a rich and growing subset of supramolecular chemistry where functional self-assemblies are programmed in a versatile manner using nucleic acids as readily-available and readily-tunable templates. In this review, we summarize the different DNA recognition modes and the basic supramolecular interactions at play in this context. We discuss the recent results that report the DNA-templated self-assembly of small molecules into complex yet precise nanoarrays, going from 1D to 3D architectures. Finally, we show their emerging functions as photonic/electronic nanowires, sensors, gene delivery vectors, and supramolecular catalysts, and their growing applications in a wide range of area from materials to biological sciences.
Also flagged:Transcriptional FactorKLF11CancerKrüppel-like factor 11Sp1Krüppel-like zinc finger transcription factors
Journal Article2020-04-22✓ 1 SnippetLin L, Mahner S, Jeschke U, Hester A.
In-Text Gene Mentions
Introduction)
…interacting with thehistone deacetylase corepressor complexdeacetylase corepressor comple…
Show Full Abstract
KLF11 (Krüppel-like factor 11) belongs to the family of Sp1/Krüppel-like zinc finger transcription factors that play important roles in a variety of cell types and tissues. KLF11 was initially described as a transforming growth factor-beta (TGF-β) inducible immediate early gene (TIEG). KLF11 promotes the effects of TGF-β on cell growth control by influencing the TGFβ-Smads signaling pathway and regulating the transcription of genes that induce either apoptosis or cell cycle arrest. In carcinogenesis, KLF11 can show diverse effects. Its function as a tumor suppressor gene can be suppressed by phosphorylation of its binding domains via oncogenic pathways. However, KLF 11 can itself also show tumor-promoting effects and seems to have a crucial role in the epithelial-mesenchymal transition process. Here, we review the current knowledge about the function of KLF11 in cell growth regulation. We focus on its transcriptional regulatory function and its influence on the TGF-β signaling pathway. We further discuss its possible role in mediating crosstalk between various signaling pathways in normal cell growth and in carcinogenesis.
Also flagged:brain developmentpathogenesisencephalopathy of prematuritysleepbehavioralpsycho-behavioral disorders
Journal Article2020-04-22No SnippetsLien R.
Show Full Abstract
Neurocritical care is an approach of comprehensive care through multidisciplinary coordination and implementation of neuroprotective strategies to reduce the risk of neurologic injury among critically ill patients. Premature infants are at a special risk of sustaining brain injury and having adverse neurodevelopmental outcome. The pathogenesis of "encephalopathy of prematurity" is tightly linked to hemodynamic instability during postnatal transition, immaturity of the cerebral vascular bed and nervous system, and the commonly encountered inflammation in an intensive care setting. Clinical assessment aided by renewed monitoring techniques, together with therapies supported by best available evidence may provide opportunities to salvage these vulnerable brains. Indeed, to promote optimal brain development and to ensure neurodevelopmental intact survival is of imperial priority in the modern care of preterm infants.
Also flagged:NAFLDsteatosissteatohepatitiscirrhosisalcoholsinsulin
Journal Article2020-04-22✓ 1 SnippetFernandez-Travieso JC, Rodriguez-Perez I, Ruenes-Domech C, lIlnait-Ferrer J, Fernandez-Dorta L, Mendoza-Castano S.
In-Text Gene Mentions
Methods)
…autoimmune liver disease,hemochromatosis, hepatotoxicity, human immuno…
Show Full Abstract
<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) encompasses a spectrum of diseases ranging from steatosis to steatohepatitis and cirrhosis. Given the increasing incidence of NAFLD and the long-term consequences of this disease, it is important to identify the risk factors and therapeutic measures. Abexol is a mixture of beeswax alcohols with antioxidant, gastro-protective and anti-inflammatory effects. The aim was to conduct a pooled analysis of clinical trials data of the effects of Abexol treatment in patients with NAFLD.<h4>Methods</h4>The present analysis includes the data of all patients with NAFLD obtained from medium-term randomized, double-blinded, placebo controlled clinical studies with Abexol. One hundred patients with NAFLD received Abexol (100 mg/day) or placebo for 6 months. Significant changes in the ultrasound analysis of the liver were considered a primary efficacy variable. Secondary endpoints were decreased homeostasis model assessment (HOMA) index and insulin levels, and improved clinical symptoms. Statistical analysis of all data was according to the intention-to-treat method.<h4>Results</h4>Both groups were statistically homogeneous at baseline conditions. At 6 months of treatment, the number of Abexol-treated patients exhibiting a normal liver echo pattern on ultrasonography was greater than that of the placebo patients (P < 0.05). Abexol significantly reduced (P < 0.05) insulin levels and HOMA index. The proportion of Abexol patients showing symptom improvement was higher (P < 0.01) than that of the placebo group. Treatments were safe and well tolerated.<h4>Conclusions</h4>Treatment of Abexol during 6 months significantly ameliorates liver fat accumulation and insulin resistances, meanwhile improving clinical evolution in patients with NAFLD. The treatment was safe and well tolerated in these patients.
Research Square2020-04-22Preprint (No Snippets API)Zhou B, She J, Wang Y, Ma X.
Show Full Abstract
<title>Abstract</title> <p>Objectives It is of clinical significance to evaluate the disease severity and investigate possible biomarkers of COVID-19. In this study, we aim to describe the clinical characteristics of infection makers in severe and very severe patients with COVID-19.Methods This is a single center, observational analysis. We enrolled 48 in-hospital severe patients with COVID-19 admitted to the West District of Union Hospital of Tongji Medical College and analyzed infection biomarkers in 20 patients who had been tested for ferritin, PCT, CRP, etc.Results We noted significantly increased CRP (1.48mg/L [IQR: 16.69-2.74] vs. 57.98mg/L [IQR: 38.335-77.565], P<0.05), PCT(0.05ng/ml [IQR: 0.03-0.06] vs. 0.21ng/ml [IQR: 0.11-0.42], P<0.05) and ferritin (291.13ng/ml [IQR: 102.1-648.42] vs. 1006.16ng/ml [IQR: 408.265-1988.25]) in severe COVID-19. For blood count, significant increase was noticed in neutrophil count (3.75*10^9/L [IQR: 3.42-4.93] vs. 8.11*10^9/L [IQR: 5.675-8.905], P<0.05); and decrease was seen in lymphocyte count (1.62*10^9/L [IQR: 0.7-1.73] vs. 0.68*10^9/L [IQR: 0.385-1.04], P<0.05), and platelet count (214*10^9/L [IQR: 184-247] vs. 147*10^9/L [IQR: 126-202.5], P<0.05) in severe COVID-19.Conclusions The serum levels of CRP, PCT and ferritin are markedly increased in very severe compared with severe COVID-19. Increased CRP, PCT and ferritin level might correlate to secondary bacterial infection and associated with poor clinical prognosis.</p>
Also flagged:Acid SphingomyelinasesepsismelanomasphingomyelinasefluoresceinASM
Journal Article2020-04-21No SnippetsKappe C, Mohamed ZH, Naser E, Carpinteiro A, Arenz C.
Show Full Abstract
Activity of acid sphingomyelinase has been implicated in a number of diseases like acute lung injury, sepsis or metastasis of melanoma cells. Here, we present a sphingomyelinase FRET probe based on FAM/BODIPY dyes for real-time monitoring of acid sphingomyelinase. The probe gives rise to a tremendous increase in fluorescence of the fluorescein FRET donor upon cleavage and we show that this is, to a significant part, due to cleavage-associated phase transition, suggesting a more systematic consideration of such effects for future probe development. The probe allows for the first time to monitor relative sphingomyelinase activities of intact living cells by flow cytometry.
Also flagged:carbapenemCarbapenemaseKPC-2infectious diseasenucleotide-Associated Infections
Journal Article2020-04-21No SnippetsStoesser N, Phan HTT, Seale AC, Aiken Z, Thomas S, Smith M, Wyllie D, George R, Sebra R, Mathers AJ, Vaughan A, Peto TEA, Ellington MJ, Hopkins KL, Crook DW, Orlek A, Welfare W, Cawthorne J, Lenney C, Dodgson A, Woodford N, Walker AS, TRACE Investigators’ Group.
Show Full Abstract
Carbapenem resistance in <i>Enterobacterales</i> is a public health threat. <i>Klebsiella pneumoniae</i> carbapenemase (encoded by alleles of the <i>bla</i><sub>KPC</sub> family) is one of the most common transmissible carbapenem resistance mechanisms worldwide. The dissemination of <i>bla</i><sub>KPC</sub> historically has been associated with distinct <i>K. pneumoniae</i> lineages (clonal group 258 [CG258]), a particular plasmid family (pKpQIL), and a composite transposon (Tn<i>4401</i>). In the United Kingdom, <i>bla</i><sub>KPC</sub> has represented a large-scale, persistent management challenge for some hospitals, particularly in North West England. The dissemination of <i>bla</i><sub>KPC</sub> has evolved to be polyclonal and polyspecies, but the genetic mechanisms underpinning this evolution have not been elucidated in detail; this study used short-read whole-genome sequencing of 604 <i>bla</i><sub>KPC</sub>-positive isolates (Illumina) and long-read assembly (PacBio)/polishing (Illumina) of 21 isolates for characterization. We observed the dissemination of <i>bla</i><sub>KPC</sub> (predominantly <i>bla</i><sub>KPC-2</sub>; 573/604 [95%] isolates) across eight species and more than 100 known sequence types. Although there was some variation at the transposon level (mostly Tn<i>4401a</i>, 584/604 [97%] isolates; predominantly with ATTGA-ATTGA target site duplications, 465/604 [77%] isolates), <i>bla</i><sub>KPC</sub> spread appears to have been supported by highly fluid, modular exchange of larger genetic segments among plasmid populations dominated by IncFIB (580/604 isolates), IncFII (545/604 isolates), and IncR (252/604 isolates) replicons. The subset of reconstructed plasmid sequences (21 isolates, 77 plasmids) also highlighted modular exchange among non-<i>bla</i><sub>KPC</sub> and <i>bla</i><sub>KPC</sub> plasmids and the common presence of multiple replicons within <i>bla</i><sub>KPC</sub> plasmid structures (>60%). The substantial genomic plasticity observed has important implications for our understanding of the epidemiology of transmissible carbapenem resistance in <i>Enterobacterales</i> for the implementation of adequate surveillance approaches and for control.
Also flagged:mannose phosphate isomerasecongenital disorder of glycosylationcongenital disordersMPIintellectual disabilityneurological impairment
Journal Article2020-04-21✓ 1 SnippetČechová A, Altassan R, Borgel D, Bruneel A, Correia J, Girard M, Harroche A, Kiec-Wilk B, Mohnike K, Pascreau T, Pawliński Ł, Radenkovic S, Vuillaumier-Barrot S, Aldamiz-Echevarria L, Couce ML, Martins EG, Quelhas D, Morava E, de Lonlay P, Witters P, Honzík T.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Mannose phosphate isomerase-congenital disorder of glycosylation (MPI-CDG) deficiency is a rare subtype of congenital disorders of protein N-glycosylation. It is characterised by deficiency of MPI caused by pathogenic variants in MPI gene. The manifestation of MPI-CDG is different from other CDGs as the patients suffer dominantly from gastrointestinal and hepatic involvement whereas they usually do not present intellectual disability or neurological impairment. It is also one of the few treatable subtypes of CDGs with proven effect of oral mannose. This article covers a complex review of the literature and recommendations for the management of MPI-CDG with an emphasis on the clinical aspect of the disease. A team of international experts elaborated summaries and recommendations for diagnostics, differential diagnosis, management, and treatment of each system/organ involvement based on evidence-based data and experts' opinions. Those guidelines also reveal more questions about MPI-CDG which need to be further studied.
Also flagged:PCDH19epilepsyEFMRcognitive impairmentintellectual disabilitymovement disorders
Journal Article2020-04-21✓ 1 SnippetZhao X, Wang Y, Mei S, Kong X.
In-Text Gene Mentions
Methods)
…DOCK7, SLC13A5, CHD2,VRK2, KCNMA1 .…
Show Full Abstract
<h4>Background</h4>Epilepsy limited to females with mental retardation (EFMR) is a rare type of epilepsy with an X-linked mode of inheritance, which affect heterozygous females while the males are not affected. Mutations within the protocadherin 19 (PCDH19) gene have been identified as the direct cause of EFMR. The phenotype of EFMR is characterized by seizure onset in infancy with or without cognitive impairment, intellectual disturbances, and autistic features.<h4>Methods</h4>Whole-exome sequencing (WES) was performed in the proband to identify the underlying genetic mutations. The candidate genes were confirmed by Sanger sequencing following PCR amplification. In silico analyses were conducted to predict the effect of the novel missense mutation on the function of PCDH19 protein.<h4>Results</h4>We identified three female patients in a family with a novel missense mutation in PCDH19, c.812G>A (p. (Gly271Asp)). The patients III-1 and III-2 presented with more severe clinical phenotypes and an earlier age of onset (6 and 11 months, respectively), intellectual disability, and movement disorders. By contrast, patient II-4 has a later age of onset (23 months), and there was no relapse of seizures without antiepileptic treatment after the age of six. In silico analyses showed that p. (Gly271Asp) in the PCDH19 affects a highly conserved residue.<h4>Conclusions</h4>Our results indicated that patients with the same PCDH19 mutation in a family may show intrafamilial phenotypic variability. Givening the mother of the proband was 18 weeks pregnant and intends to have a prenatal diagnosis, the more reasonable and less harmful strategies for prenatal diagnosis could be chosen based on the results of noninvasive prenatal testing and genetic testing.
Also flagged:innate immunitypathogenesisdeep vein thrombosismyocardial infarctionstrokevon Willebrand factor
Journal Article2020-04-21✓ 2 SnippetsConstantinescu-Bercu A, Grassi L, Frontini M, Salles-Crawley II, Woollard K, Crawley JT, Crawley JT.
In-Text Gene Mentions
Introduction)
…Genome wide association studies (GWAS) on venous thromboembolism (VTE) have identified a panel of genes (ABO, F2, F5, F11, FGG, PROCR) with well-described influences upon coagulation and thrombotic risk, as well as those with well-established causative links (e.g. PROS, PROC, SERPINC1) (Germain et al., 2015; Germain et al., 2011; Rosendaal and Reitsma, 2009).…
Introduction)
…, PROC ,SERPINC1) ( Germain…
Show Full Abstract
Platelet-neutrophil interactions are important for innate immunity, but also contribute to the pathogenesis of deep vein thrombosis, myocardial infarction and stroke. Here we report that, under flow, von Willebrand factor/glycoprotein Ibα-dependent platelet 'priming' induces integrin α<sub>IIb</sub>β<sub>3</sub> activation that, in turn, mediates neutrophil and T-cell binding. Binding of platelet α<sub>IIb</sub>β<sub>3</sub> to SLC44A2 on neutrophils leads to mechanosensitive-dependent production of highly prothrombotic neutrophil extracellular traps. A polymorphism in <i>SLC44A2</i> (rs2288904-A) present in 22% of the population causes an R154Q substitution in an extracellular loop of SLC44A2 that is protective against venous thrombosis results in severely impaired binding to both activated α<sub>IIb</sub>β<sub>3</sub> and VWF-primed platelets. This was confirmed using neutrophils homozygous for the <i>SLC44A2</i> R154Q polymorphism. Taken together, these data reveal a previously unreported mode of platelet-neutrophil crosstalk, mechanosensitive NET production, and provide mechanistic insight into the protective effect of the <i>SLC44A2</i> rs2288904-A polymorphism in venous thrombosis.
Also flagged:intraventricular hemorrhagepatent ductus arteriosusHb
Journal Article2020-04-21No SnippetsBarboza JJ, Albitres-Flores L, Rivera-Meza M, Rodriguez-Huapaya J, Caballero-Alvarado J, Pasupuleti V, Hernandez AV.
Show Full Abstract
<h4>Background</h4>To systematically evaluate short-term efficacy of UCM versus other interventions in preterm infants.<h4>Methods</h4>Six engines were searched until February 2020 for randomized controlled trials (RCTs) assessing UCM versus immediate cord clamping (ICC), delayed cord clamping (DCC), or no intervention. Primary outcomes were overall mortality, intraventricular hemorrhage (IVH), and patent ductus arteriosus (PDA); secondary outcomes were need for blood transfusion, mean blood pressure (MBP), serum hemoglobin (Hb), and ferritin levels. Random-effects meta-analyses were used.<h4>Results</h4>Fourteen RCTs (n = 1708) were included. In comparison to ICC, UCM did not decrease mortality (RR 0.5, 95% CI 0.2-1.1), IVH (RR 0.7, 95% CI 0.5-1.0), or PDA (RR 1.0, 95% CI 0.7-1.5). However, UCM reduced need of blood transfusion (RR 0.5, 95% CI 0.3-0.9) and increased MBP (MD 2.5 mm Hg, 95% CI 0.5-4.5), Hb (MD 1.2 g/dL, 95% CI 0.8-1.6), and ferritin (MD 151.4 ng/dL, 95% CI 59.5-243.3). In comparison to DCC, UCM did not reduce mortality, IVH, PDA, or need of blood transfusion but increased MBP (MD 3.7, 95% CI 0.6-6.9) and Hb (MD 0.3, 95% CI -0.2-0.8). Only two RCTs had high risk of bias.<h4>Conclusions</h4>UCM did not decrease short-term clinical outcomes in comparison to ICC or DCC in preterm infants. Intermediate outcomes improved significantly with UCM.<h4>Impact</h4>In 14 randomized controlled trials (RCTs), umbilical cord milking (UCM) did not reduce mortality, intraventricular hemorrhage, or patent ductus arteriosus compared to immediate (ICC) or delayed cord clamping (DCC). UCM improved mean blood pressure and hemoglobin levels compared to ICC or DCC. In comparison to ICC, UCM reduced the need for blood transfusion. We updated searches until February 2020, stratified by type of control, and performed subgroup analyses. There was low quality of evidence about clinical efficacy of UCM. Most of RCTs had low risk of bias. UCM cannot be recommended as standard of care for preterm infants.
Also flagged:mitochondrial diseasesmultisystemic disordersmitochondrialmitochondrial disordersKARSAARS2
Journal Article2020-04-21✓ 1 SnippetFelhi R, Charif M, Sfaihi L, Mkaouar-Rebai E, Desquiret-Dumas V, Kallel R, Bris C, Goudenège D, Guichet A, Bonneau D, Procaccio V, Reynier P, Amati-Bonneau P, Hachicha M, Fakhfakh F, Lenaers G.
In-Text Gene Mentions
Abstract)
…EARS2 (c.486-7C>G) andDARS2(c.1456C>T) were concomitantly…
Show Full Abstract
Mitochondrial diseases are a clinically heterogeneous group of multisystemic disorders that arise as a result of various mitochondrial dysfunctions. Autosomal recessive aARS deficiencies represent a rapidly growing group of severe rare inherited mitochondrial diseases, involving multiple organs, and currently without curative option. They might be related to defects of mitochondrial aminoacyl t-RNA synthetases (mtARS) that are ubiquitous enzymes involved in mitochondrial aminoacylation and the translation process. Here, using NGS analysis of 281 nuclear genes encoding mitochondrial proteins, we identified 4 variants in different mtARS in three patients from unrelated Tunisian families, with clinical features of mitochondrial disorders. Two homozygous variants were found in KARS (c.683C>T) and AARS2 (c.1150-4C>G), respectively in two patients, while two heterozygous variants in EARS2 (c.486-7C>G) and DARS2 (c.1456C>T) were concomitantly found in the third patient. Bio-informatics investigations predicted their pathogenicity and deleterious effects on pre-mRNA splicing and on protein stability. Thus, our results suggest that mtARS mutations are common in Tunisian patients with mitochondrial diseases.
Also flagged:embryogenesisgastrulationbone morphogenetic proteinBMPNotchhedgehog
Journal Article2020-04-21No SnippetsKostouros A, Koliarakis I, Natsis K, Spandidos DA, Tsatsakis A, Tsiaoussis J.
Show Full Abstract
The large intestine, part of the gastrointestinal tract (GI), is composed of all three germ layers, namely the endoderm, the mesoderm and the ectoderm, forming the epithelium, the smooth muscle layers and the enteric nervous system, respectively. Since gastrulation, these layers develop simultaneously during embryogenesis, signaling to each other continuously until adult age. Two invaginations, the anterior intestinal portal (AIP) and the caudal/posterior intestinal portal (CIP), elongate and fuse, creating the primitive gut tube, which is then patterned along the antero‑posterior (AP) axis and the radial (RAD) axis in the context of left‑right (LR) asymmetry. These events lead to the formation of three distinct regions, the foregut, midgut and hindgut. All the above‑mentioned phenomena are under strict control from various molecular pathways, which are critical for the normal intestinal development and function. Specifically, the intestinal epithelium constitutes a constantly developing tissue, deriving from the progenitor stem cells at the bottom of the intestinal crypt. Epithelial differentiation strongly depends on the crosstalk with the adjacent mesoderm. Major molecular pathways that are implicated in the embryogenesis of the large intestine include the canonical and non‑canonical wingless‑related integration site (Wnt), bone morphogenetic protein (BMP), Notch and hedgehog systems. The aberrant regulation of these pathways inevitably leads to several intestinal malformation syndromes, such as atresia, stenosis, or agangliosis. Novel theories, involving the regulation and homeostasis of intestinal stem cells, suggest an embryological basis for the pathogenesis of colorectal cancer (CRC). Thus, the present review article summarizes the diverse roles of these molecular factors in intestinal embryogenesis and related disorders.
Also flagged:gene expressionAcidPI3KAKTmTORforkhead box transcription factors
Journal Article2020-04-21No SnippetsWang Y, Wang X, Jiang Y, Liu R, Cao D, Pan J, Luo Y.
Show Full Abstract
MicroRNAs (miRNAs) are upstream regulators of gene expression and are involved in several biological processes. The purpose of the present study was to obtain a detailed spatiotemporal miRNA expression profile in mouse retina, to identify one or more miRNAs that are key to mouse retinal development and to investigate the roles and mechanisms of these miRNAs. The miRNA expression pattern of the developing mouse retina was acquired from Locked Nucleic Acid microarrays. Data were processed to identify differentially expressed miRNAs (DE‑miRNAs) using the linear model in Python 3.6. Following bioinformatics analysis and reverse transcription‑quantitative polymerase chain reaction validation, 8 miRNAs (miR‑9‑5p, miR‑130a‑3p, miR‑92a‑3p, miR‑20a‑5p, miR‑93‑5p, miR‑9‑3p, miR‑709 and miR‑124) were identified as key DE‑miRNAs with low variability during mouse retinal development. Gene Ontology analysis revealed that the target genes of the DE‑miRNAs were enriched in cellular metabolic processes. Kyoto Encyclopedia of Genes and Genomes analysis demonstrated that the target genes of the DE‑miRNAs were significantly enriched in PI3K/AKT/mTOR, class O of forkhead box transcription factors, mitogen‑activated protein kinase (MAPK), neurotrophin and transforming growth factor (TGF)‑β signaling, as well as focal adhesion and the axon guidance pathway. PI3K, AKT, PTEN, MAPK1, Son of Sevenless, sphingosine‑1‑phosphate receptor 1, BCL‑2L11, TGF‑β receptor type 1/2 and integrin α (ITGA)/ITGAB, which are key components of the aforementioned pathways and were revealed to be target genes of several of the DE‑miRNAs. The present study used a linear model to identify several DE‑miRNAs, as well as their target genes and associated pathways, which may serve crucial roles in mouse retinal development. Therefore, the results obtained in the present study may provide the groundwork for further experiments.
Also flagged:NucleotideDNA ligase 1ligase 3chromatinligasesmethylation
Journal Article2020-04-21No SnippetsSriramachandran AM, Petrosino G, Méndez-Lago M, Schäfer AJ, Batista-Nascimento LS, Zilio N, Ulrich HD.
Show Full Abstract
DNA single-strand breaks (SSBs) are among the most common lesions in the genome, arising spontaneously and as intermediates of many DNA transactions. Nevertheless, in contrast to double-strand breaks (DSBs), their distribution in the genome has hardly been addressed in a meaningful way. We now present a technique based on genome-wide ligation of 3'-OH ends followed by sequencing (GLOE-Seq) and an associated computational pipeline designed for capturing SSBs but versatile enough to be applied to any lesion convertible into a free 3'-OH terminus. We demonstrate its applicability to mapping of Okazaki fragments without prior size selection and provide insight into the relative contributions of DNA ligase 1 and ligase 3 to Okazaki fragment maturation in human cells. In addition, our analysis reveals biases and asymmetries in the distribution of spontaneous SSBs in yeast and human chromatin, distinct from the patterns of DSBs.
Also flagged:vitamin Cimmune systemAcute Respiratory Distress SyndromeARDSCovid19infectious disease
Journal Article2020-04-21✓ 1 SnippetBoretti A, Banik BK.
In-Text Gene Mentions
Methods)
…for patients withhemochromatosis[ 53 ].…
Show Full Abstract
The recent outbreak of Covid19 has required urgent treatments for numerous patients. No suitable vaccines or antivirals are available for Covid19. The efficiency against Covid19 of WHO therapies of choice, that are two antivirals developed for other pathologies, is controversial. Therefore, alternative approaches are required. Intravenous (IV) Vitamin C (Vit-C) has emerged as one of the other alternatives for this purpose. Here we review the effects of IV Vit-C on the immune system response, the antiviral properties of IV Vit-C, and finally the antioxidant properties of IV Vit-C to specifically address the cytokines' storm characteristic of the Acute Respiratory Distress Syndrome (ARDS) that occur in the later cycle of the Covid19 infectious disease.
Also flagged:waterpolymerasemineraloxygencarbon dioxidePolydimethylsiloxan
Journal Article2020-04-21No SnippetsSchulz M, Probst S, Calabrese S, R Homann A, Borst N, Weiss M, von Stetten F, Zengerle R, Paust N.
Show Full Abstract
We present a versatile tool for the generation of monodisperse water-in-fluorinated-oil droplets in standard reaction tubes by centrifugal step emulsification. The microfluidic cartridge is designed as an insert into a standard 2 mL reaction tube and can be processed in standard laboratory centrifuges. It allows for droplet generation and subsequent transfer for any downstream analysis or further use, does not need any specialized device, and manufacturing is simple because it consists of two parts only: A structured substrate and a sealing foil. The design of the structured substrate is compatible to injection molding to allow manufacturing at large scale. Droplets are generated in fluorinated oil and collected in the reaction tube for subsequent analysis. For sample sizes up to 100 µL with a viscosity range of 1 mPa·s-4 mPa·s, we demonstrate stable droplet generation and transfer of more than 6 × 10<sup>5</sup> monodisperse droplets (droplet diameter 66 µm ± 3 µm, CV ≤ 4%) in less than 10 min. With two application examples, a digital droplet polymerase chain reaction (ddPCR) and digital droplet loop mediated isothermal amplification (ddLAMP), we demonstrate the compatibility of the droplet production for two main amplification techniques. Both applications show a high degree of linearity (ddPCR: R<sup>2</sup> ≥ 0.994; ddLAMP: R<sup>2</sup> ≥ 0.998), which demonstrates that the cartridge and the droplet generation method do not compromise assay performance.
Also flagged:Immune ResponseInsulindiabetic fetopathygestational diabetes mellitustype 2 diabetes mellitusmaternal diabetes
Journal Article2020-04-21✓ 2 SnippetsKopylov AT, Kaysheva AL, Papysheva O, Gribova I, Kotaysch G, Kharitonova L, Mayatskaya T, Krasheninnikova A, Morozov SG.
In-Text Gene Mentions
Discussion)
…Previously, proteome-scaled profiling of serum in pregnant women with GDM revealed several promising biomarkers including AFM, VTN, APCS, SERPINC1, etc. However, after validation by SRM mass spectrometry, only VTN has been confirmed as most contributing to the maternal risk factor of GDM development [32].…
Discussion)
…AFM, VTN, APCS,SERPINC1, etc.…
Show Full Abstract
<h4>Background</h4>The purpose of the study is to establish and quantitatively assess protein markers and their combination in association with insulin uptake that may be have value for early prospective recognition of diabetic fetopathy (DF) as a complication in patients with diabetes mellitus during gestation.<h4>Methods</h4>Proteomic surveying and accurate quantitative measurement of selected proteins from plasma samples collected from the patients with gestational diabetes mellitus (GDM) and type 2 diabetes mellitus (T2DM) who gave birth of either healthy or affected by maternal diabetes newborns was performed using mass spectrometry.<h4>Results</h4>We determined and quantitatively measured several proteins, including CRP, CEACAM1, CNDP1 and Ig-family that were significantly differed in patients that gave birth of newborns with signs of DF. We found that patients with newborns associated with DF are characterized by significantly decreased CEACAM1 (113.18 ± 16.23 ng/mL and 81.09 ± 10.54 ng/mL in GDM and T2DM, <i>p</i> < 0.005) in contrast to control group (515.6 ± 72.14 ng/mL, <i>p</i> < 0.005). On the contrary, the concentration of CNDP1 was increased in DF-associated groups and attained 49.3 ± 5.18 ng/mL and 37.7 ± 3.34 ng/mL (<i>p</i> < 0.005) in GDM and T2DM groups, respectively. Among other proteins, dramatically decreased concentration of IgG4 and IgA2 subclasses of immunoglobulins were noticed.<h4>Conclusion</h4>The combination of the measured markers may assist (AUC = 0.893 (CI 95%, 0.785-0.980) in establishing the clinical finding of the developing DF especially in patients with GDM who are at the highest risk of chronic insulin resistance.
Also flagged:Degradationprotein degradationubiquitin ligaseE3proteolysisinhibitor of apoptosis protein
Journal Article2020-04-21✓ 1 SnippetIshikawa M, Tomoshige S, Demizu Y, Naito M.
In-Text Gene Mentions
S I O 001029)
…Mechanistic analysis revealed that (i) 20 did not decrease HTT mRNA, (ii) an artificial complex between cIAP1 and aggregates was detected by means of ELISA, (iii) a negative control compound (an analog in which the hydroxy group and amino group on bestatin were replaced with hydrogen atoms, and which does not bind to cIAP1) did not reduce mHtt level, and iv) proteasomal degradation of mHtt was confirmed by co-treatment with a proteasome inhibitor MG132.…
Show Full Abstract
New therapeutic modalities are needed to address the problem of pathological but undruggable proteins. One possible approach is the induction of protein degradation by chimeric drugs composed of a ubiquitin ligase (E3) ligand coupled to a ligand for the target protein. This article reviews chimeric drugs that decrease the level of specific proteins such as proteolysis targeting chimeric molecules (PROTACs) and specific and nongenetic inhibitor of apoptosis protein (IAP)-dependent protein erasers (SNIPERs), which target proteins for proteasome-mediated degradation. We cover strategies for increasing the degradation activity induced by small molecules, and their scope for application to undruggable proteins.
Journal Article2020-04-21No SnippetsLeu SJ, Lee YC, Lee CH, Liao PY, Chiang CW, Yang CM, Su CH, Ou TY, Liu KJ, Lo HJ, Tsai BY, Yang YY.
Show Full Abstract
<i>Candida albicans</i> (<i>C. albicans</i>) is an opportunistic human pathogen responsible for approximately a half of clinical candidemia. The emerging <i>Candida</i> spp. with resistance to azoles is a major challenge in clinic, suggesting an urgent demand for new drugs and therapeutic strategies. Alpha-enolase (Eno1) is a multifunctional protein and represents an important marker for invasive candidiasis. Thus, <i>C. albicans</i> Eno1 (CaEno1) is believed to be an important target for the development of therapeutic agents and antibody drugs. Recombinant CaEno1 (rCaEno1) was first used to immunize chickens. Subsequently, we used phage display technology to construct two single chain variable fragment (scFv) antibody libraries. A novel biopanning procedure was carried out to screen anti-rCaEno1 scFv antibodies, whose specificities were further characterized. The polyclonal IgY antibodies showed binding to rCaEno1 and native CaEno1. A dominant scFv (CaS1) and its properties were further characterized. CaS1 attenuated the growth of <i>C. albicans</i> and inhibited the binding of CaEno1 to plasminogen. Animal studies showed that CaS1 prolonged the survival rate of mice and zebrafish with candidiasis. The fungal burden in kidney and spleen, as well as level of inflammatory cytokines were significantly reduced in CaS1-treated mice. These results suggest CaS1 has potential of being immunotherapeutic drug against <i>C. albicans</i> infections.
Also flagged:cationsmetabolismcell growthdeathdivalentHIV-1 infection
Journal Article2020-04-21✓ 1 SnippetKhan N, Chen X, Geiger JD.
In-Text Gene Mentions
S I O 001029)
…Nef-induced mis-trafficking of the HFE protein to perinuclear regions near the trans-Golgi network might lead to enhanced HIV-1 infection by increasing levels of intracellular iron.…
Show Full Abstract
Divalent cations are essential for life and are fundamentally important coordinators of cellular metabolism, cell growth, host-pathogen interactions, and cell death. Specifically, for human immunodeficiency virus type-1 (HIV-1), divalent cations are required for interactions between viral and host factors that govern HIV-1 replication and pathogenicity. Homeostatic regulation of divalent cations' levels and actions appear to change as HIV-1 infection progresses and as changes occur between HIV-1 and the host. In people living with HIV-1, dietary supplementation with divalent cations may increase HIV-1 replication, whereas cation chelation may suppress HIV-1 replication and decrease disease progression. Here, we review literature on the roles of zinc (Zn<sup>2+</sup>), iron (Fe<sup>2+</sup>), manganese (Mn<sup>2+</sup>), magnesium (Mg<sup>2+</sup>), selenium (Se<sup>2+</sup>), and copper (Cu<sup>2+</sup>) in HIV-1 replication and pathogenicity, as well as evidence that divalent cation levels and actions may be targeted therapeutically in people living with HIV-1.
Also flagged:walking pneumoniamycoplasmosispneumoniainfectionpolystyreneflorfenicol
Journal Article2020-04-21✓ 1 SnippetAbdelazeem WM, Zolnikov TR, Mohammed ZR, Saad A, Osman KM.
In-Text Gene Mentions
Discussion)
…For example, M. arginini can modulate inflammatory response and energy metabolism on the transcription level in B-lymphoid cells withHTT mutation( Krzysztoń-Russjan et al., 2016 ).…
Show Full Abstract
In the scientific literature, a small amount of information is found concerning mycoplasmosis in camel species. A variety of pathogens could be causative agents for pneumonia, but walking pneumonia is mostly caused by Mycoplasma with slow development and mild symptoms. The aim of this study was to identify mycoplasmas from camels (Camelus dromedarius) and extending the arsenal of factors implicated in pathogenicity of M. arginini to shed light on the current knowledge gap. 460 lung samples (pneumonic; n=210 and apparently healthy; n=250) were randomly collected from the one-humped camels (C. domedarius) that have been imported from Sudan and slaughtered at Cairo Slaughterhouse. 48 out of 210 isolates (22.9%) recovered from the pneumonic lungs were recorded as M. arginini. Positive PCR results were obtained for all 48 isolates. On the other hand, infection with the organism was not detected in the apparently healthy lungs. Hemolysis and hydrogen sulphide (H<sub>2</sub>S) production, a compound that has previously not been identified as a virulence factor in M. arginini, was evident in 100% of the isolates. The 48 M. arginini isolates were weak in their ability to form biofilm on polystyrene surfaces. All isolates were 100% susceptible to florfenicol and streptomycin and 100% resistant to ciprofloxacin. Resistance to lincomycin, spiromycin, tylosin, doxacyclin and erythromycin was observed at different frequencies. 13 different combinations of antibiotics representing one to four classes were evident with the Macrolide erythromycin being the most represented. It also should be noted that the ciprofloxacin, doxacyclin, lincomycin, erythromycin combination was the most noted in 21/48 isolates. Surprisingly, none of the virulence genes (vsp, uvrC and gapA) and quinolone resistance genes (parC and gyrA) were detected by PCR.
We investigated the effect of chronic (6 weeks) consumption of 10% alcohol on the principal elements of BDNF (BDNF, proBDNF, p75, and TrkB receptors) and 5-HT (5-HT, 5-HIAA, tryptophan hydroxylase-2 [Tph-2], 5-HT transporter [5-HTT], 5-HT<sub>1A</sub>, 5-HT<sub>2A</sub>, and 5-HT<sub>7</sub> receptors) systems in the brain of C57Bl/6 mice. BDNF mRNA level in the raphe nuclei area and BDNF protein level in the hippocampus were lowered in ethanol-treated mice. The increase in proBDNF protein level in the raphe nuclei area, cortex, and amygdala and the increase of p75 receptor protein levels in the raphe nuclei area were revealed after ethanol exposure. Alcohol intake reduced the protein level and increased the activity of Tph-2, the key enzyme for serotonin biosynthesis in the brain, and increased the main 5-HT metabolite 5-HIAA level and 5-HIAA/5-НТ ratio as well as the 5-HT<sub>7</sub> receptor mRNA level in the raphe nuclei area. In the cortex, 5-HT<sub>2A</sub> receptor protein level was reduced, and 5-HIAA/5-HT ratio was increased. These data showed considerable impact of alcoholization on the BDNF system, resulting in proBDNF and p75 receptor expression enhancement. Alcohol-induced changes in BDNF and 5-HT systems were revealed in the raphe nuclei area where the majority of the cell bodies of the 5-HT neurons are localized, as well as in the cortex, hippocampus, and amygdala. Our data suggest that the BDNF/5-HT interaction contributes to the mechanism underlying chronic alcohol-induced neurodegenerative disorders.
Also flagged:Nrf2Ferroptosisdeathglutathione(GSH) peroxidase 4GPX4
Journal Article2020-04-21No SnippetsSong X, Long D.
Show Full Abstract
Ferroptosis is a kind of regulated cell death (RCD) caused by the redox state disorder of intracellular microenvironment controlled by glutathione (GSH) peroxidase 4 (GPX4), which is inhibited by iron chelators and lipophilic antioxidants. In addition to classical regulatory mechanisms, new regulatory factors for ferroptosis have been discovered in recent years, such as the P53 pathway, the activating transcription factor (ATF)3/4 pathway, Beclin 1 (BECN1) pathway, and some non-coding RNA. Ferroptosis is closely related to cancer treatment, neurodegenerative diseases, ischemia-reperfusion of organ, neurotoxicity, and others, in particular, in the field of neurodegenerative diseases treatment has aroused people's interest. The nuclear factor E2 related factor 2 (Nrf2/NFE2L2) has been proved to play a key role in neurodegenerative disease treatment and ferroptosis regulation. Ferroptosis promotes the progression of neurodegenerative diseases, while the expression of Nrf2 and its target genes (Ho-1, Nqo-1, and Trx) has been declined with aging; therefore, there is still insufficient evidence for ferroptosis and Nrf2 regulatory networks in the field of neurodegenerative diseases. In this review, we will provide a brief overview of ferroptosis regulatory mechanisms, as well as an emphasis on the mechanism of Nrf2 regulating ferroptosis. We also highlight the role of ferroptosis and Nrf2 during the process of neurodegenerative diseases and investigate a theoretical basis for further research on the relationship between Nrf2 and ferroptosis in the process of neurodegenerative diseases treatment.
Also flagged:Amyotrophic lateral sclerosisALSneurodegenerative diseasedeathglutamatemitochondrial
Journal Article2020-04-21No SnippetsMcCombe PA, Lee JD, Woodruff TM, Henderson RD.
Show Full Abstract
Amyotrophic lateral sclerosis (ALS) is a severe neurodegenerative disease that is defined by loss of upper and lower motor neurons, associated with accumulation of protein aggregates in cells. There is also pathology in extra-motor areas of the brain, Possible causes of cell death include failure to deal with the aggregated proteins, glutamate toxicity and mitochondrial failure. ALS also involves abnormalities of metabolism and the immune system, including neuroinflammation in the brain and spinal cord. Strikingly, there are also abnormalities of the peripheral immune system, with alterations of T lymphocytes, monocytes, complement and cytokines in the peripheral blood of patients with ALS. The precise contribution of the peripheral immune system in ALS pathogenesis is an active area of research. Although some trials of immunomodulatory agents have been negative, there is strong preclinical evidence of benefit from immune modulation and further trials are currently underway. Here, we review the emerging evidence implicating peripheral immune alterations contributing to ALS, and their potential as future therapeutic targets for clinical intervention.
<i>Mycobacterium tuberculosis</i> (Mtb) infects alveolar macrophages (AMs), causing pulmonary tuberculosis (PTB), the most common form of the disease. Less frequently, Mtb is disseminated to many other organs and tissues, resulting in different extrapulmonary forms of TB. Nevertheless, very few studies have addressed the global mRNA response of human AMs, particularly from humans with the active form of the disease. Strikingly, almost no studies have addressed the response of human extrapulmonary macrophages to Mtb infection. In this pilot study, using microarray technology, we examined the transcriptomic <i>ex vivo</i> response of AMs from PTB patients (AMTBs) and AMs from control subjects (AMCTs) infected with two clinical isolates of Mtb. Furthermore, we also studied the infection response of human splenic macrophages (SMs) to Mtb isolates, as a model for extrapulmonary infection, and compared the transcriptomic response between AMs and SMs. Our results showed a striking difference in global mRNA profiles in response to infection between AMs and SMs, implicating a tissue-specific macrophage response to Mtb.
…Locus 1p31.1 (rs3101336, rs7550173, NEGR1; locus 1 in Table 1) was significantly associated with both MDD and depressive symptoms, educational attainment, and intelligence.…
Discussion)
…NEGR1 (neuronal growth regulator 1 gene), a well-known obesity-associated gene (Willer, 2009), is associated with white matter integrity (Dennis et al., 2014), and shows high expression in several brain tissues (highest median expression in frontal cortex, Supplementary Figure S1).…
Results)
…Locus 1p31.1 (rs3101336, rs7550173, and comprising NEGR1) was significantly associated with the maximal number of four phenotypes (educational attainment, intelligence, depressive symptoms, and MDD).…
Discussion)
…Recently, NEGR1 was also found to play a role in intracellular cholesterol trafficking (Joo et al., 2019).…
Discussion)
…Significantly, elevated levels of NEGR1 transcripts were found in the dorsolateral prefrontal cortex of patients with schizophrenia compared to healthy controls (Karis et al., 2018).…
Show Full Abstract
Anthropometric traits and mental disorders or traits are known to be associated clinically and to show genetic overlap. We aimed to identify genetic variants with relevance for mental disorders/traits and either (i) body mass index (or obesity), (ii) body composition, (and/or) (iii) body fat distribution. We performed a look-up analysis of 1,005 genome-wide significant SNPs for BMI, body composition, and body fat distribution in 15 mental disorders/traits. We identified 40 independent loci with one or more SNPs fulfilling our threshold significance criterion (<i>P</i> < 4.98 × 10<sup>-5</sup>) for the mental phenotypes. The majority of loci was associated with schizophrenia, educational attainment, and/or intelligence. Fewer associations were found for bipolar disorder, neuroticism, attention deficit/hyperactivity disorder, major depressive disorder, depressive symptoms, and well-being. Unique associations with measures of body fat distribution adjusted for BMI were identified at five loci only. To investigate the potential causality between body fat distribution and schizophrenia, we performed two-sample Mendelian randomization analyses. We found no causal effect of body fat distribution on schizophrenia and vice versa. In conclusion, we identified 40 loci which may contribute to genetic overlaps between mental disorders/traits and BMI and/or shape related phenotypes. The majority of loci identified for body composition overlapped with BMI loci, thus suggesting pleiotropic effects.
Also flagged:Sézary syndromecutaneous T-cell lymphomasCTCLmycosis fungoidespathogenesisJanus kinase
Journal Article2020-04-21✓ 1 SnippetMirza AS, Horna P, Teer JK, Song J, Akabari R, Hussaini M, Sokol L.
In-Text Gene Mentions
Results)
…PAPPA2, PCLO, PKHD1L1,UNC13C, VWA3B , and…
Show Full Abstract
Sézary syndrome (SS) is a genetically and clinically distinct entity among cutaneous T-cell lymphomas (CTCL). SS is characterized by more aggressive disease compared to the most common indolent type of CTCL, mycosis fungoides. However, there are limited available genomic data regarding SS. To characterize and expand current mappings of the genomic landscape of CTCL, whole exome sequencing (WES) was performed on peripheral blood samples from seven patients with SS. We detected 21,784 variants, of which 21,140 were novel and 644 were previously described. Filtering revealed 551 nonsynonymous variants among 525 mutated genes-25 recurrent mutations and 1 recurrent variant. Several recurrently mutated genes crucial to pathogenesis pathways, including Janus kinase (JAK)/signal transducers and activators of transcription (STAT), peroxisome proliferator-activated receptors (PPAR), PI3K-serine/threonine protein kinases (AKT), and fibroblast growth factor receptors (FGFR), were identified. Furthermore, genetic mutations spanned both known and novel genes, supporting the idea of a long-tail distribution of mutations in lymphoma. Acknowledging these genetic variants and their affected pathways may inspire future targeted therapies. WES of a limited number of SS patients revealed both novel findings and corroborated complexities of the "long-tail" distribution of previously reported mutations.
Also flagged:HuntingtinpolyglutamineHuntington's diseaseHDbindingpeptides
Journal Article2020-04-21✓ 5 SnippetsFeng M, Bell DR, Wang Z, Zhang W.
In-Text Gene Mentions
Abstract)
…There is a strong negative correlation between the polyglutamine (polyQ) domain length (Q-length) in the intrinsically disordered Huntingtin protein (Htt) exon-1 and the age of onset of Huntington's disease (HD).…
Introduction)
…Neurodegenerative Huntington's disease (HD) is caused by expansion of the trinucleotide CAG repeats in exon-1 of the HD gene, the mutation that encodes an extended polyglutamine (polyQ) tract within the N-terminal exon-1 of the Huntingtin protein (Htt) (Macdonald et al., 1993).…
Abstract)
…isordered Huntingtin protein (Htt) exon-1 and the…
Introduction)
…the Huntingtin protein (Htt) (Macdonald et al.,…
Introduction)
…throughout the entireHttexon-1 protein (Kang…
Show Full Abstract
There is a strong negative correlation between the polyglutamine (polyQ) domain length (Q-length) in the intrinsically disordered Huntingtin protein (Htt) exon-1 and the age of onset of Huntington's disease (HD). PolyQ of Q-length longer than 40 has the propensity of forming very compact aggregate structures, leading to HD at full penetrance. Recent advances in nanobiotechnology provided a new platform for the development of novel diagnosis and therapeutics. Here, we explore the possibility of utilizing 2D-nanomaterials to inhibit the formation of supercompact polyQ structures through the so-called "folding-upon-binding" where the protein structure is dependent on the binding substrate. Using molecular dynamics simulations, we characterize two polyQ peptides with Q-length of 22 (Q22, normal length) and 46 (Q46, typical length causing HD) binding to both graphene and molybdenum disulfide (MoS<sub>2</sub>) nanosheets, which have been applied as antibacterial or anticancer agents. Upon binding, Q22 unfolds and elongates on both grapheme and MoS<sub>2</sub> surfaces, regardless of its initial conformation, with graphene showing slightly stronger effect. In contrast, initially collapsed Q46 remains mostly collapsed within our simulation time on both nanosheets even though they do provide some "stretching" to Q46 as well. Further analyses indicate that the hydrophobic nature of graphene/MoS<sub>2</sub> promotes the stretching of polyQ on nanosheets. However, there is strong competition with the intra-polyQ interactions (mainly internal hydrogen bonds) leading to the disparate folding/binding behaviors of Q22 and Q46. Our results present distinct Q-length specific behavior of the polyQ domain upon binding to two types of 2D-nanomaterials which holds clinical relevance for Huntington's disease.
Also flagged:Hepatitis B Virus Infectiontenofovirimmune-globulinHBV infectionchronic diseasesHBeAg
Journal Article2020-04-21No SnippetsDu J, Wang Z, Wu B.
Show Full Abstract
<h4>Background</h4>Mother-to-child transmission (MTCT) cannot be completely prevented by the administration of active-passive immunoprophylaxis in pregnant women with hepatitis B virus (HBV) DNA levels <10<sup>6</sup> copies/mL. This study will assess the economic outcomes of expanding antiviral prophylaxis in pregnant women with HBV DNA levels <10<sup>6</sup> copies/mL.<h4>Methods</h4>A decision model was adopted to measure the economic outcomes of expanded antiviral prophylaxis at different cutoff values of HBV DNA in HBsAg(+) pregnant women in the context of the United States and China. The model inputs, including clinical, cost, and utility data, were extracted from published studies. Sensitivity analyses were carried out to examine the uncertainty of the model outputs. Quality-adjusted life-years (QALYs) and direct medical costs were expressed over a lifetime horizon.<h4>Results</h4>Compared with standard antiviral prophylaxis at HBV DNA ≥10<sup>6</sup> copies/mL, expanded antiviral prophylaxis improved the health outcomes, and the incremental cost of expanded antiviral prophylaxis varied from $2063 in pregnant women with HBV DNA ≥10<sup>5</sup> copies/mL to $14<sub> </sub>925 in all HBsAg(+) pregnant women per QALY gained in the United States, and from $1624 to $12<sub> </sub>348 in China. The model outcome was considerably influenced by the discount rate, key clinical parameters related to the incidence of MTCT, and efficacy of the prophylaxis strategy.<h4>Conclusions</h4>This study indicates that antiviral prophylaxis using tenofovir among pregnant women with HBV DNA <10<sup>6</sup> copies/mL may be a cost-effective option, and the cutoff value of the HBV DNA load for antiviral prophylaxis needs to be tailored.
Also flagged:pathogenesisgene expressiontranscriptional regulatorscancercell proliferationcancers
Journal Article2020-04-21✓ 2 SnippetsAhadi A.
In-Text Gene Mentions
Title)
…ZNFX1antisense RNA 1…
Title)
…finger NFX1-type containing 1(ZNFX1) and localized on…
Show Full Abstract
Long noncoding RNAs (lncRNAs) act as regulators of gene expression and pivotal transcriptional regulators in cancer cells via diverse mechanisms. lncRNAs involves a variety of pathological and biological activities, such as apoptosis, cell proliferation, metastasis, and invasion. By using microarray and RNA sequencing, it was identified that dysregulation of lncRNAs affects the tumorigenesis process. Taken together, these lncRNAs are putative biomarker and therapeutic target in human malignancies. In this review, I discuss the latest finding regarding the dysregulation of some important lncRNAs and their diverse mechanisms of these lncRNAs in the pathogenesis and progression of certain cancers; also, I summarize the possible roles of lncRNAs in clinical application for diagnosis and prognosis of cancer.
bioRxiv2020-04-21Preprint (No Snippets API)Lai HTT, Nguyen LH, Kranjc A, Nguyen TT, Nguyen-Manh D.
Show Full Abstract
The outbreak of the 2019-nCoV coronavirus causing severe acute respiratory syndrome which can be fatal, especially in elderly population, has been declared a pandemic by the World Health Organization. Many biotechnology laboratories are rushing to develop therapeutic antibodies and antiviral drugs for treatment of this viral disease. The viral CoV spike (S) glycoprotein is one of the main targets for pharmacological intervention. Its receptor-binding domain (RBD) interacts with the human ACE2 receptor ensuring the entry of the viral genomes into the host cell. In this work, we report on the differences in the binding of the RBD of the previous coronavirus SARS-CoV and of the newer 2019-nCoV coronavirus to the human ACE2 receptor using atomistic molecular dynamics techniques. Our results show major mutations in the 2019-nCoV RBD with respect to the SARS-CoV RBD occurring at the interface of RBD-ACE2 complex. These mutations make the 2019-nCoV RBD protein backbone much more flexible, hydrophobic interactions are reduced and additional polar/charged residues appear at the interface. We observe that higher flexibility of the 2019-nCoV RBD with respect to the SARS-CoV RBD leads to a bigger binding interface between the 2019-nCoV RBD and ACE2 and to about 20% more contacts between them in comparison with SARS-CoV. Taken together, the 2019-nCoV RBD shows more stable binding interface and higher binding affinity for the ACE2 receptor. The mutations not only stabilize the binding interface, they also lead to overall more stable 2019-nCoV RBD protein structure, even far from the binding interface. Our results on the molecular differences in the binding between the two viruses can provide important inputs for development of appropriate antiviral treatments of the new viruses, addressing the necessity of ongoing pandemics.
Journal Article2020-04-20✓ 2 SnippetsGoldwaser EL, Miller CWT.
In-Text Gene Mentions
Abstract)
…elation to the <i>5-HTT</i>LPR polymorphism…
Abstract)
…levance of the <i>5-HTT</i>LPR polymorphism…
Show Full Abstract
<h4>Objective</h4>New technologies incorporating genetics and neuroimaging into psychiatric care offer the possibility of illuminating associations among genetic alleles, neural functioning, and patients' response to various psychotherapeutic modalities. In this review, the authors survey the literature on the emerging field of genetic predictors of psychotherapy response, particularly in relation to the <i>5-HTT</i>LPR polymorphism and individual response to manualized psychotherapy.<h4>Methods</h4>The extant literature was reviewed, with PubMed serving as the primary database.<h4>Results</h4>Several polymorphisms have been linked with response or resistance to treatment. Given the number of studies assessing the relevance of the <i>5-HTT</i>LPR polymorphism to treatment response, this review focuses on this genetic variation.<h4>Conclusions</h4>Because individual genetic endowments may predict nonresponse to manualized treatment modalities, it may become possible to identify individuals who would benefit from insight-oriented, open-ended psychotherapy tailored to their individual distress tolerance levels, rather than from shorter manualized treatment.
Also flagged:sepsisironthalassemiaβ-globindextran-d-glucan
Journal Article2020-04-20✓ 1 SnippetVisitchanakun P, Saisorn W, Wongphoom J, Chatthanathon P, Somboonna N, Svasti S, Fucharoen S, Leelahavanichkul A.
In-Text Gene Mentions
Abstract)
…more severe secondaryhemochromatosisand gut leakage…
Show Full Abstract
Iron overload induces intestinal-permeability defect (gut leakage), and gut translocation of organismal molecules might enhance systemic inflammation and sepsis severity in patients with thalassemia (Thal). Hence, iron administration in Hbb<sup>th3/+</sup> mice, heterozygous β-globin-deficient Thal mice, was explored. Oral iron administration induced more severe secondary hemochromatosis and gut leakage in Thal mice compared with wild-type (WT) mice. Gut leakage was determined by <i>1</i>) FITC-dextran assay, <i>2</i>) spontaneous serum elevation of endotoxin (LPS) and (1→3)-β-d-glucan (BG), molecular structures of gut-organisms, and <i>3</i>) reduction of tight-junction molecules with increased enterocyte apoptosis (activated caspase-3) by immunofluorescent staining. Iron overload also enhanced serum cytokines and increased <i>Bacteroides</i> spp. (gram-negative bacteria) in feces as analyzed by microbiome analysis. LPS injection in iron-overloaded Thal mice produced higher mortality and prominent cytokine responses. Additionally, stimulation with LPS plus iron in macrophage from Thal mice induced higher cytokines production with lower β-globin gene expression compared with WT. Furthermore, possible gut leakage as determined by elevated LPS or BG (>60 pg/mL) in serum without systemic infection was demonstrated in 18 out of 41 patients with β-thalassemia major. Finally, enhanced LPS-induced cytokine responses of mononuclear cells from these patients compared with cells from healthy volunteers were demonstrated. In conclusion, oral iron administration in Thal mice induced more severe gut leakage and increased fecal gram-negative bacteria, resulting in higher levels of endotoxemia and serum inflammatory cytokines compared with WT. Preexisting hyperinflammatory cytokines in iron-overloaded Thal enhanced susceptibility toward infection.<b>NEW & NOTEWORTHY</b> Although the impact of iron accumulation in several organs of patients with thalassemia is well known, the adverse effect of iron accumulation in gut is not frequently mentioned. Here, we demonstrated iron-induced gut-permeability defect, impact of organismal molecules from gut translocation of, and macrophage functional defect upon the increased sepsis susceptibility in thalassemia mice.
Also flagged:measlesmumpsrubellavaricellachickenpoxdeath
Journal Article2020-04-20No SnippetsDi Pietrantonj C, Rivetti A, Marchione P, Debalini MG, Demicheli V.
Show Full Abstract
<h4>Background</h4>Measles, mumps, rubella, and varicella (chickenpox) are serious diseases that can lead to serious complications, disability, and death. However, public debate over the safety of the trivalent MMR vaccine and the resultant drop in vaccination coverage in several countries persists, despite its almost universal use and accepted effectiveness. This is an update of a review published in 2005 and updated in 2012.<h4>Objectives</h4>To assess the effectiveness, safety, and long- and short-term adverse effects associated with the trivalent vaccine, containing measles, rubella, mumps strains (MMR), or concurrent administration of MMR vaccine and varicella vaccine (MMR+V), or tetravalent vaccine containing measles, rubella, mumps, and varicella strains (MMRV), given to children aged up to 15 years.<h4>Search methods</h4>We searched the Cochrane Central Register of Controlled Trials (CENTRAL) (the Cochrane Library 2019, Issue 5), which includes the Cochrane Acute Respiratory Infections Group's Specialised Register, MEDLINE (1966 to 2 May 2019), Embase (1974 to 2 May 2019), the WHO International Clinical Trials Registry Platform (2 May 2019), and ClinicalTrials.gov (2 May 2019).<h4>Selection criteria</h4>We included randomised controlled trials (RCTs), controlled clinical trials (CCTs), prospective and retrospective cohort studies (PCS/RCS), case-control studies (CCS), interrupted time-series (ITS) studies, case cross-over (CCO) studies, case-only ecological method (COEM) studies, self-controlled case series (SCCS) studies, person-time cohort (PTC) studies, and case-coverage design/screening methods (CCD/SM) studies, assessing any combined MMR or MMRV / MMR+V vaccine given in any dose, preparation or time schedule compared with no intervention or placebo, on healthy children up to 15 years of age.<h4>Data collection and analysis</h4>Two review authors independently extracted data and assessed the methodological quality of the included studies. We grouped studies for quantitative analysis according to study design, vaccine type (MMR, MMRV, MMR+V), virus strain, and study settings. Outcomes of interest were cases of measles, mumps, rubella, and varicella, and harms. Certainty of evidence of was rated using GRADE.<h4>Main results</h4>We included 138 studies (23,480,668 participants). Fifty-one studies (10,248,159 children) assessed vaccine effectiveness and 87 studies (13,232,509 children) assessed the association between vaccines and a variety of harms. We included 74 new studies to this 2019 version of the review. Effectiveness Vaccine effectiveness in preventing measles was 95% after one dose (relative risk (RR) 0.05, 95% CI 0.02 to 0.13; 7 cohort studies; 12,039 children; moderate certainty evidence) and 96% after two doses (RR 0.04, 95% CI 0.01 to 0.28; 5 cohort studies; 21,604 children; moderate certainty evidence). The effectiveness in preventing cases among household contacts or preventing transmission to others the children were in contact with after one dose was 81% (RR 0.19, 95% CI 0.04 to 0.89; 3 cohort studies; 151 children; low certainty evidence), after two doses 85% (RR 0.15, 95% CI 0.03 to 0.75; 3 cohort studies; 378 children; low certainty evidence), and after three doses was 96% (RR 0.04, 95% CI 0.01 to 0.23; 2 cohort studies; 151 children; low certainty evidence). The effectiveness (at least one dose) in preventing measles after exposure (post-exposure prophylaxis) was 74% (RR 0.26, 95% CI 0.14 to 0.50; 2 cohort studies; 283 children; low certainty evidence). The effectiveness of Jeryl Lynn containing MMR vaccine in preventing mumps was 72% after one dose (RR 0.24, 95% CI 0.08 to 0.76; 6 cohort studies; 9915 children; moderate certainty evidence), 86% after two doses (RR 0.12, 95% CI 0.04 to 0.35; 5 cohort studies; 7792 children; moderate certainty evidence). Effectiveness in preventing cases among household contacts was 74% (RR 0.26, 95% CI 0.13 to 0.49; 3 cohort studies; 1036 children; moderate certainty evidence). Vaccine effectiveness against rubella is 89% (RR 0.11, 95% CI 0.03 to 0.42; 1 cohort study; 1621 children; moderate certainty evidence). Vaccine effectiveness against varicella (any severity) after two doses in children aged 11 to 22 months is 95% in a 10 years follow-up (rate ratio (rr) 0.05, 95% CI 0.03 to 0.08; 1 RCT; 2279 children; high certainty evidence). Safety There is evidence supporting an association between aseptic meningitis and MMR vaccines containing Urabe and Leningrad-Zagreb mumps strains, but no evidence supporting this association for MMR vaccines containing Jeryl Lynn mumps strains (rr 1.30, 95% CI 0.66 to 2.56; low certainty evidence). The analyses provide evidence supporting an association between MMR/MMR+V/MMRV vaccines (Jeryl Lynn strain) and febrile seizures. Febrile seizures normally occur in 2% to 4% of healthy children at least once before the age of 5. The attributable risk febrile seizures vaccine-induced is estimated to be from 1 per 1700 to 1 per 1150 administered doses. The analyses provide evidence supporting an association between MMR vaccination and idiopathic thrombocytopaenic purpura (ITP). However, the risk of ITP after vaccination is smaller than after natural infection with these viruses. Natural infection of ITP occur in 5 cases per 100,000 (1 case per 20,000) per year. The attributable risk is estimated about 1 case of ITP per 40,000 administered MMR doses. There is no evidence of an association between MMR immunisation and encephalitis or encephalopathy (rate ratio 0.90, 95% CI 0.50 to 1.61; 2 observational studies; 1,071,088 children; low certainty evidence), and autistic spectrum disorders (rate ratio 0.93, 95% CI 0.85 to 1.01; 2 observational studies; 1,194,764 children; moderate certainty). There is insufficient evidence to determine the association between MMR immunisation and inflammatory bowel disease (odds ratio 1.42, 95% CI 0.93 to 2.16; 3 observational studies; 409 cases and 1416 controls; moderate certainty evidence). Additionally, there is no evidence supporting an association between MMR immunisation and cognitive delay, type 1 diabetes, asthma, dermatitis/eczema, hay fever, leukaemia, multiple sclerosis, gait disturbance, and bacterial or viral infections.<h4>Authors' conclusions</h4>Existing evidence on the safety and effectiveness of MMR/MMRV vaccines support their use for mass immunisation. Campaigns aimed at global eradication should assess epidemiological and socioeconomic situations of the countries as well as the capacity to achieve high vaccination coverage. More evidence is needed to assess whether the protective effect of MMR/MMRV could wane with time since immunisation.
Also flagged:liver hepatocellular carcinomacancerLIHCpathogenesisliver cancertumor
Journal Article2020-04-20✓ 5 SnippetsBai KH, He SY, Shu LL, Wang WD, Lin SY, Zhang QY, Li L, Cheng L, Dai YJ.
In-Text Gene Mentions
Discussion)
…In addition, we found that genes ECM1, HAND2, PTGIS, SFRP1, SRPX, COLEC10, and GPR182 were significantly under‐expressed in LIHC in the Oncomine database, with the exception of DCN. Extracellular matrix protein 1 (ECM1) is expressed in the extracellular matrix of the liver, and knockout of ECM1 has been shown to lead to spontaneous and severe liver fibrosis in mice.24, 25…
Discussion)
…Expression of PTGIS has been shown to be decreased in the liver of mice with hepatic fibrosis compared to wild mice.26, 27…
Abstract)
…, HAND2 ,PTGIS, SFRP1 ,…
Discussion)
…PTGIS, member of…
Discussion)
…Expression ofPTGIShas been shown…
Show Full Abstract
Cancer stem cells (CSCs) are characterized by self-renewal and -differential potential as compared to common cancer cells and play an important role in the development and therapeutic resistance of liver hepatocellular carcinoma (LIHC). However, the specific pathogenesis of LIHC stem cells is still unclear, and the genes involved in the stemness of LIHC stem cells are currently unknown. In this study, we investigated novel biomarkers associated with LIHC and explored the expression characteristics of stem cell-related genes in LIHC. We found that mRNA expression-based stemness index (mRNAsi) was significantly overexpressed in liver cancer tissues. Further, mRNAsi expression in LIHC increased with the tumor pathological grade, with grade 4 tumors harboring the greatest stem cell features. Upon establishing mRNAsi scores based on mRNA expression of every gene, we found an association with poor overall survival in LIHC. Moreover, modules of interest were determined based on weighted gene co-expression network analysis (WGCNA) inclusion criteria, and three significant modules (red, green, and brown) and 21 key genes (DCN, ECM1, HAND2, PTGIS, SFRP1, SRPX, COLEC10, GRP182, ADAMTS7, CD200, CDH11, COL8A1, FAP, LZTS1, MAP1B, NAV1, NOTCH3, OLFML2A, PRR16, TMEM119, and VCAN) were identified. Functional analysis of these 21 genes demonstrated their enrichment in pathways involved in angiogenesis, negative regulation of DNA-binding transcription factor activity, apoptosis, and autophagy. Causal relationship with proteins indicated that the Wnt, Notch, and Hypoxia pathways are closely related to LIHC tumorigenesis. To our knowledge, this is the first report of a novel CSC biomarker, mRNAsi, to predict the prognosis of LIHC. Further, we identified 21 key genes through mRNA expression network analysis, which could be potential therapeutic targets to inhibit the stemness of cancer cells in LIHC.
Also flagged:RALY heterogeneous nuclear ribonucleoproteinRALYleucine rich repeat containing G protein-coupled receptor 4LGR4solute carrier family 23 member 2SLC23A2
Journal Article2020-04-20✓ 5 SnippetsHuang X, Otecko NO, Peng M, Weng Z, Li W, Chen J, Zhong M, Zhong F, Jin S, Geng Z, Luo W, He D, Ma C, Han J, Ommeh SC, Zhang Y, Zhang X, Du B.
In-Text Gene Mentions
Discussion)
…We detected two members of the solute carrier family (SLC), SLC23A2 and SLC2A14. SLC23A2 is a major mediator of the transport of ascorbic acid, an indispensable metabolite that is fundamental for survival [42].…
Abstract)
…member 14 (SLC2A14), besides the…
Results)
…SLC23A2 ), andSLC2A14.…
Results)
…with SLC23A2 andSLC2A14, which play…
Discussion)
…its related homologue,SLC2A14.…
Show Full Abstract
<h4>Background</h4>Yellow-feathered chickens (YFCs) have a long history in China. They are well-known for the nutritional and commercial importance attributable to their yellow color phenotype. Currently, there is a huge paucity in knowledge of the genetic determinants responsible for phenotypic and biochemical properties of these iconic chickens. This study aimed to uncover the genetic structure and the molecular underpinnings of the YFCs trademark coloration.<h4>Results</h4>The whole-genomes of 100 YFCs from 10 major traditional breeds and 10 Huaibei partridge chickens from China were re-sequenced. Comparative population genomics based on autosomal single nucleotide polymorphisms (SNPs) revealed three geographically based clusters among the YFCs. Compared to other Chinese indigenous chicken genomes incorporated from previous studies, a closer genetic proximity within YFC breeds than between YFC breeds and other chicken populations is evident. Through genome-wide scans for selective sweeps, we identified RALY heterogeneous nuclear ribonucleoprotein (RALY), leucine rich repeat containing G protein-coupled receptor 4 (LGR4), solute carrier family 23 member 2 (SLC23A2), and solute carrier family 2 member 14 (SLC2A14), besides the classical beta-carotene dioxygenase 2 (BCDO2), as major candidates pigment determining genes in the YFCs.<h4>Conclusion</h4>We provide the first comprehensive genomic data of the YFCs. Our analyses show phylogeographical patterns among the YFCs and potential candidate genes giving rise to the yellow color trait of the YFCs. This study lays the foundation for further research on the genome-phenotype cross-talks that define important poultry traits and for formulating genetic breeding and conservation strategies for the YFCs.
Also flagged:Drp1mitochondrialmetabolismClec16adynamin-related protein 1mitophagy
Journal Article2020-04-20No SnippetsDuan C, Kuang L, Xiang X, Zhang J, Zhu Y, Wu Y, Yan Q, Liu L, Li T.
Show Full Abstract
The adaptation of mitochondrial homeostasis to ischemic injury is not fully understood. Here, we studied the role of dynamin-related protein 1 (Drp1) in this process. We found that mitochondrial morphology was altered in the early stage of ischemic injury while mitochondrial dysfunction occurred in the late stage of ischemia. Drp1 appeared to inhibit mitophagy by upregulating mito-Clec16a, which suppressed mito-Parkin recruitment and subsequently impaired the formation of autophagosomes in vascular tissues after ischemic injury. Moreover, ischemia-induced Drp1 activation enhanced apoptosis through inducing mitochondrial translocation of BAX and thereby increasing release of Cytochrome C to activate caspase-3/-9 signalling. Furthermore, Drp1 mediated metabolic disorders and inhibited the levels of mitochondrial glutathione to impair free radical scavenging, leading to further increases in ROS and the exacerbation of mitochondrial dysfunction after ischemic injury. Together, our data suggest a critical role for Drp1 in ischemic injury.
Also flagged:castration-resistant prostate cancerCRPCneuroendocrine diseasetumorenzalutamideCDX
Journal Article2020-04-20✓ 1 SnippetFaugeroux V, Pailler E, Oulhen M, Deas O, Brulle-Soumare L, Hervieu C, Marty V, Alexandrova K, Andree KC, Stoecklein NH, Tramalloni D, Cairo S, NgoCamus M, Nicotra C, Terstappen LWMM, Manaresi N, Lapierre V, Fizazi K, Scoazec JY, Loriot Y, Judde JG, Farace F.
In-Text Gene Mentions
Results)
…Y-box 2) ,POU3F2(POU class 3…
Show Full Abstract
Transformation of castration-resistant prostate cancer (CRPC) into an aggressive neuroendocrine disease (CRPC-NE) represents a major clinical challenge and experimental models are lacking. A CTC-derived eXplant (CDX) and a CDX-derived cell line are established using circulating tumor cells (CTCs) obtained by diagnostic leukapheresis from a CRPC patient resistant to enzalutamide. The CDX and the derived-cell line conserve 16% of primary tumor (PT) and 56% of CTC mutations, as well as 83% of PT copy-number aberrations including clonal TMPRSS2-ERG fusion and NKX3.1 loss. Both harbor an androgen receptor-null neuroendocrine phenotype, TP53, PTEN and RB1 loss. While PTEN and RB1 loss are acquired in CTCs, evolutionary analysis suggest that a PT subclone harboring TP53 loss is the driver of the metastatic event leading to the CDX. This CDX model provides insights on the sequential acquisition of key drivers of neuroendocrine transdifferentiation and offers a unique tool for effective drug screening in CRPC-NE management.
Journal Article2020-04-20No SnippetsPerry JM, Tao F, Roy A, Lin T, He XC, Chen S, Lu X, Nemechek J, Ruan L, Yu X, Dukes D, Moran A, Pace J, Schroeder K, Zhao M, Venkatraman A, Qian P, Li Z, Hembree M, Paulson A, He Z, Xu D, Tran TH, Deshmukh P, Nguyen CT, Kasi RM, Ryan R, Broward M, Ding S, Guest E, August K, Gamis AS, Godwin A, Sittampalam GS, Weir SJ, Li L.
Show Full Abstract
Leukaemia stem cells (LSCs) underlie cancer therapy resistance but targeting these cells remains difficult. The Wnt-β-catenin and PI3K-Akt pathways cooperate to promote tumorigenesis and resistance to therapy. In a mouse model in which both pathways are activated in stem and progenitor cells, LSCs expanded under chemotherapy-induced stress. Since Akt can activate β-catenin, inhibiting this interaction might target therapy-resistant LSCs. High-throughput screening identified doxorubicin (DXR) as an inhibitor of the Akt-β-catenin interaction at low doses. Here we repurposed DXR as a targeted inhibitor rather than a broadly cytotoxic chemotherapy. Targeted DXR reduced Akt-activated β-catenin levels in chemoresistant LSCs and reduced LSC tumorigenic activity. Mechanistically, β-catenin binds multiple immune-checkpoint gene loci, and targeted DXR treatment inhibited expression of multiple immune checkpoints specifically in LSCs, including PD-L1, TIM3 and CD24. Overall, LSCs exhibit distinct properties of immune resistance that are reduced by inhibiting Akt-activated β-catenin. These findings suggest a strategy for overcoming cancer therapy resistance and immune escape.
Also flagged:Prostaglandin EP2 receptorNotchDuchenne muscular dystrophyγ-secretasebutylester
Journal Article2020-04-20No SnippetsSakai-Takemura F, Nogami K, Elhussieny A, Kawabata K, Maruyama Y, Hashimoto N, Takeda S, Miyagoe-Suzuki Y.
Show Full Abstract
Understanding the signaling pathways that regulate proliferation and differentiation of muscle progenitors is essential for successful cell transplantation for treatment of Duchenne muscular dystrophy. Here, we report that a γ-secretase inhibitor, DAPT (N-[N-(3,5-difluorophenacetyl-L-alanyl)]-S-phenylglycine tertial butyl ester), which inhibits the release of NICD (Notch intercellular domain), promotes the fusion of human muscle progenitors in vitro and improves their engraftment in the tibialis anterior muscle of immune-deficient mice. Gene expression analysis revealed that DAPT severely down-regulates PTGER2, which encodes prostaglandin (PG) E2 receptor 2 (EP2), in human muscle progenitors in the differentiation condition. Functional analysis suggested that Notch signaling inhibits differentiation and promotes self-renewal of human muscle progenitors via PGE2/EP2 signaling in a cAMP/PKA-independent manner.
Also flagged:phosphorusalkaline phosphatasewaterporeseed germinationnitrate
Journal Article2020-04-20No SnippetsXomphoutheb T, Jiao S, Guo X, Mabagala FS, Sui B, Wang H, Zhao L, Zhao X.
Show Full Abstract
An appropriate tillage method must be implemented by maize growers to improve phosphorus dynamics in the soil in order to increase phosphorus uptake by plant. The objective of this study was to investigate the effects of tillage systems on phosphorus and its fractions in rhizosphere and non-rhizosphere soils under maize. An experimental field was established, with phosphate fertilizers applied to four treatment plots: continuous rotary tillage (CR), continuous no-tillage (CN), plowing-rotary tillage (PR), and plowing-no tillage (PN). Under the different tillage methods, the available P was increased in the non-rhizosphere region. However, the concentration of available P was reduced in the rhizosphere soil region. The soil available P decreased with the age of the crop until the maize reached physiological maturity. The non-rhizosphere region had 132.9%, 82.5%, 259.8%, and 148.4% more available P than the rhizosphere region under the CR, PR, CN, and PN treatments, respectively. The continuous no-tillage method (CN) improved the uptake of soil phosphate by maize. The concentrations of Ca<sub>2</sub>-P, Ca<sub>8</sub>-P, Fe-P, Al-P and O-P at the maturity stage were significantly lower than other seedling stages. However, there was no significant relationship between total P and the P fractions. Therefore, a continuous no-tillage method (CN) can be used by farmers to improve phosphorus availability for spring maize. Soil management practices minimizing soil disturbance can be used to impove phosphorus availability for maize roots, increase alkaline phosphatase activity in the rhizosphere soil and increase the abundance of different phosphorus fractions.
Journal Article2020-04-20✓ 2 SnippetsLi M, Nopparat J, Aguilar BJ, Chen YH, Zhang J, Du J, Ai X, Luo Y, Jiang Y, Boykin C, Lu Q.
In-Text Gene Mentions
Text
…Carbonic anhydrase-related protein 10…
Text
…CA10…
Show Full Abstract
Only a small number of genes are bona fide oncogenes and tumor suppressors such as Ras, Myc, β-catenin, p53, and APC. However, targeting these cancer drivers frequently fail to demonstrate sustained cancer remission. Tumor heterogeneity and evolution contribute to cancer resistance and pose challenges for cancer therapy due to differential genomic rearrangement and expression driving distinct tumor responses to treatments. Here we report that intratumor heterogeneity of Wnt/β-catenin modulator δ-catenin controls individual cell behavior to promote cancer. The differential intratumor subcellular localization of δ-catenin mirrors its compartmentalization in prostate cancer xenograft cultures as result of mutation-rendered δ-catenin truncations. Wild-type and δ-catenin mutants displayed distinct protein interactomes that highlight rewiring of signal networks. Localization specific δ-catenin mutants influenced p120<sup>ctn</sup>-dependent Rho GTPase phosphorylation and shifted cells towards differential bFGF-responsive growth and motility, a known signal to bypass androgen receptor dependence. Mutant δ-catenin promoted Myc-induced prostate tumorigenesis while increasing bFGF-p38 MAP kinase signaling, β-catenin-HIF-1α expression, and the nuclear size. Therefore, intratumor δ-catenin heterogeneity originated from genetic remodeling promotes prostate cancer expansion towards androgen independent signaling, supporting a neomorphism model paradigm for targeting tumor progression.
Also flagged:mineralosteoporosisAGPAT4C1QL1HipTADA2A
Journal Article2020-04-20✓ 1 SnippetZhang H, Liu L, Ni JJ, Wei XT, Feng GJ, Yang XL, Xu Q, Zhang ZJ, Hai R, Tian Q, Shen H, Deng HW, Pei YF, Zhang L.
In-Text Gene Mentions
Text
…PLCL1…
Show Full Abstract
Aiming to identify pleiotropic genomic loci for bone mineral density and bone size, we performed a bivariate GWAS in five discovery samples and replicated in two large-scale samples. We identified 2 novel loci at 2q37.1 and 6q26. Our findings provide insight into common genetic architecture underlying both traits.<h4>Introduction</h4>Bone mineral density (BMD) and bone size (BS) are two important factors that contribute to the development of osteoporosis and osteoporotic fracture. Both BMD and BS are highly heritable and they are genetically correlated. In this study, we aim to identify pleiotropic loci associated with BMD and BS.<h4>Methods</h4>We conducted a bivariate genome-wide association (GWA) analysis of hip BMD and hip BS in 6180 participants from 5 samples, followed by in silico replication in the UK Biobank study of BMD (N = 426,824) and the deCODE study of BS (N = 28,954), respectively.<h4>Results</h4>SNPs from 2 genomic loci were significant at the genome-wide significance (GWS) level (p lt; 5 × 10<sup>-8</sup>) in the discovery samples and were successfully replicated in the replication samples (2q37.1, lead SNP rs7575512, discovery p = 1.49 × 10<sup>-10</sup>, replication p = 0.05; 6q26, lead SNP rs1040724, discovery p = 1.95 × 10<sup>-8</sup>, replication p = 0.03). Functional annotations suggested functional relevance of the identified variants to bone development.<h4>Conclusion</h4>Our findings provide insight into the common genetic architecture underlying BMD and BS, and enhance our understanding of the potential mechanism of osteoporosis fracture.
Also flagged:Ironnovel coronavirus pneumoniaCOVID-19infectionsviral infectiondeferiprone
Journal Article2020-04-20✓ 2 SnippetsLiu W, Zhang S, Nekhai S, Liu S.
In-Text Gene Mentions
Introduction)
…dramatically in ahemochromatosispatient who underwent…
Introduction)
…iron regulator protein (HFE), a competitor of…
Show Full Abstract
<h4>Purpose of the review</h4>The ongoing outbreak of novel coronavirus pneumonia (COVID-19) caused by the 2019 novel coronavirus (SARS-CoV-2) in China is lifting widespread concerns. Thus, therapeutic options are urgently needed, and will be discussed in this review.<h4>Recent findings</h4>Iron-containing enzymes are required for viruses most likely including coronaviruses (CoVs) to complete their replication process. Moreover, poor prognosis occurred in the conditions of iron overload for patients upon infections of viruses. Thus, limiting iron represents a promising adjuvant strategy in treating viral infection through oral uptake or venous injection of iron chelators, or through the manipulation of the key iron regulators. For example, treatment with iron chelator deferiprone has been shown to prolong the survival of acquired immunodeficiency syndrome (AIDS) patients. Increasing intracellular iron efflux via increasing iron exporter ferroportin expression also exhibits antiviral effect on human immunodeficiency virus (HIV). The implications of other metals besides iron are also briefly discussed.<h4>Summary</h4>For even though we know little about iron regulation in COVID-19 patients thus far, it could be deduced from other viral infections that iron chelation might be an alternative beneficial adjuvant in treating COVID-19.
Dopamine (DA) signaling is critical to the modulation of multiple brain functions including locomotion, reinforcement, attention and cognition. The literature provides strong evidence that altered DA availability and actions can impact normal neurodevelopment, with both early and enduring consequences on anatomy, physiology and behavior. An appreciation for the developmental contributions of DA signaling to brain development is needed to guide efforts to preclude and remedy neurobehavioral disorders, such as attention-deficit/hyperactivity disorder, addiction, bipolar disorder, schizophrenia and autism spectrum disorder, each of which exhibits links to DA via genetic, cellular and/or pharmacological findings. In this review, we highlight research pursued in preclinical models that use genetic and pharmacological approaches to manipulate DA signaling at sensitive developmental stages, leading to changes at molecular, circuit and/or behavioral levels. We discuss how these alterations can be aligned with traits displayed by neuropsychiatric diseases. Lastly, we review human studies that evaluate contributions of developmental perturbations of DA systems to increased risk for neuropsychiatric disorders.
Also flagged:Gold Nanoparticlespyrophosphateethylene glycolglutathionemagnesium1-naphthalenethiol
Journal Article2020-04-20No SnippetsTeixeira A, Paris JL, Roumani F, Diéguez L, Prado M, Espiña B, Abalde-Cela S, Garrido-Maestu A, Rodriguez-Lorenzo L.
