Also flagged:Prostate Cancertamoxifenestrogensartemisininbreast cancerSynthesis
Journal Article2020-06-30No SnippetsFröhlich T, Mai C, Bogautdinov RP, Morozkina SN, Shavva AG, Friedrich O, Gilbert DF, Tsogoeva SB.
Show Full Abstract
In the search for new and effective treatments of breast and prostate cancer, a series of hybrid compounds based on tamoxifen, estrogens, and artemisinin were successfully synthesized and analyzed for their in vitro activities against human prostate (PC-3) and breast cancer (MCF-7) cell lines. Most of the hybrid compounds exhibit a strong anticancer activity against both cancer cell lines - for example, EC<sub>50</sub> (PC-3) down to 1.07 μM, and EC<sub>50</sub> (MCF-7) down to 2.08 μM - thus showing higher activities than their parent compounds 4-hydroxytamoxifen (afimoxifene, 7; EC<sub>50</sub> =75.1 (PC-3) and 19.3 μM (MCF-7)), dihydroartemisinin (2; EC<sub>50</sub> =263.6 (PC-3) and 49.3 μM (MCF-7)), and artesunic acid (3; EC<sub>50</sub> =195.1 (PC-3) and 32.0 μM (MCF-7)). The most potent compounds were the estrogen-artemisinin hybrids 27 and 28 (EC<sub>50</sub> =1.18 and 1.07 μM, respectively) against prostate cancer, and hybrid 23 (EC<sub>50</sub> =2.08 μM) against breast cancer. These findings demonstrate the high potential of hybridization of artemisinin and estrogens to further improve their anticancer activities and to produce synergistic effects between linked pharmacophores.
Also flagged:Tumourcolorectal cancermetastatic diseasegastrointestinal cancersPTBcancers
Journal Article2020-06-30No SnippetsZlobec I, Berger MD, Lugli A.
Show Full Abstract
Tumour budding in colorectal cancer has become an important prognostic factor. Represented by single cells or small tumour cell clusters at the invasion front of the tumour mass, these tumour buds seem to reflect cells in a 'hybrid' state of epithelial-mesenchymal transition, and evidence indicates that the presence of these entities is associated with lymph node metastasis, local recurrence and distant metastatic disease. The International Tumour Budding Consensus Conference (ITBCC) has highlighted a scoring system for the reporting of tumour budding in colorectal cancer, as well as different clinical scenarios that could affect patient management. Other organs are not spared: tumour budding has been described in numerous gastrointestinal and non-gastrointestinal cancers. Here, we give an update on ITBCC validation studies in the context of colorectal cancer and the clinical implications of tumour budding throughout the upper gastrointestinal and pancreatico-biliary tract.
<h4>Background</h4>Vertebral fractures (VFs) are the most common clinical manifestation of osteoporosis associated with high morbimortality. A personal/familiar history of fractures increases the risk of fractures. The purpose of this study is to identify possible molecular markers associated with osteoporotic VFs in elderly women from community.<h4>Methods</h4>Transcriptomic analysis using Affymetrix HTA2 microarray was performed using whole blood samples of 240 subjects from a population-based survey (Sao Paulo Ageing & Health [SPAH] study). Only elderly women with osteoporosis diagnosis by densitometry were analyzed, and divided in two groups: VF: women with osteoporosis and VFs versus no vertebral fracture (NVF): women with osteoporosis and NVFs. They were matched for age, chronic disease, medication use, and bone mineral density (BMD). The logistic regression model adjusted for age was applied for transcriptome data analysis. SYBR green-based quantitative polymerase chain reaction (qPCR) was used to validate the most significant expression changes obtained in the microarray experiment.<h4>Results</h4>Microarray analysis identified 142 differentially expressed genes (DEGs, p < .01), 57 upregulated and 85 downregulated, compared VF versus NVF groups. The DEG with the greatest expression difference was the Gamma2-Syntrophin (SNTG2) (β = 31.88, p = .005). Validation by qPCR confirmed increased expression in VF group of Syntrophin (SNTG2, fold change = 2.79, p = .009), TRAF3 Interacting Protein2 (TRAF3IP2, fold change = 2.79, p = .020), and Integrin Subunit Alpha 6 (ITGA6, fold change = 2.86, p = .038).<h4>Conclusion</h4>Our data identified and validated the association of SNTG2 (608715), TRAF3IP2 (607043), and ITGA6 (147556) with osteoporotic VF in elderly women, independently of BMD. These results suggest that these transcripts have potential clinical significance and may help to explain the molecular mechanisms and biological functions of vertebral fracture.
The BthA protein from the microorganism <i>Burkholderia thailandensis</i> contains two hemes with axial His/OH<sub>2</sub> and His/Tyr coordinations separated by the closest interheme distance of 14 Å. BthA has a similar structure and belongs to the same family of multiheme cytochrome <i>c</i> peroxidases as MauG, which performs long-range oxidation of the partner protein methylamine dehydrogenase. Magnetic Mössbauer spectroscopy of the diferric state of BthA corroborates previous structural work identifying a high-spin (His/OH<sub>2</sub>) peroxidatic heme and a low-spin (His/Tyr) electron transfer heme. Unlike MauG, addition of H<sub>2</sub>O<sub>2</sub> fully converts the diferric form of BthA to a stable 2e<sup>-</sup> oxidized state, allowing a new assessment of this state. The peroxidatic heme is found to be oxidized to a canonical compound II, S = 1 oxoiron(IV) heme. In contrast, the electronic properties of the oxidized His/Tyr heme are puzzling. The isomer shift of the His/Tyr heme (0.17 mm/s) is close to that of the precursor S = 1/2 Fe<sup>3+</sup> heme (0.21 mm/s) which suggests oxidation of the Tyr. However, the spin-dipolar hyperfine coupling constants are found here to be the same as those for the ferryl peroxidatic heme, indicating that the His/Tyr heme is also a compound II, S = 1 Fe<sup>4+</sup> heme and ruling out oxidation of the Tyr. DFT calculations indicate that the unusually high isomer shift is not attributable to the rare axial His/Tyr heme coordination. The calculations are only compatible with spectroscopy for an unusually long Fe<sup>4+</sup>-O<sub>Tyr</sub> distance, which is presumably under the influence of the protein environment of the His/Tyr heme moiety in the H<sub>2</sub>O<sub>2</sub> oxidized state of the protein. The results offer new insights into how high valence intermediates can be tuned by the protein environment for performing long-range oxidation.
Also flagged:allergic diseasesallergic diseaseasthmahay fevereczemaallergy
Journal Article2020-06-30No SnippetsFerreira MAR, Vonk JM, Baurecht H, Marenholz I, Tian C, Hoffman JD, Helmer Q, Tillander A, Ullemar V, Lu Y, Grosche S, Rüschendorf F, Granell R, Brumpton BM, Fritsche LG, Bhatta L, Gabrielsen ME, Nielsen JB, Zhou W, Hveem K, Langhammer A, Holmen OL, Løset M, Abecasis GR, Willer CJ, Emami NC, Cavazos TB, Witte JS, Szwajda A, 23andMe Research Team, collaborators of the SHARE study, Hinds DA, Hübner N, Weidinger S, Magnusson PK, Jorgenson E, Karlsson R, Paternoster L, Boomsma DI, Almqvist C, Lee YA, Koppelman GH.
Show Full Abstract
Risk factors that contribute to inter-individual differences in the age-of-onset of allergic diseases are poorly understood. The aim of this study was to identify genetic risk variants associated with the age at which symptoms of allergic disease first develop, considering information from asthma, hay fever and eczema. Self-reported age-of-onset information was available for 117,130 genotyped individuals of European ancestry from the UK Biobank study. For each individual, we identified the earliest age at which asthma, hay fever and/or eczema was first diagnosed and performed a genome-wide association study (GWAS) of this combined age-of-onset phenotype. We identified 50 variants with a significant independent association (P<3x10-8) with age-of-onset. Forty-five variants had comparable effects on the onset of the three individual diseases and 38 were also associated with allergic disease case-control status in an independent study (n = 222,484). We observed a strong negative genetic correlation between age-of-onset and case-control status of allergic disease (rg = -0.63, P = 4.5x10-61), indicating that cases with early disease onset have a greater burden of allergy risk alleles than those with late disease onset. Subsequently, a multivariate GWAS of age-of-onset and case-control status identified a further 26 associations that were missed by the univariate analyses of age-of-onset or case-control status only. Collectively, of the 76 variants identified, 18 represent novel associations for allergic disease. We identified 81 likely target genes of the 76 associated variants based on information from expression quantitative trait loci (eQTL) and non-synonymous variants, of which we highlight ADAM15, FOSL2, TRIM8, BMPR2, CD200R1, PRKCQ, NOD2, SMAD4, ABCA7 and UBE2L3. Our results support the notion that early and late onset allergic disease have partly distinct genetic architectures, potentially explaining known differences in pathophysiology between individuals.
Skeletal muscle fibers are primarily categorized into oxidative and glycolytic fibers, and the ratios of different myofiber types are important factors in determining livestock meat quality. However, the molecular mechanism for determining muscle fiber types in chickens was hardly understood. In this study, we used RNA sequencing to systematically compare mRNA and microRNA transcriptomes of the oxidative muscle sartorius (SART) and glycolytic muscle pectoralis major (PMM) of Chinese Qingyuan partridge chickens. Among the 44,705 identified mRNAs in the two types of muscles, 3,457 exhibited significantly different expression patterns, including 2,364 up-regulated and 1,093 down-regulated mRNAs in the SART. A total of 698 chicken miRNAs were identified, including 189 novel miRNAs, among which 67 differentially expressed miRNAs containing 42 up-regulated and 25 down-regulated miRNAs in the SART were identified. Furthermore, function enrichment showed that the differentially expressed mRNAs and miRNAs were involved in energy metabolism, muscle contraction, and calcium, peroxisome proliferator-activated receptor (PPAR), insulin and adipocytokine signaling. Using miRNA-mRNA integrated analysis, we identified several candidate miRNA-gene pairs that might affect muscle fiber performance, viz, gga-miR-499-5p/SOX6 and gga-miR-196-5p/CALM1, which were supported by target validation using the dual-luciferase reporter system. This study revealed a mass of candidate genes and miRNAs involved in muscle fiber type determination, which might help understand the molecular mechanism underlying meat quality traits in chickens.
Journal Article2020-06-30No SnippetsKaufman D, McKay N, Routson C, Erb M, Dätwyler C, Sommer PS, Heiri O, Davis B.
Show Full Abstract
An extensive new multi-proxy database of paleo-temperature time series (Temperature 12k) enables a more robust analysis of global mean surface temperature (GMST) and associated uncertainties than was previously available. We applied five different statistical methods to reconstruct the GMST of the past 12,000 years (Holocene). Each method used different approaches to averaging the globally distributed time series and to characterizing various sources of uncertainty, including proxy temperature, chronology and methodological choices. The results were aggregated to generate a multi-method ensemble of plausible GMST and latitudinal-zone temperature reconstructions with a realistic range of uncertainties. The warmest 200-year-long interval took place around 6500 years ago when GMST was 0.7 °C (0.3, 1.8) warmer than the 19<sup>th</sup> Century (median, 5<sup>th</sup>, 95<sup>th</sup> percentiles). Following the Holocene global thermal maximum, GMST cooled at an average rate -0.08 °C per 1000 years (-0.24, -0.05). The multi-method ensembles and the code used to generate them highlight the utility of the Temperature 12k database, and they are now available for future use by studies aimed at understanding Holocene evolution of the Earth system.
Also flagged:HIST1H2BNMTAGHIST1H1BKCNB1GLT8D1GABBR1
Journal Article2020-06-30✓ 5 SnippetsWu Y, Cao H, Baranova A, Huang H, Li S, Cai L, Rao S, Dai M, Xie M, Dou Y, Hao Q, Zhu L, Zhang X, Yao Y, Zhang F, Xu M, Wang Q.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Discussion)
…Among 146 genes, there were seven genes common to four disorders, including GLT8D1, KCNB1, GABBR1, HIST1H1B, HIST1H2BN, and HIST1H4L in SCZ, DEP, BD, and ASD, and DCC in ADHD, ASD, DEP, and SCZ.…
Abstract)
…KCNB1 , andDCC.…
Discussion)
…and ASD, andDCCin ADHD, ASD,…
Discussion)
…DCCplays a pivotal…
Show Full Abstract
We conducted a cross-trait meta-analysis of genome-wide association study on schizophrenia (SCZ) (n = 65,967), bipolar disorder (BD) (n = 41,653), autism spectrum disorder (ASD) (n = 46,350), attention deficit hyperactivity disorder (ADHD) (n = 55,374), and depression (DEP) (n = 688,809). After the meta-analysis, the number of genomic loci increased from 14 to 19 in ADHD, from 3 to 10 in ASD, from 45 to 57 in DEP, from 8 to 54 in BD, and from 64 to 87 in SCZ. We observed significant enrichment of overlapping genes among different disorders and identified a panel of cross-disorder genes. A total of seven genes were found being commonly associated with four out of five psychiatric conditions, namely GABBR1, GLT8D1, HIST1H1B, HIST1H2BN, HIST1H4L, KCNB1, and DCC. The SORCS3 gene was highlighted due to the fact that it was involved in all the five conditions of study. Analysis of correlations unveiled the existence of two clusters of related psychiatric conditions, SCZ and BD that were separate from the other three traits, and formed another group. Our results may provide a new insight for genetic basis of the five psychiatric disorders.
Also flagged:myeloid leukemiamyeloid sarcomaMSacute myeloid leukemiaAMLmyelodysplastic syndromes
Journal Article2020-06-30No SnippetsFrietsch JJ, Hunstig F, Wittke C, Junghanss C, Franiel T, Scholl S, Hochhaus A, Hilgendorf I.
Show Full Abstract
Myeloid sarcoma (MS) as a solid extra-medullary (EM) manifestation of acute myeloid leukemia (AML), myeloproliferative or myelodysplastic syndromes is a rare presentation of relapse after allogeneic hematopoietic stem cell transplantation (HSCT). The databases of the Departments of Hematology and Oncology of the University Hospitals of Jena and Rostock were screened for patients aged 18 years or older for onset of MS after HSCT for myeloid malignancies between 2002 and 2019. Nineteen patients with MS were identified, the majority of whom had received reduced-intensity conditioning (RIC). The median onset of MS was 425 days after HSCT and the median overall survival since MS was 234 days. Although MS is associated with a poor prognosis, three patients survived more than two years and one more than 11 years after MS onset. These results indicate that RIC protocols may be associated with a higher risk of EM relapse. Since EM relapse occurred in the presence of Graft-versus-host-disease, these observations also demonstrate the limitations of graft-versus-tumor effects after HSCT. In conclusion, occurrence of MS after HSCT is associated with a poor prognosis, as multimodal curative concepts including intensive chemotherapy and another HSCT are often not viable.
Also flagged:Typehereditary hemochromatosisSLC40A1hypopituitarismirontype 4 hereditary hemochromatosis
Journal Article2020-06-30✓ 2 SnippetsHonma Y, Karasuyama T, Kumamoto K, Shimajiri S, Toki Y, Tatsumi Y, Sumida K, Koikawa K, Morino K, Oe S, Miyagawa K, Yamasaki M, Shibata M, Abe S, Ikuta K, Hayashi H, Harada M.
In-Text Gene Mentions
Abstract)
…Hemochromatosisis a clinical…
Abstract)
…atosis (ferroportin-associatedhemochromatosis) by the findings…
Show Full Abstract
Hemochromatosis is a clinical syndrome characterized by iron overload in various organs. We present here a case of type 4 hereditary hemochromatosis due to heterozygous mutation in SLC40A1 gene (p.D157A). SLC40A1 encodes ferroportin, a macromolecule only known as iron exporter from mammalian cells. He first presented symptoms correlated with hypopituitarism. Furthermore, marked hyperferritinemia and high transferrin saturation were revealed in combination with the findings of iron overload in the liver, spleen and pituitary gland by computed tomography and magnetic resonance imaging. Liver biopsy revealed iron deposition in both hepatocytes and Kupffer cells. SLC40A1 mutations are considered to cause wide heterogeneity by various ferroportin mutations. Thus, clinicopathological examinations seem to be very important for diagnosing phenotype of type 4 hemochromatosis in addition to the gene analysis. We diagnosed him as type 4B hereditary hemochromatosis (ferroportin-associated hemochromatosis) by the findings of high transferrin saturation and iron deposition in hepatocytes, and then started iron chelating treatment. We should suspect the possibility of hereditary hemochromatosis even in Japanese with severe iron overload. Although the same mutation in SLC40A1 gene (p.D157A) had been reported to cause "loss of function" phenotype, we considered that the mutation of our case caused "gain of function" phenotype.
Also flagged:Histone AcetyltransferaseMOFfatty acidphosphorylationmitochondrialcarbon
Journal Article2020-06-30✓ 1 SnippetKhoa LTP, Tsan YC, Mao F, Kremer DM, Sajjakulnukit P, Zhang L, Zhou B, Tong X, Bhanu NV, Choudhary C, Garcia BA, Yin L, Smith GD, Saunders TL, Bielas SL, Lyssiotis CA, Dou Y.
In-Text Gene Mentions
Text
…Eci2…
Show Full Abstract
Self-renewing embryonic stem cells (ESCs) respond to environmental cues by exiting pluripotency or entering a quiescent state. The molecular basis underlying this fate choice remains unclear. Here, we show that histone acetyltransferase MOF plays a critical role in this process through directly activating fatty acid oxidation (FAO) in the ground-state ESCs. We further show that the ground-state ESCs particularly rely on elevated FAO for oxidative phosphorylation (OXPHOS) and energy production. Mof deletion or FAO inhibition induces bona fide quiescent ground-state ESCs with an intact core pluripotency network and transcriptome signatures akin to the diapaused epiblasts in vivo. Mechanistically, MOF/FAO inhibition acts through reducing mitochondrial respiration (i.e., OXPHOS), which in turn triggers reversible pluripotent quiescence specifically in the ground-state ESCs. The inhibition of FAO/OXPHOS also induces quiescence in naive human ESCs. Our study suggests a general function of the MOF/FAO/OXPHOS axis in regulating cell fate determination in stem cells.
…CT revealed liverhemochromatosis, but the findings…
Show Full Abstract
Amiodarone, prescribed for cardiac conditions, including dysrhythmia, is associated with bradycardia. However, few reports have demonstrated that bradycardia is observed when amiodarone is used in combination with sofosbuvir, a direct-acting antiviral drug for chronic hepatitis C. We herein report the case of a male patient in his 70s with chronic atrial fibrillation and prostatic hyperplasia and was also taking amiodarone, who experienced severe bradycardia and syncope a day after taking sofosbuvir and ribavirin for chronic hepatitis C. After discontinuing amiodarone, ribavirin, and sofosbuvir, bradycardia did not recur. Therefore, we must consider drug interactions between amiodarone and sofosbuvir in patients with severe bradycardia.
<h4>Objective</h4>To catalog and characterize the proteome of normal human intervertebral disc (IVD).<h4>Methods</h4>Nine magnetic resonance imaging (MRI) normal IVDs were harvested from 9 different brain dead yet alive voluntary organ donors and were subjected to electrospray ionization-liquid chromatography tandem mass spectrometry (ESI-LC-MS/MS) acquisition.<h4>Results</h4>A total of 1,116 proteins were identified. Functional enrichment analysis tool DAVID ver. 6.8 categorized: extracellular proteins (38%), intracellular (31%), protein-containing complex (13%), organelle (9%), membrane proteins (6%), supramolecular complex (2%), and 1% in the cell junction. Molecular function revealed: binding activity (42%), catalytic activity (31%), regulatory activity (14%), and structural activity (7%). Molecular transducer, transporter, and transcription regulator activity together contributed to 6%. A comparison of the proteins obtained from this study to others in the literature showed a wide variation in content with only 3% of bovine, 5% of murine, 54% of human scoliotic discs, and 10.2% of discs adjacent to lumbar burst fractures common to our study of organ donors. Between proteins reported in scoliosis and lumbar fracture patients, only 13.51% were common, further signifying the contrast amongst the various MRI normal IVD samples.<h4>Conclusion</h4>The proteome of "healthy" human IVDs has been defined, and our results show that proteomic data on IVDs obtained from scoliosis, fracture patients, and cadavers lack normal physiological conditions and should not be used as biological controls despite normal MRI findings. This questions the validity of previous studies that have used such discs as controls for analyzing the pathomechanisms of disc degeneration.
Also flagged:Obesityresponse to tastebehavioraltype 2 diabetes mellituscardiovascular diseasecancer
Journal Article2020-06-30✓ 1 SnippetKroll DS, Feldman DE, Biesecker CL, McPherson KL, Manza P, Joseph PV, Volkow ND, Wang GJ.
In-Text Gene Mentions
S I O 001029)
…In an intervention study, women with obesity and BED showed improved midbrain 5-HTT binding during fluoxetine, a selective serotonin reuptake inhibitor used for weight loss in individuals with obesity [95] and therapy-facilitated remission [96].…
Show Full Abstract
While the global prevalence of obesity has risen among both men and women over the past 40 years, obesity has consistently been more prevalent among women relative to men. Neuroimaging studies have highlighted several potential mechanisms underlying an individual's propensity to become obese, including sex/gender differences. Obesity has been associated with structural, functional, and chemical alterations throughout the brain. Whereas changes in somatosensory regions appear to be associated with obesity in men, reward regions appear to have greater involvement in obesity among women than men. Sex/gender differences have also been observed in the neural response to taste among people with obesity. A more thorough understanding of these neural and behavioral differences will allow for more tailored interventions, including diet suggestions, for the prevention and treatment of obesity.
Also flagged:β-amyloidtauα-synucleinneurodegenerative disordersoxygendeath
Journal Article2020-06-30No SnippetsAbramov AY, Potapova EV, Dremin VV, Dunaev AV.
Show Full Abstract
Aggregation of the misfolded proteins β-amyloid, tau, huntingtin, and α-synuclein is one of the most important steps in the pathology underlying a wide spectrum of neurodegenerative disorders, including the two most common ones-Alzheimer's and Parkinson's disease. Activity and toxicity of these proteins depends on the stage and form of aggregates. Excessive production of free radicals, including reactive oxygen species which lead to oxidative stress, is proven to be involved in the mechanism of pathology in most of neurodegenerative disorders. Both reactive oxygen species and misfolded proteins play a physiological role in the brain, and only deregulation in redox state and aggregation of the proteins leads to pathology. Here, we review the role of misfolded proteins in the activation of ROS production from various sources in neurons and glia. We discuss if free radicals can influence structural changes of the key toxic intermediates and describe the putative mechanisms by which oxidative stress and oligomers may cause neuronal death.
Also flagged:Lung cancerNon-small-cell lung cancerNSCLCnucleotidesgene expressioncancer
Journal Article2020-06-30✓ 2 SnippetsGinn L, Shi L, Montagna M, Garofalo M.
In-Text Gene Mentions
S I O 001029)
…Furthermore, lncRNA ZNFX1 antisense RNA 1 (ZFAS1) acted as a ceRNA for miR-150 to increase HMGA2, resulting in increased NSCLC invasion [99].…
I A O 0000606)
…ZNFX1antisense RNA 1…
Show Full Abstract
Lung cancer is associated with a high mortality, with around 1.8 million deaths worldwide in 2018. Non-small-cell lung cancer (NSCLC) accounts for around 85% of cases and, despite improvement in the management of NSCLC, most patients are diagnosed at advanced stage and the five-year survival remains around 15%. This highlights a need to identify novel ways to treat the disease to reduce the burden of NSCLC. Long non-coding RNAs (lncRNAs) are non-coding RNA molecules longer than 200 nucleotides in length which play important roles in gene expression and signaling pathways. Recently, lncRNAs were implicated in cancer, where their expression is dysregulated resulting in aberrant functions. LncRNAs were shown to function as both tumor suppressors and oncogenes in a variety of cancer types. Although there are a few well characterized lncRNAs in NSCLC, many lncRNAs remain un-characterized and their mechanisms of action largely unknown. LncRNAs have success as therapies in neurodegenerative diseases, and having a detailed understanding of their function in NSCLC may guide novel therapeutic approaches and strategies. This review discusses the role of lncRNAs in NSCLC tumorigenesis, highlighting their mechanisms of action and their clinical potential.
The dynamic evolution of materials with medical applications, particularly for drug delivery and wound dressing applications, gives impetus to design new proposed materials, among which, hydrogels represent a promising, powerful tool. In this context, multifunctional hydrogels have been obtained from chemically modified chitosan and acrylic polymers as cross-linkers, followed by subsequent conjugation with arginine. The hydrogels were finely tuned considering the variation of the synthetic monomer and the preparation conditions. The advantage of using both natural and synthetic polymers allowed porous networks with superabsorbent behavior, associated with a non-Fickian swelling mechanism. The in vitro release profiles for ibuprofen and the corresponding kinetics were studied, and the results revealed a swelling-controlled release. The biodegradability studies in the presence of lysozyme, along with the hemostatic evaluation and the induced fibroblast and stem cell proliferation, have shown that the prepared hydrogels exhibit characteristics that make them suitable for local drug delivery and wound dressing.
Also flagged:CiprofloxacinLevofloxacinPeptidefluoroquinolonecell-penetratingamide
Journal Article2020-06-30No SnippetsPtaszyńska N, Gucwa K, Olkiewicz K, Heldt M, Serocki M, Stupak A, Martynow D, Dębowski D, Gitlin-Domagalska A, Lica J, Łęgowska A, Milewski S, Rolka K.
Show Full Abstract
Seven conjugates composed of well-known fluoroquinolone antibacterial agents, ciprofloxacin (CIP) or levofloxacin (LVX), and a cell-penetrating peptide transportan 10 (TP10-NH<sub>2</sub>) were synthesised. The drugs were covalently bound to the peptide via an amide bond, methylenecarbonyl moiety, or a disulfide bridge. Conjugation of fluoroquinolones to TP10-NH<sub>2</sub> resulted in congeners demonstrating antifungal in vitro activity against human pathogenic yeasts of the <i>Candida</i> genus (MICs in the 6.25 - 100 µM range), whereas the components were poorly active. The antibacterial in vitro activity of most of the conjugates was lower than the activity of CIP or LVX, but the antibacterial effect of CIP-S-S-TP10-NH<sub>2</sub> was similar to the mother fluoroquinolone. Additionally, for two representative CIP and LVX conjugates, a rapid bactericidal effect was shown. Compared to fluoroquinolones, TP10-NH<sub>2</sub> and the majority of its conjugates generated a relatively low level of reactive oxygen species (ROS) in human embryonic kidney cells (HEK293) and human myeloid leukemia cells (HL-60). The conjugates exhibited cytotoxicity against three cell lines, HEK293, HepG2 (human liver cancer cell line), and LLC-PK1 (old male pig kidney cells), with IC<sub>50</sub> values in the 10 - 100 µM range and hemolytic activity. The mammalian toxicity was due to the intrinsic cytoplasmic membrane disruption activity of TP10-NH<sub>2</sub> since fluoroquinolones themselves were not cytotoxic. Nevertheless, the selectivity index values of the conjugates, both for the bacteria and human pathogenic yeasts, remained favourable.
Also flagged:magnesiumbiomineralizationmineralapatitecell adhesionhydroxyapatite
Journal Article2020-06-30No SnippetsHo YH, Man K, Joshi SS, Pantawane MV, Wu TC, Yang Y, Dahotre NB.
Show Full Abstract
The present study aims to evaluate effect of hydroxyapatite (HA, Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>OH<sub>2</sub>), a ceramic similar to natural bone, into AZ31B Mg alloy matrix on biomineralization and biocompatibility. The novel friction stir processing additive manufacturing route was employed to fabricate Mg-HA composites. Various HA contents (5, 10, 20 wt%) were incorporated into Mg matrix. Microstructural observation and chemical composition analysis revealed that refined Mg grains and dispersion of HA particles at micro/nanoscales were achieved in Mg-HA composites after the friction stir processing. The biomineralization evaluation were carried out using immersion experiments in simulated body fluid followed by mineral morphology observation and chemical composition analysis. The wettability measurements were conducted to correlate the biomineralization behavior. The results showed improvement in wettability and bone-like Ca/P ratio in apatite deposit on the composites compared to as-received Mg. In addition, the increase of blood compatibility, cell viability and spreading were found in the higher HA content composites, indicating the improved biocompatibility. Therefore, friction stir processed Mg-20 wt%HA composite exhibited the highest wettability and better cell adhesion among other composites due to the effect of increased HA content within Mg matrix.
Also flagged:Amidestriazolegeranylgeranyl diphosphate synthaseGGDPSbone marrow cancermultiple myeloma
Journal Article2020-06-30No SnippetsGoetz DB, Varney ML, Wiemer DF, Holstein SA.
Show Full Abstract
Geranylgeranyl diphosphate synthase (GGDPS) inhibitors are of potential therapeutic interest as a consequence of their activity against the bone marrow cancer multiple myeloma. A series of bisphosphonates linked to an isoprenoid tail through an amide linkage has been prepared and tested for the ability to inhibit GGDPS in enzyme and cell-based assays. The amides were designed as analogues to triazole-based GGDPS inhibitors. Several of the new compounds show GGDPS inhibitory activity in both enzyme and cell assays, with potency dependent on chain length and olefin stereochemistry.
<h4>Background & aims</h4>Systemic iron status affects multiple health outcomes, however its net effect on life expectancy is not known. We conducted a two-sample Mendelian randomization (MR) study to investigate the association of genetically proxied iron status with life expectancy.<h4>Methods</h4>Using genetic data from 48,972 individuals, we identified three genetic variants as instrumental variables for systemic iron status. We obtained genetic associations of these variants with parental lifespan (n = 1,012,240) and individual survival to the 90th vs. 60th percentile age (11,262 cases and 25,483 controls). We used the inverse-variance weighted method to estimate the effect of a 1-standard deviation (SD) increase in genetically predicted serum iron on each of the life expectancy outcomes.<h4>Results</h4>We found a detrimental effect of genetically proxied higher iron status on life expectancy. A 1-SD increase in genetically predicted serum iron corresponded to 0.70 (95% confidence interval [CI] -1.17, -0.24; P = 3.00 × 10<sup>-3</sup>) fewer years of parental lifespan and had odds ratio 0.81 (95% CI 0.70, 0.93; P = 4.44 × 10<sup>-3</sup>) for survival to the 90th vs. 60th percentile age. We did not find evidence to suggest that these results were biased by pleiotropic effects of the genetic variants.<h4>Conclusions</h4>Higher systemic iron status may reduce life expectancy. The clinical implications of this finding warrant further investigation, particularly in the context of iron supplementation in individuals with normal iron status.
Also flagged:Protocadherinscell adhesion moleculescadherincancerextracellularcadherins
Journal Article2020-06-30No SnippetsPancho A, Aerts T, Mitsogiannis MD, Seuntjens E.
Show Full Abstract
Protocadherins (Pcdhs) are cell adhesion molecules that belong to the cadherin superfamily, and are subdivided into clustered (cPcdhs) and non-clustered Pcdhs (ncPcdhs) in vertebrates. In this review, we summarize their discovery, expression mechanisms, and roles in neuronal development and cancer, thereby highlighting the context-dependent nature of their actions. We furthermore provide an extensive overview of current structural knowledge, and its implications concerning extracellular interactions between cPcdhs, ncPcdhs, and classical cadherins. Next, we survey the known molecular action mechanisms of Pcdhs, emphasizing the regulatory functions of proteolytic processing and domain shedding. In addition, we outline the importance of Pcdh intracellular domains in the regulation of downstream signaling cascades, and we describe putative Pcdh interactions with intracellular molecules including components of the WAVE complex, the Wnt pathway, and apoptotic cascades. Our overview combines molecular interaction data from different contexts, such as neural development and cancer. This comprehensive approach reveals potential common Pcdh signaling hubs, and points out future directions for research. Functional studies of such key factors within the context of neural development might yield innovative insights into the molecular etiology of Pcdh-related neurodevelopmental disorders.
Also flagged:neurodevelopmental disordersepileptic encephalopathyintellectual disabilityepilepsy syndromesneurodevelopment disordersepilepsy syndrome
Journal Article2020-06-30✓ 5 SnippetsWon D, Kim SH, Kim B, Lee ST, Kang HC, Choi JR.
In-Text Gene Mentions
Results)
…The initial diagnostic test was performed, and CACNA1E encoding a subunit of a calcium channel was considered a candidate for epileptic encephalopathy; however, the OMIM database did not clearly report this gene and the related disease.…
Genetic diagnosis of patients with neurodevelopmental disorders is imperative and a standard clinical practice. Considering the continuous accumulation of data on disease-causing variants, reanalysis of previously established sequencing data is important. Periodic reanalysis of variants with uncertain significance has become mandatory in clinical laboratories. Therefore, to confirm the utility of the reanalysis of targeted gene panel data in clinical laboratories, we re-evaluated the data of two groups of patients who had undergone targeted gene panel testing for neurodevelopmental disorders (<i>n</i> = 116) and epileptic encephalopathy (<i>n</i> = 384). This reanalysis was based on a reannotation process reflecting updated databases. Six (5.2%) and seven (1.8%) new pathogenic or likely pathogenic variants were identified in these two groups, respectively, attributable to the updated guidelines and <i>de novo</i> reports from unrelated patients. Although relatively low, considerable increase in the diagnostic yield was confirmed. We suggest that reanalysis of genetic variants, mainly using changes in databases and updated interpretations, should be implemented as a routine practice in clinical laboratories.
Also flagged:immunoglobulinlactationBTNlung cancersbreast cancerscancer
Journal Article2020-06-30✓ 5 SnippetsWang Y, Zhao N, Zhang X, Li Z, Liang Z, Yang J, Liu X, Wu Y, Chen K, Gao Y, Yin Z, Lin X, Zhou H, Tian D, Cao Y, Hao J.
In-Text Gene Mentions
Discussion)⭐ same-sentence co-mention
…However, low expressions of BTN2A1, BTN2A2, BTN3A1, BTN3A2, BTN3A3, and BTNL9 were significantly correlated with worse OS of LUAD (Figure 5A).…
The butyrophilins (BTNs) represent a unique family of immunoglobulin. They were considered to be involved in milk lactation after their discovery in 1981. With the development of research, an increasing number of research revealed that BTNs play important roles in immune regulation [1992-2019]. Our research aimed to summarize the BTN research status and their relationship with lung cancers and breast cancers by bibliometrics and bioinformatics methods. Our results indicate that the researches on immune-regulatory functions of BTNs gradually developed from 1992 to 2006, whereas they increased quickly after 2007. There are international cooperations among 56 countries, of which the United States is the most active one with the highest number of studies as well as highest citations. By coauthorship and cocitation analysis, we showed that Adrian Hayday, who is active in γδ T-cell field, was an active author in BTN publications with average year of 2015 and led a subfield. By keywords co-occurrence analysis, we found that γδ T cell, which is an important cancer immune regulator, is one important hotspot. Finally, we found that several BTN members' expression levels were significantly correlated with prognosis of lung cancer and breast cancer patients. Thus, these BTNs might play immune regulatory effects and could serve as potential biomarkers for cancer.
Also flagged:Cholestasisneonatal cholestasisidiopathic cholestasisalpha-1-antitrypsindeficiencyNC
Journal Article2020-06-30No SnippetsSantos Silva E, Almeida A, Frutuoso S, Martins E, Valente MJ, Santos-Silva A, Lopes AI.
Show Full Abstract
<b>Introduction:</b> In the last two decades there have been advances in the diagnosis and management of neonatal cholestasis, which may have changed its epidemiology, diagnostic accuracy, outcomes, and survival. Our goal was to characterize these changes over time in our setting. <b>Methods:</b> Retrospective cohort study in a tertiary center, enrolling patients born between January 1985 and October 2019. The cohort was divided into two periods, before (A; <i>n</i> = 67) and after (B; <i>n</i> = 87) the year 2000; and in two groups, according to patient's outcome (favorable, unfavorable). Overall survival and survival with and without orthotopic liver transplant (OLT) were evaluated in the two periods (A and B) and in different subgroups of underlying entities. <b>Results:</b> We found that the age of cholestasis recognition decreased significantly from period A to period B [median 43 days and 22 days, respectively, (<i>p</i> < 0.001)]; the changes in epidemiology were relevant, with a significant decrease in alpha-1-antitrypsin deficiency (<i>p</i> < 0.001) and an increase in transient cholestasis (<i>p</i> = 0.004). A next-generation sequencing (NGS) panel available since mid-2017 was applied to 13 patients with contributory results in 7, but, so far, only in 2 patients led to conclusive diagnosis of underlying entities. The number of cases of idiopathic cholestasis did not vary significantly. Over time there was no significant change in the outcome (<i>p</i> = 0.116). Overall survival and survival without OLT had no significant improvement during the period of observation (in periods A and B, 86 vs. 88%, and 85 vs. 87%, respectively). However, in period B, with OLT we achieved the goal of 100% of survival rate. <b>Conclusions:</b> Our data suggest that transient cholestasis became a very important subset of neonatal cholestasis, requiring specific guidance. The NGS panels can provide important inputs on disease diagnosis but, if applied without strict criteria and expertise, they can open a Pandora's box due to misinterpretation. Despite all the advances in accurate diagnosis and timely management-including early recognition of cholestasis-the improvement in patient outcomes and survival were still not significant.
Also flagged:histonehistone acetyltransferasesacetyllysineamino acidshistone deacetylases
Journal Article2020-06-30✓ 1 SnippetWahab S, Saettone A, Nabeel-Shah S, Dannah N, Fillingham J.
In-Text Gene Mentions
Introduction)
…factors, such aslinker histoneshistones, further organize…
Show Full Abstract
The eukaryotic histone acetylation cycle is composed of three classes of proteins, histone acetyltransferases (HATs) that add acetyl groups to lysine amino acids, bromodomain (BRD) containing proteins that are one of the most characterized of several protein domains that recognize acetyl-lysine (Kac) and effect downstream function, and histone deacetylases (HDACs) that catalyze the reverse reaction. Dysfunction of selected proteins of these three classes is associated with human disease such as cancer. Additionally, the HATs, BRDs, and HDACs of fungi and parasitic protozoa present potential drug targets. Despite their importance, the function and mechanisms of HATs, BRDs, and HDACs and how they relate to chromatin remodeling (CR) remain incompletely understood. <i>Tetrahymena thermophila</i> (Tt) provides a highly tractable single-celled free-living protozoan model for studying histone acetylation, featuring a massively acetylated somatic genome, a property that was exploited in the identification of the first nuclear/type A HAT Gcn5 in the 1990s. Since then, <i>Tetrahymena</i> remains an under-explored model for the molecular analysis of HATs, BRDs, and HDACs. Studies of HATs, BRDs, and HDACs in <i>Tetrahymena</i> have the potential to reveal the function of HATs and BRDs relevant to both fundamental eukaryotic biology and to the study of disease mechanisms in parasitic protozoa.
Also flagged:enterogenesiscapsulesgene expressionLgr5Short bowel syndromeSBS
Journal Article2020-06-30✓ 1 SnippetPortelli KI, Park JB, Taylor JS, Thomas AL, Stelzner M, Martin MG, Dunn JCY.
In-Text Gene Mentions
Text
…Olfm4…
Show Full Abstract
<h4>Background/purpose</h4>Intraluminal springs have recently been shown to lengthen segments of intestine in a process known as distraction enterogenesis. We hypothesized that biocompatible springs could be used to lengthen defunctionalized murine small intestine and would lead to identifiable intestinal adaptations at the molecular level.<h4>Methods</h4>Age and weight matched C57BL/6 mice underwent surgical insertion of nitinol spring-loaded capsules into a Roux limb of jejunum. Segment lengths were measured at initial spring placement and at euthanasia after 14 and 21 days. Histology and gene expression of the Roux limb were evaluated at scarification and compared to untreated control segments.<h4>Results</h4>Intestinal segments loaded with compressed springs lengthened an average of 240%, which was significantly longer than control segments loaded with either empty capsules or uncompressed springs. Muscularis thickening was greater in spring-treated mice compared to controls without springs. Crypt depth and Lgr5+ expression was greater in mice that received compressed spring treatments when compared to control groups.<h4>Conclusions</h4>Insertion of a compressed nitinol spring into a Roux limb results in significant intestinal lengthening, smooth muscle thickening, and Lgr5+ expression in a mouse model. The ability to increase small bowel length in a defunctionalized murine model may be used to understand the mechanism of distraction enterogenesis.
Also flagged:bindingtranscription factorscancerosteosarcomaEwing sarcomabone-related diseases
Journal Article2020-06-30No SnippetsQu J, Ouyang Z, Wu W, Li G, Wang J, Lu Q, Li Z.
Show Full Abstract
Super-enhancers (SEs) are a large cluster of <i>cis</i>-regulatory DNA elements that contain many binding motifs, which master transcription factors and cofactors bind to with high density. SEs usually regulate the expression of genes that can control the cell identity and fate, and SEs can be used to explain the patterns of the expression of cell-specific genes. Hence, it shows great potential for application in the treatment of diseases like cancer. At present, the clinical treatments for osteosarcoma, Ewing sarcoma, and other bone-related diseases remain challenging. The poor prognosis and difficult treatment of these diseases imposes heavy economic burden on patients and society. In recent years, research on SEs with respect to bone-related diseases has attracted increasing attention. In this paper, we first review the identification and functional mechanisms of SEs. Then, we integrate the findings of the emerging studies on SEs in bone-related diseases. Finally, we summarize recent strategies for targeting SEs for the treatment of bone-related diseases. This review aims to provide comprehensive insights into the roles of SEs in bone-related diseases.
Also flagged:Thalassemiadisorderssynthesisglobinbeta thalassemiairon
Journal Article2020-06-30✓ 2 SnippetsBanjade P, Bhandari J.
In-Text Gene Mentions
Discussion)
…Complications of iron overload adults with Human homeostatic iron regulator protein (HFE)-associated hereditary hemochromatosis: involvement of heart (dilated cardiomyopathy and pericarditis), liver(chronic hepatitis, fibrosis, and cirrhosis) and endocrine glands( diabetes mellitus, hypoparathyroidism, hypothyroidism, hypopituitarism and low adrenal secretion).6 For the complication of iron overload serum ferritin has to be investigated along with endocrine function, cardiac function.6 Regular blood monitoring for the above condition that may appear has been performing in our patient too.…
Discussion)
…iron regulator protein (HFE)-associated hereditary hemoch…
Show Full Abstract
Thalassemia is inherited autosomal recessive disorders characterized by reduced rate of hemoglobin synthesis due to a defect in alpha or beta globin chain synthesis. Maldives has a beta thalassemia prevalence rate of 16-18%. Classical symptoms of beta thalassemia are common on those patients who present late for blood transfusion which is common among the south Asian countries due to resource poor situation. This case is a rare case report of commonly occurring phenomenon which has been reported less among south Asian region. Reporting this case will help health worker to manage cases accordingly. A five and half year prior diagnosed case of beta thalassemia at age of 2 years and lost to follow up presented with cough, Dyspnoea, Irritability, fatigue with classic symptom of beta thalassemia. She was managed with blood transfusion and kept on continuous follow up for transfusion and iron overload management.
Also flagged:Extracellular vesiclesneurodegenerative diseasessucrosedeathbrain diseaseextracellular
Journal Article2020-06-30No SnippetsHuang Y, Cheng L, Turchinovich A, Mahairaki V, Troncoso JC, Pletniková O, Haughey NJ, Vella LJ, Hill AF, Zheng L, Witwer KW.
Show Full Abstract
Extracellular vesicles (EVs) are involved in a wide range of physiological and pathological processes by shuttling material out of and between cells. Tissue EVs may thus lend insights into disease mechanisms and also betray disease when released into easily accessed biological fluids. Since brain-derived EVs (bdEVs) and their cargo may serve as biomarkers of neurodegenerative diseases, we evaluated modifications to a published, rigorous protocol for separation of EVs from brain tissue and studied effects of processing variables on quantitative and qualitative outcomes. To this end, size exclusion chromatography (SEC) and sucrose density gradient ultracentrifugation were compared as final separation steps in protocols involving stepped ultracentrifugation. bdEVs were separated from brain tissues of human, macaque, and mouse. Effects of tissue perfusion and a model of post-mortem interval (PMI) before final bdEV separation were probed. MISEV2018-compliant EV characterization was performed, and both small RNA and protein profiling were done. We conclude that the modified, SEC-employing protocol achieves EV separation efficiency roughly similar to a protocol using gradient density ultracentrifugation, while decreasing operator time and, potentially, variability. The protocol appears to yield bdEVs of higher purity for human tissues compared with those of macaque and, especially, mouse, suggesting opportunities for optimization. Where possible, perfusion should be performed in animal models. The interval between death/tissue storage/processing and final bdEV separation can also affect bdEV populations and composition and should thus be recorded for rigorous reporting. Finally, different populations of EVs obtained through the modified method reported herein display characteristic RNA and protein content that hint at biomarker potential. To conclude, this study finds that the automatable and increasingly employed technique of SEC can be applied to tissue EV separation, and also reveals more about the importance of species-specific and technical considerations when working with tissue EVs. These results are expected to enhance the use of bdEVs in revealing and understanding brain disease.
Also flagged:calciumphosphorousskull fracturephosphorusmineralTraumatic brain injury
Journal Article2020-06-30No SnippetsTamuli RP, Saikia B, Sarmah S, Patowary AJ.
Show Full Abstract
<h4>Introduction</h4>Traumatic brain injury (TBI) or head injury is one of the leading causes of morbidity and mortality globally. TBI includes a fractured skull as an indicator of insult which can affect the treatment outcome as well. The development of any fracture depends on a combination of factors defining the intrinsic properties of the bone and the extrinsic factors related to the impact. A decrease in bone mass secondary to deficiency of calcium (Ca) and phosphorus (P) can be a significant factor intrinsic to the skull bone, which can modulate the outcome of the impact by increasing the susceptibility of bones towards fractures. We undertook this research to find out whether or not the Ca and <i>P</i> concentration in skull bone has a role to play as an intrinsic factor, in the development of skull fracture following Road Traffic Accidents (RTAs).<h4>Methodology</h4>In this case-control study conducted for two years, we collected 94 bone samples, i.e. 47 each, from skull bones with head injuries following RTA, with (case) and without (control) fracture of the skull. The elemental analyses for the bony concentration of Ca and <i>P</i> in both the groups were then compared using energy dispersive X-ray (EDX). Unpaired <i>t</i>-test and Fisher's exact test was used for statistical analysis.<h4>Results</h4>The elemental analysis of bones provided evidence that suggests that whilst; Ca is the only mineral that appears to have a significant correlation with the development of fracture skull, the overall Ca: <i>P</i> ratio of less than 1.99 increases the chances of skull fracture by 3.9 times.<h4>Conclusions</h4>Both individual bony Ca concentration and Ca: <i>P</i> ratio can be regarded as important intrinsic factors for the development of skull fracture.
<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is common in both prediabetic patients and healthy overweight individuals, yet it remains understudied. This study investigates the effects of hepatic steatosis on fibrosis and evaluates the major predictors of liver injury in prediabetes and whether this damage is reversible with Mediterranean diet and administration of the nutraceutical silymarin.<h4>Methods</h4>First, a case-control study was conducted in which 212 patients with prediabetes, not known to have NAFLD, and 126 healthy controls underwent clinical evaluation, transient elastography with measurement of liver stiffness (LS) and controlled attenuation parameter (CAP). Subsequently, the 212 prediabetic patients were enrolled into a prospective randomized interventional study: 104 were allocated to Mediterranean diet alone while 108 followed Mediterranean diet plus supplementation with silymarin (a flavonolignan complex isolated from <i>Silybum marianum</i> and <i>Morus alba</i>). The administered silymarin dose was 210 mg twice daily for 6 months. Clinical and instrumental evaluations were repeated at the end of the 6 month-study period. Prediabetics were genotyped for patatin like phospholipase domain containing 3 (PNPLA3).<h4>Results</h4>In the case-control study, 29% of prediabetic patients have significant fibrosis defined as LS ≥ 7.9 kPa vs only 3% of controls (<i>p</i> < 0.001). PNPLA3 genotype CG/GG are significantly associated with significant fibrosis LS ≥ 7.9 relative to CC genotype χ2(1) = 76.466, <i>p</i> < 0.001. Binomial regression analysis shows that increase in BMI, ALT and AST are significantly associated with increased likelihood of significant fibrosis (χ2(7) = 191.9, <i>p</i> < .001) prior to intervention. In the randomized interventional study, prediabetics following Mediterranean diet alone (group 1) experienced a significant regression of fibrosis and decrease in ALT, HbA1c, FBS after 6 months (<i>p</i> < 0.001); similar findings were observed in patients following Mediterranean diet plus silymarin regimen (group 2); group 2 had a significant decrease in HbA1c relative to group 1 (95% CI: 37.8-38.6 vs 39.5-40.3, <i>p</i> < 0.001).<h4>Conclusion</h4>PNPLA3 genotype CG/GG and elevated BMI are the major predictors of significant fibrosis in prediabetic patients prior to intervention in this study. Mediterranean diet either alone or with silymarin treatment for 6 months leads to significant regression of liver damage and improvement of the glycemic profile in prediabetic patients. Yet, as combination treatment of silymarin with Mediterranean diet shows significant reduction of HbA1c when compared to diet alone, this suggests that silymarin may exert an independent anti-glycemic action.
medRxiv2020-06-30Preprint (No Snippets API)Thomas T, Stefanoni D, Dzieciatkowska M, Issaian A, Nemkov T, Hill RC, Francis RO, Hudson KE, Buehler PW, Zimring JC, Hod EA, Hansen KC, Spitalnik SL, D’Alessandro A.
Show Full Abstract
The SARS-CoV-2 beta coronavirus is the etiological driver of COVID-19 disease, which is primarily characterized by shortness of breath, persistent dry cough, and fever. Because they transport oxygen, red blood cells (RBCs) may play a role in the severity of hypoxemia in COVID-19 patients. The present study combines state-of-the-art metabolomics, proteomics, and lipidomics approaches to investigate the impact of COVID-19 on RBCs from 23 healthy subjects and 29 molecularly-diagnosed COVID-19 patients. RBCs from COVID-19 patients had increased levels of glycolytic intermediates, accompanied by oxidation and fragmentation of ankyrin, spectrin beta, and the N-terminal cytosolic domain of band 3 (AE1). Significantly altered lipid metabolism was also observed, especially short and medium chain saturated fatty acids, acyl-carnitines, and sphingolipids. Nonetheless, there were no alterations of clinical hematological parameters, such as RBC count, hematocrit, and mean corpuscular hemoglobin concentration, with only minor increases in mean corpuscular volume. Taken together, these results suggest a significant impact of SARS-CoV-2 infection on RBC structural membrane homeostasis at the protein and lipid levels. Increases in RBC glycolytic metabolites are consistent with a theoretically improved capacity of hemoglobin to off-load oxygen as a function of allosteric modulation by high-energy phosphate compounds, perhaps to counteract COVID-19-induced hypoxia. Conversely, because the N-terminus of AE1 stabilizes deoxyhemoglobin and finely tunes oxygen off-loading, RBCs from COVID-19 patients may be incapable of responding to environmental variations in hemoglobin oxygen saturation when traveling from the lungs to peripheral capillaries and, as such, may have a compromised capacity to transport and deliver oxygen. <h4>Graphical Abstract</h4> <h4>Key Points</h4> COVID-19 promotes oxidation and fragmentation of membrane proteins, including the N-term of band 3 RBCs from COVID-19 patients are characterized by increases in glycolysis and altered lipidomes COVID-19 impacts two critical mechanisms that finely tune red cell membranes and hemoglobin oxygen affinity
Research Square2020-06-30Preprint (No Snippets API)Taniguchi-Ponciano K, Vadillo E, Lopez-Macias C, Carvente-Garcia R, Mayani H, Ferat-Osorio E, Flores-Padilla G, Torres J, Gonzales-Bonilla CR, Majluf A, Albarran-Sanchez A, Galan JC, Peña-Martínez E, Silva-Román G, Vela-Patiño S, Ferreira-Hermosillo A, Ramirez-Renteria C, Espinoza-Sanchez NA, Pelayo-Camacho R, Bonifaz L, Arriaga-Pizano L, Mata-Lozano C, Andonegui-Elguera S, Wacher-Rodarte N, De-Lira-Barraza R, Villanueva-Compean H, Esquivel-Pi A, Ramírez-Montes-de-Oca R, Anda-Garay C, Noyola-García M, Guizar-García L, Cerbulo-Vazquez A, Zamudio-Meza H, Marrero-Rodríguez D, Mercado M.
Show Full Abstract
SARS-CoV-2 , the etiological agent causing COVID-19, has infected more than 8.7 million people with over 461000 deaths worldwide since its emergence in December 2019. Factors for severe disease, such as diabetes, hypertension and obesity have been identified however, the precise pathogenesis is poorly understood. In order to understand its pathophysiology and to develop effective therapeutic strategies, it is essential to define the prevailing immune cellular subsets. We performed circulating immune cells scRNAseq from five critically ill COVID-19 patients. Immature myeloid populations, such as promyelocytes-myelocytes, metamyelocytes, band neutrophils, monocytoid precursors and activated monocytes predominated. Trajectory with pseudotime analysis supported the finding of immature cell states. Gene ontology showed myeloid cell activation in immune response, DNA and RNA processing, defense response to virus and response to type 1 interferon. Lymphoid lineage was scarce. Our results uncover a transcriptomic profiles related to immature myeloid lineages and suggest the potential induction of trained immunity.
Also flagged:deathneural tube defectsNTDsdevelopmental anomaliesspina bifidaanencephaly
Journal Article2020-06-29✓ 1 SnippetTaiwo TE, Cao X, Cabrera RM, Lei Y, Finnell RH.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
Every year nearly 6 percent of children worldwide are born with a serious congenital malformation, resulting in death or lifelong disability. In the United States, birth defects remain one of the leading causes of infant mortality. Among the common structural congenital defects are conditions known as neural tube defects (NTDs). These are a class of malformation of the brain and spinal cord where the neural tube fails to close during the neurulation. Although NTDs remain among the most pervasive and debilitating of all human developmental anomalies, there is insufficient understanding of their etiology. Previous studies have proposed that complex birth defects like NTDs are likely omnigenic, involving interconnected gene regulatory networks with associated signals throughout the genome. Advances in technologies have allowed researchers to more critically investigate regulatory gene networks in ever increasing detail, informing our understanding of the genetic basis of NTDs. Employing a systematic analysis of these complex birth defects using massively parallel DNA sequencing with stringent bioinformatic algorithms, it is possible to approach a greater level of understanding of the genomic architecture underlying NTDs. Herein, we present a brief overview of different approaches undertaken in our laboratory to dissect out the genetics of susceptibility to NTDs. This involves the use of mouse models to identify candidate genes, as well as large scale whole genome/whole exome (WGS/WES) studies to interrogate the genomic landscape of NTDs. The goal of this research is to elucidate the gene-environment interactions contributing to NTDs, thus encouraging global research efforts in their prevention.
Journal Article2020-06-29No SnippetsMadsen EB, Höijer I, Kvist T, Ameur A, Mikkelsen MJ.
Show Full Abstract
Long-read sequencing can resolve regions of the genome that are inaccessible to short reads, and therefore are ideal for genome-gap closure, solving structural rearrangements and sequencing through repetitive elements. Here we introduce the Xdrop technology: a novel microfluidic-based system that allows for targeted enrichment of long DNA molecules starting from only a few nanograms of DNA. Xdrop is based on the isolation of long DNA fragments in millions of droplets, where the droplets containing a target sequence of interest are fluorescently labeled and sorted using flow cytometry. The final product from the Xdrop procedure is an enriched population of long DNA molecules that can be investigated by sequencing. To demonstrate the capability of Xdrop, we performed enrichment of the human papilloma virus 18 integrated into the genome of human HeLa cells. Analysis of the sequencing reads resolved three HPV18-chr8 integrations at base-pair resolution, and the captured fragments extended up to 30 kb into the human genome at the integration sites. Further, we enriched the complete TP53 locus in a leukemia cell line and could successfully phase coexisting mutations using PacBio sequencing. In summary, our results show that Xdrop is an efficient enrichment technology for studying complex genomic regions.
Also flagged:Oral cancerneoplasm oforal squamous cell carcinomaOSCCcell adhesionlocalization
Journal Article2020-06-29No SnippetsAmiri-Dashatan N, Koushki M, Jalilian A, Ahmadi NA, Rezaei-Tavirani M.
Show Full Abstract
Background: Oral cancer is a frequently encountered neoplasm of the head and neck region, being the eighth most common type of human malignancy worldwide. Despite improvement in its control, morbidity and mortality, rates have improved little in the past decades. The present investigations about gene interaction and pathways still could not clear the appearance and development of oral squamous cell carcinoma (OSCC), completely. The aim of this study is to investigate the key genes and microRNAs interaction in OSCC. Materials and Methods: The microarray datasets GSE13601 and GSE98463, including mRNA and miRNA profiles, were extracted from the GEO database and were analyzed using GEO2R. Functional and pathway enrichment analyses were performed by using the DAVID database. The protein-protein interaction (PPI) network was constructed and analyzed using STRING database and Cytoscape software, respectively. Finally, miRDB was applied to predict the targets of the differentially expressed miRNAs (DEMs). Results: Totally, 97 differentially expressed genes (DEGs) were found in OSCC, including 66 up-regulated and 31 down-regulated genes. The gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses showed that up-regulated genes were significantly enriched in movement of cell or subcellular component, cell adhesion, biological adhesion, cellular localization, apoptotic signaling pathway, while the downregulated genes were enriched in muscle system process and oxidation-reduction process. From the PPI network, the top 10 nodes with the highest degree were detected as hub genes. In addition, 18 DEMs were screened, which included 7 up-regulated and 11 down-regulated miRNAs. STAT1 was potentially targeted by three miRNAs, including has-miR- 6825-5P, has-miR-4495, and has-miR-5580-3P. Conclusion: The roles of DEMs such as hsa-mir-5580-3p in OSCC through interactions with DEGs CD44, ACLY, ACTR3, STAT1, LAMC2 and YWHAZ may offer a suitable candidate biomarker pattern for diagnosis, prognosis and treatment processes in OSCC.
Journal Article2020-06-29✓ 3 SnippetsVisscher MO, Carr AN, Winget J, Huggins T, Bascom CC, Isfort R, Lammers K, Narendran V.
In-Text Gene Mentions
I A O 0000326)
…PEBP1…
Abstract)
…TMG3, S100A7, andPEBP1, and decreased in…
Discussion)
…PEBP1, a serine protease…
Show Full Abstract
<h4>Background</h4>The objective of this study was to measure skin characteristics in premature (PT), late preterm (LPT), and full-term (FT) neonates compared with adults at two times (T1, T2).<h4>Methods</h4>Skin samples of 61 neonates and 34 adults were analyzed for protein biomarkers, natural moisturizing factor (NMF), and biophysical parameters. Infant groups were: <34 weeks (PT), 34-<37 weeks (LPT), and ≥37 weeks (FT).<h4>Results</h4>Forty proteins were differentially expressed in FT infant skin, 38 in LPT infant skin, and 12 in PT infant skin compared with adult skin at T1. At T2, 40 proteins were differentially expressed in FT infants, 38 in LPT infants, and 54 in PT infants compared with adults. All proteins were increased at both times, except TMG3, S100A7, and PEBP1, and decreased in PTs at T1. The proteins are involved in filaggrin processing, protease inhibition/enzyme regulation, and antimicrobial function. Eight proteins were decreased in PT skin compared with FT skin at T1. LPT and FT proteins were generally comparable at both times. Total NMF was lower in infants than adults at T1, but higher in infants at T2.<h4>Conclusions</h4>Neonates respond to the physiological transitions at birth by upregulating processes that drive the production of lower pH of the skin and water-binding NMF components, prevent protease activity leading to desquamation, and increase the barrier antimicrobial properties.<h4>Impact</h4>Neonates respond to the transitions at birth by upregulating processes that drive the production of lower pH of the skin and NMF, prevent protease activity leading to desquamation, and increase the antimicrobial properties of the barrier. The neonatal epidermal barrier exhibits a markedly different array of protein biomarkers both shortly after birth and 2-3 months later, which are differentially expressed versus adults. The major biomarker-functional classes included filaggrin processing, protease inhibitor/enzyme regulators, antimicrobials, keratins, lipids, and cathepsins. The findings will guide improvement of infant skin care practices, particularly for the most premature infants with the ultimate goals mitigating nosocomial infection.
…We also identified colocalizing signals in a number of clinically relevant coding mutations, including sites linking PTPN22 with Crohn’s disease, NIPA with coronary artery disease and platelet trait variation, and the hemochromatosis gene HFE with altered lipid levels.…
Results)
…Patients with hemochromatosis have lower cholesterol levels than normal, although an open question is whether this observation is due to manifestations of disease or HFE deficiency itself.…
Abstract)
…variation, and thehemochromatosisgene HFE with…
Abstract)
…the hemochromatosis geneHFEwith altered lipid…
Methods)
…variant (rs1800562) inHFE, mutations in…
Show Full Abstract
<h4>Background</h4>Genetic associations link hematopoietic traits and disease end-points, but most causal variants and genes underlying these relationships are unknown. Here, we used genetic colocalization to nominate loci and genes related to shared genetic signal for hematopoietic, cardiovascular, autoimmune, neuropsychiatric, and cancer phenotypes.<h4>Methods</h4>Our aim was to identify colocalization sites for human traits among established genome-wide significant loci. Using genome-wide association study (GWAS) summary statistics, we determined loci where multiple traits colocalized at a false discovery rate < 5%. We then identified quantitative trait loci among colocalization sites to highlight related genes. In addition, we used Mendelian randomization analysis to further investigate certain trait relationships genome-wide.<h4>Results</h4>Our findings recapitulated developmental hematopoietic lineage relationships, identified loci that linked traits with causal genetic relationships, and revealed novel trait associations. Out of 2706 loci with genome-wide significant signal for at least 1 blood trait, we identified 1779 unique sites (66%) with shared genetic signal for 2+ hematologic traits. We could assign some sites to specific developmental cell types during hematopoiesis based on affected traits, including those likely to impact hematopoietic progenitor cells and/or megakaryocyte-erythroid progenitor cells. Through an expanded analysis of 70 human traits, we defined 2+ colocalizing traits at 2123 loci from an analysis of 9852 sites (22%) containing genome-wide significant signal for at least 1 GWAS trait. In addition to variants and genes underlying shared genetic signal between blood traits and disease phenotypes that had been previously related through Mendelian randomization studies, we defined loci and related genes underlying shared signal between eosinophil percentage and eczema. We also identified colocalizing signals in a number of clinically relevant coding mutations, including sites linking PTPN22 with Crohn's disease, NIPA with coronary artery disease and platelet trait variation, and the hemochromatosis gene HFE with altered lipid levels. Finally, we anticipate potential off-target effects on blood traits related novel therapeutic targets, including TRAIL.<h4>Conclusions</h4>Our findings provide a road map for gene validation experiments and novel therapeutics related to hematopoietic development, and offer a rationale for pleiotropic interactions between hematopoietic loci and disease end-points.
Also flagged:cell divisionorganellesmitosiscytoplasmcentrosomesmitochondria
Journal Article2020-06-29No SnippetsSunchu B, Cabernard C.
Show Full Abstract
Asymmetric cell division (ACD) is an evolutionarily conserved mechanism used by prokaryotes and eukaryotes alike to control cell fate and generate cell diversity. A detailed mechanistic understanding of ACD is therefore necessary to understand cell fate decisions in health and disease. ACD can be manifested in the biased segregation of macromolecules, the differential partitioning of cell organelles, or differences in sibling cell size or shape. These events are usually preceded by and influenced by symmetry breaking events and cell polarization. In this Review, we focus predominantly on cell intrinsic mechanisms and their contribution to cell polarization, ACD and binary cell fate decisions. We discuss examples of polarized systems and detail how polarization is established and, whenever possible, how it contributes to ACD. Established and emerging model organisms will be considered alike, illuminating both well-documented and underexplored forms of polarization and ACD.
Also flagged:tumorMBNL1cancersstomach adenocarcinomastriple-negative breast cancerJNK
Journal Article2020-06-29✓ 4 SnippetsRay D, Yun YC, Idris M, Cheng S, Boot A, Iain TBH, Rozen SG, Tan P, Epstein DM.
In-Text Gene Mentions
Results)
…Next, we ectopically expressed a MAP2K7–JNK1 fusion construct in HFE-145 cells to assess whether activation of JNK signaling alone can recapitulate the MBNL1 down-regulation-mediated cancer stemness phenotype.…
Results)
…To directly examine the role of MAP2K7∆exon2 splice isoform in cellular dedifferentiation and cancer stem/progenitor-like properties, we used an antisense morpholino (AMO) directed against the 5′ splice site of MAP2K7 exon2 (36) to force MAP2K7 exon2 skipping in HFE-145 cells.…
Results)
…We next asked whether the high-confidence ASEs we identified in HFE-145 cells were also differentially spliced in MBNL1-low cancers.…
Results)
…We found that 39 of the 201 (∼20%) high-confidence ASEs, in at least one MBNL1-low cancer showed statistically significant difference in median PSI value between tumor and normal samples (P value <0.05, determined by Wilcoxon signed-rank test) in the direction concordant with KD of MBNL1 in HFE-145 cells (Fig. 2 C and D).…
Show Full Abstract
Master splicing regulator MBNL1 shapes large transcriptomic changes that drive cellular differentiation during development. Here we demonstrate that MBNL1 is a suppressor of tumor dedifferentiation. We surveyed <i>MBNL1</i> expression in matched tumor/normal pairs across The Cancer Genome Atlas and found that <i>MBNL1</i> was down-regulated in several common cancers. Down-regulation of <i>MBNL1</i> predicted poor overall survival in breast, lung, and stomach adenocarcinomas and increased relapse and distant metastasis in triple-negative breast cancer. Down-regulation of MBNL1 led to increased tumorigenic and stem/progenitor-like properties in vitro and in vivo. A discrete set of alternative splicing events (ASEs) are shared between <i>MBNL1</i>-low cancers and embryonic stem cells including a <i>MAP2K7∆</i>exon2 splice variant that leads to increased stem/progenitor-like properties via JNK activation. Accordingly, JNK inhibition is capable of reversing <i>MAP2K7</i>∆exon2-driven tumor dedifferentiation in MBNL1-low cancer cells. Our work elucidates an alternative-splicing mechanism that drives tumor dedifferentiation and identifies biomarkers that predict enhanced susceptibility to JNK inhibition.
Also flagged:lung cancercancersadenocarcinomasFOXF2lung cancerstumor
Journal Article2020-06-29✓ 5 SnippetsPérez-Morales J, Tunali I, Stringfield O, Eschrich SA, Balagurunathan Y, Gillies RJ, Schabath MB.
In-Text Gene Mentions
Results)
…NGTDM busyness low:RABGAP1L, LOC101928674 , and…
Results)
…RABGAP1Lexpression was significantly…
Results)
…the risk groups,RABGAP1Lexpression was higher…
Results)
…= 0.7928 forRABGAP1L).…
Discussion)
…RABGAP1Lwas found to…
Show Full Abstract
The National Lung Screening Trial (NLST) demonstrated that screening with low-dose computed tomography (LDCT) is associated with a 20% reduction in lung cancer mortality. One potential limitation of LDCT screening is overdiagnosis of slow growing and indolent cancers. In this study, peritumoral and intratumoral radiomics was used to identify a vulnerable subset of lung patients associated with poor survival outcomes. Incident lung cancer patients from the NLST were split into training and test cohorts and an external cohort of non-screen detected adenocarcinomas was used for further validation. After removing redundant and non-reproducible radiomics features, backward elimination analyses identified a single model which was subjected to Classification and Regression Tree to stratify patients into three risk-groups based on two radiomics features (NGTDM Busyness and Statistical Root Mean Square [RMS]). The final model was validated in the test cohort and the cohort of non-screen detected adenocarcinomas. Using a radio-genomics dataset, Statistical RMS was significantly associated with FOXF2 gene by both correlation and two-group analyses. Our rigorous approach generated a novel radiomics model that identified a vulnerable high-risk group of early stage patients associated with poor outcomes. These patients may require aggressive follow-up and/or adjuvant therapy to mitigate their poor outcomes.
…urodevelopment (NR2F6, USHBP1,DCC, and FAT3), and…
Show Full Abstract
Imaging genetics offers the possibility of detecting associations between genotype and brain structure as well as function, with effect sizes potentially exceeding correlations between genotype and behavior. However, study results are often limited due to small sample sizes and methodological differences, thus reducing the reliability of findings. The IMAGEN cohort with 2000 young adolescents assessed from the age of 14 onwards tries to eliminate some of these limitations by offering a longitudinal approach and sufficient sample size for analyzing gene-environment interactions on brain structure and function. Here, we give a systematic review of IMAGEN publications since the start of the consortium. We then focus on the specific phenotype 'drug use' to illustrate the potential of the IMAGEN approach. We describe findings with respect to frontocortical, limbic and striatal brain volume, functional activation elicited by reward anticipation, behavioral inhibition, and affective faces, and their respective associations with drug intake. In addition to describing its strengths, we also discuss limitations of the IMAGEN study. Because of the longitudinal design and related attrition, analyses are underpowered for (epi-) genome-wide approaches due to the limited sample size. Estimating the generalizability of results requires replications in independent samples. However, such densely phenotyped longitudinal studies are still rare and alternative internal cross-validation methods (e.g., leave-one out, split-half) are also warranted. In conclusion, the IMAGEN cohort is a unique, very well characterized longitudinal sample, which helped to elucidate neurobiological mechanisms involved in complex behavior and offers the possibility to further disentangle genotype × phenotype interactions.
Also flagged:agingbiosynthesismetabolismproteasescell proliferationcell differentiation
Journal Article2020-06-29✓ 4 SnippetsMa J, Liu M, Wang Y, Xin C, Zhang H, Chen S, Zheng X, Zhang X, Xiao F, Yang S.
In-Text Gene Mentions
Results)
…is enriched inSERPINC1, A2M, FGG, FGB,…
Results)
…APOA1, HP, CLU,SERPINC1, B2M), and metabolic…
Discussion)
…(HP), antithrombin III (SERPINC1), and fibrinogen.…
Discussion)
…SERPINC1regulates the blood…
Show Full Abstract
Skin aging is a specific manifestation of the physiological aging process that occurs in virtually all organisms. In this study, we used data independent acquisition mass spectrometry to perform a comparative analysis of protein expression in volar forearm skin samples from of 20 healthy young and elderly Chinese individuals. Our quantitative proteomic analysis identified a total of 95 differentially expressed proteins (DEPs) in aged skin compared to young skin. Enrichment analyses of these DEPs (57 upregulated and 38 downregulated proteins) based on the GO, KEGG, and KOG databases revealed functional clusters associated with immunity and inflammation, oxidative stress, biosynthesis and metabolism, proteases, cell proliferation, cell differentiation, and apoptosis. We also found that GAPDH, which was downregulated in aged skin samples, was the top hub gene in a protein-protein interaction network analysis. Some of the DEPs identified herein had been previously correlated with aging of the skin and other organs, while others may represent novel age-related entities. Our non-invasive proteomics analysis of human epidermal proteins may guide future research on skin aging to help develop treatments for age-related skin conditions and rejuvenation.
Genistein, a soy-derived phytoestrogen, has been shown to exhibit anti-neoplastic activities in various cancers. Nevertheless, its effects on the elimination of tumor-initiating cells of head and neck cancer (HNC-TICs) remain unclear. Here, we investigated the inhibitory effect of genistein on HNC-TICs and potential mechanisms. Our results demonstrated that genistein lowered the proliferation of HNC-TICs by examining the percentage of ALDH1+ or CD44+ cells. Aside from the downregulation of epithelial-mesenchymal transition (EMT) in HNC-TICs, genistein restricted their tumor propagating capacities in a dose-dependent fashion. Moreover, genistein potentiated cell death caused by three commonly used chemotherapeutic agents (doxorubicin, cisplatin, and 5-FU). Our findings proved that genistein induced ROS production through upregulation of miR-34a, leading to apoptosis in HNC-TICs. The genistein-elicited miR-34a reduced self-renewal, migration, invasion capacities and ALDH1 activity, which may be partly owing to the repression of EMT. Furthermore, we showed that RTCB was a novel target that was negatively regulated by miR-34a and involved in the tumor repressive effect of genistein. Besides, the in vivo study validated that genistein retarded tumor growth through the elevation of miR-34a and suppression of RTCB. These results suggested that genistein-induced miR-34a contributed to the ROS-associated apoptosis and diminished stemness properties via repression of RTCB in HNC-TICs.
Also flagged:Central Nervous System LymphomaPrimary central nervous system lymphomasbrain tumorstumorpeptideMS
Journal Article2020-06-29No SnippetsWaldera-Lupa DM, Poschmann G, Kirchgaessler N, Etemad-Parishanzadeh O, Baberg F, Brocksieper M, Seidel S, Kowalski T, Brunn A, Haghikia A, Gold R, Stefanski A, Deckert M, Schlegel U, Stühler K.
Show Full Abstract
Primary central nervous system lymphomas (PCNSL) account for approximately 2% to 3% of all primary brain tumors. Until now, neuropathological tumor tissue analysis, most frequently gained by stereotactic biopsy, is still the diagnostic gold standard. Here, we rigorously analyzed two independent patient cohorts comprising the clinical entities PCNSL (<i>n</i> = 47), secondary central nervous system lymphomas (SCNSL; <i>n</i> = 13), multiple sclerosis (MS, <i>n</i> = 23), glioma (<i>n</i> = 10), other tumors (<i>n</i> = 17) and tumor-free controls (<i>n</i> = 21) by proteomic approaches. In total, we identified more than 1220 proteins in the cerebrospinal fluid (CSF) and validated eight candidate biomarkers by a peptide-centric approach in an independent patient cohort (<i>n</i> = 63). Thus, we obtained excellent diagnostic accuracy for the stratification between PCNSL, MS and glioma patients as well as tumor-free controls for three peptides originating from the three proteins VSIG4, GPNMB4 and APOC2. The combination of all three biomarker candidates resulted in diagnostic accuracy with an area under the curve (AUC) of 0.901 (PCNSL vs. MS), AUC of 0.953 (PCNSL vs. glioma) and AUC 0.850 (PCNSL vs. tumor-free control). In summary, the determination of VSIG4, GPNMB4 and APOC2 in CSF as novel biomarkers for supporting the diagnosis of PCNSL is suggested.
Journal Article2020-06-29No SnippetsDupeyron M, Baril T, Bass C, Hayward A.
Show Full Abstract
<h4>Background</h4><i>Tc1/mariner</i> transposons are widespread DNA transposable elements (TEs) that have made important contributions to the evolution of host genomic complexity in metazoans. However, the evolution and diversity of the <i>Tc1/mariner</i> superfamily remains poorly understood. Following recent developments in genome sequencing and the availability of a wealth of new genomes, <i>Tc1/mariner</i> TEs have been identified in many new taxa across the eukaryotic tree of life. To date, the majority of studies focussing on <i>Tc1</i>/<i>mariner</i> elements have considered only a single host lineage or just a small number of host lineages. Thus, much remains to be learnt about the evolution of <i>Tc1/mariner</i> TEs by performing analyses that consider elements that originate from across host diversity.<h4>Results</h4>We mined the non-redundant database of NCBI using BLASTp searches, with transposase sequences from a diverse set of reference <i>Tc1/mariner</i> elements as queries. A total of 5158 <i>Tc1/mariner</i> elements were retrieved and used to reconstruct evolutionary relationships within the superfamily. The resulting phylogeny is well resolved and includes several new groups of <i>Tc1/mariner</i> elements. In particular, we identify a new family of plant-genome restricted <i>Tc1/mariner</i> elements, which we call <i>PlantMar</i>. We also show that the <i>pogo</i> family is much larger and more diverse than previously appreciated, and we review evidence for a potential revision of its status to become a separate superfamily.<h4>Conclusions</h4>Our study provides an overview of <i>Tc1-mariner</i> phylogeny and summarises the impressive diversity of <i>Tc1-mariner</i> TEs among sequenced eukaryotes. <i>Tc1/mariner</i> TEs are successful in a wide range of eukaryotes, especially unikonts (the taxonomic supergroup containing Amoebozoa, Opisthokonta, Breviatea, and Apusomonadida). In particular, ecdysozoa, and especially arthropods, emerge as important hosts for <i>Tc1/mariner</i> elements (except the <i>PlantMar</i> family). Meanwhile, the <i>pogo</i> family, which is by far the largest <i>Tc1/mariner</i> family, also includes many elements from fungal and chordate genomes. Moreover, there is evidence of the repeated exaptation of <i>pogo</i> elements in vertebrates, including humans, in addition to the well-known example of <i>CENP-B</i>. Collectively, our findings provide a considerable advancement in understanding of <i>Tc1/mariner</i> elements, and more generally they suggest that much work remains to improve understanding of the diversity and evolution of DNA TEs.
Also flagged:angiosarcomaalcoholthrombocytopeniahypoalbuminemiaTumorPIVKA-II
Journal Article2020-06-29✓ 1 SnippetInoue M, Matsumoto M, Sakuhara Y, Takakuwa Y, Yoshii S, Akakura N, Sakamoto N.
In-Text Gene Mentions
Discussion)
…diseases such ashemochromatosisand von Recklinghausen's…
Show Full Abstract
A man in his 50s presented with pitting edema of both lower legs and abdominal distension as his chief complaint. His personal medical history and family history were unremarkable, except that he was a heavy drinker consuming 66 g of alcohol per day and a heavy smoker. Blood tests upon admission showed slight hepatic dysfunction, thrombocytopenia, jaundice, hypoalbuminemia, and decreased coagulability. Tumor marker tests showed elevated levels of CA19-9 and PIVKA-II. Contrast-enhanced computed tomography revealed enhancement of multiple masses predominantly in the right lobe of the liver in the early phase, followed by diffuse enhancement of the entire liver in the delayed phase. Hepatic arteriography demonstrated large hemangioma-like lesions corresponding to the masses revealed by computed tomography. That findings seemed to be cotton wool appearance. On magnetic resonance images, there were multiple mass-like lesions that showed homogeneous or heterogeneous low signal intensity on T1-weighted images, and clearly high signal intensity on T2-weighted images. The findings were atypical and no definite diagnosis could be made. Hepatic failure then rapidly worsened, and the patient died on hospital day 20. Autopsy led to the diagnosis of hepatic angiosarcoma.
Also flagged:complement-dependent cytotoxicityglomerulonephritisnephropathyproteasecreatinineglucose
Journal Article2020-06-29✓ 1 SnippetMertens I, Willems H, Van Loon E, Schildermans K, Boonen K, Baggerman G, Valkenborg D, Gwinner W, Anglicheau D, Essig M, Marquet P, Naesens M.
In-Text Gene Mentions
Results)
…); antithrombin (SERPINC1); and transferrin…
Show Full Abstract
<h4>Introduction</h4>Antibody-mediated rejection (ABMR) impacts kidney allograft outcome. The diagnosis is made based on findings from invasive kidney transplant biopsy specimens. The aim of this study was to identify a noninvasive urinary protein biomarker for ABMR after kidney transplantation.<h4>Methods</h4>We performed a multicenter case-control study to identify a urinary biomarker for ABMR (training cohort, <i>n</i> = 249) and an independent, prospective multicenter cohort study for validation (<i>n</i> = 391). We used concomitant biopsies to classify the samples according to the Banff classification. After untargeted protein identification and quantification, we used a support vector machine to train the model in the training cohort. The primary endpoint was the diagnostic accuracy of the urinary biomarker for ABMR in the validation cohort.<h4>Results</h4>We identified a set of 10 urinary proteins that accurately discriminated patients with (<i>n</i> = 60) and without (<i>n</i> = 189) ABMR in the training cohort with an area under the curve (AUC) of 0.98 (95% confidence interval [CI], 0.96-1.00). The diagnostic accuracy was maintained in the validation cohort (AUC, 0.88; 95% CI, 0.8-0.93) for discriminating the presence (<i>n</i> = 43) from the absence (<i>n</i> = 348) of ABMR. The negative predictive value of the 10-protein marker set for exclusion of ABMR was 0.99, and the positive predictive value was 0.33. The diagnostic accuracy was independent of the reason for performing the biopsy, time after transplantation, and better than the accuracy of gross proteinuria (AUC, 0.76).<h4>Conclusions</h4>We identified and validated a urinary protein biomarker set that can be used to exclude ABMR.
Journal Article2020-06-29✓ 1 SnippetNikooienejad A, Wang W, Johnson VE.
In-Text Gene Mentions
Text
…SUDS3…
Show Full Abstract
Efficient variable selection in high dimensional cancer genomic studies is critical for discovering genes associated with specific cancer types and for predicting response to treatment. Censored survival data is prevalent in such studies. In this article we introduce a Bayesian variable selection procedure that uses a mixture prior composed of a point mass at zero and an inverse moment prior in conjunction with the partial likelihood defined by the Cox proportional hazard model. The procedure is implemented in the R package BVSNLP, which supports parallel computing and uses a stochastic search method to explore the model space. Bayesian model averaging is used for prediction. The proposed algorithm provides better performance than other variable selection procedures in simulation studies, and appears to provide more consistent variable selection when applied to actual genomic datasets.
Also flagged:malignant bowel obstructionbowel obstructioncancergastrointestinal cancersobstructiontumour
Journal Article2020-06-28No SnippetsBaddeley E, Bravington A, Johnson M, Currow DC, Murtagh FE, Boland E, Obita G, Nelson A, Seddon K, Oliver A, Noble S, Boland J.
Show Full Abstract
<h4>Introduction</h4>Studies regarding the management of malignant bowel obstruction (MBO) report conflicting findings. This is partly due to different outcome measures being used to evaluate severity of MBO and the response to treatments. Furthermore, current outcome measures focus mainly on measurable physiological parameters which may not correlate strongly with patient-defined quality of life. The development of core outcome sets allows a consistent approach to evaluating clinical conditions taking into consideration patient, healthcare professional and researcher viewpoints. It follows an internationally recognised standard methodology. We present a protocol for the development of a core outcome set for Research and Assessment of MBO (RAMBO).<h4>Methods</h4>RAMBO is a multicentre study, comprising of four phases: a systematic review to examine current scope of outcome measures associated with MBO (phase I). Interviews with patients, companions and healthcare professionals will explore priorities and preferences for care and outcomes (phase II). An expert panel meeting will collate the findings into a set of outcomes (phase III), refined by consensus through a Delphi survey with key stakeholders (phase IV). The final set of outcomes will be ratified at a consensus meeting. Each step will actively include patient partners. Thematic analysis and descriptive statistics will be used to analyse qualitative and quantitative data, respectively.<h4>Ethics and dissemination</h4>Ethical approval was obtained (Wales REC 5, REF: 19/LO/1876). Study participants and relevant stakeholders will be updated with newsletters and a lay summary at the end of the study. Abstracts will be submitted to national and international conferences, result papers will be submitted to peer-reviewed, open access journals.<h4>Trial and prospero registration numbers</h4>Core Outcome Measures in Effectiveness Trials (1402); Systematic Literature Review (CRD42019150648); Rapid Review (CRD42020176393).
Also flagged:reading disabilityneuron migrationdendritenucleotidebehavioralRAPGEF2
Journal Article2020-06-28No SnippetsLancaster HS, Liu X, Dinu V, Li J.
Show Full Abstract
<h4>Introduction</h4>Past research has suggested that reading disability is a complex disorder involving genetic and environment contributions, as well as gene-gene and gene-environment interaction, but to date little is known about the underlying mechanisms.<h4>Method</h4>Using the Avon Longitudinal Study of Parents and Children, we assessed the contributions of genetic, demographic, and environmental variables on case-control status using machine learning. We investigated the functional interactions between genes using pathway and network analysis.<h4>Results</h4>Our results support a systems approach to studying the etiology of reading disability with many genes (e.g., RAPGEF2, KIAA0319, DLC1) and biological pathways (e.g., neuron migration, positive regulation of dendrite regulation, nervous system development) interacting with each other. We found that single nucleotide variants within genes often had opposite effects and that enriched biological pathways were mediated by neuron migration. We also identified behavioral (i.e., receptive language, nonverbal intelligence, and vocabulary), demographic (i.e., mother's highest education), and environmental (i.e., birthweight) factors that influenced case-control status when accounting for genetic information.<h4>Discussion</h4>The behavioral and demographic factors were suggested to be protective against reading disability status, while birthweight conveyed risk. We provided supporting evidence that reading disability has a complex biological and environmental etiology and that there may be a shared genetic and neurobiological architecture for reading (dis)ability.
Also flagged:neurodegenerative diseasesagingneurodegenerative diseasemetforminrapamycinresveratrol
Journal Article2020-06-28✓ 1 SnippetSoo SK, Rudich PD, Traa A, Harris-Gauthier N, Shields HJ, Van Raamsdonk JM.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
While aging is the greatest risk factor for the development of neurodegenerative disease, the role of aging in these diseases is poorly understood. In the inherited forms of these diseases, the disease-causing mutation is present from birth but symptoms appear decades later. This indicates that these mutations are well tolerated in younger individuals but not in older adults. Based on this observation, we hypothesized that changes taking place during normal aging make the cells in the brain (and elsewhere) susceptible to the disease-causing mutations. If so, then delaying some of these age-related changes may be beneficial in the treatment of neurodegenerative disease. In this review, we examine the effects of five compounds that have been shown to extend longevity (metformin, rapamycin, resveratrol, N-acetyl-l-cysteine, curcumin) in four of the most common neurodegenerative diseases (Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis). While not all investigations observe a beneficial effect of these compounds, there are multiple studies that show a protective effect of each of these lifespan-extending compounds in animal models of neurodegenerative disease. Combined with genetic studies, this suggests the possibility that targeting the aging process may be an effective strategy to treat neurodegenerative disease.
Also flagged:viral infectionsimmune responsespathogenesisgene expressionacute kidney injuryantibody
Journal Article2020-06-27No SnippetsMengel M, Loupy A, Haas M, Roufosse C, Naesens M, Akalin E, Clahsen-van Groningen MC, Dagobert J, Demetris AJ, Duong van Huyen JP, Gueguen J, Issa F, Robin B, Rosales I, Von der Thüsen JH, Sanchez-Fueyo A, Smith RN, Wood K, Adam B, Colvin RB.
Show Full Abstract
This meeting report from the XV Banff conference describes the creation of a multiorgan transplant gene panel by the Banff Molecular Diagnostics Working Group (MDWG). This Banff Human Organ Transplant (B-HOT) panel is the culmination of previous work by the MDWG to identify a broadly useful gene panel based on whole transcriptome technology. A data-driven process distilled a gene list from peer-reviewed comprehensive microarray studies that discovered and validated their use in kidney, liver, heart, and lung transplant biopsies. These were supplemented by genes that define relevant cellular pathways and cell types plus 12 reference genes used for normalization. The 770 gene B-HOT panel includes the most pertinent genes related to rejection, tolerance, viral infections, and innate and adaptive immune responses. This commercially available panel uses the NanoString platform, which can quantitate transcripts from formalin-fixed paraffin-embedded samples. The B-HOT panel will facilitate multicenter collaborative clinical research using archival samples and permit the development of an open source large database of standardized analyses, thereby expediting clinical validation studies. The MDWG believes that a pathogenesis and pathway based molecular approach will be valuable for investigators and promote therapeutic decision-making and clinical trials.
Also flagged:LRRC8A-dependent volume-regulated anion channelsischemiainjuryVolume-regulated anion channelsleucine-rich repeat-containing protein 8ALRRC8A
Journal Article2020-06-27✓ 1 SnippetZhou JJ, Luo Y, Chen SR, Shao JY, Sah R, Pan HL.
In-Text Gene Mentions
Text
…leucine-rich repeat-containing protein 8…
Show Full Abstract
Volume-regulated anion channels (VRACs) are critically involved in regulating cell volume, and leucine-rich repeat-containing protein 8A (LRRC8A, SWELL1) is an obligatory subunit of VRACs. Cell swelling occurs early after brain ischemia, but it is unclear whether neuronal LRRC8a contributes to ischemia-induced glutamate release and brain injury. We found that Lrrc8a conditional knockout (Lrrc8a-cKO) mice produced by crossing Nestin<sup>Cre+/-</sup> with Lrrc8a<sup>flox+/+</sup> mice died 7-8 weeks of age, indicating an essential role of neuronal LRRC8A for survival. Middle cerebral artery occlusion (MCAO) caused an early increase in LRRC8A protein levels in the hippocampus in wild-type (WT) mice. Whole-cell patch-clamp recording in brain slices revealed that oxygen-glucose deprivation significantly increased the amplitude of VRAC currents in hippocampal CA1 neurons in WT but not in Lrrc8a-cKO mice. Hypotonicity increased the frequency of spontaneous excitatory postsynaptic currents (sEPSCs) in hippocampal CA1 neurons in WT mice, and this was abolished by DCPIB, a VRAC blocker. But in Lrrc8a-cKO mice, hypotonic solution had no effect on the frequency of sEPSCs in these neurons. Furthermore, the brain infarct volume and neurological severity score induced by MCAO were significantly lower in Lrrc8a-cKO mice than in WT mice. In addition, MCAO-induced increases in cleaved caspase-3 and calpain activity, two biochemical markers of neuronal apoptosis and death, in brain tissues were significantly attenuated in Lrrc8a-cKO mice compared with WT mice. These new findings indicate that cerebral ischemia increases neuronal LRRC8A-dependent VRAC activity and that VRACs contribute to increased glutamatergic input to hippocampal neurons and brain injury caused by ischemic stroke.
Also flagged:Protofilamentneurodegenerative diseasepolyglutaminetrypsinbindingfibril
Journal Article2020-06-27✓ 3 SnippetsBoatz JC, Piretra T, Lasorsa A, Matlahov I, Conway JF, van der Wel PCA.
In-Text Gene Mentions
Abstract)
…with the former (httNT or N17)…
Abstract)
…in absence ofhttNT .…
Text
…htt…
Show Full Abstract
Huntington's disease is a progressive neurodegenerative disease caused by expansion of the polyglutamine domain in the first exon of huntingtin (HttEx1). The extent of expansion correlates with disease progression and formation of amyloid-like protein deposits within the brain. The latter display polymorphism at the microscopic level, both in cerebral tissue and in vitro. Such polymorphism can dramatically influence cytotoxicity, leading to much interest in the conditions and mechanisms that dictate the formation of polymorphs. We examine conditions that govern HttEx1 polymorphism in vitro, including concentration and the role of the non-polyglutamine flanking domains. Using electron microscopy, we observe polymorphs that differ in width and tendency for higher-order bundling. Strikingly, aggregation yields different polymorphs at low and high concentrations. Narrow filaments dominate at low concentrations that may be more relevant in vivo. We dissect the role of N- and C-terminal flanking domains using protein with the former (htt<sup>NT</sup> or N17) largely removed. The truncated protein is generated by trypsin cleavage of soluble HttEx1 fusion protein, which we analyze in some detail. Dye binding and solid-state NMR studies reveal changes in fibril surface characteristics and flanking domain mobility. Higher-order interactions appear facilitated by the C-terminal tail, while the polyglutamine forms an amyloid core resembling those of other polyglutamine deposits. Fibril-surface-mediated branching, previously attributed to secondary nucleation, is reduced in absence of htt<sup>NT</sup>. A new model for the architecture of the HttEx1 filaments is presented and discussed in context of the assembly mechanism and biological activity.
Bicuspid aortic valve (BAV) is the most common congenital heart defect, found in up to 2% of the population and associated with a 30% lifetime risk of complications. BAV is inherited as an autosomal dominant trait with incomplete penetrance and variable expressivity due to a complex genetic architecture that involves many interacting genes. In this review, we highlight the current state of knowledge about BAV genetics, principles and methods for BAV gene discovery, clinical applications of BAV genetics, and important future directions.
Also flagged:vasodilationdeoxyhemoglobinMMPmembraneorganizationgene-expression
Journal Article2020-06-27No SnippetsSingh MF, Braver TS, Cole MW, Ching S.
Show Full Abstract
A key challenge for neuroscience is to develop generative, causal models of the human nervous system in an individualized, data-driven manner. Previous initiatives have either constructed biologically-plausible models that are not constrained by individual-level human brain activity or used data-driven statistical characterizations of individuals that are not mechanistic. We aim to bridge this gap through the development of a new modeling approach termed Mesoscale Individualized Neurodynamic (MINDy) modeling, wherein we fit nonlinear dynamical systems models directly to human brain imaging data. The MINDy framework is able to produce these data-driven network models for hundreds to thousands of interacting brain regions in just 1-3 min per subject. We demonstrate that the models are valid, reliable, and robust. We show that MINDy models are predictive of individualized patterns of resting-state brain dynamical activity. Furthermore, MINDy is better able to uncover the mechanisms underlying individual differences in resting state activity than functional connectivity methods.
Also flagged:membrane proteinantibodywatermembrane proteinsphospholipidmembrane
Journal Article2020-06-27No SnippetsNygaard R, Kim J, Mancia F.
Show Full Abstract
Recent advances in single-particle cryogenic-electron microscopy have facilitated an exponential growth in the number of membrane protein structures determined to close to atomic resolution. Nevertheless, despite improvements in microscope hardware, cryo-EM software and sample preparation techniques, challenges remain for structural analysis of small-sized membrane proteins (i.e.<150 kilodalton). Here we discuss recent examples of structures of macromolecules from this category determined by cryo-EM. We analyze the underlying difficulties, the enabling technologies such as the use of antibody fragments to gain size and provide fiducials for particle alignment, and the unresolved issues like dislocation of complexes at the air-water interface. Finally, we briefly highlight the biological relevance of some of these success stories, and our predictions for the future.
Bleeding is the most feared and difficult to predict adverse event of anticoagulation. We sought to investigate whether calibrated automated thrombography (CAT) parameters are associated with minor bleeding (MB) in anticoagulated patients following venous thromboembolism (VTE). Enrolled were 132 patients on rivaroxaban, 145 on vitamin K antagonists (VKA) and 31 controls who stopped anticoagulation. Prior to the next dose of the anticoagulant, we measured CAT parameters, along with rivaroxaban concentration and INR. During a median follow-up of 10 months, we recorded minor and major bleedings. On rivaroxaban, 27 (20.5%) patients with MB had longer time to start thrombin generation, lower peak thrombin generation and lower endogenous thrombin potential compared with subjects without MB (all <i>p</i> < 0.001). All CAT parameters, except for peak thrombin generation (<i>p</i> = 0.049), were similar in VKA patients with (<i>n</i> = 25, 17.2%) vs. without MBs. By logistic regression, time to start thrombin generation (<i>p</i> = 0.007) and unprovoked VTE (<i>p</i> = 0.041) independently predicted MBs on rivaroxaban. Major bleedings were more frequent in patients with MBs (17.3% vs. 1.8%, <i>p</i> < 0.001). Abnormal CAT parameters characterize VTE patients prone to MBs on rivaroxaban, but not on VKA. Time to start thrombin generation measured about 24 h since the last rivaroxaban dose might help predict MBs.
Also flagged:oxygenmitochondrialelectron transport chainNADPH oxidasesperoxisomesendoplasmic reticulum
Journal Article2020-06-27No SnippetsNarayanan D, Ma S, Özcelik D.
Show Full Abstract
Reactive oxygen species (ROS) are produced predominantly by the mitochondrial electron transport chain and by NADPH oxidases in peroxisomes and in the endoplasmic reticulum. The antioxidative defense counters overproduction of ROS with detoxifying enzymes and molecular scavengers, for instance, superoxide dismutase and glutathione, in order to restore redox homeostasis. Mutations in the redox landscape can induce carcinogenesis, whereas increased ROS production can perpetuate cancer development. Moreover, cancer cells can increase production of antioxidants, leading to resistance against chemo- or radiotherapy. Research has been developing pharmaceuticals to target the redox landscape in cancer. For instance, inhibition of key players in the redox landscape aims to modulate ROS production in order to prevent tumor development or to sensitize cancer cells in radiotherapy. Besides the redox landscape of a single cell, alternative strategies take aim at the multi-cellular level. Extracellular vesicles, such as exosomes, are crucial for the development of the hypoxic tumor microenvironment, and hence are explored as target and as drug delivery systems in cancer therapy. This review summarizes the current pharmaceutical and experimental interventions of the cancer redox landscape.
Also flagged:Ergosterolbutylhydroxybutylnitrosaminebladder cancercell cycle-related
Journal Article2020-06-27No SnippetsIkarashi N, Hoshino M, Ono T, Toda T, Yazawa Y, Sugiyama K.
Show Full Abstract
We previously showed that ergosterol has an inhibitory effect on bladder carcinogenesis. In this study, we aimed to elucidate the molecular mechanism by which ergosterol inhibits bladder carcinogenesis using a rat model of N-butyl-N-(4-hydroxybutyl)nitrosamine-induced bladder cancer. The messenger ribonucleic acid (mRNA) expression level of the cell cycle-related gene cyclin D1 and inflammation-related gene cyclooxygenase-2 in bladder epithelial cells was significantly increased in the carcinogenesis group compared with the control group. In contrast, in ergosterol-treated rats, these increases were significantly suppressed. Ergosterol did not affect the plasma testosterone concentration or the binding of dihydrotestosterone to androgen receptor (AR). The mRNA expression levels of 5α-reductase type 2 and AR were higher in the carcinogenesis group than in the control group but were significantly decreased by ergosterol administration. These results suggest that ergosterol inhibits bladder carcinogenesis by modulating various aspects of the cell cycle, inflammation-related signaling, and androgen signaling. Future clinical application of the preventive effect of ergosterol on bladder carcinogenesis is expected.
Journal Article2020-06-27✓ 5 SnippetsBarton JC, Barton JC, Cruz E, Teles MJ, Guimarães JT, Porto G.
In-Text Gene Mentions
Abstract)
…Subnormal IgG1 or IgG3 levels occurred in 30% of hemochromatosis probands with HFE p.C282Y homozygosity and were concordant in HLA-identical siblings.…
Title)
…Chromosome 6p SNP microhaplotypes and IgG3 levels in hemochromatosis probands with HFE p.C282Y homozygosity.…
Subnormal IgG1 or IgG3 levels occurred in 30% of hemochromatosis probands with HFE p.C282Y homozygosity and were concordant in HLA-identical siblings. We sought to identify factors associated with IgG subclasses in Alabama probands with p.C282Y homozygosity evaluated for 500 kb microhaplotypes AAT and GGG defined by SNPs in chromosome 6p genes PGBD1, ZNF193, and ZNF165. In regressions on IgG subclasses, we used: age; sex; GGG (dichotomous); iron removed to achieve depletion; CD8+ T-lymphocytes; and other IgG subclasses. Among 49 probands, AAT and GGG occurred in 95.9% and 16.3%, respectively. Thirteen probands (26.5%) had subnormal IgG1; 11 probands (22.4%) had subnormal IgG3. Mean IgG3 was higher in probands with than without GGG (75 mg/dL [95% confidence interval 63, 89] vs. 58 mg/dL [49, 71], respectively; p = 0.0321). Regression on IgG3 revealed: GGG positivity (p = 0.0106); and IgG1 (p = 0.0015). In a replication cohort of 22 Portugal probands with p.C282Y homozygosity, mean IgG3 was higher in probands with than without GGG (46 ± 16 vs. 31 ± 12 mg/dL, respectively; p = 0.0410). We conclude that mean IgG3 levels are higher in hemochromatosis probands with p.C282Y homozygosity with chromosome 6p microhaplotype GGG than in probands homozygous for microhaplotype AAT.
Also flagged:methylationosteoporosisosteoarthritispostmenopausal osteoporosiscalciumRap1
Journal Article2020-06-26✓ 5 SnippetsZhou Y, Yang L, Wang H, Chen X, Jiang W, Wang Z, Liu S, Liu Y.
In-Text Gene Mentions
I A O 0000615)
…In summary, 13 differentially methylated genes, including PLEKHA2, PLEKHB1, PNPLA7, SCD, MGST3, TSNAX, PRKCZ, GNA11, COL4A1, SOX6, ACE, SYK and TGFB3, and 5 related signaling pathways (calcium, cGMP‐PKG, endocytosis, Rap1 and AMPK) were identified in postmenopausal women with osteoporosis in this study.…
Discussion)
…Our findings suggested that SOX6, ACE, SYK and TGFB3 may play important roles in the bone formation of osteoporosis in postmenopausal women.…
Discussion)
…In addition, the association between SOX6 and osteoporosis has been documented [34].…
Abstract)
…genes, such asSOX6, ACE ,…
Abstract)
…, COL4A1 ,SOX6, ACE ,…
Show Full Abstract
Osteoporosis is characterized by systemic microarchitecture impairment and bone loss, which ultimately lead to fragility fractures. This disease is most common in older people, especially in postmenopausal women. Cancellous bone is affected by osteoporosis earlier than cortical bone, and DNA methylation microarray analysis of the hip cancellous bone of patients with osteoarthritis revealed differential methylation. In view of the important role of cancellous bone in bone development, we examined genome-wide DNA methylation profiles in the cancellous bone from patients with postmenopausal osteoporosis versus healthy postmenopausal women using Illumina 850K methylation microarray analysis. Under a threshold of P < 0.05, we obtained a total of 8973 differentially methylated genes, such as SOX6, ACE, SYK and TGFB3. Under a threshold of P < 0.05 and |△β| > 0.2, a total of 17 and 34 key differentially methylated genes were further identified at the promoter region and cytosine- phosphate- guanine (CpG) islands (such as PRKCZ, GNA11 and COL4A1), respectively. PLEKHA2, PLEKHB1, PNPLA7, SCD, MGST3 and TSNAX were the most common differentially methylated genes at both the promoter region and CpG islands. Five important signaling pathways, including the calcium signaling pathway, the cyclic guanosine phospho-protein kinase G (cGMP-PKG) signaling pathway, endocytosis, the Rap1 signaling pathway and the AMPK signaling pathway were identified. Our study may be suitable as a basis for exploring the mechanisms underlying osteoporosis in postmenopausal women.
Also flagged:SynthesisTetramic Acidacetyltetramic acidscell walllipid
Journal Article2020-06-26No SnippetsWingen LM, Rausch M, Schneider T, Menche D.
Show Full Abstract
An efficient route to various vancoresmycin-type tetramic acids has been developed. The modular route is based on an effective Fries-type rearrangement to introduce various appending acetyl residues. The minimum inhibitory concentration (MIC) values of the new tetramic acids against Staphylococcus aureus and Escherichia coli were determined, revealing that three of the new compounds exhibit antimicrobial activity against S. aureus. These bioactive compounds were structurally most closely related to the authentic vancoresmycin building block. Additionally, the compounds induced a lial-lux bioreporter, which responds to cell wall stress induced by antibiotics that interfere with the lipid II biosynthesis cycle. These data suggest the tetramic acid moiety to be a part of the vancoresmycin pharmacophore.
Also flagged:Pax6gene expressionnetrin 1semaphorin 3aaxonsorganization
Journal Article2020-06-26✓ 4 SnippetsQuintana-Urzainqui I, Hernández-Malmierca P, Clegg JM, Li Z, Kozić Z, Price DJ.
In-Text Gene Mentions
Methods)
…The following digoxigenin-labelled probes were synthetized in the lab from cDNA: Ntn1 (kindly donated by Dr Thomas Theil, (University of Edinburgh, UK); forward primer, CTTCCTCACCGACCTCAATAAC; reverse primer, GCGATTTAGGTGACACTATAGTTGTGCCTACAGTCACACACC), Sema3a (forward primer, ACTGCTCTGACTTGGAGGAC; reverse primer, ACAAACACGAGTGCTGGTAG); Plxna1 (forward primer, GACGAGATTCTGGTGGCTCT; reverse primer, CATGGCAGGGAGAGGAAGG), DCC (forward primer, AACAGAAGGTCAAGCACGTG; reverse primer, CAATCACCACGACCAACACA), Unc5a (forward primer, CTGTCAGACCCTGCTGAGT; reverse primer, GGGCTAGAGTTCGCCAGTC), Unc5d (forward primer, GGACAGAGCTGAGGACAACT; reverse primer, GTATCAAACGTGGCGCAGAT).…
Methods)
… primer, CATGGCAGGGAGAGGAAGG),DCC(forward primer, AACAGAAGGTCAA…
Results)
…genes analysed (Dcc, Unc5a and…
Discussion)
…2007 ) andDCC( Powell et…
Show Full Abstract
Thalamocortical axons (TCAs) cross several tissues on their journey to the cortex. Mechanisms must be in place along the route to ensure they connect with their targets in an orderly fashion. The ventral telencephalon acts as an instructive tissue, but the importance of the diencephalon in TCA mapping is unknown. We report that disruption of diencephalic development by Pax6 deletion results in a thalamocortical projection containing mapping errors. We used conditional mutagenesis to test whether these errors are due to the disruption of pioneer projections from prethalamus to thalamus and found that, although this correlates with abnormal TCA fasciculation, it does not induce topographical errors. To test whether the thalamus contains navigational cues for TCAs, we used slice culture transplants and gene expression studies. We found the thalamic environment is instructive for TCA navigation and that the molecular cues netrin 1 and semaphorin 3a are likely to be involved. Our findings indicate that the correct topographic mapping of TCAs onto the cortex requires the order to be established from the earliest stages of their growth by molecular cues in the thalamus itself.
Also flagged:OTULINautophagyATG13membranedegradationcytoplasmic
Journal Article2020-06-26✓ 3 SnippetsChu Y, Kang Y, Yan C, Yang C, Zhang T, Huo H, Liu Y.
In-Text Gene Mentions
Abstract)
…Together, our study provides evidence that LUBAC and OTULIN cooperatively regulate autophagy initiation and autophagosome maturation by mediating the linear ubiquitination and the stabilization of ATG13.<b>Abbreviations:</b> ATG: autophagy-related; CALCOCO2/NDP52: calcium binding and coiled-coil domain 2; CQ: chloroquine; CUL1-FBXL20: cullin 1-F-box and leucine rich repeat protein 20; CUL3-KLHL20: cullin 3-kelch like family member 20; CUL4-AMBRA1: cullin 4-autophagy and beclin 1 regulator 1; CYLD: CYLD lysine 63 deubiquitinase; DAPI: 4',6-diamidino-2-phenylindole; DUB: deubiquitinating enzyme; EBSS: Earle's Balanced Salt Solution; GFP: green fluorescent protein; GST: glutathione S-transferase; IKBKG/NEMO: inhibitor of nuclear factor kappa B kinase regulatory subunit gamma; LUBAC: linear ubiquitin chain assembly complex; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; MAP1LC3B/LC3B: microtubule-associated protein 1 light chain 3B; MIM: MIT-interacting motif; mRFP: monomeric red fluorescent protein; NEDD4: NEDD4 E3 ubiquitin protein ligase; NFKB: NF-kappaB complex; OPTN: optineurin; OTULIN: OTU deubiquitinase with linear linkage specificity; PIK3C3/Vps34: phosphatidylinositol 3-kinase catalytic subunit type 3; PtdIns: phosphatidylinositol; PtdIns3K: class III phosphatidylinositol 3-kinase complex; PtdIns3P: phosphatidylinositol 3-phosphate; RBCK1/HOIL1: RANBP2-type and C3HC4-type zinc finger containing 1; RB1CC1/FIP200: RB1-inducible coiled-coil 1; RIPK1: receptor interacting serine/threonine kinase 1; RNF216: ring finger protein 216; RNF31/HOIP: ring finger protein 31; RT-PCR: reverse transcriptase polymerase chain reaction; S. Typhimurium: <i>Salmonella enterica</i> serovar Typhimurium; SHARPIN: SHANK associated RH domain interactor; SMURF1: SMAD specific E3 ubiquitin protein ligase 1; SQSTM1: sequestosome 1; STING: stimulator of interferon response cGAMP interactor 1; STUB1/CHIP: STIP1 homology and U-box containing protein 1; TNF/TNF-alpha: tumor necrosis factor; TNFAIP3/A20: TNF alpha induced protein 3; TRAF6: TNF receptor associated factor 6; TRIM32: tripartite motif containing 32; UBAN: ubiquitin binding in TNIP/ABIN and IKBKG/NEMO proteins; ULK1/2: unc-51 like autophagy activating kinase 1/2; USP: ubiquitin specific peptidase; UVRAG: UV radiation resistance associated; VCPIP1: valosin containing protein interacting protein 1; WIPI2: WD repeat domain, phosphoinositide interacting protein 2; ZBTB16-CUL3-RBX1: zinc finger and BTB domain containing protein 16-cullin 3-ring-box 1; ZRANB1: zinc finger RANBP2-type containing 1.…
Abstract)
…repeat protein 20; CUL3-KLHL20: cullin 3-kelch like…
Text
…KLHL20…
Show Full Abstract
Macroautophagy/autophagy is a membrane-mediated intracellular degradation pathway, through which bulky cytoplasmic content is digested in lysosomes. How the autophagy initiation and maturation steps are regulated is not clear. In this study, we found an E3 ubiquitin ligase complex, linear ubiquitin chain assembly complex (LUBAC) and a deubiquitinating enzyme (DUB) OTULIN localize to the phagophore area to control autophagy initiation and maturation. LUBAC key component RNF31/HOIP translocates to the LC3 puncta area when autophagy is induced. <i>RNF31</i> knockdown inhibits autophagy initiation, and cells are more sensitive to bacterial infection. <i>OTULIN</i> knockdown, however, promotes autophagy initiation but blocks autophagy maturation. In <i>OTULIN</i> knockdown cells, excessive ubiquitinated ATG13 protein was recruited to the phagophore for prolonged expansion, and therefore inhibits autophagosome maturation. Together, our study provides evidence that LUBAC and OTULIN cooperatively regulate autophagy initiation and autophagosome maturation by mediating the linear ubiquitination and the stabilization of ATG13.<b>Abbreviations:</b> ATG: autophagy-related; CALCOCO2/NDP52: calcium binding and coiled-coil domain 2; CQ: chloroquine; CUL1-FBXL20: cullin 1-F-box and leucine rich repeat protein 20; CUL3-KLHL20: cullin 3-kelch like family member 20; CUL4-AMBRA1: cullin 4-autophagy and beclin 1 regulator 1; CYLD: CYLD lysine 63 deubiquitinase; DAPI: 4',6-diamidino-2-phenylindole; DUB: deubiquitinating enzyme; EBSS: Earle's Balanced Salt Solution; GFP: green fluorescent protein; GST: glutathione S-transferase; IKBKG/NEMO: inhibitor of nuclear factor kappa B kinase regulatory subunit gamma; LUBAC: linear ubiquitin chain assembly complex; MAP1LC3/LC3: microtubule-associated protein 1 light chain 3; MAP1LC3B/LC3B: microtubule-associated protein 1 light chain 3B; MIM: MIT-interacting motif; mRFP: monomeric red fluorescent protein; NEDD4: NEDD4 E3 ubiquitin protein ligase; NFKB: NF-kappaB complex; OPTN: optineurin; OTULIN: OTU deubiquitinase with linear linkage specificity; PIK3C3/Vps34: phosphatidylinositol 3-kinase catalytic subunit type 3; PtdIns: phosphatidylinositol; PtdIns3K: class III phosphatidylinositol 3-kinase complex; PtdIns3P: phosphatidylinositol 3-phosphate; RBCK1/HOIL1: RANBP2-type and C3HC4-type zinc finger containing 1; RB1CC1/FIP200: RB1-inducible coiled-coil 1; RIPK1: receptor interacting serine/threonine kinase 1; RNF216: ring finger protein 216; RNF31/HOIP: ring finger protein 31; RT-PCR: reverse transcriptase polymerase chain reaction; S. Typhimurium: <i>Salmonella enterica</i> serovar Typhimurium; SHARPIN: SHANK associated RH domain interactor; SMURF1: SMAD specific E3 ubiquitin protein ligase 1; SQSTM1: sequestosome 1; STING: stimulator of interferon response cGAMP interactor 1; STUB1/CHIP: STIP1 homology and U-box containing protein 1; TNF/TNF-alpha: tumor necrosis factor; TNFAIP3/A20: TNF alpha induced protein 3; TRAF6: TNF receptor associated factor 6; TRIM32: tripartite motif containing 32; UBAN: ubiquitin binding in TNIP/ABIN and IKBKG/NEMO proteins; ULK1/2: unc-51 like autophagy activating kinase 1/2; USP: ubiquitin specific peptidase; UVRAG: UV radiation resistance associated; VCPIP1: valosin containing protein interacting protein 1; WIPI2: WD repeat domain, phosphoinositide interacting protein 2; ZBTB16-CUL3-RBX1: zinc finger and BTB domain containing protein 16-cullin 3-ring-box 1; ZRANB1: zinc finger RANBP2-type containing 1.
Also flagged:Acute LeukemiaALLlymphoid enhancer-binding factor 1gene expressionpolymerasetumor
Journal Article2020-06-26No SnippetsSırma Ekmekci S, Emrence Z, Abacı N, Sarıman M, Salman B, Ekmekci CG, Güleç Ç.
Show Full Abstract
<h4>Objective</h4>T-cell acute lymphoblastic leukemia (T-ALL) is an aggressive disease resulting from the accumulation of genetic changes that affect the development of T-cells. The precise role of lymphoid enhancer-binding factor 1 (<i>LEF1</i>) in T-ALL has been controversial since both overexpression and inactivating <i>LEF1</i> mutations have been reported to date. Here, we investigate the potential gene targets of <i>LEF1</i> in the Jurkat human T-cell leukemia cell line.<h4>Materials and methods</h4>We used small interfering RNA (siRNA) technology to knock down <i>LEF1</i> in Jurkat cells and then compared the gene expression levels in the <i>LEF1</i> knockdown cells with non-targeting siRNA-transfected and non-transfected cells by employing microarray analysis.<h4>Results</h4>We identified <i>DHRS2</i>, a tumor suppressor gene, as the most significantly downregulated gene in <i>LEF1</i> knockdown cells, and we further confirmed its downregulation by real-time quantitative polymerase chain reaction (qRT-PCR) in mRNA and at protein level by western blotting.<h4>Conclusion</h4>Our results revealed that <i>DHRS2</i> is positively regulated by <i>LEF1</i> in Jurkat cells, which indicates the capability of <i>LEF1</i> as a tumor suppressor and, together with previous reports, suggests that <i>LEF1</i> exhibits a regulatory role in T-ALL via not only its oncogenic targets but also tumor suppressor genes.
Also flagged:Progesteroneglioblastomaglioblastoma multiformeGBMcell growthoxygen
Journal Article2020-06-26No SnippetsAltinoz MA, Ucal Y, Yilmaz MC, Kiris İ, Ozisik O, Sezerman U, Ozpinar A, Elmaci İ.
Show Full Abstract
While pregnancy may accelerate glioblastoma multiforme (GBM) growth, parity and progesterone (P4) containing treatments (ie, hormone replacement therapy) reduce the risk of GBM development. In parallel, low and high doses of P4 exert stimulating and inhibitory actions on GBM growth, respectively. The mechanisms behind the high-dose P4-suppression of GBM growth is unknown. In the present study, we assessed the changes in growth and proteomic profiles when high-dose P4 (100 and 300 µM) was administered in human U87 and A172 GBM cell lines. The xCELLigence system was used to examine cell growth when different concentrations of P4 (20, 50, 100, and 300 µM) was administered. The protein profiles were determined by two-dimensional gel electrophoresis in both cell lines when 100 and 300 µM P4 were administered. Finally, the pathways enriched by the differentially expressed proteins were assessed using bioinformatic tools. Increasing doses of P4 blocked the growth of both GBM cells. We identified 26 and 51 differentially expressed proteins (fc > 2) in A172 and U87 cell lines treated with P4, respectively. Only the pro-tumorigenic mitochondrial ornithine aminotransferase and anti-apoptotic mitochondrial 60 kDa heat shock protein were downregulated in A172 cell line and U87 cell line when treated with P4, respectively. Detoxification of reactive oxygen species, cellular response to stress, glucose metabolism, and immunity-related proteins were altered in P4-treated GBM cell lines. The paradox on the effect of low and high doses of P4 on GBM growth is gaining attention. The mechanism related to the high dose of P4 on GBM growth can be explained by the alterations in detoxification mechanisms, stress, and immune response and glucose metabolism. P4 suppresses GBM growth and as it is nontoxic in comparison to classical chemotherapeutics, it can be used as a new strategy in GBM treatment in the future.
Also flagged:chromatinneurogenesisEML3SCAF1SLC3A2TBR1
Journal Article2020-06-26✓ 3 SnippetsLu L, Liu X, Huang WK, Giusti-Rodríguez P, Cui J, Zhang S, Xu W, Wen Z, Ma S, Rosen JD, Xu Z, Bartels CF, Kawaguchi R, Hu M, Scacheri PC, Rong Z, Li Y, Sullivan PF, Song H, Ming GL, Li Y, Jin F.
In-Text Gene Mentions
I A O 0000326)
…POU3F2…
Text
…MRPL39…
Text
…FBXL4…
Show Full Abstract
Genome-wide mapping of chromatin interactions at high resolution remains experimentally and computationally challenging. Here we used a low-input "easy Hi-C" protocol to map the 3D genome architecture in human neurogenesis and brain tissues and also demonstrated that a rigorous Hi-C bias-correction pipeline (HiCorr) can significantly improve the sensitivity and robustness of Hi-C loop identification at sub-TAD level, especially the enhancer-promoter (E-P) interactions. We used HiCorr to compare the high-resolution maps of chromatin interactions from 10 tissue or cell types with a focus on neurogenesis and brain tissues. We found that dynamic chromatin loops are better hallmarks for cellular differentiation than compartment switching. HiCorr allowed direct observation of cell-type- and differentiation-specific E-P aggregates spanning large neighborhoods, suggesting a mechanism that stabilizes enhancer contacts during development. Interestingly, we concluded that Hi-C loop outperforms eQTL in explaining neurological GWAS results, revealing a unique value of high-resolution 3D genome maps in elucidating the disease etiology.
Also flagged:Insulinagingpeptide-sensinginsulin-like growth factormetabolism
Journal Article2020-06-26No SnippetsWeigelt CM, Sehgal R, Tain LS, Cheng J, Eßer J, Pahl A, Dieterich C, Grönke S, Partridge L.
Show Full Abstract
Circular RNAs (circRNAs) are abundant and accumulate with age in neurons of diverse species. However, only few circRNAs have been functionally characterized, and their role during aging has not been addressed. Here, we use transcriptome profiling during aging and find that accumulation of circRNAs is slowed down in long-lived insulin mutant flies. Next, we characterize the in vivo function of a circRNA generated by the sulfateless gene (circSfl), which is consistently upregulated, particularly in the brain and muscle, of diverse long-lived insulin mutants. Strikingly, lifespan extension of insulin mutants is dependent on circSfl, and overexpression of circSfl alone is sufficient to extend the lifespan. Moreover, circSfl is translated into a protein that shares the N terminus and potentially some functions with the full-length Sfl protein encoded by the host gene. Our study demonstrates that insulin signaling affects global circRNA accumulation and reveals an important role of circSfl during aging in vivo.
Also flagged:neuropsychiatric disordersmajor depressive disorderACClong-termneurotrophinaxon
Journal Article2020-06-26No SnippetsYoshino Y, Roy B, Dwivedi Y.
Show Full Abstract
MicroRNAs (miRNAs), a family of non-coding RNAs, have recently gained a considerable attention in neuropsychiatric disorders. Being a pleiotropic modulator of target gene(s), miRNA has been recognized as central to downstream gene regulatory networks. In the recent past, reports have suggested their role in changing the epigenetic landscape in brain of subjects with major depressive disorder (MDD). Anterior cingulate cortex (ACC) is a brain area implicated in several complex cognitive functions, such as impulse control, emotion, and decision-making and is associated with psychopathology associated with mood regulation. In this study, we examined whether MDD is associated with altered miRNA transcriptome in ACC and whether altered miRNA landscape is associated with modifications in specific gene network(s) at the functional level. Using next generation sequencing (NGS), it was observed that 117 miRNAs (4.61%) were significantly upregulated and 54 (2.13%) were downregulated in MDD subjects (n = 22) compared with non-psychiatric controls (n = 25). Using 24 most significantly upregulated miRNAs in the MDD group, we determined functional enrichment of target genes and found them to be associated with long-term potentiation, neurotrophin signaling, and axon guidance. Intra- and inter-cluster similarities of enriched terms based on overrepresented gene list showed neurobiological functions associated with neuronal growth and survival. Web centric parameters and ontology enrichment functions identified two major domains related to phosphatidyl signaling, GTPase signaling, neuronal migration, and neurotrophin signaling. Our findings of altered miRNA landscape along with a shift in targetome relate to previously reported morphometric changes and neuronal atrophy in ACC of MDD subjects.
Also flagged:DeathBreast Cancersynthesispeptidepeptidesamino acids
Journal Article2020-06-26No SnippetsInsuasty-Cepeda DS, Barragán-Cárdenas AC, Ochoa-Zarzosa A, López-Meza JE, Fierro-Medina R, García-Castañeda JE, Rivera-Monroy ZJ.