Show Full Abstract
We developed a droplet-based optofluidic system for the detection of foodborne pathogens. Specifically, the loop-mediated isothermal amplification (LAMP) technique was combined with surface-enhanced Raman scattering (SERS), which offers an excellent method for DNA ultradetection. However, the direct SERS detection of DNA compromises the simplicity of data interpretation due to the variability of its SERS fingerprints. Therefore, we designed an indirect SERS detection method using multifunctional gold nanoparticles (AuNPs) based on the formation of pyrophosphate generated during the DNA amplification by LAMP. Towards this goal, we prepared multifunctional AuNPs involving three components with key roles: (1) thiolated poly(ethylene glycol) as stabilizing agent, (2) 1-naphthalenethiol as Raman reporter, and (3) glutathione as a bioinspired chelating agent of magnesium (II) ions. Thus, the variation in the SERS signal of 1-naphthalenethiol was controlled by the aggregation of AuNPs triggered by the complexation of pyrophosphate and glutathione with free magnesium ions. Using this strategy, we detected <i>Listeria monocytogenes</i>, not only in buffer, but also in a food matrix (i.e., ultra-high temperaturemilk) enabled by the massive production of hotspots as a result of the self-assemblies that enhanced the SERS signal. This allowed the development of a microdroplet-LAMP-SERS platform with isothermal amplification and real-time identification capabilities.
Also flagged:SynthesisIndoleUrsolic Acidhepatocarcinomamitochondrialmembrane
Journal Article2020-04-20No SnippetsLi AL, Hao Y, Wang WY, Liu QS, Sun Y, Gu W.
Show Full Abstract
In this study, a series of new indole derivatives of ursolic acid bearing different <i>N</i>-(aminoalkyl)carboxamide side chains were designed, synthesized, and evaluated for their in vitro cytotoxic activities against two human hepatocarcinoma cell lines (SMMC-7721 and HepG2) and normal hepatocyte cell line (LO2) via MTT assay. Among them, compound <b>5f</b> exhibited the most potent activity against SMMC-7721 and HepG2 cells with IC<sub>50</sub> values of 0.56 ± 0.08 μM and 0.91 ± 0.13 μM, respectively, and substantially lower cytotoxicity to LO2 cells. A follow-up enzyme inhibition assay and molecular docking study indicated that compound <b>5f</b> can significantly inhibit the activity of Topoisomerase IIα. Further mechanistic studies performed in SMMC-7721 cells revealed that compound <b>5f</b> can elevate the intracellular ROS levels, decrease mitochondrial membrane potential, and finally lead to the apoptosis of SMMC-7721 cells. Collectively, compound <b>5f</b> is a promising Topoisomerase II (Topo II) inhibitor, which exhibited the potential as a lead compound for the discovery of novel anticancer agents.
Also flagged:hydroxyapatitetricalcium phosphateporemagnesiummetalsaluminum
Journal Article2020-04-20No SnippetsSedelnikova MB, Sharkeev YP, Tolkacheva TV, Khimich MA, Bakina OV, Fomenko AN, Kazakbaeva AA, Fadeeva IV, Egorkin VS, Gnedenkov SV, Schmidt J, Loza K, Prymak O, Epple M.
Show Full Abstract
A comparative analysis of the structure, properties and the corrosion behavior of the micro-arc coatings based on Sr-substituted hydroxyapatite (Sr-HA) and Sr-substituted tricalcium phosphate (Sr-TCP) deposited on Mg0.8Ca alloy substrates was performed. The current density during the formation of the Sr-HA coatings was higher than that for the Sr-TCP coatings. As a result, the Sr-HA coatings were thicker and had a greater surface roughness R<sub>a</sub> than the Sr-TCP coatings. In addition, pore sizes of the Sr-HA were almost two times larger. The ratio (Ca + Sr + Mg)/P were equal 1.64 and 1.47 for Sr-HA and Sr-TCP coatings, respectively. Thus, it can be assumed that the composition of Sr-HA and Sr-TCP coatings was predominantly presented by (Sr,Mg)-substituted hydroxyapatite and (Sr,Mg)-substituted tricalcium phosphate. However, the average content of Sr was approximately the same for both types of the coatings and was equal to 1.8 at.%. The Sr-HA coatings were less soluble and had higher corrosion resistance than the Sr-TCP coatings. Cytotoxic tests in vitro demonstrated a higher cell viability after cultivation with extracts of the Sr-HA coatings.
Also flagged:RNA-binding proteinmyeloid leukemiasblastchronic myeloid leukemiaacute myeloid leukemiaRNA-binding proteins
Journal Article2020-04-20✓ 2 SnippetsBajaj J, Hamilton M, Shima Y, Chambers K, Spinler K, Van Nostrand EL, Yee BA, Blue SM, Chen M, Rizzeri D, Chuah C, Oehler VG, Broome HE, Sasik R, Scott-Browne J, Rao A, Yeo GW, Reya T.
In-Text Gene Mentions
Text
…Abt1…
Text
…Stau1…
Show Full Abstract
Aggressive myeloid leukemias such as blast crisis chronic myeloid leukemia and acute myeloid leukemia remain highly lethal. Here we report a genome-wide in vivo CRISPR screen to identify new dependencies in this disease. Among these, RNA-binding proteins (RBPs) in general, and the double-stranded RBP Staufen2 (Stau2) in particular, emerged as critical regulators of myeloid leukemia. In a newly developed knockout mouse, loss of Stau2 led to a profound decrease in leukemia growth and improved survival in mouse models of the disease. Further, Stau2 was required for growth of primary human blast crisis chronic myeloid leukemia and acute myeloid leukemia. Finally, integrated analysis of CRISPR, eCLIP and RNA-sequencing identified Stau2 as a regulator of chromatin-binding factors, driving global alterations in histone methylation. Collectively, these data show that in vivo CRISPR screening is an effective tool for defining new regulators of myeloid leukemia progression and identify the double-stranded RBP Stau2 as a critical dependency of myeloid malignancies.
Also flagged:siliconWatercarbonionsorganic compoundsthioacetamide
Journal Article2020-04-20No SnippetsOwens-Baird B, Sousa JPS, Ziouani Y, Petrovykh DY, Zarkevich NA, Johnson DD, Kolen'ko YV, Kovnir K.
Show Full Abstract
How the crystal structures of ordered transition-metal phosphide catalysts affect the hydrogen-evolution reaction (HER) is investigated by measuring the anisotropic catalytic activities of selected crystallographic facets on large (mm-sized) single crystals of iron-phosphide (FeP) and monoclinic nickel-diphosphide (<i>m</i>-NiP<sub>2</sub>). We find that different crystallographic facets exhibit distinct HER activities, in contrast to a commonly held assumption of severe surface restructuring during catalytic activity. Moreover, density-functional-theory-based computational studies show that the observed facet activity correlates well with the H-binding energy to P atoms on specific surface terminations. Direction dependent catalytic properties of two different phosphides with different transition metals, crystal structures, and electronic properties (FeP is a metal, while <i>m</i>-NiP<sub>2</sub> is a semiconductor) suggests that the anisotropy of catalytic properties is a common trend for HER phosphide catalysts. This realization opens an additional rational design for highly efficient HER phosphide catalysts, through the growth of nanocrystals with specific exposed facets. Furthermore, the agreement between theory and experimental trends indicates that screening using DFT methods can accelerate the identification of desirable facets, especially for ternary or multinary compounds. The large single-crystal nature of the phosphide electrodes with well-defined surfaces allows for determination of the catalytically important double-layer capacitance of a flat surface, <i>C</i> <sub>dl</sub> = 39(2) μF cm<sup>-2</sup> for FeP, useful for an accurate calculation of the turnover frequency (TOF). X-ray photoelectron spectroscopy (XPS) studies of the catalytic crystals that were used show the formation of a thin oxide/phosphate overlayer, presumably <i>ex situ</i> due to air-exposure. This layer is easily removed for FeP, revealing a surface of pristine metal phosphide.
Also flagged:Sulfamic acidhydroxysynthesiswater-methyl coumarin3,4-dihydropyrimidinone
Journal Article2020-04-20No SnippetsKaid MM, Gebreil A, El-Hakam SA, Ahmed AI, Ibrahim AA.
Show Full Abstract
Herein we introduce an effective approach for incorporating sulfamic acid (SA) into HKUST-1. The synthesized materials have been characterized using XRD, XPS, BET, FT-IR, SEM, EDX and TEM. The X-ray diffraction pattern of SA@HKUST-1 is analogous to that of parent HKUST-1 in line shape and <i>d</i>-spacing, proving that chemical modification could be obtained without damage to structural solidity. The XPS spectra confirmed successful sulfonation, due to the single S 2p peak being attributable to SO<sub>3</sub>H groups at 168 eV. Catalytic efficiency was studied for 7-hydroxy-4-methyl coumarin and 3,4-dihydropyrimidinone synthesis and it was found to be highly dependent on the amount of SA loaded over HKUST-1. Moreover, the adsorptive removal activity of some common organic and inorganic pollutants from water has been studied. To fully understand the adsorption process, the effects of initial dye concentration, pH of solution, adsorbent dosage, contact time and temperature on the adsorption process were successfully studied. Under the optimum conditions 10 wt% SA@HKUST-1 was able to reach the maximum adsorption capacity for Pb<sup>2+</sup> (298 mg g<sup>-1</sup>) and Malachite green (290 mg g<sup>-1</sup>). Hopefully, this will facilitate research on improving the prospective use of MOFs for future applications.
Proteus mirabilis is a Gram-negative uropathogen and frequent cause of catheter-associated urinary tract infection (CAUTI). One important virulence factor is its urease enzyme, which requires nickel to be catalytically active. It is, therefore, hypothesized that nickel import is critical for P. mirabilis urease activity and pathogenesis during infection. P. mirabilis strain HI4320 encodes two putative nickel import systems, designated Nik and Ynt. By disrupting the substrate-binding proteins from each import system (nikA and yntA), we show that Ynt is the primary nickel importer, while Nik only compensates for loss of Ynt at high nickel concentrations. We further demonstrate that these are the only binding proteins capable of importing nickel for incorporation into the urease enzyme. Loss of either nickel-binding protein results in a significant fitness defect in a murine model of CAUTI, but YntA is more crucial as the yntA mutant was significantly outcompeted by the nikA mutant. Furthermore, despite the importance of nickel transport for hydrogenase activity, the sole contribution of yntA and nikA to virulence is due to their role in urease activity, as neither mutant exhibited a fitness defect when disrupted in a urease-negative background.
<h4>Background</h4>Aquaculture is a fast-growing industry and therefore welfare and environmental impact have become of utmost importance. Preventing stress associated to common aquaculture practices and optimizing the fish stress response by quantification of the stress level, are important steps towards the improvement of welfare standards. Stress is characterized by a cascade of physiological responses that, in-turn, induce further changes at the whole-animal level. These can either increase fitness or impair welfare. Nevertheless, monitorization of this dynamic process has, up until now, relied on indicators that are only a snapshot of the stress level experienced. Promising technological tools, such as proteomics, allow an unbiased approach for the discovery of potential biomarkers for stress monitoring. Within this scope, using Gilthead seabream (Sparus aurata) as a model, three chronic stress conditions, namely overcrowding, handling and hypoxia, were employed to evaluate the potential of the fish protein-based adaptations as reliable signatures of chronic stress, in contrast with the commonly used hormonal and metabolic indicators.<h4>Results</h4>A broad spectrum of biological variation regarding cortisol and glucose levels was observed, the values of which rose higher in net-handled fish. In this sense, a potential pattern of stressor-specificity was clear, as the level of response varied markedly between a persistent (crowding) and a repetitive stressor (handling). Gel-based proteomics analysis of the plasma proteome also revealed that net-handled fish had the highest number of differential proteins, compared to the other trials. Mass spectrometric analysis, followed by gene ontology enrichment and protein-protein interaction analyses, characterized those as humoral components of the innate immune system and key elements of the response to stimulus.<h4>Conclusions</h4>Overall, this study represents the first screening of more reliable signatures of physiological adaptation to chronic stress in fish, allowing the future development of novel biomarker models to monitor fish welfare.
Also flagged:Tumourpalbocicliboestrogen receptorbreast cancersCDK4breast cancer
Journal Article2020-04-19No SnippetsPancholi S, Ribas R, Simigdala N, Schuster E, Nikitorowicz-Buniak J, Ressa A, Gao Q, Leal MF, Bhamra A, Thornhill A, Morisset L, Montaudon E, Sourd L, Fitzpatrick M, Altelaar M, Johnston SR, Marangoni E, Dowsett M, Martin LA.
Show Full Abstract
Combination of CDK4/6 inhibitors and endocrine therapy improves clinical outcome in advanced oestrogen receptor (ER)-positive breast cancer, however relapse is inevitable. Here, we show in model systems that other than loss of RB1 few gene-copy number (CN) alterations are associated with irreversible-resistance to endocrine therapy and subsequent secondary resistance to palbociclib. Resistance to palbociclib occurred as a result of tumour cell re-wiring leading to increased expression of EGFR, MAPK, CDK4, CDK2, CDK7, CCNE1 and CCNE2. Resistance altered the ER genome wide-binding pattern, leading to decreased expression of 'classical' oestrogen-regulated genes and was accompanied by reduced sensitivity to fulvestrant and tamoxifen. Persistent CDK4 blockade decreased phosphorylation of tuberous sclerosis complex 2 (TSC2) enhancing EGFR signalling, leading to the re-wiring of ER. Kinome-knockdown confirmed dependency on ERBB-signalling and G2/M-checkpoint proteins such as WEE1, together with the cell cycle master regulator, CDK7. Noteworthy, sensitivity to CDK7 inhibition was associated with loss of ER and RB1 CN. Overall, we show that resistance to CDK4/6 inhibitors is dependent on kinase re-wiring and the redeployment of signalling cascades previously associated with endocrine resistance and highlights new therapeutic networks that can be exploited upon relapse after CDK4/6 inhibition.
Also flagged:FUSamyotrophic lateral sclerosisALSfrontotemporal lobar degenerationessential tremormovement disorders
Journal Article2020-04-19✓ 1 SnippetZhou B, Wang H, Cai Y, Wen H, Wang L, Zhu M, Chen Y, Yu Y, Lu X, Zhou M, Fang P, Li X, Hong D.
In-Text Gene Mentions
Methods)
…the Huntingtin (HTT) gene was performed…
Show Full Abstract
<h4>Background</h4>Mutations in the fused in sarcoma (FUS) gene have been associated with amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration, and essential tremor. Among the FUS mutations, p.P525L as a hot spot variant has been reported in more than 20 patients with ALS. Apart from the typical ALS phenotype, patients with p.P525L mutation exhibit some atypical symptoms. However, movement disorders related to p.P525L mutation have not been emphasized currently.<h4>Methods</h4>Two unrelated patients with ALS were evaluated through a set of clinical and laboratory tests. The genetic screening was performed through next-generation sequencing. Muscle biopsies were performed on the 2 patients. Muscle samples were stained according to standard histological and immunohistochemical procedures.<h4>Results</h4>The first patient presented with juvenile-onset neurogenic weakness and wasting and simultaneously had dropped head, ophthalmoplegia, tremor, involuntary movements, and cognitive impairments. The second patient showed a typical ALS phenotype and prominent adventitious movements. Genetic screening disclosed de novo p.P525L FUS mutation in the 2 patients by family cosegregation analysis. Muscle biopsy showed neurogenic patterns and numerous lipid droplets aggregating in the fibers.<h4>Conclusion</h4>Apart from the typical ALS phenotype, patients with p.P525L mutation in the FUS gene can present with great clinical heterogeneity including multiple movement disorders. Numerous lipid droplets in muscle fibers indicate that skeletal muscle is likely an important therapeutic target for ALS.
Also flagged:BATF2multidruggastric cancertumorleucine zipper ATF‐like transcription factor 2resistant
Journal Article2020-04-18✓ 1 SnippetLin W, Miao Y, Meng X, Huang Y, Zhao W, Ruan J.
In-Text Gene Mentions
S I O 001029)
…Another study revealed that miR‐765 serves an oncogenic role in multiple myeloma progression by directly targeting SOX6 [15].…
Show Full Abstract
Elucidation of the mechanisms underlying multidrug resistance (MDR) is required to ensure the efficacy of chemotherapy against gastric cancer (GC). To investigate this issue, here we identified that microRNA-765 (miRNA-765) is up-regulated both in MDR GC cell lines and in specimens from patients who are not responding to chemotherapy. In addition, down-regulation of miRNA-765 increased the sensitivity of GC cells to anticancer drugs, whereas its overexpression had the opposite effect. Moreover, miRNA-765 suppressed drug-induced apoptosis and positively regulated the expression of MDR-related genes. Finally, we showed that the basic leucine zipper ATF-like transcription factor 2, a tumor suppressor gene, is the functional target of miRNA-765. In summary, these results suggest that miRNA-765 may promote MDR via basic leucine zipper ATF-like transcription factor 2 in GC cells.
Also flagged:POLE2Squamous Cell Lung CancercancerTumorGene expressioncell division
Journal Article2020-04-18No SnippetsWu Z, Wang YM, Dai Y, Chen LA.
Show Full Abstract
BACKGROUND Squamous cell lung cancer is the main cause of cancer-associated mortality. The discovery of promising prognostic biomarkers for predicting the survival of patients with squamous cell lung cancer remains a challenge. MATERIAL AND METHODS Gene expression profiles of GSE33479 and GSE51855, including 42 squamous cell lung cancer tissues and 17 normal tissues, from the GEO database were assessed to find common differentially expressed genes (DEGs) via the GEO2R online tool and Venn diagram software. Then, gene ontology (GO) and Kyoto Encyclopedia of Gene and Genome (KEGG) pathway analyses were conducted. The key protein-protein interaction (PPI) network within those common DEGs was subsequently illustrated through a combination of Search Tool for Retrieval of Interacting Genes (STRING) and Cytoscape software. Finally, core genes associated with survival and levels of immune infiltration were demonstrated by the Kaplan-Meier plotter and Tumor Immune Estimation Resource (TIMER) online database, respectively. RESULTS In total, 483 DEGs were involved, including 216 upregulated genes enriched in "cell division", "DNA replication", and "DNA repair pathway" and 267 downregulated genes enriched in "cell adhesion", "oxidation-reduction process", and "cell-cell signaling". The 75 core genes were selected by Molecular Complex Detection applied in Cytoscape. Four genes - MND1, FOXM1, CDC6, and POLE2 - were found to be significantly associated with survival. Further analysis of the KEEG pathway and TIMER database revealed that only POLE2 was enriched in "DNA replication" and its higher expression was negatively associated with survival and immune infiltration. CONCLUSIONS Higher expression of POLE2 is a prognosis-related biomarker for worse survival and is negatively associated with immune infiltration in squamous cell lung cancer.
Also flagged:MEF2skeletal muscle atrophyPolyglutaminespinal and bulbar muscular atrophySBMAdegenerative disorder of the
Journal Article2020-04-18✓ 5 SnippetsNath SR, Lieberman ML, Yu Z, Marchioretti C, Jones ST, Danby ECE, Van Pelt KM, Sorarù G, Robins DM, Bates GP, Pennuto M, Lieberman AP.
In-Text Gene Mentions
Methods)
…HA-MEF2C and GFP-Q74Htt, HEK-293 cells were…
Methods)
…HA-MEF2 and GFP-Q74Htt.…
Methods)
…pEGFP-Q74 (pEGFP-Q74Htt) was a gift…
Results)
…interaction between GFP-74QHttand HA-MEF2C, indicating…
Results)
…with soluble polyQHtt(Supplementary Fig. 5D–F).…
Show Full Abstract
Polyglutamine (polyQ) tract expansion leads to proteotoxic misfolding and drives a family of nine diseases. We study spinal and bulbar muscular atrophy (SBMA), a progressive degenerative disorder of the neuromuscular system caused by the polyQ androgen receptor (AR). Using a knock-in mouse model of SBMA, AR113Q mice, we show that E3 ubiquitin ligases which are a hallmark of the canonical muscle atrophy machinery are not induced in AR113Q muscle. Similarly, we find no evidence to suggest dysfunction of signaling pathways that trigger muscle hypertrophy or impairment of the muscle stem cell niche. Instead, we find that skeletal muscle atrophy is characterized by diminished function of the transcriptional regulator Myocyte Enhancer Factor 2 (MEF2), a regulator of myofiber homeostasis. Decreased expression of MEF2 target genes is age- and glutamine tract length-dependent, occurs due to polyQ AR proteotoxicity, and is associated with sequestration of MEF2 into intranuclear inclusions in muscle. Skeletal muscle from R6/2 mice, a model of Huntington disease which develops progressive atrophy, also sequesters MEF2 into inclusions and displays age-dependent loss of MEF2 target genes. Similarly, SBMA patient muscle shows loss of MEF2 target gene expression, and restoring MEF2 activity in AR113Q muscle rescues fiber size and MEF2-regulated gene expression. This work establishes MEF2 impairment as a novel mechanism of skeletal muscle atrophy downstream of toxic polyglutamine proteins and as a therapeutic target for muscle atrophy in these disorders.
Also flagged:Neurodegenerative Diseasescytoplasminclusion bodiesAlzheimerdeathamyloid proteins
Journal Article2020-04-18No SnippetsMijanović O, Branković A, Borovjagin A, Butnaru DV, Bezrukov EA, Sukhanov RB, Shpichka A, Timashev P, Ulasov I.
Show Full Abstract
Neurodegenerative diseases (NDDs) are most commonly found in adults and remain essentially incurable. Gene therapy using AAV vectors is a rapidly-growing field of experimental medicine that holds promise for the treatment of NDDs. To date, the delivery of a therapeutic gene into target cells via AAV represents a major obstacle in the field. Ideally, transgenes should be delivered into the target cells specifically and efficiently, while promiscuous or off-target gene delivery should be minimized to avoid toxicity. In the pursuit of an ideal vehicle for NDD gene therapy, a broad variety of vector systems have been explored. Here we specifically outline the advantages of adeno-associated virus (AAV)-based vector systems for NDD therapy application. In contrast to many reviews on NDDs that can be found in the literature, this review is rather focused on AAV vector selection and their preclinical testing in experimental and preclinical NDD models. Preclinical and in vitro data reveal the strong potential of AAV for NDD-related diagnostics and therapeutic strategies.
Also flagged:16S rRNAV416SITSGlutamate decarboxylaseCC
Journal Article2020-04-17✓ 2 SnippetsMao JH, Kim YM, Zhou YX, Hu D, Zhong C, Chang H, Brislawn CJ, Fansler S, Langley S, Wang Y, Peisl BYL, Celniker SE, Threadgill DW, Wilmes P, Orr G, Metz TO, Jansson JK, Snijders AM.
In-Text Gene Mentions
Discussion)
…Examples of known human genes associated with memory also identified in our study include: NTM and KLHl20 that are associated with Alzheimer’s disease and DOCK8 and KANK1 that are associated with neurodevelopmental disorders including memory potential [29–31].…
Discussion)
…[ 32 ],Prdx6that was associated…
Show Full Abstract
<h4>Background</h4>Recent evidence has linked the gut microbiome to host behavior via the gut-brain axis [1-3]; however, the underlying mechanisms remain unexplored. Here, we determined the links between host genetics, the gut microbiome and memory using the genetically defined Collaborative Cross (CC) mouse cohort, complemented with microbiome and metabolomic analyses in conventional and germ-free (GF) mice.<h4>Results</h4>A genome-wide association analysis (GWAS) identified 715 of 76,080 single-nucleotide polymorphisms (SNPs) that were significantly associated with short-term memory using the passive avoidance model. The identified SNPs were enriched in genes known to be involved in learning and memory functions. By 16S rRNA gene sequencing of the gut microbial community in the same CC cohort, we identified specific microorganisms that were significantly correlated with longer latencies in our retention test, including a positive correlation with Lactobacillus. Inoculation of GF mice with individual species of Lactobacillus (L. reuteri F275, L. plantarum BDGP2 or L. brevis BDGP6) resulted in significantly improved memory compared to uninoculated or E. coli DH10B inoculated controls. Untargeted metabolomics analysis revealed significantly higher levels of several metabolites, including lactate, in the stools of Lactobacillus-colonized mice, when compared to GF control mice. Moreover, we demonstrate that dietary lactate treatment alone boosted memory in conventional mice. Mechanistically, we show that both inoculation with Lactobacillus or lactate treatment significantly increased the levels of the neurotransmitter, gamma-aminobutyric acid (GABA), in the hippocampus of the mice.<h4>Conclusion</h4>Together, this study provides new evidence for a link between Lactobacillus and memory and our results open possible new avenues for treating memory impairment disorders using specific gut microbial inoculants and/or metabolites. Video Abstract.
Also flagged:HDMSNneurodegenerative diseasecognitionHuntingtons Disease
Journal Article2020-04-17✓ 2 SnippetsPonzi A, Barton SJ, Bunner KD, Rangel-Barajas C, Zhang ES, Miller BR, Rebec GV, Kozloski J.
In-Text Gene Mentions
Introduction)
…The fact that the Huntingtin protein (Htt) is involved in synaptic function [9, 21] also suggests that HD may primarily be a synaptopathology [22].…
Introduction)
…the Huntingtin protein (Htt) is involved in…
Show Full Abstract
Medium spiny neurons (MSNs) comprise over 90% of cells in the striatum. In vivo MSNs display coherent burst firing cell assembly activity patterns, even though isolated MSNs do not burst fire intrinsically. This activity is important for the learning and execution of action sequences and is characteristically dysregulated in Huntington's Disease (HD). However, how dysregulation is caused by the various neural pathologies affecting MSNs in HD is unknown. Previous modeling work using simple cell models has shown that cell assembly activity patterns can emerge as a result of MSN inhibitory network interactions. Here, by directly estimating MSN network model parameters from single unit spiking data, we show that a network composed of much more physiologically detailed MSNs provides an excellent quantitative fit to wild type (WT) mouse spiking data, but only when network parameters are appropriate for the striatum. We find the WT MSN network is situated in a regime close to a transition from stable to strongly fluctuating network dynamics. This regime facilitates the generation of low-dimensional slowly varying coherent activity patterns and confers high sensitivity to variations in cortical driving. By re-estimating the model on HD spiking data we discover network parameter modifications are consistent across three very different types of HD mutant mouse models (YAC128, Q175, R6/2). In striking agreement with the known pathophysiology we find feedforward excitatory drive is reduced in HD compared to WT mice, while recurrent inhibition also shows phenotype dependency. We show that these modifications shift the HD MSN network to a sub-optimal regime where higher dimensional incoherent rapidly fluctuating activity predominates. Our results provide insight into a diverse range of experimental findings in HD, including cognitive and motor symptoms, and may suggest new avenues for treatment.
Also flagged:RNA-binding proteinHNRNPURNA-binding proteinstranslationalbindingneurological diseases
Journal Article2020-04-17✓ 1 SnippetYugami M, Okano H, Nakanishi A, Yano M.
In-Text Gene Mentions
Discussion)
…gnase-1 (ZC3H12A), Roquin1/2 (RC3H1/2) and Arid5a might…
Show Full Abstract
RNA-binding proteins (RBPs) control many types of post-transcriptional regulation, including mRNA splicing, mRNA stability, and translational efficiency, by directly binding to their target RNAs and their mutation and dysfunction are often associated with several human neurological diseases and tumorigenesis. Crosslinking immunoprecipitation (CLIP), coupled with high-throughput sequencing (HITS-CLIP), is a powerful technique for investigating the molecular mechanisms underlying disease pathogenesis by comprehensive identification of RBP target sequences at the transcriptome level. However, HITS-CLIP protocol is still required for some optimization due to experimental complication, low efficiency and time-consuming, whose library has to be generated from very small amounts of RNAs. Here we improved a more efficient, rapid, and reproducible CLIP method by optimizing BrdU-CLIP. Our protocol produced a 10-fold greater yield of pre-amplified CLIP library, which resulted in a low duplicate rate of CLIP-tag reads because the number of PCR cycles required for library amplification was reduced. Variance of the yields was also reduced, and the experimental period was shortened by 2 days. Using this, we validated IL-6 expression by a nuclear RBP, HNRNPU, which directly binds the 3'-UTR of IL-6 mRNA in HeLa cells. Importantly, this interaction was only observed in the cytoplasmic fraction, suggesting a role of cytoplasmic HNRNPU in mRNA stability control. This optimized method enables us to accurately identify target genes and provides a snapshot of the protein-RNA interactions of nucleocytoplasmic shuttling RBPs.
Also flagged:EPACcyclic adenosine monophosphatesignal transductionmyelinationexchange proteinmyelin sheath
Journal Article2020-04-17✓ 1 SnippetGao ZZ, Li YC, Shao CY, Xiao J, Shen Y, Zhou L.
In-Text Gene Mentions
Text
…SOX6…
Show Full Abstract
Increasing evidence suggests that a cyclic adenosine monophosphate (cAMP)-dependent intracellular signal drives the process of myelination. Yet, the signal transduction underlying the action of cAMP on central nervous system myelination remains undefined. In the present work, we sought to determine the role of EPAC (exchange protein activated by cAMP), a downstream effector of cAMP, in the development of the myelin sheath using EPAC1 and EPAC2 double-knockout (EPAC<sup>dKO</sup>) mice. The results showed an age-dependent regulatory effect of EPAC1 and EPAC2 on myelin development, as their deficiency caused more myelin sheaths in postnatal early but not late adult mice. Knockout of EPAC promoted the proliferation of oligodendrocyte precursor cells and had diverse effects on myelin-related transcription factors, which in turn increased the expression of myelin-related proteins. These results indicate that EPAC proteins are negative regulators of myelination and may be promising targets for the treatment of myelin-related diseases.
Also flagged:Alanine aminotransferasechronic hepatitis Cliver cirrhosisportal hypertensionHCV infectionALT
Journal Article2020-04-17✓ 1 SnippetGiuffrè M, Fouraki S, Campigotto M, Colombo A, Visintin A, Buonocore MR, Aversano A, Budel M, Tinè F, Abazia C, Masutti F, Crocè LS.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>Spleen stiffness (SS) has gained a lot of interest in the context of liver cirrhosis and portal hypertension stratification. However, there is a paucity of data on confounding factors that may alter SS values.<h4>Methods</h4>Between January 2018 and October 2019, we enrolled 120 healthy subjects and 117 patients with hepatitis C virus (HCV) infection who did not have significant liver fibrosis (i.e., F0-1). Abdominal ultrasound evaluation was performed on each individual to measure portal vein diameter, portal flow velocity, spleen bipolar diameter, and splenic area. We also performed liver and spleen elastography.<h4>Results</h4>HCV patients had higher SS (p < 0.001), portal vein diameter (p = 0.031), portal flow velocity (p = 0.035), spleen bipolar diameter (p = 0.042) and area (p = 0.025), and ALT levels (p < 0.001). Linear regression models showed that SS increased by 3.220 kPa for each mm of portal vein diameter, by 0.7 kPa for each cm/s of portal flow velocity, by 2.239 kPa for each cm of spleen bipolar diameter, and by 0.233 kPa for each cm<sup>2</sup> of spleen area. Patients with HCV infection were stratified according to median ALT levels (i.e. 32 IU/L). SS and spleno-portal axis parameters were significantly higher in patients with an ALT level > 32 IU/L. Besides, the relationship between SS and ALT was described by cubic polynomial regression according to the following equation: 11.735 + 0.404 (ALT)<sup>1</sup> - 0.002 (ALT)<sup>2</sup> + 4.26 × 10<sup>-6</sup> (ALT)<sup>3</sup>.<h4>Conclusions</h4>Our results bring new light to the role of inflammation as a confounding factor for SS measurement. Therefore, particular attention should be paid to serum transaminase for a correct evaluation of spleen elastography.
Also flagged:lung cancerlung diseasecancersCancertumorchronic obstructive pulmonary disease
Journal Article2020-04-17No SnippetsMoore A, Kramer MR, Rosengarten D, Shtraichman O, Zer A, Dudnik E, Korzets Y, Allen AM.
Show Full Abstract
Background Lung transplantation is a life-saving treatment for patients with end stage lung disease. There may be a higher incidence of lung cancer in lung transplant recipients, and these cancers tend to be diagnosed at a more advanced stage. There is very little data on the safety and efficacy of stereotactic body radiation therapy (SBRT) for lesions in the native lung in lung-transplant recipients. Patients and methods A retrospective chart review of all patients who have undergone lung transplantation and were treated with SBRT for lung cancer in the native lung in the Davidoff Cancer Center was performed. Results Four patients who were treated with SBRT to a total of 5 lesions were included. Two patients were treated without histological confirmation of malignancy. All cases were discussed in a multidisciplinary tumor board before being referred for radiotherapy. Standard SBRT dosing was used. Responses were assessed by imaging. Three lesions exhibited a complete response and two lesions had a partial response. The patients who had partial responses developed distant metastases and died shortly. No patient developed measurable toxicity. Conclusions SBRT is effective and safe for the management of lung cancer in lung-transplant patients. Standard dose and fractionation can be used.
Also flagged:digestiongestationIL-8TNF-αenzyme activitylipases
Journal Article2020-04-17✓ 2 SnippetsNavis M, Muncan V, Sangild PT, Møller Willumsen L, Koelink PJ, Wildenberg ME, Abrahamse E, Thymann T, van Elburg RM, Renes IB.
In-Text Gene Mentions
Results)
…Expression level ofOLFM4, a marker…
Results)
…amplifying cells (OLFM4), Paneth cells…
Show Full Abstract
<h4>Background</h4>The human digestive tract is structurally mature at birth, yet maturation of gut functions such as digestion and mucosal barrier continues for the next 1-2 years. Human milk and infant milk formulas (IMF) seem to impact maturation of these gut functions differently, which is at least partially related to high temperature processing of IMF causing loss of bioactive proteins and formation of advanced glycation end products (AGEs). Both loss of protein bioactivity and formation of AGEs depend on heating temperature and time. The aim of this study was to investigate the impact of mildly pasteurized whey protein concentrate (MP-WPC) compared to extensively heated WPC (EH-WPC) on gut maturation in a piglet model hypersensitive to enteral nutrition.<h4>Methods</h4>WPC was obtained by cold filtration and mildly pasteurized (73 °C, 30 s) or extensively heat treated (73 °C, 30 s + 80 °C, 6 min). Preterm (~90% gestation) and near-term piglets (~96% gestation) received enteral nutrition based on MP-WPC or EH-WPC for five days. Macroscopic and histologic lesions in the gastro-intestinal tract were evaluated and intestinal responses were further assessed by RT-qPCR, immunohistochemistry and enzyme activity analysis.<h4>Results</h4>A diet based on MP-WPC limited epithelial intestinal damage and improved colonic integrity compared to EH-WPC. MP-WPC dampened colonic IL1-β, IL-8 and TNF-α expression and lowered T-cell influx in both preterm and near-term piglets. Anti-microbial defense as measured by neutrophil influx in the colon was only observed in near-term piglets, correlated with histological damage and was reduced by MP-WPC. Moreover, MP-WPC stimulated iALP activity in the colonic epithelium and increased differentiation into enteroendocrine cells compared to EH-WPC.<h4>Conclusions</h4>Compared to extensively heated WPC, a formula based on mildly pasteurized WPC limits gut inflammation and stimulates gut maturation in preterm and near-term piglets and might therefore also be beneficial for preterm and (near) term infants.
Also flagged:ErythropoietinHepcidinironmetabolismEPObiosynthesis
Journal Article2020-04-17✓ 5 SnippetsTomczyk M, Kortas J, Flis D, Kaczorowska-Hac B, Grzybkowska A, Borkowska A, Lewicka E, Dabrowska-Kugacka A, Antosiewicz J.
In-Text Gene Mentions
Introduction)
…the development ofhemochromatosisare found in…
Introduction)
…found in theHFEgene located on…
Introduction)
…Since theHFEprotein mediates intracellular…
Introduction)
…mutations in theHFEgene would respond…
Introduction)
…the wild-type (WT)HFEgene.…
Show Full Abstract
Alterations in iron metabolism after physical activity are manifested through the rise of blood hepcidin (Hpc) levels. However, in many athletes, no changes in Hpc levels are observed after exercise despite the presence of inflammation. The missing links could be erythropoietin (EPO) and erythroferrone (ERFE), which down-regulate Hpc biosynthesis. EPO, ERFE and Hpc biosynthesis is modified by serum iron through transferrin receptor 2. Consequently, we investigated whether marathon-induced changes in EPO, ERFE and Hpc levels are blood iron-dependent. Twenty-nine healthy male marathon runners were analyzed. Serum iron, ferritin, transferrin, EPO, ERFE and Hpc levels were assessed before, immediately after, and 9 ± 2 days after the marathon. The runners whose serum Hpc decreased after the marathon (<i>n = 15</i>), showed a significant increase in ERFE levels. In athletes whose serum iron levels were below 105 µg/day (<i>n = 15</i>), serum EPO (<i>p = 0.00</i>) and ERFE levels (<i>p = 0.00</i>) increased with no changes in Hpc concentration. However, in athletes with low serum iron, no changes in EPO levels were observed when serum ferritin exceeded 70 ng/mL (<i>n = 7</i>). Conversely, an increase in ERFE levels was observed in marathoners with low serum iron, independently of serum ferritin (<i>n = 7</i>). This indicates modulation of blood iron may affect exercise-induced changes in the EPO/ERFE/Hpc axis. Further study is needed to fully understand the physiological meaning of the interdependence between iron and the EPO/ERFE/Hpc axis.
Journal Article2020-04-17✓ 5 SnippetsPacifici F, Della-Morte D, Piermarini F, Arriga R, Scioli MG, Capuani B, Pastore D, Coppola A, Rea S, Donadel G, Andreadi A, Abete P, Sconocchia G, Bellia A, Orlandi A, Lauro D.
In-Text Gene Mentions
Discussion)
…Further confirming this evidence, we demonstrated as lack of Prdx6 induces sarcopenia in mice, affecting both cellular muscle differentiation and muscle atrophy mechanisms.…
Discussion)
…In this study, we found a reduction in CSA of Prdx6-/- skeletal muscle fibers compared to control group, demonstrating the presence of sarcopenia.…
Results)
…Similarly to Prdx6, SIRT1 has shown to modulate insulin release and to be implicated in metabolic disorders [22].…
Abstract)
…We previously reported as the absence of Peroxiredoxin 6 (Prdx6), an antioxidant enzyme implicated in maintaining intracellular redox homeostasis, induces an early-stage of T2DM.…
Discussion)
…On the other way, by increasing Prdx6 activity through mutant Prdx6 K122/142R (arginine), mice gained protective efficacy against oxidative stress and premature senescence in LECs [35].…
Show Full Abstract
With the increase in average life expectancy, several individuals are affected by age-associated non-communicable chronic diseases (NCDs). The presence of NCDs, such as type 2 diabetes mellitus (T2DM), leads to the reduction in skeletal muscle mass, a pathological condition defined as sarcopenia. A key factor linking sarcopenia with cellular senescence and diabetes mellitus (DM) is oxidative stress. We previously reported as the absence of Peroxiredoxin 6 (Prdx6), an antioxidant enzyme implicated in maintaining intracellular redox homeostasis, induces an early-stage of T2DM. In the present study we sought to understand the role of Prdx6 in the crosstalk between aging and diabetic sarcopenia, by using Prdx6 knockout (<i>Prdx6<sup>-/-</sup></i>) mice. Absence of Prdx6 reduced telomeres length and Sirtuin1 (SIRT1) nuclear localization. An increase in Sa-β-Gal activity and p53-p21 pro-aging pathway were also evident. An impairment in IGF-1 (Insulin-like Groth Factor-1)/Akt-1/mTOR pathway leading to a relative increase in Forkhead Box O1 (FOXO1) nuclear localization and in a decrease of muscle differentiation as per lower levels of myoblast determination protein 1 (MyoD) was observed. Muscle atrophy was also present in <i>Prdx6<sup>-/-</sup></i> mice by the increase in Muscle RING finger 1 (MuRF1) levels and proteins ubiquitination associated to a reduction in muscle strength. The present study, innovatively, highlights a fundamental role of Prdx6, in the crosstalk between aging, sarcopenia, and DM.
Also flagged:cancertumourgene expressionmetabolismbrain tumourglioma
Journal Article2020-04-17✓ 2 SnippetsGalardi S, Michienzi A, Ciafrè SA.
In-Text Gene Mentions
Discussion)
…Moreover, its expression is a recognized marker of the proneural subtype of glioblastomas [57] and, even more importantly, in cooperation with Sox2, Pou3f2 and Sall2, Olig2 is a key master transcription factor of glioblastoma-initiating cells [62].…
Discussion)
…cooperation with Sox2,Pou3f2and Sall2, Olig2…
Show Full Abstract
N<sup>6</sup>-methyladenosine (m<sup>6</sup>A) is one of the most widespread and abundant internal messenger RNA modifications found in eukaryotes. Emerging evidence suggests that this modification is strongly linked to the activation and inhibition of cancer pathways and is associated with prognostically significant tumour subtypes. The present review describes the dynamic nature of m<sup>6</sup>A regulator enzymes, as methyltransferases, demethylases and m<sup>6</sup>A binding proteins, and points out thevalue of the balance among these proteins in regulating gene expression, cell metabolism and cancer development. The main focus of this review is on the roles of m<sup>6</sup>A modification in glioblastoma, the most aggressive and invariably lethal brain tumour. Although the study of m<sup>6</sup>A in glioblastoma is a young one, and papers in this field can yield divergent conclusions, the results collected so far clearly demonstrate that modulation of mRNA m<sup>6</sup>A levels impacts multiple aspects of this tumour, including growth, glioma stem cells self-renewal, and tumorigenesis, suggesting that mRNA m<sup>6</sup>A modification may serve as a promising target for glioblastoma therapy. We also present recent data about another type of epitranscriptomic modification, the methylation of cytosine at a specific site of 28S rRNA, as it was recently shown to affect the biology of glioma cells, with high potential of clinical implications.
Also flagged:TumorExtracellular Vesiclesextracellularvesicleshyaluronic aciddoxorubicin
Journal Article2020-04-17No SnippetsPark J, Lee H, Youn YS, Oh KT, Lee ES.
Show Full Abstract
In this study, we fabricated tumor-homing pH-sensitive extracellular vesicles for efficient tumor treatment. These vesicles were prepared using extracellular vesicles (EVs; BTEVs extracted from BT-474 tumor cells or SKEVs extracted from SK-N-MC tumor cells), hyaluronic acid grafted with 3-(diethylamino)propylamine (HDEA), and doxorubicin (DOX, as a model antitumor drug). Consequently, HDEA/DOX anchored EVs (HDEA@EVs) can interact with origin tumor cells owing to EVs' homing ability to origin cells. Therefore, EV blends of HDEA@BTEVs and HDEA@SKEVs demonstrate highly increased cellular uptake in both BT-474 and SK-N-MC cells: HDEA@BTEVs for BT-474 tumor cells and HDEA@SKEVs for SK-N-MC tumor cells. Furthermore, the hydrophobic HDEA present in HDEA@EVs at pH 7.4 can switch to hydrophilic HDEA at pH 6.5 as a result of acidic pH-induced protonation of 3-(diethylamino)propylamine (DEAP) moieties, resulting in an acidic pH-activated EVs' disruption, accelerated release of encapsulated DOX molecules, and highly increased cell cytotoxicity. However, EV blends containing pH-insensitive HA grafted with deoxycholic acid (HDOC) (HDOC@BTEVs and HDOC@SKEVs) showed less cell cytotoxicity for both BT-474 and SK-N-MC tumor cells, because they did not act on EVs' disruption and the resulting DOX release. Consequently, the use of these tumor-homing pH-sensitive EV blends may result in effective targeted therapies for various tumor cells.
<h4>Purpose</h4>To evaluate the effect of a PP mesh on duct deferens morphology, testicular size and testosterone levels.<h4>Methods</h4>Forty adult male rats were distributed into groups: 1) no surgery; 2) inguinotomy; 3) mesh placed on the duct deferens; and 4) mesh placed on the spermatic funiculus. After 90 postoperative days, the inguinal region was resected, and blood samples were collected for the measurement of serum testosterone (pg/dl). The ducts deferens were sectioned in three axial sections according to the relationship with the mesh - cranial, medial and caudal. The wall thickness and duct deferens lumen area were measured.<h4>Results</h4>The morphology of the duct deferens was preserved in all groups. The mesh placement did not alter this morphology in any of the analyzed segments. Surgery, with or without mesh placement, did not alter the morphology, wall thickness or lumen area (p>0.05). In all operated groups, serum testosterone levels were similar (p>0.05) but there was a decrease in testicle size (p<0.05).<h4>Conclusion</h4>Surgery, with or without mesh placement, did not alter the morphology of the duct deferens and, although this treatment resulted in testicular size reduction, it did not affect serum testosterone levels.
<i>Tripterygium wilfordii Hook.f</i> and <i>Tripterygium hypoglaucum (H.Lév.) Hutch</i> is effective herbs to prevent aggravation of Rheumatoid arthritis (RA). However, both of them show severe side effects in the reproductive system and other systems. Kunxian Capsule (KX), a Traditional Chinese Medicine (TCM) patent prescription, comprised of 4 herbs, including <i>H.Lév. Hutch</i>, is reported to be an available prescription in treating RA with fewer side effects as compares to Tripterygium tablets. To reveal the pharmacological mechanism of KX in RA treatment and side effect alleviation, we collected related information of KX from open-access databases and performed various analyses. 1354 targets were identified in KX. These targets were enriched in the calcium signaling pathway, cAMP signaling pathway, cGMP-PKG signaling pathway and PI3K-AKT signaling pathway, forming biological functions, such as cofactor binding, coenzyme binding, etc. These pathways or functions mostly affect cell cycle, differentiation, and maturation of Th17 cells, macrophage, and synovial fibroblast. These targets also act on the IL-17 signaling pathway, Th17 cell differentiation signaling pathway and TNF signaling pathway, which is related to inflammation response inhibition. Next, a disease network was constructed, which indicated IMPDH2, MTHFD1 are the key genes answering for the side effects of <i>H.Lév. Hutch</i>. The side effect-related genes lead to the negative regulation of nucleic acid, which could be restored by the rest 3 herbs through some positive amino acid metabolism. In conclusion, KX is a relatively safe alternative approach in RA intervention.
<i>Cryptococcus neoformans</i> is a causative agent for pulmonary infection and meningoencephalitis. Understanding the host's response to <i>C. neoformans</i> infection is critical for developing effective treatment. Even though some have elucidated the host response at the transcriptome level, little is known about how it modulates its defense machinery through the proteome mechanism or how protein posttranslational modification responds to the infection. In this work, we employed a murine infection model and mass spectrometry to systematically determine the proteome and acetylome statuses of lungs and brains in the early stage of infection. To extensively analyze the host response, we integrated the proteome data to the transcriptome results. Critical genes, including genes involved in phagosome, lysosome, and platelet activation are significantly altered in protein and gene expression during infection. In the acetylome analysis, we demonstrated that lung and brain tissues differentially regulate protein acetylation during infection. The three primary groups of proteins altered in acetylation status are histones, proteins involved in glucose and fatty acid metabolism, and proteins from the immune system. These analyses provide an integrative regulation network of the host responding to <i>C. neoformans</i> and shed new light on understanding the host's regulation mechanism when responding to <i>C. neoformans</i>.
Also flagged:gestationanemiairon deficiency anemiaironiron anemiasyphilis infection
Journal Article2020-04-17No SnippetsPanburana P, Odthon T, Pongmee P, Hansahiranwadee W.
Show Full Abstract
<h4>Objective</h4>To study the effect of intact umbilical cord milking (I-UCM) procedure in comparison with the procedure of delayed cord clamping (DCC) in term neonates.<h4>Study design</h4>A randomized controlled trial.<h4>Setting</h4>Department of Obstetrics and Gynecology and Department of Pediatrics, Faculty of Medicine Ramathibodi Hospital, Mahidol University.<h4>Materials and methods</h4>The study was performed from June 2017 to March 2018. Singleton term pregnant women (37-42 weeks' gestation) were recruited. Neonates were randomized into DCC and I-UCM groups. Umbilical cord was 3 times milked toward the neonate in 25 cm length from umbilical stump which was still attached to the placenta before cutting the cord in I-UCM group. Delay in cord clamping for 60 seconds was performed before the cord cutting in DCC group. Neonatal and maternal outcomes were recorded.<h4>Results</h4>Of 168 neonates included in this trial, 84 cases were randomized into each group. The baseline characteristics of both groups were comparable. No statistical difference was found in terms of the mean of hemoglobin levels in the DCC and I-UCM groups which were 16.9 (±1.6) g/dl and 17.0 (±1.9) g/dl, respectively (P-value 0.75). There was no difference in terms of adverse neonatal and maternal outcomes in both groups.<h4>Conclusion</h4>Both I-UCM and DCC revealed a comparable effect on hematologic status without deleterious effects on neonatal and maternal outcomes at the age of 48-72 hours in term neonates.
Also flagged:Gene ExpressionBasal Cell CarcinomaCYFIP2HOXB5EGFRFOXN3
Journal Article2020-04-17No SnippetsLiu Y, Liu H, Bian Q.
Show Full Abstract
<h4>Purpose</h4>This work is aimed at identifying several molecular markers correlated with the diagnosis and development of basal cell carcinoma (BCC).<h4>Methods</h4>The available microarray datasets for BCC were obtained from the Gene Expression Omnibus (GEO) database, and differentially expressed genes (DEGs) were identified between BCC and healthy controls. Afterward, the functional enrichment analysis and protein-protein interaction (PPI) network analysis of these screened DEGs were performed. An external validation for the DEG expression level was also carried out, and receiver operating characteristic curve analysis was used to evaluate the diagnostic values of DEGs.<h4>Result</h4>In total, five microarray datasets for BCC were downloaded and 804 DEGs (414 upregulated and 390 downregulated genes) were identified. Functional enrichment analysis showed that these genes including <i>CYFIP2</i>, <i>HOXB5</i>, <i>EGFR</i>, <i>FOXN3</i>, <i>PTPN3</i>, <i>CDC20</i>, <i>MARCKSL1</i>, <i>FAS</i>, and <i>PTCH1</i> were closely correlated with the cell process and <i>PTCH1</i> played central roles in the BCC signaling pathway. Moreover, <i>EGFR</i> was a hub gene in the PPI network. The expression changes of six genes (<i>CYFIP2</i>, <i>HOXB5</i>, <i>FOXN3</i>, <i>PTPN3</i>, <i>MARCKSL1</i>, and <i>FAS</i>) were validated by an external GSE74858 dataset analysis. Finally, ROC analysis revealed that <i>CYFIP2</i>, HOXB5, <i>PTPN3</i>, <i>MARCKSL1</i>, <i>PTCH1</i>, and <i>CDC20</i> could distinguish BCC and healthy individuals.<h4>Conclusion</h4>Nine gene signatures (<i>CYFIP2</i>, <i>HOXB5</i>, <i>EGFR</i>, <i>FOXN3</i>, <i>PTPN3</i>, <i>CDC20</i>, <i>MARCKSL1</i>, <i>FAS</i>, and <i>PTCH1</i>) may serve as promising targets for BCC detection and development.
Also flagged:schizophreniacardiometabolic diseaseCMDcoronary artery diseasestype 2 diabeteslipoprotein
Journal Article2020-04-17✓ 5 SnippetsLiu H, Sun Y, Zhang X, Li S, Hu D, Xiao L, Chen Y, He L, Wang DW.
In-Text Gene Mentions
Results)
…Specifically, VRK2, NT5C2, INO80E, YPEL3, and MAPK3 are the common candidate genes of SCZ and BMI; NT5C2, FES, and FURIN are the candidate genes for both SCZ and CAD; ARL6IP4, OGFOD2, PITPNM2, CDK2AP1, C12orf65, ABCB9, SETD8, MPHOSPH9, SREBF1, TOM1L2, and GATAD2A are associated with the comorbidity of SCZ and T2D; SLC39A8, AMBRA1, C12orf65, and SETD8 are associated with the comorbidity of SCZ and HDL; GATAD2A and TM6SF2 are the common candidate genes of SCZ, TC, and TG.…
Abstract)
…These genes includeVRK2, SLC39A8 ,…
Results)
…( ZNF668 ,NEGR1, KAT8 ,…
Results)
…six genes (NEGR1, KAT8 ,…
Results)
…Specifically,VRK2, NT5C2 ,…
Show Full Abstract
Genome-wide association studies (GWAS) have identified abundant risk loci associated with schizophrenia (SCZ), cardiometabolic disease (CMD) including body mass index, coronary artery diseases, type 2 diabetes, low- and high-density lipoprotein, total cholesterol, and triglycerides. Although recent studies have suggested that genetic risk shared between these disorders, the pleiotropic genes and biological pathways shared between them are still vague. Here we integrated comprehensive multi-dimensional data from GWAS, expression quantitative trait loci (eQTL), and gene set database to systematically identify potential pleiotropic genes and biological pathways shared between SCZ and CMD. By integrating the results from different approaches including FUMA, Sherlock, SMR, UTMOST, FOCUS, and DEPICT, we revealed 21 pleiotropic genes that are likely to be shared between SCZ and CMD. These genes include <i>VRK2</i>, <i>SLC39A8</i>, <i>NT5C2</i>, <i>AMBRA1</i>, <i>ARL6IP4</i>, <i>OGFOD2</i>, <i>PITPNM2</i>, <i>CDK2AP1</i>, <i>C12orf65</i>, <i>ABCB9</i>, <i>SETD8</i>, <i>MPHOSPH9, FES</i>, <i>FURIN</i>, <i>INO80E</i>, <i>YPEL3</i>, <i>MAPK3</i>, <i>SREBF1</i>, <i>TOM1L2</i>, <i>GATAD2A</i>, and <i>TM6SF2</i>. In addition, we also performed the gene-set enrichment analysis using the software of GSA-SNP2 and MAGMA with GWAS summary statistics and identified three biological pathways (MAPK-TRK signaling, growth hormone signaling, and regulation of insulin secretion signaling) shared between them. Our study provides insights into the pleiotropic genes and biological pathways underlying mechanisms for the comorbidity of SCZ and CMD. However, further genetic and functional studies are required to validate the role of these potential pleiotropic genes and pathways in the etiology of the comorbidity of SCZ and CMD, which should provide potential targets for future diagnostics and therapeutics.
Also flagged:Cas9transposonshoming endonucleasechromosomesmalariaZika
Journal Article2020-04-17No SnippetsCourtier-Orgogozo V, Danchin A, Gouyon PH, Boëte C, Boëte C.
Show Full Abstract
The probability D that a given clustered regularly interspaced short palindromic repeats (CRISPR)-based gene drive element contaminates another, nontarget species can be estimated by the following Drive Risk Assessment Quantitative Estimate (DRAQUE) Equation: D = h y b + t r a n s f × e x p r e s s × c u t × f l a n k × i m m u n e × n o n e x t i n c t with <i>hyb</i> = probability of hybridization between the target species and a nontarget species; <i>transf</i> = probability of horizontal transfer of a piece of DNA containing the gene drive cassette from the target species to a nontarget species (with no hybridization); <i>express</i> = probability that the <i>Cas9</i> and guide RNA genes are expressed; <i>cut</i> = probability that the CRISPR-guide RNA recognizes and cuts at a DNA site in the new host; <i>flank</i> = probability that the gene drive cassette inserts at the cut site; <i>immune</i> = probability that the immune system does not reject <i>Cas9</i>-expressing cells; <i>nonextinct</i> = probability of invasion of the drive within the population. We discuss and estimate each of the seven parameters of the equation, with particular emphasis on possible transfers within insects, and between rodents and humans. We conclude from current data that the probability of a gene drive cassette to contaminate another species is not insignificant. We propose strategies to reduce this risk and call for more work on estimating all the parameters of the formula.
Also flagged:bindingmono- anddinucleotidevirulence genesriboflavinroseoflavin 12
Journal Article2020-04-17No SnippetsGolabi F, Mehdizadeh Aghdam E, Shamsi M, Sedaaghi MH, Barzegar A, Hejazi MS.
Show Full Abstract
<i><b>Introduction:</b></i> Riboswitches are short regulatory elements generally found in the untranslated regions of prokaryotes' mRNAs and classified into several families. Due to the binding possibility between riboswitches and antibiotics, their usage as engineered regulatory elements and also their evolutionary contribution, the need for bioinformatics tools of riboswitch detection is increasing. We have previously introduced an alignment independent algorithm for the identification of frequent sequential blocks in the families of riboswitches. Herein, we report the application of block location-based feature extraction strategy (BLBFE), which uses the locations of detected blocks on riboswitch sequences as features for classification of seed sequences. Besides, mono- and dinucleotide frequencies, k-mer, DAC, DCC, DACC, PC-PseDNC-General and SC-PseDNC-General methods as some feature extraction strategies were investigated. <i><b>Methods:</b></i> The classifiers of the Decision tree, KNN, LDA, and Naïve Bayes, as well as k-fold cross-validation, were employed for all methods of feature extraction to compare their performances based on the criteria of accuracy, sensitivity, specificity, and f-score performance measures. <i><b>Results:</b></i> The outcome of the study showed that the BLBFE strategy classified the riboswitches indicating 87.65% average correct classification rate (CCR). Moreover, the performance of the proposed feature extraction method was confirmed with average values of 94.31%, 85.01%, 95.45% and 85.38% for accuracy, sensitivity, specificity, and f-score, respectively. <i><b>Conclusion:</b></i> Our result approved the performance of the BLBFE strategy in the classification and discrimination of the riboswitch groups showing remarkable higher values of CCR, accuracy, sensitivity, specificity and f-score relative to previously studied feature extraction methods.
Also flagged:DicyclohexylcarbodiimidesilicalactateAFMLactic acidS21
Journal Article2020-04-17No SnippetsWang C, Hao H, Hashizume D, Tajima K.
Show Full Abstract
The chirality of organic semiconductors is important for various applications in optoelectronics and spintronics. Here, we propose a new strategy to induce structural chirality in achiral organic semiconductors in thin films. Enantiomeric fullerene derivatives (<i>S</i>)-pSi and (<i>R</i>)-pSi, which have oligo(dimethylsiloxane) as a low-surface-energy moiety, were synthesized and used as surface-segregated monolayers (SSMs) in spin-coated films of several achiral fullerene derivatives. Upon thermal annealing, the presence of the chiral SSMs led to the crystallization of the fullerenes in the films as an SSM-induced crystal phase at lower temperatures. The crystallized films showed circular dichroism ascribed to the fullerene absorption, the sign and the intensity of which depended on the handedness of the SSM molecules and the film thickness, respectively. These results indicate that the achiral fullerene derivatives in the films were induced by the SSMs to crystallize into enantiomorphic crystals. Our approach to inducing chirality in organic thin films is compatible with many device applications.
Also flagged:aminoquinazolinesphosphatescopper ionscopperphosphoric acid
Journal Article2020-04-17No SnippetsAoki K, Osako R, Deng J, Hayashita T, Hashimoto T, Suzuki Y.
Show Full Abstract
Detection and visualization of phosphates such as ATP in living organisms can facilitate the elucidation of various biological events. Although substantial efforts had been made in this area, present methods have disadvantages such as the need for specialized equipment and poor sensitivities. To address these limitations, novel fluorescent probes, (di-(2-picolyl)amino)quinazolines, were developed for application in ATP detection. They selectively recognized copper ions by fluorescence quenching, and their copper complexes displayed fluorescence enhancement in the presence of phosphoric acid derivatives. This fluorescence on-off system enabled highly sensitive fluorescence detection of ATP when combined with a phenyl boronic acid-modified γ-cyclodextrin through a plausible multipoint recognition system.
Also flagged:Pyrimidinehand, foot, and mouth diseaseencephalitismyocarditisacute flaccid myelitispneumonia
Journal Article2020-04-16✓ 3 SnippetsXu N, Yang J, Zheng B, Zhang Y, Cao Y, Huan C, Wang S, Chang J, Zhang W.
In-Text Gene Mentions
Introduction)
…In recent years, CA6 and CA10 have been reported to be responsible for HFMD (14, –, 17).…
Introduction)
…years, CA6 andCA10have been reported…
Discussion)
…EV71, CA16, CA6,CA10, CVB3, and EVD68,…
Show Full Abstract
Human enteroviruses (EVs), including coxsackieviruses, the numbered enteroviruses, and echoviruses, cause a wide range of diseases, such as hand, foot, and mouth disease (HFMD), encephalitis, myocarditis, acute flaccid myelitis (AFM), pneumonia, and bronchiolitis. Therefore, broad-spectrum anti-EV drugs are urgently needed to treat EV infection. Here, we demonstrate that FNC (2'-deoxy-2'-β-fluoro-4'-azidocytidine), a small nucleoside analog inhibitor that has been demonstrated to be a potent inhibitor of HIV and entered into a clinical phase II trial in China, potently inhibits the viral replication of a multitude of EVs, including enterovirus 71 (EV71), coxsackievirus A16 (CA16), CA6, EVD68, and coxsackievirus B3 (CVB3), at the nanomolar level. The antiviral mechanism of FNC involves mainly positive- and negative-strand RNA synthesis inhibition by targeting and competitively inhibiting the activity of EV71 viral RNA-dependent RNA polymerase (3D<sup>pol</sup>), as demonstrated through quantitative real-time reverse transcription-PCR (RT-qPCR), <i>in vitro</i> 3D<sup>pol</sup> activity, and isothermal titration calorimetry (ITC) experiments. We further demonstrated that FNC treatment every 2 days with 1 mg/kg of body weight in EV71 and CA16 infection neonatal mouse models successfully protected mice from lethal challenge with EV71 and CA16 viruses and reduced the viral load in various tissues. These findings provide important information for the clinical development of FNC as a broad-spectrum inhibitor of human EV pathogens.<b>IMPORTANCE</b> Human enterovirus (EV) pathogens cause various contagious diseases such as hand, foot, and mouth disease, encephalitis, myocarditis, acute flaccid myelitis, pneumonia, and bronchiolitis, which have become serious health threats. However, except for the EV71 vaccine on the market, there are no effective strategies to prevent and treat other EV pathogen infections. Therefore, broad-spectrum anti-EV drugs are urgently needed. In this study, we demonstrated that FNC, a small nucleoside analog inhibitor that has been demonstrated to be a potent inhibitor of HIV and entered into a clinical phase II trial in China, potently inhibits the viral replication of a multitude of EVs at the nanomolar level. Further investigation revealed that FNC inhibits positive- and negative-strand RNA synthesis of EVs by interacting and interfering with the activity of EV71 viral RNA-dependent RNA polymerase (3D<sup>pol</sup>). Our findings demonstrate for the first time that FNC is an effective broad-spectrum inhibitor for human EV pathogens.
Also flagged:PyrroleDihydroorotate DehydrogenaseMalariapyrimidineDHODHpyrroles
Journal Article2020-04-16No SnippetsKokkonda S, Deng X, White KL, El Mazouni F, White J, Shackleford DM, Katneni K, Chiu FCK, Barker H, McLaren J, Crighton E, Chen G, Angulo-Barturen I, Jimenez-Diaz MB, Ferrer S, Huertas-Valentin L, Martinez-Martinez MS, Lafuente-Monasterio MJ, Chittimalla R, Shahi SP, Wittlin S, Waterson D, Burrows JN, Matthews D, Tomchick D, Rathod PK, Palmer MJ, Charman SA, Phillips MA.
Show Full Abstract
Malaria puts at risk nearly half the world's population and causes high mortality in sub-Saharan Africa, while drug resistance threatens current therapies. The pyrimidine biosynthetic enzyme dihydroorotate dehydrogenase (DHODH) is a validated target for malaria treatment based on our finding that triazolopyrimidine DSM265 (<b>1</b>) showed efficacy in clinical studies. Herein, we describe optimization of a pyrrole-based series identified using a target-based DHODH screen. Compounds with nanomolar potency versus <i>Plasmodium</i> DHODH and <i>Plasmodium</i> parasites were identified with good pharmacological properties. X-ray studies showed that the pyrroles bind an alternative enzyme conformation from <b>1</b> leading to improved species selectivity versus mammalian enzymes and equivalent activity on <i>Plasmodium falciparum</i> and <i>Plasmodium vivax</i> DHODH. The best lead DSM502 (<b>37</b>) showed <i>in vivo</i> efficacy at similar levels of blood exposure to <b>1</b>, although metabolic stability was reduced. Overall, the pyrrole-based DHODH inhibitors provide an attractive alternative scaffold for the development of new antimalarial compounds.
Also flagged:hydrocarbonnanoparticleDicyclohexylcarbodiimideOligonucleotidesilicaiodine
Journal Article2020-04-16✓ 1 SnippetKockelmann J, Stickdorn J, Kasmi S, De Vrieze J, Pieszka M, Ng DYW, David SA, De Geest BG, Nuhn L.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
The reactivation of the innate immune system by toll-like receptor (TLR) agonists holds promise for anticancer immunotherapy. Severe side effects caused by unspecific and systemic activation of the immune system upon intravenous injection prevent the use of small-molecule TLR agonists for such purposes. However, a covalent attachment of small-molecule imidazoquinoline (IMDQ) TLR7/8 agonists to pH-degradable polymeric nanogels could be shown to drastically reduce the systemic inflammation but retain the activity to tumoral tissues and their draining lymph nodes. Here, we introduce the synthesis of poly(norbornene)-based, acid-degradable nanogels for the covalent ligation of IMDQs. While the intact nanogels trigger sufficient TLR7/8 receptor stimulation, their degraded version of soluble, IMDQ-conjugated poly(norbornene) chains hardly activates TLR7/8. This renders their clinical safety profile, as degradation products are obtained, which would not only circumvent nanoparticle accumulation in the body but also provide nonactive, polymer-bound IMDQ species. Their immunologically silent behavior guarantees both spatial and temporal control over immune activity and, thus, holds promise for improved clinical applications.
Also flagged:chronic obstructive pulmonary diseaseCOPDoxygenobstructive lung diseaseinflammatory airwaychronic asthma
Journal Article2020-04-16No SnippetsBurge AT, Cox NS, Abramson MJ, Holland AE.
Show Full Abstract
<h4>Background</h4>Escalating awareness of the magnitude of the challenge posed by low levels of physical activity in people with chronic obstructive pulmonary disease (COPD) highlights the need for interventions to increase physical activity participation. The widely-accepted benefits of physical activity, coupled with the increasing availability of wearable monitoring devices to objectively measure participation, has led to a dramatic rise in the number and variety of studies that aimed to improve the physical activity of people with COPD. However, little was known about the relative efficacy of interventions tested so far.<h4>Objectives</h4>In people with COPD, which interventions are effective at improving objectively-assessed physical activity?<h4>Search methods</h4>We identified trials from the Cochrane Airways Trials Register Register, which contains records identified from bibliographic databases including the Cochrane Central Register of Controlled Trials, MEDLINE, Embase, CINAHL, AMED, and PsycINFO. We also searched PEDro, ClinicalTrials.gov, the World Health Organization International Clinical Trials Registry Platform portal and the Australian New Zealand Clinical Trials Registry (from inception to June 2019). We checked reference lists of all primary studies and review articles for additional references, as well as respiratory journals and respiratory meeting abstracts, to identify relevant studies.<h4>Selection criteria</h4>We included randomised controlled trials of interventions that used objective measures for the assessment of physical activity in people with COPD. Trials compared an intervention with no intervention or a sham/placebo intervention, an intervention in addition to another standard intervention common to both groups, or two different interventions.<h4>Data collection and analysis</h4>We used standard methods recommended by Cochrane. Subgroup analyses were possible for supervised compared to unsupervised pulmonary rehabilitation programmes in clinically-stable COPD for a range of physical activity outcomes. Secondary outcomes were health-related quality of life, exercise capacity, adverse events and adherence. Insufficient data were available to perform prespecified subgroup analyses by duration of intervention or disease severity. We undertook sensitivity analyses by removing studies that were at high or unclear risk of bias for the domains of blinding and incomplete outcome data.<h4>Main results</h4>We included 76 studies with 8018 participants. Most studies were funded by government bodies, although some were sponsored by equipment or drug manufacturers. Only 38 studies had physical activity as a primary outcome. A diverse range of interventions have been assessed, primarily in single studies, but improvements have not been systematically demonstrated following any particular interventions. Where improvements were demonstrated, results were confined to single studies, or data for maintained improvement were not provided. Step count was the most frequently reported outcome, but it was commonly assessed using devices with documented inaccuracy for this variable. Compared to no intervention, the mean difference (MD) in time in moderate- to vigorous-intensity physical activity (MVPA) following pulmonary rehabilitation was four minutes per day (95% confidence interval (CI) -2 to 9; 3 studies, 190 participants; low-certainty evidence). An improvement was demonstrated following high-intensity interval exercise training (6 minutes per day, 95% CI 4 to 8; 2 studies, 275 participants; moderate-certainty evidence). One study demonstrated an improvement following six months of physical activity counselling (MD 11 minutes per day, 95% CI 7 to 15; 1 study, 280 participants; moderate-certainty evidence), but we found mixed results for the addition of physical activity counselling to pulmonary rehabilitation. There was an improvement following three to four weeks of pharmacological treatment with long-acting muscarinic antagonist and long-acting beta<sub>2</sub>-agonist (LAMA/LABA) compared to placebo (MD 10 minutes per day, 95% CI 4 to 15; 2 studies, 423 participants; high-certainty evidence). These interventions also demonstrated improvements in other measures of physical activity. Other interventions included self-management strategies, nutritional supplementation, supplemental oxygen, endobronchial valve surgery, non-invasive ventilation, neuromuscular electrical stimulation and inspiratory muscle training.<h4>Authors' conclusions</h4>A diverse range of interventions have been assessed, primarily in single studies. Improvements in physical activity have not been systematically demonstrated following any particular intervention. There was limited evidence for improvement in physical activity with strategies including exercise training, physical activity counselling and pharmacological management. The optimal timing, components, duration and models for interventions are still unclear. Assessment of quality was limited by a lack of methodological detail. There was scant evidence for a continued effect over time following completion of interventions, a likely requirement for meaningful health benefits for people with COPD.
Also flagged:histone deacetylasegene expressionmitotic deacetylaseHDACneurogenesisSLIT3
Journal Article2020-04-16✓ 4 SnippetsMondal B, Jin H, Kallappagoudar S, Sedkov Y, Martinez T, Sentmanat MF, Poet GJ, Li C, Fan Y, Pruett-Miller SM, Herz HM.
In-Text Gene Mentions
Results)
…We investigated SLIT3 and NETRIN1 (NTN1), which are key ligands of the SLIT/ROBO and NETRIN/DCC/UNC signaling pathways, and are regulators of neuron maturation and neurite outgrowth but are also playing roles in angiogenesis, lung morphogenesis, mammary gland development and cancer progression involving processes such as cell migration, cell interaction and cell adhesion (Bashaw and Klein, 2010; Blockus and Chédotal, 2016; Lai Wing Sun et al., 2011; Seiradake et al., 2016).…
Results)
…the SLIT/ROBO and NETRIN/DCC/UNC signaling pathways, and…
Results)
…the SLIT3/ROBO3 and NTN1/DCC/UNC5B signaling axes from…
Discussion)
…SLIT/ROBO, EPHRIN/EPH, NETRIN/DCC/UNC, and SEMAPHORIN/PLEXIN si…
Show Full Abstract
The mitotic deacetylase complex (MiDAC) is a recently identified histone deacetylase (HDAC) complex. While other HDAC complexes have been implicated in neurogenesis, the physiological role of MiDAC remains unknown. Here, we show that MiDAC constitutes an important regulator of neural differentiation. We demonstrate that MiDAC functions as a modulator of a neurodevelopmental gene expression program and binds to important regulators of neurite outgrowth. MiDAC upregulates gene expression of pro-neural genes such as those encoding the secreted ligands SLIT3 and NETRIN1 (NTN1) by a mechanism suggestive of H4K20ac removal on promoters and enhancers. Conversely, MiDAC inhibits gene expression by reducing H3K27ac on promoter-proximal and -distal elements of negative regulators of neurogenesis. Furthermore, loss of MiDAC results in neurite outgrowth defects that can be rescued by supplementation with SLIT3 and/or NTN1. These findings indicate a crucial role for MiDAC in regulating the ligands of the SLIT3 and NTN1 signaling axes to ensure the proper integrity of neurite development.
Also flagged:gene expressioncytoskeletonmetabolismimmunoglobulinphagosomedendritic cell maturation
Journal Article2020-04-16No SnippetsAlcorn JF, Avula R, Chakka AB, Schwarzmann WE, Nowalk MP, Lin CJ, Ortiz MA, Horne WT, Chandran UR, Nagg JP, Zimmerman RK, Cole KS, Moehling KK, Martin JM.
Show Full Abstract
The human immune response to inactivated influenza vaccine is dynamic and impacted by age and preexisting immunity. Our goal was to identify postvaccination transcriptomic changes in peripheral blood mononuclear cells from children. Blood samples were obtained before and at 3 or 7 days postvaccination with 2016-2017 quadrivalent inactivated influenza vaccine and RNA sequencing was performed. There were 1,466 differentially expressed genes (DEGs) for the Day 0-Day 3 group and 513 DEGs for the Day 0-Day 7 group. Thirty-three genes were common between the two groups. The majority of the transcriptomic changes at Day 3 represented innate inflammation and apoptosis pathways. Day 7 DEGs were characterized by activation of cellular processes, including the regulation of cytoskeleton, junctions, and metabolism, and increased expression of immunoglobulin genes. DEGs at Day 3 were compared between older and younger children revealing increased inflammatory gene expression in the older group. Vaccine history in the year prior to the study was characterized by robust DEGs at Day 3 with decreased phagosome and dendritic cell maturation in those who had been vaccinated in the previous year. PBMC responses to inactivated influenza vaccination in children differed significantly by the timing of sampling, patient age, and vaccine history. These data provide insight into the expected molecular pathways to be temporally altered by influenza vaccination in children.
Also flagged:neoplasiagene expressioncognitionintellectual disabilityautism spectrum disorderattention-deficit/hyperactivity disorder
Journal Article2020-04-16✓ 1 Snippetvan Essen MJ, Nayler S, Becker EBE, Jacob J.
In-Text Gene Mentions
Introduction)
…, and thechromatin modifiermodifier chromodomain helicase…
Show Full Abstract
The cerebellum is a pivotal centre for the integration and processing of motor and sensory information. Its extended development into the postnatal period makes this structure vulnerable to a variety of pathologies, including neoplasia. These properties have prompted intensive investigations that reveal not only developmental mechanisms in common with other regions of the neuraxis but also unique strategies to generate neuronal diversity. How the phenotypically distinct cell types of the cerebellum emerge rests on understanding how gene expression differences arise in a spatially and temporally coordinated manner from initially homogeneous cell populations. Increasingly sophisticated fate mapping approaches, culminating in genetic-induced fate mapping, have furthered the understanding of lineage relationships between early- versus later-born cells. Tracing the developmental histories of cells in this way coupled with analysis of gene expression patterns has provided insight into the developmental genetic programmes that instruct cellular heterogeneity. A limitation to date has been the bulk analysis of cells, which blurs lineage relationships and obscures gene expression differences between cells that underpin the cellular taxonomy of the cerebellum. This review emphasises recent discoveries, focusing mainly on single-cell sequencing in mouse and parallel human studies that elucidate neural progenitor developmental trajectories with unprecedented resolution. Complementary functional studies of neural repair after cerebellar injury are challenging assumptions about the stability of postnatal cellular identities. The result is a wealth of new information about the developmental mechanisms that generate cerebellar neural diversity, with implications for human evolution.
…se, gout, hyperparathyroidism,hemochromatosis, and Wilson disease,…
Show Full Abstract
<h4>Objective</h4>To determine if findings of "cartilage icing" and chondrocalcinosis on knee radiography can differentiate between gout and calcium pyrophosphate deposition (CPPD).<h4>Methods</h4>IRB-approval was obtained and informed consent was waived for this retrospective study. Electronic medical records from over 2.3 million patients were searched for keywords to identify subjects with knee aspiration-proven cases of gout or CPPD. Radiographs were reviewed by two fellowship-trained musculoskeletal radiologists in randomized order, blinded to the patients' diagnoses. Images were evaluated regarding the presence or absence of cartilage icing, chondrocalcinosis, tophi, gastrocnemius tendon calcification, and joint effusion. Descriptive statistics, sensitivity, specificity, positive and negative predictive values, and accuracy were calculated.<h4>Results</h4>From 49 knee radiographic studies in 46 subjects (31 males and 15 females; mean age 66±13 years), 39% (19/49) showed gout and 61% (30/49) CPPD on aspiration. On knee radiographs, cartilage icing showed a higher sensitivity for CPPD than gout (53-67% and 26%, respectively). Chondrocalcinosis also showed a higher sensitivity for CPPD than gout (50-57% versus 5%), with 95% specificity and 94% positive predictive value for diagnosis of CPPD versus gout. Soft tissue tophus-like opacities were present in gout at the patellar tendon (5%, 1/19) and at the popliteus groove in CPPD (15%, 4/27). Gastrocnemius tendon calcification was present in 30% (8/27) of subjects with CPPD, and 5% (1/19) of gout.<h4>Conclusion</h4>In subjects with joint aspiration-proven crystal disease of the knee, the radiographic finding of cartilage icing was seen in both gout and CPPD. Chondrocalcinosis (overall and hyaline cartilage) as well as gastrocnemius tendon calcification positively correlated with the diagnosis of CPPD over gout.
Also flagged:CA9tumourtongue squamous cell carcinomacancerpathogenesiscell differentiation
Journal Article2020-04-16No SnippetsGuan C, Ouyang D, Qiao Y, Li K, Zheng G, Lao X, Zhang S, Liao G, Liang Y.
Show Full Abstract
CA9 is a member of the carbonic anhydrases' family, that is often expressed in cancer cells under hypoxic condition. However, the role of CA9 in the molecular mechanisms of tongue squamous cell carcinoma (TSCC) pathogenesis remains unclear. CA9 expression was analysed using the TCGA database, and its influence on survival was performed using Kaplan-Meier, LASSO and COX regression analyses. The correlation between CA9 and immune infiltration was investigated by CIBERSORT and ESTIMATE. Moreover, the relationship between CA9 expression and downstream molecular regulation pathways was analysed by GSEA, GO and WGCNA. CA9 expression correlated with clinical prognosis and tumour grade in TSCC. Moreover, CA9 expression potentially contributes to the regulation of cancer cell differentiation and mediates tumour-associated genes and signalling pathways, including apoptosis, hypoxia, G2M checkpoint, PI3K/AKR/mTOR signalling and TGF-beta signalling pathways. However, the follicular helper T cells, regulatory T cells, immune and stromal scores showed no significance between high and low CA9 expression groups. These findings suggested that CA9 plays a critical role of TSCC prognosis and tumour grade. CA9 expression significantly correlated with the regulation of cell differentiation, various oncogenes and cancer-associated pathways.
Also flagged:chromatingene expressionnucleotideschizophreniaSETD1Ahistone methyltransferase
Journal Article2020-04-16✓ 2 SnippetsMoriano J, Boeckx C.
In-Text Gene Mentions
Results)
…Among these, some well-studied disease-relevant genes are found: HTT (Huntington disease) [11], FOXP2 (language impairment) [12], CHD8 and CPEB4 (autism spectrum disorder) [13, 14], TCF4 (Pitt-Hopkins syndrome and schizophrenia) [15, 16], GLI3 (macrocephaly and Greig cephalopolysyndactyly syndrome) [17], PHC1 (primary, autosomal recessive, microcephaly-11) [18], RCAN1 (Down syndrome) [19], and DYNC1H1 (cortical malformations and microcephaly) [20].…
Results)
…genes are found:HTT(Huntington disease) […
Show Full Abstract
<h4>Background</h4>Recent paleogenomic studies have highlighted a very small set of proteins carrying modern human-specific missense changes in comparison to our closest extinct relatives. Despite being frequently alluded to as highly relevant, species-specific differences in regulatory regions remain understudied. Here, we integrate data from paleogenomics, chromatin modification and physical interaction, and single-cell gene expression of neural progenitor cells to identify derived regulatory changes in the modern human lineage in comparison to Neanderthals/Denisovans. We report a set of genes whose enhancers and/or promoters harbor modern human single nucleotide changes and are active at early stages of cortical development.<h4>Results</h4>We identified 212 genes controlled by regulatory regions harboring modern human changes where Neanderthals/Denisovans carry the ancestral allele. These regulatory regions significantly overlap with putative modern human positively-selected regions and schizophrenia-related genetic loci. Among the 212 genes, we identified a substantial proportion of genes related to transcriptional regulation and, specifically, an enrichment for the SETD1A histone methyltransferase complex, known to regulate WNT signaling for the generation and proliferation of intermediate progenitor cells.<h4>Conclusions</h4>This study complements previous research focused on protein-coding changes distinguishing our species from Neanderthals/Denisovans and highlights chromatin regulation as a functional category so far overlooked in modern human evolution studies. We present a set of candidates that will help to illuminate the investigation of modern human-specific ontogenetic trajectories.
Also flagged:endometriosispathogenesisendometriotic cystwound repairSMARCD1matrix metallopeptidase 1
Journal Article2020-04-16No SnippetsTakebayashi K, Nasu K, Okamoto M, Aoyagi Y, Hirakawa T, Narahara H.
Show Full Abstract
<h4>Background</h4>A number of microRNAs are aberrantly expressed in endometriosis and are involved in its pathogenesis. Our previous study demonstrated that has-miR-100-5p expression is enhanced in human endometriotic cyst stromal cells (ECSCs). The present study aimed to elucidate the roles of has-miR-100-5p in the pathogenesis of endometriosis.<h4>Methods</h4>Normal endometrial stromal cells (NESCs) were isolated from normal eutopic endometrium without endometriosis. Using hsa-miR-100-5p-transfected NESCs, we evaluated the effect of hsa-miR-100-5p on the invasiveness of these cells by Transwell invasion assay and in-vitro wound repair assay. We also investigated the downstream signal pathways of hsa-miR-100-5p by microarray analysis and Ingenuity pathways analysis.<h4>Results</h4>hsa-miR-100-5p transfection enhanced the invasion and motility of NESCs. After hsa-miR-100-5p transfection, mRNA expression of SWItch/sucrose non-fermentable-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 (SMARCD1) was significantly attenuated. Whereas, the expression of matrix metallopeptidase 1 (MMP1) mRNA and active MMP1 protein levels was upregulated.<h4>Conclusion</h4>We found that SMARCD1/MMP-1 is a downstream pathway of hsa-miR-100-5p. hsa-miR-100-5p transfection enhanced the motility of NESCs by inhibiting SMARCD1 expression and MMP1 activation. These findings suggest that enhanced hsa-miR-100-5p expression in endometriosis is involved in promoting the acquisition of endometriosis-specific characteristics during endometriosis development. Our present findings on the roles of hsa-miR-100-5p may thus contribute to understand the epigenetic mechanisms involved in the pathogenesis of endometriosis.
Also flagged:spindleNocodazolePRC1Microtubulealpha-tubulinHistone H2B
Journal Article2020-04-16✓ 1 SnippetTotsuka T, Ohsugi M.
In-Text Gene Mentions
Introduction)
…processes such as protamine-histone exchangeexchange 11 .…
Show Full Abstract
To study the functional differences between maternal and paternal genomes in mammalian development, embryos with only one parental genome are often used. Androgenetic embryos are produced by the removal of maternal chromosomes before or after fertilization by techniques that require specialized skills and are associated with high risk of cellular damage. Here, we developed a novel method for producing androgenetic mouse embryos without the invasive enucleation process. We found that during in vitro fertilization in the presence of low-dose nocodazole, a microtubule destabilizing drug, whole oocyte chromosomes were extruded into the second polar body resulting in the production of androgenetic embryos. We further demonstrated that low-dose nocodazole decreased the spindle size and prevented chromosome segregation but did not compromise oocyte meiotic resumption. This led to the formation of a protrusion around the chromosomes, accumulation of protein regulator of cytokinesis 1 (PRC1) to the microtubules around the chromosomes, and assembly of a contractile ring at the neck region of the protrusion. Our method uses the intrinsic cytokinetic mechanism to exclude maternal chromatin from zygotes and may be applicable to other mammals.
Also flagged:cancerdeathresponse to signalsbindingextracellularcell proliferation
Journal Article2020-04-16✓ 5 SnippetsPark SY, Park SY, Nam JS.
In-Text Gene Mentions
S I O 001029)
…Then, activated integrin signaling led to DCC reactivation and promoted the proliferation of cancer cells at the metastatic lesion.…
Abstract)
…the biology ofDCCreawakening is key…
I A O 0000615)
…reports propose thatDCCreawakening is the…
I A O 0000615)
…act as substantialDCC-reawakening factors.…
I A O 0000615)
…are involved inDCCreawakening are currently…
Show Full Abstract
Recurrent cancer that spreads to distant sites is the leading cause of disease-related death among cancer patients. Cancer cells are likely to disseminate during cancer progression, and some may enter dormancy, remaining viable but not increasing. These dormant cancer cells (DCCs) are rarely detectable with current diagnostic systems. Moreover, they can interpret homoeostatic signals from the microenvironment, thereby evading immune surveillance and chemotherapy. Eventually, DCCs can reawaken in response to signals, which are not yet fully understood, resulting in recurrence and metastasis. Therefore, understanding the biology of DCC reawakening is key to preventing metastasis. Over the last decade, a growing body of literature has revealed the mechanisms involved in cancer dormancy and reawakening. The cytotoxic activity of immune cells can cause cancer cells to enter a dormant state, and chronic inflammation can reactivate cancer proliferation at distant sites. Upon the binding of circulating DCCs to extracellular molecules, various signaling cascades are activated and reinitiate cell proliferation. In the present review, we attempt to consolidate the existing literature to provide a framework for the understanding of this crucial step in cancer progression.
Also flagged:fatty acidcarboxypeptidase MCPMmyristic acidfatty acidssaturated fatty acids
Journal Article2020-04-16✓ 1 SnippetShi L, Liu L, Lv X, Ma Z, Li C, Li Y, Zhao F, Sun D, Han B.
In-Text Gene Mentions
Abstract)
…dimeric binding sites),SOX6(sex-determining region Y-box…
Show Full Abstract
Our previous GWAS revealed 83 significant SNPs and 20 promising candidate genes associated with milk fatty acid traits in dairy cattle. Out of them, the carboxypeptidase M (CPM) gene contains a genome-wide significant SNP, Hapmap49848-BTA-106779, which is strongly associated with myristic acid (C14:0; P = 0.0064). Herein, we aimed to confirm the genetic effects of CPM on milk fatty acids in Chinese Holstein. Seven SNPs were detected by re-sequencing the sequences of entire exons and 3000 bp of up-/downstream flanking regions of the CPM gene, of which three were in 5' flanking region, one in the 3' UTR and three were in the 3' flanking region. Using the Haploview 4.1, we estimated the LD among the identified SNPs and found two haplotype blocks. With the animal model, we performed the SNP- and haplotype-based association analyses, and observed that these SNPs and haplotype blocks mainly had strong genetic associations with medium-chain saturated fatty acids (caproic acid, C6:0; caprylic acid, C8:0; capric acid, C10:0; and lauric acid, C12:0) (P < 0.0001-0.0257). In addition, using the Genomatix software, we predicted that three SNPs in the 5' flanking region of CPM (g.45079507A>G, g.45080228C>A and g.45080335C>G) changed the transcription factor binding sites for PREF (progesterone receptor biding site), ZBRK1 (transcription factor with eight central zinc fingers and an N-terminal KRAB domain), SOX9 (sex-determining region Y-box 9, dimeric binding sites), SOX6 (sex-determining region Y-box 6) and FOXP1-ES (alternative splicing variant of FOXP1, activated in ESCs). Further, the dual-luciferase reporter assay showed these three SNPs altered the transcriptional activity of CPM gene (P ≤ 0.0006). In summary, using the post-GWAS strategy, we first confirmed the significant genetic effects of CPM with milk fatty acids in dairy cattle, and identified three potential causal mutations.
Also flagged:ribonucleosidespseudouridinemethylationsseleniumcancerdevelopmental illnesses
Journal Article2020-04-16No SnippetsMcCown PJ, Ruszkowska A, Kunkler CN, Breger K, Hulewicz JP, Wang MC, Springer NA, Brown JA.
Show Full Abstract
The chemical identity of RNA molecules beyond the four standard ribonucleosides has fascinated scientists since pseudouridine was characterized as the "fifth" ribonucleotide in 1951. Since then, the ever-increasing number and complexity of modified ribonucleosides have been found in viruses and throughout all three domains of life. Such modifications can be as simple as methylations, hydroxylations, or thiolations, complex as ring closures, glycosylations, acylations, or aminoacylations, or unusual as the incorporation of selenium. While initially found in transfer and ribosomal RNAs, modifications also exist in messenger RNAs and noncoding RNAs. Modifications have profound cellular outcomes at various levels, such as altering RNA structure or being essential for cell survival or organism viability. The aberrant presence or absence of RNA modifications can lead to human disease, ranging from cancer to various metabolic and developmental illnesses such as Hoyeraal-Hreidarsson syndrome, Bowen-Conradi syndrome, or Williams-Beuren syndrome. In this review article, we summarize the characterization of all 143 currently known modified ribonucleosides by describing their taxonomic distributions, the enzymes that generate the modifications, and any implications in cellular processes, RNA structure, and disease. We also highlight areas of active research, such as specific RNAs that contain a particular type of modification as well as methodologies used to identify novel RNA modifications. This article is categorized under: RNA Processing > RNA Editing and Modification.
Also flagged:RAB10ionschromosomesdodecylphagosomenuclei
Journal Article2020-04-16No SnippetsBesusso D, Schellino R, Boido M, Belloli S, Belloli S, Parolisi R, Conforti P, Faedo A, Cernigoj M, Campus I, Laporta A, Bocchi VD, Murtaj V, Parmar M, Spaiardi P, Talpo F, Maniezzi C, Toselli MG, Biella G, Moresco RM, Vercelli A, Buffo A, Cattaneo E.
Show Full Abstract
Huntington disease (HD) is an inherited late-onset neurological disorder characterized by progressive neuronal loss and disruption of cortical and basal ganglia circuits. Cell replacement using human embryonic stem cells may offer the opportunity to repair the damaged circuits and significantly ameliorate disease conditions. Here, we showed that in-vitro-differentiated human striatal progenitors undergo maturation and integrate into host circuits upon intra-striatal transplantation in a rat model of HD. By combining graft-specific immunohistochemistry, rabies virus-mediated synaptic tracing, and ex vivo electrophysiology, we showed that grafts can extend projections to the appropriate target structures, including the globus pallidus, the subthalamic nucleus, and the substantia nigra, and receive synaptic contact from both host and graft cells with 6.6 ± 1.6 inputs cell per transplanted neuron. We have also shown that transplants elicited a significant improvement in sensory-motor tasks up to 2 months post-transplant further supporting the therapeutic potential of this approach.
Also flagged:RAB10ionschromosomesdodecylphagosomenuclei
Journal Article2020-04-16No SnippetsChen MJ, Lummertz da Rocha E, Cahan P, Kubaczka C, Hunter P, Sousa P, Mullin NK, Fujiwara Y, Nguyen M, Tan Y, Landry S, Han A, Yang S, Lu YF, Jha DK, Vo LT, Zhou Y, North TE, Zon LI, Daley GQ, Schlaeger TM.
Show Full Abstract
Studies of hematopoietic stem cell (HSC) development from pre-HSC-producing hemogenic endothelial cells (HECs) are hampered by the rarity of these cells and the presence of other cell types with overlapping marker expression profiles. We generated a Tg(Runx1-mKO2; Ly6a-GFP) dual reporter mouse to visualize hematopoietic commitment and study pre-HSC emergence and maturation. Runx1-mKO2 marked all intra-arterial HECs and hematopoietic cluster cells (HCCs), including pre-HSCs, myeloid- and lymphoid progenitors, and HSCs themselves. However, HSC and lymphoid potential were almost exclusively found in reporter double-positive (DP) cells. Robust HSC activity was first detected in DP cells of the placenta, reflecting the importance of this niche for (pre-)HSC maturation and expansion before the fetal liver stage. A time course analysis by single-cell RNA sequencing revealed that as pre-HSCs mature into fetal liver stage HSCs, they show signs of interferon exposure, exhibit signatures of multi-lineage differentiation gene expression, and develop a prolonged cell cycle reminiscent of quiescent adult HSCs.
Also flagged:Carbonic Anhydrase VIIINucleotidecarbonic anhydrase 8CA-VIIIbindingITPR1
Journal Article2020-04-16No SnippetsSanyanga TA, Tastan Bishop Ö.
Show Full Abstract
Human carbonic anhydrase 8 (CA-VIII) is an acatalytic isoform of the α -CA family. Though the protein cannot hydrate CO<sub>2</sub>, CA-VIII is essential for calcium (Ca<sup>2+</sup>) homeostasis within the body, and achieves this by allosterically inhibiting the binding of inositol 1,4,5-triphosphate (IP<sub>3</sub>) to the IP<sub>3</sub> receptor type 1 (ITPR1) protein. However, the mechanism of interaction of CA-VIII to ITPR1 is not well understood. In addition, functional defects to CA-VIII due to non-synonymous single nucleotide polymorphisms (nsSNVs) result in Ca<sup>2+</sup> dysregulation and the development of the phenotypes such as cerebellar ataxia, mental retardation and disequilibrium syndrome 3 (CAMRQ3). The pathogenesis of CAMRQ3 is also not well understood. The structure and function of CA-VIII was characterised, and pathogenesis of CAMRQ3 investigated. Structural and functional characterisation of CA-VIII was conducted through SiteMap and CPORT to identify potential binding site residues. The effects of four pathogenic nsSNVs, S100A, S100P, G162R and R237Q, and two benign S100L and E109D variants on CA-VIII structure and function was then investigated using molecular dynamics (MD) simulations, dynamic cross correlation (DCC) and dynamic residue network (DRN) analysis. SiteMap and CPORT analyses identified 38 unique CA-VIII residues that could potentially bind to ITPR1. MD analysis revealed less conformational sampling within the variant proteins and highlighted potential increases to variant protein rigidity. Dynamic cross correlation (DCC) showed that wild-type (WT) protein residue motion is predominately anti-correlated, with variant proteins showing no correlation to greater residue correlation. DRN revealed variant-associated increases to the accessibility of the N-terminal binding site residues, which could have implications for associations with ITPR1, and further highlighted differences to the mechanism of benign and pathogenic variants. SNV presence is associated with a reduction to the usage of Trp37 in all variants, which has implications for CA-VIII stability. The differences to variant mechanisms can be further investigated to understand pathogenesis of CAMRQ3, enhancing precision medicine-related studies into CA-VIII.
…In the second step, the template with a fibrous three-dimensional structure was loaded with calcium phosphates (CPs), resulting in a hybrid composite consisting of a network of randomly distributed polymeric fibres covered with a layer of CPs having different compositions, which are most likely a combination between brushite (CaHPO4·2H2O) as a major phase and hydroxyapatite (Ca10(PO4)6(OH)2) as a minor phase [51].…
Show Full Abstract
The current work focuses on the development of mineral scaffolds with complex composition and controlled morphology by using a polymeric template in the form of nonwoven fibre webs fabricated through electrospinning. By a cross-linking process, gelatine fibres stable in aqueous solutions were achieved, these being further subjected to a loading step with two types of mineral phases: calcium phosphates deposited by chemical reaction and barium titanate nanoparticles as decoration on the previously achieved structures. Thus, hybrid materials were obtained and subsequently processed in terms of freeze-drying and heat treating with the purpose of burning the template and consolidating the mineral part as potential bone implants with improved biological response by external stimulation. The results confirmed the tunable morphology, as well as the considerable applicability of both as-prepared and final samples for the development of medical devices, which encourages the continuation of research in the direction of assessing the synergistic contribution of barium titanate domains polarisation/magnetisation by external applied fields.
Also flagged:Gliomaprimarytumourgliomasglioblastomatumour of
Journal Article2020-04-16No SnippetsZhang Y, Lin X, Geng X, Shi L, Li Q, Liu F, Fang C, Wang H.
Show Full Abstract
Glioma is the most common primary tumour of the central nervous system, and is associated with a high postoperative recurrence rate and resistance to chemotherapy. High‑grade glioblastoma in particular has a very poor prognosis and poses a serious threat to human health. Related studies have confirmed that the occurrence and development of gliomas are closely associated with the abnormal expression and regulation of genes. Moreover, the number of studies on the association of the expression of non‑coding RNAs [linear RNAs, microRNAs and circular RNAs (circRNAs)] in human cells with glioma has been gradually increasing in recent years. Among those, circRNAs, previously considered to be 'splicing errors', have been shown to be highly expressed in eukaryotic cells and regulate the biological behaviour of gliomas. circRNAs are highly abundant and stable, and have become a research hotspot in the field of glioma molecular biology. The aim of the present review was to focus on the research progress regarding the association between circRNA expression and gliomas, and to provide a theoretical basis according to the currently available literature for further exploring this association. The present study may be of value for the early diagnosis, pathological grading, targeted therapy and prognostic evaluation of gliomas.
Also flagged:gene expressionFZD8SRGAP2ARHGAP11BTBC1D3chromosome
Journal Article2020-04-16✓ 5 SnippetsLi M, Zhang W, Zhou X.
In-Text Gene Mentions
Methods)
…isoform of theSTAU1gene are ENST00000371856,…
Results)
…STAU1was also located…
Results)
…STAU1encoding the double-stranded…
Results)
…isoforms of humanSTAU1.…
Results)
…studies found thatSTAU1plays a role…
Show Full Abstract
Understanding the evolution of human intelligence is an important undertaking in the science of human genetics. A great deal of biological research has been conducted to search for genes which are related to the significant increase in human brain volume and cerebral cortex complexity during hominid evolution. However, genetic changes affecting intelligence in hominid evolution have remained elusive. We supposed that a subset of intelligence-related genes, which harbored intra-species variations in human populations, may also be evolution-related genes which harbored inter-species variations between humans (<i>Homo sapiens</i>) and great apes (including <i>Pan troglodytes</i> and <i>Pongo abelii</i>). Here we combined inter-species and intra-species genetic variations to discover genes involved in the evolution of human intelligence. Information was collected from published GWAS works on intelligence and a total of 549 genes located within the intelligence-associated loci were identified. The intelligence-related genes containing human-specific variations were detected based on the latest high-quality genome assemblies of three human's closest species. Finally, we identified 40 strong candidates involved in human intelligence evolution. Expression analysis using RNA-Seq data revealed that most of the genes displayed a relatively high expression in the cerebral cortex. For these genes, there is a distinct expression pattern between humans and other species, especially in neocortex tissues. Our work provided a list of strong candidates for the evolution of human intelligence, and also implied that some intelligence-related genes may undergo inter-species evolution and contain intra-species variation.
Also flagged:histonechromatinnucleosomebindinghistoneschromatosome
Journal Article2020-04-16✓ 1 Snippetde Wit H, Koorsen G.
In-Text Gene Mentions
Abstract)
…Humanlinker histoneshistones (H1s) are…
Show Full Abstract
Human linker histones (H1s) are important in chromatin packaging and condensation. The central globular domain of H1 anchors the protein to the nucleosome. The nucleosomal binding modes of different H1 globular domains may affect nucleosomal DNA accessibility in distinct ways. The globular domain structures of human linker histones H1.0 (GH1.0), H1.4 (GH1.4), H1t (GH1t) and H1oo (GH1oo) were homology modelled and energy minimized. A docking algorithm [validated by re-docking GH5 from the GH5-chromatosome crystal structure (PDB: 4QLC) to the nucleosome] was used to dock the modelled domains to the same nucleosome template. In addition, GH1 (PDB: 1GHC) and a protein consisting of the N-terminal and globular domains of H1x (NGH1x) were also docked using this algorithm. Models of these docked structures are presented here in the form of PDB files. The models can be used to gain more insight with regards to the nucleosomal binding modes of H1s and their individual influence on chromatin compaction.
Also flagged:synthesisCHNS21carboxyformateaminoS26
Journal Article2020-04-16No SnippetsKaźmierczak M, Koroniak H.
Show Full Abstract
Herein, we present an efficient synthesis of dipeptide analogues of α-fluorinated β-aminophosphonates. Each step of the synthesis was optimized to provide excellent yields. Moreover, the absolute configuration of the obtained compounds was determined by X-ray analysis, which proved the stereochemistry that was proposed based on NMR studies.
Journal Article2020-04-16✓ 2 SnippetsYan X, Zhao X, Huo R, Xu T.
In-Text Gene Mentions
Introduction)
…example, ADAM15 andTRIM38inhibit NF-κB and…
Discussion)
…WWP2 andTRIM38can negatively regulate…
Show Full Abstract
MyD88 is a conserved intracellular adaptor, which plays an important role in the innate immune system. MyD88 transmits signals for downstream of toll-like and IL-1 receptors to activate NF-κB signaling pathway, which is tightly controlled in the immune response to maintain immune intensity and immune homeostasis at different stages. NF-κB signaling pathway has been extensively studied in mammals, but regulatory molecular mechanism is still unclear in teleost fish. We determined that IRF3 and IRF8 can regulate MyD88-mediated NF-κB signaling pathway in fish. Interestingly, MyD88 is precisely regulated by IRF3 and IRF8 through the same mechanism but in completely opposite ways. IRF3 promotes MyD88-mediated NF-κB signaling pathway, whereas IRF8 inhibits the signaling pathway. MyD88 is regulated via ubiquitin-proteasome degradation, whereas IRF3 or IRF8 inhibited or promoted MyD88 degradation in this pathway. Specifically, in the early stage of lipopolysaccharide (LPS) stimulation or <i>Vibrio</i> infection, up-regulation of IRF3 and down-regulation of IRF8 eventually increased MyD88 expression to activate the NF-κB signaling pathway to trigger immune response. In the late stage of stimulation, down-regulated IRF3 and up-regulated IRF8 synergistically regulate the expression of MyD88 to a normal level, thus maintaining the immune balance of homeostasis and preventing serious damage from persistent over-immunization. This study presents information on Myd88-NF-κB signaling pathway in teleost fish and provides new insights into its regulatory mechanism in fish immune system.
Also flagged:AsthmaHay FeverEczemainflammatory bowel diseaseT cells differentiationbronchial disease
Journal Article2020-04-16✓ 2 SnippetsGuo H, An J, Yu Z.
In-Text Gene Mentions
Results)
…CGN has been reported associated with asthma, but it was not detected by MAGMA and/or MetaXcan for asthma data; RAD50 has been reported as associated with hay fever, but it was not detected by MAGMA and/or MetaXcan for hay fever data; eight genes (AHI1, IL2, MICB, NDFIP1, PLCL1, PRKCQ, SLC25A46, and WDR36) have been reported as associated with eczema, but they were not detected by MAGMA and/or MetaXcan for eczema data (Supplementary Data 6, 7).…
Results)
…IL2, MICB, NDFIP1,PLCL1, PRKCQ, SLC25A46, and…
Show Full Abstract
Asthma, hay fever and eczema are three comorbid diseases with high prevalence and heritability. Their common genetic architectures have not been well-elucidated. In this study, we first conducted a linkage disequilibrium score regression analysis to confirm the strong genetic correlations between asthma, hay fever and eczema. We then integrated three distinct association analyses (metaCCA multi-trait association analysis, MAGMA genome-wide and MetaXcan transcriptome-wide gene-based tests) to identify shared risk genes based on the large-scale GWAS results in the GeneATLAS database. MetaCCA can detect pleiotropic genes associated with these three diseases jointly. MAGMA and MetaXcan were performed separately to identify candidate risk genes for each of the three diseases. We finally identified 150 shared risk genes, in which 60 genes are novel. Functional enrichment analysis revealed that the shared risk genes are enriched in inflammatory bowel disease, T cells differentiation and other related biological pathways. Our work may provide help on treatment of asthma, hay fever and eczema in clinical applications.
Also flagged:lipidmetabolismoxygennitric oxidesignal transductionangiogenesis
Journal Article2020-04-15✓ 1 SnippetPenso-Dolfin L, Haerty W, Hindle A, Di Palma F.
In-Text Gene Mentions
Results)
…( Hmox1 ,Hfe), and lipid…
Show Full Abstract
<h4>Background</h4>The Weddell Seal (Leptonychotes weddelli) represents a remarkable example of adaptation to diving among marine mammals. This species is capable of diving > 900 m deep and remaining underwater for more than 60 min. A number of key physiological specializations have been identified, including the low levels of aerobic, lipid-based metabolism under hypoxia, significant increase in oxygen storage in blood and muscle; high blood volume and extreme cardiovascular control. These adaptations have been linked to increased abundance of key proteins, suggesting an important, yet still understudied role for gene reprogramming. In this study, we investigate the possibility that post-transcriptional gene regulation by microRNAs (miRNAs) has contributed to the adaptive evolution of diving capacities in the Weddell Seal.<h4>Results</h4>Using small RNA data across 4 tissues (brain, heart, muscle and plasma), in 3 biological replicates, we generate the first miRNA annotation in this species, consisting of 559 high confidence, manually curated miRNA loci. Evolutionary analyses of miRNA gain and loss highlight a high number of Weddell seal specific miRNAs. Four hundred sixteen miRNAs were differentially expressed (DE) among tissues, whereas 80 miRNAs were differentially expressed (DE) across all tissues between pups and adults and age differences for specific tissues were detected in 188 miRNAs. mRNA targets of these altered miRNAs identify possible protective mechanisms in individual tissues, particularly relevant to hypoxia tolerance, anti-apoptotic pathways, and nitric oxide signal transduction. Novel, lineage-specific miRNAs associated with developmental changes target genes with roles in angiogenesis and vasoregulatory signaling.<h4>Conclusions</h4>Altogether, we provide an overview of miRNA composition and evolution in the Weddell seal, and the first insights into their possible role in the specialization to diving.
Also flagged:Sex1penicillinmacrolidesmacrolideermBmefA
Journal Article2020-04-15✓ 1 SnippetVorobieva S Jensen V, Furberg AS, Slotved HC, Bazhukova T, Haldorsen B, Caugant DA, Sundsfjord A, Valentiner-Branth P, Simonsen GS.
In-Text Gene Mentions
Methods)
…EachDCCconsisted of a nursery and a kindergarten and was attended by 21 to 200 children.…
Show Full Abstract
<h4>Background</h4>The 13-valent Pneumococcal Conjugate Vaccine (PCV-13) was introduced in the National Immunization Programme (NIP) schedule in Russia in March 2014. Previously, the 7-valent Pneumococcal Conjugate Vaccine (PCV-7) was marketed in Russia in 2009 but has never been offered for mass vaccination. A carriage study was performed among children in Arkhangelsk in 2006. The objective was to determine the prevalence of carriage, serotype distribution, antimicrobial susceptibility and the molecular structure of Streptococcus pneumoniae strains before marketing and introduction of PCV-13.<h4>Methods</h4>A cross-sectional study was conducted on a cluster-randomized sample of children and a self-administrated questionnaire for parents/guardians. Nasopharyngeal samples were collected from 438 children younger than 7 years attending nurseries and kindergartens in the Arkhangelsk region, Russia. Detailed demographic data, as well as information about the child's health, traveling, exposure to antimicrobials within the last 3 months and anthropometric measurements were collected for all study subjects. Variables extracted from the questionnaire were analysed using statistic regression models to estimate the risk of carriage. All pneumococcal isolates were examined with susceptibility testing, serotyping and multilocus sequence typing.<h4>Results</h4>The overall prevalence of asymptomatic carriage was high and peaking at 36 months with a rate of 57%. PCV-13 covered 67.3% of the detected strains. High rates of non-susceptibility to penicillin, macrolides and multidrug resistance were associated with specific vaccine serotypes, pandemic clones, and local sequence types. Nine percent of isolates represented three globally disseminated disease-associated pandemic clones; penicillin- and macrolide-resistant clones Norway<sup>NT</sup>-42 and Poland<sup>6B</sup>-20, as well as penicillin- and macrolide-susceptible clone Netherlands<sup>3</sup>-31. A high level of antimicrobial consumption was noted by the study. According to the parent's reports, 89.5% of the children used at least one antimicrobial regime since birth. None of the hypothesised predictors of S. pneumoniae carriage were statistically significant in univariable and multivariable logistic models.<h4>Conclusions</h4>The study identified a high coverage of the PCV-13-vaccine, but serotype replacement and expansion of globally disseminated disease-associated clones with non-vaccine serotypes may be expected. Further surveillance of antimicrobial resistance and serotype distribution is therefore required.
<h4>Background</h4>Colon adenocarcinoma (COAD) is one of the most lethal cancers. It is particularly important to accurately predict prognosis and to provide individualized treatment. Several lines of evidence suggest that genetic factors and clinicopathological characteristics are related to cancer onset and progression. The aim of this study was to identify potential prognostic genes and to develop a nomogram to predict survival and recurrence of COAD.<h4>Methods</h4>To identify potential prognostic genes in COAD, microarray datasets were downloaded from the Gene Expression Omnibus (GEO) database. Differentially expressed genes (DEGs) were obtained from GEO2R. Venn diagram was drawn to select those genes that were overexpressed in all datasets, and survival analyses were performed to determine the prognostic values of the selected genes. New nomograms were developed based on the genes that were significantly associated with prognosis. Clinicopathological data were obtained from The Cancer Genome Atlas (TCGA). Finally, the new nomograms were compared head-to-head comparison with the TNM nomogram.<h4>Results</h4>From GSE21510, GSE110223, GSE113513 and GSE110224, a total of 834, 218, 236 and 613 overexpressed DEGs were screened out, respectively. The Venn diagram revealed that 12 genes appeared in all four profiles. After survival analyses, only INHBA expression was associated with both overall survival (OS) and disease-free survival (DFS). Multivariate analyses revealed that age, pathological N and pathological M were significant independent risk factors for OS. Age, pathological N, pathological M and INHBA were significant independent risk factors for DFS. Two prediction models predicted the probability of 3-year survival and 5-year survival for OS and DFS, respectively. The concordance indexes were 0.785 for 3-year overall survival, 0.759 for 5-year overall survival, 0.789 for 3-year disease-free survival and 0.757 for 5-year disease-free survival. The head-to-head comparison according to time-dependent ROC curves indicated that the new models had higher predictive accuracy. Decision curve analyses (DCA) indicated that the clinical value of the new models were higher than TNM models for predicting disease-free survival.<h4>Conclusion</h4>The combination of INHBA expression with a clinical nomogram improves prognostic power in colon adenocarcinoma, especially for predicting recurrence.
Journal Article2020-04-15✓ 2 SnippetsGarcía P, Bizama C, Rosa L, Espinoza JA, Weber H, Cerda-Infante J, Sánchez M, Montecinos VP, Lorenzo-Bermejo J, Boekstegers F, Dávila-López M, Alfaro F, Leiva-Acevedo C, Parra Z, Romero D, Kato S, Leal P, Lagos M, Roa JC.
In-Text Gene Mentions
Results)
…Based on the genes with the largest expression variability, PUC-GBC2 showed an enrichment of genes coding for proteins that form the extracellular matrix, such as COL3A1, POSTN and HAPLN1. On the other hand, genes involved in the regulation of cancer stem cell properties (HNF1A, OLFM4, PCK1 and REG4) and cell metabolism (CYP2B6 and SLC44A4) were overrepresented in PUC-GBC1.…
Results)
…( HNF1A ,OLFM4, PCK1 and…
Show Full Abstract
<h4>Background</h4>Gallbladder cancer (GBC) is the most common tumor of the biliary tract. The incidence of GBC shows a large geographic variability, being particularly frequent in Native American populations. In Chile, GBC represents the second cause of cancer-related death among women. We describe here the establishment of three novel cell lines derived from the ascitic fluid of a Chilean GBC patient, who presented 46% European, 36% Mapuche, 12% Aymara and 6% African ancestry.<h4>Results</h4>After immunocytochemical staining of the primary cell culture, we isolated and comprehensively characterized three independent clones (PUC-GBC1, PUC-GBC2 and PUC-GBC3) by short tandem repeat DNA profiling and RNA sequencing as well as karyotype, doubling time, chemosensitivity, in vitro migration capability and in vivo tumorigenicity assay. Primary culture cells showed high expression of CK7, CK19, CA 19-9, MUC1 and MUC16, and negative expression of mesothelial markers. The three isolated clones displayed an epithelial phenotype and an abnormal structure and number of chromosomes. RNA sequencing confirmed the increased expression of cytokeratin and mucin genes, and also of TP53 and ERBB2 with some differences among the three cells lines, and revealed a novel exonic mutation in NF1. The PUC-GBC3 clone was the most aggressive according to histopathological features and the tumorigenic capacity in NSG mice.<h4>Conclusions</h4>The first cell lines established from a Chilean GBC patient represent a new model for studying GBC in patients of Native American descent.
Also flagged:Hepatocellular carcinomaliver cancercancerdeathpathogenesisbinding
Journal Article2020-04-15✓ 1 SnippetHuang Z, Zhou JK, Peng Y, He W, Huang C.
In-Text Gene Mentions
I A O 0000606)
…ZNFX1antisense RNA 1…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most frequent subtype of primary liver cancer and one of the leading causes of cancer-related death worldwide. However, the molecular mechanisms underlying HCC pathogenesis have not been fully understood. Emerging evidences have recently suggested the crucial role of long noncoding RNAs (lncRNAs) in the tumorigenesis and progression of HCC. Various HCC-related lncRNAs have been shown to possess aberrant expression and participate in cancerous phenotypes (e.g. persistent proliferation, evading apoptosis, accelerated vessel formation and gain of invasive capability) through their binding with DNA, RNA or proteins, or encoding small peptides. Thus, a deeper understanding of lncRNA dysregulation would provide new insights into HCC pathogenesis and novel tools for the early diagnosis and treatment of HCC. In this review, we summarize the dysregulation of lncRNAs expression in HCC and their tumor suppressive or oncogenic roles during HCC tumorigenesis. Moreover, we discuss the diagnostic and therapeutic potentials of lncRNAs in HCC.
Also flagged:acute kidney injurysepsisKidney Diseaseacute respiratory distress syndromeARDSvasopressin
Journal Article2020-04-15✓ 1 SnippetWiersema R, Jukarainen S, Vaara ST, Poukkanen M, Lakkisto P, Wong H, Linder A, van der Horst ICC, Pettilä V.
In-Text Gene Mentions
Results)
…3 (PRTN3), olfactomedin-4 (OLFM4), and matrix metalloproteinas…
Show Full Abstract
<h4>Background</h4>The pathophysiology of septic acute kidney injury is inadequately understood. Recently, subphenotypes for sepsis and AKI have been derived. The objective of this study was to assess whether a combination of comorbidities, baseline clinical data, and biomarkers could classify meaningful subphenotypes in septic AKI with different outcomes.<h4>Methods</h4>We performed a post hoc analysis of the prospective Finnish Acute Kidney Injury (FINNAKI) study cohort. We included patients admitted with sepsis and acute kidney injury during the first 48 h from admission to intensive care (according to Kidney Disease Improving Global Outcome criteria). Primary outcomes were 90-day mortality and renal recovery on day 5. We performed latent class analysis using 30 variables obtained on admission to classify subphenotypes. Second, we used logistic regression to assess the association of derived subphenotypes with 90-day mortality and renal recovery on day 5.<h4>Results</h4>In total, 301 patients with septic acute kidney injury were included. Based on the latent class analysis, a two-class model was chosen. Subphenotype 1 was assigned to 133 patients (44%) and subphenotype 2 to 168 patients (56%). Increased levels of inflammatory and endothelial injury markers characterized subphenotype 2. At 90 days, 29% of patients in subphenotype 1 and 41% of patients in subphenotype 2 had died. Subphenotype 2 was associated with a lower probability of short-term renal recovery and increased 90-day mortality.<h4>Conclusions</h4>In this post hoc analysis, we identified two subphenotypes of septic acute kidney injury with different clinical outcomes. Future studies are warranted to validate the suggested subphenotypes of septic acute kidney injury.
Also flagged:gentamycinCCNAo-nitrophenolgalactosideprotein localizationlls
Journal Article2020-04-15✓ 1 SnippetDel Medico L, Cerletti D, Schächle P, Christen M, Christen B.
In-Text Gene Mentions
Results)
…nepR , a Cro/CI transcription factortranscription factor (CCNA_023…
Show Full Abstract
Understanding how bacteria colonize surfaces and regulate cell-cycle progression in response to cellular adhesion is of fundamental importance. Here, we use transposon sequencing in conjunction with fluorescence resonance energy transfer (FRET) microscopy to uncover the molecular mechanism for how surface sensing drives cell-cycle initiation in <i>Caulobacter crescentus</i> We identify the type IV pilin protein PilA as the primary signaling input that couples surface contact to cell-cycle initiation via the second messenger cyclic di-GMP (c-di-GMP). Upon retraction of pili filaments, the monomeric pilin reservoir in the inner membrane is sensed by the 17-amino acid transmembrane helix of PilA to activate the PleC-PleD two-component signaling system, increase cellular c-di-GMP levels, and signal the onset of the cell cycle. We termed the PilA signaling sequence CIP for "cell-cycle initiating pilin" peptide. Addition of the chemically synthesized CIP peptide initiates cell-cycle progression and simultaneously inhibits surface attachment. The broad conservation of the type IV pili and their importance in pathogens for host colonization suggests that CIP peptide mimetics offer strategies to inhibit surface sensing, prevent biofilm formation and control persistent infections.
Also flagged:junctophilin 3emp124 1INVmethylationCHST9
Journal Article2020-04-15✓ 2 SnippetsHalvorsen M, Huh R, Oskolkov N, Wen J, Netotea S, Giusti-Rodriguez P, Karlsson R, Bryois J, Nystedt B, Ameur A, Kähler AK, Ancalade N, Farrell M, Crowley JJ, Li Y, Magnusson PKE, Gyllensten U, Hultman CM, Sullivan PF, Szatkiewicz JP.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Methods)
…, FXN ,HTT, JPH3 ,…
Show Full Abstract
Despite considerable progress in schizophrenia genetics, most findings have been for large rare structural variants and common variants in well-imputed regions with few genes implicated from exome sequencing. Whole genome sequencing (WGS) can potentially provide a more complete enumeration of etiological genetic variation apart from the exome and regions of high linkage disequilibrium. We analyze high-coverage WGS data from 1162 Swedish schizophrenia cases and 936 ancestry-matched population controls. Our main objective is to evaluate the contribution to schizophrenia etiology from a variety of genetic variants accessible to WGS but not by previous technologies. Our results suggest that ultra-rare structural variants that affect the boundaries of topologically associated domains (TADs) increase risk for schizophrenia. Alterations in TAD boundaries may lead to dysregulation of gene expression. Future mechanistic studies will be needed to determine the precise functional effects of these variants on biology.
Also flagged:methylationgene expressionMAPKNIKNF-kappaBresponse to
Journal Article2020-04-15✓ 1 SnippetNicoletti CF, Pinhel MAS, Noronha NY, de Oliveira BA, Salgado Junior W, Jácome A, Diaz-Lagares A, Casanueva F, Crujeiras AB, Nonino CB.
In-Text Gene Mentions
Discussion)
…family of proteins (PEBP1), which has important…
Show Full Abstract
DNA methylation could provide a link between environmental, genetic factors and weight control and can modify gene expression pattern. This study aimed to identify genes, which are differentially expressed and methylated depending on adiposity state by evaluating normal weight women and obese women before and after bariatric surgery (BS). We enrolled 24 normal weight (BMI: 22.5 ± 1.6 kg/m<sup>2</sup>) and 24 obese women (BMI: 43.3 ± 5.7 kg/m<sup>2</sup>) submitted to BS. Genome-wide methylation analysis was conducted using Infinium Human Methylation 450 BeadChip (threshold for significant CpG sites based on delta methylation level with a minimum value of 5%, a false discovery rate correction (FDR) of q < 0.05 was applied). Expression levels were measured using HumanHT-12v4 Expression BeadChip (cutoff of p ≤ 0.05 and fold change ≥2.0 was used to detect differentially expressed probes). The integrative analysis of both array data identified four genes (i.e. TPP2, PSMG6, ARL6IP1 and FAM49B) with higher methylation and lower expression level in pre-surgery women compared to normal weight women: and two genes (i.e. ZFP36L1 and USP32) that were differentially methylated after BS. These methylation changes were in promoter region and gene body. All genes are related to MAPK cascade, NIK/NF-kappaB signaling, cellular response to insulin stimulus, proteolysis and others. Integrating analysis of DNA methylation and gene expression evidenced that there is a set of genes relevant to obesity that changed after BS. A gene ontology analysis showed that these genes were enriched in biological functions related to adipogenesis, orexigenic, oxidative stress and insulin metabolism pathways. Also, our results suggest that although methylation plays a role in gene silencing, the majority of effects were not correlated.
Also flagged:TAZOsteogenesisextracellularapparatusnucleusphosphorylation
Journal Article2020-04-15No SnippetsKovar H, Bierbaumer L, Radic-Sarikas B.
Show Full Abstract
YAP and TAZ are intracellular messengers communicating multiple interacting extracellular biophysical and biochemical cues to the transcription apparatus in the nucleus and back to the cell/tissue microenvironment interface through the regulation of cytoskeletal and extracellular matrix components. Their activity is negatively and positively controlled by multiple phosphorylation events. Phenotypically, they serve an important role in cellular plasticity and lineage determination during development. As they regulate self-renewal, proliferation, migration, invasion and differentiation of stem cells, perturbed expression of YAP/TAZ signaling components play important roles in tumorigenesis and metastasis. Despite their high structural similarity, YAP and TAZ are functionally not identical and may play distinct cell type and differentiation stage-specific roles mediated by a diversity of downstream effectors and upstream regulatory molecules. However, YAP and TAZ are frequently looked at as functionally redundant and are not sufficiently discriminated in the scientific literature. As the extracellular matrix composition and mechanosignaling are of particular relevance in bone formation during embryogenesis, post-natal bone elongation and bone regeneration, YAP/TAZ are believed to have critical functions in these processes. Depending on the differentiation stage of mesenchymal stem cells during endochondral bone development, YAP and TAZ serve distinct roles, which are also reflected in bone tumors arising from the mesenchymal lineage at different developmental stages. Efforts to clinically translate the wealth of available knowledge of the pathway for cancer diagnostic and therapeutic purposes focus mainly on YAP and TAZ expression and their role as transcriptional co-activators of TEAD transcription factors but rarely consider the expression and activity of pathway modulatory components and other transcriptional partners of YAP and TAZ. As there is a growing body of evidence for YAP and TAZ as potential therapeutic targets in several cancers, we here interrogate the applicability of this concept to bone tumors. To this end, this review aims to summarize our current knowledge of YAP and TAZ in cell plasticity, normal bone development and bone cancer.
Also flagged:Amyloid betaAβextracellularvesiclesneurocognitive disordersExtracellular Vesicles
Journal Article2020-04-15No SnippetsAndrás IE, Sewell BB, Toborek M.
Show Full Abstract
Amyloid beta (Aβ) depositions are more abundant in HIV-infected brains. The blood-brain barrier, with its backbone created by endothelial cells, is assumed to be a core player in Aβ homeostasis and may contribute to Aβ accumulation in the brain. Exposure to HIV increases shedding of extracellular vesicles (EVs) from human brain endothelial cells and alters EV-Aβ levels. EVs carrying various cargo molecules, including a complex set of proteins, can profoundly affect the biology of surrounding neurovascular unit cells. In the current study, we sought to examine how exposure to HIV, alone or together with Aβ, affects the surface and total proteomic landscape of brain endothelial EVs. By using this unbiased approach, we gained an unprecedented, high-resolution insight into these changes. Our data suggest that HIV and Aβ profoundly remodel the proteome of brain endothelial EVs, altering the pathway networks and functional interactions among proteins. These events may contribute to the EV-mediated amyloid pathology in the HIV-infected brain and may be relevant to HIV-1-associated neurocognitive disorders.
Also flagged:SertralineserotoninreuptakeAutism Spectrum Disorderserotonin transportertryptophan hydroxylase 2
Journal Article2020-04-15✓ 2 SnippetsAlolaby RR, Jiraanont P, Durbin-Johnson B, Jasoliya M, Tang HT, Hagerman R, Tassone F.
In-Text Gene Mentions
Introduction)
…molecules ( SERT,5-HTT) have been…
Introduction)
…serotonin transporter (5-HTT) involved in…
Show Full Abstract
Sertraline is one among several selective serotonin reuptake inhibitors (SSRIs) that exhibited improvement of language development in Autism Spectrum Disorder (ASD); however, the molecular mechanism has not been elucidated. A double blind, randomized, 6-month, placebo-controlled, clinical trial of low-dose sertraline in children ages (3-6 years) with ASD was conducted at the UC Davis MIND Institute. It aimed at evaluating the efficacy and benefit with respect to early expressive language development and global clinical improvement. This study aimed to identify molecular biomarkers that might be key players in the serotonin pathway and might be predictive of a clinical response to sertraline. Fifty eight subjects with the diagnosis of ASD were randomized to sertraline or placebo. Eight subjects from the sertraline arm and five from the placebo arm discontinued from the study. Furthermore, four subjects did not have a successful blood draw. Hence, genotypes for 41 subjects (20 on placebo and 21 on sertraline) were determined for several genes involved in the serotonin pathway including the serotonin transporter-linked polymorphic region (<i>5-HTTLPR</i>), the tryptophan hydroxylase 2 (<i>TPH2</i>), and the Brain-Derived Neurotrophic Factor (<i>BDNF</i>). In addition, plasma levels of <i>BDNF</i>, Matrix metallopeptidase 9 (<i>MMP-9</i>) and a selected panel of cytokines were determined at baseline and post-treatment. Intent-to-treat analysis revealed several primary significant correlations between molecular changes and the Mullen Scales of Early Learning (MSEL) and Clinical Global Impression Scale - Improvement (CGI-I) of treatment and control groups but they were not significant after adjustment for multiple testing. Thus, sertraline showed no benefit for treatment of young children with ASD in language development or changes in molecular markers in this study. These results indicate that sertraline may not be beneficial for the treatment of children with ASD; however, further investigation of larger groups as well as longer term follow-up studies are warranted.
…– 181 Thepolycomb repressiverepressive protein complexes…
Show Full Abstract
Hepatitis C virus (HCV) infection is the major risk factor for liver cirrhosis and hepatocellular carcinoma (HCC). The mechanisms of HCC initiation, growth, and metastasis appear to be highly complex due to the decade-long interactions between the virus, immune system, and overlapping bystander effects of host metabolic liver disease. The lack of a readily accessible animal model system for HCV is a significant obstacle to understand the mechanisms of viral carcinogenesis. Traditionally, the primary prevention strategy of HCC has been to eliminate infection by antiviral therapy. The success of virus elimination by antiviral treatment is determined by the SVR when the HCV is no longer detectable in serum. Interferon-alpha (IFN-α) and its analogs, pegylated IFN-α (PEG-IFN-α) alone with ribavirin (RBV), have been the primary antiviral treatment of HCV for many years with a low cure rate. The cloning and sequencing of HCV have allowed the development of cell culture models, which accelerated antiviral drug discovery. It resulted in the selection of highly effective direct-acting antiviral (DAA)-based combination therapy that now offers incredible success in curing HCV infection in more than 95% of all patients, including those with cirrhosis. However, several emerging recent publications claim that patients who have liver cirrhosis at the time of DAAs treatment face the risk of HCC occurrence and recurrence after viral cure. This remains a substantial challenge while addressing the long-term benefit of antiviral medicine. The host-related mechanisms that drive the risk of HCC in the absence of the virus are unknown. This review describes the multifaceted mechanisms that create a tumorigenic environment during chronic HCV infection. In addition to the potential oncogenic programming that drives HCC after viral clearance by DAAs, the current status of a biomarker development for early prediction of cirrhosis regression and HCC detection post viral treatment is discussed. Since DAAs treatment does not provide full protection against reinfection or viral transmission to other individuals, the recent studies for a vaccine development are also reviewed.
Also flagged:TRP Channelsneurodegenerative diseasesagingpathogenesistransient receptor potential (TRP) channelsoxygen
Journal Article2020-04-15✓ 1 SnippetHong C, Jeong B, Park HJ, Chung JY, Lee JE, Kim J, Shin YC, So I.
In-Text Gene Mentions
Introduction)
…the Huntington (HTT) gene (…
Show Full Abstract
The development of treatment for neurodegenerative diseases (NDs) such as Alzheimer's disease, Parkinson's disease, Huntington's disease, and amyotrophic lateral sclerosis is facing medical challenges due to the increasingly aging population. However, some pharmaceutical companies have ceased the development of therapeutics for NDs, and no new treatments for NDs have been established during the last decade. The relationship between ND pathogenesis and risk factors has not been completely elucidated. Herein, we review the potential involvement of transient receptor potential (TRP) channels in NDs, where oxidative stress and disrupted Ca<sup>2+</sup> homeostasis consequently lead to neuronal apoptosis. Reactive oxygen species (ROS) -sensitive TRP channels can be key risk factors as polymodal sensors, since progressive late onset with secondary pathological damage after initial toxic insult is one of the typical characteristics of NDs. Recent evidence indicates that the dysregulation of TRP channels is a missing link between disruption of Ca<sup>2+</sup> homeostasis and neuronal loss in NDs. In this review, we discuss the latest findings regarding TRP channels to provide insights into the research and quests for alternative therapeutic candidates for NDs. As the structures of TRP channels have recently been revealed by cryo-electron microscopy, it is necessary to develop new TRP channel antagonists and reevaluate existing drugs.
Also flagged:AdenosarcomaTumorMullerian adenosarcomatumorssarcomachromosome
Journal Article2020-04-15No SnippetsBan Y, Fischer JV, Maniar KP, Guo H, Zeng C, Li Y, Zhang Q, Wang X, Zhang W, Bulun SE, Wei JJ.
Show Full Abstract
Mullerian adenosarcoma (MAS) is a biphasic tumor with malignant stroma. It is most commonly of endometrial origin but occasionally originates in the cervix, ovary, or other pelvic/peritoneal sites. The typical MAS is low grade with an indolent clinical course; however, tumors with sarcomatous overgrowth (SO) or a high-grade sarcoma tend to be aggressive. Tumor etiology is largely unknown. To better understand the global genome alterations and gene mutations in MAS, whole-genome sequencing (WGS) and target validation analysis were performed. MAS showed remarkable chromosome (chr) copy number variation (CNV), specifically, gains in chr 1q, 5p, 12p, 12q, and 17q and losses in chr 3p, 3q, 9p, and 11q. Gain of chr 12q13-15 was present in 50% of cases. The selected gene products in gain regions were upregulated as measured by immunohistochemistry. HMGA2 overexpression was significantly correlated with SO. While the structural variation (SV) rate was relatively low overall, a disproportionally high rate of break-ends at chr 7 was noted involving 6 in-frame rearrangement fusion genes. Among 40 frequently mutated genes detected by WGS and validated in 29 MAS by next generation sequencing (NGS), <i>KMT2C</i>, and <i>BCOR</i> were frequently seen in MAS both with and without SO, while <i>MAGEC1</i> and <i>KDM6B</i> were strongly associated with SO. Overall, a higher rate of frequently mutated genes was found in MAS with SO (33%) than MAS without (11%). This study uncovers the complex and specific genetic alterations in this malignancy. The findings provide a tool for future investigation of these molecular changes in tumorigenesis and target therapies.
Also flagged:membraneosteoarthritiscell proliferationcollagenase Pwaterpenicillin
Journal Article2020-04-15✓ 1 SnippetWang T, Hill RC, Dzieciatkowska M, Zhu L, Infante AM, Hu G, Hansen KC, Pei M.
In-Text Gene Mentions
Discussion)
…of SOX5 ,SOX6, and SOX9…
Show Full Abstract
Adult stem cells have unique properties in both proliferation and differentiation preference. In this study, we hypothesized that adipose stem cells have a depot-dependent lineage preference. Four rabbits were used to provide donor-matched adipose stem cells from either subcutaneous adipose tissue (ScAT) or infrapatellar fat pad (IPFP). Proliferation and multi-lineage differentiation were evaluated in adipose stem cells from donor-matched ScAT and IPFP. RNA sequencing (RNA-seq) and proteomics were conducted to uncover potential molecular discrepancy in adipose stem cells and their corresponding matrix microenvironments. We found that stem cells from ScAT exhibited significantly higher proliferation and adipogenic capacity compared to those from donor-matched IPFP while stem cells from IPFP displayed significantly higher chondrogenic potential compared to those from donor-matched ScAT. Our findings are strongly endorsed by supportive data from transcriptome and proteomics analyses, indicating a site-dependent lineage preference of adipose stem cells.
<b>Background:</b> The terminal ileum and ileocaecal junction form a transition zone in a relatively inaccessible portion of the gastrointestinal tract. Little is known about the motility of this region with few detailed studies, indicating the need for a robust synthesis of current knowledge. This review aimed to evaluate the quantitative and qualitative data on the manometry findings of the terminal ileum and ileocaecal junction during the fasting and post-prandial periods in healthy individuals and patients with motility disorders or patients after bowel surgery. <b>Methods:</b> A systematic search of five databases (Medline, Pubmed, Embase, Scopus, and Cochrane Library) was performed. Studies that presented manometry data from the human ileum or ileocaecal junction were included. <b>Results:</b> Forty-two studies met the inclusion criteria. The main motility patterns reported in the terminal ileum during fasting were the migrating motor complex, discrete clustered contractions, prolonged propagated contractions and phasic contractions. Post-prandial motility featured irregular, intense contractions. Some studies found a region of sustained increased pressure at the ileocaecal junction while others did not. Patients with motility disorders showed differences in manometry including retrograde propagation of phase III. Patients post-bowel surgery showed differences including higher incidence of phase III. <b>Conclusion:</b> Motility patterns of the terminal ileum differ between fasting and fed states. Large variability existed in manometry recordings of the terminal ileum. Technical challenges and lack of standardized definitions may reduce accuracy of manometry assessment. Further research is needed to understand how this key portion of the gut physiologically functions.
Also flagged:Hepatocellular carcinomaliver cancergene expressiontumorPTTG1UBE2C
Journal Article2020-04-15No SnippetsZhang G, Kang Z, Mei H, Huang Z, Li H.
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most common type of primary liver cancer. Ample data have been reported to unravel the carcinogenesis over the past decades. Although pinpointing the cause of the HCC is challenging, this in and of itself may not be an insuperable problem. Indeed, the emergence of novel molecular targets has given rise to targeted therapy for HCC. Compared to traditional treatments, drugs with molecularly targeted agents are considered an optimal way to treat HCC. However, targeted approaches are currently limited among HCC patients. In our work, we explored more potential genes for targeted treatment of HCC. Initially, differentially expressed genes (DEGs) were identified in gene expression profiling interactive analysis (GEPIA) and NetworkAnalyst. Subsequently, 10 key genes were selected through enrichment analysis and PPI network construction. Based on the GEPIA and Oncomine databases, six upregulated genes were selected. High protein expression of these six genes were confirmed through the Human Protein Atlas database. In addition, these six genes were associated with unfavorable overall survival and progression-free survival based on Kaplan-Meier plotter bioinformatics. Moreover, gene expression was closely related to the tumor stages and pathological grades, as determined with UALCAN. More importantly, PTTG1, UBE2C, and ZWINT were identified as potential targets of anti-cancer drugs using cBioPortal. qPCR and western blot assays were used to show the high expression levels of the latter three genes in HCC cell lines. Collectively, these findings are expected to provide a theoretical basis for and give novel insights into clinical research of HCC.
Also flagged:glucosecisplatinplatinumovarian cancerENO1Senescence-associated
Journal Article2020-04-15✓ 1 SnippetSantana-Rivera Y, Rabelo-Fernández RJ, Quiñones-Díaz BI, Grafals-Ruíz N, Santiago-Sánchez G, Lozada-Delgado EL, Echevarría-Vargas IM, Apiz J, Soto D, Rosado A, Meléndez L, Valiyeva F, Vivas-Mejía PE.
In-Text Gene Mentions
I A O 0000326)
…PRDX6…
Show Full Abstract
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop a platinum-resistant disease with a poor overall prognosis. The molecular events leading to the cisplatin resistance of ovarian cancer cells are not fully understood. Here, we performed a proteomic analysis to identify protein candidates deregulated in a cisplatin-resistant ovarian cancer cell line (A2780CP20) in comparison to their sensitive counterpart (A2780). Forty-eight proteins were differentially abundant in A2780CP20, as compared with A2780, cells. Enolase-1 (ENO1) was significantly decreased in cisplatin-resistant ovarian cancer cells. Western blots and RT-PCR confirmed our findings. Ectopic ENO1 expression increased the sensitivity of ovarian cancer cells to cisplatin treatment. In contrast, small-interfering (siRNA)-based ENO1 silencing in A2780 cells reduced the sensitivity of these cells to cisplatin treatment. Whereas glucose consumption was lower, intracellular levels were higher in cisplatin-resistant ovarian cancer cells as compared with their cisplatin-sensitive counterparts. Senescence-associated β-galactosidase (β-Gal) levels were higher in cisplatin-resistant ovarian cancer cells as compared with cisplatin-sensitive ovarian cancer cells. β-Gal levels were decreased in ENO1 overexpressed clones. Protein levels of the cell cycle regulators and senescence markers p21 and p53 showed opposite expression patterns in cisplatin-resistant compared with cisplatin sensitive cells. Our studies suggest that decreased expression of ENO1 promotes glucose accumulation, induces senescence, and leads to cisplatin resistance of ovarian cancer cells.
Also flagged:TNFR-Associated FactorsReceptor-Interacting Protein Kinasereceptor-interacting protein kinasesTNFαTLRIFN
Journal Article2020-04-15No SnippetsHou J, Pang Y, Li Q.
Show Full Abstract
TNFR-associated factors (TRAFs) and receptor-interacting protein kinases (RIPKs) are important immunological linker molecules in mammals and play important roles in the TNFα, TLR and IFN signaling pathways. However, the evolutionary origins of these genes in vertebrates have not previously been described in lampreys. In this study, we searched the genomes of <i>Lampetra japonicum, Lethenteron reissneri</i>, and <i>Petromyzon marinus</i> for genes encoding <i>trafs</i> and <i>ripks</i> and performed homologous sequence alignment, phylogenetic tree, functional domain, conserved motif, gene structure, and synteny analyses to determine their evolutionary relationships. The distribution of the lamprey <i>traf</i> and <i>ripk</i> families and the immune response of the gene families in lampreys stimulated by different pathogens were also demonstrated, suggesting a role of structural changes in expression and functional diversification. Additionally, the dual luciferase reporter gene assay showed that the addition of exogenous immunomodulator (TNFα or IFN) to the overexpression of LjLRIPK1a or LjTRAF3/6 significantly downregulated NF-κB or ISRE activation. LjRIPK1a can significantly enhance caspase-8 activity, and overexpression of LjRIPK1a or LjTRAF3a/6 in HEK293T cells results in cell apoptosis. In summary, this study makes an important contribution to the understanding of the <i>traf</i> and <i>ripk</i> gene families in different vertebrates. Our results also provide new evidence for the evolution of vertebrate TRAFs and RIPKs and their impacts on immune regulation.
Journal Article2020-04-15✓ 4 SnippetsPoplawski GHD, Kawaguchi R, Van Niekerk E, Lu P, Mehta N, Canete P, Lie R, Dragatsis I, Meves JM, Zheng B, Coppola G, Tuszynski MH.
In-Text Gene Mentions
Abstract)
…huntingtin gene (Htt) is a central hub in the regeneration transcriptome; deletion of Htt significantly attenuates regeneration, which shows that Htt has a key role in neural plasticity after injury…
Grafts of spinal-cord-derived neural progenitor cells (NPCs) enable the robust regeneration of corticospinal axons and restore forelimb function after spinal cord injury<sup>1</sup>; however, the molecular mechanisms that underlie this regeneration are unknown. Here we perform translational profiling specifically of corticospinal tract (CST) motor neurons in mice, to identify their 'regenerative transcriptome' after spinal cord injury and NPC grafting. Notably, both injury alone and injury combined with NPC grafts elicit virtually identical early transcriptomic responses in host CST neurons. However, in mice with injury alone this regenerative transcriptome is downregulated after two weeks, whereas in NPC-grafted mice this transcriptome is sustained. The regenerative transcriptome represents a reversion to an embryonic transcriptional state of the CST neuron. The huntingtin gene (Htt) is a central hub in the regeneration transcriptome; deletion of Htt significantly attenuates regeneration, which shows that Htt has a key role in neural plasticity after injury.
<h4>Objective</h4>Elevated tumour necrosis factor (TNF)-α has been implicated in the progression of liver fibrosis and pathogenesis of non-alcoholic fatty liver disease (NAFLD). We aim to investigate the impact of anti-TNF-α agents on the development of cirrhosis and NAFLD.<h4>Design</h4>This retrospective cohort study used a US claims database between 1 January 2010 and 31 December 2016. We identified adult patients with ankylosing spondylitis, inflammatory bowel disease, psoriatic arthritis or rheumatoid arthritis. Anti-TNF-α agents of interest included adalimumab, certolizumab, etanercept, golimumab and infliximab. The primary composite outcome was the development of new-onset cirrhosis, NAFLD or non-alcoholic steatohepatitis (NASH). The secondary outcomes were the development of (1) cirrhosis and (2) NAFLD or NASH. Propensity score for anti-TNF-α agent use was generated by logistic regression. Cox proportional hazard models adjusting for the propensity score were used with regard to time-varying anti-TNF-α agent exposure.<h4>Results</h4>This study included 226 555 incident patients with immune-related diseases. During the median 1.5 years follow-up, there was an increased hazard with anti-TNF-α agent use in regard to liver outcomes (composite outcome HR: 1.47, 95% CI 1.27 to 1.70; cirrhosis HR 1.47, 95% CI 0.96 to 2.23; NAFLD or NASH HR 1.53, 95% CI 1.32 to 1.77). The composite outcome hazard was increased for each immune-related disease (HR 1.25-1.90).<h4>Conclusion</h4>In the short term, we did not observe a beneficial effect of anti-TNF-α agent use for development of cirrhosis, NAFLD or NASH in patients with immune-related diseases.
Journal Article2020-04-15No SnippetsLim J, Heo J, Ju H, Shin JW, Kim Y, Lee S, Yu HY, Ryu CM, Yun H, Song S, Hong KS, Chung HM, Kim HR, Roe JS, Choi K, Kim IG, Jeong EM, Shin DM.
Show Full Abstract
Glutathione (GSH), the most abundant nonprotein thiol functioning as an antioxidant, plays critical roles in maintaining the core functions of mesenchymal stem cells (MSCs), which are used as a cellular immunotherapy for graft-versus-host disease (GVHD). However, the role of GSH dynamics in MSCs remains elusive. Genome-wide gene expression profiling and high-throughput live-cell imaging assays revealed that CREB1 enforced the GSH-recovering capacity (GRC) of MSCs through NRF2 by directly up-regulating NRF2 target genes responsible for GSH synthesis and redox cycling. MSCs with enhanced GSH levels and GRC mediated by CREB1-NRF2 have improved self-renewal, migratory, anti-inflammatory, and T cell suppression capacities. Administration of MSCs overexpressing CREB1-NRF2 target genes alleviated GVHD in a humanized mouse model, resulting in improved survival, decreased weight loss, and reduced histopathologic damages in GVHD target organs. Collectively, these findings demonstrate the molecular and functional importance of the CREB1-NRF2 pathway in maintaining MSC GSH dynamics, determining therapeutic outcomes for GVHD treatment.
…Additionally, GNA14 expression levels were partially correlated with CTNNB1, RYR2, FLG, CSMD3 and CACNA1E expression levels in HCC.…
Results)
…subunit alpha1 E (CACNA1E; partial correlation, −0.206;…
Discussion)
…FLG, CSMD3 andCACNA1Eexpression levels in…
Show Full Abstract
Guanine nucleotide-binding protein subunit α14 (GNA14) knockdown was demonstrated to inhibit the proliferation of endometrial carcinoma cells in a recent study; however, its role in hepatocellular carcinoma (HCC) is unknown. In the present study, the clinical significance of GNA14 in HCC was assessed using a dataset of patients with HCC from The Cancer Genome Atlas database. The Integrative Molecular Database of Hepatocellular Carcinoma and Oncomine databases were also used to identify the expression levels of GNA14 in HCC tissues. The association between GNA14 expression levels and clinicopathological features was assessed using the Wilcoxon signed-rank test and logistic regression analysis. Kaplan-Meier curves and Cox regression analysis were applied to evaluate the independent risk factors for clinical outcomes. The present study determined GNA14 DNA methylation levels and tumor-infiltrating immune cells, as well as used Gene Set Enrichment Analysis (GSEA) in HCC. GNA14 mRNA expression levels were lower in HCC compared with normal tissues. Downregulation of GNA14 in HCC was significantly associated with tumor grade, clinical stage and T stage. Furthermore, low expression of GNA14 was an independent predictor for survival outcomes. GNA14 expression levels were partially correlated with the infiltration of B cells and macrophages. Additionally, GSEA analysis revealed that the expression levels of GNA14 were associated with multiple signaling pathways, such as translation, DNA replication, and homologous recombination. In conclusion, low GNA14 expression may be a novel biomarker for diagnosis and prognosis prediction for patients with HCC.
<h4>Background</h4>Fine particulate matter (PM<sub>2.5</sub>) has been associated with breast cancer specific mortality, particularly for women with Stage I cancer. We examined the biological pathways that are perturbed by PM<sub>2.5</sub> exposures by analyzing gene expression measurements from breast tissue specimens.<h4>Methods</h4>The Nurses' Health Studies (NHS and NHSII) are prospective cohorts with archival breast tissue specimens from breast cancer cases. Global gene expression data were ascertained with the Affymetrix Glue Human Transcriptome Array 3.0. PM<sub>2.5</sub> was estimated using spatio-temporal models linked to participants' home addresses. All analyses were performed separately in tumor (n = 591) and adjacent-normal (n = 497) samples, and stratified by estrogen receptor (ER) status and stage. We used multivariable linear regression, gene-set enrichment analyses (GSEA), and the least squares kernel machine (LSKM) to assess whether 3-year cumulative average pre-diagnosis PM<sub>2.5</sub> exposure was associated with breast-tissue gene expression pathways among predominately Stage I and II women (90.7%) and postmenopausal (81.2%) women. Replication samples (tumor, n = 245; adjacent-normal, n = 165) were measured on Affymetrix Human Transcriptome Array (HTA 2.0).<h4>Results</h4>Overall, no pathways in the tumor area were significantly associated with PM<sub>2.5</sub> exposure. Among 272 adjacent-normal samples from Stage I ER-positive women, PM<sub>2.5</sub> was associated with perturbations in the oxidative phosphorylation, protein secretion, and mTORC1 signaling pathways (GSEA and LSKM p-values <0.05); however, results were not replicated in a small set of replication samples (n = 80).<h4>Conclusions</h4>PM<sub>2.5</sub> was generally not associated with breast tissue gene expression though was suggested to perturb oxidative phosphorylation and regulation of proteins and cellular signaling in adjacent-normal breast tissue. More research is needed on the biological role of PM<sub>2.5</sub> that influences breast tumor progression.
Research Square2020-04-15Preprint (No Snippets API)Huang X, Otecko NO, Peng M, Weng Z, Li W, Chen J, Zhong M, Zhong F, Jin S, Geng Z, Luo W, He D, Ma C, Han J, Ommeh SC, Zhang Y, Zhang X, Du B.
Show Full Abstract
<title>Abstract</title> <p><bold>Background:</bold> Yellow-feathered chickens (YFCs) have a long history in China. They are well-known for the nutritional and commercial importance attributable to their yellow color phenotype. Currently, there is a huge paucity in knowledge of the genetic determinants responsible for phenotypic and biochemical properties of these iconic chickens. This study aimed to uncover the genetic structure and the molecular underpinnings of the YFCs trademark coloration.<bold>Results:</bold> The whole-genomes of 100 YFCs from 10 major traditional breeds and 10 Huaibei partridge chickens from China were re-sequenced. Comparative population genomics based on autosomal single nucleotide polymorphisms (SNPs) revealed three geographically based clusters among the YFCs. Compared to other Chinese indigenous chicken genomes incorporated from previous studies, a closer genetic proximity within YFC breeds than between YFC breeds and other chicken populations is evident. Through genome-wide scans for selective sweeps, we identified RALY heterogeneous nuclear ribonucleoprotein (RALY), leucine rich repeat containing G protein-coupled receptor 4 (<italic>LGR4</italic>), solute carrier family 23 member 2 (<italic>SLC23A2</italic>), and solute carrier family 2 member 14 (<italic>SLC2A14</italic>), besides the classical beta-carotene dioxygenase 2 (<italic>BCDO2</italic>),<italic> </italic>as major candidates pigment determining genes in the YFCs.<bold>Conclusion:</bold> We provide the first comprehensive genomic data of the YFCs. Our analyses show phylogeographical patterns among the YFCs and potential candidate genes giving rise to the yellow color trait of the YFCs. This study lays the foundation for further research on the genome-phenotype cross-talks that define important poultry traits and for formulating genetic breeding and conservation strategies for the YFCs.</p>
Also flagged:CACNA1Hepilepsychildhoodabsence epilepsyDravet Syndromegbb
Journal Article2020-04-14No SnippetsCalhoun JD, Huffman AM, Bellinski I, Kinsley L, Bachman E, Gerard E, Kearney JA, Carvill GL.
Show Full Abstract
CACNA1H genetic variants were originally reported in a childhood absence epilepsy cohort. Subsequently, genetic testing for CACNA1H became available and is currently offered by commercial laboratories. However, the current status of CACNA1H as a monogenic cause of epilepsy is controversial, highlighted by ClinGen's recent reclassification of CACNA1H as disputed. We analyzed published CACNA1H variants and those reported in ClinVar and found none would be classified as pathogenic or likely pathogenic per the American College of Medical Genetics classification criteria. Moreover, Cacna1h did not modify survival in a Dravet Syndrome mouse model. We observed a mild increase in susceptibility to hyperthermia-induced seizures in mice with reduced Cacna1h expression. Overall, we conclude that there is limited evidence that CACNA1H is a monogenic cause of epilepsy in humans and that this gene should be removed from commercial genetic testing panels to reduce the burden of variants of uncertain significance for healthcare providers, families and patients with epilepsy.
Also flagged:GlucagonGAPDHPax6phosphorylationcretop
Journal Article2020-04-14✓ 5 SnippetsZhang F, Ma D, Zhao W, Wang D, Liu T, Liu Y, Yang Y, Liu Y, Mu J, Li B, Zhang Y, Pan Y, Guo C, Du H, Li L, Fu X, Cao Z, Jin L.
In-Text Gene Mentions
I A O 0000326)
…Sox6…
I A O 0000326)
…sox6…
Methods)
…for Foxo1 ,Sox6, Fzd5 ,…
Methods)
…The mouseSox6promoter, upstream 2…
Methods)
…, CREB ,Sox6, ADA-Foxo1 or…
Show Full Abstract
B cell dysfunction due to obesity can be associated with alterations in the levels of micro-RNAs (miRNAs). However, the role of miRNAs in these processes remains elusive. Here, we show that miR-802 is increased in the pancreatic islets of obese mouse models and demonstrate that inducible transgenic overexpression of miR-802 in mice causes impaired insulin transcription and secretion. We identify Foxo1 as a transcription factor of miR-802 promoting its transcription, and NeuroD1 and Fzd5 as targets of miR-802-dependent silencing. Repression of NeuroD1 in β cell and primary islets impairs insulin transcription and reduction of Fzd5 in β cell, which, in turn, impairs Ca<sup>2+</sup> signaling, thereby repressing calcium influx and decreasing insulin secretion. We functionally create a novel network between obesity and β cell dysfunction via miR-802 regulation. Elucidation of the impact of obesity on microRNA expression can broaden our understanding of pathophysiological development of diabetes.
Also flagged:mRNAcDNATbpCiitaMHC IIantigen presentation
Journal Article2020-04-14✓ 5 SnippetsLehmann FM, von Burg N, Ivanek R, Teufel C, Horvath E, Peter A, Turchinovich G, Staehli D, Eichlisberger T, Gomez de Agüero M, Coto-Llerena M, Prchal-Murphy M, Sexl V, Bentires-Alj M, Mueller C, Finke D.
In-Text Gene Mentions
Methods)
…The following primer were used: Tbp fw (GGCACCACCCCCTTGTACCCT), Tbp rv (ACGCAGTTGTCCGTGGCTCT), Il12b fw (TGGGAGTACCCTGACTCCTG), Il12b rv (AGGAACGCACCTTTCTGGTT),Tnfsf4fw (ACTCTCTTCCTCTCCGGCAAA), Tnfsf4 rv (TTGCCCATCCTCACATCTGG), Il23p19 fw (CACCAGCGGGACATATGAATCT), Il23p19 rv (CACTGGATACGGGGCACATT), Ifng fw (CTGAGACAATGAACGCTACAC), and Ifng rv (TTTCTTCCACATCTATGCCAC).…
Methods)
…The following primer were used: Tbp fw (GGCACCACCCCCTTGTACCCT), Tbp rv (ACGCAGTTGTCCGTGGCTCT), Il12b fw (TGGGAGTACCCTGACTCCTG), Il12b rv (AGGAACGCACCTTTCTGGTT), Tnfsf4 fw (ACTCTCTTCCTCTCCGGCAAA),Tnfsf4rv (TTGCCCATCCTCACATCTGG), Il23p19 fw (CACCAGCGGGACATATGAATCT), Il23p19 rv (CACTGGATACGGGGCACATT), Ifng fw (CTGAGACAATGAACGCTACAC), and Ifng rv (TTTCTTCCACATCTATGCCAC).…
Methods)
…The following primer were used: Tbp fw (GGCACCACCCCCTTGTACCCT), Tbp rv (ACGCAGTTGTCCGTGGCTCT), Il12b fw (TGGGAGTACCCTGACTCCTG), Il12b rv (AGGAACGCACCTTTCTGGTT),Tnfsf4 fw (ACTCTCTTCCTCTCCGGCAAA), Tnfsf4 rv (TTGCCCATCCTCACATCTGG), Il23p19 fw (CACCAGCGGGACATATGAATCT), Il23p19 rv (CACTGGATACGGGGCACATT), Ifng fw (CTGAGACAATGAACGCTACAC), and Ifng rv (TTTCTTCCACATCTATGCCAC).…
Methods)
…The following primer were used: Tbp fw (GGCACCACCCCCTTGTACCCT), Tbp rv (ACGCAGTTGTCCGTGGCTCT), Il12b fw (TGGGAGTACCCTGACTCCTG), Il12b rv (AGGAACGCACCTTTCTGGTT), Tnfsf4 fw (ACTCTCTTCCTCTCCGGCAAA),Tnfsf4 rv (TTGCCCATCCTCACATCTGG), Il23p19 fw (CACCAGCGGGACATATGAATCT), Il23p19 rv (CACTGGATACGGGGCACATT), Ifng fw (CTGAGACAATGAACGCTACAC), and Ifng rv (TTTCTTCCACATCTATGCCAC).…
Although group 3 innate lymphoid cells (ILC3s) are efficient inducers of T cell responses in the spleen, they fail to induce CD4<sup>+</sup> T cell proliferation in the gut. The signals regulating ILC3-T cell responses remain unknown. Here, we show that transcripts associated with MHC II antigen presentation are down-modulated in intestinal natural cytotoxicity receptor (NCR)<sup>-</sup> ILC3s. Further data implicate microbiota-induced IL-23 as a crucial signal for reversible silencing of MHC II in ILC3s, thereby reducing the capacity of ILC3s to present antigen to T cells in the intestinal mucosa. Moreover, IL-23-mediated MHC II suppression is dependent on mTORC1 and STAT3 phosphorylation in NCR<sup>-</sup> ILC3s. By contrast, splenic interferon-γ induces MHC II expression and CD4<sup>+</sup> T cell stimulation by NCR<sup>-</sup> ILC3s. Our results thus identify biological circuits for tissue-specific regulation of ILC3-dependent T cell responses. These pathways may have implications for inducing or silencing T cell responses in human diseases.
Also flagged:cancermelanomalung cancerprogrammed cell death 1PD-1ligand 1
Journal Article2020-04-14✓ 1 SnippetYe Y, Jing Y, Li L, Mills GB, Diao L, Liu H, Liu H, Han L.
In-Text Gene Mentions
Results)
…checkpoints (e.g., TNFRSF4,TNFSF4, ICOS and CD27)…
Show Full Abstract
Immune checkpoint blockade therapies have extended patient survival across multiple cancer lineages, but there is a heated debate on whether cancer immunotherapy efficacy is different between male and female patients. We summarize the existing meta-analysis to show inconsistent conclusions for whether gender is associated with the immunotherapy response. We analyze molecular profiling from ICB-treated patients to identify molecular differences for immunotherapy responsiveness. We perform comprehensive analyses for patients from The Cancer Genome Atlas (TCGA) and reveal divergent patterns for sex bias in immune features across multiple cancer types. We further validate our observations in multiple independent data sets. Considering that the majority of clinical trials are in melanoma and lung cancer, meta-analyses that pool multiple cancer types have limitations to discern whether cancer immunotherapy efficacy is different between male and female patients. Future studies should include omics profiling to investigate sex-associated molecular differences in immunotherapy.
Also flagged:Head and neck cancersquamous cell carcinomashead and neck squamous cell carcinomaHNSCCcancergene expression
Journal Article2020-04-14No SnippetsLi L, Wang XL, Lei Q, Sun CZ, Xi Y, Chen R, He YW.
Show Full Abstract
Head and neck cancer is the sixth most common malignancy around the world, and 90% of cases are squamous cell carcinomas. In this study, we performed a systematic investigation of the immunogenomic landscape to identify prognostic biomarkers for head and neck squamous cell carcinoma (HNSCC). We analyzed the expression profiles of immune-related genes (IRGs) and clinical characteristics by interrogating RNA-seq data from 527 HNSCC patients in the cancer genome atlas (TCGA) dataset, including 41 HPV+ and 486 HPV- samples. We found that differentially expressed immune genes were closely associated with patient prognosis in HNSCC by comparing the differences in gene expression between cancer and normal samples and performing survival analysis. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were performed to annotate the biological functions of the differentially expressed immunogenomic prognosis-related genes. Two additional cohorts from the Oncomine database were used for validation. 65, 56 differentially expressed IRGs was associated with clinical prognosis in total and HPV<sup>-</sup> samples, respectively. Furthermore, we extracted 10, 11 prognosis-related IRGs from 65, 56 differentially expressed IRGs, respectively. They were significantly correlated with clinical prognosis and used to construct the prognosis prediction models. The multivariable ROC curves (specifically, the AUC) were used to measure the accuracy of the prognostic models. These genes were mainly enriched in several gene ontology (GO) terms related to immunocyte migration and receptor and ligand activity. KEGG pathway analysis revealed enrichment of pathways related to cytokine-cytokine receptor interactions, which are primarily involved in biological processes. In addition, we identified 63 differentially expressed transcription factors (TFs) from 4784 differentially expressed genes, and 16 edges involving 18 nodes were formed in the regulatory network between differentially expressed TFs and the high-risk survival-associated IRGs. B cell and CD4 T cell infiltration levels were significantly negatively correlated with the expression of prognosis-related immune genes regardless of HPV status. In conclusion, this comprehensive analysis identified the prognostic IRGs as potential biomarkers, and the model generated in this study may enable an accurate prediction of survival.
Also flagged:Myotonic dystrophy type 1genetic disordermuscular dystrophymyotoniapathogenesisdystrophy
Journal Article2020-04-14✓ 1 SnippetKurkiewicz A, Cooper A, McIlwaine E, Cumming SA, Adam B, Krahe R, Puymirat J, Schoser B, Timchenko L, Ashizawa T, Thornton CA, Rogers S, McClure JD, Monckton DG.
In-Text Gene Mentions
Introduction)
…(CUGBP1), HNRNPH1 andSTAU1(Staufen1) [ 2…
Show Full Abstract
Myotonic dystrophy type 1 (DM1) is a rare genetic disorder, characterised by muscular dystrophy, myotonia, and other symptoms. DM1 is caused by the expansion of a CTG repeat in the 3'-untranslated region of DMPK. Longer CTG expansions are associated with greater symptom severity and earlier age at onset. The primary mechanism of pathogenesis is thought to be mediated by a gain of function of the CUG-containing RNA, that leads to trans-dysregulation of RNA metabolism of many other genes. Specifically, the alternative splicing (AS) and alternative polyadenylation (APA) of many genes is known to be disrupted. In the context of clinical trials of emerging DM1 treatments, it is important to be able to objectively quantify treatment efficacy at the level of molecular biomarkers. We show how previously described candidate mRNA biomarkers can be used to model an effective reduction in CTG length, using modern high-dimensional statistics (machine learning), and a blood and muscle mRNA microarray dataset. We show how this model could be used to detect treatment effects in the context of a clinical trial.
Also flagged:membranesGene Expressiontranscription factorsangiogenesisHypoxia Inducible Factor 1 Subunit AlphaHIF1A
Journal Article2020-04-14No SnippetsShao D, He S, Ye Z, Zhu X, Sun W, Fu W, Ma T, Li Z.
Show Full Abstract
<h4>Background</h4>This study aimed to identify and evaluate potential molecular targets associated with the development of proliferative diabetic retinopathy (DR).<h4>Methods</h4>The microarray dataset "GSE60436" generated from fibrovascular membranes (FVMs) associated with proliferative DR was downloaded from the Gene Expression Omnibus database. Differentially expressed genes (DEGs) from the active FVMs and control or inactive FVMs and control were evaluated and co-DEGs were identified using VEEN analysis. Functional enrichment analysis, and protein-protein interactions (PPI) network and module analyses were performed on the upregulated and downregulated coDEGs. Finally, several predictions regarding microRNAs (miRNAs) and transcription factors (TFs) were made to construct a putative TF-miRNA-target network.<h4>Results</h4>A total of 1475 co-DEGs were screened in active/inactive FVM samples, including 461 upregulated and 1014 downregulated genes, which were enriched for angiogenesis [Hypoxia Inducible Factor 1 Subunit Alpha (HIF1A) and Placental Growth Factor (PGF)] and visual perception, respectively. In the case of the upregulated co-DEGs, Kinesin Family Member 11 (KIF11), and BUB1 Mitotic Checkpoint Serine/Threonine Kinase (BUB1) exhibited the highest values in both the PPI network and module analyses, as well as the genes related to mitosis. In the case of downregulated co-DEGs, several G protein subunits, including G Protein Subunit Beta 3 (GNB3), exhibited the highest values in both the PPI network and module analyses. The genes identified in the module analysis were found to be from the signal transduction-related pathways. In addition, we were able to identify four miRNAs and five TFs, including miR-136 and miR-374.<h4>Conclusions</h4>In brief, HIF1A, PGF, KIF11, G protein subunits, and miR-136, miR-374 may all be involved in angiogenesis, retinal endothelial cell proliferation, and visual signal transduction in proliferative DR. This study provides a number of novel insights that may aid the development of future studies dedicated to discovering novel therapeutic targets in proliferative DR.
Also flagged:tissue developmentmembraneNRF2p53hormone-negative ductal carcinoma in situtriple-negative breast cancer
Journal Article2020-04-14✓ 1 SnippetPereira EJ, Burns JS, Lee CY, Marohl T, Calderon D, Wang L, Atkins KA, Wang CC, Janes KA.