Show Full Abstract
The effect on the cytotoxicity against breast cancer cell lines of the substitution of <sup>26</sup>Met residue in the sequence of the Bovine Lactoferricin-derived dimeric peptide LfcinB (20-30)<sub>2</sub>: (<sup>20</sup>RRWQWRMKKLG<sup>30</sup>)<sub>2</sub>-K-<i>Ahx</i> with amino acids of different polarity was evaluated. The process of the synthesis of the LfcinB (20-30)<sub>2</sub> analog peptides was similar to the original peptide. The cytotoxic assays showed that some analog peptides exhibited a significant cytotoxic effect against breast cancer cell lines HTB-132 and MCF-7, suggesting that the substitution of the Met with amino acids of a hydrophobic nature drastically enhances its cytotoxicity against HTB-132 and MCF-7 cells, reaching IC<sub>50</sub> values up to 6 µM. In addition, these peptides have a selective effect, since they exhibit a lower cytotoxic effect on the non-tumorigenic cell line MCF-12. Interestingly, the cytotoxic effect is fast (90 min) and is maintained for up to 48 h. Additionally, through flow cytometry, it was found that the obtained dimeric peptides generate cell death through the apoptosis pathway and do not compromise the integrity of the cytoplasmic membrane, and there are intrinsic apoptotic events involved. These results show that the obtained peptides are extremely promising molecules for the future development of drugs for use against breast cancer.
Also flagged:Oligonucleotidesmetabolismribosomeprotein synthesisPIWIgene expression
Journal Article2020-06-26No SnippetsDhuri K, Bechtold C, Quijano E, Pham H, Gupta A, Vikram A, Bahal R.
Show Full Abstract
Antisense oligonucleotides (ASOs) bind sequence specifically to the target RNA and modulate protein expression through several different mechanisms. The ASO field is an emerging area of drug development that targets the disease source at the RNA level and offers a promising alternative to therapies targeting downstream processes. To translate ASO-based therapies into a clinical success, it is crucial to overcome the challenges associated with off-target side effects and insufficient biological activity. In this regard, several chemical modifications and diverse delivery strategies have been explored. In this review, we systematically discuss the chemical modifications, mechanism of action, and optimized delivery strategies of several different classes of ASOs. Further, we highlight the recent advances made in development of ASO-based drugs with a focus on drugs that are approved by the Food and Drug Administration (FDA) and the European Medicines Agency (EMA) for clinical applications. We also discuss various promising ASO-based drug candidates in the clinical trials, and the outstanding opportunity of emerging microRNA as a viable therapeutic target for future ASO-based therapies.
In silico models to predict which tumors will respond to a given drug are necessary for Precision Oncology. However, predictive models are only available for a handful of cases (each case being a given drug acting on tumors of a specific cancer type). A way to generate predictive models for the remaining cases is with suitable machine learning algorithms that are yet to be applied to existing in vitro pharmacogenomics datasets. Here, we apply XGBoost integrated with a stringent feature selection approach, which is an algorithm that is advantageous for these high-dimensional problems. Thus, we identified and validated 118 predictive models for 62 drugs across five cancer types by exploiting four molecular profiles (sequence mutations, copy-number alterations, gene expression, and DNA methylation). Predictive models were found in each cancer type and with every molecular profile. On average, no omics profile or cancer type obtained models with higher predictive accuracy than the rest. However, within a given cancer type, some molecular profiles were overrepresented among predictive models. For instance, CNA profiles were predictive in breast invasive carcinoma (BRCA) cell lines, but not in small cell lung cancer (SCLC) cell lines where gene expression (GEX) and DNA methylation profiles were the most predictive. Lastly, we identified the best XGBoost model per cancer type and analyzed their selected features. For each model, some of the genes in the selected list had already been found to be individually linked to the response to that drug, providing additional evidence of the usefulness of these models and the merits of the feature selection scheme.
Also flagged:polyadenylationnucleusRNA-binding proteinRBPbindingsynthesis
Journal Article2020-06-26✓ 1 SnippetWang Y, Feng W, Xu S, He B.
In-Text Gene Mentions
Results)
…such as ST13,SHISA6, PTPRR, RABL6, MUM1…
Show Full Abstract
Cleavage and polyadenylation are essential processes that can impact many aspects of mRNA fate. Most eukaryotic genes have alternative polyadenylation (APA) events. While the heterogeneity of mRNA polyadenylation isoform choice has been studied in specific tissues, less attention has been paid to the neuronal heterogeneity of APA selection at single-nucleus resolution. APA is highly controlled during development and neuronal activation, however, to what extent APA events vary in a specific neuronal cell population and the regulatory mechanisms are still unclear. In this paper, we investigated dynamic APA usage in different cell types using snRNA-seq data of 1424 human brain cells generated by single-cell 3' RNA sequencing. We found that distal APA sites are not only favored by global neuronal cells, but that their usage also varies between the principal types of neuronal cell populations (excitatory neurons and inhibitory neurons). A motif analysis and a gene functional analysis indicated the enrichment of RNA-binding protein (RBP) binding sites and neuronal functions for the set of genes with neuron-enhanced distal PAS usage. Our results revealed the extensive involvement of APA regulation in neuronal populations at the single-nucleus level, providing new insights into roles for APA in specific neuronal cell populations, as well as utility in future functional studies.
<h4>Background</h4>Exocrine pancreatic insufficiency results from the destruction of the pancreatic parenchyma and is diagnosed by using direct or indirect tests, both of which have shortcomings. Chronic pancreatitis is the most frequent cause of this pathology in adults.<h4>Methods</h4>Patients meeting radiological or histological diagnostic criteria of chronic pancreatitis are enrolled and the stool elastase test is conducted, considering fecal elastase levels >200 µg/g to represent normal pancreatic function, and levels <200 μg/g to indicate the presence of exocrine pancreatic insufficiency. Additionally, we determine the body mass index of the patients and study their nutritional status and main biochemical and hematological variables, including their glucose and hemoglobin A1c (HbA1c) levels.<h4>Results</h4>Exocrine pancreatic insufficiency is detected in 60% of the patients. Among these, 83.3% are severe cases, and 72% of the latter also are diagnosed with endocrine pancreatic insufficiency (diabetes mellitus). During the nutritional status study, HbA1c levels are significantly higher, and magnesium and prealbumin levels are significantly lower in patients with exocrine pancreatic insufficiency than in those without this disease.<h4>Conclusions</h4>Exocrine and endocrine pancreatic insufficiency are highly prevalent among patients with chronic pancreatitis and an early diagnosis of these diseases is vital to improve the clinical management of these patients and reduce their risk of mortality.
Also flagged:transition metal complexestransitionsynthesistransferphotosynthesisPhotocatalysis
Journal Article2020-06-26No SnippetsThomson CG, Lee AL, Vilela F.
Show Full Abstract
The synergy between photocatalysis and continuous flow chemical reactors has shifted the paradigms of photochemistry, opening new avenues of research with safer and scalable processes that can be readily implemented in academia and industry. Current state-of-the-art photocatalysts are homogeneous transition metal complexes that have favourable photophysical properties, wide electrochemical redox potentials, and photostability. However, these photocatalysts present serious drawbacks, such as toxicity, limited availability, and the overall cost of rare transition metal elements. This reduces their long-term viability, especially at an industrial scale. Heterogeneous photocatalysts (HPCats) are an attractive alternative, as the requirement for the separation and purification is largely removed, but typically at the cost of efficiency. Flow chemical reactors can, to a large extent, mitigate the loss in efficiency through reactor designs that enhance mass transport and irradiation. Herein, we review some important developments of heterogeneous photocatalytic materials and their application in flow reactors for sustainable organic synthesis. Further, the application of continuous flow heterogeneous photocatalysis in environmental remediation is briefly discussed to present some interesting reactor designs that could be implemented to enhance organic synthesis.
Also flagged:bindingcheckpoint kinase 1CHK1serine/threonine-protein kinasecell cyclecancer
Journal Article2020-06-26No SnippetsMai NT, Lan NT, Vu TY, Duong PTM, Tung NT, Phung HTT.
Show Full Abstract
Checkpoint kinase 1 (CHK1) is a serine/threonine-protein kinase that is involved in cell cycle regulation in eukaryotes. Inhibition of CHK1 is thus considered as a promising approach in cancer therapy. In this study, the fast pulling of ligand (FPL) process was applied to predict the relative binding affinities of CHK1 inhibitors using non-equilibrium molecular dynamics (MD) simulations. The work of external harmonic forces to pull the ligand out of the binding cavity strongly correlated with the experimental binding affinity of CHK1 inhibitors with the correlation coefficient of R = -0.88 and an overall root mean square error (RMSE) of 0.99 kcal/mol. The data indicate that the FPL method is highly accurate in predicting the relative binding free energies of CHK1 inhibitors with an affordable CPU time. A new set of molecules were designed based on the molecular modeling of interactions between the known inhibitor and CHK1 as inhibitory candidates. Molecular docking and FPL results exhibited that the binding affinities of developed ligands were similar to the known inhibitor in interaction with the catalytic site of CHK1, producing very potential CHK1 inhibitors of that the inhibitory activities should be further evaluated in vitro.
Also flagged:cDNAscRNA-SeqcDNAsribosomalcentral nervous system disordersbrain development
Journal Article2020-06-26✓ 1 SnippetEura N, Matsui TK, Luginbühl J, Matsubayashi M, Nanaura H, Shiota T, Kinugawa K, Iguchi N, Kiriyama T, Zheng C, Kouno T, Lan YJ, Kongpracha P, Wiriyasermkul P, Sakaguchi YM, Nagata R, Komeda T, Morikawa N, Kitayoshi F, Jong M, Kobashigawa S, Nakanishi M, Hasegawa M, Saito Y, Shiromizu T, Nishimura Y, Kasai T, Takeda M, Kobayashi H, Inagaki Y, Tanaka Y, Makinodan M, Kishimoto T, Kuniyasu H, Nagamori S, Muotri AR, Shin JW, Sugie K, Mori E.
In-Text Gene Mentions
Results)
…1998 ), andSOX6, important for…
Show Full Abstract
The brainstem is a posterior region of the brain, composed of three parts, midbrain, pons, and medulla oblongata. It is critical in controlling heartbeat, blood pressure, and respiration, all of which are life-sustaining functions, and therefore, damages to or disorders of the brainstem can be lethal. Brain organoids derived from human pluripotent stem cells (hPSCs) recapitulate the course of human brain development and are expected to be useful for medical research on central nervous system disorders. However, existing organoid models are limited in the extent hPSCs recapitulate human brain development and hence are not able to fully elucidate the diseases affecting various components of the brain such as brainstem. Here, we developed a method to generate human brainstem organoids (hBSOs), containing midbrain/hindbrain progenitors, noradrenergic and cholinergic neurons, dopaminergic neurons, and neural crest lineage cells. Single-cell RNA sequence (scRNA-seq) analysis, together with evidence from proteomics and electrophysiology, revealed that the cellular population in these organoids was similar to that of the human brainstem, which raises the possibility of making use of hBSOs in investigating central nervous system disorders affecting brainstem and in efficient drug screenings.
Also flagged:pathogenesiscoronary heart diseasestrokeinflammatory responsedeficiencyblood stasis syndromes
Journal Article2020-06-26No SnippetsZhai X, Wang X, Wang L, Xiu L, Wang W, Pang X.
Show Full Abstract
<h4>Introduction</h4>The fundamental theory of traditional Chinese medicine (TCM) implies that when different diseases have the same pathogen, the syndromes of these individual diseases will be the same. "Treating different diseases with the same method" is a TCM principle suggesting that when different diseases have similar pathological changes during different stages of their development, the same method of treatment can be applied. Our study aims to analyze the concept "treating different diseases with the same method" from a molecular perspective, in order to clarify its biological basis and to objectively standardize future TCM syndrome research.<h4>Objective</h4>The TCM syndromes Qi deficiency and blood stasis have similar pathogenesis in relation to coronary heart disease (CHD) and stroke. We aim to use big data technology and complex network theory to mine the genes specifically relevant to these TCM syndromes. This study aims to explore the correlation between the biological indicators of CHD and stroke from a scientific perspective.<h4>Methods</h4>Mining the relevant neuroendocrine-immune (NEI) genes by means of gene entity recognition, complex network construction, network integration, and decomposition to categorize relevant syndrome terms and establish a digital dictionary of gene specifically related to individual diseases. We analyzed the biological basis of "treating different diseases with the same method" from a molecular level using the TCMIP v2.0 platform in order to categorize the TCM syndromes most relevant to CHD and stroke.<h4>Results</h4>We found 46 genes were involved in the TCM syndromes of Qi deficiency and blood stasis of CHD and stroke. The same genes and their molecular mechanism also appeared to be in close relation to inflammatory response, apoptosis, and proliferation.<h4>Conclusion</h4>By using information extraction and complex network technology, we discovered the biological indicators of the TCM syndromes Qi deficiency and blood stasis of CHD and stroke. In the era of big data, our results can provide a new method for the researchers of TCM syndrome differentiation, as well as an effective and specific methodology for standardization of TCM.
Also flagged:DEAD-Box Helicasesolid tumortumorosteosarcomaDDX56Gene Expression
Journal Article2020-06-26No SnippetsZhu C, Zhang X, Kourkoumelis N, Shen Y, Huang W.
Show Full Abstract
<b>Background:</b> Osteosarcoma is a solid tumor common in the musculoskeletal system. The DEAD-box helicase (DDX) families play an important role in tumor genesis and proliferation. <b>Objective:</b>To screen potential molecular targets in osteosarcoma and elucidate its relationship with DDX56. <b>Methods:</b> We employed the Gene Expression Omnibus and The Cancer Genome Atlas datasets for preliminary screening. DDX56 expression was measured by RT-qPCR in three osteosarcoma cell lines. Biological roles of DDX56 were explored by Gene ontology, Kyoto Encyclopedia of Genes and Genomes and Ingenuity Pathway Analysis. Cell proliferation, cycle, and apoptosis assays were performed using Lentivirus™ knockdown technique. <b>Results:</b> It was found that DDX56 expression was regularly upregulated in osteosarcoma tissue and cell lines, while DDX56 knockdown inhibited cell proliferation and promoted cell apoptosis. <b>Conclusions:</b> The findings suggest DDX56 as a potential therapeutic target for the treatment of osteosarcoma.
Also flagged:Yes-associated proteincell proliferationCNS diseasesCentral Nervous System DiseaseswtsSTE20-like protein kinase 1
Journal Article2020-06-26No SnippetsJin J, Zhao X, Fu H, Gao Y.
Show Full Abstract
Yes-associated protein (YAP) is a key effector downstream of the Hippo signaling pathway and plays an important role in the development of the physiology and pathology of the central nervous system (CNS), especially regulating cell proliferation, differentiation, migration, and apoptosis. However, the roles and underlying mechanisms of YAP in CNS diseases are still puzzling. Here, this review will systematically and comprehensively summarize the biological feature, pathological role, and underlying mechanisms of YAP in normal and pathologic CNS, which aims to provide insights into the potential molecular targets and new therapeutic strategies for CNS diseases.
Also flagged:Ferroptosisdeathironlipidperoxidesrespiratory disease
Journal Article2020-06-26✓ 1 SnippetTao N, Li K, Liu J.
In-Text Gene Mentions
Introduction)
…anolamine-binding protein 1- (PEBP1-) involved regulatory pathway…
Show Full Abstract
Ferroptosis is a new mode of cell death that is characterized by the excessive accumulation of iron and lipid peroxides. It has unique morphological changes and disparate biochemical features and plays an intricate role in many pathophysiological processes. A great deal of researches confirms that ferroptosis can be regulated by numerous molecules through different mechanisms, supporting great potentials for novel pharmacological therapeutics. Recently, several studies reveal that ferroptosis is also closely associated with the initiation and development of respiratory disease. Understanding the specific mechanism, the molecular trait of ferroptosis and their relationship with pulmonary disease could provide significant references regarding effective treatment of these obstinate disease.
Also flagged:Ironiron-related disordersblood-transport proteinsfereneiron deficiencymembranes
Journal Article2020-06-26✓ 2 SnippetsSerhan M, Jackemeyer D, Long M, Sprowls M, Diez Perez I, Maret W, Chen F, Tao N, Forzani E.
In-Text Gene Mentions
Introduction)
…inheriting the so-calledhemochromatosisgenes from both…
Introduction)
…overload thereby leavinghemochromatosisas a disorder…
Show Full Abstract
<i>Background</i>: Abnormally low or high blood iron levels are common health conditions worldwide and can seriously affect an individual's overall well-being. A low-cost point-of-care technology that measures blood iron markers with a goal of both preventing and treating iron-related disorders represents a significant advancement in medical care delivery systems. <i>Methods:</i> A novel assay equipped with an accurate, storable, and robust dry sensor strip, as well as a smartphone mount and (iPhone) app is used to measure total iron in human serum. The sensor strip has a vertical flow design and is based on an optimized chemical reaction. The reaction strips iron ions from blood-transport proteins, reduces Fe(III) to Fe(II), and chelates Fe(II) with ferene, with the change indicated by a blue color on the strip. The smartphone mount is robust and controls the light source of the color reading App, which is calibrated to obtain output iron concentration results. The real serum samples are then used to assess iron concentrations from the new assay, and validated through intra-laboratory and inter-laboratory experiments. The intra-laboratory validation uses an optimized iron detection assay with multi-well plate spectrophotometry. The inter-laboratory validation method is performed in a commercial testing facility (LabCorp). <i>Results</i>: The novel assay with the dry sensor strip and smartphone mount, and App is seen to be sensitive to iron detection with a dynamic range of 50 - [Formula: see text]/dL, sensitivity of 0.00049 a.u/[Formula: see text]/dL, coefficient of variation (CV) of 10.5%, and an estimated detection limit of [Formula: see text]/dL These analytical specifications are useful for predicting iron deficiency and overloads. The optimized reference method has a sensitivity of 0.00093 a.u/[Formula: see text]/dL and CV of 2.2%. The correlation of serum iron concentrations (N = 20) between the optimized reference method and the novel assay renders a slope of 0.95, and a regression coefficient of 0.98, suggesting that the new assay is accurate. Last, a spectrophotometric study of the iron detection reaction kinetics is seen to reveal the reaction order for iron and chelating agent. <i>Conclusion:</i> The new assay is able to provide accurate results in intra- and inter- laboraty validations, and has promising features of both mobility and low-cost manufacturing suitable for global healthcare settings.
medRxiv2020-06-26Preprint (No Snippets API)Johnston KJ, Ward J, Ray PR, Adams MJ, McIntosh AM, Smith BH, Strawbridge RJ, Price TJ, Smith DJ, Nicholl BI, Bailey ME.
Show Full Abstract
Chronic pain is highly prevalent worldwide and imparts significant socioeconomic and public health burden and is more prevalent in women than in men. Factors that influence susceptibility and mechanisms of chronic pain development, are not fully understood. To investigate sex differences in chronic pain, we carried out a sex-stratified genome-wide association study of Multisite Chronic Pain (MCP), a derived chronic pain phenotype in UK Biobank. Genetic correlations between MCP in each sex and a range of psychiatric, autoimmune, and anthropometric phenotypes were examined. The relationship between female and male MCP, and chronic widespread pain was investigated using polygenic risk scoring. Expression of sex-specific MCP-associated loci in a range of tissues was examined using GTEx, and separately in neural and non-neural human tissues with assessment for dorsal-root ganglion (DRG) enrichment. For genes enriched for neural-tissue expression the full GTEx database was queried for sex-differential gene expression in CNS regions, and for high expression in sex-specific tissues. Expression in neural mouse tissue was also examined for orthologs of these genes. A total of 123 SNPs at five independent loci were significantly associated with MCP in men. In women, a total of 286 genome-wide significant SNPs at ten independent loci were discovered. Meta-analysis of sex-stratified GWAS output found 87 independent SNPs to be significantly associated with MCP. We found sex-specific MCP-associated genes, with 31 genes and 37 genes associated with female and male MCP respectively and one gene associated with MCP in both sexes ( DCC ). We found evidence for sex-specific pleiotropy and risk for MCP was found to be associated with chronic widespread pain in a sex-differential manner. Male and female MCP were highly genetically correlated, but at r g significantly less than 1. All 37 male MCP-associated genes and all but one of 31 female MCP-associated genes were found to be expressed in the DRG, and many showed elevated expression in sex-specific tissues. Overall, findings indicate sex differences in chronic pain at the SNP, gene and transcriptomic level, and highlight possible sex-specific pleiotropy for MCP. Results support the proposition of a strong nervous-system component to chronic pain in both sexes, emphasise the importance of the DRG, and indicate specific loci which may play a specialised role in nociception.
Also flagged:Coagulopathyheat strokebacterial infectionpolyinosinic:polycytidylic acidlipopolysaccharideviral infection
Journal Article2020-06-25✓ 1 SnippetProctor EA, Dineen SM, Van Nostrand SC, Kuhn MK, Barrett CD, Brubaker DK, Yaffe MB, Lauffenburger DA, Leon LR.
In-Text Gene Mentions
Results)
…complex (TAT), antithrombin (ATIII), and soluble thrombomodulin…
Show Full Abstract
<h4>Background</h4>Immune challenge is known to increase heat stroke risk, although the mechanism of this increased risk is unclear.<h4>Objectives</h4>We sought to understand the effect of immune challenge on heat stroke pathology.<h4>Patients/methods</h4>Using a mouse model of classic heat stroke, we examined the impact of prior viral or bacterial infection on hematological aspects of recovery. Mice were exposed to heat either 48 or 72 hours following polyinosinic:polycytidylic acid (poly I:C) or lipopolysaccharide injection, time points when symptoms of illness (fever, lethargy, anorexia) were minimized or completely absent.<h4>Results</h4>Employing multivariate supervised machine learning to identify patterns of molecular and cellular markers associated with heat stroke, we found that prior viral infection simulated with poly I:C injection resulted in heat stroke presenting with high levels of factors indicating coagulopathy. Despite a decreased number of platelets in the blood, platelets are large and non-uniform in size, suggesting younger, more active platelets. Levels of D-dimer and soluble thrombomodulin were increased in more severe heat stroke, and in cases of the highest level of organ damage markers D-dimer levels dropped, indicating potential fibrinolysis-resistant thrombosis. Genes corresponding to immune response, coagulation, hypoxia, and vessel repair were up-regulated in kidneys of heat-challenged animals; these correlated with both viral treatment and distal organ damage while appearing before discernible tissue damage to the kidney itself.<h4>Conclusions</h4>Heat stroke-induced coagulopathy may be a driving mechanistic force in heat stroke pathology, especially when exacerbated by prior infection. Coagulation markers may serve as accessible biomarkers for heat stroke severity and therapeutic strategies.
Also flagged:autophagyinflammatory responseAIEC infectionsecretionK12ATG5
Journal Article2020-06-25No SnippetsLarabi A, Dalmasso G, Delmas J, Barnich N, Nguyen HTT.
Show Full Abstract
Adherent-invasive <i>E. coli</i> (AIEC), which abnormally colonize the intestinal mucosa of Crohn's disease (CD) patients, are able to adhere to and invade intestinal epithelial cells (IECs), survive and replicate within macrophages and induce a pro-inflammatory response. AIEC infection of IECs induces secretion of exosomes that increase AIEC replication in exosome-receiving IECs and macrophages. Here, we investigated the mechanism underlying the increased AIEC replication in cells receiving exosomes from AIEC-infected cells. Exosomes released by uninfected human intestinal epithelial T84 cells (Exo-uninfected) or by T84 cells infected with the clinical AIEC LF82 strain (Exo-LF82), the nonpathogenic <i>E. coli</i> K12 strain (Exo-K12) or the commensal <i>E. coli</i> HS strain (Exo-HS) were purified and used to stimulate T84 cells. Stimulation of T84 cells with Exo-LF82 inhibited autophagy compared with Exo-uninfected, Exo-K12 and Exo-HS. qRT-PCR analysis revealed increased levels of miR-30c and miR-130a in Exo-LF82 compared to Exo-uninfected, Exo-K12 and Exo-HS. These miRNAs were transferred <i>via</i> exosomes to recipient cells, in which they targeted and inhibited ATG5 and ATG16L1 expression and thereby autophagy response, thus favoring AIEC intracellular replication. Inhibition of these miRNAs in exosome-donor cells infected with AIEC LF82 abolished the increase in miR-30c and miR-130a levels in the released Exo-LF82 and in Exo-LF82-receiving cells, thus suppressing the inhibitory effect of Exo-LF82 on ATG5 and ATG16L1 expression and on autophagy-mediated AIEC clearance in Exo-LF82-receiving cells. Our study shows that upon AIEC infection, IECs secrete exosomes that can transfer specific miRNAs to recipient IECs, inhibiting autophagy-mediated clearance of intracellular AIEC.
Also flagged:Antibodyinfectionimmune responsepolymeraseIgGantibodies
Journal Article2020-06-25No SnippetsDeeks JJ, Dinnes J, Takwoingi Y, Davenport C, Spijker R, Taylor-Phillips S, Adriano A, Beese S, Dretzke J, Ferrante di Ruffano L, Harris IM, Price MJ, Dittrich S, Emperador D, Hooft L, Leeflang MM, Van den Bruel A, Cochrane COVID-19 Diagnostic Test Accuracy Group.
Show Full Abstract
<h4>Background</h4>The severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus and resulting COVID-19 pandemic present important diagnostic challenges. Several diagnostic strategies are available to identify current infection, rule out infection, identify people in need of care escalation, or to test for past infection and immune response. Serology tests to detect the presence of antibodies to SARS-CoV-2 aim to identify previous SARS-CoV-2 infection, and may help to confirm the presence of current infection.<h4>Objectives</h4>To assess the diagnostic accuracy of antibody tests to determine if a person presenting in the community or in primary or secondary care has SARS-CoV-2 infection, or has previously had SARS-CoV-2 infection, and the accuracy of antibody tests for use in seroprevalence surveys.<h4>Search methods</h4>We undertook electronic searches in the Cochrane COVID-19 Study Register and the COVID-19 Living Evidence Database from the University of Bern, which is updated daily with published articles from PubMed and Embase and with preprints from medRxiv and bioRxiv. In addition, we checked repositories of COVID-19 publications. We did not apply any language restrictions. We conducted searches for this review iteration up to 27 April 2020.<h4>Selection criteria</h4>We included test accuracy studies of any design that evaluated antibody tests (including enzyme-linked immunosorbent assays, chemiluminescence immunoassays, and lateral flow assays) in people suspected of current or previous SARS-CoV-2 infection, or where tests were used to screen for infection. We also included studies of people either known to have, or not to have SARS-CoV-2 infection. We included all reference standards to define the presence or absence of SARS-CoV-2 (including reverse transcription polymerase chain reaction tests (RT-PCR) and clinical diagnostic criteria).<h4>Data collection and analysis</h4>We assessed possible bias and applicability of the studies using the QUADAS-2 tool. We extracted 2x2 contingency table data and present sensitivity and specificity for each antibody (or combination of antibodies) using paired forest plots. We pooled data using random-effects logistic regression where appropriate, stratifying by time since post-symptom onset. We tabulated available data by test manufacturer. We have presented uncertainty in estimates of sensitivity and specificity using 95% confidence intervals (CIs).<h4>Main results</h4>We included 57 publications reporting on a total of 54 study cohorts with 15,976 samples, of which 8526 were from cases of SARS-CoV-2 infection. Studies were conducted in Asia (n = 38), Europe (n = 15), and the USA and China (n = 1). We identified data from 25 commercial tests and numerous in-house assays, a small fraction of the 279 antibody assays listed by the Foundation for Innovative Diagnostics. More than half (n = 28) of the studies included were only available as preprints. We had concerns about risk of bias and applicability. Common issues were use of multi-group designs (n = 29), inclusion of only COVID-19 cases (n = 19), lack of blinding of the index test (n = 49) and reference standard (n = 29), differential verification (n = 22), and the lack of clarity about participant numbers, characteristics and study exclusions (n = 47). Most studies (n = 44) only included people hospitalised due to suspected or confirmed COVID-19 infection. There were no studies exclusively in asymptomatic participants. Two-thirds of the studies (n = 33) defined COVID-19 cases based on RT-PCR results alone, ignoring the potential for false-negative RT-PCR results. We observed evidence of selective publication of study findings through omission of the identity of tests (n = 5). We observed substantial heterogeneity in sensitivities of IgA, IgM and IgG antibodies, or combinations thereof, for results aggregated across different time periods post-symptom onset (range 0% to 100% for all target antibodies). We thus based the main results of the review on the 38 studies that stratified results by time since symptom onset. The numbers of individuals contributing data within each study each week are small and are usually not based on tracking the same groups of patients over time. Pooled results for IgG, IgM, IgA, total antibodies and IgG/IgM all showed low sensitivity during the first week since onset of symptoms (all less than 30.1%), rising in the second week and reaching their highest values in the third week. The combination of IgG/IgM had a sensitivity of 30.1% (95% CI 21.4 to 40.7) for 1 to 7 days, 72.2% (95% CI 63.5 to 79.5) for 8 to 14 days, 91.4% (95% CI 87.0 to 94.4) for 15 to 21 days. Estimates of accuracy beyond three weeks are based on smaller sample sizes and fewer studies. For 21 to 35 days, pooled sensitivities for IgG/IgM were 96.0% (95% CI 90.6 to 98.3). There are insufficient studies to estimate sensitivity of tests beyond 35 days post-symptom onset. Summary specificities (provided in 35 studies) exceeded 98% for all target antibodies with confidence intervals no more than 2 percentage points wide. False-positive results were more common where COVID-19 had been suspected and ruled out, but numbers were small and the difference was within the range expected by chance. Assuming a prevalence of 50%, a value considered possible in healthcare workers who have suffered respiratory symptoms, we would anticipate that 43 (28 to 65) would be missed and 7 (3 to 14) would be falsely positive in 1000 people undergoing IgG/IgM testing at days 15 to 21 post-symptom onset. At a prevalence of 20%, a likely value in surveys in high-risk settings, 17 (11 to 26) would be missed per 1000 people tested and 10 (5 to 22) would be falsely positive. At a lower prevalence of 5%, a likely value in national surveys, 4 (3 to 7) would be missed per 1000 tested, and 12 (6 to 27) would be falsely positive. Analyses showed small differences in sensitivity between assay type, but methodological concerns and sparse data prevent comparisons between test brands.<h4>Authors' conclusions</h4>The sensitivity of antibody tests is too low in the first week since symptom onset to have a primary role for the diagnosis of COVID-19, but they may still have a role complementing other testing in individuals presenting later, when RT-PCR tests are negative, or are not done. Antibody tests are likely to have a useful role for detecting previous SARS-CoV-2 infection if used 15 or more days after the onset of symptoms. However, the duration of antibody rises is currently unknown, and we found very little data beyond 35 days post-symptom onset. We are therefore uncertain about the utility of these tests for seroprevalence surveys for public health management purposes. Concerns about high risk of bias and applicability make it likely that the accuracy of tests when used in clinical care will be lower than reported in the included studies. Sensitivity has mainly been evaluated in hospitalised patients, so it is unclear whether the tests are able to detect lower antibody levels likely seen with milder and asymptomatic COVID-19 disease. The design, execution and reporting of studies of the accuracy of COVID-19 tests requires considerable improvement. Studies must report data on sensitivity disaggregated by time since onset of symptoms. COVID-19-positive cases who are RT-PCR-negative should be included as well as those confirmed RT-PCR, in accordance with the World Health Organization (WHO) and China National Health Commission of the People's Republic of China (CDC) case definitions. We were only able to obtain data from a small proportion of available tests, and action is needed to ensure that all results of test evaluations are available in the public domain to prevent selective reporting. This is a fast-moving field and we plan ongoing updates of this living systematic review.
Also flagged:EEPD1reproductiongene expressioncastrationMYH1MYH4
Journal Article2020-06-25✓ 1 SnippetLi Y, Wang M, Li Q, Gao Y, Li Q, Li J, Cao Y.
In-Text Gene Mentions
Results)
…, MYH1 ,PLCL1, SLC6A1 ,…
Show Full Abstract
Previous research regarding Holstein cows has mainly focused on increasing milk yield. However, in order to maximize the economical profits of Holstein cattle farming, it is necessary to fully take advantage of Holstein bulls to produce high-grade beef. The present study aims to investigate different transcriptomic profiling of Holstein bulls and steers, via high-throughput RNA-sequencing (RNA-seq). The growth and beef quality traits of Holstein steers and bulls were characterized via assessment of weight, rib eye area, marbling score, shear force and intramuscular fat percentage of the longissimus lumborum (LL) muscle. The results indicated that castration improved the meat quality, yet reduced the meat yield. Subsequently, RNA-seq of the LL muscle from Holstein steers and bulls revealed a total of 56 differentially expressed genes (DEGs). We performed the functional enrichment analysis in Gene Ontology (GO) annotations of the DEGs using GOseq R package software and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis using KOBAS tool. Through the integrated analysis of DEGs with reported QTLs and SNPs, seven promising candidate genes potentially affecting the beef quality of LL muscle following castration were discovered, including muscle structural protein coding genes (MYH1, MYH4, MYH10) and functional protein coding genes (GADL1, CYP2R1, EEPD1, SHISA3). Among them, MYH10, GADL1, CYP2R1, EEPD1 and SHISA3 were novel candidate genes associated with beef quality traits. Notably, EEPD1 was associated with both meat quality and reproduction traits, thus indicating its overlapping role in responding to hormone change, and subsequently inducing beef quality improvement. Our findings provide a complete dataset of gene expression profile of LL in Holstein bulls and steers, and will aid in understanding how castration influence meat yield and quality.
Also flagged:CalciumAmino acidisoindolinesisoindoline-contractionvoltage-dependent calcium channels
Journal Article2020-06-25No SnippetsDe La Rosa JAM, García-Castañeda M, Nishigaki T, Gómora JC, Mancilla-Percino T, Ávila G.
Show Full Abstract
Amino acid-derived isoindolines are synthetic compounds that were created with the idea of investigating their biological actions. The amino acid moiety was included on the grounds that it may help to avoid toxic effects. Recently, the isoindoline MDIMP was shown to inhibit both cardiac excitation-contraction coupling and voltage-dependent calcium channels. Here, we revealed that MDIMP binds preferentially to low-voltage-activated (LVA) channels. Using a holding potential of -90 mV, the following IC<sub>50</sub> values were found (in micromolars): >1000 (Ca<sub>V</sub>2.3), 957 (Ca<sub>V</sub>1.3), 656 (Ca<sub>V</sub>1.2), 219 (Ca<sub>V</sub>3.2), and 132 (Ca<sub>V</sub>3.1). Moreover, the isoindoline also promoted both accelerated inactivation kinetics of high-voltage-activated Ca<sup>2+</sup> channels and a modest upregulation of Ca<sub>V</sub>1.3 and Ca<sub>V</sub>2.3. Additional data indicate that although MDIMP binds to the closed state of the channels, it has more preference for the inactivated one. Concerning Ca<sub>V</sub>3.1, the compound did not alter the shape of the instantaneous current-voltage curve, and substituting one or two residues in the selectivity filter drastically increased the IC<sub>50</sub> value, suggesting that MDIMP binds to the extracellular side of the pore. However, an outward current failed in removing the inhibition, which implies an alternative mechanism may be involved. The enantiomer (<i>R</i>)-MDIMP [methyl (<i>R</i>)-2-(1,3-dihydroisoindol-2-yl)-4-methylpentanoate], on the other hand, was synthesized and evaluated, but it did not improve the affinity to LVA channels. Implications of these findings are discussed in terms of the possible underlying mechanisms and pharmacological relevance. SIGNIFICANCE STATEMENT: We have studied the regulation of voltage-gated calcium channels by MDIMP, which disrupts excitation-contraction coupling in cardiac myocytes. The latter effect is more potent in atrial than ventricular myocytes, and this could be explained by our results showing that MDIMP preferentially blocks low-voltage-activated channels. Our data also provide mechanistic insights about the blockade and suggest that MDIMP is a promising member of the family of Ca<sup>2+</sup> channel blockers, with possible application to the inhibition of subthreshold membrane depolarizations.
Also flagged:ironbeta thalassemiaHAMPHepcidinthalassemiairon regulatory proteins
Journal Article2020-06-25✓ 5 SnippetsShah M, Danish L, Khan NU, Zaman F, Ismail M, Hussain M, Pervaiz R, Iqbal A.
In-Text Gene Mentions
S I O 001029)
…We studied the presence of G71D mutation of HAMP gene and H63D mutation of HFE gene in beta thalassemia major and minor group to check the association of these mutations with serum ferritin level of beta thalassemia patients.…
I A O 0000615)
…The G71D and H63D mutation of HAMP and HFE gene are frequently found in beta thalassemia major patients.…
Introduction)
…The low expression level of Hepcidin is usually seen whether there is mutation in HAMP gene or a gene named Hemochromatosis (HFE), that codes for HFE protein in case of HFE disease (Le Gac & Férec, 2005).…
Abstract)
…The aim of this research work was to study the presence of G71D mutation of HAMP gene and H63D mutation of HFE gene in beta thalassemia major and minor group to check the association of these mutations with serum ferritin level of beta thalassemia patients.…
Abstract)
…Mutation in either HAMP gene or HFE gene causes Hepcidin protein deficiency that can lead to iron overload in beta thalassemia patients.…
Show Full Abstract
<h4>Background</h4>Hepcidin and hemochromatosis (HFE) are iron regulatory proteins that are encoded by HAMP and HFE genes. Mutation in either HAMP gene or HFE gene causes Hepcidin protein deficiency that can lead to iron overload in beta thalassemia patients. The aim of this research work was to study the presence of G71D mutation of HAMP gene and H63D mutation of HFE gene in beta thalassemia major and minor group to check the association of these mutations with serum ferritin level of beta thalassemia patients.<h4>Methods</h4>The study was conducted on 42 beta thalassemia major and 20 beta thalassemia minor samples along with 20 control samples. The genotyping of both mutations has done by ARM-PCR technique with specific set of primers.<h4>Results</h4>Significant effect of G71D and H63D mutations was observed on serum ferritin level of thalassemia major group. The risk allele of HAMP G71D and HFE H63D was found with high frequency (48% and 49%, respectively) in beta thalassemia major than in control group. High genotypic frequency of HAMP and HFE gene mutation gene mutation was observed in beta thalassemia major than beta thalassemia minor and control group (7% and 9%, respectively).<h4>Conclusion</h4>It can be concluded that both HAMP and HFE gene mutations show high frequency in beta thalassemia major patients and mean significant association between mutations and high serum ferritin level of beta thalassemia major patients but the nonsignificant results of Odd ratios showed that both mutations do not act as major risk factor in beta thalassemia major.
Also flagged:schizophreniabrain developmentneurological disordersautismmethylationregulation of neuronal synaptic plasticity
Journal Article2020-06-25✓ 1 SnippetStroud H, Yang MG, Tsitohay YN, Davis CP, Sherman MA, Hrvatin S, Ling E, Greenberg ME.
In-Text Gene Mentions
Text
…Sox6…
Show Full Abstract
The maturation of the mammalian brain occurs after birth, and this stage of neuronal development is frequently impaired in neurological disorders, such as autism and schizophrenia. However, the mechanisms that regulate postnatal brain maturation are poorly defined. By purifying neuronal subpopulations across brain development in mice, we identify a postnatal switch in the transcriptional regulatory circuits that operates in the maturing mammalian brain. We show that this developmental transition includes the formation of hundreds of cell-type-specific neuronal enhancers that appear to be modulated by neuronal activity. Once selected, these enhancers are active throughout adulthood, suggesting that their formation in early life shapes neuronal identity and regulates mature brain function.
Also flagged:FAN1Huntington diseaseHDbindingmitomycin Camino acid
Journal Article2020-06-25No SnippetsKim KH, Hong EP, Shin JW, Chao MJ, Loupe J, Gillis T, Mysore JS, Holmans P, Jones L, Orth M, Monckton DG, Long JD, Kwak S, Lee R, Gusella JF, MacDonald ME, Lee JM.
Show Full Abstract
A recent genome-wide association study of Huntington disease (HD) implicated genes involved in DNA maintenance processes as modifiers of onset, including multiple genome-wide significant signals in a chr15 region containing the DNA repair gene Fanconi-Associated Nuclease 1 (FAN1). Here, we have carried out detailed genetic, molecular, and cellular investigation of the modifiers at this locus. We find that missense changes within or near the DNA-binding domain (p.Arg507His and p.Arg377Trp) reduce FAN1's DNA-binding activity and its capacity to rescue mitomycin C-induced cytotoxicity, accounting for two infrequent onset-hastening modifier signals. We also idenified a third onset-hastening modifier signal whose mechanism of action remains uncertain but does not involve an amino acid change in FAN1. We present additional evidence that a frequent onset-delaying modifier signal does not alter FAN1 coding sequence but is associated with increased FAN1 mRNA expression in the cerebral cortex. Consistent with these findings and other cellular overexpression and/or suppression studies, knockout of FAN1 increased CAG repeat expansion in HD-induced pluripotent stem cells. Together, these studies support the process of somatic CAG repeat expansion as a therapeutic target in HD, and they clearly indicate that multiple genetic variations act by different means through FAN1 to influence HD onset in a manner that is largely additive, except in the rare circumstance that two onset-hastening alleles are present. Thus, an individual's particular combination of FAN1 haplotypes may influence their suitability for HD clinical trials, particularly if the therapeutic agent aims to reduce CAG repeat instability.
Also flagged:neurodegenerative diseasesHDpathogenesismovement disordersbehavioralsynaptic connections
Journal Article2020-06-25No SnippetsWilton DK, Stevens B.
Show Full Abstract
Glial cells play critical roles in the normal development and function of neural circuits, but in many neurodegenerative diseases, they become dysregulated and may contribute to the development of brain pathology. In Huntington's disease (HD), glial cells both lose normal functions and gain neuropathic phenotypes. In addition, cell-autonomous dysfunction elicited by mutant huntingtin (mHTT) expression in specific glial cell types is sufficient to induce both pathology and Huntington's disease-related impairments in motor and cognitive performance, suggesting that these cells may drive the development of certain aspects of Huntington's disease pathogenesis. In support of this imaging studies in pre-symptomatic HD patients and work on mouse models have suggested that glial cell dysfunction occurs at a very early stage of the disease, prior to the onset of motor and cognitive deficits. Furthermore, selectively ablating mHTT from specific glial cells or correcting for HD-induced changes in their transcriptional profile rescues some HD-related phenotypes, demonstrating the potential of targeting these cells for therapeutic intervention. Here we review emerging research focused on understanding the involvement of different glial cell types in specific aspects of HD pathogenesis. This work is providing new insight into how HD impacts biological functions of glial cells in the healthy brain as well as how HD induced dysfunction in these cells might change the way they integrate into biological circuits.
Journal Article2020-06-25✓ 1 SnippetSarkar S, Tsuchida Y, Diab R, Xu C, Yermalitsky V, Davies SS, Ikizler TA, Hung AM, Kon V, Flynn CR.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>Individuals with non-alcoholic fatty liver disease (NAFLD), which includes non-alcoholic steatohepatitis (NASH), are at increased risk for cardiovascular events, independent of traditional risk factors. Limited data on pro-inflammatory high density lipoprotein (HDL) in NASH exists in the literature. We hypothesized that HDL from individuals with NASH would be more pro-inflammatory than HDL from individuals without NASH.<h4>Methods</h4>Study participants were individuals with obesity who had undergone bariatric surgery with wedge liver biopsy. Using HDL isolated from serum obtained from study participants at the time of surgery, HDL-elicited macrophage cytokine expression (TNF-α, IL-1β, and IL-6) from THP-1 macrophages, HDL-associated receptor expression (ABCA1 and ABCG1) from apolipoprotein E deficient (apo E<sup>-/-</sup>) mouse peritoneal macrophages, and isolevuglandin (isoLG) modified HDL were measured.<h4>Results</h4>11 women with NASH and 15 women without NASH were included in the study. Both TNF-α (P = 0.032) and IL-1β (P = 0.029) were significantly more expressed by THP-1 macrophages exposed to HDL from women with NASH compared to women without NASH. ABCA1 and ABCG1 expression by apo E<sup>-/-</sup> mouse peritoneal macrophages was not significantly different when exposed to HDL from either women with NASH or women without NASH. IsoLG-modified HDL isolated from the serum of women with NASH trended higher than women without NASH.<h4>Conclusion</h4>Our study suggests a more pro-inflammatory HDL in women with obesity and NASH compared to women with obesity and without NASH.
Also flagged:azetidinoneazetidinonesarylaldehydesSchiff basethiazolidinone
Journal Article2020-06-25No SnippetsHussein EM, Alsantali RI, Morad M, Obaid RJ, Altass HM, Sayqal A, Abourehab MAS, Elkhawaga AA, Aboraia ASM, Ahmed SA.
Show Full Abstract
<h4>Background</h4>Thiazoles, thiazolidinones and azetidinones are highly ranked amongst natural and synthetic heterocyclic derivatives due to their great pharmaceutical potential.<h4>Results</h4>New thiazolidinone and azetidinone class of bioactive agents based on 4-(2,7-dichloro-9<i>H</i>-fluoren-4-yl)thiazole moiety have been successfully synthesized. 4-(2,7-dichloro-9<i>H</i>-fluoren-4-yl)thiazol-2-amine was synthesized and allowed to react with various aryl/heteroaryl aldehydes to afford the corresponding Schiff base intermediates. The target thiazolidinone and azetidinone analogues have derived from Schiff bases by their reactions with thioglycolic acid and chloroacetyl chloride, respectively. The newly synthesized compounds were then evaluated for their antimicrobial activity against some multidrug resistant strains and examined for cytotoxic activity against normal lung fibroblast (WI-38), human lung carcinoma (A549), and human breast carcinoma (MDA-MB-231) cell lines to develop a novel class of fluorene-based bioactive agents. The mode of action and the binding interaction of the synthesized compound with the active sites of dihydrofolate reductase enzyme were well identified by fluorescence-activated cell sorting (FACS) analysis and molecular docking study.<h4>Conclusion</h4>Some of the synthesized compounds showed remarkable activity against A-549 and MDA-MB-231 when compared to Taxol, which was used as a reference drug. 2,7-dichloro-9<i>H</i>-fluorene-based azetidinones are more efficient as antimicrobial and anticancer agents compared to dichloro-9<i>H</i>-fluorene-based thiazolidinones derivatives.
…Netrin receptors have been expressed in developing retina and Netrin-neogenin signaling, which might stimulate retinal ganglion cell axon growth into and along the optic nerve.20,21 Netrin-1/UNC5B may activate retinal vessel development and they can stimulate pro-angiogenesis.22 The guidance of retinal ganglion cell axons through the optic disc is dependent on the DCC/Netrin-1 axonal guidance system.21 Furthermore, netrin-1 contributes to steering axons out of the retina.23 Under hypoxic conditions, the Netrin-1 level increases and it might be a key factor in inducing retinal neovascularization.25,26 Retinal neovascularization is the major pathological condition of several diseases including diabetic retinopathy, retinal vein occlusion, and age-related macular degeneration.8,24,27 Netrin-1 promotes retinal angiogenesis in oxygen-induced retinopathy.28,29…
Diabetic retinopathy (DR) is a retinal vascular disorder associated with both type 1 and type 2 diabetes mellitus (DM). It is characterized by specific loss of pericytes, which leads to an augmented blood vessel permeability, and development of new blood vessels (retinal neovascularization). Moreover, stiffening of eye membrane, inflammation, and apoptosis of endothelial cells also lead to damage of the blood-retinal barrier and blindness in most cases unless it's detected and managed early. Hence, this review was intended to assess the potential roles of Netrin-1 and -4 as new/alternative biomarkers and therapeutic options for DR. Netrin-1 and -4 have been the most known ligands and are well known for their role in neural guidance. DR has both neural and vascular components; therefore, biomarkers used for both neural and vascular retinal tissues are potentially important. According to different experimental and clinical studies, as compared to the normal groups, there was a significant increment in both retinal Netrin-1 and -4 mRNA and protein levels in the retinopathy groups. In addition, exogenous supplementation of these proteins is also used as a therapeutic agent for DR.
Also flagged:acute myelocytic leukemiaAMLFAT2CAMK2ATCERG1GDF9
Journal Article2020-06-25✓ 5 SnippetsZhuang H, Chen Y, Sheng X, Hong L, Gao R, Zhuang X.
In-Text Gene Mentions
Discussion)
…9 out of 10 (PREX1, CAMK2A, DNTTIP1, CRISPLD1, PTGIS, GDF9, FAT2, DOC2B and TCERG1) genes are typically suggested as biomarkers in several cancers and show close correlations with multiple cancer prognoses, including in endometrial cancer, breast cancer (BC), ovarian cancer, lung cancer, oral cancer, and colorectal cancer (CRC) (Dillon & Miller, 2015; Chen et al., 2017; Sawai et al., 2018; Li et al., 2019; Singh, Chandra & Bapat, 2015; Du et al., 2012; Katoh, 2012; Satyamoorthy et al., 2014).…
<h4>Background</h4>Currently, acute myelocytic leukemia (AML) still has a poor prognosis. As a result, gene markers for predicting AML prognosis must be identified through systemic analysis of multi-omics data.<h4>Methods</h4>First of all, the copy number variation (CNV), mutation, RNA-Seq, and single nucleotide polymorphism (SNP) data, as well as those clinical follow-up data, were obtained based on The Cancer Genome Atlas (TCGA) database. Thereafter, all samples (<i>n</i> = 229) were randomized as test set and training set, respectively. Of them, the training set was used to screen for genes related to prognosis, and genes with mutation, SNP or CNV. Then, shrinkage estimate was used for feature selection of all the as-screened genes, to select those stable biomarkers. Eventually, a prognosis model related to those genes was established, and validated within the GEO verification (<i>n</i> = 124 and 72) and test set (<i>n</i> = 127). Moreover, it was compared with the AML prognosis prediction model reported in literature.<h4>Results</h4>Altogether 832 genes related to prognosis, 23 related to copy amplification, 774 associated with copy deletion, and 189 with significant genomic variations were acquired in this study. Later, genes with genomic variations and those related to prognosis were integrated to obtain 38 candidate genes; eventually, a shrinkage estimate was adopted to obtain 10 feature genes (including FAT2, CAMK2A, TCERG1, GDF9, PTGIS, DOC2B, DNTTIP1, PREX1, CRISPLD1 and C22orf42). Further, a signature was established using these 10 genes based on Cox regression analysis, and it served as an independent factor to predict AML prognosis. More importantly, it was able to stratify those external verification, test and training set samples with regard to the risk (<i>P</i> < 0.01). Compared with the prognosis prediction model reported in literature, the model established in this study was advantageous in terms of the prediction performance.<h4>Conclusion</h4>The signature based on 10 genes had been established in this study, which is promising to be used to be a new marker for predicting AML prognosis.
Journal Article2020-06-25No SnippetsTakahashi K, Fujiya M, Konishi H, Murakami Y, Iwama T, Sasaki T, Kunogi T, Sakatani A, Ando K, Ueno N, Kashima S, Moriichi K, Tanabe H, Okumura T.
Show Full Abstract
The oncogenic properties of heterogeneous nuclear ribonucleoprotein H1 (hnRNP H1) have been reported, although the tumor-promoting mechanism remains unclear. We herein report the mechanism underlying colorectal cancer cell progression mediated by hnRNP H1. The growth of colorectal cancer cells was suppressed by hnRNP H1 downregulation. A terminal deoxynucleotidyl transferase dUTP nick-end labeling assay revealed the anti-apoptotic effect of hnRNP H1 in colorectal cancer cells. An RNA immunoprecipitation assay revealed that hnRNP H1 bound to sphingosine-1-phosphate lyase 1 (SGPL1). Reverse transcription-polymerase chain reaction revealed the high expression of hnRNP H1 mRNA in colorectal cancer cells and Spearman's rank correlation coefficient showed a strong positive correlation between hnRNP H1 mRNA and SGPL1 mRNA. An siRNA of hnRNP H1 decreased SGPL1 mRNA expression in colorectal cancer cells, but not in non-tumorous cells. These findings suggested that hnRNP H1 increased SGPL1 mRNA expression specifically in cancer cells through direct binding. Targeted knockdown of hnRNP H1 or SGPL1 with siRNAs upregulated p53 phosphorylation and p53-associated molecules, resulting in cell growth inhibition, while hnRNP H1 upregulated the mRNA of SGPL1 and inhibited p53 activation, thereby promoting tumor cell growth. This is a novel mechanism underlying colorectal cancer cell progression mediated by hnRNP H1-SGPL1 mRNA stabilization.
Also flagged:Cellulosesynthesiswaternanofibrilscalcium phosphatefibrils
Journal Article2020-06-25No SnippetsPogorelova N, Rogachev E, Digel I, Chernigova S, Nardin D.
Show Full Abstract
Bacterial cellulose (BC) is a promising material for biomedical applications due to its unique properties such as high mechanical strength and biocompatibility. This article describes the microbiological synthesis, modification, and characterization of the obtained BC-nanocomposites originating from symbiotic consortium <i>Medusomyces gisevii</i>. Two BC-modifications have been obtained: BC-Ag and BC-calcium phosphate (BC-Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub>). Structure and physicochemical properties of the BC and its modifications were investigated by scanning electron microscopy (SEM), energy-dispersive X-ray spectroscopy (EDX), atomic force microscopy (AFM), and infrared Fourier spectroscopy as well as by measurements of mechanical and water holding/absorbing capacities. Topographic analysis of the surface revealed multicomponent thick fibrils (150-160 nm in diameter and about 15 µm in length) constituted by 50-60 nm nanofibrils weaved into a left-hand helix. Distinctive features of Ca-phosphate-modified BC samples were (a) the presence of 500-700 nm entanglements and (b) inclusions of Ca<sub>3</sub>(PO<sub>4</sub>)<sub>2</sub> crystals. The samples impregnated with Ag nanoparticles exhibited numerous roundish inclusions, about 110 nm in diameter. The boundaries between the organic and inorganic phases were very distinct in both cases. The Ag-modified samples also showed a prominent waving pattern in the packing of nanofibrils. The obtained BC gel films possessed water-holding capacity of about 62.35 g/g. However, the dried (to a constant mass) BC-films later exhibited a low water absorption capacity (3.82 g/g). It was found that decellularized BC samples had 2.4 times larger Young's modulus and 2.2 times greater tensile strength as compared to dehydrated native BC films. We presume that this was caused by molecular compaction of the BC structure.
Also flagged:MelatoninLiver CancerHepatocellular carcinomaindoleaminesleeprhythms
Journal Article2020-06-25✓ 1 SnippetElmahallawy EK, Mohamed Y, Abdo W, Yanai T.
In-Text Gene Mentions
Introduction)
…HCC such ashemochromatosisand alpha 1-antitrypsin…
Show Full Abstract
Hepatocellular carcinoma (HCC) is the most common hepatobiliary malignancy with limited therapeutic options. On the other hand, melatonin is an indoleamine that modulates a variety of potential therapeutic effects. In addition to its important role in the regulation of sleep-wake rhythms, several previous studies linked the biologic effects of melatonin to various substantial endocrine, neural, immune and antioxidant functions, among others. Furthermore, the effects of melatonin could be influenced through receptor dependent and receptor independent manner. Among the other numerous physiological and therapeutic effects of melatonin, controlling the survival and differentiation of mesenchymal stem cells (MSCs) has been recently discussed. Given its controversial interaction, several previous reports revealed the therapeutic potential of MSCs in controlling the hepatocellular carcinoma (HCC). Taken together, the intention of the present review is to highlight the effects of melatonin and mesenchymal stem cells as a key for functional integrity for liver cancer treatment. We hope to provide solid piece of information that may be helpful in designing novel drug targets to control HCC.
Also flagged:saltwaterinsulinantibodyoligonucleotideformation
Journal Article2020-06-25No SnippetsShi N, Easley CJ.
Show Full Abstract
While droplet-based microfluidics is a powerful technique with transformative applications, most devices are passively operated and thus have limited real-time control over droplet contents. In this report, an automated droplet-based microfluidic device with pneumatic pumps and salt water electrodes was developed to generate and coalesce up to six aqueous-in-oil droplets (2.77 nL each). Custom control software combined six droplets drawn from any of four inlet reservoirs. Using our μChopper method for lock-in fluorescence detection, we first accomplished continuous linear calibration and quantified an unknown sample. Analyte-independent signal drifts and even an abrupt decrease in excitation light intensity were corrected in real-time. The system was then validated with homogeneous insulin immunoassays that showed a nonlinear response. On-chip droplet merging with antibody-oligonucleotide (Ab-oligo) probes, insulin standards, and buffer permitted the real-time calibration and correction of large signal drifts. Full calibrations (LOD<sub>conc</sub> = 2 ng mL<sup>-1</sup> = 300 pM; LOD<sub>amt</sub> = 5 amol) required <1 min with merely 13.85 nL of Ab-oligo reagents, giving cost-savings 160-fold over the standard well-plate format while also automating the workflow. This proof-of-concept device-effectively a microfluidic digital-to-analog converter-is readily scalable to more droplets, and it is well-suited for the real-time automation of bioassays that call for expensive reagents.
…cholangitis, Wilson's disease,hemochromatosis, and alpha-1-antitrypsin defi…
Show Full Abstract
A 51-year-old woman was admitted to the hospital with abdominal pain, jaundice, and transaminitis. The patient's laboratory results showed elevated liver enzymes, high antinuclear antibodies (ANA) titer, positive anti-smooth muscle antibody, and hypergammaglobulinemia. Given risk factors for HIV infection, an ADVIA Centaur® HIV Antigen/Antibody Combo assay was performed showing a reactive sample with a follow up HIV-1 nucleic acid test (NAT) proving to be negative. Following confirmation of autoimmune hepatitis type I via a liver biopsy, steroids were initiated and significant clinical improvement of symptoms as well as resolution in transaminitis were noted. Autoimmunity is the most likely causative factor in inducing a false positive reactive screening assay. It is important to recognize that cross-reactivity with autoimmune conditions and HIV specific proteins is a potential concern for false reactive samples.
Also flagged:RNA PolymerasesRNA-dependent RNA polymeraseRdRpRdRpsEntrectinibDENV infection
Journal Article2020-06-25No SnippetsYi D, Li Q, Pang L, Wang Y, Zhang Y, Duan Z, Liang C, Cen S.
Show Full Abstract
All RNA viruses encode the RNA-dependent RNA polymerase (RdRp) which replicates and transcribes viral RNA. This essential viral enzyme does not exist in mammalian cells, thus presents a main target for the development of antiviral drugs with potential pan-antiviral activity. In this study, we take advantage of the structurally equivalent site in the dengue virus (DENV) RdRp, the N-pocket, and in the human norovirus (hNV) RdRp, the B-site, and performed a parallel structure-based virtual screening to discover compounds that can inhibit the RdRps of both hNV and DENV. We successfully identified a small molecule called Entrectinib (RAI-13) as a potent inhibitor of both hNV and DENV infection. Specifically, RAI-13 binds directly to hNV and DENV RdRps, effectively inhibits the polymerase activity in the <i>in vitro</i> biochemical assays, and exhibits does-responsive inhibition of murine norovirus (MNV) and DENV2 infection with IC50 values of 2.01 and 2.43 μM, respectively. Most promisingly, RAI-13 inhibits hepatitis C virus (HCV) infection by 95% at the 2 μM concentration. We have therefore discovered a small molecule compound that targets an allosteric site that is shared by different viral RdRps and strongly inhibits multiple pathogenic RNA viruses, thus holding the potential of being developed into a broad-spectrum antiviral drug.
Also flagged:root rot diseasesinfectionphlDand root rotpltprn
Journal Article2020-06-25✓ 3 SnippetsCastro Tapia MP, Madariaga Burrows RP, Ruiz Sepúlveda B, Vargas Concha M, Vera Palma C, Moya-Elizondo EA.
In-Text Gene Mentions
Methods)
…A bacterial consortium composed ofP. protegens strains Ca10, Ca6, and ChB7 was used to treat the wheat seeds.…
Methods)
…In order to obtain the bacterial concentration, a volume of 40 μl of each stored strain was individually placed into Falcon tubes with 10 ml of KB broth, and kept in agitation at 150 rpm during 24 h. Eight ml were transferred to a flask with 200 ml of KB broth, which was subsequently shaken using a rotary shaker at 250 rpm during 48 h. Bacterial suspensions of theCa10, Ca6, and ChB7 strains [~10 10 colony forming units (CFU) ml −1 ] were centrifuged at 4,000 rpm at 20°C for 8 min.…
Seed treatments with antagonistic bacteria could reduce the severity of crown and root rot diseases in wheat crops. The objective of this study was to evaluate the potential antagonistic activity of a bacterial consortium of three Chilean strains of <i>Pseudomonas protegens</i> against the wheat crown and root rot pathogens <i>Gaeumannomyces graminis</i> var. <i>tritici</i>, <i>Rhizoctonia cerealis</i>, and <i>Fusarium culmorum</i>. Two field experiments were carried out on artificially infested soil during two consecutive seasons (2016-2017 and 2017-2018) in an Andisol soil of southern Chile. Control treatments (not inoculated with fungi) were also included. Each treatment included a seed treatment of spring wheat cv. Pantera-INIA with and without the bacterial consortium. Both phytosanitary damage (incidence and severity) and agronomic components were evaluated. Bacterial populations with the <i>phlD</i>+ gene in the wheat plant rhizosphere during anthesis state (Z6) were also quantified. In both seasons, infection severity decreased by an average of 16.8% in seeds treated with <i>P. protegens</i> consortium, while yield components such as spikes m<sup>-1</sup> and number of grains per spike increased. The use of antagonistic bacteria resulted in a total yield increase only during the first experimental season (P < 0.05). In general, accumulated rainfall influenced the antagonistic effect of the consortium of <i>P. protegens</i> strains, accounting for the differences observed between the two seasons. The results suggest that this <i>P. protegens</i> consortium applied on seeds can promote plant growth and protect wheat crops against crown and root rot pathogens in Southern Chile under field conditions.
Also flagged:DopamineAxonNucleusaxonsNetrin-1dendritic spine
Journal Article2020-06-25✓ 5 SnippetsCuesta S, Nouel D, Reynolds LM, Morgunova A, Torres-Berrío A, White A, Hernandez G, Cooper HM, Flores C.
In-Text Gene Mentions
Abstract)
…This segregation of mesolimbic versus mesocortical dopamine pathways is mediated by the guidance cue receptor DCC, which signals dopamine axons intended to innervate the NAcc to recognize this region as their final target.…
Introduction)
…DCC receptors may require Netrin-1 to induce dopamine targeting in adolescence because the expression pattern of these proteins in dopamine axons and forebrain post-synaptic targets is complementary (Manitt et al., 2011).…
Introduction)
…Adult mice with Netrin-1 haploinsufficiency show increased medial PFC dopamine concentrations in comparison to wild-type mice and are protected against amphetamine-induced increase in locomotor activity similarly to adult mice with Dcc haploinsufficiency (Flores et al., 2005; Grant et al., 2007; Manitt et al., 2011, 2013; Pokinko et al., 2015).…
I A O 0000615)
…In contrast, therapeutic-like doses of amphetamine [i.e., doses that reach peak plasma concentrations within the range of those observed in therapeutic settings (Cuesta et al., 2019)] upregulate DCC protein expression without altering Netrin-1, leading to protective-like phenotypes.…
I A O 0000615)
…Adolescent exposure to recreational-like doses of amphetamine [i.e., doses that reach peak plasma concentrations within the range of those seen in recreational use (Cuesta et al., 2019)] downregulates both DCC in dopamine neurons and Netrin-1 in the NAcc, disrupting the development of dopamine circuitry and of cognitive control (Yetnikoff et al., 2010; Reynolds et al., 2015, 2018; Cuesta et al., 2018, 2019; Reynolds and Flores, 2019).…
Show Full Abstract
The fine arrangement of neuronal connectivity during development involves the coordinated action of guidance cues and their receptors. In adolescence, the dopamine circuitry is still developing, with mesolimbic dopamine axons undergoing target-recognition events in the nucleus accumbens (NAcc), while mesocortical projections continue to grow toward the prefrontal cortex (PFC) until adulthood. This segregation of mesolimbic versus mesocortical dopamine pathways is mediated by the guidance cue receptor DCC, which signals dopamine axons intended to innervate the NAcc to recognize this region as their final target. Whether DCC-dependent mesolimbic dopamine axon targeting in adolescence requires the action of its ligand, Netrin-1, is unknown. Here we combined shRNA strategies, quantitative analysis of pre- and post-synaptic markers of neuronal connectivity, and pharmacological manipulations to address this question. Similar to DCC levels in the ventral tegmental area, Netrin-1 expression in the NAcc is dynamic across postnatal life, transitioning from high to low expression across adolescence. Silencing Netrin-1 in the NAcc in adolescence results in an increase in the expanse of the dopamine input to the PFC in adulthood, with a corresponding increase in the number of presynaptic dopamine sites. This manipulation also results in altered dendritic spine density and morphology of medium spiny neurons in the NAcc in adulthood and in reduced sensitivity to the behavioral activating effects of the stimulant drug of abuse, amphetamine. These cellular and behavioral effects mirror those induced by <i>Dcc</i> haploinsufficiency within dopamine neurons in adolescence. Dopamine targeting in adolescence requires the complementary interaction between DCC receptors in mesolimbic dopamine axons and Netrin-1 in the NAcc. Factors regulating either DCC or Netrin-1 in adolescence can disrupt mesocorticolimbic dopamine development, rendering vulnerability or protection to phenotypes associated with psychiatric disorders.
Also flagged:neurodegenerative disorderPDgene expressionα-synucleinLewy bodiesnigrostriatal
Journal Article2020-06-25✓ 3 SnippetsÁsgrímsdóttir ES, Arenas E.
In-Text Gene Mentions
S I O 001029)
…A second mDA neuron (DA2) was detected at week 8 (E13.5 in mouse) and was found to additionally express SOX6, a transcription factor (Panman et al., 2014), LMO3, a transcriptional co-activator of Pitx3 (Bifsha et al., 2017) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1), an enzyme involved in DA catabolism (Goldstein et al., 2013) as well as the synthesis of retinoic acid (McCaffery and Drager, 1994) and GABA (Kim et al., 2015).…
Introduction)
…the SNc, includingSox6( Panman et…
Introduction)
…GWAS studies (SOX6, Dube et…
Show Full Abstract
Parkinson's disease (PD) is a progressive neurodegenerative disorder that predominantly affects dopaminergic (DA) neurons of the substantia nigra. Current treatment options for PD are symptomatic and typically involve the replacement of DA neurotransmission by DA drugs, which relieve the patients of some of their motor symptoms. However, by the time of diagnosis, patients have already lost about 70% of their substantia nigra DA neurons and these drugs offer only temporary relief. Therefore, cell replacement therapy has garnered much interest as a potential treatment option for PD. Early studies using human fetal tissue for transplantation in PD patients provided proof of principle for cell replacement therapy, but they also highlighted the ethical and practical difficulties associated with using human fetal tissue as a cell source. In recent years, advancements in stem cell research have made human pluripotent stem cells (hPSCs) an attractive source of material for cell replacement therapy. Studies on how DA neurons are specified and differentiated in the developing mouse midbrain have allowed us to recapitulate many of the positional and temporal cues needed to generate DA neurons <i>in vitro</i>. However, little is known about the developmental programs that govern human DA neuron development. With the advent of single-cell RNA sequencing (scRNA-seq) and bioinformatics, it has become possible to analyze precious human samples with unprecedented detail and extract valuable high-quality information from large data sets. This technology has allowed the systematic classification of cell types present in the human developing midbrain along with their gene expression patterns. By studying human development in such an unbiased manner, we can begin to elucidate human DA neuron development and determine how much it differs from our knowledge of the rodent brain. Importantly, this molecular description of the function of human cells has become and will increasingly be a reference to define, evaluate, and engineer cell types for PD cell replacement therapy and disease modeling.
Research Square2020-06-25Preprint (No Snippets API)Shokri G, Rezaei R, Esfandiari M, Tasharrofi N, Fathi-roodsari M, Hashemi M, Kouhkan F.
Show Full Abstract
<title>Abstract</title> <p><bold>Background</bold> The precise epigenetic pathways and mechanisms involved in determining the fate of neural progenitor stem cells (NPCs) into differentiated neural lineages including oligodendrocytes (OLs) is an unresolved issue. MiRNAs are one of the key differentiating factors whose aberrant expression has been shown to disturb proper development. In the present study the leading role of miR-19 in NPCs differentiation to OLs was investigated.<bold>Methods</bold> MiR-19 was overexpressed in hiPSC derived NPCs and for confirming differentiation to the desired cell line, i.e. OL, the expression of cell line-specific genes was evaluated by Real-Time PCR. Oligodendrocyte progenitor cells (OPCs) precursor in the differentiated cells was studied by Flow cytometry. Luciferase activity was also measured to confirm the interaction of miR-19 with the 3’UTR of mRNA of the putative genes. <bold>Results</bold> Our results indicate that the upregulation of miR-19 is a contributing factor in determining NPCs' fate and the timing of progenitor division arrest. MiR-19 can cause a significant expression of OL markers. Besides, miR-19 repressed proneuronal differentiation factors including NeuroD1, NeuroD4, and neurogenin. Moreover, the higher expression of miR-19 could downregulate SOX4, SOX5, and SOX6 genes, which are involved in inhibiting OL differentiation and maturation. <bold>Conclusions</bold> Our finding demonstrated the functional link of miR-19 to regulatory networks of NPCs differentiation, as well as introduced a new strategy for modulating OL fate commitment and development of novel cell therapies.</p>
Also flagged:ExtracellularsteroidsagingG-protein-coupled receptoraldosteronekidney failure
Journal Article2020-06-24✓ 5 SnippetsZheng W, Ocorr K, Tatar M.
In-Text Gene Mentions
Discussion)⭐ same-sentence co-mention
…Knockdown of Gpr52 reduces HTT levels in a human tissue model, whereas neurodegeneration is suppressed by knockdown of DopEcR in Drosophila that express human HTT. The urotensin II receptor (UTS2R) is a conserved GPCR implicated in renal fibrosis by trans-modulating EGFR and activating MAPK protein (Tian et al., 2008; Vaudry et al., 2015).…
…modulate huntingtin protein (HTT) through cAMP-dependent mecha…
Discussion)⭐ same-sentence co-mention
…Knockdown ofGpr52reduces HTT levels…
Show Full Abstract
Aldosterone is produced by the mammalian adrenal cortex to modulate blood pressure and fluid balance; however, excessive, prolonged aldosterone promotes fibrosis and kidney failure. How aldosterone triggers disease may involve actions independent of its canonical mineralocorticoid receptor. Here, we present a <i>Drosophila</i> model of renal pathology caused by excess extracellular matrix formation, stimulated by exogenous aldosterone and by insect ecdysone. Chronic administration of aldosterone or ecdysone induces expression and accumulation of collagen-like Pericardin in adult nephrocytes - podocyte-like cells that filter circulating hemolymph. Excess Pericardin deposition disrupts nephrocyte (glomerular) filtration and causes proteinuria in <i>Drosophila</i>, hallmarks of mammalian kidney failure. Steroid-induced Pericardin production arises from cardiomyocytes associated with nephrocytes, potentially reflecting an analogous role of mammalian myofibroblasts in fibrotic disease. Remarkably, the canonical ecdysteroid nuclear hormone receptor, Ecdysone receptor (EcR), is not required for aldosterone or ecdysone to stimulate Pericardin production or associated renal pathology. Instead, these hormones require a cardiomyocyte-associated G-protein-coupled receptor, Dopamine-EcR (DopEcR), a membrane-associated receptor previously characterized in the fly brain to affect behavior. DopEcR in the brain is known to affect behavior through interactions with the <i>Drosophila</i> Epidermal growth factor receptor (Egfr), referred to as dEGFR. Here, we find that the steroids ecdysone and aldosterone require dEGFR in cardiomyocytes to induce fibrosis of the cardiac-renal system. In addition, endogenous ecdysone that becomes elevated with age is found to foster age-associated fibrosis, and to require both cardiomyocyte DopEcR and dEGFR. This <i>Drosophila</i> renal disease model reveals a novel signaling pathway through which steroids may modulate mammalian fibrosis through potential orthologs of DopEcR.
Tilimycin is an enterotoxin produced by the opportunistic pathogen <i>Klebsiella oxytoca</i> that causes antibiotic-associated hemorrhagic colitis (AAHC). This pyrrolobenzodiazepine (PBD) natural product is synthesized by a bimodular nonribosomal peptide synthetase (NRPS) pathway composed of three proteins: NpsA, ThdA, and NpsB. We describe the functional and structural characterization of the fully reconstituted NRPS system and report the steady-state kinetic analysis of all natural substrates and cofactors as well as the structural characterization of both NpsA and ThdA. The mechanism of action of tilimycin was confirmed using DNA adductomics techniques through the detection of putative N-2 guanine alkylation after tilimycin exposure to eukaryotic cells, providing the first structural characterization of a PBD-DNA adduct formed in cells. Finally, we report the rational design of small-molecule inhibitors that block tilimycin biosynthesis in whole cell <i>K. oxytoca</i> (IC<sub>50</sub> = 29 ± 4 μM) through the inhibition of NpsA (<i>K</i><sub>D</sub> = 29 ± 4 nM).
Also flagged:anemiathrombocytopeniagranulocyte colony stimulating factorCHK1cell cycletumors
Journal Article2020-06-24✓ 1 SnippetGatti-Mays ME, Karzai FH, Soltani SN, Zimmer A, Green JE, Lee MJ, Trepel JB, Yuno A, Lipkowitz S, Nair J, McCoy A, Lee JM.
<h4>Lessons learned</h4>Monotherapy with prexasertib demonstrated modest activity in BRCA wild-type, recurrent triple-negative breast cancer, highlighting the unmet need for combination treatment strategies. Neutropenia, anemia, and thrombocytopenia are common with the use of prexasertib but are manageable with supportive care measures. Prophylactic use of granulocyte colony stimulating factor should be considered to avoid dose reductions or treatment delays. Pharmacodynamic studies showed prexasertib treatment induced DNA damage in peripheral immune cells.<h4>Background</h4>Cell cycle checkpoint kinase 1 (CHK1) is a major G2/M cell cycle regulator in tumors with p53 dysfunction, such as triple-negative breast cancer (TNBC). We hypothesized the second-generation CHK1 inhibitor, prexasertib, would yield clinical activity in sporadic TNBC.<h4>Methods</h4>This single arm, phase II trial evaluated prexasertib at 105 mg/m<sup>2</sup> IV every 2 weeks in patients with metastatic/recurrent TNBC. The primary endpoint was overall response rate (ORR).<h4>Results</h4>All nine patients enrolled were germline BRCA wild-type (BRCAwt) and had at least one prior treatment. One partial response (PR) was observed (ORR of 11.1%). Four patients experienced stable disease. The median progression-free survival (PFS) was 86 days (range 17 to 159 days). Grade 3/4 treatment-related adverse events included afebrile neutropenia (n = 8; 88.9%), anemia (n = 3; 33.3%), and thrombocytopenia (n = 1; 11.1%). Pharmacodynamic studies showed prexasertib treatment induced DNA damage in peripheral immune cells and demonstrated a decrease in activated/reinvigorated CD8 T cells; however, the one patient with a PR showed evidence of T-cell recovery.<h4>Conclusion</h4>Prexasertib monotherapy had modest clinical efficacy in BRCAwt TNBC. Further studies of prexasertib in combination with other agents are needed.
Also flagged:bindingWntdishevelled proteinsDVL1-3signalosomemembrane
Journal Article2020-06-24✓ 1 SnippetChen Z, Wasney GA, Picaud S, Filippakopoulos P, Vedadi M, D'Angiolella V, Bullock AN.
In-Text Gene Mentions
Discussion)
…ligases, such asKLHL20[ 33 ]…
Show Full Abstract
Wnt signalling is dependent on dishevelled proteins (DVL1-3), which assemble an intracellular Wnt signalosome at the plasma membrane. The levels of DVL1-3 are regulated by multiple Cullin-RING E3 ligases that mediate their ubiquitination and degradation. The BTB-Kelch protein KLHL12 was the first E3 ubiquitin ligase to be identified for DVL1-3, but the molecular mechanisms determining its substrate interactions have remained unknown. Here, we mapped the interaction of DVL1-3 to a 'PGXPP' motif that is conserved in other known partners and substrates of KLHL12, including PLEKHA4, PEF1, SEC31 and DRD4. To determine the binding mechanism, we solved a 2.4 Å crystal structure of the Kelch domain of KLHL12 in complex with a DVL1 peptide that bound with low micromolar affinity. The DVL1 substrate adopted a U-shaped turn conformation that enabled hydrophobic interactions with all six blades of the Kelch domain β-propeller. In cells, the mutation or deletion of this motif reduced the binding and ubiquitination of DVL1 and increased its stability confirming this sequence as a degron motif for KLHL12 recruitment. These results define the molecular mechanisms determining DVL regulation by KLHL12 and establish the KLHL12 Kelch domain as a new protein interaction module for a novel proline-rich motif.
Bovine leukemia virus (BLV) is a δ-retrovirus responsible for Enzootic Bovine Leukosis (EBL), a lymphoproliferative disease that affects cattle. The virus causes immune system deregulation, favoring the development of secondary infections. In that context, mastitis incidence is believed to be increased in BLV infected cattle. The aim of this study was to analyze the transcriptome profile of a BLV infected mammary epithelial cell line (MAC-T). Our results show that BLV infected MAC-T cells have an altered expression of IFN I signal pathway and genes involved in defense response to virus, as well as a collagen catabolic process and some protooncogenes and tumor suppressor genes. Our results provide evidence to better understand the effect of BLV on bovine mammary epithelial cell's immune response.
Also flagged:Bmi-1tumorintegration site 1Raf kinase inhibitory proteinRKIPgastric cancer
Journal Article2020-06-24No SnippetsLi Y, Tian Z, Tan Y, Lian G, Chen S, Chen S, Li J, Li X, Huang K, Chen Y.
Show Full Abstract
<h4>Background</h4>We previously reported an inverse relationship between B cell-specific Moloney murine leukemia virus integration site 1 (Bmi-1) and Raf kinase inhibitory protein (RKIP), which is associated with the prognosis of gastric cancer (GC). In this study, we further explored the microRNA (miRNA) regulatory mechanism between Bmi-1 and RKIP.<h4>Methods</h4>Microarray analysis was first carried out to identify miRNA profiles that were differentially expressed in cells overexpressing Bmi-1. Then, miRNAs that could regulate RKIP were identified. Quantitative real-time PCR (qRT-PCR) and Western blotting were performed to measure the expression of Bmi-1, miR-155, miR-27a and RKIP. RKIP was confirmed as a target of miR-27a and miR-155 through luciferase reporter assays, qRT-PCR and Western blotting. The effects of the Bmi-1/miR-27a/RKIP and Bmi-1/miR-155/RKIP axes on tumor growth, proliferation, migration, invasion, colony-formation ability, metastasis and chemoresistance were investigated both in vitro and in vivo.<h4>Results</h4>The downregulation of RKIP by Bmi-1 occurred at the protein but not mRNA level. This indicates probable posttranscriptional regulation. miRNA expression profiles of cells with ectopic expression of Bmi-1 were analyzed and compared to those of control cells by microarray analysis. A total of 51 upregulated and 72 downregulated miRNAs were identified. Based on publicly available algorithms, miR-27a and miR-155 were predicted, selected and demonstrated to target RKIP. Bmi-1, miR-27a and miR-155 are elevated in human GC and associated with poor prognosis of GC, while RKIP is expressed at lower levels in GC and correlated with good prognosis. Then, in vitro tests shown that in addition to regulating RKIP expression via miR-27a and miR-155, Bmi-1 was also able to regulate the migration, invasion, proliferation, colony-formation ability and chemosensitivity of GC cells through the same pathway. Finally, the in vivo test showed similar results, whereby the knockdown of the Bmi-1 gene led to the inhibition of tumor growth, metastasis and chemoresistance through miR-27a and miR-155.<h4>Conclusions</h4>Bmi-1 was proven to induce the expression of miR-27a and miR-155 and thus promote tumor metastasis and chemoresistance by targeting RKIP in GC. Overall, miR-27a and miR-155 might be promising targets for the screening, diagnosis, prognosis, treatment and disease monitoring of GC.
Also flagged:cancerhereditary disorderSBSdelrunAMDL
Journal Article2020-06-24✓ 3 SnippetsShickh S, Gutierrez Salazar M, Zakoor KR, Lázaro C, Gu J, Goltz J, Kleinman D, Noor A, Khalouei S, Mighton C, Reble E, Kodida R, Bombard Y, DiTroia S, Baxter S, Watkins N, Care M, Adler A, Horsburgh S, Morar O, Murphy J, Nevay DL, Szybowska M, Aronson M, Panchal S, Godoy R, Holter S, Randall Armel S, Semotiuk K, Elser C, Kim RH, Chitayat D, So J, Faghfoury H, Silver J, Morel CF, Lerner-Ellis J.
In-Text Gene Mentions
I A O 0000326)
…ZNF644…
I A O 0000326)
…ARFGEF2…
I A O 0000326)
…HFE…
Show Full Abstract
<h4>Background</h4>Exome and genome sequencing have been demonstrated to increase diagnostic yield in paediatric populations, improving treatment options and providing risk information for relatives. There are limited studies examining the clinical utility of these tests in adults, who currently have limited access to this technology.<h4>Methods</h4>Patients from adult and cancer genetics clinics across Toronto, Ontario, Canada were recruited into a prospective cohort study evaluating the diagnostic utility of exome and genome sequencing in adults. Eligible patients were ≥18 years of age and suspected of having a hereditary disorder but had received previous uninformative genetic test results. In total, we examined the diagnostic utility of exome and genome sequencing in 47 probands and 34 of their relatives who consented to participate and underwent exome or genome sequencing.<h4>Results</h4>Overall, 17% (8/47) of probands had a pathogenic or likely pathogenic variant identified in a gene associated with their primary indication for testing. The diagnostic yield for patients with a cancer history was similar to the yield for patients with a non-cancer history (4/18 (22%) vs 4/29 (14%)). An additional 24 probands (51%) had an inconclusive result. Secondary findings were identified in 10 patients (21%); three had medically actionable results.<h4>Conclusions</h4>This study lends evidence to the diagnostic utility of exome or genome sequencing in an undiagnosed adult population. The significant increase in diagnostic yield warrants the use of this technology. The identification and communication of secondary findings may provide added value when using this testing modality as a first-line test.
Also flagged:Parkinson's diseaseactinautophagyCxcl10GAPDHDARPP32
Journal Article2020-06-24✓ 4 SnippetsSharma M, Rajendrarao S, Shahani N, Ramírez-Jarquín UN, Subramaniam S.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Results)
…Previous studies indicate that autophagy is dysregulated in HD, and it is known that HTT plays several roles in regulating the dynamics of autophagy (21, 52).…
S I O 001029)
…Huntington disease (HD) is a fatal neurodegenerative disorder that is caused by CAG expansion mutation of the Huntingtin gene (HTT), which codes for polyglutamine.…
Discussion)
…Interestingly,HTTcan act as…
Show Full Abstract
Huntington disease (HD) is caused by an expansion mutation of the N-terminal polyglutamine of huntingtin (mHTT). mHTT is ubiquitously present, but it induces noticeable damage to the brain's striatum, thereby affecting motor, psychiatric, and cognitive functions. The striatal damage and progression of HD are associated with the inflammatory response; however, the underlying molecular mechanisms remain unclear. Here, we report that cGMP-AMP synthase (cGAS), a DNA sensor, is a critical regulator of inflammatory and autophagy responses in HD. Ribosome profiling revealed that the <i>cGAS</i> mRNA has high ribosome occupancy at exon 1 and codon-specific pauses at positions 171 (CCG) and 172 (CGT) in HD striatal cells. Moreover, the protein levels and activity of cGAS (based on the phosphorylated STING and phosphorylated TBK1 levels), and the expression and ribosome occupancy of cGAS-dependent inflammatory genes (<i>Ccl5</i> and <i>Cxcl10</i>) are increased in HD striatum. Depletion of cGAS diminishes cGAS activity and decreases the expression of inflammatory genes while suppressing the up-regulation of autophagy in HD cells. In contrast, reinstating cGAS in cGAS-depleted HD cells activates cGAS activity and promotes inflammatory and autophagy responses. Ribosome profiling also revealed that <i>LC3A</i> and <i>LC3B</i>, the two major autophagy initiators, show altered ribosome occupancy in HD cells. We also detected the presence of numerous micronuclei, which are known to induce cGAS, in the cytoplasm of neurons derived from human HD embryonic stem cells. Collectively, our results indicate that cGAS is up-regulated in HD and mediates inflammatory and autophagy responses. Thus, targeting the cGAS pathway may offer therapeutic benefits in HD.
Also flagged:IL-6CancerlactatePhototransductionadenomacorticosterone
Journal Article2020-06-24✓ 3 SnippetsHadadi E, Taylor W, Li XM, Aslan Y, Villote M, Rivière J, Duvallet G, Auriau C, Dulong S, Raymond-Letron I, Provot S, Bennaceur-Griscelli A, Acloque H.
In-Text Gene Mentions
Results)
…Furthermore, we observed DCC cells with H&E staining of bone sections, and μCT analysis also revealed bone lesions, highlighting the dissemination of cancer cells to bone (Supplementary Fig. 4a).…
Results)
…Furthermore, we observedDCCcells with H&E…
Results)
…reduction in PyMT-positiveDCCand in the…
Show Full Abstract
Breast cancer is the most common type of cancer worldwide and one of the major causes of cancer death in women. Epidemiological studies have established a link between night-shift work and increased cancer risk, suggesting that circadian disruption may play a role in carcinogenesis. Here, we aim to shed light on the effect of chronic jetlag (JL) on mammary tumour development. To do this, we use a mouse model of spontaneous mammary tumourigenesis and subject it to chronic circadian disruption. We observe that circadian disruption significantly increases cancer-cell dissemination and lung metastasis. It also enhances the stemness and tumour-initiating potential of tumour cells and creates an immunosuppressive shift in the tumour microenvironment. Finally, our results suggest that the use of a CXCR2 inhibitor could correct the effect of JL on cancer-cell dissemination and metastasis. Altogether, our data provide a conceptual framework to better understand and manage the effects of chronic circadian disruption on breast cancer progression.
Also flagged:cancercell cyclechromosometumourstumourcancers
Journal Article2020-06-24No SnippetsLundberg A, Lindström LS, Parker JS, Löverli E, Perou CM, Bergh J, Tobin NP.
Show Full Abstract
Pan-cancer genomic analyses based on the magnitude of pathway activity are currently lacking. Focusing on the cell cycle, we examined the DNA mutations and chromosome arm-level aneuploidy within tumours with low, intermediate and high cell-cycle activity in 9515 pan-cancer patients with 32 different tumour types. Boxplots showed that cell-cycle activity varied broadly across and within all cancers. TP53 and PIK3CA mutations were common in all cell cycle score (CCS) tertiles but with increasing frequency as cell-cycle activity levels increased (P < 0.001). Mutations in BRAF and gains in 16p were less frequent in CCS High tumours (P < 0.001). In Kaplan-Meier analysis, patients whose tumours were CCS Low had a longer Progression Free Interval (PFI) relative to Intermediate or High (P < 0.001) and this significance remained in multivariable analysis (CCS Intermediate: HR = 1.37; 95% CI 1.17-1.60, CCS High: 1.54; 1.29-1.84, CCS Low = Ref). These results demonstrate that whilst similar DNA alterations can be found at all cell-cycle activity levels, some notable exceptions exist. Moreover, independent prognostic information can be derived on a pan-cancer level from a simple measure of cell-cycle activity.
Journal Article2020-06-24No SnippetsKakuta Y, Ichikawa R, Fuyuno Y, Hirano A, Umeno J, Torisu T, Watanabe K, Asakura A, Nakano T, Izumiyama Y, Okamoto D, Naito T, Moroi R, Kuroha M, Kanazawa Y, Kimura T, Shiga H, Naito T, Esaki M, Kawai Y, Tokunaga K, Nakamura M, Matsumoto T, Nagasaki M, Kinouchi Y, Unno M, Masamune A.
Show Full Abstract
Expression quantitative trait locus (eQTL) analyses have enabled us to predict the function of disease susceptibility SNPs. However, eQTL for the effector memory T cells (TEM) located in the lamina propria mononuclear cells (LPMCs), which play an important role in Crohn's disease (CD), are not yet available. Thus, we conducted RNA sequencing and eQTL analyses of TEM cells located in the LPMCs from IBD patients (n = 20). Genome-wide association study (GWAS) was performed using genotyping data of 713 Japanese CD patients and 2,063 controls. We compared the results of GWAS and eQTL of TEM, and also performed a transcriptome-wide association study using eQTL from Genotype Tissue Expression project. By eQTL analyses of TEM, correlations of possible candidates were confirmed in 22,632 pairs and 2,463 genes. Among these candidates, 19 SNPs which showed significant correlation with tenascin-XA (TNXA) expression were significantly associated with CD in GWAS. By TWAS, TNFSF15 (FDR = 1.35e-13) in whole blood, ERV3-1 (FDR = 2.18e-2) in lymphocytes, and ZNF713 (FDR = 3.04e-2) in the sigmoid colon was significantly associated with CD. By conducting integration analyses using GWAS and eQTL data, we confirmed multiple gene transcripts are involved in the development of CD.
Also flagged:dopamineoligonucleotidesPTBParkinson Diseaseneurodegenerative disordersRNA binding protein
Journal Article2020-06-24No SnippetsQian H, Kang X, Hu J, Zhang D, Liang Z, Meng F, Zhang X, Xue Y, Maimon R, Dowdy SF, Devaraj NK, Zhou Z, Mobley WC, Cleveland DW, Fu XD.
Show Full Abstract
Parkinson's disease is characterized by loss of dopamine neurons in the substantia nigra<sup>1</sup>. Similar to other major neurodegenerative disorders, there are no disease-modifying treatments for Parkinson's disease. While most treatment strategies aim to prevent neuronal loss or protect vulnerable neuronal circuits, a potential alternative is to replace lost neurons to reconstruct disrupted circuits<sup>2</sup>. Here we report an efficient one-step conversion of isolated mouse and human astrocytes to functional neurons by depleting the RNA-binding protein PTB (also known as PTBP1). Applying this approach to the mouse brain, we demonstrate progressive conversion of astrocytes to new neurons that innervate into and repopulate endogenous neural circuits. Astrocytes from different brain regions are converted to different neuronal subtypes. Using a chemically induced model of Parkinson's disease in mouse, we show conversion of midbrain astrocytes to dopaminergic neurons, which provide axons to reconstruct the nigrostriatal circuit. Notably, re-innervation of striatum is accompanied by restoration of dopamine levels and rescue of motor deficits. A similar reversal of disease phenotype is also accomplished by converting astrocytes to neurons using antisense oligonucleotides to transiently suppress PTB. These findings identify a potentially powerful and clinically feasible approach to treating neurodegeneration by replacing lost neurons.
Also flagged:Carbonic Anhydrase 8CA8α-carbonic anhydrasesS100Pcongenital ataxiamild cognitive impairment
Journal Article2020-06-24✓ 1 SnippetChi TH, Hsieh BY, Liang PS, Han TH, Hsieh M.
In-Text Gene Mentions
Text
…CA10…
Show Full Abstract
Carbonic anhydrase 8 (CA8), an isozyme of α-carbonic anhydrases, lacks the ability to catalyze the reversible hydration of CO<sub>2</sub> to bicarbonate and proton. Previous studies have shown that single point mutations of CA8, CA8-S100P, and CA8-G162R, are associated with novel syndromes including congenital ataxia and mild cognitive impairment. Our previous results demonstrated that overexpression of wild type (WT) CA8 promoted cell proliferation, neurite outgrowth, anti-apoptosis, invasion and migration abilities in neuronal cells. In this study, we examined the expressions and functions of CA8-S100P and CA8-G162R in neuroblastoma cells lines, compared with those of WT CA8. Our results show that the protein expressions of mutant CA8-S100P and CA8-G162R were significantly decreased in Neuro-2a and SK-N-SH cells. Interestingly, CA8-S100P demonstrated a significant increase in cell proliferation in both Neuro-2a and SK-N-SH cells. However, both CA8 mutations showed significantly decreased effects on cell protection and migration in SK-N-SH cells. Surprisingly, a significant increase of invasive ability was observed in SK-N-SH cells with overexpression of CA8-S100P as compared with those with overexpression of WT CA8 under retinoic acid (RA) treatment. In addition, we found that Neuro-2a cells with overexpression of CA8-S100P and CA8-G162R showed significantly increased neurite outgrowth. Taken together, our data suggest that the expressions of CA8-S100P and CA8-G162R in neuronal cells alter cell morphology, proliferation, mobility and viability; indicating that the homozygous point mutations of CA8 lead to not only the loss of WT CA8 function, but also the gain of novel functions leading to neuromuscular dysfunction.
Also flagged:COVID-19HIF-1ABL2endothelial dysfunctioncoagulationHIF-1α
Journal Article2020-06-24✓ 1 SnippetMarchetti M.
In-Text Gene Mentions
Introduction)
…the patients, sinceantithrombin-III, fibrinogen, and platelet…
Show Full Abstract
COVID-19 pandemia is a major health emergency causing hundreds of deaths worldwide. The high reported morbidity has been related to hypoxia and inflammation leading to endothelial dysfunction and aberrant coagulation in small and large vessels. This review addresses some of the pathways leading to endothelial derangement, such as complement, HIF-1α, and ABL tyrosine kinases. This review also highlights potential targets for prevention and therapy of COVID-19-related organ damage and discusses the role of marketed drugs, such as eculizumab and imatinib, as suitable candidates for clinical trials.
…This includes variants in CACNA1E (Cav2.3 α1) causing developmental epileptic encephalopathies with contractures, macrocephaly, and dyskinesia [22], in CACNA1G (Cav3.1 α1) causing childhood-onset cerebellar atrophy [13] and in CACNA1H (Cav3.2 α1) causing early-onset hypertension with primary aldosteronism [74].…
Show Full Abstract
The identification of rare disease-causing variants in humans by large-scale next-generation sequencing (NGS) studies has also provided us with new insights into the pathophysiological role of de novo missense variants in the CACNA1D gene that encodes the pore-forming α1-subunit of voltage-gated Cav1.3 L-type Ca<sup>2+</sup> channels. These CACNA1D variants have been identified somatically in aldosterone-producing adenomas as well as germline in patients with neurodevelopmental and in some cases endocrine symptoms. In vitro studies in heterologous expression systems have revealed typical gating changes that indicate enhanced Ca<sup>2+</sup> influx through Cav1.3 channels as the underlying disease-causing mechanism. Here we summarize the clinical findings of 12 well-characterized individuals with a total of 9 high-risk pathogenic CACNA1D variants. Moreover, we propose how information from somatic mutations in aldosterone-producing adenomas could be used to predict the potential pathogenicity of novel germline variants. Since these pathogenic de novo variants can cause a channel-gain-of function, we also discuss the use of L-type Ca<sup>2+</sup> channel blockers as a potential therapeutic option.
…Tesli et al. (2016) [10] demonstrated reduced blood levels of VRK2 mRNA in a large sample of individuals with schizophrenia relative to controls (p < 10− 12), thereby strongly supporting a genetic contribution of VRK2 to the causes of schizophrenia.…
Introduction)
…In fact, sequence variants in the VRK2 gene are robustly associated with schizophrenia [3–5], and also with depression [6], bipolar disorder [7], and epilepsy [8, 9].…
Introduction)
…Since future studies on Vrk2 gene function will be needed to explore the genetic basis of psychiatric disease, an understanding of gene structure is a necessary first step.…
Abstract)
…Common sequence variations in the VRK2 gene contribute to genetic risk for various psychiatric diseases including schizophrenia and major depressive disorder.…
Introduction)
…It has recently been reported that in the brain, Vrk2 expression is restricted to microglia [12] If this were verified, this would be of some significance for understanding the causes of schizophrenia, as it would unequivocally implicate microglial dysfunction in disease aetiology.…
Show Full Abstract
Common sequence variations in the VRK2 gene contribute to genetic risk for various psychiatric diseases including schizophrenia and major depressive disorder. Despite the clear importance of studying the regulation and function of VRK2 for understanding the causes of these diseases, the organisation and expression of the gene remain poorly characterised. Using reverse-transcriptase-PCR, we have amplifed exons of Vrk2 mRNA from regions of mouse brain, and from different cell classes comprising neurones, astrocytes and microglial cells. We find that Vrk2 mRNA is expressed in all cell types, and that the splicing of the mouse Vrk2 gene is much more complex than previously appreciated. In addition to the predicted alternative splicing (absence/presence) of the penultimate 3 prime exon, we also detected a variety of 5 prime structures, including two novel exons spanning the first characterised exon (exon 1), which we term exons 1a and 1b. While expressed in neurones and astrocytes, exon 1b was not expressed in microglial cells. Expression of transcripts containing exon 1a in microglia was increased by immune stimulation. An additional truncated transcript lacking 7 central exons was also identified. As with the human gene, the results confirm complex patterns of alternative splicing which are likely to be relevant for understanding the physiological and pathological function of the gene in the CNS.
Also flagged:Covid-19Acute Limb IschemiaHeparinclottingreverse-transcriptasepolymerase
Journal Article2020-06-24✓ 4 SnippetsBaccellieri D, Bilman V, Apruzzi L, Monaco F, D'Angelo A, Loschi D, Melissano G, Chiesa R.
In-Text Gene Mentions
Discussion)
…years), antithrombin III (ATIII) activity less than…
Discussion)
…the deficiency ofATIII, clinical indices for…
Discussion)
…unlikely that theATIIIdeficiency was the…
I A O 0000615)
…HR, deficiency ofATIII); third, the aPTT…
Show Full Abstract
Heparin resistance is an uncommon phenomenon defined as the need for high-dose unfractionated heparin (UFH) of more than 35,000 IU/day to achieve the target activated partial-thromboplastin time ratio or the failure to achieve the desired activated clotting time after a full UFH dose. This rare phenomenon is being more commonly observed in Covid-19 patients in a hypercoagulable state. We describe a Covid-19 patient confirmed by reverse-transcriptase polymerase chain reaction assay, with acute limb ischemia, who developed heparin resistance. The patient was managed by the departments of vascular surgery, anesthesia and intensive care, and the Coagulation Service and Thrombosis Research from San Raffaele Scientific Institute, Milan, Italy.
<h4>Background</h4>A subset of patients have no risk factors for the development of hepatocellular carcinoma (HCC). We evaluated differences in clinical variables between patients with and without risk factors who underwent surgical resection.<h4>Methods</h4>A prospectively maintained database was queried for patients who underwent R0/R1 resection of HCC between 1992 and 2016. Risk factors included HCV, HBV, hemochromatosis, alcoholic liver disease, or cirrhosis, stage 2 or 3 fibrosis or severe (>66%) steatosis of the non-neoplastic liver. Variables were compared between patients with and without risk factors.<h4>Results</h4>There were 416 patients who underwent resection; 276 (66%) had known risk factors while 140 (34%) did not. Patients without risk factors were more likely to be older, female and have hyperlipidemia or coronary artery disease (p < 0.004). These patients had larger tumors and were more likely to undergo major hepatectomy (p < 0.001). There was no difference in OS (5-year, 56% vs 47%, p = 0.335), RFS (27% vs 24%, p = 0.398), or the rates of intrahepatic (HR:1.16 [95%CI:0.95-1.57], p = 0.344) and extrahepatic recurrences (HR:0.72 [95%CI:0.4-1.3], p = 0.261) between groups.<h4>Conclusion</h4>Patients without risk factors for HCC presented with larger tumors yet had similar outcomes, suggesting these tumors may represent a different disease process, and underlying liver dysfunction can influence overall outcome.
Also flagged:agingage-related diseasesdetoxificationmethylationchromatinpolyphenols
Journal Article2020-06-24No SnippetsProshkina E, Shaposhnikov M, Moskalev A.
Show Full Abstract
Throughout life, organisms are exposed to various exogenous and endogenous factors that cause DNA damages and somatic mutations provoking genomic instability. At a young age, compensatory mechanisms of genome protection are activated to prevent phenotypic and functional changes. However, the increasing stress and age-related deterioration in the functioning of these mechanisms result in damage accumulation, overcoming the functional threshold. This leads to aging and the development of age-related diseases. There are several ways to counteract these changes: 1) prevention of DNA damage through stimulation of antioxidant and detoxification systems, as well as transition metal chelation; 2) regulation of DNA methylation, chromatin structure, non-coding RNA activity and prevention of nuclear architecture alterations; 3) improving DNA damage response and repair; 4) selective removal of damaged non-functional and senescent cells. In the article, we have reviewed data about the effects of various trace elements, vitamins, polyphenols, terpenes, and other phytochemicals, as well as a number of synthetic pharmacological substances in these ways. Most of the compounds demonstrate the geroprotective potential and increase the lifespan in model organisms. However, their genome-protecting effects are non-selective and often are conditioned by hormesis. Consequently, the development of selective drugs targeting genome protection is an advanced direction.
Also flagged:Abdominal artery aneurysmaneurysmgene expressionneurological diseasesAbdominal Aortic AneurysmAbdominal aortic aneurysms
Journal Article2020-06-24✓ 5 SnippetsZalewski DP, Ruszel KP, Stępniewski A, Gałkowski D, Bogucki J, Komsta Ł, Kołodziej P, Chmiel P, Zubilewicz T, Feldo M, Kocki J, Bogucka-Kocka A.
In-Text Gene Mentions
Results)
…Seven out of 18 genes are associated with neurological diseases: Alzheimer’s disease (CPT1A, SUFU, ZSWIM8, PDCD4), schizophrenia (HTT, NBEAL2) and Parkinson disease (PRDM13).…
Results)
…Analyzed genes were associated with cardiovascular diseases (CPT1A, THOC5, KIAA1549L), diabetes (ANKRD13D, CPT1A), lipids metabolism (CPT1A, GIT2), inflammation mediators (GGT1), glutathione metabolism (GGT1), aging (GGT1, PDCD4), cancer (HTT, SUFU, UBE4B, PDCD4), RNA transport and processing (THOC5, UPF1), proteolysis (SUFU, UBE4B), chemical dependency (ZZEF1, KIAA1549L)…
Discussion)
…Interestingly, there were seven genes associated with neurological disorders, including Alzheimer’s disease (CPT1A, SUFU, ZSWIM8, PDCD4), schizophrenia (HTT, NBEAL2) and Parkinson’s disease (PRDM13).…
Results)
…, GIT2 ,HTT, KIAA1549L ,…
Results)
…), cancer (HTT, SUFU ,…
Show Full Abstract
Abdominal artery aneurysm (AAA) refers to abdominal aortic dilatation of 3 cm or greater. AAA is frequently underdiagnosed due to often asymptomatic character of the disease, leading to elevated mortality due to aneurysm rupture. MiRNA constitute a pool of small RNAs controlling gene expression and is involved in many pathologic conditions in human. Targeted panel detecting altered expression of miRNA and genes involved in AAA would improve early diagnosis of this disease. In the presented study, we selected and analyzed miRNA and gene expression signatures in AAA patients. Next, generation sequencing was applied to obtain miRNA and gene-wide expression profiles from peripheral blood mononuclear cells in individuals with AAA and healthy controls. Differential expression analysis was performed using DESeq2 and uninformative variable elimination by partial least squares (UVE-PLS) methods. A total of 31 miRNAs and 51 genes were selected as the most promising biomarkers of AAA. Receiver operating characteristics (ROC) analysis showed good diagnostic ability of proposed biomarkers. Genes regulated by selected miRNAs were determined in silico and associated with functional terms closely related to cardiovascular and neurological diseases. Proposed biomarkers may be used for new diagnostic and therapeutic approaches in management of AAA. The findings will also contribute to the pool of knowledge about miRNA-dependent regulatory mechanisms involved in pathology of that disease.
Also flagged:Ironepilepsyheadachesdiabetesnitrogenalkaloid
Journal Article2020-06-24✓ 1 SnippetFernández-Lázaro D, Mielgo-Ayuso J, Córdova Martínez A, Seco-Calvo J.
In-Text Gene Mentions
Methods)
…or spleen) andhemochromatosis(deposits of Fe…
Show Full Abstract
Black pepper (<i>Piper nigrum</i> L.) has been employed in medicine (epilepsy, headaches, and diabetes), where its effects are mainly attributed to a nitrogen alkaloid called piperidine (1-(1-[1,3-benzodioxol-5-yl]-1-oxo-2,4 pentenyl) piperidine). Piperine co-administered with vitamins and minerals has improved its absorption. Therefore, this study aimed to describe the impact of the joint administration of iron (Fe) plus black pepper in physically active healthy individuals. Fe is a micronutrient that aids athletic performance by influencing the physiological functions involved in endurance sports by improving the transport, storage, and utilization of oxygen. Consequently, athletes have risk factors for Fe depletion, Fe deficiency, and eventually, anemia, mainly from mechanical hemolysis, gastrointestinal disturbances, and loss of Fe through excessive sweating. Declines in Fe stores have been reported to negatively alter physical capacities such as aerobic capacity, strength, and skeletal muscle recovery in elite athletes. Thus, there is a need to maintain Fe storage, even if Fe intake meets the recommended daily allowance (RDA), and Fe supplementation may be justified in physically active individuals, in states of Fe deficiency, with or without anemia. Females, in particular, should monitor their Fe hematological profile. The recommended oral Fe supplements are ferrous or ferric salts, sulfate, fumarate, and gluconate. These preparations constitute the first line of treatment; however, the high doses administered have gastrointestinal side effects that reduce tolerance and adherence to treatment. Thus, a strategy to counteract these adverse effects is to improve the bioavailability of Fe. Therefore, piperine may benefit the absorption of Fe through its bioavailability enhancement properties. Three research studies of Fe associated with black pepper have reported improvements in parameters related to the metabolism of Fe, without adverse effects. Although more research is needed, this could represent an advance in oral Fe supplementation for physically active individuals.
Also flagged:Glaucomaoptic neuropathiesdeathvisionblindnessGlaucomas
Journal Article2020-06-24No SnippetsLu R, Soden PA, Lee E.
Show Full Abstract
Glaucoma is a group of optic neuropathies characterized by the progressive degeneration of retinal ganglion cells (RGCs). Patients with glaucoma generally experience elevations in intraocular pressure (IOP), followed by RGC death, peripheral vision loss and eventually blindness. However, despite the substantial economic and health-related impact of glaucoma-related morbidity worldwide, the surgical and pharmacological management of glaucoma is still limited to maintaining IOP within a normal range. This is in large part because the underlying molecular and biophysical mechanisms by which glaucomatous changes occur are still unclear. In the present review article, we describe current tissue-engineered models of the intraocular space that aim to advance the state of glaucoma research. Specifically, we critically evaluate and compare both 2D and 3D-culture models of the trabecular meshwork and nerve fiber layer, both of which are key players in glaucoma pathophysiology. Finally, we point out the need for novel organ-on-a-chip models of glaucoma that functionally integrate currently available 3D models of the retina and the trabecular outflow pathway.
Also flagged:Orphan G Protein Coupled ReceptorsG protein coupled receptorsGPCRssignal transductionmood disordersorphan GPCRs
Journal Article2020-06-24✓ 5 SnippetsWatkins LR, Orlandi C.
In-Text Gene Mentions
Methods)
…Validation experiments using the same method in GPR52 transfected HEK293 cells showed that reserpine selectively and dose-dependently activated GPR52 [81].…
Methods)
…OFT on a line of GPR52 KO mice showed a longer time spent in the center, suggesting a role of GPR52 in anxiety-like behaviors [81].…
Methods)
…Due to the altered expression levels, GPR52 seems to be involved in stress-related and anxiety processes, and further research could provide a more concrete understanding of this oGPCR’s neurophysiological role.…
Methods)
…Moreover, the hypothesized role of GPR52 in modulating the dopaminergic system indicates a possible involvement in the aggravating symptoms of mood disorders, such as anhedonia [4,184].…
Methods)
…However, the observed hyperactivity of the GPR52 KO mice could have played a role in such findings; therefore, further and more directed analysis of anxiety-like behaviors should be conducted.…
Show Full Abstract
G protein coupled receptors (GPCRs) are the main mediators of signal transduction in the central nervous system. Therefore, it is not surprising that many GPCRs have long been investigated for their role in the development of anxiety and mood disorders, as well as in the mechanism of action of antidepressant therapies. Importantly, the endogenous ligands for a large group of GPCRs have not yet been identified and are therefore known as orphan GPCRs (oGPCRs). Nonetheless, growing evidence from animal studies, together with genome wide association studies (GWAS) and post-mortem transcriptomic analysis in patients, pointed at many oGPCRs as potential pharmacological targets. Among these discoveries, we summarize in this review how emotional behaviors are modulated by the following oGPCRs: ADGRB2 (BAI2), ADGRG1 (GPR56), GPR3, GPR26, GPR37, GPR50, GPR52, GPR61, GPR62, GPR88, GPR135, GPR158, and GPRC5B.
Also flagged:MethylationColorectal carcinogenesisDNA methyltransferasesDNMTsgene expressionDNMT
Journal Article2020-06-24✓ 1 SnippetCervena K, Siskova A, Buchler T, Vodicka P, Vymetalkova V.
In-Text Gene Mentions
S I O 001029)
…In the study of Bhangu et al. [189], the methylation status of SEPT9, DCC, BOLL, and SFRP2 genes was established in repeated plasma samples from 34 patients with CRC liver metastasis that had undergone neoadjuvant chemotherapy.…
Show Full Abstract
Colorectal carcinogenesis (CRC) is caused by the gradual long-term accumulation of both genetic and epigenetic changes. Recently, epigenetic alterations have been included in the classification of the CRC molecular subtype, and this points out their prognostic impact. As epigenetic modifications are reversible, they may represent relevant therapeutic targets. DNA methylation, catalyzed by DNA methyltransferases (DNMTs), regulates gene expression. For many years, the deregulation of DNA methylation has been considered to play a substantial part in CRC etiology and evolution. Despite considerable advances in CRC treatment, patient therapy response persists as limited, and their profit from systemic therapies are often hampered by the introduction of chemoresistance. In addition, inter-individual changes in therapy response in CRC patients can arise from their specific (epi)genetic compositions. In this review article, we summarize the options of CRC treatment based on DNA methylation status for their predictive value. This review also includes the therapy outcomes based on the patient's methylation status in CRC patients. In addition, the current challenge of research is to develop therapeutic inhibitors of DNMT. Based on the essential role of DNA methylation in CRC development, the application of DNMT inhibitors was recently proposed for the treatment of CRC patients, especially in patients with DNA hypermethylation.
Also flagged:cfDNAV345ctDNANucleic AcidSoft tissue sarcomasmalignant tumours
Journal Article2020-06-24No SnippetsEastley N, Sommer A, Ottolini B, Neumann R, Luo JL, Hastings RK, McCulloch T, Esler CP, Shaw JA, Ashford RU, Royle NJ.
Show Full Abstract
Soft tissue sarcomas (STS) are rare, malignant tumours with a generally poor prognosis. Our aim was to explore the potential of cell free DNA (cfDNA) and circulating tumour DNA (ctDNA) analysis to track non-metastatic STS patients undergoing attempted curative treatment. The analysed cohort (<i>n</i> = 29) contained multiple STS subtypes including myxofibrosarcomas, undifferentiated pleomorphic sarcomas, leiomyosarcomas, and dedifferentiated liposarcomas amongst others. Perioperative cfDNA levels trended towards being elevated in patients (<i>p</i> = 0.07), although did not correlate with tumour size, grade, recurrence or subtype, suggesting a limited diagnostic or prognostic role. To characterise ctDNA, an amplicon panel covering three genes commonly mutated in STSs was first trialled on serial plasma collected from nine patients throughout follow-up. This approach only identified ctDNA in 2.5% (one in 40) of the analysed samples. Next custom-designed droplet digital PCR assays and Ion AmpliSeq™ panels were developed to track single nucleotide variants identified in patients' STSs by whole exome sequencing (1-6 per patient). These approaches identified ctDNA in 17% of patients. Although ctDNA was identified before radiologically detectable recurrence in two cases, the absence of demonstrable ctDNA in 83% of cases highlights the need for much work before circulating nucleic acids can become a useful means to track STS patients.
Also flagged:steroidbiosynthesisagingSalmonella infectioninfectionresponse to electric
Journal Article2020-06-24No SnippetsLi H, Liu S, Du Y, Tan J, Luo J, Sun Y.
Show Full Abstract
At present, studies on macrophage proteins mainly focus on biological stimuli, with less attention paid to the responses of macrophage proteins to physical stimuli, such as electric fields. Here, we exploited the electric field-sensitive hub proteins of macrophages. RAW 264.7 macrophages were treated with a direct current electric field (dcEF) (200 mV/mm) for four hours, followed by RNA-Seq analysis. Differentially expressed genes (DEGs) were obtained, followed by Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genomes pathway (KEGG) and protein-protein interaction (PPI) analysis. Eight qPCR-verified DEGs were selected. Subsequently, three-dimensional protein models of DEGs were modeled by Modeller and Rosetta, followed by molecular dynamics simulation for 200 ns with GROMACS. Finally, dcEFs (10, 50, and 500 mV/mm) were used to simulate the molecular dynamics of DEG proteins for 200 ns, followed by trajectory analysis. The dcEF has no obvious effect on RAW 264.7 morphology. A total of 689 DEGs were obtained, and enrichment analysis showed that the steroid biosynthesis pathway was most affected by the dcEF. Moreover, the three-dimensional protein structures of hub proteins were constructed, and trajectory analysis suggested that the dcEF caused an increase in the atomic motion of the protein in a dcEF-intensity-dependent manner. Overall, we provide new clues and a basis for investigating the hub proteins of macrophages in response to electric field stimulation.
In recent years, synthetic calcium phosphate (CaP) ceramics have emerged as an alternative to bone grafts in the treatment of large critical-sized bone defects. To successfully substitute for bone grafts, materials must be osteoinductive, that is, they must induce osteogenic differentiation and subsequent bone formation <i>in vivo</i>. Although a set of osteoinductive CaP ceramics has been developed, the precise biological mechanism by which a material directs cells toward osteogenesis and the role of individual chemical and physical properties in this mechanism remain incompletely understood. Here, we used proteomics to compare serum protein adsorption to two CaP ceramics with different osteoinductive potential, namely an osteoinductive β-tricalcium phosphate (TCP) and a non-osteoinductive hydroxyapatite (HA). Moreover, we analyzed the protein profiles of human mesenchymal stromal cells (hMSCs) cultured on these two ceramics. The serum protein adsorption experiments in the absence of cells highlighted the proteins that are highly abundant in the serum and/or have a high affinity to CaP. The extent of adsorption was suggested to be affected by the available surface area for binding and by the ion exchange dynamics on the surface. Several proteins were uniquely expressed by hMSCs on TCP and HA surfaces. Proteins identified as enriched on TCP were involved in processes related to wound healing, cell proliferation, and the production of extracellular matrix. On the other hand, proteins that were enriched on HA were involved in processes related to protein production, translation, localization, and secretion. In addition, we performed a separate proteomics analysis on TCP, HA, and two biphasic calcium phosphates with known osteoinductive potential and performed a clustering analysis on a combination of a set of proteins found to be enriched on osteoinductive materials with a set of proteins already known to be involved in osteogenesis. This yielded two protein networks potentially involved in the process of osteoinduction - one consisting of collagen fragments and collagen-related enzymes and a second consisting of endopeptidase inhibitors and regulatory proteins. The results of this study show that protein profiling can be a useful tool to help understand the effect of biomaterial properties on the interactions between a biomaterial and a biological system. Such understanding will contribute to the design and development of improved biomaterials for (bone) regenerative therapies.
Also flagged:Neoantigenspeptidescell surfaceHLAimmune responsestumor
Journal Article2020-06-24No SnippetsMutis T, Xagara A, Spaapen RM.
Show Full Abstract
For hundreds of thousands of years, the human genome has extensively evolved, resulting in genetic variations in almost every gene. Immunological reflections of these genetic variations become clearly visible after an allogeneic stem cell transplantation (allo-SCT) as minor Histocompatibility (H) antigens. Minor H antigens are peptides cleaved from genetically encoded variable protein regions after which they are presented at the cell surface by HLA molecules. After allo-SCT with minor H antigen mismatches between donor and recipient, donor T cells recognize the minor H antigens of the recipient as foreign, evoking strong alloreactive immune responses. Studies in the late eighties have discovered that a subset of minor H antigens are encoded by hematopoietic system-specific genes. After allo-SCT, this subset is strictly expressed on the hematopoietic malignant cells and was therefore the first well-defined highly immunogenic group of tumor-specific antigens. In the last decade, neoantigens derived from genetic mutations in tumors have been identified as another group of immunogenic tumor-specific antigens. Therefore, hematopoietic minor H antigens and neoantigens are therapeutic equivalents. This review will connect our current knowledge about the immune biology and identification of minor H antigens and neoantigens leading to novel conclusions on their prediction.
Also flagged:ChromosomeKallmann SyndromeX-linked ichthyosisKSchondrodysplasia punctataintellectual disability
Journal Article2020-06-24✓ 1 SnippetMa W, Mao J, Wang X, Duan L, Song Y, Lian X, Zheng J, Liu Z, Nie M, Wu X.
In-Text Gene Mentions
Introduction)
…, NTN1 ,DCC, and AMHR2…
Show Full Abstract
<h4>Background</h4>A large deletion in Xp22.3 can result in contiguous gene syndromes, including X-linked ichthyosis (XLI) and Kallmann syndrome (KS), presenting with short stature, chondrodysplasia punctata, intellectual disability, and strabismus. XLI and KS are caused by the deletion of <i>STS</i> and <i>ANOS1</i>, respectively.<h4>Method</h4>Two KS patients with XLI were screened to identify possible pathogenic mutations using whole exome sequencing. The clinical characteristics, molecular genetics, treatment outcomes, and genotype-phenotype association for each patient were analyzed.<h4>Results</h4>We identified a novel 3,923 kb deletion within the Xp22.31 region (chrX: 5810838-9733877) containing <i>STS</i>, <i>ANOS1</i>, <i>GPR143</i>, <i>NLGN4X</i>, <i>VCX-A</i>, <i>PUDP</i>, and <i>PNPLA4</i> in patient 1, who presented with KS, XLI, obesity, hyperlipidemia, and strabismus. We identified a novel 5,807 kb deletion within the Xp22.31-p22.33 regions (chrX: 2700083-8507807) containing <i>STS</i>, <i>ANOS1</i>, and other 24 genes in patient 2, who presented with KS, XLI, obesity, and strabismus. No developmental delay, abnormal speech development, or autistic behavior were noticed in either patient.<h4>Conclusion</h4>We identified two novel microdeletions in the X chromosome leading to KS and XLI. These findings contribute to the understanding of the molecular mechanisms that drive contiguous gene syndromes. Our research confirmed that the Kallmann-Ichthyosis phenotype is caused by microdeletions at the chromosome level.
Also flagged:secretionimmune responsetranslationalgene expressioncell-adhesion surfaceoxygen
Journal Article2020-06-24✓ 1 SnippetTsai AC, Jeske R, Chen X, Yuan X, Li Y.
In-Text Gene Mentions
I A O 0000615)
…SOX9, SOX5, andSOX6, as well as…
Show Full Abstract
Human mesenchymal stem cells (hMSCs) are a promising candidate in cell therapy as they exhibit multilineage differentiation, homing to the site of injury, and secretion of trophic factors that facilitate tissue healing and/or modulate immune response. As a result, hMSC-derived products have attracted growing interests in preclinical and clinical studies. The development of hMSC culture platforms for large-scale biomanufacturing is necessary to meet the requirements for late-phase clinical trials and future commercialization. Microcarriers in stirred-tank bioreactors have been widely utilized in large-scale expansion of hMSCs for translational applications because of a high surface-to-volume ratio compared to conventional 2D planar culture. However, recent studies have demonstrated that microcarrier-expanded hMSCs differ from dish- or flask-expanded cells in size, morphology, proliferation, viability, surface markers, gene expression, differentiation potential, and secretome profile which may lead to altered therapeutic potency. Therefore, understanding the bioprocessing parameters that influence hMSC therapeutic efficacy is essential for the optimization of microcarrier-based bioreactor system to maximize hMSC quantity without sacrificing quality. In this review, biomanufacturing parameters encountered in planar culture and microcarrier-based bioreactor culture of hMSCs are compared and discussed with specific focus on cell-adhesion surface (e.g., discontinuous surface, underlying curvature, microcarrier stiffness, porosity, surface roughness, coating, and charge) and the dynamic microenvironment in bioreactor culture (e.g., oxygen and nutrients, shear stress, particle collision, and aggregation). The influence of dynamic culture in bioreactors on hMSC properties is also reviewed in order to establish connection between bioprocessing and stem cell function. This review addresses fundamental principles and concepts for future design of biomanufacturing systems for hMSC-based therapy.
Also flagged:chimeric antigen receptortumormembraneinterleukin 21cytotoxicityantibody
Journal Article2020-06-24✓ 1 SnippetYang Y, Badeti S, Tseng HC, Ma MT, Liu T, Jiang JG, Liu C, Liu D.