In-Text Gene Mentions
Text
…PRDX6…
Show Full Abstract
Breast and mammary epithelial cells experience different local environments during tissue development and tumorigenesis. Microenvironmental heterogeneity gives rise to distinct cell regulatory states whose identity and importance are just beginning to be appreciated. Cellular states diversify when clonal three-dimensional (3D) spheroids are cultured in basement membrane, and one such state is associated with stress tolerance and poor response to anticancer therapeutics. Here, we found that this state was jointly coordinated by the NRF2 and p53 pathways, which were costabilized by spontaneous oxidative stress within 3D cultures. Inhibition of NRF2 or p53 individually disrupted some of the transcripts defining the regulatory state but did not yield a notable phenotype in nontransformed breast epithelial cells. In contrast, combined perturbation prevented 3D growth in an oxidative stress-dependent manner. By integrating systems models of NRF2 and p53 signaling in a single oxidative stress network, we recapitulated these observations and made predictions about oxidative stress profiles during 3D growth. NRF2 and p53 signaling were similarly coordinated in normal breast epithelial tissue and hormone-negative ductal carcinoma in situ lesions but were uncoupled in triple-negative breast cancer (TNBC), a subtype in which p53 is usually mutated. Using the integrated model, we correlated the extent of this uncoupling in TNBC cell lines with the importance of NRF2 in the 3D growth of these cell lines and their predicted handling of oxidative stress. Our results point to an oxidative stress tolerance network that is important for single cells during glandular development and the early stages of breast cancer.
…Knockdown of DinoflagellateCondensinCcSMC4 Subunit Leads…
Introduction)
…Condensindysfunction leads to…
Introduction)
…Condensinstructural maintenance of…
Introduction)
…Condensinsare pentameric protein…
Results)
…Condensinfunctions are regulated…
Show Full Abstract
Dinoflagellates have some of the largest genomes, and their liquid-crystalline chromosomes (LCCs) have high degrees of non-nucleosomal superhelicity with cation-mediated DNA condensation. It is currently unknown if condensins, pentameric protein complexes containing structural maintenance of chromosomes 2/4, commonly involved in eukaryotic chromosomes condensation in preparation for M phase, may be involved in the LCC structure. We find that CcSMC4p (dinoflagellate SMC4 homolog) level peaked at S/G2 phase, even though LCCs do not undergo global-decondensation for replication. Despite the differences in the chromosomal packaging system, heterologous CcSMC4p expression suppressed conditional lethality of the corresponding fission yeast mutant, suggesting conservation of some canonical condensin functions. CcSMC4p-knockdown led to sustained expression of the S-phase marker PCNAp, S-phase impediment, and distorted nuclei in the early stage of CcSMC4p depletion. Prolonged CcSMC4p-knockdown resulted in aneuploidal cells and nuclear swelling with increasing LCC decompaction-decondensation. Cumulatively, our data suggested CcSMC4p function was required for dinoflagellate S-phase progression, and we propose that condensin-mediated higher-order compaction provisioning is involved in the provision of local rigidity for the replisome.
Advances in genomic science are informing an expansion of genetic testing for neurodegenerative diseases, which can be used for diagnostic and predictive purposes and performed in both medical and consumer genomics settings. Such testing-which is often for severe and incurable conditions like Huntington's, Alzheimer's, and Parkinson's diseases-raises important ethical and health communication challenges. This review addresses such challenges in the contexts of clinical, research, and direct-to-consumer genetic testing; these include informed consent, risk estimation and communication, potential benefits and psychosocial harms of genetic information (e.g., genetic discrimination), access to services, education and workforce needs, and health policies. The review also highlights future areas of likely growth in the field, including polygenic risk scores, use of genetic testing in clinical trials, and return of individual research results.
Allosteric regulation of protein functions is ubiquitous in organismal biology, but the principles governing its evolution are not well understood. Here we discuss recent studies supporting the large-scale existence of latent allostery in ancestor proteins of superfamilies. As suggested, the evolution of allostery could be driven by the need for specificity in paralogs of slow evolving protein complexes with conserved active sites. The same slow evolution is displayed by purifying selection exhibited in allosteric proteins with somatic mutations involved in cancer, where disease-associated mutations are enriched in both orthosteric and allosteric sites. Consequently, disease-associated variants can be used to identify druggable allosteric sites that are specific for paralogs in protein superfamilies with otherwise similar functions.
Also flagged:medulloblastomaintracranial malignant tumorpathogenesisGene Expressioncell cyclespindle
Journal Article2020-04-14No SnippetsLiu Z, Zhang R, Sun Z, Yao J, Yao P, Chen X, Wang X, Gao M, Wan J, Du Y, Zhao S.
Show Full Abstract
<h4>Background</h4>Medulloblastoma (MB) is the most common intracranial malignant tumor in children. The genes and pathways involved in the pathogenesis of MB are relatively unknown. We aimed to identify potential biomarkers and small-molecule drugs for MB.<h4>Methods</h4>Gene expression profile data sets were obtained from the Gene Expression Omnibus (GEO) database and the differentially expressed genes (DEGs) were identified using the Limma package in R. Functional annotation, and cell signaling pathway analysis of DEGs was carried out using DAVID and Kobas. A protein-protein interaction network was generated using STRING. Potential small-molecule drugs were identified using CMap.<h4>Result</h4>We identified 104 DEGs (29 upregulated; 75 downregulated). Gene ontology analysis showed enrichment in the mitotic cell cycle, cell cycle, spindle, and DNA binding. Cell signaling pathway analysis identified cell cycle, HIF-1 signaling pathway, and phospholipase D signaling pathway as key pathways. SYN1, CNTN2, FAIM2, MT3, and SH3GL2 were the prominent hub genes and their expression level were verified by RT-qPCR. Vorinostat, resveratrol, trichostatin A, pyrvinium, and prochlorperazine were identified as potential drugs for MB. The five hub genes may be targets for diagnosis and treatment of MB, and the small-molecule compounds are promising drugs for effective treatment of MB.<h4>Conclusion</h4>In this study we obtained five hub genes of MB, SYN1, CNTN2, FAIM2, MT3, and SH3GL2 were confirmed as hub genes. Meanwhile, Vorinostat, resveratrol, trichostatin A, pyrvinium, and prochlorperazine were identified as potential drugs for MB.
Also flagged:MastocytosisSystemic mastocytosismast cell proliferationKITtransmembranetyrosine kinase
Journal Article2020-04-14No SnippetsPiris-Villaespesa M, Alvarez-Twose I.
Show Full Abstract
Systemic mastocytosis is a rare and heterogeneous disease characterized by mast cell proliferation and activation. KIT is a transmembrane tyrosine kinase which plays a key role in mast cell growth, differentiation and survival. After interaction with its ligand, the stem cell factor, KIT dimerizes activating downstream pathways involving multiple tyrosine kinases (PI3K, JAK/STAT, RAS/ERK). Activating mutations in KIT are detected in most cases of systemic mastocytosis, being the most common <i>KIT</i> D816V. Therefore, since the emergence of tyrosine kinase inhibitors, KIT inhibition has been an attractive approach when facing mastocytosis treatment. Initial reports showed that only the rare <i>KIT</i> D816V negative cases were responsive to tyrosine kinase inhibitors. However, the development of new tyrosine kinase inhibitors such as midostaurin or avapritinib with activity against mast cells carrying the D816V KIT mutation, has changed the landscape of this disease.
Also flagged:capecitabineERBB2NTRK1RNF43CDK6CDKN2B
Journal Article2020-04-14✓ 2 SnippetsWakai T, Nagahashi M, Shimada Y, Prasoon P, Sakata J.
In-Text Gene Mentions
S I O 001029)
…In the liver biopsy of a 62 year‐old female patient, Ross et al49 applied a NGS filtering process of 28 formalin‐fixed paraffin‐embedded (FFPE) samples of intrahepatic cholangiocarcinoma, and identified a new gene fusion, RABGAP1L‐NTRK1 (3.6%).…
Introduction)
…new gene fusion,RABGAP1L‐NTRK1 (3.6%).…
Show Full Abstract
Biliary tract cancer (BTC) is clinically and pathologically heterogeneous and responds inadequately to treatment. A small section of patients develop resectable disease, although the relapse rates are high; the benefits of adjuvant capecitabine chemotherapy for BTC are now understood, and gemcitabine-based combination chemotherapy is the first line of therapeutic strategy for BTC; however, alternative therapy for BTC is not known. Genomic profiling can provide detailed information regarding the carcinogenesis, identification, and therapy for BTC. Currently, confirmed restorative targets for BTC are lacking. In this review, we aimed to analyze the preclinical and clinical implications of a spectrum of genomic alterations associated with new potentially remedial targets. We focused on eight draggable genes for BTC, which were described as having evidence of therapeutic impact (evidence level 2A-3B) based on the clinical practice guidance for next-generation sequencing in cancer diagnosis and treatment; these include ERBB2, NTRK1, RNF43, CDK6, CDKN2B, FGFR2, IDH1, and IDH2. Moreover, some of the BTC present microsatellite instability, hypermutation, and germline variants, which we also reviewed. Finally, we discussed the therapeutic options based on the next-generation sequencing findings in BTC. Studies have demonstrated that BTC includes subgroups with individually distinct driver mutations, most of which will be targeted with new treatment plans.
Also flagged:Hepatocellular carcinomamalignant tumourcancerliver cancerdeathtumour
Journal Article2020-04-13No SnippetsSun JY, Zhang XY, Cao YZ, Zhou X, Gu J, Mu XX.
Show Full Abstract
Hepatocellular carcinoma (HCC) is the sixth most common malignant tumour, which has posed a heavy health and financial burden worldwide. Due to limited symptoms at the early stage and the limitation in current biomarkers, HCC patients are usually diagnosed at the advanced stage with a pessimistic overall survival rate. Circular RNAs (circRNAs) are a subclass of single-stranded RNAs characterized by a covalently closed loop structure without 3'- or 5'-end. With advances in high-throughput sequencing technology and bioinformatics, accumulating studies have demonstrated the promotor or suppressor roles of circRNAs in the carcinogenesis, progression, and metastasis of HCC. Moreover, circRNAs are characteristic of higher abundance, stability and conservation compared with linear RNAs. Therefore, circRNAs have emerged as one of the most promising diagnostic and prognostic biomarkers for HCC with reliable accuracy, sensitivity and specificity. In this review, we briefly introduce the characteristics of circRNAs and summarize the roles of circRNAs in the biological procedures of HCC. Furthermore, we provide an overview on the potential diagnostic and prognostic value of circRNAs as biomarkers for patients with HCC. Finally, we discuss future perspectives of circRNAs in cancer research.
Also flagged:hepatic sclerosiscirrhosisdeathK76portal hypertensionK74
Journal Article2020-04-13✓ 5 SnippetsEmdin CA, Haas ME, Khera AV, Aragam K, Chaffin M, Klarin D, Hindy G, Jiang L, Wei WQ, Feng Q, Karjalainen J, Havulinna A, Kiiskinen T, Bick A, Ardissino D, Wilson JG, Schunkert H, McPherson R, Watkins H, Elosua R, Bown MJ, Samani NJ, Baber U, Erdmann J, Gupta N, Danesh J, Saleheen D, Chang KM, Vujkovic M, Voight B, Damrauer S, Lynch J, Kaplan D, Serper M, Tsao P, Million Veteran Program, Mercader J, Hanis C, Daly M, Denny J, Gabriel S, Kathiresan S.
In-Text Gene Mentions
I A O 0000326)
…HFE…
Methods)
…To examine whether known alcoholic and non-alcoholic cirrhosis variants associate with all-cause cirrhosis, we tested the association of six known cirrhosis variants (PNPLA3 I48M, TM6SF2 E167K, MBOAT7 rs641738, HSD17B13 rs72613567, HFE C282Y and SERPINA1 E366K[11,16,18,19]) with all-cause cirrhosis in UK Biobank (hospitalization or death due to ICD codes K70.2, K70.3, K70.4, K74.0, K74.1, K74.2, K74.6, K76.6, or I85).…
Results)
…We replicated known associations of PNPLA3, TM6SF2, HFE and HDS17B13 variants with cirrhosis at genome-wide significance (Table 1).…
Methods)
…rs641738, HSD17B13 rs72613567,HFEC282Y and SERPINA1…
Results)
…, TM6SF2 ,HFEand HDS17B13 variants…
Show Full Abstract
Analyzing 12,361 all-cause cirrhosis cases and 790,095 controls from eight cohorts, we identify a common missense variant in the Mitochondrial Amidoxime Reducing Component 1 gene (MARC1 p.A165T) that associates with protection from all-cause cirrhosis (OR 0.91, p = 2.3*10-11). This same variant also associates with lower levels of hepatic fat on computed tomographic imaging and lower odds of physician-diagnosed fatty liver as well as lower blood levels of alanine transaminase (-0.025 SD, 3.7*10-43), alkaline phosphatase (-0.025 SD, 1.2*10-37), total cholesterol (-0.030 SD, p = 1.9*10-36) and LDL cholesterol (-0.027 SD, p = 5.1*10-30) levels. We identified a series of additional MARC1 alleles (low-frequency missense p.M187K and rare protein-truncating p.R200Ter) that also associated with lower cholesterol levels, liver enzyme levels and reduced risk of cirrhosis (0 cirrhosis cases for 238 R200Ter carriers versus 17,046 cases of cirrhosis among 759,027 non-carriers, p = 0.04) suggesting that deficiency of the MARC1 enzyme may lower blood cholesterol levels and protect against cirrhosis.
Journal Article2020-04-13No SnippetsLi HZ, Xu XH, Lin N, Wang DW, Lin YM, Su ZZ, Lu HD.
Show Full Abstract
The current study was aimed at exploring the potential roles and possible mechanisms of miR-10a-5p in osteoarthritis (OA). We performed RT-qPCR, Western blot, CCK8, EdU Assay, and flow cytometry assay to clarify the roles of miR-10a-5p in OA. Furthermore, the whole transcriptome sequencing together with integrated bioinformatics analyses were conducted to elucidate the underlying mechanisms of miR-10a-5p involving in OA. Our results demonstrated that miR-10a-5p was upregulated in OA and acted as a significant contributing factor for OA. A large number of circRNAs, lncRNAs, miRNAs, and mRNAs were identified by overexpressing miR-10a-5p. Functional enrichment analyses indicated that these differentially-expressed genes were enriched in some important terms including PPAR signaling pathway, PI3K-Akt signaling pathway, and p53 signaling pathway. A total of 42 hub genes were identified in the protein-protein interaction network including SERPINA1, TTR, APOA1, and A2M. Also, we constructed the network regulatory interactions across coding and noncoding RNAs triggered by miR-10a-5p, which revealed the powerful regulating effects of miR-10a-5p. Moreover, we found that HOXA3 acted as the targeted genes of miR-10a-5p and miR-10a-5p contributed to the progression of OA by suppressing HOXA3 expression. Our findings shed insight on regulatory mechanisms of miR-10a-5p, which might provide novel therapeutic targets for OA.
Also flagged:Bmal1cell differentiationCircadian oscillationsClockCryptochromeembryogenesis
Journal Article2020-04-13No SnippetsGallardo A, Molina A, Asenjo HG, Martorell-Marugán J, Montes R, Ramos-Mejia V, Sanchez-Pozo A, Carmona-Sáez P, Lopez-Onieva L, Landeira D.
Show Full Abstract
Mammals optimize their physiology to the light-dark cycle by synchronization of the master circadian clock in the brain with peripheral clocks in the rest of the tissues of the body. Circadian oscillations rely on a negative feedback loop exerted by the molecular clock that is composed by transcriptional activators Bmal1 and Clock, and their negative regulators Period and Cryptochrome. Components of the molecular clock are expressed during early development, but onset of robust circadian oscillations is only detected later during embryogenesis. Here, we have used naïve pluripotent mouse embryonic stem cells (mESCs) to study the role of Bmal1 during early development. We found that, compared to wild-type cells, <i>Bmal1</i>-/- mESCs express higher levels of Nanog protein and altered expression of pluripotency-associated signalling pathways. Importantly, <i>Bmal1-/-</i> mESCs display deficient multi-lineage cell differentiation capacity during the formation of teratomas and gastrula-like organoids. Overall, we reveal that Bmal1 regulates pluripotent cell differentiation and propose that the molecular clock is an hitherto unrecognized regulator of mammalian development.
Remarkable progress has come from whole-brain models linking anatomy and function. Paradoxically, it is not clear how a neuronal dynamical system running in the fixed human anatomical connectome can give rise to the rich changes in the functional repertoire associated with human brain function, which is impossible to explain through long-term plasticity. Neuromodulation evolved to allow for such flexibility by dynamically updating the effectivity of the fixed anatomical connectivity. Here, we introduce a theoretical framework modeling the dynamical mutual coupling between the neuronal and neurotransmitter systems. We demonstrate that this framework is crucial to advance our understanding of whole-brain dynamics by bidirectional coupling of the two systems through combining multimodal neuroimaging data (diffusion magnetic resonance imaging [dMRI], functional magnetic resonance imaging [fMRI], and positron electron tomography [PET]) to explain the functional effects of specific serotoninergic receptor (5-HT<sub>2A</sub>R) stimulation with psilocybin in healthy humans. This advance provides an understanding of why psilocybin is showing considerable promise as a therapeutic intervention for neuropsychiatric disorders including depression, anxiety, and addiction. Overall, these insights demonstrate that the whole-brain mutual coupling between the neuronal and the neurotransmission systems is essential for understanding the remarkable flexibility of human brain function despite having to rely on fixed anatomical connectivity.
Also flagged:axonalneuroinflammatory diseasecoagulationglutathioneacivicinrelapsing multiple sclerosis
Journal Article2020-04-13✓ 1 SnippetMendiola AS, Ryu JK, Bardehle S, Meyer-Franke A, Ang KK, Wilson C, Baeten KM, Hanspers K, Merlini M, Thomas S, Petersen MA, Williams A, Thomas R, Rafalski VA, Meza-Acevedo R, Tognatta R, Yan Z, Pfaff SJ, Machado MR, Bedard C, Rios Coronado PE, Jiang X, Wang J, Pleiss MA, Green AJ, Zamvil SS, Pico AR, Bruneau BG, Arkin MR, Akassoglou K.
In-Text Gene Mentions
Results)
…(e.g. F9, Itgb3,Serpinc1, Gp9, Gp1ba ;…
Show Full Abstract
Oxidative stress is a central part of innate immune-induced neurodegeneration. However, the transcriptomic landscape of central nervous system (CNS) innate immune cells contributing to oxidative stress is unknown, and therapies to target their neurotoxic functions are not widely available. Here, we provide the oxidative stress innate immune cell atlas in neuroinflammatory disease and report the discovery of new druggable pathways. Transcriptional profiling of oxidative stress-producing CNS innate immune cells identified a core oxidative stress gene signature coupled to coagulation and glutathione-pathway genes shared between a microglia cluster and infiltrating macrophages. Tox-seq followed by a microglia high-throughput screen and oxidative stress gene network analysis identified the glutathione-regulating compound acivicin, with potent therapeutic effects that decrease oxidative stress and axonal damage in chronic and relapsing multiple sclerosis models. Thus, oxidative stress transcriptomics identified neurotoxic CNS innate immune populations and may enable discovery of selective neuroprotective strategies.
Also flagged:aggressionneuropsychiatric disordersglutamic acid decarboxylase 2GAD2orexin receptor 2cre
Journal Article2020-04-13✓ 1 SnippetFlanigan ME, Aleyasin H, Li L, Burnett CJ, Chan KL, LeClair KB, Lucas EK, Matikainen-Ankney B, Durand-de Cuttoli R, Takahashi A, Menard C, Pfau ML, Golden SA, Bouchard S, Calipari ES, Nestler EJ, DiLeone RJ, Yamanaka A, Huntley GW, Clem RL, Russo SJ.
In-Text Gene Mentions
Methods)
…to housekeeping genesAbt1(Mm00803824_m1) and Hprt…
Show Full Abstract
Heightened aggression is characteristic of multiple neuropsychiatric disorders and can have various negative effects on patients, their families and the public. Recent studies in humans and animals have implicated brain reward circuits in aggression and suggest that, in subsets of aggressive individuals, domination of subordinate social targets is reinforcing. In this study, we showed that, in male mice, orexin neurons in the lateral hypothalamus activated a small population of glutamic acid decarboxylase 2 (GAD2)-expressing neurons in the lateral habenula (LHb) via orexin receptor 2 (OxR2) and that activation of these GAD2 neurons promoted male-male aggression and conditioned place preference for aggression-paired contexts. Moreover, LHb GAD2 neurons were inhibitory within the LHb and dampened the activity of the LHb as a whole. These results suggest that the orexin system is important for the regulation of inter-male aggressive behavior and provide the first functional evidence of a local inhibitory circuit within the LHb.
Also flagged:chondrocyte developmentSox9sex determining region YSRY-type high mobility group (HMG) box 9chondrogenesis
Journal Article2020-04-13✓ 1 SnippetHe L, Bi Y, Wang R, Pan C, Chen H, Lan X, Qu L.
In-Text Gene Mentions
Discussion)
…HMG box6 (Sox6) [ 41…
Show Full Abstract
The SRY-type HMG box 9 (<i>Sox9</i>) gene plays an important role in chondrocyte development as well as changes in hypertrophic chondrocytes, indicating that <i>Sox9</i> can regulate growth in animals. However, no studies to date have examined the correlation between variations in <i>Sox9</i> and growth traits in goats. Here, we found a 4 bp indel in the 3'UTR of <i>Sox9</i> and verified its association with growth traits in Shaanbei white cashmere goats (<i>n</i> = 1109). The frequencies of two genotypes (ID and II) were 0.397 and 0.603, respectively, and polymorphic information content (PIC) values showed that the indel had a medium PIC (PIC > 0.25). The 4 bp indel was significantly correlated with body length (<i>p</i> = 0.006), heart girth (<i>p</i> = 0.001), and hip width (<i>p</i> = 4.37 × 10 <sup>-4</sup>). Notably, individuals with the ID genotype had significantly superior phenotypic traits compared with individuals bearing the II genotype. Hence, we speculated that the 4 bp indel is an important mutation affecting growth traits in goat, and may serve as an effective DNA molecular marker for marker-assisted selection in goat breeding programs.
Journal Article2020-04-13No SnippetsRodrigues JC, Bachi ALL, Silva GAV, Rossi M, do Amaral JB, Lezirovitz K, de Brito R.
Show Full Abstract
Noise exposure represents the second most common cause of acquired sensorineural hearing loss and we observed that tumor necrosis factor α (TNFα) was involved in this context. The effect of <i>Tnfα</i> gene silencing on the expression profile related to the TNFα metabolic pathway in an experimental model of noise-induced hearing loss had not previously been studied.<h4>Methods</h4>Single ears of Wistar rats were pretreated with <i>Tnfα</i> small interfering RNA (siRNA) by trans-tympanic administration 24 h before they were exposed to white noise (120 dBSPL for three hours). After 24 h of noise exposure, we analyzed the electrophysiological threshold and the amplitude of waves I, II, III, and IV in the auditory brain response click. In addition, qRT-PCR was performed to evaluate the TNFα metabolic pathway in the ears submitted or not to gene silencing.<h4>Results</h4>Preservation of the electrophysiological threshold and the amplitude of waves was observed in the ears submitted to gene silencing compared to the ears not treated. Increased anti-apoptotic gene expression and decreased pro-apoptotic gene expression were found in the treated ears.<h4>Conclusion</h4>Our results allow us to suggest that the blockade of TNFα by gene silencing was useful to prevent noise-induced hearing loss.
Also flagged:protein tyrosine kinaseEphrin type-B receptor 3EPHB3colorectal cancersEPHB2LRIG1
Journal Article2020-04-13✓ 5 SnippetsJang BG, Kim HS, Bae JM, Kim WH, Hyun CL, Kang GH.
In-Text Gene Mentions
Abstract)
…EPHB3 expression was higher in CRCs than in normal mucosa and was associated with the intestinal stem cell markers EPHB2, OLFM4, LRIG1, and a proposed cancer stem cell marker, CD44.…
The protein tyrosine kinase Ephrin type-B receptor 3 (EPHB3) is expressed in cells at the base of intestinal crypts, acting as a cellular guide in the maintenance of intestinal crypt architecture. We aimed to investigate the expression profile of EPHB3 in colorectal precancerous lesions and colorectal cancers (CRCs), and assess its prognostic value. EPHB3 expression was higher in CRCs than in normal mucosa and was associated with the intestinal stem cell markers EPHB2, OLFM4, LRIG1, and a proposed cancer stem cell marker, CD44. Enhanced EPHB3 expression significantly declined during the transformation from adenoma to carcinoma and as the tumor invaded into deeper tissue layers. Namely, a substantial reduction of EPHB3 expression was observed in the budding cancer cells at the invasive tumor fronts, which was more extensive than E-cadherin downregulation. In an azoxymethane/dextran sulfate sodium-induced, colitis-associated, CRC model, EPHB3 expression increased along with tumor development. In a large cohort of CRC patients, EPHB3 positivity was observed in 24% of 610 CRCs and was negatively correlated with tumor differentiation, lympho-vascular invasion, and tumor, node, and metastasis stages. EPHB3 was positively associated with microsatellite instability but was associated with neither CpG island methylation, nor with KRAS and BRAF mutations. Notably, EPHB3 positivity was associated with better clinical outcomes, although it was not an independent prognostic marker. Overexpression of EPHB3 in the colon cancer cell line, DLD1, led to decreased cell growth and migration and reduced mitogen-activated protein kinase signaling. Taken together, our data demonstrate the suppressive role of EPHB3 in CRC progression.
Also flagged:CircadianCancerColorectal Cancercolon adenocarcinomaHDtumors
Journal Article2020-04-13✓ 5 SnippetsYalçin M, El-Athman R, Ouk K, Priller J, Relógio A.
In-Text Gene Mentions
Results)
…We extended our enriched gene set for HD retrieved with the PSEA analysis (25 genes, Table S1), to include two well-known HD-associated genes from the literature HTT [47] and HSPH1 (Heat shock protein family H (Hsp110) member 1), which has been shown to suppress or disaggregate HTT fibrils [48].…
Results)
…HD is caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene, resulting in a protein with an expanded polyglutamine tract.…
Discussion)
…HTT is expressed throughout the body and the mutant protein not only affects the brain but also peripheral tissues as weight loss, cardiomyopathies and skeletal muscle malfunction have been described for HD [59].…
Introduction)
…These candidate genes were HSPH1, HTT, SIN3A, and CLTC. Alterations in expression of our candidate genes showed correlation with patient survival in core clock components PER3, NR1D1, and CSNK2A1 and angiogenesis related VEGFA. Furthermore, our analysis highlights the link between the core-clock genes to cancer hallmark genes such as AKT1, MTOR, and MYC based on the literature.…
Results)
…Interestingly, we observed that four HD-associated genes, namely TP53, HTT, SIN3A, and CLTC were listed among the top frequently mutated candidate genes.…
Show Full Abstract
Accumulating evidence points to a link between circadian clock dysfunction and the molecular events that drive tumorigenesis. Here, we investigated the connection between the circadian clock and the hallmarks of cancer in an in vitro model of colorectal cancer (CRC). We used a cross-platform data normalization method to concatenate and compare available microarray and RNA-sequencing time series data of CRC cell lines derived from the same patient at different disease stages. Our data analysis suggests differential regulation of molecular pathways between the CRC cells and identifies several of the circadian and likely clock-controlled genes (CCGs) as cancer hallmarks and circadian drug targets. Notably, we found links of the CCGs to Huntington's disease (HD) in the metastasis-derived cells. We then investigated the impact of perturbations of our candidate genes in a cohort of 439 patients with colon adenocarcinoma retrieved from the Cancer Genome Atlas (TCGA). The analysis revealed a correlation of the differential expression levels of the candidate genes with the survival of patients. Thus, our study provides a bioinformatics workflow that allows for a comprehensive analysis of circadian properties at different stages of colorectal cancer, and identifies a new association between cancer and HD.
For clinical epidemiology specialists, connecting the genetic diversity of <i>Echinococcus</i> <i>multilocularis</i> to sources of infection or particular sites has become somewhat of a holy grail. It is very difficult to trace the infection history of alveolar echinococcosis (AE) patients as there may be an incubation period of five to 15 years before reliable diagnosis. Moreover, the variability of parasitic manifestations in human patients raises the possibility of genetically different isolates of <i>E. multilocularis</i> having different levels of pathogenicity. Thus, the exposure of human patients to different strains or genotypes circulating in geographically different environments may lead to different disease outcomes. Molecular tools, such as the microsatellite marker EmsB, were required to investigate these aspects. This genetic marker was previously tested on a collection of 1211 European field samples predominantly of animal origin, referenced on a publicly available database. In this study, we investigated a panel of 66 metacestode samples (between 1981 and 2019) recovered surgically from 63 patients diagnosed with alveolar echinococcosis originating from four European countries (France, Switzerland, Germany, Belgium). In this study, we identified nine EmsB profiles, five of which were found in patients located in the same areas of France and Switzerland. One profile was detected on both sides of the French-Swiss border, whereas most patients from non-endemic regions clustered together in another profile. EmsB profiles appeared to remain stable over time because similar profiles were detected in patients who underwent surgery recently and patients who underwent surgery some time ago. This study sheds light on possible pathways of contamination in humans, including proximity contamination in some cases, and the dominant contamination profiles in Europe, particularly for extrahepatic lesions.
Also flagged:AcuteThrombomodulinvein thrombosisliver cirrhosisportal vein thrombosisacute portal thrombosis
Journal Article2020-04-13✓ 1 SnippetNakayama S, Murashima N.
In-Text Gene Mentions
Discussion)
…of monotherapy withantithrombin-IIIfor PVT has…
Show Full Abstract
Portal vein thrombosis is a major complication associated with liver cirrhosis. In cirrhotic patients, a decrease in procoagulant and anticoagulant factors and an unstable balance between them is observed, and a relative decrease in the activation of anticoagulant drivers is one of the main causes of portal vein thrombosis (PVT). Herein, we report a case of acute portal thrombosis associated with liver cirrhosis and treated with a recombinant form of soluble thrombomodulin (thrombomodulin alpha, TM-<i>α</i>) in combination with antithrombin III. TM-<i>α</i> was administered in accordance with the dosage and route of administration for disseminated intravascular coagulation therapy and resulted in dissolution of PVT with a gradual decrease in D-dimer levels. No adverse events were observed during the course of treatment. In the future, in addition to conventional anticoagulation therapy using heparin or antivitamin K drugs, novel therapies targeting protein C activation using a recombinant form of soluble thrombomodulin may play an important role in the treatment of acute PVT.
Inositol hexakisphosphate (InsP<sub>6</sub>; phytic acid) is considered as the second messenger and plays a very important role in plants, animals, and human beings. It is the principal storage form of phosphorus in many plant tissues, especially in dry fruits, bran, and seeds. The resulting anion is a colorless species that plays a critical role in nutrition and is believed to cure many diseases. A fluoresceinated aminohexanol tethered inositol hexakisphosphate (<b>III</b>) had been synthesized earlier involving many complicated steps. We describe here a simple two-step synthesis of (<b>III</b>) and its characterization using different techniques such as matrix-assisted laser desorption ionization mass spectrometry, tandem mass spectrometry, and Fourier transform infrared, ultraviolet-visible, ultraviolet-fluorescence, <sup>1</sup>H nuclear magnetic resonance (NMR), and two-dimensional NMR spectroscopies. The effect of (<b>III</b>) has been investigated in the model systems, <i>Arabidopsis thaliana</i> and <i>Drosophila melanogaster</i>. Using Schrodinger software, computational studies on the binding of (<b>III</b>) with the protein 2P1M (Auxin-receptor TIR1-adaptor ASK1 complex) has revealed strong binding propensity with this compound. These studies on the fluoresceinated tethered phytic acid could have far reaching implications on its efficacy for human health and treatment of diseases (cancer/tumor and glioblastoma) and for understanding phosphorous recycling in the environment, especially for plant systems.
bioRxiv2020-04-13Preprint (No Snippets API)Wang X, Kadarmideen HN.
Show Full Abstract
Metabolites represent the ultimate response of biological systems, so metabolomics is considered to link the genotypes and phenotypes. Feed efficiency is one of the most important phenotypes in sustainable pig production and is the main breeding goal trait. We utilized metabolic and genomic datasets from a total of 108 pigs from our own previously published studies that involved 59 Duroc and 49 Landrace pigs with data on feed efficiency (residual feed intake or RFI), genotype (PorcineSNP80 BeadChip) data and metabolomic data (45 final metabolite datasets derived from LC-MS system). Utilizing these datasets, our main aim was to identify genetic variants (single-nucleotide polymorphisms or SNPs) that affect 45 different metabolite concentrations in plasma collected at the start and end of the performance testing of pigs categorized as high or low in their feed efficiency (based on RFI values). Genome-wide significant genetic variants could be then used as potential genetic or biomarkers in breeding programs for feed efficiency. The other objective was to reveal the biochemical mechanisms underlying genetic variations for pigs’ feed efficiency. In order to achieve these objectives, we firstly conducted a metabolite genome-wide association study (mGWAS) based on mixed linear models and found 152 genome-wide significant SNPs ( P -value < 1.06E-06) in association with 17 metabolites that included 90 significant SNPs annotated to 52 genes. On chromosome one alone, 51 significant SNPs associated with isovalerylcarnitine and propionylcarnitine were found to be in strong linkage disequilibrium (LD). SNPs in strong LD annotated to FBXL4 and CCNC consisted of two haplotype blocks where three SNPs (ALGA0004000, ALGA0004041 and ALGA0004042) were in the intron regions of FBXL4 and CCNC . The interaction network revealed that CCNC and FBXL4 were linked by the hub gene N6AMT1 that was associated with isovalerylcarnitine and propionylcarnitine. Moreover, three metabolites (i.e., isovalerylcarnitine, propionylcarnitine and pyruvic acid) were clustered in one group based on the low-high RFI pigs. This study performed a comprehensive metabolite-based GWAS analysis for pigs with differences in feed efficiency and provided significant metabolites for which there is a significant genetic variation as well as biological interaction networks. The identified metabolite genetic variants, genes and networks in high versus low feed efficient pigs could be considered as potential genetic or biomarkers for feed efficiency.
Also flagged:OATP1ACYP3AABCB1ABCG2NTRKlarotrectinib
Journal Article2020-04-12No SnippetsWang Y, Sparidans RW, Li W, Lebre MC, Beijnen JH, Schinkel AH.
Show Full Abstract
<h4>Background and purpose</h4>Larotrectinib is a FDA-approved oral small-molecule inhibitor for treatment of neurotrophic tropomyosin receptor kinase fusion-positive cancer. We here investigated the functions of the multidrug efflux transporters ABCB1 and ABCG2, the SLCO1A/1B (OATP1A/1B) uptake transporters, and the multispecific drug-metabolizing enzyme CYP3A in larotrectinib pharmacokinetic behaviour.<h4>Experimental approach</h4>In vitro, transepithelial drug transport and uptake assays were performed. In vivo, larotrectinib (10 mg·kg<sup>-1</sup> ) was administered orally to relevant genetically modified mouse models. Cell medium, plasma samples, and organ homogenates were measured by a sensitive and specific LC-MS/MS larotrectinib assay.<h4>Key results</h4>In vitro, larotrectinib was avidly transported by human (h) ABCB1 and mouse (m) Abcg2 efficiently by hABCG2 and modestly by hOATP1A2. In vivo, both mAbcb1a/1b and mAbcg2 markedly limited larotrectinib oral availability and brain and testis accumulation (by 2.1-fold, 10.4-fold, and 2.7-fold, respectively), with mAbcb1a/1b playing a more prominent role. mOatp1a/1b also restricted larotrectinib oral availability (by 3.8-fold) and overall tissue exposure, apparently by mediating substantial uptake into the liver, thus likely facilitating hepatobiliary excretion. Additionally, larotrectinib is an excellent substrate of CYP3A, which restricts the oral availability of larotrectinib and hence its tissue exposure.<h4>Conclusions and implications</h4>ABCG2 and especially ABCB1 limit the oral availability and brain and testis penetration of larotrectinib, while OATP1A/1B transporters restrict its systemic exposure by mediating hepatic uptake, thus allowing hepatobiliary excretion. CYP3A-mediated metabolism can strongly limit larotrectinib oral availability and hence its tissue concentrations. These insights may be useful in the further clinical development of larotrectinib.
The <i>Drosophila</i> male germline stem cell (GSC) lineage provides a great model to understand stem cell maintenance, proliferation, differentiation and dedifferentiation. Here, we use the <i>Drosophila</i> GSC lineage to systematically analyze the transcriptome of discrete but continuously differentiating germline cysts. We first isolated single cysts at each recognizable stage from wild-type testes, which were subsequently applied for RNA-seq analyses. Our data delineate a high-resolution transcriptome atlas in the entire male GSC lineage: the most dramatic switch occurs from early to late spermatocyte, followed by the change from the mitotic spermatogonia to early meiotic spermatocyte. By contrast, the transit-amplifying spermatogonia cysts display similar transcriptomes, suggesting common molecular features among these stages, which may underlie their similar behavior during both differentiation and dedifferentiation processes. Finally, distinct differentiating germ cell cyst samples do not exhibit obvious dosage compensation of X-chromosomal genes, even considering the paucity of X-chromosomal gene expression during meiosis, which is different from somatic cells. Together, our single cyst-resolution, genome-wide transcriptional profile analyses provide an unprecedented resource to understand many questions in both germ cell biology and stem cell biology fields.
Also flagged:inflammatory bowel diseasemethylationcytokinecoeliac diseaseUlcerative Colitiscolon cancer
Journal Article2020-04-12No SnippetsAgliata I, Fernandez-Jimenez N, Goldsmith C, Marie JC, Bilbao JR, Dante R, Hernandez-Vargas H.
Show Full Abstract
Abnormal DNA methylation has been described in human inflammatory conditions of the gastrointestinal tract, such as inflammatory bowel disease (IBD). As other complex diseases, IBD results from the balance between genetic predisposition and environmental exposures. As such, DNA methylation may be the consequence (and potential effector) of both, genetic susceptibility variants and/or environmental signals such as cytokine exposure. We attempted to discern between these two non-excluding possibilities by performing a combined analysis of published DNA methylation data in intestinal mucosal cells of IBD and control samples. We identified abnormal DNA methylation at different levels: deviation from mean methylation signals at site and region levels, and differential variability. A fraction of such changes is associated with genetic polymorphisms linked to IBD susceptibility. In addition, by comparing with another intestinal inflammatory condition (i.e., coeliac disease) we propose that aberrant DNA methylation can also be the result of unspecific processes such as chronic inflammation. Our characterization suggests that IBD methylomes combine intrinsic and extrinsic responses in intestinal mucosal cells, and could point to knowledge-based biomarkers of IBD detection and progression.
Also flagged:Inositol 1,4,5-Trisphosphate Receptorsendoplasmic reticulumpathogenesiscalciummetabolismmembrane protein
Journal Article2020-04-12✓ 2 SnippetsGambardella J, Lombardi A, Morelli MB, Ferrara J, Santulli G.
In-Text Gene Mentions
S I O 001029)
…Blocking the Htt–ITPR1 interaction in vivo was shown to regulate the abnormal calcium signaling in response to glutamate, protecting the neurons from death, and improving motor coordination [58], posing ITPR1 in a key position in HD pathophysiology and supporting the use of ITPR1-based therapies.…
S I O 001029)
…In HD, the causative mutation is the poliQ expansion of Huntingtin (Htt), although the cellular and molecular mechanisms of GABAergic neurons loss are not clearly understood [55].…
Show Full Abstract
Inositol 1,4,5-trisphosphate receptors (ITPRs) are intracellular calcium release channels located on the endoplasmic reticulum of virtually every cell. Herein, we are reporting an updated systematic summary of the current knowledge on the functional role of ITPRs in human disorders. Specifically, we are describing the involvement of its loss-of-function and gain-of-function mutations in the pathogenesis of neurological, immunological, cardiovascular, and neoplastic human disease. Recent results from genome-wide association studies are also discussed.
Also flagged:WntHedgehogRunx2chondrocyte proliferationHckChondrocyte maturation
Journal Article2020-04-12✓ 1 SnippetMatsuura VKSK, Yoshida CA, Komori H, Sakane C, Yamana K, Jiang Q, Komori T.
In-Text Gene Mentions
Introduction)
…Sox9, Sox5, andSox6induce Col2a1 expression…
Show Full Abstract
Runx2 is required for chondrocyte proliferation and maturation. In the search of Runx2 target genes in chondrocytes, we found that Runx2 up-regulated the expression of hematopoietic cell kinase (<i>Hck)</i>, which is a member of the Src tyrosine kinase family, in chondrocytes, that <i>Hck</i> expression was high in cartilaginous limb skeletons of wild-type mice but low in those of <i>Runx2</i><sup>-/-</sup> mice, and that Runx2 bound the promoter region of <i>Hck</i>. To investigate the functions of Hck in chondrocytes, transgenic mice expressing a constitutively active form of <i>Hck</i> (<i>Hck</i><sup>CA</sup>) were generated using the <i>Col2a1</i> promoter/enhancer. The hind limb skeletons were fused, the tibia became a large, round mass, and the growth plate was markedly disorganized. Chondrocyte maturation was delayed until E16.5 but accelerated thereafter. BrdU-labeled, but not terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL)-positive, chondrocytes were increased. Furthermore, <i>Hck</i> knock-down reduced the proliferation of primary chondrocytes. In microarray and real-time RT-PCR analyses using hind limb RNA from <i>Hck</i><sup>CA</sup> transgenic mice, the expression of Wnt (<i>Wnt10b</i>, <i>Tcf7</i>, <i>Lef1</i>, <i>Dkk1</i>) and hedgehog (<i>Ihh</i>, <i>Ptch1</i>, and <i>Gli1</i>) signaling pathway genes was upregulated. These findings indicated that <i>Hck</i>, whose expression is regulated by Runx2, is highly expressed in chondrocytes, and that <i>Hck</i><sup>CA</sup> activates Wnt and hedgehog signaling pathways, and promotes chondrocyte proliferation without increasing apoptosis.
Also flagged:fluoxetineHIF-1αNetrinVEGFangiogenesisischemic stroke
Journal Article2020-04-12✓ 1 SnippetHu Q, Liu L, Zhou L, Lu H, Wang J, Chen X, Wang Q.
In-Text Gene Mentions
Abstract)
…and its receptorDCC, VEGF and its…
Show Full Abstract
Fluoxetine is one of the most promising drugs for improving clinical outcome in patients with ischemic stroke. This in vivo study investigated the hypothesis that fluoxetine may affect HIF-1α-Netrin/VEGF cascade, angiogenesis and neuroprotection using a rat model of transient middle cerebral artery occlusion (tMCAO). The rats were given fluoxetine or saline after tMCAO for 4 weeks. Then, protein expression of HIF-1α-Netrin/VEGF cascade was examined at 1, 2, 4 weeks after tMCAO. In vivo synchrotron radiation were performed to observe microangiography of ischemic brain after 4 weeks of tMCAO. The infarct size and neurobehavioral test were carried out 1 to 4 weeks after tMCAO. Results revealed that HIF-1α expression was upregulated in fluoxetine-treated group. Similarly, fluoxetine increased protein expression of Netrin and its receptor DCC, VEGF and its receptor VEGFR. Synchrotron radiation angiography revealed more branches in fluoxetine-treated rats. We found no difference of infarct volume between fluoxetine and saline treated rats after 1 week of tMCAO, and ischemia-induced brain atrophy volume in fluoxetine-treated group was attenuated after 4 weeks of tMCAO. Neurological deficits were improved in fluoxetine-treated rats at 3 and 4 weeks after tMCAO. Our results indicated that fluoxetine could upregulate protein expression of HIF-1α-Netrin/VEGF cascade, promote angiogenesis, and improve long-term functional recovery after ischemic stroke.
Also flagged:Vanadiumcancerobesitymetabolismmetalsanion
Journal Article2020-04-12No SnippetsŚcibior A, Pietrzyk Ł, Plewa Z, Skiba A.
Show Full Abstract
<h4>Background</h4>Vanadium (V) is an element with a wide range of effects on the mammalian organism. The ability of this metal to form organometallic compounds has contributed to the increase in the number of studies on the multidirectional biological activity of its various organic complexes in view of their application in medicine.<h4>Objective</h4>This review aims at summarizing the current state of knowledge of the pharmacological potential of V and the mechanisms underlying its anti-viral, anti-bacterial, anti-parasitic, anti-fungal, anti-cancer, anti-diabetic, anti-hypercholesterolemic, cardioprotective, and neuroprotective activity as well as the mechanisms of appetite regulation related to the possibility of using this element in the treatment of obesity. The toxicological potential of V and the mechanisms of its toxic action, which have not been sufficiently recognized yet, as well as key information about the essentiality of this metal, its physiological role, and metabolism with certain aspects on the timeline is collected as well. The report also aims to review the use of V in the implantology and industrial sectors emphasizing the human health hazard as well as collect data on the directions of further research on V and its interactions with Mg along with their character.<h4>Results and conclusions</h4>Multidirectional studies on V have shown that further analyses are still required for this element to be used as a metallodrug in the fight against certain life-threatening diseases. Studies on interactions of V with Mg, which showed that both elements are able to modulate the response in an interactive manner are needed as well, as the results of such investigations may help not only in recognizing new markers of V toxicity and clarify the underlying interactive mechanism between them, thus improving the medical application of the metals against modern-age diseases, but also they may help in development of principles of effective protection of humans against environmental/occupational V exposure.
Also flagged:Cerebral Venous Sinus ThrombosisvisionproteinS(PS) deficiencyantithrombin III
Journal Article2020-04-12✓ 1 SnippetKomro J, Findakly D.
In-Text Gene Mentions
Abstract)
…isolated antithrombin III (ATIII) deficiency, and one…
Show Full Abstract
Cerebral venous sinus thrombosis (CVST) is a rare condition characterized by elevated intracranial pressure due to impaired cerebral venous drainage, potentially leading to life-threatening consequences. We searched the PubMed electronic database for 'cerebral venous sinus thrombosis' and 'prothrombotic' cases reported in adults (19+ years) and conducted a systematic review for the published literature in the English language pooled with a case from our institution. Data were analyzed regarding patient demographics, risk factors, clinical features, treatment modalities, and outcomes when available. Thirty cases of CVST were identified (29 case reports, of whom two were described in a case series, and the one case from our institution). The patients' mean age was 39 years (range: 19 - 65). The male: female ratio was 1.14:1. The majority (73.3%) had at least one preexisting risk factor, with prescription drug use being the most common risk factor (33.3%) shared among all patients. Most patients (83.3%) presented with at least two symptoms. The most common presenting symptoms were headache (70%), gastrointestinal disturbance (50%), and seizures (40%). Focal deficits (36.7%), vision disturbances (30%), and altered consciousness (20%) were the remaining presenting complaints. Twelve cases (40%) commented on papilledema, with 10 (83.3%) having papilledema present. Anticoagulation abnormalities were examined in 26 cases (86.7%), out of which four cases (15.4%) had isolated protein S (PS) deficiency, three cases (11.5%) had isolated antithrombin III (ATIII) deficiency, and one case (3.8%) had isolated protein C (PC) deficiency. The most common initial imaging modality (22 cases, 73.3%), and most commonly used overall (23 cases, 76.7%), was computed tomography (CT). Magnetic resonance imaging (MRI) was the second most common imaging modality for initial use (five cases, 16.7%), diagnosis or confirmation of CVST (eight cases, 26.7%), and overall (21 cases, 70%). Heparin treatment was involved in the treatment of 18 cases (60%), and warfarin treatment was used in 10 cases (33.3%). Heparin-warfarin combination treatment was utilized in eight cases (26.7%). Most patients survived (28 cases, 93.3%), while the two remaining patients died secondary to brain death from the CVST (6.7%). The findings from this study highlight the clinical characteristics of CVST. Therefore, this study aims to increase awareness of this rare entity. Physicians should maintain a high index of suspicion in order to diagnose patients presenting in the proper clinical context, given this case shares various forms of presentations with other common clinical conditions but requires long-term anticoagulation.
<h4>Background</h4>HIV-associated neurocognitive disorders (HAND) persist in the era of combined antiretroviral therapy (ART) despite reductions in viral load (VL) and overall disease severity. The mechanisms underlying HAND in the ART era are not well understood but are likely multifactorial, involving alterations in common pathways such as inflammation, autophagy, neurogenesis, and mitochondrial function. Newly developed omics approaches hold potential to identify mechanisms driving neuropathogenesis of HIV in the ART era.<h4>Methods</h4>In this study, using 33 postmortem frontal cortex (FC) tissues, neuropathological, molecular, and biochemical analyses were used to determine cellular localization and validate expression levels of the prolific transcription factor (TF), CCAAT enhancer binding protein (C/EBP) β, in brain tissues from HIV+ cognitively normal and HAND cases. RNA sequencing (seq) and transcriptomic analyses were performed on FC tissues including 24 specimens from well-characterized people with HIV that had undergone neurocognitive assessments. In vitro models for brain cells were used to investigate the role of C/EBPβ in mediating gene expression.<h4>Results</h4>The most robust signal for TF dysregulation was observed in cases diagnosed with minor neurocognitive disorder (MND) compared to cognitive normal (CN) cases. Of particular interest, due to its role in inflammation, autophagy and neurogenesis, C/EBPβ was significantly upregulated in MND compared to CN brains. C/EBPβ was increased at the protein level in HAND brains. C/EBPβ levels were significantly reduced in neurons and increased in astroglia in HAND brains compared to CN. Transfection of human astroglial cells with a plasmid expressing C/EBPβ induced expression of multiple targets identified in the transcriptomic analysis of HAND brains, including dynamin-1-like protein (DNM1L) and interleukin-1 receptor-associated kinase 1. Recombinant HIV-Tat reduced and increased C/EBPβ levels in neuronal and astroglial cells, respectively.<h4>Conclusions</h4>These findings are the first to present RNAseq-based transcriptomic analyses of HIV+ brain tissues, providing further evidence of altered neuroinflammation, neurogenesis, mitochondrial function, and autophagy in HAND. Interestingly, these studies confirm a role for CEBPβ in regulating inflammation, metabolism, and autophagy in astroglia. Therapeutic strategies aimed at transcriptional regulation of astroglia or downstream pathways may provide relief to HIV+ patients at risk for HAND and other neurological disorders.
Also flagged:Obesitynonalcoholic fatty liver diseaseNAFLDtype 2 diabetesCVDmethylation
Journal Article2020-04-11No SnippetsOuni M, Schürmann A.
Show Full Abstract
Obesity is a worldwide epidemic and contributes to global morbidity and mortality mediated via the development of nonalcoholic fatty liver disease (NAFLD), type 2 diabetes (T2D), cardiovascular (CVD) and other diseases. It is a consequence of an elevated caloric intake, a sedentary lifestyle and a genetic as well as an epigenetic predisposition. This review summarizes changes in DNA methylation and microRNAs identified in blood cells and different tissues in obese human and rodent models. It includes information on epigenetic alterations which occur in response to fat-enriched diets, exercise and metabolic surgery and discusses the potential of interventions to reverse epigenetic modifications.
Journal Article2020-04-11No SnippetsEl-Senousy WM, Abu Senna ASM, Mohsen NA, Hasan SF, Sidkey NM.
Show Full Abstract
The objective of this study was to compare the prevalence of human rotavirus group A common G and P genotypes in human Egyptian stool specimens and raw sewage samples to determine the most common genotypes for future vaccine development. From 1026 stool specimens of children with acute diarrhea and using nested RT-PCR, 250 samples (24.37%) were positive for human rotavirus group A. Using multiplex RT-PCR, rotavirus common P and G genotypes were detected as 89.20% and 46.40% of the positive clinical specimens respectively. This low percentage of common G genotypes frequency may affect the efficiency of the available live attenuated oral rotavirus vaccines [Rotarix® (human rotavirus G1P[8]) and RotaTeq® (reassortant bovine-human rotavirus G1-4P[5] and G6P[8])], however the percentage of clinical specimens which were negative for common G genotypes but positive for P[8] genotype was 12.00%. From 24 positive raw sewage samples for rotavirus group A VP6 collected from Zenin and El-Gabal El-Asfar wastewater treatment plants (WWTPs), 21 samples (87.50%) were typeable for common P genotypes while 13 samples (54.17%) were typeable for common G genotypes. Phylogenetic analysis of a VP8 partial gene of 45 P-typeable clinical isolates and 20 P-typeable raw sewage samples showed high similarity to reference strains and the majority of mutations were silent and showed lower to non-significant similarity with the two vaccine strains. This finding is useful for determining the most common antigens required for future vaccine development.
Also flagged:Neurodegenerative DiseasesPost-translational modificationsNDD-proteinopathiespathogenesisALSspinocerebellar ataxias
Journal Article2020-04-11✓ 5 SnippetsSchaffert LN, Carter WG.
In-Text Gene Mentions
Introduction)
…In HD, the expanded polyQ stretch of the protein induces production of N-terminal Htt fragments that are prone to misfold and form amyloid-like structures [65,66,67,68].…
Introduction)
…The formation of aggregated Htt within neuronal intranuclear inclusion bodies is a histopathological hallmark of HD [60].…
Introduction)
…Htt is a large, 3144-amino acid, monomeric protein required for embryonic neurogenesis that controls a number of nuclear and cytoplasmic homeostatic functions including regulation of synaptic activity [63,64].…
Discussion)
…Consistent with this proposal, restored N-terminal Htt phosphorylation reversed neurotoxicity in a model of HD [176].…
Introduction)
…HD is caused by an expansion of the CAG repeat (≥36) in the Huntingtin (Htt) gene on chromosome 4p16.3, that when translated produces an elongated polyglutamine (polyQ) stretch in the Htt protein [59].…
Show Full Abstract
The accumulation of abnormal protein aggregates represents a universal hallmark of neurodegenerative diseases (NDDs). Post-translational modifications (PTMs) regulate protein structure and function. Dysregulated PTMs may influence the propensity for protein aggregation in NDD-proteinopathies. To investigate this, we systematically reviewed the literature to evaluate effects of PTMs on aggregation propensity for major proteins linked to the pathogenesis and/or progression of NDDs. A search of PubMed, MEDLINE, EMBASE, and Web of Science Core Collection was conducted to retrieve studies that investigated an association between PTMs and protein aggregation in seven NDDs: Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), amyotrophic lateral sclerosis (ALS), spinocerebellar ataxias, transmissible spongiform encephalopathy, and multiple sclerosis. Together, 1222 studies were identified, of which 69 met eligibility criteria. We identified that the following PTMs, in isolation or combination, potentially act as modulators of proteinopathy in NDDs: isoaspartate formation in Aβ, phosphorylation of Aβ or tau in AD; acetylation, 4-hydroxy-2-neonal modification, <i>O</i>-GlcNAcylation or phosphorylation of α-synuclein in PD; acetylation or phosphorylation of TAR DNA-binding protein-43 in ALS, and SUMOylation of superoxide dismutase-1 in ALS; and phosphorylation of huntingtin in HD. The potential pharmacological manipulation of these aggregation-modulating PTMs represents an as-yet untapped source of therapy to treat NDDs.
Also flagged:Huntington DiseaseHDneurodegenerative disorderchoreadystoniacognitive decline
Journal Article2020-04-10✓ 2 SnippetsRiccò M, Vezzosi L, Balzarini F, Gualerzi G, Ranzieri S.
In-Text Gene Mentions
Introduction)
…The hereditary nature of HD was identified since 19th century, and the discovery of the causal HD gene (i.e. the huntingtin gene, HTT; chromosome 4) has established HD as triggered by a CAG triplet repeat expansion (HTT), which leads to an expanded polyglutamine stretch in the huntingtin protein, and subsequent protein misfolding (1,3,4).…
Introduction)
…the huntingtin gene,HTT; chromosome 4) has…
Show Full Abstract
Worldwide prevalence of Huntington's disease (HD) is quite heterogenous. As Italy is characterized by significant genetic heterogeneity, with presumptive differences between Italian regions, this review was undertaken to define available data of HD prevalence in Italy, to assess geographic heterogeneity, and reconcile possible variation in HD prevalence rates with the availability of genetic testing.<h4>Methods</h4>In total, 14 relevant studies were identified from Medline/Embase, and analysis of available Italian regional reports on rare diseases.<h4>Results</h4>A cumulative prevalence of 3.9/100,000 inhabitants (95% Confidence Interval 3.0 - 5.0) was identified, with apparently higher rates in the last decades (4.1/100,000 vs. 3.0/100,000). The lowest rates were among the resident of the Oristano province in Sardinia, while the highest were reported in three mountainous and rather isolated areas (i.e. Molise, San Marino, Varese; all well over 10 cases/100,000 inhabitants). These differences cannot be not fully explained by varying approaches to case-ascertainment or diagnosis, and a possible "founder effect" may therefore be extensively advocated.<h4>Discussion</h4>The prevalence of HD in retrieved Italian reports varied up to almost tenfold between different geographical regions. Even though such variation can in part be attributed to differences in case-ascertainment and/or diagnostic criteria, there is consistent evidence of significant founder effects in certain areas such as the provinces of Varese, the Republic of San Marino, and the region od Molise - all of them with estimates > 10/100,000 cases. As our estimates suggest that up to half of Italian HD cases may be still waiting, Public Health approach should improve diagnostic rates in order to guaranteeing palliative and symptomatic interventions (antidepressants, antipsychotics, anti-choreiform medications) to all individuals and their families.
Also flagged:Cas9organizationneurotransmitter receptorssynaptic scaffolding proteinslocalizationantibodies
Journal Article2020-04-10No SnippetsWillems J, de Jong APH, Scheefhals N, Mertens E, Catsburg LAE, Poorthuis RB, de Winter F, Verhaagen J, Meye FJ, MacGillavry HD.
Show Full Abstract
The correct subcellular distribution of proteins establishes the complex morphology and function of neurons. Fluorescence microscopy techniques are invaluable to investigate subcellular protein distribution, but they suffer from the limited ability to efficiently and reliably label endogenous proteins with fluorescent probes. We developed ORANGE: Open Resource for the Application of Neuronal Genome Editing, which mediates targeted genomic integration of epitope tags in rodent dissociated neuronal culture, in organotypic slices, and in vivo. ORANGE includes a knock-in library for in-depth investigation of endogenous protein distribution, viral vectors, and a detailed two-step cloning protocol to develop knock-ins for novel targets. Using ORANGE with (live-cell) superresolution microscopy, we revealed the dynamic nanoscale organization of endogenous neurotransmitter receptors and synaptic scaffolding proteins, as well as previously uncharacterized proteins. Finally, we developed a mechanism to create multiple knock-ins in neurons, mediating multiplex imaging of endogenous proteins. Thus, ORANGE enables quantification of expression, distribution, and dynamics for virtually any protein in neurons at nanoscale resolution.
<b>Objective:</b> To determine the associations between plasma creatinine (PCr), plasma uric acid (PUA), and urinary oxidative stress (OS) biomarkers with the ALSFRS-R at baseline and survival in a large epidemiological cohort study (ALS COSMOS) with a well-phenotyped patient population (<i>N</i> = 355).<b>Methods:</b> Fasting plasma and first void urine samples were obtained. PCr, PUA, urinary 8-oxo-deoxy guanosine (8-oxodG), and 15-F<sub>2t</sub>-isoprostane (IsoP) were analyzed at baseline, near the midpoint of follow-up, and at the final blood draw (before death or withdrawal from study). We estimated associations between these biomarkers and the ALSFRS-R at baseline and survival.<b>Results:</b> At baseline, PCr correlated with ALSFRS-R (Spearman <i>r</i> = 0.30), percent (%) FVC (<i>r</i> = 0.20), PUA (<i>r</i> = 0.37), and 8-oxodG (<i>r</i> = -0.13, all <i>p</i> < 0.05). Baseline PCr significantly predicted survival (adjusted hazard ratio 0.28, <i>p</i> < 0.001). Time to death from baseline was shortest for those in the lowest two PCr quartiles relative to the highest two quartiles. PCr and ALSFRS-R values were significantly correlated at all three time points (baseline: <i>r</i> = 0.29, midpoint: <i>r</i> = 0.23, final: <i>r</i> = 0.38, all <i>p</i> < 0.001). PCr and PUA significantly declined over time, whereas OS biomarkers significantly increased over time.<b>Conclusions:</b> To date, PCr predicted survival the best, compared to PUA, 8-oxodG, and IsoP. Although PCr represents the degree of muscle mass, it may also represent complex biochemical changes in ALS. Because the field has no reliable prognostic biomarkers, the importance of PCr warrants further investigation through clinical studies in ALS.
Also flagged:antibodyarsenicmanganesemetalsleaddiphtheria
Journal Article2020-04-10No SnippetsWelch BM, Branscum A, Geldhof GJ, Ahmed SM, Hystad P, Smit E, Afroz S, Megowan M, Golam M, Sharif O, Rahman M, Quamruzzaman Q, Christiani DC, Kile ML.
Show Full Abstract
<h4>Background</h4>Many populations are exposed to arsenic, lead, and manganese. These metals influence immune function. We evaluated the association between exposure to single and multiple metals, including arsenic, lead, and manganese, to humoral immunity as measured by antibody concentrations to diphtheria and tetanus toxoid among vaccinated Bangladeshi children. Additionally, we examined if this association was potentially mediated by nutritional status.<h4>Methods</h4>Antibody concentrations to diphtheria and tetanus were measured in children's serum at age 5 (n = 502). Household drinking water was sampled to quantify arsenic (W-As) and manganese (W-Mn), whereas lead was measured in blood (B-Pb). Exposure samples were taken during pregnancy, toddlerhood, and early childhood. Multiple linear regression models (MLRs) with single or combined metal predictors were used to determine the association with antibody outcomes. MLR results were transformed to units of percent change in outcome per doubling of exposure to improve interpretability. Structural equation models (SEMs) were used to further assess exposure to metal mixtures. SEMs regressed a latent exposure variable (Metals), informed by all measured metal variables (W-As, W-Mn, and B-Pb), on a latent outcome variable (Antibody), informed by measured antibody variables (diphtheria and tetanus). Weight-for-age z-score (WFA) at age 5 was evaluated as a mediator.<h4>Results</h4>Diphtheria antibody was negatively associated with W-As during pregnancy in MLR, but associations were attenuated after adjusting for W-Mn and B-Pb (- 2.9% change in diphtheria antibody per doubling in W-As, 95% confidence interval [CI]: - 7%, 1.5%). Conversely, pregnancy levels of B-Pb were positively associated with tetanus antibody, even after adjusting for W-As and W-Mn (13.3%, 95% CI: 1.7%, 26.3%). Overall, null associations were observed between W-Mn and antibody outcomes. Analysis by SEMs showed that the latent Metals mixture was significantly associated with the latent Antibody outcome (β = - 0.16, 95% CI: - 0.26, - 0.05), but the Metals variable was characterized by positive and negative loadings of W-As and B-Pb, respectively. Sex-stratified MLR and SEM analyses showed W-As and B-Pb associations were exclusive to females. Mediation by WFA was null, indicating Metals only had direct effects on Antibody.<h4>Conclusions</h4>We observed significant modulation of vaccine antibody concentrations among children with pregnancy and early life exposures to drinking water arsenic and blood lead. We found distinct differences by child sex, as only females were susceptible to metal-related modulations in antibody levels. Weight-for-age, a nutritional status proxy, did not mediate the association between the metal mixture and vaccine antibody.
Also flagged:cholesterol 24-hydroxylaseautophagyneuroblastomacholesterolmetabolismneurodegenerative diseases
Journal Article2020-04-10✓ 5 SnippetsNóbrega C, Conceição A, Costa RG, Koppenol R, Sequeira RL, Nunes R, Carmo-Silva S, Marcelo A, Matos CA, Betuing S, Caboche J, Cartier N, Alves S.
In-Text Gene Mentions
S I O 001029)
…To further investigate the mechanisms of CYP46A1-mediated effects in the clearance of HTT-MUT via autophagic pathway experiments were preformed using a plasmid expressing the autophagic protein LC3B fused with RFP or GFP, and using an autophagy inhibitor (chloroquine—ChQ; Fig. 2a) [31].…
S I O 001029)
…Altogether, our data suggest that CYP46A1 degrades HTT-MUT via autophagy and that CYP46A1 may be a good target to alleviate HD progression.…
S I O 001029)
…We analyzed by immunocytochemistry the impact of CYP46A1 overexpression in neuroblastoma (N2a) cells overexpressing the exon 1 of HTT-MUT carrying 74 glutamine (Q74) fused with GFP.…
S I O 001029)
…Here, we further show that CYP46A1 is able to decrease the number and size of HTT-MUT aggregates within a neuroblastoma cellular model of HD.…
Introduction)
…Huntington’s disease (HD), is an autosomal dominant inherited neurodegenerative disorder [1, 2], resulting from an abnormal CAG-repeat expansion in the coding region of the HTT gene, resulting in an expanded polyglutamine (polyQ) tract of the huntingtin protein (HTT) [3].…
Show Full Abstract
<h4>Objective</h4>Compromised brain cholesterol turnover and altered regulation of brain cholesterol metabolism have been allied with some neurodegenerative diseases, including Huntington's disease (HD). Following our previous studies in HD, in this study we aim to investigate in vitro in a neuroblastoma cellular model of HD, the effect of CYP46A1 overexpression, an essential enzyme in cholesterol metabolism, on huntingtin aggregation and levels.<h4>Results</h4>We found that CYP46A1 reduces the quantity and size of mutant huntingtin aggregates in cells, as well as the levels of mutant huntingtin protein. Additionally, our results suggest that the observed beneficial effects of CYP46A1 in HD cells are linked to the activation of autophagy. Taken together, our results further demonstrate that CYP46A1 is a pertinent target to counteract HD progression.
Journal Article2020-04-10No SnippetsStern JL, Hibshman G, Hu K, Ferrara SE, Costello JC, Kim W, Tamayo P, Cech TR, Huang FW.
Show Full Abstract
In a substantial fraction of cancers <i>TERT</i> promoter (TERTp) mutations drive expression of the catalytic subunit of telomerase, contributing to their proliferative immortality. We conducted a pan-cancer analysis of cell lines and find a TERTp mutation expression signature dominated by epithelial-to-mesenchymal transition and MAPK signaling. These data indicate that TERTp mutants are likely to generate distinctive tumor microenvironments and intercellular interactions. Analysis of high-throughput screening tests of 546 small molecules on cell line growth indicated that TERTp mutants displayed heightened sensitivity to specific drugs, including RAS pathway inhibitors, and we found that inhibition of MEK1 and 2, key RAS/MAPK pathway effectors, inhibited TERT mRNA expression. Consistent with an enrichment of mesenchymal states in TERTp mutants, cell lines and some patient tumors displayed low expression of the central adherens junction protein E-cadherin, and we provide evidence that its expression in these cells is regulated by MEK1/2. Several mesenchymal transcription factors displayed elevated expression in TERTp mutants including ZEB1 and 2, TWIST1 and 2, and SNAI1. Of note, the developmental transcription factor SNAI2/SLUG was conspicuously elevated in a significant majority of TERTp-mutant cell lines, and knock-down experiments suggest that it promotes TERT expression. IMPLICATIONS: Cancers harboring <i>TERT</i> promoter mutations are often more lethal, but the basis for this higher mortality remains unknown. Our study identifies that TERTp mutants, as a class, associate with a distinct gene and protein expression signature likely to impact their biological and clinical behavior and provide new directions for investigating treatment approaches for these cancers.
Also flagged:MID1E3 ubiquitin ligaseRING-containing proteinsTRIM18microtubule-binding proteinPP2A
Journal Article2020-04-10No SnippetsBaldini R, Mascaro M, Meroni G.
Show Full Abstract
MID1 is an E3 ubiquitin ligase of the Tripartite Motif (TRIM) subfamily of RING-containing proteins, hence also known as TRIM18. MID1 is a microtubule-binding protein found in complex with the catalytic subunit of PP2A (PP2Ac) and its regulatory subunit alpha 4 (α4). To date, several substrates and interactors of MID1 have been described, providing evidence for the involvement of MID1 in a plethora of essential biological processes, especially during embryonic development. Mutations in the MID1 gene are responsible of the X-linked form of Opitz syndrome (XLOS), a multiple congenital disease characterised by defects in the development of midline structures during embryogenesis. Here, we review MID1-related physiological mechanisms as well as the pathological implication of the MID1 gene in XLOS and in other clinical conditions.
Also flagged:synthesispenicillaminemethylene blueelectronsalbuminBSA
Journal Article2020-04-10No SnippetsNawrot KC, Wawrzyńczyk D, Bezkrovnyi O, Kępiński L, Cichy B, Samoć M, Nyk M.
Show Full Abstract
We demonstrate a low-temperature synthesis of hydrophilic, penicillamine-stabilized hybrid CdS-Au nanoparticles (NPs) utilizing different Au concentrations. The obtained hybrid nanomaterials exhibit photoluminescence quenching and emission lifetime reduction in comparison with their raw semiconductor CdS NPs counterparts. An increase of concentration of Au present at the surface of CdS leads to lower photoluminescence intensity and faster emission decays, suggesting more efficient charge separation when larger Au domains are present. For photocatalysis studies, we performed methylene blue (MB) absorption measurements under irradiation in the presence of CdS-Au NPs. After 1 h of light exposure, we observed the absorbance decrease to about 35% and 10% of the initial value for the CdS-5Au and CdS-7.5Au (the hybrid NPs obtained in a presence of 5.0 and 7.5 mM Au), respectively, which indicates MB reduction caused by electrons effectively separated from holes on metal surface. In further similar photocatalysis experiments, we measured bovine serum albumin (BSA) integrated photoluminescence intensity quenching in the presence of CdS-Au NPs, with a 50% decrease being obtained for CdS-2.5Au NPs and CdS-5Au NPs, with a faster response rate detected for the system prepared with a higher Au concentration. The results suggest hole-driven reactive oxygen species (ROS) production, causing BSA degeneration. Finally, we performed two-photon excited emission (TPEE) measurements for CdS-5Au NPs, obtaining their two-photon absorption (TPA) cross-section values up to 15.8 × 10<sup>3</sup> GM (Goeppert-Mayer units). We conclude that the obtained water-soluble CdS-Au NPs exhibit potential triple functionalities as photocatalysts for reduction and oxidation reactions as well as materials for two-photon absorption applications, so that they may be considered as future theranostics.
Also flagged:azidethymidineEthyldeoxythymidineS21S22
Journal Article2020-04-10No SnippetsRaposo CD, Conceição CA, Barros MT.
Show Full Abstract
Polymeric nanoparticles can be used for drug delivery systems in healthcare. For this purpose poly(lactic-co-glycolic acid) (PLGA) and poly(ethylene glycol) (PEG) offer an excellent polymeric matrix. In this work, PLGA and PEG polymers were functionalized with coumarin and carbohydrate moieties such as thymidine, glucose, galactose, and mannose that have high biological specificities. Using a single oil in water emulsion methodology, functionalized PLGA nanoparticles were prepared having a smooth surface and sizes ranging between 114-289 nm, a low polydispersity index and a zeta potential from -28.2 to -56.0 mV. However, for the corresponding PEG derivatives the polymers obtained were produced in the form of films due to the small size of the hydrophobic core.
The reaction between organic azides and alkyne derivatives via the Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) is an efficient strategy to combine phthalocyanines and analogues with different materials. As examples of such materials, it can be considered the following ones: graphene oxide, carbon nanotubes, silica nanoparticles, gold nanoparticles, and quantum dots. This approach is also being relevant to conjugate phthalocyanines with carbohydrates and to obtain new sophisticated molecules; in such way, new systems with significant potential applications become available. This review highlights recent developments on the synthesis of phthalocyanine, subphthalocyanine, and porphyrazine derivatives where CuAAC reactions are the key synthetic step.
Also flagged:Dyskeratosis congenitacancerbone marrow failure syndromep53metabolismtelomeres
Journal Article2020-04-10✓ 1 SnippetToufektchan E, Lejour V, Durand R, Giri N, Draskovic I, Bardot B, Laplante P, Jaber S, Alter BP, Londono-Vallejo JA, Savage SA, Toledo F.
In-Text Gene Mentions
Results)
…the exception ofhemochromatosis.…
Show Full Abstract
Dyskeratosis congenita is a cancer-prone inherited bone marrow failure syndrome caused by telomere dysfunction. A mouse model recently suggested that p53 regulates telomere metabolism, but the clinical relevance of this finding remained uncertain. Here, a germline missense mutation of <i>MDM4</i>, a negative regulator of p53, was found in a family with features suggestive of dyskeratosis congenita, e.g., bone marrow hypocellularity, short telomeres, tongue squamous cell carcinoma, and acute myeloid leukemia. Using a mouse model, we show that this mutation (p.T454M) leads to increased p53 activity, decreased telomere length, and bone marrow failure. Variations in p53 activity markedly altered the phenotype of <i>Mdm4</i> mutant mice, suggesting an explanation for the variable expressivity of disease symptoms in the family. Our data indicate that a germline activation of the p53 pathway may cause telomere dysfunction and point to polymorphisms affecting this pathway as potential genetic modifiers of telomere biology and bone marrow function.
Also flagged:calcium phosphatemineralcalcium phosphatestumorbiomineralsCancer
Journal Article2020-04-10No SnippetsKhalifehzadeh R, Arami H.
Show Full Abstract
Calcium phosphate is the inorganic mineral of hard tissues such as bone and teeth. Due to their similarities to the natural bone, calcium phosphates are highly biocompatible and biodegradable materials that have found numerous applications in dental and orthopedic implants and bone tissue engineering. In the form of nanoparticles, calcium phosphate nanoparticles (CaP's) can also be used as effective delivery vehicles to transfer therapeutic agents such as nucleic acids, drugs, proteins and enzymes into tumor cells. In addition, facile preparation and functionalization of CaP's, together with their inherent properties such as pH-dependent solubility provide advantages in delivery and release of these bioactive agents using CaP's as nanocarriers. In this review, the challenges and achievements in the intracellular delivery of these agents to tumor cells are discussed. Also, the most important issues in the design and potential applications of CaP-based biominerals are addressed with more focus on their biodegradability in tumor microenvironment.
Also flagged:thyroid canceraginggene expressionTNFRSF12ACHI3L1hyperthyroidism
Journal Article2020-04-10No SnippetsLian M, Cao H, Baranova A, Kural KC, Hou L, He S, Shao Q, Fang J.
Show Full Abstract
The prevalence of thyroid cancer (TC) is high in the elderly. The present study was based on the hypothesis that genes, which have increased activity with aging, may play a role in the development of TC. A large-scale literature-based data analysis was conducted to explore the genes that are implicated in both TC and aging. Subsequently, a mega-analysis of 16 RNA expression datasets (1,222 samples: 439 healthy controls, and 783 patients with TC) was conducted to test a set of genes associated with aging but not TC. To uncover a possible link between these genes and TC, a functional pathway analysis was conducted, and the results were validated by analysis of gene co-expression. A multiple linear regression (MLR) model was employed to study the possible influence of sample size, population region and study age on the gene expression levels in TC. A total of 262 and 816 genes were identified to have increased activity with aging and TC, respectively; with a significant overlap of 63 genes (P<3.82×10<sup>-35</sup>). The mega-analysis revealed two aging-associated genes (<i>CHI3L1</i> and <i>TNFRSF12A</i>) to be significantly associated with TC (P<2.05×10<sup>-8</sup>), and identified the association with multiple hypoxia-driven pathways through functional pathway analysis, also confirmed by the co-expression analysis. The MLR analysis identified population region as a significant factor contributing to the expression levels of <i>CHI3L1</i> and <i>TNFRSF12A</i> in TC samples (P<3.24×10<sup>-4</sup>). The determination of genes that promote aging was warranted due to their possible involvement in TC. The present study suggests <i>CHI3L1</i> and <i>TNFRSF12A</i> as novel common risk genes associated with both aging and TC.
Also flagged:Deathresponse to heatadaptive responseoxygenheat illnessescone
Journal Article2020-04-10No SnippetsMalgoyre A, Siracusa J, Tardo-Dino PE, Garcia-Vicencio S, Koulmann N, Charlot K.
Show Full Abstract
A basal heat stress test (HST) to predict the magnitude of adaptive responses during heat acclimatization (HA) would be highly useful for the armed forces. The aim was to identify physiological markers assessed during a HST (three 8-min running sets at 50% of the speed at VO<sub>2max</sub>) performed just before a 14-day HA period that would identify participants still at "risk" at the end of HA. Individuals that responded poorly (large increases in rectal temperature [T<sub>rec</sub>] and heart rate [HR]) during the initial HST were more likely to respond favorably to HA (large reductions in T<sub>rec</sub> and HR). However, they were also more likely to exhibit lower tolerance to HST at D15. Basal T<sub>rec</sub> was found to efficiently discriminate participants showing a T<sub>rec</sub> > 38.5°C after HA, who are considered to be "at risk". Finally, participants were classified by quartiles based on basal T<sub>rec</sub> and HR at the end of the HST and physiological strain index (PSI). Most of the participants "at risk" were among the upper quartile (i.e. the least tolerant) of T<sub>rec</sub> and PSI (<i>p = </i>0.011 for both). Overall, these results show that the individuals who are less tolerant to a basal HST are very likely to benefit the most from HA but they also remain less tolerant to heat at the end of HA than those who better tolerated the basal HST. A basal HST could therefore theoretically help the command to select the most-ready personnel in hot conditions while retaining those who are less tolerant 6.
bioRxiv2020-04-10Preprint (No Snippets API)Sajuthi SP, DeFord P, Jackson ND, Montgomery MT, Everman JL, Rios CL, Pruesse E, Nolin JD, Plender EG, Wechsler ME, Mak AC, Eng C, Salazar S, Medina V, Wohlford EM, Huntsman S, Nickerson DA, Germer S, Zody MC, Abecasis G, Kang HM, Rice KM, Kumar R, Oh S, Rodriguez-Santana J, Burchard EG, Seibold MA.
Show Full Abstract
Coronavirus disease 2019 (COVID-19) outcomes vary from asymptomatic infection to death. This disparity may reflect different airway levels of the SARS-CoV-2 receptor, ACE2, and the spike protein activator, TMPRSS2. Here we explore the role of genetics and co-expression networks in regulating these genes in the airway, through the analysis of nasal airway transcriptome data from 695 children. We identify expression quantitative trait loci (eQTL) for both ACE2 and TMPRSS2 , that vary in frequency across world populations. Importantly, we find TMPRSS2 is part of a mucus secretory network, highly upregulated by T2 inflammation through the action of interleukin-13, and that interferon response to respiratory viruses highly upregulates ACE2 expression. Finally, we define airway responses to coronavirus infections in children, finding that these infections upregulate IL6 while also stimulating a more pronounced cytotoxic immune response relative to other respiratory viruses. Our results reveal mechanisms likely influencing SARS-CoV-2 infectivity and COVID-19 clinical outcomes.
Also flagged:Serotonin5-hydroxytryptaminecognitioncell physiologycell divisionmitochondrial
Journal Article2020-04-09No SnippetsCruz-Corchado J, Ooi FK, Das S, Prahlad V.
Show Full Abstract
Serotonin (5-hydroxytryptamine, 5-HT), is a phylogenetically ancient molecule best characterized as a neurotransmitter that modulates multiple aspects of mood and social cognition. The roles that 5-HT plays in normal and abnormal behavior are not fully understood but have been posited to be due to its common function as a 'defense signal'. However, 5-HT levels also systemically impact cell physiology, modulating cell division, migration, apoptosis, mitochondrial biogenesis, cellular metabolism and differentiation. Whether these diverse cellular effects of 5-HT also share a common basis is unclear. <i>C. elegans</i> provides an ideal system to interrogate the systemic effects of 5-HT, since lacking a blood-brain barrier, 5-HT synthesized and released by neurons permeates the organism to modulate neuronal as well as non-neuronal cells throughout the body. Here we used RNA-Seq to characterize the systemic changes in gene expression that occur in <i>C. elegans</i> upon altering 5-HT levels, and compared the transcriptomes to published datasets. We find that an acute increase in 5-HT is accompanied by a global decrease in gene expression levels, upregulation of genes involved in stress pathways, changes that significantly correlate with the published transcriptomes of animals that have activated defense and immune responses, and an increase in levels of phosphorylated eukaryotic initiation factor, eIF2α. In 5-HT deficient animals lacking tryptophan hydroxylase (<i>tph-1</i><i>(mg280)</i><i>II</i>) there is a net increase in gene expression, with an overrepresentation of genes related to development and chromatin. Surprisingly, the transcriptomes of animals with acute increases in 5-HT levels, and 5-HT deficiency do not overlap with transcriptomes of mutants with whom they share striking physiological resemblance. These studies are the first to catalog systemic transcriptome changes that occur upon alterations in 5-HT levels. They further show that in <i>C. elegans</i> changes in gene expression upon altering 5-HT levels, and changes in physiology, are not directly correlated.
Also flagged:Cellulosepolysaccharidenanocelluloseglycosaminoglycansglycanssynthesis
Journal Article2020-04-09No SnippetsYang Y, Lu YT, Zeng K, Heinze T, Groth T, Zhang K.
Show Full Abstract
Glycans play important roles in all major kingdoms of organisms, such as archea, bacteria, fungi, plants, and animals. Cellulose, the most abundant polysaccharide on the Earth, plays a predominant role for mechanical stability in plants, and finds a plethora of applications by humans. Beyond traditional use, biomedical application of cellulose becomes feasible with advances of soluble cellulose derivatives with diverse functional moieties along the backbone and modified nanocellulose with versatile functional groups on the surface due to the native features of cellulose as both cellulose chains and supramolecular ordered domains as extractable nanocellulose. With the focus on ionic cellulose-based compounds involving both these groups primarily for biomedical applications, a brief introduction about glycoscience and especially native biologically active glycosaminoglycans with specific biomedical application areas on humans is given, which inspires further development of bioactive compounds from glycans. Then, both polymeric cellulose derivatives and nanocellulose-based compounds synthesized as versatile biomaterials for a large variety of biomedical applications, such as for wound dressings, controlled release, encapsulation of cells and enzymes, and tissue engineering, are separately described, regarding the diverse routes of synthesis and the established and suggested applications for these highly interesting materials.