In-Text Gene Mentions
Results)
…as CD252 andTNFSF4, a ligand for…
Show Full Abstract
Clinical success of chimeric antigen receptor (CAR) T cell immunotherapy requires the engineering of autologous T cells, which limits the broader implementation of CAR cell therapy. The development of allogeneic and universal cell products will significantly broaden their application and reduce costs. Allogeneic natural killer (NK) cells can be used for universal CAR immunotherapy. Here, we develop an alternative approach for the rapid expansion of primary NK and CAR-NK cells with superior expansion capability and <i>in vivo</i> cytotoxicity from various sources (including peripheral blood, cord blood, and tumor tissue). We apply a human B-lymphoblastoid cell-line 721.221 (hereinafter, 221)-based artificial feeder cell system with membrane-bound interleukin 21 (mIL-21) to propagate NK and CAR-NK cells. The expansion capability, purity, and cytotoxicity of NK cells expanded with 221-mIL-21 feeder cells are superior to that of conventional K562-mIL-21 feeder cells. RNA sequencing (RNA-seq) data show that 221-mIL-21 feeder cell-expanded NK cells display a less differentiated, non-exhausted, limited fratricidal, memory-like phenotype correlated with enriched metabolic pathways, which explains underlying mechanisms. Thus, "off-the-shelf" NK and CAR-NK cells with superior functionalities and expansion using a genetically modified 221-mIL-21 feeder cell expansion system will greatly support clinical use of NK immunotherapy.
Also flagged:Transcriptional Factor Yin Yang 1Breast CancerTranscription factor Yin Yang 1YY1tumorstumor
Journal Article2020-06-24✓ 4 SnippetsGuo Q, Wang T, Yang Y, Gao L, Zhao Q, Zhang W, Xi T, Zheng L.
In-Text Gene Mentions
Discussion)
…For example, PCDH17, a common tumor suppressor gene, transcriptional downregulation is mainly mediated by abnormal histone acetylation in acute leukemia.46…
Discussion)
…,41 Promoter methylation of tumor suppressor genes (TSGs) has been found to promote tumorigenesis, such as BRCA1, and PLCD1 and PCDH17 are downregulated in cancer.42…
Discussion)
…and PLCD1 andPCDH17are downregulated in…
Discussion)
…45 For example,PCDH17, a common tumor…
Show Full Abstract
Transcription factor Yin Yang 1 (YY1) is upregulated in multiple tumors and plays essential roles in tumor proliferation and metastasis. However, the function of YY1 in breast cancer stemness remains unclear. Herein, we found that YY1 expression was negatively correlated with the overall survival and relapse-free survival of breast cancer patients and positively correlated with the expression of stemness markers in breast cancer. Overexpression of YY1 increased the expression of stemness markers, elevated CD44<sup>+</sup>CD24<sup>-</sup> cell sub-population, and enhanced the capacity of cell spheroid formation and tumor-initiation. In contrast, YY1 knockdown exhibited the opposite effects. Mechanistically, YY1 decreased microRNA-873-5p (miR-873-5p) level by recruiting histone deacetylase 4 (HDAC4) and HDAC9 to miR-873-5p promoter and thus increasing the deacetylation level of miR-873-5p promoter. Sequentially, YY1 activated the downstream PI3K/AKT and ERK1/2 pathways, which have been confirmed to be suppressed by miR-873-5p in our recent work. Moreover, the suppressed effect of YY1/miR-873-5p axis on the stemness of breast cancer cells was partially dependent on PI3K/AKT and ERK1/2 pathways. Finally, it was found that the YY1/miR-873-5p axis is involved in the chemoresistance of breast cancer cells. Our study defines a novel YY1/miR-873-5p axis responsible for the stemness of breast cancer cells.
An intriguing relationship between menstrual cycle phase at the time of breast cancer surgery and clinical outcomes was first proposed in the late 1980s. Despite a number of clinical studies conducted to address this, as well as meta-analyses and systematic reviews, there remains significant controversy surrounding the effect of menstrual cycle phase at time of surgery on the prognosis of premenopausal breast cancer. While some studies have suggested that surgery performed during the luteal phase results in the most favourable outcome, other studies report the follicular phase is more favourable, and others show no association. Given the conflicting results, there remains insufficient evidence to determine whether there is an optimal time of the month to perform surgery. This issue has dogged breast cancer surgery for decades; knowledge of an optimal time of the month to conduct surgery would be a simple approach to improving patient outcomes. This review explores the potential biological mechanisms through which the hormonal milieu might contribute to differences in prognosis, and why clinical findings are so variable. It is concluded that a significant problem with current clinical research is the lack of insight from mechanistic studies. While there are a number of plausible biological mechanisms that could lead to altered survival, supporting evidence is limited. There are also variable approaches to defining the menstrual cycle phase and hormone receptor status of the tumour and few studies controlled for prognostic factors such as tumour size and stage, or addressed the impact of adjuvant treatments. Elucidation of the specific confounding factors, as well as biological mechanistic pathways that could explain the potential relationship between timing of surgery and survival, will greatly assist in designing robust well-controlled prospective clinical studies to evaluate this paradigm.
bioRxiv2020-06-24Preprint (No Snippets API)Verstockt B, Verstockt S, Rahiman SA, Ke B, Arnauts K, Cleynen I, Sabino J, Ferrante M, Matteoli G, Vermeire S.
Show Full Abstract
<h4>ABSTRACT</h4> Patients with IBD are considered immunosuppressed, but do not seem more vulnerable for COVID-19. Nevertheless, intestinal inflammation has shown an important risk factor for SARS-CoV-2 infection and prognosis. Therefore, we investigated the effect of intestinal inflammation on the viral intestinal entry mechanisms, including ACE2 , in IBD. We collected (un)inflamed mucosal biopsies from CD (n=193) and UC (n=158) patients, and 51 matched non-IBD controls for RNA sequencing, differential gene expression and co-expression analysis. Organoids from UC patients were subjected to an inflammatory mix and processed for RNA sequencing. Transmural ileal biopsies were processed for single-cell (sc) sequencing. Publicly available colonic sc-RNA sequencing data, and microarrays from tissue pre/post anti-TNF therapy, were analyzed. In inflamed CD ileum, ACE2 was significantly decreased compared to control ileum (p=4.6E-07), whereas colonic ACE2 expression was higher in inflamed colon of CD/UC compared to control (p=8.3E-03; p=1.9E-03). Sc-RNA sequencing confirmed this ACE2 dysregulation, and exclusive epithelial ACE2 expression. Network analyses highlighted HNF4A as key regulator of ileal ACE2 , while pro-inflammatory cytokines and interferon regulating factors regulated colonic ACE2. Inflammatory stimuli upregulated ACE2 in UC organoids (p=1.7E-02), not in non-IBD controls (p=9.1E-01). Anti-TNF therapy restored colonic ACE2 dysregulation in responders. Intestinal inflammation alters SARS-CoV-2 coreceptors in the intestine, with opposing effects in ileum and colon. HNF4A , an IBD susceptibility gene, is an important upstream regulator of ACE2 in ileum, whereas interferon signaling dominates in colon. Our data support the importance of adequate control of IBD in order to reduce risk of (complicated) COVID-19.
bioRxiv2020-06-24Preprint (No Snippets API)Giobbe GG, Bonfante F, Zambaiti E, Gagliano O, Jones BC, Luni C, Laterza C, Perin S, Stuart HT, Pagliari M, Bortolami A, Mazzetto E, Manfredi A, Colantuono C, Di Filippo L, Pellegata A, Li VSW, Eaton S, Thapar N, Cacchiarelli D, Elvassore N, De Coppi P.
Show Full Abstract
Coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) infection is a global public health emergency. COVID-19 typically manifests as a respiratory illness but an increasing number of clinical reports describe gastrointestinal (GI) symptoms. This is particularly true in children in whom GI symptoms are frequent and viral shedding outlasts viral clearance from the respiratory system. By contrast, fetuses seem to be rarely affected by COVID-19, although the virus has been detected in placentas of affected women. These observations raise the question of whether the virus can infect and replicate within the stomach once ingested. Moreover, it is not yet clear whether active replication of SARS-CoV-2 is possible in the stomach of children or in fetuses at different developmental stages. Here we show the novel derivation of fetal gastric organoids from 8-21 post-conception week (PCW) fetuses, and from pediatric biopsies, to be used as an in vitro model for SARS-CoV-2 gastric infection. Gastric organoids recapitulate human stomach with linear increase of gastric mucin 5AC along developmental stages, and expression of gastric markers pepsinogen, somatostatin, gastrin and chromogranin A. In order to investigate SARS-CoV-2 infection with minimal perturbation and under steady-state conditions, we induced a reversed polarity in the gastric organoids (RP-GOs) in suspension. In this condition of exposed apical polarity, the virus can easily access viral receptor angiotensin-converting enzyme 2 (ACE2). The pediatric RP-GOs are fully susceptible to infection with SARS-CoV-2, where viral nucleoprotein is expressed in cells undergoing programmed cell death, while the efficiency of infection is significantly lower in fetal organoids. The RP-GOs derived from pediatric patients show sustained robust viral replication of SARS-CoV-2, compared with organoids derived from fetal stomachs. Transcriptomic analysis shows a moderate innate antiviral response and the lack of differentially expressed genes belonging to the interferon family. Collectively, we established the first expandable human gastric organoid culture across fetal developmental stages, and we support the hypothesis that fetal tissue seems to be less susceptible to SARS-CoV-2 infection, especially in early stages of development. However, the virus can efficiently infect gastric epithelium in pediatric patients, suggesting that the stomach might have an active role in fecal-oral transmission of SARS-CoV-2.
Also flagged:pituitary insufficiencyPIsexual dysfunctionpituitary adenomaPituitary macroadenomapituitary tumors
Journal Article2020-06-23✓ 1 SnippetBeysel S, Çalişkan M, Kizilgül M, Kan S, Özbek M, Çakal E.
In-Text Gene Mentions
Discussion)
…as having neurosarcoidosis,hemochromatosis, and cranial diabetes…
Show Full Abstract
<h4>Background/aim</h4>This retrospective study aimed to investigate the clinical profile of pituitary insufficiency (PI) in adult population.<h4>Materials and methods</h4>One hundred and fifty patients who were diagnosed as having PI between 2012 and 2018 (53.3% female, mean age 48.13 ± 15.83 years) were retrospectively analyzed.<h4>Results</h4>Age at diagnosis was higher in females as compared with males (51.13 ± 15.95 vs. 44.70 ± 15.08 years, P = 0.012). The most frequent presenting signs were headache (29.4%) and visual disturbance (19.6%) in general. Females frequently presented with headache (33.3%), whereas males presented with sexual dysfunction (34.4%). The most frequent cause of PI was nonfunctional pituitary adenoma (28.8%) in general population. A frequent cause of PI was Sheehan’s syndrome (33.8%) among females and nonfunctional pituitary adenoma (38.6%) among males. Pituitary macroadenoma (75.8%) was frequent in pituitary tumors with PI. 55.3 % of the patients had 4 pituitary hormones deficiencies and 26.0% of patients had 3 pituitary hormones deficiencies. Gonadotropin deficiency was the leading pituitary hormone deficiency. The frequency of posttraumatic PI was 4.7% in the general population.<h4>Conclusion</h4>Nonfunctional pituitary adenoma was the most common cause of PI among males and Sheehan’s syndrome was a major etiologic factor in females. Sheehan’s syndrome remains an important health problem in Turkey although obstetric care has improved. Posttraumatic PI should be considered in the differential diagnosis of idiopathic PI.
Also flagged:glioblastoma multiformeGBMcancerstumortumorsnanoparticle
Journal Article2020-06-23✓ 1 SnippetReichel D, Sagong B, Teh J, Zhang Y, Wagner S, Wang H, Chung LWK, Butte P, Black KL, Yu JS, Perez JM.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
Despite significant efforts to improve glioblastoma multiforme (GBM) treatment, GBM remains one of the most lethal cancers. Effective GBM treatments require sensitive intraoperative tumor visualization and effective postoperative chemotherapeutic delivery. Unfortunately, the diffusive and infiltrating nature of GBM limits the detection of GBM tumors, and current intraoperative visualization methods limit complete tumor resection. In addition, although chemotherapy is often used to eliminate any cancerous tissue remaining after surgery, most chemotherapeutic drugs do not effectively cross the brain-blood barrier (BBB) or enter GBM tumors. As a result, GBM has limited treatment options with high recurrence rates, and methods that improve its complete visualization during surgery and treatment are needed. Herein, we report a fluorescent nanoparticle platform for the near-infrared fluorescence (NIRF)-based tumor boundary visualization and image-guided drug delivery into GBM tumors. Our nanoplatform is based on ferumoxytol (FMX), an FDA-approved magnetic resonance imaging-sensitive superparamagnetic iron oxide nanoparticle, which is conjugated with hepthamethine cyanine (HMC), a NIRF ligand that specifically targets the organic anion transporter polypeptides that are overexpressed in GBM. We have shown that HMC-FMX nanoparticles cross the BBB and selectively accumulate in the tumor using orthotopic GBM mouse models, enabling NIRF-based visualization of infiltrating tumor tissue. In addition, HMC-FMX can encapsulate chemotherapeutic drugs, such as paclitaxel or cisplatin, and deliver these agents into GBM tumors, reducing tumor size and increasing survival. Taken together, these observations indicate that HMC-FMX is a promising nanoprobe for GBM surgical visualization and drug delivery.
Also flagged:leukodystrophiesmyelinTUBB4ALeukodystrophyVanishing White MatterPelizaeus-Merzbacher Disease
Journal Article2020-06-23No SnippetsSchmidt JL, Pizzino A, Nicholl J, Foley A, Wang Y, Rosenfeld JA, Mighion L, Bean L, da Silva C, Cho MT, Truty R, Garcia J, Speare V, Blanco K, Powis Z, Hobson GM, Kirwin S, Krock B, Lee H, Deignan JL, Westemeyer MA, Subaran RL, Thiffault I, Tsai EA, Fang T, Helman G, Vanderver A.
Show Full Abstract
Leukodystrophies are a heterogeneous group of heritable disorders characterized by abnormal brain white matter signal on magnetic resonance imaging (MRI) and primary involvement of the cellular components of myelin. Previous estimates suggest the incidence of leukodystrophies as a whole to be 1 in 7,000 individuals, however the frequency of specific diagnoses relative to others has not been described. Next generation sequencing approaches offer the opportunity to redefine our understanding of the relative frequency of different leukodystrophies. We assessed the relative frequency of all 30 leukodystrophies (associated with 55 genes) in more than 49,000 exomes. We identified a relatively high frequency of disorders previously thought of as very rare, including Aicardi Goutières Syndrome, TUBB4A-related leukodystrophy, Peroxisomal biogenesis disorders, POLR3-related Leukodystrophy, Vanishing White Matter, and Pelizaeus-Merzbacher Disease. Despite the relative frequency of these conditions, carrier-screening laboratories regularly test only 20 of the 55 leukodystrophy-related genes, and do not test at all, or test only one or a few, genes for some of the higher frequency disorders. Relative frequency of leukodystrophies previously considered very rare suggests these disorders may benefit from expanded carrier screening.
Also flagged:ASCL1transcription factorscell cyclebrain tumorsGlioblastomastumor
Journal Article2020-06-23✓ 3 SnippetsVue TY, Kollipara RK, Borromeo MD, Smith T, Mashimo T, Burns DK, Bachoo RM, Johnson JE.
In-Text Gene Mentions
Introduction)
…NFIA, NKX2.2, OLIG2,POU3F2, SALL2, SOX2, and…
Results)
…, SOX4 ,SOX6, SOX8 ,…
Results)
…domain genes (POU3F2, POU3F3 ,…
Show Full Abstract
Glioblastomas (GBMs) are incurable brain tumors with a high degree of cellular heterogeneity and genetic mutations. Transcription factors that normally regulate neural progenitors and glial development are aberrantly coexpressed in GBM, conferring cancer stem-like properties to drive tumor progression and therapeutic resistance. However, the functional role of individual transcription factors in GBMs in vivo remains elusive. Here, we demonstrate that the basic-helix-loop-helix transcription factor ASCL1 regulates transcriptional targets that are central to GBM development, including neural stem cell and glial transcription factors, oncogenic signaling molecules, chromatin modifying genes, and cell cycle and mitotic genes. We also show that the loss of ASCL1 significantly reduces the proliferation of GBMs induced in the brain of a genetically relevant glioma mouse model, resulting in extended survival times. RNA-seq analysis of mouse GBM tumors reveal that the loss of ASCL1 is associated with downregulation of cell cycle genes, illustrating an important role for ASCL1 in controlling the proliferation of GBM.
<h4>Introduction</h4>Variability exists in the disease trajectories of Alzheimer's disease (AD) patients. We performed a genome-wide association study to examine rate of cognitive decline (ROD) in patients with AD.<h4>Methods</h4>We tested for interactions between genetic variants and time since diagnosis to predict the ROD of a composite cognitive score in 3946 AD cases and performed pathway analysis on the top genes.<h4>Results</h4>Suggestive associations (P < 1.0 × 10<sup>-6</sup> ) were observed on chromosome 15 in DNA polymerase-γ (rs3176205, P = 1.11 × 10<sup>-7</sup> ), chromosome 7 (rs60465337,P = 4.06 × 10<sup>-7</sup> ) in contactin-associated protein-2, in RP11-384F7.1 on chromosome 3 (rs28853947, P = 5.93 × 10<sup>-7</sup> ), family with sequence similarity 214 member-A on chromosome 15 (rs2899492, P = 5.94 × 10<sup>-7</sup> ), and intergenic regions on chromosomes 16 (rs4949142, P = 4.02 × 10<sup>-7</sup> ) and 4 (rs1304013, P = 7.73 × 10<sup>-7</sup> ). Significant pathways involving neuronal development and function, apoptosis, memory, and inflammation were identified.<h4>Discussion</h4>Pathways related to AD, intelligence, and neurological function determine AD progression, while previously identified AD risk variants, including the apolipoprotein (APOE) ε4 and ε2 variants, do not have a major impact.
<h4>Background</h4>Splicing is crucial for proper gene expression, and is predominately executed by the major spliceosome. Conversely, 722 introns in 699 human minor intron-containing genes (MIGs) are spliced by the minor spliceosome. Splicing of these minor introns is disrupted in diseases caused by pathogenic variants in the minor spliceosome, ultimately leading to the aberrant expression of a subset of these MIGs. However, the effect of variants in minor introns and MIGs on diseases remains unexplored.<h4>Methods</h4>Variants in MIGs and associated clinical manifestations were identified using ClinVar. The HPO database was then used to curate the related symptoms and affected organ systems.<h4>Results</h4>We found pathogenic variants in 211 MIGs, which commonly resulted in intellectual disability, seizures and microcephaly. This revealed a subset of MIGs whose aberrant splicing may contribute to the pathogenesis of minor spliceosome-related diseases. Moreover, we identified 51 pathogenic variants in minor intron splice sites that reduce the splice site strength and can induce alternative splicing.<h4>Conclusion</h4>These findings highlight that disrupted minor intron splicing has a broader impact on human diseases than previously appreciated. The hope is that this knowledge will aid in the development of therapeutic strategies that incorporate the minor intron splicing pathway.
Chondrocytes, comparable to many cells from the connective tissue, dedifferentiate and end up in a similar fibroblastoid cell type, marked by the loss of the specific expression pattern. Here, chondrocytes isolated from osteoarthritic (OA) patients were investigated. The OA chondrocytes used in this work were not affected by the loss of specific gene expression upon cell culture. The mRNA levels of known cartilage markers, such as SOX5, SOX6, SOX9, aggrecan and proteoglycan 4, remained unchanged. Since chondrocytes from OA and healthy tissue show different DNA methylation patterns, the underlying mechanisms of cartilage marker maintenance were investigated with a focus on the epigenetic modification by DNA methylation. The treatment of dedifferentiated chondrocytes with the DNA methyltransferase inhibitor 5-aza-2´-deoxycytidine (5-aza-dC) displayed no considerable impact on the maintenance of marker gene expression observed in the dedifferentiated state, while the chondrogenic differentiation capacity was compromised. On the other hand, the pre-cultivation with 5-aza-dC improved the osteogenesis and adipogenesis of OA chondrocytes. Contradictory to these effects, the DNA methylation levels were not reduced after treatment for four weeks with 1 μM 5-aza-dC. In conclusion, 5-aza-dC affects the differentiation capacity of OA chondrocytes, while the global DNA methylation level remains stable. Furthermore, dedifferentiated chondrocytes isolated from late-stage OA patients represent a reliable cell source for in vitro studies and disease models without the need for additional alterations.
Also flagged:Huntingtinstriatal atrophymembraneHDpathogenesisautosomal dominant neurodegenerative disorder
Journal Article2020-06-23✓ 5 SnippetsGoodliffe J, Rubakovic A, Chang W, Pathak D, Luebke J.
In-Text Gene Mentions
Introduction)
…Recently, mouse models have been developed that enable more detailed dissection of the functional role of different domains of the Htt gene in HD pathogenesis, including the polyQ expansion, the polyproline domain, and the N-terminal 17 amino acid domain (N17).…
Discussion)
…While it is hypothesized that changes to channel gene expression underlie many of the physiological abnormalities reported in mouse models of HD, it is clear that the deletion of the N17 domain results in changes to gene expression in BACHD mice [48], the Q31 (BACWTΔN17) model may also experience changes at the genomic level and future studies of this model may be useful in understanding how the various domains of the Htt gene influence transcription.…
Abstract)
…Together this study indicates that N17 plays a role in the modulation of the properties of MSNs in both mHtt and WT-Htt mice, but does not markedly exacerbate HD-like pathogenesis in the BACHD model.…
Discussion)
…Together, our findings are consistent with the notion that N17 plays a role in modifying the functions of both WT Htt and mutant Htt in this mouse model of HD.…
Introduction)
…Huntington’s Disease (HD) is an autosomal dominant neurodegenerative disorder caused by CAG repeat expansion in exon 1 of the Huntingtin gene (Htt) [1].…
Show Full Abstract
In the BACHD mouse model of Huntington's disease (HD), deletion of the N17 domain of the Huntingtin gene (BACHDΔN17, Q97) has been reported to lead to nuclear accumulation of mHTT and exacerbation of motor deficits, neuroinflammation and striatal atrophy (Gu et al., 2015). Here we characterized the effect of N17 deletion on dorsolateral striatal medium spiny neurons (MSNs) in BACHDΔN17 (Q97) and BACWTΔN17 (Q31) mice by comparing them to MSNs in wildtype (WT) mice. Mice were characterized on a series of motor tasks and subsequently whole cell patch clamp recordings with simultaneous biocytin filling of MSNs in in vitro striatal slices from these mice were used to comprehensively assess their physiological and morphological features. Key findings include that: Q97 mice exhibit impaired gait and righting reflexes but normal tail suspension reflexes and normal coats while Q31 mice do not differ from WT; intrinsic membrane and action potential properties are altered -but differentially so- in MSNs from Q97 and from Q31 mice; excitatory and inhibitory synaptic currents exhibit higher amplitudes in Q31 but not Q97 MSNs, while excitatory synaptic currents occur at lower frequency in Q97 than in WT and Q31 MSNs; there is a reduced total dendritic length in Q31 -but not Q97- MSNs compared to WT, while spine density and number did not differ in MSNs in the three groups. The findings that Q31 MSNs differed from Q97 and WT neurons with regard to some physiological features and structurally suggest a novel role of the N17 domain in the function of WT Htt. The motor phenotype seen in Q97 mice was less robust than that reported in an earlier study (Gu et al., 2015), and the alterations to MSN physiological properties were largely consistent with changes reported previously in a number of other mouse models of HD. Together this study indicates that N17 plays a role in the modulation of the properties of MSNs in both mHtt and WT-Htt mice, but does not markedly exacerbate HD-like pathogenesis in the BACHD model.
Also flagged:SepsisGene Expressionpediatric sepsisStaphylococcus aureus infectionstarchsucrose
Journal Article2020-06-23No SnippetsXie K, Kong S, Li F, Zhang Y, Wang J, Zhao W.
Show Full Abstract
BACKGROUND Sepsis is an extremely common health issue with a considerable mortality rate in children. Our understanding about the pathogenic mechanisms of sepsis is limited. The aim of this study was to identify the differential expression genes (DEGs) in pediatric sepsis through comprehensive analysis, and to provide specific insights for the clinical sepsis therapies in children. MATERIAL AND METHODS Three pediatric gene expression profiles (GSE25504, GSE26378, GSE26440) were downloaded from the Gene Expression Omnibus (GEO) database. The difference expression genes (DEGs) between pediatric sepsis and normal control group were screened with the GEO2R online tool. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses of the DEGs were performed. Cytoscape with CytoHubba were used to identify the hub genes. Finally, NetworkAnalyst was used to construct the targeted microRNAs (miRNAs) of the hub genes. RESULTS Totally, 160 overlapping upward genes and 61 downward genes were identified. In addition, 5 KEGG pathways, including hematopoietic cell lineage, Staphylococcus aureus infection, starch and sucrose metabolism, osteoclast differentiation, and tumor necrosis factor (TNF) signaling pathway, were significantly enriched using a database for labeling, visualization, and synthetic discovery. In combination with the results of the protein-protein interaction (PPI) network and CytoHubba, 9 hub genes including ITGAM, TLR8, IL1ß, MMP9, MPO, FPR2, ELANE, SPI1, and C3AR1 were selected. Combined with DEG-miRNAs visualization, 5 miRNAs, including has-miR-204-5p, has-miR-211-5p, has-miR-590-5p, and has-miR-21-5p, were predicted as possibly the key miRNAs. CONCLUSIONS Our findings will contribute to identification of potential biomarkers and novel strategies for pediatric sepsis treatment.
Also flagged:ZNF322AphosphorylationautophagosomeIRS1AKTglucose
Journal Article2020-06-23No SnippetsCheung CHY, Hsu CL, Lin TY, Chen WT, Wang YC, Huang HC, Juan HF.
Show Full Abstract
<h4>Background</h4>ZNF322A is an oncogenic transcription factor that belongs to the Cys2His2-type zinc-finger protein family. Accumulating evidence suggests that ZNF322A may contribute to the tumorigenesis of lung cancer, however, the ZNF322A-mediated downstream signaling pathways remain unknown.<h4>Methods</h4>To uncover ZNF322A-mediated functional network, we applied phosphopeptide enrichment and isobaric labeling strategies with mass spectrometry-based proteomics using A549 lung cancer cells, and analyzed the differentially expressed proteins of phosphoproteomic and proteomic profiles to determine ZNF322A-modulated pathways.<h4>Results</h4>ZNF322A highlighted a previously unidentified insulin signaling, heat stress, and signal attenuation at the post-translational level. Consistently, protein-phosphoprotein-kinase interaction network analysis revealed phosphorylation of IRS1 and HSP27 were altered upon ZNF322A-silenced lung cancer cells. Thus, we further investigated the molecular regulation of ZNF322A, and found the inhibitory transcriptional regulation of ZNF322A on PIM3, which was able to phosphorylate IRS1 at serine<sup>1101</sup> in order to manipulate glucose uptake via the PI3K/AKT/mTOR signaling pathway. Moreover, ZNF322A also affects the unfolded protein response by phosphorylation of HSP27<sup>S82</sup> and eIF2a<sup>S51</sup>, and triggers autophagosome formation in lung cancer cells.<h4>Conclusions</h4>These findings not only give new information about the molecular regulation of the cellular proteins through ZNF322A at the post-translational level, but also provides a resource for the study of lung cancer therapy.
Repulsive guidance molecules (RGMs) are cell surface proteins that regulate the development and homeostasis of many tissues and organs, including the nervous, skeletal, and immune systems. They control fundamental biological processes, such as migration and differentiation by direct interaction with the Neogenin (NEO1) receptor and function as coreceptors for the bone morphogenetic protein (BMP)/growth differentiation factor (GDF) family. We determined crystal structures of all three human RGM family members in complex with GDF5, as well as the ternary NEO1-RGMB-GDF5 assembly. Surprisingly, we show that all three RGMs inhibit GDF5 signaling, which is in stark contrast to RGM-mediated enhancement of signaling observed for other BMPs, like BMP2. Despite their opposite effect on GDF5 signaling, RGMs occupy the BMP type 1 receptor binding site similar to the observed interactions in RGM-BMP2 complexes. In the NEO1-RGMB-GDF5 complex, RGMB physically bridges NEO1 and GDF5, suggesting cross-talk between the GDF5 and NEO1 signaling pathways. Our crystal structures, combined with structure-guided mutagenesis of RGMs and BMP ligands, binding studies, and cellular assays suggest that RGMs inhibit GDF5 signaling by competing with GDF5 type 1 receptors. While our crystal structure analysis and in vitro binding data initially pointed towards a simple competition mechanism between RGMs and type 1 receptors as a possible basis for RGM-mediated GDF5 inhibition, further experiments utilizing BMP2-mimicking GDF5 variants clearly indicate a more complex mechanism that explains how RGMs can act as a functionality-changing switch for two structurally and biochemically similar signaling molecules.
Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 differentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in differentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream effector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer.
Also flagged:Chronic Pelvic Pain SyndromeEnoKidney DiseasesCCRPDiabetesDPT
Journal Article2020-06-23No SnippetsClemens JQ, Kutch JJ, Mayer EA, Naliboff BD, Rodriguez LV, Klumpp DJ, Schaeffer AJ, Kreder KJ, Clauw DJ, Harte SE, Schrepf AD, Williams DA, Andriole GL, Lai HH, Buchwald D, Lucia MS, van Bokhoven A, Mackey S, Moldwin RM, Pontari MA, Stephens-Shields AJ, Mullins C, Landis JR.
Show Full Abstract
<h4>Aims</h4>The Multidisciplinary Approach to the Study of Chronic Pelvic Pain (MAPP) Research Network initiated a second observational cohort study-the Symptom Patterns Study (SPS)-to further investigate the underlying pathophysiology of Urologic Chronic Pelvic Pain Syndrome (UCPPS) and to discover factors associated with longitudinal symptom changes and responses to treatments.<h4>Methods</h4>This multisite cohort study of males and females with UCPPS features a run-in period of four weekly web-based symptom assessments before a baseline visit, followed by quarterly assessments up to 36 months. Controls were also recruited and assessed at baseline and 6 months. Extensive clinical data assessing urological symptoms, nonurological pain, chronic overlapping pain syndromes, and psychosocial factors were collected. Diverse biospecimens for biomarker and microbiome studies, quantitative sensory testing (QST) data under multiple stimuli, and structural and functional neuroimaging scans were obtained under a standardized protocol.<h4>Results</h4>Recruitment was initiated (July 2015) and completed (February 2019) at six discovery sites. A total of 620 males and females with UCPPS and 73 Controls were enrolled, including 83 UCPPS participants who re-enrolled from the first MAPP Network cohort study (2009-2012). Baseline neuroimaging scans, QST measures, and biospecimens were obtained on 578 UCPPS participants. The longitudinal follow-up of the cohort is ongoing.<h4>Conclusions</h4>This comprehensive characterization of a large UCPPS cohort with extended follow-up greatly expands upon earlier MAPP Network studies and provides unprecedented opportunities to increase our understanding of UCPPS pathophysiology, factors associated with symptom change, clinically relevant patient phenotypes, and novel targets for future interventions.
…disorders, such ashemochromatosisand iron refractory…
Text
…Hfe…
Text
…hemochromatosis…
Show Full Abstract
The bone morphogenetic protein (BMP)-SMAD signaling pathway plays a central role in regulating hepcidin, which is the master hormone governing systemic iron homeostasis. Hepcidin is produced by the liver and acts on the iron exporter ferroportin to control iron absorption from the diet and iron release from body stores, thereby providing adequate iron for red blood cell production, while limiting the toxic effects of excess iron. BMP6 and BMP2 ligands produced by liver endothelial cells bind to BMP receptors and the coreceptor hemojuvelin (HJV) on hepatocytes to activate SMAD1/5/8 signaling, which directly upregulates hepcidin transcription. Most major signals that influence hepcidin production, including iron, erythropoietic drive, and inflammation, intersect with the BMP-SMAD pathway to regulate hepcidin transcription. Mutation or inactivation of BMP ligands, BMP receptors, HJV, SMADs or other proteins that modulate the BMP-SMAD pathway result in hepcidin dysregulation, leading to iron-related disorders, such as hemochromatosis and iron refractory iron deficiency anemia. Pharmacologic modulators of the BMP-SMAD pathway have shown efficacy in pre-clinical models to regulate hepcidin expression and treat iron-related disorders. This review will discuss recent insights into the role of the BMP-SMAD pathway in regulating hepcidin to control systemic iron homeostasis.
Also flagged:Histone DeacetylasesHistoneschromatinHistonegene expressionhistone acetyltransferases
Journal Article2020-06-23✓ 1 SnippetVerza FA, Das U, Fachin AL, Dimmock JR, Marins M.
In-Text Gene Mentions
Introduction)
…and H4, andlinker histoneshistones (H1/H5) […
Show Full Abstract
Histones are the main structural proteins of eukaryotic chromatin. Histone acetylation/ deacetylation are the epigenetic mechanisms of the regulation of gene expression and are catalyzed by histone acetyltransferases (HAT) and histone deacetylases (HDAC). These epigenetic alterations of DNA structure influence the action of transcription factors which can induce or repress gene transcription. The HATs catalyze acetylation and the events related to gene transcription and are also responsible for transporting newly synthesized histones from the cytoplasm to the nucleus. The activity of HDACs is mainly involved in silencing gene expression and according to their specialized functions are divided into classes I, II, III and IV. The disturbance of the expression and mutations of HDAC genes causes the aberrant transcription of key genes regulating important cancer pathways such as cell proliferation, cell-cycle regulation and apoptosis. In view of their role in cancer pathways, HDACs are considered promising therapeutic targets and the development of HDAC inhibitors is a hot topic in the search for new anticancer drugs. The present review will focus on HDACs I, II and IV, the best known inhibitors and potential alternative inhibitors derived from natural and synthetic products which can be used to influence HDAC activity and the development of new cancer therapies.
Also flagged:MAPERKmicrotubule-associated protein kinaseextracellular regulated kinaseMAPKextracellular information transduction
Journal Article2020-06-23No SnippetsAlbert-Gascó H, Ros-Bernal F, Castillo-Gómez E, Olucha-Bordonau FE.
Show Full Abstract
The signaling pathway of the microtubule-associated protein kinase or extracellular regulated kinase (MAPK/ERK) is a common mechanism of extracellular information transduction from extracellular stimuli to the intracellular space. The transduction of information leads to changes in the ongoing metabolic pathways and the modification of gene expression patterns. In the central nervous system, ERK is expressed ubiquitously, both temporally and spatially. As for the temporal ubiquity, this signaling system participates in three key moments: (i) Embryonic development; (ii) the early postnatal period; and iii) adulthood. During embryonic development, the system is partly responsible for the patterning of segmentation in the encephalic vesicle through the FGF8-ERK pathway. In addition, during this period, ERK directs neurogenesis migration and the final fate of neural progenitors. During the early postnatal period, ERK participates in the maturation process of dendritic trees and synaptogenesis. During adulthood, ERK participates in social and emotional behavior and memory processes, including long-term potentiation. Alterations in mechanisms related to ERK are associated with different pathological outcomes. Genetic alterations in any component of the ERK pathway result in pathologies associated with neural crest derivatives and mental dysfunctions associated with autism spectrum disorders. The MAP-ERK pathway is a key element of the neuroinflammatory pathway triggered by glial cells during the development of neurodegenerative diseases, such as Parkinson's and Alzheimer's disease, Huntington's disease, and amyotrophic lateral sclerosis, as well as prionic diseases. The process triggered by MAPK/ERK activation depends on the stage of development (mature or senescence), the type of cellular element in which the pathway is activated, and the anatomic neural structure. However, extensive gaps exist with regards to the targets of the phosphorylated ERK in many of these processes.
Also flagged:anemiaNeonatal anemianeonatal jaundicepolycythemiapostpartum hemorrhagegestation
Journal Article2020-06-23No SnippetsSongthamwat M, Witsawapaisan P, Tanthawat S, Songthamwat S.
Show Full Abstract
<h4>Objective</h4>To compare the effect of delayed cord clamping at 30 seconds and 1 minute on the incidence of neonatal hematocrit, anemia, maternal and neonatal complications in term cesarean delivered neonates.<h4>Methods</h4>An opened labelled, randomized controlled trial was undertaken. The 160 healthy term cesarean-born neonates were randomly allocated to either 30 seconds or 1-minute groups of delayed cord clamping (DCC) (groups 1 and 2). Neonatal venous hematocrit (Hct) and microbilirubin (Mb) were measured at 48-72 hours after birth.<h4>Results</h4>One hundred and fifty-nine neonates completed this study. Mean neonatal hematocrit ± standard deviation at 48-72 hours was 49.9 ± 6.0% in group 1 and 51.2 ± 5.9% in group 2 without a statistical difference. Neonatal anemia (Hct less than 45%) occurred in 14/79 neonates (17.7%) in group 1 and in 8/80 cases (10.0%) in group 2 without a significant difference between groups. The incidence of neonatal jaundice and polycythemia (hematocrit more than 65%) was similar between groups. There were no significant differences; in the estimated blood loss during the operation, the incidence of postpartum hemorrhage and other maternal and neonatal complications.<h4>Conclusion</h4>Neonatal hematocrit was not significantly different following DCC at 30 seconds and at 1 minute, but the incidence of neonatal anemia decreased with the longer timing of DCC. The estimated blood loss and other complications were not different between the two groups. Therefore, one minute-DCC should be considered for neonatal anemic prevention when compared with 30 seconds-DCC.
Also flagged:mitochondrialMitochondriametabolismcalciumimmune responsesneurodegenerative diseases
Journal Article2020-06-23✓ 2 SnippetsYan X, Wang B, Hu Y, Wang S, Zhang X.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease is caused by trinucleotide repeats of CAG (36 repeats or more) on the short arm of chromosome 4p16.3 in the Huntingtin (Htt) gene (MacDonald et al., 1993).…
S I O 001029)
…Notably, intracellular aggregates of elongated Htt, a well-established autophagy substrate, were significantly decreased by memantine.…
Show Full Abstract
Neurodegenerative diseases, including Alzheimer's, Parkinson's, Huntington's, and amyotrophic lateral sclerosis, are characterized by a progressive loss of selective neuron subtypes in the central nervous system (CNS). Although various factors account for the initiation and development of these diseases, accumulating evidence shows that impaired mitochondrial function is a prominent and common mechanism. Mitochondria play a critical role in neurons and are involved in energy production, cellular metabolism regulation, intracellular calcium homeostasis, immune responses, and cell fate. Thus, cells in the CNS heavily rely on mitochondrial integrity. Many aspects of mitochondrial dysfunction are manifested in neurodegenerative diseases, including aberrant mitochondrial quality control (mitoQC), mitochondrial-driven inflammation, and bioenergetic defects. Herein, we briefly summarize the molecular basis of mitoQC, including mitochondrial proteostasis, biogenesis, dynamics, and organelle degradation. We also focus on the research, to date, regarding aberrant mitoQC and mitochondrial-driven inflammation in several common neurodegenerative diseases. In addition, we outline novel therapeutic strategies that target aberrant mitoQC in neurodegenerative diseases.
Plasmids can provide advantageous traits to host bacteria, although they may impose a fitness cost. Chromosome-encoded factors are important for regulating the expression of genes on plasmids, and host chromosomes may differ in terms of their interactions with a given plasmid. Accordingly, differences in fitness cost loading and compensatory co-evolution may occur for various host chromosome/plasmid combinations. However, the mechanisms of compensatory evolution are highly divergent and require further insights. Here, we reveal novel evolutionally mechanisms of <i>Pseudomonas putida</i> KT2440 to improve the fitness cost imposed by the incompatibility P-1 (IncP-1) multidrug resistance plasmid RP4. A mixed culture of RP4-harboring and -free KT2440 cells was serially transferred every 24 h under non-selective conditions. Initially, the proportion of RP4-harboring cells decreased rapidly, but it immediately recovered, suggesting that the fitness of RP4-harboring strains improved during cultivation. Larger-sized colonies appeared during 144-h mixed culture, and evolved strains isolated from larger-sized colonies showed higher growth rates and fitness than those of the ancestral strain. Whole-genome sequencing revealed that evolved strains had one of two mutations in the same intergenic region of the chromosome. Based on the research of another group, this region is predicted to contain a stress-inducible small RNA (sRNA). Identification of the transcriptional start site in this sRNA indicated that one mutation occurred within the sRNA region, whereas the other was in its promoter region. Quantitative reverse-transcription PCR showed that the expression of this sRNA was strongly induced by RP4 carriage in the ancestral strain but repressed in the evolved strains. When the sRNA region was overexpressed in the RP4-free strain, the fitness decreased, and the colony size became smaller. Using transcriptome analysis, we also showed that the genes involved in amino acid metabolism and stress responses were differentially transcribed by overexpression of the sRNA region. These results indicate that the RP4-inducible chromosomal sRNA was responsible for the fitness cost of RP4 on KT2440 cells, where this sRNA is of key importance in host evolution toward rapid amelioration of the cost.
…Interestingly, mutations in FBXL4 cause a mitochondrial disease characterized by a clinical syndrome that includes epilepsy (67).…
Show Full Abstract
Seizure patterns observed in patients with epilepsy suggest that circadian rhythms and sleep/wake mechanisms play some role in the disease. This review addresses key topics in the relationship between circadian rhythms and seizures in epilepsy. We present basic information on circadian biology, but focus on research studying the influence of both the time of day and the sleep/wake cycle as independent but related factors on the expression of seizures in epilepsy. We review studies investigating how seizures and epilepsy disrupt expression of core clock genes, and how disruption of clock mechanisms impacts seizures and the development of epilepsy. We focus on the overlap between mechanisms of circadian-associated changes in SCN neuronal excitability and mechanisms of epileptogenesis as a means of identifying key pathways and molecules that could represent new targets or strategies for epilepsy therapy. Finally, we review the concept of chronotherapy and provide a perspective regarding its application to patients with epilepsy based on their individual characteristics (i.e., being a "morning person" or a "night owl"). We conclude that better understanding of the relationship between circadian rhythms, neuronal excitability, and seizures will allow both the identification of new therapeutic targets for treating epilepsy as well as more effective treatment regimens using currently available pharmacological and non-pharmacological strategies.
Also flagged:MembranePeroxisomesfatty acidsoxygenorganelleslipid
Journal Article2020-06-23No SnippetsChen C, Li J, Qin X, Wang W.
Show Full Abstract
Peroxisomes participate in essential cellular metabolic processes, such as oxidation of fatty acids (FAs) and maintenance of reactive oxygen species (ROS) homeostasis. Peroxisomes must communicate with surrounding organelles to exchange information and metabolites. The formation of membrane contact sites (MCSs), where protein-protein or protein-lipid complexes tether the opposing membranes of two organelles, represents an essential means of organelle crosstalk. Peroxisomal MCS (PO-MCS) studies are emerging but are still in the early stages. In this review, we summarize the identified PO-MCSs with the ER, mitochondria, lipid droplets, and lysosomes in mammalian cells and discuss their tethering mechanisms and physiological roles. We also highlight several features of PO-MCSs that may help future studies.
Also flagged:cerebral ischemiaRESTcerebral ischemia reperfusion injury
Journal Article2020-06-23✓ 1 SnippetZhang AP, Zhang YY, Liu AF, Wang K, Li C, Liu YE, Zhang YQ, Zhou J, Lv J, Jiang WJ.
In-Text Gene Mentions
Abstract)
…the association ofRepressor Element-1 Silencing Transcription factorElement-1 Silencing Transcript…
Show Full Abstract
<h4>Background and purpose</h4>Ischemia-reperfusion injuries (IRIs) can aggravate the condition of some patients with acute occlusion of major intracranial artery (AOMIA) who received endovascular thrombectomy. Here, we provided data confirming the association of Repressor Element-1 Silencing Transcription factor (REST) with the long-term neuroprotective effect of the middle cerebral artery occlusion (MCAO) rats underwent Gradual Flow Restoration (GFR).<h4>Methods</h4>Long term neuroprotective effects of GFR intervention were evaluated on MCAO rats model after 3d and 7d reperfusion. The neurological deficit score and TTC staining were performed to evaluate the degree of brain damage in GFR and other interventions at different time. Differentially expressed genes related to cerebral ischemia reperfusion injury (CIRI) were initially screened and identified using GSE32529 microarray analysis. REST protein expression in rat brain cortex infarction was detected by Western blot analysis.<h4>Results</h4>MCAO rats intervened with GFR exhibited reduced neurological deficit (P < 0.05) and alleviated brain infarction volume (P < 0.01). The REST gene with up-regulated expression and its downstream genes with down-regulated expression were screened by Microarray analysis. The brain cortex infarction in MCAO rats produced high levels of REST expression. The GFR intervention inhibited REST expression, and alleviated brain injury on MCAO rats.<h4>Conclusion</h4>Our results demonstrated that GFR intervention plays a long-term neuroprotective role and reduces brain edema and damage at reperfusion, possibly by inhibiting REST expression.
Also flagged:Propionic acidADAD-PPAcancervirus infectionneurological diseases
Journal Article2020-06-23✓ 1 SnippetAliashrafi M, Nasehi M, Zarrindast MR, Joghataei MT, Zali H, Siadat SD.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Show Full Abstract
<h4>Purpose</h4>Microbiota-derived metabolites could alter the brain tissue toward the neurodegeneration disease. This study aims to select the genes associated with Propionic acid (PPA) and compromise Alzheimer's disease (AD) to find the possible roles of PPA in AD pathogenesis.<h4>Methods</h4>Microbiota-derived metabolites could alter the brain tissue toward the neurodegeneration disease. This study aims to select the genes associated with Propionic acid (PPA) and compromise Alzheimer's disease (AD) to find the possible roles of PPA in AD pathogenesis.<h4>Results</h4>Amongst all genes associated with PPA and AD, 284 genes to be shared by searching databases and were subjected to further analysis. AD-PPA genes mainly involved in cancer, bacterial and virus infection, and neurological and non-neurological diseases. Gene Ontology and pathway analysis covered the most AD hallmark, such as amyloid formation, apoptosis, proliferation, inflammation, and immune system. Network analysis revealed hub and bottleneck genes. MCODE analysis also indicated the seed genes represented in the significant subnetworks. <i>ICAM1</i> and <i>CCND1</i> were the hub, bottleneck, and seed genes.<h4>Conclusions</h4>PPA interacted genes implicated in AD act through pathways initiate neuronal cell death. In sum up, AD-PPA shared genes exhibited evidence that supports the idea PPA secreted from bacteria could alter brain physiology toward the emerging AD signs. This idea needs to confirm by more future investigation in animal models.
Also flagged:Candida infectionsAzolefungal infectionsCYP51bindingSterol 14α‐Demethylase
Journal Article2020-06-22No SnippetsBinjubair FA, Parker JE, Warrilow AG, Puri K, Braidley PJ, Tatar E, Kelly SL, Kelly DE, Simons C.
Show Full Abstract
Fungal infections are a global issue affecting over 150 million people worldwide annually, with 750 000 of these caused by invasive Candida infections. Azole drugs are the frontline treatment against fungal infections; however, resistance to current azole antifungals in C. albicans poses a threat to public health. Two series of novel azole derivatives, short and extended derivatives, have been designed, synthesised and investigated for CYP51 inhibitory activity, binding affinity and minimum inhibitory concentration (MIC) against C. albicans strains. The short derivatives were more potent against the C. albicans strains (e. g., MIC 2-(4-chlorophenyl)-N-(2,4-dichlorobenzyl)-3-(1H-imidazol-1-yl)propanamide (5 f) <0.03 μg/mL, N-(4-((4-chlorophenyl)sulfonamido)benzyl)-2-phenyl-3-(1H-1,2,4-triazol-1-yl)propanamide (12 c), 1 μg/mL, fluconazole 0.125 μg/mL) but both displayed comparable enzyme binding and inhibition (5 f K<sub>d</sub> 62±17 nM, IC<sub>50</sub> 0.46 μM; 12 c K<sub>d</sub> 43±18 nM, IC<sub>50</sub> 0.33 μM, fluconazole K<sub>d</sub> 41±13 nM, IC<sub>50</sub> 0.31 μM, posaconazole K<sub>d</sub> 43±11 nM, IC<sub>50</sub> 0.2 μM). The short series had poor selectivity for CaCYP51 over the human homologue, whereas the selectivity of the extended series, for example, compound 12 c, was higher (21.5-fold) than posaconazole (4.7-fold) based on K<sub>d</sub> values, although posaconazole was more selective (615-fold) than 12 c (461-fold) based on IC<sub>50</sub> values. Based on inhibitory activity and selectivity profile, the extended series are the better of the two series for further development.
Also flagged:colitiscytokineIL-102,4,6-trinitrobenzene sulphonic acidCrohn's diseaseIL-12
Journal Article2020-06-22No Snippetsda Cunha VP, Preisser TM, Santana MP, Machado DCC, Pereira VB, Miyoshi A.
Show Full Abstract
<h4>Aims</h4>To investigate the anti-inflammatory activity of an invasive and Hp65-producing strain Lactococcus lactis NCDO2118 FnBPA+ (pXYCYT:Hsp65) in acute 2,4,6-trinitrobenzene sulphonic acid (TNBS)-induced colitis in mice as an innovative therapeutic strategy against Crohn's disease (CD).<h4>Methods and results</h4>The pXYCYT:Hsp65 plasmid was transformed into the L. lactis NCDO2118 FnBPA+ strain, resulting in the L. lactis NCDO2118 FnBPA+ (pXYCYT:Hsp65) strain. Then, the functionality of the strain was evaluated in vitro for Hsp65 production by Western blotting and for invasion into Caco-2 cells. The results demonstrated that the strain was able to produce Hsp65 and efficiently invade eukaryotic cells. Subsequently, in vivo, the anti-inflammatory capacity of the recombinant strain was evaluated in colitis induced with TNBS in BALB/c mice. Oral administration of the recombinant strain was able to attenuated the severity of colitis by mainly reducing IL-12 and IL-17 levels and increasing IL-10 and secretory immunoglobulin A levels.<h4>Conclusions</h4>The L. lactis NCDO2118 FnBPA+ (pXYCYT:Hsp65) strain contributed to a reduction in inflammatory damage in experimental CD.<h4>Significance and impact of the study</h4>This study, which used L. lactis for the production and delivery of Hsp65, has scientific relevance because it shows the efficacy of this new strategy based on therapeutic protein delivery into mammalian enterocytes.
Also flagged:affective disordersorganizationPet1P2ry1monoamineserotonin
Journal Article2020-06-22✓ 2 SnippetsOkaty BW, Sturrock N, Escobedo Lozoya Y, Chang Y, Senft RA, Lyon KA, Alekseyenko OV, Dymecki SM.
In-Text Gene Mentions
Results)
…For example,Pou3f2(POU class three…
Discussion)
…fourteen, such asPou3f2, Bcl11a ,…
Show Full Abstract
Among the brainstem raphe nuclei, the dorsal raphe nucleus (DR) contains the greatest number of <i>Pet1</i>-lineage neurons, a predominantly serotonergic group distributed throughout DR subdomains. These neurons collectively regulate diverse physiology and behavior and are often therapeutically targeted to treat affective disorders. Characterizing <i>Pet1</i> neuron molecular heterogeneity and relating it to anatomy is vital for understanding DR functional organization, with potential to inform therapeutic separability. Here we use high-throughput and DR subdomain-targeted single-cell transcriptomics and intersectional genetic tools to map molecular and anatomical diversity of DR-<i>Pet1</i> neurons. We describe up to fourteen neuron subtypes, many showing biased cell body distributions across the DR. We further show that <i>P2ry1-Pet1</i> DR neurons - the most molecularly distinct subtype - possess unique efferent projections and electrophysiological properties. These data complement and extend previous DR characterizations, combining intersectional genetics with multiple transcriptomic modalities to achieve fine-scale molecular and anatomic identification of <i>Pet1</i> neuron subtypes.
<h4>Background</h4>Umbilical cord clamping is a crucial step during the third stage of labour that separates the newborn from the placenta. Despite the available evidence that delayed umbilical cord clamping is more beneficial to infants, as well as the existence of 2014 WHO recommendation that the umbilical cord should be clamped between 1 and 3 minutes, its implementation is still low in many countries including Tanzania.<h4>Objective</h4>This study describes the experiences and perceptions of nurse-midwives`and obstetricians`about the timing of umbilical cord clamping at a regional referral hospital in Tanzania.<h4>Methods</h4>A descriptive qualitative study design that adopted a purposeful sampling strategy to recruit 19 participants was used. Nine semi-structured interviews with six nurse-midwives`and three obstetricians`, as well as one focus group discussion with ten nurse-midwives`were conducted. Thematic analysis guided the analysis of data.<h4>Results</h4>Three main themes generated from the data, each having 2 to 5 subthemes. 1. Experiences about the timing of umbilical cord clamping. 2. Perceptions about the umbilical cord clamping. 3. Factors influencing the practice of delayed umbilical cord clamping to improve newborn health outcomes.<h4>Conclusion</h4>Although the nurse-midwives`and obstetricians`commonly practiced clamping the umbilical cord immediately after delivery, they understood that delayed cord clamping has a potential benefit of oxygenation to the newborn in the event of the need for resuscitation. To move forward with the good practice in maternal and newborn care, proper pre-service and providers training on matters underlying childbirth is essential to address the gap of knowledge. Delayed cord clamping should be practiced widely to improve the health outcomes of the newborn.
Also flagged:5-methylcytosinehepatocellular carcinomatumorcancerspathogenesismethylation
Journal Article2020-06-22No SnippetsZhang Q, Zheng Q, Yu X, He Y, Guo W.
Show Full Abstract
<h4>Background</h4>Post-transcriptional methylation modifications, including 5-methylcytosine (m5C) modification, are closely related to the tumorigenesis of cancers. However, the mRNA profile of m5C modification in hepatocellular carcinoma (HCC) is unknown.<h4>Methods</h4>Methylated RNA immunoprecipitation sequencing was performed to identify m5C peaks on mRNA of human HCC tissues and adjacent tissues, and differences in m5C between the two groups were analyzed. In addition, we conducted a bioinformatics analysis to predict the function of specific methylated transcripts.<h4>Results</h4>We found that there was a noticeable difference in m5C between HCC and paired non-tumor tissues, suggesting that m5C could play a role in the pathogenesis of HCC. In addition, analyses of gene ontology and the Kyoto Encyclopedia of Genes and Genomes showed that the unique distribution pattern of mRNA m5C in HCC was associated with a wide range of cellular functions.<h4>Conclusions</h4>Our results revealed different distribution patterns of m5C in HCC and adjacent tissues and provided new insights into a novel function of m5C RNA methylation of mRNA in HCC progression.
<h4>Objectives</h4>The present review systematically summarized existing publications regarding the genetic associations between voltage-gated calcium channels (VGCCs) and autism spectrum disorder (ASD).<h4>Methods</h4>A comprehensive literature search was conducted to gather pertinent studies in three online databases. Two authors independently screened the included records based on the selection criteria. Discrepancies in each step were settled through discussions.<h4>Results</h4>From 1163 resulting searched articles, 28 were identified for inclusion. The most prominent among the VGCCs variants found in ASD were those falling within loci encoding the α subunits, CACNA1A, CACNA1B, CACNA1C, CACNA1D, CACNA1E, CACNA1F, CACNA1G, CACNA1H, and CACNA1I as well as those of their accessory subunits CACNB2, CACNA2D3, and CACNA2D4. Two signaling pathways, the IP3-Ca<sup>2+</sup> pathway and the MAPK pathway, were identified as scaffolds that united genetic lesions into a consensus etiology of ASD.<h4>Conclusions</h4>Evidence generated from this review supports the role of VGCC genetic variants in the pathogenesis of ASD, making it a promising therapeutic target. Future research should focus on the specific mechanism that connects VGCC genetic variants to the complex ASD phenotype.
Also flagged:waterchewingtemporomandibular joint disordersmethacrylatesurethanemethyl methacrylate
Journal Article2020-06-22No SnippetsYildiz Domanic K, Aslan YU, Ozkan Y.
Show Full Abstract
<h4>Background</h4>This study aimed to demonstrate that the material of the occlusal splint can be chosen according to the needs of individual patients and contribute to the knowledge of the wear rate of these materials.<h4>Methods</h4>In this study, four occlusal splint materials (Sr Ivocap Heat Cured, Valplast, SR Ivocap Elastomer and Eclipse) and three antagonists (natural tooth enamel, inCoris TZI and IPS e.max Press ceramic materials) were used. Each wear test was performed using a chewing simulator (n = 16; test load: 50 N; number of cycles: 10,000, 20,000 and 30,000; continuous rinsing with water at 30 °C for the wet condition). The Shapiro Wilk test was used for normal distribution suitability. Antagonist on average wear quantities both main effects and interactions of material, cycle and condition factors were investigated by Univariate variance analysis. Multiple comparisons were examined using the Games-Howell test.<h4>Results</h4>There was a statistically significant effect of the difference in materials on the amount of wear (p < 0.001). Furthermore, there was a statistically significant difference among the mean values of all materials (p > 0.001). The highest mean value was obtained with Eclipse (0,318 μm<sup>3</sup>), and the lowest mean value was obtained with Valplast (0,134 μm<sup>3</sup>).<h4>Conclusion</h4>Our study found differences in the in vitro wear rate among various occlusal splint materials.
Also flagged:CysteineMHCbindingtumordisulfideHLA-A
Journal Article2020-06-22✓ 1 SnippetSachs A, Moore E, Kosaloglu-Yalcin Z, Peters B, Sidney J, Rosenberg SA, Robbins PF, Sette A.
In-Text Gene Mentions
Text
…ECI2…
Show Full Abstract
The availability of MHC-binding prediction tools has been useful in guiding studies aimed at identifying candidate target Ags to generate reactive T cells and to characterize viral and tumor-reactive T cells. Nevertheless, prediction algorithms appear to function poorly for epitopes containing cysteine (Cys) residues, which can oxidize and form disulfide bonds with other Cys residues under oxidizing conditions, thus potentially interfering with their ability to bind to MHC molecules. Analysis of the results of HLA-A*02:01 class I binding assays carried out in the presence and absence of the reducing agent 2-ME indicated that the predicted affinity for 25% of Cys-containing epitopes was underestimated by a factor of 3 or more. Additional analyses were undertaken to evaluate the responses of human CD8<sup>+</sup> tumor-reactive T cells against 10 Cys-containing HLA class I-restricted minimal determinants containing substitutions of α-aminobutyric acid (AABA), a cysteine analogue containing a methyl group in place of the sulfhydryl group present in Cys, for the native Cys residues. Substitutions of AABA for Cys at putative MHC anchor positions often significantly enhanced T cell recognition, whereas substitutions at non-MHC anchor positions were neutral, except for one epitope where this modification abolished T cell recognition. These findings demonstrate the need to evaluate MHC binding and T cell recognition of Cys-containing peptides under conditions that prevent Cys oxidation, and to adjust current prediction binding algorithms for HLA-A*02:01 and potentially additional class I alleles to more accurately rank peptides containing Cys anchor residues.
Also flagged:membrane proteinsGPCRstransmembraneextracellularG proteinsβ-arrestins
Journal Article2020-06-22No SnippetsSutkeviciute I, Vilardaga JP.
Show Full Abstract
G protein-coupled receptors (GPCRs) represent the largest family of cell membrane proteins, with >800 GPCRs in humans alone, and recognize highly diverse ligands, ranging from photons to large protein molecules. Very important to human medicine, GPCRs are targeted by about 35% of prescription drugs. GPCRs are characterized by a seven-transmembrane α-helical structure, transmitting extracellular signals into cells to regulate major physiological processes via heterotrimeric G proteins and β-arrestins. Initially viewed as receptors whose signaling via G proteins is delimited to the plasma membrane, it is now recognized that GPCRs signal also at various intracellular locations, and the mechanisms and (patho)physiological relevance of such signaling modes are actively investigated. The propensity of GPCRs to adopt different signaling modes is largely encoded in the structural plasticity of the receptors themselves and of their signaling complexes. Here, we review emerging modes of GPCR signaling via endosomal membranes and the physiological implications of such signaling modes. We further summarize recent structural insights into mechanisms of GPCR activation and signaling. We particularly emphasize the structural mechanisms governing the continued GPCR signaling from endosomes and the structural aspects of the GPCR resensitization mechanism and discuss the recently uncovered and important roles of lipids in these processes.
Also flagged:lipidtriglyceridemetabolismcell differentiationmammary glandlactation
Journal Article2020-06-22✓ 1 SnippetKim SJ, Ha JW, Kim H.
In-Text Gene Mentions
Results)
…In particular,PLCL1encodes a protein…
Show Full Abstract
Analyzing the associations between genotypic changes and phenotypic traits on a genome-wide scale can contribute to understanding the functional roles of distinct genetic variations during breed development. We performed a whole-genome analysis of Angus and Jersey cattle breeds using conditional mutual information, which is an information-theoretic method estimating the conditional independency among multiple factor variables. The proposed conditional mutual information-based approach allows breed-discriminative genetic variations to be explicitly identified from tens of millions of SNP (single nucleotide polymorphism) positions on a genome-wide scale while minimizing the usage of prior knowledge. Using this data-driven approach, we identified biologically relevant functional genes, including breed-specific variants for cattle traits such as beef and dairy production. The identified lipid-related genes were shown to be significantly associated with lipid and triglyceride metabolism, fat cell differentiation, and muscle development. In addition, we confirmed that milk-related genes are involved in mammary gland development, lactation, and mastitis-associated processes. Our results provide the distinct properties of Angus and Jersey cattle at a genome-wide level. Moreover, this study offers important insights into discovering unrevealed genetic variants for breed-specific traits and the identification of genetic signatures of diverse cattle breeds with respect to target breed-specific properties.
…with the Netrin-receptorDCC(Deleted in Colorectal…
Show Full Abstract
Horizontal gaze palsy with progressive scoliosis (HGPPS) is a rare, inherited disorder characterized by a congenital absence of conjugate horizontal eye movements with progressive scoliosis developing in childhood and adolescence. Mutations in the Roundabout (<i>ROBO</i>3) gene located on chromosome 11q23-25 are responsible for the development of horizontal gaze palsy and progressive scoliosis. However, some studies redefined the locus responsible for this pathology to a 9-cM region. This study carried out a systematic review in which 25 documents were analyzed, following Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) standards. The search was made in the following electronic databases from January 1995 to October 2019: PubMed, Scopus, Web of Science, PEDRO, SPORT Discus, and CINAHL. HGPPS requires a multidisciplinary diagnostic approach, in which magnetic resonance imaging might be the first technique to suggest the diagnosis, which should be verified by an analysis of the <i>ROBO</i>3 gene. This is important to allow for adequate ocular follow up, apply supportive therapies to prevent the rapid progression of scoliosis, and lead to appropriate genetic counseling.
…During mitosis, HTT moves to the poles of the spindle, together with dynein and provides for the accumulation of NUMA (nuclear mitotic apparatus protein) and leucine-glycine-asparagine (LGN, G-protein-signaling modulator 2, GPSM2) proteins [102,103].…
Title)
…Interplay of theHTTProtein, Microtubules and…
Abstract)
…Huntingtin gene (HTT) causes an…
Introduction)
…protein called huntingtin (HTT) [ 69 ]…
Introduction)
…TheHTTgene expresses in…
Show Full Abstract
Huntington's disease is a severe and currently incurable neurodegenerative disease. An autosomal dominant mutation in the Huntingtin gene (<i>HTT</i>) causes an increase in the polyglutamine fragment length at the protein N-terminus. The consequence of the mutation is the death of neurons, mostly striatal neurons, leading to the occurrence of a complex of motor, cognitive and emotional-volitional personality sphere disorders in carriers. Despite intensive studies, the functions of both mutant and wild-type huntingtin remain poorly understood. Surprisingly, there is the selective effect of the mutant form of HTT even on nervous tissue, whereas the protein is expressed ubiquitously. Huntingtin plays a role in cell physiology and affects cell transport, endocytosis, protein degradation and other cellular and molecular processes. Our experimental data mining let us conclude that a significant part of the Huntingtin-involved cellular processes is mediated by microtubules and other cytoskeletal cell structures. The review attempts to look at unresolved issues in the study of the huntingtin and its mutant form, including their functions affecting microtubules and other components of the cell cytoskeleton.
Also flagged:nanomaterialstumourperiodontal diseasebone formationmembranesosteogenesis
Journal Article2020-06-22No SnippetsZakrzewski W, Dobrzynski M, Rybak Z, Szymonowicz M, Wiglusz RJ.
Show Full Abstract
Regenerative properties are different in every human tissue. Nowadays, with the increasing popularity of dental implants, bone regenerative procedures called augmentations are sometimes crucial in order to perform a successful dental procedure. Tissue engineering allows for controlled growth of alveolar and periodontal tissues, with use of scaffolds, cells, and signalling molecules. By modulating the patient's tissues, it can positively influence poor integration and healing, resulting in repeated implant surgeries. Application of nanomaterials and stem cells in tissue regeneration is a newly developing field, with great potential for maxillofacial bony defects. Nanostructured scaffolds provide a closer structural support with natural bone, while stem cells allow bony tissue regeneration in places when a certain volume of bone is crucial to perform a successful implantation. Several types of selected nanomaterials and stem cells were discussed in this study. Their use has a high impact on the efficacy of the current and future procedures, which are still challenging for medicine. There are many factors that can influence the regenerative process, while its general complexity makes the whole process even harder to control. The aim of this study was to evaluate the effectiveness and advantage of both stem cells and nanomaterials in order to better understand their function in regeneration of bone tissue in oral cavity.
Also flagged:OX40CD27tumour necrosis factorTNFOX40LCD70
Journal Article2020-06-22✓ 2 SnippetsRojas JM, Alejo A, Avia JM, Rodríguez-Martín D, Sánchez C, Alcamí A, Sevilla N, Martín V.
In-Text Gene Mentions
Methods)
…TNFRSF4 ), OX40L (TNFSF4), CD27 ( TNFRSF7…
I A O 0000326)
…of mammalian OX40L (TNFSF4) proteins D. Multiple…
Show Full Abstract
Members of the tumour necrosis factor (TNF) superfamily OX40L and CD70 and their receptors are costimulating signalling axes critical for adequate T cell activation in humans and mice but characterisation of these molecules in other species including ruminants is lacking. Here we cloned and expressed the predicted ovine orthologues of the receptors OX40 and CD27, as well as soluble recombinant forms of their potential ovine ligands, <i>Oa</i>OX40L and <i>Oa</i>CD70. Using biochemical and immunofluorescence analyses, we show that both signalling axes are functional in sheep. We show that oligomeric recombinant ligand constructs are able to induce signalling through their receptors on transfected cells. Recombinant defective human adenoviruses were constructed to express the soluble forms of <i>Oa</i>OX40L and <i>Oa</i>CD70. Both proteins were detected in the supernatant of adenovirus-infected cells and shown to activate NF-κB signalling pathway through their cognate receptor. These adenovirus-secreted <i>Oa</i>OX40L and <i>Oa</i>CD70 forms could also activate ovine T cell proliferation and enhance IFN-γ production in CD4<sup>+</sup> and CD8<sup>+</sup> T cells. Altogether, this study provides the first characterisation of the ovine costimulatory OX40L-OX40 and CD70-CD27 signalling axes, and indicates that their activation in vivo may be useful to enhance vaccination-induced immune responses in sheep and other ruminants.
Also flagged:chloroformnanodiamondrecombinase polymeraseRPAwatergene expressions
Journal Article2020-06-22No SnippetsAzimi-Boulali J, Madadelahi M, Madou MJ, Martinez-Chapa SO.
Show Full Abstract
The use of multiphase flows in microfluidics to carry dispersed phase material (droplets, particles, bubbles, or fibers) has many applications. In this review paper, we focus on such flows on centrifugal microfluidic platforms and present different methods of dispersed phase material generation. These methods are classified into three specific categories, i.e., step emulsification, crossflow, and dispenser nozzle. Previous works on these topics are discussed and related parameters and specifications, including the size, material, production rate, and rotational speed are explicitly mentioned. In addition, the associated theories and important dimensionless numbers are presented. Finally, we discuss the commercialization of these devices and show a comparison to unveil the pros and cons of the different methods so that researchers can select the centrifugal droplet/particle generation method which better suits their needs.
Unstable repeat disorders comprise a variable group of incurable human neurological and neuromuscular diseases caused by an increase in the copy number of tandem repeats located in various regions of their resident genes. It has become clear that dense DNA methylation in hyperexpanded non-coding repeats induces transcriptional silencing and, subsequently, insufficient protein synthesis. However, the ramifications of this paradigm reveal a far more profound role in disease pathogenesis. This review will summarize the significant progress made in a subset of non-coding repeat diseases demonstrating the role of dense landscapes of 5-methylcytosine (5mC) as a common disease modifier. However, the emerging findings suggest context-dependent models of 5mC-mediated silencing with distinct effects of excessive DNA methylation. An in-depth understanding of the molecular mechanisms underlying this peculiar group of human diseases constitutes a prerequisite that could help to discover novel pathogenic repeat loci, as well as to determine potential therapeutic targets. In this regard, we report on a brief description of advanced strategies in DNA methylation profiling for the identification of unstable Guanine-Cytosine (GC)-rich regions and on promising examples of molecular targeted therapies for Fragile X disease (FXS) and Friedrich ataxia (FRDA) that could pave the way for the application of this technique in other hypermethylated expansion disorders.
Also flagged:Thietanesthiaheterocyclessynthesisthietanealkyldialkyl
Journal Article2020-06-22No SnippetsXu J.
Show Full Abstract
Thietanes are important aliphatic four-membered thiaheterocycles that are found in the pharmaceutical core and structural motifs of some biological compounds. They are also useful intermediates in organic synthesis. Various synthetic methods of thietanes have been developed, including inter- and intramolecular nucleophilic thioetherifications, photochemical [2 + 2] cycloadditions, ring expansions and contractions, nucleophilic cyclizations, and some miscellaneous methods. The recently developed methods provide some new strategies for the efficient preparation of thietanes and their derivatives. This review focuses on the synthetic methods to construct thietane backbones developed during 1966 to 2019.
Also flagged:AdriamycinIdiopathic nephrotic syndromeglomerular filtrationINSWntRac1
Journal Article2020-06-22No SnippetsLi S, Liu Y, He X, Luo X, Shi H, Qu G, Wen X, Gan W, Wang J, Zhang A.
Show Full Abstract
Idiopathic nephrotic syndrome (INS) is a disease involving injury to podocytes in the glomerular filtration barrier, and its specific causes have not been elucidated. Transfer RNA-derived fragments (tRFs), products of precise tRNA cleavage, have been indicated to play critical roles in various diseases. Currently, there is no relevant research on the role of tRFs in INS. This study intends to explore the changes in and importance of tRFs during podocyte injury in vitro and to further analyze the potential mechanism of INS. Differentially expressed tRFs in the adriamycin-treated group were identified by high-throughput sequencing and further verified by quantitative RT-PCR. In total, 203 tRFs with significant differential expression were identified, namely, 102 upregulated tRFs and 101 downregulated tRFs (<i>q</i> < 0.05, ∣log2FC | ≥2). In particular, AS-tDR-008924, AS-tDR-011690, tDR-003634, AS-tDR-013354, tDR-011031, AS-tDR-001008, and AS-tDR-007319 were predicted to be involved in podocyte injury by targeting the Gpr, Wnt, Rac1, and other genes. Furthermore, gene ontology analysis showed that these differential tRFs were strongly associated with podocyte injury processes such as protein binding, cell adhesion, synapses, the actin cytoskeleton, and insulin-activate receptor activity. KEGG pathway analysis predicted that they participated in the PI3K-Akt signaling pathway, Wnt signaling pathway, and Ras signaling pathway. It was reported that these pathways contribute to podocyte injury. In conclusion, our study revealed that changes in the expression levels of tRFs might be involved in INS. Seven of the differentially expressed tRFs might play important roles in the process of podocyte injury and are worthy of further study.
Also flagged:coenzyme a ligasestype III PKSphenylacetate-CoA ligasealkaloidssynthesishydroxy
Journal Article2020-06-22No SnippetsWang J, Ding N, Wu Y, Shi X, Qi B, Liu X, Wang X, Li J, Tu P, Shi S.
Show Full Abstract
2-Hydroxy-4<i>H</i>-quinolizin-4-one scaffolds were enzymatically synthesized by integrating three enzymes including phenylacetate-CoA ligase (PcPCL) from an endophytic fungus <i>Penicillium chrysogenum</i> MT-12, malonyl-CoA synthase (AtMatB) from <i>Arabidopsis thaliana</i>, and a type III polyketide synthase (HsPKS3) from Chinese club moss <i>Huperzia serrata</i>. The findings paved the way to produce these kinds of structurally interesting alkaloids by engineered microorganisms.
Also flagged:endiandric acidbeilschmiedol Bbeilschmiedol Cphenylalkene obscurene Achloroquineuterine tumors
Journal Article2020-06-21No SnippetsWaleguele CC, Mba'ning BM, Awantu AF, Bankeu JJK, Fongang YSF, Ngouela AS, Tsamo E, Sewald N, Lenta BN, Krause RWM.
Show Full Abstract
The MeOH/CH<sub>2</sub>Cl<sub>2</sub> (1:1) extracts of the roots and leaves of <i>Beilschmiedia louisii</i> and <i>B. obscura</i> showed potent antitrypanosomal activity during preliminary screening on <i>Trypanosoma brucei brucei</i>. Phytochemical investigation of these extracts led to the isolation of a mixture of two new endiandric acid derivatives beilschmiedol B (<b>1</b>) and beilschmiedol C (<b>2</b>), and one new phenylalkene obscurene A (<b>3</b>) together with twelve known compounds (<b>4</b>-<b>15</b>). In addition, four new derivatives (<b>11a</b>-<b>11d</b>) were synthesized from compound <b>11</b>. Their structures were elucidated based on their NMR and MS data. Compounds <b>5</b>, <b>6</b>, and <b>7</b> were isolated for the first time from the <i>Beilschmiedia</i> genus. Additionally, the NMR data of compound <b>4</b> are given here for the first time. The isolates were evaluated for their antitrypanosomal and antimalarial activities against <i>Tb brucei</i> and the <i>Plasmodium falciparum</i> chloroquine-resistant strain <i>Pf3D7</i> in vitro, respectively. From the tested compounds, the mixture of new compounds <b>1</b> and <b>2</b> exhibited the most potent antitrypanosomal activity in vitro with IC<sub>50</sub> value of 4.91 μM.
Also flagged:MetabolismCancertumorextracellularadenosinetryptophan
Journal Article2020-06-21No SnippetsGiannone G, Ghisoni E, Genta S, Scotto G, Tuninetti V, Turinetto M, Valabrega G.
Show Full Abstract
Immune checkpoint inhibitors (ICIs) have changed therapeutic algorithms in several malignancies, although intrinsic and secondary resistance is still an issue. In this context, the dysregulation of immuno-metabolism plays a leading role both in the tumor microenvironment (TME) and at the host level. In this review, we summarize the most important immune-metabolic factors and how they could be exploited therapeutically. At the cellular level, an increased concentration of extracellular adenosine as well as the depletion of tryptophan and uncontrolled activation of the PI3K/AKT pathway induces an immune-tolerant TME, reducing the response to ICIs. Moreover, aberrant angiogenesis induces a hypoxic environment by recruiting VEGF, T<sub>reg</sub> cells and immune-suppressive tumor associated macrophages (TAMs). On the other hand, factors such as gender and body mass index seem to affect the response to ICIs, while the microbiome composition (and its alterations) modulates both the response and the development of immune-related adverse events. Exploiting these complex mechanisms is the next goal in immunotherapy. The most successful strategy to date has been the combination of antiangiogenic drugs and ICIs, which prolonged the survival of patients with non-small-cell lung cancer (NSCLC) and hepatocellular carcinoma (HCC), while results from tryptophan pathway inhibition studies are inconclusive. New exciting strategies include targeting the adenosine pathway, TAMs and the microbiota with fecal microbiome transplantation.
<h4>Background</h4>The first confirmed case of African swine fever (ASF) in Vietnam was reported officially in February 2019. To date, ASF virus (ASFV) have been detected in 63/63 provinces in Vietnam. Currently, real-time polymerase chain reaction (PCR) is considered to be a powerful tool for viral detection in field samples, including ASFV. However, some recent reports have suggested that mismatches in primer and probe binding regions may directly affect real-time PCR qualification, leading a false-negative result.<h4>Aim</h4>This study aims to further examine a conflicting result obtained from two OIE recommended methods, conventional PCR and real-time PCR, for ASFV detection.<h4>Methods</h4>Two ASF suspected pigs from different provinces in the north of Vietnam were selected for this study based on clinical signs and postmortem lesions. The different results obtained by OIE-recommended conventional PCR and real-time PCR were further analyzed by the Sanger sequencing method and virus isolation in combination with hemadsorption (HAD) test using porcine alveolar macrophages cells.<h4>Results</h4>The results showed that when the primer sequence matched perfectly with the sequences of field isolates, a mutation in probe binding region was found, indicating that a single mismatch in the probe binding site may cause a false-negative result by real-time PCR in detecting ASFV in clinical samples in Vietnam. An agreement between conventional PCR, using PPA1/PPA2 primers and two golden standard methods, virus isolation in combination with HAD assay, and sequencing method was observed in this study.<h4>Conclusion</h4>A single mismatch in the probe binding site caused a failse-negative result by realtime PCR method in field diagnosis of ASFV. The needs consideration when selecting the appropriate molecular diagnostic methods is based on the current databases of ASFV sequences, particularly for epidemiological surveillance of ASF.
bioRxiv2020-06-21Preprint (No Snippets API)Ku Y, Park J, Cho R, Lee Y, Park H, Kim M, Hur K, Byun SY, Liu J, Shum D, Shin D, Koh Y, Cho J, Yoon S, Hong J, Kim Y.
Show Full Abstract
<h4>SUMMARY</h4> 5-Aza-2′-deoxycytidine, also known as decitabine, is a DNA-methyltransferase inhibitor (DNMTi) used to treat acute myeloid leukemia (AML). Decitabine activates the transcription of endogenous retroviruses (ERV), which can induce an immune response by acting as cellular double-stranded RNAs (dsRNAs). Here, we employ an image-based screening platform to identify dsRNA-binding factors that mediate the downstream effect of ERV induction. We find that Staufen1 (Stau1) knockdown decreases the interferon signature and rescues decitabine-mediated cell death. Moreover, Stau1 directly binds to ERV RNAs and stabilizes them, together with a long non-coding RNA TINCR. We further show that TINCR enhances the interaction between Stau1 and ERV RNAs. Analysis of a clinical patient cohort reveals that AML patients with low Stau1 and TINCR expressions exhibits inferior treatment outcomes to the DNMTi therapy. Our study reveals that decitabine-mediated cell death is a consequence of complex interactions among different dsRNA-binding proteins for access to their common dsRNA targets. <h4>HIGHLIHGTS</h4> Image-based RNAi screening reveals multiple dsRBPs regulate response to decitabine Stau1 binds to ERV RNAs and affects their stability and subcellular localization TINCR binds to Stau1 and enhances Stau1-ERV interactions AML/MDS patients with low Stau1 and TINCR expressions show poor response to DNMTis
Also flagged:breast cancerdoxorubicincancerACTanthracyclineSHISA3
Journal Article2020-06-20No SnippetsPark B, Sim SH, Lee KS, Kim HJ, Park IH.
Show Full Abstract
We performed a genome-wide association study to investigate the association between single nucleotide polymorphisms and anthracycline-induced cardiotoxicity (ACT) in patients diagnosed with early breast cancer. From January 2000 to December 2015, 8490 patients underwent breast surgery at the National Cancer Center in Korea. Patients who received doxorubicin (cumulative dose 240 mg/m<sup>2</sup> -300 mg/m<sup>2</sup> ) with or without trastuzumab as a neoadjuvant/adjuvant therapy were included in our cohort. Sixty-seven patients in our cohort were diagnosed with ACT. Clinical data, including age, body weight, height, cancer stage, trastuzumab treatment, comorbidities, and concomitant medications, were collected retrospectively. Patients were classified as having either persistent or transient ACT based on their clinical course. In total, 346 946 single nucleotide polymorphisms in 42 cases and 215 controls were tested in this study. Body mass index (BMI) ≥25 kg/m<sup>2</sup> [odds ratio (OR) = 2.45, 95% confidence interval (CI), 1.23-4.88, P = .011] and trastuzumab use (OR = 2.40, 95% CI, 1.11-5.17, P = .026) were identified as significant risk factors. We found 7 genetic variants for ACT including rs17530621 (SHISA3, P = 3.10E-06), rs11894115 (MPP4, P = 4.71E-06), rs58328254 (RPL7, P = 6.09E-06), and rs117299725 (PRUNE2, P = 8.53E-06), although none of these variants reached the Bonferroni-corrected significance level when adjusted for BMI and trastuzumab use ( = α1.44E-07 based on 0.05/346 946). rs117299725 was a common variant when only the persistent ACT group was analyzed separately. It is meaningful that our study analyzed comprehensively the influence of genetic variation on ACT, along with some clinical factors in Asian breast cancer patients who received anthracycline with or without trastuzumab. Further research will be needed on candidate genetic variants found in this study.
…and human hemochromatosis (HFE) genes are involved…
Results)
…Mutations in theHFEgene can lead…
Show Full Abstract
<h4>Background</h4>Bariatric surgery can effectively treat morbid obesity; however, micronutrient deficiencies are common despite recommendations for high-dose supplements. Genetic predisposition to deficiencies underscores necessary identification of high-risk candidates. Personalized nutrition (PN) can be a tool to manage these deficiencies.<h4>Methods</h4>Medline, PubMed, and Google Scholar were searched. Articles involving genetic testing, micronutrient metabolism, and bariatric surgery were included.<h4>Results</h4>Studies show associations between genetic variants and micronutrient metabolism. Research demonstrates genetic testing to be a predictor for outcomes among obesity and bariatric surgery populations. There is limited research in bariatric surgery and micronutrient genetic variants.<h4>Conclusion</h4>Genotype-based PN is becoming feasible to provide an effective treatment of micronutrient deficiencies associated with bariatric surgery. The role of genomic technology in micronutrient recommendations needs further investigation.
Also flagged:localizationextracellular matrixECM) proteinscollagenlamininfibronectin
Journal Article2020-06-20✓ 2 SnippetsBäckström A, Kugel L, Gnann C, Xu H, Aslan JE, Lundberg E, Stadler C.
In-Text Gene Mentions
Results)
…by staining ofPEBP1(G) looks very…
Results)
…the microtubules, thePEBP1stain spreads further…
Show Full Abstract
Imaging is a powerful approach for studying protein expression and has the advantage over other methodologies in providing spatial information in situ at single cell level. Using immunofluorescence and confocal microscopy, detailed information of subcellular distribution of proteins can be obtained. While adherent cells of different tissue origin are relatively easy to prepare for imaging applications, non-adherent cells from hematopoietic origin, present a challenge due to their poor attachment to surfaces and subsequent loss of a substantial fraction of the cells. Still, these cell types represent an important part of the human proteome and express genes that are not expressed in adherent cell types. In the era of cell mapping efforts, overcoming the challenge with suspension cells for imaging applications would enable systematic profiling of hematopoietic cells. In this work, we successfully established an immunofluorescence protocol for preparation of suspension cell lines, peripheral blood mononucleated cells (PBMC) and human platelets on an adherent surface. The protocol is based on a multi-well plate format with automated sample preparation, allowing for robust high throughput imaging applications. In combination with confocal microscopy, the protocol enables systematic exploration of protein localization to all major subcellular structures.
…Non-random chromosomal translocations involving the putative transcription factor Mixed Lineage Leukemia Translocated to 10 (MLLT10, also known as AF10) are commonly observed in both acute myeloid and lymphoid leukemias and are indicative of a poor prognosis.…
Title)
…MLLT10in benign and…
Abstract)
…Translocated to 10 (MLLT10, also known as…
Abstract)
…actions of oncogenicMLLT10fusion proteins, the…
Abstract)
…role of wild-typeMLLT10in hematopoiesis is…
Show Full Abstract
Non-random chromosomal translocations involving the putative transcription factor Mixed Lineage Leukemia Translocated to 10 (MLLT10, also known as AF10) are commonly observed in both acute myeloid and lymphoid leukemias and are indicative of a poor prognosis. Despite the well-described actions of oncogenic MLLT10 fusion proteins, the role of wild-type MLLT10 in hematopoiesis is not well characterized. The protein structure and several interacting partners have been described and provide indications as to the potential functions of MLLT10. This review examines these aspects of MLLT10, contextualizing its function in benign and malignant hematopoiesis.
Also flagged:behavioralHuntington diseaseHDneurodegenerative disorderanxietywater
Journal Article2020-06-20✓ 1 SnippetNovati A, Manfré G, Flunkert S, Van der Harst JE, Homberg JR, Wronski R, Nguyen HP.
In-Text Gene Mentions
Abstract)
…expansion in theHTTgene.…
Show Full Abstract
Huntington disease (HD) is a neurodegenerative disorder caused by a polyglutamine expansion in the HTT gene. Various HD animal models have been generated to mimic the motor, cognitive and neuropsychiatric disturbances that affect HD patients. Reproducing disease phenotypes within these models is essential to identify reliable readouts for therapy studies. We validated behavioral phenotypes shown earlier by other research groups in the BACHD rat model, using both previously applied and novel tests for motor, cognitive and anxiety-like behaviors. We first confirmed known BACHD rats' phenotypes in rotarod, open field (OF) and elevated plus maze (EPM) tests. We then assessed the reproducibility of key phenotypes in the model using new tests: cliff hanging, passive avoidance (PA), Morris water maze (MWM), light dark box and light spot tests. We confirmed impaired motor coordination in the rotarod test and reduced activity in the OF. In line with earlier results in BACHD rats using different tests, we showed impaired reversal learning in MWM and decreased anxiety-like behavior with the light spot test supporting the validity of BACHD rats as a model of HD. Results in the EPM, light dark box, cliff hanging and PA tests did not confirm earlier findings. This may depend on phenotype inconsistencies or rather be related to differences in environmental variables, test typology, experimental settings, animal age and chosen behavioral parameters.
…To form this bond between BMP-2 and the QDot®s, we utilized DCC as a coupling agent to serve as a hydrogen donor to form the amide bond.…
Methods)
…1X PBS only,DCConly, QDot ®…
Results)
…the presence ofDCC.…
Show Full Abstract
Quantum Dot<sup>®</sup>s (QDot<sup>®</sup>s) are novel, semi-conductive nanostructures that emit a certain fluorescence when excited by specific wavelengths. QDot<sup>®</sup>s are more photostable, brighter, and photobleach less than other fluorescent dyes. These characteristics give them the potential to be used in many biological applications. The shells of QDot<sup>®</sup>s are coated with functional groups, such as carboxylate and organic groups, allowing them to couple to peptides/proteins and be used for real-time imaging and high-resolution microscopy. Here, we utilize Quantum Dot<sup>®</sup>s and Bone Morphogenetic Protein-2 (BMP-2) to create a BMP-2-QDot<sup>®</sup>s conjugate. BMP-2 is a growth factor that drives many processes such as cardiogenesis, neural growth, and osteogenesis. Despite its numerous roles, the trafficking and uptake of BMP-2 into cells is not well-established, especially during progression of diseases. The results presented here demonstrate for the first time a fluorescent BMP-2 analog that binds to the BMP-receptors (BMPRs), remains biologically active, and is stable for long time periods. Previous attempts to develop a biological BMP-2 analog with Fluorescein isothiocyanate (FITC) or nanodiamonds lacked data on the analog's stability. Furthermore, these analogs did not address whether they can signal within the cell by binding to the BMPRs or were mediated by non-stable conjugates.
Also flagged:cancerbreast cancertumorSH2B3BRCA1primary immunodeficiency
Journal Article2020-06-20✓ 1 SnippetPalomero L, Galván-Femenía I, de Cid R, Espín R, Barnes DR, Cimba, Blommaert E, Gil-Gil M, Falo C, Stradella A, Ouchi D, Roso-Llorach A, Violan C, Peña-Chilet M, Dopazo J, Extremera AI, García-Valero M, Herranz C, Mateo F, Mereu E, Beesley J, Chenevix-Trench G, Roux C, Mak T, Brunet J, Hakem R, Gorrini C, Antoniou AC, Lázaro C, Pujana MA.
In-Text Gene Mentions
Results)
…system: CDKN2A/B ,DCC, MUC1 ,…
Show Full Abstract
Proper immune system function hinders cancer development, but little is known about whether genetic variants linked to cancer risk alter immune cells. Here, we report 57 cancer risk loci associated with differences in immune and/or stromal cell contents in the corresponding tissue. Predicted target genes show expression and regulatory associations with immune features. Polygenic risk scores also reveal associations with immune and/or stromal cell contents, and breast cancer scores show consistent results in normal and tumor tissue. SH2B3 links peripheral alterations of several immune cell types to the risk of this malignancy. Pleiotropic SH2B3 variants are associated with breast cancer risk in BRCA1/2 mutation carriers. A retrospective case-cohort study indicates a positive association between blood counts of basophils, leukocytes, and monocytes and age at breast cancer diagnosis. These findings broaden our knowledge of the role of the immune system in cancer and highlight promising prevention strategies for individuals at high risk.
Also flagged:Ewing's sarcomaEWSmetastatic diseasesolid tumorgene expressionCancer
Journal Article2020-06-20No SnippetsScarborough JA, McClure E, Anderson P, Dhawan A, Durmaz A, Lessnick SL, Hitomi M, Scott JG.
Show Full Abstract
Advances in the treatment of Ewing's sarcoma (EWS) are desperately needed, particularly in the case of metastatic disease. A deeper understanding of collateral sensitivity, where the evolution of therapeutic resistance to one drug aligns with sensitivity to another drug, may improve our ability to effectively target this disease. For the first time in a solid tumor, we produced a temporal collateral sensitivity map that demonstrates the evolution of collateral sensitivity and resistance in EWS. We found that the evolution of collateral resistance was predictable with some drugs but had significant variation in response to other drugs. Using this map of temporal collateral sensitivity in EWS, we can see that the path toward collateral sensitivity is not always repeatable, nor is there always a clear trajectory toward resistance or sensitivity. Identifying transcriptomic changes that accompany these states of transient collateral sensitivity could improve treatment planning for patients with EWS.
Also flagged:KaempferolmalonylextracellularribosomesbiosynthesisFLS
Journal Article2020-06-20✓ 1 SnippetLiu Z, Zhao Q, Zuo ZX, Yuan SQ, Yu K, Zhang Q, Zhang X, Sheng H, Ju HQ, Cheng H, Wang F, Xu RH, Liu ZX.
In-Text Gene Mentions
Results)
…abuse, fatty liver,hemochromatosis, and viral infection…
Show Full Abstract
Ferroptosis is a type of cell death related to cancer; however, the characteristics of ferroptosis in cancers are still uncertain. Based on the data in The Cancer Genome Atlas, we found that most ferroptosis regulator genes (FRGs) were differentially expressed in tumors, somatic copy number alterations (SCNA) and DNA methylation contributed to their aberrant expression. We established the ferroptosis potential index (FPI) to reveal the functional roles of ferroptosis and noticed that the FPI was higher in tumors than in normal tissues in most cancers and was associated with subtypes and clinical features. The FPI was negatively correlated with several metabolic pathways but positively associated with several important metastasis-related pathways and immune-related pathways. High FPI predicted poor prognosis in several tumors, whereas FPI and FRGs impacted drug sensitivity. Our study presents a systematic analysis of ferroptosis and its regulatory genes and highlights the potential of ferroptosis-based cancer therapy.
bioRxiv2020-06-20Preprint (No Snippets API)Shrestha R, Fernandez ML, Dawson A, Hoenisch J, Volik S, Lin Y, Anderson S, Kim H, Haegert A, Colborne S, McConeghy B, Bell RH, Brahmbhatt S, DiMattia GE, Le Bihan S, Morin GB, Collins CC, Carey MS.
Show Full Abstract
<h4>Background</h4> Low-grade serous ovarian carcinoma (LGSOC) is a rare tumor subtype with high case fatality rates. As such, there is a pressing need to develop more effective treatments using newly available preclinical models for therapeutic discovery and drug evaluation. Here, we use a multiomics approach to interrogate a collection of LGSOC patient-derived cell lines to elucidate novel biomarkers and therapeutic vulnerabilities. <h4>Methods</h4> Fourteen LGSOC cell lines were interrogated using whole exome sequencing, RNA sequencing, and mass spectrometry-based proteomics. Somatic mutation, copy-number aberrations, gene and protein expression were analyzed and integrated using different computational approaches. LGSOC cell line data was compared to publicly available LGSOC tumor data (AACR GENIE cohort), and also used for predictive biomarker identification of MEK inhibitor (MEKi) efficacy. Protein interaction databases were evaluated to identify novel therapeutic targets. <h4>Results</h4> KRAS mutations were exclusively found in MEKi-sensitive and NRAS mutations mostly in MEKi-resistant cell lines. Analysis of COSMIC mutational signatures revealed distinct patterns of nucleotide substitution mutations in MEKi-sensitive and MEKi-resistant cell lines. Deletions of CDKN2A/B and MTAP genes (chromosome 9p21) were much more frequent in cell lines than tumor samples and possibly represent key driver events in the absence of KRAS/NRAS/BRAF mutations. For in-vitro MEKi efficacy prediction, proteomic data provided better discrimination than gene expression data. Condensin, MCM, and RFC protein complexes were identified as potential treatment targets in MEKi-resistant cell lines. <h4>Conclusions</h4> Our LGSOC cell lines are representative models of the most common molecular aberrations found in LGSOC tumors. This study highlights the importance of using proteomic data in multiomics assessment of drug prediction and identification of potential therapeutic targets. CDKN2A/B and MTAP deficiency offer an opportunity to find synthetically lethal candidates for novel treatments. Multiomics approaches are crucial to improving our understanding of the molecular aberrations in LGSOC, establishing effective drug prediction programs and identifying novel therapeutic targets in LGSOC.
<h4> A bstract </h4> Coronaviruses (CoVs) stand out for their large RNA genome and complex RNA-synthesizing machinery comprising 16 nonstructural proteins (nsps). The bifunctional nsp14 contains an N-terminal 3’-to-5’ exoribonuclease (ExoN) and a C-terminal N7-methyltransferase (N7-MTase) domain. While the latter presumably operates during viral mRNA capping, ExoN is thought to mediate proofreading during genome replication. In line with such a role, ExoN-knockout mutants of mouse hepatitis virus (MHV) and severe acute respiratory syndrome coronavirus (SARS-CoV) were previously found to have a crippled but viable hypermutation phenotype. Remarkably, using an identical reverse genetics approach, an extensive mutagenesis study revealed the corresponding ExoN-knockout mutants of another betacoronavirus, Middle East respiratory syndrome coronavirus (MERS-CoV), to be non-viable. This is in agreement with observations previously made for alpha- and gammacoronaviruses. Only a single MERS-CoV ExoN active site mutant could be recovered, likely because the introduced D191E substitution is highly conservative in nature. For 11 other MERS-CoV ExoN active site mutants, not a trace of RNA synthesis could be detected, unless – in some cases – reversion had first occurred. Subsequently, we expressed and purified recombinant MERS-CoV nsp14 and established in vitro assays for both its ExoN and N7-MTase activities. All ExoN knockout mutations that were lethal when tested via reverse genetics were found to severely decrease ExoN activity, while not affecting N7-MTase activity. Our study thus reveals an additional function for MERS-CoV nsp14 ExoN, which apparently is critical for primary viral RNA synthesis, thus differentiating it from the proofreading activity thought to boost long-term replication fidelity in MHV and SARS-CoV. <h4> I mportance </h4> The bifunctional nsp14 subunit of the coronavirus replicase contains 3’-to-5’ exoribonuclease (ExoN) and N7-methyltransferase (N7-MTase) domains. For the betacoronaviruses MHV and SARS-CoV, the ExoN domain was reported to promote the fidelity of genome replication, presumably by mediating some form of proofreading. For these viruses, ExoN knockout mutants are alive while displaying an increased mutation frequency. Strikingly, we now established that the equivalent knockout mutants of MERS-CoV ExoN are non-viable and completely deficient in RNA synthesis, thus revealing an additional and more critical function of ExoN in coronavirus replication. Both enzymatic activities of (recombinant) MERS-CoV nsp14 were evaluated using newly developed in vitro assays that can be used to characterize these key replicative enzymes in more detail and explore their potential as target for antiviral drug development.
Also flagged:upper respiratory illnessORF1abpneumoniainfectionsSARSPhenylalanine
Journal Article2020-06-19No SnippetsPhan LT, Nguyen TV, Huynh LKT, Dao MH, Vo TAN, Vu NHP, Pham HTT, Nguyen HT, Nguyen TT, Le HQ, Nguyen TV, Nguyen QH, Huynh TP, Nguyen SN, Nguyen AH, Nguyen NT, Nguyen TNT, Nguyen LT, Luong QC, Cao TM, Pham QD.
Show Full Abstract
In January 2020, we identified two severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2)-infected patients in a familial cluster with one person coming from Wuhan, China. The complete genome sequences of two SARS-CoV-2 strains isolated from these patients were identical and 99.98% similar to strains isolated in Wuhan. This is genetically suggestive of human-to-human transmission of SARS-CoV-2 and indicates Wuhan as the most plausible origin of the early outbreak in Vietnam. The younger patient had a mild upper respiratory illness and a brief viral shedding, whereas the elderly with multi-morbidity had pneumonia, prolonged viral shedding, and residual lung damage. The evidence of nonsynonymous substitutions in the ORF1ab region of the viral sequence warrants further studies.
Also flagged:cardiovascular dysfunctiongestationNanomaterialscardiovascular diseaseischemic heart diseaseheart failure
Journal Article2020-06-19✓ 1 SnippetKunovac A, Hathaway QA, Pinti MV, Taylor AD, Hollander JM.
In-Text Gene Mentions
Text
…SERPINC1…
Show Full Abstract
Ambient air, occupational settings, and the use and distribution of consumer products all serve as conduits for toxicant exposure through inhalation. While the pulmonary system remains a primary target following inhalation exposure, cardiovascular implications are exceptionally culpable for increased morbidity and mortality. The epidemiological evidence for cardiovascular dysfunction resulting from acute or chronic inhalation exposure to particulate matter has been well documented, but the mechanisms driving the resulting disturbances remain elusive. In the current review, we aim to summarize the cellular and molecular mechanisms that are directly linked to cardiovascular health following exposure to a variety of inhaled toxicants. The purpose of this review is to provide a comprehensive overview of the biochemical changes in the cardiovascular system following particle inhalation exposure and to highlight potential biomarkers that exist across multiple exposure paradigms. We attempt to integrate these molecular signatures in an effort to provide direction for future investigations. This review also characterizes how molecular responses are modified in at-risk populations, specifically the impact of environmental exposure during critical windows of development. Maternal exposure to particulate matter during gestation can lead to fetal epigenetic reprogramming, resulting in long-term deficits to the cardiovascular system. In both direct and indirect (gestational) exposures, connecting the biochemical mechanisms with functional deficits outlines pathways that can be targeted for future therapeutic intervention. Ultimately, future investigations integrating "omics"-based approaches will better elucidate the mechanisms that are altered by xenobiotic inhalation exposure, identify biomarkers, and guide in clinical decision making.
Journal Article2020-06-19✓ 4 SnippetsVeeroju S, Mamazhakypov A, Rai N, Kojonazarov B, Nadeau V, Breuils-Bonnet S, Li L, Weissmann N, Rohrbach S, Provencher S, Bonnet S, Seeger W, Schermuly R, Novoyatleva T.
In-Text Gene Mentions
Results)
…Furthermore, the expression of key enzymes of prostanglandin processing, Cyclooxygenase 2 (Cox2), and Prostacyclin Synthase (Ptgis), responsible for conversion of prostaglandin H2 to prostacyclin (prostaglandin I2) were not significantly altered in RVs of PAB-operated mice in comparison to RVs of SHAM-operated control mice, though p53 accumulation augmented Cox2 and Ptgis protein accumulation (Fig 4H, 4I and 4J).…
S I O 001029)
…(H) Representative western blot analysis and (I, J) subsequent densitometric quantification of Cyclooxygenase 2 (Cox2) and Prostaglandin I2 Synthase (Ptgis) in RV tissues of SHAM, PAB and PAB+Quinacrine treated mice (n = 3 per group).…
Results)
…and Prostacyclin Synthase (Ptgis), responsible for conversion…
Results)
…augmented Cox2 andPtgisprotein accumulation (…
Show Full Abstract
The leading cause of death in Pulmonary Arterial Hypertension (PAH) is right ventricular (RV) failure. The tumor suppressor p53 has been associated with left ventricular hypertrophy (LVH) and remodeling but its role in RV hypertrophy (RVH) is unclear. The purpose of this study was to determine whether pharmacological activation of p53 by Quinacrine affects RV remodeling and function in the pulmonary artery banding (PAB) model of compensated RVH in mice. The effects of p53 activation on cellular functions were studied in isolated cardiomyocytes, cardiac fibroblasts and endothelial cells (ECs). The expression of p53 was examined both on human RV tissues from patients with compensated and decompensated RVH and in mouse RV tissues early and late after the PAB. As compared to control human RVs, there was no change in p53 expression in compensated RVH, while a marked upregulation was found in decompensated RVH. Similarly, in comparison to SHAM-operated mice, unaltered RV p53 expression 7 days after PAB, was markedly induced 21 days after the PAB. Quinacrine induced p53 accumulation did not further deteriorate RV function at day 7 after PAB. Quinacrine administration did not increase EC death, neither diminished EC number and capillary density in RV tissues. No major impact on the expression of markers of sarcomere organization, fatty acid and mitochondrial metabolism and respiration was noted in Quinacrine-treated PAB mice. p53 accumulation modulated the expression of Heme Oxygenase 1 (HO-1) and Glucose Transporter (Glut1) in mouse RVs and in adult cardiomyocytes. We conclude that early p53 activation in PAB-induced RVH does not cause substantial detrimental effects on right ventricular remodeling and function.
Also flagged:Leucineautophagyamino acidmechanistic target of rapamycin complex 1mTORC1autophagosome
Journal Article2020-06-19No SnippetsSon SM, Park SJ, Stamatakou E, Vicinanza M, Menzies FM, Rubinsztein DC.
Show Full Abstract
Macroautophagy ("autophagy") is the main lysosomal catabolic process that becomes activated under nutrient-depleted conditions, like amino acid (AA) starvation. The mechanistic target of rapamycin complex 1 (mTORC1) is a well-conserved negative regulator of autophagy. While leucine (Leu) is a critical mTORC1 regulator under AA-starved conditions, how Leu regulates autophagy is poorly understood. Here, we describe that in most cell types, including neurons, Leu negatively regulates autophagosome biogenesis via its metabolite, acetyl-coenzyme A (AcCoA). AcCoA inhibits autophagy by enhancing EP300-dependent acetylation of the mTORC1 component raptor, with consequent activation of mTORC1. Interestingly, in Leu deprivation conditions, the dominant effects on autophagy are mediated by decreased raptor acetylation causing mTORC1 inhibition, rather than by altered acetylation of other autophagy regulators. Thus, in most cell types we examined, Leu regulates autophagy via the impact of its metabolite AcCoA on mTORC1, suggesting that AcCoA and EP300 play pivotal roles in cell anabolism and catabolism.
Also flagged:Nolz1axonaxonsinnervationaxonallocomotion
Journal Article2020-06-19✓ 2 SnippetsSoleilhavoup C, Travaglio M, Patrick K, Garção P, Boobalan E, Adolfs Y, Spriggs RV, Moles-Garcia E, Dhiraj D, Oosterveen T, Ferri SL, Abel T, Brodkin ES, Pasterkamp RJ, Brooks BP, Panman L.
In-Text Gene Mentions
Introduction)
…, including Slit/Robo, Netrin/Dcc, Ephrin, Semaphorin and…
Discussion)
…, Robo1 ,Dccand Nrp2 55…
Show Full Abstract
Midbrain dopaminergic (DA) axons make long longitudinal projections towards the striatum. Despite the importance of DA striatal innervation, processes involved in establishment of DA axonal connectivity remain largely unknown. Here we demonstrate a striatal-specific requirement of transcriptional regulator Nolz1 in establishing DA circuitry formation. DA projections are misguided and fail to innervate the striatum in both constitutive and striatal-specific Nolz1 mutant embryos. The lack of striatal Nolz1 expression results in nigral to pallidal lineage conversion of striatal projection neuron subtypes. This lineage switch alters the composition of secreted factors influencing DA axonal tract formation and renders the striatum non-permissive for dopaminergic and other forebrain tracts. Furthermore, transcriptomic analysis of wild-type and Nolz1<sup>-/-</sup> mutant striatal tissue led to the identification of several secreted factors that underlie the observed guidance defects and proteins that promote DA axonal outgrowth. Together, our data demonstrate the involvement of the striatum in orchestrating dopaminergic circuitry formation.
Also flagged:floweringcircadian rhythmGICONSTANS-LIKEFLOWERING LOCUS TFT
Journal Article2020-06-19No SnippetsLiu L, Ou C, Chen S, Shen Q, Liu B, Li M, Zhao Z, Kong X, Yan X, Zhuang F.
Show Full Abstract
Carrot (Daucus carota L.) is a biennial plant requiring vernalization to induce flowering, but long days can promote its premature bolting and flowering. The basic genetic network controlling the flowering time has been constructed for carrot, but there is limited information on the molecular mechanisms underlying the photoperiodic flowering response. The published carrot genome could provide an effective tool for systematically retrieving the key integrator genes of GIGANTEA (GI), CONSTANS-LIKE (COL), FLOWERING LOCUS T (FT), and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 (SOC1) homologues in the photoperiod pathway. In this study, the bolting time of wild species "Songzi" (Ws) could be regulated by different photoperiods, but the orange cultivar "Amsterdam forcing" (Af) displayed no bolting phenomenon. According to the carrot genome and previous de novo transcriptome, 1 DcGI, 15 DcCOLs, 2 DcFTs, and 3 DcSOC1s were identified in the photoperiod pathway. The circadian rhythm peaks of DcGI, DcCOL2, DcCOL5a, and DcCOL13b could be delayed under long days (LDs). The peak value of DcCOL2 in Af (12.9) was significantly higher than that in Ws (6.8) under short day (SD) conditions, and was reduced under LD conditions (5.0). The peak values of DcCOL5a in Ws were constantly higher than those in Af under the photoperiod treatments. The expression levels of DcFT1 in Ws (463.0) were significantly upregulated under LD conditions compared with those in Af (1.4). These responses of DcCOL2, DcCOL5a, and DcFT1 might be related to the different bolting responses of Ws and Af. This study could provide valuable insights into understanding the key integrator genes in the carrot photoperiod pathway.
Journal Article2020-06-19✓ 4 SnippetsQian J, Qian J, Olbrecht S, Boeckx B, Vos H, Laoui D, Etlioglu E, Wauters E, Pomella V, Verbandt S, Busschaert P, Bassez A, Franken A, Bempt MV, Xiong J, Weynand B, van Herck Y, Antoranz A, Bosisio FM, Thienpont B, Floris G, Vergote I, Smeets A, Tejpar S, Lambrechts D.
In-Text Gene Mentions
I A O 0000326)
…OLFM4…
I A O 0000326)
…SOX6…
I A O 0000326)
…PTGIS…
Results)
…were marked bySOX6expression, as well…
Show Full Abstract
The stromal compartment of the tumor microenvironment consists of a heterogeneous set of tissue-resident and tumor-infiltrating cells, which are profoundly moulded by cancer cells. An outstanding question is to what extent this heterogeneity is similar between cancers affecting different organs. Here, we profile 233,591 single cells from patients with lung, colorectal, ovary and breast cancer (n = 36) and construct a pan-cancer blueprint of stromal cell heterogeneity using different single-cell RNA and protein-based technologies. We identify 68 stromal cell populations, of which 46 are shared between cancer types and 22 are unique. We also characterise each population phenotypically by highlighting its marker genes, transcription factors, metabolic activities and tissue-specific expression differences. Resident cell types are characterised by substantial tissue specificity, while tumor-infiltrating cell types are largely shared across cancer types. Finally, by applying the blueprint to melanoma tumors treated with checkpoint immunotherapy and identifying a naïve CD4<sup>+</sup> T-cell phenotype predictive of response to checkpoint immunotherapy, we illustrate how it can serve as a guide to interpret scRNA-seq data. In conclusion, by providing a comprehensive blueprint through an interactive web server, we generate the first panoramic view on the shared complexity of stromal cells in different cancers.
Also flagged:HIF-1αRKIPpancreatic cancerhypoxia inducible factor-1αtumor inducible factorRaf-1 kinase inhibitory protein
Journal Article2020-06-19No SnippetsSrivani G, Behera SK, Dariya B, Chalikonda G, Alam A, Nagaraju GP.
Show Full Abstract
Protein-protein interactions (PPIs) are important biochemical processes that represent a major challenge in modern biology. Current approaches, which include high-throughput screening and computer aided ligand design, have limitations regarding the identification of hit matter. This current investigation focuses on computational study for protein-protein docking of hypoxia inducible factor-1α (HIF-1α), a tumor inducible factor, and Raf-1 kinase inhibitory protein (RKIP), a tumor metastasis suppressor. These are individually crystallized structures of interacting proteins, which interact to generate a conformational space. HIF activity in pancreatic tumors is determined by hypoxia and HIF-1α subunit availability. RKIP can be used as a prognostic indicator in a number of tumors. The interaction of RKIP with HIF-1α protects against pancreatic cancer (PC) metastasis by inhibiting its hypoxia function. We have explored the binding affinity between both the proteins with the HADDOCK (high ambiguity driven protein-protein docking) server, which determined that 158 structures in 11 clusters represent 79.0% of water-refined models. Of the best 10 clusters, the structures of cluster 2 were found to be better, as they had the lowest Z-score. Further supporting HIF-1α-RKIP interaction, pulldown assay has shown dissociation of RKIP from HIF-1α after CoCl2 treatment in both PC cell lines.
Also flagged:Amyotrophic lateral sclerosisneurodegenerative diseasedeathneuromuscular respiratory failureALSneurodegenerative diseases
Journal Article2020-06-19No SnippetsBean DM, Al-Chalabi A, Dobson RJB, Iacoangeli A.
Show Full Abstract
Amyotrophic lateral sclerosis is a neurodegenerative disease of the upper and lower motor neurons resulting in death from neuromuscular respiratory failure, typically within two to five years of first symptoms. Several rare disruptive gene variants have been associated with ALS and are responsible for about 15% of all cases. Although our knowledge of the genetic landscape of this disease is improving, it remains limited. Machine learning models trained on the available protein-protein interaction and phenotype-genotype association data can use our current knowledge of the disease genetics for the prediction of novel candidate genes. Here, we describe a knowledge-based machine learning method for this purpose. We trained our model on protein-protein interaction data from IntAct, gene function annotation from Gene Ontology, and known disease-gene associations from DisGeNet. Using several sets of known ALS genes from public databases and a manual review as input, we generated a list of new candidate genes for each input set. We investigated the relevance of the predicted genes in ALS by using the available summary statistics from the largest ALS genome-wide association study and by performing functional and phenotype enrichment analysis. The predicted sets were enriched for genes associated with other neurodegenerative diseases known to overlap with ALS genetically and phenotypically, as well as for biological processes associated with the disease. Moreover, using ALS genes from ClinVar and our manual review as input, the predicted sets were enriched for ALS-associated genes (ClinVar <i>p</i> = 0.038 and manual review <i>p</i> = 0.060) when used for gene prioritisation in a genome-wide association study.
Also flagged:Membrane Transport Proteinscancercell homeostasistumoursmembraneATP
Journal Article2020-06-19✓ 1 SnippetAlmasi S, El Hiani Y.
In-Text Gene Mentions
S I O 001029)
…For example, CaV2.3 encoded by the human CACNA1E gene is upregulated in Wilm’s tumours (a rare childhood kidney cancer), and its expression level is associated with reduced relapse-free survival [129].…
Show Full Abstract
Improving the therapeutic efficacy of conventional anticancer drugs represents the best hope for cancer treatment. However, the shortage of druggable targets and the increasing development of anticancer drug resistance remain significant problems. Recently, membrane transport proteins have emerged as novel therapeutic targets for cancer treatment. These proteins are essential for a plethora of cell functions ranging from cell homeostasis to clinical drug toxicity. Furthermore, their association with carcinogenesis and chemoresistance has opened new vistas for pharmacology-based cancer research. This review provides a comprehensive update of our current knowledge on the functional expression profile of membrane transport proteins in cancer and chemoresistant tumours that may form the basis for new cancer treatment strategies.
Endometriosis is characterized by ectopic endometrial tissue implantation, mostly within the peritoneum, and affects women in their reproductive age. Studies have been done to clarify its etiology, but the precise molecular mechanisms and pathophysiology remain unclear. We downloaded genome-wide mRNA expression and clinicopathological data of endometriosis patients and controls from NCBI's Gene Expression Omnibus, after a systematic search of multiple independent studies comprising 156 endometriosis patients and 118 controls to identify causative genes, risk factors, and potential diagnostic/therapeutic biomarkers. Comprehensive gene expression meta-analysis, pathway analysis, and gene ontology analysis was done using a bioinformatics-based approach. We identified 1590 unique differentially expressed genes (129 upregulated and 1461 downregulated) mapped by IPA as biologically relevant. The top upregulated genes were <i>FOS</i>, <i>EGR1</i>, <i>ZFP36</i>, <i>JUNB</i>, <i>APOD</i>, <i>CST1</i>, <i>GPX3</i>, and <i>PER1</i>, and the top downregulated ones were <i>DIO2</i>, <i>CPM</i>, <i>OLFM4</i>, <i>PALLD</i>, <i>BAG5</i>, <i>TOP2A</i>, <i>PKP4</i>, <i>CDC20B</i>, and <i>SNTN</i>. The most perturbed canonical pathways were mitotic roles of Polo-like kinase, role of Checkpoint kinase proteins in cell cycle checkpoint control, and ATM signaling. Protein-protein interaction analysis showed a strong network association among FOS, EGR1, ZFP36, and JUNB. These findings provide a thorough understanding of the molecular mechanism of endometriosis, identified biomarkers, and represent a step towards the future development of novel diagnostic and therapeutic options.
Also flagged:Lung cancercancersolid cancerstumorprostate-specific antigensolid tumors
Journal Article2020-06-19✓ 5 SnippetsEl-Khoury V, Schritz A, Kim SY, Lesur A, Sertamo K, Bernardin F, Petritis K, Pirrotte P, Selinsky C, Whiteaker JR, Zhang H, Kennedy JJ, Lin C, Lee LW, Yan P, Tran NL, Inge LJ, Chalabi K, Decker G, Bjerkvig R, Paulovich AG, Berchem G, Kim YJ.
In-Text Gene Mentions
Discussion)
…The 6-protein diagnostic panel consisted of FLNA, PRDX6 and ARHGDIB, associated with tumor growth, cell invasion and metastasis [36,37,38,39,40,41], GSTO1, having an antioxidant defense role (together with PRDX6) [38,41,42,43], TUBA4A, found enriched in serum exosomes from NSCLC patients [44], and the tumor suppressor CDH13 [45].…
Discussion)
…The increased levels of GSTO1 and PRDX6 in plasma of lung cancer patients may reflect their protective role in the cancer redox environment, or may be associated with the activation of antioxidant pathways resulting from cigarette smoking.…
Lung cancer is the deadliest cancer worldwide, mainly due to its advanced stage at the time of diagnosis. A non-invasive method for its early detection remains mandatory to improve patients' survival. Plasma levels of 351 proteins were quantified by Liquid Chromatography-Parallel Reaction Monitoring (LC-PRM)-based mass spectrometry in 128 lung cancer patients and 93 healthy donors. Bootstrap sampling and least absolute shrinkage and selection operator (LASSO) penalization were used to find the best protein combination for outcome prediction. The PanelomiX platform was used to select the optimal biomarker thresholds. The panel was validated in 48 patients and 49 healthy volunteers. A 6-protein panel clearly distinguished lung cancer from healthy individuals. The panel displayed excellent performance: area under the receiver operating characteristic curve (AUC) = 0.999, positive predictive value (PPV) = 0.992, negative predictive value (NPV) = 0.989, specificity = 0.989 and sensitivity = 0.992. The panel detected lung cancer independently of the disease stage. The 6-protein panel and other sub-combinations displayed excellent results in the validation dataset. In conclusion, we identified a blood-based 6-protein panel as a diagnostic tool in lung cancer. Used as a routine test for high- and average-risk individuals, it may complement currently adopted techniques in lung cancer screening.
Also flagged:cell proliferationWntcytokinecell surfaceproteinscell surface proteins
Journal Article2020-06-19No SnippetsBonnet M, Kaspric N, Vonnahme K, Viala D, Chambon C, Picard B.
Show Full Abstract
Crosstalk between adipose and muscular tissues is hypothesized to regulate the number of muscular and adipose cells during fetal growth, with post-natal consequences on lean and fat masses. Such crosstalk largely remains, however, to be described. We hypothesized that a characterization of the proteomes of adipose and muscular tissues from bovine fetuses may enhance the understanding of the crosstalk between these tissues through the prediction of their secretomes and surfaceomes. Proteomic experiments have identified 751 and 514 proteins in fetal adipose tissue and muscle. These are mainly involved in the regulation of cell proliferation or differentiation, but also in pathways such as apoptosis, Wnt signalling, or cytokine-mediated signalling. Of the identified proteins, 51 adipokines, 11 myokines, and 37 adipomyokines were predicted, together with 26 adipose and 13 muscular cell surface proteins. Analysis of protein-protein interactions suggested 13 links between secreted and cell surface proteins that may contribute to the adipose-muscular crosstalk. Of these, an interaction between the adipokine plasminogen and the muscular cell surface alpha-enolase may regulate the fetal myogenesis. The in silico secretome and surfaceome analyzed herein exemplify a powerful strategy to enhance the elucidation of the crosstalk between cell types or tissues.
Also flagged:matingSRFimmune responseoestrusovulationfertilization
Journal Article2020-06-19No SnippetsBarranco I, Padilla L, Martinez CA, Martinez CA, Alvarez-Rodriguez M, Parrilla I, Lucas X, Ferreira-Dias G, Yeste M, Rodriguez-Martinez H, Roca J.
Show Full Abstract
The seminal plasma (SP) modulates the female reproductive immune environment after mating, and microRNAs (miRNAs) could participate in the process. Considering that the boar ejaculate is built by fractions differing in SP-composition, this study evaluated whether exposure of mucosal explants of the sow internal genital tract (uterus, utero-tubal junction and isthmus) to different SP-fractions changed the profile of explant-secreted miRNAs. Mucosal explants retrieved from oestrus sows (<i>n</i> = 3) were in vitro exposed to: Medium 199 (M199, Control) or M199 supplemented (1:40 <i>v</i>/<i>v</i>) with SP from the sperm-rich fraction (SRF), the post-SRF or the entire recomposed ejaculate, for 16 h. After, the explants were cultured in M199 for 24 h to finally collect the media for miRNA analyses using GeneChip miRNA 4.0 Array (Affymetrix). Fifteen differentially expressed (False Discovery Rate (FDR) < 0.05 and Fold-change ≥ 2) miRNAs (11 down- versus 4 up-regulated) were identified (the most in the media of uterine explants incubated with SP from post-SRF). Bioinformatics analysis identified that predicted target genes of dysregulated miRNAs, mainly miR-34b, miR-205, miR-4776-3p and miR-574-5p, were involved in functions and pathways related to immune response. In conclusion, SP is able to elicit changes in the miRNAs profile secreted by female genital tract, ultimately depending SP-composition.
<h4>Introduction</h4>To investigate effects of Sitagliptin on the enhancement of beta-cell function, reducing insulin resistance, serum glucagon like peptide-1 (GLP-1) concentrations and blood glucose in patients with type 2 diabetes mellitus (T2D) and suggest one of the underlying mechanisms on beta-cell function and insulin resistance.<h4>Patients and methods</h4>This was a cross-sectional and observational study in comparison to the control group. A study population of 44 newly diagnosed patients with T2D treated with Sitagliptin with a dose of 100 mg/day for 3 months was analyzed to compare 52 healthy participants. Indices for beta-cell function, peripheral insulin sensitivity, and insulin resistance were calculated with homeostasis model assessment 2 (HOMA2) calculator and compared. Serum GLP-1 concentrations were analyzed, and regression analysis was conducted to find the correlations between GLP-1 and beta-cell function and insulin resistance.<h4>Results</h4>Newly diagnosed patients with T2D witnessed a significant reduction in beta-cell function, serum GLP-1 concentrations at the time of diagnosis. After treatment with Sitagliptin 100 mg/day, they achieved significant improvements in beta-cell function, peripheral insulin sensitivity and insulin resistance. Serum GLP-1 concentrations were increased significantly to those levels in the control group and correlated with peripheral insulin sensitivity and insulin resistance in patients whose beta-cell functions improved.<h4>Conclusion</h4>Sitagliptin improved beta-cell function, insulin resistance and blood glucose in newly diagnosed patients with T2D. Meanwhile, Sitagliptin ameliorated serum GLP-1 concentrations, which contributed to the enhancement of beta-cell.
Journal Article2020-06-19✓ 1 SnippetStanifer ML, Kee C, Cortese M, Zumaran CM, Triana S, Mukenhirn M, Kraeusslich HG, Alexandrov T, Bartenschlager R, Boulant S.
In-Text Gene Mentions
I A O 0000326)
…OLFM4…
Show Full Abstract
Severe acute respiratory syndrome-related coronavirus-2 (SARS-CoV-2) is an unprecedented worldwide health problem that requires concerted and global approaches to stop the coronavirus 2019 (COVID-19) pandemic. Although SARS-CoV-2 primarily targets lung epithelium cells, there is growing evidence that the intestinal epithelium is also infected. Here, using both colon-derived cell lines and primary non-transformed colon organoids, we engage in the first comprehensive analysis of the SARS-CoV-2 life cycle in human intestinal epithelial cells (hIECs). Our results demonstrate that hIECs fully support SARS-CoV-2 infection, replication, and production of infectious de novo virus particles. We found that viral infection elicits an extremely robust intrinsic immune response where interferon-mediated responses are efficient at controlling SARS-CoV-2 replication and de novo virus production. Taken together, our data demonstrate that hIECs are a productive site of SARS-CoV-2 replication and suggest that the enteric phase of SARS-CoV-2 may participate in the pathologies observed in COVID-19 patients by contributing to increasing patient viremia and fueling an exacerbated cytokine response.
Also flagged:peptidepeptidesbreast cancerantibodiestranscription factorNgn2
Journal Article2020-06-19✓ 1 SnippetVitrinel B, Iannitelli DE, Mazzoni EO, Christiaen L, Vogel C.
In-Text Gene Mentions
Results)
…proteins included EZRI,PEBP1, and TBB5 that…
Show Full Abstract
The rise of single-cell transcriptomics has created an urgent need for similar approaches that use a minimal number of cells to quantify expression levels of proteins. We integrated and optimized multiple recent developments to establish a proteomics workflow to quantify proteins from as few as 1000 mammalian stem cells. The method uses chemical peptide labeling, does not require specific equipment other than cell lysis tools, and quantifies >2500 proteins with high reproducibility. We validated the method by comparing mouse embryonic stem cells and in vitro differentiated motor neurons. We identify differentially expressed proteins with small fold changes and a dynamic range in abundance similar to that of standard methods. Protein abundance measurements obtained with our protocol compared well to corresponding transcript abundance and to measurements using standard inputs. The protocol is also applicable to other systems, such as fluorescence-activated cell sorting (FACS)-purified cells from the tunicate <i>Ciona</i>. Therefore, we offer a straightforward and accurate method to acquire proteomics data from minimal input samples.
Cytokinins (CKs) are a diverse group of evolutionarily significant growth-regulating molecules. While the CK biosynthesis and signal transduction pathways are the most well-understood in plant systems, these molecules have been identified in all kingdoms of life. This review follows the recent discovery of an expanded CK profile in the social amoeba, <i>Dictyostelium discoideum</i>. A comprehensive review on the present knowledge of CK biosynthesis, signal transduction, and CK-small molecule interactions within members of Dictyostelia will be summarized. In doing so, the utility of social amoebae will be highlighted as a model system for studying the evolution of these hormone-like signaling agents, which will set the stage for future research in this area.
Also flagged:carbonateapatitebone formationCarbonate apatitehydroxyapatitealkaline phosphatase
Journal Article2020-06-19No SnippetsHiromoto S, Itoh S, Noda N, Yamazaki T, Katayama H, Akashi T.
Show Full Abstract
Corrosion-control coatings which can enhance bone formation and be completely replaced by bone are attractive for biodegradable Mg alloys. Carbonate apatite (CAp) and hydroxyapatite (HAp) coatings were formed on Mg-4 wt% Y-3 wt% rare earth (WE43) alloy as a corrosion-control and bioabsorbable coating in the coating solution with various concentrations of NaHCO<sub>3</sub>. The incorporation of carbonate group in apatite structure was examined using X-ray diffraction and Fourier transform infrared spectroscopy. Rat osteoclast precursor and MC3T3-E1 osteoblast cells were cultured on the CAp- and HAp-coated WE43 to examine the osteoclastic resorption and the alkaline phosphatase (ALP) activity, respectively. Mg ions in the used medium were quantified to examine the corrosion-control ability. The NaHCO<sub>3</sub> addition in the solution resulted in the formation of B-type CAp in which the phosphate group of apatite structure was substituted with the carbonate group. The osteoclastic resorption was observed only for the CAp coatings as the cracking of the coatings and the corrosion of substrate WE43 strongly localized under osteoclast cell bodies. The CAp and HAp coatings significantly enhanced the ALP activity of osteoblasts. The CAp-coated WE43 specimens showed 1/5 smaller amount of Mg ion release than the uncoated WE43 on the first day of culturing osteoblasts. For the subsequent 22 days, the Mg ion release was reduced to 1/2 by the CAp coatings. In the presence of osteoclasts, the CAp coatings showed slightly lower corrosion protectiveness than the HAp coating. It was demonstrated that the CAp coatings can be a bioabsorbable and corrosion-control coating for biodegradable Mg alloys.
medRxiv2020-06-19Preprint (No Snippets API)Taylor K, Das S, Pearson M, Kozubek J, Pawlowski M, Jensen CE, Skowron Z, Møller GL, Strivens M, Gardner S.
Show Full Abstract
<h4>ABSTRACT</h4> <h4>BACKGROUND</h4> Epidemiological studies indicate that as many as 20% of individuals who test positive for COVID-19 develop severe symptoms that can require hospitalization. These symptoms include low platelet count, severe hypoxia, increased inflammatory cytokines and reduced glomerular filtration rate. Additionally, severe COVID-19 is associated with several chronic co-morbidities, including cardiovascular disease, hypertension and type 2 diabetes mellitus. The identification of genetic risk factors that impact differential host responses to SARS-CoV-2, resulting in the development of severe COVID-19, is important in gaining greater understanding into the biological mechanisms underpinning life-threatening responses to the virus. These insights could be used in the identification of high-risk individuals and for the development of treatment strategies for these patients. <h4>METHODS</h4> As of June 6, 2020, there were 976 patients who tested positive for COVID-19 and were hospitalized, indicating they had a severe response to SARS-CoV-2. To overcome the limited number of patients with a mild form of COVID-19, we used similar control criteria to our previous study looking at shared genetic risk factors between severe COVID-19 and sepsis, selecting controls who had not developed sepsis despite having maximum co-morbidity risk and exposure to sepsis-causing pathogens. <h4>RESULTS</h4> Using a combinatorial (high-order epistasis) analysis approach, we identified 68 protein-coding genes that were highly associated with severe COVID-19. At the time of analysis, nine of these genes have been linked to differential response to viral pathogens including SARS-CoV-2. We also found many novel targets that are involved in key biological pathways associated with the development of severe COVID-19, including production of pro-inflammatory cytokines, endothelial cell dysfunction, lipid droplets, neurodegeneration and viral susceptibility factors. <h4>CONCLUSION</h4> The variants we found in genes relating to immune response pathways and cytokine production cascades, were in equal proportions across all severe COVID-19 patients, regardless of their co-morbidities. This suggests that such variants are not associated with any specific co-morbidity, but are common amongst patients who develop severe COVID-19. This is consistent with being able to find and validate severe disease biomarker signatures when larger patient datasets become available. Several of the genes identified relate to lipid programming, beta-catenin and protein kinase C signalling. These processes converge in a central pathway involved in plasma membrane repair, clotting and wound healing. This pathway is largely driven by Ca 2+ activation, which is a known serum biomarker associated with severe COVID-19 and ARDS. This suggests that aberrant calcium ion signalling may be responsible for driving severe COVID-19 responses in patients with variants in genes that regulate the expression and activity of this ion. We intend to perform further analyses to confirm this hypothesis. Among the 68 severe COVID-19 risk-associated genes, we found several druggable protein targets and pathways. Nine are targeted by drugs that have reached at least Phase I clinical trials, and a further eight have active chemical starting points for novel drug development. Several of these targets were particularly enriched in specific co-morbidities, providing insights into shared pathological mechanisms underlying both the development of severe COVID-19, ARDS and these predisposing co-morbidities. We can use these insights to identify patients who are at greatest risk of contracting severe COVID-19 and develop targeted therapeutic strategies for them, with the aim of improving disease burden and survival rates.
Research Square2020-06-19Preprint (No Snippets API)Mousavi SF, Siadat SD, Setayesh T.
Show Full Abstract
<h4>Background: </h4> Magnetospirillum gryphiswaldense (MSR-1), a type of magnetotactic bacteria are capable of forming magnetosomes, which are nanometer-sized particles and membrane-enclosed organelles containing crystals of magnetite (Fe 3 O 4 ). For the synthesis of magnetosomes, bacteria require a significant amount of iron. Iron is an essential element for most life on earth; however, the elevation of iron level leads to hemochromatosis.This research aimed to investigate whether MSR-1 has an impact on the alteration of iron levels in mammalian cells in vivo. Female BALB/c were received intraperitonealinjections of iron-dextran (100mg/kg b.w.) 2 times per week for four consecutive weeks, and the iron was allowed to equilibrate for 15 days. The MSR-1 (10 9 in 200 µl PBS)were injected into healthy (C+MSR-1) and iron overloaded (IO+MSR-1) mice. The control healthy (C+ no MSR-1) and control iron overloaded (IO+ no MSR-1) mice received PBS. After the administration of bacteria, the viable bacterial numbers were evaluated in mice. Iron levels in serum and liver, as well as urinary iron exertion, were detected. <h4>Results: </h4> Bacteria were not detected in the liver, spleen, and lymph nodes of mice after 72 hours of post-injection. Serum iron and total liver iron levels in C+MSR-1 were reduced compare to C-MSR-1 (by 42.1% and 34.1%), respectively. Moreover, similar patterns were observed in IO+MSR-1 compare to IO+ no MSR-1, 42.1% iron reduction in serum, and 32.1% in the liver after 24h of post-injection. The urinary iron exertion was dramatically increased (by 3-fold) compared to groups with no MSR-1. <h4>Conclusion: </h4> Our results suggest that MSR-1 can reduce the iron in iron-overloaded mice and, therefore, may inhibit the organ damage caused by excess iron. Our research on optimizing the biological magnetic system is continuing.
bioRxiv2020-06-19Preprint (No Snippets API)Venkatakrishnan A, Kayal N, Anand P, Badley AD, Church GM, Soundararajan V.
Show Full Abstract
The hand of molecular mimicry in shaping SARS-CoV-2 evolution and immune evasion remains to be deciphered. We identify 33 distinct 8-mer/9-mer peptides that are identical between SARS-CoV-2 and human proteomes, along similar extents of viral mimicry observed in other viruses. Interestingly, 20 novel peptides have not been observed in any previous human coronavirus (HCoV) strains. Four of the total mimicked 8-mers/9-mers map onto HLA-B*40:01, HLA-B*40:02, and HLA-B*35:01 binding peptides from human PAM, ANXA7, PGD, and ALOX5AP proteins. This mimicry of multiple human proteins by SARS-CoV-2 is made salient by the targeted genes being focally expressed in arteries, lungs, esophagus, pancreas, and macrophages. Further, HLA-A*03 restricted 8-mer peptides are shared broadly by human and coronaviridae helicases with primary expression of the mimicked human proteins in the neurons and immune cells. This study presents the first comprehensive scan of peptide mimicry by SARS-CoV-2 of the human proteome and motivates follow-up research into its immunological consequences.
Also flagged:chondrocalcinosisTMJperipheral calcific diseasepyrophosphate arthropathypseudogoutCalcium pyrophosphate deposition disease
Journal Article2020-06-18✓ 1 SnippetWillekens I, Fares A, Devos H, Shahabpour M, Lenchik L, Buls N, De Maeseneer M.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Objective</h4>The aim of this study was to investigate the prevalence of TMJ chondrocalcinosis on head CT scans in patients with chondrocalcinosis of the knee or wrist.<h4>Methods and materials</h4>227 patients with radiological evidence of calcifications on knee or wrist radiographs had a head CT scan obtained for unrelated purposes. CT scans were retrospectively reviewed for the presence of temporomandibular crystal deposition. Prevalence, bilaterality, age and gender distribution were determined.<h4>Results</h4>41 of 227 (18%) of patients had TMJ chondrocalcinosis. TMJ chondrocalcinosis was more common in females (17%) than males (1%). It was more commonly unilateral (68%) than bilateral (32%).<h4>Conclusion</h4>In patients with peripheral calcific disease, the TMJ is more commonly involved than previously reported and this is more common in females compared to males.
Also flagged:membraneextracellularvesicleinfectionTNF-αALIX
Journal Article2020-06-18No SnippetsMonsivais LA, Sheller-Miller S, Russell W, Saade GR, Dixon CL, Urrabaz-Garza R, Menon R.
Show Full Abstract
<h4>Problem</h4>Fetal inflammatory signals can be propagated to maternal tissues to initiate labor via exosomes (extracellular vesicles; 30-150 nm). We tested the hypothesis that fetal membrane cells exposed to infectious and inflammatory mediators associated with preterm birth (PTB) produce exosomes with distinct protein cargo contents indicative of underlying pathobiology.<h4>Methods of study</h4>Fetal membrane explants (FM) as well as primary amnion epithelial (AEC) and mesenchymal cells (AMC), and chorion cells (CC) from term deliveries were maintained in normal conditions (control) or exposed to LPS 100 ng/mL or TNF-α 50 ng/mL for 48 hours. Exosomes were isolated from media by differential centrifugation and size exclusion chromatography and characterized using cryo-electron microscopy (morphology), nanoparticle tracking analysis (size and quantity), Western blot (markers), and mass spectroscopy (cargo proteins). Ingenuity pathway analysis (IPA) determined pathways indicated by differentially expressed proteins.<h4>Results</h4>Irrespective of source or treatment, exosomes were spherical, had similar size, quantities, and markers (ALIX, CD63, and CD81). However, exosome cargo proteins were different between FM and individual fetal membrane cell-derived exosomes in response to treatments. Several common proteins were seen; however, there are several unique proteins expressed by exosomes from different cell types in response to distinct stimuli indicative of unique pathways and physiological functions in cells.<h4>Conclusions</h4>We demonstrate collective tissue and independent cell response reflected in exosomes in response to infectious and inflammatory stimuli. These cargoes determined underlying physiology and their potential in enhancing inflammation in a paracrine fashion.
Journal Article2020-06-18✓ 2 SnippetsManco L, Machado-Rodrigues AM, Padez C.
In-Text Gene Mentions
Title)
…Association study of common functional genetic polymorphisms in SLC6A4 (5-HTT) and MAOA genes with obesity in portuguese children.…
Title)
…polymorphisms in SLC6A4 (5-HTT) and MAOA genes…
Show Full Abstract
<h4>Objectives</h4>To investigate the association of polymorphisms in <i>SLC6A4</i> and <i>MAOA</i> genes with obesity indices in children.<h4>Material and methods</h4>A total of 637 Portuguese children (317 girls; 320 boys) aged 3-11 years-old were genotyped for the <i>SLC6A4</i> polymorphisms, 5-HTTLPR and STin2, and for a <i>MAOA</i> VNTR. Polymorphisms were analysed by PCR-based methods.<h4>Results</h4>Although non-significant (<i>p</i> = .089), our study revealed the Stin2 10 minor allele with a marked higher frequency in girls with overweight/obesity (0.466) in comparison with controls (0.376). Combining the two <i>SLC6A4</i> polymorphisms, haplotype S/12 revealed in girls significant or nominally significant protective effects against BMI (β = -0.615; <i>p</i> = .009), BMI Z-score (β = -0.251; <i>p</i> = .006), WC (β = -1.4; <i>p</i> = .02) and WHtR (β = -0.008; <i>p</i> = .04).<h4>Conclusions</h4>We found some evidences for the role of <i>SLC6A4</i> gene in measures of childhood obesity, mainly in girls.
Also flagged:membrane proteinslipidstyrenemaleic acidmaleic amideamide
Journal Article2020-06-18No SnippetsFiori MC, Zheng W, Kamilar E, Simiyu G, Altenberg GA, Liang H.
Show Full Abstract
Membrane proteins can be reconstituted in polymer-encased nanodiscs for studies under near-physiological conditions and in the absence of detergents, but traditional styrene-maleic acid copolymers used for this purpose suffer severely from buffer incompatibilities. We have recently introduced zwitterionic styrene-maleic amide copolymers (zSMAs) to overcome this limitation. Here, we compared the extraction and reconstitution of membrane proteins into lipid nanodiscs by a series of zSMAs with different styrene:maleic amide molar ratios, chain sizes, and molecular weight distributions. These copolymers solubilize, stabilize, and support membrane proteins in nanodiscs with different efficiencies depending on both the structure of the copolymers and the membrane proteins.
Worldwide, nonalcoholic fatty liver disease (NAFLD) has reached epidemic proportions and in parallel, hepatocellular carcinoma (HCC) has become one of the fastest growing cancers. Despite the rise in these disease entities, detailed long-term outcomes of large NAFLD-associated HCC cohorts are lacking. In this report, we compared the overall and recurrence-free survival rates of NAFLD HCC cases to patients with HBV and HCV-associated HCC cases. Distinguishing features of NAFLD-associated HCC patients in the cirrhosis and non-cirrhosis setting were also identified. We conducted a retrospective study of 125 NAFLD, 170 HBV and 159 HCV HCC patients, utilizing clinical, pathological and radiographic data. Multivariate regression models were used to study the overall and recurrence-free survival. The overall survival rates were significantly higher in the NAFLD-HCC cases compared to HBV-HCC (HR = 0.35, 95% CI 0.15-0.80) and HCV-HCC (HR = 0.37, 95% CI 0.17-0.77) cases. The NAFLD-HCC patients had a trend for higher recurrence-free survival rates compared to HBV and HCV-HCC cases. Within the NAFLD group, 18% did not have cirrhosis or advanced fibrosis; Hispanic ethnicity (OR = 12.34, 95% CI 2.59-58.82) and high BMI (OR = 1.19, 95% CI 1.07-1.33) were significantly associated with having cirrhosis. NAFLD-HCC cases were less likely to exhibit elevated serum AFP (p < 0.0001). After treatments, NAFLD-related HCC patients had longer overall but not recurrence-free survival rates compared to patients with viral-associated HCC. Non-Hispanic ethnicity and normal BMI differentiated non-cirrhosis versus cirrhosis NAFLD HCC. Further studies are warranted to identify additional biomarkers to stratify NAFLD patients without cirrhosis who are at risk for HCC.
Also flagged:ironmetabolismosteoporosisHepcidinrheumatoid arthritisRA
Journal Article2020-06-18✓ 2 SnippetsSato H, Takai C, Kazama JJ, Wakamatsu A, Hasegawa E, Kobayashi D, Kondo N, Nakatsue T, Abe A, Ito S, Ishikawa H, Kuroda T, Suzuki Y, Narita I.
Hepcidin, a major regulator of iron metabolism and homeostasis, is regulated by inflammation. Recent studies have suggested that hepcidin and iron metabolism are involved in osteoporosis, and the aim of this study was to determine whether serum hepcidin levels are correlated with the degree of osteoporosis in patients with rheumatoid arthritis (RA). A total of 262 patients with RA (67.5 ± 11.4 years; 77.5% female) were enrolled. Serum iron, ferritin, and hepcidin levels were positively correlated each other. Multiple regression analyses revealed that the serum iron level was positively correlated with femoral T and Z scores, whereas the serum hepcidin level was not. Serum hepcidin level was correlated with the serum 25-hydroxy vitamin D level, which was in turn positively related to the femoral Z score. Serum hepcidin and serum iron were indirectly and directly related to osteoporosis in patients with RA.
Also flagged:digestionthrombintrypsinendoglucuronidaseswaterethanol
Journal Article2020-06-18✓ 1 SnippetKvist S, Manzano-Marín A, de Carle D, Trontelj P, Siddall ME.
In-Text Gene Mentions
Results)
…achelase, halyxin andantithrombin-III(from the King…
Show Full Abstract
The European medicinal leech has been used for medicinal purposes for millennia, and continues to be used today in modern hospital settings. Its utility is granted by the extremely potent anticoagulation factors that the leech secretes into the incision wound during feeding and, although a handful of studies have targeted certain anticoagulants, the full range of anticoagulation factors expressed by this species remains unknown. Here, we present the first draft genome of the European medicinal leech, Hirudo medicinalis, and estimate that we have sequenced between 79-94% of the full genome. Leveraging these data, we searched for anticoagulation factors across the genome of H. medicinalis. Following orthology determination through a series of BLAST searches, as well as phylogenetic analyses, we estimate that fully 15 different known anticoagulation factors are utilized by the species, and that 17 other proteins that have been linked to antihemostasis are also present in the genome. We underscore the utility of the draft genome for comparative studies of leeches and discuss our results in an evolutionary context.
Also flagged:NECTIN4adhesion moleculeMethadoneopioidheroinadherens junction
Journal Article2020-06-18✓ 2 SnippetsFang CP, Liu TH, Chung RH, Tsou HH, Kuo HW, Wang SC, Liu CC, Liu SC, Chen ACH, Liu YL.
In-Text Gene Mentions
Discussion)
…When the number of subjects was increased to 449,484 in the neuroticism genome-wide association analyses, SNP rs41266050 of RABGAP1L was identified as a neuroticism genetic biomarker [34] with an even closer distance 13,465,474 bp toward NECTIN4. This suggested that the NECTIN4 might be one of the candidate genes associated with neuroticism personality trait.…
Discussion)
…SNP rs41266050 ofRABGAP1Lwas identified as…
Show Full Abstract
Methadone is a synthetic opioid used as maintenance treatment for patients addicted to heroin. Skin irritation is one of the adverse events caused by opioid use. 344 methadone maintenance treatment (MMT) patients were recruited with records and measurements on methadone dose, plasma methadone concentrations, and treatment emergent symptom scales (TESS). 15 patients reported with skin irritation. Five SNPs located within the NECTIN4 genetic region were genotyped. The NECTIN4 gene within the adherens junction interaction pathway was associated with methadone dose in pathway-based genome wide association analyses (P = 0.0008). Three highly-linked SNPs, rs11265549, rs3820097, and rs4656978, were significantly associated with methadone dose (P = 0.0003), plasma concentrations of R,S-methadone (P = 0.0004) and TNF-α (P = 0.010) in all 344 MMT patients, and with self-report skin irritation symptom scores (P = 0.010) in the 15 MMT patients who reported with skin irritation. To identify the possible roles of plasma level of Nectin-4 in the responses to MMT and opioid use, additional age- and gender-matched 51 controls and 83 methadone-free abstinent former heroin users were recruited. Plasma level of Nectin-4 was the highest in MMT patients among the three groups. The results suggest involvement of genetic variants on NECTIN4 in methadone dose. Plasma Nectin-4 level is likely an indicator for continued use of opioids.
Also flagged:COVID-19pneumoniapleural effusionhydroxychloroquinemembraneCOVID-19 infection
Journal Article2020-06-18✓ 3 SnippetsKuroki Y, Hiyama K, Minami J, Takeuchi M, Shojima M, Matsueda S, Nagae H, Nakano T.
In-Text Gene Mentions
Discussion)
…no decrease inATIIIwas observed, and…
Discussion)
…coagulation and inactivatesATIII, derived from leukocytes…
I A O 0000613)
…The antithrombin III (ATIII) level was within…
Show Full Abstract
On 31 December 2019, cases of pneumonia whose cause was later identified as SARS-CoV-2 were detected in Wuhan City, Hubei Province of China, and now COVID-19 has spread worldwide. On March 1, 2020, a 69-year-old Japanese man who had been on hemodialysis for 3 years was diagnosed as having COVID-19 pneumonia and hospitalized at our Medical Center. Pulmonary CT revealed bilateral multiple consolidation with bilateral pleural effusion. Aggressive weight reduction was needed to improve the patient's respiratory condition. Hemodialysis therapy was performed in isolation with hydroxychloroquine administration, but the formation of a dialysis membrane clot forced the withdrawal of dialysis therapy. Changing the dialysis membrane material and anticoagulant enabled the resumption of dialysis therapy, allowing the body weight to correct downward. On the 5th hospitalization day, the patient's fever dropped and he showed improved oxygenation and chest X-ray. He was eventually discharged. The hydroxychloroquine and appropriate fluid management may have contributed to the patient's recovery. Clinicians should pay close attention to avoid dialysis-related problems when treating a patient with COVID-19.
Also flagged:visionmTORNotchGlaucomaSIX6primary open angle glaucoma
Journal Article2020-06-18✓ 1 SnippetTeotia P, Niu M, Ahmad I.
In-Text Gene Mentions
Results)
…GAP43 , andDCC), compared with…
Show Full Abstract
Glaucoma is characterized by a progressive degeneration of retinal ganglion cells (RGCs), leading to irreversible vision loss. Currently, there is no effective treatment for RGC degeneration. We used a disease-in-a-dish stem cell model to examine the developmental susceptibility of RGCs to glaucomatous degeneration, which may inform on the formulation of therapeutic approaches. Here, we used single-cell transcriptome analysis of SIX6 risk allele (SIX6<sup>risk allele</sup> ) primary open angle glaucoma patient-specific and control hRGCs to compare developmental trajectories in terms of lineage- and stage-specific transcriptional signature to identify dysregulated stages/genes, and subtype composition to estimate the relative vulnerability of RGCs to degeneration because their ability to regenerate axons are subtype-specific. The developmental trajectories, beginning from neural stem cells to RGCs, were similar between SIX6<sup>risk allele</sup> and control RGCs. However, the differentiation of SIX6<sup>risk allele</sup> RGCs was relatively stalled at the retinal progenitor cell stage, compromising the acquisition of mature phenotype and subtype composition, compared with controls, which was likely due to dysregulated mTOR and Notch signaling pathways. Furthermore, SIX6<sup>risk allele</sup> RGCs, as compared with controls, expressed fewer genes corresponding to RGC subtypes that are preferentially resistant to degeneration. The immature phenotype of SIX6<sup>risk allele</sup> RGCs with underrepresented degeneration-resistant subtypes may make them vulnerable to glaucomatous degeneration.
Also flagged:gene expressioninnate responsesphagocytosisextracellularwound healingbenzocaine
Journal Article2020-06-18No SnippetsRodgers AK, Smith JJ, Voss SR.
Show Full Abstract
Immune cells are known to be critical for successful limb regeneration in the axolotl (Ambystoma mexicanum), but many details regarding their identity, behavior, and function are yet to be resolved. We isolated peripheral leukocytes from the blood of adult axolotls and then created two samples for single-cell sequencing: 1) peripheral leukocytes (N = 7889) and 2) peripheral leukocytes with presumptive macrophages from the intraperitoneal cavity (N = 4998). Using k-means clustering, we identified 6 cell populations from each sample that presented gene expression patterns indicative of erythrocyte, thrombocyte, neutrophil, B-cell, T-cell, and myeloid cell populations. A seventh, presumptive macrophage cell population was identified uniquely from sample 2. We then isolated cells from amputated axolotl limbs at 1 and 6 days post-amputation (DPA) and performed single cell sequencing (N = 8272 and 9906 cells respectively) to identify immune and non-immune cell populations. Using k-means clustering, we identified 8 cell populations overall, with the majority of cells expressing erythrocyte-specific genes. Even though erythrocytes predominated, we used an unbiased approach to identify infiltrating neutrophil, macrophage, and lymphocyte populations at both time points. Additionally, populations expressing genes for epidermal cells, fibroblast-like cells, and endothelial cells were also identified. Consistent with results from previous experimental studies, neutrophils were more abundant at 1 DPA than 6 DPA, while macrophages and non-immune cells exhibited inverse abundance patterns. Of note, we identified a small population of fibroblast-like cells at 1 DPA that was represented by considerably more cells at 6 DPA. We hypothesize that these are early progenitor cells that give rise to the blastema. The enriched gene sets from our work will aid future single-cell investigations of immune cell diversity and function during axolotl limb regeneration.
Calcium pyrophosphate dihydrate deposition (CPPD) disease, also known as pseudogout, in which crystals are deposited in the joints and/or soft tissues, leads to a variety of articular and periarticular disorders. Herein we report a 67-year-old female patient with neck pain who was diagnosed as CPPD disease of both the atlantoaxial joint and right C4-C5 facet joint with radiological findings. The combined use of computed tomography and magnetic resonance imaging can be helpful in establishing a diagnosis and providing the correct treatment.
Also flagged:Brain InjuryAcutecentral nervous system (CNS) diseaseCNS diseasedeath
Journal Article2020-06-18No SnippetsChen J, Wang Y, Wu J, Yang J, Li M, Chen Q.
Show Full Abstract
Acute central nervous system (CNS) disease is very common and with high mortality. Many basic studies have confirmed the molecular mechanism of early brain injury (EBI) after acute CNS disease. Neuron death and dysfunction are important reasons for the neurological dysfunction in patients with acute CNS disease. Ferroptosis is a nonapoptotic form of cell death, the classical characteristic of which is based on the iron-dependent accumulation of toxic lipid reactive oxygen species. Previous studies have indicated that this mechanism is critical in the cell death events observed in many diseases, including cancer, tumor resistance, Alzheimer's disease, Parkinson's disease, stroke, and intracerebral hemorrhage (ICH). Ferroptosis may also play a very important role in EBI after acute CNS disease. Unresolved issues include the relationship between ferroptosis and other forms of cell death after acute CNS disease, the specific molecular mechanisms of EBI, the strategies to activate or inhibit ferroptosis to achieve desirable attenuation of EBI, and the need to find new molecular markers of ferroptosis that can be used to detect and study this process <i>in vivo</i> after acute CNS disease.
Also flagged:fractalkineCX3CR1FKNphagocytosisneurodegenerative disorderHD
Journal Article2020-06-18✓ 1 SnippetKim A, García-García E, Straccia M, Comella-Bolla A, Miguez A, Masana M, Alberch J, Canals JM, Rodríguez MJ.
In-Text Gene Mentions
Methods)
…33 in theHTTgene.…
Show Full Abstract
Huntington's disease (HD) is an inherited neurodegenerative disorder in which the striatum is the most affected brain region. Although a chronic inflammatory microglial reaction that amplifies disease progression has been described in HD patients, some murine models develop symptoms without inflammatory microglial activation. Thus, dysfunction of non-inflammatory microglial activity could also contribute to the early HD pathological process. Here, we show the involvement of microglia and particularly fractalkine signaling in the striatal synaptic dysfunction of R6/1 mice. We found reduced fractalkine gene expression and protein concentration in R6/1 striata from 8 to 20 weeks of age. Consistently, we also observed a down-regulation of fractalkine levels in the putamen of HD patients and in HD patient hiPSC-derived neurons. Automated cell morphology analysis showed a non-inflammatory ramified microglia in the striatum of R6/1 mice. However, we found increased PSD-95-positive puncta inside microglia, indicative of synaptic pruning, before HD motor symptoms start to manifest. Indeed, microglia appeared to be essential for striatal synaptic function, as the inhibition of microglial activity with minocycline impaired the induction of corticostriatal long-term depression (LTD) in wild-type mice. Notably, fractalkine administration restored impaired corticostriatal LTD in R6/1 mice. Our results unveil a role for fractalkine-dependent neuron-microglia interactions in the early striatal synaptic dysfunction characteristic of HD.
Also flagged:cancerscolorectal cancerreverse transcriptionpolymerasePNNbinding
Journal Article2020-06-18No SnippetsXie Y, Li J, Li P, Li N, Zhang Y, Binang H, Zhao Y, Duan W, Chen Y, Wang Y, Du L, Wang C.
Show Full Abstract
Circular RNAs (circRNAs) are emerging as cardinal areas of focus in the non-coding RNA field. Growing evidences have revealed exosomal circRNAs as potential biomarkers for detection of various cancers. However, the clinical importance of most serum exosomal circRNAs in colorectal cancer (CRC) have rarely been investigated. In this study, we examined the possible clinical application of serum exosomal circRNAs in the diagnosis of CRC. Firstly, we conducted RNA sequencing (RNA-seq) analysis using fifty CRC and fifty healthy control serum samples to identify CRC-related circRNAs. The sequencing data showed 122 differentially expressed circRNAs including 100 up-regulated and 22 down-regulated circRNA transcripts in CRC patients. Then, eight most dysregulated circRNAs were selected for validation by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay. Validation analysis revealed that the serum exosomal circ-PNN (hsa_circ_0101802) levels were significantly up-regulated in CRC cases compared with those in the healthy control groups. Receiver operating characteristic curve (ROC) analysis suggested that circ-PNN had significant value in CRC diagnosis with areas under the ROC curve (AUC) of 0.855 and 0.826 in the training and validation sets, respectively. We also found that the AUC of serum exosomal circ-PNN for early-stage CRC was 0.854. Finally, a network map based on circ-PNN was constructed to determine its potential miRNA-mRNAs binding. We also demonstrated that the expression of hsa-miR-6833-3P, hsa-let-7i-3p and hsa-miR-1301-3P were negatively correlated with circ-PNN in CRC patients. Collectively, our findings indicated that serum exosomal circ-PNN might be a potential non-invasive biomarker for the detection of CRC and may play a crucial role in the pathogenesis of CRC.
Also flagged:BCL6CMG2GAGTrypsinprolactin receptorprolactin
Journal Article2020-06-18No SnippetsShinbara K, Liu W, van Neer RHP, Katoh T, Suga H.
Show Full Abstract
Backbone macrocyclic structures are often found in diverse bioactive peptides and contribute to greater conformational rigidity, peptidase resistance, and potential membrane permeability compared to their linear counterparts. Therefore, such peptide scaffolds are an attractive platform for drug-discovery endeavors. Recent advances in synthetic methods for backbone macrocyclic peptides have enabled the discovery of novel peptide drug candidates against diverse targets. Here, we overview recent technical advancements in the synthetic methods including 1) enzymatic synthesis, 2) chemical synthesis, 3) split-intein circular ligation of peptides and proteins (SICLOPPS), and 4) <i>in vitro</i> translation system combined with genetic code reprogramming. We also discuss screening methodologies compatible with those synthetic methodologies, such as one-beads one-compound (OBOC) screening compatible with the synthetic method 2, cell-based assay compatible with 3, limiting-dilution PCR and mRNA display compatible with 4.
Also flagged:Alzheimer's diseaseADAlzheimer-s-Diseaseneurodegenerative diseasememory impairmentaphasia
Journal Article2020-06-18No SnippetsZhao T, Hu Y, Zang T, Wang Y.
Show Full Abstract
<b>Background:</b> At present, the main diagnostic methods for Alzheimer's disease (AD) are positron emission tomography (PET) scanning of the brain and analysis of cerebrospinal fluid (CSF) sample, but these methods are expensive and harmful to patients. Recently, more researchers focus on diagnosing AD by detecting biomarkers in blood, which is a cheaper and harmless way. Therefore, identifying AD-related proteins in blood can help treatment and diagnosis. <b>Methods:</b> We proposed a hypothesis that similar diseases share similar proteins. Diseases with similar symptoms are caused by abnormalities of similar proteins. Assuming that the similarities between AD and other diseases obey the normal distribution, we developed an iterative method based on disease similarity (IBDS). We combined Elastic Network (EN) with Minimum angle regression (MAR) to find the optimal solution. Finally, we used case studies and Summary data Mendelian Random (SMR) to verify our method. <b>Results:</b> We selected 39 diseases which are highly related to AD. They correspond 1,481 kinds of proteins. One hundred and eighty-four proteins are reported to be related to AD in Uniprot and the number would be 284 with our method. The AUC of our method by cross-validation is 0.9251 which is much higher than previous methods. <b>Conclusion:</b> In this paper, we presented a novel method for prioritizing AD-related proteins. Seven proteins have tissue specificity in blood among these 284 proteins, which could be used to diagnose AD in future. Case studies and SMR have been used to prove the relationship between these 7 proteins and AD. <b>Availability and Implementation:</b> https://github.com/zty2009/Identifying-Protein-Biomarkers-in-Blood-for-Alzheimer-s-Disease.
Also flagged:heart rhythm disorderstrokeheart failurearrhythmiaAtrial FibrillationAF
Journal Article2020-06-18No SnippetsRoselli C, Rienstra M, Ellinor PT.
Show Full Abstract
Atrial fibrillation is a common heart rhythm disorder that leads to an increased risk for stroke and heart failure. Atrial fibrillation is a complex disease with both environmental and genetic risk factors that contribute to the arrhythmia. Over the last decade, rapid progress has been made in identifying the genetic basis for this common condition. In this review, we provide an overview of the primary types of genetic analyses performed for atrial fibrillation, including linkage studies, genome-wide association studies, and studies of rare coding variation. With these results in mind, we aim to highlighting the existing knowledge gaps and future directions for atrial fibrillation genetics research.
Research Square2020-06-18Preprint (No Snippets API)Wang S, Qiu Z, Hou Y, Deng X, Zheng T, Yan R, Wu P, Xie S, Zhou Q, Huang J, Li X.
Show Full Abstract
The current coronavirus disease 2019 (COVID-19) pandemic presents a global public health challenge. The viral pathogen responsible, Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), binds to a host receptor ACE2 through its spike (S) glycoprotein, which mediates membrane fusion and virus entry. Although the role of ACE2 as a receptor for SARS-CoV-2 is clear, studies have shown that ACE2 expression across different human tissues is extremely low, especially in pulmonary and bronchial cells. Thus, other host receptors and/or co-receptors that promote the entry of SARS-CoV-2 into cells of the respiratory system might exist. In this study, we have identified tyrosine-protein kinase receptor UFO (AXL), specifically interacts with SARS-CoV-2 S on the host cell membrane. When overexpressed in cells that do not highly express either AXL or ACE2, AXL promotes virus entry as efficiently as ACE2. Strikingly, deleting AXL, but not ACE2, significantly reduces infection of pulmonary cells by the SARS-CoV-2 virus pseudotype. Soluble human recombinant AXL, but not ACE2, blocks SARS-CoV-2 virus pseudotype infection in pulmonary cells. Taken together, our findings suggest AXL may play an important role in promoting SARS-CoV-2 infection of the human respiratory system and is a potential target in future clinical intervention strategies.
Also flagged:Bipolar DisorderBPnucleotidespolymeraseaxonMapk
Journal Article2020-06-17✓ 1 SnippetBame M, McInnis MG, O'Shea KS.
In-Text Gene Mentions
Text
…CACNA1E…
Show Full Abstract
Bipolar disorder (BP) is a complex psychiatric condition characterized by severe fluctuations in mood for which underlying pathological mechanisms remain unclear. Family and twin studies have identified a hereditary component to the disorder, but a single causative gene (or set of genes) has not been identified. MicroRNAs (miRNAs) are small, noncoding RNAs ∼20 nucleotides in length, that are responsible for the posttranslational regulation of multiple genes. They have been shown to play important roles in neural development as well as in the adult brain, and several miRNAs have been reported to be dysregulated in postmortem brain tissue isolated from bipolar patients. Because there are no viable cellular models to study BP, we have taken advantage of the recent discovery that somatic cells can be reprogrammed to pluripotency then directed to form the full complement of neural cells. Analysis of RNAs extracted from Control and BP patient-derived neurons identified 58 miRNAs that were differentially expressed between the two groups. Using quantitative polymerase chain reaction we validated six miRNAs that were elevated and two miRNAs that were expressed at lower levels in BP-derived neurons. Analysis of the targets of the miRNAs indicate that they may regulate a number of cellular pathways, including axon guidance, Mapk, Ras, Hippo, Neurotrophin, and Wnt signaling. Many are involved in processes previously implicated in BP, such as cell migration, axon guidance, dendrite and synapse development, and function. We have validated targets of several different miRNAs, including <i>AXIN2</i>, <i>BDNF</i>, <i>RELN</i>, and <i>ANK3</i> as direct targets of differentially expressed miRNAs using luciferase assays. Identification of pathways altered in patient-derived neurons suggests that disruption of these regulatory networks that may contribute to the complex phenotypes in BP.
Also flagged:PALB2cardiovascular diseaseslipid disorderscancerhereditary cancerWT1
Journal Article2020-06-17✓ 5 SnippetseMERGE Clinical Annotation Working Group.
In-Text Gene Mentions
Abstract)
…Correcting for testing indication, we found a 3.02% overall frequency of IFs; 2.54% from 59 genes the American College of Medical Genetics and Genomics recommends for IF return, and 0.48% in other genes, primarily HFE and PALB2. IFs associated with cancer susceptibility were most frequent (1.38%), followed by cardiovascular diseases (0.87%), and lipid disorders (0.50%).…
Discussion)
…Of these, we returned IFs in HFE (associated with hemochromatosis; only in homozygotes for the higher-penetrance p.Cys282Tyr variant18) PALB2 (breast cancer), KCNE1 (arrhythmia), HNF1A (maturity-onset diabetes of the young), and MEFV (familial Mediterranean fever; only in homozygotes or compound heterozygotes for NM_000243.2:c.2080A>G (p.Met694Val) or NM_000243.2:c.2177T>C (p.Val726Ala) ).…
<h4>Purpose</h4>Discovering an incidental finding (IF) or secondary finding (SF) is a potential result of genomic testing, but few data exist describing types and frequencies of SFs likely to appear in broader clinical populations.<h4>Methods</h4>The Electronic Medical Records and Genomics Network Phase III (eMERGE III) developed a CLIA-compliant sequencing panel of 109 genes and 1551 variants of clinical relevance or research interest and deployed this panel at ten clinical sites. We evaluated medically actionable SFs across 67 genes and 14 single-nucleotide variants (SNVs) in a diverse cohort of 21,915 participants drawn from a variety of settings (e.g., primary care, biobanks, specialty clinics).<h4>Results</h4>Correcting for testing indication, we found a 3.02% overall frequency of SFs; 2.54% from 59 genes the American College of Medical Genetics and Genomics recommends for SF return, and 0.48% in other genes, primarily HFE and PALB2. SFs associated with cancer susceptibility were most frequent (1.38%), followed by cardiovascular diseases (0.87%), and lipid disorders (0.50%). After removing HFE, the frequency of SFs and proportion of pathogenic versus likely pathogenic SFs did not differ in those self-identifying as White versus others.<h4>Conclusion</h4>Here we present frequencies and types of medically actionable secondary findings to support informed decision making by patients, participants, and practitioners engaged in genomic medicine.
Also flagged:epithelial to mesenchymal transitionhepatocellular carcinomacancerportal vein tumorPCBP1luciferase
Journal Article2020-06-17✓ 5 SnippetsSong LN, Qiao GL, Yu J, Yang CM, Chen Y, Deng ZF, Song LH, Ma LJ, Yan HL.
In-Text Gene Mentions
Results)
…Circ0003998 derived from exons (6 to 7) of ARFGEF2 gene were significantly upregulated in the PVTT group (p = 0.000000273) than in the HCC group; and therefore, circ0003998 was selected as the candidate circRNA.…
Introduction)
…exchange factor 2 (ARFGEF2) and located at…
Methods)
…as compared toARFGEF2mRNA.…
Results)
…to 7) ofARFGEF2gene were significantly…
Results)
…exon 6 ofARFGEF2, in order to…
Show Full Abstract
<h4>Background</h4>Circular RNAs (circRNAs) play a critical regulatory role in cancer progression. However, the underlying mechanisms of circRNAs in hepatocellular carcinoma (HCC) metastasis remain mostly unknown.<h4>Methods</h4>Has_circ_0003998 (circ0003998) was identified by RNAs sequencing in HCC patients with /without portal vein tumor thrombus (PVTT) metastasis. The expression level of circ0003998 was further detected by in situ hybridization on tissues microarray (ISH-TMA) and qRT-PCR in 25 HCC patients with PVTT metastasis. Moreover, the 25 HCC patients with PVTT metastasis and 50 HCC patients without PVTT metastasis were recruited together to analyze the correlation between circ0003998 expression and HCC clinical characteristics. Transwell, migration and CCK8 assays, as well as nude mice model of lung or liver metastasis were used to evaluate the role of circ0003998 in epithelial to mesenchymal transition (EMT) in HCC. The regulatory mechanisms of circ0003998 in miR-143-3p and PCBP1 were determined by dual-luciferase reporter assay, nuclear-cytoplasmic fractionation, fluorescent in situ hybridization, RNA pull- down, microRNA sequence, western blot and RNA immunoprecipitation.<h4>Results</h4>Compared with adjacent normal liver tissues (ANL), circ0003998 expression was significantly upregulated in PVTT tissues and HCC tissues, and its expression correlates with the aggressive characteristics of HCC patients. Further assays suggested that circ0003998 promoted EMT of HCC both in vitro and in vivo. Mechanistically, our data indicated that circ0003998 may act as a ceRNA (competing endogenous RNA) of microRNA-143-3p to relieve the repressive effect on EMT-related stimulator, FOSL2; meanwhile, circ0003998 could bind with PCBP1-poly(rC) binding protein 1 (PCBP1) to increase the expression level of EMT-related genes, CD44v6.<h4>Conclusion</h4>Circ0003998 promotes EMT of HCC by circ0003998/miR-143-3p/FOSL2 axis and circ0003998 /PCBP1/CD44v6 axis.
Also flagged:Depressioninflammatory responsesmajor depressive disorderantibodiesCD4adhesion molecules
Journal Article2020-06-17No SnippetsBeurel E, Toups M, Nemeroff CB.
Show Full Abstract
Depression represents the number one cause of disability worldwide and is often fatal. Inflammatory processes have been implicated in the pathophysiology of depression. It is now well established that dysregulation of both the innate and adaptive immune systems occur in depressed patients and hinder favorable prognosis, including antidepressant responses. In this review, we describe how the immune system regulates mood and the potential causes of the dysregulated inflammatory responses in depressed patients. However, the proportion of never-treated major depressive disorder (MDD) patients who exhibit inflammation remains to be clarified, as the heterogeneity in inflammation findings may stem in part from examining MDD patients with varied interventions. Inflammation is likely a critical disease modifier, promoting susceptibility to depression. Controlling inflammation might provide an overall therapeutic benefit, regardless of whether it is secondary to early life trauma, a more acute stress response, microbiome alterations, a genetic diathesis, or a combination of these and other factors.
Also flagged:IL-23baseIL-17autoimmune diseaseCD4autoantibody
Journal Article2020-06-17✓ 1 SnippetHong H, Gao M, Wu Q, Yang P, Liu S, Li H, Burrows PD, Cua D, Chen JY, Hsu HC, Mountz JD.
In-Text Gene Mentions
Text
…histone variate…
Show Full Abstract
IL-23 promotes autoimmune disease, including Th17 CD4 T cell development and autoantibody production. In this study, we show that a deficiency of the p19 component of IL-23 in the autoimmune BXD2 (BXD2-<i>p19<sup>-/-</sup></i> ) mouse leads to a shift of the follicular T helper cell program from follicular T helper (Tfh)-IL-17 to Tfh-IFN-γ. Although the germinal center (GC) size and the number of GC B cells remained the same, BXD2-<i>p19<sup>-/-</sup></i> mice exhibited a lower class-switch recombination (CSR) in the GC B cells, leading to lower serum levels of IgG2b. Single-cell transcriptomics analysis of GC B cells revealed that whereas <i>Ifngr1</i>, <i>Il21r</i>, and <i>Il4r</i> genes exhibited a synchronized expression pattern with <i>Cxcr5</i> and plasma cell program genes, <i>Il17ra</i> exhibited a synchronized expression pattern with <i>Cxcr4</i> and GC program genes. Downregulation of <i>Ighg2b</i> in BXD2-<i>p19<sup>-/-</sup></i> GC B cells was associated with decreased expression of CSR-related novel base excision repair genes that were otherwise predominantly expressed by <i>Il17ra</i> <sup>+</sup> GC B cells in BXD2 mice. Together, these results suggest that although IL-23 is dispensable for GC formation, it is essential to promote a population of Tfh-IL-17 cells. IL-23 acts indirectly on <i>Il17ra</i> <sup>+</sup> GC B cells to facilitate CSR-related base excision repair genes during the dark zone phase of GC B cell development.
Also flagged:mitochondriaobesityVacuolesmembraneelectroniodide
Journal Article2020-06-17✓ 3 SnippetsMarei WFA, Smits A, Mohey-Elsaeed O, Pintelon I, Ginneberge D, Bols PEJ, Moerloose K, Leroy JLMR.
In-Text Gene Mentions
Methods)
…CAT, PRDX1, PRDX3,PRDX6and NRF2 )…
Results)
…increased CAT andPRDX6mRNA expression.…
Discussion)
…of CAT andPRDX6were significantly increased…
Show Full Abstract
Maternal obesity can cause reduced oocyte quality and subfertility. Mitochondrial dysfunction plays a central role here, and most often inbred mouse models are used to study these pathways. We hypothesized that the mouse genetic background can influence the impact of high fat diet (HFD)-induced obesity on oocyte quality. We compared the inbred C57BL/6 (B6) and the outbred Swiss strains after feeding a HFD for 13w. HFD-mice had increased body weight gain, hypercholesterolemia, and increased oocyte lipid droplet (LD) accumulation in both strains. LD distribution was strain-dependent. In Swiss mouse oocytes, HFD significantly increased mitochondrial inner membrane potential (MMP), reactive oxygen species concentrations, mitochondrial ultrastructural abnormalities (by 46.4%), and endoplasmic reticulum (ER) swelling, and decreased mtDNA copy numbers compared with Swiss controls (P < 0.05). Surprisingly, B6-control oocytes exhibited signs of cellular stress compared to the Swiss controls (P < 0.05); upregulated gene expression of ER- and oxidative stress markers, high mitochondrial ultrastructural abnormalities (48.6%) and ER swelling. Consequently, the HFD impact on B6 oocyte quality was less obvious, with 9% higher mitochondrial abnormalities, and no additive effect on MMP and stress marks compared to B6 control (P > 0.1). Interestingly, mtDNA in B6-HFD oocytes was increased suggesting defective mitophagy. In conclusion, we show evidence that the genetic background or inbreeding can affect mitochondrial functions in oocytes and may influence the impact of HFD on oocyte quality. These results should create awareness when choosing and interpreting data obtained from different mouse models before extrapolating to human applications.
Also flagged:sodiumpotassiumdiabetescreatinineureaglomerular filtration
Journal Article2020-06-17✓ 1 SnippetBaqar S, Michalopoulos A, Jerums G, Ekinci EI.
In-Text Gene Mentions
Results)
…diabetes after transplant,hemochromatosis, and pancreatitis induced…
Show Full Abstract
<h4>Objective</h4>Despite public health bodies advocating for lowering dietary sodium and increasing potassium intake to improve cardiovascular outcomes, people with diabetes are not meeting these targets. We hypothesize that (i) both at an individual level and within the cohort, there will be a low adherence to the guidelines and (ii) sodium and potassium intake will remain stable over time.<h4>Methods</h4>We conducted this prospective study in a cohort of 904 participants with diabetes who provided 24-h urine collections from 2009 to 2015. Dietary sodium and potassium intake were estimated from 24-h urinary sodium (uNa) and potassium (uK) measurements. Additional data were collected for: 24-h urinary volume (uVol), creatinine (uCr),; serum creatinine, urea, estimated glomerular filtration rate (eGFR), glycated haemoglobin (HbA1c), fasting glucose, lipids); clinical characteristics (age, blood pressure (BP), body mass index (BMI) and duration of diabetes). Adherence to recommended dietary sodium (uNa < 2300 mg/24 h (100mmol/24 h)) and potassium (uK > 4680 mg/24 h(120 mmol/24)) intake were the main outcome measures.<h4>Results</h4>Participants (n = 904) completed 3689 urine collections (average four collections/participant). The mean ± SD (mmol/24 h) for uNa was 181 ± 73 and uK was 76 ± 25. After correcting uNa for uCr, 7% and 5% of participants met dietary sodium and potassium guidelines respectively. Males were less likely to meet sodium guidelines (OR 0.40, p < 0.001) but were more likely to meet potassium guidelines (OR 6.13, p < 0.001). Longer duration of diabetes was associated with higher adherence to sodium and potassium guidelines (OR 1.04, p < 0.001 and OR 0.96, p = 0.006 respectively). Increasing age was significantly associated with adherence to potassium guidelines (OR 0.97, p = 0.007).<h4>Conclusions</h4>People with diabetes do not follow current dietary sodium and potassium guidelines and are less likely to change their dietary intake of sodium and potassium over time.
Also flagged:nicotine addictiond14Huntingting10cardiovascular diseaseDeath
Journal Article2020-06-17✓ 5 SnippetsSundblom J, Niemelä V, Ghazarian M, Strand AS, Bergdahl IA, Jansson JH, Söderberg S, Stattin EL.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Abstract)
…Trinucleotide (CAG) repeat expansions longer than 39 in the huntingtin (HTT) gene cause Huntington’s disease (HD).…
Title)
…alleles in theHTTgene in Northern…
Abstract)
…expansions in theHTTgene in north…
Abstract)
…analysis of theHTTgene was performed,…
Show Full Abstract
Trinucleotide (CAG) repeat expansions longer than 39 in the huntingtin (HTT) gene cause Huntington's disease (HD). The frequency of intermediate alleles (IA) with a length of 27-35 in the general population is not fully known, but studied in specific materials connected to the incidence of HD. The Swedish Huntingtin Alleles and Phenotype (SHAPE) study aims to assess the frequency of trinucleotide repeat expansions in the HTT gene in north Sweden. 8260 individuals unselected for HD from the counties of Norr- and Västerbotten in the north of Sweden were included. DNA samples were obtained and analysis of the HTT gene was performed, yielding data on HTT gene expansion length in 7379 individuals. A high frequency of intermediate alleles, 6.8%, was seen. Also, individuals with repeat numbers lower than ever previously reported (<5) were found. These results suggest a high frequency of HD in the norther parts of Sweden. Subsequent analyses may elucidate the influence of IA:s on traits other than HD.
Also flagged:non-communicable diseasescardiovascular diseasesdiabeteshypertensiondyslipidemiapsychiatric disorders
Journal Article2020-06-17No SnippetsBelaunzaran-Zamudio PF, Caro-Vega Y, Giganti MJ, Castilho JL, Crabtree-Ramirez BE, Shepherd BE, Mejía F, Cesar C, Moreira RC, Wolff M, Pape JW, Padgett D, McGowan CC, Sierra-Madero JG, Caribbean, Central and South American network for HIV epidemiology (CCASAnet).
Show Full Abstract
<h4>Background</h4>A growing population of older adults with HIV will increase demands on HIV-related healthcare. Nearly a quarter of people receiving care for HIV in Latin America are currently 50 years or older, yet little is known about the frequency of comorbidities in this population. We estimated the prevalence and incidence of non-communicable diseases (NCDs) among people 50 years of age or older (≥50yo) receiving HIV care during 2000-2015 in six centers affiliated with the Caribbean, Central and South American network for HIV epidemiology (CCASAnet).<h4>Methods</h4>We estimated the annual prevalence, and overall prevalence and incidence of cardiovascular diseases, diabetes, hypertension, dyslipidemia, psychiatric disorders, chronic liver and renal diseases, and non-AIDS-defining cancers, and multimorbidity (more than one NCD) of people ≥50yo receiving care for HIV. Analyses were performed according to age at enrollment into HIV care (<50yo and ≥50yo).<h4>Results</h4>We included 3,415 patients ≥50yo, of whom 1,487(43%) were enrolled at age ≥50 years. The annual prevalence of NCDs increased from 32% to 68% and multimorbidity from 30% to 40% during 2000-2015. At the last registered visit, 53% of patients enrolled <50yo and 50% of those enrolled ≥50yo had at least one NCD. Most common NCDs at the last visit in each age-group at enrollment were dyslipidemia (36% in <50yo and 28% in ≥50yo), hypertension (17% and 18%), psychiatric disorders (15% and 10%), and diabetes (11% and 12%).<h4>Conclusions</h4>The prevalence of NCDs and multimorbidity in people ≥50 years receiving care for HIV in CCASAnet centers in Latin America increased substantially in the last 15 years. Our results make evident the need of planning for provision of complex, primary care for aging adults living with HIV.
Programmed cellular responses to cycling ovarian-derived steroid hormones are central to normal endometrial function. Abnormalities therein, as in the estrogen-dependent, progesterone-"resistant" disorder, endometriosis, predispose to infertility and poor pregnancy outcomes. The endometrial stromal fibroblast (eSF) is a master regulator of pregnancy success. However, the complex hormone-epigenome-transcriptome interplay in eSF by each individual steroid hormone, estradiol (E2) and/or progesterone (P4), under physiologic and pathophysiologic conditions, is poorly understood and was investigated herein. Genome-wide analysis in normal, early and late stage eutopic eSF revealed: i) In contrast to P4, E2 extensively affected the eSF DNA methylome and transcriptome. Importantly, E2 resulted in a more open versus closed chromatin, confirmed by histone modification analysis. Combined E2 with P4 affected a totally different landscape than E2 or P4 alone. ii) P4 responses were aberrant in early and late stage endometriosis, and mapping differentially methylated CpG sites with progesterone receptor targets from the literature revealed different but not decreased P4-targets, leading to question the P4-"resistant" phenotype in endometriosis. Interestingly, an aberrant E2-response was noted in eSF from endometriosis women; iii) Steroid hormones affected specific genomic contexts and locations, significantly enriching enhancers and intergenic regions and minimally involving proximal promoters and CpG islands, regardless of hormone type and eSF disease state. iv) In eSF from women with endometriosis, aberrant hormone-induced methylation signatures were mainly due to existing DNA methylation marks prior to hormone treatments and involved known endometriosis genes and pathways. v) Distinct DNA methylation and transcriptomic signatures revealed early and late stage endometriosis comprise unique disease subtypes. Taken together, the data herein, for the first time, provide significant insight into the hormone-epigenome-transcriptome interplay of each steroid hormone in normal eSF, and aberrant E2 response, distinct disease subtypes, and pre-existing epigenetic aberrancies in the setting of endometriosis, provide mechanistic insights into how endometriosis affects endometrial function/dysfunction.
Also flagged:bindingtransportationdegradationcapsules
Journal Article2020-06-17✓ 1 SnippetYu J, Hu B.
In-Text Gene Mentions
Methods)
…TheDCCbasic structure is…
Show Full Abstract
To effectively minimize elevator safety accidents, big data technology is combined with deep learning technology based on the Spark platform. This study first introduces the relevant theories of elevator safety monitoring technology, namely big data technology and deep learning technology. Then, the fault types that occur in the running state of the elevator are identified, and a finite state machine model is established. An elevator fault monitoring method based on the Spark platform is proposed, namely finite state machine (FSM), and the results of elevator safety fault monitoring are evaluated. Based on deep learning, an elevator fault warning model is constructed and its early warning performance is evaluated. The results show that the study can realize real-time and effective monitoring in the operation state of the elevator, and can determine the fault type of the elevator by binding the abnormal operation state with the corresponding fault. The feasibility of the elevator safety monitoring efficiency is evaluated based on three indexes: mutual information, accuracy, and false positives. Compared with other algorithms, the proposed FSM algorithm has the largest mutual information (0.1337), the highest accuracy (0.9899), the lowest false positive rate (0.0624), and the lowest false negative rate (0.1126); compared with other models, the elevator fault warning model proposed in this study has the lowest root mean-square error (RMSE) value (0.0201), the highest accuracy (0.9834), the lowest Loss value (0.0012), and the shortest convergence time (88.2608s), indicating that the elevator safety monitoring system and elevator fault warning model are feasible. This study establishes a good direction for elevator safety monitoring efficiency in China.
Also flagged:NLRP3sepsisplatelet activationimmune responseinfectionCaspase 1
Journal Article2020-06-17No SnippetsCornelius DC, Travis OK, Tramel RW, Borges-Rodriguez M, Baik CH, Greer M, Giachelli CA, Tardo GA, Williams JM.
Show Full Abstract
Sepsis is characterized by organ dysfunction due to a dysregulated immune response to infection. Currently, no effective treatment for sepsis exists. Platelets are recognized as mediators of the immune response and may be a potential therapeutic target for the treatment of sepsis. We previously demonstrated that NLRP3 inflammasome activation in sepsis-induced activated platelets was associated with multi-organ injury in the cecal-ligation puncture (CLP) rat model of sepsis. In this study, we tested the hypothesis that inhibition of NLRP3 would inhibit platelet activation and attenuate multi-organ injury in the CLP rat. CLP (n = 10) or Sham (n = 10) surgery were performed in male and female Sprague-Dawley rats. A subset of CLP rats were treated with MCC950 (50mg/kg/d), a specific NLRP3 inhibitor (CLP+MCC950, n = 10). At 72 hrs. post-CLP, blood and organs were harvested for analysis of platelet activation, NLRP3 activation, inflammation and end organ damage. Platelet activation increased from 8±0.8% in Sham to 16±1% in CLP, and was reduced to 9±1% in CLP+M rats (p<0.05). NLRP3 activation was also increased in platelets of CLP vs Sham. NLRP3 expression was unchanged in kidney and lung after CLP, but Caspase 1 expression and IL-1β were increased. MCC950 treatment attenuated NLRP3 activation in platelets. Plasma, kidney, and lung levels of NLRP3 inflammasome associated cytokines, IL-1ß and IL-18, were significantly increased in CLP compared to Sham rats. Inhibition of NLRP3 normalized cytokine levels. Glomerular injury, pulmonary edema, and endothelial dysfunction markers were increased in CLP rats vs Sham. MCC950 treatment significantly decreased renal and pulmonary injury and endothelial dysfunction in CLP+M. Our results demonstrate a role for NLRP3 in contributing to platelet activation and multi-organ injury in sepsis.
Also flagged:Lipidmineralslipid acyl hydroperoxides2thiobarbituric acidfluorosis
Journal Article2020-06-17No SnippetsTkachenko H, Kurhaluk N, Skaletska N, Maksin V, Osadowski Z.
Show Full Abstract
The study aimed to assess the levels of trace elements, minerals, and toxic elements as well as lipid peroxidation biomarkers (lipid acyl hydroperoxides, 2-thiobarbituric acid reactive substances (TBARS)) in the blood of children with chronic fluorosis from endemic fluorosis areas (Sosnivka village, Lviv region, western Ukraine). The results were compared with healthy children from Staryi Sambir (Lviv region, western Ukraine), whose drinking water contained permissible levels (< 1 ppm) of fluoride. Thirty-one children from the Sosnivka village in the Lviv region, including 16 females and 15 males aged 7-10 years, with clinically diagnosed fluorosis, were recruited for the study. The children had been exposed to fluoride (> 1.5 ppm) through drinking water for more than 5 years. In the blood, eight macro- and microelements (calcium, zinc, potassium, iron, copper, selenium, manganese, chromium), five additional elements (sulfur, bromine, chlorine, nickel, strontium), and four toxic elements (lead, mercury, cadmium, mercury) were assessed with the X-ray fluorescence method. The results of our study demonstrated a 14-fold decrease in the copper level, a 2.5-fold decrease in the calcium and zinc levels, and a 2-fold decrease in the selenium level in the blood of children with chronic fluorosis compared with the healthy children from the non-fluorosis area. In turn, a 1.7- and 1.4-fold increase in the strontium and lead content, respectively, was noted. The sulfur, chlorine, potassium, calcium, copper, zinc, and selenium levels in the blood samples of children with chronic fluorosis were lower than the reference value. The children had higher blood TBARS levels, while the acyl hydroperoxide levels were non-significantly increased in comparison with healthy children living in the non-fluorosis area. Additionally, the bromine level was correlated positively with the selenium level and acyl hydroperoxides. However, more studies are needed to clarify the relationship between blood mineral status, oxidative stress biomarkers, and chronic fluorosis.
Also flagged:Metforminarecolinebindingfertilizationmitochondriatype 2 diabetes
Journal Article2020-06-17No SnippetsLi WD, Zang CJ, Yin S, Shen W, Sun QY, Zhao M.
Show Full Abstract
<h4>Objectives</h4>Arecoline is the main bioactive substance extracted from Areca catechu L, which has cell, neural and genetic toxicity. The function of arecoline in reproductive system has not been well explored.<h4>Materials and methods</h4>To investigate the toxic effects of arecoline on oocyte development, immunofluorescence staining, qPCR, Western blotting, sperm binding assays and in vitro fertilization were performed to evaluate oocyte meiosis competence and embryo development.<h4>Results</h4>Our data revealed that arecoline exposure disrupts actin filament dynamics, spindle assembly and kinetochore-microtubule attachment stability in mouse oocytes, leading to aneuploidy and oocyte meiosis arrest. In addition, arecoline treatment disturbs the distribution of mitochondria, reduces ATP production and increases the level of oxidative stress, which ultimately induces oocyte apoptosis. Supplementation with metformin, a medicine for type 2 diabetes in the clinic, partially alleviates these damages.<h4>Conclusions</h4>Metformin has a protective effect on arecoline-induced mouse oocytes apoptosis.
Also flagged:gene expressionnucleusCPAAPAPolyadenylationDisorders
Journal Article2020-06-17✓ 1 SnippetNourse J, Spada S, Danckwardt S.
In-Text Gene Mentions
S I O 001029)
…Huntington disease is caused by a CAG repeat expansion in exon 1 of the huntingtin (HTT) gene [248].…
Show Full Abstract
A crucial feature of gene expression involves RNA processing to produce 3' ends through a process termed 3' end cleavage and polyadenylation (CPA). This ensures the nascent RNA molecule can exit the nucleus and be translated to ultimately give rise to a protein which can execute a function. Further, alternative polyadenylation (APA) can produce distinct transcript isoforms, profoundly expanding the complexity of the transcriptome. CPA is carried out by multi-component protein complexes interacting with multiple RNA motifs and is tightly coupled to transcription, other steps of RNA processing, and even epigenetic modifications. CPA and APA contribute to the maintenance of a multitude of diverse physiological processes. It is therefore not surprising that disruptions of CPA and APA can lead to devastating disorders. Here, we review potential CPA and APA mechanisms involving both loss and gain of function that can have tremendous impacts on health and disease. Ultimately we highlight the emerging diagnostic and therapeutic potential CPA and APA offer.
Also flagged:HomeostasisBrain Arteriovenous MalformationbAVMtransforming growth factor betaTGF-βBMP
Journal Article2020-06-17No SnippetsScimone C, Granata F, Longo M, Mormina E, Turiaco C, Caragliano AA, Donato L, Sidoti A, D'Angelo R.
Show Full Abstract
Brain arteriovenous malformation (bAVM) is a congenital defect affecting brain microvasculature, characterized by a direct shunt from arterioles to venules. Germline mutations in several genes related to transforming growth factor beta (TGF-β)/BMP signaling are linked to both sporadic and hereditary phenotypes. However, the low incidence of inherited cases makes the genetic bases of the disease unclear. To increase this knowledge, we performed a whole exome sequencing on five patients, on DNA purified by peripheral blood. Variants were filtered based on frequency and functional class. Those selected were validated by Sanger sequencing. Genes carrying selected variants were prioritized to relate these genes with those already known to be linked to bAVM development. Most of the prioritized genes showed a correlation with the TGF-βNotch signaling and vessel morphogenesis. However, two novel pathways related to cilia morphogenesis and ion homeostasis were enriched in mutated genes. These results suggest novel insights on sporadic bAVM onset and confirm its genetic heterogeneity. The high frequency of germline variants in genes related to TGF-β signaling allows us to hypothesize bAVM as a complex trait resulting from the co-existence of low-penetrance loci. Deeper knowledge on bAVM genetics can improve personalized diagnosis and can be helpful with genotype-phenotype correlations.
Also flagged:triple-negative breast cancercancersSmall nucleolar RNA host gene 22tumorovarian carcinomagene expression
Journal Article2020-06-17✓ 5 SnippetsFang X, Zhang J, Li C, Liu J, Shi Z, Zhou P.
In-Text Gene Mentions
Results)
…To determine the importance of SNHG22/miR-324-3p/SUDS3 axis in TNBC, we further detected the expression level of them in clinical TNBC samples and conducted animal study.…
Results)
…For the sake of probing into the function of SNHG22/miR-324-3p/SUDS3 axis in TNBC, we carried out a series of restoration experiments.…
Abstract)
…Subsequently, we identified that SUDS3, a tumor-facilitator with elevated expression in TNBC, was the downstream target of SNHG22/miR-324-3p axis.…
Results)
…To analyze the association of SUDS3 with SNHG22 and miR-324-3p in TNBC, we then implemented a series of experiments.…
Abstract)
…LncRNA SNHG22 facilitated cell growth and motility in TNBC via sponging miR-324-3p and upregulating SUDS3, highlighting a new promising road for TNBC treatment development.…
Show Full Abstract
<h4>Background</h4>Increasing evidence has indicated the important role of long non-coding RNAs (lncRNAs) in regulating the development and progression of cancers, including triple-negative breast cancer (TNBC). Small nucleolar RNA host gene 22 (SNHG22) is a novel lncRNA that has been identified as tumor-contributor in ovarian carcinoma. However, its function has not been explored in TNBC.<h4>Methods</h4>qRT-PCR was used to identify gene expression at mRNA level while western blot was utilized to analyze the protein level. Functional assays were implemented to identify changes on the proliferation, apoptosis and motility of TNBC cells under different conditions. Additionally, mechanistic assays, such as RIP assay, RNA pull down assay and luciferase reporter assay, were applied to assess relationships between molecules.<h4>Results</h4>SNHG22 represented a high expression level in TNBC tissues and cells. Besides, SNHG22 silencing restrained the proliferation, migration and invasion of TNBC cells. Furthermore, miR-324-3p that was lowly expressed in TNBC cells was conformed to be sponged by SNHG22. Moreover, upregulated miR-324-3p inhibited cell proliferation and motility in TNBC. Subsequently, we identified that SUDS3, a tumor-facilitator with elevated expression in TNBC, was the downstream target of SNHG22/miR-324-3p axis. Of note, miR-324-3p repression or SUDS3 overexpression could rescue the anti-tumor effect of SNHG22 silencing on the malignant phenotypes of TNBC cells.<h4>Conclusion</h4>LncRNA SNHG22 facilitated cell growth and motility in TNBC via sponging miR-324-3p and upregulating SUDS3, highlighting a new promising road for TNBC treatment development.
<h4>Background</h4>Haematoxylin and eosin (H&E)-which respectively stain nuclei blue and other cellular and stromal material pink-are routinely used for clinical diagnosis based on the identification of morphological features. A richer characterization can be achieved by laser capture microdissection coupled to mass spectrometry (LCM-MS), giving an unbiased assay of the proteins that make up the tissue. However, the process of fixing and H&E staining of tissues provides challenges with standard sample preparation methods for mass spectrometry, resulting in low protein yield. Here we describe a microproteomics technique to analyse H&E-stained, formalin-fixed paraffin-embedded (FFPE) tissues.<h4>Methods</h4>Herein, we utilize heat extraction, physical disruption, and in column digestion for the analysis of H&E stained FFPE tissues. Micro-dissected morphologically normal human lung alveoli (0.082 mm<sup>3</sup>) and human lung blood vessels (0.094 mm<sup>3</sup>) from FFPE-fixed H&E-stained sections from Idiopathic Pulmonary Fibrosis (IPF) specimens (n = 3 IPF specimens) were then subject to a qualitative and then quantitative proteomics approach using BayesENproteomics. In addition, we tested the sensitivity of this method by processing and analysing a range of micro-dissected human lung blood vessel tissue volumes.<h4>Results</h4>This approach yields 1252 uniquely expressed proteins (at a protein identification threshold of 3 unique peptides) with 892 differentially expressed proteins between these regions. In accord with prior knowledge, our methodology approach confirms that human lung blood vessels are enriched with smoothelin, CNN1, ITGA7, MYH11, TAGLN, and PTGIS; whereas morphologically normal human lung alveoli are enriched with cytokeratin-7, -8, -18, -19, 14, and -17. In addition, we identify a total of 137 extracellular matrix (ECM) proteins and immunohistologically validate that laminin subunit beta-1 localizes to morphologically normal human lung alveoli and tenascin localizes to human lung blood vessels. Lastly, we show that this micro-proteomics technique can be applied to tissue volumes as low as 0.0125 mm<sup>3</sup>.<h4>Conclusion</h4>Herein we show that our multistep sample preparation methodology of LCM-MS can identify distinct, characteristic proteomic compositions of anatomical features within complex fixed and stained tissues.
Also flagged:Oligonucleotidesasialoglycoprotein receptoroligonucleotideacute hepatic porphyria
Journal Article2020-06-17No SnippetsDebacker AJ, Voutila J, Catley M, Blakey D, Habib N.
Show Full Abstract
Targeted delivery of oligonucleotides to liver hepatocytes using N-acetylgalactosamine (GalNAc) conjugates that bind to the asialoglycoprotein receptor has become a breakthrough approach in the therapeutic oligonucleotide field. This technology has led to the approval of givosiran for the treatment of acute hepatic porphyria, and there are another seven conjugates in registrational review or phase 3 trials and at least another 21 conjugates at earlier stages of clinical development. This review highlights some of the recent chemical and preclinical advances in this space, leading to a large number of clinical candidates against a diverse range of targets in liver hepatocytes. The review focuses on the use of this delivery system for small interfering RNAs (siRNAs) and antisense molecules that cause downregulation of target mRNA and protein. A number of other approaches such as anti-microRNAs and small activating RNAs are starting to exploit the technology, broadening the potential of this approach for therapeutic oligonucleotide intervention.
Also flagged:neurodegenerative diseasePDneuromuscular junctionangiogenesisaxonautophagy
Journal Article2020-06-17No SnippetsLavin KM, Ge Y, Sealfon SC, Nair VD, Nair VD, Wilk K, McAdam JS, Windham ST, Kumar PL, McDonald MN, Bamman MM.
Show Full Abstract
Parkinson's disease (PD) is the most common motor neurodegenerative disease, and neuromuscular function deficits associated with PD contribute to disability. Targeting these symptoms, our laboratory has previously evaluated 16-week high-intensity resistance exercise as rehabilitative training (RT) in individuals with PD. We reported significant improvements in muscle mass, neuromuscular function (strength, power, and motor unit activation), indices of neuromuscular junction integrity, total and motor scores on the unified Parkinson's disease rating scale (UPDRS), and total and sub-scores on the 39-item PD Quality of Life Questionnaire (PDQ-39), supporting the use of RT to reverse symptoms. Our objective was to identify transcriptional networks that may contribute to RT-induced neuromuscular remodeling in PD. We generated transcriptome-wide skeletal muscle RNA-sequencing in 5 participants with PD [4M/1F, 67 ± 2 years, Hoehn and Yahr stages 2 (<i>n</i> = 3) and 3 (<i>n</i> = 2)] before and after 16-week high intensity RT to identify transcriptional networks that may in part underpin RT-induced neuromuscular remodeling in PD. Following RT, 304 genes were significantly upregulated, notably related to remodeling and nervous system/muscle development. Additionally, 402 genes, primarily negative regulators of muscle adaptation, were downregulated. We applied the recently developed Pathway-Level Information ExtractoR (PLIER) method to reveal coordinated gene programs (as latent variables, LVs) that differed in skeletal muscle among young (YA) and old (OA) healthy adults and PD (<i>n</i> = 12 per cohort) at baseline and in PD pre- vs. post-RT. Notably, one LV associated with angiogenesis, axon guidance, and muscle remodeling was significantly lower in PD than YA at baseline and was significantly increased by exercise. A different LV annotated to denervation, autophagy, and apoptosis was increased in both PD and OA relative to YA and was also reduced by 16-week RT in PD. Thus, this analysis identified two novel skeletal muscle transcriptional programs that are dysregulated by PD and aging, respectively. Notably, RT has a normalizing effect on both programs in individuals with PD. These results identify potential molecular transducers of the RT-induced improvements in neuromuscular remodeling and motor function that may aid in optimizing exercise rehabilitation strategies for individuals with PD.
Also flagged:metabolic disordersovernutritionmatinglactationGlucoseglucose intolerance
Journal Article2020-06-17✓ 2 SnippetsZhou L, Xiao X, Li M, Zhang Q, Yu M, Zheng J, Deng M.
In-Text Gene Mentions
Results)
…Maternal exercise dramatically increased the abundance of Odoricbacter in the offspring of theHFEgroup ( Figure 4E ).…
Methods)
…At 8 weeks of age, to explore the effects of maternal exercise on metabolic phenotypes and gut microbiota in young offspring, one male per litter of the three groups (offspring from MC at 8 weeks, C, n = 6; offspring from MHF at 8 weeks, HF, n = 9; offspring from MHFE at 8 weeks,HFE, n = 6) were sacrificed.…
Show Full Abstract
Early-life overnutrition programs increased risks of metabolic disorders in adulthood. Regular exercise has been widely accepted to be an effective measure to maintain metabolic health. However, the intergenerational effects of maternal exercise and the specific mechanism are largely unclear. Our objective was to investigate whether maternal exercise could alleviate the metabolic disturbances induced by early-life overnutrition in both dams and offspring and to explore the role of gut microbiota in mediating the effects. C57BL/6 female mice were randomly divided into three groups: the control group, which were fed a normal control diet; high-fat group, which received a high-fat diet; and high-fat with exercise intervention group, which was fed a high-fat diet and received a voluntary wheel running training. The diet intervention started from 3 weeks prior to mating and lasted throughout pregnancy and lactation. The exercise intervention was only prior to and during pregnancy. The male offspring got free access to normal chow diet from weaning to 24 weeks of age. Glucose tolerance test and biochemical parameters were detected in dams at weaning and offspring at 8 and 24 weeks of age. Their cecal contents were collected for the 16 s rDNA amplicon sequencing. The results showed that maternal high-fat diet resulted in significant glucose intolerance, insulin resistance, and lipid profiles disorders in both dams and offspring. Maternal exercise markedly improved insulin sensitivity in dams and metabolic disorders in offspring from young into adulthood. The decrease in unfavorable bacteria and the persistent enrichment of short-chain fatty acids-producers from mothers to adult offspring, particularly the genus <i>Odoribacter</i>, were all associated with the improvement of metabolism by maternal exercise. Overall, maternal exercise could significantly mitigate the detrimental effects of a maternal high-fat diet on metabolism in both dams and male offspring. The continuous alterations in gut microbiota might be a critical factor in deciphering the metabolic benefits of maternal exercise, which provides some novel evidence and targets for combating metabolic diseases.
Also flagged:dopaminePDcognitionneuropsychiatric disordersLmx1aFoxA2
Journal Article2020-06-17No SnippetsCardoso T, Lévesque M.
Show Full Abstract
Mesencephalic dopaminergic (mDA) neurons derived from pluripotent stem cells (PSCs) have proven to be pivotal for disease modeling studies and as a source of transplantable tissue for regenerative therapies in Parkinson's disease (PD). Current differentiation protocols can generate standardized and reproducible cell products of dopaminergic neurons that elicit the characteristic transcriptional profile of ventral midbrain. Nonetheless, dopamine neurons residing in the mesencephalon comprise distinct groups of cells within diffusely defined anatomical boundaries and with distinct functional, electrophysiological, and molecular properties. Here we review recent single cell sequencing studies that are shedding light on the neuronal heterogeneity within the mesencephalon and discuss how resolving the complex molecular profile of distinct sub-populations within this region could help refine patterning and quality control assessment of PSC-derived mDA neurons to subtype-specificity in vitro. In turn, such advances would have important impact in improving cell replacement therapy, disease mechanistic studies and drug screening in PD.
<h4>Background</h4>Leukodystrophies are genetic diseases affecting the white matter and leading to early death. Our objective was to determine leukodystrophy incidence, using genomics sequencing databases allele frequencies of disease-causing variants.<h4>Methods</h4>From 49 genes, representing the standardly defined group of leukodystrophies, we identified potential disease-causing variants from publications in the Human Genetic Mutation Database and from predictions in the Genome Aggregation Database. Allele frequencies were estimated from Genome Aggregation Database. Allele frequencies for each gene were summed to generate a super allele frequency and we used the Hardy-Weinberg equation to calculate overall expected live birth incidence associated with the gene in question.<h4>Results</h4>We identified 4564 pathogenic variants for 25 discrete leukodystrophies. The largest effect was from GALC variants (Krabbe disease), which had a predicted incidence of one in 12,080 live births, 8.3 times higher than published estimates. The second most frequently predicted leukodystrophy was the RNA polymerase III-related disorders, which had an incidence of 1:26,160. Overall, we found a leukodystrophy incidence of 1 in 4733 live births, significantly higher than previous estimates.<h4>Conclusions</h4>Our data are consistent with a significant underdiagnosis of leukodystrophy patients. An intriguing additional consideration is that there may be genetic modifiers that lead to weaker, absent, or adult-onset disease phenotypes.
Also flagged:extracellularagingECM proteinscell proliferationphotonproteoglycans
Journal Article2020-06-17✓ 1 SnippetMcCabe MC, Hill RC, Calderone K, Cui Y, Yan Y, Quan T, Fisher GJ, Hansen KC.
In-Text Gene Mentions
Results)
…(FC = −2.5),SERPINC1(FC = −2.3),…
Show Full Abstract
Human skin is composed of the cell-rich epidermis, the extracellular matrix (ECM) rich dermis, and the hypodermis. Within the dermis, a dense network of ECM proteins provides structural support to the skin and regulates a wide variety of signaling pathways which govern cell proliferation and other critical processes. Both intrinsic aging, which occurs steadily over time, and extrinsic aging (photoaging), which occurs as a result of external insults such as solar radiation, cause alterations to the dermal ECM. In this study, we utilized both quantitative and global proteomics, alongside single harmonic generation (SHG) and two-photon autofluorescence (TPAF) imaging, to assess changes in dermal composition during intrinsic and extrinsic aging. We find that both intrinsic and extrinsic aging result in significant decreases in ECM-supporting proteoglycans and structural ECM integrity, evidenced by decreasing collagen abundance and increasing fibril fragmentation. Intrinsic aging also produces changes distinct from those produced by photoaging, including reductions in elastic fiber and crosslinking enzyme abundance. In contrast, photoaging is primarily defined by increases in elastic fiber-associated protein and pro-inflammatory proteases. Changes associated with photoaging are evident even in young (mid 20s) sun-exposed forearm skin, indicating that proteomic evidence of photoaging is present decades prior to clinical signs of photoaging. GO term enrichment revealed that both intrinsic aging and photoaging share common features of chronic inflammation. The proteomic data has been deposited to the ProteomeXchange Consortium via the PRIDE partner repository with the data set identifier PXD015982.
Also flagged:Coagulationgynecological disordersPCOSOCPInsulinclotting factors
Journal Article2020-06-17✓ 1 SnippetManzoor S, Ganie MA, Majid S, Shabir I, Kawa IA, Fatima Q, Jeelani H, Yousuf SD, Rashid F.
In-Text Gene Mentions
Abstract)
…Factor V, tPA,TAT-IIIand D-dimer were…
Show Full Abstract
Human polycystic ovary syndrome (PCOS)-a cluster of diseases displays various symptoms associated with endocrine and gynecological disorders in childbearing women. Oral contraceptive pills (OCP) being a drug of choice minimizes symptoms and complications associated with the disorder. But, the controversial data available in literature regarding use of OCPs compels us to setup a study design regarding effect of OCP treatment in PCOS subjects and the possible outcomes specifically regarding coagulation pathways. Two PCOS study groups have been selected according to Rotterdam Criteria: one with OCP treatment (n = 50) and other without any drug treatment i.e., drug naive (n = 50). Anthropometry, Biochemistry, Hormones, Insulin and various clotting factors like Factor XI, Factor V, tPA, TAT-III and D-dimer were analyzed in both groups. The results showed worsening of IR, Metabolic parameters and coagulopathy in OCP group comparative to drug naive group indicating adverse effects of the OCP treatment which puts these women at risk for number of future clinical implications especially Cardiovascular and metabolic complications.
medRxiv2020-06-17Preprint (No Snippets API)Song Y, Ye Y, Su S, Stephens A, Cai T, Chung M, Han M, Newstead MW, Frame D, Singer BH, Kurabayashi K.
Show Full Abstract
Despite widespread concern for cytokine storms leading to severe morbidity in COVID-19, rapid cytokine assays are not routinely available for monitoring critically ill patients. We report the clinical application of a machine learning-based digital protein microarray platform for rapid multiplex quantification of cytokines from critically ill COVID-19 patients admitted to the intensive care unit (ICU) at the University of Michigan Hospital. The platform comprises two low-cost modules: (i) a semi-automated fluidic dispensing/mixing module that can be operated inside a biosafety cabinet to minimize the exposure of technician to the virus infection and (ii) a 12-12-15 inch compact fluorescence optical scanner for the potential near-bedside readout. The platform enabled daily cytokine analysis in clinical practice with high sensitivity (<0.4pg/mL), inter-assay repeatability (∼10% CV), and near-real-time operation with a 10min assay incubation. A cytokine profiling test with the platform allowed us to observe clear interleukin −6 (IL-6) elevations after receiving tocilizumab (IL-6 inhibitor) while significant cytokine profile variability exists across all critically ill COVID-19 patients and to discover a weak correlation between IL-6 to clinical biomarkers, such as Ferritin and CRP. Our data revealed large subject-to-subject variability in a patient’s response to anti-inflammatory treatment for COVID-19, reaffirming the need for a personalized strategy guided by rapid cytokine assays.
bioRxiv2020-06-17Preprint (No Snippets API)Stukalov A, Girault V, Grass V, Karayel O, Bergant V, Urban C, Haas DA, Huang Y, Oubraham L, Wang A, Hamad MS, Piras A, Hansen FM, Tanzer MC, Paron I, Zinzula L, Enghleitner T, Reinecke M, Lavacca TM, Ehmann R, Wölfel R, Jores J, Kuster B, Protzer U, Rad R, Ziebuhr J, Thiel V, Scaturro P, Mann M, Pichlmair A.
Show Full Abstract
<h4>Summary</h4> The global emergence of SARS-CoV-2 urgently requires an in-depth understanding of molecular functions of viral proteins and their interactions with the host proteome. Several individual omics studies have extended our knowledge of COVID-19 pathophysiology 1–10 . Integration of such datasets to obtain a holistic view of virus-host interactions and to define the pathogenic properties of SARS-CoV-2 is limited by the heterogeneity of the experimental systems. We therefore conducted a concurrent multi-omics study of SARS-CoV-2 and SARS-CoV. Using state-of-the-art proteomics, we profiled the interactome of both viruses, as well as their influence on transcriptome, proteome, ubiquitinome and phosphoproteome in a lung-derived human cell line. Projecting these data onto the global network of cellular interactions revealed crosstalk between the perturbations taking place upon SARS-CoV-2 and SARS-CoV infections at different layers and identified unique and common molecular mechanisms of these closely related coronaviruses. The TGF-β pathway, known for its involvement in tissue fibrosis, was specifically dysregulated by SARS-CoV-2 ORF8 and autophagy by SARS-CoV-2 ORF3. The extensive dataset (available at https://covinet.innatelab.org ) highlights many hotspots that can be targeted by existing drugs and it can guide rational design of virus- and host-directed therapies, which we exemplify by identifying kinase and MMPs inhibitors with potent antiviral effects against SARS-CoV-2.
Also flagged:membraneethylene glycolgelatinneuroblastomaRenPEG
Journal Article2020-06-16No SnippetsMiao Y, Liu H, Cheng W, Liu Y, Kim S, Yuan X, Kusi-Appiah A, Lenhert S, Ma T, Ren Y, Chung H, Guan J.
Show Full Abstract
Existing clinical cell therapies, which rely on the use of biological functionalities of living cells, can be further enhanced by conjugating functional particles to the cells to form cell-particle complexes. Disk-shaped microparticles produced by the top-down microfabrication approach possess unique advantages for this application. However, none of the current mechanisms for conjugating the microfabricated microparticles to the cells are principally applicable to all types of cells with therapeutic potentials. On the other hand, membrane intercalation is a well-established mechanism for attaching fluorescent molecules to living cells or for immobilizing cells on a solid surface. This paper reports a study on conjugating disk-shaped microparticles, referred to as micropatches, to living cells through membrane intercalation for the first time. The procedure for producing the cell-micropatch complexes features an unprecedented integration of microcontact printing of micropatches, end-grafting of linear molecules of octadecyl chain and poly(ethylene glycol) to the printed micropatches, and use of gelatin as a temperature-sensitive sacrificial layer to allow the formation and subsequent release of the cell-micropatch complexes. Complexes composed of mouse neuroblastoma cells were found to be stable in vitro, and the micropatch-bound cells were viable, proliferative, and differentiable. Moreover, complexes composed of four other types of cells were produced. The membrane-intercalation mechanism and the corresponding fabrication technique developed in this study are potentially applicable to a wide range of therapeutic cells and thus promise to be useful for developing new cell therapies enhanced by the disk-shaped microparticles.
Also flagged:ethylene glycolbindingnorbornenepeptidespolystyrenedithiol
Journal Article2020-06-16No SnippetsLe NNT, Liu TL, Johnston J, Krutty JD, Templeton KM, Harms V, Dias A, Le H, Gopalan P, Murphy WL.
Show Full Abstract
We describe a screening approach to identify customized substrates for serum-free human mesenchymal stromal cell (hMSC) culture. In particular, we combine a biomaterials screening approach with design of experiments (DOE) and multivariate analysis (MVA) to understand the effects of substrate stiffness, substrate adhesivity, and media composition on hMSC behavior in vitro. This approach enabled identification of poly(ethylene glycol)-based and integrin binding hydrogel substrate compositions that supported functional hMSC expansion in multiple serum-containing and serum-free media, as well as the expansion of MSCs from multiple, distinct sources. The identified substrates were compatible with standard thaw, seed, and harvest protocols. Finally, we used MVA on the screening data to reveal the importance of serum and substrate stiffness on hMSC expansion, highlighting the need for customized cell culture substrates in optimal hMSC biomanufacturing processes.
Chronic unresolved inflammation is the primary determinant of cardiovascular disease. Precise mechanisms that define the genesis of unresolved inflammation in heart failure with preserved ejection fraction (HFpEF) are of interest due to the obesity epidemic. To examine the obesity phenotype and its direct/indirect consequences, multiple approaches were employed using the lipoxin receptor (abbreviated as ALX) dysfunction mouse model. Indirect calorimetry analyses revealed that the deletion of ALX dysregulated energy metabolism driving toward age-related obesity. Heart function data suggest that obesity-prone ALX deficient mice had impaired myocardium strain. Comprehensive measurement of chemokines, extracellular matrix, and arrhythmogenic arrays confirmed the dysregulation of multiple ion channels gene expression with amplified inflammatory chemokines and cytokines response at the age of 4 months compared with WT counterparts. Quantitative analyses of leukocytes demonstrated an increase of proinflammatory Ly6C<sup>hi</sup> CCR2<sup>+</sup> macrophages in the spleen and heart at a steady-state resulting in an inflamed splenocardiac axis. Signs of subtle inflammation were marked with cardiorenal, endothelial defects with decreased CD31 and eNOS and an increased iNOS and COX2 expression. Thus, ALX receptor deficiency serves as an experimental model that defines multiple cellular and molecular mechanisms in HFpEF that could be a target for the development of HFpEF therapy in cardiovascular medicine.
Also flagged:distal cholangiocarcinomacholangiocarcinomatumorcancerdeathlymph node metastasis
Journal Article2020-06-16✓ 5 SnippetsWu R, Zhang G, Feng J, Zhang L, Yang Z.
In-Text Gene Mentions
Abstract)
…758 patients withDCCfrom the Surveillance,…
Introduction)
…the prognosis ofDCCpatients [ 10…
Discussion)
…the prognosis ofDCCpatients with resectable…
Discussion)
…of patients withDCC( Fig 1A…
Discussion)
…the prognosis ofDCCpatients with ELNs…
Show Full Abstract
<h4>Introduction</h4>The American Joint Committee on Cancer (AJCC) recommended retrieval of at least 12 lymph nodes and firstly classified N category by the number of positive lymph nodes (PLNs) for Distal Cholangiocarcinoma (DCC).<h4>Objective</h4>The end of this cohort study was to explore the optimal cut-off values of the number of examined lymph nodes (ELNs) and PLNs to better stratify patients by utilizing a population-based database.<h4>Methods</h4>A number of 758 patients with DCC from the Surveillance, Epidemiology, and End Results (SEER) database were enrolled in the study and comparing by the survival analysis.<h4>Results</h4>Survival analysis found that patients with ELNs < 5 had a lower 3-year disease-specific survival rate than ELNs ≥ 5 in N0M0 cohort (35.3% vs. 53.0%, P = 0.001) and in M0 cohort (42.7% vs. 32.8%, P = 0.006); survival curves between patients with ELNs < 12 and ELNs ≥ 12 were overlapped in N0M0 cohort (P = 0.256) and in M0 cohort (P = 0.233). Among patients with ELNs ≥ 5, using the optimal cut-off value of the number of PLNs (0, 2) could accurately stratify patients, but the recommendation of the number of PLNs (0, 3) by the AJCC could not.<h4>Conclusions</h4>This study recommended examining at least 5 lymph nodes and defining PLNs = 1-2 as the N1 category and PLNs ≥ 3 as the N2 category, which may better stratify distal cholangiocarcinoma patients and improve the accuracy of the eighth edition AJCC staging.
Also flagged:SETD1Bneurodevelopmental disorderhistone methyltransferasesneurodevelopmental syndromescancerslysine
Journal Article2020-06-16✓ 1 SnippetRoston A, Evans D, Gill H, McKinnon M, Isidor B, Cogné B, Mwenifumbo J, van Karnebeek C, An J, Jones SJM, Farrer M, Demos M, Connolly M, Gibson WT, CAUSES Study, EPGEN Study.
In-Text Gene Mentions
Abstract)
…histone methyltransferases andchromatin modifiersmodifiers has been…
Show Full Abstract
<h4>Background</h4>Dysfunction of histone methyltransferases and chromatin modifiers has been implicated in complex neurodevelopmental syndromes and cancers. <i>SETD1B</i> encodes a lysine-specific methyltransferase that assists in transcriptional activation of genes by depositing H3K4 methyl marks. Previous reports of patients with rare variants in <i>SETD1B</i> describe a distinctive phenotype that includes seizures, global developmental delay and intellectual disability.<h4>Methods</h4>Two of the patients described herein were identified via genome-wide and exome-wide testing, with microarray and research-based exome, through the CAUSES (Clinical Assessment of the Utility of Sequencing and Evaluation as a Service) Research Clinic at the University of British Columbia. The third Vancouver patient had clinical trio exome sequencing through Blueprint Genetics. The fourth patient underwent singleton exome sequencing in Nantes, with subsequent recruitment to this cohort through GeneMatcher.<h4>Results</h4>Here we present clinical reports of four patients with rare coding variants in <i>SETD1B</i> that demonstrate a shared phenotype, including intellectual disability, language delay, conserved musculoskeletal findings and seizures that may be treatment-refractory. We include supporting evidence from next-generation sequencing among a cohort of paediatric patients with epilepsy.<h4>Conclusion</h4>Rare coding variants in <i>SETD1B</i> can cause a diagnosable syndrome and could contribute as a risk factor for epilepsy, autism and other neurodevelopmental phenotypes. In the long term, some patients may also be at increased risk for cancers and other complex diseases. Thus, longitudinal studies are required to further elucidate the precise role of SETD1B in neurodevelopmental disorders and other systemic disease.
Also flagged:gene expressionmyositisdermatomyositisantisynthetase syndromeautoantibodiesEGR4
Journal Article2020-06-16No SnippetsPinal-Fernandez I, Casal-Dominguez M, Derfoul A, Pak K, Miller FW, Milisenda JC, Grau-Junyent JM, Selva-O'Callaghan A, Carrion-Ribas C, Paik JJ, Albayda J, Christopher-Stine L, Lloyd TE, Corse AM, Mammen AL.
Show Full Abstract
<h4>Objectives</h4>Myositis is a heterogeneous family of diseases that includes dermatomyositis (DM), antisynthetase syndrome (AS), immune-mediated necrotising myopathy (IMNM), inclusion body myositis (IBM), polymyositis and overlap myositis. Additional subtypes of myositis can be defined by the presence of myositis-specific autoantibodies (MSAs). The purpose of this study was to define unique gene expression profiles in muscle biopsies from patients with MSA-positive DM, AS and IMNM as well as IBM.<h4>Methods</h4>RNA-seq was performed on muscle biopsies from 119 myositis patients with IBM or defined MSAs and 20 controls. Machine learning algorithms were trained on transcriptomic data and recursive feature elimination was used to determine which genes were most useful for classifying muscle biopsies into each type and MSA-defined subtype of myositis.<h4>Results</h4>The support vector machine learning algorithm classified the muscle biopsies with >90% accuracy. Recursive feature elimination identified genes that are most useful to the machine learning algorithm and that are only overexpressed in one type of myositis. For example, CAMK1G (calcium/calmodulin-dependent protein kinase IG), EGR4 (early growth response protein 4) and CXCL8 (interleukin 8) are highly expressed in AS but not in DM or other types of myositis. Using the same computational approach, we also identified genes that are uniquely overexpressed in different MSA-defined subtypes. These included apolipoprotein A4 (APOA4), which is only expressed in anti-3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR) myopathy, and MADCAM1 (mucosal vascular addressin cell adhesion molecule 1), which is only expressed in anti-Mi2-positive DM.<h4>Conclusions</h4>Unique gene expression profiles in muscle biopsies from patients with MSA-defined subtypes of myositis and IBM suggest that different pathological mechanisms underly muscle damage in each of these diseases.
Also flagged:Hepatocellular carcinomacancercirrhosisliver diseasessugarfatty liver
Journal Article2020-06-16✓ 1 SnippetLapidot Y, Amir A, Nosenko R, Uzan-Yulzari A, Veitsman E, Cohen-Ezra O, Davidov Y, Weiss P, Bradichevski T, Segev S, Koren O, Safran M, Ben-Ari Z.
Hepatocellular carcinoma (HCC) is the second leading cause of cancer-related mortality worldwide. While cirrhosis is the main risk factor for HCC, the factors influencing progression from cirrhosis to HCC remain largely unknown. Gut microbiota plays a key role in liver diseases; however, its association with HCC remains elusive. This study aimed to elucidate microbial differences between patients with HCC-associated cirrhosis (HCC-cirrhosis) and cirrhotic patients without HCC and healthy volunteers and to explore the associations between diet, lifestyle, and the microbiome of these patients. Fecal samples and food frequency questionnaires were collected from 95 individuals (30 HCC-cirrhosis patients, 38 cirrhotic patients without HCC, and 27 age- and body mass index [BMI]-matched healthy volunteers). 16S rRNA gene sequencing was performed. Bacterial richness in cirrhosis and HCC-cirrhosis patients was significantly lower than in healthy controls. The HCC-cirrhosis group was successfully classified with an area under the curve (AUC) value of 0.9 based on the dysbiotic fecal microbial signature. The HCC-cirrhosis group had a significant overrepresentation of <i>Clostridium</i> and <i>CF231</i> and reduced <i>Alphaproteobacteria</i> abundance compared to cirrhotic patients without HCC. Patients with HCC-cirrhosis who were overweight displayed significantly decreased bacterial richness and altered microbiota composition compared to their normal-weight counterparts. There was a significant correlation in the HCC-cirrhosis group between intake of artificial sweeteners and the presence of <i>Akkermansia muciniphila</i> A unique microbial signature was observed in patients with HCC-cirrhosis, irrespective of cirrhosis stage, diet, or treatment. BMI, dietary sugar, and artificial sweeteners were significantly associated with alterations in the microbiome of HCC-cirrhosis patients. However, the increased abundance of <i>Clostridium</i> and <i>CF231</i> observed in HCC-cirrhosis patients was not influenced by environmental factors, implying that this change was due to development of HCC.<b>IMPORTANCE</b> Development of hepatocellular carcinoma in patients with cirrhosis is associated with alterations in intestinal microbiota, including an escalation of dysbiosis and reduced bacterial richness. This study demonstrates that reduced bacterial richness and dysbiosis escalate with the progression of cirrhosis from compensated to decompensated cirrhosis and to HCC-associated cirrhosis (HCC-cirrhosis). Moreover, we report for the first time the effect of environmental factors on HCC-cirrhosis. Excess weight was associated with increased dysbiosis in patients with HCC compared to their normal-weight counterparts. Moreover, fatty liver, consumption of artificial sweeteners, and high-sugar foods were associated with altered microbial composition, including altered levels of <i>Akkermansia muciniphila</i> in HCC-cirrhosis. We have successfully determined that levels of <i>Alphaproteobacteria</i> and the two genera <i>CF231</i> and <i>Clostridium</i> are significantly altered in cirrhotic patients who develop hepatocellular carcinoma, independently of cirrhosis severity and dietary habits.
Arctic regions, which are changing rapidly as they warm 2 to 3 times faster than the global average, still retain microbial habitats that serve as natural laboratories for understanding mechanisms of microbial adaptation to extreme conditions. Seawater-derived brines within both sea ice (sea-ice brine) and ancient layers of permafrost (cryopeg brine) support diverse microbes adapted to subzero temperatures and high salinities, yet little is known about viruses in these extreme environments, which, if analogous to other systems, could play important evolutionary and ecosystem roles. Here, we characterized viral communities and their functions in samples of cryopeg brine, sea-ice brine, and melted sea ice. Viral abundance was high in cryopeg brine (1.2 × 10<sup>8</sup> ml<sup>-1</sup>) and much lower in sea-ice brine (1.3 × 10<sup>5</sup> to 2.1 × 10<sup>5</sup> ml<sup>-1</sup>), which roughly paralleled the differences in cell concentrations in these samples. Five low-input, quantitative viral metagenomes were sequenced to yield 476 viral populations (i.e., species level; ≥10 kb), only 12% of which could be assigned taxonomy by traditional database approaches, indicating a high degree of novelty. Additional analyses revealed that these viruses: (i) formed communities that differed between sample type and vertically with sea-ice depth; (ii) infected hosts that dominated these extreme ecosystems, including <i>Marinobacter</i>, <i>Glaciecola</i>, and <i>Colwellia</i>; and (iii) encoded fatty acid desaturase (<i>FAD</i>) genes that likely helped their hosts overcome cold and salt stress during infection, as well as mediated horizontal gene transfer of <i>FAD</i> genes between microbes. Together, these findings contribute to understanding viral abundances and communities and how viruses impact their microbial hosts in subzero brines and sea ice.<b>IMPORTANCE</b> This study explores viral community structure and function in remote and extreme Arctic environments, including subzero brines within marine layers of permafrost and sea ice, using a modern viral ecogenomics toolkit for the first time. In addition to providing foundational data sets for these climate-threatened habitats, we found evidence that the viruses had habitat specificity, infected dominant microbial hosts, encoded host-derived metabolic genes, and mediated horizontal gene transfer among hosts. These results advance our understanding of the virosphere and how viruses influence extreme ecosystems. More broadly, the evidence that virally mediated gene transfers may be limited by host range in these extreme habitats contributes to a mechanistic understanding of genetic exchange among microbes under stressful conditions in other systems.
Also flagged:psychiatric disordersself-harmsnp 2suicidal behaviour disorderpsychiatric disorderpsychiatric
Journal Article2020-06-16✓ 5 SnippetsCampos AI, Verweij KJH, Statham DJ, Madden PAF, Maciejewski DF, Davis KAS, John A, Hotopf M, Heath AC, Martin NG, Rentería ME.
In-Text Gene Mentions
Results)⭐ same-sentence co-mention
…, SEMA3D ,DCC, DDX27 and…
Results)⭐ same-sentence co-mention
…, DCC ,DDX27and ZNFX1 .…
Results)⭐ same-sentence co-mention
…, DDX27 andZNFX1.…
Results)
…genes LINGO2 ,DCC, FBXO27 and…
Discussion)
…both phenotypes, wasDCC.…
Show Full Abstract
Family studies have identified a heritable component to self-harm that is partially independent from comorbid psychiatric disorders. However, the genetic aetiology of broad sense (non-suicidal and suicidal) self-harm has not been characterised on the molecular level. In addition, controversy exists about the degree to which suicidal and non-suicidal self-harm share a common genetic aetiology. In the present study, we conduct genome-wide association studies (GWAS) on lifetime self-harm ideation and self-harm behaviour (i.e. any lifetime self-harm act regardless of suicidal intent) using data from the UK Biobank (n > 156,000). We also perform genome wide gene-based tests and characterize the SNP heritability and genetic correlations between these traits. Finally, we test whether polygenic risk scores (PRS) for self-harm ideation and self-harm behaviour predict suicide attempt, suicide thoughts and non-suicidal self-harm (NSSH) in an independent target sample of 8,703 Australian adults. Our GWAS results identified one genome-wide significant locus associated with each of the two phenotypes. SNP heritability (h<sub>snp</sub><sup>2</sup>) estimates were ~10%, and both traits were highly genetically correlated (LDSC r<sub>g</sub> > 0.8). Gene-based tests identified seven genes associated with self-harm ideation and four with self-harm behaviour. Furthermore, in the target sample, PRS for self-harm ideation were significantly associated with suicide thoughts and NSSH, and PRS for self-harm behaviour predicted suicide thoughts and suicide attempt. Follow up regressions identified a shared genetic aetiology between NSSH and suicide thoughts, and between suicide thoughts and suicide attempt. Evidence for shared genetic aetiology between NSSH and suicide attempt was not statistically significant.
Also flagged:pancreatic adenocarcinomaRHOAROCK2cancersluciferasebinding
Journal Article2020-06-16✓ 2 SnippetsLiu J, Zhu Y, Ge C.
In-Text Gene Mentions
Introduction)
…The lncRNA ZFAS1, the antisense transcript of the gene ZNFX1, is abnormally expressed in many cancers.…
Introduction)
…of the geneZNFX1, is abnormally expressed…
Show Full Abstract
<h4>Background</h4>The mortality and morbidity rates of pancreatic adenocarcinoma have been increasing over the past two decades, and an understanding of the mechanisms underlying pancreatic adenocarcinoma progression is urgently needed. The long non-coding RNA ZFAS1 has been demonstrated to be an oncogene in some cancers, but its function and mechanism in pancreatic adenocarcinoma remain unclear.<h4>Methods</h4>The ZFAS1 expression level in pancreatic adenocarcinoma was predicted by bioinformatic analysis, and the expression level of ZFAS1 in pancreatic adenocarcinoma tissue samples and cell lines was further detected by quantitative real-time PCR and in situ hybridization. The functions of ZFAS1 in pancreatic adenocarcinoma in vitro and in vivo were investigated by further bioinformatic analysis. Dual-luciferase reporter assays were used to confirm the binding of ZFAS1/miR-3924 and miR-3924/ROCK2, and rescue assays were performed to further investigate the underlying mechanism.<h4>Results</h4>ZFAS1 overexpression in pancreatic adenocarcinoma was predicted and experimentally verified. ZFAS1 silencing inhibited pancreatic adenocarcinoma metastasis in vitro and in vivo. The competing endogenous RNA mechanism of ZFAS1 was also identified.<h4>Conclusions</h4>Our results demonstrated the promotive effect of ZFAS1 on pancreatic adenocarcinoma metastasis and suggested its potential role as a novel regulator of ROCK2.
Also flagged:Neuronal Growth Regulator 1OtoancorinLung CancerCell adhesion moleculestumorOTOA
Journal Article2020-06-16✓ 2 SnippetsZhang L, Tian W, Zhou B.
In-Text Gene Mentions
Abstract)
…(SNPs) of CAMs,neuronal growth regulator 1growth regulator 1…
Abstract)
…growth regulator 1 (<i>NEGR1</i>), and Otoancorin (<i>OTOA…
Show Full Abstract
Cell adhesion molecules (CAMs) play crucial roles in the genesis and progress of tumor. We investigated the effects of single nucleotide polymorphisms (SNPs) of CAMs, neuronal growth regulator 1 (<i>NEGR1</i>), and Otoancorin (<i>OTOA</i>) on lung cancer susceptibility in Chinese nonsmoking females. Logistic regression and Cox regression analyses were conducted to investigate the effects of SNPs and environmental factors. For rs3102911, genotype TT carriers decreased the risk of lung cancer with an odds ratio (OR) of 0.635. AA genotypes of rs741718 increased the risk of lung cancer with an OR of 3.527. In stratified analysis, genotype AA carriers of rs741718 had a high susceptibility to lung adenocarcinoma compared with GG and AG genotypes. Analyses of association between SNPs and clinical characteristics revealed that rs3102911 as a protective factor and rs741718 as a risk factor influenced the lung cancer occurrence and progression in nonsmoking females.
Also flagged:neurological diseasesretinal degenerative diseasesmembranevisionsignal transductionsblindness
Journal Article2020-06-16✓ 4 SnippetsLiou RH, Edwards TL, Martin KR, Wong RC.
In-Text Gene Mentions
Introduction)
…of transcription factorsPOU3F2, ASCL1 ,…
Introduction)
…, MYT1L ,POU3F2, TLX3 ,…
Introduction)
…and FOXA2 withPOU3F2, ASCL1 ,…
Introduction)
…by overexpression ofPOU3F2, MYT1L ,…
Show Full Abstract
Stem cell and cell reprogramming technology represent a rapidly growing field in regenerative medicine. A number of novel neural reprogramming methods have been established, using pluripotent stem cells (PSCs) or direct reprogramming, to efficiently derive specific neuronal cell types for therapeutic applications. Both in vitro and in vivo cellular reprogramming provide diverse therapeutic pathways for modeling neurological diseases and injury repair. In particular, the retina has emerged as a promising target for clinical application of regenerative medicine. Herein, we review the potential of neuronal reprogramming to develop regenerative strategy, with a particular focus on treating retinal degenerative diseases and discuss future directions and challenges in the field.
Also flagged:deathpathogenesispost-translational modificationsHDpolyglutaminemitochondrial
Journal Article2020-06-16✓ 5 SnippetsLontay B, Kiss A, Virág L, Tar K.
In-Text Gene Mentions
S I O 001029)
…This pathomechanism is related to the enhanced NMDA-induced excitotoxicity that provokes the reduced expression of DARPP-32, leading to increased PP1 activity and decreased phosphorylation of PP1 substrates, including HTT in HD striatum [92].…
S I O 001029)
…The deregulation of these intracellular signaling pathways is associated with reduced Akt and ERK activation and a decrease in HTT phosphorylation in the HD brain.…
S I O 001029)
…IKK-induced phosphorylation of HTT also activates other PTMs of adjacent lysine residues, including acetylation, ubiquitination, and SUMOylation, which enhances HTT clearance by lysosomes and proteasomes [82].…
S I O 001029)
…Proteolytic cleavage of HTT has a major impact on the molecular pathogenesis of HD.…
S I O 001029)
…IKKβ phosphorylation of HTT at Ser-13 and Ser-16 induces HTT clearance, reduces aggregate accumulation, and blocks HD progression in HD mice, but this process becomes impaired by the polyQ expansion of HTT.…
Show Full Abstract
Huntington's disease (HD) is an autosomal dominant inherited neurodegenerative disorder characterized by the loss of motor control and cognitive ability, which eventually leads to death. The mutant huntingtin protein (HTT) exhibits an expansion of a polyglutamine repeat. The mechanism of pathogenesis is still not fully characterized; however, evidence suggests that post-translational modifications (PTMs) of HTT and upstream and downstream proteins of neuronal signaling pathways are involved. The determination and characterization of PTMs are essential to understand the mechanisms at work in HD, to define possible therapeutic targets better, and to challenge the scientific community to develop new approaches and methods. The discovery and characterization of a panoply of PTMs in HTT aggregation and cellular events in HD will bring us closer to understanding how the expression of mutant polyglutamine-containing HTT affects cellular homeostasis that leads to the perturbation of cell functions, neurotoxicity, and finally, cell death. Hence, here we review the current knowledge on recently identified PTMs of HD-related proteins and their pathophysiological relevance in the formation of abnormal protein aggregates, proteolytic dysfunction, and alterations of mitochondrial and metabolic pathways, neuroinflammatory regulation, excitotoxicity, and abnormal regulation of gene expression.
The formation of adipocytes during embryogenesis has been largely understudied. However, preadipocytes appear to originate from multipotent mesenchymal stromal/stem cells which migrate from the mesoderm to their anatomical localization. Most studies on adipocyte formation (adipogenesis) have used preadipocytes derived from adult stem/stromal cells. Adipogenesis consists of two phases, namely commitment and terminal differentiation. This review discusses the role of signalling pathways, epigenetic modifiers, and transcription factors in preadipocyte commitment and differentiation into mature adipocytes, as well as limitations in our understanding of these processes. To date, a limited number of transcription factors, genes and signalling pathways have been described to regulate preadipocyte commitment. One reason could be that most studies on adipogenesis have used preadipocytes already committed to the adipogenic lineage, which are therefore not suitable for studying preadipocyte commitment. Conversely, over a dozen molecular players including transcription factors, genes, signalling pathways, epigenetic regulators, and microRNAs have been described to be involved in the differentiation of preadipocytes to adipocytes; however, only peroxisome proliferator-activated receptor gamma has proven to be clinically relevant. A detailed understanding of how the molecular players underpinning adipogenesis relate to adipose tissue function could provide new therapeutic approaches for addressing obesity without compromising adipose tissue function.
Also flagged:Colonic Activin Receptor-Like Kinase 1polymeraseactivin receptor-like kinase 1ACVRL1ALK1CD
Journal Article2020-06-16✓ 4 SnippetsToyonaga T, Steinbach EC, Keith BP, Barrow JB, Schaner MR, Wolber EA, Beasley C, Huling J, Wang Y, Allbritton NL, Chaumont N, Sadiq TS, Koruda MJ, Jain A, Long MD, Barnes EL, Herfarth HH, Isaacs KL, Hansen JJ, Shanahan MT, Rahbar R, Furey TS, Sethupathy P, Sheikh SZ.
In-Text Gene Mentions
Methods)
…antibody, rabbit anti-humanOLFM4antibody, and mouse/rabbit…
Results)
…genes LGR5 ,OLFM4, and ASCL2…
Results)
…of LGR5 andOLFM4, and a…
Results)
…IncreasedOLFM4protein expression in…
Show Full Abstract
<h4>Background & aims</h4>Intestinal epithelial cell (IEC) barrier dysfunction is critical to the development of Crohn's disease (CD). However, the mechanism is understudied. We recently reported increased microRNA-31-5p (miR-31-5p) expression in colonic IECs of CD patients, but downstream targets and functional consequences are unknown.<h4>Methods</h4>microRNA-31-5p target genes were identified by integrative analysis of RNA- and small RNA-sequencing data from colonic mucosa and confirmed by quantitative polymerase chain reaction in colonic IECs. Functional characterization of activin receptor-like kinase 1 (ACVRL1 or ALK1) in IECs was performed ex vivo using 2-dimensional cultured human primary colonic IECs. The impact of altered colonic ALK1 signaling in CD for the risk of surgery and endoscopic relapse was evaluated by a multivariate regression analysis and a Kaplan-Meier estimator.<h4>Results</h4>ALK1 was identified as a target of miR-31-5p in colonic IECs of CD patients and confirmed using a 3'-untranslated region reporter assay. Activation of ALK1 restricted the proliferation of colonic IECs in a 5-ethynyl-2-deoxyuridine proliferation assay and down-regulated the expression of stemness-related genes. Activated ALK1 signaling increased colonic IEC differentiation toward colonocytes. Down-regulated ALK1 signaling was associated with increased stemness and decreased colonocyte-specific marker expression in colonic IECs of CD patients compared with healthy controls. Activation of ALK1 enhanced epithelial barrier integrity in a transepithelial electrical resistance permeability assay. Lower colonic ALK1 expression was identified as an independent risk factor for surgery and was associated with a higher risk of endoscopic relapse in CD patients.<h4>Conclusions</h4>Decreased colonic ALK1 disrupted colonic IEC barrier integrity and was associated with poor clinical outcomes in CD patients.
Also flagged:glucocorticoidAcute Lymphoblastic LeukemiaALLCell proliferationglucocorticoidsautophagy
Journal Article2020-06-16No SnippetsLong S, Ren D, Zhong F, Niu Y, Qin X, Mu D, Liu W.
Show Full Abstract
<h4>Objective</h4>To analyze the expression levels of miR-145 in ALL children and their effects on the prognosis of ALL and to explore the mechanism of miR-145 in reversing the resistance of ALL cells to glucocorticoids.<h4>Methods</h4>A GEO database dataset was used to analyze the expression levels of miR-145 in ALL children. The association between miR-145 and childhood prognosis was analyzed by the TARGET database data. The expression levels of miR-145 in the glucocorticoid-resistant ALL cell line CEM-C1 were increased by lipofectamine 2000-mediated transfection. Cell proliferation inhibition experiments were performed to detect the effect of miR-145 on the response of CEM-C1 cell line to glucocorticoids. The expression levels of the apoptotic, autophagic and drug resistance-associated genes and proteins were detected by qPCR and western blot analysis.<h4>Results</h4>The expression levels of miR-145 were decreased in ALL patients (<i>P</i> < 0.001) and the prognosis of ALL in children with high miR-145 expression was significantly improved (<i>P</i> < 0.001). Increased miR-145 expression can improve the sensitivity of CEM-C1 cells to glucocorticoids. The expression levels of the proapoptotic and the anti-apoptotic genes <i>Bax</i> and <i>Bcl-2</i> were increased and decreased, respectively, whereas the expression levels of the autophagicgenes <i>Beclin 1</i> and <i>LC</i> were increased. In addition, the expression levels of the drug resistance gene <i>MDR1</i> were decreased.<h4>Conclusion</h4>The expression levels of miR-145 in ALL children were decreased and they were associated with disease prognosis. The data indicated that miR-145 can reverse cell resistance by regulating apoptosis of CEM-C1 cells and autophagy.
<h4>Introduction</h4>African swine fever (ASF) was officially reported in Vietnam in February 2019 and spread across the whole country, affecting all 63 provinces and cities.<h4>Material and methods</h4>In this study, ASF virus (ASFV) VN/Pig/HaNam/2019 (VN/Pig/HN/19) strain was isolated in primary porcine alveolar macrophage (PAM) cells from a sample originating from an outbreak farm in Vietnam's Red River Delta region. The isolate was characterised using the haemadsorption (HAD) test, real-time PCR, and sequencing. The activity of antimicrobial feed products was evaluated <i>via</i> a contaminated ASFV feed assay.<h4>Results</h4>Phylogenetic analysis of the viral p72 and EP402R genes placed VN/Pig/HN/19 in genotype II and serogroup 8 and related it closely to Eastern European and Chinese strains. Infectious titres of the virus propagated in primary PAMs were 10<sup>6</sup> HAD<sub>50</sub>/ml. Our study reports the activity against ASFV VN/Pig/HN/19 strain of antimicrobial Sal CURB RM E Liquid, F2 Dry and K2 Liquid. Our feed assay findings suggest that the antimicrobial RM E Liquid has a strong effect against ASFV replication. These results suggest that among the Sal CURB products, the antimicrobial RM E Liquid may have the most potential as a mitigant feed additive for ASFV infection. Therefore, further studies on the use of antimicrobial Sal CURB RM E Liquid <i>in vivo</i> are required.<h4>Conclusions</h4>Our study demonstrates the threat of ASFV and emphasises the need to control and eradicate it in Vietnam by multiple measures.
Also flagged:Ovarian Cancermalignant tumorovarian cancersSTAT3IL-31Ovarian carcinoma
Journal Article2020-06-16No SnippetsWang X, Lin FK, Li JR, Wang HS.
Show Full Abstract
<h4>Introduction</h4>Ovarian carcinoma is a malignant tumor with a high mortality rate and a lack of effective treatment options for patients at advanced stages. For improving outcomes and helping patients with poor prognosis, choose a suitable therapy and an excellent risk assessment model and new treatment options are needed.<h4>Materials and methods</h4>Ovarian cancer gene expression profile of GSE32062 was downloaded from the NCBI GEO database for screening differentially expressed genes (DEGs) between well and poor prognosis groups using limma package in R (version 3.4.1). Prognosis-related genes and clinical prognostic factors were obtained from univariate and multivariate Cox regression analyses, and a comprehensive risk assessment model was constructed using a Pathway Dysregulation Score (PDS) matrix, Cox-Proportional Hazards (Cox-PH) regression, as well as L1-least absolute shrinkage and selection operator (L1-LASSO) penalization. Then, significant DEGs were converted to pathways and optimal prognosis-related pathways were screened. Finally, risk prediction models based on pathways, genes involved in pathways, and comprehensive clinical risk factors with pathways were built. Their prognostic functions were assessed in verification sets. Besides, genes involved in immune-pathways were checked for immune infiltration using immunohistochemistry.<h4>Results</h4>A superior risk assessment model involving 9 optimal combinations of pathways and one clinical factor was constructed. The pathway-based model was found to be superior to the gene-based model. <i>Phospho-STAT3</i> (from JAK-STAT signaling pathway) and <i>IL-31</i> (from DEGs) were found to be related to immune infiltration.<h4>Conclusion</h4>We have generated a comprehensive risk assessment model consisting of a clinical risk factor and pathways that showed a possible bright foreground. The set of significant pathways might play as a better prognosis model which is more accurate and applicable than the DEG set. Besides, <i>p-STAT3</i> and <i>IL-31</i> showing correlation to immune infiltration of ovarian cancer tissues may be potential therapeutic targets for treating ovarian cancers.
Also flagged:Disseminated intravascular coagulationdeathfibrinogencoagulopathycoagulationHemorrhage
Journal Article2020-06-16✓ 1 SnippetYoshida K, Watanabe K, Sato Y, Sumiyoshi M, Murakawa M.
In-Text Gene Mentions
Discussion)
…thromboplastin time; AT-III,antithrombin-III; BT, body temperature).…
Show Full Abstract
Disseminated intravascular coagulation (DIC) in obstetrics is related to postpartum hemorrhage and has been a leading cause of maternal death. We here report a successful treatment, via damage control surgery (DCS), of a life-threatening massive hemorrhage of more than 20,000 mL due to DIC. A 30-year-old female was admitted to our hospital because of atonic bleeding. Since she was having a uterine rupture, an emergency hysterectomy was performed. Because of the severe DIC (fibrinogen, 65 mg/dL; platelet count, 6.0 × 10<sup>9</sup>/L), oozing persisted after the hysterectomy; thus, intraperitoneal gauze packing was performed as DCS. Afterwards, the coagulopathy was corrected, and the gauze was removed on the second postoperative day (POD 2). The patient was discharged without complications on POD 16. The present case demonstrated that performing DCS and waiting for improvement of the coagulation system can be one of the treatment options for management of patients with severe DIC.