Also flagged:IκBαcytokineintestinalcell differentiationPRC2chromatin
Journal Article2020-04-09✓ 1 SnippetMarruecos L, Bertran J, Guillén Y, González J, Batlle R, López-Arribillaga E, Garrido M, Ruiz-Herguido C, Lisiero D, González-Farré M, Arce-Gallego S, Iglesias M, Nebreda AR, Miyamoto S, Bigas A, Espinosa L.
In-Text Gene Mentions
I A O 0000326)
…Olfm4…
Show Full Abstract
The intestinal epithelium is a paradigm of adult tissue in constant regeneration that is supported by intestinal stem cells (ISCs). The mechanisms regulating ISC homeostasis after injury are poorly understood. We previously demonstrated that IκBα, the main regulator of NF-κB, exerts alternative nuclear functions as cytokine sensor in a subset of PRC2-regulated genes. Here, we show that nuclear IκBα is present in the ISC compartment. Mice deficient for IκBα show altered intestinal cell differentiation with persistence of a fetal-like ISC phenotype, associated with aberrant PRC2 activity at specific loci. Moreover, IκBα-deficient intestinal cells produce morphologically aberrant organoids carrying a PRC2-dependent fetal-like transcriptional signature. DSS treatment, which induces acute damage in the colonic epithelium of mice, results in a temporary loss of nuclear P-IκBα and its subsequent accumulation in early CD44-positive regenerating areas. Importantly, IκBα-deficient mice show higher resistance to damage, likely due to the persistent fetal-like ISC phenotype. These results highlight intestinal IκBα as a chromatin sensor of inflammation in the ISC compartment.
Also flagged:Phosphorylationmyelin regulatory factorneurodegenerative diseasesmultiple sclerosisHDPRKG 2
Journal Article2020-04-09✓ 5 SnippetsYin P, Liu Q, Pan Y, Yang W, Yang S, Wei W, Chen X, Hong Y, Bai D, Li XJ, Li S.
In-Text Gene Mentions
Introduction)
…In Huntington's disease (HD), the mutant huntingtin (HTT) protein carries an expanded polyglutamine (polyQ) repeat in its N‐terminal region, which promotes aggregate formation in aged neuronal and glial cells and causes progressive neurodegeneration and neurological symptoms 6, 7, 8.…
Results)
…Because PLP‐150Q mice only express mutant HTT in oligodendrocytes, the protective effects of LAQ indicate that LAQ could improve the function of oligodendrocytes to reduce neurological symptoms of HD mice and motivated us to further explore the mechanistic action of LAQ on oligodendrocytes.…
Results)
…This in vitro finding, which suggests that expression of mutant HTT may directly or indirectly activate PRKG2 to phosphorylate MYRF, is consistent with the in vivo evidence of the elevated PRKG2 (Fig 4E) and MYRF phosphorylation (Fig 3G) in the HD brains.…
Methods)
…The generation of transgenic PLP‐23Q and PLP‐150Q mice that express N‐terminal human HTT (amino acids 1–212) containing 23Q or 150Q was described in our previous studies 23.…
Methods)
…HEK293 cells were transfected with PRK‐nMYRF, N‐terminal HTT (1–212 amino acids) PRK‐HTT‐150Q or PRK‐HTT‐23Q and pGL4.1‐pMBP (MBP promoter luciferase).…
Show Full Abstract
Demyelination is a common pathological feature of a large number of neurodegenerative diseases including multiple sclerosis and Huntington's disease (HD). Laquinimod (LAQ) has been found to have therapeutic effects on multiple sclerosis and HD. However, the mechanism underlying LAQ's therapeutic effects remains unknown. Using HD mice that selectively express mutant huntingtin in oligodendrocytes and show demyelination, we found that LAQ reduces the Ser259 phosphorylation on myelin regulatory factor (MYRF), an oligodendrocyte-specific transcription factor promoting the expression of myelin-associated genes. The reduced MYRF phosphorylation inhibits MYRF's binding to mutant huntingtin and increases the expression of myelin-associated genes. We also found that PRKG2, a cGMP-activated protein kinase subunit II, promotes the Ser259-MYRF phosphorylation and that knocking down PRKG2 increased myelin-associated protein's expression in HD mice. Our findings suggest that PRKG2-regulated phosphorylation of MYRF is involved in demyelination and can serve as a potential therapeutic target for reducing demyelination.
Also flagged:Sevofluraneneuronal migrationaxon growthlissencephalybehavioralneuron migration
Journal Article2020-04-09✓ 5 SnippetsChai D, Yan J, Li C, Sun Y, Jiang H.
In-Text Gene Mentions
S I O 001029)
…Netrin-1/Dcc deficiency displayed a similar defect in neuronal migration and axon outgrowth as Nova2 deficiency induced by dual sevoflurane exposure. (A) Dcc shRNA (sh3) reliably reduces the Dcc expression.…
S I O 001029)
…While Netrin-1/Dcc shRNA mitigated the Nova2 rescue phenomenon, which was similar to the neuronal migration deficits induced by dual sevoflurane exposure.…
Results)
…Finally, we found that Netrin-1/Dcc knockdown mitigated the Nova2-induced reversal of deficits in neuronal migration after dual sevoflurane exposure (Figure 5A, 5B).…
Discussion)
…Moreover, Dcc alternative splicing is perturbed by Nova2 deficiency in vivo [21], and alternative splicing might therefore be involved in sevoflurane-induced deficits in neuronal development.…
S I O 001029)
…Both Nova2 knockdown and dual sevoflurane exposure suppressed Netrin-1/Dcc protein expression. (A) QPCR revealed that Netrin-1 mRNA expression was decreased among 28 candidate genes in the Nova2 shRNA group (F = 0.76, P = 0.0015**, N = 3, Student’s t-test), while Dcc mRNA expression wasn’t change (F = 0.699, P = 0.0519, N = 3, Student’s t-test).…
Show Full Abstract
The highly organized laminar structure of the mammalian brain is dependent on successful neuronal migration, and migration deficits can cause lissencephaly and behavioral and cognitive defects. Here, we investigated the contribution of neuronal migration dysregulation to anesthesia-induced neurotoxicity in the fetal brain. Pregnant C57BL/6 mice at embryonic day 14.5 received 2.5% sevoflurane daily for two days. Cortical neuron migration and axon lengths were evaluated using GFP immunostaining. Morris water maze tests were performed to assess the effects of sevoflurane exposure on spatial memory in offspring. We found that sevoflurane exposure decreased axon length and caused cognitive defects in young mice. RNA sequencing revealed that these defects were associated with reduced neuro-oncological ventral antigen 2 (Nova2) expression. In utero electroporation experiments using Nova2 shRNA recapitulated this finding. Nova2 shRNA inhibited neuronal migration and decreased axon lengths. Finally, we found that Netrin-1/Deleted in Colorectal Cancer (Dcc) proteins acted downstream of Nova2 to suppresses neuronal migration. These findings describe a novel mechanism by which prenatal anesthesia exposure affects embryonic neural development and postnatal behavior.
Also flagged:nucleotidereverse transcriptaseAIDSenvelopesenvelopemethadone
Journal Article2020-04-09No SnippetsNguyen TA, Tran TH, Nguyen BT, Pham TTP, Hong Le NT, Ta DV, Phan HTT, Nguyen LH, Ait-Ahmed M, Ho HT, Taieb F, Madec Y, MOVIDA 2 study group.
Show Full Abstract
<h4>Background</h4>Access to HIV viral load is crucial to efficiently monitor patients on antiretroviral treatment (ART) and prevent HIV drug resistance acquisition. However, in some remote settings, access to viral load monitoring is still complex due to logistical and financial constraints. Use of dried blood spots (DBS) for blood collection could overcome these difficulties. This study aims to describe feasibility and operability of DBS use for routine viral load monitoring.<h4>Methods</h4>From June 2017 to April 2018, HIV-infected adults who initiated ART were enrolled in a prospective cohort in 43 clinical sites across 6 provinces in North Vietnam. Following national guidelines, the first viral load monitoring was planned 6 months after ART initiation. DBS were collected at the clinical site and sent by post to a central laboratory in Hanoi for viral load measurement.<h4>Results</h4>Of the 578 patients enrolled, 537 were still followed 6 months after ART initiation, of which DBS was collected for 397 (73.9%). The median (inter quartile range) delay between DBS collection at site level and reception at the central laboratory was 8 (6-19) days and for 70.0% viral load was measured ≤30 days after blood collection. The proportion of patients with viral load ≥1000 copies/mL at the 6 month evaluation was 15.9% (n = 59). Of these, a DBS was collected again to confirm virological failure in 15 (24.4%) of which virological failure was confirmed in 11 (73.3%).<h4>Conclusion</h4>Delay of DBS transfer to the central laboratory was acceptable and most viral loads were measured in ≤30 days, in-line with routine follow-up. However, the level of DBS coverage and the proportion of patients in failure for whom a confirmatory viral load was available were suboptimal, indicating that integration of viral load monitoring in the field requires, among other things, careful training and strong involvement of the local teams. The proportion of patients experiencing virological failure was in line with other reports; interestingly those who reported being non-adherent and those with a low BMI were more at risk of failure.
Also flagged:inflammatory responseimmune responsemitochondrialoxygenND2ND4
Journal Article2020-04-09No SnippetsYang L, He T, Xiong F, Chen X, Fan X, Jin S, Geng Z.
Show Full Abstract
<h4>Background</h4>Improving feed efficiency is one of the important breeding targets for poultry industry. The aim of current study was to investigate the breast muscle transcriptome data of native chickens divergent for feed efficiency. Residual feed intake (RFI) value was calculated for 1008 closely related chickens. The 5 most efficient (LRFI) and 5 least efficient (HRFI) birds were selected for further analysis. Transcriptomic data were generated from breast muscle collected post-slaughter.<h4>Results</h4>The differently expressed genes (DEGs) analysis showed that 24 and 325 known genes were significantly up- and down-regulated in LRFI birds. An enrichment analysis of DEGs showed that the genes and pathways related to inflammatory response and immune response were up-regulated in HRFI chickens. Moreover, Gene Set Enrichment Analysis (GSEA) was also employed, which indicated that LRFI chickens increased expression of genes related to mitochondrial function. Furthermore, protein network interaction and function analyses revealed ND2, ND4, CYTB, RAC2, VCAM1, CTSS and TLR4 were key genes for feed efficiency. And the 'phagosome', 'cell adhesion molecules (CAMs)', 'citrate cycle (TCA cycle)' and 'oxidative phosphorylation' were key pathways contributing to the difference in feed efficiency.<h4>Conclusions</h4>In summary, a series of key genes and pathways were identified via bioinformatics analysis. These key genes may influence feed efficiency through deep involvement in ROS production and inflammatory response. Our results suggested that LRFI chickens may synthesize ATP more efficiently and control reactive oxygen species (ROS) production more strictly by enhancing the mitochondrial function in skeletal muscle compared with HRFI chickens. These findings provide some clues for understanding the molecular mechanism of feed efficiency in birds and will be a useful reference data for native chicken breeding.
Alzheimer's disease (AD) is a chronic neurodegenerative disease with significant financial costs and negative impacts on quality of life. Psychotic symptoms, i.e., the presence of delusions and/or hallucinations, is a frequent complication of AD. About 50% of AD patients will develop psychotic symptoms (AD with Psychosis, or AD + P) and these patients will experience an even more rapid cognitive decline than AD patients without psychosis (AD-P). In a previous analysis on medication records of 776 AD patients, we had shown that use of Vitamin D was associated with delayed time to psychosis in AD patients and Vitamin D was used more by AD-P than AD + P patients. To explore the potential molecular mechanism behind our findings, we applied systems pharmacology approaches to investigate the crosstalk between AD and psychosis. Specifically, we built protein-protein interaction (PPI) networks with proteins encoded by AD- and psychosis-related genes and Vitamin D-perturbed genes. Using network analysis we identified several high-impact genes, including NOTCH4, COMT, CACNA1C and DRD3 which are related to calcium homeostasis. The new findings highlight the key role of calcium-related signaling pathways in AD + P development and may provide a new direction and facilitate hypothesis generation for future drug development.
Also flagged:norepinephrine transporterNETheart failureParkinson's diseaseneuroendocrine tumorspositron
Journal Article2020-04-09✓ 2 SnippetsChen X, Kudo T, Lapa C, Buck A, Higuchi T.
In-Text Gene Mentions
Introduction)
…transporter (SERT or5-HTT), which is crucial…
I A O 0000606)
…Serotonin transporter, also5-HTT…
Show Full Abstract
The norepinephrine transporter (NET) is a major target for the evaluation of the cardiac sympathetic nerve system in patients with heart failure and Parkinson's disease. It is also used in the therapeutic applications against certain types of neuroendocrine tumors, as exemplified by the clinically used <sup>123/131</sup>I-MIBG as theranostic single-photon emission computed tomography (SPECT) agent. With the development of more advanced positron emission tomography (PET) technology, more radiotracers targeting NET have been reported, with superior temporal and spatial resolutions, along with the possibility of functional and kinetic analysis. More recently, fluorine-18-labelled NET tracers have drawn increasing attentions from researchers, due to their longer radiological half-life relative to carbon-11 (110 min vs. 20 min), reduced dependence on on-site cyclotrons, and flexibility in the design of novel tracer structures. In the heart, certain NET tracers provide integral diagnostic information on sympathetic innervation and the nerve status. In the central nervous system, such radiotracers can reveal NET distribution and density in pathological conditions. Most radiotracers targeting cardiac NET-function for the cardiac application consistent of derivatives of either norepinephrine or MIBG with its benzylguanidine core structure, e.g. <sup>11</sup>C-HED and <sup>18</sup>F-LMI1195. In contrast, all NET tracers used in central nervous system applications are derived from clinically used antidepressants. Lastly, possible applications of NET as selective tracers over organic cation transporters (OCTs) in the kidneys and other organs controlled by sympathetic nervous system will also be discussed.
Also flagged:deathironlipidperoxidescystineglutathione
Journal Article2020-04-09No SnippetsAnandhan A, Dodson M, Schmidlin CJ, Liu P, Zhang DD.
Show Full Abstract
Ferroptosis is a non-apoptotic mode of regulated cell death that is iron and lipid peroxidation dependent. As new mechanistic insight into ferroptotic effectors and how they are regulated in different disease contexts is uncovered, our understanding of the physiological and pathological relevance of this mode of cell death continues to grow. Along these lines, a host of pharmacological modulators of this pathway have been identified, targeting proteins involved in iron homeostasis; the generation and reduction of lipid peroxides; or cystine import and glutathione metabolism. Also, of note, many components of the ferroptosis cascade are target genes of the transcription factor nuclear factor erythroid 2-related factor 2 (NRF2), indicating its critical role in mediating the ferroptotic response. In this review, we discuss the in vitro, in vivo, and clinical evidence of ferroptosis in disease, including a brief discussion of targeting upstream mediators of this cascade, including NRF2, to treat ferroptosis-driven diseases.
Redox balance is essential for normal brain, hence dis-coordinated oxidative reactions leading to neuronal death, including programs of regulated death, are commonly viewed as an inevitable pathogenic penalty for acute neuro-injury and neurodegenerative diseases. Ferroptosis is one of these programs triggered by dyshomeostasis of three metabolic pillars: iron, thiols, and polyunsaturated phospholipids. This review focuses on: (1) lipid peroxidation (LPO) as the major instrument of cell demise, (2) iron as its catalytic mechanism, and (3) thiols as regulators of pro-ferroptotic signals, hydroperoxy lipids. Given the central role of LPO, we discuss the engagement of selective and specific enzymatic pathways versus random free radical chemical reactions in the context of the phospholipid substrates, their biosynthesis, intracellular location, and related oxygenating machinery as participants in ferroptotic cascades. These concepts are discussed in the light of emerging neuro-therapeutic approaches controlling intracellular production of pro-ferroptotic phospholipid signals and their non-cell-autonomous spreading, leading to ferroptosis-associated necroinflammation.
DDX6 helicase is an RNA-binding protein involved in different aspects of gene expression regulation. The roles played by DDX6 depend on the complexes associated with it. Here, for the first time, we characterize the protein complexes associated with DDX6 in human adipose tissue-derived stem cells (hASCs) and analyze the dynamics of this helicase under different conditions of translational activity and differentiation. The results obtained demonstrated that the DDX6 helicase is associated with proteins involved in the control of mRNA localization, translation and metabolism in hASCs. DDX6 complexes may also assemble into more complex structures, such as RNA-dependent granules, the abundance and composition of which change upon inhibited translational activity. This finding supports the supposition that DDX6 is possibly involved in the regulation of the mRNA life cycle in hASCs. Although there was no significant variation in the protein composition of these complexes during early adipogenic or osteogenic induction, there was a change in the distribution pattern of DDX6: the number of DDX6 granules per cell was reduced during adipogenesis and was enhanced during osteogenesis.
In December 2019, a novel coronavirus (SARS-CoV-2) was identified in COVID-19 patients in Wuhan, Hubei Province, China. SARS-CoV-2 shares both high sequence similarity and the use of the same cell entry receptor, angiotensin-converting enzyme 2 (ACE2), with severe acute respiratory syndrome coronavirus (SARS-CoV). Several studies have provided bioinformatic evidence of potential routes of SARS-CoV-2 infection in respiratory, cardiovascular, digestive and urinary systems. However, whether the reproductive system is a potential target of SARS-CoV-2 infection has not yet been determined. Here, we investigate the expression pattern of ACE2 in adult human testes at the level of single-cell transcriptomes. The results indicate that ACE2 is predominantly enriched in spermatogonia and Leydig and Sertoli cells. Gene Set Enrichment Analysis (GSEA) indicates that Gene Ontology (GO) categories associated with viral reproduction and transmission are highly enriched in ACE2-positive spermatogonia, while male gamete generation related terms are downregulated. Cell-cell junction and immunity-related GO terms are increased in ACE2-positive Leydig and Sertoli cells, but mitochondria and reproduction-related GO terms are decreased. These findings provide evidence that the human testis is a potential target of SARS-CoV-2 infection, which may have significant impact on our understanding of the pathophysiology of this rapidly spreading disease.
Also flagged:respiratory distress syndromegestationironnecrotizing enterocolitisoxygenintraventricular hemorrhage
Journal Article2020-04-09✓ 3 SnippetsOrtiz-Esquinas I, Gómez-Salgado J, Rodriguez-Almagro J, Arias-Arias Á, Ballesta-Castillejos A, Hernández-Martínez A.
In-Text Gene Mentions
Results)
…was compared withDCCin five RCTs…
Discussion)
…versus ICC andDCC.…
Discussion)
…to ICC orDCC, we can only…
Show Full Abstract
Umbilical cord milking (UCM) could be an alternative in cases where delayed umbilical cord clamping cannot be performed, therefore our objective was to evaluate the effects of UCM in newborns <37 weeks' gestation. In this systematic review and meta-analysis, we searched MEDLINE, EMBASE, CINAHL, the Cochrane Database of Clinical Trials, the clinicaltrails.gov database for randomized UCM clinical trials with no language restrictions, which we then compared with other strategies. The sample included 2083 preterm infants. The results of our meta-analysis suggest that UCM in premature infants can reduce the risk of transfusion (relative risk (RR)= 0.78 [95% confidence interval (CI),0.67-0.90]) and increase hemoglobin(pooled weighted mean difference (PWMD)= 0.89 g/L[95%CI 0.55-1.22]) and mean blood pressure (PWMD=1.92 mmHg [95% CI 0.55-3.25]). Conversely, UCM seems to increase the risk of respiratory distress syndrome (RR = 1.54 [95% CI 1.03-2.29]), compared to the control groups. In infants born at <33 weeks, UCM was associated with a reduced risk of transfusion (RR= 0.81 [95%CI 0.66-0.99]), as well as higher quantities of hemoglobin (PWMD= 0.91 g/L[95%CI 0.50-1.32]). UCM reduces the risk of transfusion in preterm infants, and increases initial hemoglobin, hematocrit, and mean blood pressure levels with respect to controls.
Also flagged:Neurodegenerative Disordersdeathmetabolismorganellesneurodegenerative diseasesamyotrophic lateral sclerosis
Journal Article2020-04-09No SnippetsOppedisano F, Maiuolo J, Gliozzi M, Musolino V, Carresi C, Nucera S, Scicchitano M, Scarano F, Bosco F, Macrì R, Ruga S, Zito MC, Palma E, Muscoli C, Mollace V.
Show Full Abstract
The neurodegenerative process is characterized by the progressive ultrastructural alterations of selected classes of neurons accompanied by imbalanced cellular homeostasis, a process which culminates, in the later stages, in cell death and the loss of specific neurological functions. Apart from the neuronal cell impairment in selected areas of the central nervous system which characterizes many neurodegenerative diseases (e.g., Alzheimer's Disease, Parkinson's Disease, Huntington's Disease, etc.), some alterations may be found in the early stages including gliosis and the misfolding or unfolding accumulation of proteins. On the other hand, several common pathophysiological mechanisms can be found early in the course of the disease including altered oxidative metabolism, the loss of cross-talk among the cellular organelles and increased neuroinflammation. Thus, antioxidant compounds have been suggested, in recent years, as a potential strategy for preventing or counteracting neuronal cell death and nutraceutical supplementation has been studied in approaching the early phases of neurodegenerative diseases. The present review will deal with the pathophysiological mechanisms underlying the early stages of the neurodegenerative process. In addition, the potential of nutraceutical supplementation in counteracting these diseases will be assessed.
…of CIS-resistance wasSLC2A14regulated by miR-195…
Show Full Abstract
Ovarian cancer rates the highest mortality among all gynecological malignancies. The main reason for high mortality is the development of drug resistance. It can be related to increased expression of drug transporters and increased expression of extracellular matrix (ECM) proteins. Our foremost aim was to exhibit alterations in the miRNA expression levels in cisplatin (CIS), paclitaxel (PAC), doxorubicin (DOX), and topotecan (TOP)-resistant variants of the W1 sensitive ovarian cancer cell line-using miRNA microarray. The second goal was to identify miRNAs responsible for the regulation of drug-resistant genes. According to our observation, alterations in the expression of 40 miRNAs were present. We could observe that, in at least one drug-resistant cell line, the expression of 21 miRNAs was upregulated and that of 19 miRNAs was downregulated. We identified target genes for 22 miRNAs. Target analysis showed that miRNA regulates key genes responsible for drug resistance. Among others, we observed regulation of the ATP-binding cassette subfamily B member 1 gene (<i>ABCB1</i>) in the paclitaxel-resistant cell line by miR-363 and regulation of the collagen type III alpha 1 chain gene (<i>COL3A1</i>) in the topotekan-resistant cell line by miR-29a.
Progestins are widely used for the treatment of gynecologic disorders and alone, or combined with an estrogen, are used as contraceptives. While their potencies, efficacies and side effects vary due to differences in structures, doses and routes of administration, little is known about their effects on the endometrial transcriptome in the presence or absence of estrogen. Herein, we assessed the transcriptome and pathways induced by progesterone (P<sub>4</sub>) and the three most commonly used synthetic progestins, medroxyprogesterone acetate (MPA), levonorgestrel (LNG), and norethindrone acetate (NETA), on human endometrial stromal fibroblasts (eSF), key players in endometrial physiology and reproductive success. While there were similar transcriptional responses, each progestin induced unique genes and biofunctions, consistent with their structural similarities to progesterone (P<sub>4</sub> and MPA) or testosterone (LNG and NETA), involving cellular proliferation, migration and invasion. Addition of estradiol (E<sub>2</sub>) to each progestin influenced the number of differentially expressed genes and biofunctions in P<sub>4</sub> and MPA, while LNG and NETA signatures were more independent of E<sub>2</sub>. Together, these data suggest different mechanisms of action for different progestins, with progestin-specific altered signatures when combined with E<sub>2</sub>. Further investigation is warranted for a personalized approach in different gynecologic disorders, for contraception, and minimizing side effects associated with their use.
Also flagged:AndrogenTwist1gene expressionhelix-loop-transcription factorepithelial-to-mesenchymal transition
Journal Article2020-04-09✓ 5 SnippetsKhatiwada P, Kannan A, Malla M, Dreier M, Shemshedini L.
In-Text Gene Mentions
S I O 001029)
…(A) LNCaP, C81, CWR-22Rv1 and PC3 cells or (B–D) LNCaP cells were grown in 2% DCC-serum with ethanol (−) or 10 nM R1881 (+) for 48 h with (B) transfection of control or AR siRNA, (C) treatment with or without 50 nM Casodex, or (D) transfection with pGL3, Twist1-Luc, or ARE-Luc.…
S I O 001029)
…(E) ChIP assay was performed with LNCaP cells grown in 2% DCC-serum with ethanol or 10 nM R1881, as shown, to measure recruitment of ETV1 or AR to the Twist1 promoter regions A, E, E1, or E2 and PSA.…
S I O 001029)
…(B and C) LNCaP cells, grown in either (B) full serum or (C) 2% DCC-serum and treated with ethanol (−) or 10 nM R1881 (+), were co-transfected with pGL3 or Twist1-Luc and scrambled shRNA (−), ETV1 shRNA (+), or empty vector (−), as indicated.…
S I O 001029)
…(F) LNCaP cells grown in 2% DCC for 48 h were treated with ethanol (−) or R1881 (+) for 4, 8 or 24 h and expression of Twist1, ETV1 and PSA was measured using qRT-PCR.…
Methods)
…medium with 10%DCC-stripped serum.…
Show Full Abstract
Twist1, a basic helix-loop-helix transcription factor that regulates a number of genes involved in epithelial-to-mesenchymal transition (EMT), is upregulated in prostate cancer. Androgen regulation of Twist1 has been reported in a previous study. However, the mechanism of androgen regulation of the Twist1 gene is not understood because the Twist1 promoter lacks androgen receptor (AR)-responsive elements. Previous studies have shown that the Twist1 promoter has putative binding sites for PEA3 subfamily of ETS transcription factors. Our lab has previously identified Ets Variant 1 (ETV1), a member of the PEA3 subfamily, as a novel androgen-regulated gene that is involved in prostate cancer cell invasion through unknown mechanism. In view of these data, we hypothesized that androgen-activated AR upregulates Twist1 gene expression via ETV1. Our data confirmed the published work that androgen positively regulates Twist1 gene expression and further showed that this positive effect was directed at the Twist1 promoter. The positive effect of androgen on Twist1 gene expression was abrogated upon disruption of AR expression by siRNA or of AR activity by Casodex. More importantly, our data show that disruption of ETV1 leads to significant decrease in both androgen-mediated upregulation as well as basal level of Twist1, which we are able to rescue upon re-expression of ETV1. Indeed, we are able to show that ETV1 mediates the androgen upregulation of Twist1 by acting on the proximal region of Twist1 promoter. Additionally, our data show that Twist1 regulates prostate cancer cell invasion and EMT, providing a possible mechanism by which ETV1 mediates prostate cancer cell invasion. In conclusion, in this study we report Twist1 as an indirect target of AR and androgen regulation through ETV1.
Also flagged:reproductionAmhFoxl2Cyp19aspermatogenesisSox9
Journal Article2020-04-09✓ 1 SnippetZhang X, Zhou J, Li L, Huang W, Ahmad HI, Ahmad HI, Li H, Jiang H, Chen J.
In-Text Gene Mentions
Results)
…Sox3, Sox4, Sox5,Sox6, Sox7, Sox8, Sox9,…
Show Full Abstract
<h4>Background</h4>Sturgeons (Acipenseriformes) are polyploid chondrostean fish that constitute an important model species for studying development and evolution in vertebrates. To better understand the mechanisms of reproduction regulation in sturgeon, this study combined PacBio isoform sequencing (Iso-Seq) with Illumina short-read RNA-seq methods to discover full-length genes involved in early gametogenesis of the Amur sturgeon, <i>Acipenser schrenckii</i>.<h4>Results</h4>A total of 50.04 G subread bases were generated from two SMRT cells, and herein 164,618 nonredundant full-length transcripts (unigenes) were produced with an average length of 2782 bp from gonad tissues (three testes and four ovaries) from seven 3-year-old <i>A. schrenckii</i> individuals. The number of ovary-specific expressed unigenes was greater than those of testis (19,716 vs. 3028), and completely different KEGG pathways were significantly enriched between the ovary-biased and testis-biased DEUs. Importantly, 60 early gametogenesis-related genes (involving 755 unigenes) were successfully identified, and exactly 50% (30/60) genes of those showed significantly differential expression in testes and ovaries. Among these, the Amh and Gsdf with testis-biased expression, and the Foxl2 and Cyp19a with ovary-biased expression strongly suggested the important regulatory roles in spermatogenesis and oogenesis of <i>A. schrenckii</i>, respectively. We also found the four novel Sox9 transcript variants, which increase the numbers of regulatory genes and imply function complexity in early gametogenesis. Finally, a total of 236,672 AS events (involving 36,522 unigenes) were detected, and 10,556 putative long noncoding RNAs (lncRNAs) and 4339 predicted transcript factors (TFs) were also respectively identified, which were all significantly associated with the early gametogenesis of <i>A. schrenckii</i>.<h4>Conclusions</h4>Overall, our results provide new genetic resources of full-length transcription data and information as a genomic-level reference for sturgeon. Crucially, we explored the comprehensive genetic characteristics that differ between the testes and ovaries of <i>A. schrenckii</i> in the early gametogenesis stage, which could provide candidate genes and theoretical basis for further the mechanisms of reproduction regulation of sturgeon.
Also flagged:MethylationGene ExpressioncognitionNeurotrophinlong-term depressionAPP
Journal Article2020-04-09No SnippetsSoerensen M, Hozakowska-Roszkowska DM, Nygaard M, Larsen MJ, Schwämmle V, Christensen K, Christiansen L, Tan Q.
Show Full Abstract
Monozygotic twins are genetically identical but rarely phenotypically identical. Epigenetic and transcriptional variation could influence this phenotypic discordance. Investigation of intra-pair differences in molecular markers and a given phenotype in monozygotic twins controls most of the genetic contribution, enabling studies of the molecular features of the phenotype. This study aimed to identify genes associated with cognition in later life using integrated enrichment analyses of the results of blood-derived intra-pair epigenome-wide and transcriptome-wide association analyses of cognition in 452 middle-aged and old-aged monozygotic twins (56-80 years). Integrated analyses were performed with an unsupervised approach using KeyPathwayMiner, and a supervised approach using the KEGG and Reactome databases. The supervised approach identified several enriched gene sets, including "neuroactive ligand receptor interaction" (<i>p</i>-value = 1.62<sup>∗</sup>10-2), "Neurotrophin signaling" (<i>p</i>-value = 2.52<sup>∗</sup>10-3), "Alzheimer's disease" (<i>p</i>-value = 1.20<sup>∗</sup>10-2), and "long-term depression" (<i>p</i>-value = 1.62<sup>∗</sup>10-2). The unsupervised approach resulted in a 238 gene network, including the Alzheimer's disease gene <i>APP</i> (Amyloid Beta Precursor Protein) as an exception node, and several novel candidate genes. The strength of the unsupervised method is that it can reveal previously uncharacterized sub-pathways and detect interplay between biological processes, which remain undetected by the current supervised methods. In conclusion, this study identified several previously reported cognition genes and pathways and, additionally, puts forward novel candidates for further verification and validation.
Also flagged:MethylationCervical Cancertumorinfectiongynecologicalcancer
Journal Article2020-04-09✓ 2 SnippetsZhu H, Zhu H, Tian M, Wang D, He J, Xu T.
In-Text Gene Mentions
S I O 001029)
…Clarke et al. (2017) demonstrated that, compared with healthy controls, ADCYAP1, ASCL1, CADM1, DCC, ATP10, DBC1, HS3ST2, MOS, SOX1, MYOD1, SOX17, and TMEFF2 showed higher levels of methylation. ASCL1, LHX8, and ST6GALNAC5 exhibited increased DNA methylation in cervical cancer; DNA hypermethylation also increases with the severity of cervical cancer (Kremer et al., 2018). Moreover, Verlaat et al. showed that DNA methylation usually occurs at the pre-tumorigenic stage and reaches the highest level after tumorigenesis induced by hrHPV. Twelve genes (ANKRD18CP, C13orf18, EPB41L3, JAM3, SOX1, ZSCAN1, GHSR, SST, ZIC1, FAM19A4, PHACTR3, and PRDM14) are potential biomarkers for diagnosing cervical cancer (Verlaat et al., 2018b). Clarke et al. also found that DNA methylation occurs during the transition from HPV infection to the pre-cancer stage for all the 12 carcinogenic HPV types (Clarke et al., 2018). Promoter DNA methylation regulates miRNA expression that is an important mechanism employed during the development of cervical cancer. miR-424 has been shown to be hypermethylated in its promoter and is linked to the progression of cervical cancer (Varghese et al., 2018).…
S I O 001029)
…DCC is involved in cell cycle control and apoptosis and can be found in several cancers, such as ovarian cancer, etc. However, experiments in the future need to confirm if methylated DCC can serve as a marker during the screening of cervical cancer (Clarke et al., 2017).…
Show Full Abstract
Recent discoveries have led to the development of novel ideas and techniques that have helped elucidate the correlation between epigenetics and tumor biology. Nowadays, the field of tumor genetics has evolved to include a new type of regulation by epigenetics. An increasing number of studies have demonstrated the importance of DNA methylation and hydroxymethylation in specific genes in the progression of cervical cancer. Determining the methylation and hydroxymethylation profiles of these genes will help in the early prevention and diagnosis, monitoring recurrence, prognosis, and treatment of patients with cervical cancer. In this review, we focus on the significance of aberrant DNA methylation and hydroxymethylation in cervical cancer and the use of these epigenetic signatures in clinical settings.
Also flagged:PolycythemiaHereditary hemochromatosisironanemiachronic obstructive pulmonary diseasecirrhosis
Journal Article2020-04-09✓ 5 SnippetsKhan AA, Hadi Y, Hassan A, Kupec J.
In-Text Gene Mentions
Methods)
…Patients who carried the clinical diagnosis of hemochromatosis, confirmed to be positive on HFE gene testing, were included.…
Abstract)
…Hemochromatosiscauses pulmonary, pancreatic,…
Abstract)
…patients who underwentHFEgene analysis and…
Abstract)
…the diagnosis ofhemochromatosis.…
Abstract)
…all patients withhemochromatosis, with most patients’…
Show Full Abstract
Introduction Hereditary hemochromatosis is a syndrome of dysregulated iron homeostasis resulting in the excessive deposition of iron. Hemochromatosis causes pulmonary, pancreatic, and hepatic dysfunction, all of which are risk factors for anemia in the general population. Conversely, iron overload states are thought to predispose to polycythemia. The effect of the homozygosity and heterozygosity of hereditary hemochromatosis-associated genes on hemoglobin levels has not been sufficiently studied. Materials and methods We conducted a retrospective cohort study at West Virginia University of all patients who underwent HFE gene analysis and carried the diagnosis of hemochromatosis. Charts were reviewed to identify relevant variables and the patients' clinical course. Results A total of 213 patients were included with 143 male participants (67.13%). The mean age was 53.6 years (SD: 15.2). A total of 108 patients were homozygous for the C282Y mutation. The prevalence of baseline characteristics are as follows: tobacco use 46.3%, chronic obstructive pulmonary disease 16.4%, malignancy 20.1%, cirrhosis 16.8%, anticoagulant use 6.5%, and chronic renal insufficiency 13.1%. The mean hemoglobin of the population was 15.0 mg/dL (SD 2.21). Anemia was seen in 23 patients (10.80%) and 59 patients (27.6%) had polycythemia. Concurrent malignancy and the presence of chronic renal insufficiency were significantly associated with anemia in both the univariate and multivariate analysis (p-values < 0.001). Patients with homozygosity for C282Y were more likely to receive phlebotomy as compared to other patients. Serum ferritin was not associated with anemia or polycythemia on multivariate analyses (p-values 0.197 and 0.105, respectively). Conclusion Despite the high prevalence of comorbidities that are known risk factors for anemia in the general population, few patients with hereditary hemochromatosis develop anemia. Female patients with hereditary hemochromatosis are relatively protected against polycythemia, affecting only one-fourth of all patients with hemochromatosis, with most patients' serum hemoglobin reported within normal limits.
Also flagged:Fungal MacrolactoneLipopolysaccharideInflammatory ResponseNucleusmacrolactonesteroids
Journal Article2020-04-08✓ 1 SnippetBanala RR, Vemuri SK, Ev S, Av GR, Gpv S.
In-Text Gene Mentions
Introduction)
…and II, andSOX6and SOX9 […
Show Full Abstract
<h4>Study design</h4>Developing an in vitro model for assessing the anti-inflammatory properties of curvularin.<h4>Purpose</h4>To evaluate the efficacy of natural fungal macrolactone as a therapeutic drug against lipopolysaccharide (LPS)-induced inflammation in primary human nucleus pulposus cells (NPCs) in vitro.<h4>Overview of literature</h4>Lumbar disk disease is a common cause of lower back pain (LBP) and sciatica. It is an established fact that inflammation, rather than mechanical compression on the nerve root, plays a role in the cause of LBP and sciatica. Current treatment options for reducing inflammation are either nonsteroidal anti-inflammatory drugs or steroids, prolonged use of which can potentially lead to adverse effects such as gastrointestinal disturbances and renal and cardiac issues. Hence, there is a need for better antiinflammatory drugs with no or minimal complications for treating inflammation-induced LBP and sciatica. Curvularin (Cur), a fungal macrolactone, is known for its anti-inflammatory activity, but nothing is known about its impact on inflammation due to disk pathologies.<h4>Methods</h4>Primary NPCs were cultured and characterized by flow cytometry and immunocytochemistry using the CD24 antibody and treated with 10 μg/mL LPS for 36 hours and then treated with Cur, betamethasone, and dexamethasone (10 μg/mL) for 48 hours, after which cell cycle analysis, cell viability assay, and gene expression studies (quantitative polymerase chain reaction [PCR] and quantitative real-time-PCR) were conducted. The NPCs treated with Cur downregulated the expression of pro-inflammatory cytokines (tumor necrosis factor-α, interleukin [IL]-1β, and IL-6); matrix metalloproteinases (MMPs; MMP-2 and MMP-3), ADAMTS; and apoptotic marker (cytochrome c).<h4>Results</h4>In our study, Cur-treated cells showed enhanced expression of collagen 9A1 and insulin-like growth factor receptor 1, indicating the recovery of NPCs from inflammatory assault.<h4>Conclusions</h4>Based on observations, the anti-inflammatory properties of Cur render it an excellent drug molecule for treating disk degeneration nonsurgically, by direct injection into spinal disks when treating LBP and sciatica.
Journal Article2020-04-08✓ 1 SnippetLittle TM, Jordan PW.
In-Text Gene Mentions
Results)
…Condensinforms two separate…
Show Full Abstract
Errors during meiotic resumption in oocytes can result in chromosome missegregation and infertility. Several cell cycle kinases have been linked with roles in coordinating events during meiotic resumption, including polo-like kinases (PLKs). Mammals express four kinase-proficient PLKs (PLK1-4). Previous studies assessing the role of PLK1 have relied on RNA knockdown and kinase inhibition approaches, as <i>Plk1 </i>null mutations are embryonically lethal. To further assess the roles of PLK1 during meiotic resumption, we developed a <i>Plk1</i> conditional knockout (cKO) mouse to specifically mutate <i>Plk1</i> in oocytes. Despite normal oocyte numbers and follicle maturation, <i>Plk1</i> cKO mice were infertile. From analysis of meiotic resumption, <i>Plk1</i> cKO oocytes underwent nuclear envelope breakdown with the same timing as control oocytes. However, <i>Plk1</i> cKO oocytes failed to form compact bivalent chromosomes, and localization of cohesin and condensin were defective. Furthermore, <i>Plk1</i> cKO oocytes either failed to organize α-tubulin or developed an abnormally small bipolar spindle. These abnormalities were attributed to aberrant release of the microtubule organizing center (MTOC) linker protein, C-NAP1, and the failure to recruit MTOC components and liquid-like spindle domain (LISD) factors. Ultimately, these defects result in meiosis I arrest before homologous chromosome segregation.
Also flagged:hematological diseasesmyelodysplastic syndromeanemialeukopenialeukocytosisthrombocytopenia
Journal Article2020-04-08✓ 1 SnippetWu YY, Huang TC, Ye RH, Fang WH, Lai SW, Chang PY, Liu WN, Kuo TY, Lee CH, Tsai WC, Lin C.
In-Text Gene Mentions
Introduction)
…ancytopenia, polycythemia, andhemochromatosis, as well as…
Show Full Abstract
<h4>Background</h4>Bone marrow aspiration and biopsy remain the gold standard for the diagnosis of hematological diseases despite the development of flow cytometry (FCM) and molecular and gene analyses. However, the interpretation of the results is laborious and operator dependent. Furthermore, the obtained results exhibit inter- and intravariations among specialists. Therefore, it is important to develop a more objective and automated analysis system. Several deep learning models have been developed and applied in medical image analysis but not in the field of hematological histology, especially for bone marrow smear applications.<h4>Objective</h4>The aim of this study was to develop a deep learning model (BMSNet) for assisting hematologists in the interpretation of bone marrow smears for faster diagnosis and disease monitoring.<h4>Methods</h4>From January 1, 2016, to December 31, 2018, 122 bone marrow smears were photographed and divided into a development cohort (N=42), a validation cohort (N=70), and a competition cohort (N=10). The development cohort included 17,319 annotated cells from 291 high-resolution photos. In total, 20 photos were taken for each patient in the validation cohort and the competition cohort. This study included eight annotation categories: erythroid, blasts, myeloid, lymphoid, plasma cells, monocyte, megakaryocyte, and unable to identify. BMSNet is a convolutional neural network with the YOLO v3 architecture, which detects and classifies single cells in a single model. Six visiting staff members participated in a human-machine competition, and the results from the FCM were regarded as the ground truth.<h4>Results</h4>In the development cohort, according to 6-fold cross-validation, the average precision of the bounding box prediction without consideration of the classification is 67.4%. After removing the bounding box prediction error, the precision and recall of BMSNet were similar to those of the hematologists in most categories. In detecting more than 5% of blasts in the validation cohort, the area under the curve (AUC) of BMSNet (0.948) was higher than the AUC of the hematologists (0.929) but lower than the AUC of the pathologists (0.985). In detecting more than 20% of blasts, the AUCs of the hematologists (0.981) and pathologists (0.980) were similar and were higher than the AUC of BMSNet (0.942). Further analysis showed that the performance difference could be attributed to the myelodysplastic syndrome cases. In the competition cohort, the mean value of the correlations between BMSNet and FCM was 0.960, and the mean values of the correlations between the visiting staff and FCM ranged between 0.952 and 0.990.<h4>Conclusions</h4>Our deep learning model can assist hematologists in interpreting bone marrow smears by facilitating and accelerating the detection of hematopoietic cells. However, a detailed morphological interpretation still requires trained hematologists.
Journal Article2020-04-08✓ 1 SnippetJiao P, Fan W, Cao Y, Zhang H, Tian L, Sun L, Luo T, Liu W, Li J.
In-Text Gene Mentions
I A O 0000326)
…RC3H1…
Show Full Abstract
Influenza B virus (IBV) belongs to the Orthomyxoviridae family and generally causes sporadic epidemics but is occasionally deadly to individuals. The current research mainly focuses on clinical and pathological characteristics of IBV. However, to better prevent or treat the disease, one must determine the strategies developed by IBV to invade and disrupt cellular proteins and approach to replicate itself, to suppress antiviral innate immunity, and understand how the host responds to IBV infection. The B/Shanghai/PD114/2018 virus was able to infect alveolar epithelial cells (A549) cells, with good potential for replication. To identify host cellular responses against IBV infection, differentially expressed genes (DEGs) were obtained using RNA sequencing. The GO and KEGG pathway term enrichment analyses with the DEGs were performed, and we found that the DEGs were primary involved in metabolic processes and cellular function, which may be related to the host response, including the innate immune response against the virus. Our transcriptome analysis results demonstrated robust induction of interferon and interferon-stimulated gene expression by IBV in human cells during the early stages of infection, providing a foundation for further studies focused on antiviral drug development and interactions between the virus and host.
Also flagged:fluoridepositroncarbanioncarbonsoxygensulfur
Journal Article2020-04-08No SnippetsQu W, Hu B, Babich JW, Waterhouse N, Dooley M, Ponnala S, Urgiles J.
Show Full Abstract
Carbon-11 (<sup>11</sup>C) is one of the most ideal positron emitters for labeling bioactive molecules for molecular imaging studies. The lack of convenient and fast incorporation methods to introduce <sup>11</sup>C into organic molecules often hampers the use of this radioisotope. Here, a fluoride-mediated desilylation (FMDS) <sup>11</sup>C-labeling approach is reported. This method relies on thermodynamically favored Si-F bond formation to generate a carbanion, therefore enabling the highly efficient and speedy incorporation of [<sup>11</sup>C]CO<sub>2</sub> and [<sup>11</sup>C]CH<sub>3</sub>I into molecules with diversified structures. It provides facile and rapid access to <sup>11</sup>C-labeled compounds with carbon-11 attached at various hybridized carbons as well as oxygen, sulfur and nitrogen atoms with broad functional group tolerance. The exemplified syntheses of several biologically and clinically important radiotracers illustrates the potentials of this methodology.
Also flagged:Hydroxycinnamoyl Amino Acidssynthesishydroxycinnamoyl amidesp -coumaroyltyrosinephenylalanine
Journal Article2020-04-08No SnippetsBerti F, Navarini L, Colomban S, Forzato C.
Show Full Abstract
The synthesis of five hydroxycinnamoyl amides (HCAs) was accomplished and their identification and quantification in the green coffee bean samples of <i>Coffea</i> <i>arabica</i>, <i>Coffea</i> <i>canephora</i>, and <i>Coffea</i> <i>liberica</i> was performed. The HCAs <i>p</i>-coumaroyl-<i>N</i>-tyrosine <b>1b</b>, caffeoyl-<i>N</i>-phenylalanine <b>2b</b>, caffeoyl-<i>N</i>-tyrosine <b>3b</b>, and <i>p</i>-coumaroyl-<i>N</i>-tryptophan <b>4b</b> were characteristic of the <i>C. canephora</i> species while caffeoyl-<i>N</i>-tryptophan <b>5b</b> was present in both <i>C. canephora</i> and <i>C. arabica</i>, but with higher content in <i>C. canephora</i>. The HCAs presence was also analyzed in <i>C. liberica</i> for the first time and none of the targeted compounds was found, indicating that this species is very similar to <i>C. arabica</i> species. Between <i>C. canephora</i> samples from various origins, significant differences were observed regarding the presence of all the HCAs, with <i>C. canephora</i> from Tanzania containing all five derivatives.
Also flagged:Plant Diseaseinfectionvirulence genesviralNucleotidebinding
Journal Article2020-04-08No SnippetsParisi M, Alioto D, Tripodi P.
Show Full Abstract
Pepper (<i>Capsicum</i> spp.) is one of the major vegetable crops grown worldwide largely appreciated for its economic importance and nutritional value. This crop belongs to the large Solanaceae family, which, among more than 90 genera and 2500 species of flowering plants, includes commercially important vegetables such as tomato and eggplant. The genus includes over 30 species, five of which (<i>C. annuum</i>, <i>C. frutescens</i>, <i>C. chinense</i>, <i>C. baccatum</i>, and <i>C. pubescens</i>) are domesticated and mainly grown for consumption as food and for non-food purposes (e.g., cosmetics). The main challenges for vegetable crop improvement are linked to the sustainable development of agriculture, food security, the growing consumers' demand for food. Furthermore, demographic trends and changes to climate require more efficient use of plant genetic resources in breeding programs. Increases in pepper consumption have been observed in the past 20 years, and for maintaining this trend, the development of new resistant and high yielding varieties is demanded. The range of pathogens afflicting peppers is very broad and includes fungi, viruses, bacteria, and insects. In this context, the large number of accessions of domesticated and wild species stored in the world seed banks represents a valuable resource for breeding in order to transfer traits related to resistance mechanisms to various biotic stresses. In the present review, we report comprehensive information on sources of resistance to a broad range of pathogens in pepper, revisiting the classical genetic studies and showing the contribution of genomics for the understanding of the molecular basis of resistance.
Also flagged:RutinHuntington's diseaseinsulinIGF1autophagyHD
Journal Article2020-04-08✓ 3 SnippetsCordeiro LM, Machado ML, da Silva AF, Obetine Baptista FB, da Silveira TL, Soares FAA, Arantes LP.
In-Text Gene Mentions
Abstract)
…HD is caused by an abnormally long polyglutamine (polyQ) expansion in the huntingtin (Htt) protein, which confers toxic functions to mutant Htt leading to neurodegeneration.…
Abstract)
…in the huntingtin (Htt) protein, which confers…
Abstract)
…functions to mutantHttleading to neurodegeneration.…
Show Full Abstract
Huntington's disease (HD) is inherited neurodegenerative disease, it is characterized by excessive motor movements and cognitive and emotional deficits. HD is caused by an abnormally long polyglutamine (polyQ) expansion in the huntingtin (Htt) protein, which confers toxic functions to mutant Htt leading to neurodegeneration. Rutin is a flavonoid found in plants, buckwheat, some teas and also in apples. Although previous studies have already indicated that rutin has some protective effects in HD's models, the underlying mechanisms are still unknown. In our study, we investigated the effects of rutin in Caenorhabditis elegans model of HD. We assessed polyQ aggregation, oxidative damage, neurodegeneration level and lifespan, and investigated the possible role of autophagy and insulin/IGF1 (IIS) signaling pathways in the beneficial effects induced by rutin. Overall, our data demonstrate that chronic rutin treatment reduced polyglutamine (polyQ) protein aggregation in muscle, reduced polyQ-mediated neuronal death in ASH sensory neurons, and extended lifespan. The possible mechanisms involved are antioxidant activity, activation of protein degradation (autophagy) and insulin/IGF1 (IIS) signaling pathways. These findings indicate that rutin consumption might be helpful in preventing HD and also provide possible pathways to be explored to search for new therapies against proteinopathies related to aging.
Also flagged:Condensin Ichromosomescondensin IIchromosomemitosismale meiosis
Journal Article2020-04-08✓ 4 SnippetsKleinschnitz K, Vießmann N, Jordan M, Heidmann SK.
In-Text Gene Mentions
Methods)
…RNAi-mediated knockdown ofCondensinmRNA, we used…
Methods)
…Condensin-EGFP is an abbreviation…
Methods)
…UAS-Condensin-siRNA represents transgenes e…
Discussion)
…Condensincomplexes are required…
Show Full Abstract
The heteropentameric condensin complexes play vital roles in the formation and faithful segregation of mitotic chromosomes in eukaryotes. While the different contributions of the two common condensin complexes, condensin I and condensin II, to chromosome morphology and behavior in mitosis have been thoroughly investigated, much less is known about the specific roles of the two complexes during meiotic divisions. In Drosophila melanogaster, faithful mitotic divisions depend on functional condensin I, but not on condensin II. However, meiotic divisions in Drosophila males require functional condensin II subunits. The role of condensin I during male meiosis in Drosophila has been unresolved. Here, we show that condensin I-specific subunits localize to meiotic chromatin in both meiosis I and II during Drosophila spermatogenesis. Live cell imaging reveals defects during meiotic divisions after RNAi-mediated knockdown of condensin I-specific mRNAs. This phenotype correlates with reduced male fertility and an increase in nondisjunction events both in meiosis I and meiosis II. Consistently, a reduction in male fertility was also observed after proteasome-mediated degradation of the condensin I subunit Barren. Taken together, our results demonstrate an essential role of condensin I during male meiosis in Drosophila melanogaster.
Also flagged:Gliomaluciferasecell proliferationNeogeninmalignant tumorsbrain tumors
Journal Article2020-04-08✓ 2 SnippetsWang Y, Tian Y, Li Z, Zheng Z, Zhu L.
In-Text Gene Mentions
Discussion)
…Neogenin, also known as a tumor suppressor protein Deleted in Colorectal Cancer (DCC), is low-expressed in many cancers, and this deficiency of neogenin increases the risk of tumor malignancy [25].…
Discussion)
…in Colorectal Cancer (DCC), is low-expressed in…
Show Full Abstract
This study aimed to explore the pathological mechanism in regulating glioma progression. The expression of miR-92 and neogenin was evaluated by qRT-PCR and western blot. Cell viability and apoptosis were measured by MTT and flow cytometry assays, respectively. The migration and invasion abilities were examined by transwell assays. The interaction between miR-92 and neogenin was conducted by dual-luciferase reporter system. As a result, we found that the expression of miR-92 was up-regulated in glioma tissues and cell lines. Down-regulation of miR-92 inhibited glioma cell proliferation, migration, invasion and promoted cell apoptosis rate of U251 and U87 cells. Notably, miR-92 was identified to directly target to 3'-UTR of neogenin. Furthermore, neogenin was down-regulated in glioma tissues and cells in a miR-92-correlated manner. Overexpression of neigenin could cause similar results to miR-92 knockdown in U251 and U87 cells. However, the silencing of neogenin partially reversed the effects of miR-92 knockdown on cell proliferation, migration, invasion and apoptosis of glioma cells in vitro. In conclusion, we clarified that miR-92 knockdown could suppress the malignant progression of glioma cells in vitro by targeting neogenin. Therefore, miR-92 could serve as a potential diagnostic and prognostic marker in glioma patients.
Also flagged:TumorGlioblastomaGBbrain cancercancersbrain tumors
Journal Article2020-04-08No SnippetsGrégoire H, Roncali L, Rousseau A, Chérel M, Delneste Y, Jeannin P, Hindré F, Garcion E.
Show Full Abstract
Glioblastoma (GB) is the most common and devastating form of brain cancer. Despite conventional treatments, progression or recurrences are systematic. In recent years, immunotherapies have emerged as an effective treatment in a number of cancers, leaving the question of their usefulness also faced with the particular case of brain tumors. The challenge here is major not only because the brain is the seat of our consciousness but also because of its isolation by the blood-brain barrier and the presence of a unique microenvironment that constitutes the central nervous system (CNS) with very specific constituent or patrolling cells. Much of the microenvironment is made up of immune cells or inflammation. Among these, tumor-associated macrophages (TAMs) are of significant interest as they are often involved in facilitating tumor progression as well as the development of resistance to standard therapies. In this review, the ubiquity of TAMs in GB will be discussed while the specific case of microglia resident in the brain will be also emphasized. In addition, the roles of TAMs as accomplices in the progression of GB and resistance to treatment will be presented. Finally, clinical trials targeting TAMs as a means of treating cancer will be discussed.
Journal Article2020-04-08No SnippetsSuraeva O, Champanhac C, Mailänder V, Wurm FR, Weiss H, Berger R, Mezger M, Landfester K, Lieberwirth I.
Show Full Abstract
A polyethylene-like polymer with an in-chain vitamin C group was synthesized by olefin metathesis polymerization. Here, we describe both the synthesis and a comprehensive physical characterization. Because of the olefin metathesis synthesis, the vitamin C groups are equidistantly arranged in the polyethylene (PE) main chain. Their separation was adjusted to 20 CH<sub>2</sub> units. After hydrogenation, a semicrystalline polymer is obtained that is soluble in polar solvents. Because of its size and steric effect, the vitamin C acts as a chain defect, which is expelled from the crystal lattice, yielding a lamellar crystal with a homogeneous thickness corresponding to the interdefect distance. The physical properties were examined by various methods including differential scanning calorimetry, X-ray scattering, and transmission electron microscopy. We show that vitamin C retains its radical scavenger properties despite being incorporated into a polyethylene chain. Furthermore, we demonstrate that it is degrading in alkaline conditions. To complete its suitability as a biocompatible material, cytotoxicity and cell uptake experiments were performed. We show that the polymer is nontoxic and that it is taken up in nanoparticular form via endocytosis processes into the cytoplasm of cells.
Also flagged:atherosclerosisASheart attacksstrokeperipheral vascular diseaseBerberine
Journal Article2020-04-08No SnippetsMa X, Zhang T, Luo Z, Li X, Lin M, Li R, Du P, Yu X, Ma C, Yan P, Su J, Wang L, Li Y, Jiang J.
Show Full Abstract
Atherosclerosis (AS) is the leading cause of heart attacks, stroke, and peripheral vascular disease. Berberine (BBR), a botanical medicine, has diversified anti-atherosclerotic effects but with poor absorption. The aim of this study was to develop an effective BBR-entrapped nano-system for treating AS in high-fat diet (HFD)-fed <i>Apoe</i> <sup>(-/-)</sup> mice, and also explore the possible underlying mechanisms involved. Three d-<i>α</i>-tocopherol polyethylene glycol (PEG) succinate (TPGS) analogues with different PEG chain lengths were synthesized to formulate BBR-entrapped micelles. HFD-fed <i>Apoe</i> <sup>(-/-)</sup> mice were administered with optimized formula (BBR, 100 mg/kg/day) orally for 5 months. The artery plaque onset and related metabolic disorders were evaluated, and the underlying mechanisms were studied. Our data showed that, BT<sub>1500</sub>M increased BBR deposition in liver and adipose by 107.6% and 172.3%, respectively. In the <i>Apoe</i> <sup>(-/-)</sup> mice, BT<sub>1500</sub>M ameliorated HFD-induced hyperlipidemia and lipid accumulation in liver and adipose. BT<sub>1500</sub>M also suppressed HFD-induced chronic inflammation as evidenced by the reduced liver and adipose levels of interleukin-6 (IL-6), tumor necrosis factor-<i>α</i> (TNF-<i>α</i>) and interleukin-1<i>β (</i>IL-1<i>β</i>); and decreased plasma level of TNF-<i>α</i>, IL-6, IL-1<i>β</i>, interferon-<i>γ (</i>IFN-<i>γ</i>), monocyte chemotactic protein (MCP), and macrophage inflammatory factor (MIP). The mechanism study showed that BT<sub>1500</sub>M changed <i>Ampk</i> and <i>Nf-κb</i> gene expression, and interrupted a crosstalk process between adipocytes and macrophages. Further investigation proved that BT<sub>1500</sub>M decreased endothelial lesion and subsequent macrophage activation, cytokines release, as well as cholesteryl ester gathering in the aortic arch, resulting in ameliorated artery plaque build-up. Our results provide a practical strategy for treating AS using a BBR-entrapped nano-system.
Also flagged:hydrazidefluoridehexanedihydrazidebutylpyrroledimethylformamide
Journal Article2020-04-08No SnippetsPark S, Ju J, Lee YJ, Lee SY.
Show Full Abstract
Sensing of fluoride in a solvent is highly required in healthcare and environmental rehabilitation. Among the various sensing methods, optical sensing has attracted significant research interest because it can conveniently recognize fluoride. Herein, a low molecular weight organogelator, <i>N</i>'1,<i>N</i>'6-bis(3-(1-pyrrolyl)propanoyl) hexanedihydrazide (DPH), containing a central butyl chain conjugated to two pyrrole rings through hydrazide groups, was used for optical sensing of fluoride in the forms of both solution and organogel. Association of fluoride with the -NH moiety of the hydrazide group endowed the DPH solution in dimethylformamide with a hyperchromicity under 350 nm. Exploiting the UV absorptivity, the DPH solution was examined as a chemosensor, displaying good selectivity toward fluoride among various anions and moderate sensitivity with a detection limit of 0.49 μM. The practical use of the DPH solution was demonstrated for fluoride sensing in toothpaste. Binding of fluoride also changed the molecular interactions of the DPH organogel, resulting in a phase transition from gel to sol. This gel-to-sol transition enabled the sensing of fluoride by the naked eye.
Research Square2020-04-08Preprint (No Snippets API)Ren X, Xu K, Xu J, Geng M, Lu C, Kong L, Cai Y, Hou W, Lu Y, Aihaiti Y, Wang R, Xu P.
Show Full Abstract
<title>Abstract</title> <p>Background To understand the roles of synovial tissue in rheumatoid arthritis (RA), we comprehensively investigated the protein profiles of synovial tissues in patients with RA and osteoarthritis (OA). Methods Protein were isolated from synovial tissues of 46 patients (22 with RA, 24with OA). Proteins were digested and labeled with TMT kit. All the peptide were send to LC-MS/MS analysis, and processed with Mascot and Proteome Discovery (version 1.4) search engines. All the protein data were analysis with Gene ontology (GO) and KEGG on line database. Four up-regulated protein were examined with western blotting and IHC. The RNAi were used for revealing the OLFM4 function in FLS. Results In total, over 500 proteins were identified as the different expression protein compared RA and OA synovia tissues, including 239 proteins were up-regulated in RA, and 271 proteins were up-regulated in OA. GO and KEGG analysis of the different expressed protein mostly identified as developmental processes and protein processing in ER. RT-qPCR, western blotting and IHC confirmed that there was a strong over expressed OLFM4 in RA synovia tissues. OLFM4 could be up-regulated under inflammatory stimulation, and participate in fibroblast like synoviocytes proliferation. Conclusion patients with RA possessed considerably different protein profiles of synovial tissues from with OA. The unique protein profiles of RA synovial tissues, such as the OLFM4 and MZB1 had been up-regulated compared to the OA, may reflect the pathophysiology of RA.</p>
Also flagged:Heparanaseheparansulfateoligosaccharidestumorinsulin
Journal Article2020-04-07✓ 1 SnippetZhu S, Li J, Loka RS, Song Z, Vlodavsky I, Zhang K, Nguyen HM.
In-Text Gene Mentions
Text
…ATIII…
Show Full Abstract
Heparanase cleaves polymeric heparan sulfate (HS) molecules into smaller oligosaccharides, allowing for release of angiogenic growth factors promoting tumor development and autoreactive immune cells to reach the insulin-producing β cells. Interaction of heparanase with HS chains is regulated by specific substrate sulfation sequences. We have synthesized 11 trisaccharides that are highly tunable in structure and sulfation pattern, allowing us to determine how heparanase recognizes HS substrate and selects a favorable cleavage site. Our study shows that (1) <i>N</i>-SO<sub>3</sub><sup>-</sup> at +1 subsite and 6-<i>O</i>-SO<sub>3</sub><sup>-</sup> at -2 subsite of trisaccharides are critical for heparanase recognition, (2) addition of 2-<i>O</i>-SO<sub>3</sub><sup>-</sup> at the -1 subsite and of 3-<i>O</i>-SO<sub>3</sub><sup>-</sup> to GlcN unit is not advantageous, and (3) the anomeric configuration (α or β) at the reducing end is crucial in controlling heparanase activity. Our study also illustrates that the α-trisaccharide having <i>N</i>- and 6-<i>O</i>-SO<sub>3</sub><sup>-</sup> at -2 and +1 subsites inhibited heparanase and was resistant toward hydrolysis.
Also flagged:Condensin ICap-Ggene expressionchromosomecell divisionsbehavioural
Journal Article2020-04-07✓ 4 SnippetsHassan A, Araguas Rodriguez P, Heidmann SK, Walmsley EL, Aughey GN, Southall TD.
In-Text Gene Mentions
Abstract)
…Condensincomplexes are essential…
Introduction)
…dosage compensation complex (DCC), closely related to…
Introduction)
…Condensinmutations in mitotic…
Discussion)
…Condensinbinding data reported…
Show Full Abstract
Condensin complexes are essential for mitotic chromosome assembly and segregation during cell divisions, however, little is known about their functions in post-mitotic cells. Here we report a role for the condensin I subunit Cap-G in <i>Drosophila</i> neurons. We show that, despite not requiring condensin for mitotic chromosome compaction, post-mitotic neurons express Cap-G. Knockdown of Cap-G specifically in neurons (from their birth onwards) results in developmental arrest, behavioural defects, and dramatic gene expression changes, including reduced expression of a subset of neuronal genes and aberrant expression of genes that are not normally expressed in the developing brain. Knockdown of Cap-G in mature neurons results in similar phenotypes but to a lesser degree. Furthermore, we see dynamic binding of Cap-G at distinct loci in progenitor cells and differentiated neurons. Therefore, Cap-G is essential for proper gene expression in neurons and plays an important role during the early stages of neuronal development.
Also flagged:Alzheimer's diseaseapolipoprotein EAPOE5‐HT transporter5Aβ
Journal Article2020-04-07✓ 1 SnippetGeerts H, Spiros A.
In-Text Gene Mentions
Discussion)
…Of interest, a clinical study with citalopram, a 5‐HTT blocker that increases ambient 5‐HT levels for addressing agitation in AD patients, resulted in cognitive worsening.51…
Show Full Abstract
<h4>Background</h4>Many trials of amyloid-modulating agents fail to improve cognitive outcome in Alzheimer's disease despite substantial reduction of amyloid β levels.<h4>Methods</h4>We applied a mechanism-based Quantitative Systems Pharmacology model exploring the pharmacodynamic interactions of apolipoprotein E (APOE), Catechol -O -methyl Transferase (COMTVal158Met), and 5-HT transporter (5-HTTLPR) rs25531 genotypes and aducanumab.<h4>Results</h4>The model predicts large clinical variability. Anticipated placebo differences on Alzheimer's Disease Assessment Scale (ADAS)-COG in the aducanumab ENGAGE and EMERGE ranged from 0.77 worsening to 1.56 points improvement, depending on the genotype-comedication combination. 5-HTTLPR L/L subjects are found to be the most resilient. Virtual patient simulations suggest improvements over placebo between 4% and 20% at the 10 mg/kg dose, depending on the imbalance of the 5-HTTLPR genotype and exposure. In the Phase II PRIME trial, maximal anticipated placebo difference at 10 mg/kg ranges from 0.3 worsening to 5.3 points improvement.<h4>Discussion</h4>These virtual patient simulations, once validated against clinical data, could lead to better informed future clinical trial designs.
BACKGROUND Osteoarthritis (OA) is a common disorder in the elderly. OA influences the daily life of patients and has become a worldwide health problem. It is still unclear whether the pathogenesis mechanism is different between males and females. This study investigated the differentially expressed genes (DEGs) and explored the different signaling pathways of OA between males and females. MATERIAL AND METHODS Data sets of GSE55457, GSE55584, and GSE12021 were retrieved from Gene Expression Omnibus to conduct DEGs analysis. Enrichment analysis of Kyoto Encyclopedia of Genes and Genomes pathway and Gene Ontology term was performed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) bioinformatics tool. The protein interaction network was constructed in Cytoscape 3.7.2. qRT-PCR was then performed to validate the expression of hub genes in OA patients and healthy people. RESULTS In total, 4 co-upregulated and 10 co-downregulated genes were identified. We found that enriched pathways were different between males and females. BCL2L1, EEF1A1, EEF2, HNRNPD, and PABPN1 were considered as hub genes in OA pathogenesis in males, while EEF2, EEF1A1, RPL37A, FN1 were considered as hub genes in OA pathogenesis in females. Consistent with the bioinformatics analysis, the qRT-PCR analysis also showed that the gene expression of BCL2L1, HNRNPD, and PABPN1 was significantly lower in male OA patients. In contrast, EEF2, EEF1A1, and RPL37A were significantly lower in female OA patients. CONCLUSIONS The DEGs identified may be involved in different OA disease progression mechanisms between males and females, and they are considered as treatment targets or prognosis markers for males and females. The pathogenesis mechanism is sex-dependent.
Also flagged:microcytic anaemiaretinal degenerationdiabetes mellitusaceruloplasminaemiahepatopathyceruloplasmin
Journal Article2020-04-07✓ 1 SnippetOndrejkovičová M, Dražilová S, Drakulová M, Siles JL, Zemjarová Mezenská R, Jungová P, Fabián M, Rychlý B, Žigrai M.
In-Text Gene Mentions
I A O 0000613)
…mutations in theHFEgene and 4…
Show Full Abstract
<h4>Background</h4>Aceruloplasminaemia is a very rare autosomal recessive disorder caused by a mutation in the ceruloplasmin gene, which is clinically manifested by damage to the nervous system and retinal degeneration. This classical clinical picture can be preceded by diabetes mellitus and microcytic anaemia, which are considered to be early manifestations of aceruloplasminaemia.<h4>Case presentation</h4>In our report, we describe the case of a patient with aceruloplasminaemia detected in an early stage (without clinical symptoms of damage to the nervous system) during the search for the cause of hepatopathy with very low values of serum ceruloplasmin. Molecular genetic examination of the CP gene for ceruloplasmin identified a new variant c.1664G > A (p.Gly555Glu) in the homozygous state, which has not been published in the literature or population frequency databases to date. Throughout the 21-month duration of chelatase treatment, the patient, who is 43 years old, continues to be without neurological and psychiatric symptomatology. We observed a decrease in the serum concentration of ferritin without a reduction in iron deposits in the brain on magnetic resonance imaging.<h4>Conclusion</h4>Currently, there is no unequivocal recommendation of an effective treatment for aceruloplasminaemia. Early diagnosis is important in the neurologically asymptomatic stage.
<h4>Background</h4>Multiple epiphyseal dysplasia (MED) is a common skeletal dysplasia that is characterized by variable degrees of epiphyseal abnormality primarily involving the hip and knee joints. Mutations in a gene encoding matrilin-3 (MATN3) have been reported as disease causing of autosomal dominant MED. The current study identified a novel c.572 C > A variant (p.A191D) in exon 2 of MATN3 in a Vietnamese family with MED.<h4>Case presentation</h4>A standard clinical tests and radiological examination were performed in an 8-year-old Vietnamese girl patient. The clinical examination showed that patient height was under average, with bent lower limbs, limited mobility and dislocation of the joints at both knees. Radiological documentation revealed abnormal cartilage development at the epiphysis of the femur and patella. The patient has a varus deformity of the lower limbs. The patient was diagnosed with autosomal dominant MED using molecular testing in the order of the coding sequences and flanking sequences of five genes: COMP (exons 8-19), MATN3 (exon 2), COL9A2 (exon 3), COL9A3 (exon 3), COL9A1 (exon 8) by Sanger sequencing. A novel heterozygous missense variant (c.572 C > A, p.A191D) in MATN3 was identified in this family, which were not inherited from parents. The p.A191D was predicted and classified as a pathogenic variant. When the two predicted structures of the wild type and mutant matrilin-3 were compared, the p.A191D substitution caused conformational changes near the substitution site, resulting in deformity of the β-sheet of the single A domain of matrilin- 3.<h4>Conclusions</h4>This is the first Vietnamese MED family attributed to p.A191D matrilin-3 variant, and our clinical, radiological and molecular data suggest that the novel de novo missense variant in MATN3 contributed to MED.
Also flagged:pathogenesisneurodegenerative disordersneurodegenerative diseaseHDα-synucleinPD
Journal Article2020-04-07✓ 5 SnippetsWu YY, Kuo HC.
In-Text Gene Mentions
Introduction)
…Since miR-125b and miR-150 target p53, which regulates expression of the p65 subunit of NFκB (RelA/NFκB) and miR-146a, the regulatory mechanisms of miRNA-146a-, 125b- and 150-dependent HTT expression have been further linked to apoptosis in HD [41].…
Introduction)
…We also summarize the current knowledge of how ncRNAs may affect disease-relevant mechanisms, such as HTT aggregation in HD (Fig. 1), α-synuclein aggregation in PD (Fig. 2), amyloid-β secretion and pTau accumulation in AD (Figs. 3 and 4).…
Introduction)
…In another example, the level of miR-132 is associated with Ago2-dependent HTT clearance in animal models of HD, and supplementation with miR-132 improves motor function and lifespan in an HD mouse [45, 56].…
Introduction)
…the hungtingtin (HTT) gene.…
Introduction)
…RNA derived fromHTT, regulates mHTT…
Show Full Abstract
Recent transcriptome analyses have revealed that noncoding RNAs (ncRNAs) are broadly expressed in mammalian cells and abundant in the CNS, with tissue and cell type-specific expression patterns. Moreover, ncRNAs have been found to intricately and dynamically regulate various signaling pathways in neurodegeneration. As such, some antisense transcripts and microRNAs are known to directly affect neurodegeneration in disease contexts. The functions of ncRNAs in pathogenesis are unique for each disorder, as are the pertinent networks of ncRNA/miRNA/mRNA that mediate these functions. Thus, further understanding of ncRNA biogenesis and effects might aid the discovery of diagnostic biomarkers or development of effective therapeutics for neurodegenerative disorders. Here, we review the ncRNAs that have so far been identified in major neurodegenerative disease etiology and the mechanisms that link ncRNAs with disease-specific phenotypes, such as HTT aggregation in HD, α-synuclein in PD, and Aβ plaques and hyperphosphorylated Tau in AD. We also summarize the known lncRNA/miRNA/mRNA networks that participate in neurodegenerative diseases, and we discuss ncRNA-related treatments shown to delay disease onset and prolong lifespan in rodent models.
The receptor deleted in colorectal cancer (DCC) and its ligand netrin-1 are essential for axon guidance during development and are expressed by neurons in the mature brain. Netrin-1 recruits GluA1-containing α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptors (AMPARs) and is critical for long-term potentiation (LTP) at CA3-CA1 hippocampal Schaffer collateral synapses, while conditional DCC deletion from glutamatergic neurons impairs hippocampal-dependent spatial memory and severely disrupts LTP induction. DCC co-fractionates with the detergent-resistant component of postsynaptic density, yet is enriched in axonal growth cones that differentiate into presynaptic terminals during development. Specific presynaptic and postsynaptic contributions of DCC to the function of mature neural circuits have yet to be identified. Employing hippocampal subregion-specific conditional deletion of DCC, we show that DCC loss from CA1 hippocampal pyramidal neurons resulted in deficits in spatial memory, increased resting membrane potential, abnormal dendritic spine morphology, weaker spontaneous excitatory postsynaptic activity, and reduced levels of postsynaptic adaptor and signaling proteins; however, the capacity to induce LTP remained intact. In contrast, deletion of DCC from CA3 neurons did not induce detectable changes in the intrinsic electrophysiological properties of CA1 pyramidal neurons, but impaired performance on the novel object place recognition task as well as compromised excitatory synaptic transmission and LTP at Schaffer collateral synapses. Together, these findings reveal specific pre- and post-synaptic contributions of DCC to hippocampal synaptic plasticity underlying spatial memory.
Also flagged:methylationrheumatoid arthritisRAMHCcell surfacehypomethylation
Journal Article2020-04-07No SnippetsPitaksalee R, Burska AN, Ajaib S, Rogers J, Parmar R, Mydlova K, Xie X, Droop A, Nijjar JS, Chambers P, Emery P, Hodgett R, McInnes IB, Ponchel F.
Show Full Abstract
<h4>Background</h4>The genetic risk associated with rheumatoid arthritis (RA) includes genes regulating DNA methylation, one of the hallmarks of epigenetic re-programing, as well as many T-cell genes, with a strong MHC association, pointing to immunogenetic mechanisms as disease triggers leading to chronicity. The aim of our study was to explore DNA methylation in early, drug-naïve RA patients, towards a better understanding of early events in pathogenesis.<h4>Result</h4>Monocytes, naïve and memory CD4<sup>+</sup> T-cells were sorted from 6 healthy controls and 10 RA patients. DNA methylation was assessed using a genome-wide Illumina 450K CpG promoter array. Differential methylation was confirmed using bisulfite sequencing for a specific gene promoter, ELISA for several cytokines and flow cytometry for cell surface markers. Differentially methylated (DM) CpGs were observed in 1047 genes in naïve CD4<sup>+</sup> T-cells, 913 in memory cells and was minimal in monocytes with only 177 genes. Naive CD4<sup>+</sup> T-cells were further investigated as presenting differential methylation in the promoter of > 500 genes associated with several disease-relevant pathways, including many cytokines and their receptors. We confirmed hypomethylation of a region of the TNF-alpha gene in early RA and differential expression of 3 cytokines (IL21, IL34 and RANKL). Using a bioinformatics package (DMRcate) and an in-house analysis based on differences in β values, we established lists of DM genes between health and RA. Publicly available gene expression data were interrogated to confirm differential expression of over 70 DM genes. The lists of DM genes were further investigated based on a functional relationship database analysis, which pointed to an IL6/JAK1/STAT3 node, related to TNF-signalling and engagement in Th17 cell differentiation amongst many pathways. Five DM genes for cell surface markers (CD4, IL6R, IL2RA/CD25, CD62L, CXCR4) were investigated towards identifying subpopulations of CD4<sup>+</sup> T-cells undergoing these modifications and pointed to a subset of naïve T-cells, with high levels of CD4, IL2R, and CXCR4, but reduction and loss of IL6R and CD62L, respectively.<h4>Conclusion</h4>Our data provided novel conceptual advances in the understanding of early RA pathogenesis, with implications for early treatment and prevention.
Also flagged:alkaloids(IL)-6nitric oxide synthaseiNOScyclooxygenaselipopolysaccharide
Journal Article2020-04-07No SnippetsCheng JT, Guo C, Cui WJ, Zhang Q, Wang SH, Zhao QH, Liu DW, Zhang J, Chen S, Chen C, Liu Y, Pan ZH, Liu A.
Show Full Abstract
Two rare N-β-D-glucopyranosyl-1H-indole-3-acetic acid conjugates, N-[2-(1-β-D-glucopyranosyl)-1H-indol-3-yl)acetyl]-L-glutamic acid (1) and N-[2-(1-β-D-glucopyranosyl)-1H-indol-3-yl)acetyl]-L-aspartic acid (2) were isolated from Ginkgo biloba. The structures were elucidated by analyses of HRMS and NMR spectroscopic data. In addition, a simplified and efficient synthetic route for compounds 1 and 2 is also disclosed to determine the absolute configurations of them. This concise syntheses of compounds 1 and 2 may facilitate studies of the biology of this type alkaloids. Compounds 1 and 2 were also tested for their cytotoxic and anti-inflammatory activities. The biological evaluation showed that compounds 1 and 2 led to the decrease of interleukin (IL)-6, nitric oxide synthase (iNOS) and cyclooxygenase (COX)-2 at mRNA level in lipopolysaccharide (LPS)-stimulated murine macrophage RAW264.7 cells.
Also flagged:SHOX2lung cancermethylationcancerEGFRgene expression
Journal Article2020-04-07No SnippetsLi N, Zeng Y, Huang J.
Show Full Abstract
<h4>Background</h4>An increasing number of studies have focused on the early diagnostic value of the methylation of RASSF1A and SHOX2 in lung cancer. However, the intricate cellular events related to RASSF1A and SHOX2 in lung cancer are still a mystery. For researchers and clinicians aiming to more profoundly understand the diagnostic value of methylated RASSF1A and SHOX2 in lung cancer, this review will provide deeper insights into the molecular events of RASSF1A and SHOX2 in lung cancer.<h4>Methodology</h4>We searched for relevant publications in the PubMed and Google Scholar databases using the keywords "RASSF1A", "SHOX2" and "lung cancer" etc. First, we reviewed the RASSF1A and SHOX2 genes, from their family structures to the functions of their basic structural domains. Then we mainly focused on the roles of RASSF1A and SHOX2 in lung cancer, especially on their molecular events in recent decades. Finally, we compared the value of measuring RASSF1A and SHOX2 gene methylation with that of the common methods for the diagnosis of lung cancer patients.<h4>Results</h4>The RASSF1A and SHOX2 genes were confirmed to be regulators or effectors of multiple cancer signaling pathways, driving tumorigenesis and lung cancer progression. The detection of RASSF1A and SHOX2 gene methylation has higher sensitivity and specificity than other commonly used methods for diagnosing lung cancer, especially in the early stage.<h4>Conclusions</h4>The RASSF1A and SHOX2 genes are critical for the processes of tumorigenesis, development, metastasis, drug resistance, and recurrence in lung cancer. The combined detection of RASSF1A and SHOX2 gene methylation was identified as an excellent method for the screening and surveillance of lung cancer that exhibits high sensitivity and specificity.
Also flagged:chaperoninCCTchaperonesmall heat shock proteinsproteostasisaging
Journal Article2020-04-07✓ 1 SnippetVonk WIM, Rainbolt TK, Dolan PT, Webb AE, Brunet A, Frydman J.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Neural stem and progenitor cells (NSPCs) are critical for continued cellular replacement in the adult brain. Lifelong maintenance of a functional NSPC pool necessitates stringent mechanisms to preserve a pristine proteome. We find that the NSPC chaperone network robustly maintains misfolded protein solubility and stress resilience through high levels of the ATP-dependent chaperonin TRiC/CCT. Strikingly, NSPC differentiation rewires the cellular chaperone network, reducing TRiC/CCT levels and inducing those of the ATP-independent small heat shock proteins (sHSPs). This switches the proteostasis strategy in neural progeny cells to promote sequestration of misfolded proteins into protective inclusions. The chaperone network of NSPCs is more effective than that of differentiated cells, leading to improved management of proteotoxic stress and amyloidogenic proteins. However, NSPC proteostasis is impaired by brain aging. The less efficient chaperone network of differentiated neural progeny may contribute to their enhanced susceptibility to neurodegenerative diseases characterized by aberrant protein misfolding and aggregation.
Also flagged:NEAT1acute myeloid leukemianuclear enriched abundant transcript 1polymeraseCell growthbromide
Journal Article2020-04-07✓ 1 SnippetFeng S, Liu N, Chen X, Liu Y, An J.