Also flagged:Uveitisobesityexperimental autoimmune uveitisinterphotoreceptor retinoid binding proteinGene expressionT-cell proliferation
Journal Article2020-06-16No SnippetsYin G, Zeng W, Hu K, Gao J, Liu J, Chen Y, Chen F.
Show Full Abstract
<b>Purpose:</b> Previous studies have shown that parental abnormal physiological conditions such as inflammation, stress, and obesity can be transferred to offspring. The purpose of this study was to investigate the impact of parental uveitis on the development and susceptibility to experimental autoimmune uveitis (EAU) in offspring. <b>Methods:</b> Parental male and female B10RIII mice were immunized with interphotoreceptor retinoid binding protein (IRBP) 161-180 in complete Freund's adjuvant and were immediately allowed to mate. Gross examination of the offspring gestated with EAU was performed to determine the influence of parental uveitis on offspring development after birth. Gene expression profiles were analyzed in the affected eyes of offspring under EAU to identify differentially expressed genes (DEGs). Adult offspring were given 5, 25, and 50 μg IRBP<sub>161-180</sub> to compare their susceptibility to EAU. Immunized mice were clinically and pathologically evaluated for the development of EAU. Ag-specific T-cell proliferation and IL-17 production from spleens and lymph nodes were evaluated on day 14 or 35 after immunization. <b>Results:</b> Hair loss, delay of eye opening, and swollen spleens in the offspring from parents with uveitis were observed from day 14 to 39 after birth. DEGs were involved in the immune system process, muscle system process, and cell development. The altered antigen processing and presentation, cell adhesion molecules, and phagosome in the eyes of the offspring from uveitis-affected parents were enriched. Offspring gestated with EAU showed a susceptibility to EAU and an earlier onset and higher severity of EAU compared to the control group mice. IRBP-specific lymphocyte proliferation and IL-17 production were observed in the EAU offspring with exposure to parental uveitis. <b>Conclusions:</b> The results suggest that mouse parents with uveitis can increase their offspring's susceptibility to EAU, probably through altering cell adhesion molecules and antigen processing and presentation related to the T-cell proliferation and Th17 response.
<b>Background:</b> Preterm infants exposed to chorioamnionitis and with a fetal inflammatory response are at risk for neonatal morbidity and adverse outcome. Alarmins S100A8, S100A9, and S100A12 are expressed by myeloid cells and have been associated with inflammatory activation and monocyte modulation. <b>Aim:</b> To study S100A alarmin expression in cord blood monocytes from term healthy and preterm infants and relate results to clinical findings, inflammatory biomarkers and alarmin protein levels, as well as pathways identified by differentially regulated monocyte genes. <b>Methods:</b> Cord blood CD14+ monocytes were isolated from healthy term (<i>n</i> = 10) and preterm infants (<30 weeks gestational age, <i>n</i> = 33) by MACS technology. Monocyte RNA was sequenced and gene expression was analyzed by Principal Component Analysis and hierarchical clustering. Pathways were identified by Ingenuity Pathway Analysis. Inflammatory proteins were measured by Multiplex ELISA, and plasma S100A proteins by mass spectrometry. Histological chorioamnionitis (HCA) and fetal inflammatory response syndrome (FIRS) were diagnosed by placenta histological examination. <b>Results:</b> S100A8, S100A9, and S100A12 gene expression was significantly increased and with a wider range in preterm vs. term infants. High S100A8 and S100A9 gene expression (<i>n</i> = 17) within the preterm group was strongly associated with spontaneous onset of delivery, HCA, FIRS and elevated inflammatory proteins in cord blood, while low expression (<i>n</i> = 16) was associated with impaired fetal growth and physician-initiated delivery. S100A8 and S100A9 protein levels were significantly lower in preterm vs. term infants, but within the preterm group high S100A gene expression, spontaneous onset of labor, HCA and FIRS were associated with elevated protein levels. One thousand nine hundred genes were differentially expressed in preterm infants with high vs. low S100A alarmin expression. Analysis of 124 genes differentially expressed in S100A high as well as FIRS and HCA groups identified 18 common pathways and S100A alarmins represented major hubs in network analyses. <b>Conclusion:</b> High expression of S100A alarmins in cord blood monocytes identifies a distinct clinical risk group of preterm infants exposed to chorioamnionitis and with a fetal inflammatory response. Gene and pathway analyses suggest that high S100A alarmin expression also affects monocyte function. The connection with monocyte phenotype and inflammation-stimulated S100A expression in other cell types (e.g., neutrophils) warrants further investigation.
Also flagged:RIPK3Chronic kidney diseasediabetic kidney diseasekidney fibrosisrenal fibrosisreceptor-interacting serine/threonine-protein kinase
Journal Article2020-06-16No SnippetsShi Y, Chen X, Huang C, Pollock C.
Show Full Abstract
Chronic kidney disease (CKD) is the end result of a plethora of renal insults, including repeated episodes of acute or toxic kidney injury, glomerular, or diabetic kidney disease. It affects a large number of the population worldwide, resulting in significant personal morbidity and mortality and economic cost to the community. Hence it is appropriate to focus on treatment strategies that interrupt the development of kidney fibrosis, the end result of all forms of CKD, in addition to upstream factors that may be specific to certain diseases. However, the current clinical approach to prevent or manage renal fibrosis remains unsatisfactory. The rising importance of receptor-interacting serine/threonine-protein kinase (RIPK) 3 in the inflammatory response and TGF-β1 signaling is increasingly recognized. We discuss here the biological functions of RIPK3 and its role in the development of renal fibrosis.
Also flagged:SynapseexocytosisvesicleorganizationlocalizationCa 2+
Journal Article2020-06-16✓ 1 SnippetHeld RG, Liu C, Ma K, Ramsey AM, Tarr TB, De Nola G, Wang SSH, Wang J, van den Maagdenberg AMJM, Schneider T, Sun J, Blanpied TA, Kaeser PS.
In-Text Gene Mentions
Text
…Cacna1e…
Show Full Abstract
Presynaptic Ca<sub>V</sub>2 channels are essential for Ca<sup>2+</sup>-triggered exocytosis. In addition, there are two competing models for their roles in synapse structure. First, Ca<sup>2+</sup> channels or Ca<sup>2+</sup> entry may control synapse assembly. Second, active zone proteins may scaffold Ca<sub>V</sub>2s to presynaptic release sites, and synapse structure is Ca<sub>V</sub>2 independent. Here, we ablated all three Ca<sub>V</sub>2s using conditional knockout in cultured hippocampal neurons or at the calyx of Held, which abolished evoked exocytosis. Compellingly, synapse and active zone structure, vesicle docking, and transsynaptic nano-organization were unimpaired. Similarly, long-term blockade of action potentials and Ca<sup>2+</sup> entry did not disrupt active zone assembly. Although Ca<sub>V</sub>2 knockout impaired the localization of β subunits, α2δ-1 localized normally. Rescue with Ca<sub>V</sub>2 restored exocytosis, and Ca<sub>V</sub>2 active zone targeting depended on the intracellular C-terminus. We conclude that synapse assembly is independent of Ca<sub>V</sub>2s or Ca<sup>2+</sup> entry through them. Instead, active zone proteins recruit and anchor Ca<sub>V</sub>2s via Ca<sub>V</sub>2 C-termini.
Also flagged:carbonagingsulfatecoagulationsaltwater
Journal Article2020-06-16No SnippetsTakeishi A, Storelvmo T, Fierce L.
Show Full Abstract
Aerosol emissions from forest fires may impact cloud droplet activation through an increase in particle number concentrations ("the number effect") and also through a decrease in the hygroscopicity <i> κ</i> of the entire aerosol population ("the hygroscopicity effect") when fully internal mixing is assumed in models. This study investigated these effects of fire particles on the properties of simulated deep convective clouds (DCCs), using cloud-resolving simulations with the Weather Research and Forecasting model coupled with Chemistry for a case study in a partly idealized setting. We found that the magnitude of the hygroscopicity effect was in some cases strong enough to entirely offset the number/size effect, in terms of its influence on modeled droplet and ice crystal concentrations. More specifically, in the case studied here, the droplet number concentration was reduced by about 37% or more due solely to the hygroscopicity effect. In the atmosphere, by contrast, fire particles likely have a much weaker impact on the hygroscopicity of the pre-existing background aerosol, as such a strong impact would occur only if the fire particles mixed immediately and uniformly with the background. We also show that the differences in the number of activated droplets eventually led to differences in the optical thickness of the clouds aloft, though this finding is limited to only a few hours of the initial development stage of the DCCs. These results suggest that accurately and rigorously representing aerosol mixing and <i> κ</i> in models is an important step toward accurately simulating aerosol-cloud interactions under the influence of fires.
Also flagged:methylationTumorhematoxylinestrogen receptorprogesterone receptorhuman epidermal growth factor receptor-2
Journal Article2020-06-16✓ 5 SnippetsKong DD, Fu RZ, Li L, Wang W, Wang SB.
In-Text Gene Mentions
Introduction)
…The objective of the study was to assess whether the methylation status of PCDH17 in TNBC tissues was associated with the response to NAC.…
Discussion)
…The present study evaluated 280 patients with TNBC who received NAC and identified that 81.4% of patients were positive for PCDH17 methylation.…
Introduction)
…In the present study, methylation-specific PCR (MSP) was used to detect the methylation status of PCDH17 in TNBC specimens prior to NAC.…
Abstract)
…The present study aimed to assess whether the methylation status of the protocadherin 17 gene (PCDH17) in triple-negative breast cancer (TNBC) tissues was associated with the efficacy of neoadjuvant chemotherapy (NAC).…
Results)
…Fig. 2 includes the methylated positive control, the demethylated positive control, the blank control and methylation status of protocadherin 17 in triple-negative breast cancer tissues detected via methylation-specific PCR (3 and 7 were unmethylated; 4, 5, 6 and 8 were methylated). Methylation analyses by MSP revealed that of the 280 patients with TNBC, 228 (81.4%) were positive for PCDH17 methylation and 52 (18.6%) were negative for PCDH17 methylation. The results of the associations between methylation status of PCDH17 and clinicopathological features are shown in Table II. Clinicopathological parameters, such as age, menopausal status, histological tumor grade, T stage, TNM stage, pathological tumor type, lymph node metastasis, radiotherapy and Ki67 status, were not significantly different in patients with different PCDH17 methylation status (P>0.05; Table II).…
Show Full Abstract
The present study aimed to assess whether the methylation status of the protocadherin 17 gene (<i>PCDH17</i>) in triple-negative breast cancer (TNBC) tissues was associated with the efficacy of neoadjuvant chemotherapy (NAC). The present study included 280 patients diagnosed with TNBC using core needle biopsy. Tumor pathological diagnosis was determined via hematoxylin and eosin staining. Immunohistochemical staining was used to determine estrogen receptor, progesterone receptor, human epidermal growth factor receptor-2 and Ki-67 status. <i>PCDH17</i> methylation status was analyzed using methylation-specific PCR. χ<sup>2</sup> tests were performed to analyze differences between <i>PCDH17</i> methylation status and TNBC clinicopathological features. Univariate and multivariate logistic regressions were used to analyze whether <i>PCDH17</i> methylation status predicted a curative effect of NAC. The multivariate analysis included factors with P<0.2 from the univariate analysis and those that were clinically associated with NAC. A total of 228 patients were positive for <i>PCDH17</i> methylation, while the remainder 52 were negative. Additionally, 107 patients achieved pathological complete response (pCR) after NAC. The pCR rate was 67.3% among the 52 patients negative for <i>PCDH17</i> methylation and 31.6% among the 228 patients positive for <i>PCDH17</i> methylation. Patients who were negative for <i>PCDH17</i> methylation and had high <i>Ki67</i> expression exhibited significantly higher pCR rates than their counterparts. The present results demonstrate that <i>PCDH17</i> methylation status may predict the response to NAC in patients with TNBC. Therefore, this epigenetic characteristic may serve as an indicator of treatment efficacy.
Also flagged:TumorLung AdenocarcinomaLUADLung Squamous Cell CarcinomaLUSCgene expression
Journal Article2020-06-16No SnippetsZhang L, Chen J, Cheng T, Yang H, Li H, Pan C.
Show Full Abstract
This study aimed to investigate the key genes and immune microenvironment involved in different TNM stages of lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC). The gene expression and clinical characteristics data were downloaded from the genomic data commons (GDC) database. After initial data processing, the characteristics of the immune microenvironment were analyzed. The differentially expressed genes (DEGs) in tumor vs. normal, and in early vs. advanced stages were screened, followed by Spearman correlation test for tumor infiltrating immune cells (TIICs) to identify immune-related genes. Finally, functional enrichment, protein-protein interaction, and survival analyses were performed. In LUAD, early stage was with higher immune scores, greater number of memory B cells and M0 macrophages compared to advanced stage. M0 and M2 macrophages, and resting memory CD4+ T cells accounted for a large proportion of TIICs in LUAD. The abundance of M0 macrophage infiltration was significantly correlated with the TNM stage and survival. In LUSC, early stage was with higher cytolytic activity and neoantigen burden compared to advanced stage. M0 and M2 macrophages, and plasma cells accounted for a large proportion of TIICs in LUSC. The abundance of resting and activated mast cells was significantly correlated with TNM stage, while resting dendritic cells, eosinophils, activated memory CD4 T cells, and mast cells were significantly correlated with prognosis. Tumor mutation burden analysis revealed that the median of variants per sample decreased from stage I to IV in LUAD, while it increased in LUSC. Further, 83 and 9 immune-related DEGs were identified in LUAD and LUSC, respectively, of which 23 genes in LUAD and 2 genes in LUSC correlated with survival. In conclusion, we identified the key genes, and characterized the tumor immune microenvironment in LUAD and LUSC which may provide therapeutic targets for the treatment of NSCLC.
Also flagged:Hydrogen sulfideangiogenesistube formationHydrogensulfideanethole
Journal Article2020-06-16✓ 1 SnippetChen JJY, van der Vlies AJ, Hasegawa U.
In-Text Gene Mentions
I A O 0000326)
…DCC…
Show Full Abstract
Hydrogen sulfide (H<sub>2</sub>S), an important gaseous signalling molecule in the human body, has been shown to be involved in many physiological processes such as angiogenesis. Since the biological activities of H<sub>2</sub>S are known to be significantly affected by the dose and exposure duration, the development of H<sub>2</sub>S delivery systems that enable control of H<sub>2</sub>S release is critical for exploring its therapeutic potential. Here, we prepared polymeric micelles with different H<sub>2</sub>S release profiles, which were prepared from amphiphilic block copolymers consisting of a hydrophilic poly(<i>N</i>-acryloyl morpholine) segment and a hydrophobic segment containing H<sub>2</sub>S-releasing anethole dithiolethione (ADT) groups. The thermodynamic stability of the micelles was modulated by altering the ADT content of the polymers. The micelles with higher thermodynamic stability showed significantly slower H<sub>2</sub>S release. Furthermore, the sustained H<sub>2</sub>S release from the micelles enhanced migration and tube formation in human umbilical vein cells (HUVECs) and induced vascularlization in the <i>in ovo</i> chick chorioallantoic membrane (CAM) assay.
Research Square2020-06-16Preprint (No Snippets API)Zhong L, Guo Z, Pan Y, Zhu X, Chen Y.
Show Full Abstract
<title>Abstract</title> <p><bold>Objective: </bold>This study aimed to screen the potential molecular targets for proximal, mid, and distal esophageal cancers.<bold>Methods:</bold> The clinical data, RNA-seq data, and survival data for TCGA esophageal cancer were retrieved from UCSC Xena database. The samples with clinical information on the esophageal tumor central location were selected. Differential analyses on different groups (mid <italic>vs</italic>. proximal, distal <italic>vs</italic>. proximal, and distal <italic>vs</italic>. mid) were performed. Following the differentially expressed genes (DEGs) in three groups were analyzed, the common genes were subjected to survival analysis, miRNA prediction, and drug-gene analysis. The specific genes were annotated for functional and module analyses.<bold>Results:</bold> Six common genes, namely <italic>KCNA1</italic>, <italic>CCDC196</italic>, <italic>UNC5CL</italic>, <italic>CYP3A5</italic>, <italic>CA10,</italic> and <italic>REG3A</italic>, were analyzed among three comparison groups.<italic> </italic>The expression of <italic>CA10 </italic>and <italic>REG3A</italic> was significantly correlated in the prognosis of patients with esophageal cancer. The distal <italic>vs</italic>. mid groups screened 766 specific DEGs, and the mid <italic>vs</italic>. proximal group screened 99 specific DEGs. Functional analysis showed that the genes of distal <italic>vs.</italic> mid groups, including <italic>EDN3</italic>,<italic> CGA</italic>, <italic>CCR9,</italic> and <italic>GABRA2</italic>, as well as genes in the mid <italic>vs</italic>. proximal groups, including <italic>GCGR</italic>, <italic>OXTR,</italic> and <italic>MCHR2</italic>, were significantly enriched in neural functions. In the distal <italic>vs</italic>. proximal groups, there were 314 specific DEGs, including <italic>CYP2C8</italic> and <italic>OXGR1</italic>.<bold>Conclusion: </bold>Six common genes may serve as the potential molecular targets for the treatment of all proximal, mid, and distal esophageal cancers.</p>
bioRxiv2020-06-16Preprint (No Snippets API)de Almeida RM, Thomas GL, Glazier JA.
Show Full Abstract
To understand the difference between benign and severe outcomes after Coronavirus infection, we urgently need ways to clarify and quantify the time course of tissue and immune responses. Here we re-analyze 72-hour time-series microarrays generated in 2013 by Sims and collaborators for SARS-CoV-1 in vitro infection of a human lung epithelial cell line. Transcriptograms, a Bioinformatics tool to analyze genome-wide gene expression data, allow us to define an appropriate context-dependent threshold for mechanistic relevance of gene differential expression. Without knowing in advance which genes are relevant, classical analyses detect every gene with statistically-significant differential expression, leaving us with too many genes and hypotheses to be useful. Using a Transcriptogram-based top-down approach, we identified three major, differentially-expressed gene sets comprising 219 mainly immune-response-related genes. We identified timescales for alterations in mitochondrial activity, signaling and transcription regulation of the innate and adaptive immune systems and their relationship to viral titer. At the individual-gene level, EGR3 was significantly upregulated in infected cells. Similar activation in T-cells and fibroblasts in infected lung could explain the T-cell anergy and eventual fibrosis seen in SARS-CoV-1 infection. The methods can be applied to RNA data sets for SARS-CoV-2 to investigate the origin of differential responses in different tissue types, or due to immune or preexisting conditions or to compare cell culture, organoid culture, animal models, and human-derived samples.
bioRxiv2020-06-16Preprint (No Snippets API)McLaughlin K, Bechtel M, Bojkova D, Wass MN, Michaelis M, Cinatl J.
Show Full Abstract
SARS-CoV-2 is the causative agent of COVID-19. Severe COVID-19 disease has been associated with disseminated intravascular coagulation and thrombosis, but the mechanisms underlying COVID-19-related coagulopathy remain unknown. Since the risk of severe COVID-19 disease is higher in males than in females and increases with age, we combined proteomics data from SARS-CoV-2-infected cells with human gene expression data from the Genotype-Tissue Expression (GTEx) database to identify gene products involved in coagulation that change with age, differ in their levels between females and males, and are regulated in response to SARS-CoV-2 infection. This resulted in the identification of transferrin as a candidate coagulation promoter, whose levels increases with age and are higher in males than in females and that is increased upon SARS-CoV-2 infection. A systematic investigation of gene products associated with the GO term “blood coagulation” did not reveal further high confidence candidates, which are likely to contribute to COVID-19-related coagulopathy. In conclusion, the role of transferrin should be considered in the course of COVID-19 disease and further examined in ongoing clinic-pathological investigations.
…Therapeutic strategies for the inhibition of the hypoxia-promoted TrkAIII oncogene, a potential driver oncogene in cancers including neuroblastoma and Merkel cell carcinoma, include the small molecule Trk tyrosine kinase inhibitors, Larotrectinib, Entrectinib, Cabozantinib, Merestinib, TRS-011, DS-6051B, MGCD156, PLX486 and DCC-2710, FDA-approved or in clinical trials for cancers with Trk-fusion oncogenes or with altered Trk activity, that could be repurposed for treating tumours that express TrkAIII (Fig. 6b) [328].…
Show Full Abstract
Hypoxia-induced alternative splicing is a potent driving force in tumour pathogenesis and progression. In this review, we update currents concepts of hypoxia-induced alternative splicing and how it influences tumour biology. Following brief descriptions of tumour-associated hypoxia and the pre-mRNA splicing process, we review the many ways hypoxia regulates alternative splicing and how hypoxia-induced alternative splicing impacts each individual hallmark of cancer. Hypoxia-induced alternative splicing integrates chemical and cellular tumour microenvironments, underpins continuous adaptation of the tumour cellular microenvironment responsible for metastatic progression and plays clear roles in oncogene activation and autonomous tumour growth, tumor suppressor inactivation, tumour cell immortalization, angiogenesis, tumour cell evasion of programmed cell death and the anti-tumour immune response, a tumour-promoting inflammatory response, adaptive metabolic re-programming, epithelial to mesenchymal transition, invasion and genetic instability, all of which combine to promote metastatic disease. The impressive number of hypoxia-induced alternative spliced protein isoforms that characterize tumour progression, classifies hypoxia-induced alternative splicing as the 11th hallmark of cancer, and offers a fertile source of potential diagnostic/prognostic markers and therapeutic targets.
Also flagged:gestational diabetes mellitusinsulin resistancecoagulationlipidCRPIGFBP2
Journal Article2020-06-15✓ 1 SnippetLiu X, Sun J, Wen X, Duan J, Xue D, Pan Y, Sun J, Zhang W, Cheng X, Wang C.
In-Text Gene Mentions
Discussion)
…of antithrombin III (ATIII), and a higher…
Show Full Abstract
<h4>Background</h4>The practices used to diagnose gestational diabetes mellitus (GDM) could only be carried out around the time of detectable symptoms, and predictive capacity is little.<h4>Methods</h4>LC-MS/MS was conducted to explore overview proteomics for GDM complicated pregnant woman at 16-18 gestation weeks, while normal pregnant for control. Enzyme-linked immunosorbent assay was further applied in an independent cohort of 15 GDM cases and 15 controls for verification.<h4>Results</h4>The results indicated that 24 protein expression levels were significantly changed in GDM group samples, and inflammation, oxidative stress, insulin resistance, blood coagulation, and lipid homeostasis were associated with GDM. The abnormal expression of CRP and IGFBP2 was verified in the first-trimester maternal plasma in women who subsequently developed GDM.<h4>Conclusions</h4>This study not only identified 24 potential predictive biomarkers for GDM also provided a global overview of protein rearrangements induced by GDM.
Also flagged:genetic neurodegenerative disorderpathogenesismyelinationMovement DisordersMovement Disordermyelin
Journal Article2020-06-15✓ 2 SnippetsCasella C, Lipp I, Rosser A, Jones DK, Metzler-Baddeley C.
In-Text Gene Mentions
S I O 001029)
…The phenotype exhibited by each animal model of HD needs to be considered in the context of the different approaches used to generate the respective model.42 Key distinguishing factors are the genetic approach and transgene construct used, for example, the use of full‐length or only a fragment of mutant huntingtin (HTT), the length of the CAG repeat incorporated into the genome, the expression of the HD mutation from a transgene versus knock‐in of the mutation into the endogenous HTT locus.…
S I O 001029)
…The mutation accountable for HD is an expansion of the cytosine‐adenine‐guanine (CAG) repeat within the huntingtin (HTT) gene.…
Many genetic variants identified in genome-wide association studies (GWAS) are associated with multiple, sometimes seemingly unrelated, traits. This motivates multi-trait association analyses, which have successfully identified novel associated loci for many complex diseases. While appealing, most existing methods focus on analyzing a relatively small number of traits, and may yield inflated Type 1 error rates when a large number of traits need to be analyzed jointly. As deep phenotyping data are becoming rapidly available, we develop a novel method, referred to as aMAT (adaptive multi-trait association test), for multi-trait analysis of any number of traits. We applied aMAT to GWAS summary statistics for a set of 58 volumetric imaging derived phenotypes from the UK Biobank. aMAT had a genomic inflation factor of 1.04, indicating the Type 1 error rate was well controlled. More important, aMAT identified 24 distinct risk loci, 13 of which were ignored by standard GWAS. In comparison, the competing methods either had a suspicious genomic inflation factor or identified much fewer risk loci. Finally, four additional sets of traits have been analyzed and provided similar conclusions.
Non-cardiac surgery is associated with significant cardiovascular complications. Reported mortality rate ranges from 1.9% to 4% in unselected patients. A postoperative surge in pro-inflammatory cytokines is a well-known feature and putative contributor to these complications. Despite much clinical research, little is known about the biomolecular changes in cardiac tissue following non-cardiac surgery. In order to increase our understanding, we analyzed whole-transcriptional and metabolic profiling data sets from hearts of mice harvested two, four, and six weeks following isolated thoracotomy. Hearts from healthy litter-mates served as controls. Functional network enrichment analyses showed a distinct impact on cardiac transcription two weeks after surgery characterized by a downregulation of mitochondrial pathways in the absence of significant metabolic alterations. Transcriptional changes were not detectable four and six weeks following surgery. Our study shows distinct and reversible transcriptional changes within the first two weeks following isolated thoracotomy. This coincides with a time period, in which most cardiovascular events happen.
Also flagged:psychiatric illnesssensory processingSPSpsychological distressserotonin transporterSLC6A4
Journal Article2020-06-15✓ 5 SnippetsLicht CL, Mortensen EL, Hjordt LV, Stenbaek DS, Arentzen TE, Nørremølle A, Knudsen GM.
In-Text Gene Mentions
Introduction)
…In response to environmental adversity a functional polymorphism in the serotonin (5‐hydroxy‐tryptamine, 5‐HT) transporter (5‐HTT) gene SLC6A4, the 5‐HTT linked polymorphic region (5‐HTTLPR), may predispose to mental illness (Uher & McGuffin, 2008, 2010).…
Abstract)
…The short (s) allele of the 5‐HTTLPR polymorphism in the promoter region of the human serotonin transporter (5‐HTT) gene SLC6A4 has previously been associated with anxiety‐related personality dimensions.…
S I O 001029)
…The short (s) allele of the 5‐HTTLPR polymorphism in the promoter region of the human serotonin transporter (5‐HTT) gene has previously been associated with anxiety‐related personality dimensions, including Neuroticism and Harm Avoidance.…
…uman serotonin transporter (5‐HTT) gene has previously…
Show Full Abstract
<h4>Background</h4>The short (s) allele of the 5-HTTLPR polymorphism in the promoter region of the human serotonin transporter (5-HTT) gene SLC6A4 has previously been associated with anxiety-related personality dimensions. However, this relationship has not been confirmed in all studies and may be modified by environmental circumstances and/or psychiatric illness. This study examined whether the temperamental trait sensory processing sensitivity (SPS), characterized by increased responsivity to environmental stimuli, is related to 5-HTTLPR/rs25531 genotype.<h4>Methods</h4>5-HTTLPR and rs25531 genotypes, level of SPS, self-reported Revised NEO Personality Inventory (NEO-PI-R) and Temperament and Character Inventory (TCI) personality profiles, and symptoms of psychological distress (SCL-90R Global Severity Index) were determined for 405 healthy volunteers.<h4>Results</h4>Sensory processing sensitivity was highly correlated with the anxiety-related dimensions of the NEO-PI-R and the TCI models of personality, Neuroticism, and Harm Avoidance, respectively. However, the level of SPS was not associated with the combined 5-HTTLPR and rs25531 s'/s' genotype. Neuroticism and Harm Avoidance were also not associated with 5-HTTLPR/rs25531 s'/s' genotype. Correcting for symptoms of psychological distress had no effect on the relationships between personality and genotype.<h4>Conclusion</h4>The level of SPS was not associated with serotonin transporter gene variation. Further, combined 5-HTTLPR and rs25531 genotype was not associated with other anxiety-related dimensions.
Nuptial plumage coloration is critical in the mating choice of the crested ibis. This species has a characteristic nuptial plumage that develops from the application of a black sticky substance, secreted by a patch of skin in the throat and neck region. We aimed to identify the genes regulating its coloring, by comparing skin transcriptomes between ibises during the breeding and nonbreeding seasons. In breeding season skins, key eumelanin synthesis genes, <i>TYR</i>, <i>DCT</i>, and <i>TYRP1</i> were upregulated. Tyrosine metabolism, which is closely related to melanin synthesis, was also upregulated, as were transporter proteins belonging to multiple <i>SLC</i> families, which might act during melanosome transportation to keratinocytes. These results indicate that eumelanin is likely an important component of the black substance. In addition, we observed upregulation in lipid metabolism in breeding season skins. We suggest that the lipids contribute to an oil base, which imbues the black substance with water insolubility and enhances its adhesion to feather surfaces. In nonbreeding season skins, we observed upregulation in cell adhesion molecules, which play critical roles in cell interactions. A number of molecules involved in innervation and angiogenesis were upregulated, indicating an ongoing expansion of nerves and blood vessels in sampled skins. Feather β keratin, a basic component of avian feather filament, was also upregulated. These results are consistent with feather regeneration in the black skin of nonbreeding season ibises. Our results provide the first molecular evidence indicating that eumelanin is the key component of ibis coloration.
Also flagged:EDMDEmerinenvelopepathogenesisEMDEDMD1
Journal Article2020-06-15✓ 3 SnippetsIyer A, Holaska JM.
In-Text Gene Mentions
Discussion)
…29 ] andLap1[ 76 ].…
Discussion)
…is possible thatLap1and Lap2β are…
Discussion)
…to Lap2β orLap1and displaces other…
Show Full Abstract
Mutations in the gene encoding emerin (<i>EMD</i>) cause Emery-Dreifuss muscular dystrophy (EDMD1), an inherited disorder characterized by progressive skeletal muscle wasting, irregular heart rhythms and contractures of major tendons. The skeletal muscle defects seen in EDMD are caused by failure of muscle stem cells to differentiate and regenerate the damaged muscle. However, the underlying mechanisms remain poorly understood. Most EDMD1 patients harbor nonsense mutations and have no detectable emerin protein. There are three EDMD-causing emerin mutants (S54F, Q133H, and D95-99) that localize correctly to the nuclear envelope and are expressed at wildtype levels. We hypothesized these emerin mutants would share in the disruption of key molecular pathways involved in myogenic differentiation. We generated myogenic progenitors expressing wildtype emerin and each EDMD1-causing emerin mutation (S54F, Q133H, D95-99) in an emerin-null (EMD<sup>-/y</sup>) background. S54F, Q133H, and D95-99 failed to rescue EMD<sup>-/y</sup> myogenic differentiation, while wildtype emerin efficiently rescued differentiation. RNA sequencing was done to identify pathways and networks important for emerin regulation of myogenic differentiation. This analysis significantly reduced the number of pathways implicated in EDMD1 muscle pathogenesis.
Also flagged:Axin2ATOH1Tnfrsf19GFPllschromatin remodeling
Journal Article2020-06-15✓ 3 SnippetsBaulies A, Angelis N, Foglizzo V, Danielsen ET, Patel H, Novellasdemunt L, Kucharska A, Carvalho J, Nye E, De Coppi P, Li VSW.
In-Text Gene Mentions
I A O 0000326)
…Olfm4…
Methods)
…408791_C2), Lgr5 (312171),Olfm4(REF 311831).…
Results)
…( Lgr5 andOlfm4) were also…
Show Full Abstract
<h4>Background & aims</h4>Notch signaling maintains intestinal stem cells (ISCs). When ISCs exit the niche, Notch signaling among early progenitor cells at position +4/5 regulates their specification toward secretory vs enterocyte lineages (binary fate). The transcription factor ATOH1 is repressed by Notch in ISCs; its de-repression, when Notch is inactivated, drives progenitor cells to differentiate along the secretory lineage. However, it is not clear what promotes transition of ISCs to progenitors and how this fate decision is established.<h4>Methods</h4>We sorted cells from Lgr5-GFP knockin intestines from mice and characterized gene expression patterns. We analyzed Notch regulation by examining expression profiles (by quantitative reverse transcription polymerase chain reaction and RNAscope) of small intestinal organoids incubated with the Notch inhibitor DAPT, intestine tissues from mice given injections of the γ-secretase inhibitor dibenzazepine, and mice with intestine-specific disruption of Rbpj. We analyzed intestine tissues from mice with disruption of the RUNX1 translocation partner 1 gene (Runx1t1, also called Mtg8) or CBFA2/RUNX1 partner transcriptional co-repressor 3 (Cbfa2t3, also called Mtg16), and derived their organoids, by histology, immunohistochemistry, and RNA sequencing (RNA-seq). We performed chromatin immunoprecipitation and sequencing analyses of intestinal crypts to identify genes regulated by MTG16.<h4>Results</h4>The transcription co-repressors MTG8 and MTG16 were highly expressed by +4/5 early progenitors, compared with other cells along crypt-villus axis. Expression of MTG8 and MTG16 were repressed by Notch signaling via ATOH1 in organoids and intestine tissues from mice. MTG8- and MTG16-knockout intestines had increased crypt hyperproliferation and expansion of ISCs, but enterocyte differentiation was impaired, based on loss of enterocyte markers and functions. Chromatin immunoprecipitation and sequencing analyses showed that MTG16 bound to promoters of genes that are specifically expressed by stem cells (such as Lgr5 and Ascl2) and repressed their transcription. MTG16 also bound to previously reported enhancer regions of genes regulated by ATOH1, including genes that encode Delta-like canonical Notch ligand and other secretory-specific transcription factors.<h4>Conclusions</h4>In intestine tissues of mice and human intestinal organoids, MTG8 and MTG16 repress transcription in the earliest progenitor cells to promote exit of ISCs from their niche (niche exit) and control the binary fate decision (secretory vs enterocyte lineage) by repressing genes regulated by ATOH1.
Also flagged:Netrin-1peripheral nerve injuryphosphatidylinositol 4-kinase IIaAMPA receptordeleted incolorectal cancer
Journal Article2020-06-15✓ 5 SnippetsLi J, Wang G, Weng Y, Ding M, Yu W.
In-Text Gene Mentions
Abstract)
…in colorectal cancer (DCC) are fundamental for…
Abstract)
…spinal netrin-1 secretion,DCClevel and Pi4KIIa…
Abstract)
…spinal netrin-1 release,DCClevel and Pi4KIIa…
Abstract)
…spinal over-expression ofDCCand Pi4KIIa.…
Abstract)
…spinal expression ofDCCand Pi4KIIa.…
Show Full Abstract
<h4>Background</h4>The burden of neuropathic pain is growing worldwide. Recent studies recapitulate the requirement for AMPA receptor in excitatory synaptic plasticity underlying pain-related syndromes. Netrin-1 and its receptor deleted in colorectal cancer (DCC) are fundamental for AMPA receptor dependent synaptic transmission. Phosphatidylinositol 4-kinase IIa (Pi4KIIa) mediates post-synaptic insertion of AMPA receptor in neuropathic disorders. This study investigates whether netrin-1 and Pi4KIIa regulate peripheral nerve injury-induced neuropathic pain.<h4>Methods</h4>A model of chronic constriction injury (CCI) of the sciatic nerve in mice was established to induce neuropathic pain. Paw withdrawal mechanical threshold, paw withdrawal thermal latency, spinal netrin-1 secretion, DCC level and Pi4KIIa expression were examined. Netrin-1 knockdown by shRNA, recombinant netrin-1 and Pi4KIIa inhibitor were employed to elucidate the substantial mechanisms.<h4>Results</h4>CCI surgery initiated and sustained the persistent reduction in paw withdrawal mechanical threshold and paw withdrawal thermal latency, along with the increase in spinal netrin-1 release, DCC level and Pi4KIIa expression. Netrin-1 deficiency impaired CCI-induced neuropathic pain behaviors and spinal over-expression of DCC and Pi4KIIa. Pharmacological inhibition of Pi4KIIa attenuated peripheral nerve injury induced mechanical allodynia and thermal hyperalgesia in a dose-dependent manner. Spinal application of recombinant netrin-1 caused pain hypersensitivity and up-regulated spinal expression of DCC and Pi4KIIa. Central inhibition of Pi4KIIa reversed exogenous netrin-1 evoked acute pain phenotype.<h4>Conclusion</h4>Our current results demonstrate the contribution of spinal netrin-1 and DCC in modulating the expression of Pi4KIIa in the pathogenesis of neuropathic pain in mice.
Also flagged:lactatedichloroacetatelactic acidosisMitochondrial methionyl-tRNA formyltransferasemitochondrialMTFMT
Journal Article2020-06-15✓ 1 SnippetBennett J, Kerr M, Greenway SC, Friederich MW, Van Hove JLK, Hittel D, Khan A.
In-Text Gene Mentions
Discussion)
…a mutation inFBXL4that we described…
Show Full Abstract
Mitochondrial methionyl-tRNA formyltransferase (<i>MTFMT</i>) is a nuclear-encoded gene that produces a protein involved in mitochondrial translation. MTFMT formylates a portion of Met-tRNA<sup>Met</sup>, which allows for translation initiation of mitochondrial mRNA. Mutations in this gene have been shown to result in decreased mitochondrial translation with reduction function of the electron transport chain complexes I, III, IV, and V, thus affecting cellular energy production. Our patient presented with severe lactic acidosis in the neonatal period, and was found to be homozygous for the pathogenic mutation c.994C > T, p.(Arg332*). Her blood lactate levels normalized and her cardiomyopathy reversed after initiation of dichloroacetate (30 mg/kg/day). After two years of follow-up, she continues to show long-term lactate stability, continues to make developmental gains, and is in overall good general health. This is the first report using dichloroacetate in a patient with MTFMT deficiency, which may be a potential therapeutic option that warrants further study.
<h4>Background</h4>More than 50% of patients with type 2 diabetes mellitus (DM) also have hypertension. Moreover, hypertension has been regarded as one paraneoplastic phenomenon of hepatocellular carcinoma (HCC). Our study was designed to determine the relationship between blood pressure and DM in HCC patients.<h4>Patients and methods</h4>A total of 879 HCC patients were included and 151 (17.2%) were diagnosed with DM. Multivariable logistic regression analysis was used to determine the relationship and the results were expressed as adjusted odds ratios (AORs) and their 95% confidence intervals (CIs). Considering the effect of potential confounders, sub-group analysis was performed. We would further study the association of systolic blood pressure (SBP) with fasting glucose, and the association between DM duration/treatment and SBP level.<h4>Results</h4>Compared with non-diabetic patients, the diabetic patients had increased levels of SBP (133.7±18.5 mmHg vs 128.3±15.2 mmHg, P=0.001) and fasting blood glucose (9.13±3.04 mmol/L vs 5.18±1.08 mmol/L, P<0.001), an elder age (58.5±10.2 years vs 55.3±11.2 years, P=0.001), a higher percentage of cirrhosis diagnosis (60.9% vs 48.2%, P=0.004), lower percentages of drinking (18.5% vs 30.8%, P=0.002) and smoking (30.5% vs 43.7%, P=0.003), and decreased levels of GGT (median/interquartile-range 88/53-177 U/L vs 117/58-248 U/L, P=0.037), platelet count (121.4±76.6 ×10<sup>9</sup>/L vs 151.2±82.8 ×10<sup>9</sup>/L, P<0.001) and hemoglobin (124.3±25.5 g/L vs 133.6±24.2 g/L, P<0.001). Multivariable analysis showed that, statistically significant differences were found for SBP ≥140 mmHg (AOR=2.101; 95% CI, 1.424-3.100; P<0.001), smoking (AOR=0.637; 95% CI, 0.415-0.979; P=0.040), hemoglobin (AOR=0.990; 95% CI, 0.983-0.998; P=0.010) and platelet count (AOR=0.996; 95% CI, 0.994-0.999; P=0.009). For the relationship between SBP and DM, the positive result was supported by most (10/14) of the subgroup analyses.<h4>Conclusion</h4>SBP level was increased in HCC patients with diabetes mellitus.
Also flagged:Acute Fatty Liver DiseaseAcute fatty liver of pregnancyfulminant liver failuregestationacute hepatic failureliver failure
Journal Article2020-06-15✓ 2 SnippetsAfridi F, Feely M, Reddy R.
In-Text Gene Mentions
I A O 0000613)
…(AFP) level, andhemochromatosisscreen.…
I A O 0000613)
…can present acutely,hemochromatosisis an indolent…
Show Full Abstract
Acute fatty liver of pregnancy (AFLP) is a rare disorder that typically presents in the third trimester. We report a case of a 21-year-old woman with a history of intrauterine fetal demise at 19 weeks' gestation who developed fulminant liver failure 1 week after the fetal demise. She was diagnosed with AFLP as per the Swansea criteria. An orthotopic liver transplant was attempted but was unsuccessful. AFLP usually presents between the 30th to 38th weeks of gestation. However, it can occur in the postpartum period after only 19 weeks of gestation as highlighted in our case.
Also flagged:sepsisgene expressionORM1CEP55S100A12S100P
Journal Article2020-06-15✓ 2 SnippetsLu J, Li Q, Wu Z, Zhong Z, Ji P, Li H, He C, Feng J, Zhang J.
In-Text Gene Mentions
Abstract)
…The ten genes (OLFM4, ORM1, CEP55, S100A12,…
Text
…OLFM4…
Show Full Abstract
Accurate diagnosis of sepsis remains challenging, new markers or combinations of markers are urgently needed. In the present study, we screened differentially expressed genes (DEGs) between sepsis and non-sepsis blood samples across three previously published gene expression data sets. Common upregulated and downregulated DEGs were ranked according to their average functional similarity. The ten genes (OLFM4, ORM1, CEP55, S100A12, S100P, LRG1, CEACAM8, MS4A4A, PLSCR1, and IL1R2) with the largest average functional similarity among the common upregulated genes and another ten genes (THEMIS, IL2RB, CD2, IL7R, CD3E, KLRB1, PVRIG, CCRR3, TGFBR3, and PLEKHA1) with the largest average functional similarity among the common downregulated genes were separately identified as the upregulated crucial gene set and the downregulated crucial gene set. Gene set variation analysis (GSVA) was used to obtain the GSVA index of each sample against the two crucial gene sets. Both the two crucial GSVA indexes may be robust markers for sepsis with high area under ROC curve. The diagnostic utility of the upregulated GSVA index was validated in another independent data set. Functional analyses revealed several sepsis-related pathways. In conclusion, we proposed two sepsis-related gene sets across multiple data sets and created two GSVA indexes with promising diagnostic value.
Also flagged:Narcolepsyinterferon-gammaC-C chemokine receptorcytokinecytokine receptorpathogenesis
Journal Article2020-06-15✓ 2 SnippetsOuyang H, Zhou Z, Zheng Q, Zhang J.
In-Text Gene Mentions
Abstract)
…IFNAR1, IL10RB, DNMT1,TNFSF4and NFATC2 ).…
Discussion)
…IFNAR1, IL10RB, DNMT1,TNFSF4, and NFATC2.…
Show Full Abstract
<b>Aims:</b> To investigate the interactions among narcolepsy-associated genes and reveal the pathways these genes involved through bioinformatics analyses. <b>Methods:</b> The study was performed with the following steps: 1) Selected the previously discovered narcolepsy risk genes through literature review, 2) pathway enrichment analysis, and construction of gene-gene and protein-protein interaction (PPI) networks for narcolepsy. <b>Results:</b> 1) GO analysis revealed the positive regulation of interferon-gamma production as the most enriched terms in biological process, and C-C chemokine receptor activity as the most enriched term in molecular function, 2) KEGG pathway enrichment analysis revealed selective enrichment of genes in cytokine-cytokine receptor interaction signaling pathways, and 3) five hub genes were identified (<i>IFNAR1, IL10RB, DNMT1, TNFSF4</i> and <i>NFATC2</i>). <b>Conclusion:</b> The bioinformatics results provide new insights into the molecular pathogenesis of narcolepsy and the identification of potential therapeutic targets for narcolepsy treatment.
…S levels, andantithrombin-IIIdeficiency could contribute…
Show Full Abstract
Human immunodeficiency virus (HIV) infection is a known hypercoagulable state with venous thromboembolism with a high mortality rate compared to the general population. The homeostatic balance in HIV infected patients improves with treatment compared to those who are not. A decreased hypercoagulable state noted by low levels of Von Willebrand factor, factor VIII and d-dimer levels along with higher protein C and S activity in patients on treatment suggests that hypercoagulable state is partially correctable with highly active antiretroviral therapy. HIV with heart muscle involvement can present as myocarditis or as dilated cardiomyopathy with left or right ventricular dysfunction. Here we present a case of a 57-year-old man with a known history of HIV infection, noncompliant with medical therapy presenting with dilated cardiomyopathy with biventricular thrombi with reduced protein C, protein S, and Antithrombin III levels.
Also flagged:Cleft lipCLcleft palateCPDown syndromeorofacial cleft
Journal Article2020-06-15No SnippetsIwata J.
Show Full Abstract
Cleft lip (CL) with/without cleft palate (CP) (hereafter CL/P) is the second most common congenital birth defect, affecting 7.94 to 9.92 children per 10,000 live births worldwide, followed by Down syndrome. An increasing number of genes have been identified as affecting susceptibility and/or as causative genes for CL/P in mouse genetic and chemically-induced CL and CP studies, as well as in human genome-wide association studies and linkage analysis. While marked progress has been made in the identification of genetic and environmental risk factors for CL/P, the interplays between these factors are not yet fully understood. This review aims to summarize our current knowledge of CL and CP from genetically engineered mouse models and environmental factors that have been studied in mice. Understanding the regulatory mechanism(s) of craniofacial development may not only advance our understanding of craniofacial developmental biology, but could also provide approaches for the prevention of birth defects and for tissue engineering in craniofacial tissue regeneration.
bioRxiv2020-06-15Preprint (No Snippets API)Meston D, Bi W, Rietschel T, van Ham M, Leichert LI, Jänsch L.
Show Full Abstract
T lymphocytes are key components in adaptive immunity and their activation naturally involves mitochondrial-derived oxygen species (mtROS). In particular, H 2 O 2 has been implicated as an important signaling molecule regulating major T cell functions. H 2 O 2 targets the oxidation status of functional cysteine residues but knowledge if and where this happens in T cell signaling networks is widely missing. This study aimed to identify mtROS-sensitive processes in activated primary human CD4 + T cells. By using a thiol-specific redox proteomic approach we examined the oxidation state of 4784 cysteine-containing peptides of ex vivo stimulated T cells from healthy individuals. Upon activation, a shift in oxidation was observed at catalytic cysteine residues of peroxiredoxins (PRDX5 & PRDX6), and T cells were found to maintain their global thiol-redox homeostasis. In parallel, a distinct set of 88 cysteine residues were found to be differentially oxidized upon T cell activation suggesting novel functional thiol switches. In mitochondria, cysteine oxidations selectively modified regulators of respiration (NDUFA2, NDUFA8, and UQCRH) confirming electron leakage from electron transport complexes I and III. The majority of oxidations occurred outside mitochondria and enriched sensitive thiols at regulators of cytoskeleton dynamics (e.g. CYFIP2 and ARPC1B) and known immune functions including the non-receptor tyrosine phosphatase PTPN7. Conversely, cysteine reduction occurred predominantly at transcriptional regulators and sites that coordinate zinc-binding in zinc-finger motifs. Indeed, fluorescence microscopy revealed a colocalization of zinc-rich microenvironments and mitochondria in T cells suggesting mtROS-dependent zinc-release of identified transcriptional regulators including ZFP36, RPL37A and CRIP2. In conclusion, this study complements knowledge on the mtROS signaling network and suggests zinc-dependent thiol switches as a mechanism of how mtROS affects transcription and translation in T cells.
Also flagged:BRAFColorectal CancerColon cancermethylationagingKRAS
Journal Article2020-06-14No SnippetsMolina-Cerrillo J, San Román M, Pozas J, Alonso-Gordoa T, Pozas M, Conde E, Rosas M, Grande E, García-Bermejo ML, Carrato A.
Show Full Abstract
Colon cancer is one of the most frequently diagnosed malignancies in adults, considering both its incidence and prevalence. Anatomically, the right colon is considered as being from the cecum to the splenic flexure, and the left colon is from the splenic flexure to the rectum. Sidedness is a surrogate of a wide spectrum of colorectal cancer (CRC) biology features (embryology, microbiome, methylation, microsatellite instability (MSI), BRAF, aging, KRAS, consensus molecular subtypes (CMS), etc.), which result in prognostic factors. Different molecular subtypes have been identified, according to genomic and transcriptomic criteria. A subgroup harboring a BRAF mutation has been described, and represents approximately 10% of the patients diagnosed with colon cancer. This subgroup has morphological, clinical, and therapeutic characteristics that differ substantially from patients who do not carry this genetic alteration. Unfortunately, there is no established standard of care for this particular cohort of patients. This manuscript aims to study the biology of this subgroup of colon cancer, to understand the current approach in clinical research.
…Depending on the disease, different protein aggregates are found such as α-synuclein (α-syn) in PD, β-amyloid (Aβ) plaques and hyper-phosphorylated tau neurofibrillary tangles (NFTs) in AD, huntingtin (Htt) in HD, superoxide dismutase 1 (SOD1), and TAR DNA binding protein 43 (TDP-43) in ALS and scrapie prion protein (PrPSc) in spongiform encephalopathies [52].…
I A O 0000606)
…shock protein 90;Htt: huntingtin, IBs: ubiquitinat…
Show Full Abstract
NRF2 acts by controlling gene expression, being the master regulator of the Phase II antioxidant response, and also being key to the control of neuroinflammation. NRF2 activity is regulated at several levels, including protein degradation by the proteasome, transcription, and post-transcription. The purpose of this review is to offer a concise and critical overview of the main mechanisms of NRF2 regulation and their actual or potential use as targets for the treatment of neurodegenerative diseases.
Also flagged:polyphenolsglutathione peroxidaseGSH-Pxglutathionemalonaldehydemetabolism
Journal Article2020-06-14✓ 2 SnippetsLi W, He ZQ, Zhang XY, Chen YJ, Zuo JJ, Cao Y.
In-Text Gene Mentions
Introduction)
…expression of GST,Prdx6, PPIA, alfatoxin aldehyde…
Discussion)
…expressions of GST,Prdx6, PPIA, alfatoxin aldehyde…
Show Full Abstract
Eucalyptus leaf polyphenols extract (EPE) has been proved to have various bioactivities, but few reports focus on its antioxidant mechanism <i>in vivo</i>. The purpose of this study was to elucidate the effect and mechanism of EPE dietary supplements on antioxidant capacity in chicken. A total of 216 chickens were randomly selected for a 40-day experiment. Four treatment groups received diets including the control diet only, the control diet + low EPE (0.6 g/kg), the control diet + moderate EPE (0.9 g/kg), and the control diet + high EPE (1.2 g/kg). Compared with control group, the glutathione peroxidase (GSH-Px) activity and glutathione (GSH) content in the breast muscle of the moderate EPE treatment group was significantly higher (<i>p</i> < 0.05), while the malonaldehyde (MDA) content in the moderate EPE group was reduced (<i>p</i> < 0.05). Moreover, proteomic and transcriptomic analyses of the breast muscle revealed that glutathione metabolism and the peroxisome were the two crucial metabolic pathways responsible for increased antioxidant capacity of the muscle. Accordingly, nine candidate genes and two candidate proteins were identified related to improved antioxidant status induced by EPE supplements. This research provides new insights into the molecular mechanism of antioxidant capacity in chickens treated with EPE dietary supplements.
Also flagged:circularankylosing spondylitisASpeptidylserinephosphorylation
Journal Article2020-06-14No SnippetsKou J, Liu G, Liu X, Li T, Wei Y, Sun Y, Wang T, Wang Y, Zheng X.
Show Full Abstract
Recent studies have reported that circular RNAs (circRNAs) play a crucial regulatory role in a variety of human diseases. However, the roles of circRNAs in ankylosing spondylitis (AS) remain unclear. In this study, we conducted circRNA expression profiling of the spinal ligament tissues of patients with AS by RNA sequencing (RNA-seq) and analyzed the potential functions of differentially expressed circRNA by Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses to investigate the potential mechanisms associated with AS. The results showed that a total of 1,172 circRNAs were detected in the spinal ligament tissue samples, of which 123 circRNAs were significantly differentially expressed by a fold change ≥ 1.5 and <i>p</i> value < 0.05. Among these, 57 circRNAs were upregulated, and 66 were downregulated. GO and KEGG analyses demonstrated that the differentially expressed circRNAs were mainly involved in the regulation of biological processes of peptidyl-serine phosphorylation and human immune system that may be related to AS. In addition, the circRNA/miRNA interaction networks were established to predict the potential roles of differentially expressed circRNAs by bioinformatics analysis. Taken together, these results revealed the expression profiles of circRNAs and the potential functions of the differentially expressed circRNAs in the spinal ligament tissue of patients with AS, which may provide new clues for understanding the mechanisms associated with AS, and proceed to identify novel potential molecular targets for the diagnoses and treatment of AS.
Rhabdomyosarcoma (RMS) is a malignant soft tissue tumor of the pediatric population which is  rarely seen in adults. Metastatic rhabdomyosarcoma is even rarer. We present an unusual case of a 49 year old female presenting with palpitations and uterine bleeding. An Echo-cardiogram revealed a large oval mass on the posterior mitral leaflet and a Computerized Tomography (CT) scan of the abdomen revealed a uterine growth. Surgical excision of the cardiac mass was done and histological analysis of cardiac lesion confirmed it to be rhabdomyosarcoma with a primary source in the uterus. The patient became asymptomatic from a cardiac standpoint after excision of the mass and was scheduled for chemo/radiation therapy for the primary uterine malignancy. Metastatic cardiac rhabdomyosarcoma can be confused with a myxoma or any other primary or secondary cardiac tumors resulting in delayed diagnosis. However, its aggressive nature makes it a life-threatening tumor that requires an early diagnosis to prevent fatal consequences.
medRxiv2020-06-14Preprint (No Snippets API)Kim AS.
Show Full Abstract
As of April 30, 2020, the number of cumulative confirmed coronavirus disease 2019 (COVID-19) cases exceeded 3 million worldwide and 1 million in the US with an estimated fatality rate of more than 7 percent. Because the patterns of the occurrence of new confirmed cases and deaths over time are complex and seemingly country-specific, estimating the long-term pandemic spread is challenging. I developed a simple transformation algorithm to investigate the characteristics of the case and death time series per nation, and described the universal similarities observed in the transformed time series of 19 nations in the Group of Twenty (G20). To investigate the universal similarities among the cumulative profiles of confirmed cases and deaths of 19 individual nations in the G20, a transformation algorithm of the time series data sets was developed with open-source software programs. The algorithm was used to extract and analyze statistical information from daily updated COVID-19 pandemic data sets from the European Centre for Disease Prevention and Control (ECDC). Two new parameters for each nation were suggested as factors for time-shifting and time-scaling to define reduced time, which was used to quantify the degree of universal similarities among nations. After the cumulative confirmed case and death profiles of a nation were transformed by using reduced time, most of the 19 nations, with few exceptions, had transformed profiles that closely converged to those of Italy after the onset of cases and deaths. The initial profiles of the cumulative confirmed cases per nation universally showed 3 – 4 week latency periods, during which the total number of cases remained at approximately ten. The latency period of the cumulative number of deaths was approximately half the latency number of cumulative cases, and subsequent uncontrollable increases in human deaths seemed unavoidable because the coronavirus had already widely spread. Immediate governmental actions, including responsive public-health policy-making and enforcement, are observed to be critical to minimize (and possibly stop) further infections and subsequent deaths. In the pandemic spread of infectious viral diseases, such as COVID-19 studied in this work, different nations show dissimilar and seemingly uncorrelated time series profiles of infected cases and deaths. After these statistical phenomena were viewed as identical events occurring at a distinct rate in each country, the reported algorithm of the data transformation using the reduced time revealed a nation-independent, universal profile (especially initial periods of the pandemic spread) from which a nation-specific, predictive estimation could be made and used to assist in immediate public-health policy-making.
Also flagged:Lung AdenocarcinomaANLNIGFBP1TFAP2AMED4LINC00461
Journal Article2020-06-13No SnippetsTang H, Wang Z, Shao Q, Wang Y, Yang Q.
Show Full Abstract
BACKGROUND The aim of this study was to explore a comprehensive analysis of the competing endogenous (ceRNA) network of lung adenocarcinoma and predict its regulatory mechanism and prognosis correlation based on The Cancer Genome Atlas (TCGA) database. MATERIAL AND METHODS The genes expression data from 535 lung adenocarcinoma cases and 59 normal tissue cases were acquired and downloaded from TCGA database, and differentially expressed messenger RNA (mRNA), long noncoding RNA (lncRNA) and microRNA (miRNA) were selected primarily by "edgeR" package in R software, which further constructs lncRNA-miRNA-mRNA ceRNA network. We then proceed to carry out Gene Ontology enrichment analysis, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis, and Kaplan-Meier survival analysis of the mRNAs involved in the ceRNA network. RESULTS There are 3 mRNAs (ANLN, IGFBP1, and TFAP2A) in differentially expressed genes, 4 lncRNAs (AC015923.1, FGF12-AS2, LINC00211, and MED4-AS1), and 2 miRNAs (miR-31 and miR-490) associated with the prognostic of lung adenocarcinoma. Besides, LINC00461 and has-mir-139 as key nodes were found in the ceRNA network. Significantly, miR-31 shows the greatest prognostic value related to the adverse effect of the prognostic of lung adenocarcinoma (P<0.001). CONCLUSIONS By analyzing the expression data of lung adenocarcinoma in TCGA database, we found that 3 mRNAs, 4 lncRNAs, and 2 miRNAs were screened as potential prognostic factors for lung adenocarcinoma. In addition, LINC00461 and has-mir-139 are 2 important regulatory network nodes in lung adenocarcinoma ceRNA.
Also flagged:fatty acylfatty acyl-CoA ligasesLipidmetabolismfatty acid adenylating enzymescholesterol
Journal Article2020-06-13No SnippetsBaran M, Grimes KD, Sibbald PA, Fu P, Boshoff HIM, Wilson DJ, Aldrich CC.
Show Full Abstract
Lipid metabolism in Mycobacterium tuberculosis (Mtb) relies on 34 fatty acid adenylating enzymes (FadDs) that can be grouped into two classes: fatty acyl-CoA ligases (FACLs) involved in lipid and cholesterol catabolism and long chain fatty acyl-AMP ligases (FAALs) involved in biosynthesis of the numerous essential and virulence-conferring lipids found in Mtb. The precise biochemical roles of many FACLs remain poorly characterized while the functionally non-redundant FAALs are much better understood. Here we describe the systematic investigation of 5'-O-[N-(alkanoyl)sulfamoyl]adenosine (alkanoyl adenosine monosulfamate, alkanoyl-AMS) analogs as potential multitarget FadD inhibitors for their antitubercular activity and biochemical selectivity towards representative FAAL and FACL enzymes. We identified several potent compounds including 12-azidododecanoyl-AMS 28, 11-phenoxyundecanoyl-AMS 32, and nonyloxyacetyl-AMS 36 with minimum inhibitory concentrations (MICs) against M. tuberculosis ranging from 0.098 to 3.13 μM. Compound 32 was notable for its impressive biochemical selectivity against FAAL28 (apparent K<sub>i</sub> = 0.7 μM) versus FACL19 (K<sub>i</sub> > 100 μM), and uniform activity against a panel of multidrug and extensively drug-resistant TB strains with MICs ranging from 3.13 to 12.5 μM in minimal (GAST) and rich (7H9) media. The SAR analysis provided valuable insights for further optimization of 32 and also identified limitations to overcome.
Also flagged:OX40antibodyatopic dermatitisADantibodiesEczema
Journal Article2020-06-13No SnippetsNakagawa H, Iizuka H, Nemoto O, Shimabe M, Furukawa Y, Kikuta N, Ootaki K.
Show Full Abstract
<h4>Background</h4>KHK4083, a fully human anti-OX40 monoclonal antibody, is a potential novel therapeutic option for moderate to severe atopic dermatitis (AD), targeting the immunopathogenic pathways.<h4>Objective</h4>Assess the safety and tolerability of repeated doses of KHK4083 in patients with moderate to severe AD, and investigate the pharmacokinetics and immunogenicity of KHK4083. Additionally, assess the clinical efficacy and pharmacodynamics as exploratory objectives.<h4>Methods</h4>In this phase 1, single-center, open-label, repeated-dose study, a total of 22 patients received KHK4083 10 mg/kg IV on Day 1, Day 15 and Day 29, and were followed until Day 155.<h4>Results</h4>There were no deaths, serious adverse events (SAEs), or discontinuations due to adverse events (AEs). Common treatment-emergent AEs were mild or moderate pyrexia (11 patients, 50.0 %), and chills (8 patients, 36.4 %). No clinically meaningful changes in the laboratory values, vital signs, and electrocardiogram recordings were observed. The C<sub>max</sub> was 267 ± 53 μg/mL and the t<sub>1/2</sub> was 303 ± 88 h at Day 29. The overall assessment of antibodies against KHK4083 (immunogenicity) showed low positive responses. Continued improvement in the Eczema Area and Severity Index (EASI) and Investigator's Global Assessment (IGA) scores were observed throughout the study. The mean and median percent changes in thymus and activation-regulated chemokine (TARC) continued to decrease over time to -70.4 and -78.8 % until Day 155.<h4>Conclusion</h4>Repeated intravenous infusion of KHK4083 had an acceptable safety profile in patients with moderate to severe AD. Sustained improvement in the symptoms of AD was observed after completion of KHK4083 treatment.
Also flagged:hisCalcium PhosphateBone marrowavascular necrosisosteoarthritisOA
Journal Article2020-06-13No SnippetsKapil N, Samuel LT, Kamath AF.
Show Full Abstract
Bone marrow lesions (BMLs) are localized areas of edema within subchondral bone, which are often due to early chondromalacia changes, subchondral insufficiency stress or microfractures, and/or avascular necrosis. The presence of BMLs worsen outcomes after arthroscopy and arthroplasty, thus making their management important in the preservation of hip function. In recent years, the advent of Subchondroplasty (SCP; Zimmer Knee Creations Incorporated, Exton, PA)-a minimally invasive surgical technique that involves injecting an isothermic calcium phosphate solution to stabilize BMLs-has shown promising results in managing pain from osteoarthritis (OA). The SCP material (AccuFill Bone Substitute Material, Zimmer Knee Creations Incorporated) has a similar physical and chemical structure to native bone mineral. In this Technical Note, we discuss a surgical approach for managing acetabular and femoral head BMLs with SCP. We also review the prior clinical trials reporting on SCP for knee OA. SCP may be a promising technique as part of the treatment algorithm for managing hip OA, and clinical trial enrollment has begun for hip SCP. On the basis of these results, further investigations into this procedure may be warranted.
Also flagged:agingneurodegenerative diseasesbrain disorderslipidG protein-coupled receptorlysophosphatidic acids
Journal Article2020-06-13✓ 2 SnippetsChoi SH, Lee R, Nam SM, Kim DG, Cho IH, Kim HC, Cho Y, Rhim H, Nah SY.
In-Text Gene Mentions
S I O 001029)
…In addition, astrocytes are involved in Aβ uptake and degradation121, 122 Regarding PD, it has been observed that α-synuclein, the main component of Lewy body inclusions, accumulates in astrocytes, and correlates with the extent of neuronal loss.123, 124 Furthermore, α-synuclein released from neurons is taken up by astrocytes.124, 125, 126 In the HD brain, disease progression correlates with an increase in reactive astrocytes, and HTT, which contains polyglutamine, also accumulates in astrocytes.127, 128 Loss of the glutamate transporter GLT1, which is involved in astrocytic autophagy, is a common characteristic found in human HD brain and animal models129, 130 Thus, uptake or removal of neurodegenerative disease-related proteins through astrocytic autophagy point to the contribution of astrocytes in neurodegenerative diseases.…
S I O 001029)
…The genetic mutation responsible for HD is an abnormal expansion of a CAG trinucleotide repeat in the HTT gene that encodes for huntingtin (HTT).96, 97, 98 Symptoms of HD usually begin between 30 and 50 years of age.96…
Show Full Abstract
<h4>Background</h4>A dramatic increase in aging populations and low birth rates rapidly drive aging societies and increase aging-associated neurodegenerative diseases. However, functional food or medicinal formulations to prevent geriatric brain disorders are not readily available. <i>Panax ginseng</i> is a candidate, since ginseng has long-been consumed as a rejuvenating agent. However, the underlying molecular mechanisms and the components of ginseng that are responsible for brain rejuvenation and human longevity are unknown. Accumulating evidence shows that gintonin is a candidate for the anti-aging ingredient of ginseng, especially in brain senescence.<h4>Methods</h4>Gintonin, a glycolipoprotein complex, contains three lipid-derived G protein-coupled receptor ligands: lysophosphatidic acids (LPAs), lysophosphatidylinositols (LPIs), and linoleic acid (LA). LPA, LPI, and LA act on six LPA receptor subtypes, GPR55, and GPR40, respectively. These G protein-coupled receptors are distributed within the nervous and non-nervous systems of the human body.<h4>Results</h4>Gintonin-enriched fraction (GEF) exhibits anti-brain senescence and effects against disorders such as Alzheimer's disease (AD), Huntington's disease (HD), and Parkinson's disease (PD). Oral administration of gintonin in animal models of d-galactose-induced brain aging, AD, HD, and PD restored cognitive and motor functions. The underlying molecular mechanisms of gintonin-mediated anti-brain aging and anti-neurodegenerative diseases include neurogenesis, autophagy stimulation, anti-apoptosis, anti-oxidative stress, and anti-inflammatory activities. This review describes the characteristics of gintonin and GEF, and how gintonin exerts its effects on brain aging and brain associated-neurodegenerative diseases.<h4>Conclusion</h4>Finally, we describe how GEF can be applied to improve the quality of life of senior citizens in aging societies.
Also flagged:genetic diseasegenetic disordersMPSembryogenesisvascular anomaliesProteus syndrome
Journal Article2020-06-12No SnippetsMiller CR, Lee K, Pfau RB, Reshmi SC, Corsmeier DJ, Hashimoto S, Dave-Wala A, Jayaraman V, Koboldt D, Matthews T, Mouhlas D, Stein M, McKinney A, Grossman T, Kelly BJ, White P, Magrini V, Wilson RK, Mardis ER, Cottrell CE.
Show Full Abstract
Exome sequencing (ES) has become an important tool in pediatric genomic medicine, improving identification of disease-associated variation due to assay breadth. Depth is also afforded by ES, enabling detection of lower-frequency mosaic variation compared to Sanger sequencing in the studied tissue, thus enhancing diagnostic yield. Within a pediatric tertiary-care hospital, we report two years of clinical ES data from probands evaluated for genetic disease to assess diagnostic yield, characteristics of causal variants, and prevalence of mosaicism among disease-causing variants. Exome-derived, phenotype-driven variant data from 357 probands was analyzed concurrent with parental ES data, when available. Blood was the source of nucleic acid. Sequence read alignments were manually reviewed for all assessed variants. Sanger sequencing was used for suspected de novo or mosaic variation. Clinical provider notes were reviewed to determine concordance between laboratory-reported data and the ordering provider's interpretation of variant-associated disease causality. Laboratory-derived diagnostic yield and provider-substantiated diagnoses had 91.4% concordance. The cohort returned 117 provider-substantiated diagnoses among 115 probands for a diagnostic yield of 32.2%. De novo variants represented 64.9% of disease-associated variation within trio analyses. Among the 115 probands, five harbored disease-associated somatic mosaic variation. Two additional probands were observed to inherit a disease-associated variant from an unaffected mosaic parent. Among inheritance patterns, de novo variation was the most frequent disease etiology. Somatic mosaicism is increasingly recognized as a significant contributor to genetic disease, particularly with increased sequence depth attainable from ES. This report highlights the potential and importance of detecting mosaicism in ES.
Also flagged:ironhemochromatosis type 4FDlocalizationbindingdeficiency
Journal Article2020-06-12✓ 5 SnippetsViveiros A, Panzer M, Baumgartner N, Schaefer B, Finkenstedt A, Henninger B, Theurl I, Nachbaur K, Weiss G, Haubner R, Decristoforo C, Tilg H, Zoller H.
In-Text Gene Mentions
Abstract)
…Regression analysis of serum hepcidin and ferritin in patients with iron overload are compatible with hepcidin deficiency in HFE hemochromatosis and hepcidin resistance in R178Q FD.…
Discussion)
…The shallow slope of the regression line in a cohort of HFE‐hemochromatosis patients indicates relative hepcidin deficiency, whereas the steeper than normal slope in our patient with R178‐associated FD suggests an exaggerated hepcidin response compatible with hepcidin resistance.…
Results)
…When regression analysis between log(ferritin) and hepcidin was used as a surrogate of hepcidin regulation in response to iron stores, the R178Q heterozygous patient had an exaggerated response in comparison to a cohort of HFE‐hemochromatosis patients and a cohort of patients with proven high liver iron concentration but normal HFE genotype (Figure 5).…
Introduction)
…Mutations in SLC40A1 have been identified in patients with hepatic iron overload and are considered the second most common genetic cause of hemochromatosis after the disease‐associated polymorphism C282Y in HFE. 1, 2, 3 SLC40A1 mutations can cause two different clinical phenotypes differentiated by transferrin saturation and patterns of iron storage.4…
Abstract)
…hepcidin deficiency inHFEhemochromatosis and hepcidin…
Show Full Abstract
<h4>Background & aims</h4>Ferroportin disease (FD) and hemochromatosis type 4 (HH4) are associated with variants in the ferroportin-encoding gene SLC40A1. Both phenotypes are characterized by iron overload despite being caused by distinct variants that either mediate reduced cellular iron export in FD or resistance against hepcidin-induced inactivation of ferroportin in HH4. The aim of this study was to assess if reduced iron export also confers hepcidin resistance and causes iron overload in FD associated with the R178Q variant.<h4>Methods</h4>The ferroportin disease variants R178Q andA77D and the HH4-variant C326Y were overexpressed in HEK-293T cells and subcellular localization was characterized by confocal microscopy and flow cytometry. Iron export and cytosolic ferritin were measured as markers of iron transport and radioligand binding studies were performed. The hepcidin-ferroportin axis was assessed by ferritin/hepcidin correlation in patients with different iron storage diseases.<h4>Results</h4>In the absence of hepcidin, the R178Q and A77D variants exported less iron when compared to normal and C326Y ferroportin. In the presence of hepcidin, the R178Q and C326Y, but not the A77D-variant, exported more iron than cells expressing normal ferroportin. Regression analysis of serum hepcidin and ferritin in patients with iron overload are compatible with hepcidin deficiency in HFE hemochromatosis and hepcidin resistance in R178Q FD.<h4>Conclusions</h4>These results support a novel concept that in certain FD variants reduced iron export and hepcidin resistance could be interlinked. Evasion of mutant ferroportin from hepcidin-mediated regulation could result in uncontrolled iron absorption and iron overload despite reduced transport function.
Concentrations of different nucleic acid species in biological samples span many orders of magnitude. A real-time polymerase chain reaction maps the concentration of a target nucleic acid sequence log-linearly into cycle threshold to enable quantitation with a wide dynamic range but suffers from enzymatic biases. Here, we present a general design for constructing hybridization probe sets with highly log-linear response curves to enable accurate enzyme-free quantitation across large ranges (more than 6 logs) of target DNA concentrations. The sensitivity of each component probe is accurately adjusted via formulation stoichiometry to reduce the standard error of target quantitation down to 7%. As a proof of concept, we show multiplexed quantitation of three microRNA species in total RNA of the human brain and liver.
Also flagged:intellectual disabilityCDG) type Iglycosylationventricular septal defectidiopathic scoliosisantithrombin deficiency
Journal Article2020-06-12✓ 5 Snippetsde la Morena-Barrio ME, Sabater M, de la Morena-Barrio B, Ruhaak RL, Miñano A, Padilla J, Toderici M, Roldán V, Gimeno JR, Vicente V, Corral J.
In-Text Gene Mentions
Abstract)
…Congenital disorder of glycosylation diagnosis started through the identification of antithrombin deficiency without SERPINC1 defect and the detection of hypoglycosylated forms.…
Discussion)
…The identification of antithrombin deficiency without SERPINC1 defects and hypoglycosylation was the first clue of a CDG.…
Abstract)
…ntithrombin deficiency withoutSERPINC1defect and the…
Methods)
…SERPINC1(OMIM: 107300), the…
Results)
…However, noSERPINC1variants were detected,…
Show Full Abstract
<h4>Background</h4>Congenital disorder of glycosylation (CDG) type I is a group of rare disorders caused by recessive mutations in up to 25 genes that impair the N-glycan precursor formation and its transfer to proteins resulting in hypoglycosylation of multiple proteins. Congenital disorder of glycosylation causes multisystem defects usually with psychomotor delay that is diagnosed in the infancy. We aim to supply further evidences supporting that CDG may be underestimated.<h4>Methods</h4>Antithrombin and factor XI were studied by chromogenic and coagulometric methods. Hypoglycosylation of plasma proteins was evaluated by western blot, HPLC, Q-TOF, and RP-LC-MRM-MS. Genetic analysis included whole exome, Sanger sequencing, and PCR-allele specific assay.<h4>Results</h4>We here present an intriguing patient with an exceptional phenotype: 25-year-old women with a ventricular septal defect and severe idiopathic scoliosis but no facial dysmorphism, who dances as a professional, and has a University degree. Congenital disorder of glycosylation diagnosis started through the identification of antithrombin deficiency without SERPINC1 defect and the detection of hypoglycosylated forms. Increased levels of hypoglycosylated forms of F XI (also with significant deficiency) and transferrin were also detected. Whole exome analysis showed a novel homozygous ALG12 variant c.77T>A, p.(Val26Asp) supporting an ALG12-CDG diagnosis. It also showed three new variants in KMT2D, and a mild, known ALG6 variant.<h4>Conclusions</h4>This novel ALG12-CDG patient (the 13th reported) underlines the heterogeneity of this CDG and broadens its phenotypical spectrum, supports that these disorders are underestimated, and suggests that combination of global hypoglycosylation with specific gene defects might determine the clinical manifestations of CDG patients.
Also flagged:PJA1epilepsycraniofacial malformationstrigonocephalyZNF143MSX2
Journal Article2020-06-12✓ 2 SnippetsSuzuki T, Suzuki T, Raveau M, Miyake N, Sudo G, Tsurusaki Y, Watanabe T, Sugaya Y, Tatsukawa T, Mazaki E, Shimohata A, Kushima I, Aleksic B, Shiino T, Toyota T, Iwayama Y, Nakaoka K, Ohmori I, Sasaki A, Watanabe K, Hirose S, Kaneko S, Inoue Y, Yoshikawa T, Ozaki N, Kano M, Shimoji T, Matsumoto N, Yamakawa K.
In-Text Gene Mentions
Results)
…Eight of those (SCN1A, IQSEC2, STXBP1, CACNA1E, ARID1B, DDX3X, WHSC1, PHF21A) have been known to be responsible for NDDs associated with IDs or epilepsies.9, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29…
Results)
…, STXBP1 ,CACNA1E, ARID1B, DDX3X ,…
Show Full Abstract
<h4>Objective</h4>Neurodevelopmental disorders (NDDs) often associate with epilepsy or craniofacial malformations. Recent large-scale DNA analyses identified hundreds of candidate genes for NDDs, but a large portion of the cases still remain unexplained. We aimed to identify novel candidate genes for NDDs.<h4>Methods</h4>We performed exome sequencing of 95 patients with NDDs including 51 with trigonocephaly and subsequent targeted sequencing of additional 463 NDD patients, functional analyses of variant in vitro, and evaluations of autism spectrum disorder (ASD)-like phenotypes and seizure-related phenotypes in vivo.<h4>Results</h4>We identified de novo truncation variants in nine novel genes; CYP1A1, C14orf119, FLI1, CYB5R4, SEL1L2, RAB11FIP2, ZMYND8, ZNF143, and MSX2. MSX2 variants have been described in patients with cranial malformations, and our present patient with the MSX2 de novo truncation variant showed cranial meningocele and partial epilepsy. MSX2 protein is known to be ubiquitinated by an E3 ubiquitin ligase PJA1, and interestingly we found a PJA1 hemizygous p.Arg376Cys variant recurrently in seven Japanese NDD patients; five with trigonocephaly and one with partial epilepsy, and the variant was absent in 886 Japanese control individuals. Pja1 knock-in mice carrying p.Arg365Cys, which is equivalent to p.Arg376Cys in human, showed a significant decrease in PJA1 protein amount, suggesting a loss-of-function effect of the variant. Pja1 knockout mice displayed moderate deficits in isolation-induced ultrasonic vocalizations and increased seizure susceptibility to pentylenetetrazole.<h4>Interpretation</h4>These findings propose novel candidate genes including PJA1 and MSX2 for NDDs associated with craniofacial abnormalities and/or epilepsy.
Also flagged:AnxietyDepressionCAPHuntington's diseaseHDdystonia
Journal Article2020-06-12✓ 2 SnippetsAchenbach J, von Hein SM, Saft C.
In-Text Gene Mentions
Introduction)
…Neurodegenerative Huntington's disease (HD) is caused by CAG trinucleotide expansion in the huntingtin gene (HTT; Walker, 2007).…
Introduction)
…the huntingtin gene (HTT; Walker, 2007 ).…
Show Full Abstract
<h4>Background</h4>Motor phenotypes in Huntington's disease vary manifold. Phenotype classification is essential to adapt treatment. The aim of this study was to classify a dystonic subtype closer.<h4>Methods</h4>A total of 7,512 manifest ENROLL-HD participants were subdivided into mainly choreatic (N = 606), dystonic (N = 402), and hypokinetic-rigid (N = 369) subjects. Cognitive (verbal fluency, symbol digit, stroop color, trail making, Mini-Mental State Examination), functional (total functional capacity, Independence Scale), and psychiatric (problem behaviors assessment, Hospital Anxiety and Depression Scale) performance was evaluated at baseline visit.<h4>Results</h4>Symptoms onset for dystonic were similar to hypokinetic-rigid, but earlier compared to choreatic subjects (p < .001). Cognition was better in both groups compared to hypokinetic rigid (all p < .001). Functionality differed between all groups (all p < .001). Differences remained (all p < .001) after controlling for CAP score, CAG, age, disease duration, and education.<h4>Conclusions</h4>Motor subtypes differ in functional and cognitive capacities but less in psychiatric. We identified better cognitive and functional capacities and similar onsets in predominant dystonic compared to hypokinetic-rigid patients.
Monocytes and monocyte-derived cells, including Mϕs and dendritic cells, exhibit a diverse array of phenotypic states that are dictated by their surrounding microenvironment. These cells direct T cell activation and function via cues that range from being immunosuppressive to immunostimulatory. Solid tumors and atherosclerotic plaques represent two pathological niches with distinct immune microenvironments. While monocytes and their progeny possess a phenotypic spectrum found within both disease contexts, most within tumors are pro-tumoral and support evasion of host immune responses by tumor cells. In contrast, monocyte-derived cells within atherosclerotic plaques are usually pro-atherogenic, pro-inflammatory, and predominantly directed against self-antigens. Consequently, cancer immunotherapies strive to enhance the immune response against tumor antigens, whereas atherosclerosis treatments seek to dampen the immune response against lipid antigens. Insights into monocyte-T cell interactions within these niches could thus inform therapeutic strategies for two immunologically distinct diseases. Here, we review monocyte diversity, interactions between monocytes and T cells within tumor and plaque microenvironments, how certain therapies have leveraged these interactions, and novel strategies to assay such associations.
Also flagged:non-small cell lung cancerNSCLClymph node metastasisregional lymph node metastasistumorLung cancer
Journal Article2020-06-12No SnippetsHuang T, Sun H, Luo X, Zhang X, Jin K, Wang F, Sun L, Cheng N, Wu S, Lou Q, Li B.
Show Full Abstract
<h4>Background</h4>To explore the correlation of flash dual source computed tomography perfusion imaging (CTPI) and regional lymph node metastasis of non-small cell lung cancer (NSCLC), and to evaluate the value of CT perfusion parameters in predicting regional lymph node metastasis of NSCLC.<h4>Methods</h4>120 consecutive patients with NSCLC confirmed by postoperative histopathology were underwent flash dual source CT perfusion imaging in pre-operation. The CT perfusion parameters of NSCLC, such as blood flow (BF), blood volume (BV), mean transit time (MTT) and permeability (PMB) were obtained by the image post-processing. Then microvessel density (MVD), luminal vascular number (LVN), luminal vascular area (LVA) and luminal vascular perimeter (LVP) of NSCLC were counted by immunohistochemistry. These cases were divided into group A (patients with lymph node metastasis, 58 cases) and group B (patients without lymph node metastasis, 62 cases) according to their pathological results. The CT perfusion parameters and the microvessel parameters were contrastively analysed between the two groups. Receiver operating characteristic (ROC) curve was used to assess the diagnostic efficiency of CT perfusion parameters in predicting regional lymph node metastasis of NSCLC in pre-operation.<h4>Results</h4>Group A presented significantly lower LVA, BF and higher MTT, PMB than Group B (P < 0.05), while BV, LVN, LVP and MVD were no significant difference (P > 0.05). Correlation analysis showed that BF was correlated with LVA and LVP (P < 0.05), while BV, MTT and PMB were not correlated with LVN, LVA and LVP (P > 0.05). All the perfusion parameters were not correlated with MVD. According to the ROC curve analysis, when BF < 85.16 ml/100 ml/min as a cutoff point to predict regional lymph node metastasis of NSCLC, the sensitivity, specificity, accuracy, positive predictive value and negative predictive value were 60.8, 81.7, 71.5, 75.6 and 69.5% respectively.<h4>Conclusion</h4>Flash dual source CT perfusion imaging can non-invasively indicate the luminal vascular structure of tumor and BF can be used as one of the important indexes in predicting regional lymph node metastasis of NSCLC in pre-operation.
Also flagged:carbonateapatitehypersensitivityDentine hypersensitivityperiodontitisnerve
Journal Article2020-06-12No SnippetsDing PH, Dai A, Hu HJ, Huang JP, Liu JM, Chen LL.
Show Full Abstract
<h4>Background</h4>Dentine hypersensitivity (DH) could occur or intensify after non-surgical periodontal therapy because of the exposure of dentine tubules, but currently no gold standard exists to treat DH. It has been demonstrated that nano-sized particles presented potential for dentine tubules blocking and remineralization. This randomized controlled trial aimed to investigate the efficacy of dentifrice containing nano-carbonate apatite (n-CAP) in reducing dentine hypersensitivity (DH) after non-surgical periodontal therapy.<h4>Methods</h4>48 periodontitis patients with DH were included in this clinical trial. After non-surgical periodontal therapy, patients included were randomized to test and control group and the respective dentifrices were applied at chairside, after which they were instructed to brush teeth with the allocated dentifrices twice a day at home. Periodontal parameters were recorded at baseline and the last follow-up. DH was measured by air-blast test and recorded by visual analogue scale (VAS) and Schiff sensitivity scale at baseline, after polishing (0 week) and 2/4/6 weeks.<h4>Results</h4>45 participants completed the follow-up. Periodontal parameters were improved and comparable between groups. Significant reduction in DH was observed in both groups at all time-points compared to baseline in terms of VAS and Schiff score. The test group achieved significantly greater relief from hypersensitivity compared with the control group after 4-week at-home use (for change of VAS, test group: 2.27 ± 2.47 versus control group: 1.68 ± 2.24, p = 0.036; for change of Schiff, test group: 0.94 ± 0.92 versus control group: 0.61 ± 0.83, p < 0.001). The 6-week results showed borderline significance between groups in terms of change of Schiff (p = 0.027) and no significance in terms of change of VAS (p = 0.256).<h4>Conclusions</h4>Home-use of n-CAP based dentifrice had some benefit on alleviation of DH following non-surgical periodontal therapy after 4 weeks compared to the control product.<h4>Trial registration</h4>Chinese Clinical Trials Registry (No. ChiCTR-IPR-17011678, http://www.chictr.org.cn/, registered 16 June, 2017).
Also flagged:interferon-γinterferon(IFN)γimmunoproteasomechronic multiple sclerosisMS
Journal Article2020-06-12✓ 5 SnippetsSmith BC, Sinyuk M, Jenkins JE, Psenicka MW, Williams JL.
In-Text Gene Mentions
Results)
…In WMLs, there was an inverse relationship between LMP7 and PRDX6 specifically in the spinal cord (Fig. 1e), suggesting that the iP may play a role in reducing oxidative stress in MS lesions and that there may be a difference in iP expression and/or function in regional astrocytes.…
…of oxidative stress (PRDX6) within astrocytes by…
Results)
…between LMP7 andPRDX6specifically in the…
Show Full Abstract
<h4>Background</h4>In early autoimmune neuroinflammation, interferon (IFN)γ and its upregulation of the immunoproteasome (iP) is pathologic. However, during chronic multiple sclerosis (MS), IFNγ has protective properties. Although dysregulation of the iP has been implicated in neurodegeneration, its function remains to be fully elucidated. Here, we demonstrate that IFNγ signaling in regional astrocytes induces the iP and promotes protection of the CNS during chronic autoimmunity.<h4>Methods</h4>In a multiple sclerosis (MS) brain, we evaluated mRNA expression and labeled postmortem MS brainstem and spinal cord for iP subunits and indicators of oxidative stress. Primary regional human astrocytes were analyzed for iP regulation and function by quantitative reverse transcription-polymerase chain reaction (qRT-PCR), Western blot, OxyBlot, and reactive oxygen species and caspase activity detection assays. Following immunization with myelin oligodendrocyte glycoprotein (MOG)<sub>35-55</sub>, the role of IFNγ signaling and the iP during chronic experimental autoimmune encephalomyelitis (EAE) were assessed using pharmacologic inhibition of the iP and genetic interruption of IFNγ signaling specifically in astrocytes. Central nervous system (CNS) tissues were analyzed by immunohistochemistry (IHC) and immunofluorescence, and cell-specific colocalization was quantified.<h4>Results</h4>In MS tissue, iP expression was enhanced in the spinal cord compared to brainstem lesions, which correlated with a decrease in oxidative stress. In vitro, IFNγ stimulation enhanced iP expression, reduced reactive oxygen species burden, and decreased oxidatively damaged and poly-ubiquitinated protein accumulation preferentially in human spinal cord astrocytes, which was abrogated with the use of the iP inhibitor, ONX 0914. During the chronic phase of an MS animal model, EAE, ONX 0914 treatment exacerbated the disease and led to increased oxidative stress and poly-ubiquitinated protein buildup. Finally, mice with astrocyte-specific loss of the IFNγ receptor exhibited worsened chronic EAE associated with reduced iP expression, enhanced lesion size and oxidative stress, and poly-ubiquitinated protein accumulation in astrocytes.<h4>Conclusions</h4>Taken together, our data reveal a protective role for IFNγ in chronic neuroinflammation and identify a novel function of the iP in astrocytes during CNS autoimmunity.
Also flagged:ChromosomenucleotideZIC2FOXD4developmental delayRNASEH2B
Journal Article2020-06-12No SnippetsNg J, Sams E, Baldridge D, Kremitzki M, Wegner DJ, Lindsay T, Fulton R, Cole FS, Turner TN.
Show Full Abstract
We present a case of 9p- syndrome with a complex chromosomal event originally characterized by the classical karyotype approach as 46,XX,der(9)t(9;13)(p23;q13). We used advanced technologies (Bionano Genomics genome imaging and 10× Genomics sequencing) to characterize the location of the translocation and accompanying deletion on Chromosome 9 and duplication on Chromosome 13 with single-nucleotide breakpoint resolution. The translocation breakpoint was at Chr 9:190938 and Chr 13:50850492, the deletion at Chr 9:1-190938, and the duplication at Chr 13:50850492-114364328. We identified genes in the deletion and duplication regions that are known to be associated with this patient's phenotype (e.g., <i>ZIC2</i> in dysmorphic facial features, <i>FOXD4</i> in developmental delay, <i>RNASEH2B</i> in developmental delay, and <i>PCDH9</i> in autism). Our results indicate that clinical genomic assessment of individuals with complex karyotypes can be refined to a single-base-pair resolution when utilizing Bionano and 10× Genomics sequencing. With the 10× Genomics data, we were also able to characterize other variation (e.g., loss of function) throughout the remainder of the patient's genome. Overall, the Bionano and 10× technologies complemented each other and provided important insight into our patient with 9p- syndrome. Altogether, these results indicate that newer technologies can identify precise genomic variants associated with unique patient phenotypes that permit discovery of novel genotype-phenotype correlations and therapeutic strategies.
Also flagged:lysosomesendosomesEEA1UbiquitinautophagosomesRFP
Journal Article2020-06-12✓ 3 SnippetsWetzel L, Blanchard S, Rama S, Beier V, Kaufmann A, Wollert T.
In-Text Gene Mentions
Introduction)
…such as Huntingtin (Htt) in an autophagy-dependent…
Results)
…Finally,Httaggregates were present…
Results)
…the clearance ofHttaggregates occurs in…
Show Full Abstract
The accumulation of protein aggregates is involved in the onset of many neurodegenerative diseases. Aggrephagy is a selective type of autophagy that counteracts neurodegeneration by degrading such aggregates. In this study, we found that LC3C cooperates with lysosomal TECPR1 to promote the degradation of disease-related protein aggregates in neural stem cells. The N-terminal WD-repeat domain of TECPR1 selectively binds LC3C which decorates matured autophagosomes. The interaction of LC3C and TECPR1 promotes the recruitment of autophagosomes to lysosomes for degradation. Augmented expression of TECPR1 in neural stem cells reduces the number of protein aggregates by promoting their autophagic clearance, whereas knockdown of LC3C inhibits aggrephagy. The PH domain of TECPR1 selectively interacts with PtdIns(4)P to target TECPR1 to PtdIns(4)P containing lysosomes. Exchanging the PH against a tandem-FYVE domain targets TECPR1 ectopically to endosomes. This leads to an accumulation of LC3C autophagosomes at endosomes and prevents their delivery to lysosomes.
Also flagged:IRAK-Mmelanomaskin cancertumorMyD88calpastatin
Journal Article2020-06-12✓ 1 SnippetGeng D, Ciavattone N, Lasola JJ, Shrestha R, Sanchez A, Guo J, Vlk A, Younis R, Wang L, Brown AJ, Zhang Y, Velasco-Gonzalez C, Tan AC, Davila E.
Melanoma represents the most serious type of skin cancer. Although recent years have seen advances using targeted and immunotherapies, most patients remain at high risk for tumor recurrence. Here we show that IRAK-M, a negative regulator of MyD88 signaling, is deficient or low in melanoma and expression levels correlate with patient survival. Inducing IRAK-M expression using genetic approaches or epigenetic modifiers initiates apoptosis by prompting its interaction with TRAF6 via IRAK-M's C-terminal domain. This complex recruits and degrades calpastatin which stimulates calpain activity and triggers caspase-3-dependent but caspase-8,-9-independent apoptosis. Using a drug screen, we identified compounds that induced IRAK-M expression. Administration of IRAK-M-inducing drugs reduced tumor growth in mice but was ineffective against IRAK-M knock-down tumors. These results uncover a previously uncharacterized apoptosis pathway, emphasize IRAK-M as a potential therapeutic target and suggest that the anticancer activity of certain drugs could do so through their ability to induce IRAK-M expression.
…replaced by thehistone chaperone complexchaperone complex HIRA,…
Show Full Abstract
Eukaryotic gene expression is regulated not only by genomic enhancers and promoters, but also by covalent modifications added to both chromatin and RNAs. Whereas cellular gene expression may be either enhanced or inhibited by specific epigenetic modifications deposited on histones (in particular, histone H3), these epigenetic modifications can also repress viral gene expression, potentially functioning as a potent antiviral innate immune response in DNA virus-infected cells. However, viruses have evolved countermeasures that prevent the epigenetic silencing of their genes during lytic replication, and they can also take advantage of epigenetic silencing to establish latent infections. By contrast, the various covalent modifications added to RNAs, termed epitranscriptomic modifications, can positively regulate mRNA translation and/or stability, and both DNA and RNA viruses have evolved to utilize epitranscriptomic modifications as a means to maximize viral gene expression. As a consequence, both chromatin and RNA modifications could serve as novel targets for the development of antivirals. In this Review, we discuss how host epigenetic and epitranscriptomic processes regulate viral gene expression at the levels of chromatin and RNA function, respectively, and explore how viruses modify, avoid or utilize these processes in order to regulate viral gene expression.
Also flagged:Aggregation-prone proteinsAPPchaperonephosphorylationneurodegeneration, aggregation-prone proteins
Journal Article2020-06-12No SnippetsMelnik A, Cappelletti V, Vaggi F, Piazza I, Tognetti M, Schwarz C, Cereghetti G, Ahmed MA, Soste M, Matlack K, de Souza N, Csikasz-Nagy A, Picotti P.
Show Full Abstract
Aggregation-prone proteins (APPs) have been implicated in numerous human diseases but the underlying mechanisms are incompletely understood. Here we comparatively analysed cellular responses to different APPs. Our study is based on a systematic proteomic and phosphoproteomic analysis of a set of yeast proteotoxicity models expressing different human disease-related APPs, which accumulate intracellular APP inclusions and exhibit impaired growth. Clustering and functional enrichment analyses of quantitative proteome-level data reveal that the cellular response to APP expression, including the chaperone response, is specific to the APP, and largely differs from the response to a more generalized proteotoxic insult such as heat shock. We further observe an intriguing association between the subcellular location of inclusions and the location of the cellular response, and provide a rich dataset for future mechanistic studies. Our data suggest that care should be taken when designing research models to study intracellular aggregation, since the cellular response depends markedly on the specific APP and the location of inclusions. Further, therapeutic approaches aimed at boosting protein quality control in protein aggregation diseases should be tailored to the subcellular location affected by inclusion formation. SIGNIFICANCE: We have examined the global cellular response, in terms of protein abundance and phosphorylation changes, to the expression of five human neurodegeneration-associated, aggregation-prone proteins (APPs) in a set of isogenic yeast models. Our results show that the cellular response to each APP is unique to that protein, is different from the response to thermal stress, and is associated with processes at the subcellular location of APP inclusion formation. These results further our understanding of how cells, in a model organism, respond to expression of APPs implicated in neurodegenerative diseases like Parkinson's, Alzheimer's, and ALS. They have implications for mechanisms of toxicity as well as of protective responses in the cell. The specificity of the response to each APP means that research models of these diseases should be tailored to the APP in question. The subcellular localization of the response suggest that therapeutic interventions should also be targeted within the cell.
Also flagged:Nrf2neurodegenerative diseaseshomeostatic iron regulatorparaquatdeathmitochondrial
Journal Article2020-06-12✓ 5 SnippetsSong IY, Snyder AM, Kim Y, Neely EB, Wade QW, Connor JR.
In-Text Gene Mentions
Abstract)
…To further elucidate the role of Hfe variant genotype in neuroprotection mediated by astrocytes, we added media from the paraquat-treated astrocytes to differentiated SH-SY5Y neuroblastoma cells and found a significantly larger reduction in the viability when treated with WT-Hfe astrocyte media than the H67D-Hfe astrocyte media possibly due to higher secretion of IL-6 observed in the WT-Hfe astrocytes.…
There is considerable interest in gene and environment interactions in neurodegenerative diseases. The HFE (homeostatic iron regulator) gene variant (H63D) is highly prevalent in the population and has been investigated as a disease modifier in multiple neurodegenerative diseases. We have developed a mouse model to interrogate the impact of this gene variant in a model of paraquat toxicity. Using primary astrocytes, we found that the H67D-Hfe(equivalent of the human H63D variant) astrocytes are less vulnerable than the WT-Hfe astrocytes to paraquat-induced cell death, mitochondrial damage, and cellular senescence. We hypothesized that the Hfe variant-associated protection is a result of the activation of the Nrf2 antioxidant defense system and found a significant increase in Nrf2 levels after paraquat exposure in the H67D-Hfe astrocytes than the WT-Hfe astrocytes. Moreover, decreasing Nrf2 by molecular or pharmaceutical manipulation resulted in increased vulnerability to paraquat in the H67D-Hfe astrocytes. To further elucidate the role of Hfe variant genotype in neuroprotection mediated by astrocytes, we added media from the paraquat-treated astrocytes to differentiated SH-SY5Y neuroblastoma cells and found a significantly larger reduction in the viability when treated with WT-Hfe astrocyte media than the H67D-Hfe astrocyte media possibly due to higher secretion of IL-6 observed in the WT-Hfe astrocytes. To further explore the mechanism of Nrf2 protection, we measured NQO1, the Nrf2-mediated antioxidant, in primary astrocytes and found a significantly higher NQO1 level in the H67D-Hfe astrocytes. To consider the translational potential of our findings, we utilized the PPMI (Parkinson's Progression Markers Initiative) clinical database and found that, consistent with the mouse study, H63D-HFE carriers had a significantly higher NQO1 level in the CSF than the WT-HFE carriers. Consistent with our previous reports on H63D-HFE in disease, these data further suggest that HFE genotype in the human population impacts the antioxidant defense system and can therefore alter pathogenesis.
Also flagged:Sickle Cell Diseasechronic liver diseasesickle cell hepatopathyacquired viral hepatitisModel for End Stage Liver Diseasegenetic diseases
Journal Article2020-06-12✓ 2 SnippetsHogen R, Kim M, Lee Y, Lo M, Kaur N, Kahn J, Chopra S, Qazi Y, Sedra A, Kim J, O'Brien L, Genyk Y, Sher L, Emamaullee J.
In-Text Gene Mentions
Abstract)
…hepatitis, or secondaryhemochromatosis.…
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>Up to 30% of patients with sickle cell disease (SCD) develop chronic liver disease via etiologies including sickle cell hepatopathy, acquired viral hepatitis, or secondary hemochromatosis. It is unclear how many patients with SCD ultimately undergo liver transplantation (LT) and what factors are associated with survival after LT. In this study, we examined LT outcomes in these patients by reviewing the Scientific Registry of Transplant Recipients (SRTR) and our institutional experience.<h4>Methods</h4>Analysis of the SRTR identified 23 LT recipients and five simultaneous liver and kidney transplantation (SLKT) recipients with SCD. Patient demographics and graft and patient survival were analyzed. Two patients with SCD at our institution underwent SLKT.<h4>Results</h4>Review of the SRTR revealed that recipients with SCD had significantly higher model for end-stage liver disease scores (33 versus 21, P = 0.004), preoperative intensive care unit admission (43.5% versus 19.1%, P = 0.007), preoperative dialysis (17.4% versus 4.9%, P = 0.009), and were more likely to be status 1 (26.1% versus 12.1%, P = 0.041) when compared with the reference population of African American LT recipients. Despite being higher risk at the time of LT, patients with SCD had equivalent posttransplant graft and patient survival when compared with the reference population (P = 0.5 and P = 0.2, respectively) and a 2:1 propensity score-matched group (P = 0.5 and P = 0.2, respectively). Two recent SLKT recipients with SCD from our institution have performed well with stable allograft function.<h4>Conclusions</h4>Data from the SRTR demonstrate that patients with SCD can expect equivalent graft and patient survival after LT despite exhibiting more comorbidities at the time of LT. The low number of patients with SCD who underwent LT in the SRTR in comparison with the rate of chronic liver disease in this population raises the question as to whether a disparity in access to LT exists for this complex population.
Also flagged:RetinoblastomaRBtumor of the eyetumormembraneextracellular
Journal Article2020-06-12No SnippetsGalardi A, Colletti M, Lavarello C, Di Paolo V, Mascio P, Russo I, Cozza R, Romanzo A, Valente P, De Vito R, Pascucci L, Peinado H, Carcaboso AM, Petretto A, Locatelli F, Di Giannatale A.
Show Full Abstract
Retinoblastoma (RB) is the most common tumor of the eye in early childhood. Although recent advances in conservative treatment have greatly improved the visual outcome, local tumor control remains difficult in the presence of massive vitreous seeding. Traditional biopsy has long been considered unsafe in RB, due to the risk of extraocular spread. Thus, the identification of new biomarkers is crucial to design safer diagnostic and more effective therapeutic approaches. Exosomes, membrane-derived nanovesicles that are secreted abundantly by aggressive tumor cells and that can be isolated from several biological fluids, represent an interesting alternative for the detection of tumor-associated biomarkers. In this study, we defined the protein signature of exosomes released by RB tumors (RBT) and vitreous seeding (RBVS) primary cell lines by high resolution mass spectrometry. A total of 5666 proteins were identified. Among these, 5223 and 3637 were expressed in exosomes RBT and one RBVS group, respectively. Gene enrichment analysis of exclusively and differentially expressed proteins and network analysis identified in RBVS exosomes upregulated proteins specifically related to invasion and metastasis, such as proteins involved in extracellular matrix (ECM) remodeling and interaction, resistance to anoikis and the metabolism/catabolism of glucose and amino acids.
Also flagged:Auditory Evoked PotentialsMood disorderscircadian rhythmmajor depressive disorderDepressionMood Disorder
Journal Article2020-06-12✓ 1 SnippetPark YM.
In-Text Gene Mentions
Discussion)
…positively and with5-HTTbinding negatively in…
Show Full Abstract
Mood disorders often accompany circadian rhythm abnormalities. The serotonergic system (STS) is related to mood and circadian rhythm. This study aimed to test whether serotonergic neurotransmission, using the loudness dependence of auditory evoked potential (LDAEP), is associated with circadian preference in patients with major depressive disorder (MDD). Depression severity was assessed in 18-65-year-old outpatients (<i>n</i> = 48) using the Beck Depression Inventory scores and Hamilton Depression Rating Scale at baseline. Additionally, various scales, including the Korean version of the Composite Scale of Morningness (K-CSM), Korean version of the Mood Disorder Questionnaire (K-MDQ), and Korean version of the Childhood Trauma Questionnaire (K-CTQ), were used. LDAEP was also measured at baseline. The subjects were divided into three groups according to the circadian preference using total K-CSM scores (morningness (<i>n</i> = 10) vs intermediate (<i>n</i> = 19) vs. eveningness (<i>n</i> = 19)) and two groups according to median based on each K-CSM score, respectively (higher K-CSM (<i>n</i> = 25) vs. lower K-CSM (<i>n</i> = 23)). The bipolarity, suicidality, and age at onset differed among the three groups. Impulsivity, depression severity, suicidality, hopelessness, bipolarity, frequency of emotional abuse, and age at onset differed between the two group divisions. Thus, the STS might serve as the mediator between the circadian system and mood.
Also flagged:Mac-2 Binding ProteinLiver FibrosisFatty Liver DiseaseM2BPglycoproteinnonalcoholic fatty liver disease
Journal Article2020-06-12✓ 1 SnippetKamada Y, Morishita K, Koseki M, Nishida M, Asuka T, Naito Y, Yamada M, Takamatsu S, Sakata Y, Takehara T, Miyoshi E.
<i>Background</i>: Mac-2 binding protein (M2BP) is a highly glycosylated secreted glycoprotein that is involved in immune defense and regulation. Our cross-sectional studies indicated that serum M2BP was a useful liver fibrosis biomarker for nonalcoholic fatty liver disease (NAFLD). In this study, we conducted a 7-year longitudinal study to investigate the significance of serum M2BP levels (baseline and at 7-year follow-up) and their relationships with other metabolic parameters of fatty liver disease. <i>Methods</i>: We enrolled 715 study subjects (521 male and 194 female) during health examinations. Study subjects received blood sampling tests and abdominal ultrasound tests at baseline and follow-up. <i>Results</i>: Univariate analyses demonstrated that serum M2BP levels were significantly correlated with various parameters related to metabolic risk (body mass index (BMI), systolic blood pressure, triglyceride, high density lipoprotein (HDL)-cholesterol) and metabolic syndrome diseases (obesity, hypertension, dyslipidemia, diabetes mellitus, fatty liver (FL)). Multiple logistic regression analyses demonstrated that BMI and FL were independent determinants for serum M2BP levels. Baseline serum M2BP levels were significant independent determinants for changes in platelet count, Fibrosis-4 (FIB4) index, and NAFLD fibrosis score. Higher serum M2BP levels (>1.80 μg/mL) strongly correlated with changes in the FIB4-index. <i>Conclusions</i>: The results of this study suggest that changes in serum M2BP levels reflect changes in specific metabolic disease-related parameters, and baseline serum M2BP levels could predict changes in liver fibrosis.
Also flagged:COVID-19 infectionCOVID-19hemoglobinopathyfetal hemoglobininfectionangiotensin-converting enzyme 2
Journal Article2020-06-12No SnippetsSotoudeh E, Sotoudeh H.
Show Full Abstract
COVID-19 infection is less common in children (with higher fetal hemoglobin levels). In our preliminary study, we also observed a low prevalence and fatality of COVID-19 in countries with high rate of hemoglobinopathy carries. Given these two facts, the hemoglobin structure can play a role in the physiopathology of COVID-19 disease. Several drugs are known to increase fetal hemoglobin in adults. Adding these drugs to COVID-19 clinical trials may improve the patients' outcomes.
…The miR-18a suppresses the expression of PTEN, WNK2, SOX6, BTG3, and RBSP3 genes by binding to their 3′-UTR transcripts, and causes PD-L1 expression and Wnt/β-catenin pathway activation in cervical carcinoma (Dong P. et al., 2019).…
Show Full Abstract
The spliceosomal complex components, together with the heterogeneous nuclear ribonucleoproteins (hnRNPs) and serine/arginine-rich (SR) proteins, regulate the process of constitutive and alternative splicing, the latter leading to the production of mRNA isoforms coding multiple proteins from a single pre-mRNA molecule. The expression of splicing factors is frequently deregulated in different cancer types causing the generation of oncogenic proteins involved in cancer hallmarks. Cervical cancer is caused by persistent infection with oncogenic human papillomaviruses (HPVs) and constitutive expression of viral oncogenes. The aberrant activity of hnRNPs and SR proteins in cervical neoplasia has been shown to trigger the production of oncoproteins through the processing of pre-mRNA transcripts either derived from human genes or HPV genomes. Indeed, hnRNP and SR splicing factors have been shown to regulate the production of viral oncoprotein isoforms necessary for the completion of viral life cycle and for cell transformation. Target-therapy strategies against hnRNPs and SR proteins, causing simultaneous reduction of oncogenic factors and inhibition of HPV replication, are under development. In this review, we describe the current knowledge of the functional link between RNA splicing factors and deregulated cellular as well as viral RNA maturation in cervical cancer and the opportunity of new therapeutic strategies.
Also flagged:Gastric CancerPeptideLipidPaclitaxeltumormalignant tumors
Journal Article2020-06-12No SnippetsJian Y, Zhao M, Cao J, Fan T, Bu W, Yang Y, Li W, Zhang W, Qiao Y, Wang J, Wen A.
Show Full Abstract
<h4>Aim</h4>The aim of this study was to develop a GX1-modified nanostructured lipid carrier (NLCs) and to evaluate its ability to improve the anti-gastric cancer tumor effects of paclitaxel (PTX).<h4>Main methods</h4>The GX1-modified NLCs were synthesized and loaded with PTX (GX1-PTX-NLCs) by emulsion solvent evaporation technique. The anti-tumor activity and pharmacodynamics were then evaluated by in vitro cell studies and animal experiments.<h4>Key findings</h4>The GX1-modified NLCs were successfully synthesized and confirmed by <sup>1</sup>H NMR and MALDI-TOF-MS. PTX-loaded NLCs produced particles with average size distribution less than or equal to 222 nm and good drug loading and entrapment efficiency. In vitro studies demonstrated that GX1-PTX-NLCs had a more obvious inhibitory effect on Co-HUVEC cells than PTX and unmodified PTX-NLCs. The cellular uptake results also showed that GX1-PTX-NLCs were largely concentrated in Co-HUVEC cells, and the uptake rates of GX1-PTX-NLCs in Co-HUVEC were higher than those of the free drug and the PTX-NLC. In vivo studies demonstrated that GX1-PTX-NLCs possess strong anti-tumor effect and showed higher tumor growth inhibition and lower toxicity in nude mice.<h4>Significance</h4>These results suggest that GX1-modified NLCs enhanced the anti-tumor activity of PTX and reduced its toxicity effectively. GX1-PTX-NLCs may be considered as a potent drug delivery system for therapy of gastric cancer.
Also flagged:MacrophageAgingCholesterolage-related macular degenerationGene ExpressionLipid
Journal Article2020-06-12No SnippetsLi J, Yin X, Zhang B, Li C, Lu P.
Show Full Abstract
<h4>Purpose</h4>Macrophage aging is involved with the occurrence and progression of age-related macular degeneration (AMD). The purpose of this study was to identify the specific microRNAs (miRNA), mRNAs, and their interactions underlying macrophage aging and response to cholesterol through bioinformatical analysis in order to get a better understanding of the mechanism of AMD.<h4>Methods</h4>The microarray data were obtained from Gene Expression Omnibus (accession GSE111304 and GSE111382). The age-related differentially expressed genes in macrophages were identified using R software. Further miRNA-mRNA interactions were analyzed through miRWalk, mirTarBase, starBase, and then produced by Cytoscape. The functional annotations including Gene Ontology and KEGG pathways of the miRNA target genes were performed by the DAVID and the STRING database. In addition, protein-protein interaction network was constructed to identify the key genes in response to exogenous cholesterol.<h4>Results</h4>When comparing aged and young macrophages, a total of 14 miRNAs and 101 mRNAs were detected as differentially expressed. Besides, 19 validated and 544 predicted miRNA-mRNA interactions were detected. Lipid metabolic process was found to be associated with macrophage aging through functional annotations of the miRNA targets. After being treated with oxidized and acetylated low-density lipoprotein, miR-714 and 16 mRNAs differentially expressed in response to both kinds of cholesterol between aged and young macrophages. Among them, 6 miRNA-mRNA predicted pairs were detected. The functional annotations were mainly related to lipid metabolism process and farnesyl diphosphate farnesyl transferase 1 (FDFT1) was identified to be the key gene in the difference of response to cholesterol between aged and young macrophages.<h4>Conclusions</h4>Lipid metabolic process was critical in both macrophage aging and response to cholesterol thus was regarded to be associated with the occurrence and progression of AMD. Moreover, miR-714-FDFT1 may modulate cholesterol homeostasis in aged macrophages and have the potential to be a novel therapeutic target for AMD.
Also flagged:cytoplasmlocalizationnucleuscytoplasmicapolipoprotein Egene expression
Journal Article2020-06-12✓ 2 SnippetsFerguson CM, Echeverria D, Hassler M, Ly S, Khvorova A.
In-Text Gene Mentions
Results)
…larger portion ofHttmRNA was localized…
Discussion)
…nuclear localization ofHTTmRNA.…
Show Full Abstract
RNA interference (RNAi) is a potent mechanism that silences mRNA and protein expression in all cells and tissue types. RNAi is known to exert many of its functional effects in the cytoplasm, and thus, the cellular localization of target mRNA may impact observed potency. Here, we demonstrate that cell identity has a profound impact on accessibility of apolipoprotein E (ApoE) mRNA to RNAi. We show that, whereas both neuronal and glial cell lines express detectable ApoE mRNA, in neuronal cells, ApoE mRNA is not targetable by RNAi. Screening of a panel of thirty-five chemically modified small interfering RNAs (siRNAs) did not produce a single hit in a neuronal cell line, whereas up to fifteen compounds showed strong efficacy in glial cells. Further investigation of the cellular localization of ApoE mRNA demonstrates that ApoE mRNA is partially spliced and preferentially localized to the nucleus (∼80%) in neuronal cells, whereas more than 90% of ApoE mRNA is cytoplasmic in glial cells. Such an inconsistency in intracellular localization and splicing might provide an explanation for functional differences in RNAi compounds. Thus, cellular origin might have an impact on accessibility of mRNA to RNAi and should be taken into account during the screening process.
Also flagged:fibrinPerflubronnanoparticleCancerDanae100
Journal Article2020-06-12No SnippetsEsser AK, Ross MH, Fontana F, Su X, Gabay A, Fox GC, Xu Y, Xiang J, Schmieder AH, Yang X, Cui G, Scott M, Achilefu S, Chauhan J, Fletcher S, Lanza GM, Weilbaecher KN.
Show Full Abstract
Tumor-associated macrophages (TAMs) enhance tumor growth in mice and are correlated with a worse prognosis for breast cancer patients. While early therapies sought to deplete all macrophages, current therapeutics aim to reprogram pro-tumor macrophages (M2) and preserve those necessary for anti-tumor immune responses (M1). Recent studies have shown that c-MYC (MYC) is induced in M2 macrophages <i>in vitro</i> and <i>in vivo</i> where it regulates the expression of tumor-promoting genes. In a myeloid lineage MYC KO mouse model, MYC had important roles in macrophage maturation and function leading to reduced tumor growth. We therefore hypothesized that targeted delivery of a MYC inhibitor to established M2 TAMs could reduce polarization toward an M2 phenotype in breast cancer models. <b>Methods:</b> In this study, we developed a MYC inhibitor prodrug (MI3-PD) for encapsulation within perfluorocarbon nanoparticles, which can deliver drugs directly to the cytosol of the target cell through a phagocytosis independent mechanism. We have previously shown that M2-like TAMs express significant levels of the vitronectin receptor, integrin β3, and <i>in vivo</i> targeting and therapeutic potential was evaluated using αvβ3 integrin targeted rhodamine-labeled nanoparticles (NP) or integrin αvβ3-MI3-PD nanoparticles. <b>Results:</b> We observed that rhodamine, delivered by αvβ3-rhodamine NP, was incorporated into M2 tumor promoting macrophages through both phagocytosis-independent and dependent mechanisms, while NP uptake in tumor suppressing M1 macrophages was almost exclusively through phagocytosis. In a mouse model of breast cancer (4T1-GFP-FL), M2-like TAMs were significantly reduced with αvβ3-MI3-PD NP treatment. To validate this effect was independent of drug delivery to tumor cells and was specific to the MYC inhibitor, mice with integrin β3 knock out tumors (PyMT-Bo1 β3KO) were treated with αvβ3-NP or αvβ3-MI3-PD NP. M2 macrophages were significantly reduced with αvβ3-MI3-PD nanoparticle therapy but not αvβ3-NP treatment. <b>Conclusion:</b> These data suggest αvβ3-NP-mediated drug delivery of a c-MYC inhibitor can reduce protumor M2-like macrophages while preserving antitumor M1-like macrophages in breast cancer.
Also flagged:osteoarthritisEZH2OAjoint diseaseagingobesity
Journal Article2020-06-12✓ 1 SnippetLi Y, Yuan F, Song Y, Guan X.
In-Text Gene Mentions
Introduction)
…proliferation by targetingSox6to trigger OA…
Show Full Abstract
Osteoarthritis (OA) is a joint disease caused by a variety of factors, including aging, obesity and trauma. MicroRNAs (miRNAs) have been reported to be crucial regulators during OA progression. The present study aimed to investigate the role of miR-17-5p and miR-19b-3p during OA development. Interleukin (IL)-1β-treated chondrocytes were used to mimic OA <i>in vitro</i>. The expression levels of miR-17-5p and enhancer of zeste homolog 2 (EZH2) were measured in cartilage tissues and chondrocytes using reverse transcription-quantitative PCR or western blotting. Apoptosis was assessed by flow cytometry. The protein expression levels of extracellular matrix (ECM)-associated genes were detected by western blotting. The binding sites between miR-17-5p or miR-19b-3p and EZH2 were predicted using the MicroT-CDS online database and verified using dual-luciferase reporter and RIP assays. miR-17-5p expression was downregulated, whereas EZH2 expression was upregulated in OA cartilage tissues and IL-1β-induced chondrocytes compared with that in the control tissues and cells. miR-17-5p mimics inhibited IL-1β-induced apoptosis and ECM degradation in chondrocytes. EZH2 was the target of miR-17-5p and miR-19b-3p in chondrocytes, and enhanced apoptosis and ECM degradation in IL-1β-stimulated chondrocytes. Rescue experiments revealed that miR-17-5p or miR-19b-3p mimic-induced inhibition of OA progression was reversed by EZH2 overexpression. In conclusion, miR-17-5p and miR-19b-3p inhibited OA progression by targeting EZH2, which may serve as a potential therapeutic target for OA.
Also flagged:phosphorusphthalocyaninecancerPhthalocyanineswatertumor
Journal Article2020-06-12No SnippetsZhou LN, Pan H, Kan JL, Guan Q, Zhou Y, Dong YB.
Show Full Abstract
As one of the noninvasive cancer treatments, photothermal therapy (PTT) has drawn intense attention recently. In this context, an important task is to explore novel and versatile nanoscale photothermal agents (PTAs), especially those with strong NIR-II light absorption, high photothermal conversion efficiency, good photostability and biocompatibility. Phthalocyanines (Pcs), as the second-generation photosensitizers, are a promising class of candidates for PTT due to their strong NIR absorption and high photothermal conversion efficiency. However, the poor water solubility severely limited their application as PTAs in tumor treatment. Herein, we report a molecular phosphorus phthalocyanine (P-Pc)-based nanoagent <i>via</i> incorporation of human serum albumin (HSA) under mild conditions. The obtained nanoscale P-Pc-HSA possesses excellent photothermal conversion efficiency (64.7%) upon 1064 nm light irradiation, furthermore, it can be a highly efficient NIR-II antitumor nanoagent <i>via</i> photothermal treatment (PTT), which is fully evidenced by the <i>in vitro</i> and <i>in vivo</i> experiments.
Also flagged:GuanineThymineDNA polymerase λenolpolymerasecytosine
Journal Article2020-06-11No SnippetsLi P, Rangadurai A, Al-Hashimi HM, Hammes-Schiffer S.
Show Full Abstract
DNA bases can adopt energetically unfavorable tautomeric forms that enable the formation of Watson-Crick-like (WC-like) mispairs, which have been proposed to give rise to spontaneous mutations in DNA and misincorporation errors in DNA replication and translation. Previous NMR and computational studies have indicated that the population of WC-like guanine-thymine (G-T) mispairs depends on the environment, such as the local nucleic acid sequence and solvation. To investigate these environmental effects, herein G-T mispair tautomerization processes are studied computationally in aqueous solution, in A-form and B-form DNA duplexes, and within the active site of a DNA polymerase λ variant. The wobble G-T (wG-T), WC-like G-T*, and WC-like G*-T forms are considered, where * indicates the enol tautomer of the base. The minimum free energy paths for the tautomerization from the wG-T to the WC-like G-T* and from the WC-like G-T* to the WC-like G*-T are computed with mixed quantum mechanical/molecular mechanical (QM/MM) free energy simulations. The reaction free energies and free energy barriers are found to be significantly influenced by the environment. The wG-T→G-T* tautomerization is predicted to be endoergic in aqueous solution and the DNA duplexes but slightly exoergic in the polymerase, with Arg517 and Asn513 providing electrostatic stabilization of G-T*. The G-T*→G*-T tautomerization is also predicted to be slightly more thermodynamically favorable in the polymerase relative to these DNA duplexes. These simulations are consistent with an experimentally driven kinetic misincorporation model suggesting that G-T mispair tautomerization occurs in the ajar polymerase conformation or concertedly with the transition from the ajar to the closed polymerase conformation. Furthermore, the order of the associated two proton transfer reactions is predicted to be different in the polymerase than in aqueous solution and the DNA duplexes. These studies highlight the impact of the environment on the thermodynamics, kinetics, and fundamental mechanisms of G-T mispair tautomerization, which plays a role in a wide range of biochemically important processes.
Also flagged:encephalopathic syndromephosphorylationmitochondrialautophagymitochondrial diseaseFBXL 4
Journal Article2020-06-11✓ 5 SnippetsAlsina D, Lytovchenko O, Schab A, Atanassov I, Schober FA, Jiang M, Koolmeister C, Wedell A, Taylor RW, Wredenberg A, Larsson NG.