In-Text Gene Mentions
Discussion)
…AndMRPL39hindered the progression…
Show Full Abstract
<h4>Background</h4>Acute myeloid leukemia (AML) is a heterogeneous hematological disease. Our purpose of the research was to investigate the regulatory influence of long non-coding RNA (lncRNA) nuclear enriched abundant transcript 1 (NEAT1)/microRNA-338-3p (miR-338-3p)/CREB3 regulatory factor (CREBRF) in AML progression.<h4>Methods</h4>The associated RNA and protein levels were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot, respectively. Cell growth was assessed through colony formation assay and 3-(4,5-dimethylthiazol-2-y1)-2, 5-diphenyl tetrazolium bromide (MTT) assay. Flow cytometry was exploited to determine the apoptosis rate. Cell migration and invasion were detected by transwell assay. The combination of miR-338-3p and NEAT1 or CREBRF was analyzed via the dual-luciferase reporter assay.<h4>Results</h4>NEAT1 and CREBRF were down-regulated in AML tissues and cells. NEAT1 up-regulation suppressed cell growth, migration and invasion but enhanced apoptosis of AML cells. Inhibition of CREBRF reverted the NEAT1-induced effects on AML cells. Moreover, NEAT1 directly targeted miR-338-3p and miR-338-3p targeted CREBRF. NEAT1/miR-338-3p could affect cellular behaviors of AML cells via the modulation of CREBRF.<h4>Conclusion</h4>NEAT1/miR-338-3p axis repressed the AML progression through regulating CREBRF, which might afford a favorable perspective for the AML treatment molecularly.
Also flagged:IL-2tumorimmune responsesCbl-bE3 ubiquitin ligasecytokine
Journal Article2020-04-07No SnippetsHan S, Chung DC, St Paul M, Liu ZQ, Garcia-Batres C, Elford AR, Tran CW, Chapatte L, Ohashi PS.
Show Full Abstract
Regulatory T cells are integral to the regulation of autoimmune and anti-tumor immune responses. However, several studies have suggested that changes in T cell signaling networks can result in T cells that are resistant to the suppressive effects of regulatory T cells. Here, we investigated the role of Cbl-b, an E3 ubiquitin ligase, in establishing resistance to Treg-mediated suppression. We found that the absence of Cbl-b, a negative regulator of multiple TCR signaling pathways, rendered T cells impartial to Treg suppression by regulating cytokine networks leading to improved anti-tumor immunity despite the presence of Treg cells in the tumor. Specifically, Cbl-b KO CD4<sup>+</sup>FoxP3<sup>-</sup> T cells hyper-produced IL-2 and together with IL-2 Rα upregulation served as an essential mechanism to escape suppression by Treg cells. Furthermore, we report that IL-2 serves as the central molecule required for cytokine-induced Treg resistance. Collectively our data emphasize the role of IL-2 as a key mechanism that renders CD4<sup>+</sup> T cells resistant to the inhibitory effects of Treg cells.
Also flagged:DepressionKetamineaffective disorderN-methyl-D-aspartate receptorNMDARphosphorylation
Journal Article2020-04-07✓ 1 SnippetXiao Y, Luo H, Yang WZ, Zeng Y, Shen Y, Ni X, Shi Z, Zhong J, Liang Z, Fu X, Tu H, Sun W, Shen WL, Hu J, Yang J.
In-Text Gene Mentions
Results)
…(T1888; S2153) andPlcl1(S570) were up-regulated…
Show Full Abstract
Depression is a common affective disorder characterized by significant and persistent low mood. Ketamine, an N-methyl-D-aspartate receptor (NMDAR) antagonist, is reported to have a rapid and durable antidepressant effect, but the mechanisms are unclear. Protein phosphorylation is a post-translational modification that plays a crucial role in cell signaling. Thus, we present a phosphoproteomics approach to investigate the mechanisms underlying stress-induced depression and the rapid antidepressant effect of ketamine in mice. We analyzed the phosphoprotein changes induced by chronic unpredictable mild stress (CUMS) and ketamine treatment in two known mood control centers, the medial prefrontal cortex (mPFC) and the nucleus accumbens (NAc). We initially obtained >8,000 phosphorylation sites. Quantitation revealed 3,988 sites from the mPFC and 3,196 sites from the NAc. Further analysis revealed that changes in synaptic transmission-related signaling are a common feature. Notably, CUMS-induced changes were reversed by ketamine treatment, as shown by the analysis of commonly altered sites. Ketamine also induced specific changes, such as alterations in synapse organization, synaptic transmission, and enzyme binding. Collectively, our findings establish a signaling framework for stress-induced depression and the rapid antidepressant effect of ketamine.
Also flagged:small nucleolar RNA host genescancersSNHG1SNHG3SNHG6SNHG7
Journal Article2020-04-07✓ 1 SnippetZimta AA, Tigu AB, Braicu C, Stefan C, Ionescu C, Berindan-Neagoe I.
In-Text Gene Mentions
Introduction)
…protein coding geneZnfx1(zinc finger NFX-1-type…
Show Full Abstract
The small nucleolar RNA host genes (SNHGs) are a group of long non-coding RNAs, which are reported in many studies as being overexpressed in various cancers. With very few exceptions, the SNHGs (SNHG1, SNHG3, SNHG5, SNHG6, SNHG7, SNHG12, SNHG15, SNHG16, SNHG20) are recognized as inducing increased proliferation, cell cycle progression, invasion, and metastasis of cancer cells, which makes this class of transcripts a viable biomarker for cancer development and aggressiveness. Through our literature research, we also found that silencing of SNHGs through small interfering RNAs or short hairpin RNAs is very effective in both <i>in vitro</i> and <i>in vivo</i> experiments by lowering the aggressiveness of solid cancers. The knockdown of SNHG as a new cancer therapeutic option should be investigated more in the future.
Also flagged:Cytochrome Oxidase Icytochrome c oxidase subunit ICOInucleotidepollinationcytochrome c oxidase I
Journal Article2020-04-07No SnippetsLombogia CA, Posangi J, Pollo HN, Tulung M, Tallei TE.
Show Full Abstract
Asian cavity-nesting honey bee <i>Apis nigrocincta</i>, a native bee species from Sulawesi and the Philippines, plays a vital role in pollinating flowering plants in local ecosystem and agriculture. In this study, we assessed the intraspecific genetic variation of <i>A. nigrocincta</i> using the sequence of cytochrome c oxidase subunit I (COI). Molecular phylogenetic analysis showed that there were three main clades in <i>A. nigrocincta</i> specimens from Sulawesi based on their respective locations (North, Central, and South Sulawesi). Genetic distance analysis using the Kimura 2-parameter (K2P) model showed that the intraspecific genetic distance in Sulawesi specimens ranged from 0.000 to 0.055. There are 26 nucleotide polymorphic sites within Sulawesi <i>A. nigrocincta</i>. The variation was dominated by transition T ↔ C. The molecular identification result was supported by morphological identification. The results of the two methods agree that the specimen under study was <i>A. nigrocincta</i>. The result of genetic distance calculation indicated that although the tested specimens were derived from remote locations, the genetic variation was still within the range of intraspecific variation.
Also flagged:Lung AdenocarcinomaLung cancercancerLUADtumorhuman leukocyte antigen
Journal Article2020-04-07No SnippetsXu F, Chen JX, Yang XB, Hong XB, Li ZX, Lin L, Chen YS.
Show Full Abstract
Lung cancer is the most common cause of cancer deaths worldwide, and lung adenocarcinoma (LUAD) is the most common histological subtype. However, the prognostic and predictive outcomes differ because of this cancer type heterogeneity. LUAD subtypes were identified on the basis of the immunogenomic profiling of 29 immune signatures. We named three LUAD subtypes: Immunity High, Immunity Medium, and Immunity Low. The Immunity High subtype was characterized by immune activation, e.g., increased immune scores, elevated stromal scores and the highest infiltration of CD8<sup>+</sup> T cells, and decreased tumor purities. Activated expressions of human leukocyte antigen (HLA) genes, immune checkpoint molecules, and T helper 1 (Th1)/interferon-gamma (IFNγ) gene signature were also observed in the Immunity High subtype. <i>N</i> <sup>6</sup>-methyladenosine (m<sup>6</sup>A) RNA methylation, associated with cancer initiation and progression, was reduced in the Immunity High subtype. Functional and signaling pathway enrichment analysis further showed that differentially expressed genes between the Immunity High subtype and the other subtypes mainly participated in immune response and some cancer-associated pathways. In addition, the Immunity High subtype exhibited more sensitivity to immunotherapy and chemotherapy. Finally, candidate compounds that aimed at LUAD subtype differentiation were identified. Comprehensively characterizing the LUAD subtypes based on immune signatures may help to provide potential strategies for LUAD treatment.
<b>Background and Aims</b>: Extrahepatic cholangiocarcinoma (CCA) without liver-fluke is increasing. Multifactorial carcinogenesis makes it hard to find biomarkers related to CCA. Although there are a few studies of bile proteomics, these showed different protein profiles because of having heterogeneous groups of patients and different sampling methods. Our aim was to identify the specific bile proteins of extrahepatic CCA patients. <b>Methods</b>: We collected bile from 23 patients undergoing endoscopic nasobiliary drainage in Korea University Guro Hospital from May 2018 to January 2019. The CCA group included 18 patients diagnosed with extrahepatic CCA, and the control group included 5 patients with benign biliary conditions. We analyzed bile proteome using liquid chromatography mass spectrometry. We compared the relative abundance of various proteins in the CCA and control groups. <b>Results</b>: In all, we identified a total of 245 proteins in the bile of CCA and control patients. Increased top 14 proteins in CCA patients were immunoglobulin kappa light chain, apolipoprotein B, inter-alpha-trypsin inhibitor heavy chain H4, apolipoprotein E, Mucin 5B, inter-alpha-trypsin inhibitor heavy chain H1, apolipoprotein A-IV, intercellular adhesion molecule 1, complement C7, complement C5, apolipoprotein C-III, albumin, antithrombin-III, and apolipoprotein A-II. However, the significantly increased proteins in bile of CCA patients comparing with control patients were immunoglobulin kappa light chain, apolipoprotein E, albumin, apolipoprotein A-I, antithrombin-III, α1-antitrypsin, serotransferrin, immunoglobulin heavy constant mu, immunoglobulin J chain, complement C4-A, and complement C3 (p<0.05). <b>Conclusions</b>: In this study, we identified several proteins that were significantly increased in the bile of extrahepatic CCA. Further study is needed to validate them as potential tumor-associated proteins that may be potential biomarkers for CCA.
Also flagged:Ferritinthalassemiaalanine aminotransferaseALTaspartate aminotransferaseAST
Journal Article2020-04-07✓ 1 SnippetAl-Moshary M, Imtiaz N, Al-Mussaed E, Khan A, Ahmad S, Albqami S.
In-Text Gene Mentions
Methods)
…(e.g., hepatitis andhemochromatosis) or having acute…
Show Full Abstract
Aims The aim of our study was to correlate liver function tests with serum ferritin levels in multi-transfused thalassemia patients. Methods This was a descriptive cross-sectional study conducted in the department of hematology, Khyber Medical University, from January 2018 to December 2018. Thalassemia patients of either sex dependent on transfusion ≥ 1 year and having a confirmatory report of the disease were included in our study. The nonprobability convenience sampling technique was used. The Pearson correlation coefficient was applied to observe the correlation between serum ferritin level and liver function tests. A p-value of ≤0.05 was considered statistically significant. SPSS version 23 (SPSS Inc., Chicago, Illinois) was used for data analysis. Results A total of 138 subjects of age range 2-23 years, with a mean age of 12.08 ± 6.02 years, were included in our study. The mean serum ferritin of patients in our study was 3278.64 ng/ml with the lowest of 285.2 ng/mL and the highest of 10940.2 ng/ml. With the increase in serum ferritin levels, a rapid increase in alanine aminotransferase (ALT), aspartate aminotransferase (AST), and alkaline phosphatase (ALP) levels was seen. When serum ferritin levels were correlated with total bilirubin level, the bilirubin level remains static with a further increase in serum ferritin levels. Conclusion It was deduced that iron deposition is the ultimate reason for increased liver enzymes. There was a positive correlation between serum ferritin and ALT, AST, and ALP while a weak connection was found between serum ferritin and bilirubin levels.
Also flagged:reproductionantibodygene expressionnitrogenVTG2NELL2
Journal Article2020-04-07No SnippetsPick JL, Hatakeyama M, Ihle KE, Gasparini J, Haussy C, Ishishita S, Matsuda Y, Yoshimura T, Kanaoka MM, Shimizu-Inatsugi R, Shimizu KK, Tschirren B.
Show Full Abstract
The trade-off between reproduction and self-maintenance is a cornerstone of life history theory, yet its proximate underpinnings are elusive. Here, we used an artificial selection approach to create replicated lines of Japanese quail (<i>Coturnix japonica</i>) that differ genetically in their reproductive investment. Whole transcriptome sequencing revealed that females from lines selected for high reproductive output show a consistent upregulation of genes associated with reproduction but a simultaneous downregulation of immune genes. Concordant phenotypic differences in immune function (i.e., specific antibody response against keyhole limpet hemocyanin) were observed between the selection lines, even in males who do not provide parental care. Our findings demonstrate the key role of obligate transcriptional constraints in the maintenance of life history variation. These constraints set fundamental limits to productivity and health in natural and domestic animal populations.
Also flagged:GRP94glucose-regulated protein 94cancersCytosineAdenosinesilica
Journal Article2020-04-06✓ 1 SnippetPechalrieu D, Assemat F, Halby L, Marcellin M, Yan P, Chaoui K, Sharma S, Chiosis G, Burlet-Schiltz O, Arimondo PB, Lopez M.
In-Text Gene Mentions
I A O 0000326)
…Ca10…
Show Full Abstract
We synthesized affinity-based chemical probes of cytosine-adenosine bisubstrate analogs and identified several potential targets by proteomic analysis. The validation of the proteomic analysis identified the chemical probe as a specific inhibitor of glucose-regulated protein 94 (GRP94), a potential drug target for several types of cancers. Therefore, as a result of the use of bisubstrate-type chemical probes and a chemical-biology methodology, this work opens the way to the development of a new family of GRP94 inhibitors that could potentially be of therapeutic interest.
Also flagged:bladder cancertumorcancermuscle‐invasive bladder cancernonmuscle invasive bladder cancerNMIBC
Journal Article2020-04-06No SnippetsShen C, Wu Z, Wang Y, Gao S, Da, Xie L, Qie Y, Tian D, Hu H.
Show Full Abstract
Growing evidence has indicated that circular RNAs (circRNAs) play crucial roles in multiple biological processes. However, alterations in circRNA profiles during bladder cancer progression and the clinical significance thereof remain unclear. Therefore, high-throughput RNA sequencing was conducted to identify circRNA and mRNA profiles in five pairs of bladder cancer tissues and adjacent noncancerous tissues. A total of 87 differentially expressed circRNAs and 2756 mRNAs were detected in above bladder cancer samples compared with paired noncancerous samples. Functional enrichment analyses, circRNA-microRNA-mRNA, and protein-protein interaction networks revealed that these dysregulated circRNAs were potentially involved in carcinogenesis and evolution of bladder cancer. Subsequently, the differential expression of eight circRNAs was detected by real-time qPCR. Hsa_circ_0003141 and hsa_circ_0008039 were significantly upregulated as well as hsa_circ_0026782, hsa_circ_0077837, hsa_circ_0004826, and hsa_circ_0001946 were significantly downregulated among validation of 70 matched bladder cancer tissues (≥75%). Moreover, hsa_circ_0077837 and hsa_circ_0004826 were also verified as markedly downregulated in four bladder cancer cells (100%). Naturally, hsa_circ_0077837 and hsa_circ_0004826 were also demonstrated using RNase-R+ resistance experiments. In addition, Fisher's exact test, Kaplan-Meier plots, Cox regression analyses, and receiver operating characteristic curve was performed to assess their clinical value. Downregulation of hsa_circ_0077837 and hsa_circ_0004826 all was significantly correlated with worse clinicopathological features and poor prognosis of bladder cancer patients. The area under the receiver operating characteristic curve of them was 0.775 (P < .0001) and 0.790 (P < .0001), respectively. Not surprisingly, in vitro functional experiments also demonstrated that the overexpression of hsa_circ_0077837 and hsa_circ_0004826 significantly weakened the proliferation, migration, and invasion of bladder cancer cells. Overall, hsa_circ_0077837 and hsa_circ_0004826 might act as tumor suppressors in the bladder cancer progression and serve as a potential biomarker for the diagnosis, prognosis, and therapy of bladder cancer.
Also flagged:cerebral infarctsbeta globindeathSilent cerebral infarctsCystic FibrosisGenetic Disorders
Journal Article2020-04-06No SnippetsEstcourt LJ, Kimber C, Hopewell S, Trivella M, Doree C, Abboud MR.
Show Full Abstract
<h4>Background</h4>Sickle cell disease (SCD) is one of the commonest severe monogenic disorders in the world, due to the inheritance of two abnormal haemoglobin (beta globin) genes. SCD can cause severe pain, significant end-organ damage, pulmonary complications, and premature death. Silent cerebral infarcts are the commonest neurological complication in children and probably adults with SCD. Silent cerebral infarcts also affect academic performance, increase cognitive deficits and may lower intelligence quotient.<h4>Objectives</h4>To assess the effectiveness of interventions to reduce or prevent silent cerebral infarcts in people with SCD.<h4>Search methods</h4>We searched for relevant trials in the Cochrane Library, MEDLINE (from 1946), Embase (from 1974), the Transfusion Evidence Library (from 1980), and ongoing trial databases; all searches current to 14 November 2019. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Trials Register: 07 October 2019.<h4>Selection criteria</h4>Randomised controlled trials comparing interventions to prevent silent cerebral infarcts in people with SCD. There were no restrictions by outcomes examined, language or publication status.<h4>Data collection and analysis</h4>We used standard Cochrane methodological procedures.<h4>Main results</h4>We included five trials (660 children or adolescents) published between 1998 and 2016. Four of the five trials were terminated early. The vast majority of participants had the haemoglobin (Hb)SS form of SCD. One trial focused on preventing silent cerebral infarcts or stroke; three trials were for primary stroke prevention and one trial dealt with secondary stroke prevention. Three trials compared the use of regular long-term red blood cell transfusions to standard care. Two of these trials included children with no previous long-term transfusions: one in children with normal transcranial doppler (TCD) velocities; and one in children with abnormal TCD velocities. The third trial included children and adolescents on long-term transfusion. Two trials compared the drug hydroxyurea and phlebotomy to long-term transfusions and iron chelation therapy: one in primary prevention (children), and one in secondary prevention (children and adolescents). The quality of the evidence was moderate to very low across different outcomes according to GRADE methodology. This was due to trials being at high risk of bias because they were unblinded; indirectness (available evidence was only for children with HbSS); and imprecise outcome estimates. Long-term red blood cell transfusions versus standard care Children with no previous long-term transfusions and higher risk of stroke (abnormal TCD velocities or previous history of silent cerebral infarcts) Long-term red blood cell transfusions may reduce the incidence of silent cerebral infarcts in children with abnormal TCD velocities, risk ratio (RR) 0.11 (95% confidence interval (CI) 0.02 to 0.86) (one trial, 124 participants, low-quality evidence); but make little or no difference to the incidence of silent cerebral infarcts in children with previous silent cerebral infarcts on magnetic resonance imaging and normal or conditional TCDs, RR 0.70 (95% CI 0.23 to 2.13) (one trial, 196 participants, low-quality evidence). No deaths were reported in either trial. Long-term red blood cell transfusions may reduce the incidence of: acute chest syndrome, RR 0.24 (95% CI 0.12 to 0.49) (two trials, 326 participants, low-quality evidence); and painful crisis, RR 0.63 (95% CI 0.42 to 0.95) (two trials, 326 participants, low-quality evidence); and probably reduces the incidence of clinical stroke, RR 0.12 (95% CI 0.03 to 0.49) (two trials, 326 participants, moderate-quality evidence). Long-term red blood cell transfusions may improve quality of life in children with previous silent cerebral infarcts (difference estimate -0.54; 95% confidence interval -0.92 to -0.17; one trial; 166 participants), but may have no effect on cognitive function (least squares means: 1.7, 95% CI -1.1 to 4.4) (one trial, 166 participants, low-quality evidence). Transfusions continued versus transfusions halted: children and adolescents with normalised TCD velocities (79 participants; one trial) Continuing red blood cell transfusions may reduce the incidence of silent cerebral infarcts, RR 0.29 (95% CI 0.09 to 0.97 (low-quality evidence). We are very uncertain whether continuing red blood cell transfusions has any effect on all-cause mortality, Peto odds ratio (OR) 8.00 (95% CI 0.16 to 404.12); or clinical stroke, RR 0.22 (95% CI 0.01 to 4.35) (very low-quality evidence). The trial did not report: comparative numbers for SCD-related adverse events; quality of life; or cognitive function. Hydroxyurea and phlebotomy versus transfusions and chelation Primary prevention, children (121 participants; one trial) We are very uncertain whether switching to hydroxyurea and phlebotomy has any effect on: silent cerebral infarcts (no infarcts); all-cause mortality (no deaths); risk of stroke (no strokes); or SCD-related complications, RR 1.52 (95% CI 0.58 to 4.02) (very low-quality evidence). Secondary prevention, children and adolescents with a history of stroke (133 participants; one trial) We are very uncertain whether switching to hydroxyurea and phlebotomy has any effect on: silent cerebral infarcts, Peto OR 7.28 (95% CI 0.14 to 366.91); all-cause mortality, Peto OR 1.02 (95%CI 0.06 to 16.41); or clinical stroke, RR 14.78 (95% CI 0.86 to 253.66) (very low-quality evidence). Switching to hydroxyurea and phlebotomy may increase the risk of SCD-related complications, RR 3.10 (95% CI 1.42 to 6.75) (low-quality evidence). Neither trial reported on quality of life or cognitive function.<h4>Authors' conclusions</h4>We identified no trials for preventing silent cerebral infarcts in adults, or in children who do not have HbSS SCD. Long-term red blood cell transfusions may reduce the incidence of silent cerebral infarcts in children with abnormal TCD velocities, but may have little or no effect on children with normal TCD velocities. In children who are at higher risk of stroke and have not had previous long-term transfusions, long-term red blood cell transfusions probably reduce the risk of stroke, and other SCD-related complications (acute chest syndrome and painful crises). In children and adolescents at high risk of stroke whose TCD velocities have normalised, continuing red blood cell transfusions may reduce the risk of silent cerebral infarcts. No treatment duration threshold has been established for stopping transfusions. Switching to hydroxyurea with phlebotomy may increase the risk of silent cerebral infarcts and SCD-related serious adverse events in secondary stroke prevention. All other evidence in this review is of very low-quality.
Also flagged:Nicotinamide mononucleotide adenylyltransferaseTauphosphorylationAlzheimer's diseasetauopathiesMolecular chaperones
Journal Article2020-04-06No SnippetsMa X, Zhu Y, Lu J, Xie J, Li C, Shin WS, Qiang J, Liu J, Dou S, Xiao Y, Wang C, Jia C, Long H, Yang J, Fang Y, Jiang L, Zhang Y, Zhang S, Zhai RG, Liu C, Li D.
Show Full Abstract
Tau hyper-phosphorylation and deposition into neurofibrillary tangles have been found in brains of patients with Alzheimer's disease (AD) and other tauopathies. Molecular chaperones are involved in regulating the pathological aggregation of phosphorylated Tau (pTau) and modulating disease progression. Here, we report that nicotinamide mononucleotide adenylyltransferase (NMNAT), a well-known NAD<sup>+</sup> synthase, serves as a chaperone of pTau to prevent its amyloid aggregation in vitro as well as mitigate its pathology in a fly tauopathy model. By combining NMR spectroscopy, crystallography, single-molecule and computational approaches, we revealed that NMNAT adopts its enzymatic pocket to specifically bind the phosphorylated sites of pTau, which can be competitively disrupted by the enzymatic substrates of NMNAT. Moreover, we found that NMNAT serves as a co-chaperone of Hsp90 for the specific recognition of pTau over Tau. Our work uncovers a dedicated chaperone of pTau and suggests NMNAT as a key node between NAD<sup>+</sup> metabolism and Tau homeostasis in aging and neurodegeneration.
…AT protein is encoded by the SERPINC1 (serpin family C member 1) gene and consists of 432 amino acids, contains three disulfide bonds and four possible glucosylation sites.…
Title)
…New genetic variant in the SERPINC1 gene: hereditary Antithrombin deficiency case report, familial thrombosis and considerations on genetic counseling…
Abstract)
…Mutations in the serpin family C member 1 gene (SERPINC1) can lead to Quantitative (type I) and Qualitative (type II) types of antithrombin deficiency.…
Discussion)
…In our patient diagnosed with antithrombin deficiency we detected a new SERPINC1 variant – c.662 G > C (p.W221S).…
Discussion)
…Hereditary antithrombin deficiency is a monogenic disorder with no less than 220 pathogenic genetic [4] variants described in the SERPINC1 gene.…
Show Full Abstract
<h4>Background</h4>Inherited deficiency of the antithrombin (hereditary antithrombin deficiency, AT deficiency, OMIM #613118) is a relatively rare (1:2000-3000) autosomal-dominant disorder with high risk of venous thromboembolism. Mutations in the serpin family C member 1 gene (SERPINC1) can lead to Quantitative (type I) and Qualitative (type II) types of antithrombin deficiency. We describe a new genetic variant in the SERPINC1 gene and our approach to variant interpretation.<h4>Case presentation</h4>We observed a 29 y.o. female proband with the episode of venous thrombosis at the age of 18 and family history of thrombosis. The antithrombin level in our patient was low, 44-48% (AT deficiency type I). A new genetic variant c.662G > C (p.W221S) in the SERPINC1 gene was detected in proband and affected father but was absent in healthy sister. We used in silico tools to evaluate the possible impact of p.W221S variant on protein structure and function. In mutated SERPINC1 protein a new N-linked glycosylation site is formed, however, it is unclear if the glycosylation at 219-221 site is possible.<h4>Conclusion</h4>The proband was provided with appropriate genetic counseling and referred to a hematologist. Based on all the evidence we classify the p.W221S variant as variant of unknown clinical significance. In this paper we discuss some aspects of genetic counseling, variant interpretation and thromboembolic prophilaxis.
Also flagged:RNA binding proteinsRBPbindingnucleotidenucleuscytoplasm
Journal Article2020-04-06No SnippetsVan Nostrand EL, Pratt GA, Yee BA, Wheeler EC, Blue SM, Mueller J, Park SS, Garcia KE, Gelboin-Burkhart C, Nguyen TB, Rabano I, Stanton R, Sundararaman B, Wang R, Fu XD, Graveley BR, Yeo GW.
Show Full Abstract
<h4>Background</h4>A critical step in uncovering rules of RNA processing is to study the in vivo regulatory networks of RNA binding proteins (RBPs). Crosslinking and immunoprecipitation (CLIP) methods enable mapping RBP targets transcriptome-wide, but methodological differences present challenges to large-scale analysis across datasets. The development of enhanced CLIP (eCLIP) enabled the mapping of targets for 150 RBPs in K562 and HepG2, creating a unique resource of RBP interactomes profiled with a standardized methodology in the same cell types.<h4>Results</h4>Our analysis of 223 eCLIP datasets reveals a range of binding modalities, including highly resolved positioning around splicing signals and mRNA untranslated regions that associate with distinct RBP functions. Quantification of enrichment for repetitive and abundant multicopy elements reveals 70% of RBPs have enrichment for non-mRNA element classes, enables identification of novel ribosomal RNA processing factors and sites, and suggests that association with retrotransposable elements reflects multiple RBP mechanisms of action. Analysis of spliceosomal RBPs indicates that eCLIP resolves AQR association after intronic lariat formation, enabling identification of branch points with single-nucleotide resolution, and provides genome-wide validation for a branch point-based scanning model for 3' splice site recognition. Finally, we show that eCLIP peak co-occurrences across RBPs enable the discovery of novel co-interacting RBPs.<h4>Conclusions</h4>This work reveals novel insights into RNA biology by integrated analysis of eCLIP profiling of 150 RBPs with distinct functions. Further, our quantification of both mRNA and other element association will enable further research to identify novel roles of RBPs in regulating RNA processing.
The early life gut microbiota plays a crucial role in regulating and maintaining the intestinal barrier, with disturbances in these communities linked to dysregulated renewal and replenishment of intestinal epithelial cells. Here we sought to determine pathological cell shedding outcomes throughout the postnatal developmental period, and which host and microbial factors mediate these responses. Surprisingly, neonatal mice (Day 14 and 21) were highly refractory to induction of cell shedding after intraperitoneal administration of liposaccharide (LPS), with Day 29 mice showing strong pathological responses, more similar to those observed in adult mice. These differential responses were not linked to defects in the cellular mechanisms and pathways known to regulate cell shedding responses. When we profiled microbiota and metabolites, we observed significant alterations. Neonatal mice had high relative abundances of Streptococcus, Escherichia, and Enterococcus and increased primary bile acids. In contrast, older mice were dominated by Candidatus Arthromitus, Alistipes, and Lachnoclostridium, and had increased concentrations of SCFAs and methyamines. Antibiotic treatment of neonates restored LPS-induced small intestinal cell shedding, whereas adult fecal microbiota transplant alone had no effect. Our findings further support the importance of the early life window for microbiota-epithelial interactions in the presence of inflammatory stimuli and highlights areas for further investigation.
Journal Article2020-04-06✓ 1 SnippetLi Q, Sun Y, Jarugumilli GK, Liu S, Dang K, Cotton JL, Xiol J, Chan PY, DeRan M, Ma L, Li R, Zhu LJ, Li JH, Leiter AB, Ip YT, Camargo FD, Luo X, Johnson RL, Wu X, Mao J.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
Intestinal homeostasis is tightly regulated by complex yet poorly understood signaling networks. Here, we demonstrate that Lats1/2, the core Hippo kinases, are essential to maintain Wnt pathway activity and intestinal stem cells. Lats1/2 deletion leads to loss of intestinal stem cells but drives Wnt-uncoupled crypt expansion. To explore the function of downstream transcriptional enhanced associate domain (TEAD) transcription factors, we identified a selective small-molecule reversible inhibitor of TEAD auto-palmitoylation that directly occupies its lipid-binding site and inhibits TEAD-mediated transcription in vivo. Combining this chemical tool with genetic and proteomics approaches, we show that intestinal Wnt inhibition by Lats deletion is Yes-associated protein (YAP)/transcriptional activator with PDZ-binding domain (TAZ) dependent but TEAD independent. Mechanistically, nuclear YAP/TAZ interact with Groucho/Transducin-Like Enhancer of Split (TLE) to block Wnt/T-cell factor (TCF)-mediated transcription, and dual inhibition of TEAD and Lats suppresses Wnt-uncoupled Myc upregulation and epithelial over-proliferation in Adenomatous polyposis coli (APC)-mutated intestine. Our studies highlight a pharmacological approach to inhibit TEAD palmitoylation and have important implications for targeting Wnt and Hippo signaling in human malignancies.
Also flagged:Cohesinreplication forkcentromereschromosomesTopoisomerase IIreplicative helicase
Journal Article2020-04-06✓ 1 SnippetMinchell NE, Keszthelyi A, Baxter J.
In-Text Gene Mentions
Results)
…Condensindepletion also suppressed…
Show Full Abstract
DNA topological stress inhibits DNA replication fork (RF) progression and contributes to DNA replication stress. In Saccharomyces cerevisiae, we demonstrate that centromeric DNA and the rDNA array are especially vulnerable to DNA topological stress during replication. The activity of the SMC complexes cohesin and condensin are linked to both the generation and repair of DNA topological-stress-linked damage in these regions. At cohesin-enriched centromeres, cohesin activity causes the accumulation of DNA damage, RF rotation, and pre-catenation, confirming that cohesin-dependent DNA topological stress impacts on normal replication progression. In contrast, at the rDNA, cohesin and condensin activity inhibit the repair of damage caused by DNA topological stress. We propose that, as well as generally acting to ensure faithful genetic inheritance, SMCs can disrupt genome stability by trapping DNA topological stress.
<h4>Objective</h4>To describe and identify the importance of different indicators of the aerobic and anaerobic fitness of male ultra-trail runners according to their level of participation (regional or national).<h4>Methods</h4>Forty-four male ultra-trail runners were assessed (36.5±7.2 years). They were classified as regional (n=25) and national (n=19). Wingate test was used to assess the anaerobic pathway. A progressive incremental running test was performed and ventilatory thresholds registered, in parallel to heart rate and lactate concentration at the end of the protocol. Comparison between groups was performed using independent samples t-test.<h4>Results</h4>No significant differences were found between outputs derived from Wingate test. For aerobic fitness, while examining absolute values, differences were uniquely significant for the second ventilatory threshold (ultra-trail regional runners: 3.78±0.32L.min-1; ultra-trail national runners: 4.03±0.40L.min-1 p<0.05). Meantime, when aerobic fitness was expressed per unit of body mass, differences were significant for the second ventilatory threshold (ultra-trail regional runners: 50.75±6.23mL.kg-1.min-1; ultra-trail national runners: 57.88±4.64mL.kg-1.min-1 p<0.05) and also maximum volume of oxygen (ultra-trail regional runners: 57.33±7.66mL.kg-1.min-1; ultra-trail national runners: 63.39±4.26mL.kg-1.min-1 p<0.05).<h4>Conclusion</h4>This study emphasized the importance of expressing physiological variables derived from running protocols per unit of body mass. Also, the second ventilatory threshold appears to be the best and the only aerobic fitness variable to distinguish between trail runners according to competitive level. Maximal oxygen uptake seems of relative interest to distinguish between long distance runners according to competitive level.
Deubiquitinases (DUBs) are involved in various cellular functions. They deconjugate ubiquitin (UBQ) from ubiquitylated substrates to regulate their activity and stability. Studies on the roles of deubiquitylation have been conducted in various cancers to identify the carcinogenic roles of DUBs. In this review, we evaluate the biological roles of DUBs in cancer, including proliferation, cell cycle control, apoptosis, the DNA damage response, tumor suppression, oncogenesis, and metastasis. This review mainly focuses on the regulation of different downstream effectors and pathways via biochemical regulation and posttranslational modifications. We summarize the relationship between DUBs and human cancers and discuss the potential of DUBs as therapeutic targets for cancer treatment. This review also provides basic knowledge of DUBs in the development of cancers and highlights the importance of DUBs in cancer biology.
Also flagged:starchdegradationRDSsynthesis-fatty acids
Journal Article2020-04-06✓ 1 SnippetZheng L, Wu S, Shen J, Han X, Jin C, Chen X, Zhao S, Cao Y, Yao J.
In-Text Gene Mentions
Methods)
…, UXT andMRPL39) was calculated…
Show Full Abstract
<h4>Background</h4>Starch is an important substance that supplies energy to ruminants. To provide sufficient energy for high-yielding dairy ruminants, they are typically fed starch-enriched diets. However, starch-enriched diets have been proven to increase the risk of milk fat depression (MFD) in dairy cows. The starch present in ruminant diets could be divided into rumen-degradable starch (RDS) and rumen escaped starch (RES) according to their different degradation sites (rumen or intestine). Goats and cows have different sensitivities to MFD. Data regarding the potential roles of RDS in milk fat synthesis in the mammary tissue of dairy goats and in regulating the occurrence of MFD are limited.<h4>Results</h4>Eighteen Guanzhong dairy goats (day in milk = 185 ± 12 d) with similar parity, weight, and milk yield were selected and randomly assigned to one of three groups (<i>n</i> = 6), which were fed an LRDS diet (Low RDS = 20.52%), MRDS diet (Medium RDS = 22.15%), or HRDS diet (High RDS = 24.88%) for 5 weeks. Compared with that of the LRDS group, the milk fat contents in the MRDS and HRDS groups significantly decreased. The yields of short-, medium- and long-chain fatty acids decreased in the HRDS group. Furthermore, increased RDS significantly decreased ruminal <i>B. fibrisolvens</i> and <i>Pseudobutyrivibrio</i> abundances and increased the <i>trans</i>-10, <i>cis</i>-12 conjugated linoleic acid (CLA) and <i>trans</i>-10 C18:1 contents in the rumen fluid.A multiomics study revealed that the HRDS diet affected mammary lipid metabolism down-regulation of <i>ACSS2</i>, <i>MVD</i>, <i>AGPS</i>, <i>SCD5</i>, <i>FADS2</i>, <i>CERCAM</i>, <i>SC5D</i>, <i>HSD17B7</i>, <i>HSD17B12</i>, <i>ATM</i>, <i>TP53RK</i>, <i>GDF1</i> and <i>LOC102177400</i>. Remarkably, the significant decrease of <i>INSIG1</i>, whose expression was depressed by <i>trans</i>-10, <i>cis</i>-12 CLA, could reduce the activity of <i>SREBP</i> and, consequently, downregulate the downstream gene expression of SREBF1.<h4>Conclusions</h4>HRDS-induced goat MFD resulted from the downregulation of genes involved in lipogenesis, particularly, <i>INSIG1</i>. Specifically, even though the total starch content and the concentrate-to-fiber ratio were the same as those of the high-RDS diet, the low and medium RDS diets did not cause MFD in lactating goats.
Also flagged:tumorGKN1Gastrokine 1extracellular spacegastric cancermacropinocytosis
Journal Article2020-04-06✓ 3 SnippetsYoon JH, Ashktorab H, Smoot DT, Nam SW, Hur H, Park WS.
In-Text Gene Mentions
Abstract)
…Following uptake of HFE-145-derived exosomes in recipient cells, GKN1 protein bound to HRas and inhibited the binding of HRas to b-Raf and c-Raf which subsequently downregulated HRas/Raf/MEK/ERK signaling pathways in AGS, MKN1 cells, and MKN1-derived xenograft tumor tissues.…
Abstract)
…Tumor suppressor activities of exosome-carrying GKN1 protein were analyzed using transwell co-culture, MTT assay, BrdU incorporation, immunoprecipitation, and Western blot analysis.<h4>Results</h4>HFE-145-derived exosomes were internalized only into HFE-145 gastric epithelial cells and gastric cancer cells.…
Abstract)
…The objective of this study was to investigate the uptake and tumor-suppressive pathways of exosome-associated GKN1 protein in gastric epithelial cells.<h4>Methods</h4>Immunofluorescent and Western blot analysis were used to investigate gastric-specific uptake of HFE-145-derived exosomes.…
Show Full Abstract
<h4>Background</h4>Gastrokine 1 (GKN1) is a stomach-specific tumor suppressor that is secreted into extracellular space as an exosomal cargo protein. The objective of this study was to investigate the uptake and tumor-suppressive pathways of exosome-associated GKN1 protein in gastric epithelial cells.<h4>Methods</h4>Immunofluorescent and Western blot analysis were used to investigate gastric-specific uptake of HFE-145-derived exosomes. Binding affinity of HFE-145 derived exosomes with integrin proteins was examined using protein microarray chip. Tumor suppressor activities of exosome-carrying GKN1 protein were analyzed using transwell co-culture, MTT assay, BrdU incorporation, immunoprecipitation, and Western blot analysis.<h4>Results</h4>HFE-145-derived exosomes were internalized only into HFE-145 gastric epithelial cells and gastric cancer cells. Gastric-specific uptake of stomach-derived exosomes required integrin α6 and αX proteins. Clathrin and macropinocytosis increased the uptake of exosomes into gastric epithelial cells, whereas caveolin inhibited the uptake of exosomes. Transwell co-culture of AGS cells with HFE-145 cells markedly inhibited viability and proliferation of AGS cells. Following uptake of HFE-145-derived exosomes in recipient cells, GKN1 protein bound to HRas and inhibited the binding of HRas to b-Raf and c-Raf which subsequently downregulated HRas/Raf/MEK/ERK signaling pathways in AGS, MKN1 cells, and MKN1-derived xenograft tumor tissues. In addition, exosomal GKN1 protein suppressed both migration and invasion of gastric cancer cells by inhibiting epithelial-mesenchymal transition.<h4>Conclusions</h4>Gastric-specific uptake of exosomes derived from gastric epithelial cells requires integrin α6 and αX proteins in both gastric epithelial cells and exosomes. Exosomal GKN1 protein inhibits gastric carcinogenesis by downregulating HRas/Raf/MEK/ERK signaling pathways.
…kulturelle Adaptation desACE-IIIdurchzuführen, um die…
Discussion)
…value of theACE-IIIin the German-speaking…
Discussion)
…validate the translatedACE-IIIin an actual…
Show Full Abstract
<b>Objective:</b> Age-related disorders, such as dementia, significantly contribute to the global burden of disease. Adequate screening in the primary care setting is critical for early detection and proper management. The Addenbrooke's Cognitive Examination III (ACE-III) is an open-source neuropsychological test with superior diagnostic quality in comparison to the Mini-Mental State Examination (MMSE). Our aim was to perform a guideline-conform English-German translation and cultural adaptation of the ACE-III in order to enable implementation in German-speaking countries. <b>Methods:</b> The translation and cultural adaptation were performed in accordance with the "Principles of Good Practice for the Translation and Cultural Adaptation Process for Patient-Reported Outcomes (PRO) Measures" from the International Society for Pharmacoeconomics and Outcome Research (ISPOR) (Wild et al. 2005). Four separate English-German translations were compiled into one German consensus translation, which was then translated back into English and compared to the original English version. After comparison, the German consensus translation was revised with emphasis on the identified differences between the English original version and the English translated version. This revised German consensus translation was subsequently evaluated for clinical applicability on a 5-point scale (0 - not applicable; 5 - applicable without any restrictions) by 20 practitioners experienced in the field of neuropsychological testing, using an anonymized, paper-based 22-item survey. <b>Results:</b> Nineteen of the 20 practitioners (95.0%) rated the German ACE-III translation as overall applicable. The median rating was 4.0 [IQR (4.0/5.0)]. When evaluating survey items assessing the applicability of the individual 19 subtests of the ACE-III, all of them (100%) were rated as applicable with a median rating of 4.5 [IQR (4.1/4.9)]. <b>Conclusion:</b> The German ACE-III translation in its current form is generally applicable and can be utilized for clinical and scientific purposes.
Also flagged:cycloalanopineOpinesamino acidsα-keto acidscarbonylscarbohydrates
Journal Article2020-04-06No SnippetsAntwi I, Chiorean S, van Belkum MJ, Vederas JC.
Show Full Abstract
Opines are widely distributed natural products formed by the reductive condensation of amino acids with α-keto acids or carbonyls of carbohydrates. They have important biological roles in bacteria, higher plants, fungi, invertebrates and mammals, including humans. An unusual cyclic opine of undefined stereochemistry, cycloalanopine, was previously isolated from <i>Lactobacillus rhamnosus</i> LS8 and reported to have antimicrobial activity against both Gram-negative and Gram-positive bacteria. In this work, we report a three-step strategy to synthetically access pure isomers of this cyclic compound and analogs thereof. In the key step, acyclic bis-hydrazides can be oxidized with (diacetoxyiodo) benzene to corresponding cyclic <i>N</i>,<i>N'</i>-diacylhydrazides. The three cycloalanopine isomers, along with several analogs, were synthesized and tested against a panel of Gram-positive and Gram-negative bacteria. We identified the active isomer as the <i>meso</i> compound: (4<i>R</i>,6<i>S</i>)-4,6-dimethyl-1,2,5-triazepan-3,7-dione. Additionally, a glycine derivative, (<i>R</i>)-4-methyl-1,2,5-triazepan-3,7-dione, was ascertained to be more potent. This compound was active against both Gram-positive and Gram-negative organisms with the strongest potency against <i>Escherichia coli</i> and <i>Acinetobacter baumannii</i>, an opportunistic pathogen found in hospital-derived infections.
bioRxiv2020-04-06Preprint (No Snippets API)Lapina C, Rodic M, Peschanski D, Mesmoudi S.
Show Full Abstract
The literature reports several symptoms of SARS-CoV-2 in humans such as fever, cough, fatigue, pneumonia, and headache. Furthermore, patients infected with similar strains (SARS-CoV and MERS-CoV) suffered testis, liver, or thyroid damage. Angiotensin-converting enzyme 2 (ACE2) serves as an entry point into cells for some strains of coronavirus (SARS-CoV, MERS-CoV, SARS-CoV-2). Our hypothesis was that as ACE2 is essential to the SARS-CoV-2 virus invasion, then brain regions where ACE2 is the most expressed are more likely to be disturbed by the infection. Thus, the expression of other genes which are also over-expressed in those damaged areas could be affected. We used mRNA expression levels data of genes provided by the Allen Human Brain Atlas (ABA), and computed spatial correlations with the LinkRbrain platform. Genes whose co-expression is spatially correlated to that of ACE2 were then clustered into 16 groups, depending on the organ in which they are the most expressed (as described by the NCBI genes database). The list of organs where genes sharing local over-expression with the ACE2 gene are the most expressed is astonishingly similar to the organs affected by Covid-19.
Also flagged:diabetesmetabolic syndromegallstonesObesityinsulin resistancegallstones disease
Journal Article2020-04-05✓ 1 SnippetAlmobarak AO, Jervase A, Fadl AA, Garelnabi NIA, Hakem SA, Hussein TM, Ahmad AAA, Ahmed ISE, Badi S, Ahmed MH.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>The gallstones are common health problem across the world with huge financial burden on health authorities. Obesity and insulin resistance are associated with risk of gallstones disease (GSD). The aim of this study was to assess the prevalence of metabolic syndrome (MetS) and diabetes and associated risk factors in Sudanese patients with gallstones.<h4>Methods</h4>A prospective cross-sectional study, enrolled patients with gallstones attending Ibn Sina Specialized Teaching Hospital for gastrointestinal and hepatobiliary diseases. A structured questionnaire was applied, anthropometric measures were taken, and blood tested for HbA1c, fasting glucose and lipid profile. Data was analysed using SPSS version 23.<h4>Results</h4>A total number of 151 participants were recruited in the study, 71 of them were ultrasound confirmed GSD patients, and the other 80 were controls without GSD over a period of six months. The prevalence of the MetS and diabetes was 30% and 23.9% respectively. Borderline diabetes was 16.9% and overweight and obesity constituted more than half of the sample 59.6%. Using Chi-Square test, a statistically significant association was found between MetS and HDL, TG, LDL level, waist circumference and blood pressure (BP). Absolute predictors and the risk factors for gallstone disease were waist circumference, age, HbA1c and LDL.<h4>Conclusions</h4>The prevalence of MetS and diabetes among gallstone patients was 30% and 23.9% respectively. Absolute predictors and the risk factors for gallstone disease were waist circumference, age, HbA1c and LDL.
Also flagged:ironoverloadiron deficient anemiaHFE2HAMPTFR2
Journal Article2020-04-05✓ 4 SnippetsPiperno A, Pelucchi S, Mariani R.
In-Text Gene Mentions
Abstract)
…Hemochromatosisincludes five different…
Abstract)
…Mutations inHFE, HFE2, HAMP and…
Text
…HFE…
Text
…hemochromatosis…
Show Full Abstract
Hereditary iron overload includes several disorders characterized by iron accumulation in tissues, organs, or even single cells or subcellular compartments. They are determined by mutations in genes directly involved in hepcidin regulation, cellular iron uptake, management and export, iron transport and storage. Systemic forms are characterized by increased serum ferritin with or without high transferrin saturation, and with or without functional iron deficient anemia. Hemochromatosis includes five different genetic forms all characterized by high transferrin saturation and serum ferritin, but with different penetrance and expression. Mutations in HFE, HFE2, HAMP and TFR2 lead to inadequate or severely reduced hepcidin synthesis that, in turn, induces increased intestinal iron absorption and macrophage iron release leading to tissue iron overload. The severity of hepcidin down-regulation defines the severity of iron overload and clinical complications. Hemochromatosis type 4 is caused by dominant gain-of-function mutations of ferroportin preventing hepcidin-ferroportin binding and leading to hepcidin resistance. Ferroportin disease is due to loss-of-function mutation of SLC40A1 that impairs the iron export efficiency of ferroportin, causes iron retention in reticuloendothelial cell and hyperferritinemia with normal transferrin saturation. Aceruloplasminemia is caused by defective iron release from storage and lead to mild microcytic anemia, low serum iron, and iron retention in several organs including the brain, causing severe neurological manifestations. Atransferrinemia and DMT1 deficiency are characterized by iron deficient erythropoiesis, severe microcytic anemia with high transferrin saturation and parenchymal iron overload due to secondary hepcidin suppression. Diagnosis of the different forms of hereditary iron overload disorders involves a sequential strategy that combines clinical, imaging, biochemical, and genetic data. Management of iron overload relies on two main therapies: blood removal and iron chelators. Specific therapeutic options are indicated in patients with atransferrinemia, DMT1 deficiency and aceruloplasminemia.
Also flagged:HepcidinIron Transportersironmetabolismlactoferrinhomocysteine
Journal Article2020-04-05✓ 5 SnippetsSkrypnik K, Bogdański P, Sobieska M, Suliburska J.
In-Text Gene Mentions
Discussion)
…After bindingHFEtranslocated from TfR1, TfR2 induces hepcidin synthesis, which should lead to increased hepcidin serum concentration [ 16 ].…
Discussion)
…One significant limitation of our study is that we did not analyze a range of molecules that take part in Fe turnover, such asHFE, ferroportin, and NTBI.…
Introduction)
…sly, TfR1-associated protein (HFE) is translocated from…
Introduction)
…as to howHFEand TfR2 might…
Discussion)
…turnover, such asHFE, ferroportin, and NTBI.…
Show Full Abstract
The influence of probiotic supplementation on iron metabolism remains poorly investigated. However, a range of studies, especially on <i>Lactobacillus plantarum</i> 299v (Lp229v), have indicated a possible positive impact of probiotics on iron absorption. The aim of the study was to determine the effect of multistrain probiotic supply on iron balance. Thirty Wistar rats were randomized into three groups: placebo (KK group), and multistrain probiotic per os in a daily dose of 2.5 × 10<sup>9</sup> colony forming units (CFU) (PA group) or 1 × 10<sup>10</sup> CFU (PB group). Multistrain probiotic consisted of nine bacterial strains: <i>Bifidobacterium bifidum</i> W23, <i>B. lactis</i> W51, <i>B. lactis</i> W52, <i>Lactobacillus acidophilus</i> W37, <i>L. brevis</i> W63, <i>L. casei</i> W56, <i>L. salivarius</i> W24, <i>Lactococcus lactis</i> W19, and <i>Lc. lactis</i> W58, in equal proportions. After six weeks, blood and organ samples were collected. No differences were found between the three groups in terms of serum concentrations of hepcidin (HEPC), lactoferrin (LTF), homocysteine (HCY), ferritin (Ft), or erythroferrone (ErFe), or in liver content of divalent metal transporter 1 (DMT1), transferrin receptors 1 and 2 (TfR), or ZRT/IRT-like protein 14 (ZIP14) proteins. In the overall sample, positive correlations were noted between the serum concentrations of hepcidin and lactoferrin, and hepcidin and ferritin; serum concentration of hepcidin and DMT1 and TfR1 in the liver; and serum concentration of erythroferrone and TfR2 in the liver. The correlations of serum hepcidin and erythroferrone with liver DMT1 and TfR represent significant mechanisms of Fe homeostasis. Our study has shown that multistrain probiotic supplementation used in the experiment did not disrupt the biochemical and hepatic regulatory processes of Fe balance and did not demonstrate significant influence on selected parameters of Fe metabolism.
bioRxiv2020-04-05Preprint (No Snippets API)Zhao X, Zheng S, Chen D, Zheng M, Li X, Li G, Lin H, Chang J, Zeng H, Guo J.
Show Full Abstract
<h4>ABSTRACT</h4> C3A is a sub-clone of human hepatoblastoma HepG2 cell line with the strong contact inhibition of growth. We fortuitously found that C3A was more susceptible to human coronavirus HCoV-OC43 infection than HepG2, which was attributed to the increased efficiency of virus entry into C3A cells. In an effort to search for the host cellular protein(s) mediating the differential susceptibility of the two cell lines to HCoV-OC43 infection, we found that ADAP2, GILT and LY6E, three cellular proteins with known activity of interfering virus entry, expressed at significantly higher levels in HepG2 cells. Functional analyses revealed that ectopic expression of LY6E, but not GILT or ADAP2, in HEK 293 cells inhibited the entry of HCoV-OC43. While overexpression of LY6E in C3A and A549 cells efficiently inhibited the infection of HCoV-OC43, knockdown of LY6E expression in HepG2 significantly increased its susceptibility to HCoV-OC43 infection. Moreover, we found that LY6E also efficiently restricted the entry mediated by the envelope spike proteins of other human coronaviruses, including the currently pandemic SARS-CoV-2. Interestingly, overexpression of serine protease TMPRSS2 or amphotericin treatment significantly neutralized the IFITM3 restriction of human coronavirus entry, but did not compromise the effect of LY6E on the entry of human coronaviruses. The work reported herein thus demonstrates that LY6E is a critical antiviral immune effector that controls CoV infection and pathogenesis via a distinct mechanism. <h4>Importance</h4> Virus entry into host cells is one of the key determinants of host range and cell tropism and is subjected to the control by host innate and adaptive immune responses. In the last decade, several interferon inducible cellular proteins, including IFITMs, GILT, ADAP2, 25CH and LY6E, had been identified to modulate the infectious entry of a variety of viruses. Particularly, LY6E was recently identified as host factors to facilitate the entry of several human pathogenic viruses, including human immunodeficiency virus, influenza A virus and yellow fever virus. Identification of LY6E as a potent restriction factor of coronaviruses expands the biological function of LY6E and sheds new light on the immunopathogenesis of human coronavirus infection.
Also flagged:Cholangiocarcinomatrypan blueRAquercetinkaempferolcaspase 3
Journal Article2020-04-04No SnippetsWang Y, Dong B, Xue W, Feng Y, Yang C, Liu P, Cao J, Zhu C.
Show Full Abstract
BACKGROUND This study used network pharmacology method and cell model to assess the effects of Radix Astragali (RA) on cholangiocarcinoma (CCA) and to predict core targets and molecular mechanisms. MATERIAL AND METHODS We performed an in vitro study to assess the effect of RA on CCA using CCK8 assay, the Live-Cell Analysis System, and trypan blue staining. The components and targets of RA were analyzed using the Traditional Chinese Medicine Systems Pharmacology database, and genes associated with CCA were retrieved from the GeneCards and OMIM platforms. Protein-protein interactions were analyzed with the STRING platform. The components-targets-disease network was built by Cytoscape. The TIMER database revealed the expression of core targets with diverse immune infiltration levels. GO and KEGG analyses were performed to identify molecular-biology processes and signaling pathways. The predictions were verified by Western blotting. RESULTS Concentration-dependent antitumor activity was confirmed in the cholangiocarcinoma QBC939 cell line treated with RA. RA contained 16 active compounds, with quercetin and kaempferol as the core compounds. The most important biotargets for RA in CCA were caspase 3, MAPK8, MYC, EGFR, and PARP. The TIMER database revealed that the expression of caspase3 and MYC was related with diverse immune infiltration levels of CCA. The results of Western blotting showed RA significantly influenced the expression of the 5 targets that network pharmacology predicted. CONCLUSIONS RA is an active medicinal material that can be developed into a safe and effective multi-targeted anticancer treatment for CCA.
Journal Article2020-04-04No SnippetsSchlattmann A, von Lützau K, Kaspar U, Becker K.
Show Full Abstract
Livestock-associated methicillin-resistant <i>Staphylococcus aureus</i> (LA-MRSA) remains a serious public health threat. Porcine nasal cavities are predominant habitats of LA-MRSA. Hence, components of their microbiota might be of interest as putative antagonistically acting competitors. Here, an extensive culturomics approach has been applied including 27 healthy pigs from seven different farms; five were treated with antibiotics prior to sampling. Overall, 314 different species with standing in nomenclature and 51 isolates representing novel bacterial taxa were detected. <i>Staphylococcus aureus</i> was isolated from pigs on all seven farms sampled, comprising ten different <i>spa</i> types with t899 (<i>n</i> = 15, 29.4%) and t337 (<i>n</i> = 10, 19.6%) being most frequently isolated. Twenty-six MRSA (mostly t899) were detected on five out of the seven farms. Positive correlations between MRSA colonization and age and colonization with <i>Streptococcus hyovaginalis</i>, and a negative correlation between colonization with MRSA and <i>Citrobacter</i> spp. were found (<i>p</i> < 0.05). Of 209 non-<i>S. aureus</i> members of the <i>Staphylococcaceae</i> family, 25 isolates (12.0%) from three out of the seven farms exhibited methicillin resistance, including two <i>Macrococcus goetzii</i> isolates carrying the <i>mecB</i> gene. Among 125 <i>Enterobacterales</i>, none tested positive for extended-spectrum beta-lactamase (ESBL) and carbapenemase production. The high frequency of methicillin-resistant staphylococci supports the need for enhanced efforts within the "One Health" concept to manage the antibiotic resistance crisis in the human and veterinary medicine sector.
Despite good responses to first-line treatment with platinum-based combination chemotherapy, most ovarian cancer patients will relapse and eventually develop platinum-resistant disease with poor prognosis. Although reports suggest that integrin-linked kinase (ILK) is a potential target for ovarian cancer treatment, identification of ILK downstream effectors has not been fully explored. The purpose of this study was to investigate the molecular and biological effects of targeting ILK in cisplatin-resistant ovarian cancer. Western blot analysis showed that phosphorylation levels of ILK were higher in cisplatin-resistant compared with cisplatin-sensitive ovarian cancer cells. Further immunohistochemical analysis of ovarian cancer patient samples showed a significant increase in phosphorylated ILK levels in the tumor tissue when compared to normal ovarian epithelium. Targeting ILK by small-interfering RNA (siRNA) treatment reduced cisplatin-resistant cell growth and invasion ability, and increased apoptosis. Differential gene expression analysis by RNA sequencing (RNA-Seq) upon ILK-siRNA transfection followed by Ingenuity Pathway Analysis (IPA) and survival analysis using the Kaplan-Meier plotter database identified multiple target genes involved in cell growth, apoptosis, invasion, and metastasis, including several non-coding RNAs. Taken together, results from this study support ILK as an attractive target for ovarian cancer and provide potential ILK downstream effectors with prognostic and therapeutic value.
…iseases (autoimmune hepatitis,hemochromatosis, iron overload, Wilson’s…
Show Full Abstract
In the United States, chronic viral hepatitis B and C (CHB and CHC), nonalcoholic fatty liver disease (NAFLD), and alcohol-related liver disease (ALD) are the main causes of liver deaths attributable to hepatocellular carcinoma (HCC) and cirrhosis. Our aim was to assess the changes in the rates of mortality and years of potential life lost (YLL) for HCC and cirrhosis due to different liver diseases. We used multiple-cause mortality data (2007-2017) from the National Center for Health Statistics. Annual percentage change (APC) in age-standardized death rate per 100,000 (ASDR) and age-standardized years of life lost per 100,000 (ASYLLR) were calculated. In the United States in 2017, there were 2,797,265 deaths with 73,424 liver deaths, contributing to 1,467,742 of YLL. Of the liver deaths, HCC was noted in 12,169 (16.6%) and cirrhosis in 60,111 (82.0%). CHC was responsible for 50.4% of HCC deaths; NAFLD, 35.4%; HBV, 6.0%; ALD, 5.4%; and others, 2.8%. NAFLD was responsible for 48.9% of cirrhosis deaths; ALD, 34.7%; CHC, 12.3%; CHB, 0.9%; and others, 3.2%. Between 2007 and 2017, the increase in ASDR for HCC due to ALD and NAFLD accelerated after 2014 (APC, 11.38% and 6.55%, respectively) whereas CHC stabilized (APC, 0.63%; <i>P</i> = 0.272) after 2011. The increase in ASYLLR of HCC escalated after 2014 for ALD and NAFLD (APC, 12.12% and 6.15%, respectively) and leveled out for CHC after 2012 (APC, -1.05%; <i>P</i> = 0.056). Furthermore, the highest annual increase in ASDR and ASYLLR for cirrhosis was due to ALD (APC, 3.24% and 3.34%, respectively) followed by NAFLD (APC, 1.23% and 0.49%, respectively). <i>Conclusion:</i> Over the past decade, ASDR and ASYLLR due to ALD and NAFLD have been increasing in the United States. The rising burden of HCC and cirrhosis are primarily driven by NAFLD and ALD.
medRxiv2020-04-04Preprint (No Snippets API)Li X, Qian K, Xie L, Li X, Cheng M, Jiang L, Schuller BW.
Show Full Abstract
<h4>Background</h4> As the novel coronavirus triggering COVID-19 has broken out in Wuhan, China and spread rapidly worldwide, it threatens the lives of thousands of people and poses a global threat on the economies of the entire world. However, infection with COVID-19 is currently rare in children. <h4>Objective</h4> To discuss the latest findings and research focus on the basis of characteristics of children confirmed with COVID-19, and provide an insight into the future treatment and research direction. <h4>Methods</h4> We searched the terms “COVID-19 OR coronavirus OR SARS-CoV-2” AND “Pediatric OR children” on PubMed, Embase, Cochrane library, NIH, CDC, and CNKI. The authors also reviewed the guidelines published on Chinese CDC and Chinese NHC. <h4>Results</h4> We included 25 published literature references related to the epidemiology, clinical manifestation, accessary examination, treatment, and prognosis of pediatric patients with COVID-19. <h4>Conclusion</h4> The numbers of children with COVID-19 pneumonia infection are small, and most of them come from family aggregation. Symptoms are mainly mild or even asymptomatic, which allow children to be a risk factor for transmission. Thus, strict epidemiological history screening is needed for early diagnosis and segregation. This holds especially for infants, who are more susceptible to infection than other age groups in pediatric age, but have most likely subtle and unspecific symptoms. They need to be paid more attention to. CT examination is a necessity for screening the suspected cases, because most of the pediatric patients are mild cases, and plain chest X-ray do not usually show the lesions or the detailed features. Therefore, early chest CT examination combined with pathogenic detection is a recommended clinical diagnosis scheme in children. The risk factors which may suggest severe or critical progress for children are: Fast respiratory rate and/or; lethargy and drowsiness mental state and/or; lactate progressively increasing and/or; imaging showed bilateral or multi lobed infiltration, pleural effusion or rapidly expending of lesions in a short period of time and/or; less than 3 months old or those who underly diseases. For those critical pediatric patients with positive SARS-CoV-2 diagnosis, polypnea may be the most common symptom. For treatment, the elevated PCT seen in children in contrast to adults suggests that the underlying coinfection/secondary infection may be more common in pediatric patients and appropriate antibacterial treatment should be considered. Once cytokine storm is found in these patients, anti-autoimmune or blood-purifying therapy should be given in time. Furthermore, effective isolation measures and appropriate psychological comfort need to be provided timely.
An experimental technique called difference topology combined with the mathematics of tangle analysis has been used to unveil the structure of DNA bound by the Mu transpososome. However, difference topology experiments can be difficult and time consuming. We discuss a modification that greatly simplifies this experimental technique. This simple experiment involves using a topoisomerase to trap DNA crossings bound by a protein complex and then running a gel to determine the crossing number of the knotted product(s). We develop the mathematics needed to analyze the results and apply these results to model the topology of DNA bound by 13S condensin and by the condensin MukB.
Also flagged:MStranslationalKEAP1glial cell differentiationcostimulationviral infection
Journal Article2020-04-03✓ 1 SnippetManuel AM, Dai Y, Freeman LA, Jia P, Zhao Z.
In-Text Gene Mentions
Discussion)
…our results, as “histone deacetylase complexdeacetylase complex” was…
Show Full Abstract
<h4>Background</h4>Multiple sclerosis (MS) is a complex disease in which the immune system attacks the central nervous system. The molecular mechanisms contributing to the etiology of MS remain poorly understood. Genome-wide association studies (GWAS) of MS have identified a small number of genetic loci significant at the genome level, but they are mainly non-coding variants. Network-assisted analysis may help better interpret the functional roles of the variants with association signals and potential translational medicine application. The Dense Module Searching of GWAS tool (dmGWAS version 2.4) developed in our team is applied to 2 MS GWAS datasets (GeneMSA and IMSGC GWAS) using the human protein interactome as the reference network. A dual evaluation strategy is used to generate results with reproducibility.<h4>Results</h4>Approximately 7500 significant network modules were identified for each independent GWAS dataset, and 20 significant modules were identified from the dual evaluation. The top modules included GRB2, HDAC1, JAK2, MAPK1, and STAT3 as central genes. Top module genes were enriched with functional terms such as "regulation of glial cell differentiation" (adjusted p-value = 2.58 × 10<sup>- 3</sup>), "T-cell costimulation" (adjusted p-value = 2.11 × 10<sup>- 6</sup>) and "virus receptor activity" (adjusted p-value = 1.67 × 10<sup>- 3</sup>). Interestingly, top gene networks included several MS FDA approved drug target genes HDAC1, IL2RA, KEAP1, and RELA, CONCLUSIONS: Our dmGWAS network analyses highlighted several genes (GRB2, HDAC1, IL2RA, JAK2, KEAP1, MAPK1, RELA and STAT3) in top modules that are promising to interpret GWAS signals and link to MS drug targets. The genes enriched with glial cell differentiation are important for understanding neurodegenerative processes in MS and for remyelination therapy investigation. Importantly, our identified genetic signals enriched in T cell costimulation and viral receptor activity supported the viral infection onset hypothesis for MS.
Also flagged:PDACCas9cancertumorstumorpancreatic cancer
Journal Article2020-04-03No SnippetsLiu E, Zhang ZZ, Cheng X, Liu X, Cheng L.
Show Full Abstract
<h4>Background</h4>Pancreatic ductal adenocarcinoma (PDAC) is the most common pancreatic malignancy. Due to its wide heterogeneity, PDAC acts aggressively and responds poorly to most chemotherapies, causing an urgent need for the development of new therapeutic strategies. Cell lines have been used as the foundation for drug development and disease modeling. CRISPR-Cas9 plays a key role in every step-in drug discovery: from target identification and validation to preclinical cancer cell testing. Using cell-line models and CRISPR-Cas9 technology together make drug target prediction feasible. However, there is still a large gap between predicted results and actionable targets in real tumors. Biological network models provide great modus to mimic genetic interactions in real biological systems, which can benefit gene perturbation studies and potential target identification for treating PDAC. Nevertheless, building a network model that takes cell-line data and CRISPR-Cas9 data as input to accurately predict potential targets that will respond well on real tissue remains unsolved.<h4>Methods</h4>We developed a novel algorithm 'Spectral Clustering for Network-based target Ranking' (SCNrank) that systematically integrates three types of data: expression profiles from tumor tissue, normal tissue and cell-line PDAC; protein-protein interaction network (PPI); and CRISPR-Cas9 data to prioritize potential drug targets for PDAC. The whole algorithm can be classified into three steps: 1. using STRING PPI network skeleton, SCNrank constructs tissue-specific networks with PDAC tumor and normal pancreas tissues from expression profiles; 2. With the same network skeleton, SCNrank constructs cell-line-specific networks using the cell-line PDAC expression profiles and CRISPR-Cas 9 data from pancreatic cancer cell-lines; 3. SCNrank applies a novel spectral clustering approach to reduce data dimension and generate gene clusters that carry common features from both networks. Finally, SCNrank applies a scoring scheme called 'Target Influence score' (TI), which estimates a given target's influence towards the cluster it belongs to, for scoring and ranking each drug target.<h4>Results</h4>We applied SCNrank to analyze 263 expression profiles, CRPSPR-Cas9 data from 22 different pancreatic cancer cell-lines and the STRING protein-protein interaction (PPI) network. With SCNrank, we successfully constructed an integrated tissue PDAC network and an integrated cell-line PDAC network, both of which contain 4414 selected genes that are overexpressed in tumor tissue samples. After clustering, 4414 genes are distributed into 198 clusters, which include 367 targets of FDA approved drugs. These drug targets are all scored and ranked by their TI scores, which we defined to measure their influence towards the network. We validated top-ranked targets in three aspects: Firstly, mapping them onto the existing clinical drug targets of PDAC to measure the concordance. Secondly, we performed enrichment analysis to these drug targets and the clusters there are within, to reveal functional associations between clusters and PDAC; Thirdly, we performed survival analysis for the top-ranked targets to connect targets with clinical outcomes. Survival analysis reveals that overexpression of three top-ranked genes, PGK1, HMMR and POLE2, significantly increases the risk of death in PDAC patients.<h4>Conclusion</h4>SCNrank is an unbiased algorithm that systematically integrates multiple types of omics data to do potential drug target selection and ranking. SCNrank shows great capability in predicting drug targets for PDAC. Pancreatic cancer-associated gene candidates predicted by our SCNrank approach have the potential to guide genetics-based anti-pancreatic drug discovery.
Also flagged:chromosomesHbp1Vgll4Pim3chromosomal regionswater
Journal Article2020-04-03No SnippetsYang W, Wang Y, Jiang D, Tian C, Zhu C, Li G, Chen H.
Show Full Abstract
<h4>Background</h4>Scatophagus argus is a popular farmed fish in several countries of Southeast Asia, including China. Although S. argus has a highly promising economic value, a significant lag of breeding research severely obstructs the sustainable development of aquaculture industry. As one of the most important economic traits, growth traits are controlled by multiple gene loci called quantitative trait loci (QTLs). It is urgently needed to launch a marker assisted selection (MAS) breeding program to improve growth and other pivotal traits. Thus a high-density genetic linkage map is necessary for the fine mapping of QTLs associated with target traits.<h4>Results</h4>Using restriction site-associated DNA sequencing, 6196 single nucleotide polymorphism (SNP) markers were developed from a full-sib mapping population for genetic map construction. A total of 6193 SNPs were grouped into 24 linkage groups (LGs), and the total length reached 2191.65 cM with an average marker interval of 0.35 cM. Comparative genome mapping revealed 23 one-to-one and 1 one-to-two syntenic relationships between S. argus LGs and Larimichthys crocea chromosomes. Based on the high-quality linkage map, a total of 44 QTLs associated with growth-related traits were identified on 11 LGs. Of which, 19 significant QTLs for body weight were detected on 9 LGs, explaining 8.8-19.6% of phenotypic variances. Within genomic regions flanking the SNP markers in QTL intervals, we predicted 15 candidate genes showing potential relationships with growth, such as Hbp1, Vgll4 and Pim3, which merit further functional exploration.<h4>Conclusions</h4>The first SNP genetic map with a fine resolution of 0.35 cM for S. argus has been developed, which shows a high level of syntenic relationship with L. crocea genomes. This map can provide valuable information for future genetic, genomic and evolutionary studies. The QTLs and SNP markers significantly associated with growth-related traits will act as useful tools in gene mapping, map-based cloning and MAS breeding to speed up the genetic improvement in important traits of S. argus. The interesting candidate genes are promising for further investigations and have the potential to provide deeper insights into growth regulation in the future.
Also flagged:Chronic persistent hepatitisFibrosis and cirrhosis of liverChronic hepatitis, unspecifiedAlcoholic liver diseasedeltaMalignant neoplasm of liver
Journal Article2020-04-03✓ 2 SnippetsVaz J, Eriksson B, Strömberg U, Buchebner D, Midlöv P.
In-Text Gene Mentions
Methods)
…sclerosing cholangitis andhemochromatosis.…
Results)
…in four patients,hemochromatosisin three patients,…
Show Full Abstract
<h4>Background</h4>The incidence of cirrhosis for individuals in Sweden has previously been reported as stable/low among European countries. However, Swedish population-based studies are scarce and none of them included data from the most recent decade (2010-2019). We aimed to describe the incidence and aetiology of cirrhosis in the Halland region from 2011 to 2018, and to describe the severity and prevalence of liver-related complications and other primary comorbidities at the time of cirrhosis diagnosis.<h4>Methods</h4>We conducted a retrospective cohort study of all patients with cirrhosis in Halland, which has a population of 310,000 inhabitants. Medical records and histopathology registries were reviewed.<h4>Results</h4>A total of 598 patients with cirrhosis were identified. The age-standardised incidence was estimated at 23.2 per 100,000 person-years (95% CI 21.3-25.1), 30.5 (95% CI 27.5-33.8) for men and 16.4 (95% CI 14.3-18.7) for women. When stratified by age, the highest incidence rates were registered at age 60-69 years. Men had a higher incidence rate for most age groups when compared to women. The most common aetiology was alcohol (50.5%), followed by cryptogenic cirrhosis (14.5%), hepatitis C (13.4%), and non-alcoholic fatty liver disease (5.7%). Most patients had at least one liver-related complication at diagnosis (68%). The most common comorbidities at diagnosis were arterial hypertension (33%), type 2 diabetes (29%) and obesity (24%).<h4>Conclusions</h4>Based on previous Swedish studies, our results indicate that the incidence of cirrhosis in Sweden might be considerably higher than previously reported. It is uncertain if the incidence of cirrhosis has previously been underestimated or if an actual increment has occurred during the course of the most recent decade. The increased incidence rates of cirrhosis reported in Halland are multifactorial and most likely related to higher incidence rates among the elderly. Pre-obesity and obesity are common in cirrhosis and non-alcoholic fatty liver disease has become an important cause of cirrhosis in Halland.
Also flagged:hypersensitivitycollagenfibrilshydroxyapatitecalcium phosphatesodium
Journal Article2020-04-03No SnippetsZhou Z, Ge X, Bian M, Xu T, Li N, Lu J, Yu J.
Show Full Abstract
<h4>Background</h4>The remineralization approach mechanically occludes the exposed dentinal tubules mechanically, reduces the permeability of dentinal tubules and eliminates the symptoms of dentin hypersensitivity. The aim of the present study was to investigate the remineralization of demineralized dentin slices using CPP-ACP combined with TPP, and the research hypothesis was that CPP-ACP combined with TPP could result in extrafibrillar and intrafibrillar remineralization of dentin.<h4>Methods</h4>Demineralized dentin slices were prepared and randomly divided into the following groups: A (the CPP-ACP group), B (the CPP-ACP + TPP combination group), C (the artificial saliva group), D (the negative control group), and E (the positive control group). Dentin slice samples from groups A, B and C were remineralized and the remineralization effect was evaluated using scanning electron microscopy (SEM), transmission electron microscopy (TEM), energy-dispersive X-ray spectroscopy (EDX), attenuated total reflection-Fourier transform infrared spectroscopy (ATR-FTIR) and X-ray diffraction (XRD).<h4>Results</h4>Treatment with CPP-ACP combined with TPP occluded the dentinal tubules and resulted in remineralization of collagen fibrils. The hydroxyapatite crystals formed via remineralization were found to closely resemble the natural dentin components.<h4>Conclusion</h4>CPP-ACP combined with TPP has a good remineralization effect on demineralized dentin slices.
Also flagged:Schizophreniapsychiatric disorderGene expressionVEGFAvascular endothelial growth factorBDNF
Journal Article2020-04-03No SnippetsHuang G, Osorio D, Guan J, Ji G, Cai JJ.
Show Full Abstract
Schizophrenia (SCZ) is a severe, highly heterogeneous psychiatric disorder with varied clinical presentations. The polygenic genetic architecture of SCZ makes identification of causal variants a daunting task. Gene expression analyses hold the promise of revealing connections between dysregulated transcription and underlying variants in SCZ. However, the most commonly used differential expression analysis often assumes grouped samples are from homogeneous populations and thus cannot be used to detect expression variance differences between samples. Here, we applied the test for equality of variances to normalized expression data, generated by the CommonMind Consortium (CMC), from brains of 212 SCZ and 214 unaffected control (CTL) samples. We identified 87 genes, including VEGFA (vascular endothelial growth factor) and BDNF (brain-derived neurotrophic factor), that showed a significantly higher expression variance among SCZ samples than CTL samples. In contrast, only one gene showed the opposite pattern. To extend our analysis to gene sets, we proposed a Mahalanobis distance-based test for multivariate homogeneity of group dispersions, with which we identified 110 gene sets with a significantly higher expression variability in SCZ, including sets of genes encoding phosphatidylinositol 3-kinase (PI3K) complex and several others involved in cerebellar cortex morphogenesis, neuromuscular junction development, and cerebellar Purkinje cell layer development. Taken together, our results suggest that SCZ brains are characterized by overdispersed gene expression-overall gene expression variability among SCZ samples is significantly higher than that among CTL samples. Our study showcases the application of variability-centric analyses in SCZ research.
Cyanobacteria are model organisms for photosynthesis and are attractive for biotechnology applications. To aid investigation of genotype-phenotype relationships in cyanobacteria, we develop an inducible CRISPRi gene repression library in Synechocystis sp. PCC 6803, where we aim to target all genes for repression. We track the growth of all library members in multiple conditions and estimate gene fitness. The library reveals several clones with increased growth rates, and these have a common upregulation of genes related to cyclic electron flow. We challenge the library with 0.1 M L-lactate and find that repression of peroxiredoxin bcp2 increases growth rate by 49%. Transforming the library into an L-lactate-secreting Synechocystis strain and sorting top lactate producers enriches clones with sgRNAs targeting nutrient assimilation, central carbon metabolism, and cyclic electron flow. In many examples, productivity can be enhanced by repression of essential genes, which are difficult to access by transposon insertion.
Journal Article2020-04-03No SnippetsParrot T, Oger R, Allard M, Desfrançois J, Raingeard de la Blétière D, Coutolleau A, Preisser L, Khammari A, Dréno B, Delneste Y, Guardiola P, Fradin D, Gervois N.
Show Full Abstract
Peripheral CD4<sup>+</sup>CD8<sup>+</sup> double positive (DP) T cells are a phenotypically and functionally heterogeneous population depending on their origin and pathologic context. We previously identified among tumour infiltrating lymphocytes in melanoma, a tumour-reactive MHC class-I restricted CD4<sup>low</sup>CD8<sup>high</sup> DP αβ T-cell subpopulation with CD4-like function. In this study, we used an in-depth comparative transriptomic analysis of intra-melanoma DP T cells and CD4 and CD8 single positive (SP) T cells, to better comprehend the origin of this DP phenotype, and define the transcriptomic signature of activated DP T cells. We observed that intra-melanoma DP T cells were transcriptome-wise closer to their CD8 SP T-cell counterparts in terms of number of genes differentially expressed (97 in common with CD8 SP T cells and 15 with CD4 SP T cells) but presented hallmarks of a transition to a CD4-like functional profile (CD40LG) with a decreased cytotoxic signature (KLRC1) in favour of an increased cytokine-receptor interaction signature (IL4, IL24, IL17A…). This unleashed CD4-like program could be the results of the observed unbalanced expression of the THPOK/Runx3 transcription factors in DP T cells. Overall, this study allow us to speculate that intra-melanoma DP T cells arise from CD8 SP T cells being reprogrammed to a helper function.
Also flagged:NucleoporinsTransport ReceptorsCell Differentiationnucleuscytoplasmnuclear pore complexes
Journal Article2020-04-03No SnippetsKhan AU, Qu R, Ouyang J, Dai J.
Show Full Abstract
Bidirectional molecular movements between the nucleus and cytoplasm take place through nuclear pore complexes (NPCs) embedded in the nuclear membrane. These macromolecular structures are composed of several nucleoporins, which form seven different subcomplexes based on their biochemical affinity. These nucleoporins are integral components of the complex, not only allowing passive transport but also interacting with importin, exportin, and other molecules that are required for transport of protein in various cellular processes. Transport of different proteins is carried out either dependently or independently on transport receptors. As well as facilitating nucleocytoplasmic transport, nucleoporins also play an important role in cell differentiation, possibly by their direct gene interaction. This review will cover the general role of nucleoporins (whether its dependent or independent) and nucleocytoplasmic transport receptors in cell differentiation.
…Next, the HTT transgene detection was performed via PCR.…
Introduction)
…the huntingtin protein (htt) with an excessive…
Introduction)
…Thehtthas more than…
Introduction)
…Thehttprotein is ubiquitously…
Introduction)
…Htthas an important…
Show Full Abstract
Huntington's disease (HD) is a hereditary neurodegenerative disease caused by a polyglutamine expansion in the huntingtin protein, Striatum atrophy in HD leads to a progressive disturbance of psychiatric, motor, and cognitive function. Recent studies of HD patients revealed that the degeneration of cerebellum is also observed independently from the striatal atrophy during early HD stage and may contribute to the motor impairment and ataxia observed in HD. Cerebellar Purkinje cells (PCs) are responsible for the proper cerebellar pathways functioning and motor control. Recent studies on mouse models of HD have shown that the abnormality of the biochemical functions of PCs are observed in HD, suggesting the contribution of PC dysfunction and death to the impaired movement coordination observed in HD. To investigate ataxic symptoms in HD we performed a series of experiments with the yeast artificial chromosome transgenic mouse model of HD (YAC128). Using extracellular single-unit recording method we found that the portion of the cerebellar PCs with bursting and irregular patterns of spontaneous activity drastically rises in aged YAC128 HD mice when compared with wild type littermates. Previous studies demonstrated that SK channels are responsible for the cerebellar PC pacemaker activity and that positive modulation of SK channel activity exerted beneficial effects in different ataxic mouse models. Here we studied effects of the SK channels modulator chlorzoxazone (CHZ) on the motor behavior of YAC128 HD mice and also on the electrophysiological activity and neuroanatomy of the cerebellar PCs from these mice. We determined that the long-term intraperitoneal injections of CHZ alleviated the progressive impairment in the firing pattern of YAC128 PCs. We also demonstrated that treatment with CHZ rescued age-dependent motor incoordination and improved the cerebellar morphology in YAC128 mice. We propose that abnormal changes in the PC firing patterns might be a one of the possible causes of ataxic symptoms in HD and in other polyglutamine disorders and that the pharmacological activation of SK channels may serve as a potential way to improve the activity of cerebellar PCs and relieve the ataxic phenotype in HD patients.
Journal Article2020-04-03✓ 1 SnippetVanneste M, Feddersen CR, Varzavand A, Zhu EY, Foley T, Zhao L, Holt KH, Milhem M, Piper R, Stipp CS, Dupuy AJ, Henry MD.
In-Text Gene Mentions
Discussion)
…protein (Keap1) andkelch-like family member 20family member 20…
Show Full Abstract
Patients with malignant melanoma have a 5-year survival rate of only 15-20% once the tumor has metastasized to distant tissues. While MAP kinase pathway inhibitors (MAPKi) are initially effective for the majority of patients with melanoma harboring BRAF<sup>V600E</sup> mutation, over 90% of patients relapse within 2 years. Thus, there is a critical need for understanding MAPKi resistance mechanisms. In this manuscript, we performed a forward genetic screen using a whole genome shRNA library to identify negative regulators of vemurafenib resistance. We identified loss of NF1 and CUL3 as drivers of vemurafenib resistance. NF1 is a known driver of vemurafenib resistance in melanoma through its action as a negative regulator of RAS. However, the mechanism by which CUL3, a key protein in E3 ubiquitin ligase complexes, is involved in vemurafenib resistance was unknown. We found that loss of CUL3 was associated with an increase in RAC1 activity and MEK<sup>S298</sup> phosphorylation. However, the addition of the Src family inhibitor saracatinib prevented resistance to vemurafenib in CUL3<sup>KD</sup> cells and reversed RAC1 activation. This finding suggests that inhibition of the Src family suppresses MAPKi resistance in CUL3<sup>KD</sup> cells by inactivation of RAC1. Our results also indicated that the loss of CUL3 does not promote the activation of RAC1 through stabilization, suggesting that CUL3 is involved in the stability of upstream regulators of RAC1. Collectively, our study identifies the loss of CUL3 as a driver of MAPKi resistance through activation of RAC1 and demonstrates that inhibition of the Src family can suppress the MAPKi resistance phenotype in CUL3<sup>KD</sup> cells by inactivating RAC1 protein.
Also flagged:hypophysitisautoantibodyurothelial cancerhypopituitarismipilimumabcytotoxic T-lymphocyte-associated protein 4
Journal Article2020-04-03No SnippetsLeiter A, Gnjatic S, Fowkes M, Kim-Schulze S, Laface I, Galsky MD, Gallagher EJ.
Show Full Abstract
<h4>Objective</h4>Hypophysitis is an increasingly recognized adverse effect of immune checkpoint inhibitor (ICI) therapy for malignancy. However, the mechanisms through which ICIs induce hypophysitis are largely unknown. We aim to describe 2 cases of ICI-mediated hypophysitis and perform autoantibody profiling on serial samples from these patients to determine if common autoantibodies could be identified.<h4>Methods</h4>We describe 2 cases of patients with metastatic urothelial cancer who received ICI therapy and subsequently developed severe fatigue, prompting a hormonal workup consistent with hypopituitarism. Patient 1 received the ICI ipilimumab (anti-cytotoxic T-lymphocyte-associated protein 4) and patient 2 received the ICI pembrolizumab (anti-programmed cell death protein 1). Both patients had serial seromic immune biomarker profiling using high-density protein arrays before and after developing hypophysitis. Once a common autoantibody was found, zinc finger CCHC-type containing 8 (ZCCHC8), we used immunohistochemistry to assess its presence in pituitary tissue.<h4>Results</h4>Of a limited number of increased autoantibodies detected, those to ZCCHC8 were the only common antibodies to increase at least 3-fold post-hypophysitis in both patients. Using immunohistochemistry staining, we show for the first time that ZCCHC8 is expressed in pituitary gland tissue.<h4>Conclusion</h4>Seromic profiling identified a common autoantibody, ZCCHC8, in 2 patients who developed hypophysitis on ICI therapy, and other serial autoantibody increases in each patient. These findings warrant validation in other cohorts to determine if the response is to self or tumor antigen, and may reveal novel insights into pituitary gland physiology and the pathogenesis of ICI-mediated hypophysitis.
Also flagged:antibodyinfectionsHCV infectionliver diseaseHCV infectionscirrhosis
Journal Article2020-04-02No SnippetsKondili LA, Gamkrelidze I, Blach S, Marcellusi A, Galli M, Petta S, Puoti M, Vella S, Razavi H, Craxi A, Mennini FS, PITER collaborating group.
Show Full Abstract
<h4>Background and aims</h4>Cost-effective screening strategies are needed to make hepatitis C virus (HCV) elimination a reality. We determined if birth cohort screening is cost-effective in Italy.<h4>Methods</h4>A model was developed to quantify screening and healthcare costs associated with HCV. The model-estimated prevalence of undiagnosed HCV was used to calculate the antibody screens needed annually, with a €25 000 cost-effectiveness threshold. Outcomes were assessed under the status quo and a scenario that met the World Health Organization's targets for elimination of HCV. The elimination scenario was assessed under five screening strategies.<h4>Results</h4>A graduated birth cohort screening strategy (graduated screening 1: 1968-1987 birth cohorts, then expanding to 1948-1967 cohorts) was the least costly. This strategy would gain approximately 144 000 quality-adjusted life years (QALYs) by 2031 and result in an 89.3% reduction in HCV cases, compared to an 89.6%, 89.0%, 89.7% and 88.7% reduction for inversed graduated screening, 1948-77 birth cohort, 1958-77 birth cohort and universal screening, respectively. Graduated screening 1 yielded the lowest incremental cost-effectiveness ratio (ICER) of €3552 per QALY gained.<h4>Conclusions</h4>In Italy, a graduated screening scenario is the most cost-effective strategy. Other countries could consider a similar birth cohort approach when developing HCV screening strategies.
Also flagged:Insulinglucoseethanololeanane triterpenoidsmethyldeoxy
Journal Article2020-04-02No SnippetsAn JP, Park EJ, Ryu B, Lee BW, Cho HM, Doan TP, Pham HTT, Oh WK.
Show Full Abstract
During an effort to find insulin mimetic compounds, the leaves of <i>Gymnema inodorum</i> were shown to have a stimulatory effect on glucose uptake in 3T3-L1 adipocyte cells. Bioassay-guided fractionation on a 70% ethanol extract of <i>G. inodorum</i> was applied to yield two new (<b>1</b> and <b>2</b>) and two known (<b>8</b> and <b>9</b>) oleanane triterpenoids with a methyl anthranilate moiety together with five further new oleanane triterpenoids (<b>3</b>-<b>7</b>). The chemical structures of all isolates were determined based on their spectroscopic data, including IR, UV, NMR, and mass spectrometric analysis. The isolated compounds (<b>1</b>-<b>9</b>) were determined for their stimulatory activities on glucose uptake in differentiated 3T3-L1 adipocyte cells using 2-deoxy-2-[(7-nitro-2,1,3-benzoxadiazol-4-yl)amino]-d-glucose (2-NBDG) as a fluorescent-tagged glucose probe. Three compounds (<b>3</b>, <b>5</b>, and <b>9</b>) showed stimulatory effects on the uptake of 2-NBDG in 3T3-L1 adipocyte cells. Chemicals with a methyl anthranilate moiety have been considered as crucial contributors of flavor odor in foods, and quantitative analysis showed the content of compound <b>8</b> to be 0.90 ± 0.01 mg/g of the total extract. These results suggest that the leaves of <i>G. inodorum</i> have the potential to be used as an antidiabetic functional food or tea.
Protein turnover, the net result of protein synthesis and degradation, enables cells to remodel their proteomes in response to internal and external cues. Previously, we analyzed protein turnover rates in cultured brain cells under basal neuronal activity and found that protein turnover is influenced by subcellular localization, protein function, complex association, cell type of origin, and by the cellular environment (Dörrbaum et al., 2018). Here, we advanced our experimental approach to quantify changes in protein synthesis and degradation, as well as the resulting changes in protein turnover or abundance in rat primary hippocampal cultures during homeostatic scaling. Our data demonstrate that a large fraction of the neuronal proteome shows changes in protein synthesis and/or degradation during homeostatic up- and down-scaling. More than half of the quantified synaptic proteins were regulated, including pre- as well as postsynaptic proteins with diverse molecular functions.
Also flagged:translationalnucleotideRANpeptidespolyalaninepolyserine
Journal Article2020-04-02No SnippetsRudich P, Watkins S, Lamitina T.
Show Full Abstract
Expanded CAG nucleotide repeats are the underlying genetic cause of at least 14 incurable diseases, including Huntington's disease (HD). The toxicity associated with many CAG repeat expansions is thought to be due to the translation of the CAG repeat to create a polyQ protein, which forms toxic oligomers and aggregates. However, recent studies show that HD CAG repeats undergo a non-canonical form of translation called Repeat-associated non-AUG dependent (RAN) translation. RAN translation of the CAG sense and CUG anti-sense RNAs produces six distinct repeat peptides: polyalanine (polyAla, from both CAG and CUG repeats), polyserine (polySer), polyleucine (polyLeu), polycysteine (polyCys), and polyglutamine (polyGln). The toxic potential of individual CAG-derived RAN polypeptides is not well understood. We developed pure C. elegans protein models for each CAG RAN polypeptide using codon-varied expression constructs that preserve RAN protein sequence but eliminate repetitive CAG/CUG RNA. While all RAN polypeptides formed aggregates, only polyLeu was consistently toxic across multiple cell types. In GABAergic neurons, which exhibit significant neurodegeneration in HD patients, codon-varied (Leu)38, but not (Gln)38, caused substantial neurodegeneration and motility defects. Our studies provide the first in vivo evaluation of CAG-derived RAN polypeptides in a multicellular model organism and suggest that polyQ-independent mechanisms, such as RAN-translated polyLeu peptides, may have a significant pathological role in CAG repeat expansion disorders.
Also flagged:asthmaSLC26A1thymic stromal lymphopoietinTSLPhistonechromatin
Journal Article2020-04-02✓ 1 SnippetGautam Y, Afanador Y, Ghandikota S, Mersha TB.
In-Text Gene Mentions
Text
…histone complexity…
Show Full Abstract
Genome-wide association studies (GWAS) have identified hundreds of primarily non-coding disease-susceptibility variants that further need functional interpretation to prioritize and discriminate the disease-relevant variants. We present a comprehensive genome-wide non-coding variant prioritization scheme followed by validation using Pyrosequencing and TaqMan assays in asthma. We implemented a composite Functional Annotation Score (cFAS) to investigate over 32,000 variants consisting of 1525 GWAS-lead asthma-susceptibility variants and their LD proxies (r<sup>2</sup> ≥ 0.80). Functional annotation pipeline in cFAS revealed 274 variants with significant score at 1% false discovery rate. This study implicates a novel locus 4p16 (SLC26A1) with eQTL variant (rs11936407) and known loci in 17q12-21 and 5q22 which encode ORM1-like protein 3 (ORMDL3, rs406527, and rs12936231) and thymic stromal lymphopoietin (TSLP, rs3806932 and rs10073816) epithelial gene, respectively. Follow-up validation analysis through pyrosequencing of CpG sites in and nearby rs4065275 and rs11936407 showed genotype-dependent hypomethylation on asthma cases compared with healthy controls. Prioritized variants are enriched for asthma-specific histone modification associated with active chromatin (H3K4me1 and H3K27ac) in T cells, B cells, lung, and immune-related interferon gamma signaling pathways. Our findings, together with those from prior studies, suggest that SNPs can affect asthma by regulating enhancer activity, and our comprehensive bioinformatics and functional analysis could lead to biological insights into asthma pathogenesis.Graphic abstract.
Also flagged:synapsesneurodegenerative disorderHDHuntingtinsynaptic contactsdendrites
Journal Article2020-04-02✓ 3 SnippetsSavage JC, St-Pierre MK, Carrier M, El Hajj H, Novak SW, Sanchez MG, Cicchetti F, Tremblay MÈ.
In-Text Gene Mentions
Abstract)
…HD is caused by a mutation elongating the CAG repeats within the Huntingtin gene, resulting in HTT protein misfolding.…
Introduction)
…of the huntingtin (HTT) gene [ 2…
Discussion)
…uses the endogenousHTTpromoter and microglia…
Show Full Abstract
<h4>Background</h4>Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder that affects cognitive and motor abilities by primarily targeting the striatum and cerebral cortex. HD is caused by a mutation elongating the CAG repeats within the Huntingtin gene, resulting in HTT protein misfolding. Although the genetic cause of HD has been established, the specific susceptibility of neurons within various brain structures has remained elusive. Microglia, which are the brain's resident macrophages, have emerged as important players in neurodegeneration. Nevertheless, few studies have examined their implication in HD.<h4>Methods</h4>To provide novel insights, we investigated the maturation and dysfunction of striatal microglia using the R6/2 mouse model of HD. This transgenic model, which presents with 120+/-5 CAG repeats, displays progressive motor deficits beginning at 6 weeks of age, with full incapacitation by 13 weeks. We studied microglial morphology, phagocytic capacity, and synaptic contacts in the striatum of R6/2 versus wild-type (WT) littermates at 3, 10, and 13 weeks of age, using a combination of light and transmission electron microscopy. We also reconstructed dendrites and determined synaptic density within the striatum of R6/2 and WT littermates, at nanoscale resolution using focused ion beam scanning electron microscopy.<h4>Results</h4>At 3 weeks of age, prior to any known motor deficits, microglia in R6/2 animals displayed a more mature morphological phenotype than WT animals. Microglia from R6/2 mice across all ages also demonstrated increased phagocytosis, as revealed by light microscopy and transmission electron microscopy. Furthermore, microglial processes from 10-week-old R6/2 mice made fewer contacts with synaptic structures than microglial processes in 3-week-old R6/2 mice and age-matched WT littermates. Synaptic density was not affected by genotype at 3 weeks of age but increased with maturation in WT mice. The location of synapses was lastly modified in R6/2 mice compared with WT controls, from targeting dendritic spines to dendritic trunks at both 3 and 10 weeks of age.<h4>Conclusions</h4>These findings suggest that microglia may play an intimate role in synaptic alteration and loss during HD pathogenesis.
Also flagged:transcription factorscell differentiationTRAF2NCK-interacting kinaseTNIKtumor necrosis factor
Journal Article2020-04-02✓ 1 SnippetJaeger-Ruckstuhl CA, Hinterbrandner M, Höpner S, Correnti CE, Lüthi U, Friedli O, Freigang S, Al Sayed MF, Bührer ED, Amrein MA, Schürch CM, Radpour R, Riether C, Ochsenbein AF.
In-Text Gene Mentions
Results)
…associated repressors (Cdk5rap1) were increased…
Show Full Abstract
Co-stimulatory signals, cytokines and transcription factors regulate the balance between effector and memory cell differentiation during T cell activation. Here, we analyse the role of the TRAF2-/NCK-interacting kinase (TNIK), a signaling molecule downstream of the tumor necrosis factor superfamily receptors such as CD27, in the regulation of CD8<sup>+</sup> T cell fate during acute infection with lymphocytic choriomeningitis virus. Priming of CD8<sup>+</sup> T cells induces a TNIK-dependent nuclear translocation of β-catenin with consecutive Wnt pathway activation. TNIK-deficiency during T cell activation results in enhanced differentiation towards effector cells, glycolysis and apoptosis. TNIK signaling enriches for memory precursors by favouring symmetric over asymmetric cell division. This enlarges the pool of memory CD8<sup>+</sup> T cells and increases their capacity to expand after re-infection in serial re-transplantation experiments. These findings reveal that TNIK is an important regulator of effector and memory T cell differentiation and induces a population of stem cell-like memory T cells.
Also flagged:Cirrhosisliver cirrhosisvasodilationportal hypertensionendothelial nitric oxide synthaseeNOS
Journal Article2020-04-02✓ 2 SnippetsTurkseven S, Bolognesi M, Di Pascoli M.
In-Text Gene Mentions
Abstract)
…andin I<sub>2</sub> synthase (PTGIS) was evaluated.<h4>Results</h…
Abstract)
…PTGISmRNA expression did…
Show Full Abstract
<h4>Background</h4>In liver cirrhosis, a marked splanchnic vasodilation causes an increase in portal blood flow, contributing to the development of portal hypertension.<h4>Aim</h4>To evaluate if, in experimental cirrhosis, a different vascular reactivity exists between splenic and mesenteric components of the splanchnic circulation.<h4>Methods</h4>Liver cirrhosis was induced in Sprague Dawley rats by common bile duct ligation. In sections of splenic and superior mesenteric arteries, cumulative dose-response curves were obtained. mRNA expression of endothelial nitric oxide synthase (eNOS), inducible NOS (iNOS), and prostaglandin I<sub>2</sub> synthase (PTGIS) was evaluated.<h4>Results</h4>In cirrhotic rats, mesenteric but not splenic arteries showed a significant increase in endothelium-dependent relaxation to acetylcholine. In control and cirrhotic rats, COX inhibition alone did not significantly change the response of mesenteric arteries to acetylcholine; after inhibiting also NOS, the relaxation was completely abolished in control but only partially decreased in cirrhotic rats. After the inhibition of COX and NOS, the relaxation to acetylcholine was similarly decreased in splenic arteries from control and cirrhotic animals. The contraction induced by phenylephrine of both mesenteric and splenic arteries was decreased in cirrhotic rats. PTGIS mRNA expression did not differ in splenic and mesenteric arteries from control and cirrhotic rats; in cirrhotic rats, eNOS and iNOS mRNA expression was increased in mesenteric but not in splenic vascular bed.<h4>Conclusion</h4>In cirrhotic rats, a decreased splenic arterial response to vasoconstrictors, rather than an increased response to vasodilators, contributes to splanchnic vasodilation, while in mesenteric arteries also an increased response to vasodilators secondary to, but not only, eNOS and iNOS overexpression, plays a role.
Also flagged:deathferroptosistraumatic brain injuryneurological diseaseshemorrhagic strokecancer
Journal Article2020-04-02No SnippetsRatan RR.
Show Full Abstract
Over the past five decades, thanatology has come to include the study of how individual cells in our bodies die appropriately and inappropriately in response to physiological and pathological stimuli. Morphological and biochemical criteria have been painstakingly established to create clarity around definitions of distinct types of cell death and mechanisms for their activation. Among these, ferroptosis has emerged as a unique, oxidative stress-induced cell death pathway with implications for diseases as diverse as traumatic brain injury, hemorrhagic stroke, Alzheimer's disease, cancer, renal ischemia, and heat stress in plants. In this review, I highlight some of the formative studies that fostered its recognition in the nervous system and describe how chemical biological tools have been essential in defining events necessary for its execution. Finally, I discuss emerging opportunities for antiferroptotic agents as therapeutic agents in neurological diseases.
Also flagged:Acetatefatty livernon-alcoholic fatty liverAtherosclerosisIronPhenylalanine
Journal Article2020-04-02✓ 3 SnippetsParisinos CA, Wilman HR, Thomas EL, Kelly M, Nicholls RC, McGonigle J, Neubauer S, Hingorani AD, Patel RS, Hemingway H, Bell JD, Banerjee R, Yaghootkar H.
<h4>Background & aims</h4>MRI-based corrected T1 (cT1) is a non-invasive method to grade the severity of steatohepatitis and liver fibrosis. We aimed to identify genetic variants influencing liver cT1 and use genetics to understand mechanisms underlying liver fibroinflammatory disease and its link with other metabolic traits and diseases.<h4>Methods</h4>First, we performed a genome-wide association study (GWAS) in 14,440 Europeans, with liver cT1 measures, from the UK Biobank. Second, we explored the effects of the cT1 variants on liver blood tests, and a range of metabolic traits and diseases. Third, we used Mendelian randomisation to test the causal effects of 24 predominantly metabolic traits on liver cT1 measures.<h4>Results</h4>We identified 6 independent genetic variants associated with liver cT1 that reached the GWAS significance threshold (p <5×10<sup>-8</sup>). Four of the variants (rs759359281 in SLC30A10, rs13107325 in SLC39A8, rs58542926 in TM6SF2, rs738409 in PNPLA3) were also associated with elevated aminotransferases and had variable effects on liver fat and other metabolic traits. Insulin resistance, type 2 diabetes, non-alcoholic fatty liver and body mass index were causally associated with elevated cT1, whilst favourable adiposity (instrumented by variants associated with higher adiposity but lower risk of cardiometabolic disease and lower liver fat) was found to be protective.<h4>Conclusion</h4>The association between 2 metal ion transporters and cT1 indicates an important new mechanism in steatohepatitis. Future studies are needed to determine whether interventions targeting the identified transporters might prevent liver disease in at-risk individuals.<h4>Lay summary</h4>We estimated levels of liver inflammation and scarring based on magnetic resonance imaging of 14,440 UK Biobank participants. We performed a genetic study and identified variations in 6 genes associated with levels of liver inflammation and scarring. Participants with variations in 4 of these genes also had higher levels of markers of liver cell injury in blood samples, further validating their role in liver health. Two identified genes are involved in the transport of metal ions in our body. Further investigation of these variations may lead to better detection, assessment, and/or treatment of liver inflammation and scarring.
<b>Abstrac</b><b>t:</b> Vietnam is one of the countries most affected worldwide by the highly pathogenic avian influenza (HPAI) virus, which caused enormous economic loss and posed threats to public health. Over nearly two decades, with the antigenic changes in the diversified H5Ny viruses, the limited protective efficacy of the available vaccines was encountered. Therefore, it is necessary to approach a technology platform for the country to accelerate vaccine production that enables quick response to new influenza subtypes. This study utilized a powerful reverse genetics technique to successfully generate a recombinant H5N1 vaccine strain (designated as IBT-RG02) containing two surface proteins (haemagglutinin (HA) and neuraminidase (NA)) from the HPAI H5N1 (A/duck/Vietnam/HT2/2014(H5N1)) of the dominant clade 2.3.2.1c in Vietnam during 2012-2014. Importantly, the IBT-RG02 vaccine candidate has elicited high antibody titres in chickens (geometric mean titre (GMT) of 6.42 and 6.92, log<sub>2</sub> on day 14 and day 28 p.i., respectively). To test the efficacy, immunized chickens were challenged with the circulating virulent strains. As results, there was a high protection rate of 91.6% chickens against the virulent A/DK/VN/Bacninh/NCVD-17A384/2017 of the same clade and a cross-protection of 83.3% against A/duck/TG/NAVET(3)/2013 virus of clade 1.1. Our promising results showed that we can independently master the reverse genetics technology for generation of highly immunogenic vaccine candidates, and henceforth, it is a timely manner to reformulate avian influenza virus vaccines against variable H5 clade HPAI viruses in Vietnam.
Also flagged:TSPONeurodegenerative DiseasesPsychiatric DisordersAlcohol Use DisordersTraumatic Brain Injurydeath
Journal Article2020-04-02✓ 1 SnippetDimitrova-Shumkovska J, Krstanoski L, Veenman L.
In-Text Gene Mentions
S I O 001029)
…A third neurodegenerative disease to be mentioned here, HD, is an inherited and incurable neurodegenerative disease caused by trinucleotide repeat (CG) in the huntingtin (HTT)-encoding gene, which causes significant motor, cognitive, and psychiatric deficits [78].…
Show Full Abstract
Neuroinflammation and cell death are among the common symptoms of many central nervous system diseases and injuries. Neuroinflammation and programmed cell death of the various cell types in the brain appear to be part of these disorders, and characteristic for each cell type, including neurons and glia cells. Concerning the effects of 18-kDa translocator protein (TSPO) on glial activation, as well as being associated with neuronal cell death, as a response mechanism to oxidative stress, the changes of its expression assayed with the aid of TSPO-specific positron emission tomography (PET) tracers' uptake could also offer evidence for following the pathogenesis of these disorders. This could potentially increase the number of diagnostic tests to accurately establish the stadium and development of the disease in question. Nonetheless, the differences in results regarding TSPO PET signals of first and second generations of tracers measured in patients with neurological disorders versus healthy controls indicate that we still have to understand more regarding TSPO characteristics. Expanding on investigations regarding the neuroprotective and healing effects of TSPO ligands could also contribute to a better understanding of the therapeutic potential of TSPO activity for brain damage due to brain injury and disease. Studies so far have directed attention to the effects on neurons and glia, and processes, such as death, inflammation, and regeneration. It is definitely worthwhile to drive such studies forward. From recent research it also appears that TSPO ligands, such as PK11195, Etifoxine, Emapunil, and 2-Cl-MGV-1, demonstrate the potential of targeting TSPO for treatments of brain diseases and disorders.
<h4>Background</h4>Anemia is a known adverse prognostic factor among patients with cardiovascular diseases. We investigated whether the hemoglobin level was associated with the rhythm outcome after atrial fibrillation (AF) catheter ablation (AFCA).<h4>Methods</h4>We included 2627 patients who underwent AFCA and a guidelines-based rhythm follow-up (age 58 ± 10.9 years, 73% men, 30.6% with persistent AF), and evaluated the association of pre-AFCA anemia (haemoglobin <13 g/dL in men and <12 g/dL in women) and rhythm outcomes. We studied the mechanistic relationship between anemia and AF recurrence using a Mendelian randomization analysis (1775 subjects with genome-wide association study) after reviewing already proven 12 hemoglobin-associated genetic polymorphisms.<h4>Results</h4>The body mass index, paroxysmal AF, warfarin use, and baseline red cell distribution width were independently associated with anemia in patients with AF. During a 23-month follow-up (interval OR 9-48 months), the clinical AF recurrence rate was significantly higher in patients with than without anemia (log-rank p = 0.001; propensity score-matched log-rank p = 0.004). This pattern was more significant in male patients (Log-rank p < 0.001) or patients with paroxysmal AF (Log-rank p < 0.001). Anemia (hazard ratio [HR] 1.45 [1.17-1.80], p = 0.001), left atrial diameter (HR 1.03 [1.01-1.04], p < 0.001), a female sex (HR 1.17 [1.00-1.36], p = 0.047), and persistent AF (HR 1.58 [1.36-1.84], p < 0.001) were independently associated with post-AFCA clinical recurrence. In the Mendelian randomization, we could not find a significant direct causal relationship between anemia and AF recurrence at the genetic level.<h4>Conclusions</h4>Pre-AFCA anemia is an independent predictor of post-AFCA clinical recurrence, especially in male patients, without a genetically direct causal relationship.
Also flagged:antibodiespeptidespolynucleotidesheparinsodiumsalt
Journal Article2020-04-02✓ 2 SnippetsSouthan C.
In-Text Gene Mentions
Introduction)
…heparin case isSERPINC1(ATIII) the mechanism…
Introduction)
…case is SERPINC1 (ATIII) the mechanism is…
Show Full Abstract
Bioscientists reading papers or patents strive to discern the key relationships reported within a document "D" where a bioactivity "A" with a quantitative result "R" (e.g., an IC<sub>50</sub>) is reported for chemical structure "C" that modulates (e.g., inhibits) a protein target "P". A useful shorthand for this connectivity thus becomes DARCP. The problem at the core of this article is that the community has spent millions effectively burying these relationships in PDFs over many decades but must now spend millions more trying to get them back out. The key imperative for this is to increase the flow into structured open databases. The positive impacts will include expanded data mining opportunities for drug discovery and chemical biology. Over the last decade commercial sources have manually extracted DARCP from ≈300,000 documents encompassing ≈7 million compounds interacting with ≈10,000 targets. Over a similar time, the Guide to Pharmacology, BindingDB and ChEMBL have carried out analogues DARCP extractions. Although their expert-curated numbers are lower (i.e., ≈2 million compounds against ≈3700 human proteins), these open sources have the great advantage of being merged within PubChem. Parallel efforts have focused on the extraction of document-to-compound (D-C-only) connectivity. In the absence of molecular mechanism of action (mmoa) annotation, this is of less value but can be automatically extracted. This has been significantly accomplished for patents, (e.g., by IBM, SureChEMBL and WIPO) for over 30 million compounds in PubChem. These have recently been joined by 1.4 million D-C submissions from three major chemistry publishers. In addition, both the European and US PubMed Central portals now add chemistry look-ups from abstracts and full-text papers. However, the fully automated extraction of DARCLP has not yet been achieved. This stands in contrast to the ability of biocurators to discern these relationships in minutes. Unfortunately, no journals have yet instigated a flow of author-specified DARCP directly into open databases. Progress may come from trends such as open science, open access (OA), findable, accessible, interoperable and reusable (FAIR), resource description framework (RDF) and WikiData. However, we will need to await the technical applicability in respect to DARCP capture to see if this opens up connectivity.
Also flagged:ChodlCd200Aqp1Zcchc18limb developmentNdnf
Journal Article2020-04-02✓ 2 SnippetsHagner A, Shin W, Sinha S, Alpaugh W, Workentine M, Abbasi S, Rahmani W, Agabalyan N, Sharma N, Sparks H, Yoon J, Labit E, Cobb J, Dobrinski I, Biernaskie J.
In-Text Gene Mentions
I A O 0000326)
…Dcc…
Results)
…pairings such asDcc/Ntn1 and Edn3/Ednr(a/b) betwe…
Show Full Abstract
The adult hair follicle (HF) undergoes successive regeneration driven by resident epithelial stem cells and neighboring mesenchyme. Recent work described the existence of HF dermal stem cells (hfDSCs), but the genetic regulation of hfDSCs and their daughter cell lineages in HF regeneration remains unknown. Here we prospectively isolate functionally distinct mesenchymal compartment in the HF (dermal cup [DC; includes hfDSCs] and dermal papilla) and define the transcriptional programs involved in hfDSC function and acquisition of divergent mesenchymal fates. From this, we demonstrate cross-compartment mesenchymal signaling within the HF niche, whereby DP-derived R-spondins act to stimulate proliferation of both hfDSCs and epithelial progenitors during HF regeneration. Our findings describe unique transcriptional programs that underlie the functional heterogeneity among specialized fibroblasts within the adult HF and identify a novel regulator of mesenchymal progenitor function during tissue regeneration.
Also flagged:Hsp90heat shock protein 90rice blastrice sheath blightleaf rustfungicide
Journal Article2020-04-02No SnippetsNguyen HTT, Choi S, Kim S, Lee JH, Park AR, Yu NH, Yoon H, Bae CH, Yeo JH, Choi GJ, Son H, Kim JC.
Show Full Abstract
Endophytic fungi are great resources for the identification of useful natural products such as antimicrobial agents. In this study, we performed the antifungal screening of various plant endophytic fungi against the dollar spot pathogen <i>Sclerotinia homoeocarpa</i> and finally selected <i>Humicola</i> sp. JS-0112 as a potential biocontrol agent. The bioactive compound produced by the strain JS-0112 was identified as monorden known as an inhibitor of heat shock protein 90 (Hsp90). Monorden exhibited strong antagonistic activity against most tested plant pathogenic fungi particularly against tree pathogens and oomycetes with the minimum inhibitory concentration values less than 2.5 μg mL<sup>-1</sup>. Extensive <i>in planta</i> assays revealed that monorden effectively suppressed the development of several important plant diseases such as rice blast, rice sheath blight, wheat leaf rust, creeping bentgrass dollar spot, and cucumber damping-off. Especially, it showed much stronger disease control efficacy against cucumber damping-off than a synthetic fungicide chlorothalonil. Subsequent molecular genetic analysis of fission yeast and <i>Fusarium graminearum</i> suggested that Hsp90 is a major inhibitory target of monorden, and sequence variation among fungal Hsp90 is a determinant for the dissimilar monorden sensitivity of fungi. This is the first report dealing with the disease control efficacy and antifungal mechanism of monorden against fungal plant diseases and we believe that monorden can be used as a lead molecule for developing novel fungicides with new action mechanism for the control of plant diseases caused by fungi and oomycetes.
Also flagged:SPRY4Cisplatintumorsnon-small-cell lung cancerNSCLCpolymerase
Journal Article2020-04-02No SnippetsYe Y, Gu J, Liu P, Wang H, Jiang L, Lei T, Yu S, Han G, Wang Z.
Show Full Abstract
<h4>Purpose</h4>Long non-coding RNA (lncRNA) SPRY4 intronic transcript 1 (SPRY4-IT1) is reported to play important roles in the occurrence and development of many tumors. However, the possible role of SPRY4-IT1 in cisplatin (DDP) resistance of non-small-cell lung cancer (NSCLC) remains unclear. The aim of this study is to investigate the functions and molecular mechanisms underlying SPRY4-IT1 of cisplatin resistance in NSCLC.<h4>Methods</h4>Expression of SPRY4-IT1 was analyzed in A549 and cisplatin-resistant A549/DDP cell lines by quantitative real-time polymerase chain reaction (RT-qPCR). Overexpression techniques were applied to investigate the biological functions of SPRY4-IT1 in cisplatin-resistant A549/DDP cells. The effects of SPRY4-IT1 on proliferation and apoptosis were evaluated using cell counting kit-8 (CCK8) assays, colony formation assay and flow-cytometric analysis. The expressions of epithelial-mesenchymal transition (EMT)-associated proteins, including E-cadherin and Vimentin, were detected by Western blot. Microarray analysis was performed to identify the putative targets of SPRY4-IT1, which were further verified by Western blotting and RT-qPCR. A549/DDP cells transfected with pCDNA-SPRY4-IT1 were injected into nude mice in order to verify the effect of SPRY4-IT1 on cisplatin resistance in vivo.<h4>Results</h4>The present study demonstrated that SPRY4-IT1 expression was decreased in A549/DDP cells compared with parental A549 cells. Upregulation of SPRY4-IT1 suppressed cell proliferation and caused apoptosis of A549/DDP cells both in vitro and in vivo. MPZL-1 was negatively regulated by SPRY4-IT1. Furthermore, upregulation of SPRY4-IT1 and downregulation of MPZL-1 could suppress epithelial-mesenchymal transition (EMT), which was characterized by increased E-cadherin expression and decreased Vimentin expression.<h4>Conclusion</h4>Upregulation of SPRY4-IT1 reversed the cisplatin-resistant phenotype of NSCLC partially by downregulating MPZL-1 via inhibiting EMT process.
Also flagged:TumorLung Cancerlung carcinomaadenocarcinomasquamous cell carcinomasmall cell carcinoma
Journal Article2020-04-02No SnippetsBoler AK, Roy S, Bandyopadhyay A, Bandyopadhyay A, Ghosh MK.
Show Full Abstract
<h4>Background</h4>Being a minimally invasive diagnostic technique, Fine-Needle Aspiration Cytology (FNAC) has become the first-line test and corresponding aspirated material has become the target specimen for diagnosis and ancillary tests in lung carcinoma. Although the role of Cell Blocks (CBs) in diagnosis and in ancillary testing is well recognized in literature, limited attention has been paid to specimen procurement and triage in the preparation of CBs. In the present scenario, CBs are not consistently optimal because of its low cellularity.<h4>Aims</h4>This study is aimed to describe an improvised technique of specimen acquisition and cell block preparation in CT-guided FNACs of lung carcinoma cases in a resource-constrained center and to assess its efficacy for optimal representation of cellularity, morphology, and architecture.<h4>Materials and methods</h4>Total 85 lung carcinoma cases undergoing CT-guided FNAC in our center from February 2017 to January 2018 were included in this study. 4 to 5 direct smears and subsequent CBs were made from material obtained by single pass. Cellularity of smears and corresponding cell blocks were assessed and categorized according to a scoring system (score 1 to 3 for number of cells <50, 50-100, >100, respectively). Preserved architecture and morphology were also assessed in smears and CBs.<h4>Results</h4>The evaluated samples showed a cellularity score 3 in 65.4%CBs and score 2 in 24.7% CBs. Overall, 90.1% cell blocks had acceptable cellularity. Cell morphology was preserved in all CBs of acceptable cellularity, except for two adenocarcinoma, one squamous cell carcinoma, and one small cell carcinoma blocks. Cellular architecture was also preserved in all CBs of acceptable cellularity.<h4>Conclusions</h4>This simple improvised technique of CB preparation optimized its cellularity, morphology, and architectural preservation, even after adequate cellular FNA smears.
Also flagged:17α-EstradiolE2protein synthesissynthesisaging-
Journal Article2020-04-01✓ 1 SnippetMiller BF, Pharaoh GA, Hamilton KL, Peelor FF, Kirkland JL, Freeman WM, Mann SN, Kinter M, Price JC, Stout MB.
In-Text Gene Mentions
Text
…PRDX6…
Show Full Abstract
17α-Estradiol (17α-E2) is a "non-feminizing" estrogen that extends life span in male, but not female, mice. We recently reported that 17α-E2 had robust beneficial effects on metabolic and inflammatory parameters in aged male mice. However, it remains unclear if 17α-E2 also delays other "hallmarks" of aging, particularly maintaining proteostasis. Here, we used isotope labeling methods in older mice to examine proteostatic mechanisms. We compared weight-matched mild calorie restricted (CR) and 17α-E2 treated male mice with the hypothesis that 17α-E2 would increase protein synthesis for somatic maintenance. 17α-E2 had no effect on protein synthesis or DNA synthesis in multiple tissues, including white adipose tissue. Conversely, mild short-term CR decreased DNA synthesis and increased the protein to DNA synthesis ratio in multiple tissues. Examination of individual protein synthesis and content did not differentiate treatments, although it provided insight into the regulation of protein content between tissues. Contrary to our hypothesis, we did not see the predicted differences in protein to DNA synthesis following 17α-E2 treatment. However, mild short-term CR elicited differences consistent with both lifelong CR and other treatments that curtail aging processes. These data indicated that despite similar maintenance of body mass, 17α-E2 and CR treatments elicit distinctly different proteostatic outcomes.
Also flagged:psychological distressschizophreniaanxietydepressionaddictionanorexia
Journal Article2020-04-01✓ 2 SnippetsAdams MJ, Hill WD, Howard DM, Dashti HS, Davis KAS, Campbell A, Clarke TK, Deary IJ, Hayward C, Porteous D, Hotopf M, McIntosh AM.
In-Text Gene Mentions
Results)⭐ same-sentence co-mention
…genes, TNNI3K ,LRRIQ3, NEGR1 ,…
Results)⭐ same-sentence co-mention
…, LRRIQ3 ,NEGR1, FPGT and…
Show Full Abstract
<h4>Background</h4>People who opt to participate in scientific studies tend to be healthier, wealthier and more educated than the broader population. Although selection bias does not always pose a problem for analysing the relationships between exposures and diseases or other outcomes, it can lead to biased effect size estimates. Biased estimates may weaken the utility of genetic findings because the goal is often to make inferences in a new sample (such as in polygenic risk score analysis).<h4>Methods</h4>We used data from UK Biobank, Generation Scotland and Partners Biobank and conducted phenotypic and genome-wide association analyses on two phenotypes that reflected mental health data availability: (i) whether participants were contactable by e-mail for follow-up; and (ii) whether participants responded to follow-up surveys of mental health.<h4>Results</h4>In UK Biobank, we identified nine genetic loci associated (P <5 × 10-8) with e-mail contact and 25 loci associated with mental health survey completion. Both phenotypes were positively genetically correlated with higher educational attainment and better health and negatively genetically correlated with psychological distress and schizophrenia. One single nucleotide polymorphism association replicated along with the overall direction of effect of all association results.<h4>Conclusions</h4>Re-contact availability and follow-up participation can act as further genetic filters for data on mental health phenotypes.
Also flagged:Hypoparathyroidismendocrine disorderparathyroid hormonecognitive dysfunctionHPPTH
Journal Article2020-04-01✓ 1 SnippetBrod M, Waldman LT, Smith A, Karpf D.
In-Text Gene Mentions
Introduction)
…and prolonged hypomagnesemia,hemochromatosis, Wilson disease, metastasis,…
Show Full Abstract
<h4>Background and objective</h4>Hypoparathyroidism is a rare endocrine disorder characterized by absent or inappropriately low levels of circulating parathyroid hormone. Patients with hypoparathyroidism receiving standard-of-care therapy report debilitating physical and cognitive symptoms, which may indicate a reduced health-related quality of life. The purpose of this study was to develop a new disease-specific measure of the signs and symptoms of hypoparathyroidism, the Hypoparathyroidism Patient Experience Scale-Symptom (HPES-Symptom), and provide evidence for the content validity of items in the measure based on rigorous qualitative research methodologies for patient-reported outcome development.<h4>Methods</h4>Semi-structured, individual concept elicitation interviews were conducted with five clinical experts and 42 adults with hypoparathyroidism in the USA to identify the signs and symptoms of relevance and importance to those with the condition. Transcripts were coded and analyzed using an adapted grounded theory approach. Following item generation, cognitive debriefing interviews of the draft measure were conducted in an independent sample of 16 adults with hypoparathyroidism.<h4>Results</h4>One hundred percent of the concept elicitation patient sample reported experiencing physical symptoms that were attributed to hypoparathyroidism, including tingling/numbness/paresthesia (n = 37, 88%), muscle cramping (n = 36, 86%), and physical fatigue (n = 35, 83%). The majority of patients (n = 36, 86%) further reported experiencing cognitive dysfunction, including impaired memory (n = 24, 57%), impaired ability to have a conversation (n = 21, 50%), and lack of concentration/focus (n = 18, 43%). Seventeen major signs and symptoms were identified during item generation and included in the preliminary measure. After the cognitive debriefing, the 17-item HPES-Symptom was generated.<h4>Conclusions</h4>The findings provided evidence of content validity for the HPES-Symptom in US adults with hypoparathyroidism. Additional research is needed to validate the measure in patients with hypoparathyroidism to assess its psychometric properties.
Also flagged:hydrogensulfideage-related diseasescystathionine β-synthasecystathionine γ-lya-se3-mercaptopyruvate sulfurtransferase
Journal Article2020-04-01✓ 2 SnippetsTabassum R, Jeong NY, Jung J.
In-Text Gene Mentions
S I O 001029)
…HD is the autosomal-dominant neurodegenerative disorder that is caused by abnormal expansion of polyglutamine (CAG) repeats in the huntingtin (HTT) (An et al., 2012).…
S I O 001029)
…HD is a prototypical age-associated disease caused by CAG trinucleotide repeats in the HTT protein, for which neural dysfunction and death occur due to excitotoxicity, oxidative damage, and apoptosis.…
Show Full Abstract
Hydrogen sulfide (H<sub>2</sub>S) is a gasotransmitter that acts as an antioxidant and exhibits a wide variety of cytoprotective and physiological functions in age-associated diseases. One of the major causes of age-related diseases is oxidative stress. In recent years, the importance of H<sub>2</sub>S has become clear, although its antioxidant function has not yet been fully explored. The enzymes cystathionine β-synthase, cystathionine γ-lya-se, and 3-mercaptopyruvate sulfurtransferase are involved in the enzymatic production of H<sub>2</sub>S. Previously, H<sub>2</sub>S was considered a neuromodulator, given its role in long-term hippocampal potentiation, but it is now also recognized as an antioxidant in age-related neurodegeneration. Due to aerobic metabolism, the central nervous system is vulnerable to oxidative stress in brain aging, resulting in age-associated degenerative diseases. H<sub>2</sub>S exerts its antioxidant effect by limiting free radical reactions through the activation of antioxidant enzymes, including superoxide dismutase, catalase, and glutathione peroxidase, which protect against the effects of aging by regulating apoptosis-related genes, including p53, Bax, and Bcl-2. This review explores the implications and mechanisms of H<sub>2</sub>S as an antioxidant in age-associated neurodegenerative diseases, including Alzheimer's disease, Parkinson's disease, Huntington's disease, and Down syndrome.
Also flagged:axonalnerve injuriesoligodendrocyte precursor cell differentiationmyelinationpro-inflammatory cytokinesastrocyte
Journal Article2020-04-01✓ 1 SnippetNguyen LH, Ong W, Wang K, Wang M, Nizetic D, Chew SY.
In-Text Gene Mentions
Results)
…Sox6, Hes5, ZFP238, and…
Show Full Abstract
MiR-219 and miR-338 (miR-219/miR-338) are oligodendrocyte-specific microRNAs. The overexpression of these miRs in oligodendrocyte precursor cells promotes their differentiation and maturation into oligodendrocytes, which may enhance axonal remyelination after nerve injuries in the central nervous system (CNS). As such, the delivery of miR-219/miR-338 to the CNS to promote oligodendrocyte precursor cell differentiation, maturation and myelination could be a promising approach for nerve repair. However, nerve injuries in the CNS also involve other cell types, such as microglia and astrocytes. Herein, we investigated the effects of miR-219/miR-338 treatment on microglia and astrocytes in vitro and in vivo. We found that miR-219/miR-338 diminished microglial expression of pro-inflammatory cytokines and suppressed astrocyte activation. In addition, we showed that miR-219/miR-338 enhanced oligodendrocyte precursor cell differentiation and maturation in a scratch assay paradigm that re-created a nerve injury condition in vitro. Collectively, our results suggest miR-219/miR-338 as a promising treatment for axonal remyelination in the CNS following nerve injuries. All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC), Nanyang Technological University (approval No. A0309 and A0333) on April 27, 2016 and October 8, 2016.
Also flagged:Progesterone ReceptorinfertilityPGRgene expressionchromatinbinding
Journal Article2020-04-01No SnippetsChi RA, Wang T, Adams N, Wu SP, Young SL, Spencer TE, DeMayo F.
Show Full Abstract
<h4>Context</h4>Poor uterine receptivity is one major factor leading to pregnancy loss and infertility. Understanding the molecular events governing successful implantation is hence critical in combating infertility.<h4>Objective</h4>To define Progesterone Receptor (PGR)-regulated molecular mechanisms and epithelial roles in receptivity.<h4>Design</h4>RNA-sequencing and PGR-ChIP-seq were conducted in parallel to identify PGR-regulated pathways during the Window of implantation (WOI) in endometrium of fertile women.<h4>Setting</h4>Endometrial biopsies from the proliferative and mid-secretory phases were analyzed.<h4>Patients or other participants</h4>Participants were fertile, reproductive aged (18-37 years) women with normal cycle length, and without any history of dysmenorrhea, infertility, or irregular cycles. In total, 42 endometrial biopsies obtained from 42 women were analyzed in this study.<h4>Interventions</h4>There were no interventions during this study.<h4>Main outcome measures</h4>Here we measured the alterations in gene expression and PGR occupancy in the genome during the WOI, based on the hypothesis that PGR binds uterine chromatin cycle dependently to regulate genes involved in uterine cell differentiation and function.<h4>Results</h4>653 genes were identified with regulated PGR binding and differential expression during the WOI. These were involved in regulating inflammatory response, xenobiotic metabolism, epithelial mesenchymal transition, cell death, interleukin/Signal Transducer And Activator Of Transcription (STAT) signaling, estrogen response, and Mammalian target of rapamycin complex 1 (MTORC1) response. Transcriptome of the epithelium identified 3052 differentially expressed genes, of which 658 were uniquely regulated. Transcription factors Interferon Regulatory Factor 8 (IRF8) and Myocyte Enhancer Factor 2C (MEF2C) were found to be regulated in the epithelium during the WOI at the protein level, suggesting potentially important functions that are previously unrecognized.<h4>Conclusion</h4>PGR binds the genomic regions of genes regulating critical processes in uterine receptivity and function.
Huntington's disease (HD) is a neurodegenerative disorder characterized by involuntary movements, cognitive deficits, and psychiatric disturbances. Although evidence indicates that projections from motor cortical areas play a key role in the development of dysfunctional striatal activity and motor phenotype, little is known about the changes in cortical microcircuits and their role in the development of the HD phenotype. Here we used two-photon laser-scanning microscopy to evaluate network dynamics of motor cortical neurons in layers II/III in behaving transgenic R6/2 and knock-in Q175+/- mice. Symptomatic R6/2 mice displayed increased motion manifested by a significantly greater number of motion epochs, whereas symptomatic Q175 mice displayed decreased motion. In both models, calcium transients in symptomatic mice displayed reduced amplitude, suggesting decreased bursting activity. Changes in frequency were genotype- and time-dependent; for R6/2 mice, the frequency was reduced during both motion and nonmotion, whereas in symptomatic Q175 mice, the reduction only occurred during nonmotion. In presymptomatic Q175 mice, frequency was increased during both behavioral states. Interneuronal correlation coefficients were generally decreased in both models, suggesting disrupted interneuronal communication in HD cerebral cortex. These results indicate similar and contrasting effects of the HD mutation on cortical ensemble activity depending on mouse model and disease stage.
Also flagged:TuberculosisInfectionribonucleic acidgene expressiontuberculosis infectioninterferon gamma
Journal Article2020-04-01No SnippetsTornheim JA, Madugundu AK, Paradkar M, Fukutani KF, Queiroz ATL, Gupte N, Gupte AN, Kinikar A, Kulkarni V, Balasubramanian U, Sreenivasamurthy S, Raja R, Pradhan N, Shivakumar SVBY, Valvi C, Hanna LE, Andrade BB, Mave V, Pandey A, Gupta A, CTRIUMPh RePORT India Study Team.
Show Full Abstract
<h4>Background</h4>Gene expression profiling is emerging as a tool for tuberculosis diagnosis and treatment response monitoring, but limited data specific to Indian children and incident tuberculosis infection (TBI) exist.<h4>Methods</h4>Sixteen pediatric Indian tuberculosis cases were age- and sex-matched to 32 tuberculosis-exposed controls (13 developed incident TBI without subsequent active tuberculosis). Longitudinal samples were collected for ribonucleic acid sequencing. Differential expression analysis generated gene lists that identify tuberculosis diagnosis and tuberculosis treatment response. Data were compared with published gene lists. Population-specific risk score thresholds were calculated.<h4>Results</h4>Seventy-one genes identified tuberculosis diagnosis and 25 treatment response. Within-group expression was partially explained by age, sex, and incident TBI. Transient changes in gene expression were identified after both infection and treatment. Application of 27 published gene lists to our data found variable performance for tuberculosis diagnosis (sensitivity 0.38-1.00, specificity 0.48-0.93) and treatment response (sensitivity 0.70-0.80, specificity 0.40-0.80). Our gene lists found similarly variable performance when applied to published datasets for diagnosis (sensitivity 0.56-0.85, specificity 0.50-0.85) and treatment response (sensitivity 0.49- 0.86, specificity 0.50-0.84).<h4>Conclusions</h4>Gene expression profiles among Indian children with confirmed tuberculosis were distinct from adult-derived gene lists, highlighting the importance of including distinct populations in differential gene expression models.
Also flagged:calcium phosphatesilicadoxycycline hydrochloridemineralizationcalciumapatite
Journal Article2020-04-01No SnippetsProkopowicz M, Szewczyk A, Skwira A, Sądej R, Walker G.
Show Full Abstract
We reported the new biphasic composites of calcium phosphate and mesoporous silica material (CaP@MSi) in the form of powders and pellets as a potential bone drug delivery system for doxycycline hydrochloride (DOX). The CaP@MSi powders were synthesized by cationic surfactant-templating method. The effects of 10, 20, and 30% CaP content in the CaP@MSi powders on the molecular surface structure, the cytotoxicity against osteoblast cells in vitro, and the mineralization potential in simulated body fluid were investigated. The CaP@MSi characterized by the highest mineralization potential (30% CaP content) were used for DOX adsorption and pelletization process. The CaP which precipitated in the CaP@MSi composites was characterized as calcium-deficient with the Ca:P molar ratio between 1.0 and 1.2. The cytotoxicity assays demonstrated that the CaP content in MSi increases osteoblasts viability indicating the CaP@MSi (30% CaP content) as the most biocompatible. The combination of CaP and MSi was an effective strategy to improve the mineralization potential of parent material. Upon immersion in simulated body fluid, the CaP of composite converted into the bone-like apatite. The obtained pellets preserved the mineralization potential of CaP@MSi and provided the prolonged 5-day DOX release. The obtained biphasic CaP@MSi composites seem to have an application potential as bone-specific drug delivery system.
Also flagged:ironIron deficiencynutritional disorderferroptosisdeathintracerebral hemorrhage
Journal Article2020-04-01No SnippetsBartnikas TB, Steinbicker AU, Enns CA.
Show Full Abstract
<h4>Purpose of review</h4>This review summarizes recent basic science studies on homeostasis of iron, an essential dietary nutrient and potentially toxic metal, and explores the relevance of these studies to our understanding of trauma and related severe, acute events.<h4>Recent findings</h4>Recent studies in experimental models of iron homeostasis have added to our understanding of how iron levels are regulated in the body and how iron levels and iron-dependent biological processes contribute to trauma and related events. Iron deficiency, a common nutritional disorder, can impair critical organ function and wound and injury repair. Iron excess, typically because of genetic defects, can cause toxicity to tissues and, like iron deficiency, impair wound and injury repair. Finally, pharmacologic inhibition of ferroptosis, a novel form of iron-dependent cell death, is beneficial in animal models of cardiac, hepatic, and intestinal injury and intracerebral hemorrhage, suggesting that ferroptosis inhibitors could serve as novel therapeutic agents for trauma and related events.<h4>Summary</h4>Perturbations in iron homeostasis can contribute significantly to an individual's predisposition to trauma and their ability to recover posttrauma, whereas pharmacologic targeting of ferroptosis may attenuate severity of trauma-induced organ dysfunction.
Also flagged:cervical cancercancertumorcells proliferationluciferasecell cycle
Journal Article2020-04-01✓ 4 SnippetsChen Y, Song Y, Mi Y, Jin H, Cao J, Li H, Han L, Huang T, Zhang X, Ren S, Ma Q, Zou Z.
In-Text Gene Mentions
Title)
…cervical cancer cells by targeting SOX6…
Abstract)
…SOX6 downregulation mediated the oncogenic effects of miR-499a in cervical cancer…
Title)
…cells by targetingSOX6.…
Abstract)
…miR-499a-inducedSOX6downregulation mediated the…
Show Full Abstract
Emerging evidence has indicated that microRNAs are involved in multiple processes of cancer development. Previous studies have demonstrated that microRNA-499a (miR-499a) plays both oncogenic and tumor suppressive roles in several types of malignancies, and genetic variants in miR-499a are associated with the risk of cervical cancer. However, the biological roles of miR-499a in cervical cancer have not been investigated. Quantitative real-time PCR was used to assess miR-499a expression in cervical cancer cells. Mimics or inhibitor of miR-499a was transfected into cervical cancer cells to upregulate or downregulate miR-499a expression. The effects of miR-499a expression change on cervical cancer cells proliferation, colony formation, tumorigenesis, chemosensitivity, transwell migration and invasion were assessed. The potential targets of miR-499a were predicted using online database tools and validated using real-time PCR, Western blot and luciferase reporter experiments. miR-499a was significantly upregulated in cervical cancer cells. Moreover, overexpression of miR-499a significantly enhanced the proliferation, cell cycle progression, colony formation, apoptosis resistance, migration and invasion of cervical cancer cells, while inhibiting miR-499a showed the opposite effects. Further exploration demonstrated that Sex-determining region Y box 6 was the direct target of miR-499a. miR-499a-induced SOX6 downregulation mediated the oncogenic effects of miR-499a in cervical cancer. Inhibiting miR-499a could enhance the anticancer effects of cisplatin in the xenograft mouse model of cervical cancer. Our findings for the first time suggest that miRNA-499a may play an important role in the development of cervical cancer and could serve as a potential therapeutic target.
Journal Article2020-04-01No SnippetsKizny Gordon A, Phan HTT, Lipworth SI, Cheong E, Gottlieb T, George S, Peto TEA, Mathers AJ, Walker AS, Crook DW, Stoesser N.
Show Full Abstract
<h4>Background</h4>Hospital outbreaks of carbapenemase-producing organisms, such as blaIMP-4-containing organisms, are an increasing threat to patient safety.<h4>Objectives</h4>To investigate the genomic dynamics of a 10 year (2006-15) outbreak of blaIMP-4-containing organisms in a burns unit in a hospital in Sydney, Australia.<h4>Methods</h4>All carbapenem-non-susceptible or MDR clinical isolates (2006-15) and a random selection of equivalent or ESBL-producing environmental isolates (2012-15) were sequenced [short-read (Illumina), long-read (Oxford Nanopore Technology)]. Sequence data were used to assess genetic relatedness of isolates (Mash; mapping and recombination-adjusted phylogenies), perform in silico typing (MLST, resistance genes and plasmid replicons) and reconstruct a subset of blaIMP plasmids for comparative plasmid genomics.<h4>Results</h4>A total of 46/58 clinical and 67/96 environmental isolates contained blaIMP-4. All blaIMP-4-positive organisms contained five or more other resistance genes. Enterobacter cloacae was the predominant organism, with 12 other species mainly found in either the environment or patients, some persisting despite several cleaning methods. On phylogenetic analysis there were three genetic clusters of E. cloacae containing both clinical and environmental isolates, and an additional four clusters restricted to either reservoir. blaIMP-4 was mostly found as part of a cassette array (blaIMP-4-qacG2-aacA4-catB3) in a class 1 integron within a previously described IncM2 plasmid (pEl1573), with almost complete conservation of this cassette across the species over the 10 years. Several other plasmids were also implicated, including an IncF plasmid backbone not previously widely described in association with blaIMP-4.<h4>Conclusions</h4>Genetic backgrounds disseminating blaIMP-4 can persist, diversify and evolve amongst both human and environmental reservoirs during a prolonged outbreak despite intensive prevention efforts.
Also flagged:sleepinsomniabehavioralestradiolEscitaloprammenopause
Journal Article2020-04-01No SnippetsReed SD, LaCroix AZ, Anderson GL, Ensrud KE, Caan B, Carpenter JS, Cohen L, Diem SJ, Freeman EW, Joffe H, Larson JC, McCurry SM, Mitchell CM, Newton KM, Sternfeld B, Guthrie KA.
Show Full Abstract
<h4>Objective</h4>The Menopause Strategies: Finding Lasting Answers for Symptoms and Health clinical trials network was funded by the National Institutes of Health to find new ways to alleviate the most common, bothersome menopausal symptoms by designing and conducting multiple concurrent clinical intervention studies, accommodating a wide scope of populations and intervention strategies.<h4>Methods</h4>Trials were conducted in Boston, Indianapolis, Minneapolis, Oakland, Philadelphia, and Seattle, with the Data Coordinating Center in Seattle, and were designed with standardized eligibility criteria and endpoints. Primary outcomes focused on vasomotor symptoms, sleep quality and insomnia symptoms, and vaginal symptoms. Secondary outcomes included quality of life, sexual function, and mood.<h4>Results</h4>We completed five randomized clinical trials and three ancillary studies, testing nine interventions in over 1,300 women and collecting nearly 16,000 bio-specimens. Escitalopram, venlafaxine hydrochloride extended release, and low-dose estradiol diminished hot flashes by approximately 50% as compared with a 30% decrease by placebo. No benefits on vasomotor symptoms were observed with yoga or exercise compared with usual activity, nor with omega-3 supplementation compared with placebo. Cognitive behavioral therapy for insomnia reduced self-reported insomnia symptoms and improved overall sleep quality compared with menopause education control. We did not find significant benefit from a vaginal estradiol tablet or a vaginal moisturizer compared with placebo tablet and gel in diminishing the severity of vaginal symptoms.<h4>Conclusions</h4>The MsFLASH trials contributed substantially to our understanding of bothersome menopausal symptom treatment. It is important that clinicians counseling women about available treatment options consider all therapies-both nonhormonal and hormonal.
Also flagged:SPAcollagenasegene expressionlipiduncoupling protein 1mitochondria-related
Journal Article2020-04-01No SnippetsTaguchi K, Kajita K, Kitada Y, Fuwa M, Asano M, Ikeda T, Kajita T, Ishizuka T, Kojima I, Morita H.
Show Full Abstract
Despite extensive investigation, the mechanisms underlying adipogenesis are not fully understood. We previously identified proliferative cells in adipose tissue expressing adipocyte-specific genes, which were named small proliferative adipocytes (SPA). In this study, we investigated the characteristics and roles of SPA in adipose tissue. Epididymal and inguinal fat was digested by collagenase, and then SPA were separated by centrifugation from stromal vascular cells (SVC) and mature white adipocytes. To clarify the feature of gene expression in SPA, microarray and real-time PCR were performed. The expression of adipocyte-specific genes and several neuronal genes was increased in the order of SVC < SPA < mature white adipocytes. In addition, proliferin was detected only in SPA. SPA differentiated more effectively into lipid-laden cells than SVC. Moreover, differentiated SPA expressed uncoupling protein 1 and mitochondria-related genes more than differentiated SVC. Treatment of SPA with pioglitazone and CL316243, a specific β3-adrenergic receptor agonist, differentiated SPA into beige-like cells. Therefore, SPA are able to differentiate into beige cells. SPA isolated from epididymal fat (epididymal SPA), but not SPA from inguinal fat (inguinal SPA), expressed a marker of visceral adipocyte precursor, WT1. However, no significant differences were detected in the expression levels of adipocyte-specific genes or neuronal genes between epididymal and inguinal SPA. The ability to differentiate into lipid-laden cells in epididymal SPA was a little superior to that in inguinal SPA, whereas the ability to differentiate into beige-like cells was greater in inguinal SPA than epididymal SPA. In conclusion, SPA may be progenitors of beige cells.
Also flagged:portal vein thrombosisInheritedantithrombin deficiencyvenous thromboembolism
Journal Article2020-04-01✓ 5 SnippetsTeng XY, Han Y, Yin L, Xu FF, Liu ZJ.
In-Text Gene Mentions
Abstract)
…: Inherited antithrombin deficiency (OMIM 107300) is a rare autosomal dominant disorder that could increase the risk of venous thromboembolism and is usually caused by mutations of SERPINC1.…
Title)
…novel mutation ofSERPINC1in a patient…
Abstract)
…by mutations ofSERPINC1.…
Abstract)
…mutation in theSERPINC1gene in a…
Abstract)
…exon 2 ofSERPINC1gene (c.142G>A, p.P48S).…
Show Full Abstract
: Inherited antithrombin deficiency (OMIM 107300) is a rare autosomal dominant disorder that could increase the risk of venous thromboembolism and is usually caused by mutations of SERPINC1. Herein, we present a case of a novel mutation in the SERPINC1 gene in a Chinese patient. The patient was a 54-year-old man who presented with recurrent venous thromboembolism and was without a recent history of any precipitating factors. Whole exome sequencing and Sanger sequencing identified a novel heterozygous variant on exon 2 of SERPINC1 gene (c.142G>A, p.P48S).
Also flagged:RNF43Wntcolorectalsignet-ring cell carcinoma
Journal Article2020-04-01No SnippetsLi Y, Li J, Wang R, Zhang L, Fu G, Wang X, Wang Y, Fang C, Zhang D, Du D, Ma X, Pan M, Guo Q, Xu X, Hu X, Zhou Y, Mo S, Wang H, Gao J, Huang S, Liu Y, Cai S, Hua G, Peng J, Yu FX.
Also flagged:bindingRNA-binding proteinstranscription factorSox2amino-acidmetabolism
Journal Article2020-04-01✓ 1 SnippetHou L, Wei Y, Lin Y, Wang X, Lai Y, Yin M, Chen Y, Guo X, Wu S, Zhu Y, Yuan J, Tariq M, Li N, Sun H, Wang H, Zhang X, Chen J, Bao X, Jauch R.
In-Text Gene Mentions
Introduction)
…Sry andSox6colocalize with splicing…
Show Full Abstract
Some transcription factors that specifically bind double-stranded DNA appear to also function as RNA-binding proteins. Here, we demonstrate that the transcription factor Sox2 is able to directly bind RNA in vitro as well as in mouse and human cells. Sox2 targets RNA via a 60-amino-acid RNA binding motif (RBM) positioned C-terminally of the DNA binding high mobility group (HMG) box. Sox2 can associate with RNA and DNA simultaneously to form ternary RNA/Sox2/DNA complexes. Deletion of the RBM does not affect selection of target genes but mitigates binding to pluripotency related transcripts, switches exon usage and impairs the reprogramming of somatic cells to a pluripotent state. Our findings designate Sox2 as a multi-functional factor that associates with RNA whilst binding to cognate DNA sequences, suggesting that it may co-transcriptionally regulate RNA metabolism during somatic cell reprogramming.
Also flagged:bindingdetoxificationironbZIP-type transcription factorCBCYap5
Journal Article2020-04-01No SnippetsFurukawa T, Scheven MT, Misslinger M, Zhao C, Hoefgen S, Gsaller F, Lau J, Jöchl C, Donaldson I, Valiante V, Brakhage AA, Bromley MJ, Haas H, Hortschansky P.
Show Full Abstract
To sustain iron homeostasis, microorganisms have evolved fine-tuned mechanisms for uptake, storage and detoxification of the essential metal iron. In the human pathogen Aspergillus fumigatus, the fungal-specific bZIP-type transcription factor HapX coordinates adaption to both iron starvation and iron excess and is thereby crucial for virulence. Previous studies indicated that a HapX homodimer interacts with the CCAAT-binding complex (CBC) to cooperatively bind bipartite DNA motifs; however, the mode of HapX-DNA recognition had not been resolved. Here, combination of in vivo (genetics and ChIP-seq), in vitro (surface plasmon resonance) and phylogenetic analyses identified an astonishing plasticity of CBC:HapX:DNA interaction. DNA motifs recognized by the CBC:HapX protein complex comprise a bipartite DNA binding site 5'-CSAATN12RWT-3' and an additional 5'-TKAN-3' motif positioned 11-23 bp downstream of the CCAAT motif, i.e. occasionally overlapping the 3'-end of the bipartite binding site. Phylogenetic comparison taking advantage of 20 resolved Aspergillus species genomes revealed that DNA recognition by the CBC:HapX complex shows promoter-specific cross-species conservation rather than regulon-specific conservation. Moreover, we show that CBC:HapX interaction is absolutely required for all known functions of HapX. The plasticity of the CBC:HapX:DNA interaction permits fine tuning of CBC:HapX binding specificities that could support adaptation of pathogens to their host niches.
Journal Article2020-04-01No SnippetsNandyMazumdar M, Yin S, Paranjapye A, Kerschner JL, Swahn H, Ge A, Leir SH, Harris A.
Show Full Abstract
The CFTR gene lies within an invariant topologically associated domain (TAD) demarcated by CTCF and cohesin, but shows cell-type specific control mechanisms utilizing different cis-regulatory elements (CRE) within the TAD. Within the respiratory epithelium, more than one cell type expresses CFTR and the molecular mechanisms controlling its transcription are likely divergent between them. Here, we determine how two extragenic CREs that are prominent in epithelial cells in the lung, regulate expression of the gene. We showed earlier that these CREs, located at -44 and -35 kb upstream of the promoter, have strong cell-type-selective enhancer function. They are also responsive to inflammatory mediators and to oxidative stress, consistent with a key role in CF lung disease. Here, we use CRISPR/Cas9 technology to remove these CREs from the endogenous locus in human bronchial epithelial cells. Loss of either site extinguished CFTR expression and abolished long-range interactions between these sites and the gene promoter, suggesting non-redundant enhancers. The deletions also greatly reduced promoter interactions with the 5' TAD boundary. We show substantial recruitment of RNAPII to the -35 kb element and identify CEBPβ as a key activator of airway expression of CFTR, likely through occupancy at this CRE and the gene promoter.
Also flagged:mastocytosisSystemic mastocytosishematolymphoid neoplasmsKIThematologic neoplasmmast cell disease
Journal Article2020-04-01✓ 1 SnippetReiter A, George TI, Gotlib J.
In-Text Gene Mentions
Abstract)
…The approval of the multikinase/KIT inhibitor midostaurin has validated the paradigm of KIT inhibition in advSM, and the efficacy and safety of second-generation agents, such as the switch-control inhibitor ripretinib (DCC-2618) and the D816V-selective inhibitor avapritinib (BLU-285) are being further defined in ongoing clinical trials.…
Show Full Abstract
Systemic mastocytosis (SM) has greatly benefited from the broad application of precision medicine techniques to hematolymphoid neoplasms. Sensitive detection of the recurrent KIT D816V mutation and use of next-generation sequencing (NGS) panels to profile the genetic landscape of SM variants have been critical adjuncts to the diagnosis and subclassification of SM, and development of clinical-molecular prognostic scoring systems. Multilineage KIT involvement and multimutated clones are characteristic of advanced SM (advSM), especially SM with an associated hematologic neoplasm (AHN). A major challenge is how to integrate conventional markers of mast cell disease burden (percentage of bone marrow mast cell infiltration and serum tryptase levels) with molecular data (serial monitoring of both KIT D816V variant allele frequency and NGS panels) to lend more diagnostic and prognostic clarity to the heterogeneous clinical presentations and natural histories of advSM. The approval of the multikinase/KIT inhibitor midostaurin has validated the paradigm of KIT inhibition in advSM, and the efficacy and safety of second-generation agents, such as the switch-control inhibitor ripretinib (DCC-2618) and the D816V-selective inhibitor avapritinib (BLU-285) are being further defined in ongoing clinical trials. Looking forward, perhaps the most fruitful marriage of the advances in molecular genetics and treatment will be the design of adaptive basket trials that combine histopathology and genetic profiling to individualize treatment approaches for patients with diverse AHNs and relapsed/refractory SM.
Linker histones are epigenetic regulators that bind to nucleosomes and alter chromatin structures and dynamics. Biophysical studies have revealed two binding modes in the linker histone/nucleosome complex, the chromatosome, where the linker histone is either centered on or askew from the dyad axis. Each has been posited to have distinct effects on chromatin, however the molecular and thermodynamic mechanisms that drive them and their dependence on linker histone compositions remain poorly understood. We present molecular dynamics simulations of chromatosomes with the globular domain of two linker histone variants, generic H1 (genGH1) and H1.0 (GH1.0), to determine how their differences influence chromatosome structures, energetics and dynamics. Results show that both unbound linker histones adopt a single compact conformation. Upon binding, DNA flexibility is reduced, resulting in increased chromatosome compaction. While both variants enthalpically favor on-dyad binding, energetic benefits are significantly higher for GH1.0, suggesting that GH1.0 is more capable than genGH1 of overcoming the large entropic reduction required for on-dyad binding which helps rationalize experiments that have consistently demonstrated GH1.0 in on-dyad states but that show genGH1 in both locations. These simulations highlight the thermodynamic basis for different linker histone binding motifs, and details their physical and chemical effects on chromatosomes.
Also flagged:mitophagy3-nitropropionic acidmitochondrial complex-IIHuntington's diseaseHDmitochondria
Journal Article2020-04-01No SnippetsSubramaniam S.
Show Full Abstract
Mechanisms responsible for neuronal vulnerability in the brain remain unclear. Striatal neurons are preferentially damaged by 3-nitropropionic acid (3-NP), a mitochondrial complex-II inhibitor, causing striatal damage reminiscent of Huntington's disease (HD), but the mechanisms of the selectivity are not as well understood. We have discovered that Rhes, a protein enriched in the striatum, removes mitochondria via the mitophagy process. The process becomes intensified in the presence of 3-NP, thereby eliminating most of the mitochondria from the striatum. We put forward the hypothesis that Rhes acts as a 'mitophagy ligand' in the brain and promotes mitophagy via NIX, a mitophagy receptor. Since Rhes interacts and promotes toxicity in association with mutant huntingtin (mHTT), the genetic cause of HD, it is tempting to speculate on whether the exaggerated mitophagy may be a contributing factor to the striatal lesion found in HD. Thus, Rhes-mediated exaggerated mitophagy may act as a weapon of striatal destruction in the brain.
Also flagged:Attention-Deficit/Hyperactivity DisorderADHDneurodevelopmental disordersmethylphenidateatomoxetineCES1
Journal Article2020-04-01✓ 1 SnippetElsayed NA, Yamamoto KM, Froehlich TE.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Show Full Abstract
Multiple stimulant and non-stimulant medications are approved for the treatment of attention-deficit/hyperactivity disorder (ADHD), one of the most prevalent childhood neurodevelopmental disorders. Choosing among the available agents and determining the most effective ADHD medication for a given child can be a time-consuming process due to the high inter-individual variability in treatment efficacy. As a result, there is growing interest in identifying predictors of ADHD medication response in children through the burgeoning field of pharmacogenomics. This article reviews childhood ADHD pharmacogenomics efficacy studies published during the last decade (2009-2019), which have largely focused on pharmacodynamic candidate gene investigations of methylphenidate and atomoxetine response, with a smaller number investigating pharmacokinetic candidate genes and genome-wide approaches. Findings from studies which have advanced the field of ADHD pharmacogenomics through investigation of meta-analytic approaches and gene-gene interactions are also overviewed. Despite recent progress, no one genetic variant or currently available pharmacogenomics test has demonstrated clinical utility in pinpointing the optimal ADHD medication for a given individual patient, highlighting the need for further investigation.
Also flagged:Galectin-3cancernucleuscarbohydratecarbohydrate-binding proteincell proliferation
Journal Article2020-04-01✓ 1 SnippetKim SJ, Chun KH.
In-Text Gene Mentions
S I O 001029)
…Although neogenin-1 has significant sequence similarity (50% amino-acid identity) with the tumor suppressor molecule deleted in colon cancer (DCC) (86), but the expression is increased in gastric cancer patients (87).…
Show Full Abstract
Galectin-3 is a carbohydrate-binding protein and regulates diverse functions, including cell proliferation and differentiation, mRNA splicing, apoptosis induction, immune surveillance and inflammation, cell adhesion, angiogenesis, and cancer-cell metastasis. Galectin-3 is also recommended as a diagnostic or prognostic biomarker of various diseases, including heart disease, kidney disease, and cancer. Galectin-3 exists as a cytosol, is secreted in extracellular spaces on cells, and is also detected in nuclei. It has been found that galectin-3 has different functions in cellular localization: (i) Extracellular galectin-3 mediates cell attachment and detachment. (ii) cytosolic galectin-3 regulates cell survival by blocking the intrinsic apoptotic pathway, and (iii) nuclear galectin-3 supports the ability of the transcriptional factor for target gene expression. In this review, we focused on the role of galectin-3 on translocation from cytosol to nucleus, because it happens in a way independent of carbohydrate recognition and accelerates cancer progression. We also suggested here that intracellular galecin-3 could be a potent therapeutic target in cancer therapy. [BMB Reports 2020; 53(4): 173-180].
Also flagged:Plasminogenhepatic encephalopathyEnd-stage Liver DiseaseChronic Liver FailureHepatitisthyroid-stimulating hormone
Journal Article2020-04-01No SnippetsWu D, Zhang S, Xie Z, Chen E, Rao Q, Liu X, Huang K, Yang J, Xiao L, Ji F, Jiang Z, Zhao Y, Ouyang X, Zhu D, Dai X, Hou Z, Liu B, Deng B, Zhou N, Gao H, Sun Z, Li L.
Show Full Abstract
BACKGROUNDHBV-related acute-on-chronic liver failure (HBV-ACLF) is hallmarked by high short-term mortality rates, calling for accurate prognostic biomarkers for initial risk stratification.METHODSThree tandem mass tag-labeled (TMT-labeled) quantitative proteomic studies were performed on 10 patients with HBV-related acute hepatic decompensation and on 20 patients with HBV-ACLF. Candidate biomarkers were preliminarily verified in a cross-sectional cohort (n = 144) and further confirmed in 2 prospective cohorts (n = 207 and n = 148).RESULTSPlasminogen, a potential prognostic biomarker for HBV-ACLF, was identified by TMT quantitative proteomics and preliminarily verified in the cross-sectional cohort. Further validation with a prospective cohort (n = 207) showed that plasminogen levels at admission were significantly lower (P < 0.001) in HBV-ACLF nonsurvivors than in survivors. The cumulative survival duration of patients with high plasminogen levels was significantly longer (P < 0.001) than that of patients with low plasminogen levels. During hospitalization, plasminogen levels significantly decreased (P = 0.008) in the deterioration group but significantly increased (P < 0.001) in the improvement group. Additionally, plasminogen levels gradually increased in survivors but gradually decreased in nonsurvivors. The P5 score, a prognostic panel incorporating plasminogen levels, hepatic encephalopathy occurrence, age, international normalized ratio (INR), and total bilirubin, was significantly superior to the Child-Pugh, Model for End-stage Liver Disease (MELD), Chronic Liver Failure Consortium ACLF (CLIF-C ACLF), Chinese Group on the Study of Severe Hepatitis B (COSSH), and HINT (a prognostic score based on hepatic encephalopathy occurrence, INR, neutrophil count, and thyroid-stimulating hormone) scores (all P < 0.05). The performances of the plasminogen level and P5 score were validated in a second multicenter, prospective cohort (n = 148).CONCLUSIONSPlasminogen is a promising prognostic biomarker for HBV-ACLF, and sequential plasminogen measurements could profile the clinical course of HBV-ACLF. P5 is a high-performance prognostic score for HBV-ACLF.FUNDINGThe National Key Research and Development Program (2017YFC1200204); the National Natural Science Foundation of China (81400589, 81600497); the Foundation for Innovative Research Groups of the National Natural Science Foundation of China (81121002); the Chinese High-Tech Research and Development Programs (2012AA020204); the National S&T Major Project (2012ZX10002004); and the Zhejiang Provincial Medicine and Health Science and Technology Project (2016147735).
…In addition, an estimated 24,000 Germans carry the HD mutation in the huntingtin (HTT) gene and will develop HD during their lifetime.…
Abstract)
…in the huntingtin (HTT) gene and will…
Show Full Abstract
In Germany at least 8000 and probably up to ca. 14,000 people currently suffer from clinically manifest Huntington's disease (HD). In addition, an estimated 24,000 Germans carry the HD mutation in the huntingtin (HTT) gene and will develop HD during their lifetime. Although HD is a rare neurodegenerative disease, it is currently in the focus of general medical interest: clinical trials have begun that provide a rational basis for hope to slow down the so far relentless progression of the disease, ultimately resulting in patients becoming entirely dependent on nursing care. If treatment is started early enough it may be possible to mitigate the clinical manifestation of HD. These innovative therapeutic approaches aim at inhibiting the de novo production of mutant HTT gene products. A first clinical drug trial to demonstrate the efficacy (phase III) of intrathecal antisense oligonucleotides (ASO, active substance RG6042) was started in 2019. Additional clinical studies on alternative treatment approaches with allele-selective ASOs as well as gene therapeutic approaches using RNA molecules and zinc finger repressor complexes are imminent. This article gives an overview of the current gene-selective therapeutic approaches in HD under discussion.
Also flagged:oxygencatalasemembranewatersuperoxide dismutasehydrogen
Journal Article2020-04-01No SnippetsZafar SA, Hameed A, Ashraf M, Khan AS, Qamar ZU, Li X, Siddique KHM.
Show Full Abstract
Climatic variations have increased the occurrence of heat stress during critical growth stages, which negatively affects grain yield in rice. Plants adapt to harsh environments, and particularly high-temperature stress, by regulating their physiological and biochemical processes, which are key tolerance mechanisms. The identification of heat-tolerant rice genotypes and reliable selection indices are crucial for rice improvement programs. Here, we evaluated the response of a rice mutant population for high-temperature stress at the seedling and reproductive stages based on agronomic, physiological and molecular indices. Estimates of variance components revealed significant differences (P < 0.001) among genotypes, treatments and their interactions for almost all traits. The principal component analysis showed significant diversity among genotypes and traits under high-temperature stress. The mutant HTT-121 was identified as the most heat-tolerant mutant with higher grain yield, panicle fertility, cell membrane thermo-stability (CMTS) and antioxidant enzyme levels under heat stress. Various seedling-based morpho-physiological traits (leaf fresh weight, relative water contents, malondialdehyde, CMTS) and biochemical traits (superoxide dismutase, catalase and hydrogen peroxide) explained variations in grain yield that could be used as selection indices for heat tolerance in rice during early growth. Notably, heat-sensitive mutants accumulated reactive oxygen species, reduced catalase activity and upregulated OsSRFP1 expression under heat stress, suggesting their key roles in regulating heat tolerance in rice. The heat-tolerant mutants identified in this study could be used in breeding programs and to develop mapping populations to unravel the underlying genetic architecture for heat-stress adaptability.
Also flagged:tight junction proteinsfunctional dyspepsia1OCLNreverse transcriptionurease
Journal Article2020-04-01No SnippetsLee JY, Kim N, Choi YJ, Park JH, Ashktorab H, Smoot DT, Lee DH.
Show Full Abstract
<h4>Background/aims</h4>To determine whether the expression of tight junction proteins (TJPs) differs depending on the subtype of functional dyspepsia (FD) and sex.<h4>Methods</h4>Control (n = 95) and FD (n = 165) groups based on Rome III criteria were prospectively enrolled. Gastric mucosal mRNA expression levels of various TJPs (claudins [CLDN] 1, 2, and 4; zonula occludens-1; occludin [OCLN]) were assessed by reverse transcription polymerase chain reaction. Western blot was performed to determine the levels of various TJPs. <i>Helicobacter pylori</i> infection status was evaluated by histology, rapid urease test, and culture. Questionnaires were analyzed.<h4>Results</h4>In all groups irrespective of <i>H. pylori</i> , FD group showed significantly higher CLDN2 mRNA levels than control group (<i>P</i> = 0.048). The level of CLDN4 mRNA expression was significantly lower in female FD group than in male FD group (<i>P</i> = 0.018). In <i>H. pylori</i> uninfected subjects, the level of CLDN1 mRNA expression in female FD group was significantly lower than that of male FD group (<i>P</i> = 0.014). The level of CLDN2 mRNA expression was significantly higher in the male postprandial distress syndrome (<i>P</i> = 0.001) and male epigastric pain syndrome (<i>P</i> = 0.023) groups than in the male control group. In Western blot analysis, the expression of OCLN was significantly elevated 48 hour after the culture with <i>H. pylori</i> strain 43504.<h4>Conclusions</h4><i>H. pylori</i> can affect a variety of TJPs, particularly claudin-4 and occludin. Claudin-2 is thought to be involved in FD irrespective of <i>H. pylori</i> status, especially in the pathophysiology of male FD.
The nutraceutical Nicotinamide Riboside (NR), an efficacious biosynthetic precursor to NAD, is readily metabolized by the purine nucleoside phosphorylase (PNP). Access to the PNP-stable versions of NR is difficult because the glycosidic bond of NR is easily cleaved. Unlike NR, NRH, the reduced form of NR, offers sufficient chemical stability to allow the successful functionalisation of the ribosyl-moiety. Here, we report on a series of NRH and NR derived amino acid conjugates, generated in good to excellent yields and show that O5'-esterification prevents the PNP-catalyzed phosphorolysis of these NR prodrugs.
Also flagged:Ras homolog enriched in the striatumvesiclessynapsesgap junctionsD1RD2R
Journal Article2020-04-01No SnippetsSubramaniam S.