In-Text Gene Mentions
Introduction)
…Here, we describe an Fbxl4 knockout mouse and show that it recapitulates important phenotypes present in patients with mitochondrial disease caused by FBXL4 mutations.…
Methods)
…The puromycin resistance cassette was removed by crossing Fbxl4+/loxP‐Puro mice with mice expressing Flp recombinase.…
Results)
…Further analyses showed that LC3‐II, p62/SQSTM1, and ubiquitin conjugates accumulated to the same extent in both wild‐type and FBXL4 KO cells after treatment with the lysosomal inhibitor NH4Cl, as well as after treatment with the proteasomal inhibitor epoxomicin (Fig 4E and F).…
Introduction)
…FBXL4 mutations are found in ~ 0.7% of all mitochondrial patients and in ~ 14% of children with congenital lactic acidosis, making it one of the most common causes of mitochondrial disease (Dai et al, 2017).…
Methods)
…To generate the Fbxl4 knockout allele, exon 4 was flanked by loxP sites, and a puromycin resistance (PuroR) cassette flanked by Frt sites was also introduced as a selection marker.…
Show Full Abstract
Pathogenic variants in FBXL4 cause a severe encephalopathic syndrome associated with mtDNA depletion and deficient oxidative phosphorylation. To gain further insight into the enigmatic pathophysiology caused by FBXL4 deficiency, we generated homozygous Fbxl4 knockout mice and found that they display a predominant perinatal lethality. Surprisingly, the few surviving animals are apparently normal until the age of 8-12 months when they gradually develop signs of mitochondrial dysfunction and weight loss. One-year-old Fbxl4 knockouts show a global reduction in a variety of mitochondrial proteins and mtDNA depletion, whereas lysosomal proteins are upregulated. Fibroblasts from patients with FBXL4 deficiency and human FBXL4 knockout cells also have reduced steady-state levels of mitochondrial proteins that can be attributed to increased mitochondrial turnover. Inhibition of lysosomal function in these cells reverses the mitochondrial phenotype, whereas proteasomal inhibition has no effect. Taken together, the results we present here show that FBXL4 prevents mitochondrial removal via autophagy and that loss of FBXL4 leads to decreased mitochondrial content and mitochondrial disease.
…ER‐phagy receptors FAM134B,CCPG1, and TEX264 (Khaminets…
Show Full Abstract
The endoplasmic reticulum (ER) plays important roles in protein synthesis and folding, and calcium storage. The volume of the ER and expression of its resident proteins are increased in response to nutrient stress. ER-phagy, a selective form of autophagy, is involved in the degradation of the excess components of the ER to restore homeostasis. Six ER-resident proteins have been identified as ER-phagy receptors so far. In this study, we have identified CALCOCO1 as a novel ER-phagy receptor for the degradation of the tubular ER in response to proteotoxic and nutrient stress. CALCOCO1 is a homomeric protein that binds directly to ATG8 proteins via LIR- and UDS-interacting region (UIR) motifs acting co-dependently. CALCOCO1-mediated ER-phagy requires interaction with VAMP-associated proteins VAPA and VAPB on the ER membranes via a conserved FFAT-like motif. Depletion of CALCOCO1 causes expansion of the ER and inefficient basal autophagy flux. Unlike the other ER-phagy receptors, CALCOCO1 is peripherally associated with the ER. Therefore, we define CALCOCO1 as a soluble ER-phagy receptor.
Also flagged:2-oxoethyldimethyltriensodiumBochydrazine
Journal Article2020-06-11No SnippetsYi Y, Wang L, Chen L, Lin Y, Luo Z, Chen Z, Li T, Wu J, Zhong Z.
Show Full Abstract
<h4>Background</h4>Farnesol is a sesquiterpene from propolis and citrus fruit that shows promising anti-bacterial activity for caries treatment and prevention, but its hydrophobicity limits the clinical application. We aimed to develop the novel polymeric micelles (PMs) containing a kind of derivative of farnesol and a ligand of pyrophosphate (PPi) that mediated PMs to adhere tightly with the tooth enamel.<h4>Results</h4>Farnesal (Far) was derived from farnesol and successfully linked to PEG via an acid-labile hydrazone bond to form PEG-hyd-Far, which was then conjugated to PPi and loaded into PMs to form the aimed novel drug delivery system, PPi-Far-PMs. The in vitro test about the binding of PPi-Far-PMs to hydroxyapatite showed that PPi-Far-PMs could bind rapidly to hydroxyapatite and quickly release Far under the acidic conditions. Results from the mechanical testing and the micro-computed tomography indicated that PPi-Far-PMs could restore the microarchitecture of teeth with caries. Moreover, PPi-Far-PMs diminished the incidence and severity of smooth and sulcal surface caries in rats that were infected with Streptococcus mutans while being fed with a high-sucrose diet. The anti-caries efficacy of free Far can be improved significantly by PPi-Far-PMs through the effective binding of it with tooth enamel via PPi.<h4>Conclusions</h4>This novel drug-delivery system may be useful for the treatment and prevention of dental caries as well as the targeting therapy of anti-bacterial drugs in the oral disease.
…conjugated with human anti-STAU1antibody or negative…
Results)
…SNHG14 enhancedSTAU1-mediated degradation of IRF6…
Results)
…SMD (STAU1-mediated degradation) is a…
Show Full Abstract
Warburg effect is a hallmark of cancer cells, wherein glycolysis is preferred over oxidative phosphorylation even in aerobic conditions. Reprogramming of glycometabolism is especially crucial for malignancy in glioma. RNA-binding proteins and long noncoding RNAs are important for aerobic glycolysis during malignant transformation. Thus, we determined the expression and function of RNA-binding protein Lin28A, long noncoding RNA SNHG14, and transcription factor IRF6 in human glioma cells to elucidate the mechanism(s) underlying their role in glycolysis. Quantitative real-time polymerase chain reaction and western blotting showed that Lin28A and SNHG14 were overexpressed and IRF6 was downregulated in glioma. Depleting Lin28A from cells decreased the stability and expression of SNHG14. Furthermore, depleting SNHG14 reduced IRF6 mRNA degradation by targeting its 3' untranslated region and inhibiting STAU1-mediated degradation, thereby increasing the expression of IRF6. PKM2 is an important enzyme in aerobic glycolysis, and GLUT1 is the primary transporter that facilitates glucose uptake. IRF6 inhibited the transcription of PKM2 and GLUT1, thereby impairing glycolysis and cell proliferation and inducing apoptosis in glioma. Notably, depleting Lin28A and SNHG14 and overexpressing IRF6 reduced the growth of xenograft tumors in vivo and prolonged the survival of nude mice. Taken together, our data revealed that the Lin28A/SNHG14/IRF6 axis is crucial for reprogramming glucose metabolism and stimulating tumorigenesis in glioma cells. Thus, targeting this axis might help in the development of a novel therapeutic strategy for glioma metabolism.
Also flagged:interferonEbolainfectionsvirus infectioninterferon-stimulatedEbola virus infection
Journal Article2020-06-11✓ 5 SnippetsKuroda M, Halfmann PJ, Hill-Batorski L, Ozawa M, Lopes TJS, Neumann G, Schoggins JW, Rice CM, Kawaoka Y.
In-Text Gene Mentions
Discussion)
…This may suggest that CCDC92 has a role in cell susceptibility to EBOV or tissue tropism during infection.…
Results)
…Western blot analysis confirmed the expression of each CCDC92 construct and VP30 before infection (Supplementary Fig. 13).…
Results)⭐ same-sentence co-mention
…The three ISGs with the most significant inhibitory effect, PFKFB3, BTN3A3, and CCDC92, decreased EBOV∆VP30 titers by nearly 1000-fold on day 6 post infection (Fig. 1c).…
Results)
…In HEK-293T VP30 cells expressing wild-type CCDC92 or the deletion mutant that still interacted with NP (CCDC92 ∆20–72), we still observed inhibition of virus infection as indicated by a reduction in virus-driven luciferase expression (Fig. 4e).…
Results)
…Next, to identify the region of NP important for its binding to CCDC92, we generated two NP deletion mutants that lacked either the N-terminal lobe (amino acids [aa] 39–240) or the C-terminal lobe (aa 241–405) that are essential for NP oligomerization and RNA encapsidation37–40.…
Show Full Abstract
The West Africa Ebola outbreak was the largest outbreak ever recorded, with over 28,000 reported infections; this devastating epidemic emphasized the need to understand the mechanisms to counteract virus infection. Here, we screen a library of nearly 400 interferon-stimulated genes (ISGs) against a biologically contained Ebola virus and identify several ISGs not previously known to affect Ebola virus infection. Overexpression of the top ten ISGs attenuates virus titers by up to 1000-fold. Mechanistic studies demonstrate that three ISGs interfere with virus entry, six affect viral transcription/replication, and two inhibit virion formation and budding. A comprehensive study of one ISG (CCDC92) that shows anti-Ebola activity in our screen reveals that CCDC92 can inhibit viral transcription and the formation of complete virions via an interaction with the viral protein NP. Our findings provide insights into Ebola virus infection that could be exploited for the development of therapeutics against this virus.
Journal Article2020-06-11No SnippetsSukjamnong S, Thongkorn S, Kanlayaprasit S, Saeliw T, Hussem K, Warayanon W, Hu VW, Tencomnao T, Sarachana T.
Show Full Abstract
Our recent study revealed that prenatal exposure to bisphenol A (BPA) disrupted the transcriptome profiles of genes in the offspring hippocampus. In addition to genes linked to autism, several genes associated with Alzheimer's disease (AD) were found to be differentially expressed, although the association between BPA-responsive genes and AD-related genes has not been thoroughly investigated. Here, we demonstrated that in utero BPA exposure also disrupted the transcriptome profiles of genes associated with neuroinflammation and AD in the hippocampus. The level of NF-κB protein and its AD-related target gene Bace1 were significantly increased in the offspring hippocampus in a sex-dependent manner. Quantitative RT-PCR analysis also showed an increase in the expression of Tnf gene. Moreover, the reanalysis of transcriptome profiling data from several previously published BPA studies consistently showed that BPA-responsive genes were significantly associated with top AD candidate genes. The findings from this study suggest that maternal BPA exposure may increase AD risk in offspring by dysregulating genes associated with AD neuropathology and inflammation and reveal a possible relationship between AD and autism, which are linked to the same environmental factor. Sex-specific effects of prenatal BPA exposure on the susceptibility of AD deserve further investigation.
Also flagged:calciumphotonThy1ketaminemedetomidineoxygen
Journal Article2020-06-11No SnippetsAydin AK, Haselden WD, Goulam Houssen Y, Pouzat C, Rungta RL, Demené C, Tanter M, Drew PJ, Charpak S, Boido D.
Show Full Abstract
Functional ultrasound imaging (fUS) is an emerging technique that detects changes of cerebral blood volume triggered by brain activation. Here, we investigate the extent to which fUS faithfully reports local neuronal activation by combining fUS and two-photon microscopy (2PM) in a co-registered single voxel brain volume. Using a machine-learning approach, we compute and validate transfer functions between dendritic calcium signals of specific neurons and vascular signals measured at both microscopic (2PM) and mesoscopic (fUS) levels. We find that transfer functions are robust across a wide range of stimulation paradigms and animals, and reveal a second vascular component of neurovascular coupling upon very strong stimulation. We propose that transfer functions can be considered as reliable quantitative reporters to follow neurovascular coupling dynamics.
Also flagged:neurodegenerative disordersHuntington diseaseHDglutamateneurodegenerative diseasespathogenesis
Journal Article2020-06-11✓ 4 SnippetsYon M, Decoville M, Sarou-Kanian V, Fayon F, Birman S.
In-Text Gene Mentions
Introduction)
…In the present study, this methodology is used to compare three different Drosophila models of neurodegeneration: two cell-specific models of Huntington disease (HD), in which a pathogenic fragment of the human Huntingtin (HTT) protein containing a pathogenic polyglutamine expansion was expressed either in neurons (NHD model)23–29, or in glial cells (GHD model)25,26,30, and a model of excitotoxicity-induced neurodegeneration based on the knock-down of the glutamate transporter Eaat1 in synapse-associated glia (GLU model)31–36.…
Introduction)
…the human Huntingtin (HTT) protein containing a…
Results)
…of mutant humanHTTin brain glial…
Results)
…suggested that mutantHTT(mHTT) activates distinct…
Show Full Abstract
Drosophila flies are versatile animal models for the study of gene mutations in neuronal pathologies. Their small size allows performing in vivo Magic Angle Spinning (MAS) experiments to obtain high-resolution <sup>1</sup>H nuclear magnetic resonance (NMR) spectra. Here, we use spatially-resolved <sup>1</sup>H high-resolution MAS NMR to investigate in vivo metabolite contents in different segments of the fly body. A comparative study of metabolic changes was performed for three neurodegenerative disorders: two cell-specific neuronal and glial models of Huntington disease (HD) and a model of glutamate excitotoxicity. It is shown that these pathologies are characterized by specific and sometimes anatomically localized variations in metabolite concentrations. In two cases, the modifications of <sup>1</sup>H MAS NMR spectra localized in fly heads were significant enough to allow the creation of a predictive model.
So-called pharmacoresistant (R-type) voltage-gated Ca<sup>2+</sup> channels are structurally only partially characterized. Most of them are encoded by the CACNA1E gene and are expressed as different Ca<sub>v</sub>2.3 splice variants (variant Ca<sub>v</sub>2.3a to Ca<sub>v</sub>2.3e or f) as the ion conducting subunit. So far, no inherited disease is known for the CACNA1E gene but recently spontaneous mutations leading to early death were identified, which will be brought into focus. In addition, a short historical overview may highlight the development to understand that upregulation during aging, easier activation by spontaneous mutations or lack of bioavailable inorganic cations (Zn<sup>2+</sup> and Cu<sup>2+</sup>) may lead to similar pathologies caused by cellular overexcitation.
Intestinal crypts have great capacity for repair and regeneration after intestinal stem cell (ISC) injury. Here, we define the cellular remodeling process resulting from ISC niche interruption by transient Notch pathway inhibition in adult mice. Although ISCs were retained, lineage tracing demonstrated a marked reduction in ISC function after Notch disruption. Surprisingly, Notch ligand-expressing Paneth cells were rapidly lost by apoptotic cell death. The ISC-Paneth cell changes were followed by a regenerative response, characterized by expansion of cells expressing Notch ligands Dll1 and Dll4, enhanced Notch signaling, and a proliferative surge. Lineage tracing and organoid studies showed that Dll1-expressing cells were activated to function as multipotential progenitors, generating both absorptive and secretory cells and replenishing the vacant Paneth cell pool. Our analysis uncovered a dynamic, multicellular remodeling response to acute Notch inhibition to repair the niche and restore homeostasis. Notably, this crypt regenerative response did not require ISC loss.
Also flagged:synthesisphosphatidylglycerolPhosphatidylglycerolsphospholipidsdiacylglycerol
Journal Article2020-06-11No SnippetsStruzik ZJ, Weerts AN, Storch J, Thompson DH.
Show Full Abstract
Phosphatidylglycerols (PG) are a family of naturally occurring phospholipids that are responsible for critical operations within cells. PG are characterized by an (R) configuration in the diacyl glycerol backbone and an (S) configuration in the phosphoglycerol head group. Herein, we report a synthetic route to provide control over the PG stereocenters as well as control of the acyl chain identity.
Also flagged:neurocognitive disordersLipocalin-2LCN2brain injurybehavioralCCR5
Journal Article2020-06-11No SnippetsOjeda-Juárez D, Shah R, Fields JA, Harahap-Carrillo IS, Koury J, Maung R, Gelman BB, Baaten BJ, Roberts AJ, Kaul M.
Show Full Abstract
People living with HIV (PLWH) continue to develop HIV-associated neurocognitive disorders despite combination anti-retroviral therapy. Lipocalin-2 (LCN2) is an acute phase protein that has been implicated in neurodegeneration and is upregulated in a transgenic mouse model of HIV-associated brain injury. Here we show that LCN2 is significantly upregulated in neocortex of a subset of HIV-infected individuals with brain pathology and correlates with viral load in CSF and pro-viral DNA in neocortex. However, the question if LCN2 contributes to HIV-associated neurotoxicity or is part of a protective host response required further investigation. We found that the knockout of LCN2 in transgenic mice expressing HIVgp120 in the brain (HIVgp120tg) abrogates behavioral impairment, ameliorates neuronal damage, and reduces microglial activation in association with an increase of the neuroprotective CCR5 ligand CCL4. In vitro experiments show that LCN2 neurotoxicity also depends on microglia and p38 MAPK activity. Genetic ablation of CCR5 in LCN2-deficient HIVgp120tg mice restores neuropathology, suggesting that LCN2 overrides neuroprotection mediated by CCR5 and its chemokine ligands. RNA expression of 168 genes involved in neurotransmission reveals that neuronal injury and protection are each associated with genotype- and sex-specific patterns affecting common neural gene networks. In conclusion, our study identifies LCN2 as a novel factor in HIV-associated brain injury involving CCR5, p38 MAPK and microglia. Furthermore, the mechanistic interaction between LCN2 and CCR5 may serve as a diagnostic and therapeutic target in HIV patients at risk of developing brain pathology and neurocognitive impairment.
Also flagged:XIAPcaspaseIAPbreast cancercancerMAPK
Journal Article2020-06-11No SnippetsGholizadeh MA, Shamsabadi FT, Yamchi A, Golalipour M, Jhingan GD, Shahbazi M.
Show Full Abstract
<h4>Background</h4>The X-linked inhibitor of apoptosis protein (XIAP) is the most potent caspase inhibitor of the IAP family in apoptosis pathway. This study aims to identify the molecular targets of XIAP in human breast cancer cells exposed to XIAP siRNA by proteomics screening. The expression of XIAP was reduced in MCF-7 breast cancer cells by siRNA. Cell viability and the mRNA expression level of this gene were evaluated by MTS and quantitative real-time PCR procedures, respectively. Subsequently, the XIAP protein level was visualized by Western blotting and analyzed by two-dimensional (2D) electrophoresis and LC-ESI-MS/MS.<h4>Results</h4>Following XIAP silencing, cell proliferation was reduced in XIAP siRNA transfected cells. The mRNA transcription and protein expression of XIAP were decreased in cells exposed to XIAP siRNA than si-NEG. We identified 30 proteins that were regulated by XIAP, of which 27 down-regulated and 3 up-regulated. The most down-regulated proteins belonged to the Heat Shock Proteins family. They participate in cancer related processes including apoptosis and MAPK signaling pathway. Reduced expression of HSP90B1 was associated with apoptosis induction by androgen receptor and prostate specific antigen. Suppression of XIAP resulted in the enhancement of GDIB, ENO1, and CH60 proteins expression. The network analysis of XIAP-regulated proteins identified HSPA8, HSP90AA1, ENO1, and HSPA9 as key nodes in terms of degree and betweenness centrality methods.<h4>Conclusions</h4>These results suggested that XIAP may have a number of biological functions in a diverse set of non-apoptotic signaling pathways and may provide an insight into the biomedical significance of XIAP over-expression in MCF-7 cells.
Also flagged:chondrocyte proliferationdeathpathogenesisrheumatoid arthritisskeletal developmentparathyroid hormone-related protein
Journal Article2020-06-11✓ 1 SnippetKomori T.
In-Text Gene Mentions
S I O 001029)
…es (Sox9, Sox5, and Sox6) in the transcripti…
Show Full Abstract
Chondrocyte biology is a hot topic, because osteoarthritis (OA) is a serious problem in an aging society, but there are no fundamental therapeutic drugs [...].
Also flagged:Pulmonary EmbolismVenous thromboembolismcancerintracranial tumorscancersPE
Journal Article2020-06-11No SnippetsOto J, Plana E, Solmoirago MJ, Fernández-Pardo Á, Hervás D, Cana F, España F, Artoni A, Bucciarelli P, Carrabba G, Navarro S, Merati G, Medina P.
Show Full Abstract
Venous thromboembolism (VTE) is a common complication of cancer that severely increases morbidity and mortality. Patients with intracranial tumors are more likely to develop VTE than patients with cancers at other sites. Conversely, limited tools exist to identify patients with high thrombotic risk. Upon activation, neutrophils release their content through different mechanisms triggering thrombosis. We explored the ability of microRNAs (miRNAs) and plasma markers of neutrophil activation measured before surgery to predict the risk of early post-surgical pulmonary embolism (PE) in glioma and meningioma patients. We recruited and prospectively followed 50 patients with glioma and 50 with meningioma, 34% of whom in each group developed an early objectively-diagnosed post-surgical PE. We measured miRNA expression and neutrophil markers (cell-free DNA, nucleosomes, calprotectin and myeloperoxidase) before surgery. In glioma patients, we adjusted and validated a predictive model for post-surgical PE with 6 miRNAs: miR-363-3p, miR-93-3p, miR-22-5p, miR-451a, miR-222-3p and miR-140-3p (AUC = 0.78; 95% Confidence Interval (CI) [0.63, 0.94]) and another with cfDNA and myeloperoxidase as predictors (AUC = 0.71; 95%CI [0.52, 0.90]). Furthermore, we combined both types of markers and obtained a model with myeloperoxidase and miR-140-3p as predictors (AUC = 0.79; 95%CI [0.64, 0.94]). In meningioma patients we fitted and validated a predictive model with 6 miRNAs: miR-29a-3p, miR-660-5p, miR-331-3p, miR-126-5p, miR-23a-3p and miR-23b-3p (AUC = 0.69; 95%CI [0.52, 0.87]). All our models outperformed the Khorana score. This is the first study that analyzes the capability of plasma miRNAs and neutrophil activation markers to predict early post-surgical PE in glioma and meningioma patients. The estimation of the thrombotic risk before surgery may promote a tailored thromboprophylaxis in a selected group of high-risk patients, in order to minimize the incidence of PE and avoid bleedings.
Also flagged:Neurodegenerative diseasesPDADAmyotrophic lateral sclerosisALSMultiple sclerosis
Journal Article2020-06-11No SnippetsTeixeira MI, Amaral MH, Costa PC, Lopes CM, Lamprou DA.
Show Full Abstract
Neurodegenerative diseases (NDs) bear a lot of weight in public health. By studying the properties of the blood-brain barrier (BBB) and its fundamental interactions with the central nervous system (CNS), it is possible to improve the understanding of the pathological mechanisms behind these disorders and create new and better strategies to improve bioavailability and therapeutic efficiency, such as nanocarriers. Microfluidics is an intersectional field with many applications. Microfluidic systems can be an invaluable tool to accurately simulate the BBB microenvironment, as well as develop, in a reproducible manner, drug delivery systems with well-defined physicochemical characteristics. This review provides an overview of the most recent advances on microfluidic devices for CNS-targeted studies. Firstly, the importance of the BBB will be addressed, and different experimental BBB models will be briefly discussed. Subsequently, microfluidic-integrated BBB models (BBB/brain-on-a-chip) are introduced and the state of the art reviewed, with special emphasis on their use to study NDs. Additionally, the microfluidic preparation of nanocarriers and other compounds for CNS delivery has been covered. The last section focuses on current challenges and future perspectives of microfluidic experimentation.
Also flagged:AcetateradioionsimmunodeficienttumorsTFA
Journal Article2020-06-11No SnippetsLarenkov A, Rakhimov M, Lunyova K, Klementyeva O, Maruk A, Machulkin A.
Show Full Abstract
The folate receptor (FR) is a promising cell membrane-associated target for molecular imaging and radionuclide therapy of cancer (FR-α) and potentially also inflammatory diseases (FR-β) through use of folic acid-based radioconjugate. FR is often overexpressed by cells of epithelial tumors, including tumors of ovary, cervix, endometrium, lungs, kidneys, etc. In healthy tissues, FR can be found in small numbers by the epithelial cells, mainly in the kidneys. Extremely high undesired accumulation of the folate radioconjugates in the renal tissue is a main drawback of FR-targeting concept. In the course of this work, we aimed to reduce the undesirable accumulation of folate radioconjugates in the kidneys by introducing a histidine/glutamic acid tag into their structure. Two folic acid based compounds were synthesized: NODAGA-1,4-butanediamine-folic acid (FA-I, as control) and NODAGA-[Lys-(HE)<sub>2</sub>]-folic acid (FA-II) which contains a (His-Glu)<sub>2</sub> fragment. In vitro studies with FR (+) cells (KB and others) showed that both compounds have specificity for FR. Introduction of (HE)<sub>2</sub>-tag does not affect FR binding ability of the conjugates. In vivo biodistribution studies with normal laboratory animals, as well as with KB tumor bearing animals, were carried out. The results showed that introduction of the (HE)<sub>2</sub> tag into the structure of folate radioconjugates can significantly reduce the accumulation of these compounds in non-target tissues and important organs (the accumulation in the kidneys is reduced 2-4 times), leaving the accumulation in tumor at least at the same level, and even increasing it.
Also flagged:RNA Binding ProteinsPancreatic ductal adenocarcinomasPDACKRASTP53tumor
Journal Article2020-06-11✓ 5 SnippetsGlaß M, Michl P, Hüttelmaier AS.
In-Text Gene Mentions
Results)
…In addition, two further helicases among the PoRs, DDX60L and ZNFX1, were recently described to be involved in the human innate immune response against viral infection [35,36].…
Results)
…In addition, withZNFX1, a further reported…
Results)
…PoRs, DDX60L andZNFX1, were recently described…
Results)
…DDX60, DDX60L, andZNFX1, suggesting a collective…
Discussion)
…DDX60, DDX60L, andZNFX1.…
Show Full Abstract
Pancreatic ductal adenocarcinomas (PDAC) belong to the most frequent and most deadly malignancies in the western world. Mutations in KRAS and TP53 along with some other frequent polymorphisms occur almost universally and are likely to be responsible for tumor initiation. However, these mutations cannot explain the heterogeneity in therapeutic responses observed in PDAC patients, which limits efficiency of current therapeutic strategies. Instead, recent classifications of PDAC tumor samples are based on transcriptomics data and thus include information about epigenetic, transcriptomic, and post-transcriptomic deregulations. RNA binding proteins (RBPs) are important post-transcriptional regulators involved in every aspect of the RNA life cycle and thus considerably influence the transcriptome. In this study, we systematically investigated deregulated expression, prognostic value, and essentiality reported for RBPs in PDAC or PDAC cancer models using publicly available data. We identified 44 RBPs with suggested oncogenic potential. These include various proteins, e.g., IGF2 mRNA binding proteins (IGF2BPs), with reported tumor-promoting roles. We further characterized these RBPs and found common patterns regarding their expression, interaction, and regulation by microRNAs. These analyses suggest four prime candidate oncogenic RBPs with partially validated target potential: APOBEC1, IGF2BP1 and 3, and OASL.
Also flagged:breast cancercell proliferationNotch1c-myctriple negative breast cancerβ-boswellic acid
Journal Article2020-06-11No SnippetsYang K, Zeng L, Ge A, Bao T, Xu T, Xie X, Liu L.
Show Full Abstract
<h4>Background</h4>Xihuang Pill (XHP) is mainly used to treat "Ru Yan (breast cancer)". Evidence-based medical evidence and showed that XHP improves the efficacy of chemotherapy and reduced chemotherapy-induced toxicity in breast cancer patients. However, the mechanism of XHP against breast cancer is not clear.<h4>Methods</h4>The effect of XHP extract on cell half-inhibitory concentration (IC50) and cell viability of MD-MB-231 cells was detected by CCK-8 method. The cell inhibition rate of MDA-MB-453 cells were detected by MTT method. Apoptosis was detected by flow cytometry, cell transfer ability was detected by Transwell method, and cell proliferation ability was detected by colony formation assay. The expression of Notch1, β-catenin and c-myc mRNA in MDA-MB-453 cells were detected by real-time fluorescence quantitative PCR. Then, chemical informatics and transcriptomics methodology was utilized to predict the potential compounds and targets of XHP, and collect triple negative breast cancer (TNBC) genes and the data of <i>Olibanum</i> and β-boswellic acid intervention MD-MB-231 cells (from GSE102891). The cytoscape software was utilized to undergo network construction and network analysis. Finally, the data from the network analysis was imported into the DAVID database for enrichment analysis of signaling pathways and biological processes.<h4>Results</h4>The IC50 was 15.08 g/L (for MD-MB-231 cells). After interfering with MD-MB-231 cells with 15.08 g/L XHP extract for 72 h, compared with the control group, the cell viability, migration and proliferation was significantly decreased, while early apoptosis and late apoptosis were significantly increased (P < 0.01). After interfering with MDA-MB-453 cells with 6 g/L XHP extract for 72 h, compared with the control group, the cell inhibition and apoptosis rate increased, while the expression of Notch1, β-catenin and c-myc mRNA decreased. (P < 0.05). The chemical informatics and transcriptomics analysis showed that four networks were constructed and analyzed: (1) potential compounds-potential targets network of XHP; (2) XHP-TNBC PPI network; (3) DEGs PPI network of <i>Olibanum</i>-treated MD-MB 231 cells; (4) DEGs PPI network of β-boswellic acid -treated MD-MB 231 cells. Several anti-TNBC biological processes, signaling pathways, targets and so on were obtained.<h4>Conclusion</h4>XHP may exert anti-TNBC effects through regulating biological processes, signaling pathways, targets found in this study.
Also flagged:Extracellular VesiclesExtracellularvesiclesdiabetespathogenesisdiabetes mellitus
Journal Article2020-06-11No SnippetsChidester S, Livinski AA, Fish AF, Joseph PV.
Show Full Abstract
Extracellular vesicles (EVs) released by cells throughout the body have been implicated in diabetes pathogenesis. Understanding the role of EVs in regulation of β-cell function and viability may provide insights into diabetes etiology and may lead to the development of more effective screening and diagnostic tools to detect diabetes earlier and prevent disease progression. This review was conducted to determine what is known from the literature about the effect of EV crosstalk on pancreatic β-cell function and viability in the pathogenesis of diabetes mellitus, to perform a gap analysis for future research directions, and to discuss implications of available evidence for diabetes care. The literature search yielded 380 studies from which 31 studies were determined to meet eligibility criteria. The majority of studies had the disease context of autoimmunity in T1DM. The most commonly studied EV crosstalk dynamics involved localized EV-mediated communication between β-cells and other islet cells, or between β-cells and immune cells. Other organs and tissues secreting EVs that affect β-cells include skeletal muscle, hepatocytes, adipocytes, immune cells, bone marrow, vascular endothelium, and mesenchymal stem cells. Characterization of EV cargo molecules with regulatory effects in β-cells was conducted in 24 studies, with primary focus on microRNA cargo. Gaps identified included scarcity of evidence for the effect on β-cell function and viability of EVs from major metabolic organs/tissues such as muscle, liver, and adipose depots. Future research should address these gaps as well as characterize a broader range of EV cargo molecules and their activity in β-cells.
Also flagged:neurodegenerative disordersHuntington's Diseaseubiquitinubiquitin ligasesdegradationProteasome
Journal Article2020-06-11✓ 5 SnippetsSap KA, Reits EA.
In-Text Gene Mentions
S I O 001029)
…Large intracellular Htt aggregates are often called IBs and are detected in the brain of HD-affected patients, especially in the cortex and striatum.…
Introduction)
…A decrease in proteostasis and quality control during aging are thought to play a role in the development and progression of HD, which may explain that the onset of HD starts typically at the 4th decade of life, although the mutant Htt protein is already expressed prior to birth (Arrasate and Finkbeiner, 2012).…
Introduction)
…Concluding, Htt appears to be a target for both the UPS and autophagy, and enhanced selective degradation of mHtt via these pathways might be a therapeutic strategy to prevent or delay the onset of HD, with a key role for ubiquitin to target Htt for degradation.…
Introduction)
…Proteolysis of mHtt results in the formation of different mHtt protein fragments of which the N-terminal exon1 fragment containing the polyQ expansion was found to be the most pathogenic and is also observed in fibrillar aggregates in brains of HD patients (DiFiglia et al., 1997; Schilling et al., 2007; Landles et al., 2010) and overexpression of mutant Htt exon1 results in HD-like symptoms in mice (Mangiarini et al., 1996).…
Discussion)
…While many aspects of the role of ubiquitination in HD, including identification of Htt ubiquitination sites, dynamics of ubiquitin recruitment to IBs, and alterations in the ubiquitinome during HD progression can be studied with current methodologies, various remaining challenges remain to be addressed.…
Show Full Abstract
Many neurodegenerative disorders including Huntington's Disease are hallmarked by intracellular protein aggregates that are decorated by ubiquitin and different ubiquitin ligases and deubiquitinating enzymes. The protein aggregates observed in Huntington's Disease are caused by a polyglutamine expansion in the N-terminus of the huntingtin protein (Htt). Improving the degradation of mutant Htt via the Ubiquitin Proteasome System prior to aggregation would be a therapeutic strategy to delay or prevent the onset of Huntington's Disease for which there is currently no cure. Here we examine the current approaches used to study the ubiquitination of both soluble Htt as well as insolubilized Htt present in aggregates, and we describe what is known about involved (de)ubiquitinating enzymes. Furthermore, we discuss novel methodologies to study the dynamics of Htt ubiquitination in living cells using fluorescent ubiquitin probes, to identify and quantify Htt ubiquitination by mass spectrometry-based approaches, and various approaches to identify involved ubiquitinating enzymes.
Also flagged:Norbornadienesynthesiscyclopentadienemaleimidepolyacrylatespoly(ethylene glycol
Journal Article2020-06-11No SnippetsBailey SJ, Discekici EH, Barbon SM, Nguyen SN, Hawker CJ, de Alaniz JR.
Show Full Abstract
A novel method for facile postpolymerization functionalization of synthetic polymers using terminal norbornadiene (NBD) building blocks is presented. Incorporation of the NBD functionality streamlines the synthesis of a wide array of block polymers utilizing multistep click chemistry strategies. Previously, the use of NBD-functionalized initiators produced polymers that underwent a cascade of Diels-Alder (DA) reactions to unveil a reactive cyclopentadiene (Cp) chain end. When coupled with a maleimide-bearing counterpart, a highly efficient DA cycloaddition with the terminal Cp can occur. To extend this concept to a range of polyacrylates and commercially available poly(ethylene glycol) systems, we developed a novel NBD acid building block for postpolymerization functionalization. Employing this process, we have demonstrated straightforward access to a library of block polymers that leverage this NBD click platform.
bioRxiv2020-06-11Preprint (No Snippets API)Madala BS, Reis ALM, Deveson IW, Rawlinson W, Mercer TR.
Show Full Abstract
<h4>ABSTRACT</h4> DNA synthesis in vitro has enabled the rapid production of reference standards. These are used as controls, and allow measurement and improvement of the accuracy and quality of diagnostic tests. Current reference standards typically represent target genetic material, and act only as positive controls to assess test sensitivity. However, negative controls are also required to evaluate test specificity. Using a pair of chimeric A/B RNA standards, this allowed incorporation of positive and negative controls into diagnostic testing for the Severe Acute Respiratory Syndrome Coronavirus-2 (SARS-CoV-2). The chimeric standards constituted target regions for RT-PCR primer/probe sets that are joined in tandem across two separate synthetic molecules. Accordingly, a target region that is present in standard A provides a positive control, whilst being absent in standard B, thereby providing a negative control. This design enables cross-validation of positive and negative controls between the paired standards in the same reaction, with identical conditions. This enables control and test failures to be distinguished, increasing confidence in the accuracy of results. The chimeric A/B standards were assessed using the US Centers for Disease Control real-time RT-PCR protocol, and showed results congruent with other commercial controls in detecting SARS CoV-2 in patient samples. This chimeric reference standard design approach offers extensive flexibility, allowing representation of diverse genetic features and distantly related sequences, even from different organisms.
Also flagged:ARXACCaristaless related homeoboxCorpus callosum agenesisCentral Nervous Systemcognitive disabilities
Journal Article2020-06-10✓ 2 SnippetsTraversa A, Marchionni E, Giovannetti A, Genovesi ML, Panzironi N, Margiotti K, Napoli G, Piceci Sparascio F, De Luca A, Petrizzelli F, Carella M, Cardona F, Bernardo S, Manganaro L, Mazza T, Pizzuti A, Caputo V.
In-Text Gene Mentions
Introduction)
…penetrant mutations inDCC(DCC netrin 1…
Introduction)
…mutations in DCC (DCC netrin 1 receptornetrin 1 receptor,…
Show Full Abstract
<h4>Background</h4>Corpus callosum agenesis (ACC) is one of the most frequent Central Nervous System (CNS) malformations. However, genetics underlying isolated forms is still poorly recognized. Here, we report on two female familial cases with partial ACC. The proband shows isolated partial ACC and a mild neurodevelopmental phenotype. A fetus from a previous interrupted pregnancy exhibited a complex phenotype including partial ACC and the occurrence of a de novo 17q12 microduplication, which was interpreted as probably disease-causing.<h4>Methods</h4>A trio-based clinical exome sequencing (CES) was performed.<h4>Results</h4>Clinical exome sequencing data analysis led to identifying a heterozygous nonsense variant (NM_139058.3:c.922G>T; NP_620689.1:p.Glu308Ter) in the aristaless related homeobox gene (ARX) in the proband, with a putative de novo occurrence, producing a hypothetical protein lacking two essential domains. Sanger analysis confirmed the wild-type status of both parents in different tissues, and disclosed the occurrence of the nonsense variant in the fetus of the interrupted pregnancy, suggesting a formerly unrecognized contribution of the ARX mutation to the fetus' phenotype and gonadal or gonadosomatic mosaicism in one of the parents.<h4>Conclusion</h4>This study describes the phenotype associated with a heterozygous loss of function variant in ARX. Moreover, it highlights the importance of investigating both chromosomal and genetic contributions in cases of complex syndromic phenotypes involving CNS.
Coronavirus disease 2019 (COVID-19), the clinical syndrome associated with infection by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has impacted nearly every country in the world. Despite an unprecedented focus of scientific investigation, there is a paucity of evidence-based pharmacotherapies against this disease. Because of this lack of data-driven treatment strategies, broad variations in practice patterns have emerged. Observed hypercoagulability in patients with COVID-19 has created debate within the critical care community on the therapeutic utility of heparin. We seek to provide an overview of the data supporting the therapeutic use of heparin, both unfractionated and low molecular weight, as an anticoagulant for the treatment of SARS-CoV-2 infection. Additionally, we review preclinical evidence establishing biological plausibility for heparin and synthetic heparin-like drugs as therapies for COVID-19 through antiviral and anti-inflammatory effects. Finally, we discuss known adverse effects and theoretical off-target effects that may temper enthusiasm for the adoption of heparin as a therapy in COVID-19 without confirmatory prospective randomized controlled trials. Despite previous failures of anticoagulants in critical illness, plausibility of heparin for COVID-19 is sufficiently robust to justify urgent randomized controlled trials to determine the safety and effectiveness of this therapy.
Also flagged:cancerepithelial to mesenchymal transitionoligonucleotidesbreast cancerpolycomb repressive complex 2
Journal Article2020-06-10No SnippetsNguyen TM, Alchalabi S, Oluwatoyosi A, Ropri AS, Herschkowitz JI, Rosen JM.
Show Full Abstract
The purpose of this review is to highlight several areas of lncRNA biology and cancer that we hope will provide some new insights for future research. These include the relationship of lncRNAs and the epithelial to mesenchymal transition (EMT) with a focus on transcriptional and alternative splicing mechanisms and mRNA stability through miRNAs. In addition, we highlight the potential role of enhancer e-lncRNAs, the importance of transposable elements in lncRNA biology, and finally the emerging area of using antisense oligonucleotides (ASOs) and small molecules to target lncRNAs and their therapeutic implications.
<h4>Background</h4>Non-alcoholic fatty liver disease (NAFLD) is a common chronic liver disease characterized by excessive fat accumulation in the liver. One of the underlying pathophysiological mechanisms is insulin resistance (IR). Traditional Chinese medicine (TCM) has showed potential benefits in the management of NAFLD. Lingguizhugan decoction (LGZG) is a representative Chinese herbal formula; however, there is still no rigorous clinical trial supporting its application.<h4>Methods/design</h4>This study will be a three-arm, dose-optimization, randomized, double-blinded, placebo-controlled clinical trial. A total of 243 patients with NAFLD will be recruited and randomly assigned to the standard dose LGZG (SLGD) group, low dose LGZG (LLGD) group, or the placebo group based on a ratio of 1:1:1. The treatment period will be 12 weeks and the follow-up period will last 4 weeks. The primary outcome will be the proportions of participants with at least a 1-unit decrease of HOMA-IR from baseline to 12 weeks. Secondary outcomes will include the changes of body weight, body mass index, liver function, blood lipid metabolism, blood glucose metabolism, inflammatory responses, liver-kidney echo ratio by ultrasound, and various scales. Biological samples will also be collected for future researches on mechanism exploration.<h4>Discussion</h4>This study will provide initial evidence regarding the efficacy and safety of LGZG in the treatment of NAFLD with spleen-yang deficiency pattern and promote its application in community healthcare centers. In addition, potential mechanisms will be explored based on studies of oral and gut microbiota.<h4>Trial registration</h4>Chinese Clinical Trial Registry, ChiCTR1800014364. Registered on 1 January 2018. The final protocol version was V3.0.
Also flagged:neuropsychiatric disorderscongenital heart diseaseschizophreniaepileptic encephalopathiesintellectual disabilitycomplex
Journal Article2020-06-10No SnippetsNguyen TH, Dobbyn A, Brown RC, Riley BP, Buxbaum JD, Pinto D, Purcell SM, Sullivan PF, He X, Stahl EA.
Show Full Abstract
Joint analysis of multiple traits can result in the identification of associations not found through the analysis of each trait in isolation. Studies of neuropsychiatric disorders and congenital heart disease (CHD) which use de novo mutations (DNMs) from parent-offspring trios have reported multiple putatively causal genes. However, a joint analysis method designed to integrate DNMs from multiple studies has yet to be implemented. We here introduce multiple-trait TADA (mTADA) which jointly analyzes two traits using DNMs from non-overlapping family samples. We first demonstrate that mTADA is able to leverage genetic overlaps to increase the statistical power of risk-gene identification. We then apply mTADA to large datasets of >13,000 trios for five neuropsychiatric disorders and CHD. We report additional risk genes for schizophrenia, epileptic encephalopathies and CHD. We outline some shared and specific biological information of intellectual disability and CHD by conducting systems biology analyses of genes prioritized by mTADA.
Also flagged:mRNAthe16S rRNA16S rRNAsymbiosisinfectious diseasesAlloiococcus otitis
Journal Article2020-06-10No SnippetsDekaboruah E, Suryavanshi MV, Chettri D, Verma AK.
Show Full Abstract
Human body is inhabited by vast number of microorganisms which form a complex ecological community and influence the human physiology, in the aspect of both health and diseases. These microbes show a relationship with the human immune system based on coevolution and, therefore, have a tremendous potential to contribute to the metabolic function, protection against the pathogen and in providing nutrients and energy. However, of these microbes, many carry out some functions that play a crucial role in the host physiology and may even cause diseases. The introduction of new molecular technologies such as transcriptomics, metagenomics and metabolomics has contributed to the upliftment on the findings of the microbiome linked to the humans in the recent past. These rapidly developing technologies are boosting our capacity to understand about the human body-associated microbiome and its association with the human health. The highlights of this review are inclusion of how to derive microbiome data and the interaction between human and associated microbiome to provide an insight on the role played by the microbiome in biological processes of the human body as well as the development of major human diseases.
Journal Article2020-06-10✓ 3 SnippetsSalamon A, Maszlag-Török R, Veres G, Boros FA, Vágvölgyi-Sümegi E, Somogyi A, Vécsei L, Klivényi P, Zádori D.
In-Text Gene Mentions
Introduction)
…Parker et al. were the first who demonstrated that Sir2 overexpression and resveratrol (RESV) treatment (one of the most important non-selective Sirtuin inducer) could delay the development of neuronal dysfunction in a Caenorhabditis elegans model of HD (Htt N-terminal fragment, 128Q) in vivo [42].…
Introduction)
…encoding Huntington protein (Htt) which has an…
Introduction)
…model of HD (HttN-terminal fragment, 128Q)…
Show Full Abstract
The potential role of Sirt1 and Sirt2 subtypes of Sirtuins (class III NAD<sup>+</sup>-dependent deacetylases) in the pathogenesis of Huntington's disease (HD) has been extensively studied yielding some controversial results. However, data regarding the involvement of Sirt3 and their variants in HD are considerably limited. The aim of this study was to assess the expression pattern of Sirt1 and three Sirt3 mRNA isoforms (Sirt3-M1/2/3) in the striatum, cortex and cerebellum in respect of the effect of gender, age and the presence of the transgene using the N171-82Q transgenic mouse model of HD. Striatal, cortical and cerebellar Sirt1-Fl and Sirt3-M1/2/3 mRNA levels were measured in 8, 12 and 16 weeks old N171-82Q transgenic mice and in their wild-type littermates. Regarding the striatum and cortex, the presence of the transgene resulted in a significant increase in Sirt3-M3 and Sirt1 mRNA levels, respectively, whereas in case of the cerebellum the transgene resulted in increased expression of all the assessed subtypes and isoforms. Aging exerted minor influence on Sirt mRNA expression levels, both in transgene carriers and in their wild-type littermates, and there was no interaction between the presence of the transgene and aging. Furthermore, there was no difference between genders. The unequivocal cerebellar Sirtuin activation with presumed compensatory role suggests that the cerebellum might be another key player in HD in addition to the most severely affected striatum. The mitochondrially acting Sirt3 may serve as an interesting novel therapeutic target in this deleterious condition.
Also flagged:AndrogenProstate Cancerprostate adenocarcinomatumorandrogen receptorβIII-tubulin
Journal Article2020-06-10✓ 1 SnippetSánchez BG, Bort A, Vara-Ciruelos D, Díaz-Laviada I.
In-Text Gene Mentions
Introduction)
…the expression ofSox6and Sox9 differentiation…
Show Full Abstract
In the past few years, cell plasticity has emerged as a mode of targeted therapy evasion in prostate adenocarcinoma. When exposed to anticancer therapies, tumor cells may switch into a different histological subtype, such as the neuroendocrine phenotype which is associated with treatment failure and a poor prognosis. In this study, we demonstrated that long-term androgen signal depletion of prostate LNCaP cells induced a neuroendocrine phenotype followed by re-differentiation towards a "stem-like" state. LNCaP cells incubated for 30 days in charcoal-stripped medium or with the androgen receptor antagonist 2-hydroxyflutamide developed neuroendocrine morphology and increased the expression of the neuroendocrine markers βIII-tubulin and neuron specific enolase (NSE). When cells were incubated for 90 days in androgen-depleted medium, they grew as floating spheres and had enhanced expression of the stem cell markers CD133, ALDH1A1, and the transporter ABCB1A. Additionally, the pluripotent transcription factors Nanog and Oct4 and the angiogenic factor VEGF were up-regulated while the expression of E-cadherin was inhibited. Cell viability revealed that those cells were resistant to docetaxel and 2-hidroxyflutamide. Mechanistically, androgen depletion induced the decrease in AMP-activated kinase (AMPK) expression and activation and stabilization of the hypoxia-inducible factor HIF-1α. Overexpression of AMPK in the stem-like cells decreased the expression of stem markers as well as that of HIF-1α and VEGF while it restored the levels of E-cadherin and PGC-1α. Most importantly, docetaxel sensitivity was restored in stem-like AMPK-transfected cells. Our model provides a new regulatory mechanism of prostate cancer plasticity through AMPK that is worth exploring.
There are still controversies regarding the correlation between the beneficial effects for health and the administration of isolated compounds or crude extracts in therapeutic applications. <i>Campomanesia xanthocarpa</i>, found in the Brazilian Cerrado, demonstrated beneficial effects in metabolic disorders associated with obesity. We investigated the effects of <i>Campomanesia xanthocarpa</i> hydroethanolic extract and two isolated substances from the extract (S1 and S2) in a diet-induced obesity (DIO) model. Male Swiss mice were divided into five groups: (1) American Institute of Nutrition (AIN-93M) diet, (2) high-fat diet (HF), (3) HF supplemented with <i>C. xanthocarpa</i> hydroethanolic leaf extract at 100 mg/kg (HFE), (4) HF supplemented with S1 at 1 mg/kg (HFS1) and (5) HF supplemented with S2 at 1 mg/kg (HFS2). The HFS1, HFS2 and HFE groups did not present decreasing body weight or visceral adiposity gain. No differences in glycemic and lipid parameters, or in the expression of protein content in two cytokines, interleukin-6 (IL-6) and anti-inflammatory (IL-10), were observed. Only the HFS1 group displayed decreased food intake. Even though substantial effects such as an improvement in obesity features or the metabolic and histological parameters promoted by S1, S2 and the extract were not observed, further investigations are necessary to evaluate the principal genes and protein expressions involved in regulating food behavior promoted by S1.
Also flagged:cyclic guanosine monophosphate-adenosine monophosphatecGAMP) synthasecGASimmune responsesstimulator of interferonSTING
Journal Article2020-06-10✓ 3 SnippetsCheng Z, Dai T, He X, Zhang Z, Xie F, Wang S, Zhang L, Zhou F.
In-Text Gene Mentions
S I O 001029)
…In response to stimuli, the interactions of cGAS with histone deacetylase 3 (HDAC3), cytosolic carboxypeptidase 5 (CCP5), and CCP6 are enhanced, leading to the removal of inhibitory acetylation, monoglutamylation and polyglutamylation, respectively.83,84 Meanwhile, the monoubiquitination exerted by tripartite motif-containing 56 (TRIM56) and K27-linked polyubiquitination at K384 exerted by ring finger protein 185 (RNF185), occuring in residues that were previously occupied by inhibitory acetylation, result in enhanced sensing and enzymatic activity of cGAS.84,87,88 Furthermore, sumoylation catalysed by TRIM38 at K464 of m-cGAS (K479 being the corresponding residue in h-cGAS) stabilises it during early infection by preventing K48-linked polyubiquitination at the same lysine residue.…
Introduction)
…sumoylation catalysed byTRIM38at K464 of…
Introduction)
…be sumoylated byTRIM38, leading to enhanced…
Show Full Abstract
Cytosolic DNA is an indicator of pathogen invasion or DNA damage. The cytosolic DNA sensor cyclic guanosine monophosphate-adenosine monophosphate (cGAMP) synthase (cGAS) detects DNA and then mediates downstream immune responses through the molecule stimulator of interferon genes (STING, also known as MITA, MPYS, ERIS and TMEM173). Recent studies focusing on the roles of the cGAS-STING pathway in evolutionary distant species have partly sketched how the mammalian cGAS-STING pathways are shaped and have revealed its evolutionarily conserved mechanism in combating pathogens. Both this pathway and pathogens have developed sophisticated strategies to counteract each other for their survival. Here, we summarise current knowledge on the interactions between the cGAS-STING pathway and pathogens from both evolutionary and mechanistic perspectives. Deeper insight into these interactions might enable us to clarify the pathogenesis of certain infectious diseases and better harness the cGAS-STING pathway for antimicrobial methods.
Also flagged:agingneurodegenerative disorderPDneurodegenerative syndromeparalysis agitanspostural instability
Journal Article2020-06-10No SnippetsLi S, Liu H, Bian S, Sha X, Li Y, Wang Y.
Show Full Abstract
<h4>Background</h4>Late-onset Parkinson's disease (LOPD) is a common neurodegenerative disorder and lacks disease-modifying treatments, attracting major attentions as the aggravating trend of aging population. There were numerous evidences supported that accelerated aging was the primary risk factor for LOPD, thus pointed out that the mechanisms of PD should be revealed thoroughly based on aging acceleration. However, how PD was triggered by accelerated aging remained unclear and the systematic prediction model was needed to study the mechanisms of PD.<h4>Results</h4>In this paper, an improved PD predictor was presented by comparing with the normal aging process, and both aging and PD markers were identified herein using machine learning methods. Based on the aging scores, the aging acceleration network was constructed thereby, where the enrichment analysis shed light on key characteristics of LOPD. As a result, dysregulated energy metabolisms, the cell apoptosis, neuroinflammation and the ion imbalances were identified as crucial factors linking accelerated aging and PD coordinately, along with dysfunctions in the immune system.<h4>Conclusions</h4>In short, mechanisms between aging and LOPD were integrated by our computational pipeline.
Also flagged:central chondrosarcomabone tumortumorchondrosarcomatumorsChondrosarcomas
Journal Article2020-06-10No SnippetsParafioriti A, Cifola I, Gissi C, Pinatel E, Vilardo L, Armiraglio E, Di Bernardo A, Daolio PA, Felsani A, D'Agnano I, Berardi AC.
Show Full Abstract
Conventional central chondrosarcoma (CCC) is a malignant bone tumor that is characterized by the production of chondroid tissue. Since radiation therapy and chemotherapy have limited effects on CCC, treatment of most patients depends on surgical resection. This study aimed to identify the expression profiles of microRNAs (miRNAs) and isomiRs in CCC tissues to highlight their possible participation to the regulation of pathways critical for the formation and growth of this type of tumor. Our study analyzed miRNAs and isomiRs from Grade I (GI), Grade II (GII), and Grade III (GIII) histologically validated CCC tissue samples. While the different histological grades shared a similar expression profile for the top abundant miRNAs, we found several microRNAs and isomiRs showing a strong different modulation in GII + GIII vs GI grade samples and their involvement in tumor biology could be consistently hypothesized. We then in silico validated these differently expressed miRNAs in a larger chondrosarcoma public dataset and confirmed the expression trend for 17 out of 34 miRNAs. Our results clearly suggests that the contribution of miRNA deregulation, and their targeted pathways, to the progression of CCC could be relevant and strongly indicates that when studying miRNA deregulation in tumors, not only the canonical miRNAs, but the whole set of corresponding isomiRs should be taken in account. Improving understanding of the precise roles of miRNAs and isomiRs over the course of central chondrosarcoma progression could help identifying possible targets for precision medicine therapeutic intervention.
Also flagged:defectsaginglytic infectionvirionsextracellularlatent infection
Journal Article2020-06-10✓ 1 SnippetLee CH, Grey F.
In-Text Gene Mentions
S I O 001029)
…The authors followed up on one of the candidates, an RNA-binding protein Roquin encoded by the RC3H1 gene, and showed that the expression of Roquin is induced by HCMV and is required for efficient productive infection.…
Show Full Abstract
Human Cytomegalovirus (HCMV) is a highly prevalent herpesvirus, persistently infecting between 30 and 100% of the population, depending on socio-economic status (Fields et al., 2013). HCMV remains an important clinical pathogen accounting for more than 60% of complications associated with solid organ transplant patients (Kotton, 2013; Kowalsky et al., 2013; Bruminhent and Razonable, 2014). It is also the leading cause of infectious congenital birth defects and has been linked to chronic inflammation and immune aging (Ballard et al., 1979; Griffith et al., 2016; Jergovic et al., 2019). There is currently no effective vaccine and HCMV antivirals have significant side effects. As current antivirals target viral genes, the virus can develop resistance, reducing drug efficacy. There is therefore an urgent need for new antiviral agents that are effective against HCMV, have better toxicity profiles and are less vulnerable to the emergence of resistant strains. Targeting of host factors that are critical to virus replication is a potential strategy for the development of novel antivirals that circumvent the development of viral resistance. Systematic high throughput approaches provide powerful methods for the identification of novel host-virus interactions. As well as contributing to our basic understanding of virus and cell biology, such studies provide potential targets for the development of novel antiviral agents. High-throughput studies, such as RNA sequencing, proteomics, and RNA interference screens, are useful tools to identify HCMV-induced global changes in host mRNA and protein expression levels and host factors important for virus replication. Here, we summarize new findings on HCMV lytic infection from high-throughput studies since 2014 and how screening approaches have evolved.
Also flagged:Magnesiumdegradationhydroxyapatitehydrogenfluoridewater
Journal Article2020-06-10No SnippetsRahman M, Dutta NK, Roy Choudhury N.
Show Full Abstract
Magnesium (Mg) based biodegradable materials are a new generation orthopedic implant materials that are intended to possess same mechanical properties as that of bone. Mg alloys are considered as promising substitutes to permanent implants due to their biodegradability in the physiological environment. However, rapid corrosion rate is one of the major constraints of using Mg alloys in clinical applications in spite of their excellent biocompatibility. Approaches to overcome the limitations include the selection of adequate alloying elements, proper surface treatment, surface modification with coating to control the degradation rate. This review focuses on current advances on surface engineering of Mg based biomaterials for biomedical applications. The review begins with a description of corrosion mechanism of Mg alloy, the requirement for appropriate surface functionalization/coatings, their structure-property-performance relationship, and suitability for biomedical applications. The control of physico-chemical properties such as wettability, surface morphology, surface chemistry, and surface functional groups of the coating tailored by various approaches forms the pivotal part of the review. Chemical surface treatment offers initial protection from corrosion and inorganic coating like hydroxyapatite (HA) improves the biocompatibility of the substrate. Considering the demand of ideal implant materials, multilayer hybrid coatings on Mg alloy in combination with chemical pretreatment or inorganic HA coating, and protein-based polymer coating could be a promising technique to improve corrosion resistance and promote biocompatibility of Mg-based alloys.
Also flagged:ATG8AutophagymembraneLC3membranespost-translational modifications
Journal Article2020-06-10No SnippetsSora V, Kumar M, Maiani E, Lambrughi M, Tiberti M, Papaleo E.
Show Full Abstract
Autophagy is a conserved and essential intracellular mechanism for the removal of damaged components. Since autophagy deregulation is linked to different kinds of pathologies, it is fundamental to gain knowledge on the fine molecular and structural details related to the core proteins of the autophagy machinery. Among these, the family of human ATG8 proteins plays a central role in recruiting other proteins to the different membrane structures involved in the autophagic pathway. Several experimental structures are available for the members of the ATG8 family alone or in complex with their different biological partners, including disordered regions of proteins containing a short linear motif called LC3 interacting motif. Recently, the first structural details of the interaction of ATG8 proteins with biological membranes came into light. The availability of structural data for human ATG8 proteins has been paving the way for studies on their structure-function-dynamic relationship using biomolecular simulations. Experimental and computational structural biology can help to address several outstanding questions on the mechanism of human ATG8 proteins, including their specificity toward different interactors, their association with membranes, the heterogeneity of their conformational ensemble, and their regulation by post-translational modifications. We here summarize the main results collected so far and discuss the future perspectives within the field and the knowledge gaps. Our review can serve as a roadmap for future structural and dynamics studies of the ATG8 family members in health and disease.
Also flagged:chitosanvinyl alcoholOsteoarthritisOAchronic inflammatory joint diseasecartilage degeneration
Journal Article2020-06-10✓ 1 SnippetNour-Eldeen G, Abdel-Rasheed M, El-Rafei AM, Azmy O, El-Bassyouni GT.
In-Text Gene Mentions
Discussion)
…loss of Sox5,Sox6, Sox9, Col2a1 and…
Show Full Abstract
Osteoarthritis (OA) has been defined as a chronic inflammatory joint disease characterized by progressive articular cartilage degeneration. Recently growing interest in regenerative medicine, using cell therapy and tissue engineering, where cellular components in combination with engineered scaffolds and bioactive materials were used to induce functional tissue regeneration. In the present study, nanofibrous scaffold based on chitosan (CS)/poly (vinyl alcohol) (PVA) were used to develop biologically functionalized biomaterial to mimic the extracellular matrix, allowing the human adipose tissue derived mesenchymal stem cells (ADSCs) to proliferate and differentiate to chondrogenic cells. The morphology of the nanofibrous mat was examined using field emission scanning electron microscope (FE/SEM). The characteristic functional groups and the nature of the chemical bonds between atoms were evaluated using Fourier transform infrared spectroscopy (FTIR) spectrum. Characterization of the seeded cells was morphologically evaluated by scanning electron microscopy and by flow cytometry for the expression of the stem cell surface markers. The differentiation potential was verified after chondrogenic induction by analyzing the expression of chondrogenic marker genes using real-time (RT PCR). Current study suggest significant potential for the use of ADSCs with the nanofibrous scaffolds in improving the osteoarthritis pathology.
Also flagged:cardiovascular diseaseCVDextracellularvesicleslipidmembrane
Journal Article2020-06-10✓ 1 SnippetGuo D, Xu Y, Ding J, Dong J, Jia N, Li Y, Zhang M.
In-Text Gene Mentions
Methods)
…effects, by targetingSOX6, activating AKT, and…
Show Full Abstract
Despite substantial improvements in therapeutic strategies, cardiovascular disease (CVD) is still among the leading causes of mortality and morbidity worldwide. Exosomes, extracellular vesicles with a lipid bilayer membrane of endosomal origin, have been the focus of a large body of research in CVD. Exosomes not only serve as carriers for signal molecules responsible for intercellular and interorgan communication underlying CVD pathophysiology but also are bioactive agents which are partly responsible for the therapeutic effect of stem cell therapy of CVD. We here review recent insights gained into the role of exosomes in apoptosis, hypertrophy, angiogenesis, fibrosis, and inflammation in CVD pathophysiology and progression and the application and mechanisms of exosomes as therapeutic agents for CVD.
Also flagged:retinal degenerationUsherinautosomal recessive retinitis pigmentosaRPUsher syndromehearing
Journal Article2020-06-10✓ 2 SnippetsYu D, Zou J, Chen Q, Zhu T, Sui R, Yang J.
In-Text Gene Mentions
Results)
…in colorectal cancer (DCC), 5x83.1 ( Table…
Results)
…neogenin (4pln.1.C) andDCC(5x83.1), two netrin…
Show Full Abstract
Usherin is the most common causative protein associated with autosomal recessive retinitis pigmentosa (RP) and Usher syndrome (USH), which are characterized by retinal degeneration alone and in combination with hearing loss, respectively. Usherin is essential for photoreceptor survival and hair cell bundle integrity. However, the molecular mechanism underlying usherin function in normal and disease conditions is unclear. In this study, we investigated structural models of usherin domains and localization of usherin pathogenic small in-frame mutations, mainly homozygous missense mutations. We found that usherin fibronectin III (FN3) domains and most laminin-related domains have a β-sandwich structure. Some FN3 domains are predicted to interact with each other and with laminin-related domains. The usherin protein may bend at some FN3 linker regions. RP- and USH-associated small in-frame mutations are differentially located in usherin domains. Most of them are located at the periphery of β-sandwiches, with some at the interface between interacting domains. The usherin laminin epidermal growth factor repeats adopt a rod-shaped structure, which is maintained by disulfide bonds. Most missense mutations and deletion of exon 13 in this region disrupt the disulfide bonds and may affect local protein folding. Despite low expression of the recombinant entire protein and protein fragments in mammalian cell culture, usherin FN3 fragments are more robustly expressed and secreted than its laminin-related fragments. Our findings provide new insights into the usherin structure and the disease mechanisms caused by pathogenic small in-frame mutations, which will help inform future experimental research on diagnosis, disease mechanisms, and therapeutic approaches.
Heparins are the most pharmaceutically important polysaccharides. These heparin-based anticoagulant/antithrombotic agents include unfractionated heparins, low molecular weight heparins (LMWHs) and ultralow molecular weight heparins (ULMWHs). Heparins exhibit their pharmacological and biological activities through interaction with heparin-binding proteins. The prototypical heparin-binding protein is antithrombin III (AT), responsible for heparin's anticoagulant/antithrombotic activity. This study describes a filter-trapping method to isolate the chains in enoxaparin, a LMWH, which bind to AT. We demonstrate this method using the ULMWH, fondaparinux, which consists of a single well defined AT binding site. The interacting chains of enoxaparin are then characterized by activity assays, top-down liquid chromatography-mass spectrometry, and capillary zone electrophoresis mass spectrometry. This filter-trapping assay is an improvement over affinity chromatography for isolating heparin chains interacting with heparin binding proteins.
Neurodegenerative diseases (NDs) are a heterogeneous group of aging-associated disorders characterized by the disruption of cellular proteostasis machinery and the misfolding of distinct protein species to form toxic aggregates in neurons. The increasing prevalence of NDs represents a growing healthcare burden worldwide, a concern compounded by the fact that few, if any, treatments exist to target the underlying cause of these diseases. Consequently, the application of a high-throughput, physiologically relevant model system to studies dissecting the molecular mechanisms governing ND pathology is crucial for identifying novel avenues for the development of targeted therapeutics. The nematode <i>Caenorhabditis elegans</i> (<i>C. elegans</i>) has emerged as a powerful tool for the study of disease mechanisms due to its ease of genetic manipulation and swift cultivation, while providing a whole-animal system amendable to numerous molecular and biochemical techniques. To date, numerous <i>C. elegans</i> models have been generated for a variety of NDs, allowing for the large-scale <i>in vivo</i> study of protein-conformation disorders. Furthermore, the comparatively low barriers to entry in the development of transgenic worm models have facilitated the modeling of rare or "orphan" NDs, thereby providing unparalleled insight into the shared mechanisms underlying these pathologies. In this review, we summarize findings from a comprehensive collection of <i>C. elegans</i> neurodegenerative disease models of varying prevalence to emphasize shared mechanisms of proteotoxicity, and highlight the utility of these models in elucidating the molecular basis of ND pathologies.
Also flagged:imineethoxyhydroxybenzaldehydeepoxidescarbonates
Journal Article2020-06-10✓ 1 SnippetTaniya S, Khanra S, Ta S, Chatterjee S, Salam N, Das D.
In-Text Gene Mentions
Introduction)
…may lead tohemochromatosisand Parkinson's disease.…
Show Full Abstract
A dinuclear Fe(iii) complex (F1) of an imine derivative (L1) derived from 3-ethoxy-2-hydroxy-benzaldehyde and hydrazine, structurally characterised <i>via</i> single crystal X-ray studies, is employed for the catalytic conversion of epoxides to cyclic carbonates utilizing carbon dioxide. In addition, F1 is employed for the selective optical recognition of nano-molar levels of Zn<sup>2+</sup> (42.23 nM) <i>via</i> a metal displacement approach. The Job plot reveals interactions between F1 and Zn<sup>2+</sup> at a 1 : 3 molar ratio with an association constant of 7.71 × 10<sup>4</sup> M<sup>-1</sup>. Studies on the catecholase-like activity of F1 reveal a <i>k</i> <sub>cat</sub> value of 4.42 × 10<sup>3</sup> h<sup>-1</sup>.
bioRxiv2020-06-10Preprint (No Snippets API)Hopp M, Domingo-Fernández D, Gadiya Y, Detzel MS, Schmalohr BF, Steinbock F, Imhof D, Hofmann-Apitius M.
Show Full Abstract
The SARS-CoV-2 outbreak was recently declared a worldwide pandemic. Infection triggers the respiratory tract disease COVID-19, which is accompanied by serious changes of clinical biomarkers such as hemoglobin and interleukins. The same parameters are altered during hemolysis, which is characterized by an increase in labile heme. We present two approaches that aim at analyzing a potential link between available heme and COVID-19 pathogenesis. Four COVID-19 related proteins, i.e. the host cell proteins ACE2 and TMPRSS2 as well as the viral protein 7a and S protein, were identified as potential heme binders. We also performed a detailed analysis of the common pathways induced by heme and SARS-CoV-2 by superimposition of knowledge graphs covering heme biology and COVID-19 pathophysiology. Herein, focus was laid on inflammatory pathways, and distinct biomarkers as the linking elements. Finally, the results substantially improve our understanding of COVID-19 infections and disease progression of patients with different clinical backgrounds and expand the diagnostic and treatment options.
Also flagged:CancerProstate Cancercancer-related fatigueautophagyCRFGene
expression
Journal Article2020-06-09✓ 1 SnippetDickinson K, Case AJ, Kupzyk K, Saligan L.
In-Text Gene Mentions
Text
…PRDX6…
Show Full Abstract
The pathobiology of cancer-related fatigue (CRF) remains elusive, hindering the development of targeted treatments. Radiation therapy (RT), a common treatment for men with prostate cancer, induces cell damage through the generation of free radicals and oxidative stress. We hypothesized that disruption in cellular responses to this surge of nonphysiological oxidative stress might contribute to CRF in men with prostate cancer treated with RT. We evaluated the potential role of three cell damage pathways (apoptosis, autophagy, necrosis) and oxidative stress in CRF in men with prostate cancer receiving RT. Fatigue was measured by the Functional Assessment of Cancer Therapy-Fatigue (FACT-F) questionnaire. Gene expression was measured in whole blood using RT<sup>2</sup> profiler™ PCR arrays. Data were collected at two time points: either baseline or Day 1 of treatment (T1) and completion of treatment (T2). Participants were grouped into either the fatigued or nonfatigued phenotype at T2 using the recommended FACT-F cut-off score for clinical significance. We observed significant upregulation of seven genes related to three cell damage pathways in the fatigued group from T1 to T2 and no significant changes in the nonfatigued group. We also observed significant downregulation of two genes related to oxidative stress in the fatigued group compared to the nonfatigued group at T2. These collective results provide preliminary evidence that cell damage might be upregulated in the CRF phenotype. Validation of these findings using a larger and more diverse sample is warranted.
Also flagged:FAM20BB3GALT6EXTL2synthesischondroitinsulfate
Journal Article2020-06-09✓ 3 SnippetsLei J, Deng H, Ran Y, Lv Y, Amhare AF, Wang L, Guo X, Han J, Lammi MJ.
In-Text Gene Mentions
Abstract)
…along with FAM20B,GalT-II, and EXTL2, which…
Abstract)
…modifying enzymes FAM20B,GalT-II, and EXTL2 decreased…
Text
…GalT-II…
Show Full Abstract
<h4>Objective</h4>The objective of this study was to investigate the expression of enzymes involved in synthesis and modification of chondroitin sulfate (CS) in knee cartilage tissue of patients with osteoarthritis (OA) and Kashin-Beck disease (KBD).<h4>Methods</h4>The knee articular cartilage samples were obtained from 18 age- and gender-matched donors with 6 each in KBD, OA, and control groups. Hematoxylin and eosin (HE) staining, toluidine blue (TB) staining, and immunohistochemical (IHC) staining were performed to estimate the expression level and localization of aggrecan, along with FAM20B, GalT-II, and EXTL2, which are associated with CS synthesis and modification. Rank-based analyses of variance test was used for the multiple comparisons of discrepancy in the positive staining rate among the 3 groups.<h4>Results</h4>In HE and TB staining results, damaged morphology, decreased chondrocyte numbers and proteoglycans were observed in OA and KBD groups compared with the control group. In line with these trends, the positive staining rates of aggrecan were lower in KBD and OA groups than in the control group. Meanwhile, the positive staining rates of CS chain modifying enzymes FAM20B, GalT-II, and EXTL2 decreased in OA and KBD groups.<h4>Conclusions</h4>In conclusion, it was demonstrated that altered expression of CS chain modifying enzymes in OA and KBD groups influenced the synthesis procession of CS and could contribute to the damage of cartilage. Further investigation of these enzymes can provide new theoretical and experimental targets for OA and KBD pathogenesis studies.
Triple-negative breast cancer (TNBC), a specific subtype of breast cancer that does not express estrogen receptor (ER), progesterone receptor (PR), or human epidermal growth factor receptor 2 (HER-2), has clinical features that include high invasiveness, high metastatic potential, proneness to relapse, and poor prognosis. Because TNBC tumors lack ER, PR, and HER2 expression, they are not sensitive to endocrine therapy or HER2 treatment, and standardized TNBC treatment regimens are still lacking. Therefore, development of new TNBC treatment strategies has become an urgent clinical need. By summarizing existing treatment regimens, therapeutic drugs, and their efficacy for different TNBC subtypes and reviewing some new preclinical studies and targeted treatment regimens for TNBC, this paper aims to provide new ideas for TNBC treatment.
The sequential generation of layer-specific cortical neurons requires radial glia cells (RGCs) to precisely balance self-renewal and lineage commitment. While specific cell-cycle phases have been associated with these decisions, the mechanisms linking the cell-cycle machinery to cell-fate commitment remain obscure. Using single-cell RNA-sequencing, we find that the strongest transcriptional signature defining multipotent RGCs is that of G2/M-phase, and particularly CYCLIN-B1/2, while lineage-committed progenitors are enriched in G1/S-phase genes, including CYCLIN-D1. These data also reveal cell-surface markers that allow us to isolate RGCs and lineage-committed progenitors, and functionally confirm the relationship between cell-cycle phase enrichment and cell fate competence. Finally, we use cortical electroporation to demonstrate that CYCLIN-B1/2 cooperate with CDK1 to maintain uncommitted RGCs by activating the NOTCH pathway, and that CYCLIN-D1 promotes differentiation. Thus, this work establishes that cell-cycle phase-specific regulators act in opposition to coordinate the self-renewal and lineage commitment of RGCs via core stem cell regulatory pathways.
Also flagged:serotoninlumenserotonin transporterSERTgene expressionserotonin receptor
Journal Article2020-06-09No SnippetsKumar A, Russell RM, Pifer R, Menezes-Garcia Z, Cuesta S, Narayanan S, MacMillan JB, Sperandio V.
Show Full Abstract
The gut-brain axis is crucial to microbial-host interactions. The neurotransmitter serotonin is primarily synthesized in the gastrointestinal (GI) tract, where it is secreted into the lumen and subsequently removed by the serotonin transporter, SERT. Here, we show that serotonin decreases virulence gene expression by enterohemorrhagic E. coli (EHEC) and Citrobacter rodentium, a murine model for EHEC. The membrane-bound histidine sensor kinase, CpxA, is a bacterial serotonin receptor. Serotonin induces dephosphorylation of CpxA, which inactivates the transcriptional factor CpxR controlling expression of virulence genes, notably those within the locus of enterocyte effacement (LEE). Increasing intestinal serotonin by genetically or pharmacologically inhibiting SERT decreases LEE expression and reduces C. rodentium loads. Conversely, inhibiting serotonin synthesis increases pathogenesis and decreases host survival. As other enteric bacteria contain CpxA, this signal exploitation may be engaged by other pathogens. Additionally, repurposing serotonin agonists to inhibit CpxA may represent a potential therapeutic intervention for enteric bacteria.
Obesity contributes significantly to the global health burden. A better understanding of adipogenesis, the process of fat formation, may lead to the discovery of novel treatment strategies. However, it is of concern that the regulation of adipocyte differentiation has predominantly been studied using the murine 3T3-L1 preadipocyte cell line and murine experimental animal models. Translation of these findings to the human setting requires confirmation using experimental models of human origin. The ability of mesenchymal stromal/stem cells (MSCs) to differentiate into adipocytes is an attractive model to study adipogenesis in vitro. Differences in the ability of MSCs isolated from different sources to undergo adipogenic differentiation, may be useful in investigating elements responsible for regulating adipogenic differentiation potential. Genes involved may be divided into three broad categories: early, intermediate and late-stage regulators. Preadipocyte factor-1 (Pref-1) is an early negative regulator of adipogenic differentiation. In this review, we briefly discuss the adipogenic differentiation potential of MSCs derived from two different sources, namely adipose-derived stromal/stem cells (ASCs) and Wharton's Jelly derived stromal/stem cells (WJSCs). We then discuss the function and suggested mechanisms of action of Pref-1 in regulating adipogenesis, as well as current findings regarding Pref-1's role in human adipogenesis.
The severe respiratory disease COVID-19 was initially reported in Wuhan, China, in December 2019, and spread into many provinces from Wuhan. The corresponding pathogen was soon identified as a novel coronavirus named SARS-CoV-2 (formerly, 2019-nCoV). As of 2 May, 2020, over 3 million COVID-19 cases had been confirmed, and 235,290 deaths had been reported globally, and the numbers are still increasing. It is important to understand the phylogenetic relationship between SARS-CoV-2 and known coronaviruses, and to identify its hosts for preventing the next round of emergency outbreak. In this study, we employ an effective alignment-free approach, the Natural Vector method, to analyze the phylogeny and classify the coronaviruses based on genomic and protein data. Our results show that SARS-CoV-2 is closely related to, but distinct from the SARS-CoV branch. By analyzing the genetic distances from the SARS-CoV-2 strain to the coronaviruses residing in animal hosts, we establish that the most possible transmission path originates from bats to pangolins to humans.
Neurodegenerative diseases are commonly generated by intracellular accumulation of misfolded/aggregated mutated proteins. These abnormal protein aggregates impair the functions of mitochondria and induce oxidative stress, thereby resulting in neuronal cell death. In turn, neuronal damage induces chronic inflammation and neurodegeneration. Thus, reducing/eliminating these abnormal protein aggregates is a priority for any anti-neurodegenerative therapeutic approach. Although several antibodies against mutated neuronal proteins have been already developed, how to efficiently deliver them inside the target cells remains an unmet issue. Extracellular vesicles/exosomes incorporating intrabodies against the pathogenic products would be a tool for innovative therapeutic approaches. In this review/perspective article, we identify and describe the major molecular targets associated with neurodegenerative diseases, as well as the antibodies already developed against them. Finally, we propose a novel targeting strategy based on the endogenous engineering of extracellular vesicles/exosomes constitutively released by cells of the central nervous system.
MicroRNAs (miRNAs) regulate cartilage differentiation and contribute to the onset and progression of joint degeneration. These small RNA molecules may affect extracellular matrix organization (ECM) in cartilage, but for only a few miRNAs has this role been defined <i>in vivo</i>. Previously, we showed that cartilage-specific genetic ablation of the Mirc24 cluster in mice leads to impaired cartilage development due to increased RAF/MEK/ERK pathway activation. Here, we studied the expression of the cluster in cartilage by LacZ reporter gene assays and determined its role for extracellular matrix homeostasis by proteome and immunoblot analysis. The cluster is expressed in prehypertrophic/hypertrophic chondrocytes of the growth plate and we now show that the cluster is also highly expressed in articular cartilage. Cartilage-specific loss of the cluster leads to increased proteoglycan 4 and matrix metallopeptidase 13 levels and decreased aggrecan and collagen X levels in epiphyseal cartilage. Interestingly, these changes are linked to a decrease in SRY-related HMG box-containing (SOX) transcription factors 6 and 9, which regulate ECM production in chondrocytes. Our data suggests that the Mirc24 cluster is important for ECM homoeostasis and the expression of transcriptional regulators of matrix production in cartilage.
Also flagged:CarbohydrateAntigens Lewis aLewis bSialylLewis aGastrointestinal Cancers
Journal Article2020-06-09No SnippetsIndellicato R, Zulueta A, Caretti A, Trinchera M.
Show Full Abstract
Carbohydrate antigen 19.9 (CA19.9) is used as a tumor marker for clinical and research purposes assuming that it is abundantly produced by gastrointestinal cancer cells due to a cancer-associated aberrant glycosylation favoring its synthesis. Recent data has instead suggested a different picture, where immunodetection on tissue sections matches biochemical and molecular data. In addition to CA19.9, structurally related carbohydrate antigens Lewis a and Lewis b are, in fact, undetectable in colon cancer, due to the down-regulation of a galactosyltransferase necessary for their synthesis. In the pancreas, no differential expression of CA19.9 or cognate glycosyltransferases occurs in cancer. Ductal cells only express such Lewis antigens in a pattern affected by the relative levels of each glycosyltransferase, which are genetically and epigenetically determined. The elevation of circulating antigens seems to depend on the obstruction of neoplastic ducts and loss of polarity occurring in malignant ductal cells. Circulating Lewis a and Lewis b are indeed promising candidates for monitoring pancreatic cancer patients that are negative for CA19.9, but not for improving the low diagnostic performance of such an antigen. Insufficient biological data are available for gastric and bile duct cancer. Studying each patient in a personalized manner determining all Lewis antigens in the surgical specimens and in the blood, together with the status of the tissue-specific glycosylation machinery, promises fruitful advances in translational research and clinical practice.
Also flagged:T cell antigen receptorsphosphoantigenspyrophosphateisopentenyltumorsaminobisphosphonates
Journal Article2020-06-09✓ 5 SnippetsHerrmann T, Fichtner AS, Karunakaran MM.
In-Text Gene Mentions
S I O 001029)
…One non-functional gene covering the BTN3–ED exon and one full-length BTN3 ORF, which showed the highest aa identity with human BTN3A3 and vpBTN3 and also a full conservation of the amino acids of the PAg binding site [90].…
S I O 001029)
…Interestingly, vpBTN3 occurs as a singleton and had higher sequence similarity to BTN3A3 compared to BTN3A1 but complete identity in the amino acids defining the PAg binding pocket of BTN3A1 [85,86].…
S I O 001029)
…All other BTNs and BTNL molecules carry a tryptophan at this position, and a C247W substitution of BTN2A1 had no negative effect on PAg stimulation or TCR tetramer binding.…
S I O 001029)
…Another observation of unclear significance was a disulfide bridge that stabilized BTN2A1 as a homodimer formed by a cysteine at position 247, which is unique to BTN2A1.…
Abstract)
…recent discovery ofBTN2A1as Vγ9-binding protein…
Show Full Abstract
About 1-5% of human blood T cells are Vγ9Vδ2 T cells. Their hallmark is the expression of T cell antigen receptors (TCR) whose γ-chains contain a rearrangement of Vγ9 with JP (<i>TRGV9JP</i> or Vγ2Jγ1.2) and are paired with Vδ2 (<i>TRDV2</i>)-containing δ-chains. These TCRs respond to phosphoantigens (PAg) such as (E)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMBPP), which is found in many pathogens, and isopentenyl pyrophosphate (IPP), which accumulates in certain tumors or cells treated with aminobisphosphonates such as zoledronate. Until recently, these cells were believed to be restricted to primates, while no such cells are found in rodents. The identification of three genes pivotal for PAg recognition encoding for Vγ9, Vδ2, and butyrophilin (BTN) 3 in various non-primate species identified candidate species possessing PAg-reactive Vγ9Vδ2 T cells. Here, we review the current knowledge of the molecular basis of PAg recognition. This not only includes human Vγ9Vδ2 T cells and the recent discovery of BTN2A1 as Vγ9-binding protein mandatory for the PAg response but also insights gained from the identification of functional PAg-reactive Vγ9Vδ2 T cells and BTN3 in the alpaca and phylogenetic comparisons. Finally, we discuss models of the molecular basis of PAg recognition and implications for the development of transgenic mouse models for PAg-reactive Vγ9Vδ2 T cells.
Also flagged:cisplatinmuscle-invasive bladder cancerbladder cancercancercell cyclecaspase-9
Journal Article2020-06-09✓ 1 SnippetSalimian J, Baradaran B, Azimzadeh Jamalkandi S, Moridikia A, Ahmadi A.
In-Text Gene Mentions
Abstract)
…caspase-3, P53, SIRT1,OLFM4, SMAD2, and Bcl-2…
Show Full Abstract
<h4>Objectives</h4>Cisplatin is one of the common chemotherapy drugs for bladder cancer, and resistance to this drug is one of the major obstacles to effective chemotherapy. MicroRNAs (miRNAs) are a category of small noncoding RNAs that can regulate the expression of numerous genes. Recent studies showed that miRNAs can act as a powerful regulator of chemo-sensitivity in cancer cells. Hence, this study aimed to investigate the effects of miRNA-486-5p on cisplatin-sensitivity of different bladder cancer cells.<h4>Material and methods</h4>The 5637 and EJ138 cancer cells were treated with miRNA-486-5p and cisplatin, individually or in combination.<h4>Results</h4>Afterward, the cytotoxicity effects of these treatments were determined by MTT assay and the increased cisplatin-sensitivity observed in both cell lines, especially, 5637 cells. Moreover, subG1 phase cell cycle arrest, changes in the expression of caspase-9, caspase-3, P53, SIRT1, OLFM4, SMAD2, and Bcl-2 genes and nuclear fragmentation also revealed the induction of apoptosis in all treatments, which increased in combination groups. Also, the combination of miRNA-486-5p with cisplatin significantly down-regulated the expression of migration associated genes including ROCK, CD44, and MMP-9 as compared with cisplatin alone.<h4>Conclusion</h4>Altogether, these results indicated that the miRNA-486-5p could induce apoptosis and inhibit cell migration ability of the cells. It seems that pre-electroporation of cells with miRNA-486-5p has useful results in the enhancement of cisplatin sensitivity of 5637 and EJ138 cancer cells and this combination may be a promising treatment strategy for bladder cancer therapy.
Also flagged:pulmonary arterial hypertensionnucleotidepathogenesis
Journal Article2020-06-09✓ 5 SnippetsZhang SJ, Lian TY, Zhu XJ, Lu D, Xu XQ, Jiang X, Jing ZC.
In-Text Gene Mentions
Abstract)
…Pulmonary arterial hypertension (PAH) is a rare but severe illness associated with mutations in the PTGIS gene.…
Title)
…Derivation of an induced pluripotent stem cell line (PUMCHi003-A) from a patient with pulmonary arterial hypertension carrying heterozygous mutation in PTGIS gene.…
Abstract)
…We derived an induced pluripotent cell line from a PAH patient with heterozygous PTGIS c.755 G > A, which could serve as a unique model to understand the pathogenesis of PAH.…
Title)
…heterozygous mutation inPTGISgene.…
Abstract)
…mutations in thePTGISgene.…
Show Full Abstract
Pulmonary arterial hypertension (PAH) is a rare but severe illness associated with mutations in the PTGIS gene. The single nucleotide variants may lead to the impairment of the endothelial cells functions, resulting in proliferation of the smooth muscle cells and occlusion of the pulmonary arterioles. We derived an induced pluripotent cell line from a PAH patient with heterozygous PTGIS c.755 G > A, which could serve as a unique model to understand the pathogenesis of PAH.
Also flagged:Central nervous system (CNS) disordersneurodegenerative disordersepilepsybrain tumorsmultiple sclerosis
Journal Article2020-06-09No SnippetsNaqvi S, Panghal A, Flora SJS.
Show Full Abstract
Central nervous system (CNS) disorders especially neurodegenerative disorders are the major challenge for public health and demand the great attention of researchers to protect people against them. In past few decades, different treatment strategies have been adopted, but their therapeutic efficacy are not enough and have only shown partial mitigation of symptoms. Blood-brain barrier (BBB) and blood-cerebrospinal fluid barrier (BSCFB) guard the CNS from harmful substances and pose as the major challenges in delivering drugs into CNS for treatment of CNS complications such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), stroke, epilepsy, brain tumors, multiple sclerosis (MS), and encephalitis, etc. Nanotechnology has come out as an exciting and promising new platform of treating neurological disorders and has shown great potential to overcome problems related to the conventional treatment approaches. Molecules can be nanoengineered to carry out multiple specific functions such as to cross the BBB, target specific cell or signaling pathway, respond to endogenous stimuli, and act as a vehicle for gene delivery, support nerve regeneration and cell survival. In present review, the role of nanocarrier systems such as liposomes, micelles, solid lipid nanoparticles (SLNPs), dendrimers, and nanoemulsions for delivery of various neurotherapeutic agents has been discussed, besides this, their mechanism of action, and nanoformulation of different neuroprotective agents like curcumin, edaravone, nerve growth factors in CNS disorders like Alzheimer's, Parkinsonism, epilepsy, stroke, and brain tumors has been reviewed.
Also flagged:NeurodegenerationTraumatic brain injurydeathneurodegenerative diseasebasal laminacentral nervous system diseases
Journal Article2020-06-09No SnippetsZhou Y, Chen Q, Wang Y, Wu H, Xu W, Pan Y, Gao S, Dong X, Zhang JH, Shao A.
Show Full Abstract
Traumatic brain injury (TBI) represents one of the major causes of death worldwide and leads to persisting neurological deficits in many of the survivors. One of the most significant long-term sequelae deriving from TBI is neurodegenerative disease, which is a group of incurable diseases that impose a heavy socio-economic burden. However, mechanisms underlying the increased susceptibility of TBI to neurodegenerative disease remain elusive. The neurovascular unit (NVU) is a functional unit composed of neurons, neuroglia, vascular cells, and the basal lamina matrix. The key role of NVU dysfunction in many central nervous system diseases has been revealed. Studies have proved the presence of prolonged structural and functional abnormalities of the NVU after TBI. Moreover, growing evidence suggests impaired NVU function is also implicated in neurodegenerative diseases. Therefore, we propose the Neurovascular Unit Dysfunction (NVUD) Hypothesis, in which the persistent NVU dysfunction is thought to underlie the development of post-TBI neurodegeneration. We deduce NVUD Hypothesis through relational inference and supporting evidence, and suggest continued NVU abnormalities following TBI serve as the pathophysiological substrate and trigger yielding chronic neuroinflammation, proteinopathies and oxidative stress, consequently leading to the progression of neurodegenerative diseases. The NVUD Hypothesis may provide potential treatment and prevention strategies for TBI and late-onset neurodegenerative diseases.
Also flagged:Kidney diseasedeathgene expressionAdriamycinnephropathykidney
Journal Article2020-06-09✓ 2 SnippetsLu J, Zhang J, Chen M, Chen C, Li Z, Liao P.
In-Text Gene Mentions
Methods)
…C57BL/six micemice (8 weeks…
Methods)
…spleens of healthyC57BL/six micemice, and single-cell…
Show Full Abstract
Kidney disease is a significant health concern worldwide. Ineffective treatment can lead to disastrous consequences, such as organ failure and death. Research has turned to cell-based therapy, but has yet to produce an effective and reliable treatment for kidney disease. To address this problem, we examined four datasets of gene expression profiles from diseased and healthy kidney tissue in humans, mice, and rats. Differentially expressed genes (DEGs) were screened and subjected to enrichment analyses. Up-regulated genes in diseased kidney tissue were significantly enriched in pathways associated with regulatory T cells (Tregs). Analysis with the xCell tool showed that Tregs were generally increased in diseased kidney tissue in all species. To validate these results <i>in vivo</i>, kidneys were removed from mice with Adriamycin-induced nephropathy, and histology confirmed increase of Tregs. Furthermore, Tregs were adoptively transferred from healthy mice into mice with kidney injury, restoring normal structure to the damaged kidneys. Treg cells that were co-cultured with M2c macrophages exhibited up-regulation of chemokine receptors CCR2, CCR5, CCR7, CD62L, and CX3CR1. This may be the mechanism by which M2c cells enhance the migration of Tregs to the site of inflammation. We propose that Tregs may be an effective, novel candidate for cell-based therapy in pre-clinical kidney injury models.
Also flagged:PDL1Lung AdenocarcinomaPD1non-small-cell lung cancergene expressionBRCA1
Journal Article2020-06-09No SnippetsWu Y, Lin L, Liu X.
Show Full Abstract
PD1/PDL1 inhibitors have been adopted for the treatment of advanced non-small-cell lung cancer, and PDL1 expression has been investigated as a predictive biomarker for PD1/PDL1 inhibitor therapy. However, PDL1 lacks diagnostic accuracy in differentiating patients who are likely or unlikely to benefit. So, it is urgent and clinically significant to identify other associated predictive biomarkers for PD1/PDL1 inhibitor therapy. Our work was to identify PDL1-related biomarkers that could improve the patient selection for PD1/PDL1 inhibitor treatment. We obtained 500 genes coexpressed with PDL1 in lung adenocarcinoma from the TCGA database. Then, we identified 125 out of 500 genes differentially expressed in lung adenocarcinoma. A total of 39 genes were distinguished with prognostic value and associated with overall survival. Median survival time analysis based on gene expression level, protein-protein interaction analysis, GO and KEGG enrichment analyses, and significant GO and KEGG function consistency analyses were conducted to screen candidate biomarkers. Three candidate genes, BRCA1, BRIP1, and EREG, were identified to be functionally significantly coexpressed with PDL1. Functional enrichment analysis and protein-protein interaction networks further showed that these genes mainly participated in immune response and cell activation. Additionally, to find potential adjuvant therapeutic targets in PD1/PDL1 inhibitor treatment, we performed transcription factor prediction analysis. A group of negative differential expression but PDL1-related biomarkers has been identified, which might help to assess the clinical management of lung cancer patients. A combination of potential biomarkers and adjuvant therapeutic targets with PDL1 will predict the response to PD1/PDL1 inhibitors more accurately and help with the patient selection for more personalized immune checkpoint inhibitor treatment.
The deleterious effects of aging on the brain remain to be fully elucidated. In the present study, proteomic changes of young (4-month) and aged (16-month) B6129SF2/J male mouse hippocampus and cerebral cortex were investigated by using nano liquid chromatography tandem mass spectrometry (NanoLC-ESI-MS/MS) combined with tandem mass tag (TMT) labeling technology. Compared with the young animals, 390 hippocampal proteins (121 increased and 269 decreased) and 258 cortical proteins (149 increased and 109 decreased) changed significantly in the aged mouse. Bioinformatic analysis indicated that these proteins are mainly involved in mitochondrial functions (FIS1, DRP1), oxidative stress (PRDX6, GSTP1, and GSTM1), synapses (SYT12, GLUR2), ribosome (RPL4, RPS3), cytoskeletal integrity, transcriptional regulation, and GTPase function. The mitochondrial fission-related proteins FIS1 and DRP1 were significantly increased in the hippocampus and cerebral cortex of the aged mice. Further results in the hippocampus showed that ATP content was significantly reduced in aged mice. A neurotrophin brain-derived neurotrophic factor (BNDF), a protein closely related with synaptic plasticity and memory, was also significantly decreased in the hippocampus of the aged mice, with the tendency of synaptic protein markers including complexin-2, synaptophysin, GLUR2, PSD95, NMDAR2A, and NMDAR1. More interestingly, 8-hydroxydeoxyguanosine (8-OHdG), a marker of DNA oxidative damage, increased as shown by immunofluorescence staining. In summary, we demonstrated that aging is associated with systemic changes involving mitochondrial dysfunction, energy reduction, oxidative stress, loss of neurotrophic factor, synaptic proteins, and ribosomal proteins, as well as molecular deficits involved in various physiological/pathological processes.
Also flagged:SynthesisHirsutellide Acyclichexadepsipeptidepeptideexcretion
Journal Article2020-06-09No SnippetsSahile HA, Martínez-Martínez MS, Dillenberger M, Becker K, Imming P.
Show Full Abstract
Hirsutellide A is nature-derived cyclic hexadepsipeptide with reported antimycobacterial and antiplasmodial activities. To verify its structure, hirsutellide A was synthesized following a solution-phase peptide synthesis approach. A detailed analysis of the <sup>1</sup>H and <sup>13</sup>C NMR spectra of the synthesized compound revealed structural variation from what had been originally assigned for hirsutellide A, despite the use of identical building blocks. This variation occurred at the two <i>allo</i>-Ile moieties. To investigate the structure-activity relationship, the depsipeptide and peptide analogues of hirsutellide A were prepared and tested for antimycobacterial and antiplasmodial activities. The compounds displayed antiplasmodial potency against <i>Plasmodium falciparum</i> 3D7 while showing weak or no activity against <i>Mycobacterium tuberculosis</i> H37Rv. The drug-likeness of the series was assessed through <i>in vitro</i> absorption, distribution, metabolism, and excretion (ADME) profiling, revealing systematic differences between the pharmacokinetic properties of cyclic hexapeptides and hexadepsipeptides.
Also flagged:viral infectionsmembranegene expressioninfectionresponsedigestion
Journal Article2020-06-09✓ 1 SnippetRoodsant T, Navis M, Aknouch I, Renes IB, van Elburg RM, Pajkrt D, Wolthers KC, Schultsz C, van der Ark KCH, Sridhar A, Muncan V.
In-Text Gene Mentions
Results)
…OLFM4, a marker…
Show Full Abstract
Gut organoids are stem cell derived 3D models of the intestinal epithelium that are useful for studying interactions between enteric pathogens and their host. While the organoid model has been used for both bacterial and viral infections, this is a closed system with the luminal side being inaccessible without microinjection or disruption of the organoid polarization. In order to overcome this and simplify their applicability for transepithelial studies, permeable membrane based monolayer approaches are needed. In this paper, we demonstrate a method for generating a monolayer model of the human fetal intestinal polarized epithelium that is fully characterized and validated. Proximal and distal small intestinal organoids were used to generate 2D monolayer cultures, which were characterized with respect to epithelial cell types, polarization, barrier function, and gene expression. In addition, viral replication and bacterial translocation after apical infection with enteric pathogens Enterovirus A71 and <i>Listeria monocytogenes</i> were evaluated, with subsequent monitoring of the pro-inflammatory host response. This human 2D fetal intestinal monolayer model will be a valuable tool to study host-pathogen interactions and potentially reduce the use of animals in research.
Also flagged:luciferasehair bulbshairgene expressionnucleotidesbinding
Journal Article2020-06-09✓ 5 SnippetsZhao R, Li J, Liu N, Li H, Liu L, Yang F, Li L, Wang Y, He J.
In-Text Gene Mentions
Abstract)
…cated the MSTRG.223165-miR-21-SOX6axis in the…
Abstract)
…of miR-21 withSOX6and MSTRG.223165 were…
Methods)
…verify the predictedSOX6and MSTRG.223165 as…
Methods)
…3′-UTRs of theSOX6and MSTRG.223165 mRNAs…
Methods)
…lasmid to generate psiCHECK-2-SOX6-3′UTR WT, psiCHECK-2-SOX6-3′U…
Show Full Abstract
Long non-coding RNAs (lncRNA) and microRNAs (miRNA) are new found classes of non-coding RNAs (ncRNAs) that are not translated into proteins but regulate various cellular and biological processes. In this study, we conducted a transcriptomic analysis of ncRNA and mRNA expression in Aohan fine wool sheep (AFWS) at different growth stages (embryonic day 90, embryonic day 120, and the day of birth), and explored their relationship with wool follicle growth. In total, 461 lncRNAs, 106 miRNAs, and 1,009 mRNAs were found to be differentially expressed during the three stages of wool follicle development. Gene Ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed to clarify the roles of the differentially expressed lncRNA, miRNA, and mRNA in the different stages of wool follicle development. Quantitative real-time PCR (qRT-PCR) was used to validate the results of RNA-seq analysis. lncRNA (MSTRG.223165) was found to act as a competing endogenous RNA (ceRNA) and may participate in wool follicle development by acting as an miR-21 sponge. Network prediction implicated the MSTRG.223165-miR-21-<i>SOX6</i> axis in the wool follicle development. The targeting relationships of miR-21 with <i>SOX6</i> and MSTRG.223165 were validated in dual-luciferase assays. This is the first report indicating the association of the lncRNA-miRNA-mRNA network with wool follicle development in AFWS. This study provides new insights into the regulation of the wool follicle growth and represents a solid foundation for wool sheep breeding programs.
bioRxiv2020-06-09Preprint (No Snippets API)Torres-Berrío A, Morgunova A, Giroux M, Cuesta S, Nestler EJ, Flores C.
Show Full Abstract
<h4>ABSTRACT</h4> Adolescence is a period of increased vulnerability to psychiatric disorders including depression. Discovering novel biomarkers to identify individuals who are at high risk is very much needed. Our previous work shows that the microRNA miR-218 mediates susceptibility to stress and depression in adulthood, by targeting the Netrin-1 guidance cue receptor gene Dcc ( D eleted in c olorectal c ancer ) in the medial prefrontal cortex (mPFC). Here we investigated whether miR-218 regulates Dcc expression in adolescence and could serve as an early predictor of lifetime stress vulnerability. miR-218 expression in the mPFC increases from early adolescence to adulthood and correlates negatively with Dcc levels. In blood, postnatal miR-218 expression parallels changes occurring in the mPFC. Notably, circulating miR-218 levels in adolescence associate with vulnerability to social defeat stress in adulthood, with high levels associated with social avoidance severity. Indeed, downregulation of miR-218 in the mPFC in adolescence promotes resilience to stress in adulthood, indicating that adolescent miR-218 expression may serve both as a marker of risk and as a target for early interventions.
medRxiv2020-06-09Preprint (No Snippets API)Rother N, Yanginlar C, Lindeboom RG, Bekkering S, van Leent MM, Buijsers B, Jonkman I, de Graaf M, Baltissen M, Lamers LA, Riksen NP, Fayad ZA, Mulder WJ, Hilbrands LB, Joosten LA, Netea MG, Vermeulen M, van der Vlag J, Duivenvoorden R.
Show Full Abstract
<h4>ABSTRACT</h4> SARS-CoV-2 infection can cause severe disease for which currently no specific therapy is available. The use of hydroxychloroquine to prevent or treat SARS-CoV-2 infection is controversial and its mode of action poorly understood. We demonstrate that hydroxychloroquine inhibits trained immunity at the functional and epigenetic level and is accompanied by profound changes in the cellular lipidome as well as reduced expression of interferon-stimulated genes. Trained immunity comprises a functional adaptation induced by epigenetic reprogramming which facilitates the anti-viral innate immune response. Our findings therefore suggest that hydroxychloroquine may not have a beneficial effect on the anti-viral immune response to SARS-CoV-2.
Also flagged:antigen presentationmTOR-IsirolimusmTORacute rejectionliver cancer
Journal Article2020-06-08✓ 1 SnippetLevitsky J, Burrell BE, Kanaparthi S, Turka LA, Kurian S, Sanchez-Fueyo A, Lozano JJ, Demetris A, Lesniak A, Kirk AD, Stempora L, Yang GY, Mathew JM.
In-Text Gene Mentions
Text
…PEBP1…
Show Full Abstract
<h4>Background and aims</h4>As conversion from calcineurin inhibitor to sirolimus (SRL), a mechanistic target of rapamycin inhibitor (mTOR-I), has been shown to enhance immunoregulatory profiles in liver transplant (LT) recipients (LTRs), mTOR-I therapy might allow for increased success of immunosuppression (IS) withdrawal. Our aim was to determine if operational tolerance could be observed in LTRs withdrawn from SRL and if blood/graft tolerance biomarkers were predictive of successful withdrawal.<h4>Approach and results</h4>We performed a prospective trial of SRL monotherapy withdrawal in nonimmune, nonviremic LTRs > 3 years post-LT. SRL was weaned over ~6 months, and biopsies were performed 12 months postweaning or at concern for acute rejection. Twenty-one LTRs consented; 6 were excluded due to subclinical acute rejection on baseline biopsy or other reasons, and 15 underwent weaning (age 61.3 ± 8.8 years; LT to SRL weaning 6.7 ± 3 years). Eight (53%) achieved operational tolerance (TOL). Of the 7 who were nontolerant (non-TOL), 6 had mild acute rejection on biopsy near the end of weaning or at study end; 1 was removed from the trial due to liver cancer recurrence. At baseline preweaning, there were statistically increased blood tolerogenic dendritic cells and cell phenotypes correlating with chronic antigen presentation in the TOL versus non-TOL groups. A previously identified biopsy gene signature accurately predicted TOL versus non-TOL in 12/14 LTRs before weaning. At study end, biopsy staining revealed statistically significant increases in antigen-presenting cell:leukocyte pairings, FOXP3<sup>+</sup> /CD4<sup>+</sup> T cells, Tbet<sup>+</sup> /CD8<sup>+</sup> T cells, and lobular dendritic cells in the non-TOL group.<h4>Conclusions</h4>This study evaluated IS withdrawal directly from mTOR-I therapy in LTRs and achieved > 50% operational tolerance. Preweaning gene expression and peripheral blood mononuclear cell profiling may be useful as predictors of successful mTOR-I therapy withdrawal. NCT02062944.
Also flagged:MYO5Bpheochromocytomacancerpheochromocytoma and paragangliomaPPGL tumortumors
Journal Article2020-06-08No SnippetsTomić TT, Olausson J, Rehammar A, Deland L, Muth A, Ejeskär K, Nilsson S, Kristiansson E, Wassén ON, Abel F.
Show Full Abstract
Identification of additional cancer-associated genes and secondary mutations driving the metastatic progression in pheochromocytoma and paraganglioma (PPGL) is important for subtyping, and may provide optimization of therapeutic regimens. We recently reported novel recurrent nonsynonymous mutations in the MYO5B gene in metastatic PPGL. Here, we explored the functional impact of these MYO5B mutations, and analyzed MYO5B expression in primary PPGL tumor cases in relation to mutation status. Immunohistochemistry and mRNA expression analysis in 30 PPGL tumors revealed an increased MYO5B expression in metastatic compared to non-metastatic cases. In addition, subcellular localization of MYO5B protein was altered from cytoplasmic to membranous in some metastatic tumors, and the strongest and most abnormal expression pattern was observed in a paraganglioma harboring a somatic MYO5B:p.G1611S mutation. In addition to five previously discovered MYO5B mutations, the present study of 30 PPGL (8 previous and 22 new samples) also revealed two, and hence recurrent, mutations in the gene paralog MYO5A. The three MYO5B missense mutations with the highest prediction scores (p.L587P, p.G1611S and p.R1641C) were selected and functionally validated using site directed mutagenesis and stable transfection into human neuroblastoma cells (SK-N-AS) and embryonic kidney cells (HEK293). In vitro analysis showed a significant increased proliferation rate in all three MYO5B mutated clones. The two somatically derived mutations, p.L587P and p.G1611S, were also found to increase the migration rate. Expression analysis of MYO5B mutants compared to wild type clones, demonstrated a significant enrichment of genes involved in migration, proliferation, cell adhesion, glucose metabolism, and cellular homeostasis. Our study validates the functional role of novel MYO5B mutations in proliferation and migration, and suggest the MYO5-pathway to be involved in the malignant progression in some PPGL tumors.
Also flagged:autophagydeathorganelleshydroperoxyarachidonoylphosphatidylethanolamines
Journal Article2020-06-08✓ 5 SnippetsZhao J, Dar HH, Deng Y, St Croix CM, Li Z, Minami Y, Shrivastava IH, Tyurina YY, Etling E, Rosenbaum JC, Nagasaki T, Trudeau JB, Watkins SC, Bahar I, Bayır H, VanDemark AP, Kagan VE, Wenzel SE.
In-Text Gene Mentions
Title)
…PEBP1acts as a…
Abstract)
…with PE-binding protein-1 (PEBP1).…
Abstract)
…We discovered thatPEBP1is pivotal to…
Abstract)
…that PE-binding protein-1 (PEBP1) is pivotal for…
Temporally harmonized elimination of damaged or unnecessary organelles and cells is a prerequisite of health. Under Type 2 inflammatory conditions, human airway epithelial cells (HAECs) generate proferroptotic hydroperoxy-arachidonoyl-phosphatidylethanolamines (HpETE-PEs) as proximate death signals. Production of 15-HpETE-PE depends on activation of 15-lipoxygenase-1 (15LO1) in complex with PE-binding protein-1 (PEBP1). We hypothesized that cellular membrane damage induced by these proferroptotic phospholipids triggers compensatory prosurvival pathways, and in particular autophagic pathways, to prevent cell elimination through programmed death. We discovered that PEBP1 is pivotal to driving dynamic interactions with both proferroptotic 15LO1 and the autophagic protein microtubule-associated light chain-3 (LC3). Further, the 15LO1-PEBP1-generated ferroptotic phospholipid, 15-HpETE-PE, promoted LC3-I lipidation to stimulate autophagy. This concurrent activation of autophagy protects cells from ferroptotic death and release of mitochondrial DNA. Similar findings are observed in Type 2 Hi asthma, where high levels of both 15LO1-PEBP1 and LC3-II are seen in HAECs, in association with low bronchoalveolar lavage fluid mitochondrial DNA and more severe disease. The concomitant activation of ferroptosis and autophagy by 15LO1-PEBP1 complexes and their hydroperoxy-phospholipids reveals a pathobiologic pathway relevant to asthma and amenable to therapeutic targeting.
Also flagged:histoneshistonechromatinSuv39h1Suv39h2SETDB1
Journal Article2020-06-08✓ 2 SnippetsHealton SE, Pinto HD, Mishra LN, Hamilton GA, Wheat JC, Swist-Rosowska K, Shukeir N, Dou Y, Steidl U, Jenuwein T, Gamble MJ, Skoultchi AI.
In-Text Gene Mentions
Abstract)
…demonstrate that H1linker histoneshistones, the most…
Text
…linker histones…
Show Full Abstract
Nearly 50% of mouse and human genomes are composed of repetitive sequences. Transcription of these sequences is tightly controlled during development to prevent genomic instability, inappropriate gene activation and other maladaptive processes. Here, we demonstrate an integral role for H1 linker histones in silencing repetitive elements in mouse embryonic stem cells. Strong H1 depletion causes a profound de-repression of several classes of repetitive sequences, including major satellite, LINE-1, and ERV. Activation of repetitive sequence transcription is accompanied by decreased H3K9 trimethylation of repetitive sequence chromatin. H1 linker histones interact directly with Suv39h1, Suv39h2, and SETDB1, the histone methyltransferases responsible for H3K9 trimethylation of chromatin within these regions, and stimulate their activity toward chromatin in vitro. However, we also implicate chromatin compaction mediated by H1 as an additional, dominant repressive mechanism for silencing of repetitive major satellite sequences. Our findings elucidate two distinct, H1-mediated pathways for silencing heterochromatin.
Despite the advantages of neoadjuvant chemotherapy (NACT), associated toxicity is a serious complication that renders monitoring of the patients' response to NACT highly important. Thus, prediction of tumor response to treatment is imperative to avoid exposure of potential non-responders to deleterious complications. We have performed genome-wide analysis of DNA methylation by XmaI-RRBS and selected CpG dinucleotides differential methylation of which discriminates luminal B breast cancer samples with different sensitivity to NACT. With this data, we have developed multiplex methylation sensitive restriction enzyme PCR (MSRE-PCR) protocol for determining the methylation status of 10 genes (SLC9A3, C1QL2, DPYS, IRF4, ADCY8, KCNQ2, TERT, SYNDIG1, SKOR2 and GRIK1) that distinguish BC samples with different NACT response. Analysis of these 10 markers by MSRE-PCR in biopsy samples allowed us to reveal three top informative combinations of markers, (1) IRF4 and C1QL2; (2) IRF4, C1QL2, and ADCY8; (3) IRF4, C1QL2, and DPYS, with the areas under ROC curves (AUCs) of 0.75, 0.78 and 0.74, respectively. A classifier based on IRF4 and C1QL2 better meets the diagnostic panel simplicity requirements, as it consists of only two markers. Diagnostic accuracy of the panel of these two markers is 0.75, with the sensitivity of 75% and specificity of 75%.
Also flagged:Hepatocellular CarcinomaNon-Alcoholic Steatohepatitisnon-alcoholic fatty liver diseaseNAFLDNASHcholesterol
Journal Article2020-06-08✓ 1 SnippetSimoes Eugénio M, Farooq M, Dion S, Devisme C, Raguenes-Nicol C, Piquet-Pellorce C, Samson M, Dimanche-Boitrel MT, Le Seyec J.
The increase of the sedentary lifestyle and high-calorie diet have modified the etiological landscape of hepatocellular carcinoma (HCC), with a recrudescence of non-alcoholic fatty liver disease (NAFLD), especially in Western countries. The purpose of our study was to evaluate the impact of high-fat diet feeding on non-alcoholic steatohepatitis (NASH) establishment and HCC development. Streptozotocin-induced diabetic male mice were fed with high-fat-high-cholesterol diet (HFHCD) or high-fat-high-sugar diet (HFHSD) from 1 to 16 weeks. Even if liver tumors appear regardless of the high-fat diet, two distinct physiopathological patterns were evidenced, with much more severe NASH hallmarks (liver injury, inflammation and fibrosis) in diabetic mice fed with HFHCD. The mild hepatic injury, weak inflammation and fibrosis observed in HFHSD were interestingly associated with earlier emergence of more numerous liver tumors. When activated helper and cytotoxic T cells, detected by flow cytometry, infiltrated the liver of HFHCD-fed diabetic mice, a delay in the appearance of tumor nodules and a limitation of their numbers were observed, suggesting that the immune activities partly controlled tumor emergence. These data highlighted two different mouse models of HCC progression in diabetic mice depending on diet, which could be useful to evaluate new therapeutic approaches for HCC by targeting the immune response.
Also flagged:Serotonin TransporterSerTneurotransmitter transporterdeathAktPI3K
Journal Article2020-06-08✓ 2 SnippetsPham TLA, Binh TD, Liu G, Nguyen TQC, Nguyen YDH, Sahashi R, Men TT, Kamei K.
In-Text Gene Mentions
Introduction)
…One of the essential components in the regulation of serotonin is serotonin transporter (SerT) or 5-hydroxytryptamine transporter (5-HTT), which is a monoamine transporter protein responsible for the reuptake of serotonin into neurons after synaptic transmission in mammals [7].…
Introduction)
…ydroxytryptamine transporter (5-HTT), which is a…
Show Full Abstract
Serotonin transporter (SerT) in the brain is an important neurotransmitter transporter involved in mental health. However, its role in peripheral organs is poorly understood. In this study, we investigated the function of SerT in the development of the compound eye in <i>Drosophila melanogaster</i>. We found that SerT knockdown led to excessive cell death and an increased number of cells in S-phase in the posterior eye imaginal disc. Furthermore, the knockdown of <i>SerT</i> in the eye disc suppressed the activation of Akt, and the introduction of <i>PI3K</i> effectively rescued this phenotype. These results suggested that SerT plays a role in the healthy eye development of <i>D.</i> <i>melanogaster</i> by controlling cell death through the regulation of the PI3K/Akt pathway.
Also flagged:Peptidepeptidesmicrobial infectionsmembraneMembranesinfection
Journal Article2020-06-08No SnippetsBarreto-Santamaría A, Rivera ZJ, García JE, Curtidor H, Patarroyo ME, Patarroyo MA, Arévalo-Pinzón G.
Show Full Abstract
Antimicrobial peptides (AMPs) have been recognised as a significant therapeutic option for mitigating resistant microbial infections. It has been found recently that <i>Plasmodium falciparum</i>-derived, 20 residue long, peptide 35409 had antibacterial and haemolytic activity, making it an AMP having reduced selectivity, and suggesting that it should be studied more extensively for obtaining new AMPs having activity solely targeting the bacterial membrane. Peptide 35409 was thus used as template for producing short synthetic peptides (<20 residues long) and evaluating their biological activity and relevant physicochemical characteristics for therapeutic use. Four of the sixteen short peptides evaluated here had activity against <i>E. coli</i> without any associated haemolytic effects. The 35409-1 derivative (17 residues long) had the best therapeutic characteristics as it had high selectivity for bacterial cells, stability in the presence of human sera, activity against <i>E. coli</i> multiresistant clinical isolates and was shorter than the original sequence. It had a powerful membranolytic effect and low potential for inducing resistance in bacteria. This peptide's characteristics highlighted its potential as an alternative for combating infection caused by <i>E. coli</i> multiresistant bacteria and/or for designing new AMPs.
<h4>Background</h4>Previous literatures have implied that the liver fat deposition plays a crucial role in the development and progression of insulin resistance. In the present study, we aimed to investigate the association of liver fat content (LFC) with glucose metabolism status in the population of newly diagnosed type 2 diabetes mellitus (nT2DM), prediabetes mellitus (PDM) and normal controls (NC), and assessing if the LFC could as an indicator for the prediction of T2DM.<h4>Methods</h4>A total of 242 subjects (including 141 nT2DM patients, 48 PDM subjects and 53 NC) were enrolled. The levels of LFC were quantified by using the proton magnetic resonance spectroscopy ([<sup>1</sup>H]-MRS) technique. Clinical and laboratory parameters of study subjects were collected by medical records and biochemical detection. One-way ANOVA or nonparametric test (Kruskal-Wallis) was applied for intergroup comparisons; intergroup comparison was performed in using of Bonferroni multiple-significance-test correction.<h4>Results</h4>There were significantly increased LFC levels in nT2DM (14.72% ± 6.37%) than in PDM (9.62% ± 4.41%) and that of NC groups (5.11% ± 3.66%) (all <i>p </i>< 0.001). The prevalence of nonalcoholic fatty liver disease (NAFLD) was also found to be increased in nT2DM (91.48%) than in PDM (85.41%) and that of NC (32.07%) groups. Correlation analysis revealed that the increase of LFC positively associated with fast plasma glucose (FPG), 2 h plasma glucose (PG), Delta G30 and homeostatic model assessment of insulin resistance (HOMA-IR), negatively associated with Delta Ins30, Delta C30, Ins30/G30 <sub>AUC</sub>, CP30/G30 <sub>AUC</sub>, Ins <sub>AUC</sub>/G <sub>AUC</sub>, CP <sub>AUC</sub>/G <sub>AUC</sub>, homeostatic model assessment for β-cell function index (HOMA-β) and matsuda insulin sensitivity index (Matsuda ISI). Multilinear regression analysis showed that LFC, body mass index (BMI) and diastolic blood pressure (DBP) contributed for the prediction of HOMA-IR, and total cholesterol (TC), age, waist circumference (WC) and low-density lipoprotein cholesterol (LDL-C) were the significant contributors for HOMA-β.<h4>Conclusions</h4>Our study revealed an increased LFC level and prevalence of NAFLD in nT2DM than in PDM and that of NC groups, the increase of LFC was closely associated with insulin resistance and impaired glucose metabolism status, may be regarded as potential indicator contributing to the development and progression of T2DM.
Also flagged:mitochondriaDNA depletion syndrome-13Mitochondrial DNA depletion syndrome-13MTDPS13F-boxmitochondrial
Journal Article2020-06-08✓ 5 SnippetsWang S, Lin L, Wang Y, Wang A, Liu Z, Wu S, Lan X, Jia J, Zhang Y, Yuan F, Wang C, Luo X, Sun X, Avula SK, Tolaymat A, Liu C, Ren Y, Chen Y.
In-Text Gene Mentions
Abstract)
…We analysed FBXL4 expression and mitochondrial DNA level, and reviewed mutations reported in FBXL4-related literature.<h4>Results</h4>This mutation resulted in premature termination of translation and loss of 288 amino acids from C-terminus.…
Abstract)
…<h4>Background</h4>Mitochondrial DNA depletion syndrome-13 (MTDPS13) is caused by mutations in FBXL4 (F-box and leucine-rich repeat protein 4), a nuclear gene encoding an F-box protein that plays a role in maintaining mtDNA integrity and stability.<h4>Methods</h4>We identified a novel homozygous FBXL4 gene mutation, c.993dupA (p.L332Tfs*3), in a 1-year-old girl of Han Chinese descent.…
Title)
…mutation in theFBXL4gene is associated…
Abstract)
…by mutations inFBXL4(F-box and leucine-rich…
Abstract)
…mutations in FBXL4 (F-box and leucine-rich repeat protein 4and leucine-rich repeat…
Show Full Abstract
<h4>Background</h4>Mitochondrial DNA depletion syndrome-13 (MTDPS13) is caused by mutations in FBXL4 (F-box and leucine-rich repeat protein 4), a nuclear gene encoding an F-box protein that plays a role in maintaining mtDNA integrity and stability.<h4>Methods</h4>We identified a novel homozygous FBXL4 gene mutation, c.993dupA (p.L332Tfs*3), in a 1-year-old girl of Han Chinese descent. We performed three-dimensional protein structural analysis and targeted mtDNA next-generation sequencing. We analysed FBXL4 expression and mitochondrial DNA level, and reviewed mutations reported in FBXL4-related literature.<h4>Results</h4>This mutation resulted in premature termination of translation and loss of 288 amino acids from C-terminus. A three-dimensional structural analysis revealed that conserved LRR domains were lost in mutant FBXL4 protein, which likely affected its ability to form protein-protein interactions. There were no differences in FBXL4 mRNA expression levels between the patient and her parents. There were no mtDNA mutations in either the patient or her parents. However, ND1/GAPDH ratio in lymphocytes and urine, which represents mtDNA/nuclear DNA ratio, showed that the number of mitochondrial genomes was significantly lower in the patient than in her parents or wild-type subjects.<h4>Conclusion</h4>Homozygous FBXL4 gene mutation, c.993dupA, can cause mitochondrial dysfunction, and LRR region is especially important for FBXL4 protein function.
Altered serotonin (5-HT) signaling is associated with multiple brain disorders, including major depressive disorder (MDD), obsessive-compulsive disorder (OCD), and autism spectrum disorder (ASD). The presynaptic, high-affinity 5-HT transporter (SERT) tightly regulates 5-HT clearance after release from serotonergic neurons in the brain and enteric nervous systems, among other sites. Accumulating evidence suggests that SERT is dynamically regulated in distinct activity states as a result of environmental and intracellular stimuli, with regulation perturbed by disease-associated coding variants. Our lab identified a rare, hypermorphic SERT coding substitution, Gly56Ala, in subjects with ASD, finding that the Ala56 variant stabilizes a high-affinity outward-facing conformation (SERT<sup>∗</sup>) that leads to elevated 5-HT uptake <i>in vitro</i> and <i>in vivo</i>. Hyperactive SERT Ala56 appears to preclude further activity enhancements by p38α mitogen-activated protein kinase (MAPK) and can be normalized by pharmacological p38α MAPK inhibition, consistent with SERT Ala56 mimicking, constitutively, a high-activity conformation entered into transiently by p38α MAPK activation. We hypothesize that changes in SERT-interacting proteins (SIPs) support the shift of SERT into the SERT<sup>∗</sup> state which may be captured by comparing the composition of SERT Ala56 protein complexes with those of wildtype (WT) SERT, defining specific interactions through comparisons of protein complexes recovered using preparations from SERT<sup>-/-</sup> (knockout; KO) mice. Using quantitative proteomic-based approaches, we identify a total of 459 SIPs, that demonstrate both SERT specificity and sensitivity to the Gly56Ala substitution, with a striking bias being a loss of SIP interactions with SERT Ala56 compared to WT SERT. Among this group are previously validated SIPs, such as flotillin-1 (FLOT1) and protein phosphatase 2A (PP2A), whose functions are believed to contribute to SERT microdomain localization and regulation. Interestingly, our studies nominate a number of novel SIPs implicated in ASD, including fragile X mental retardation 1 protein (FMR1) and SH3 and multiple ankyrin repeat domains protein 3 (SHANK3), of potential relevance to long-standing evidence of serotonergic contributions to ASD. Further investigation of these SIPs, and the broader networks they engage, may afford a greater understanding of ASD as well as other brain and peripheral disorders associated with perturbed 5-HT signaling.
bioRxiv2020-06-08Preprint (No Snippets API)Rajan-Babu I, Peng J, Chiu R, IMAGINE Study, CAUSES Study, Mohajeri A, Dolzhenko E, Eberle MA, Eberle MA, Birol I, Friedman JM.