Show Full Abstract
Ras homolog enriched in the striatum (Rhes) is a striatal enriched protein that promotes the formation of thin membranous tubes resembling tunneling nanotubes (TNT)-"Rhes tunnels"-that connect neighboring cell and transport cargoes: vesicles and proteins between the neuronal cells. Here the literature on TNT-like structures is reviewed, and the implications of Rhes-mediated TNT, the mechanisms of its formation, and its potential in novel cell-to-cell communication in regulating striatal biology and disease are emphasized. Thought-provoking ideas regarding how Rhes-mediated TNT, if it exists, in vivo, would radically change the way neurons communicate in the brain are discussed.
Also flagged:Rhabdomyosarcomasoft-tissue sarcomaembryonal rhabdomyosarcomaERMStumorundifferentiated pleomorphic sarcoma
Journal Article2020-04-01✓ 3 SnippetsRicker CA, Crawford K, Matlock K, Lathara M, Seguin B, Rudzinski ER, Berlow NE, Keller C.
In-Text Gene Mentions
Results)
…Both the patient and the cell lines were found to have mutations in TP53, BUB1B, APC, ATRX, HRAS, ATR, CPS1, AURKA, LAG3, MUC16, AURKB, SYNE1, PKHD1, FOS, DCC, CHD9, ALK, and CENPF. Hierarchical clustering of the top 1000 genes with highest expression level in the patient's tumor sample (Supplemental Fig. S1) clusters the patient's tumor sample away from the other samples, perhaps indicating that the genes that are most highly expressed in the patient's tumor have uniquely high expression levels compared to the cohort.…
Results)
…in BUB1B ,DCC, DICER1 ,…
Results)
…SYNE1, PKHD1, FOS,DCC, CHD9, ALK ,…
Show Full Abstract
Rhabdomyosarcoma (RMS) is the most common childhood soft-tissue sarcoma. The largest subtype of RMS is embryonal rhabdomyosarcoma (ERMS) and accounts for 53% of all RMS. ERMS typically occurs in the head and neck region, bladder, or reproductive organs and portends a promising prognosis when localized; however, when metastatic the 5-yr overall survival rate is ∼43%. The genomic landscape of ERMS demonstrates a range of putative driver mutations, and thus the recognition of the pathological mechanisms driving tumor maintenance should be critical for identifying effective targeted treatments at the level of the individual patients. Here, we report genomic, phenotypic, and bioinformatic analyses for a case of a 3-yr-old male who presented with bladder ERMS. Additionally, we use an unsupervised agglomerative clustering analysis of RNA and whole-exome sequencing data across ERMS and undifferentiated pleomorphic sarcoma (UPS) tumor samples to determine several major endotypes inferring potential targeted treatments for a spectrum of pediatric ERMS patient cases.
Journal Article2020-04-01No SnippetsHeimroth RD, Casadei E, Salinas I.
Show Full Abstract
The adaptive immune system of all jawed vertebrates relies on the presence of B and T cell lymphocytes that aggregate in specific body sites to form primary and secondary lymphoid structures. Secondary lymphoid organs include organized MALT (<i>O</i>-MALT) such as the tonsils and Peyer patches. <i>O</i>-MALT became progressively organized during vertebrate evolution, and the TNF superfamily of genes has been identified as essential for the formation and maintenance of <i>O</i>-MALT and other secondary and tertiary lymphoid structures in mammals. Yet, the molecular drivers of <i>O</i>-MALT structures found in ectotherms and birds remain essentially unknown. In this study, we provide evidence that TNFSFs, such as lymphotoxins, are likely not a universal mechanism to maintain <i>O</i>-MALT structures in adulthood of teleost fish, sarcopterygian fish, or birds. Although a role for TNFSF2 (TNF-α) cannot be ruled out, transcriptomics suggest that maintenance of <i>O</i>-MALT in nonmammalian vertebrates relies on expression of diverse genes with shared biological functions in neuronal signaling. Importantly, we identify that expression of many genes with olfactory function is a unique feature of mammalian Peyer patches but not the <i>O</i>-MALT of birds or ectotherms. These results provide a new view of <i>O</i>-MALT evolution in vertebrates and indicate that different genes with shared biological functions may have driven the formation of these lymphoid structures by a process of convergent evolution.
Also flagged:scaffold proteinsCBPIQGAP1gene expressionCREB-binding proteinHAT
Journal Article2020-04-01✓ 4 SnippetsKosol S, Contreras-Martos S, Piai A, Varadi M, Lazar T, Bekesi A, Lebrun P, Felli IC, Pierattelli R, Tompa P.
In-Text Gene Mentions
Discussion)
…It is of note that huntingtin (Htt) protein, associated with the neurodegenerative disease Huntington’s disease, was observed to interact “in vitro” with the HAT domains of PCAF, CBP and p300 and to inhibit their HAT activity50.…
Abstract)
…(CBP) and theRas GTPase-activating-like protein 1GTPase-activating-like protein…
Discussion)
…interaction with theRas GTPase-activating-like protein 1GTPase-activating-like protein…
Discussion)
…note that huntingtin (Htt) protein, associated with…
Show Full Abstract
Crosstalk between cellular pathways is often mediated through scaffold proteins that function as platforms for the assembly of signaling complexes. Based on yeast two-hybrid analysis, we report here the interaction between two complex scaffold proteins, CREB-binding protein (CBP) and the Ras GTPase-activating-like protein 1 (IQGAP1). Dissection of the interaction between the two proteins reveals that the central, thus far uncharacterized, region of IQGAP1 interacts with the HAT domain and the C-terminal intrinsically disordered region of CBP (termed ID5). Structural analysis of ID5 by solution NMR spectroscopy and SAXS reveals the presence of two regions with pronounced helical propensity. The ID5 region(s) involved in the interaction of nanomolar affinity were delineated by solution NMR titrations and pull-down assays. Moreover, we found that IQGAP1 acts as an inhibitor of the histone acetyltransferase (HAT) activity of CBP. In in vitro assays, the CBP-binding region of IQGAP1 positively and negatively regulates the function of HAT proteins of different families including CBP, KAT5 and PCAF. As many signaling pathways converge on CBP and IQGAP1, their interaction provides an interface between transcription regulation and the coordination of cytoskeleton. Disruption or alteration of the interaction between these scaffold proteins may lead to cancer development or metastatic processes, highlighting the importance of this interaction.
Journal Article2020-04-01✓ 5 SnippetsRistic B, Sivaprakasam S, Narayanan M, Ganapathy V.
In-Text Gene Mentions
I A O 0000326)
…Hfe…
Introduction)
…These studies demonstrate that Hfe−/− mice have hyperuricemia and that decreased excretion of UA in the intestine via down-regulation of the UA exporter ABCG2 is likely to be the principal contributor to this phenomenon.…
Results)
…We found that the serum creatinine levels did not differ between the two groups (Supplementary Figure S1B), suggesting that there is no difference in glomerular filtration rate between wild type and Hfe−/− mice (males, 7-month-old).…
Abstract)
…Hereditary hemochromatosis (HH) is mostly caused by mutations in the iron-regulatory gene HFE. The disease is associated with iron overload, resulting in liver cirrhosis/cancer, cardiomegaly, kidney dysfunction, diabetes, and arthritis.…
Results)
…As hyperuricemia was found in Hfe−/− mice as well as in Abcg2−/− mice, we became curious about a possible connection between HFE and ABCG2.…
Show Full Abstract
Hereditary hemochromatosis (HH) is mostly caused by mutations in the iron-regulatory gene HFE. The disease is associated with iron overload, resulting in liver cirrhosis/cancer, cardiomegaly, kidney dysfunction, diabetes, and arthritis. Fe2+-induced oxidative damage is suspected in the etiology of these symptoms. Here we examined, using Hfe-/- mice, whether disruption of uric acid (UA) homeostasis plays any role in HH-associated arthritis. We detected elevated levels of UA in serum and intestine in Hfe-/- mice compared with controls. Though the expression of xanthine oxidase, which generates UA, was not different in liver and intestine between wild type and Hfe-/- mice, the enzymatic activity was higher in Hfe-/- mice. We then examined various transporters involved in UA absorption/excretion. Glut9 expression did not change; however, there was an increase in Mrp4 and a decrease in Abcg2 in Hfe-/- mice. As ABCG2 mediates intestinal excretion of UA and mutations in ABCG2 cause hyperuricemia, we examined the potential connection between iron and ABCG2. We found p53-responsive elements in hABCG2 promoter and confirmed with chromatin immunoprecipitation that p53 binds to this promoter. p53 protein was reduced in Hfe-/- mouse intestine. p53 is a heme-binding protein and p53-heme complex is subjected to proteasomal degradation. We conclude that iron/heme overload in HH increases xanthine oxidase activity and also promotes p53 degradation resulting in decreased ABCG2 expression. As a result, systemic UA production is increased and intestinal excretion of UA via ABCG2 is decreased, causing serum and tissue accumulation of UA, a potential factor in the etiology of HH-associated arthritis.
Also flagged:abdominal obesityosteoporosisIFNGPRKCQluciferaseFNK
Journal Article2020-04-01✓ 1 SnippetLiu L, Yang XL, Zhang H, Zhang ZJ, Wei XT, Feng GJ, Liu J, Peng HP, Hai R, Shen H, Tian Q, Deng HW, Pei YF, Zhang L.
In-Text Gene Mentions
I A O 0000326)
…SOX6…
Show Full Abstract
Aiming to uncover a shared genetic basis of abdominal obesity and osteoporosis, we performed a bivariate GWAS meta-analysis of femoral neck BMD (FNK-BMD) and trunk fat mass adjusted by trunk lean mass (TFM<sub>adj</sub>) in 11,496 subjects from 6 samples, followed by in silico replication in the large-scale UK Biobank (UKB) cohort. A series of functional investigations were conducted on the identified variants. Bivariate GWAS meta-analysis identified two novel pleiotropic loci 12q15 (lead SNP rs73134637, p = 3.45 × 10<sup>-7</sup>) and 10p14 (lead SNP rs2892347, p = 2.63 × 10<sup>-7</sup>) that were suggestively associated and that were replicated in the analyses of related traits in the UKB sample (osteoporosis p = 0.06 and 0.02, BMI p = 0.03 and 4.61 × 10<sup>-3</sup>, N up to 499,520). Cis-eQTL analysis demonstrated that allele C at rs73134637 was positively associated with IFNG expression in whole blood (N = 369, p = 0.04), and allele A at rs11254759 (10p14, p = 9.49 × 10<sup>-7</sup>) was negatively associated with PRKCQ expression in visceral adipose tissue (N = 313, p = 0.04) and in lymphocytes (N = 117, p = 0.03). As a proof-of-principle experiment, the function of rs11254759, which is 235 kb 5'-upstream from PRKCQ gene, was investigated by the dual-luciferase reporter assay, which clearly showed that the haplotype carrying rs11254759 regulated PRKCQ expression by upregulating PRKCQ promoter activity (p = 4.60 × 10<sup>-7</sup>) in an allelic specific manner. Mouse model analysis showed that heterozygous PRKCQ deficient mice presented decreased fat mass compared to wild-type control mice (p = 3.30 × 10<sup>-3</sup>). Mendelian randomization analysis demonstrated that both FNK-BMD and TFM<sub>adj</sub> were causally associated with fracture risk (p = 1.26 × 10<sup>-23</sup> and 1.18 × 10<sup>-11</sup>). Our findings may provide useful insights into the genetic association between osteoporosis and abdominal obesity.
Also flagged:L-GlucoseCancerous tumorscancersugartumormitochondrial
Journal Article2020-04-01No SnippetsOno K, Takigawa S, Yamada K.
Show Full Abstract
Cancerous tumors comprise cells showing metabolic heterogeneity. Among numerous efforts to understand this property, little attention has been paid to the possibility that cancer cells take up and utilize otherwise unusable substrates as fuel. Here we discuss this issue by focusing on L-glucose, the mirror image isomer of naturally occurring D-glucose; L-glucose is an unmetabolizable sugar except in some bacteria. By combining relatively small fluorophores with L-glucose, we generated fluorescence-emitting L-glucose tracers (fLGs). To our surprise, 2-NBDLG, one of these fLGs, which we thought to be merely a control substrate for the fluorescent D-glucose tracer 2-NBDG, was specifically taken up into tumor cell aggregates (spheroids) that exhibited nuclear heterogeneity, a major cytological feature of malignancy in cancer diagnosis. Changes in mitochondrial activity were also associated with the spheroids taking up fLG. To better understand these phenomena, we review here the Warburg effect as well as key studies regarding glucose uptake. We also discuss tumor heterogeneity involving aberrant uptake of glucose and mitochondrial changes based on the data obtained by fLG. We then consider the use of fLGs as novel markers for visualization and characterization of malignant tumor cells.
Vertebrate segmentation is regulated by the segmentation clock, a biological oscillator that controls periodic formation of somites, or embryonic segments, which give rise to many mesodermal tissue types. This molecular oscillator generates cyclic gene expression with the same periodicity as somite formation in the presomitic mesoderm (PSM), an area of mesenchymal cells that give rise to mature somites. Molecular components of the clock include the Hes/her family of genes that encode transcriptional repressors, but additional genes cycle. Cyclic gene transcripts are cleared rapidly, and clearance depends upon the pnrc2 (proline-rich nuclear receptor co-activator 2) gene that encodes an mRNA decay adaptor. Previously, we showed that the her1 3'UTR confers instability to otherwise stable transcripts in a Pnrc2-dependent manner, however, the molecular mechanism(s) by which cyclic gene transcripts are cleared remained largely unknown. To identify features of the her1 3'UTR that are critical for Pnrc2-mediated decay, we developed an array of transgenic inducible reporter lines carrying different regions of the 3'UTR. We find that the terminal 179 nucleotides (nts) of the her1 3'UTR are necessary and sufficient to confer rapid instability. Additionally, we show that the 3'UTR of another cyclic gene, deltaC (dlc), also confers Pnrc2-dependent instability. Motif analysis reveals that both her1 and dlc 3'UTRs contain terminally-located Pumilio response elements (PREs) and AU-rich elements (AREs), and we show that the PRE and ARE in the last 179 nts of the her1 3'UTR drive rapid turnover of reporter mRNA. Finally, we show that mutation of Pnrc2 residues and domains that are known to facilitate interaction of human PNRC2 with decay factors DCP1A and UPF1 reduce the ability of Pnrc2 to restore normal cyclic gene expression in pnrc2 mutant embryos. Our findings suggest that Pnrc2 interacts with decay machinery components and cooperates with Pumilio (Pum) proteins and ARE-binding proteins to promote rapid turnover of cyclic gene transcripts during somitogenesis.
Also flagged:MACROD2hepatocellular carcinomaGSK-3βcancertumorglycogen synthase kinase-3β
Journal Article2020-04-01No SnippetsZhou ZJ, Luo CB, Xin HY, Hu ZQ, Zhu GQ, Li J, Zhou SL.
Show Full Abstract
Structural variations (SVs) influence the development and progression of multiple types of cancer. The genes affected by SVs in hepatocellular carcinoma (HCC) and their contribution to tumor growth and metastasis remain unknown. In this study, through whole-genome sequencing (WGS), we identified <i>MACROD2</i> as the gene most frequently affected by SVs, which were associated with low MACROD2 expression levels. Low MACROD2 expression was predictive of tumor recurrence and poor overall survival. MACROD2 expression was decreased in HCC cell lines, especially those with high metastatic potential. MACROD2 knockdown in HCC cells markedly enhanced proliferation and invasiveness in vitro and tumor progression in vivo and promoted epithelial-mesenchymal transition (EMT). By contrast, MACROD2 overexpression reversed EMT and inhibited HCC growth and metastasis. Mechanistically, MACROD2 deficiency suppressed glycogen synthase kinase-3β (GSK-3β) activity and activated β-catenin signaling, which mediated the effect of MACROD2 on HCC. In clinical HCC samples, decreased MACROD2 expression was correlated with the activation of GSK-3β/β-catenin signaling and the EMT phenotype. Overall, our results revealed that MACROD2 is frequently affected by SVs in HCC, and its deficiency promotes tumor growth and metastasis by activating GSK-3β/β-catenin signaling.
Journal Article2020-04-01No SnippetsDrainas AP, Lambuta RA, Ivanova I, Serçin Ö, Sarropoulos I, Smith ML, Efthymiopoulos T, Raeder B, Stütz AM, Waszak SM, Mardin BR, Korbel JO.
Show Full Abstract
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays in isogenic cell lines. Loss of several known tumor suppressors enhances cellular proliferation and transformation. Loss of neddylation pathway genes promotes uncontrolled proliferation exclusively in TP53-deficient cells. Combined loss of CUL3 and TP53 activates an oncogenic transcriptional program governed by the nuclear factor κB (NF-κB), AP-1, and transforming growth factor β (TGF-β) pathways. This program maintains persistent cellular proliferation, induces partial epithelial to mesenchymal transition, and increases DNA damage, genomic instability, and chromosomal rearrangements. Our findings reveal CUL3 loss as a key event stimulating persistent proliferation in TP53-deficient cells. These findings may be clinically relevant, since TP53-CUL3-deficient cells are highly sensitive to ataxia telangiectasia mutated (ATM) inhibition, exposing a vulnerability that could be exploited for cancer treatment.
Also flagged:Insulin-Like Growth Factorsimmune-mediated diseasesinsulin-like growth factorIGFIGF receptorcell differentiation
Journal Article2020-04-01No SnippetsDiToro D, Harbour SN, Bando JK, Benavides G, Witte S, Laufer VA, Moseley C, Singer JR, Frey B, Turner H, Bruning J, Darley-Usmar V, Gao M, Conover C, Hatton RD, Frank S, Colonna M, Weaver CT.
Show Full Abstract
Appropriate balance of T helper 17 (Th17) and regulatory T (Treg) cells maintains immune tolerance and host defense. Disruption of Th17-Treg cell balance is implicated in a number of immune-mediated diseases, many of which display dysregulation of the insulin-like growth factor (IGF) system. Here, we show that, among effector T cell subsets, Th17 and Treg cells selectively expressed multiple components of the IGF system. Signaling through IGF receptor (IGF1R) activated the protein kinase B-mammalian target of rapamycin (AKT-mTOR) pathway, increased aerobic glycolysis, favored Th17 cell differentiation over that of Treg cells, and promoted a heightened pro-inflammatory gene expression signature. Group 3 innate lymphoid cells (ILC3s), but not ILC1s or ILC2s, were similarly responsive to IGF signaling. Mice with deficiency of IGF1R targeted to T cells failed to fully develop disease in the experimental autoimmune encephalomyelitis (EAE) model of multiple sclerosis. Thus, the IGF system represents a previously unappreciated pathway by which type 3 immunity is modulated and immune-mediated pathogenesis controlled.
Also flagged:AMPA-type glutamate receptorsAMPA-type glutamate receptorCKAMP52GluA2vestibulo-ocular reflexsynaptosomes
Journal Article2020-04-01✓ 5 SnippetsPeter S, Urbanus BHA, Klaassen RV, Wu B, Boele HJ, Azizi S, Slotman JA, Houtsmuller AB, Schonewille M, Hoebeek FE, Spijker S, Smit AB, De Zeeuw CI.
In-Text Gene Mentions
Title)
…AMPAR Auxiliary Protein SHISA6Auxiliary Protein SHISA6…
Abstract)
…AMPA-type glutamate receptor (AMPAR) auxiliary protein SHISA6auxiliary protein SHISA6…
Abstract)
…The absence ofSHISA6in Purkinje cells…
Abstract)
…Purkinje cells requireSHISA6-dependent modification of AMP…
Abstract)
…•SHISA6is prominently expressed…
Show Full Abstract
The majority of excitatory postsynaptic currents in the brain are gated through AMPA-type glutamate receptors, the kinetics and trafficking of which can be modulated by auxiliary proteins. It remains to be elucidated whether and how auxiliary proteins can modulate synaptic function to contribute to procedural memory formation. In this study, we report that the AMPA-type glutamate receptor (AMPAR) auxiliary protein SHISA6 (CKAMP52) is expressed in cerebellar Purkinje cells, where it co-localizes with GluA2-containing AMPARs. The absence of SHISA6 in Purkinje cells results in severe impairments in the adaptation of the vestibulo-ocular reflex and eyeblink conditioning. The physiological abnormalities include decreased presence of AMPARs in synaptosomes, impaired excitatory transmission, increased deactivation of AMPA receptors, and reduced induction of long-term potentiation at Purkinje cell synapses. Our data indicate that Purkinje cells require SHISA6-dependent modification of AMPAR function in order to facilitate cerebellar, procedural memory formation.
…Of 7 mutations near the gene region encoding for Mbd2 , 3 were intronic, 2 were upstream, and 2 were downstream of the gene, although all SNPs associated withDccwere intronic.…
Results)
…genes, Mbd2 andDcc( Table 1…
Results)
…SNPs associated withDccwere intronic.…
Show Full Abstract
Enhanced host protection against re-infection requires generation of memory T cells of sufficient quantity and functional quality. Unlike well-studied inbred mice, T cell responses of diverse size and quality are generated following infection of humans and outbred mice. Thus, additional models are needed that accurately reflect variation in immune outcomes in genetically diverse populations and to uncover underlying genetic causes. The Collaborative Cross (CC), a large recombinant inbred panel of mice, is an ideal model in this pursuit for the high degree of genetic variation present, because it allows for assessment of genetic factors underlying unique phenotypes. Here, we advance the utility of the CC as a tool to analyze the immune response to viral infection. We describe variability in resting immune cell composition and adaptive immune responses generated among CC strains following systemic virus infection and reveal quantitative trait loci responsible for generation of CD62L+ memory CD8 T cells.
Sin3/HDAC complexes function by deacetylating histones, condensing chromatin, and modulating gene expression. Although components used to build these complexes have been well defined, we still have only a limited understanding of the structure of the Sin3/HDAC subunits assembled around the scaffolding protein SIN3A. To characterize the spatial arrangement of Sin3 subunits, we combined Halo affinity capture, chemical crosslinking, and high-resolution mass spectrometry (XL-MS) to determine intersubunit distance constraints, identifying 66 interprotein and 63 self-crosslinks for 13 Sin3 subunits. Having assessed crosslink authenticity by mapping self-crosslinks onto existing structures, we used distance restraints from interprotein crosslinks to guide assembly of a Sin3 complex substructure. We identified the relative positions of subunits SAP30L, HDAC1, SUDS3, HDAC2, and ING1 around the SIN3A scaffold. The architecture of this subassembly suggests that multiple factors have space to assemble to collectively influence the behavior of the catalytic subunit HDAC1.
Journal Article2020-04-01No SnippetsRozenblatt-Rosen O, Regev A, Oberdoerffer P, Nawy T, Hupalowska A, Rood JE, Ashenberg O, Cerami E, Coffey RJ, Demir E, Ding L, Esplin ED, Ford JM, Goecks J, Ghosh S, Gray JW, Guinney J, Hanlon SE, Hughes SK, Hwang ES, Iacobuzio-Donahue CA, Jané-Valbuena J, Johnson BE, Lau KS, Lively T, Mazzilli SA, Pe'er D, Santagata S, Shalek AK, Schapiro D, Snyder MP, Sorger PK, Spira AE, Srivastava S, Tan K, West RB, Williams EH, Human Tumor Atlas Network.
Show Full Abstract
Crucial transitions in cancer-including tumor initiation, local expansion, metastasis, and therapeutic resistance-involve complex interactions between cells within the dynamic tumor ecosystem. Transformative single-cell genomics technologies and spatial multiplex in situ methods now provide an opportunity to interrogate this complexity at unprecedented resolution. The Human Tumor Atlas Network (HTAN), part of the National Cancer Institute (NCI) Cancer Moonshot Initiative, will establish a clinical, experimental, computational, and organizational framework to generate informative and accessible three-dimensional atlases of cancer transitions for a diverse set of tumor types. This effort complements both ongoing efforts to map healthy organs and previous large-scale cancer genomics approaches focused on bulk sequencing at a single point in time. Generating single-cell, multiparametric, longitudinal atlases and integrating them with clinical outcomes should help identify novel predictive biomarkers and features as well as therapeutically relevant cell types, cell states, and cellular interactions across transitions. The resulting tumor atlases should have a profound impact on our understanding of cancer biology and have the potential to improve cancer detection, prevention, and therapeutic discovery for better precision-medicine treatments of cancer patients and those at risk for cancer.
Also flagged:G3BP1ribonucleoproteinRNPstress granulecytoplasmicresponse to stress
Journal Article2020-04-01✓ 1 SnippetYang P, Mathieu C, Kolaitis RM, Zhang P, Messing J, Yurtsever U, Yang Z, Wu J, Li Y, Pan Q, Yu J, Martin EW, Mittag T, Kim HJ, Taylor JP.
In-Text Gene Mentions
Text
…STAU1…
Show Full Abstract
The mechanisms underlying ribonucleoprotein (RNP) granule assembly, including the basis for establishing and maintaining RNP granules with distinct composition, are unknown. One prominent type of RNP granule is the stress granule (SG), a dynamic and reversible cytoplasmic assembly formed in eukaryotic cells in response to stress. Here, we show that SGs assemble through liquid-liquid phase separation (LLPS) arising from interactions distributed unevenly across a core protein-RNA interaction network. The central node of this network is G3BP1, which functions as a molecular switch that triggers RNA-dependent LLPS in response to a rise in intracellular free RNA concentrations. Moreover, we show that interplay between three distinct intrinsically disordered regions (IDRs) in G3BP1 regulates its intrinsic propensity for LLPS, and this is fine-tuned by phosphorylation within the IDRs. Further regulation of SG assembly arises through positive or negative cooperativity by extrinsic G3BP1-binding factors that strengthen or weaken, respectively, the core SG network.
Also flagged:oxygenprotein aggregationageingproteinopathiesParkinson'sAlzheimer's disease
Journal Article2020-04-01No Snippetsvan Dam L, Dansen TB.
Show Full Abstract
It is well established that both an increase in reactive oxygen species (ROS: i.e. O2•-, H2O2 and OH•), as well as protein aggregation, accompany ageing and proteinopathies such as Parkinson's and Alzheimer's disease. However, it is far from clear whether there is a causal relation between the two. This review describes how protein aggregation can be affected both by redox signalling (downstream of H2O2), as well as by ROS-induced damage, and aims to give an overview of the current knowledge of how redox signalling affects protein aggregation and vice versa. Redox signalling has been shown to play roles in almost every step of protein aggregation and amyloid formation, from aggregation initiation to the rapid oligomerization of large amyloids, which tend to be less toxic than oligomeric prefibrillar aggregates. We explore the hypothesis that age-associated elevated ROS production could be part of a redox signalling-dependent-stress response in an attempt to curb protein aggregation and minimize toxicity.
…The FBXL4 gene is a protein coding gene, which can encode a member of the F-box protein family.28 F-box and leucine rich repeat protein 4 has a highly conserved 50-amino acid protein motif and it can specifically bind substrates to regulate the degradation of cellular regulatory proteins via ubiquitin-mediated proteolysis.29 Research has demonstrated that FBXL4 plays an important role in the maintenance of mitochondrial DNA integrity, which was associated with diseases including mitochondrial DNA depletion syndrome 13 and mitochondrial DNA depletion syndrome.28 Recently, it was shown that FBXL4 could interact with endoplasmic reticulum lectin 1 (ERLEC1), which is a molecular chaperone playing a role in the endoplasmic reticulum (ER) stress response.30 The ER stress response is related to various systemic and arterial-wall factors that promote atherosclerosis.31 A previous study demonstrated that ER stress could induce apoptosis, which may directly participate in the initiation and development of AS.32 In addition, as shown in Table 1, FBXL4-related pathways are class I major histocompatibility complex (MHC)-mediated antigen processing and presentation and the innate immune system.…
Abstract)
…This present bioinformatics analysis identified that the FBXL4, UBOX5, KBTBD6 and FBXO21 genes might play vital roles in the pathogenesis of atherosclerosis.…
Also flagged:gene silencingCas9CRISPR-Cas systemendonucleasenucleotidebinding
Journal Article2020-04-01✓ 4 SnippetsJoberty G, Fälth-Savitski M, Paulmann M, Bösche M, Doce C, Cheng AT, Drewes G, Grandi P.
In-Text Gene Mentions
Results)
…enzymes (ADK, ECH1,ECI2, EPHX2, NQO2, PDXK)…
Results)
…aspartate tRNA ligaseDARS2.…
Results)
…levels of quantifiedDARS2protein levels (38%).…
Results)
…sequencing of theDARS2allele population over…
Show Full Abstract
CRISPR/Cas9-based gene knockouts (KOs) enable precise perturbation of target gene function in human cells, which is ideally assessed in an unbiased fashion by molecular omics readouts. Typically, this requires the lengthy process of isolating KO subclones. We show here that KO subclones are phenotypically heterogenous, regardless of the guide RNA used. We present an experimental strategy that avoids subcloning and achieves fast and efficient gene silencing on cell pools, based on the synergistic combination of two guide RNAs mapping at close (40-300 bp) genomic proximity. Our strategy results in better predictable indel generation with a low allelic heterogeneity, concomitant with low or undetectable residual target protein expression, as determined by MS3 mass spectrometry proteomics. Our method is compatible with nondividing primary cells and can also be used to study essential genes. It enables the generation of high confidence omics data which solely reflect the phenotype of the target ablation.
Also flagged:intestinal tumourtumourarachidonic acidPtgs2Yaplocalization
Journal Article2020-04-01✓ 2 SnippetsRoulis M, Kaklamanos A, Schernthanner M, Bielecki P, Zhao J, Kaffe E, Frommelt LS, Qu R, Knapp MS, Henriques A, Chalkidi N, Koliaraki V, Jiao J, Brewer JR, Bacher M, Blackburn HN, Zhao X, Breyer RM, Aidinis V, Jain D, Su B, Herschman HR, Kluger Y, Kollias G, Flavell RA.
In-Text Gene Mentions
S I O 001029)
…We identified a significant reduction in the relative abundance of PGE2 and prostaglandin I2 (PGI2) in the whole tissue (Fig. 2e), consistent with the expression of the respective synthases, Ptges and Ptgis, in fibroblasts (Extended Data Fig. 1g), and a trend for decreased prostaglandin D2 (PGD2) and prostaglandin F2α (PGF2α) abundance.…
The initiation of an intestinal tumour is a probabilistic process that depends on the competition between mutant and normal epithelial stem cells in crypts<sup>1</sup>. Intestinal stem cells are closely associated with a diverse but poorly characterized network of mesenchymal cell types<sup>2,3</sup>. However, whether the physiological mesenchymal microenvironment of mutant stem cells affects tumour initiation remains unknown. Here we provide in vivo evidence that the mesenchymal niche controls tumour initiation in trans. By characterizing the heterogeneity of the intestinal mesenchyme using single-cell RNA-sequencing analysis, we identified a population of rare pericryptal Ptgs2-expressing fibroblasts that constitutively process arachidonic acid into highly labile prostaglandin E<sub>2</sub> (PGE<sub>2</sub>). Specific ablation of Ptgs2 in fibroblasts was sufficient to prevent tumour initiation in two different models of sporadic, autochthonous tumorigenesis. Mechanistically, single-cell RNA-sequencing analyses of a mesenchymal niche model showed that fibroblast-derived PGE<sub>2</sub> drives the expansion οf a population of Sca-1<sup>+</sup> reserve-like stem cells. These express a strong regenerative/tumorigenic program, driven by the Hippo pathway effector Yap. In vivo, Yap is indispensable for Sca-1<sup>+</sup> cell expansion and early tumour initiation and displays a nuclear localization in both mouse and human adenomas. Using organoid experiments, we identified a molecular mechanism whereby PGE<sub>2</sub> promotes Yap dephosphorylation, nuclear translocation and transcriptional activity by signalling through the receptor Ptger4. Epithelial-specific ablation of Ptger4 misdirected the regenerative reprogramming of stem cells and prevented Sca-1<sup>+</sup> cell expansion and sporadic tumour initiation in mutant mice, thereby demonstrating the robust paracrine control of tumour-initiating stem cells by PGE<sub>2</sub>-Ptger4. Analyses of patient-derived organoids established that PGE<sub>2</sub>-PTGER4 also regulates stem-cell function in humans. Our study demonstrates that initiation of colorectal cancer is orchestrated by the mesenchymal niche and reveals a mechanism by which rare pericryptal Ptgs2-expressing fibroblasts exert paracrine control over tumour-initiating stem cells via the druggable PGE<sub>2</sub>-Ptger4-Yap signalling axis.
Also flagged:RNA-binding proteinamyotrophic lateral sclerosisNeuNIlf3Ddx1TDP-43
Journal Article2020-04-01✓ 1 SnippetPourhaghighi R, Ash PEA, Phanse S, Goebels F, Hu LZM, Chen S, Zhang Y, Wierbowski SD, Boudeau S, Moutaoufik MT, Malty RH, Malolepsza E, Tsafou K, Nathan A, Cromar G, Guo H, Abdullatif AA, Apicco DJ, Becker LA, Gitler AD, Pulst SM, Youssef A, Hekman R, Havugimana PC, White CA, Blum BC, Ratti A, Bryant CD, Parkinson J, Lage K, Babu M, Yu H, Bader GD, Wolozin B, Emili A.
In-Text Gene Mentions
Text
…Negr1…
Show Full Abstract
Connectivity webs mediate the unique biology of the mammalian brain. Yet, while cell circuit maps are increasingly available, knowledge of their underlying molecular networks remains limited. Here, we applied multi-dimensional biochemical fractionation with mass spectrometry and machine learning to survey endogenous macromolecules across the adult mouse brain. We defined a global "interactome" comprising over one thousand multi-protein complexes. These include hundreds of brain-selective assemblies that have distinct physical and functional attributes, show regional and cell-type specificity, and have links to core neurological processes and disorders. Using reciprocal pull-downs and a transgenic model, we validated a putative 28-member RNA-binding protein complex associated with amyotrophic lateral sclerosis, suggesting a coordinated function in alternative splicing in disease progression. This brain interaction map (BraInMap) resource facilitates mechanistic exploration of the unique molecular machinery driving core cellular processes of the central nervous system. It is publicly available and can be explored here https://www.bu.edu/dbin/cnsb/mousebrain/.
Also flagged:pancreatic acinar cell carcinomapancreatic cancerpancreatic neoplasmstumourgemcitabineoxaliplatin
Journal Article2020-04-01✓ 1 SnippetDi Marco M, Carloni R, De Lorenzo S, Grassi E, Palloni A, Formica F, Brocchi S, Filippini DM, Golfieri R, Brandi G.
In-Text Gene Mentions
Text
…DCC…
Show Full Abstract
<h4>Background</h4>Pancreatic acinar cell carcinoma (PACC) is a rare type of malignant pancreatic cancer that represents approximately 1% of all pancreatic neoplasms. Due to its very low incidence, only a few retrospective studies are available. Although surgery is the first choice for treatment, most patients experience recurrence (mainly in the liver) and there are no clear recommendations for patients with advanced disease.<h4>Case summary</h4>We report two patients with PACC treated with surgery who experienced tumour recurrence in the liver. Patient 1 carried a germline mutation in the <i>APC</i> gene. Both patients were treated with gemcitabine plus oxaliplatin and gemcitabine plus capecitabine as first- and second-line therapies, respectively. After a favourable response to chemotherapy, the patients underwent radiofrequency ablation of the remaining liver metastases. For patient 1, we documented a relapse in the liver after a disease-free period of 9 mo, and treatment with gemcitabine plus capecitabine was restarted. The patient achieved a complete response, and he remains alive without evidence of disease recurrence after six years. After radiofrequency ablation, patient 2 experienced disease-free survival for 21 mo, when peritoneal relapse was diagnosed and treated with chemotherapy. The patient achieved a stable disease state for nearly two years; nevertheless, further progressive disease was documented, and he died seven years after the first relapse.<h4>Conclusion</h4>PACC presents different biological behaviours than pancreatic adenocarcinoma. Multidisciplinary treatment involving local ablative therapies may be considered for PACC.
Also flagged:agingmetabolismcell proliferationstem cell differentiationHmgcs23-hydroxy-3-methylglutaryl-coenzyme A [CoA] synthetase 2
Journal Article2020-04-01✓ 1 SnippetGebert N, Cheng CW, Kirkpatrick JM, Di Fraia D, Yun J, Schädel P, Pace S, Garside GB, Werz O, Rudolph KL, Jasper H, Yilmaz ÖH, Ori A.
In-Text Gene Mentions
Results)
…stem cell markers (Olfm4; Figure 2B )…
Show Full Abstract
The small intestine is responsible for nutrient absorption and one of the most important interfaces between the environment and the body. During aging, changes of the epithelium lead to food malabsorption and reduced barrier function, thus increasing disease risk. The drivers of these alterations remain poorly understood. Here, we compare the proteomes of intestinal crypts from mice across different anatomical regions and ages. We find that aging alters epithelial immunity, metabolism, and cell proliferation and is accompanied by region-dependent skewing in the cellular composition of the epithelium. Of note, short-term dietary restriction followed by refeeding partially restores the epithelium by promoting stem cell differentiation toward the secretory lineage. We identify Hmgcs2 (3-hydroxy-3-methylglutaryl-coenzyme A [CoA] synthetase 2), the rate-limiting enzyme for ketogenesis, as a modulator of stem cell differentiation that responds to dietary changes, and we provide an atlas of region- and age-dependent proteome changes of the small intestine.
Also flagged:non-small cell lung cancernon-small lung cancerNSCLCtumorT-cell receptorIL-1β
Journal Article2020-04-01No SnippetsMitchell KG, Diao L, Karpinets T, Negrao MV, Tran HT, Parra ER, Corsini EM, Reuben A, Federico L, Bernatchez C, Dejima H, Francisco-Cruz A, Wang J, Antonoff MB, Vaporciyan AA, Swisher SG, Cascone T, Wistuba II, Heymach JV, Gibbons DL, Zhang J, Haymaker CL, Sepesi B.
Show Full Abstract
<h4>Background</h4>The biological underpinnings of the prognostic and predictive significance of a relative neutrophilia in patients with non-small lung cancer (NSCLC) are undefined. We sought to comprehensively examine the relationships between circulating and intratumoral neutrophil populations and features of the immune contexture in patients undergoing NSCLC resection.<h4>Methods</h4>Preoperative soluble cytokine and angiogenic factors; tumor multiplex immunofluorescence; RNA, whole exome, and T-cell receptor sequencing; and flow cytometry were analyzed for relationships with populations of circulating (from complete blood counts) and intratumoral neutrophils (transcriptional signatures) in a prospectively enrolled resected NSCLC cohort (n=66). In a historical cohort (n=1524), preoperative circulating neutrophil and lymphocyte counts were analyzed for associations with overall survival (OS).<h4>Results</h4>Circulating neutrophil populations were positively correlated with increased tumor burden, and surgical tumor resection was followed by a subsequent reduction in peripheral neutrophil counts. Expansion of the circulating neutrophil compartment was associated with increased levels of pro-granulopoietic (IL-1β, IL-17A, TNFα, IL-6) and T<sub>H</sub>2-associated (IL-5, IL-13) cytokines. Tumors with high intratumoral neutrophil burden were marked by a blunted T-cell response characterized by reduced expression of cytotoxic T-cell genes (<i>CD8A</i>, <i>CD8B</i>, <i>GZMA</i>, <i>GZMB</i>), decreased CD3<sup>+</sup>CD8<sup>+</sup> cell infiltration, and diminished expression of IFNγ-related genes. The associations between increased intratumoral neutrophil burden and reduced CD3<sup>+</sup>CD8<sup>+</sup> infiltration persisted after adjustment for tumor size, histology, mutational burden, and PD-L1 expression. In 1524 patients, elevated preoperative circulating neutrophil count was independently associated with worse OS (main effect HR 1.82, 95% CI 1.24 to 2.68, p=0.002).<h4>Conclusions</h4>Our findings demonstrate that neutrophil expansion reflects protumorigenic and immunosuppressive processes that manifest as worse OS in patients undergoing NSCLC resection. These results justify further investigation of therapeutic strategies targeting neutrophil-associated immune evasion.
Also flagged:KITPDGFRαgastrointestinal stromal tumorsGastrointestinal stromal tumorGISTsarcoma
Journal Article2020-04-01No SnippetsBanks E, Grondine M, Bhavsar D, Barry E, Kettle JG, Reddy VP, Brown C, Wang H, Mettetal JT, Collins T, Adeyemi O, Overman R, Lawson D, Harmer AR, Reimer C, Drew L, Packer MJ, Cosulich S, Jones RD, Shao W, Wilson D, Guichard S, Fawell S, Anjum R.
Show Full Abstract
Gastrointestinal stromal tumor (GIST) is the most common human sarcoma driven by mutations in <i>KIT</i> or platelet-derived growth factor α (<i>PDGFR</i>α). Although first-line treatment, imatinib, has revolutionized GIST treatment, drug resistance due to acquisition of secondary <i>KIT</i>/<i>PDGFR</i>α mutations develops in a majority of patients. Second- and third-line treatments, sunitinib and regorafenib, lack activity against a plethora of mutations in KIT/PDGFRα in GIST, with median time to disease progression of 4 to 6 months and inhibition of vascular endothelial growth factor receptor 2 (VEGFR2) causing high-grade hypertension. Patients with GIST have an unmet need for a well-tolerated drug that robustly inhibits a range of KIT/PDGFRα mutations. Here, we report the discovery and pharmacological characterization of AZD3229, a potent and selective small-molecule inhibitor of KIT and PDGFRα designed to inhibit a broad range of primary and imatinib-resistant secondary mutations seen in GIST. In engineered and GIST-derived cell lines, AZD3229 is 15 to 60 times more potent than imatinib in inhibiting KIT primary mutations and has low nanomolar activity against a wide spectrum of secondary mutations. AZD3229 causes durable inhibition of KIT signaling in patient-derived xenograft (PDX) models of GIST, leading to tumor regressions at doses that showed no changes in arterial blood pressure (BP) in rat telemetry studies. AZD3229 has a superior potency and selectivity profile to standard of care (SoC) agents-imatinib, sunitinib, and regorafenib, as well as investigational agents, avapritinib (BLU-285) and ripretinib (DCC-2618). AZD3229 has the potential to be a best-in-class inhibitor for clinically relevant KIT/PDGFRα mutations in GIST.
Also flagged:cancerPD-1cell activationtumourantibodiesCD152
Journal Article2020-04-01No SnippetsSaibil SD, Ohashi PS.
Show Full Abstract
The years since 2009 have seen tremendous progress in unlocking the curative potential of the immune system for the treatment of cancer. Much of that revolution in immuno-oncology has been fueled by the clinical success of immune checkpoint inhibitors, particularly those targeting the PD-1 axis. Unfortunately, many patients still fail to benefit from checkpoint blockade or other immunotherapies. An inability to fully activate antitumour T cells contributes in part to the failure of those therapies. Here, we review the basic biology of T cell activation, with particular emphasis on the essential role of the dendritic cell and the innate immune system in T cell activation. The current understanding of the multiple factors that govern T cell activation and how they impinge on tumour immunotherapy are also discussed. Lastly, treatment strategies to potentially overcome barriers to T cell activation and to enhance the efficacy of immunotherapy are addressed.
Also flagged:bindinggene expressionosteogenesisCol1a1Col-IICol-X
Journal Article2020-04-01✓ 4 SnippetsXu WW, Xu Y, Ji F, Ji Y, Wang QG.
In-Text Gene Mentions
Abstract)
…tibia fracture healing by binding and inhibiting the SOX6…
Title)
…positively regulating theSOX6expression.…
Abstract)
…Y box 6 (SOX6) expression, while knockdown…
Abstract)
…and inhibiting theSOX6expression.…
Show Full Abstract
<h4>Objective</h4>Fragile fracture patients need to be treated with long-term fixation and the recovery process is slow. Several studies have shown that the fracture healing process is related to gene expression. We aimed to investigate the role of long chain non-coding RNA TSIX (lncRNA TSIX) on fracture healing after tibial fracture (TF) and explore the molecular mechanism underlying its action.<h4>Materials and methods</h4>The male C57BL/6J mice were used to construct TF models and osteoblasts were used as in vitro model. The proliferation, apoptosis, and osteogenesis-related genes of Col1a1, Col-II, and Col-X were detected to evaluate the role of lncRNA TSIX in vivo and in vitro after TF. Haematoxylin-eosin (HE) staining was conducted to confirm the fracture healing conditions.<h4>Results</h4>We found that LncRNA TSIX expression in plasma of TF mice significantly upregulated in a time-dependent manner. Overexpression of lncRNA TSIX could significantly inhibit proliferation but promote apoptosis and regulate the osteogenesis-related genes expression by binding and positively regulate sex-determining region Y box 6 (SOX6) expression, while knockdown of lncRNA TSIX showed the opposite effect in osteoblastic cells. Inhibition of lncRNA TSIX could improve fracture healing after TF.<h4>Conclusions</h4>Taken together, our study supported that knockdown of lncRNA TSIX could promote the tibia fracture healing by binding and inhibiting the SOX6 expression. We suggest that lncRNA TSIX/SOX may be the potential targets for the treatment of TF.
Also flagged:myocardial infarctioninguinal herniaherniaAmyand hernia type 3oxygens Hernia
Journal Article2020-04-01✓ 1 SnippetCabrera P, Roman C, Barbosa S, Alvarado F, Diaz E, Martinez M.
In-Text Gene Mentions
Abstract)
…compared to conventionaltype 1 infarction1 infarction according…
Show Full Abstract
<h4>Background</h4>Type 2 myocardial infarction (MIT2) is characterized by higher mortality rates compared to conventional type 1 infarction according to the European Society of Cardiology (ESC) in 2018. The purpose of this case is to identify appropriate therapeutic measures. A case of an Amyand's Hernia that produced an MIT2 is described in this work.<h4>Case report</h4>A 77-year-old male was admitted to our emergency department for acute abdominal pain in the right lower quadrant associated with the presence of an ipsilateral inguinal hernia with signs of peritoneal irritation, while complaining of chest pain. A positive troponin indicated the presence of myocardial infarction. A laparotomy was performed with the finding of an incarcerated right inguino-scrotal hernia that contained the gangrenous and perforated cecal appendix (Amyand hernia type 3). The treatment consisted of surgical correction of the hernia, an appendectomy, antibiotics and support in the intensive care unit with a positive outcome. The diagnosis of Amyand hernia type 3 was established intraoperatively, and by imaging, confirming the presence of an MIT2 according to the criteria of the fourth definition of ECS infarction.<h4>Conclusion</h4>In the surgical environment it is strange to find patients who present with acute abdominal pain and a myocardial infarction at the same time. It is necessary for the consultant to recognize these two entities to make a correct diagnosis and provide timely treatment to reduce any possibility of patient mortality.
Also flagged:PD-L1effusiontumornon-small cell lung cancerNSCLCmalignant pleural effusion
Journal Article2020-04-01No SnippetsSong Z, Cheng G, Zhang Y.
Show Full Abstract
<h4>Background</h4>Programmed death ligand 1 (PD-L1) tumor proportion score (TPS) is currently widely used for selection of immune therapies in non-small cell lung cancer (NSCLC). Most of samples for PD-L1 expression were obtained from tumor tissue. However, the feasible of malignant pleural effusion (MPE) cytological samples for PD-L1 detection is poorly reported. And the correlation between oncogene mutations and PD-L1 expression based on high-throughput sequencing is rarely studied.<h4>Methods</h4>NSCLC MPE cytological samples and partially paired tumor tissue from our institution analyzed for PD-L1 immunohistochemistry (IHC) using the clone SP263 pharmDx kit and evaluated genomic aberrations in all patients using next generation sequencing (NGS).<h4>Results</h4>One hundred and twenty-three MPE cell blocks and 29 paired tumor tissue were successfully tested for PD-L1 expression. PD-L1 TPS of ≥50% were seen in 18.7% (23/123) of all samples. The accordance of PD-L1 expression in tumor tissue and MPE samples was 86.2% (50% as cut-off value). PD-L1 TPS ≥50% tumors were significantly associated with <i>EGFR</i> wild-type (P=0.007), but, no correlation between other genes and PD-L1 expression. A trend of longer overall survival (OS) was observed in patients with PD-L1 TPS <50% than those TPS ≥50% (20.0 <i>vs</i>. 13.8 months, P=0.057). No difference of tumor mutational burden (TMB) was observed between patients with PD-L1 ≥50% and <50% (8.2/MB and 7.7/MB, P=0.47).<h4>Conclusions</h4>Our results suggest that cytological material is feasible for PD-L1 IHC analysis. Gene alterations could partially contribute to select the samples that with different PD-L1 expression. No correlation between the PD-L1 expression and TMB.
…These findings, together with our findings, suggest that serum OLFM4 may be involved in the pathogenesis of asthma, and that changes in serum OLFM4 levels may serve as an indicator of asthma control status.…
Abstract)
…Serum OLFM4 levels were increased in patients with asthma (the controlled asthma and uncontrolled asthma groups).…
Abstract)
…There were no significant associations identified between OLFM4 and age, gender, BMI, allergy, blood eosinophils, blood neutrophils, IgE, FeNO, or FEV1% pred.…
Discussion)
…However, in inflammatory bowel disease, OLFM4 immunostaining extended to the surface of the intestinal epithelium, and its presence was found in mucus.…
Abstract)
…Olfactomedin 4 (OLFM4) is produced by neutrophils and has been reported to be associated with asthma inflammation.…
Show Full Abstract
<h4>Background</h4>Neutrophils are a key component of inflammation in asthma. Olfactomedin 4 (OLFM4) is produced by neutrophils and has been reported to be associated with asthma inflammation. We hypothesized that serum OLFM4 may be increased in asthmatic individuals and can assist with predicting asthma control state.<h4>Methods</h4>A total of 79 individuals were enrolled from Shenzhen People's Hospital, China and divided into 3 groups: uncontrolled asthmatics (n=35), controlled asthmatics (n=14), and healthy controls (n=30). The serum OLFM4 level was measured by enzyme-linked immunosorbent assay (ELISA). Clinical characteristics (such as age, gender, allergy history, body mass index (BIM), and smoking history), clinical indicators (such as whole blood count, sputum neutrophil, sputum eosinophil, forced expiratory volume in one second as percentage of predicted volume (FEV1% pred), IgE level, high sensitivity C-reactive protein (hs-CRP), and fractional expiratory nitric oxide (FeNO) were measured and the three groups were compared. The correlation between OLFM4 and the clinical characteristics and indicators was then evaluated. Finally, stepwise multiple regression analysis was performed to determine the contribution of clinical characteristics and clinical indicators influencing serum OLFM4 level.<h4>Results</h4>Our results showed that the serum OLFM4 level was increased two-fold in the controlled asthma group (3,450.38±3,000.35 pg/mL) and three-fold in the uncontrolled asthma group (5,084.57±3,425.76 pg/mL), compared to the healthy control group (1,830.11±1,239.70 ng/mL) (P<0.001). We found a positive correlation between serum OLFM4 level and sputum neutrophils (P<0.001). OLFM4 was also found to be related to both hs-CRP level (P=0.007*) and blood neutrophil count (P<0.001). There were no significant associations identified between OLFM4 and age, gender, BMI, allergy, blood eosinophils, blood neutrophils, IgE, FeNO, or FEV1% pred.<h4>Conclusions</h4>Serum OLFM4 levels were increased in patients with asthma (the controlled asthma and uncontrolled asthma groups). There was a significant correlation between serum OLFM4 and levels of sputum neutrophil and hs-CRP, and OLFM4 was also related to both Hs-CRP level and blood neutrophil count. Serum OLFM4 level may serve as a useful biomarker for assessing asthma control state in asthmatic adults.
Also flagged:CTSKCOL4A2gastric cancerGene Expressiontumormetabolism
Journal Article2020-04-01No SnippetsFeng Z, Qiao R, Ren Z, Hou X, Feng J, He X, Chen D.
Show Full Abstract
<h4>Background</h4>In the purpose of identifying reliable biomarkers for evaluating prognosis, monitoring recurrence and exploring new therapeutic targets, it is quite necessary to screen for the genetic changes and potential molecular mechanisms of the occurrence and development of gastric cancer (GC) from the aspects of race and region.<h4>Methods</h4>Target datasets were retrieved from Gene Expression Omnibus (GEO) database with "gastric cancer" as the key word, and corresponding data was downloaded. The differentially expressed genes (DEGs) were obtained by using limma R package, and the Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway for DEGs were analyzed in Enirchr database. Protein-protein interaction (PPI) network and molecular module were also constructed through STRING database and Cytoscape software. Survival analyses were completed for DEGs in GEO and Kaplan-Meier plotter database via cross validation. Finally, the correlation between gene expression and the infiltration cell levels in tumor microenvironment (TME) was explored based on the tumor immune estimation resource (TIMER) database.<h4>Results</h4>Five GC-related microarray datasets were selected and used for differential analysis, and 222 DEGs were identified. GO analyses of DEGs were mainly involved in cell metabolism and the formation of extracellular matrix (ECM). The top enriched pathways of DEGs were protein digestion and absorption, ECM-receptor interaction, focal adhesion (FA), PI3K-Akt signaling pathway. Survival analyses of DEGs revealed that the expression levels of <i>CTSK</i> and <i>COL4A2</i> were significantly associated with poor prognosis of GC patients in Asian. Specifically, the high expression of <i>CTSK</i> had a closely related to the infiltration level of inflammatory cell in TME.<h4>Conclusions</h4><i>CTSK</i> and <i>COL4A2</i> could play a critical role in the pathogenesis of GC and act as the promising prognostic biomarkers. <i>CTSK</i> could induce the formation of immunosuppressive TME and promote the immune escape of GC cells.
Also flagged:BDNFneurodegenerative disorderbrain-derived neurotrophic factorneurotrophic factorquinolinic acidHD
Journal Article2020-04-01✓ 5 SnippetsKim HS, Jeon I, Noh JE, Lee H, Hong KS, Lee N, Pei Z, Song J.
In-Text Gene Mentions
Introduction)
…Huntingtin protein (HTT) normally participates in vesicular transportation, and the mHTT causes a selective defect of the axonal transport of BDNF from the cerebral cortex to the striatum [12], which has been linked to neuronal cell death in HD.…
Introduction)
…Huntington’s disease (HD) is an autosomal-dominant neurodegenerative disorder, caused by abnormally expanded CAG repeats in the huntingtin (Htt) gene, located on the short arm of chromosome 4 [1].…
Introduction)
…the huntingtin (Htt) gene, located…
Introduction)
…AlthoughHttgene mutation occurs…
Introduction)
…somatic instability ofHttgene mutation has…
Show Full Abstract
Huntington's disease (HD) is a dominantly inherited neurodegenerative disorder caused by abnormally expanded CAG repeats in the <i>huntingtin</i> gene. The <i>huntingtin</i> gene mutation leads to the progressive degeneration of striatal GABAergic medium spiny neurons (MSN) and reduces the level of brain-derived neurotrophic factor (BDNF) in HD patient's brain. BDNF is an essential neurotrophic factor for the cortico-striatal synaptic activity and the survival of GABAergic neurons. In this study, we transplanted BDNF-overexpressing human neural stem cells (HB1.F3.BDNF) into the contra-lateral side of unilateral quinolinic acid (QA)-lesioned striatum of HD rat model. The results of <i>in vivo</i> transplantation were monitored using various behavioral tests, 4.7 T animal magnetic resonance imaging (MRI) and immunohistochemical staining. We observed that the QA-lesioned rats receiving HB1.F3.BDNF cells exhibited significant behavioral improvements in the stepping, rotarod and apomorphine-induced rotation tests. Interestingly, contralaterally transplanted cells were migrated to the QA-lesioned striatum and the size of lateral ventricle was reduced. Histological analyses further revealed that the transplanted cells, which had migrated to the QA lesion site, were differentiated into the cells of GABAergic, MSN-type neurons expressing DARPP-32, and neural networks were established between the transplanted cells and the host brain, as revealed by retrograde tracing. Finally, there was a significant reduction of inflammatory response in HB1.F3.BDNF-transplanted HD animal model, compared with vehicle-transplanted group. Taken together, these results suggest that HB1.F3.BDNF can be an effective therapeutic strategy to treat HD patients in the future.
Also flagged:tumorsolid tumorstumorslung cancerhuman leukocyte antigenHLA
Journal Article2020-04-01✓ 1 SnippetJiang T, Cheng R, Pan Y, Zhang H, He Y, Su C, Ren S, Zhou C.
In-Text Gene Mentions
Results)
…, followed byCACNA1E(20.0%, 4/20), FHOD3…
Show Full Abstract
<h4>Background</h4>Personalized cancer vaccines based on tumor-derived neoantigens have shown strong and long-lasting antitumor effect in patients with some solid tumors. However, whether neoantigens identified from primary lesions could represent their metastatic lesions, and consequently the effect of vaccine therapy remained unknown.<h4>Methods</h4>To investigate whether neoantigens identified from primary tumors are similar to their matched metastases in lung cancer, we identified 79 samples from 24 cases. All of samples were collected before any systemic therapy. Major criteria for neoantigen identification included: derived from tumor-specific mutations, fold change >10 comparing to germline expression level, high predicted human leukocyte antigen (HLA) binding affinity and peptide of 9-11 amino acids in length.<h4>Results</h4>We found a wide range of tumor neoantigen burden in both primaries and metastases. The counts, overall distribution pattern and predicted HLA binding affinity of neoantigens were similar between primaries and metastases. However, only 20% of shared neoantigens (presented in both primaries and metastases) was observed, which were mainly derived from single nucleotide variants (SNVs) and fusions. A variety of corresponding HLA alleles were observed and 50.0% of cases were HLA-C*06:02. Finally, we observed the neoantigen intrametastases homogeneity in patients with sole brain metastases.<h4>Conclusions</h4>Neoantigen landscape in terms of the number, type and predicted HLA binding affinity was similar between primaries and metastases, but the percentage of shared neoantigens is only modest, suggesting vaccine development based solely on primary tumor neoantigen may not offer optimal therapeutic outcome, and shared neoantigen needs to be seriously considered.
<h4>Background</h4>The pathogenesis of metastatic renal cell carcinoma (mRCC), one of the most common malignant neoplasms, remains unknown. Studies on competitive endogenous RNAs (ceRNAs) have uncovered new interactions between RNAs, which suggest their roles in cancer pathogenesis. However, the role of ceRNA networks in mRCC has not yet been studied. Thus, this study aims to explore the role of ceRNA networks in mRCC development and identify potential prognostic indicators.<h4>Methods</h4>We analyzed RNA sequencing data of mRCC patients, which had been obtained from The Cancer Genome Atlas (TCGA) database. Next, differentially expressed long-noncoding RNAs (DElncRNAs), differentially expressed micro RNAs (DEmiRNAs), and differentially expressed messenger RNAs (DEmRNAs) in mRCC and clear cell RCC (ccRCC) samples were identified using the edgeR package that is available in R software. Moreover, based on the Database for Annotation, Visualization, and Integrated Discovery (DAVID), enrichment analyses for biological processes and pathways functional were performed. As such, we built a ceRNA network and performed a survival analysis using the survival package in R.<h4>Results</h4>A total of 369 DElncRNAs, 12 DEmiRNAs, and 728 DEmRNAs were identified for further analysis. Of these, 11 lncRNAs, 20 mRNAs, and 2 miRNAs were included in the ceRNA network. Moreover, 7 of the 11 lncRNAs and 3 of the 20 mRNAs were associated with the overall survival of mRCC patients (P<0.05).<h4>Conclusions</h4>Collectively, our findings allow a deepened understanding of the molecular mechanism of the ceRNA network and its role in mRCC development, which can guide both mRCC therapy and related future research.
Also flagged:clear cell renal cell carcinomaccRCCmalignant tumor of kidneypathogenesisGene Expressionexcretion
Journal Article2020-04-01No SnippetsZhang F, Wu P, Wang Y, Zhang M, Wang X, Wang T, Li S, Wei D.
Show Full Abstract
<h4>Background</h4>Clear cell renal cell carcinoma (ccRCC) is the most common malignant tumor of kidney with high mortality. The pathogenesis of ccRCC is complicated and effective prognostic predictors for clinical practice are still limited. This study aimed to identify significant genes with prognostic influence in ccRCC via bioinformatics analysis.<h4>Methods</h4>Four gene expression profiles were acquired from the Gene Expression Omnibus (GEO) database, including 168 ccRCC tissues and 143 normal tissues. Common differentially expressed genes (DEGs) between ccRCC tissues and normal kidney tissues were screened out. Then gene ontology (GO) enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were investigated. Protein-protein interaction (PPI) network of the common DEGs was diagrammed and analyzed. Kaplan-Meier analysis was conducted to identify genes with prognostic influence in ccRCC. Gene Expression Profiling Interactive Analysis (GEPIA) was finally applied to validating differential expression of genes.<h4>Results</h4>Ninety-nine common DEGs between ccRCC tissues and normal kidney tissues were eventually screened out (P<0.05, |log FC| >2). GO functional analysis showed that the down-regulated genes were enriched in excretion, negative regulation of cell proliferation, heparin binding and cellular response to BMP stimulus, etc. KEGG pathway analysis indicated that the common DEGs were particularly enriched in HIF-1 signaling pathway and aldosterone-regulated sodium reabsorption. Seven core DEGs were distinguished through PPI network analysis, of which 6 core genes <i>ANGPTL4</i>, <i>CA9</i>, <i>CXCR4</i>, <i>LOX</i>, <i>EGF</i> and <i>HRG</i> showed significantly prognostic difference in patients with ccRCC by Kaplan-Meier analysis (P<0.05). And GEPIA confirmed these genes were expressed differentially between tumor and normal tissues (P<0.05). High expression of <i>HRG</i> was correlated with good OS in ccRCC patients. Specifically, <i>HRG</i> was commonly down-regulated in ccRCC tissues compared with normal tissues according to GEPIA.<h4>Conclusions</h4>Our study shows that high expression of <i>HRG</i> denotes a better prognosis in ccRCC patients. <i>HRG</i> is down-regulated in ccRCC tissues compared with normal kidney tissues. The selective expression pattern suggests that <i>HRG</i> could be a novel prognostic predictor and potential therapeutic target for ccRCC patients.
Also flagged:cellular senescenceassociated secretoryagingchronic diseasescancerheart disease
Journal Article2020-04-01No SnippetsBasisty N, Kale A, Patel S, Campisi J, Schilling B.
Show Full Abstract
<h4>Introduction</h4>Cellular senescence is a rapidly growing field with potential relevance for the treatment of multiple human diseases. In the last decade, cellular senescence and the senescence-associated secretory phenotype (SASP) have emerged as central drivers of aging and many chronic diseases, including cancer, neurodegeneration, heart disease and osteoarthritis. Major efforts are underway to develop drugs that selectively eliminate senescent cells (senolytics) or alter the SASP (senomorphics) to treat age-related diseases in humans. The translation of senescence-targeting therapies into humans is still in early stages. Nonetheless, it is clear that proteomic approaches will facilitate the discovery of important SASP proteins, development of senescence- and SASP-derived biomarkers, and identification of therapeutic targets for senolytic and senomorphic drugs.<h4>Areas covered</h4>We review recent proteomic studies of cellular senescence and their translational relevance and, particularly, characterization of the secretory phenotype and preclinical development of biomarkers (from 2008-2020, PubMed). We focus on emerging areas, such as the heterogeneity of senescent cells and the SASP, extracellular vesicles released by senescent cells, and validating biomarkers of aging in vivo.<h4>Expert opinion</h4>Proteomic and multi-omic approaches will be important for the development of senescence-based biomarkers to facilitate and monitor future therapeutic interventions that target senescent cells.
Also flagged:silibinincancerwaterpancreatic cancerCD133CD24
Journal Article2020-04-01No SnippetsKhakinezhad Tehrani F, Ranji N, Kouhkan F, Hosseinzadeh S.
Show Full Abstract
<h4>Objectives</h4>Silibinin, as an herbal compound, has anti-cancer activity. Because of low solubility of silibinin in water and body fluids, it was encapsulated in polymersome nanoparticles and its effects were evaluated on pancreatic cancer cells and cancer stem cells.<h4>Materials and methods</h4>MIA PaCa-2 pancreatic cancer cells were treated with different doses of silibinin encapsulated in polymersome nanoparticles (SPNs). Stemness of MIA PaCa-2 cells was evaluated by hanging drop technique and CD133, CD24, and CD44 staining. The effects of SPNs on cell cycle, apoptosis and the expression of several genes and miRNAs were investigated.<h4>Results</h4>IC<sub>50</sub> of SPNs was determined to be 40 µg/ml after 24 hr. Our analysis showed that >98% of MIA PaCa-2 cells expressed three stem cell markers. FACS analysis showed a decrease in these markers in SPNs-treated cells. PI/AnnexinV staining revealed that 40 µg/ml and 50 µg/ml of SPNs increased apoptosis up to ~40% and >80% of treated cells, respectively. Upregulation of miR-34a, miR-126, and miR-let7b and downregulation of miR-155, miR-222 and miR-21 was observed in SPNs-treated cells. In addition, downregulation of some genes involved in proliferation or migration such as AKT3, MASPINE, and SERPINEA12, and upregulation of apoptotic genes were observed in treated cells.<h4>Conclusion</h4>Our results suggested that SPNs induced apoptosis and inhibited migration and proliferation in pancreatic cells and cancer stem cells through suppression of some onco-miRs and induction of some tumor suppressive miRs, as well as their targets.
Also flagged:cancerLV dysfunctionHeart Diseasebreast cancerHodgkin lymphomacoronary artery disease
Journal Article2020-04-01✓ 1 SnippetQuintana RA, Bui LP, Moudgil R, Palaskas N, Hassan S, Abe JI, Mouhayar E, Yusuf SW, Hernandez A, Banchs J.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Speckle-tracking echocardiography has enabled clinicians to detect changes in myocardial function with more sensitivity than that afforded by traditional diastolic and systolic functional measurements, including left ventricular ejection fraction. Speckle-tracking echocardiography enables evaluation of myocardial strain in terms of strain (percent change in length of a myocardial segment relative to its length at baseline) and strain rate (strain per unit of time). Both measurements have potential for use in diagnosing and monitoring the cardiovascular side effects of cancer therapy. Regional and global strain measurements can independently predict outcomes not only in patients who experience cardiovascular complications of cancer and cancer therapy, but also in patients with a variety of other clinical conditions. This review and case series examine the clinical applications and overall usefulness of speckle-tracking echocardiography in cardio-oncology and, more broadly, in clinical cardiology.
Journal Article2020-04-01✓ 1 SnippetDuran Tİ, Özgen M.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
Calcium pyrophosphate deposition disease (CPPD) is a crystal arthropathy, and may present with various clinical manifestations such as asymptomatic CPPD, osteoarthritis with CPPD, acute CPPD crystal arthritis (formerly pseudogout), and chronic CPPD crystal inflammatory arthritis. It is known that aging, trauma and osteoarthritis are major risk factors for CPPD. Acute CPP arthritis may occur as monoarticular or oligoarticular and usually involves large peripheral joints such as the knees, wrists and ankles. CPPD is characterized by sudden onset of severe pain, swelling and periarticular erythema, and systemic symptoms such as fever, chills, and weakness may occur. On the other hand, axial CPPD has been reported rarely and most cases appear with symptoms related to a mass effect such as foramen magnum syndrome, spinal stenosis, radiculopathy, myelopathy, synovial cyst or cauda equina syndrome. In addition, there are fewer reported cases of spinal CPPD that cause neck and back pain. This clinical condition should be considered in the differential diagnosis of acute neck and back pain.
Also flagged:channelopathymigrainemigraine with auraion channelsmigrainesSCN1A
Journal Article2020-04-01✓ 2 SnippetsKowalska M, Prendecki M, Kapelusiak-Pielok M, Grzelak T, Łagan-Jędrzejczyk U, Wiszniewska M, Kozubski W, Dorszewska J.
In-Text Gene Mentions
Discussion)
…Another potential target for migraine therapy may be syntaxin 1A as it is involved in serotoninergic system regulation by affecting the subcellular localization and expression of 5-HT transporter (5-HTT) [44].…
Discussion)
…of 5-HT transporter (5-HTT) [ 44 ].…
Show Full Abstract
<h4>Background</h4>Migraine is a polygenetic disease, considered as a channelopathy. The dysregulation of ion functioning due to genetic changes may activate the trigeminovascular system and induce migraine attack both migraine with aura (MA) and without aura (MO).<h4>Objectives</h4>The aim of the study was to analyze the following variants of genes encoding ion channels and associated protein: c.3199G>A <i>SCN1A</i>, c.56G>A <i>SCN2A</i>, c.28A>G and c.328T>C <i>KCNK18</i>, c.3053A>G <i>TRPA1</i>, c.31-1811C>T <i>STX1A</i> in migraine patients.<h4>Patients and methods</h4>The study included 170 migraine patients and 173 controls. HRMA and Sanger sequencing were used for genotyping. Meta-analysis was performed for c.28A>G, c.328T>C <i>KCNK18,</i> and c.31-1811C>T <i>STX1A</i>.<h4>Results</h4>AA genotype of c.56G>A <i>SCN2A</i> was found only in migraine patients. Patients with c.328T>C <i>KCNK18</i> mutation had an increased risk of developing migraine before the age of 18. Moreover, individuals with AA/TC haplotype of <i>KCNK18</i> had higher attack frequency than those with AA/TT (p<0.05). T allele of c.31-1811C>T <i>STX1A</i> was more frequent in MA patients than MO (p<0.05). The c.3053A>G <i>TRPA1</i> polymorphism was more common in patients with migraine onset before the age of 15 (p<0.05), while c.31-1811C>T <i>STX1A</i> and c.3199G>A <i>SCN1A</i> before the age of 10 (p<0.01). Meta-analysis showed a significant association of c.31-1811C>T <i>STX1A</i> polymorphism with migraine overall (OR=1.22, p=0.0086), MA, and MO. No association was found for c.28A>G <i>KCNK18</i>, c.328T>C <i>KCNK18,</i> and migraine overall.<h4>Conclusion</h4>Changes in genes encoding ion channels or proteins regulating their functioning may increase the risk of migraines and correlate with clinical features of disease, <i>e.g</i>. age of onset and attack frequency.
…It encodes 5-hydroxy-tryptamine (serotonin) transporter (5-HTT), which is involved in absorbing serotonin in serotonergic neurons.…
Show Full Abstract
The present review addresses major depressive disorder (MDD) and the implications of antidepressant treatment in the field of brain neuroplasticity, an effect initially considered adjacent but currently passed as central in the process of remission of MDD. Both in experimental animal studies and in human studies in subjects with mood disorders, neuroplasticity is considered the fundamental mechanism of neural defense against stress. Stress is the mediator between neurofunctional, neuroendocrine, neurobiological and neuroimmune disorders and depressive pathology of various intensities. Neurons have a high potential to adapt to the influences of internal and external factors. We are talking about neuroplasticity at different levels: structural neuroplasticity involving adult neurogenesis (such as plastic changes, dendritic reconstruction, when the morphology of the spine is affected); synaptic functional neuroplasticity and molecular and cellular mechanisms involved. These two major dimensions explain the pathophysiology of depression, as well as the convergence of the mechanisms involved in stress, major depressive decompensations, and the concept of neuroplasticity as the present target for new effective and potent antidepressant treatments.
…known hepatic diseases (hemochromatosis, Wilson disease, α…
Show Full Abstract
According to recent data, psoriatic patients have an increased prevalence of non-alcoholic fatty liver disease (NAFLD) and metabolic syndrome, compared with the general population. In some published studies, the severity and presence of psoriasis disease were correlated with the severity of NAFLD. In the current study, we aimed to compare the sensibility and specificity of the non-invasive scores and liver biopsy in determining fibrosis in patients with NAFLD and moderate to severe psoriasis. We performed the scientific research from June 2014-December 2017 and we included 71 patients: 40 patients with NAFLD and 31 patients with moderate to severe psoriasis according to Psoriasis Area and Severity Index (PASI) score and NAFLD, who received Etanercept treatment for at least one year. Based on the clinical and laboratory data, we calculated the following scores for fibrosis: body mass index (BMI), aspartate aminotransferase (AST)∕alanine aminotransferase (ALT) ratio, diabetes (BARD) score, Fibrosis-4 (FIB-4) score, and NAFLD fibrosis score (NFS). For liver biopsy, we used the Menghini technique. By calculating Kendall's test, we also observed a strong direct correlation between the degree of fibrosis and FIB-4 (tau=0.558) and NFS (tau=0.490) scores, with a critical statistical impact, and the lack of a correlation with the BARD score (tau=0.095; p=0.332). The hepatic biopsy allowed the more accurate establishment of the role of the non-invasive tests in the diagnosis of the lesions of steatosis, steatohepatitis, and hepatic fibrosis. The non-invasive tests are most useful for the exclusion of the evolution lesions and for the confirmation of the advanced stages of the disease. Among these, the NFS score proved a high statistically significant correlation (p<0.0001) with the fibrosis histological lesions.
Also flagged:EGFRtyrosine kinasenon-small cell lung cancerNSCLCSpred-3Akt
Journal Article2020-04-01No SnippetsHe Z, Gong F, Liao J, Wang Q, Su Y, Chen C, Lin J, Lin RJ.
Show Full Abstract
<h4>Background</h4>Epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) are standard treatment for advanced non-small cell lung cancer (NSCLC). However, the emergence of EGFR-TKIs resistance poses a big challenge to the treatment. Although several resistant mutations have been identified, our understanding of the mechanisms underlying acquired EGFR-TKIs resistance remains incomplete. This study aimed to identify novel mutations and mechanisms that could contribute to acquired EGFR-TKIs resistance in EGFR mutated NSCLC cells.<h4>Methods</h4>Erlotinib resistant cells (HCC827/ER cells) were generated from the <i>EGFR</i> mutated NSCLC cell line HCC827, and whole-exome sequencing was performed to identify gene mutations in HCC827/ER cells. The Spred-3 expression was determined using quantitative real-time PCR (qPCR) and Western blotting assays, and the p-p44/42, p44/42, p-Akt and Akt expression was determined using Western blotting. The half maximal inhibitory concentration (IC<sub>50</sub> value) was measured using the MTS assay, and cell migration was detected with a Transwell migration assay.<h4>Results</h4>Whole-exome sequencing identified deletion mutation c.120delG at exon 1 of the <i>Spred-3</i> gene, resulting in a p.E40fs change in amino acid, in HCC827/ER cells. The Spred-3 expression was much reduced in HCC827/ER cells as compared to the HCC827 cells at both mRNA and protein levels. Knocking out <i>Spred-3</i> in HCC827 cells using CRISPR/Cas9 increased erlotinib resistance and cell migration, while overexpressing <i>Spred-3</i> in HCC827/ER cells using a cDNA construct reduced erlotinib resistance and cell migration. We also showed the Ras/Raf/MAPK pathway was activated in HCC827/ER cells, and inhibiting ERK1/2 in HCC827/Spred-3-sgRNA cells resulted in reduced erlotinib resistance and cell migration.<h4>Conclusions</h4>The results of this study indicate that a loss-of-function mutation in <i>Spred-3</i> resulted in activation of the Ras/Raf/MAPK pathway that confers resistance to EGFR-TKIs in NSCLC cells harboring an <i>EGFR</i> mutation.
Also flagged:gastric cancercancergene expressiongene expressionsalcohol dehydrogenase 4ADH4
Journal Article2020-04-01No SnippetsLiu X, Gao L, Ni D, Ma C, Lu Y, Huang X.
Show Full Abstract
<h4>Background</h4>Gastric cancer (GC) is the second most frequent cause of cancer-related mortality in the world, and the five-year survival rate for GC remains very low universally. In recent years, it has become a consensus that genetic changes are associated with carcinogenesis of GC, and precision medicine based on genetic changes is one of the most popular treatments for GC patients. However, the association between some genes and GC-related protein signaling pathways is still not well understood. This study revealed that seven genes were closely related to the survival probability in GC patients.<h4>Methods</h4>We downloaded the gene expression data of GC patients from The Cancer Genome Atlas (TCGA) databases, and integrated bioinformatic analysis was performed, such as differential gene expression analysis, including Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) pathways analyses, as well as survival analysis. The r package "survival" was used to analyze the Kaplan-Meier survival analysis, which showed the associations between specific gene expressions and the outcomes of patients with GC to identify which genes could be potential prognostic biomarkers.<h4>Results</h4>This study revealed that seven genes: alcohol dehydrogenase 4 (ADH4), histamine receptor H3 (HRH3), neuropeptide Y2 receptor (NPY2R), apolipoprotein AI (APOA1), N-acetylgalactosaminyltransferase 14 (GALNT14), leucine-rich repeats and IQ motif containing 1 (LRRIQ1), and coiled-coil-domain-containing 57 (CCDC57). These seven genes were closely related to the survival probability of GC patients (P<0.05).<h4>Conclusions</h4>Our study found seven genes which could be considered as candidate prognostic biomarkers and therapeutic targets.
bioRxiv2020-04-01Preprint (No Snippets API)Hassine S, Bonnet-Magnaval F, Benoit-Bouvrette L, Doran B, Ghram M, Bouthillette M, Lecuyer E, DesGroseillers L.
Show Full Abstract
<h4>ABSTRACT</h4> Staufen1 (STAU1) is an RNA-binding protein involved in the posttranscriptional regulation of mRNAs. We report that a large fraction of STAU1 localizes to the mitotic spindle in the colorectal cancer HCT116 and in the non-transformed hTERT-RPE1 cells. Spindle-associated STAU1 partly co-localizes with ribosomes and active sites of translation. We mapped the molecular determinant required for STAU1/spindle association within the first 88 N-terminal amino acids, a domain that is not required for RNA binding. Interestingly, transcriptomic analysis of purified mitotic spindles reveals that 1054 mRNAs as well as the precursor ribosomal RNA and lncRNAs and snoRNAs involved in ribonucleoprotein assembly and processing are enriched on spindles compared to cell extracts. STAU1 knockout causes the displacement of the pre-rRNA and of 154 mRNAs coding for proteins involved in actin cytoskeleton organization and cell growth, highlighting a role for STAU1 in mRNA trafficking to spindle. These data demonstrate that STAU1 controls the localization of sub-populations of RNAs during mitosis and suggests a novel role of STAU1 in pre-rRNA maintenance during mitosis, ribogenesis and/or nucleoli reassembly. <h4>SUMMARY STATEMENT</h4> Proper localization and functions of macromolecules during cell division are crucial to ensure survival and proliferation of daughter cells.
bioRxiv2020-04-01Preprint (No Snippets API)Fitz-James MH, Tong P, Pidoux AL, Ozadam H, Yang L, White SA, Dekker J, Allshire RC.
Show Full Abstract
During mitosis chromosomes reorganise into highly compact, rod-shaped forms, thought to consist of consecutive chromatin loops around a central protein scaffold. Condensin complexes are involved in chromatin compaction, but the contribution of other chromatin proteins, DNA sequence and histone modifications is less understood. A large region of fission yeast DNA inserted into a mouse chromosome was previously observed to adopt a mitotic organisation distinct from that of surrounding mouse DNA. Here we show that a similar distinct structure is common to a large subset of insertion events in both mouse and human cells and is coincident with the presence of high levels of heterochromatic H3 lysine 9 trimethylation (H3K9me3). Hi-C and microscopy indicate that the heterochromatinised fission yeast DNA is organised into smaller chromatin loops than flanking euchromatic mouse chromatin. We conclude that heterochromatin alters chromatin loop size, thus contributing to the distinct appearance of heterochromatin on mitotic chromosomes, such as at centromeres.
medRxiv2020-04-01Preprint (No Snippets API)Shi C, Wang C, Wang H, Yang C, Cai F, Zeng F, Cheng F, Liu Y, Zhou T, Deng B, Vlodavsky I, Li J, Zhang Y.
Show Full Abstract
<h4>Summary</h4> <h4>Background</h4> On March 11, 2020, the World Health Organization declared its assessment of COVID-19 as a global pandemic. However, specific antiviral drugs are still unavailable, and pateints are managed by multiple complementary treatments. <h4>Methods</h4> The electronic medical records of COVID-19 patients where basic information, complete blood count, coagulation profile, inflammatory cytokines and serum biochemical indicators in 42 patients with COVID-19 (21 of whom were treated with low molecular weight heparin (LMWH), and 21 without LMWH) that were retrospectively analyzed to compare and evaluate the effect of LMWH treatment on disease progression. <h4>Findings</h4> 42 patients with COVID-19 treated at the hospital between February 1 and March 15, 2020, were selected for the study, of which 21 underwent LMWH treatment (LMWH group), and 21 did not (Control), during hospitalization. Changes in the percentage of lymphocytes in the LMWH group before and after LMWH treatment were significantly different from those in the control group (11·10±9·50 vs. 3·08±9·66, p =0·011, respectively). Changes in the levels of D-dimer and fibrinogen degradation products (FDP) in the LMWH group before and after LMWH treatment were significantly different from those in the control group (-2·85±3·90, -0·05±0.85, p =0·002; -9·05±13·14, -1·78±3·15, p =0·035). Strikingly, in the LMWH group, IL-6 levels were significantly reduced after LMWH treatment (47·47±58·86, 15·76±25·71, p =0·006). Besides, the changes in IL-6 levels in the LMWH group before and after LMWH treatment were significantly different from those in the control group (-32·46±65·97, 14·96±151·09, p =0·031). <h4>Interpretation</h4> LMWH improves the coagulation dysfunction of COVID-19 patients and exerts anti-inflammatory effects by reducing IL-6 and increasing lymphocyte %. It appears that LMWH can be used as a potential therapeutic drug for the treatment of COVID-19, paving the way for a subsequent well-controlled clinical trial. <h4>Funding</h4> National Natural Science Foundation of China (No. 81603037 to SC) and the National Key Research and Development Plan of China(2017YFC0909900).