Show Full Abstract
<h4>ABSTRACT</h4> Short tandem repeat (STR) expansions cause several neurological and neuromuscular disorders. Screening for STR expansions in genome-wide (exome and genome) sequencing data can enable diagnosis, optimal clinical management/treatment, and accurate genetic counselling of patients with repeat expansion disorders. We assessed the performance of lobSTR, HipSTR, RepeatSeq, ExpansionHunter, TREDPARSE, GangSTR, STRetch, and exSTRa – bioinformatics tools that have been developed to detect and/or genotype STR expansions – on experimental and simulated genome sequence data with known STR expansions aligned using two different aligners, Isaac and BWA. We then adjusted the parameter settings to optimize the sensitivity and specificity of the STR tools and fed the optimized results into a machine-learning decision tree classifier to determine the best combination of tools to detect full mutation expansions with high diagnostic sensitivity and specificity. The decision tree model supported using ExpansionHunter’s full mutation calls with those of either STRetch or exSTRa for detection of full mutations with precision, recall, and F1-score of 90%, 100%, and 95%, respectively. We used this pipeline to screen the BWA-aligned exome or genome sequence data of 306 families of children with suspected genetic disorders for pathogenic expansions of known disease STR loci. We identified 27 samples, 17 with an apparent full-mutation expansion of the AR , ATXN1 , ATXN2 , ATXN8 , DMPK , FXN , HTT , or TBP locus, nine with an intermediate or premutation allele in the FMR1 locus, and one with a borderline allele in the ATXN2 locus. We report the concordance between our bioinformatics findings and the clinical PCR results in a subset of these samples. Implementation of our bioinformatics workflow can improve the detection of disease STR expansions in exome and genome sequence diagnostics and enhance clinical outcomes for patients with repeat expansion disorders.
Also flagged:autophagyreticulophagy receptordegradationendoplasmic reticulumribophagystress
Journal Article2020-06-07✓ 1 SnippetHo CJ, Samarasekera G, Rothe K, Xu J, Yang KC, Leung E, Chan M, Jiang X, Gorski SM.
In-Text Gene Mentions
Abstract)
…CASP3: caspase 3;CCPG1: cell cycle progression…
Show Full Abstract
Proteome profiling and global protein-interaction approaches have significantly improved our knowledge of the protein interactomes of autophagy and other cellular stress-response pathways. New discoveries regarding protein complexes, interaction partners, interaction domains, and biological roles of players that are part of these pathways are emerging. The fourth Vancouver Autophagy Symposium showcased research that expands our understanding of the protein interaction networks and molecular mechanisms underlying autophagy and other cellular stress responses in the context of distinct stressors. In the keynote presentation, Dr. Wade Harper described his team's recent discovery of a novel reticulophagy receptor for selective autophagic degradation of the endoplasmic reticulum, and discussed molecular mechanisms involved in ribophagy and non-autophagic ribosomal turnover. In other presentations, both omic and targeted approaches were used to reveal molecular players of other cellular stress responses including amyloid body and stress granule formation, anastasis, and extracellular vesicle biogenesis. Additional topics included the roles of autophagy in disease pathogenesis, autophagy regulatory mechanisms, and crosstalk between autophagy and cellular metabolism in anti-tumor immunity. The relationship between autophagy and other cell stress responses remains a relatively unexplored area in the field, with future investigations required to understand how the various processes are coordinated and connected in cells and tissues.<b>Abbreviations:</b> A-bodies: amyloid bodies; ACM: amyloid-converting motif; AMFR/gp78: autocrine motility factor receptor; ATG: autophagy-related; ATG4B: autophagy related 4B cysteine peptidase; CALCOCO2/NDP52: calcium binding and coiled-coil domain 2; CAR T: chimeric antigen receptor T; CASP3: caspase 3; CCPG1: cell cycle progression 1; CAR: chimeric antigen receptor; CML: chronic myeloid leukemia; CCOCs: clear cell ovarian cancers; CVB3: coxsackievirus B3; CRISPR-Cas9: clustered regularly interspaced short palindromic repeats-CRISPR associated protein 9; DDXs: DEAD-box helicases; EIF2S1/EIF-2alpha: eukaryotic translation initiation factor 2 subunit alpha; EIF2AK3: eukaryotic translation initiation factor 2 alpha kinase 3; ER: endoplasmic reticulum; EV: extracellular vesicle; FAO: fatty acid oxidation; GABARAP: GABA type A receptor-associated protein; ILK: integrin linked kinase; ISR: integrated stress response; MTOR: mechanistic target of rapamycin kinase; MPECs: memory precursory effector T cells; MAVS: mitochondrial antiviral signaling protein; NBR1: NBR1 autophagy cargo receptor; PI4KB/PI4KIIIβ: phosphatidylinositol 4-kinase beta; PLEKHM1: pleckstrin homology and RUN domain containing M1; RB1CC1: RB1 inducible coiled-coil 1; RTN3: reticulon 3; rIGSRNAs: ribosomal intergenic noncoding RNAs; RPL29: ribosomal protein L29; RPS3: ribosomal protein S3; <i>S. cerevisiae: Saccharomyces cerevisiae</i>; sEV: small extracellular vesicles; <i>S. pombe: Schizosaccharomyces pombe</i>; SQSTM1: sequestosome 1; SF3B1: splicing factor 3b subunit 1; SILAC-MS: stable isotope labeling with amino acids in cell culture-mass spectrometry; SNAP29: synaptosome associated protein 29; TEX264: testis expressed 264, ER-phagy receptor; TNBC: triple-negative breast cancer; ULK1: unc-51 like autophagy activating kinase 1; VAS: Vancouver Autophagy Symposium.
Also flagged:methylationpanic disorderserotonin (5-HT) transporterpanic attacksanticipatory anxietyPD
Journal Article2020-06-07✓ 2 SnippetsLeibold NK, Weidner MT, Ziegler C, Ortega G, Domschke K, Lesch KP, Van den Hove DL, Schruers KR.
In-Text Gene Mentions
Abstract)
…A polymorphism in the gene encoding the serotonin (5-HT) transporter (5-HTT) has been shown to moderate the response to CO<sub>2</sub> inhalation, an experimental model for panic attacks (PAs).…
Abstract)
…serotonin (5-HT) transporter (5-HTT) has been shown…
Show Full Abstract
A polymorphism in the gene encoding the serotonin (5-HT) transporter (5-HTT) has been shown to moderate the response to CO<sub>2</sub> inhalation, an experimental model for panic attacks (PAs). Recurrent, unpredictable PAs represent, together with anticipatory anxiety of recurring attacks, the core feature of panic disorder (PD) and significantly interfere with patients' daily life. In addition to genetic components, accumulating evidence suggests that epigenetic mechanisms, which regulate gene expression by modifying chromatin structure, also play a fundamental role in the etiology of mental disorders. However, in PD, epigenetic mechanisms have barely been examined to date. In the present study, we investigated the relationship between methylation at the regulatory region of the gene encoding the 5-HTT and the reactivity to a 35% CO<sub>2</sub> inhalation in PD patients. We focused on four specific CpG sites and found a significant association between the methylation level of one of these CpG sites and the fear response. This suggests that the emotional response to CO<sub>2</sub> inhalation might be moderated by an epigenetic mechanism, and underlines the implication of the 5-HT system in PAs. Future studies are needed to further investigate epigenetic alterations in PD and their functional consequences. These insights can increase our understanding of the underlying pathophysiology and support the development of new treatment strategies.
Mitochondrial ribosomes (mitoribosomes), the specialized translational machinery for mitochondrial genes, exclusively encode the subunits of the oxidative phosphorylation (OXPHOS) system. Although OXPHOS dysfunctions are associated with hepatic disorders including hepatocellular carcinoma (HCC), their underlying mechanisms remain poorly elucidated. In this study, we aimed to investigate the effects of mitoribosome defects on OXPHOS and HCC progression. By generating a gene signature from HCC transcriptome data, we developed a scoring system, i.e., mitoribosome defect score (MDS), which represents the degree of mitoribosomal defects in cancers. The MDS showed close associations with the clinical outcomes of patients with HCC and with gene functions such as oxidative phosphorylation, cell-cycle activation, and epithelial-mesenchymal transition. By analyzing immune profiles, we observed that mitoribosomal defects are also associated with immunosuppression and evasion. Taken together, our results provide new insights into the roles of mitoribosome defects in HCC progression.
medRxiv2020-06-07Preprint (No Snippets API)Singh BB, Lowerison M, Lewinson RT, Vallerand IA, Deardon R, Gill JP, Gill BS, Barkema HW.
Show Full Abstract
<h4>Summary</h4> <h4>Background</h4> The government of India implemented social distancing interventions to contain the COVID-19 epidemic. However, effects on epidemic dynamics are yet to be understood. <h4>Methods</h4> Rates of laboratory-confirmed COVID-19 infections per day and effective reproduction number ( R t ) were estimated for 4 periods (Pre-lockdown and Lockdown Phases 1 to 3) according to nationally implemented phased interventions. Adoption of these interventions was estimated using Google mobility data. Estimates at the national level and for 12 Indian states most affected by COVID-19 are presented. <h4>Findings</h4> Daily case rates ranged from 0·03 to 30·05/10 million people across 4 discrete periods in India. From May 4-17, 2020, the National Capital Territory (NCT) of Delhi had the highest case rate (222/10 million people/day), whereas Kerala had the lowest (2·18/10 million/day). Average R t was 1·99 (95% CI 1·93-2·06) for India; it ranged from 1·38 to 2·78, decreasing over time. Median mobility in India decreased in all contact domains, with the lowest being 21% in retail/recreation (95% CI 13-46%), except home which increased to 129% (95% CI 117-132%) compared to the 100% baseline value. <h4>Interpretation</h4> The Indian government imposed strict contact mitigation, followed by a phased relaxation, which slowed the spread of COVID-19 epidemic progression in India. The identified daily COVID-19 case rates and R t will aid national and state governments in formulating ongoing COVID-19 containment plans. Furthermore, these findings may inform COVID-19 public health policy in developing countries with similar settings to India. <h4>Funding</h4> Non-funded.
Research Square2020-06-07Preprint (No Snippets API)Rinchai D, Kabeer B, Toufiq M, Tatari-Calderone Z, Deola S, Brummaier T, Garand M, Branco R, Baldwin N, Alfaki M, Altman M, Ballestrero A, Bassetti M, Zoppoli G, De Maria A, Tang B, Bedognetti D, Chaussabel D.
Show Full Abstract
<title>Abstract</title> <p>Background: Covid-19 morbidity and mortality are associated with a dysregulated immune response. Tools are needed to enhance existing immune profiling capabilities in affected patients. Here we aimed to develop an approach to support the design of focused blood transcriptome panels for profiling the immune response to SARS-CoV-2 infection. <h4>Methods:</h4> We designed a pool of candidates based on a pre-existing and well-characterized repertoire of blood transcriptional modules. Available Covid-19 blood transcriptome data was also used to guide this process. Further selection steps relied on expert curation. Additionally, we developed several custom web applications to support the evaluation of candidates. <h4>Results:</h4> As a proof of principle, we designed three targeted blood transcript panels, each with a different translational connotation: immunological relevance, therapeutic development relevance and SARS biology relevance. <h4>Conclusion:</h4> Altogether the work presented here may contribute to the future expansion of immune profiling capabilities via targeted profiling of blood transcript abundance in Covid-19 patients.</p>
Also flagged:histonecell nucleuschromatinformaldehydehistonesantibody
Journal Article2020-06-06✓ 1 SnippetTeif VB, Gould TJ, Clarkson CT, Boyd L, Antwi EB, Ishaque N, Olins AL, Olins DE.
In-Text Gene Mentions
Abstract)
…proteins, such aslinker histoneshistones, that play…
Show Full Abstract
<h4>Background</h4>Histone H1 is the most mobile histone in the cell nucleus. Defining the positions of H1 on chromatin in situ, therefore, represents a challenge. Immunoprecipitation of formaldehyde-fixed and sonicated chromatin, followed by DNA sequencing (xChIP-seq), is traditionally the method for mapping histones onto DNA elements. But since sonication fragmentation precedes ChIP, there is a consequent loss of information about chromatin higher-order structure. Here, we present a new method, xxChIP-seq, employing antibody binding to fixed intact in situ chromatin, followed by extensive washing, a second fixation, sonication and immunoprecipitation. The second fixation is intended to prevent the loss of specifically bound antibody during washing and subsequent sonication and to prevent antibody shifting to epitopes revealed by the sonication process. In many respects, xxChIP-seq is comparable to immunostaining microscopy, which also involves interaction of the primary antibody with fixed and permeabilized intact cells. The only epitopes displayed after immunostaining are the "exposed" epitopes, not "hidden" by the fixation of chromatin higher-order structure. Comparison of immunoprecipitated fragments between xChIP-seq versus xxChIP-seq should indicate which epitopes become inaccessible with fixation and identify their associated DNA elements.<h4>Results</h4>We determined the genomic distribution of histone variants H1.2 and H1.5 in human myeloid leukemia cells HL-60/S4 and compared their epitope exposure by both xChIP-seq and xxChIP-seq, as well as high-resolution microscopy, illustrating the influences of preserved chromatin higher-order structure in situ. We found that xChIP and xxChIP H1 signals are in general negatively correlated, with differences being more pronounced near active regulatory regions. Among the intriguing observations, we find that transcription-related regions and histone PTMs (i.e., enhancers, promoters, CpG islands, H3K4me1, H3K4me3, H3K9ac, H3K27ac and H3K36me3) exhibit significant deficiencies (depletions) in H1.2 and H1.5 xxChIP-seq reads, compared to xChIP-seq. These observations suggest the existence of in situ transcription-related chromatin higher-order structures stabilized by formaldehyde.<h4>Conclusion</h4>Comparison of H1 xxChIP-seq to H1 xChIP-seq allows the development of hypotheses on the chromosomal localization of (stabilized) higher-order structure, indicated by the generation of "hidden" H1 epitopes following formaldehyde crosslinking. Changes in H1 epitope exposure surrounding averaged chromosomal binding sites or epigenetic modifications can also indicate whether these sites have chromatin higher-order structure. For example, comparison between averaged active or inactive promoter regions suggests that both regions can acquire stabilized higher-order structure with hidden H1 epitopes. However, the H1 xChIP-seq comparison cannot define their differences. Application of the xxChIP-seq versus H1 xChIP-seq method is particularly relevant to chromatin-associated proteins, such as linker histones, that play dynamic roles in establishing chromatin higher-order structure.
Also flagged:ErkMAPKcadmiumprostate cancercell cyclePCa
Journal Article2020-06-06No SnippetsDasgupta P, Kulkarni P, Bhat NS, Majid S, Shiina M, Shahryari V, Yamamura S, Tanaka Y, Gupta RK, Dahiya R, Hashimoto Y.
Show Full Abstract
<h4>Purpose</h4>Cadmium (Cd) is reported to be associated with carcinogenesis. The molecular mechanisms associated with Cd-induced prostate cancer (PCa) remain elusive.<h4>Materials and methods</h4>RWPE1, PWR1E and DU 145 cells were used. RT<sup>2</sup> Profiler Array, real-time-quantitative-PCR, immunofluorescence, cell cycle, apoptosis, proliferation and colony formation assays along with Gene Set Enrichment Analysis (GSEA) were performed.<h4>Result</h4>Chronic Cd exposure of non-malignant RWPE1 and PWR1E cells promoted cell survival, proliferation and colony formation with inhibition of apoptosis. Even a two-week Cd exposure of PCa cell line (DU 145) significantly increased the proliferation and decreased apoptosis. RT<sup>2</sup> profiler array of 84 genes involved in the Erk/MAPK pathway revealed induction of gene expression in Cd-RWPE1 cells compared to RWPE1. This was confirmed by individual TaqMan gene expression analysis in both Cd-RWPE1 and Cd-PWR1E cell lines. GSEA showed an enrichment of the Erk/MAPK pathway along with other pathways such as KEGG-ERBB, KEGG-Cell Cycle, KEGG-VEGF, KEGG-Pathways in cancer and KEGG-prostate cancer pathway. We randomly selected upregulated genes from Erk/MAPK pathway and performed profile analysis in a PCa data set from the TCGA/GDC data base. We observed upregulation of these genes in PCa compared to normal samples. An increase in phosphorylation of the Erk1/2 and Mek1/2 was observed in Cd-RWPE1 and Cd-PWR1E cells compared to parental cells, confirming that Cd-exposure induces activation of the Erk/MAPK pathway.<h4>Conclusion</h4>This study demonstrates that Erk/MAPK signaling is a major pathway involved in Cd-induced malignant transformation of normal prostate cells. Understanding these dominant oncogenic pathways may help develop optimal therapeutic strategies for PCa.
Also flagged:DACH1tumourcolorectal cancerLGR5colorectal tumoursCas9
Journal Article2020-06-06✓ 3 SnippetsHu X, Zhang L, Li Y, Ma X, Dai W, Gao X, Rao X, Fu G, Wang R, Pan M, Guo Q, Xu X, Zhou Y, Gao J, Zhang Z, Cai S, Peng J, Hua G.
In-Text Gene Mentions
Methods)
…21972-1-AP, 1:200), anti-OLFM4(CST, Cat. #…
Results)
…showed weaker CD166,OLFM4and SOX2 staining…
Discussion)
…of LGR5 andOLFM4, which are suggested…
Show Full Abstract
<h4>Background</h4>Dachshund homologue 1 (DACH1) is highly expressed in LGR5+ intestinal stem cells and colorectal tumours. However, the roles of DACH1 in intestinal cell stemness and colorectal tumorigenesis remain largely undefined.<h4>Methods</h4>We used immunohistochemistry, western blotting and quantitative real-time PCR to analyse DACH1 expression in colorectal cancer (CRC) samples. CRISPR/Cas9 gene editing and lentiviral vector-mediated overexpression and shRNA-mediated knockdown of DACH1 were utilized to modulate DACH1 expression in cell lines and organoids. An intestinal organoid-based functional model was analysed, and cancer cell colony formation, sphere formation assays and murine xenotransplants were performed to reveal the role of DACH1 in CRC cell proliferation, stemness and tumorigenesis. Immunofluorescence, co-immunoprecipitation, RNA interference and microarray data analyses were conducted to demonstrate the association between DACH1 and the bone morphogenetic protein (BMP) signalling pathway.<h4>Findings</h4>DACH1 is specifically expressed in discrete crypt base cells, and increased DACH1 expression was found in all stages of CRC. Moreover, the high expression of DACH1 independently predicted poor prognosis. In colon cancer cells, shRNA-mediated suppression of DACH1 inhibited cell growth in vitro and in vivo. By studying the intestinal organoid-based functional model, we found that depletion of DACH1 reduced the organoid formation efficiency and tumour organoid size. DACH1 overexpression stimulated both colonsphere formation and tumour organoid formation in the context of dysregulated BMP signalling. Mechanistic characterizations indicated that overexpression of DACH1 affects a subset of stem cell signature genes implicated in stem cell proliferation and maintenance through the suppression of BMP signalling via SMAD4.<h4>Interpretation</h4>Together, our study highlights DACH1 as an integral regulator of BMP signalling during intestinal tumorigenesis, and DACH1 could be a potential prognostic marker and therapeutic target for colorectal cancer patients.
Also flagged:anxietyVASsalbutamolDBPheart beatingyou
Journal Article2020-06-05✓ 1 SnippetKoreki A, Garfkinel SN, Mula M, Agrawal N, Cope S, Eilon T, Gould Van Praag C, Critchley HD, Edwards M, Yogarajah M.
In-Text Gene Mentions
I A O 0000326)
…HTT…
Show Full Abstract
<h4>Objective</h4>Dissociative traits represent a disturbance in selfhood that may predispose to, and trigger, functional seizures (FSs). The predictive representation and control of the internal physiological state of the body (interoception) are proposed to underpin the integrity of the sense of self ("minimal selfhood"). Therefore, discrepancies between objective and subjective aspects of interoception may relate to symptom expression in patients with FSs. Here, we tested whether individual differences in trait measures of interoception relate to dissociative symptoms, and whether state interoceptive deficits predict FS occurrence.<h4>Methods</h4>Forty-one participants with FSs and 30 controls completed questionnaire ratings of dissociation, and measures of (1) interoceptive accuracy (IA)-objective performance on heartbeat detection tasks; (2) trait interoceptive sensibility-subjective sensitivity to internal sensations (using the Porges Body Perception Questionnaire); and (3) state interoceptive sensibility-subjective trial-by-trial measures of confidence in heartbeat detection. Interoceptive trait prediction error (ITPE) was calculated from the discrepancy between IA and trait sensibility, and interoceptive state prediction error (ISPE) from the discrepancy between IA and state sensibility.<h4>Results</h4>Patients with FSs had significantly lower IA and greater trait interoceptive sensibility than healthy controls. ITPE was the strongest predictor of dissociation after controlling for trait anxiety and depression in a regression model. ISPE correlated significantly with FS frequency after controlling for state anxiety.<h4>Significance</h4>Patients with FSs have disturbances in interoceptive processing that predict both dissociative traits reflecting the disrupted integrity of self-representation, and the expression of FSs. These findings provide insight into the pathophysiology of functional neurological disorder, and could lead to novel diagnostic and therapeutic approaches.
Also flagged:mouth diseaseinfectious diseasesHandfoot, and mouth diseaseHand, foot, and mouth diseaseinfectious disease
Journal Article2020-06-05✓ 1 SnippetKou Z, Jia J, Liu X, Luo T, Xin X, Gong J, Zhang J, Sun D, Jiang F, Gao R.
In-Text Gene Mentions
Discussion)
…Notably, some other studies showed that other EV, such as CA6 and CA10, was going to become the important causative agents for HFMD in China, Finland, France, and Japan [39–41].…
Show Full Abstract
<h4>Background</h4>Hand, foot, and mouth disease (HFMD) has become one of the most important infectious diseases recent years. Qingdao City has suffered from serious HFMD epidemic. This study aimed to describe epidemiological characteristics and investigate spatial-temporal distribution at town level in Qingdao City.<h4>Method</h4>The surveillance data of HFMD during 2013-2018 were collected from the National Notifiable Disease Surveillance System. The global Moran's I statistic was used to detect the spatial autocorrelation of HFMD cases by ArcGis 10.0 software. Purely spatial and spatial-temporal analysis was used to detect epidemic clusters by SatScanTM v9.6 software.<h4>Results</h4>The annual average incidence of HFMD cases in Qingdao City from 2013 to 2018 was 123.16 per 100000, while the incidence rate of children≤5years old was 2879.80 per 100000. The majority (88.97%) of HFMD cases were aged within 0-5 years old and the males were 60.20%. Other enterovirus (EV), enteriovirus 71(EV71), and Coxsackievirus A16 (CA16) accounted for 48.75%, 30.91% and 20.34%. The seasonal peak was between May and October. HFMD had positive spatial autocorrelation at town level with global Moran's I from 0.19 to 0.31(P<0.001). Spatial-temporal cluster analysis detected six most likely clusters and three secondary clusters from 2013 to 2018. The most likely cluster was located in urban and urban-rural fringe areas.<h4>Conclusions</h4>Urban and urban-rural fringe areas were the major locations of the clusters with other EV as the dominant pathogen between May and October. The findings suggested that the prevention and control of HFMD in Qingdao City should be focus on these high-risk periods and locations which had important public health significance for the allocation of public health resources.
Journal Article2020-06-05✓ 1 SnippetNkya S, Mwita L, Mgaya J, Kumburu H, van Zwetselaar M, Menzel S, Mazandu GK, Sangeda R, Chimusa E, Makani J.
In-Text Gene Mentions
Introduction)
…GATA1, FOG1 andSOX6, which are…
Show Full Abstract
<h4>Background</h4>Sickle cell disease (SCD) is a blood disorder caused by a point mutation on the beta globin gene resulting in the synthesis of abnormal hemoglobin. Fetal hemoglobin (HbF) reduces disease severity, but the levels vary from one individual to another. Most research has focused on common genetic variants which differ across populations and hence do not fully account for HbF variation.<h4>Methods</h4>We investigated rare and common genetic variants that influence HbF levels in 14 SCD patients to elucidate variants and pathways in SCD patients with extreme HbF levels (≥7.7% for high HbF) and (≤2.5% for low HbF) in Tanzania. We performed targeted next generation sequencing (Illumina_Miseq) covering exonic and other significant fetal hemoglobin-associated loci, including BCL11A, MYB, HOXA9, HBB, HBG1, HBG2, CHD4, KLF1, MBD3, ZBTB7A and PGLYRP1.<h4>Results</h4>Results revealed a range of genetic variants, including bi-allelic and multi-allelic SNPs, frameshift insertions and deletions, some of which have functional importance. Notably, there were significantly more deletions in individuals with high HbF levels (11% vs 0.9%). We identified frameshift deletions in individuals with high HbF levels and frameshift insertions in individuals with low HbF. CHD4 and MBD3 genes, interacting in the same sub-network, were identified to have a significant number of pathogenic or non-synonymous mutations in individuals with low HbF levels, suggesting an important role of epigenetic pathways in the regulation of HbF synthesis.<h4>Conclusions</h4>This study provides new insights in selecting essential variants and identifying potential biological pathways associated with extreme HbF levels in SCD interrogating multiple genomic variants associated with HbF in SCD.
Also flagged:cancerExtracellularvesiclesmembranemicrovesiclescell growth
Journal Article2020-06-05✓ 1 SnippetHu W, Liu C, Bi ZY, Zhou Q, Zhang H, Li LL, Zhang J, Zhu W, Song YY, Zhang F, Yang HM, Bi YY, He QQ, Tan GJ, Sun CC, Li DJ.
Extracellular vesicles (EVs), a class of heterogeneous membrane vesicles, are generally divided into exosomes and microvesicles on basis of their origination from the endosomal membrane or the plasma membrane, respectively. EV-mediated bidirectional communication among various cell types supports cancer cell growth and metastasis. EVs derived from different cell types and status have been shown to have distinct RNA profiles, comprising messenger RNAs and non-coding RNAs (ncRNAs). Recently, ncRNAs have attracted great interests in the field of EV-RNA research, and growing numbers of ncRNAs ranging from microRNAs to long ncRNAs have been investigated to reveal their specific functions and underlying mechanisms in the tumor microenvironment and premetastatic niches. Emerging evidence has indicated that EV-RNAs are essential functional cargoes in modulating hallmarks of cancers and in reciprocal crosstalk within tumor cells and between tumor and stromal cells over short and long distance, thereby regulating the initiation, development and progression of cancers. In this review, we discuss current findings regarding EV biogenesis, release and interaction with target cells as well as EV-RNA sorting, and highlight biological roles and molecular mechanisms of EV-ncRNAs in cancer biology.
Also flagged:SETDB1transcription factorschromatinSET Domain Bifurcated Histone Lysine Methyltransferase 1ESETdeath
Journal Article2020-06-05✓ 4 SnippetsJužnić L, Peuker K, Strigli A, Brosch M, Herrmann A, Häsler R, Koch M, Matthiesen L, Zeissig Y, Löscher BS, Nuber A, Schotta G, Neumeister V, Chavakis T, Kurth T, Lesche M, Dahl A, von Mässenhausen A, Linkermann A, Schreiber S, Aden K, Rosenstiel PC, Franke A, Hampe J, Zeissig S.
In-Text Gene Mentions
S I O 001029)
…(A) RNA expression of Lgr5 and Olfm4 as determined by quantitative PCR (qPCR) in the ileum of the indicated mouse strains 9 days after the first tamoxifen injection.…
<h4>Objective</h4>The intestinal epithelium is a rapidly renewing tissue which plays central roles in nutrient uptake, barrier function and the prevention of intestinal inflammation. Control of epithelial differentiation is essential to these processes and is dependent on cell type-specific activity of transcription factors which bind to accessible chromatin. Here, we studied the role of SET Domain Bifurcated Histone Lysine Methyltransferase 1, also known as ESET (SETDB1), a histone H3K9 methyltransferase, in intestinal epithelial homeostasis and IBD.<h4>Design</h4>We investigated mice with constitutive and inducible intestinal epithelial deletion of <i>Setdb1</i>, studied the expression of SETDB1 in patients with IBD and mouse models of IBD, and investigated the abundance of <i>SETDB1</i> variants in healthy individuals and patients with IBD.<h4>Results</h4>Deletion of intestinal epithelial <i>Setdb1</i> in mice was associated with defects in intestinal epithelial differentiation, barrier disruption, inflammation and mortality. Mechanistic studies showed that loss of SETDB1 leads to de-silencing of endogenous retroviruses, DNA damage and intestinal epithelial cell death. Predicted loss-of-function variants in human <i>SETDB1</i> were considerably less frequently observed than expected, consistent with a critical role of SETDB1 in human biology. While the vast majority of patients with IBD showed unimpaired mucosal SETDB1 expression, comparison of IBD and non-IBD exomes revealed over-representation of individual rare missense variants in <i>SETDB1</i> in IBD, some of which are predicted to be associated with loss of function and may contribute to the pathogenesis of intestinal inflammation.<h4>Conclusion</h4>SETDB1 plays an essential role in intestinal epithelial homeostasis. Future work is required to investigate whether rare variants in <i>SETDB1</i> contribute to the pathogenesis of IBD.
Integrating association evidence across multiple traits can improve the power of gene discovery and reveal pleiotropy. Most multi-trait analysis methods focus on individual common variants in genome-wide association studies. Here, we introduce multi-trait analysis of rare-variant associations (MTAR), a framework for joint analysis of association summary statistics between multiple rare variants and different traits. MTAR achieves substantial power gain by leveraging the genome-wide genetic correlation measure to inform the degree of gene-level effect heterogeneity across traits. We apply MTAR to rare-variant summary statistics for three lipid traits in the Global Lipids Genetics Consortium. 99 genome-wide significant genes were identified in the single-trait-based tests, and MTAR increases this to 139. Among the 11 novel lipid-associated genes discovered by MTAR, 7 are replicated in an independent UK Biobank GWAS analysis. Our study demonstrates that MTAR is substantially more powerful than single-trait-based tests and highlights the value of MTAR for novel gene discovery.
Also flagged:spermatogenesisgerm cellEgfrCxcl12SLIT2CD81
Journal Article2020-06-05✓ 2 SnippetsShami AN, Zheng X, Munyoki SK, Ma Q, Manske GL, Green CD, Sukhwani M, Orwig KE, Li JZ, Hammoud SS.
In-Text Gene Mentions
Text
…ZNFX1…
Text
…SOX6…
Show Full Abstract
Spermatogenesis is a highly regulated process that produces sperm to transmit genetic information to the next generation. Although extensively studied in mice, our current understanding of primate spermatogenesis is limited to populations defined by state-specific markers from rodent data. As between-species differences have been reported in the duration and differentiation hierarchy of this process, it remains unclear how molecular markers and cell states are conserved or have diverged from mice to man. To address this challenge, we employ single-cell RNA sequencing to identify transcriptional signatures of major germ and somatic cell types of the testes in human, macaque, and mice. This approach reveals similarities and differences in expression throughout spermatogenesis, including the stem/progenitor pool of spermatogonia, markers of differentiation, potential regulators of meiosis, RNA turnover during spermatid differentiation, and germ cell-soma communication. These datasets provide a rich foundation for future targeted mechanistic studies of primate germ cell development and in vitro gametogenesis.
Chemotherapy-induced sensorimotor disabilities, including gait and balance disorders, as well as physical fatigue often persist for months and sometimes years into disease free survival from cancer. While associated with impaired sensory function, chronic sensorimotor disorders might also depend on chemotherapy-induced defects in other neuron types. In this report, we extend consideration to motoneurons, which, if chronically impaired, would necessarily degrade movement behavior. The present study was undertaken to determine whether motoneurons qualify as candidate contributors to chronic sensorimotor disability independently from sensory impairment. We tested this possibility in vivo from rats 5 weeks following human-scaled treatment with one of the platinum-based compounds, oxaliplatin, widely used in chemotherapy for a variety of cancers. Action potential firing of spinal motoneurons responding to different fixed levels of electrode-current injection was measured in order to assess the neurons' intrinsic capacity for stimulus encoding. The encoding of stimulus duration and intensity corroborated in untreated control rats was severely degraded in oxaliplatin treated rats, in which motoneurons invariably exhibited erratic firing that was unsustained, unpredictable from one stimulus trial to the next, and unresponsive to changes in current strength. Direct measurements of interspike oscillations in membrane voltage combined with computer modeling pointed to aberrations in subthreshold conductances as a plausible contributor to impaired firing behavior. These findings authenticate impaired spike encoding as a candidate contributor to, in the case of motoneurons, deficits in mobility and fatigue. Aberrant firing also becomes a deficit worthy of testing in other CNS neurons as a potential contributor to perceptual and cognitive disorders induced by chemotherapy in patients.
Also flagged:Ripretinibgastrointestinal stromal tumoursKITPDGFRAtyrosine kinaseimatinib
Journal Article2020-06-05No SnippetsBlay JY, Serrano C, Heinrich MC, Zalcberg J, Bauer S, Gelderblom H, Schöffski P, Jones RL, Attia S, D'Amato G, Chi P, Reichardt P, Meade J, Shi K, Ruiz-Soto R, George S, von Mehren M.
Show Full Abstract
<h4>Background</h4>Resistance to approved inhibitors of KIT proto-oncogene, receptor tyrosine kinase (KIT), and platelet-derived growth factor receptor α (PDGFRA) is a clinical challenge for patients with advanced gastrointestinal stromal tumours. We compared the efficacy and safety of ripretinib, a switch-control tyrosine kinase inhibitor active against a broad spectrum of KIT and PDGFRA mutations, with placebo in patients with previously treated, advanced gastrointestinal stromal tumours.<h4>Methods</h4>In this double-blind, randomised, placebo-controlled, phase 3 study, we enrolled adult patients in 29 specialised hospitals in 12 countries. We included patients aged 18 years or older who had advanced gastrointestinal stromal tumours with progression on at least imatinib, sunitinib, and regorafenib or documented intolerance to any of these treatments despite dose modifications, and who had an Eastern Cooperative Oncology Group (ECOG) performance status of 0-2. Eligible patients were randomly assigned (2:1) to receive either oral ripretinib 150 mg once daily (ripretenib group) or placebo once daily (placebo group). Randomisation was done via an interactive response system using randomly permuted block sizes of six and stratified according to number of previous therapies and ECOG performance status. Patients, investigators, research staff, and the sponsor study team were masked to a patient's treatment allocation until the blinded independent central review (BICR) showed progressive disease for the patient. The primary endpoint was progression-free survival, assessed by BICR. The primary analysis was done in the intention-to-treat population and safety was assessed in patients who received at least one dose of study drug. Patients randomly assigned to placebo were permitted to cross over to ripretinib 150 mg at the time of disease progression. The INVICTUS study is registered with ClinicalTrials.gov, number NCT03353753, and with WHO International Clinical Trials Registry Platform, number EUCTR2017-002446-76-ES; follow-up is ongoing.<h4>Findings</h4>Between Feb 27, 2018, and Nov 16, 2018, 129 of 154 assessed patients were randomly assigned to receive either ripretinib (n=85) or placebo (n=44). At data cutoff (May 31, 2019), at a median follow-up of 6·3 months (IQR 3·2-8·2) in the ripretinib group and 1·6 months (1·1-2·7) in the placebo group, 51 patients in the ripretinib group and 37 in the placebo group had had progression-free survival events. In the double-blind period, median progression-free survival was 6·3 months (95% CI 4·6-6·9) with ripretinib compared with 1·0 months (0·9-1·7) with placebo (hazard ratio 0·15, 95% CI 0·09-0·25; p<0·0001). The most common (>2%) grade 3 or 4 treatment-related treatment-emergent adverse events in the ripretinib group (n=85) included lipase increase (four [5%]), hypertension (three [4%]), fatigue (two [2%]), and hypophosphataemia (two (2%]); in the placebo group (n=43), the most common (>2%) grade 3 or 4 treatment-related treatment-emergent adverse events were anaemia (three [7%]), fatigue (one [2%]), diarrhoea (one [2%]), decreased appetite (one [2%]), dehydration (one [2%]), hyperkalaemia (one [2%]), acute kidney injury (one [2%]), and pulmonary oedema (one [2%]). Treatment-related serious adverse events were reported in eight (9%) of 85 patients who received ripretinib and three (7%) of 43 patients who received placebo. Treatment-related deaths occurred in one patient in the placebo group (septic shock and pulmonary oedema) and one patient in the ripretinib group (cause of death unknown; the patient died during sleep).<h4>Interpretation</h4>Ripretinib significantly improved median progression-free survival compared with placebo and had an acceptable safety profile in patients with advanced gastrointestinal stromal tumours who were resistant to approved treatments.<h4>Funding</h4>Deciphera Pharmaceuticals.
The maintenance of chromosome ends in Drosophila is an exceptional phenomenon because it relies on the transposition of specialized retrotransposons rather than on the activity of the enzyme telomerase that maintains telomeres in almost every other eukaryotic species. Sequential transpositions of Het-A, TART, and TAHRE (HTT) onto chromosome ends produce long head-to-tail arrays that are reminiscent to the long arrays of short repeats produced by telomerase in other organisms. Coordinating the activation and silencing of the HTT array with the recruitment of telomere capping proteins favors proper telomere function. However, how this coordination is achieved is not well understood. Like other Drosophila retrotransposons, telomeric elements are regulated by the piRNA pathway. Remarkably, HTT arrays are both source of piRNA and targets of gene silencing thus making the regulation of Drosophila telomeric transposons a unique event among eukaryotes. Herein we will review the genetic and molecular mechanisms underlying the regulation of HTT transcription and transposition and will discuss the possibility of a crosstalk between piRNA-mediated regulation, telomeric chromatin establishment, and telomere protection.
Also flagged:congenital dyserythropoietic anemiaType 1CDA1Congenital dyserythropoietic anemia type 1macrocytic anemiaerythropoiesis
Journal Article2020-06-05✓ 1 SnippetAbramovich-Yoffe H, Shalev A, Barrett O, Shalev H, Levitas A.
In-Text Gene Mentions
Abstract)
…erythropoiesis, and secondaryhemochromatosis.…
Show Full Abstract
<h4>Background</h4>Congenital dyserythropoietic anemia type 1 (CDA1) is a rare autosomal recessive disease characterized by macrocytic anemia, ineffective erythropoiesis, and secondary hemochromatosis. Left-ventricular noncompaction (LVNC) is a cardiomyopathy that is commonly attributed to intrauterine arrest of normal compaction during the endomyocardial morphogenesis. LV hypertrabeculation/noncompaction (LVHT/NC) morphology, however, might exist in various hemoglobinopathies. Our primary objective was to determine whether the pattern of LVHT/NC is more prevalent among patients with CDA1, in comparison to subjects without CDA1, and to find potential risk factors for LVHT/NC among these patients. Our secondary objective was to evaluate the clinical implication of LVHT/NC.<h4>Methods</h4>We retrospectively assessed 32 CDA1 patients (median age 17.5, range 6-61) that underwent routine assessment of iron overload by cardiac magnetic resonance. Number and distribution of noncompacted LV segments were assessed in CDA1 patients and compared to 64 age- and gender-matched patients without CDA1. The ratio of noncompacted to compacted myocardium (NC/C ratio) in end-diastole was calculated for each of the three long-axis views. NC/C ratio > 2.3 was considered diagnostic for LVHT/NC.<h4>Results</h4>In multivariate analysis, the presence of CDA1 was independently associated with NC/C ratio > 2.3, a feature of LVHT/NC (adjusted OR = 11.46, 95%CI = 2.6-50.68, p = .001). CDA1 was strongly associated with increased number of myocardial segments exhibiting LVHT/NC pattern. Cardiac volumes and ejection fraction were preserved without clinical adverse events in long term follow-up.<h4>Conclusions</h4>CDA1 patients have a higher prevalence of LVHT/NC than normal individuals, independent of myocardial iron overload and without effect on ejection fraction or clinical outcome.
Hepatocellular carcinoma (HCC) is associated with high mortality due to its inherent heterogeneity, aggressiveness, and limited therapeutic regimes. Herein, we analyzed 21 human HCC cell lines (HCC lines) to explore intertumor molecular diversity and pertinent drug sensitivity. We used an integrative computational approach based on exploratory and single-sample gene-set enrichment analysis of transcriptome and proteome data from the Cancer Cell Line Encyclopedia, followed by correlation analysis of drug-screening data from the Cancer Therapeutics Response Portal with curated gene-set enrichment scores. Acquired results classified HCC lines into two groups, a poorly and a well-differentiated group, displaying lower/higher enrichment scores in a "Specifically Upregulated in Liver" gene-set, respectively. Hierarchical clustering based on a published epithelial-mesenchymal transition gene expression signature further supported this stratification. Between-group comparisons of gene and protein expression unveiled distinctive patterns, whereas downstream functional analysis significantly associated differentially expressed genes with crucial cancer-related biological processes/pathways and revealed concrete driver-gene signatures. Finally, correlation analysis highlighted a diverse effectiveness of specific drugs against poorly compared to well-differentiated HCC lines, possibly applicable in clinical research with patients with analogous characteristics. Overall, this study expanded the knowledge on the molecular profiles, differentiation status, and drug responsiveness of HCC lines, and proposes a cost-effective computational approach to precision anti-HCC therapies.
Also flagged:Guanine DeaminaseGDAgene expressionpigmentationstem cell factorSCF
Journal Article2020-06-05✓ 1 SnippetJung JM, Noh TK, Jo SY, Kim SY, Song Y, Kim YH, Chang SE.
In-Text Gene Mentions
Methods)
…disease, hyperthyroidism, andhemochromatosis.…
Show Full Abstract
Epidermal keratinocytes are considered as the most important neighboring cells that modify melanogenesis. Our previous study used microarray to show that guanine deaminase (GDA) gene expression is highly increased in melasma lesions. Hence, we investigated the role of GDA in skin pigmentation. We examined GDA expression in post-inflammatory hyperpigmentation (PIH) lesions, diagnosed as Riehl's melanosis. We further investigated the possible role of keratinocyte-derived GDA in melanogenesis by quantitative PCR, immunofluorescence staining, small interfering RNA-based GDA knockdown, and adenovirus-mediated GDA overexpression. We found higher GDA positivity in the hyperpigmentary lesional epidermis than in the perilesional epidermis. Both UVB irradiation and stem cell factor (SCF) plus endothelin-1 (ET-1) were used, which are well-known melanogenic stimuli upregulating GDA expression in both keratinocyte culture alone and keratinocyte and melanocyte coculture. GDA knockdown downregulated melanin content, while GDA overexpression promoted melanogenesis in the coculture. When melanocytes were treated with UVB-exposed keratinocyte-conditioned media, the melanin content was increased. Also, GDA knockdown lowered SCF and ET-1 expression levels in keratinocytes. GDA in epidermal keratinocytes may promote melanogenesis by upregulating SCF and ET-1, suggesting its role in skin hyperpigmentary disorders.
Also flagged:Glucosecancertricarboxylic acidpentosephosphateserine
Journal Article2020-06-05No SnippetsMartinez CA, Scafoglio C.
Show Full Abstract
Increased glucose uptake is a known hallmark of cancer. Cancer cells need glucose for energy production via glycolysis and the tricarboxylic acid cycle, and also to fuel the pentose phosphate pathway, the serine biosynthetic pathway, lipogenesis, and the hexosamine pathway. For this reason, glucose transport inhibition is an emerging new treatment for different malignancies, including lung cancer. However, studies both in animal models and in humans have shown high levels of heterogeneity in the utilization of glucose and other metabolites in cancer, unveiling a complexity that is difficult to target therapeutically. Here, we present an overview of different levels of heterogeneity in glucose uptake and utilization in lung cancer, with diagnostic and therapeutic implications.
Journal Article2020-06-05No SnippetsPedrero-Prieto CM, García-Carpintero S, Frontiñán-Rubio J, Llanos-González E, Aguilera García C, Alcaín FJ, Lindberg I, Durán-Prado M, Peinado JR, Rabanal-Ruiz Y.
Show Full Abstract
<h4>Background</h4>During the last two decades, over 100 proteomics studies have identified a variety of potential biomarkers in CSF of Alzheimer's (AD) patients. Although several reviews have proposed specific biomarkers, to date, the statistical relevance of these proteins has not been investigated and no peptidomic analyses have been generated on the basis of specific up- or down- regulation. Herein, we perform an analysis of all unbiased explorative proteomics studies of CSF biomarkers in AD to critically evaluate whether proteins and peptides identified in each study are consistent in distribution; direction change; and significance, which would strengthen their potential use in studies of AD pathology and progression.<h4>Methods</h4>We generated a database containing all CSF proteins whose levels are known to be significantly altered in human AD from 47 independent, validated, proteomics studies. Using this database, which contains 2022 AD and 2562 control human samples, we examined whether each protein is consistently present on the basis of reliable statistical studies; and if so, whether it is over- or under-represented in AD. Additionally, we performed a direct analysis of available mass spectrometric data of these proteins to generate an AD CSF peptide database with 3221 peptides for further analysis.<h4>Results</h4>Of the 162 proteins that were identified in 2 or more studies, we investigated their enrichment or depletion in AD CSF. This allowed us to identify 23 proteins which were increased and 50 proteins which were decreased in AD, some of which have never been revealed as consistent AD biomarkers (i.e. SPRC or MUC18). Regarding the analysis of the tryptic peptide database, we identified 87 peptides corresponding to 13 proteins as the most highly consistently altered peptides in AD. Analysis of tryptic peptide fingerprinting revealed specific peptides encoded by CH3L1, VGF, SCG2, PCSK1N, FBLN3 and APOC2 with the highest probability of detection in AD.<h4>Conclusions</h4>Our study reveals a panel of 27 proteins and 21 peptides highly altered in AD with consistent statistical significance; this panel constitutes a potent tool for the classification and diagnosis of AD.
Also flagged:Hydroxyapatitesulphorhodamine Bepithelial cellalbuminBSAamide
Journal Article2020-06-05No SnippetsEl-Bassyouni GT, Eldera SS, Kenawy SH, Hamzawy EMA.
Show Full Abstract
Hydroxyapatite (HA) nanoparticles derived from mussel shells were prepared using the wet precipitation method and were tested on human mesenchymal and epithelial cells. Shells and HA powder were characterized via X-ray diffraction analysis (XRD) and scanning electron microscopy along with energy dispersive X-ray spectroscopy (SEM/EDX), high resolution transmission electron microscopy (HR-TEM) and Fourier transform infrared spectroscopy (FTIR). The in vitro cytotoxic properties of HA and mussel shells were determined using sulphorhodamine B (SRB) assays for MCF-7 cells (HepG2) and colon (Caco-2) cells. Cell viability tests confirmed the nontoxic effects of synthesized HA and mussel shells on human mesenchymal stem cells (h-MSCs) and epithelial cells. Toxicity values were less than 50% of the cell's validity ratio based on analyses using different concentrations (from 0.01 to 1,000 μg). The results indicate that MSC and epithelial cell attachment and proliferation in the presence of both HA and shell occurred. The proliferation capability was established after 3 and 7 days. SEM images revealed that stem cells and epithelial cells attached to the scaffold indicated full and complete integration between the cells and the material. It seems that due to the ion exchange between bovine serum albumin solutions (BSA) and HA, the FTIR data confirmed an increase in the amide I and amide II bands, which indicates the compatibility of the BSA helix structure. This study sheds light on the importance of merging stem cells and nanomaterials that may lead to improvements in tissue engineering to develop novel treatments for various diseases.
Also flagged:Organic Acidhemicelluloseligninmetalsphenolsacids
Journal Article2020-06-05No SnippetsLu X, Jiang J, He J, Sun K, Sun Y.
Show Full Abstract
Pretreatment is an effective method to change the pyrolysis behavior and improve the product properties of biomass. In this study, the effects of hydrothermal treatment (HTT) and hydrothermal treatment combined with organic acid washing (HTT-A) on Chinese fir waste (CF) pyrolysis and preparation of wood vinegar (WV) were investigated. The results indicated that HTT promoted the decomposition of hemicellulose and disrupted the chemical structure, while HTT-A partly removed the lignin as well as hemicellulose. HTT-A showed a more effective removal efficiency of alkali/alkaline earth metals (AAEMs) than HTT. Both HTT and HTT-A delayed the initial decomposition temperature but promoted the pyrolysis process. The yields of WVs increased after HTT and HTT-A, while the moisture contents reduced, obviously. HTT increased the relative contents of phenols from 47.04 to 59.85% but reduced the relative contents of acids from 24.31 to 18.38%, whereas HHT-A reduced the relative contents of phenols but increased those of aldehydes. In addition, HTT and HTT-A showed the different effects on chemical compositions of WVs, especially for phenolic and acid compounds. This study indicated that HTT and HTT-A were the efficient methods to produce WVs with target chemical components, which would be conducive to the efficient application of WVs.
Also flagged:neurological diseasesdeathneurological diseasepathogenesisneurodegenerative diseasestumor disorders
Journal Article2020-06-05✓ 2 SnippetsFan W, Liang C, Ou M, Zou T, Sun F, Zhou H, Cui L.
In-Text Gene Mentions
S I O 001029)
…Huntington’s disease (HD) is an autosomal dominant progressive neurodegenerative disease involving the loss of neurons in the cortex and striatum caused by amplification of the CAG trinucleotide repeat length in the Huntingtin (HTT) gene (Imarisio et al., 2008).…
S I O 001029)
…Elevated p53 increases mutant HTT aggregation and inhibits NF-κB activity and miR-146a expression in mouse and cell models of HD (Ghose et al., 2011), and a reduction in the miR-146a level upregulates TBP in the STHdhQ111 cell lines (Sinha et al., 2010), all of which might contribute to HD.…
Show Full Abstract
Progressive functional deterioration and loss of neurons underlies neurological diseases and constitutes an important cause of disability and death worldwide. The causes of various types of neurological diseases often share several critical nerve-related cellular mechanisms and pathological features, particularly the neuroinflammatory response in the nervous system. A rapidly growing body of evidence indicates that various microRNAs play pivotal roles in these processes in neurological diseases and might be viable therapeutic targets. Among these microRNAs, microRNA-146a (miR-146a) stands out due to the rapid increase in recent literature on its mechanistic involvement in neurological diseases. In this review, we summarize and highlight the critical role of miR-146a in neurological diseases. MiR-146a polymorphisms are associated with the risk of neurological disease. Alterations in miR-146a expression levels are crucial events in the pathogenesis of numerous neurological diseases that are spatially and temporally diverse. Additionally, the target genes of miR-146a are involved in the regulation of pathophysiological processes in neurological diseases, particularly the neuroinflammatory response. In summary, miR-146a mainly plays a critical role in neuroinflammation during the progression of neurological diseases and might be a prospective biomarker and therapeutic target. Understanding the mechanisms by which miR-146a affects the neuroinflammatory response in different neurological injuries, different cell types, and even different stages of certain neurological diseases will pave the way for its use as a therapeutic target in neurodegenerative diseases.
Also flagged:Sodium ValproateFasciculationvalproic acidbehavioralautism spectrum disordertyrosine hydroxylase
Journal Article2020-06-05✓ 1 SnippetÁdám Á, Kemecsei R, Company V, Murcia-Ramón R, Juarez I, Gerecsei LI, Zachar G, Echevarría D, Puelles E, Martínez S, Csillag A.
In-Text Gene Mentions
Discussion)
…from colorectal cancer” (DCC) have also been…
Show Full Abstract
Gestational exposure to valproic acid (VPA) is known to cause behavioral deficits of sociability, matching similar alterations in human autism spectrum disorder (ASD). Available data are scarce on the neuromorphological changes in VPA-exposed animals. Here, we focused on alterations of the dopaminergic system, which is implicated in motivation and reward, with relevance to social cohesion. Whole brains from 7-day-old mice born to mothers given a single injection of VPA (400 mg/kg b.wt.) on E13.5 were immunostained against tyrosine hydroxylase (TH). They were scanned using the iDISCO method with a laser light-sheet microscope, and the reconstructed images were analyzed in 3D for quantitative morphometry. A marked reduction of mesotelencephalic (MT) axonal fascicles together with a widening of the MT tract were observed in VPA treated mice, while other major brain tracts appeared anatomically intact. We also found a reduction in the abundance of dopaminergic ventral tegmental (VTA) neurons, accompanied by diminished tissue level of DA in ventrobasal telencephalic regions (including the nucleus accumbens (NAc), olfactory tubercle, BST, substantia innominata). Such a reduction of DA was not observed in the non-limbic caudate-putamen. Conversely, the abundance of TH+ cells in the substantia nigra (SN) was increased, presumably due to a compensatory mechanism or to an altered distribution of TH+ neurons occupying the SN and the VTA. The findings suggest that defasciculation of the MT tract and neuronal loss in VTA, followed by diminished dopaminergic input to the ventrobasal telencephalon at a critical time point of embryonic development (E13-E14) may hinder the patterning of certain brain centers underlying decision making and sociability.
<b>Objective:</b> Assessing brain connectivity from electrophysiological signals is of great relevance in neuroscience, but results are still debated and depend crucially on how connectivity is defined and on mathematical instruments utilized. Aim of this work is to assess the capacity of bivariate Transfer Entropy (TE) to evaluate connectivity, using data generated from simple neural mass models of connected Regions of Interest (ROIs). <b>Approach:</b> Signals simulating mean field potentials were generated assuming two, three or four ROIs, connected via excitatory or by-synaptic inhibitory links. We investigated whether the presence of a statistically significant connection can be detected and if connection strength can be quantified. <b>Main Results:</b> Results suggest that TE can reliably estimate the strength of connectivity if neural populations work in their linear regions, and if the epoch lengths are longer than 10 s. In case of multivariate networks, some spurious connections can emerge (i.e., a statistically significant TE even in the absence of a true connection); however, quite a good correlation between TE and synaptic strength is still preserved. Moreover, TE appears more robust for distal regions (longer delays) compared with proximal regions (smaller delays): an approximate a priori knowledge on this delay can improve the procedure. Finally, non-linear phenomena affect the assessment of connectivity, since they may significantly reduce TE estimation: information transmission between two ROIs may be weak, due to non-linear phenomena, even if a strong causal connection is present. <b>Significance:</b> Changes in functional connectivity during different tasks or brain conditions, might not always reflect a true change in the connecting network, but rather a change in information transmission. A limitation of the work is the use of bivariate TE. In perspective, the use of multivariate TE can improve estimation and reduce some of the problems encountered in the present study.
Also flagged:cancerRNA-binding proteinRNase Rpeptidesribosomesribosome
Journal Article2020-06-05No SnippetsSun P, Wang H, Li G.
Show Full Abstract
Circular RNA (circRNA), which has a closed-loop structure, is a special type of endogenous RNA that plays important roles in many biological processes. With improvements in next-generation sequencing technology and bioinformatics methods, some tools have been published for circRNA detection based on RNA-seq. Here, we developed the R package "Rcirc" for further analyses of circRNA after its detection. Rcirc identifies the coding ability of circRNA and visualizes various aspects of this feature. It also provides general visualization for both single circRNAs and meta-features of thousands of circRNAs. Rcirc was designed as a user-friendly tool that provides many highly automated functions without requiring the user to perform many complicated processes. It is available on GitHub (https://github.com/PSSUN/Rcirc) under the license GPL 3.0.
Also flagged:Cyclin-Dependent Kinase-Like 5CDKL5STK9serine/threonine protein kinasechromosomeRett syndrome
Journal Article2020-06-05✓ 1 SnippetKatayama S, Sueyoshi N, Inazu T, Kameshita I.
In-Text Gene Mentions
S I O 001029)
…The following amino acid sequences of the catalytic domain of human protein kinases were used for the phylogenetic tree construction: AMPKα1 (accession no. XP_016865113.1), B-Raf (accession no. NP_004324.2), CaMKIIα (accession no. NP_001350918.1), CDK5 (accession no. CAG33322.1), CDKL1 (accession no. NP_004187.2), CDKL2 (accession no. NP_003939.1), CDKL3 (accession no. NP_001107047.1), CDKL4 (accession no. NP_001333840.1), CDKL5 (accession no. NP_001032420.1), CK1α (accession no. NP_001883.4), ERK2 (accession no. NP_002736.3), GSK-3β (accession no. NP_002084.2), LRRK2 (accession no. NP_940980.4), MEK1 (accession no. NP_002746.1), MST1 (accession no. AAA83254.1), PKAα (accession no. NP_002721.1), p70S6K (accession no. NP_003152.1), and VRK2 (accession no. AAO73049.1).…
Show Full Abstract
Cyclin-dependent kinase-like 5 (CDKL5, also known as STK9) is a serine/threonine protein kinase originally identified in 1998 during a transcriptional mapping project of the human X chromosome. Thereafter, a mutation in <i>CDKL5</i> was reported in individuals with the atypical Rett syndrome, a neurodevelopmental disorder, suggesting that CDKL5 plays an important regulatory role in neuronal function. The disease associated with <i>CDKL5</i> mutation has recently been recognised as CDKL5 deficiency disorder (CDD) and has been distinguished from the Rett syndrome owing to its symptomatic manifestation. Because <i>CDKL5</i> mutations identified in patients with CDD cause enzymatic loss of function, CDKL5 catalytic activity is likely strongly associated with the disease. Consequently, the exploration of CDKL5 substrate characteristics and regulatory mechanisms of its catalytic activity are important for identifying therapeutic target molecules and developing new treatment. In this review, we summarise recent findings on the phosphorylation of CDKL5 substrates and the mechanisms of CDKL5 phosphorylation and dephosphorylation. We also discuss the relationship between changes in the phosphorylation signalling pathways and the <i>Cdkl5</i> knockout mouse phenotype and consider future prospects for the treatment of mental and neurological disease associated with <i>CDKL5</i> mutations.
Also flagged:cancerlung cancerresponse to irradiationreverse transcriptiondeathnon-small cell lung cancer
Journal Article2020-06-05No SnippetsZhang T, Wu DM, Deng SH, Han R, Liu T, Li J, Xu Y.
Show Full Abstract
With the development of new biochemical and computational methods, circular RNAs (circRNAs) have been identified as microRNA sponges. circRNAs are associated with many diseases, particularly cancer. The present study aimed to investigate the expression profile of circRNAs in irradiated A549 lung cancer cells using high-throughput sequencing. Bioinformatics analyses were used to examine the potential functions of circRNAs. RNA sequencing data demonstrated that 1,875 circRNA targets were differentially expressed in A549 cells in response to irradiation. A total of 30 circRNAs were upregulated and 37 circRNAs were downregulated significantly in irradiation-treated A549 cells (fold change ≥2.0; P<0.05). The top 5 upregulated and downregulated circRNAs were successfully validated by reverse transcription-quantitative PCR. In addition, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis suggested that differentially expressed circRNAs might be pivotal in biological irradiation responses to irradiation. circRNA-microRNA co-expression networks highlighted the biological significance of circRNA_0002174 and circRNA_0036627, which require further study. In conclusion, the present study is, to the best of the authors' knowledge, the first to describe the differentially expressed profile of circRNAs in response to irradiation in A549 cells. These results provide a new perspective to elucidate insight into the molecular mechanisms by which A549 cells respond to radiation, and a basis for a more in-depth analysis of the potential application of circRNAs in the treatment of lung cancer therapy.
Also flagged:cryptococcosisironHereditary hemochromatosischronichepatitis B virus infectioncirrhosis
Journal Article2020-06-05✓ 5 SnippetsNichols L, Rowley L, Lall A.
In-Text Gene Mentions
Title)
…isseminated cryptococcosis andhemochromatosis: clues to diagnosis…
Discussion)
…was transplanted forhemochromatosis, but one had…
Discussion)
…splenocaval shunt andhemochromatosishas been reported…
Discussion)
…The comorbidity ofhemochromatosisand other chronic…
Discussion)
…in patients withhemochromatosis.…
Show Full Abstract
Hepatic cirrhosis, diabetes mellitus and iron overload can each independently predispose to cryptococcosis. Hereditary hemochromatosis leads to all three of these predispositions. This report is the case of a patient with chronic hepatitis B virus infection and cirrhosis, who had markedly elevated serum ferritin and 99% transferrin saturation, and developed a leukemoid reaction. Autopsy revealed disseminated cryptococcosis for which the leukemoid reaction was a clue and possible hereditary hemochromatosis of which elevated ferritin and transferrin saturation can be clues. Hereditary hemochromatosis is an important diagnosis clinicians should never miss because early treatment with phlebotomy can be life-saving. Disseminated cryptococcosis can be rapidly diagnosed with serum cryptococcal antigen test and is treatable.
medRxiv2020-06-05Preprint (No Snippets API)Schulte-Schrepping J, Reusch N, Paclik D, Baßler K, Schlickeiser S, Zhang B, Krämer B, Krammer T, Brumhard S, Bonaguro L, De Domenico E, Wendisch D, Grasshoff M, Kapellos TS, Beckstette M, Pecht T, Saglam A, Dietrich O, Mei HE, Schulz AR, Conrad C, Kunkel D, Vafadarnejad E, Xu C, Horne A, Herbert M, Drews A, Thibeault C, Pfeiffer M, Hippenstiel S, Hocke A, Müller-Redetzky H, Heim K, Machleidt F, Uhrig A, de Jarcy LB, Jürgens L, Stegemann M, Glösenkamp CR, Volk H, Goffinet C, Raabe J, Kaiser KM, Vinh MT, Rieke G, Meisel C, Ulas T, Becker M, Geffers R, Witzenrath M, Drosten C, Suttorp N, von Kalle C, Kurth F, Händler K, Schultze JL, Aschenbrenner AC, Li Y, Nattermann J, Sawitzki B, Saliba A, Sander LE, Deutsche COVID-19 OMICS Initiative (DeCOI).
Show Full Abstract
‘Severe Acute Respiratory Syndrome - Coronavirus-2’ (SARS-CoV-2) infection causes Coronavirus Disease 2019 (COVID-19), a mild to moderate respiratory tract infection in the majority of patients. A subset of patients, however, progresses to severe disease and respiratory failure with acute respiratory distress syndrome (ARDS). Severe COVID-19 has been associated with increased neutrophil counts and dysregulated immune responses. The mechanisms of protective immunity in mild forms and the pathogenesis of dysregulated inflammation in severe courses of COVID-19 remain largely unclear. Here, we combined two single-cell RNA-sequencing technologies and single-cell proteomics in whole blood and peripheral blood mononuclear cells (PBMC) to determine changes in immune cell composition and activation in two independent dual-center patient cohorts (n=46+n=54 COVID-19 samples), each with mild and severe cases of COVID-19. We observed a specific increase of HLA-DR hi CD11c hi inflammatory monocytes that displayed a strong interferon (IFN)-stimulated gene signature in patients with mild COVID-19, which was absent in severe disease. Instead, we found evidence of emergency myelopoiesis, marked by the occurrence of immunosuppressive pre-neutrophils and immature neutrophils and populations of dysfunctional and suppressive mature neutrophils, as well as suppressive HLA-DR to monocytes in severe COVID-19. Our study provides detailed insights into systemic immune response to SARS-CoV-2 infection and it reveals profound alterations in the peripheral myeloid cell compartment associated with severe courses of COVID-19.
bioRxiv2020-06-05Preprint (No Snippets API)Pearl JR, Shetty AC, Cantle JP, Bergey DE, Bragg RM, Coffey SR, Kordasiewicz HB, Hood LE, Price ND, Ament SA, Carroll JB.
Show Full Abstract
Progressive striatal gene expression changes and epigenetic alterations are a prominent feature of Huntington’s disease (HD), but the mechanistic basis remains poorly understood. Using chromatin immunoprecipitation and sequencing (ChIP-seq), we show that the huntingtin protein (HTT) reproducibly occupies specific locations in the mouse genome. Moreover, many genomic loci were differentially occupied by HTT in striatal tissue from a homozygous knock-in mouse model of HD (B6. Htt Q111/Q111 ) when compared to wildtype controls. Huntingtin ChIP-seq peaks were enriched in the coding regions of cell identity genes important for striatal function, with many of these genes found to have reduced expression in the striata of HD patients and mouse models, as well as reduced HTT occupancy in Htt Q111/Q111 mice compared to controls. Conversely, HTT ChIP-seq peaks were depleted near genes that are up-regulated in HD. ChIP-seq of bulk striatal histone modifications, generated in parallel, revealed genotype-specific colocalization of HTT with active chromatin marks (H3K4me3 and H3K27ac), and with enhancer of zeste homolog 2 (EZH2), a key enzymatic component of the PRC2 complex. Near genes that are differentially regulated in HD, greater HTT occupancy in Htt Q111/Q111 vs. wildtype mice was associated with increased EZH2 binding, increased histone H3 lysine 4 (H3K4me3), and decreased histone H3 lysine 27 (H3K27me3). Our study suggests that huntingtin-chromatin interactions may play a direct role in organizing chromatin and promoting cell type-specific gene expression, with loss of HTT occupancy predicting decreased gene expression in HD.
Also flagged:LGR4gonadotropin-releasing hormoneGnRHsecretiondelayed pubertyWnt
Journal Article2020-06-04✓ 1 SnippetMancini A, Howard SR, Marelli F, Cabrera CP, Barnes MR, Sternberg MJ, Leprovots M, Hadjidemetriou I, Monti E, David A, Wehkalampi K, Oleari R, Lettieri A, Vezzoli V, Vassart G, Cariboni A, Bonomi M, Garcia MI, Guasti L, Dunkel L.
In-Text Gene Mentions
Results)
…and controls (LRRIQ3, SEC24A ,…
Show Full Abstract
The initiation of puberty is driven by an upsurge in hypothalamic gonadotropin-releasing hormone (GnRH) secretion. In turn, GnRH secretion upsurge depends on the development of a complex GnRH neuroendocrine network during embryonic life. Although delayed puberty (DP) affects up to 2% of the population, is highly heritable, and is associated with adverse health outcomes, the genes underlying DP remain largely unknown. We aimed to discover regulators by whole-exome sequencing of 160 individuals of 67 multigenerational families in our large, accurately phenotyped DP cohort. LGR4 was the only gene remaining after analysis that was significantly enriched for potentially pathogenic, rare variants in 6 probands. Expression analysis identified specific Lgr4 expression at the site of GnRH neuron development. LGR4 mutant proteins showed impaired Wnt/β-catenin signaling, owing to defective protein expression, trafficking, and degradation. Mice deficient in Lgr4 had significantly delayed onset of puberty and fewer GnRH neurons compared with WT, whereas lgr4 knockdown in zebrafish embryos prevented formation and migration of GnRH neurons. Further, genetic lineage tracing showed strong Lgr4-mediated Wnt/β-catenin signaling pathway activation during GnRH neuron development. In conclusion, our results show that LGR4 deficiency impairs Wnt/β-catenin signaling with observed defects in GnRH neuron development, resulting in a DP phenotype.
Schizophrenia is a debilitating disorder affecting just under 1% of the population. While the symptoms of this disorder do not appear until late adolescence, pathological alterations likely occur earlier, during development in utero. While there is an increasing literature examining transcriptome alterations in patients, it is not possible to examine the changes in gene expression that occur during development in humans that will develop schizophrenia. Here we utilize three distinct rodent developmental disruption models of schizophrenia to examine potential overlapping alterations in the transcriptome, with a specific focus on markers of interneuron development. Specifically, we administered either methylazoxymethanol acetate (MAM), Polyinosinic:polycytidylic acid (Poly I:C), or chronic protein malnutrition, on GD 17 and examined mRNA expression in the developing hippocampus of the offspring 18 hours later. Here, we report alterations in gene expression that may contribute to the pathophysiology of schizophrenia, including significant alterations in interneuron development and ribosome function.
Also flagged:Huntington diseaseHDneurodegenerative disordergene expressionpathogenesisHuntingtin
Journal Article2020-06-04✓ 1 SnippetMiyazaki H, Yamanaka T, Oyama F, Kino Y, Kurosawa M, Yamada-Kurosawa M, Yamano R, Shimogori T, Hattori N, Nukina N.
In-Text Gene Mentions
Text
…Htt…
Show Full Abstract
Huntington disease (HD) is a neurodegenerative disorder caused by expanded CAG repeats in the <i>Huntingtin</i> gene. Results from previous studies have suggested that transcriptional dysregulation is one of the key mechanisms underlying striatal medium spiny neuron (MSN) degeneration in HD. However, some of the critical genes involved in HD etiology or pathology could be masked in a common expression profiling assay because of contamination with non-MSN cells. To gain insight into the MSN-specific gene expression changes in presymptomatic R6/2 mice, a common HD mouse model, here we used a transgenic fluorescent protein marker of MSNs for purification via FACS before profiling gene expression with gene microarrays and compared the results of this "FACS-array" with those obtained with homogenized striatal samples (STR-array). We identified hundreds of differentially expressed genes (DEGs) and enhanced detection of MSN-specific DEGs by comparing the results of the FACS-array with those of the STR-array. The gene sets obtained included genes ubiquitously expressed in both MSNs and non-MSN cells of the brain and associated with transcriptional regulation and DNA damage responses. We proposed that the comparative gene expression approach using the FACS-array may be useful for uncovering the gene cascades affected in MSNs during HD pathogenesis.
…Thus, characterized hydroxyapatite (Ca10 (PO4)6(OH) 2) nanoparticles (nHA) were purchased from Sky Springs Nanomaterials, Inc. (Houston, Texas, USA) as <40 nm, with a needle shaped morphology, and 98.5% purity.…
Methods)
…Thus nHA/HA was added in treatment E to provide equimolar amounts of P in the form of Ca10(PO4)6(OH)2 dictated by the recommended application rate of 20 kg/ha P2O5 based on the surface area of the 20 cm pots used for this experiment.…
Show Full Abstract
The efficacy of needle-shaped nano-hydroxyapatite (nHA; Ca<sub>10</sub>(PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) as a phosphate (Pi) fertilizer was evaluated as well as its impact on soil and soybean (Glycine max) bacterial and fungal communities. Microbial communities were evaluated in soy fertilized with nHA using ITS (internal transcribed spacer) and 16S rRNA high-throughput gene sequencing. Separate greenhouse growth experiments using agriculturally relevant nHA concentrations and application methods were used to assess plant growth and yield compared with no Pi (-P), soluble Pi (+P), and bulk HA controls. Overall, nHA treatments did not show significantly increased growth, biomass, total plant phosphorus concentrations, or yield compared with no Pi controls. Soil and rhizosphere community structures in controls and nHA treatment groups were similar, with minor shifts in the nHA-containing pots comparable to bulk HA controls at equal concentrations. The implementation of nHA in an agriculturally realistic manner and the resulting poor soy growth advises that contrary to some reports under specialized conditions, this nano-fertilizer may not be a viable alternative to traditional Pi fertilizers. If nano-phosphate fertilizers are to achieve their conjectured agricultural potential, alternative nHAs, with differing morphologies, physicochemical properties, and interactions with the soil matrix could be investigated using the evaluative procedures described.
Also flagged:PDGFDphenolchloroformnucleotidechromosomechromosomes
Journal Article2020-06-04✓ 1 SnippetLi X, Yang J, Shen M, Xie XL, Liu GJ, Xu YX, Lv FH, Yang H, Yang YL, Liu CB, Zhou P, Wan PC, Zhang YS, Gao L, Yang JQ, Pi WH, Ren YL, Shen ZQ, Wang F, Deng J, Xu SS, Salehian-Dehkordi H, Hehua E, Esmailizadeh A, Dehghani-Qanatqestani M, Štěpánek O, Weimann C, Erhardt G, Amane A, Mwacharo JM, Han JL, Hanotte O, Lenstra JA, Kantanen J, Coltman DW, Kijas JW, Bruford MW, Periasamy K, Wang XH, Li MH.
In-Text Gene Mentions
Discussion)
…( ACVR2B ,TNFSF4, CCL25 ,…
Show Full Abstract
Understanding the genetic changes underlying phenotypic variation in sheep (Ovis aries) may facilitate our efforts towards further improvement. Here, we report the deep resequencing of 248 sheep including the wild ancestor (O. orientalis), landraces, and improved breeds. We explored the sheep variome and selection signatures. We detected genomic regions harboring genes associated with distinct morphological and agronomic traits, which may be past and potential future targets of domestication, breeding, and selection. Furthermore, we found non-synonymous mutations in a set of plausible candidate genes and significant differences in their allele frequency distributions across breeds. We identified PDGFD as a likely causal gene for fat deposition in the tails of sheep through transcriptome, RT-PCR, qPCR, and Western blot analyses. Our results provide insights into the demographic history of sheep and a valuable genomic resource for future genetic studies and improved genome-assisted breeding of sheep and other domestic animals.
Also flagged:TRAP-14collagenthrombinbehaviouralcancernucleus
Journal Article2020-06-04No SnippetsJongen MSA, MacArthur BD, Englyst NA, West J.
Show Full Abstract
Investigations into the nature of platelet functional variety and consequences for homeostasis require new methods for resolving single platelet phenotypes. Here we combine droplet microfluidics with flow cytometry for high throughput single platelet function analysis. A large-scale sensitivity continuum was shown to be a general feature of human platelets from individual donors, with hypersensitive platelets coordinating significant sensitivity gains in bulk platelet populations and shown to direct aggregation in droplet-confined minimal platelet systems. Sensitivity gains scaled with agonist potency (convulxin > TRAP-14>ADP) and reduced the collagen and thrombin activation threshold required for platelet population polarization into pro-aggregatory and pro-coagulant states. The heterotypic platelet response results from an intrinsic behavioural program. The method and findings invite future discoveries into the nature of hypersensitive platelets and how community effects produce population level responses in health and disease.
Also flagged:Autophagytrinucleotidehexanucleotideneurodegenerative disordersHuntington diseaseamyotrophic lateral sclerosis
Journal Article2020-06-04✓ 2 SnippetsWen X, An P, Li H, Zhou Z, Sun Y, Wang J, Ma L, Lu B.
In-Text Gene Mentions
Abstract)
…(CAGr) in theHTTgene], and amyotrophic…
I A O 0000326)
…HTT…
Show Full Abstract
Expansions of trinucleotide or hexanucleotide repeats lead to several neurodegenerative disorders, including Huntington disease [caused by expanded CAG repeats (CAGr) in the HTT gene], and amyotrophic lateral sclerosis [ALS, possibly caused by expanded GGGGCC repeats (G4C2r) in the C9ORF72 gene], of which the molecular mechanisms remain unclear. Here, we demonstrated that lowering the Drosophila homologue of tau protein (dtau) significantly rescued in vivo neurodegeneration, motor performance impairments, and the shortened life-span in Drosophila expressing expanded CAGr or expanded G4C2r. Expression of human tau (htau4R) restored the disease-related phenotypes that had been mitigated by the loss of dtau, suggesting an evolutionarily-conserved role of tau in neurodegeneration. We further revealed that G4C2r expression increased tau accumulation by inhibiting autophagosome-lysosome fusion, possibly due to lowering the level of BAG3, a regulator of autophagy and tau. Taken together, our results reveal a novel mechanism by which expanded G4C2r causes neurodegeneration via an evolutionarily-conserved mechanism. Our findings provide novel autophagy-related mechanistic insights into C9ORF72-ALS and possible entry points to disease treatment.
Also flagged:myeloid neoplasmsmethylationcancersacute myeloid leukemiaAMLmyelodysplastic syndromes
Journal Article2020-06-04✓ 1 SnippetZhang TJ, Xu ZJ, Gu Y, Wen XM, Ma JC, Zhang W, Deng ZQ, Leng JY, Qian J, Lin J, Zhou JD, Zhou JD.
In-Text Gene Mentions
Results)
…DKK1 , andSOX6were reported with…
Show Full Abstract
The deregulated DLX gene family members DLX1/2/3/4/5/6 (DLXs) caused by DNA methylation has been demonstrated in various cancers with therapeutic target value. However, the potential role of DLXs methylation in myeloid neoplasms such as acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS) remains to be elucidated. Clinical significance of DLXs methylation/expression was analyzed in patient with AML and MDS. The functional roles of DLXs were determined in vitro. In the identification stage, we found that lower DLX5 expression was correlated with prognosis in AML among all DLXs analyzed by The Cancer Genome Atlas datasets. In the validation stage, we revealed that reduced DLX5 expression was frequently occurred, and was also correlated with promoter hypermethylation in AML evaluated by targeted bisulfite sequencing. Epigenetic studies also showed that DLX5 promoter DNA methylation was associated with its expression. By quantitative polymerase chain reaction, we also validated that DLX5 hypermethylation was frequent event in both AML and MDS, and also correlated with MDS transformation to leukemia. Moreover, DLX5 hypermethylation was associated with lower rate of complete remission and shorter time of leukemia-free/overall survival, and was also confirmed by Logistic/Cox regression analysis. Functional studies revealed the antiproliferative and pro-apoptotic effects of DLX5 in MDS-derived AML cell-line SKM-1. Finally, bioinformatics analysis demonstrated that DLX5 functioned in leukemogenesis may be through the association with PI3K/Akt signaling pathway. Collectively, our findings demonstrated that DLX5 methylation, negatively correlated DLX5 expression, was a potential prognostic and predictive indicator in patients with AML and MDS, which could also act as an epigenetic driver in myeloid neoplasms.
Also flagged:asthmaion transportglucocorticoid receptorGRglucocorticoidchromosome
Journal Article2020-06-04✓ 1 SnippetZayed H.
In-Text Gene Mentions
Results)
…4 A), SLCO1B3,DNAJC1, WNK4, TPO, TMEM74B,…
Show Full Abstract
<h4>Background</h4>Asthma is a chronic inflammatory condition linked to hyperresponsiveness in the airways. There is currently no cure available for asthma, and therapy choices are limited. Asthma is the result of the interplay between genes and the environment. The exact molecular genetic mechanism of asthma remains elusive.<h4>Aims</h4>The aim of this study is to provide a comprehensive, detailed molecular etiology profile for the molecular factors that regulate the severity of asthma and pathogenicity using integrative bioinformatics tools.<h4>Methods</h4>The GSE43696 omnibus gene expression dataset, which contains 50 moderate cases, 38 severe cases, and 20 healthy controls, was used to investigate differentially expressed genes (DEGs), susceptible chromosomal loci, gene networks, pathways, gene ontologies, and protein-protein interactions (PPIs) using an intensive bioinformatics pipeline.<h4>Results</h4>The PPI network analysis yielded DEGs that contribute to interactions that differ from moderate-to-severe asthma. The combined interaction scores resulted in higher interactions for the genes <i>STAT3, AGO2, COL1A1, CLCN6,</i> and <i>KSR</i> for moderate asthma and <i>JAK2, INSR, ERBB2, NR3C1,</i> and <i>PTK6</i> for severe asthma. Enrichment analysis (EA) demonstrated differential enrichment between moderate and severe asthma phenotypes; the ion transport regulation pathway was significantly enhanced in severe asthma phenotypes compared to that in moderate asthma phenotypes and involved <i>PER2, GCR, IRS-2, KCNK7, KCNK6, NOX1</i>, and <i>SCN7A.</i> The most enriched common pathway in both moderate and severe asthma is the development of the glucocorticoid receptor (GR) signaling pathway followed by glucocorticoid-mediated inhibition of proinflammatory and proconstrictory signaling in the airway of smooth muscle cell pathways. Gene sets were shared between severe and moderate asthma at 16 chromosome locations, including 17p13.1, 16p11.2, 17q21.31, 1p36, and 19q13.2, while 60 and 48 chromosomal locations were unique for both moderate and severe asthma, respectively. Phylogenetic analysis for DEGs showed that several genes have been intersected in phases of asthma in the same cluster of genes. This could indicate that several asthma-associated genes have a common ancestor and could be linked to the same biological function or gene family, implying the importance of these genes in the pathogenesis of asthma.<h4>Conclusion</h4>New genetic risk factors for the development of moderate-to-severe asthma were identified in this study, and these could provide a better understanding of the molecular pathology of asthma and might provide a platform for the treatment of asthma.
Also flagged:Uveal Melanomatumor of the eyeADAM10c-Metprimary tumorsluciferase
Journal Article2020-06-04No SnippetsAmaro A, Croce M, Ferrini S, Barisione G, Gualco M, Perri P, Pfeffer U, Jager MJ, Coupland SE, Mosci C, Filaci G, Fabbi M, Queirolo P, Gangemi R.
Show Full Abstract
Uveal melanoma (UM) is a rare tumor of the eye that leads to deadly metastases in about half of the patients. ADAM10 correlates with c-Met expression in UM and high levels of both molecules are related to the development of metastases. MiR122 and miR144 modulate <i>ADAM10</i> and <i>c-Met</i> expression in different settings. We hypothesized a potential onco-suppressive role for miR122 and miR144 through modulation of ADAM10 and c-Met in UM. We analyzed the UM Cancer Genome Atlas data portal (TCGA) dataset, two other cohorts of primary tumors and five human UM cell lines for miR122 and miR144 expression by miR microarray, RT-qPCR, Western blotting, miR transfection and luciferase reporter assay. Our results indicate that miR122 and miR144 are expressed at low levels in the UM cell lines and in the TCGA UM dataset and were down-modulated in a cohort of seven UM samples, compared to normal choroid. Both miR122 and miR144 directly targeted <i>ADAM10</i> and <i>c-Met</i>. Overexpression of miR122 and miR144 led to reduced expression of ADAM10 and c-Met in the UM cell lines and impaired cell proliferation, migration, cell cycle and shedding of c-Met ecto-domain. Our results show that miR122 and miR144 display an onco-suppressive role in UM through ADAM10 and c-Met modulation.
Also flagged:Ovarian cancerOCgynecological malignanciescancercancerspathogenesis
Journal Article2020-06-04No SnippetsAlexandrova E, Pecoraro G, Sellitto A, Melone V, Ferravante C, Rocco T, Guacci A, Giurato G, Nassa G, Rizzo F, Weisz A, Tarallo R.
Show Full Abstract
Ovarian cancer (OC) shows the highest mortality rate among gynecological malignancies and, because of the absence of specific symptoms, it is frequently diagnosed at an advanced stage, mainly due to the lack of specific and early biomarkers, such as those based on cancer molecular signature identification. Indeed, although significant progress has been made toward improving the clinical outcome of other cancers, rates of mortality for OC are essentially unchanged since 1980, suggesting the need of new approaches to identify and characterize the molecular mechanisms underlying pathogenesis and progression of these malignancies. In addition, due to the low response rate and the high frequency of resistance to current treatments, emerging therapeutic strategies against OC focus on targeting single factors and pathways specifically involved in tumor growth and metastasis. To date, loss-of-function screenings are extensively applied to identify key drug targets in cancer, seeking for more effective, disease-tailored treatments to overcome lack of response or resistance to current therapies. We review here the information relative to essential genes and functional pathways recently discovered in OC, often strictly interconnected with each other and representing promising biomarkers and molecular targets to treat these malignancies.
In the developing area of modern nanobiotechnology, the research is being focused on enhancement of catalytic performance in terms of efficiency and stability of enzymes to fulfill the industrial demand. In the context of this interdisciplinary era, we isolated and identified alkaline protease producer <i>Bacillus aryabhattai</i> P1 by polyphasic approach and then followed one variable at a time approach to optimize protease production from P1. The modified components of fermentation medium (g/L) were wheat bran 10, soybean flour 10, yeast extract 5, NaCl 10, KH<sub>2</sub>PO<sub>4</sub> 1, K<sub>2</sub>HPO<sub>4</sub> 1 and MgSO<sub>4</sub>·7H<sub>2</sub>O 0.2 (pH 9). The optimum alkaline protease production from P1 was recorded 75 ± 3 U/mg at 35 °C and pH 9 after 96 h of fermentation period. Molecular weight of partially purified P1 alkaline protease was 26 KDa as revealed by SDS-PAGE. Calcium based nanoceramic material was prepared by wet chemical precipitation method and doped in native P1 protease for catalytic activity enhancement. Catalytic activity of modified P1 protease was attained by nanoactivator mediated modulation was more by 5.58 fold at pH 10 and 30 °C temperature. The nanoceramic material named as nanoactivator, with grain size of 40-60 nm was suitable to redesign the active site of P1 protease. Such types of modified proteases can be used in different nanobiotechnological applications.
Also flagged:cell communicationleukocyte migrationS1Bresponse to stimulusDRB5signal transduction
Journal Article2020-06-04No SnippetsHernandez-Valdes JA, Aan de Stegge M, Hermans J, Teunis J, van Tatenhove-Pel RJ, Teusink B, Bachmann H, Kuipers OP.
Show Full Abstract
Amino acids are attractive metabolites for the pharmaceutical and food industry field. On one hand, the construction of microbial cell factories for large-scale production aims to satisfy the demand for amino acids as bulk biochemical. On the other hand, amino acids enhance flavor formation in fermented foods. Concerning the latter, flavor formation in dairy products, such as cheese is associated with the presence of lactic acid bacteria (LAB). In particular, <i>Lactococcus lactis</i>, one of the most important LAB, is used as a starter culture in fermented foods. The proteolytic activity of some <i>L. lactis</i> strains results in peptides and amino acids, which are flavor compounds or flavor precursors. However, it is still a challenge to isolate bacterial cells with enhanced amino acid production and secretion activity. In this work, we developed a growth-based sensor strain to detect the essential amino acids isoleucine, leucine, valine, histidine and methionine. Amino acids are metabolites that can be secreted by some bacteria. Therefore, our biosensor allowed us to identify wild-type <i>L. lactis</i> strains that naturally secrete amino acids, by using co-cultures of the biosensor strain with potential amino acid producing strains. Subsequently, we used this biosensor in combination with a droplet-based screening approach, and isolated three mutated <i>L. lactis</i> IPLA838 strains with 5-10 fold increased amino acid-secretion compared to the wild type. Genome re-sequencing revealed mutations in genes encoding proteins that participate in peptide uptake and peptide degradation. We argue that an unbalance in the regulation of amino acid levels as a result of these gene mutations may drive the accumulation and secretion of these amino acids. This biosensing system tackles the problem of selection for overproduction of secreted molecules, which requires the coupling of the product to the producing cell in the droplets.
Also flagged:Huntingtin-Associated Protein 1Glucocorticoid ReceptorHap1metabolismGRDexamethasone
Journal Article2020-06-04✓ 5 SnippetsChen X, Xin N, Pan Y, Zhu L, Yin P, Liu Q, Yang W, Xu X, Li S, Li XJ.
In-Text Gene Mentions
Introduction)
…Huntingtin-associated protein 1 (Hap1) was first identified as an interacting partner of huntingtin (Htt), the protein product of the Huntington’s disease (HD) gene (Li et al., 1995).…
Introduction)
…Unlike Htt that is ubiquitously expressed in the body and brain, Hap1 is enriched in neuronal cells (N2a), suggesting that Hap1 dysfunction may contribute to the selective neuropathology in HD.…
Introduction)
…partner of huntingtin (Htt), the protein product…
Introduction)
…BothHttand Hap1 are…
Introduction)
…interaction of mutantHttwith Hap1 affects…
Show Full Abstract
Huntingtin-associated protein 1 (Hap1) was initially identified as a brain-enriched protein that binds to the Huntington's disease protein, huntingtin. Unlike huntingtin that is ubiquitously expressed in the brain, Hap1 is enriched in the brain with the highest expression level in the hypothalamus. The selective enrichment of Hap1 in the hypothalamus suggests that Hap1 may play a specific role in hypothalamic function that can regulate metabolism and stress response. Here we report that Hap1 is colocalized and interacts with the glucocorticoid receptor (GR) in mouse hypothalamic neurons. Genetic depletion of Hap1 reduced the expression level of GR in the hypothalamus. Dexamethasone, a GR agonist, treatment or fasting of mice induced stress, resulting in increased expression of Hap1 in the hypothalamus. However, when Hap1 was absent, these treatments promoted GR reduction in the hypothalamus. In cultured cells, loss of Hap1 shortened the half-life of GR. These findings suggest that Hap1 stabilizes GR in the cytoplasm and that Hap1 dysfunction or deficiency may alter animal's stress response.
<h4>Background</h4>Pathologic fibrosis is characterized by dysregulation of gene expression with excessive extracellular matrix production. The genetic basis for solid organ fibrosis is well described in the literature. However, there is a paucity of evidence for similar processes in the musculoskeletal (MSK) system. The purpose of this review is to provide an overview of existing evidence of genetic predisposition to pathologic fibrosis in the cardiac, pulmonary, and MSK systems, and to describe common genetic variants associated with these processes.<h4>Methods</h4>A comprehensive search of several databases from 2000 to 2019 was conducted using relevant keywords in the English language. Genes reported as involved in idiopathic fibrotic processes in the heart, lung, hand, shoulder, and knee were recorded by 2 independent authors.<h4>Results</h4>Among 2373 eligible studies, 52 studies investigated genetic predisposition in terms of variant analysis with the following organ system distribution: 36 pulmonary studies (69%), 15 hand studies (29%), and 1 knee study (2%). Twenty-two percent of gene variants identified were associated with both pulmonary and MSK fibrosis (ie, ADAM, HLA, CARD, EIF, TGF, WNT, and ZNF genes). Genetic variants known to be involved in the MSK tissue development or contractility properties in muscle were identified in the pulmonary fibrosis.<h4>Conclusion</h4>Despite shared genetic variations in both the lung and hand, there remains limited information about genetic variants associated with fibrosis in other MSK regions. This finding establishes the necessity of further studies to elucidate the genetic determinants involved in the knee, shoulder, and other joint fibrotic pathways.<h4>Level of evidence</h4>Level III.
We describe an attempt to apply the concept of covalent binding towards the highly active allocolchicinoids selected on the basis of SAR analysis of previously synthesized molecules. To achieve the irreversible binding of the agent to the cysteine residues of the colchicine site of tubulin protein, we synthesized a number of new allocolchicinoids bearing the acceptor moiety. Some of the new derivatives possess cytotoxic activity against COLO-357, BxPC-3, HaCaT, and HEK293 cell lines in a low nanomolar range of concentrations. A substoichiometric mode of microtubule assembly inhibition was demonstrated. The most active compounds possess close to colchicine general toxicity on mice.
<h4>Background</h4>levated transferrin saturation (TS) is an imperfect test to identify adults with high-iron gene (<i>HFE</i>) p.C282Y homozygosity or elevated hepatic iron concentration.<h4>Methods</h4>e analyzed observations of non-screening, previously untreated p.C282Y homozygotes who presented with both normal TS (<50% men, <45% women) and elevated serum ferritin (SF; men, >300 µg/L; women, >200 µg/L). Iron overload was defined as hepatocyte iron grade 3 or 4, liver iron >35 µmol/g dry weight, or iron removed by phlebotomy ≥3 g. Cirrhosis was defined as regenerating nodules of hepatocytes surrounded by bands of fibrous connective tissue.<h4>Results</h4>mong 917 referred p.C282Y homozygotes, 58 (33 men, 25 women) had normal TS and elevated SF (6.3% [95% CI 4.9% to 8.1%]). Of 58 patients, 14 (24.1%) underwent liver biopsy; all 14 had hepatocyte iron grade 3 or 4. Fatty infiltration was reported in 6 of 14 liver biopsies (42.9%). Liver iron was >35 µmol/g dry weight in 7 of 8 patients tested (87.5%). Iron removed by phlebotomy was ≥3 g in 75.0% (15/20) of men and 62.5% (5/8) of women. Of 58 patients, 3 (5.2%) had iron overload and cirrhosis; each also had a proven or possible non-iron liver condition that may have acted in synergy with liver iron to increase cirrhosis risk.<h4>Conclusions</h4>Iron overload is common in non-screening, previously untreated <i>HFE</i> p.C282Y homozygotes with normal TS and elevated SF. Among our sample, 5.2% had cirrhosis. Clinicians should not assume that patients with normal TS and elevated SF do not have <i>HFE</i> p.C282Y homozygosity, iron overload, or cirrhosis.
…testing for commonhemochromatosisgenetic variants (HFE…
Abstract)
…chromatosis genetic variants (HFEC282Y and H63D)…
Text
…hemochromatosis…
Text
…HFE…
Show Full Abstract
A man aged 51 years was referred to dermatology for hand dermatitis. The dorsal hands and fingers had superficial erosions with pale pink shallow scars and milia suggestive of porphyria cutanea tarda (PCT). Urine and fecal studies were typical of PCT. The patient had daily alcohol use and was found to have elevated serum ferritin, aspartate aminotransferase, and alanine transaminase. Genetic testing for common hemochromatosis genetic variants (HFE C282Y and H63D) was normal. He underwent next-generation sequencing analysis using the 16-gene hyperferritinemia gene panel for genes known to be associated with hereditary hyperferritinemia, iron overload, or both and was discovered to have a genetic variant in bone morphogenetic 6 (BMP6, c.287T> C, p.Leu96Pro). The skin lesions improved with phlebotomy therapy.
Research Square2020-06-04Preprint (No Snippets API)Zhou Z, Chen F, Zhong S, Zhou Y, Zhang R, Kang K, Zhang X, Zhao M, Xu Y, Zhao C.
Show Full Abstract
<title>Abstract</title> <p>The aim of this study is to explore the genomic mechanism of early death in Huntington’s disease (HD). We identified 10160 and 1511 differentially expressed genes (DEGs) from comparisons of HD versus control and early versus late death, respectively. On the basis of 922 overlapped DEGs among them, six functional modules were established by weight gene correlation network analysis. The turquoise module most strongly related to overall survival of HD was significantly enriched in GABAergic synapse, retrograde endocannabinoid signaling and neuroactive ligand-receptor interaction. Low expression of five DEGs (CA10, WSB2, ACTR3B, PCDH19 and GABRB3) with highest degree of connectivity and non-zero regression coefficients were identified as hub genes, based on which the LASSO model exactly predicted the occurrence of early death in HD. Furthermore, the network analysis revealed indirect interaction of CA10 with the central hub gene GABRB3, which was involved in the pathway of GABAergic synapse. Compared with high expression of hub genes, their low expression appeared shorter overall survival of HD patients according to Kaplan-Meier survival analysis. Consequently, low expression of CA10, WSB2, ACTR3B, PCDH19 and GABRB3 were possibly associated with early death of HD. The likelihood of low expression of GABRB3 regulated by CA10 in GABAergic synapse contributed to the pathogenesis of early death in HD.</p>
Also flagged:cell wallbiosynthesisglycosyltransferasesoligosaccharidesmonosaccharidesnucleotide
Journal Article2020-06-03✓ 1 SnippetRuprecht C, Bartetzko MP, Senf D, Lakhina A, Smith PJ, Soto MJ, Oh H, Yang JY, Chapla D, Varon Silva D, Clausen MH, Hahn MG, Moremen KW, Urbanowicz BR, Pfrengle F.
In-Text Gene Mentions
Results)
…Human galactosyltransferaseB4GALT5, which normally extends…
Show Full Abstract
Growing plants with modified cell wall compositions is a promising strategy to improve resistance to pathogens, increase biomass digestibility, and tune other important properties. In order to alter biomass architecture, a detailed knowledge of cell wall structure and biosynthesis is a prerequisite. We report here a glycan array-based assay for the high-throughput identification and characterization of plant cell wall biosynthetic glycosyltransferases (GTs). We demonstrate that different heterologously expressed galactosyl-, fucosyl-, and xylosyltransferases can transfer azido-functionalized sugar nucleotide donors to selected synthetic plant cell wall oligosaccharides on the array and that the transferred monosaccharides can be visualized "on chip" by a 1,3-dipolar cycloaddition reaction with an alkynyl-modified dye. The opportunity to simultaneously screen thousands of combinations of putative GTs, nucleotide sugar donors, and oligosaccharide acceptors will dramatically accelerate plant cell wall biosynthesis research.
Under physiological conditions, the predominant form of bioavailable silicon (Si) is orthosilicic acid (OSA). In this study, given Si's recognized positive effect on bone growth and integrity, we examined the chemical form and position of this natural Si source in the inorganic bone mineral hydroxyapatite (HA). X-ray diffraction (XRD) of rat tibia bone mineral showed that the mineral phase was similar to that of phase-pure HA. However, theoretical XRD patterns revealed that at the levels found in bone, the 'Si effect' would be virtually undetectable. Thus we used first principles density functional theory calculations to explore the energetic and geometric consequences of substituting OSA into a large HA model. Formation energy analysis revealed that OSA is not favourable as a neutral interstitial substitution but can be incorporated as a silicate ion substituting for a phosphate ion, suggesting that incorporation will only occur under specific conditions at the bone-remodelling interface and that dietary forms of Si will be metabolized to simpler chemical forms, specifically [Formula: see text]. Furthermore, we show that this substitution, at the low silicate concentrations found in the biological environment, is likely to be a driver of calcium phosphate crystallization from an amorphous to a fully mineralized state.
Also flagged:PKM2hepatocellular carcinomatumorshikoninTACEpolymerase
Journal Article2020-06-03✓ 1 SnippetMartin SP, Fako V, Dang H, Dominguez DA, Khatib S, Ma L, Wang H, Zheng W, Wang XW.
In-Text Gene Mentions
Results)
…LHFPL2, MFGE8, MKI67,PEBP1, TNFSF10 and UBB).…
Show Full Abstract
<h4>Background</h4>Therapeutic options for patients with hepatocellular carcinoma (HCC) are limited. Transarterial chemoembolization (TACE) is an interventional procedure used to deliver chemotherapy and embolizing agents directly to the tumor and is the procedure of choice for patients with intermediate stage HCC. While effective, more than 40% of patients do not respond to therapy, highlighting the need to investigate possible mechanisms of resistance. We sought to evaluate mechanisms of TACE resistance and evaluate a potential therapeutic target to overcome this resistance.<h4>Methods</h4>Using a prognostic gene signature which predicts TACE response (TACE Navigator) in a cohort of HCC patients who received TACE, patients were classified as responders and non-responders. Transcriptomic and gene pathway analysis were used to identify potential drivers of TACE resistance. Knockdown of the gene encoding rate limiting enzyme PKM2 using shRNA in HCC cell lines, as well as pharmacologic inhibition of PKM2 with shikonin using an in vitro TACE model measured response to chemotherapy under hypoxia. Finally, we replicated the TACE model with shikonin using patient derived cell line organoids (PDC). Functional studies were performed in vitro using immunoblotting, quantitative polymerase chain reaction, glycolysis and hypoxia assays.<h4>Results</h4>In patient non-responders, we identified enrichment of the glycolysis pathway, specifically of the gene encoding the rate-limiting enzyme PKM2. We identified four HCC cell lines which recapitulated a TACE responder-like and non-responder-like phenotype. PKM2 knockdown in HCC cell lines demonstrated a less proliferative and aggressive phenotype as well as improved drug sensitivity to both doxorubicin and cisplatin. In vitro TACE model demonstrated that TACE non-responder-like cells overcame therapeutic resistance and rendered them susceptible to therapy through PKM2 knockdown. Lastly, we obtained similar results using a pharmacologic PKM2 inhibitor, shikonin in both cell lines, and PDC organoids.<h4>Conclusion</h4>Elevated PKM2 is associated with treatment resistance and abbreviated survival in patients receiving TACE. Elevated PKM2 in vitro is associated with increased utilization of the glycolysis pathway, resulting in oxygen independent cell metabolism. Through PKM2 knockdown as well as with pharmacologic inhibition with shikonin, non-responder cells can be reprogrammed to act as responders and could improve TACE efficacy in patients.
Glioblastoma (GBM) generally has a dismal prognosis, and it is associated with a poor quality of life as the disease progresses. However, the development of effective therapies for GBM has been deficient. Ubiquitin-conjugating enzyme E2T (UBE2T) is a member of the E2 family in the ubiquitin-proteasome pathway and a vital regulator of tumour progression, but its role in GBM is unclear. In this study, we aimed to clarify the role of UBE2T in GBM. Bioinformatics analysis identified UBE2T as an independent risk factor for gliomas. Immunohistochemistry was used to measure UBE2T expression in GBM and normal tissue samples obtained from patients with GBM. The effects of UBE2T on GBM cell invasion and migration were analysed using the Transwell assay. BALB/c nude mice were used for the in vivo assays. Immunoblotting and immunoprecipitation were performed to determine the molecular mechanisms. UBE2T was highly expressed in GBM tissues, and its expression was linked to a poor prognosis. In vitro, depletion of UBE2T significantly suppressed cell invasion and migration. Moreover, UBE2T depletion suppressed the growth of GBM subcutaneous tumours in vivo. Further experiments revealed that UBE2T suppressed invasion and migration by regulating epithelial- mesenchymal transition (EMT) via stabilising GRP78 in GBM cells. We uncovered a novel UBE2T/GRP78/EMT regulatory axis that modulates the malignant progression and recurrence of GBM, indicating that the axis might be a valuable therapeutic target.
Also flagged:HDcytoplasmicdeathsynapsegene expressionsynapses
Journal Article2020-06-03No SnippetsHuang TT, Smith R, Bacos K, Song DY, Faull RM, Waldvogel HJ, Li JY.
Show Full Abstract
Prominent features of HD neuropathology are the intranuclear and cytoplasmic inclusions of huntingtin and striatal and cortical neuronal cell death. Recently, synaptic defects have been reported on HD-related studies, including impairment of neurotransmitter release and alterations of synaptic components. However, the definite characteristics of synapse dysfunction and the underlying mechanisms remain largely unknown. We studied the gene expression levels and patterns of a number of proteins forming the cytoskeletal matrix of the presynaptic active zones in HD transgenic mice (R6/1), in hippocampal neuronal cultures overexpressing mutant huntingtin and in postmortem brain tissues of HD patients. To investigate the interactions between huntingtin and active proteins, we performed confocal microscopic imaging and immunoprecipitation in mouse and HEK 293 cell line models. The mRNA and protein levels of Bassoon were reduced in mouse and cell culture models of HD and in brain tissues of patients with HD. Moreover, a striking re-distribution of a complex of proteins including Bassoon, Piccolo and Munc 13-1 from the cytoplasm and synapses into intranuclear huntingtin aggregates with loss of active zone proteins and dendritic spines. This re-localization was age-dependent and coincided with the formation of huntingtin aggregates. Using co-immunoprecipitation, we demonstrated that huntingtin interacts with Bassoon, and that this interaction is likely mediated by a third linking protein. Three structural proteins involved in neurotransmitter release in the presynaptic active zones of neurons are altered in expression and that the proteins are redistributed from their normal functional site into mutant huntingtin aggregates.
Human pluripotent embryonic stem cells have two special features: self-renewal and pluripotency. It is important to understand the properties of pluripotent stem cells and reprogrammed stem cells. One of the major problems is the risk of reprogrammed stem cells developing into tumors. To understand the process of differentiation through which stem cells develop into cancer cells, investigators have attempted to identify the key factors that generate tumors in humans. The most effective method for the prevention of tumorigenesis is the exclusion of cancer cells during cell reprogramming. The risk of cancer formation is dependent on mutations of oncogenes and tumor suppressor genes during the conversion of stem cells to cancer cells and on the environmental effects of pluripotent stem cells. Dissecting the processes of epigenetic regulation and chromatin regulation may be helpful for achieving correct cell reprogramming without inducing tumor formation and for developing new drugs for cancer treatment. This review focuses on the risk of tumor formation by human pluripotent stem cells, and on the possible treatment options if it occurs. Potential new techniques that target epigenetic processes and chromatin regulation provide opportunities for human cancer modeling and clinical applications of regenerative medicine.
Also flagged:tumorcancerpancreatic ductal adenocarcinomaPDACtumorsgene expression
Journal Article2020-06-03No SnippetsGhaderi M, Fernández Moro C, Pouso Elduayen S, Hultin E, Verbeke CS, Björnstedt M, Dillner J.
Show Full Abstract
Ex-vivo tumor tissue culture systems are used as models to test specific anti-cancer drugs. Their main advantage is that they are closely comparable with the in vivo tumor in their host organism. We previously reported that precision-cut organotypic tissue slices of pancreatic ductal adenocarcinoma (PDAC) can be successfully cultured ex-vivo for at least 4 days. In order to study how culturing might affect transcription patterns, we now performed genome-wide transcriptome profiling of both baseline (0 h) and explanted tumors at daily intervals (24, 48 and 72 h) after start of culturing. The total-RNA from five samples of surgically resected human PDAC tumors at baseline and at different time points in culture was sequenced. Differential gene expression analysis of the whole transcriptome, testing 58,713 genes and over 206,000 transcripts, found that only a small number of genes showed significant changes in expression between baseline and cultured samples. The cultured tumor slices showed upregulation of a median of 12, 10 and 15 genes and downregulation of a median of 15, 12 and 25 genes at 24, 48 and 72 h in culture, respectively. One sample had morphologically increasing loss of tissue viability (range 0-18%). The vascular endothelial growth factor A (VEGFA) was significantly upregulated during the entire culture period in this case. Pathway over-representation analysis suggested that VEGFA together with the PTGS2 gene were upregulated at the same time as HIF-1-triggered cell apoptosis via NF-ĸB and the AP-1 activating factor was induced. Indeed, increased areas of apoptotic lesions were visible in this sample after 24 hours of culture. In conclusion, genome-wide transcriptome analysis supports that ex-vivo cultured tissue slices of PDAC may be a representative model of the original tumor. Transcriptome analysis was found to be a valuable complement to morphology for evaluation of ex-vivo cultures of PDAC.
Also flagged:Ago2lung cancersPtpn5tumorsgliomaCol11a1
Journal Article2020-06-03No SnippetsLi X, Pritykin Y, Concepcion CP, Lu Y, La Rocca G, Zhang M, King B, Cook PJ, Au YW, Popow O, Paulo JA, Otis HG, Mastroleo C, Ogrodowski P, Schreiner R, Haigis KM, Betel D, Leslie CS, Ventura A.
Show Full Abstract
The identification of microRNA (miRNA) targets by Ago2 crosslinking-immunoprecipitation (CLIP) methods has provided major insights into the biology of this important class of non-coding RNAs. However, these methods are technically challenging and not easily applicable to an in vivo setting. To overcome these limitations and facilitate the investigation of miRNA functions in vivo, we have developed a method based on a genetically engineered mouse harboring a conditional Halo-Ago2 allele expressed from the endogenous Ago2 locus. By using a resin conjugated to the HaloTag ligand, Ago2-miRNA-mRNA complexes can be purified from cells and tissues expressing the endogenous Halo-Ago2 allele. We demonstrate the reproducibility and sensitivity of this method in mouse embryonic stem cells, developing embryos, adult tissues, and autochthonous mouse models of human brain and lung cancers. This method and the datasets we have generated will facilitate the characterization of miRNA-mRNA networks in vivo under physiological and pathological conditions.
Also flagged:RAB11Small Integral Membrane Protein 22infectionselastaseCTSSRab-11
Journal Article2020-06-03✓ 1 SnippetCollin J, Queen R, Zerti D, Dorgau B, Georgiou M, Djidrovski I, Hussain R, Coxhead JM, Joseph A, Rooney P, Lisgo S, Figueiredo F, Armstrong L, Lako M.
In-Text Gene Mentions
Results)
…DPP4 (associated withMERS-CoV45) and the enzyme…
Show Full Abstract
<h4>Purpose</h4>The high infection rate of SARS-CoV-2 necessitates the need for multiple studies identifying the molecular mechanisms that facilitate the viral entry and propagation. Currently the potential extra-respiratory transmission routes of SARS-CoV-2 remain unclear.<h4>Methods</h4>Using single-cell RNA Seq and ATAC-Seq datasets and immunohistochemical analysis, we investigated SARS-CoV-2 tropism in the embryonic, fetal and adult human ocular surface.<h4>Results</h4>The co-expression of ACE2 receptor and entry protease TMPRSS2 was detected in the human adult conjunctival, limbal and corneal epithelium, but not in the embryonic and fetal ocular surface up to 21 post conception weeks. These expression patterns were corroborated by the single cell ATAC-Seq data, which revealed a permissive chromatin in ACE2 and TMPRSS2 loci in the adult conjunctival, limbal and corneal epithelium. Co-expression of ACE2 and TMPRSS2 was strongly detected in the superficial limbal, corneal and conjunctival epithelium, implicating these as target entry cells for SARS-CoV-2 in the ocular surface. Strikingly, we also identified the key pro-inflammatory signals TNF, NFKβ and IFNG as upstream regulators of the transcriptional profile of ACE2<sup>+</sup>TMPRSS2<sup>+</sup> cells in the superficial conjunctival epithelium, suggesting that SARS-CoV-2 may utilise inflammatory driven upregulation of ACE2 and TMPRSS2 expression to enhance infection in ocular surface.<h4>Conclusions</h4>Together our data indicate that the human ocular surface epithelium provides an additional entry portal for SARS-CoV-2, which may exploit inflammatory driven upregulation of ACE2 and TMPRSS2 entry factors to enhance infection.
…Although the detectable genetic cause with an expansion of cytosine- adenine- guanine (CAG)-trinucleotide repeats in the huntingtin gene (HTT) on chromosome four is obvious to access [1,8], repeat expansions higher than 60–70 CAGs are described as causing a juvenile and more bradykinetic HD phenotype and were frequently detected in juvenile cases described in earlier research [7,8,9,10].…
Introduction)
…the huntingtin gene (HTT) on chromosome four…
Show Full Abstract
<h4>Background</h4>Studies on the clinical manifestation and course of disease in children suffering from Huntington's disease (HD) are rare. Case reports of juvenile HD (onset ≤ 20 years) describe heterogeneous motoric and non-motoric symptoms, often accompanied with a delay in diagnosis. We aimed to describe this rare group of patients, especially with regard to socio-medical aspects and individual or common treatment strategies. In addition, we differentiated between juvenile and the recently defined pediatric HD population (onset < 18 years).<h4>Methods</h4>Out of 2593 individual HD patients treated within the last 25 years in the Huntington Centre, North Rhine-Westphalia (NRW), 32 subjects were analyzed with an early onset younger than 21 years (1.23%, juvenile) and 18 of them younger than 18 years of age (0.69%, pediatric).<h4>Results</h4>Beside a high degree of school problems, irritability or aggressive behavior (62.5% of pediatric and 31.2% of juvenile cases), serious problems concerning the social and family background were reported in 25% of the pediatric cohort. This includes an attempted rape and robbery at the age of 12, as problems caused by the affected children, but also alcohol-dependency in a two-year-old induced by a non-HD affected stepfather. A high degree of suicidal attempts and ideations (31.2% in pediatric and 33.3% in juvenile group) was reported, including drinking of solvents, swallowing razor blades or jumping from the fifth floor with following incomplete paraparesis. Beside dopaminergic drugs for treatment of bradykinesia, benzodiazepines and tetrabenazine for treatment of dystonia, cannabinoids, botulinum toxin injection and deep brain stimulation were used for the improvement of movement disorders, clozapine for the treatment of tremor, and dopa-induced hallucinations and zuclopenthixole for the treatment of severe aggressive behavior.<h4>Conclusions</h4>Beside abnormalities in behavior from an early age due to HD pathology, children seem to have higher socio-medical problems related to additional burden caused by early affected parents, instable family backgrounds including drug abuse of a parent or multiple changes of partners. Treatment required individualized strategies in many cases.
Also flagged:RKIPRaf Kinase Inhibitor Proteintumorcancersmelanomamalignant melanoma
Journal Article2020-06-03✓ 2 SnippetsPenas C, Apraiz A, Muñoa I, Arroyo-Berdugo Y, Rasero J, Ezkurra PA, Velasco V, Subiran N, Bosserhoff AK, Alonso S, Asumendi A, Boyano MD.
In-Text Gene Mentions
Introduction)
…hanolamine-binding protein 1 (PEBP1), was originally described…
Methods)
…°C for overnight (PEBP1#372100, 1:5000, Life…
Show Full Abstract
Raf Kinase Inhibitor Protein (RKIP) has been extensively reported as an inhibitor of key signaling pathways involved in the aggressive tumor phenotype and shows decreased expression in several types of cancers. However, little is known about RKIP in melanoma or regarding its function in normal cells. We examined the role of RKIP in both primary melanocytes and malignant melanoma cells and evaluated its diagnostic and prognostic value. IHC analysis revealed a significantly higher expression of RKIP in nevi compared with early-stage (stage I-II, AJCC 8th) melanoma biopsies. Proliferation, wound healing, and collagen-coated transwell assays uncovered the implication of RKIP on the motility but not on the proliferative capacity of melanoma cells as RKIP protein levels were inversely correlated with the migration capacity of both primary and metastatic melanoma cells but did not alter other parameters. As shown by RNA sequencing, endogenous RKIP knockdown in primary melanocytes triggered the deregulation of cellular differentiation-related processes, including genes (i.e., ZEB1, THY-1) closely related to the EMT. Interestingly, NANOG was identified as a putative transcriptional regulator of many of the deregulated genes, and RKIP was able to decrease the activation of the NANOG promoter. As a whole, our data support the utility of RKIP as a diagnostic marker for early-stage melanomas. In addition, these findings indicate its participation in the maintenance of a differentiated state of melanocytic cells by modulating genes intimately linked to the cellular motility and explain the progressive decrease of RKIP often described in tumors.
Also flagged:cognitionneuropsychiatric diseasestranscription factorspathogenesisNeurodegenerationneuron
Journal Article2020-06-03No SnippetsVolpicelli F, Perrone-Capano C, Bellenchi GC, Colucci-D'Amato L, di Porzio U.
Show Full Abstract
The relatively few dopaminergic neurons in the mammalian brain are mostly located in the midbrain and regulate many important neural functions, including motor integration, cognition, emotive behaviors and reward. Therefore, alteration of their function or degeneration leads to severe neurological and neuropsychiatric diseases. Unraveling the mechanisms of midbrain dopaminergic (mDA) phenotype induction and maturation and elucidating the role of the gene network involved in the development and maintenance of these neurons is of pivotal importance to rescue or substitute these cells in order to restore dopaminergic functions. Recently, in addition to morphogens and transcription factors, microRNAs have been identified as critical players to confer mDA identity. The elucidation of the gene network involved in mDA neuron development and function will be crucial to identify early changes of mDA neurons that occur in pre-symptomatic pathological conditions, such as Parkinson's disease. In addition, it can help to identify targets for new therapies and for cell reprogramming into mDA neurons. In this essay, we review the cascade of transcriptional and posttranscriptional regulation that confers mDA identity and regulates their functions. Additionally, we highlight certain mechanisms that offer important clues to unveil molecular pathogenesis of mDA neuron dysfunction and potential pharmacological targets for the treatment of mDA neuron dysfunction.
Also flagged:agingcanceroligonucleotideslocalizationregulation of gene expressionnucleotides
Journal Article2020-06-03No SnippetsZhao Y, Teng H, Yao F, Yap S, Sun Y, Ma L.
Show Full Abstract
Long noncoding RNAs (lncRNAs) are involved in many physiological and pathological processes, such as development, aging, immunity, and cancer. Mechanistically, lncRNAs exert their functions through interaction with proteins, genomic DNA, and other RNA, leading to transcriptional and post-transcriptional regulation of gene expression, either in <i>cis</i> or in <i>trans</i>; it is often difficult to distinguish between these two regulatory mechanisms. A variety of approaches, including RNA interference, antisense oligonucleotides, CRISPR-based methods, and genetically engineered mouse models, have yielded abundant information about lncRNA functions and underlying mechanisms, albeit with many discrepancies. In this review, we elaborate on the challenges in ascribing functions to lncRNAs based on the features of lncRNAs, including the genomic location, copy number, domain structure, subcellular localization, stability, evolution, and expression pattern. We also describe a framework for the investigation of lncRNA functions and mechanisms of action. Rigorous characterization of cancer-implicated lncRNAs is critical for the identification of bona fide anticancer targets.
Also flagged:Vitamin Cvitamin C insufficiencyinflammatory syndromeC-reactive proteinCRPascorbic acid
Journal Article2020-06-03✓ 1 SnippetGrillot J, Ait S, Bergoin C, Couronne T, Blond E, Peraldi C, Barnoud D, Chambrier C, Lauverjat M.
In-Text Gene Mentions
Results)
…patients had neitherhemochromatosisnor end-stage kidney…
Show Full Abstract
To date, there are no recommendations about screening plasma vitamin C concentration and adjust its supplementation in patients on long-term home parenteral nutrition (HPN). The aim of this study was to evaluate vitamin C status and determine if a commercial multivitamin preparation (CMVP) containing 125 mg of vitamin C is sufficient in stable patients on HPN. All clinically stable patients receiving HPN or an intravenous fluid infusion at least two times per week for at least 6 months, hospitalized for nutritional assessment, were retrospectively included, for a total of 186 patients. We found that 29% of the patients had vitamin C insufficiency (i.e., <25 µmol/L). In univariate analysis, C-reactive protein (CRP) (<i>p</i> = 0.002) and intake of only 125 mg of vitamin C (<i>p</i> = 0.001) were negatively associated with vitamin C levels, and duration of follow-up in our referral center (<i>p</i> = 0.009) was positively associated with vitamin C levels. In multivariate analysis, only CRP (<i>p</i> = 0.001) and intake of 125 mg of vitamin C (<i>p</i> < 0.0001) were independently associated with low plasma vitamin C concentration. Patients receiving only CMVP with a low plasma vitamin C level significantly received personal compounded HPN (<i>p</i> = 0.008) and presented an inflammatory syndrome (<i>p</i> = 0.002). Vitamin C insufficiency is frequent in individuals undergoing home parenteral nutrition; therefore, there is a need to monitor plasma vitamin C levels, especially in patients on HPN with an inflammatory syndrome and only on CMVP.
Regulation of gene expression has emerged as a fundamental element of transcript homeostasis. Key effectors in this process are the Argonautes (AGOs), highly specialized RNA-binding proteins (RBPs) that form complexes, such as the RNA-Induced Silencing Complex (RISC). AGOs dictate post-transcriptional gene-silencing by directly loading small RNAs and repressing their mRNA targets through small RNA-sequence complementarity. The four human highly-conserved family-members (AGO1, AGO2, AGO3, and AGO4) demonstrate multi-faceted and versatile roles in transcriptome's stability, plasticity, and functionality. The post-translational modifications of AGOs in critical amino acid residues, the nucleotide polymorphisms and mutations, and the deregulation of expression and interactions are tightly associated with aberrant activities, which are observed in a wide spectrum of pathologies. Through constantly accumulating information, the AGOs' fundamental engagement in multiple human diseases has recently emerged. The present review examines new insights into AGO-driven pathology and AGO-deregulation patterns in a variety of diseases such as in viral infections and propagations, autoimmune diseases, cancers, metabolic deficiencies, neuronal disorders, and human infertility. Altogether, AGO seems to be a crucial contributor to pathogenesis and its targeting may serve as a novel and powerful therapeutic tool for the successful management of diverse human diseases in the clinic.
<h4>Background</h4>Parenteral nutrition (PN)-associated liver disease (PNALD) is a common and life-threatening complication in patients receiving PN. However, its definitive etiology is not yet clear. Therefore, performed proteomic analyses of human liver tissue to explore the same.<h4>Methods</h4>Liver tissue was derived and compared across selected patients with (<i>n</i> = 3) /without (<i>n</i> = 4) PNALD via isobaric Tag for Relative and Absolute Quantitation (iTRAQ)-based quantitative proteomics. Bioinformatics analysis was performed using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases to explore the mechanisms of PNALD based on differentially expressed proteins (DEPs). The essential proteins that were differentially expressed between the two groups were explored and verified by western blotting.<h4>Results</h4>A total of 112 proteins were found to be differentially expressed, of which 73 were downregulated, and 39 were upregulated in the PNALD group. Bioinformatics analysis showed DEPs to be associated with mitochondrial oxidative phosphorylation (mainly involved in mitochondrial respiratory chain complex I assembly), hepatic glycolipid metabolism (involved primarily in glycogen formation and gluconeogenesis), and oxidative stress (mainly involved in antioxidant change).<h4>Conclusion</h4>Overall, our results indicated that mitochondrial energy metabolism impairment, hepatic glycolipid metabolism disorder, and excessive oxidative stress injury might explain the comprehensive mechanism underlying PNALD. Moreover, we have provided multiple potential targets for further exploring the PNALD mechanism.
Also flagged:nucleosomeNucleosome Remodellingchromatingene expressiondeathcancer
Journal Article2020-06-03No SnippetsRagheb R, Gharbi S, Cramard J, Ogundele O, Kloet SL, Burgold T, Vermeulen M, Reynolds N, Hendrich B.
Show Full Abstract
Differentiation of mammalian pluripotent cells involves large-scale changes in transcription and, among the molecules that orchestrate these changes, chromatin remodellers are essential to initiate, establish and maintain a new gene regulatory network. The Nucleosome Remodelling and Deacetylation (NuRD) complex is a highly conserved chromatin remodeller which fine-tunes gene expression in embryonic stem cells. While the function of NuRD in mouse pluripotent cells has been well defined, no study yet has defined NuRD function in human pluripotent cells. Here we find that while NuRD activity is required for lineage commitment from primed pluripotency in both human and mouse cells, the nature of this requirement is surprisingly different. While mouse embryonic stem cells (mESC) and epiblast stem cells (mEpiSC) require NuRD to maintain an appropriate differentiation trajectory as judged by gene expression profiling, human induced pluripotent stem cells (hiPSC) lacking NuRD fail to even initiate these trajectories. Further, while NuRD activity is dispensable for self-renewal of mESCs and mEpiSCs, hiPSCs require NuRD to maintain a stable self-renewing state. These studies reveal that failure to properly fine-tune gene expression and/or to reduce transcriptional noise through the action of a highly conserved chromatin remodeller can have different consequences in human and mouse pluripotent stem cells.
Journal Article2020-06-03No SnippetsKennett DJ, Prufer KM, Culleton BJ, George RJ, Robinson M, Trask WR, Buckley GM, Moes E, Kate EJ, Harper TK, O'Donnell L, Ray EE, Hill EC, Alsgaard A, Merriman C, Meredith C, Edgar HJH, Awe JJ, Gutierrez SM.
Show Full Abstract
Maize is a cultigen of global economic importance, but when it first became a staple grain in the Americas, was unknown and contested. Here, we report direct isotopic dietary evidence from 52 radiocarbon-dated human skeletons from two remarkably well-preserved rock-shelter contexts in the Maya Mountains of Belize spanning the past 10,000 years. Individuals dating before ~4700 calendar years before present (cal B.P.) show no clear evidence for the consumption of maize. Evidence for substantial maize consumption (~30% of total diet) appears in some individuals between 4700 and 4000 cal B.P. Isotopic evidence after 4000 cal B.P. indicates that maize became a persistently used staple grain comparable in dietary significance to later maize agriculturalists in the region (>70% of total diet). These data provide the earliest definitive evidence for maize as a staple grain in the Americas.
Also flagged:strontiumsilverhydroxyapatitealkaline phosphataseALPtitanium
Journal Article2020-06-03No Snippetsvan Hengel IAJ, Gelderman FSA, Athanasiadis S, Minneboo M, Weinans H, Fluit AC, van der Eerden BCJ, Fratila-Apachitei LE, Apachitei I, Zadpoor AA.
Show Full Abstract
The holy grail of orthopedic implant design is to ward off both aseptic and septic loosening for long enough that the implant outlives the patient. Questing this holy grail is feasible only if orthopedic biomaterials possess a long list of functionalities that enable them to discharge the onerous task of permanently replacing the native bone tissue. Here, we present a rationally designed and additive manufacturing (AM) topologically ordered porous metallic biomaterial that is made from Ti-6Al-4V using selective laser melting and packs most (if not all) of the required functionalities into a single implant. In addition to presenting a fully interconnected porous structure and form-freedom that enables realization of patient-specific implants, the biomaterials developed here were biofunctionalized using plasma electrolytic oxidation to locally release both osteogenic (i.e. strontium) and antibacterial (i.e. silver ions) agents. The same single-step biofunctionalization process also incorporated hydroxyapatite into the surface of the implants. Our measurements verified the continued release of both types of active agents up to 28 days. Assessment of the antibacterial activity <i>in vitro</i> and in an <i>ex vivo</i> murine model demonstrated extraordinarily high levels of bactericidal effects against a highly virulent and multidrug-resistant <i>Staphylococcus aureus</i> strain (i.e. USA300) with total eradication of both planktonic and adherent bacteria. This strong antibacterial behavior was combined with a significantly enhanced osteogenic behavior, as evidenced by significantly higher levels of alkaline phosphatase (ALP) activity compared with non-biofunctionalized implants. Finally, we discovered synergistic antibacterial behavior between strontium and silver ions, meaning that 4-32 folds lower concentrations of silver ions were required to achieve growth inhibition and total killing of bacteria. The functionality-packed biomaterial presented here demonstrates a unique combination of functionalities that make it an advanced prototype of future orthopedic biomaterials where implants will outlive patients.
Also flagged:tumorthrombosisberberinexylenesodiumpalmitate
Journal Article2020-06-03No SnippetsLi G, Wang T, Zhang X, Zhao S, Wang Y, Wu J, Peng S, Zhao M.
Show Full Abstract
<h4>Background</h4>There is a correlation between tumor and inflammation. The activity of 13-[CH<sub>2</sub>CO-Cys(Bzl)-OBzl]-berberine (13-Cys-BBR) slowing tumor growth is higher than that of BBR. Whether the anti-inflammation activity of 13-Cys-BBR is higher than that of BBR remains unknown. There is a correlation between thrombosis and inflammation. Whether 13-Cys-BBR is an inhibitor of thrombosis remains unknown.<h4>Purpose</h4>The object of this investigation is to compare the activities of 13-Cys-BBR inhibiting thrombosis and inflammation to those of BBR.<h4>Methods</h4>In vivo anti-thrombosis assay was performed on rat model of arterial and venous thrombosis. In vivo anti-inflammation assay was performed on mouse model of xylene induced ear edema.<h4>Results</h4>At oral dose of 66.7 nmol/kg, 13-Cys-BBR, but not BBR, inhibited the rats to form both venous thrombus and arterial thrombus. At oral dose of 2 μmol/kg, 13-Cys-BBR, but not BBR, inhibited the ears of the mice to occur edema.<h4>Conclusion</h4>The anti-venous thrombosis activity, anti-arterial thrombosis activity and anti-inflammation activity of 13-Cys-BBR were significantly higher than those of BBR. 13-Cys-BBR is a promising preclinical candidate.
Also flagged:Hepatocellular CarcinomatumorALBAFPCD133IL-8
Journal Article2020-06-03No SnippetsSun L, Yang H, Wang Y, Zhang X, Jin B, Xie F, Jin Y, Pang Y, Zhao H, Lu X, Sang X, Zhang H, Lin F, Sun W, Huang P, Mao Y.
Show Full Abstract
The existing <i>in vitro</i> models for antitumor drug screening have great limitations. Many compounds that inhibit 2D cultured cells do not exhibit the same pharmacological effects <i>in vivo</i>, thereby wasting human and material resources as well as time during drug development. Therefore, developing new models is critical. The 3D bioprinting technology has greater advantages in constructing human tissue compared with sandwich culture and organoid construction. Here, we used 3D bioprinting technology to construct a 3D model with HepG2 cells (3DP-HepG2). The biological activities of the model were evaluated by immunofluorescence, real-time quantitative PCR, and transcriptome sequencing. Compared with the traditional 2D cultured tumor cells (2D-HepG2), 3DP-HepG2 showed significantly improved expression of tumor-related genes, including ALB, AFP, CD133, IL-8, EpCAM, CD24, and β-TGF genes. Transcriptome sequencing analysis revealed large differences in gene expression between 3DP-HepG2 and 2D-HepG2, especially genes related to hepatocyte function and tumor. We also compared the effects of antitumor drugs in 3DP-HepG2 and 2D-HepG2, and found that the large differences in drug resistance genes between the models may cause differences in the drugs' pharmacodynamics.
Also flagged:leptinCRCPPIadipocytokineleptin receptorcancer
Journal Article2020-06-03✓ 1 SnippetLi C, Quan J, Wei R, Zhao Z, Guan X, Liu Z, Zou S, Wang X, Jiang Z.
In-Text Gene Mentions
Results)
…GCG, PRSS1, NTS,CA10, LEP, ALB, ACTL6B,…
Show Full Abstract
Leptin acts as an adipocytokine functions via the leptin receptor, which stimulates growth, migration, and invasion of cancer cells. This study is aimed at identifying leptin as a prognostic factor in colorectal cancer (CRC). The differentially expressed genes with prognostic value in CRC tissues either with or without liver metastasis were assessed based on The Cancer Genomic Atlas (TCGA). Leptin was considered a candidate gene for further analysis. Its expression features of 206 CRC patients without liver metastasis and 201 patients with metastasis on tissue microarrays were assessed by immunochemical staining, and the effect of leptin on survival was assessed by Kaplan-Meier analyses. Overexpressed leptin indicated a poorer prognosis for CRC patients in overall survival (<i>p</i> < 0.05, log-rank test) based on the TCGA database. The leptin expression significantly correlated with metastasis stage (<i>p</i> < .010) and lymph node involvement (<i>p</i> < .010). Multivariate analysis also indicated that strong leptin expression was an independent adverse prognosticator in CRC (<i>p</i> = .017). Leptin may be valued as a prognostic marker could contribute to predicting a clinical outcome for patients with CRC.
Also flagged:glioblastomaGBMGene expressiontumorPAK7axon guidance
Journal Article2020-06-03No SnippetsWang X, Liu S, Shao Z, Zhang P.
Show Full Abstract
The present study aimed to determine the potential molecular mechanisms underlying p21 (RAC1)‑activated kinase 7 (PAK7) expression in glioblastoma (GBM) and evaluate candidate prognosis biomarkers for GBM. Gene expression data from patients with GBM, including 144 tumor samples and 5 normal brain samples, were downloaded. Long non‑coding RNAs (lncRNAs) and messenger RNAs (mRNAs) were explored via re‑annotation. The differentially expressed genes (DEGs), including differentially expressed mRNAs and differentially expressed lncRNAs, were investigated and subjected to pathway analysis via gene set enrichment analysis. The miRNA‑lncRNA‑mRNA interaction [competing endogenous RNA (ceRNA)] network was investigated and survival analysis, including of overall survival (OS), was performed on lncRNAs/mRNAs to reveal prognostic markers for GBM. A total of 954 upregulated and 1,234 downregulated DEGs were investigated between GBM samples and control samples. These DEGs, including PAK7, were mainly enriched in pathways such as axon guidance. ceRNA network analysis revealed several outstanding ceRNA relationships, including miR‑185‑5p‑LINC00599‑PAK7. Moreover, paraneoplastic antigen Ma family member 5 (PNMA5) and somatostatin receptor 1 (SSTR1) were the two outstanding prognostic genes associated with OS. PAK7 may participate in the tumorigenesis of GBM by regulating axon guidance, and miR‑185‑5p may play an important role in GBM progression by sponging LINC00599 to prevent interactions with PAK7. PNMA5 and SSTR1 may serve as novel prognostic markers for GBM.
Also flagged:glycanglycansGlycomeglycoproteinsbindingmembrane glycoprotein
Journal Article2020-06-03No SnippetsBüll C, Joshi HJ, Clausen H, Narimatsu Y.
Show Full Abstract
Exploring the biological functions of the human glycome is highly challenging given its tremendous structural diversity. We have developed stable libraries of isogenic HEK293 cells with loss or gain of glycosylation features that together form the cell-based glycan array, a self-renewable resource for the display of the human glycome in the natural context. This protocol describes the use of the cell-based glycan array for dissection of molecular interactions and biological functions of glycans using a wide range of biological assays. For complete details on the use and execution of this protocol, please refer to (Narimatsu et al., 2019).
Journal Article2020-06-02✓ 4 SnippetsYang S, Wu Y, Wang S, Xu P, Deng Y, Wang M, Liu K, Tian T, Zhu Y, Li N, Zhou L, Dai Z, Kang H.
In-Text Gene Mentions
Discussion)
…DACT1, VRK2, MELTF, and FGF12 have been implicated in cancers other than CC (Dmitriev et al., 2015; Fernandez et al., 2010; Guo et al., 2017), and PRICKLE2 has been reported to correlate with CC (Senchenko et al., 2013).…
Results)
…Kinase 2 (VRK2), Melanotransferrin (…
Discussion)
…were DACT1 ,VRK2, MELTF ,…
Discussion)
…DACT1 ,VRK2, MELTF ,…
Show Full Abstract
Human papillomavirus (HPV) is a clear etiology of cervical cancer (CC). However, the associations between HPV infection and DNA methylation have not been thoroughly investigated. Additionally, it remains unknown whether HPV-related methylation signatures can identify subtypes of CC and stratify the prognosis of CC patients. DNA methylation profiles were obtained from The Cancer Genome Atlas to identify HPV-related methylation sites. Unsupervised clustering analysis of HPV-related methylation sites was performed to determine the different CC subtypes. CC patients were categorized into cluster 1 (Methylation-H), cluster 2 (Methylation-M), and cluster 3 (Methylation-L). Compared to Methylation-M and Methylation-L, Methylation-H exhibited a significantly improved overall survival (OS). Gene set enrichment analysis (GSEA) was conducted to investigate the functions that correlated with different CC subtypes. GSEA indicated that the hallmarks of tumors, including KRAS signaling, TNFα signaling via NF-κB, inflammatory response, epithelial-mesenchymal transition, and interferon-gamma response, were enriched in Methylation-M and Methylation-L. Based on mutation and copy number variation analyses, we found that aberrant mutations, amplifications, and deletions among the MYC, Notch, PI3K-AKT, and RTK-RAS pathways were most frequently detected in Methylation-H. Additionally, mutations, amplifications, and deletions within the Hippo, PI3K-AKT, and TGF-β pathways were presented in Methylation-M. Genes within the cell cycle, Notch, and Hippo pathways possessed aberrant mutations, amplifications, and deletions in Methylation-L. Moreover, the analysis of tumor microenvironments revealed that Methylation-H was characterized by a relatively low degree of immune cell infiltration. Finally, a prognostic signature based on six HPV-related methylation sites was developed and validated. Our study revealed that CC patients could be classified into three heterogeneous clusters based on HPV-related methylation signatures. Additionally, we derived a prognostic signature using six HPV-related methylation sites that stratified the OS of patients with CC into high- and low-risk groups.
<h4>Objective</h4>Rising clinical demand and changes to Radiologists' job plans mean it is becoming ever more difficult for Radiologists to teach medical students.The aim of this study was to assess the current role of Radiologists in undergraduate medical education in Scotland.<h4>Methods</h4>Consultant Radiologists working across all 14 Scottish Health Boards were invited by email to participate in an anonymous short online survey. The survey ran for 6 weeks from November 2019. One reminder email was sent a week before the survey closed.<h4>Results</h4>102 responses were recorded, representing 34% of the total whole time equivalent Radiologists in Scotland. All agreed Radiology should be taught to medical students. Over 70% (<i>n</i> = 73) taught medical students, most often during supporting professional activity time. 76 percent of Radiologists who did not teach expressed a desire to do so. The most common barrier to teaching was not having enough time in their job plan. Scottish Radiologists delivered a median of 10 h (IQR 0-22) a year of teaching to medical students. Thematic analysis of free comments revealed staffing/time constraints severely limiting ability to teach.<h4>Conclusion</h4>This is the first national survey to assess the current role of Radiologists in teaching medical students. While most are teaching or want to teach, there is a large drop-off between current Scottish and previously reported UK median teaching hours. Engagement from Universities, Royal College of Radiologists and Health Boards is urgently needed to reverse this trend.<h4>Advances in knowledge</h4>This is the first national survey into the current role of Radiologists in undergraduate medical education. There is a large drop-off between current Scottish and previously reported UK median teaching hours.
Also flagged:tissue remodelingangiogenesisoxygenwound-healingtoembryogenesis
Journal Article2020-06-02✓ 1 SnippetDomingo-Gonzalez R, Zanini F, Che X, Liu M, Jones RC, Swift MA, Quake SR, Cornfield DN, Alvira CM.
In-Text Gene Mentions
Results)
…( Sod1 ,Prdx6) ( Tsang…
Show Full Abstract
At birth, the lungs rapidly transition from a pathogen-free, hypoxic environment to a pathogen-rich, rhythmically distended air-liquid interface. Although many studies have focused on the adult lung, the perinatal lung remains unexplored. Here, we present an atlas of the murine lung immune compartment during early postnatal development. We show that the late embryonic lung is dominated by specialized proliferative macrophages with a surprising physical interaction with the developing vasculature. These macrophages disappear after birth and are replaced by a dynamic mixture of macrophage subtypes, dendritic cells, granulocytes, and lymphocytes. Detailed characterization of macrophage diversity revealed an orchestration of distinct subpopulations across postnatal development to fill context-specific functions in tissue remodeling, angiogenesis, and immunity. These data both broaden the putative roles for immune cells in the developing lung and provide a framework for understanding how external insults alter immune cell phenotype during a period of rapid lung growth and heightened vulnerability.
Also flagged:transcription factorGata6prostacyclin synthaseprostacyclinlipopolysaccharideprostanoid
Journal Article2020-06-02✓ 5 SnippetsIpseiz N, Pickering RJ, Rosas M, Tyrrell VJ, Davies LC, Orr SJ, Czubala MA, Fathalla D, Robertson AA, Bryant CE, O'Donnell V, Taylor PR.
In-Text Gene Mentions
Results)
…Transcriptomic analysis of Gata6‐WT and Gata6‐KOmye pMФ (Rosas et al, 2014) showed alterations in many such potential candidate molecules (GEO: GSE47049); however, one of the greatest differentially expressed genes was prostaglandin I2 synthase (Ptgis) which converts prostaglandin H2 (PGH2) into prostacyclin (PGI2).…
Methods)
…Adipogen), rabbit anti‐mousePtgis(catalogue number ab23668,…
Results)
…I2 synthase (Ptgis) which converts…
Results)
…reduced amount ofPtgismRNA (Fig 3…
Results)
…direct competitor toPtgisfor the conversion…
Show Full Abstract
The alarm cytokine interleukin-1β (IL-1β) is a potent activator of the inflammatory cascade following pathogen recognition. IL-1β production typically requires two signals: first, priming by recognition of pathogen-associated molecular patterns leads to the production of immature pro-IL-1β; subsequently, inflammasome activation by a secondary signal allows cleavage and maturation of IL-1β from its pro-form. However, despite the important role of IL-1β in controlling local and systemic inflammation, its overall regulation is still not fully understood. Here we demonstrate that peritoneal tissue-resident macrophages use an active inhibitory pathway, to suppress IL-1β processing, which can otherwise occur in the absence of a second signal. Programming by the transcription factor Gata6 controls the expression of prostacyclin synthase, which is required for prostacyclin production after lipopolysaccharide stimulation and optimal induction of IL-10. In the absence of secondary signal, IL-10 potently inhibits IL-1β processing, providing a previously unrecognized control of IL-1β in tissue-resident macrophages.
Also flagged:Histone deacetylase-3histone deacetylasesHDAC3cognitive impairmentagingneurodegenerative disorders
Journal Article2020-06-02No SnippetsD'Mello SR.
Show Full Abstract
<h4>Impact statement</h4>Brain development and degeneration are highly complex processes that are regulated by a large number of molecules and signaling pathways the identities of which are being unraveled. Accumulating evidence points to histone deacetylases and epigenetic mechanisms as being important regulators of these processes. In this review, we describe that histone deacetylase-3 (HDAC3) is a particularly crucial regulator of both neurodevelopment and neurodegeneration. In addition, HDAC3 regulates memory formation, synaptic plasticity, and the cognitive impairment associated with normal aging. Understanding how HDAC3 functions contributes to the normal development and functioning of the brain while also promoting neurodegeneration could lead to the development of therapeutic approaches for neurodevelopmental, neuropsychiatric, and neurodegenerative disorders.
Also flagged:oxygenapoptotic bodiesmitochondria-nuclear factor E2-related factor 2Nrf2heme oxygenase-1
Journal Article2020-06-02✓ 1 SnippetDias MKHM, Madusanka DMD, Han EJ, Kim MJ, Jeon YJ, Kim HS, Fernando IPS, Ahn G.
In-Text Gene Mentions
Discussion)
…However, based on the results, HTT potentially increased the Nrf2 levels in the nucleus, simultaneously increasing the HO-1 and NQO1 proteins in a concentration-dependent manner in the cytosol, suggesting that the cytoprotective effects of HTT against FD-induced oxidative damage was carried via the Nrf2/HO-1 signaling pathway.…
Show Full Abstract
The emergence of fine dust (FD) among air pollutants has taken a toll during the past few decades, and it has provided both controversy and a platform for open conversation amongst world powers for finding sustainable solutions and effective treatments for health issues. The present study emphasizes the protective effects of (-)-loliolide (HTT) isolated from <i>Sargassum horneri</i> against FD-induced oxidative stress in human HaCaT keratinocytes. The purification of (-)-loliolide was carried out by centrifugal partition chromatography. HTT did not show any cytotoxicity, and it further illustrated the potential to increase cell viability by reducing the reactive oxygen species (ROS) production in FD-stimulated keratinocytes. Furthermore, HTT suppressed FD-stimulated DNA damage and the formation of apoptotic bodies, and it reduced the population of cells in the sub-G<sub>1</sub> apoptosis phase. FD-induced apoptosis was advancing through the mitochondria-mediated apoptosis pathway. The cytoprotective effects of the HTT against FD-stimulated oxidative damage is mediated through squaring the nuclear factor E2-related factor 2 (Nrf2)-mediated heme oxygenase-1 (HO-1) pathway, dose-dependently increasing HO-1 and NAD(P)H dehydrogenase (quinone) 1 (NQO1) levels in the cytosol while concomitantly improving the nuclear translocation of Nrf2. Future studies could implement the protective functionality of HTT in producing pharmaceuticals that utilize natural products and benefit the diseased.
Also flagged:fucoidanalginatecellulasealginate lyasepolysaccharidesethanol
Journal Article2020-06-02No SnippetsNguyen TT, Mikkelsen MD, Tran VHN, Trang VTD, Rhein-Knudsen N, Holck J, Rasin AB, Cao HTT, Van TTT, Meyer AS.
Show Full Abstract
Fucoidans from brown macroalgae (brown seaweeds) have different structures and many interesting bioactivities. Fucoidans are classically extracted from brown seaweeds by hot acidic extraction. Here, we report a new targeted enzyme-assisted methodology for fucoidan extraction from brown seaweeds. This enzyme-assisted extraction protocol involves a one-step combined use of a commercial cellulase preparation (Cellic<sup>®</sup>CTec2) and an alginate lyase from <i>Sphingomonas</i> sp. (SALy), reaction at pH 6.0, 40 °C, removal of non-fucoidan polysaccharides by Ca<sup>2+</sup> precipitation, and ethanol-precipitation of crude fucoidan. The workability of this method is demonstrated for fucoidan extraction from <i>Fucus distichus</i> subsp. <i>evanescens</i> (basionym <i>Fucus evanescens</i>) and <i>Saccharina latissima</i> as compared with mild acidic extraction. The crude fucoidans resulting directly from the enzyme-assisted method contained considerable amounts of low molecular weight alginate, but this residual alginate was effectively removed by an additional ion-exchange chromatographic step to yield pure fucoidans (as confirmed by <sup>1</sup>H NMR). The fucoidan yields that were obtained by the enzymatic method were comparable to the chemically extracted yields for both <i>F. evanescens</i> and <i>S. latissima</i>, but the molecular sizes of the fucoidans were significantly larger with enzyme-assisted extraction. The molecular weight distribution of the fucoidan fractions was 400 to 800 kDa for <i>F. evanescens</i> and 300 to 800 kDa for <i>S. latissima</i>, whereas the molecular weights of the corresponding chemically extracted fucoidans from these seaweeds were 10-100 kDa and 50-100 kDa, respectively. Enzyme-assisted extraction represents a new gentle strategy for fucoidan extraction and it provides new opportunities for obtaining high yields of native fucoidan structures from brown macroalgae.
Also flagged:PathogenesisClear Cell CarcinomaClear cell carcinoma of the ovaryovarian clear cell carcinomaepithelial ovarian carcinomaGene Expression
Journal Article2020-06-02No SnippetsHsu YH, Wang PH, Chang AC.
Show Full Abstract
Clear cell carcinoma of the ovary (ovarian clear cell carcinoma (OCCC)) is one epithelial ovarian carcinoma that is known to have a poor prognosis and a tendency for being refractory to treatment due to unclear pathogenesis. Published investigations of OCCC have mainly focused only on individual genes and lack of systematic integrated research to analyze the pathogenesis of OCCC in a genome-wide perspective. Thus, we conducted an integrated analysis using transcriptome datasets from a public domain database to determine genes that may be implicated in the pathogenesis involved in OCCC carcinogenesis. We used the data obtained from the National Center for Biotechnology Information (NCBI) Gene Expression Omnibus (GEO) DataSets. We found six interactive functional gene clusters in the pathogenesis network of OCCC, including ribosomal protein, eukaryotic translation initiation factors, lactate, prostaglandin, proteasome, and insulin-like growth factor. This finding from our integrated analysis affords us a global understanding of the interactive network of OCCC pathogenesis.
Also flagged:mineralmineralizationnanohydroxyapatitephosphoric acidhypersensitivityCalcium phosphate
Journal Article2020-06-02No SnippetsLuong MN, Huang L, Chan DCN, Sadr A.
Show Full Abstract
Bioactive mineral-based dentin desensitizers that can quickly and effectively seal dentinal tubules and promote dentin mineralization are desired. This in vitro study evaluated a novel nanohydroxyapatite-based desensitizer, Predicta (PBD, Parkell), and its effect on bond strength of dental adhesives. Human dentin discs (2-mm thick) were subjected to 0.5 M EDTA to remove the smear layer and expose tubules, treated with PBD, and processed for surface and cross-sectional SEM examination before and after immersion in simulated body fluid (SBF) for four weeks (ISO 23317-2014). The effects of two dental desensitizers on the microshear bond strength of a universal adhesive and a two-step self-etch system were compared. SEM showed coverage and penetration of nanoparticles in wide tubules on the PBD-treated dentin at the baseline. After four weeks in SBF, untreated dentin showed amorphous mineral deposits while PBD-treated dentin disclosed a highly mineralized structure integrated with dentin. Desensitizers significantly reduced microshear bond strength test (MSBS) of adhesives by 15-20% on average, depending on the bonding protocol. In conclusion, PBD demonstrated effective immediate tubules sealing capability and promoted mineral crystal growth over dentin and into the tubules during SBF-storage. For bonding to desensitizer-treated dentin, a two-step self-etching adhesive or universal bond with phosphoric acid pretreatment are recommended.
Also flagged:Insulin-like Growth Factor-1mTORC1IGF-1mammalian target of rapamycin complex 1BMS-754807rapamycin
Journal Article2020-06-02No SnippetsBohin N, McGowan KP, Keeley TM, Carlson EA, Yan KS, Samuelson LC.
Show Full Abstract
<h4>Background & aims</h4>Intestinal crypts have a remarkable capacity to regenerate after injury from loss of crypt base columnar (CBC) stem cells. After injury, facultative stem cells (FSCs) are activated to replenish the epithelium and replace lost CBCs. Our aim was to assess the role of insulin-like growth factor-1 (IGF-1) to activate FSCs for crypt repair.<h4>Methods</h4>The intestinal regenerative response was measured after whole body 12-Gy γ-irradiation of adult mice. IGF-1 signaling or its downstream effector mammalian target of rapamycin complex 1 (mTORC1) was inhibited by administering BMS-754807 or rapamycin, respectively. Mice with inducible Rptor gene deletion were studied to test the role of mTORC1 signaling in the intestinal epithelium. FSC activation post-irradiation was measured by lineage tracing.<h4>Results</h4>We observed a coordinate increase in growth factor expression, including IGF-1, at 2 days post-irradiation, followed by a surge in mTORC1 activity during the regenerative phase of crypt repair at day 4. IGF-1 was localized to pericryptal mesenchymal cells, and IGF-1 receptor was broadly expressed in crypt progenitor cells. Inhibition of IGF-1 signaling via BMS-754807 treatment impaired crypt regeneration after 12-Gy irradiation, with no effect on homeostasis. Similarly, rapamycin inhibition of mTORC1 during the growth factor surge blunted the regenerative response. Analysis of Villin-CreER<sup>T2</sup>;Rptor<sup>fl/fl</sup> mice showed that epithelial mTORC1 signaling was essential for crypt regeneration. Lineage tracing from Bmi1-marked cells showed that rapamycin blocked FSC activation post-irradiation.<h4>Conclusions</h4>Our study shows that IGF-1 signaling through mTORC1 drives crypt regeneration. We propose that IGF-1 release from pericryptal cells stimulates mTORC1 in FSCs to regenerate lost CBCs.
Also flagged:sodium sulfateIL-6BiPPurineadenylate kinasePotassium phosphate monobasic
Journal Article2020-06-02✓ 1 SnippetYuan Q, Wang Y.
In-Text Gene Mentions
Results)
…For example, ASCL1,POU3F2, SOX2, MYT1L, NEUROD1,…
Show Full Abstract
Transcription factors (TFs) define cellular identity either by activating target cell program or by silencing donor program as demonstrated by intensive cell reprogramming studies. Here, we propose an extended minimum set cover model with stable selection (3Scover) to systematically identify silencing TFs, named safeguard TFs, from omics data. First, a cell type-TF specificity network is constructed to systematically link cell types with their specifically expressed TFs. Then we search the minimum TF set to cover this network with "many but one specificity" characteristic and integrate many subsampling models for a stable solution. 3Scover identified 30 safeguard TFs in human and mouse. These safeguard TFs are significantly enriched in the experimentally discovered reprogramming panel with their protein-protein interactors. In addition, they tend to interact closely with chromatin regulators, negatively regulate transcription, and function earlier in development. Collectively, 3Scover allows us to probe master TFs and combinatorial regulation in controlling cell identity.
Also flagged:gangliosidesSarS1BC1GALT1galactosylglobosideChloroform
Journal Article2020-06-02✓ 2 SnippetsZhang T, van Die I, Tefsen B, van Vliet SJ, Laan LC, Zhang J, Ten Dijke P, Wuhrer M, Belo AI.
In-Text Gene Mentions
I A O 0000326)
…B4GALT5…
Discussion)
…level of UGCG,B4GALT5, and B4GALT6…
Show Full Abstract
Changes in the glycosylation profile of cancer cells have been strongly associated with cancer progression. To increase our insights into the role of glycosylation in human pancreatic ductal adenocarcinoma (PDAC), we performed a study on <i>O</i>-glycans and glycosphingolipid (GSL) glycans of the PDAC cell lines Pa-Tu-8988T (PaTu-T) and Pa-Tu-8988S (PaTu-S). These cell lines are derived from the same patient, but show an almost opposite phenotype, morphology and capacity to metastasize, and may thus provide an attractive model to study the role of glycosylation in progression of PDAC. Gene-array analysis revealed that 24% of the glycosylation-related genes showed a ≥ 1.5-fold difference in expression level between the two cell lines. Subsequent validation of the data by porous graphitized carbon nano-liquid chromatography coupled to a tandem ion trap mass spectrometry and flow cytometry established major differences in <i>O</i>-glycans and GSL-glycans between the cell lines, including lower levels of T and sialylated Tn (sTn) antigens, neoexpression of globosides (Gb3 and Gb4), and higher levels of gangliosides in the mesenchymal-like PaTu-T cells compared to the epithelial-like PaTu-S. In addition, PaTu-S cells demonstrated a significantly higher binding of the immune-lectins macrophage galactose-type lectin and galectin-4 compared to PaTu-T. In summary, our data provide a comprehensive and differential glycan profile of two PDAC cell lines with disparate phenotypes and metastatic behavior. This will allow approaches to modulate and monitor the glycosylation of these PDAC cell lines, which opens up avenues to study the biology and metastatic behavior of PDAC.
Journal Article2020-06-02No SnippetsBirar VC, Gelis I, Zuo A, Blagg BSJ.
Show Full Abstract
Identification of a ligand binding site represents the starting point for a structure-based drug development program. Lack of a binding site hampers the development of improved ligands that modulate the protein of interest. In this letter, we describe the development of chemical tools that will allow for elucidation of the Hsp90 C-terminal ligand binding site. Our strategy is based on the preparation of paramagnetic analogs of KU-596, an investigational new drug that is currently undergoing clinical trials for the treatment of neuropathy and interacts with the Hsp90 C-terminal domain. In particular, we report the design and synthesis of three novel paramagnetic analogs of KU-596, which will be used to obtain long range distances for NMR structural studies of Hsp90 in complex with C-terminal ligands.
Also flagged:choreic syndromehereditary choreachoreaJPH3TBPATN1
Journal Article2020-06-02No SnippetsLaurens B, Delleci C, Goizet C, Spampinato U, Burbaud P, Guillaud E, Bestaven E, Guehl D.
Show Full Abstract
The early onset of gait akinesia should not rule out the diagnosis of hereditary chorea. It would be helpful to proceed to a whole-genome and long-read sequencing in order to track a new pathogenic variant including noncoding repeat expansion.
Also flagged:major depressive disorderDepressionrecurrent mental diseasepathogenesisbrain-derived neurotrophic factorparoxetine
Journal Article2020-06-01✓ 1 SnippetYao Z, Fu Y, Wu J, Zhang W, Yu Y, Zhang Z, Wu X, Wang Y, Hu B.
In-Text Gene Mentions
Text
…5-HTT…
Show Full Abstract
Despite many neuroimaging studies in the past years, the neuroanatomical substrates of major depressive disorder (MDD) subcortical structures are still not well understood. Since hippocampus and amygdala are the two vital subcortical structures that most susceptible to MDD, finding the evidence of morphological changes in their subregions may bring some new insights for MDD research. Combining structural magnetic resonance imaging (MRI) with novel morphometry analysis methods, we recruited 25 MDD patients and 28 healthy controls (HC), and investigated their volume and morphological differences in hippocampus and amygdala. Relative to volumetric method, our methods detected more significant global morphological atrophies (p<0.05). More precisely, subiculum and cornu ammonis (CA) 1 subregions of bilateral hippocampus, lateral (LA) and basolateral ventromedial (BLVM) of left amygdala and LA, BLVM, central (CE), amygdalostriatal transition area (ASTR), anterior cortical (ACO) and anterior amygdaloid area (AAA) of right amygdala were demonstrated prone to atrophy. Correlation analyses between each subject's surface eigenvalues and Hamilton Depression Scale (HAMD) were then performed. Correlation results showed that atrophy areas in hippocampus and amygdala have slight tendencies of expanding into other subregions with the development of MDD. Finally, we performed group morphometric analysis and drew the atrophy and expansion areas between MDD-Medicated group (only 19 medicated subjects in MDD group were included) and HC group, found some preliminary evidence about subregional morphological resilience of hippocampus and amygdala. These findings revealed new pathophysiologic patterns in the subregions of hippocampus and amygdala, which can help with subsequent smaller-scale MDD research.
<h4>Purpose</h4>Tumor response assessments on positron emission tomography (PET)/magnetic resonance imaging (MRI) scans require correct quantification of radiotracer uptake in tumors and normal organs. Historically, MRI scans have been enhanced with gadolinium (Gd)-based contrast agents, which are now controversial due to brain deposition. Recently, ferumoxytol nanoparticles have been identified as an alternative to Gd-based contrast agents because they provide strong tissue enhancement on MR images but are not deposited in the brain. However, it is not known if the strong T1- and T2-contrast obtained with iron oxide nanoparticles such as ferumoxytol could affect MR-based attenuation correction of PET data. The purpose of our study was to investigate if ferumoxytol administration prior to a 2-deoxy-2-[<sup>18</sup>F]fluoro-D-glucose [<sup>18</sup>F]FDG PET/MR scan would change standardized uptake values (SUV) of normal organs.<h4>Procedures</h4>Thirty pediatric patients (6-18 years) with malignant tumors underwent [<sup>18</sup>F]FDG-PET/MR scans (dose 3 MBq/kg). Fifteen patients received an intravenous ferumoxytol injection (5 mg Fe/kg) prior to the [<sup>18</sup>F]FDG-PET/MR scans (group 1). Fifteen additional age- and sex-matched patients received unenhanced [<sup>18</sup>F]FDG-PET/MR scans (group 2). For attenuation correction of PET data, we used a Dixon-based gradient echo sequence (TR 4.2 ms, TE 1.1, 2.3 ms, FA 5), which accounted for soft tissue, lung, fat, and background air. We used a mixed linear effects model to compare the tissue MRI enhancement, quantified as the signal-to-noise ratio (SNR), as well as tissue radiotracer signal, quantified as SUVmean and SUVmax, between group 1 and group 2. Alpha was assumed at 0.05.<h4>Results</h4>The MRI enhancement of the blood and solid extra-cerebral organs, quantified as SNR, was significantly higher on ferumoxytol-enhanced MRI scans compared to unenhanced scans (p < 0.001). However, SUVmean and SUVmax values, corrected based on the patients' body weight or body surface area, were not significantly different between the two groups (p > 0.05).<h4>Conclusion</h4>Ferumoxytol administration prior to a [<sup>18</sup>F]FDG PET/MR scan did not change standardized uptake values (SUV) of solid extra-cerebral organs. This is important, because it allows injection of ferumoxytol contrast prior to a PET/MRI procedure and, thereby, significantly accelerates image acquisition times.
<h4>Background</h4>Strategies to prevent Mycobacterium tuberculosis (Mtb) infection are urgently required. In this study, we aimed to identify correlates of protection against Mtb infection.<h4>Methods</h4>Two groups of Mtb-exposed contacts of tuberculosis (TB) patients were recruited and classified according to their Mtb infection status using the tuberculin skin test (TST; cohort 1) or QuantiFERON (QFT; cohort 2). A negative reading at baseline with a positive reading at follow-up classified TST or QFT converters and a negative reading at both time points classified TST or QFT nonconverters. Ribonucleic acid sequencing, Mtb proteome arrays, and metabolic profiling were performed.<h4>Results</h4>Several genes were found to be differentially expressed at baseline between converters and nonconverters. Gene set enrichment analysis revealed a distinct B-cell gene signature in TST nonconverters compared to converters. When infection status was defined by QFT, enrichment of type I interferon was observed. A remarkable area under the curve (AUC) of 1.0 was observed for IgA reactivity to Rv0134 and an AUC of 0.98 for IgA reactivity to both Rv0629c and Rv2188c. IgG reactivity to Rv3223c resulted in an AUC of 0.96 and was markedly higher compared to TST nonconverters. We also identified several differences in metabolite profiles, including changes in biomarkers of inflammation, fatty acid metabolism, and bile acids. Pantothenate (vitamin B5) was significantly increased in TST nonconverters compared to converters at baseline (q = 0.0060).<h4>Conclusions</h4>These data provide new insights into the early protective response to Mtb infection and possible avenues to interfere with Mtb infection, including vitamin B5 supplementation.Analysis of blood from highly exposed household contacts from The Gambia who never develop latent Mycobacterium tuberculosis infection shows distinct transcriptomic, antibody, and metabolomic profiles compared to those who develop latent tuberculosis infection but prior to any signs of infection.
Some neurons, especially in mammalian peripheral nervous system or in lower vertebrate or in vertebrate central nervous system (CNS) regenerate after axotomy, while most mammalian CNS neurons fail to regenerate. There is an emerging consensus that neurons have different intrinsic regenerative capabilities, which theoretically could be manipulated therapeutically to improve regeneration. Population-based comparisons between "good regenerating" and "bad regenerating" neurons in the CNS and peripheral nervous system of most vertebrates yield results that are inconclusive or difficult to interpret. At least in part, this reflects the great diversity of cells in the mammalian CNS. Using mammalian nervous system imposes several methodical limitations. First, the small sizes and large numbers of neurons in the CNS make it very difficult to distinguish regenerating neurons from non-regenerating ones. Second, the lack of identifiable neurons makes it impossible to correlate biochemical changes in a neuron with axonal damage of the same neuron, and therefore, to dissect the molecular mechanisms of regeneration on the level of single neurons. This review will survey the reported responses to axon injury and the determinants of axon regeneration, emphasizing non-mammalian model organisms, which are often under-utilized, but in which the data are especially easy to interpret.
Spinocerebellar ataxias (SCAs) comprise a heterogeneous group of autosomal dominant disorders. The relative frequency of the different SCA subtypes varies broadly among different geographical and ethnic groups as result of genetic drifts. This review aims to provide an update regarding SCA founders in the American continents and the Caribbean as well as to discuss characteristics of these populations. Clusters of SCAs were detected in Eastern regions of Cuba for SCA2, in South Brazil for SCA3/MJD, and in Southeast regions of Mexico for SCA7. Prevalence rates were obtained and reached 154 (municipality of Báguano, Cuba), 166 (General Câmara, Brazil), and 423 (Tlaltetela, Mexico) patients/100,000 for SCA2, SCA3/MJD, and SCA7, respectively. In contrast, the scattered families with spinocerebellar ataxia type 10 (SCA10) reported all over North and South Americas have been associated to a common Native American ancestry that may have risen in East Asia and migrated to Americas 10,000 to 20,000 years ago. The comprehensive review showed that for each of these SCAs corresponded at least the development of one study group with a large production of scientific evidence often generalizable to all carriers of these conditions. Clusters of SCA populations in the American continents and the Caribbean provide unusual opportunity to gain insights into clinical and genetic characteristics of these disorders. Furthermore, the presence of large populations of patients living close to study centers can favor the development of meaningful clinical trials, which will impact on therapies and on quality of life of SCA carriers worldwide.
Also flagged:inflammatory bowel diseasescolorectal cancermechanistic target of rapamycinmTORdigestionWnt
Journal Article2020-06-01No SnippetsFritsch SD, Weichhart T.
Show Full Abstract
The intestinal epithelium is one of the most quickly dividing tissues in our body, combining the absorptive advantages of a single layer with the protection of a constantly renewing barrier. It is continuously exposed to nutrients and commensal bacteria as well as microbial and host-derived metabolites, but also to hazards such as pathogenic bacteria and toxins. These environmental cues are sensed by the mucosa and a vast repertory of immune cells, especially macrophages. A disruption of intestinal homeostasis in terms of barrier interruption can lead to inflammatory bowel diseases and colorectal cancer, and macrophages have an important role in restoring epithelial function following injury. The mammalian/mechanistic target of rapamycin (mTOR) signalling pathway senses environmental cues and integrates metabolic responses. It has emerged as an important regulator of intestinal functions in homeostasis and disease. In this review, we are going to discuss intestinal mTOR signalling and metabolic regulation in different intestinal cell populations with a special focus on immune cells and their actions on intestinal function.
Also flagged:chronic myeloid leukemiaBCR-ABL1 kinaseCMLBCR-ABL1tyrosine kinaseCP
Journal Article2020-06-01✓ 1 SnippetKo TK, Javed A, Lee KL, Pathiraja TN, Liu X, Malik S, Soh SX, Heng XT, Takahashi N, Tan JHJ, Bhatia R, Khng AJ, Chng WJ, Sia YY, Fruman DA, Ng KP, Chan ZE, Xie KJ, Hoi Q, Chan CX, Teo ASM, Velazquez Camacho O, Meah WY, Khor CC, Ong CTJ, Soon WJW, Tan P, Ng PC, Chuah C, Hillmer AM, Ong ST.
In-Text Gene Mentions
Abstract)
…components of thepolycomb repressiverepressive complex (PRC)…
Show Full Abstract
Targeted therapies against the BCR-ABL1 kinase have revolutionized treatment of chronic phase (CP) chronic myeloid leukemia (CML). In contrast, management of blast crisis (BC) CML remains challenging because BC cells acquire complex molecular alterations that confer stemness features to progenitor populations and resistance to BCR-ABL1 tyrosine kinase inhibitors. Comprehensive models of BC transformation have proved elusive because of the rarity and genetic heterogeneity of BC, but are important for developing biomarkers predicting BC progression and effective therapies. To better understand BC, we performed an integrated multiomics analysis of 74 CP and BC samples using whole-genome and exome sequencing, transcriptome and methylome profiling, and chromatin immunoprecipitation followed by high-throughput sequencing. Employing pathway-based analysis, we found the BC genome was significantly enriched for mutations affecting components of the polycomb repressive complex (PRC) pathway. While transcriptomically, BC progenitors were enriched and depleted for PRC1- and PRC2-related gene sets respectively. By integrating our data sets, we determined that BC progenitors undergo PRC-driven epigenetic reprogramming toward a convergent transcriptomic state. Specifically, PRC2 directs BC DNA hypermethylation, which in turn silences key genes involved in myeloid differentiation and tumor suppressor function via so-called epigenetic switching, whereas PRC1 represses an overlapping and distinct set of genes, including novel BC tumor suppressors. On the basis of these observations, we developed an integrated model of BC that facilitated the identification of combinatorial therapies capable of reversing BC reprogramming (decitabine+PRC1 inhibitors), novel PRC-silenced tumor suppressor genes (NR4A2), and gene expression signatures predictive of disease progression and drug resistance in CP.
Also flagged:LipidHomeostasisleukotrienesynthesisasthmazileuton
Journal Article2020-06-01No SnippetsYou D, Lyn-Cook LE, Gatti DM, Bell N, Mayeux PR, James LP, Mattes WB, Larson GJ, Harrill AH, Harrill AH.
Show Full Abstract
Zileuton is an orally active inhibitor of leukotriene synthesis for maintenance treatment of asthma, for which clinical usage has been associated with idiosyncratic liver injury. Mechanistic understanding of zileuton toxicity is hampered by the rarity of the cases and lack of an animal model. A promising model for mechanistic study of rare liver injury is the Diversity Outbred (J:DO) mouse population, with genetic variation similar to that found in humans. In this study, female DO mice were administered zileuton or vehicle daily for 7 days (i.g.). Serum liver enzymes were elevated in the zileuton group, with marked interindividual variability in response. Zileuton exposure-induced findings in susceptible DO mice included microvesicular fatty change, hepatocellular mitosis, and hepatocellular necrosis. Inducible nitric oxide synthase and nitrotyrosine abundance were increased in livers of animals with necrosis and those with fatty change, implicating nitrosative stress as a possible injury mechanism. Conversely, DO mice lacking adverse liver pathology following zileuton exposure experienced decreased hepatic concentrations of resistin and increased concentrations of insulin and leptin, providing potential clues into mechanisms of toxicity resistance. Transcriptome pathway analysis highlighted mitochondrial dysfunction and altered fatty acid oxidation as key molecular perturbations associated with zileuton exposure, and suggested that interindividual differences in cytochrome P450 metabolism, glutathione-mediated detoxification, and farnesoid X receptor signaling may contribute to zileuton-induced liver injury (ZILI). Taken together, DO mice provided a platform for investigating mechanisms of toxicity and resistance in context of ZILI which may lead to targeted therapeutic interventions.
Also flagged:MitochondrialNoncommunicable Chronic Diseaseschronic diseasescardiovascular diseasescancerobesity
Journal Article2020-06-01No SnippetsDiaz-Vegas A, Sanchez-Aguilera P, Krycer JR, Morales PE, Monsalves-Alvarez M, Cifuentes M, Rothermel BA, Lavandero S.
Show Full Abstract
Mitochondrial damage is implicated as a major contributing factor for a number of noncommunicable chronic diseases such as cardiovascular diseases, cancer, obesity, and insulin resistance/type 2 diabetes. Here, we discuss the role of mitochondria in maintaining cellular and whole-organism homeostasis, the mechanisms that promote mitochondrial dysfunction, and the role of this phenomenon in noncommunicable chronic diseases. We also review the state of the art regarding the preclinical evidence associated with the regulation of mitochondrial function and the development of current mitochondria-targeted therapeutics to treat noncommunicable chronic diseases. Finally, we give an integrated vision of how mitochondrial damage is implicated in these metabolic diseases.
Also flagged:agingMelatoninmitochondriamitochondrialinflammatory responsemembrane
Journal Article2020-06-01✓ 1 SnippetJauhari A, Baranov SV, Suofu Y, Kim J, Singh T, Yablonska S, Li F, Wang X, Oberly P, Minnigh MB, Poloyac SM, Carlisle DL, Friedlander RM.
In-Text Gene Mentions
Text
…HTT…
Show Full Abstract
Chronic inflammation is a pathologic feature of neurodegeneration and aging; however, the mechanism regulating this process is not understood. Melatonin, an endogenous free radical scavenger synthesized by neuronal mitochondria, decreases with aging and neurodegeneration. We proposed that insufficient melatonin levels impair mitochondrial homeostasis, resulting in mitochondrial DNA (mtDNA) release and activation of cytosolic DNA-mediated inflammatory response in neurons. We found increased mitochondrial oxidative stress and decreased mitochondrial membrane potential, with higher mtDNA release in brain and primary cerebro-cortical neurons of melatonin-deficient aralkylamine N-acetyltransferase (AANAT) knockout mice. Cytosolic mtDNA activated the cGAS/STING/IRF3 pathway, stimulating inflammatory cytokine generation. We found that Huntington's disease mice had increased mtDNA release, cGAS activation, and inflammation, all inhibited by exogenous melatonin. Thus, we demonstrated that cytosolic mtDNA activated the inflammatory response in aging and neurodegeneration, a process modulated by melatonin. Furthermore, our data suggest that AANAT knockout mice are a model of accelerated aging.
Also flagged:IGF2BP1-cell-polarityAbilityMAPTDAAM1aging
Journal Article2020-06-01✓ 1 SnippetShin J, Ma S, Hofer E, Patel Y, Vosberg DE, Tilley S, Roshchupkin GV, Sousa AMM, Jian X, Gottesman R, Mosley TH, Fornage M, Saba Y, Pirpamer L, Schmidt R, Schmidt H, Carrion-Castillo A, Crivello F, Mazoyer B, Bis JC, Li S, Yang Q, Luciano M, Karama S, Lewis L, Bastin ME, Harris MA, Wardlaw JM, Deary IE, Scholz M, Loeffler M, Witte AV, Beyer F, Villringer A, Armstrong NJ, Mather KA, Ames D, Jiang J, Kwok JB, Schofield PR, Thalamuthu A, Trollor JN, Wright MJ, Brodaty H, Wen W, Sachdev PS, Terzikhan N, Evans TE, Adams HHHH, Ikram MA, Frenzel S, Auwera-Palitschka SV, Wittfeld K, Bülow R, Grabe HJ, Tzourio C, Mishra A, Maingault S, Debette S, Gillespie NA, Franz CE, Kremen WS, Ding L, Jahanshad N, ENIGMA Consortium, Sestan N, Pausova Z, Seshadri S, Paus T, neuroCHARGE Working Group.
In-Text Gene Mentions
Text
…POU3F2…
Show Full Abstract
We have carried out meta-analyses of genome-wide association studies (GWAS) (n = 23 784) of the first two principal components (PCs) that group together cortical regions with shared variance in their surface area. PC1 (global) captured variations of most regions, whereas PC2 (visual) was specific to the primary and secondary visual cortices. We identified a total of 18 (PC1) and 17 (PC2) independent loci, which were replicated in another 25 746 individuals. The loci of the global PC1 included those associated previously with intracranial volume and/or general cognitive function, such as MAPT and IGF2BP1. The loci of the visual PC2 included DAAM1, a key player in the planar-cell-polarity pathway. We then tested associations with occupational aptitudes and, as predicted, found that the global PC1 was associated with General Learning Ability, and the visual PC2 was associated with the Form Perception aptitude. These results suggest that interindividual variations in global and regional development of the human cerebral cortex (and its molecular architecture) cascade-albeit in a very limited manner-to behaviors as complex as the choice of one's occupation.
Also flagged:HuntingtinHuntington DiseaseHDcytosineadenineguanine
Journal Article2020-06-01✓ 4 SnippetsLeavitt BR, Kordasiewicz HB, Schobel SA.
In-Text Gene Mentions
Abstract)
…Huntington disease (HD) is caused by a cytosine-adenine-guanine trinucleotide repeat expansion in the huntingtin gene, HTT, that results in expression of variant (mutant) huntingtin protein (HTT).…
Abstract)
…In a recently completed phase 1/2a study of RG6042 in 46 adults with early manifest HD, antisense oligonucleotide-mediated partial reduction of HTT was reported to be generally safe and well tolerated over the course of 4-monthly RG6042 doses.…
Abstract)
…the huntingtin gene,HTT, that results in…
Abstract)
…(mutant) huntingtin protein (HTT).…
Show Full Abstract
Huntington disease (HD) is caused by a cytosine-adenine-guanine trinucleotide repeat expansion in the huntingtin gene, HTT, that results in expression of variant (mutant) huntingtin protein (HTT). Therapeutic strategies that reduce HTT levels are currently being pursued to slow or stop disease progression in people with HD. These approaches are supported by robust preclinical data indicating that reducing variant huntingtin protein is associated with decreased HD pathology. However, the risk-benefit profile of reducing either variant HTT or both variant and wild-type HTT is currently an open question that is being addressed in ongoing clinical trials. This review aims to examine the current data available regarding altered HTT in humans, normal animals, and animal models of HD. Studies indexed in PubMed were searched using the MeSH term Huntington disease or the text words huntington or huntingtin from August 31, 1999, to August 31, 2019, with no language restrictions. Additional studies were included from the reference lists of relevant studies and the authors' personal files. Articles describing at least 1 aspect of HTT reduction were included, prioritizing those published within the last 10 years. In vivo studies were also prioritized, with a focus on studies that examined the consequences of wild-type HTT reduction in adults. In a recently completed phase 1/2a study of RG6042 in 46 adults with early manifest HD, antisense oligonucleotide-mediated partial reduction of HTT was reported to be generally safe and well tolerated over the course of 4-monthly RG6042 doses. In case studies of people with rare genetic variations in huntingtin alleles, the loss of 1 wild-type allele was not associated with HD. People with homozygous cytosine-adenine-guanine expansions developed normally until the onset of HD, although they may have experienced a more aggressive disease course. In mouse models of HD, partial reduction of HTT was beneficial, with improvements in motor, cognitive, and behavioral phenotypes. The partial reduction of wild-type HTT in normal adult rodents and nonhuman primates was generally safe and well tolerated. The body of evidence reviewed in this article indicates a positive risk-benefit profile for the partial reduction of either variant HTT alone or both variant and wild-type HTT. These strategies target the underlying cause of HD and are currently being tested in several investigational clinical trials.
Acetaminophen (APAP) overdose-induced acute liver failure is an important clinical problem in the United States and the current antidote N-acetylcysteine, has a short early therapeutic window. Since most patients present late to the clinic, there is need for novel late-acting therapeutic options. Though the neuronal guidance cue netrin-1, has been shown to promote hepatic repair and regeneration during liver ischemia/reperfusion injury, its effect in APAP-induced hepatotoxicity is unknown. In the quest for a late-acting therapeutic intervention in APAP-induced liver injury, we examined the role of netrin-1 in a mouse model of APAP overdose. Male C57BL/6J mice were cotreated with exogenous netrin-1 or vehicle control, along with 300 mg/kg APAP and euthanized at 6, 12, and 24 h. Significant elevations in alanine aminotransferase indicative of liver injury were seen in control mice at 6 h and this was not affected by netrin-1 administration. Also, netrin-1 treatment did not influence mitochondrial translocation of phospho-JNK, or peroxynitrite formation indicating that there was no interference with APAP-induced injury processes. Interestingly however, netrin-1 administration attenuated liver injury at 24 h, as seen by alanine aminotransferase levels and histology, at which time significant elevations in the netrin-1 receptor, adenosine A2B receptor (A2BAR) as well as macrophage infiltration was evident. Removal of resident macrophages with clodronate liposomes or treatment with the A2BAR antagonist PSB1115 blocked the protective effects of netrin-1. Thus, our data indicate a previously unrecognized role for netrin-1 in attenuation of APAP hepatotoxicity by enhancing recovery and regeneration, which is mediated through the A2BAR and involves resident liver macrophages.
Also flagged:ObesityIronbrain developmentAnemiaPPC-reactive protein
Journal Article2020-06-01✓ 1 SnippetKoenig MD, Klikuszowian E, O'Brien KO, Pauls H, Steffen A, DeMartelly V, Ruchob R, Welke L, Hemphill N, LaBomascus B, Pezley L, McLeod A, Hirsch B, Ferrans CE, Tussing-Humphreys L.
In-Text Gene Mentions
Text
…hemochromatosis…
Show Full Abstract
<h4>Background</h4>An adequate maternal iron supply is crucial for maternal red blood cell (RBC) expansion, placental and fetal growth, and fetal brain development. Obese women may be at risk for poor iron status in pregnancy due to proinflammatory-driven overexpression of hepcidin leading to decreased iron bioavailability.<h4>Objective</h4>The objective of this study was to determine the impact of prepregnancy (PP) obesity on third-trimester maternal iron utilization.<h4>Design</h4>Using the stable isotope 57Fe, we measured iron utilization in the third trimester in PP obese [BMI (in kg/m2): ≥30] and nonobese (BMI: 18.5-29.9) women. We also assessed iron status, hepcidin, inflammation, erythropoietin, dietary iron intake, and gestational weight gain. Descriptive and inferential statistical tests (e.g., Student t test, Pearson correlation) were used for data analysis.<h4>Results</h4>Fifty pregnant women (21 PP obese, 29 PP nonobese) were included. Mean age was 27.6 ± 6.8 y and mean gestational age at time of 57Fe administration was 32.7 ± 0.7 wk. Anemia (hemoglobin <11 g/dL for non-black and <10.2 g/dL for black women) affected 38% of women (43% PP obese compared with 35% PP nonobese; P = 0.55). Women with PP obesity had significantly higher C-reactive protein (8.5 compared with 3.4 mg/L, P = 0.0007) and total body iron corrected for inflammation (6.0 compared with 4.3 mg/kg, P = 0.04) compared with the nonobese women. There was no difference in serum hepcidin or iron utilization between the PP BMI groups.<h4>Conclusion</h4>This is the first study to assess the impact of PP obesity on maternal iron utilization. We found no difference in iron utilization in the third trimester of pregnancy in women with and without PP obesity. Despite higher frequency of anemia, women with PP obesity had less depleted body iron stores, suggesting some degree of iron sequestration. This finding should be followed up and extended to understand effects on fetal iron bioavailability.
Also flagged:pathogenesisC-reactive proteinCRPinflammatory bowel diseasespeptidepeptides
Journal Article2020-06-01✓ 2 SnippetsBasso D, Padoan A, D'Incà R, Arrigoni G, Scapellato ML, Contran N, Franchin C, Lorenzon G, Mescoli C, Moz S, Bozzato D, Rugge M, Plebani M.
In-Text Gene Mentions
Abstract)
…IBD-associated over-expressed proteins included immunoglobulins and neutrophil proteins, while those under-expressed comprised proteins of the nucleic acid assembly or those (OLFM4, ENPP7) related to cancer risk.…
Abstract)
…assembly or those (OLFM4, ENPP7) related to…
Show Full Abstract
Background The sensitivities and specificities of C-reactive protein (CRP) and faecal calprotectin (fCal), as recommended for inflammatory bowel diseases (IBD) diagnosis and monitoring, are low. Our aim was to discover new stool protein/peptide biomarkers for diagnosing IBD. Methods For peptides, MALDI-TOF/MS (m/z 1000-4000) was performed using stools from an exploratory (34 controls; 72 Crohn's disease [CD], 56 ulcerative colitis [UC]) and a validation (28 controls, 27 CD, 15 UC) cohort. For proteins, LTQ-Orbitrap XL MS analysis (6 controls, 5 CD, 5 UC) was performed. Results MALDI-TOF/MS spectra of IBD patients had numerous features, unlike controls. Overall, 426 features (67 control-associated, 359 IBD-associated) were identified. Spectra were classified as control or IBD (absence or presence of IBD-associated features). In the exploratory cohort, the sensitivity and specificity of this classification algorithm were 81% and 97%, respectively. Blind analysis of the validation cohort confirmed 97% specificity, with a lower sensitivity (55%) paralleling active disease frequency. Following binary logistic regression analysis, IBD was independently correlated with MALDI-TOF/MS spectra (p < 0.0001), outperforming fCal measurements (p = 0.029). The IBD-correlated m/z 1810.8 feature was a fragment of APC2, homologous with APC, over-expressed by infiltrating cells lining the surface in UC or the muscularis-mucosae in CD (assessed by immunohistochemistry). IBD-associated over-expressed proteins included immunoglobulins and neutrophil proteins, while those under-expressed comprised proteins of the nucleic acid assembly or those (OLFM4, ENPP7) related to cancer risk. Conclusions Our study provides evidence for the clinical utility of a novel proteomic method for diagnosing IBD and insight on the pathogenic role of APC. Moreover, the newly described IBD-associated proteins might become tools for cancer risk assessment in IBD patients.
Journal Article2020-06-01No SnippetsHe X, Chen W, Liu Z, Yu G, Chen Y, Cai YJ, Sun L, Xu W, Zhong L, Gao C, Chen J, Zhang M, Yang S, Yao Y, Zhang Z, Ma F, Zhang CC, Lu HP, Yu B, Cheng TL, Qiu J, Sheng Q, Zhou HM, Lv ZR, Yan J, Zhou Y, Qiu Z, Cui Z, Zhang X, Meng A, Sun Q, Yang Y.
Show Full Abstract
Site-specific DNA double-strand breaks have been used to generate knock-in through the homology-dependent or -independent pathway. However, low efficiency and accompanying negative impacts such as undesirable indels or tumorigenic potential remain problematic. In this study, we present an enhanced reduced-risk genome editing strategy we named as NEO, which used either site-specific trans or cis double-nicking facilitated by four bacterial recombination factors (RecOFAR). In comparison to currently available approaches, NEO achieved higher knock-in (KI) germline transmission frequency (improving from zero to up to 10% efficiency with an average of 5-fold improvement for 8 loci) and 'cleaner' knock-in of long DNA fragments (up to 5.5 kb) into a variety of genome regions in zebrafish, mice and rats. Furthermore, NEO yielded up to 50% knock-in in monkey embryos and 20% relative integration efficiency in non-dividing primary human peripheral blood lymphocytes (hPBLCs). Remarkably, both on-target and off-target indels were effectively suppressed by NEO. NEO may also be used to introduce low-risk unrestricted point mutations effectively and precisely. Therefore, by balancing efficiency with safety and quality, the NEO method reported here shows substantial potential and improves the in vivo gene-editing strategies that have recently been developed.
Also flagged:Idiopathic Pulmonary Arterial HypertensionIPAHbone morphogenetic protein receptor 2pulmonary hypertensionBMPR2iloprost
Journal Article2020-06-01✓ 5 SnippetsWang XJ, Xu XQ, Sun K, Liu KQ, Li SQ, Jiang X, Zhao QH, Wang L, Peng FH, Ye J, Wu Y, Jiang R, Zhang J, Huang W, Wei WB, Yan Y, Li JH, Liu QQ, Li S, Wang Y, Zhang SY, Zhang X, Jing ZC.
In-Text Gene Mentions
S I O 001029)
…In this 2-stage genetic association study of 230 patients with idiopathic pulmonary arterial hypertension, heterozygous rare PTGIS variants were first found significantly overrepresented in 6.1%, conferring 7.8 higher odds of pulmonary arterial hypertension.…
S I O 001029)
…B, The effect of the variants of PTGIS on apoptosis in PMECs was assessed by caspase 3/7 activity after stimulation with tumor necrosis factor (TNF) and cycloheximide (CHX).…
Discussion)
…Moreover, our clinical data from acute pulmonary vasoreactivity testing demonstrate that rare PTGIS genetic variants are predictive of iloprost responsiveness, thereby providing a rationale for targeting the prostacyclin pathway as part of tailored therapies for managing patients with PTGIS variants.…
Discussion)
…Importantly, these patients lacked any BMPR2 variants, which suggests that the IPAH susceptibility of PTGIS variants is independent of BMPR2. The rare PTGIS variants identified in the discovery and replication cohorts conferred a greater odds ratio of 7.8-fold to develop IPAH.…
Discussion)
…Future study among larger cohorts will be crucial to test the variability and prognostic value of rare PTGIS variants for long-term prostacyclin treatment or the relevance to different therapeutic strategy.…
Show Full Abstract
<h4>Importance</h4>Idiopathic pulmonary arterial hypertension (IPAH) is a fatal disease with high heritability; however, the bone morphogenetic protein receptor 2 (BMPR2) gene only accounts for 17% of IPAH. The genetic basis of IPAH needs further investigation.<h4>Objective</h4>To identify novel IPAH susceptibility genes other than BMPR2.<h4>Design, setting, and participants</h4>This 2-stage, case-control genetic association study enrolled 230 patients with IPAH from 2 referral pulmonary hypertension centers in China. Eligible patients had no BMPR2 variants and were compared with 968 healthy control participants. Data were collected from January 1, 2000, to July 31, 2015, and analyzed from August 1, 2015, to May 30, 2018.<h4>Exposures</h4>PTGIS rare variants.<h4>Main outcomes and measures</h4>Whole-genome sequencing was performed to identify putative IPAH genes in a discovery cohort, with validation in an independent referral cohort. Correlation of genotype and hemodynamic characteristics was then evaluated at baseline and after pulmonary vasodilator testing. Functional assessments were conducted to analyze the effects of identified genetic variants on transcript splicing, enzymatic activity, and endothelial cell phenotypes.<h4>Results</h4>Among 230 patients with IPAH (164 female [71.3%]; mean [SD] age, 34 [18] years), an enrichment of rare variants in a gene encoding prostacyclin synthase (PTGIS) was identified in the discovery cohort. The association of PTGIS rare variants with IPAH was confirmed in the replication cohort. In the combined data set, PTGIS rare variants were found in 14 of 230 cases (6.1%) and 8 of 968 controls (0.8%) (odds ratio, 7.8; 95% CI, 3.2-18.8; P = 5 × 10-6, logistic regression). Compared with patients without PTGIS variants, inhaled iloprost induced a more significant decrease of pulmonary vascular resistance (difference in the least square mean, -21.7%; 95% CI, -31.4% to -12.0%; P < .001, linear regression model) and an increase of cardiac index (difference in the least square mean, 18.3%; 95% CI, 8.8%-27.8%; P < .001, linear regression model) in patients with PTGIS variants. The minigene assay indicated that the c.521 + 1G>A variant resulted in aberrant messenger RNA transcripts. The functional studies showed that the 2 missense rare variants (R252Q and A447T) resulted in a decrease in prostacyclin production and increased cell death of pulmonary microvascular endothelial cells.<h4>Conclusions and relevance</h4>This study identified 3 rare loss-of-function variants in the PTGIS gene from 2 independent cohorts with IPAH. The genetic variants of PTGIS predispose pulmonary vascular responses to the iloprost stimulation. These findings suggest that PTGIS variants may be involved in the pathogenesis of IPAH.
Also flagged:RBBP4histonesRetinoblastoma-binding protein 4chromatin-remodeling factorRBAP48oxygen
Journal Article2020-06-01✓ 1 SnippetMiao X, Sun T, Barletta H, Mager J, Cui W.
In-Text Gene Mentions
Text
…Suds3…
Show Full Abstract
Retinoblastoma-binding protein 4 (RBBP4) (also known as chromatin-remodeling factor RBAP48) is an evolutionarily conserved protein that has been involved in various biological processes. Although a variety of functions have been attributed to RBBP4 in vitro, mammalian RBBP4 has not been studied in vivo. Here we report that RBBP4 is essential during early mouse embryo development. Although Rbbp4 mutant embryos exhibit normal morphology at E3.5 blastocyst stage, they cannot be recovered at E7.5 early post-gastrulation stage, suggesting an implantation failure. Outgrowth (OG) assays reveal that mutant blastocysts cannot hatch from the zona or can hatch but then arrest without further development. We find that while there is no change in proliferation or levels of reactive oxygen species, both apoptosis and histone acetylation are significantly increased in mutant blastocysts. Analysis of lineage specification reveals that while the trophoblast is properly specified, both epiblast and primitive endoderm lineages are compromised with severe reductions in cell number and/or specification. In summary, these findings demonstrate the essential role of RBBP4 during early mammalian embryogenesis.
Also flagged:bradycardiavegetative stateRespiratory insufficiencySepsisCongenital heart diseaseMalignancy
Journal Article2020-06-01No SnippetsMorgan RW, Reeder RW, Meert KL, Telford R, Yates AR, Berger JT, Graham K, Landis WP, Kilbaugh TJ, Newth CJ, Carcillo JA, McQuillen PS, Harrison RE, Moler FW, Pollack MM, Carpenter TC, Notterman D, Holubkov R, Dean JM, Nadkarni VM, Berg RA, Sutton RM, Eunice Kennedy Shriver National Institute of Child Health and Human Development/Collaborative Pediatric Critical Care Research Network (CPCCRN) Pediatric Intensive Care Quality of Cardio-Pulmonary Resuscitation (PICqCPR) Investigators.
Show Full Abstract
<h4>Objectives</h4>The objective of this study was to compare survival outcomes and intra-arrest arterial blood pressures between children receiving cardiopulmonary resuscitation for bradycardia and poor perfusion and those with pulseless cardiac arrests.<h4>Design</h4>Prospective, multicenter observational study.<h4>Setting</h4>PICUs and cardiac ICUs of the Collaborative Pediatric Critical Care Research Network.<h4>Patients</h4>Children (< 19 yr old) who received greater than or equal to 1 minute of cardiopulmonary resuscitation with invasive arterial blood pressure monitoring in place.<h4>Interventions</h4>None.<h4>Measurements and main results</h4>Of 164 patients, 96 (59%) had bradycardia and poor perfusion as the initial cardiopulmonary resuscitation rhythm. Compared to those with initial pulseless rhythms, these children were younger (0.4 vs 1.4 yr; p = 0.005) and more likely to have a respiratory etiology of arrest (p < 0.001). Children with bradycardia and poor perfusion were more likely to survive to hospital discharge (adjusted odds ratio, 2.31; 95% CI, 1.10-4.83; p = 0.025) and survive with favorable neurologic outcome (adjusted odds ratio, 2.21; 95% CI, 1.04-4.67; p = 0.036). There were no differences in diastolic or systolic blood pressures or event survival (return of spontaneous circulation or return of circulation via extracorporeal cardiopulmonary resuscitation). Among patients with bradycardia and poor perfusion, 49 of 96 (51%) had subsequent pulselessness during the cardiopulmonary resuscitation event. During cardiopulmonary resuscitation, these patients had lower diastolic blood pressure (point estimate, -6.68 mm Hg [-10.92 to -2.44 mm Hg]; p = 0.003) and systolic blood pressure (point estimate, -12.36 mm Hg [-23.52 to -1.21 mm Hg]; p = 0.032) and lower rates of return of spontaneous circulation (26/49 vs 42/47; p < 0.001) than those who were never pulseless.<h4>Conclusions</h4>Most children receiving cardiopulmonary resuscitation in ICUs had an initial rhythm of bradycardia and poor perfusion. They were more likely to survive to hospital discharge and survive with favorable neurologic outcomes than patients with pulseless arrests, although there were no differences in immediate event outcomes or intra-arrest hemodynamics. Patients who progressed to pulselessness after cardiopulmonary resuscitation initiation had lower intra-arrest hemodynamics and worse event outcomes than those who were never pulseless.
Also flagged:acromegalysomatostatin receptorsomatotropinomaIGF1SSTR2SSTR5
Journal Article2020-06-01✓ 1 SnippetPuig-Domingo M, Gil J, Sampedro-Nuñez M, Jordà M, Webb SM, Serra G, Pons L, Salinas I, Blanco A, Marques-Pamies M, Valassi E, Picó A, García-Martínez A, Carrato C, Buj R, Del Pozo C, Obiols G, Villabona C, Cámara R, Fajardo-Montañana C, Alvarez CV, Bernabéu I, Marazuela M.
In-Text Gene Mentions
Abstract)
…In1-Ghrelin, PLAGL1 andPEBP1(RKIP) by RT-qPCR…
Show Full Abstract
Pharmacologic treatment of acromegaly is currently based upon assay-error strategy, the first-generation somatostatin receptor ligands (SRL) being the first-line treatment. However, about 50% of patients do not respond adequately to SRL. Our objective was to evaluate the potential usefulness of different molecular markers as predictors of response to SRL. We used somatotropinoma tissue obtained after surgery from a national cohort of 100 acromegalic patients. Seventy-one patients were treated with SRL during at least 6 months under maximal therapeutic doses according to IGF1 values. We analyzed the expression of SSTR2, SSTR5, AIP, CDH1 (E-cadherin), MKI67 (Ki-67), KLK10, DRD2, ARRB1, GHRL, In1-Ghrelin, PLAGL1 and PEBP1 (RKIP) by RT-qPCR and mutations in GNAS gene by Sanger sequencing. The response to SRL was categorized as complete response (CR), partial (PR) or non-response (NR) if IGF1 was normal, between >2<3 SDS or >3 SDS IGF1 at 6 months of follow-up, respectively. From the 71 patients treated, there were 27 CR (38%), 18 PR (25%) and 26 NR (37%). SSTR2, Ki-67 and E-cadherin were associated with SRL response (P < 0.03, P < 0.01 and P < 0.003, respectively). E-cadherin was the best discriminator for response prediction (AUC = 0.74, P < 0.02, PPV of 83.7%, NPV of 72.6%), which was validated at protein level. SSTR5 expression was higher in patients pre-treated with SRL before surgery. We conclude that somatotropinomas showed heterogeneity in the expression of genes associated with SRL response. E-cadherin was the best molecular predictor of response to SRL. Thus, the inclusion of E-cadherin in subsequent treatment-decision after surgical failure may be useful in acromegaly.
Also flagged:RPEdefectsionslocalizationKIF24Cytokinesis
Journal Article2020-06-01✓ 5 SnippetsPejskova P, Reilly ML, Bino L, Bernatik O, Dolanska L, Ganji RS, Zdrahal Z, Benmerah A, Cajanek L.
In-Text Gene Mentions
Methods)
…KIF7, SCYL2, LUZP1,CCDC92, AJUBA, BORA, NEDD9,…
Results)
…to focus on:CCDC92, LUZP1, SCYL2, KIF7,…
Results)
…of SCYL2, LUZP1,CCDC92, or KIF7 showed…
Discussion)
…of SCYL2, LUZP1,CCDC92, or KIF7, which…
Discussion)
…SCYL2, LUZP1, andCCDC92have previously been…
Show Full Abstract
Primary cilia play critical roles in development and disease. Their assembly and disassembly are tightly coupled to cell cycle progression. Here, we present data identifying KIF14 as a regulator of cilia formation and Hedgehog (HH) signaling. We show that RNAi depletion of KIF14 specifically leads to defects in ciliogenesis and basal body (BB) biogenesis, as its absence hampers the efficiency of primary cilium formation and the dynamics of primary cilium elongation, and disrupts the localization of the distal appendage proteins SCLT1 and FBF1 and components of the IFT-B complex. We identify deregulated Aurora A activity as a mechanism contributing to the primary cilium and BB formation defects seen after KIF14 depletion. In addition, we show that primary cilia in KIF14-depleted cells are defective in response to HH pathway activation, independently of the effects of Aurora A. In sum, our data point to KIF14 as a critical node connecting cell cycle machinery, effective ciliogenesis, and HH signaling.
Also flagged:bindingproteaseα-ketoamidelopinavirdarunavircoronavirus disease 2019
Journal Article2020-06-01No SnippetsSk MF, Roy R, Jonniya NA, Poddar S, Kar P.
Show Full Abstract
The recent outbreak of novel "coronavirus disease 2019" (COVID-19) has spread rapidly worldwide, causing a global pandemic. In the present work, we have elucidated the mechanism of binding of two inhibitors, namely α-ketoamide and Z31792168, to SARS-CoV-2 main protease (M<sup>pro</sup> or 3CL<sup>pro</sup>) by using all-atom molecular dynamics simulations and free energy calculations. We calculated the total binding free energy (ΔG<sub>bind</sub>) of both inhibitors and further decomposed ΔG<sub>bind</sub> into various forces governing the complex formation using the Molecular Mechanics/Poisson-Boltzmann Surface Area (MM/PBSA) method. Our calculations reveal that α-ketoamide is more potent (ΔG<sub>bind</sub>= - 9.05 kcal/mol) compared to Z31792168 (ΔG<sub>bind</sub>= - 3.25 kcal/mol) against COVID-19 3CL<sup>pro</sup>. The increase in ΔG<sub>bind</sub> for α-ketoamide relative to Z31792168 arises due to an increase in the favorable electrostatic and van der Waals interactions between the inhibitor and 3CL<sup>pro</sup>. Further, we have identified important residues controlling the 3CL<sup>pro</sup>-ligand binding from per-residue based decomposition of the binding free energy. Finally, we have compared ΔG<sub>bind</sub> of these two inhibitors with the anti-HIV retroviral drugs, such as lopinavir and darunavir. It is observed that α-ketoamide is more potent compared to lopinavir and darunavir. In the case of lopinavir, a decrease in van der Waals interactions is responsible for the lower binding affinity compared to α-ketoamide. On the other hand, in the case of darunavir, a decrease in the favorable intermolecular electrostatic and van der Waals interactions contributes to lower affinity compared to α-ketoamide. Our study might help in designing rational anti-coronaviral drugs targeting the SARS-CoV-2 main protease.Communicated by Ramaswamy H. Sarma.
Also flagged:aminoesterDrugamino-estersdexamethasoneamine
Journal Article2020-06-01No SnippetsPerni S, Prokopovich P.
Show Full Abstract
Drug localisation is still one of the main challenges in treating pathologies affecting cartilage; poly-beta-amino-esters (PBAEs) drug conjugates are a possible solution; however, their efficacy highly depends on the polymer structure hence the full potential of this delivery system is still unknown. For the purpose of optimising the delivery system design, a large library of PBAEs was synthesised and dexamethasone (DEX) uptake in cartilage was determined. All three components of PBAE (amine, acrylate and end-capping) impacted the outcome. The most effective PBAE identified enhanced DEX uptake by 8 folds compared to an equivalent dose of the commercial formulation and also prevented, through delivery of DEX, the cartilage degradation caused by IL-1α (interleukine1α). A chemometrics based predictive model was constructed and PBAEs properties most affecting the performance of the drug delivery systems were identified. This model will allow further computer based PBAEs optimisation and fast track the bench to market process for this delivery system.
<h4>Study question</h4>Are intrauterine insemination (IUI) performance characteristics and post-processing total motile sperm count (TMC) related to live birth rate in couples with unexplained infertility?<h4>Summary answer</h4>Patient discomfort with IUI and lower inseminate TMC were associated with a reduced live birth rate, while time from hCG injection to IUI, sperm preparation method and ultrasound guidance for IUI were not associated with live birth success.<h4>What is already known</h4>We previously determined that some baseline characteristics of couples with unexplained infertility, including female age, duration of infertility, history of prior loss and income, were related to live birth rate across a course of ovarian stimulation and IUI treatment. However, the relationship between treatment outcomes and per-cycle characteristics, including ultrasound guidance for IUI, timing of IUI relative to hCG injection, difficult or painful IUI and inseminate TMC, are controversial, and most prior investigations have not evaluated live birth outcome.<h4>Study design, size, duration</h4>This was a secondary analyses of 2462 cycles from the Assessment of Multiple Intrauterine Gestations from Ovarian Stimulation (AMIGOS) clinical trial. This prospective, randomised, multicentre clinical trial determined live birth rates following IUI after ovarian stimulation with clomiphene citrate, letrozole or gonadotropins in 854 couples with unexplained infertility. It was conducted between 2011 and 2014, and couples could undergo up to four consecutive treatment cycles.<h4>Participants/materials, setting, methods</h4>AMIGOS was an NIH-sponsored Reproductive Medicine Network trial conducted at 12 clinical sites. Participants were women with unexplained infertility who were between 18 and 40 years of age. Cluster-weighted generalised estimating equations (GEE), which account for informative clustering of multiple IUI treatment cycles within the same patient, were used to determine associations between IUI performance characteristics, including inseminate TMC, and live birth rate. Efficiency curves were also generated to examine the relationship between inseminate TMC and live birth rate.<h4>Main results and the role of chance</h4>After adjustment for treatment group and baseline factors previously associated with live birth across a course of OS-IUI treatment, patient discomfort during the IUI procedure was associated with a reduction in live birth rate (aRR 0.40 (0.16-0.96)). Time from hCG trigger injection to IUI was not significantly associated with outcome. Higher TMC was associated with greater live birth rate (TMC 15.1-20.0 million (14.8%) compared to ≤5 million (5.5%)) (aRR 2.09 (1.31-3.33)). However, live births did occur with TMC ≤ 1 million (5.1%).<h4>Limitations, reasons for caution</h4>This investigation is a secondary analysis, and AMIGOS was not designed to address the present question. Since timed intercourse was allowed as part of the AMIGOS trial, we cannot rule out the possibility that any given pregnancy resulted from intercourse rather than IUI.<h4>Wider implications of the findings</h4>Most factors associated with the performance of IUI were not significantly related to obtaining live birth. Our findings suggest that higher TMC inseminated leads to an increase in live birth rate up to TMC ~20 million. However, there may be no reasonable threshold below which live birth is not possible with IUI.<h4>Study funding/competing interest(s)</h4>Funding was received through grants from the Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD): U10 HD077680, U10 HD39005, U10 HD38992, U10 HD27049, U10 HD38998, U10 HD055942, HD055944, U10 HD055936 and U10 HD055925. This research was made possible by funding by the American Recovery and Reinvestment Act. Dr Hansen reports grants from NIH/NICHD and Yale University during the conduct of the study, grants from Roche Diagnostics and grants from Ferring International Pharmascience Center US outside the submitted work. Dr Peck reports support from Ferring Pharmaceuticals outside the submitted work. Dr Coward has nothing to disclose. Dr Wild reports grants from NICHD during the conduct of the study. Dr Trussell has nothing to disclose. Dr Krawetz reports grants from NICHD during the conduct of the study, grants from Merck and support from Taylor and Frances and from Springer, outside the submitted work. Dr Diamond reports grants from NIH/NICHD, Yale University, during the conduct of the study and support from Advanced Reproductive Care AbbVie, Bayer and ObsEva, outside the submitted work. Dr Legro reports support from Bayer, Kindex, Odega, Millendo and AbbVie and grants and support from Ferring, outside the submitted work. Dr Coutifaris reports grants from NICHD/NIH and personal fees from American Society for Reproductive Medicine, outside the submitted work. Dr Alvero has nothing to disclose. Dr Robinson reports grants from NIH during the conduct of the study. Dr Casson has nothing to disclose. Dr Christman reports grants from NICHD during the conduct of the study. Dr Santoro reports grants from NIH during the conduct of the study. Dr Zhang reports grants from NIH during the conduct of the study and support from Shangdong University outside the submitted work.<h4>Trial registration number</h4>n/a.
Also flagged:coronary heart diseaseaspartate aminoconvertaseASTCKlactate dehydrogenaselipid
Journal Article2020-06-01No SnippetsJiang Y, He Q, Zhang T, Xiang W, Long Z, Wu S.
Show Full Abstract
<h4>Objective</h4>To explore the mechanism of Shengmai Yin (SMY) for coronary heart disease (CHD) by systemic pharmacology and chemoinformatics.<h4>Methods</h4>Traditional Chinese Medicine Systems Pharmacology Database (TCMSP), traditional Chinese medicine integrative database (TCMID) and the traditional Chinese medicine (TCM) Database@Taiwan were used to screen and predict the bioactive components of SMY. Pharmmapper were utilized to predict the potential targets of SMY, the TCMSP was utilized to obtain the known targets of SMY. The Genecards and OMIM database were utilized to collect CHD genes. Cytoscape was then used for network construction and analysis, and DAVID was used for Gene Ontology (GO) and pathway enrichment analysis. After that, animal experiments were then performed to further validate the results of systemic pharmacology and chemoinformatics.<h4>Results</h4>Three major networks were constructed: (1) CHD genes' protein-protein interaction (PPI) network; (2) SMY-CHD PPI network; (3) SMY known target-CHD PPI network. The other networks are minor networks generated by analyzing the three major networks. Experimental results showed that compared with the model group, the Shengmai injection (SMI) can reduce the myocardial injury score and the activities of serum aspartate aminoconvertase (AST), CK and lactate dehydrogenase (LDH) in rats (P<0.05), and reduce serum lipid peroxide (LPO) content and increase serum superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) activities in myocardial infarction rats (P<0.05). SMI can also decrease the expression of MMP-9 mRNA and increase that of TIMP-1 mRNA (P<0.01).<h4>Conclusion</h4>SMY may regulate the signaling pathways (such as PPAR, FoxO, VEGF signaling), biological processes (such as angiogenesis, blood pressure formation, inflammatory response) and targets (such as AKT1, EGFR, MAPK1) so as to play a therapeutic role in CHD.
Also flagged:SepsisDeathneurodevelopmental impairmentinfectiononset sepsisgestation
Journal Article2020-06-01No SnippetsMukhopadhyay S, Puopolo KM, Hansen NI, Lorch SA, DeMauro SB, Greenberg RG, Cotten CM, Sánchez PJ, Bell EF, Eichenwald EC, Stoll BJ, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract
<h4>Objective</h4>To evaluate the hypothesis that early-onset sepsis increases risk of death or neurodevelopmental impairment (NDI) among preterm infants; and that among infants without early-onset sepsis, prolonged early antibiotics alters risk of death/NDI.<h4>Study design</h4>Retrospective cohort study of infants born at the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network centers (2006-2014) at 22-26 weeks of gestation and birth weight 401-1000 g. Early-onset sepsis defined as growth of a pathogen from blood or cerebrospinal fluid culture ≤72 hours after birth. Prolonged early antibiotics was defined as antibiotics initiated ≤72 hours and continued ≥5 days without culture-confirmed infection, necrotizing enterocolitis, or spontaneous perforation. Primary outcome was death before follow-up or NDI assessed at 18-26 months corrected age. Poisson regression was used to estimate adjusted relative risk (aRR) and CI for early-onset sepsis outcomes. A propensity score for receiving prolonged antibiotics was derived from early clinical factors and used to match infants (1:1) with and without prolonged antibiotic exposure. Log binomial models were used to estimate aRR for outcomes in matched infants.<h4>Results</h4>Among 6565 infants, those with early-onset sepsis had higher aRR (95% CI) for death/NDI compared with infants managed with prolonged antibiotics (1.18 [1.06-1.32]) and to infants without prolonged antibiotics (1.23 [1.10-1.37]). Propensity score matching was achieved for 4362 infants. No significant difference in death/NDI (1.04 [0.98-1.11]) was observed with or without prolonged antibiotics among the matched cohort.<h4>Conclusions</h4>Early-onset sepsis was associated with increased risk of death/NDI among extremely preterm infants. Among matched infants without culture-confirmed infection, prolonged early antibiotic administration was not associated with death/NDI.
Also flagged:MagnesiumSulfatemagnesium sulfatecorticosteroidsneurodevelopmental impairmentgestation
Journal Article2020-06-01No SnippetsGentle SJ, Carlo WA, Tan S, Gargano M, Ambalavanan N, Chawla S, Bell EF, Bann CM, Hintz SR, Heyne RJ, Tita A, Higgins RD, Eunice Kennedy Shriver National Institute of Child Health and Human Development (NICHD) Neonatal Research Network.
Show Full Abstract
<h4>Objective</h4>To test the primary hypothesis that extremely preterm children antenatally exposed to both magnesium sulfate and antenatal corticosteroids have a lower rate of severe neurodevelopmental impairment or death compared with those exposed to antenatal corticosteroids alone.<h4>Methods</h4>This was a prospective observational study of children born at 22 0/7-26 6/7 weeks of gestation from 2011 to 2014 at Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network hospitals (N=3,093). The primary outcome was severe neurodevelopmental impairment or death at 18-26 months of corrected age follow-up based on exposure to antenatal corticosteroids and magnesium sulfate or antenatal corticosteroids alone. Secondary outcomes included components of severe neurodevelopmental impairment by exposure group and comparisons of severe neurodevelopmental impairment or death between children exposed to both antenatal corticosteroids and magnesium sulfate with those exposed to magnesium sulfate alone or to neither antenatal corticosteroids nor magnesium sulfate. Logistic regression models adjusted for background characteristics.<h4>Results</h4>Children exposed to both antenatal corticosteroids and magnesium sulfate had a lower rate of severe neurodevelopmental impairment or death (813/2,239, 36.3%) compared with those exposed to antenatal corticosteroids alone (225/508, 44.3%; adjusted odds ratio [aOR] 0.73; 95% CI 0.58-0.91), magnesium sulfate alone (47/89, 53%; aOR 0.49; 95% CI 0.29-0.82), or neither therapy (121/251; 48.2%; aOR 0.66, 95% CI 0.49-0.89). Similarly, children exposed to both antenatal corticosteroids and magnesium sulfate had a lower rate of death compared with either or neither therapy, but the rate of severe neurodevelopmental impairment among survivors did not differ between exposure groups.<h4>Conclusion</h4>In children born between 22 0/7 and 26 6/7 weeks of gestation, exposure to both antenatal corticosteroids and magnesium sulfate was associated with lower rates of severe neurodevelopmental impairment or death and death compared with exposure to antenatal corticosteroids alone.<h4>Clinical trial registration</h4>ClinicalTrials.gov, NCT00063063.
Also flagged:atrial fibrillationAFpersistent AFtranscription factorsIGF2RCAMK2D
Journal Article2020-06-01✓ 5 SnippetsZhang H, Yang G, Zhong N, Shan J, Li X, Wu Y, Xu Y, Yuan Y.
In-Text Gene Mentions
I A O 0000615)
…Notably, miR-204 was involved in the progression of AF by regulating its target genes IGF2R, POU3F2, and AP2A2. By contrast, miR-223-3p functioned in AF by targeting PAX6, which is associated with the regulation of apoptosis in AF.…
Discussion)
…Thus, CAMK2D, IGF2R, PAX6, POU3F2, YWHAE, and AP2A2, may be crucial in AF or other diseases associated with heart, such as heart failure and arrhythmia.…
Discussion)
…Taken together with our present results, we inferred that CAMK2D, IGF2R, PAX6, POU3F2, YWHAE, and AP2A2 might play essential roles in the development of AF.…
I A O 0000615)
…Moreover, CAMK2D, IGF2R, PAX6, POU3F2, YWHAE, and AP2A2 may be the crucial genes in the development of AF.…
Abstract)
…miR-204 was involved in the progression of AF by regulating its target genes IGF2R, POU3F2, and AP2A2. On the other hand, miR-223-3p functioned in AF by targeting PAX6, which was associated with the regulation of apoptosis in AF.…
Show Full Abstract
<h4>Objective</h4>We aimed to find crucial microRNAs (miRNAs) associated with the development of atrial fibrillation (AF), and then try to elucidate the possible molecular mechanisms of miRNAs in AF.<h4>Methods</h4>The miRNA microarray, GSE68475, which included 10 right atrial appendage samples from patients with persistent AF and 11 samples from patients with normal sinus rhythm, was used for the analysis. After data preprocessing, differentially expressed miRNAs were screened using limma. Target genes of miRNAs were predicted using miRWalk2.0. We then conducted functional enrichment analyses for miRNA and target genes. Protein-protein interaction (PPI) network and module analyses for target genes were performed. Finally, transcription factors (TFs)-target genes regulatory network was predicted and constructed.<h4>Results</h4>Seven genes, including CAMK2D, IGF2R, PPP2R2A, PAX6, POU3F2, YWHAE, and AP2A2, were targeted by TFs. Among these seven genes, CAMK2D (targeted by miR-31-5p), IGF2R (targeted by miR-204-5p), PAX6 (targeted by miR-223-3p), POU3F2 (targeted by miR-204-5p), YWHAE (targeted by miR-31-5p), and AP2A2 (targeted by miR-204-5p) belonged to the top 10 degree genes in the PPI network. Notably, MiR-204-5p, miR-31-5p, and miR-223-3p had more target genes. Besides, CAMK2D was enriched in some pathways, such as adrenergic signaling in cardiomyocytes pathway and cAMP signaling pathway. YWHAE was enriched in the Hippo signaling pathway.<h4>Conclusion</h4>miR-31-5p played a crucial role in cardiomyocytes by targeting CAMK2D and YWHAE via cAMP and Hippo signaling pathways. miR-204 was involved in the progression of AF by regulating its target genes IGF2R, POU3F2, and AP2A2. On the other hand, miR-223-3p functioned in AF by targeting PAX6, which was associated with the regulation of apoptosis in AF. This study would provide a theoretical basis and potential therapeutic targets for the treatment of AF. (Anatol J Cardiol 2020; 23: 324-33).
Few studies have addressed gene expression of hemostasis-related factors during acute thrombo-hemorrhagic diseases. Bites by the lanced-headed viper Bothrops jaracaca induce rapid hemostatic disturbances in victims, leading to systemic bleedings, thrombocytopenia and consumption coagulopathy. Although circulating levels of coagulation factors recover rapidly after administration of specific antivenom therapy, it is unclear if B. jararaca venom (BjV) upregulates the mRNA synthesis of hepatic hemostasis-related factors, or if the recovery occurs under basal conditions after the neutralization of venom components by antivenom. Thus, we aimed to investigate if BjV regulates gene expression of important hemostasis-related factors synthetized by the liver. On that account, Swiss mice were injected with saline or BjV (1.6 mg/kg b.w, s.c.), and after 3, 6 and 24 h blood samples and liver fragments were collected to analyze mRNA expression by real-time qPCR. Increased gene expression of fibrinogen chains, haptoglobin and STAT3 was observed during envenomation, particularly at 3 and 6 h. At 24h, mRNA levels of F10 were raised, while those of Serpinc1, Proc and Adamts13 were diminished. Surprisingly, F3 mRNA levels were steadily decreased at 3 h. Gene expression of Thpo, F7, F5 Tfpi, Mug1 was unaltered. mRNA levels of Vwf, P4hb, F8, F2, Plg, and Serpinf2 were minimally altered, but showed important associations with Nfkb1 gene expression. In conclusion, snakebite envenomation upregulates hepatic mRNA synthesis particularly of fibrinogen chains, and acute-phase markers. This response explains the fast recovery of fibrinogen levels after antivenom administration to patients bitten by B. jararaca snakes.
Also flagged:Netrin-1ischemiaimmune responsesA2b receptorCD25antibody
Journal Article2020-06-01✓ 3 SnippetsChen Z, Chen Y, Zhou J, Li Y, Gong C, Wang X.
In-Text Gene Mentions
Methods)
…in colorectal cancer (DCC) blockade group (10…
Methods)
…netrin-1 and aDCCneutralizing antibody were…
Results)
…of netrin-1, whileDCCblockade had no…
Show Full Abstract
<h4>Objective</h4>Inflammation is the primary mechanism of lung ischemia-reperfusion injury (LIRI) and neurologic factors can regulate inflammatory immune responses. Netrin-1 is an axonal guidance molecule, but whether Netrin-1 plays a role in LIRI remains unclear.<h4>Methods</h4>A mouse model of LIRI was established. Immunohistochemistry was used to detect expression of Netrin-1 and to enumerate macrophages and T cells in lung tissue. The proportion of regulatory T cells (Tregs) was assessed by flow cytometry. Levels of apoptosis were assessed by terminal deoxynucleotidyl transferase dUTP nick end staining.<h4>Results</h4>Numbers of macrophages and T cells in the lung tissues of mice with LIRI were elevated, while expression of netrin-1 was significantly decreased. Flow cytometry showed that the proportion of Tregs in mice with LIRI was significantly decreased. The proportion of Tregs among lymphocytes was positively correlated with netrin-1 expression. <i>In vitro</i> experiments showed that netrin-1 promoted an increase in Treg proportion through the A2b receptor. Animal experiments showed that netrin-1 could inhibit apoptosis and reduce T cell and macrophage infiltration by increasing the proportion of Tregs, ultimately reducing LIRI. Treg depletion using an anti-CD25 monoclonal antibody blocked the effects of netrin-1.<h4>Conclusion</h4>Netrin-1 reduced LIRI by increasing the proportion of Tregs.
Also flagged:aminotransferasealanine aminotransferasecardiovascular diseaseASTALTCVD
Journal Article2020-06-01✓ 2 SnippetsFeng X, Wen Y, Peng FF, Wang N, Zhan X, Wu X.
In-Text Gene Mentions
Discussion)
…any etiology, andhemochromatosiswere also excluded,…
Discussion)
…diseases such ashemochromatosis, which may influence…
Show Full Abstract
<h4>Background</h4>Elevated aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio is an independent risk factor for cardiovascular disease (CVD) among the general population. However, an association between AST/ALT ratio and CVD mortality in patients on peritoneal dialysis (PD) has received little attention.<h4>Methods</h4>A total of 2224 incident PD patients from multi-centers were enrolled from November 1, 2005, to June 30, 2017, in this retrospective cohort study. The primary endpoint was CVD mortality. Eligible patients were divided into high and normal groups according to the AST/ALT ratio cut-off for CVD mortality with the receiver operating characteristic (ROC) curve. The associations between the AST/ALT ratio and CVD mortality were evaluated by the Cox regression model.<h4>Results</h4>Of eligible 1579 patients with a mean age of 49.3 ± 14.6 years, 55.4% of patients were male, 18.1% of patients had diabetes, and 64.2% of patients had hypertension. The prevalence of a high AST/ALT ratio was 76.6% in the cohort population. During a follow-up period with 4659.6 patient-years, 316 patients died, of which 193 (61.1%) deaths were caused by CVD episodes. The incidence of CVD mortality in the high group was significantly higher than that in the normal group (13.1% versus 9.2%, P = 0.024). Cumulative CVD mortality rates were significantly different between the two groups by Kaplan-Meier analysis [hazards ratio (HR) = 1.50, 95% confidence index (CI) 1.09-2.07, P = 0.014]. After adjusting for confounding factors, a higher AST/ALT ratio was independently associated with an increased risk of CVD mortality compared with their counterparts (HR = 1.43, 95%CI 1.08-2.41, P = 0.002).<h4>Conclusions</h4>PD patients with high baseline AST/ALT ratio levels may be at a significant risk of CVD mortality.
Also flagged:canceresophageal squamous cell carcinomagene expressionNucleotideesophageal cancerTCF21
Journal Article2020-06-01✓ 5 SnippetsShah R, Sharma V, Bhat A, Singh H, Sharma I, Verma S, Bhat GR, Sharma B, Bakshi D, Kumar R, Dar NA.
In-Text Gene Mentions
Discussion)
…Various studies have shown the role of DCC in colorectal carcinoma, gastric, breast, esophageal and prostate cancer [32].…
Discussion)
…In the SNP analysis we have replicated the newly identified variants (rs12190287 of TCF21, rs10046 of CYP19A1, rs2735940 of TERT, rs751402 of ERCC5, rs2699887 of SLC14A2, rs3792152 of REV1, rs10069690 of TERT, rs2981582 of FGFR2, rs1695 of GSTP1, rs251796 of TERF2, rs2229080 of DCC, rs1801010 of BCL2. Two SNPs that were showing an increased risk of ESCC within the population of our study are rs12190287 of TCF21 and rs10046 of CYP19A1.…
Discussion)
…The genetic variant rs2229080 (C > G) has been studied in ESCC and gastric cancer patients in Kashmir Valley also and it has been observed that rs2229080 of DCC has shown no association with the risk of ESCC.…
Discussion)
…, rs2229080 ofDCC, rs1801010 of…
Discussion)
…rs2229080 ofDCC(Deleted in Colorectal…
Show Full Abstract
<h4>Background</h4>MassARRAY (Agena Bioscience™) combines competitive PCR with MALDI-TOF mass spectrometry (MS) analysis that gives highly accurate, sensitive, and high-throughput methods for the quantitative analysis of variation of gene expression in multiple samples. SNPs (Single Nucleotide Polymorphisms) have a very high potential of discovering disease-gene relationships. SNP-genotyping through MassARRAY is not only a cost-effective genotyping method but also provides a platform to validate variants observed through a high-throughput Next-generation sequencing (NGS).<h4>Methods</h4>In the present study, we have incorporated the use of matrix-assisted laser desorption/ionization-time of flight, mass spectrometry (MALDI-TOF) as a tool for differentiating genotypes based on the mass of variant. We have performed multiplex PCR and genotyped 12 SNPs in 758 samples (166 cases and 592 controls). The 12 studied SNPs were chosen with a rationale for their association with multiple cancers in literature.<h4>Results</h4>This is the first study to explore these SNPs with esophageal cancer within the J&K population. Out of 12 SNPs, two SNPs rs12190287 of TCF21 and rs10046 of CYP19A1 were significantly associated with esophageal cancer with Odds Ratio (OR) 1.412 (1.09-1.8 at 95% CI, p = 0.008) and 1.54 (1.21-2.072 at 95% CI, p = 0.0007) within the population of Jammu and Kashmir.<h4>Conclusion</h4>We explored 12 SNPs that were found to be associated with multiple cancers in literature with esophageal cancer within the population of J&K. This is the first study to find the relation of these SNPs with ESCC within the studied population. This study explores the relation of genetic and environmental factors with the ESCC susceptibility.
Also flagged:PFKFB4androgenprostate cancerPCatumorcancer
Journal Article2020-06-01✓ 1 SnippetLi X, Chen Z, Li Z, Huang G, Lin J, Wei Q, Liang J, Li W.
In-Text Gene Mentions
Results)
…medium containing 10%DCC-FBS.…
Show Full Abstract
<h4>Background</h4>It is well known that androgen-deprivation therapy (ADT) can inevitably drive prostate cancer (PCa) cells into a castration-resistant state. According to the "Warburg effect", the metabolism of aggressive tumor cells increases significantly. The growth of cancer cells depends on glycolysis, which may be a potential target for cancer control. 6-Phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (PFKFB4) plays key roles in the proliferation and metastasis of PCa cells. However, there is very limited knowledge on the role of PFKFB4 in the conversion to castration resistance. The present study aimed to determine the changes in glucose consumption and PFKFB4 expression in LNCaP cells and androgen-independent LNCaP (LNCaP-AI) cells during the whole process of androgen-independent growth. Additionally, PFKFB4 expression in human PCa tissues was evaluated.<h4>Methods</h4>We established an androgen-independent LNCaP-AI cell line derived from LNCaP cells to mimic the traits of castration resistance in vitro. LNCaP-AI and LNCaP cells were cultured in the corresponding medium containing the same amount of glucose. At the end of experiments, the medium supernatant and blank medium were collected, and absorbance was measured. LNCaP-AI and LNCaP cells were harvested to detect PFKFB4 expression by Western blotting. Prostate tissue samples including PCa tissue, carcinoma-adjacent tissue and benign prostatic hyperplasia (BPH) tissue specimens were evaluated for PFKFB4 expression using immunohistochemistry.<h4>Results</h4>In 18 h supernatant samples, the glucose consumption and lactate secretion of LNCaP-AI cells were higher than those of LNCaP cells. The Western blot results indicated that PFKFB4 expression was increased in LNCaP-AI cells compared with LNCaP cells. Immunohistochemistry revealed that the expression of PFKFB4 in PCa tissue specimens was higher than that in BPH and adjacent tissue specimens. However, the differences in PCa tissue before and after ADT were not statistically significant.<h4>Conclusion</h4>PFKFB4 may be associated with enhanced glycolysis during the androgen-independent growth of PCa cells in vitro. PFKFB4 may be a marker of PCa progression. Our results provide a rationale for further clinical investigation of PCa treatment focused on controlling PFKFB4 expression.
Also flagged:methylationgonadotropinsFollicle-stimulating hormonechorionic gonadotropinhCGglucose
Journal Article2020-06-01✓ 1 SnippetHuo Y, Yan ZQ, Yuan P, Qin M, Kuo Y, Li R, Yan LY, Feng HL, Qiao J.
In-Text Gene Mentions
Results)
…, Sox17 ,Suds3, Trmt10b ,…
Show Full Abstract
<h4>Background</h4>Epigenetic abnormalities caused by superovulation have recently attracted increasing attention. Superovulation with exogenous hormones may prevent oocytes from establishing an appropriate epigenetic state, and this effect may extend to the methylation programming in preimplantation embryos, as de novo DNA methylation is a function of developmental stage of follicles and oocyte size. Follicle-stimulating hormone (FSH) and human menopausal gonadotropin (hMG) are common gonadotropins used for superovulation, and appropriate concentrations of these gonadotropins might be necessary. However, no systematic study on the effects of DNA methylation alterations in oocytes associated with superovulation with different dosages of FSH/hMG at the single-cell level has yet been reported. In the current study, different dosages of FSH/hMG combined with human chorionic gonadotropin (hCG) were used in female mice to generate experimental groups, while naturally matured oocytes and oocytes superovulated with only hCG were respectively used as controls. Single-cell level DNA methylation sequencing was carried out on all these matured oocytes.<h4>Results</h4>In this study, we revealed that the genome-wide methylation pattern and CG methylation level of the maternal imprinting control regions of all mature oocytes were globally conserved and stable. However, methylation alterations associated with superovulation were found at a specific set of loci, and the differentially methylated regions (DMRs) mainly occurred in regions other than promoters. Furthermore, some of the annotated genes in the DMRs were involved in biological processes such as glucose metabolism, nervous system development, cell cycle, cell proliferation, and embryo implantation and were altered in all dosages of FSH/hMG group (for example, Gfod2 and SYF2). Other genes were impaired only after high gonadotropin dosages (for instance, Sox17 and Phactr4).<h4>Conclusions</h4>In conclusion, the current study addressed the effects of superovulation on DNA methylation from the perspective of different dosages of gonadotropins at the single-cell level. We found that the genome-wide DNA methylation landscape was globally preserved irrespective of superovulation or of the kind and dosage of gonadotropins used, whereas the methylation alterations associated with superovulation occurred at a specific set of loci. These observed effects reflect that superovulation recruits oocytes that would not normally be ovulated or that have not undergone complete epigenetic maturation. Our results provide an important reference for the safety assessment of superovulation with different dosages of gonadotropins. However, it should be noted that this study has some limitations, as the sample number and library coverage of analyzed oocytes were relatively low. Future studies with larger sample sizes and high-coverage libraries that examine the effects of superovulation on embryo development and offspring health as well as the underlying mechanisms are still needed.
Also flagged:Pcdh18aendocytosisE-cadherincadherincell migrationmembranes
Journal Article2020-06-01No SnippetsBosze B, Ono Y, Mattes B, Sinner C, Gourain V, Thumberger T, Tlili S, Wittbrodt J, Saunders TE, Strähle U, Schug A, Scholpp S.
Show Full Abstract
The notochord defines the axial structure of all vertebrates during development. Notogenesis is a result of major cell reorganization in the mesoderm, the convergence and the extension of the axial cells. However, it is currently not fully understood how these processes act together in a coordinated way during notochord formation. The prechordal plate is an actively migrating cell population in the central mesoderm anterior to the trailing notochordal plate cells. We show that prechordal plate cells express Protocadherin 18a (Pcdh18a), a member of the cadherin superfamily. We find that Pcdh18a-mediated recycling of E-cadherin adhesion complexes transforms prechordal plate cells into a cohesive and fast migrating cell group. In turn, the prechordal plate cells subsequently instruct the trailing mesoderm. We simulated cell migration during early mesoderm formation using a lattice-based mathematical framework and predicted that the requirement for an anterior, local motile cell cluster could guide the intercalation and extension of the posterior, axial cells. Indeed, a grafting experiment validated the prediction and local Pcdh18a expression induced an ectopic prechordal plate-like cell group migrating towards the animal pole. Our findings indicate that the Pcdh18a is important for prechordal plate formation, which influences the trailing mesodermal cell sheet by orchestrating the morphogenesis of the notochord.
Also flagged:biomoleculesynthesisBiomoleculesbiotinIL-6sepsis
Journal Article2020-06-01No SnippetsCowell TW, Valera E, Jankelow A, Park J, Schrader AW, Ding R, Berger J, Bashir R, Han HS.
Show Full Abstract
Rapid, low-cost, and multiplexed biomolecule detection is an important goal in the development of effective molecular diagnostics. Our recent work has demonstrated a microfluidic biochip device that can electrically quantitate a protein target with high sensitivity. This platform detects and quantifies a target analyte by counting and capturing micron-sized beads in response to an immunoassay on the bead surface. Existing microparticles limit the technique to the detection of a single protein target and lack the magnetic properties required for separation of the microparticles for direct measurements from whole blood. Here, we report new precisely engineered microparticles that achieve electrical multiplexing and adapt this platform for low-cost and label-free multiplexed electrical detection of biomolecules. Droplet microfluidic synthesis yielded highly-monodisperse populations of magnetic hydrogel beads (MHBs) with the necessary properties for multiplexing the electrical Coulter counting on chip. Each bead population was designed to contain a different amount of the hydrogel material, resulting in a unique electrical impedance signature during Coulter counting, thereby enabling unique identification of each bead. These monodisperse bead populations span a narrow range of sizes ensuring that all can be captured sensitively and selectively under simultaneously flow. Incorporating these newly synthesized beads, we demonstrate versatile and multiplexed biomolecule detection of proteins or DNA targets. This development of multiplexed beads for the electrical detection of biomolecules, provides a critical advancement towards multiplexing the Coulter counting approach and the development of a low cost point-of-care diagnostic sensor.
Also flagged:Gene ExpressionPTSDZNF140SNRNP35glucocorticoidU12
Journal Article2020-06-01✓ 1 SnippetHuckins LM, Chatzinakos C, Breen MS, Hartmann J, Klengel T, da Silva Almeida AC, Dobbyn A, Girdhar K, Hoffman GE, Klengel C, Logue MW, Lori A, Maihofer AX, Morrison FG, Nguyen HT, Park Y, Ruderfer D, Sloofman LG, van Rooij SJH, PTSD Working Group of Psychiatric Genomics Consortium, Baker DG, Chen CY, Cox N, Duncan LE, Geyer MA, Glatt SJ, Im HK, Risbrough VB, Smoller JW, Stein DJ, Yehuda R, Liberzon I, Koenen KC, Jovanovic T, Kellis M, Miller MW, Bacanu SA, Nievergelt CM, Buxbaum JD, Sklar P, Ressler KJ, Stahl EA, Daskalakis NP.
In-Text Gene Mentions
Text
…ARFGEF2…
Show Full Abstract
To reveal post-traumatic stress disorder (PTSD) genetic risk influences on tissue-specific gene expression, we use brain and non-brain transcriptomic imputation. We impute genetically regulated gene expression (GReX) in 29,539 PTSD cases and 166,145 controls from 70 ancestry-specific cohorts and identify 18 significant GReX-PTSD associations corresponding to specific tissue-gene pairs. The results suggest substantial genetic heterogeneity based on ancestry, cohort type (military versus civilian), and sex. Two study-wide significant PTSD associations are identified in European and military European cohorts; ZNF140 is predicted to be upregulated in whole blood, and SNRNP35 is predicted to be downregulated in dorsolateral prefrontal cortex, respectively. In peripheral leukocytes from 175 marines, the observed PTSD differential gene expression correlates with the predicted differences for these individuals, and deployment stress produces glucocorticoid-regulated expression changes that include downregulation of both ZNF140 and SNRNP35. SNRNP35 knockdown in cells validates its functional role in U12-intron splicing. Finally, exogenous glucocorticoids in mice downregulate prefrontal Snrnp35 expression.
Also flagged:MineralFatty Acidlipidsaturated fatty acidpolyunsaturated fatty acidsvaccenic acid
Journal Article2020-06-01No SnippetsMonllor P, Romero G, Atzori AS, Sandoval-Castro CA, Ayala-Burgos AJ, Roca A, Sendra E, Díaz JR.
Show Full Abstract
In the Mediterranean region, artichoke and broccoli are major crops with a high amount of by-products that can be used as alternative feedstuffs for ruminants, lowering feed costs and enhancing milk sustainability while reducing the environmental impact of dairy production. However, nutritional quality of milk needs to be assured under these production conditions and an optimal inclusion ratio of silages should be determined. This work aimed to evaluate the effect of three inclusion levels (25%, 40%, and 60%) of these silages (artichoke plant, AP, and broccoli by-product, BB) in goat diets on milk yield, composition, and mineral and fatty profiles. Treatments with 60% inclusion of AP and BB presented the lowest milk yield. No differences were found on the milk mineral profile. Inclusion of AP in the animals' diet improved the milk lipid profile from the point of view of human health (AI, TI) compared to BB due to a lower saturated fatty acid content (C12:0, C14:0, and C16:0) and a higher concentration of polyunsaturated fatty acids (PUFA), especially vaccenic acid (C18:1 trans11) and rumenic acid (CLA cis9, trans11), without any differences with the control treatment.
Also flagged:Cancerdeathgene expressionmethylationhistonesgene-expression
Journal Article2020-06-01✓ 1 SnippetGarcía-Guede Á, Vera O, Ibáñez-de-Caceres I.
In-Text Gene Mentions
I A O 0000615)
…HDACs, or otherchromatin modifiermodifier complexes, such…
Show Full Abstract
Cancer is one of the leading causes of death worldwide and it can affect any part of the organism. It arises as a consequence of the genetic and epigenetic changes that lead to the uncontrolled growth of the cells. The epigenetic machinery can regulate gene expression without altering the DNA sequence, and it comprises methylation of the DNA, histones modifications, and non-coding RNAs. Alterations of these gene-expression regulatory elements can be produced by an imbalance of the intracellular environment, such as the one derived by oxidative stress, to promote cancer development, progression, and resistance to chemotherapeutic treatments. Here we review the current literature on the effect of oxidative stress in the epigenetic machinery, especially over the largely unknown ncRNAs and its consequences toward cancer development and progression.
Age-related macular degeneration (AMD) is the most common cause of irreversible blindness in the elderly population. In our previous studies, we found that deficiency of <i>CXCR5</i> causes AMD-like pathological phenotypes in mice, characterized by abnormalities and dysfunction of the retinal pigment epithelium (RPE) cells. The abnormalities included abnormal cellular shape and impaired barrier function. In the present study, primary RPE cells were derived separately from <i>CXCR5</i> knockout (KO) mice and from C57BL6 wild type (WT). The isolated primary cells were cultured for several days, and then total RNA was isolated and used for library preparation, sequencing, and the resultant raw data analyzed. Relative to the WT, a total of 1392 differentially expressed genes (DEG) were identified. Gene ontology analysis showed various biological processes, cellular components, and molecular functions were enriched. Pathway enrichment analysis revealed several pathways, including the <i>PI3K-Akt</i> signaling, <i>mTOR</i> signaling, <i>FoxO</i>, focal adhesion, endocytosis, ubiquitin-mediated proteolysis, <i>TNFα-NF-kB</i> Signaling, adipogenesis genes, <i>p53</i> signaling, Ras, autophagy, epithelial-mesenchymal transition (EMT), and mitochondrial pathway. This study explores molecular signatures associated with deficiency of <i>CXCR5</i> in RPE cells. Many of these signatures are important for homeostasis of this tissue. The identified pathways and genes require further evaluation to better understand the pathophysiology of AMD.
Also flagged:S100A6CacyBPSIPSgt1cell proliferationorganization
Journal Article2020-06-01✓ 1 SnippetFilipek A, Leśniak W.
In-Text Gene Mentions
S I O 001029)
…HD is a hereditary neurodegenerative disease caused by expansion of a polyglutamine (polyQ) stretch in the huntingtin (HTT) protein.…
Show Full Abstract
The S100A6 protein is present in different mammalian cells and tissues including the brain. It binds Ca<sup>2+</sup> and Zn<sup>2+</sup> and interacts with many target proteins/ligands. The best characterized ligands of S100A6, expressed at high level in the brain, include CacyBP/SIP and Sgt1. Research concerning the functional role of S100A6 and these two ligands indicates that they are involved in various signaling pathways that regulate cell proliferation, differentiation, cytoskeletal organization, and others. In this review, we focused on the expression/localization of these proteins in the brain and on their possible role in neurodegenerative diseases. Published results demonstrate that S100A6, CacyBP/SIP, and Sgt1 are expressed in various brain structures and in the spinal cord and can be found in different cell types including neurons and astrocytes. When it comes to their possible involvement in nervous system pathology, it is evident that their expression/level and/or subcellular localization is changed when compared to normal conditions. Among diseases in which such changes have been observed are Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), epileptogenesis, Parkinson's disease (PD), Huntington's disease (HD), and others.
Also flagged:5-hydroxytryptamine transporterstroke depressionpost-stroke depressionstrokedepressioninsomnia
Journal Article2020-06-01✓ 4 SnippetsWang Y, Liu H, Jiang Y, Shi X, Shao Y, Xu ZX.
In-Text Gene Mentions
Discussion)
…Epidemiological studies showed that about 40% of strokepatients developed some degree of depression after acute incidents, making PSD acommon and serious complication of cerebrovascular accident.38 Compared with stroke patients without PSD, stroke patients with PSD haveworse self-care, survival, and emotional abilities, and higher mortality.38 The serotonin transporter (5-HTT) gene has been widelystudied in relation to affective disorders and as the target of antidepressants39 and artificial intelligence systems for managing depression,40 as well as in other diseases.…
Discussion)
…serotonin transporter (5-HTT) gene has…
Discussion)
…and showed that5-HTTgene polymorphism was…
Discussion)
…42 The5-HTTgene was also…
Show Full Abstract
<h4>Objective</h4>To investigate the relationship between 5-hydroxytryptamine transporter gene promoter region (<i>5-HTTLPR</i>) gene polymorphism and post-stroke depression (PSD).<h4>Methods</h4>We searched the CNKI, China Science and Technology Journal, China WanFang, PubMed, Embase, and Web of Science databases for studies of the relationship between <i>5-HTTLPR</i> polymorphism and PSD. Data were evaluated using Stata software.<h4>Results</h4>The L allele was significantly related to the S allele (OR = 0.57, 95% confidence interval (CI) 0.49-0.65). The dominant genotype LL + LS was related to SS (OR = 0.48, 95%CI 0.39-0.59), the recessive genotype LL was related to LS + SS (OR = 0.39, 95%CI: 0.30-0.51), the homozygous genotype LL was related to SS (OR = 0.24, 95%CI 0.18-0.33), and the heterozygous genotype LS was related to SS (OR = 0.55, 95 CI 0.44-0.68). All the differences were significant. Ethnicity subgroup analysis showed significant differences among the five genotypes in both Asians and Caucasians. Hardy-Weinberg equilibrium (HWE) subgroup analysis showed that, after removal of a non-HWE-conforming control group, all five genotypes were significant and genotypes LL, LS + LL, and LS and L allele had beneficial effects on recovery from PSD.<h4>Conclusion</h4><i>5-HTTLPR</i> gene polymorphism is strongly associated with PSD, and the LL, LS + LL, and LS genotypes and L allele may protect against this condition.
Also flagged:eIF4ECOVID-19pneumoniaacute respiratory distress syndromeARDSCoV-2 infection
Journal Article2020-06-01No SnippetsRay PR, Wangzhou A, Ghneim N, Yousuf MS, Paige C, Tavares-Ferreira D, Mwirigi JM, Shiers S, Sankaranarayanan I, McFarland AJ, Neerukonda SV, Davidson S, Dussor G, Burton MD, Price TJ.
Show Full Abstract
The SARS-CoV-2 virus infects cells of the airway and lungs in humans causing the disease COVID-19. This disease is characterized by cough, shortness of breath, and in severe cases causes pneumonia and acute respiratory distress syndrome (ARDS) which can be fatal. Bronchial alveolar lavage fluid (BALF) and plasma from mild and severe cases of COVID-19 have been profiled using protein measurements and bulk and single cell RNA sequencing. Onset of pneumonia and ARDS can be rapid in COVID-19, suggesting a potential neuronal involvement in pathology and mortality. We hypothesized that SARS-CoV-2 infection drives changes in immune cell-derived factors that then interact with receptors expressed by the sensory neuronal innervation of the lung to further promote important aspects of disease severity, including ARDS. We sought to quantify how immune cells might interact with sensory innervation of the lung in COVID-19 using published data from patients, existing RNA sequencing datasets from human dorsal root ganglion neurons and other sources, and a genome-wide ligand-receptor pair database curated for pharmacological interactions relevant for neuro-immune interactions. Our findings reveal a landscape of ligand-receptor interactions in the lung caused by SARS-CoV-2 viral infection and point to potential interventions to reduce the burden of neurogenic inflammation in COVID-19 pulmonary disease. In particular, our work highlights opportunities for clinical trials with existing or under development rheumatoid arthritis and other (e.g. CCL2, CCR5 or EGFR inhibitors) drugs to treat high risk or severe COVID-19 cases.
Also flagged:coagulationsugarlipidironmetabolismamino acid
Journal Article2020-06-01No SnippetsGutiérrez-Guerrero YT, Ibarra-Laclette E, Martínez Del Río C, Barrera-Redondo J, Rebollar EA, Ortega J, León-Paniagua L, Urrutia A, Aguirre-Planter E, Eguiarte LE.
Show Full Abstract
<h4>Background</h4>The New World leaf-nosed bats (Phyllostomids) exhibit a diverse spectrum of feeding habits and innovations in their nutrient acquisition and foraging mechanisms. However, the genomic signatures associated with their distinct diets are unknown.<h4>Results</h4>We conducted a genomic comparative analysis to study the evolutionary dynamics related to dietary diversification and specialization. We sequenced, assembled, and annotated the genomes of five Phyllostomid species: one insect feeder (Macrotus waterhousii), one fruit feeder (Artibeus jamaicensis), and three nectar feeders from the Glossophaginae subfamily (Leptonycteris yerbabuenae, Leptonycteris nivalis, and Musonycteris harrisoni), also including the previously sequenced vampire Desmodus rotundus. Our phylogenomic analysis based on 22,388 gene families displayed differences in expansion and contraction events across the Phyllostomid lineages. Independently of diet, genes relevant for feeding strategies and food intake experienced multiple expansions and signatures of positive selection. We also found adaptation signatures associated with specialized diets: the vampire exhibited traits associated with a blood diet (i.e., coagulation mechanisms), whereas the nectarivore clade shares a group of positively selected genes involved in sugar, lipid, and iron metabolism. Interestingly, in fruit-nectar-feeding Phyllostomid and Pteropodids bats, we detected positive selection in two genes: AACS and ALKBH7, which are crucial in sugar and fat metabolism. Moreover, in these two proteins we found parallel amino acid substitutions in conserved positions exclusive to the tribe Glossophagini and to Pteropodids.<h4>Conclusions</h4>Our findings illuminate the genomic and molecular shifts associated with the evolution of nectarivory and shed light on how nectar-feeding bats can avoid the adverse effects of diets with high glucose content.
Also flagged:constipationgastrointestinal (GI) disorderloperamidevasoactive intestinal peptidenitric oxide
Journal Article2020-06-01✓ 1 SnippetHuang J, Li S, Wang Q, Guan X, Qian L, Li J, Zheng Y, Lin B.
In-Text Gene Mentions
Abstract)
…Bcl2l15, Gsdmc2, andOlfm4) in constipated mice.…
Show Full Abstract
Constipation is a prevalent and burdensome gastrointestinal (GI) disorder that seriously affects the quality of human life. This study evaluated the effects of the P. pentosaceus B49 (from human colostrum) on loperamide (Lop)-induced constipation in mice. Mice were given P. pentosaceus B49 (5 × 109 CFU or 5 × 1010 CFU) by gavage daily for 14 days. The result shows that P. pentosaceus B49 treatment relieved constipation in mice by shortening the defecation time, increasing the GI transit rate and stool production. Compared with the constipation control group, the P. pentosaceus B49-treated groups showed decreased serum levels of inhibitory neurotransmitters (vasoactive intestinal peptide and nitric oxide), increased serum levels of excitatory neurotransmitters (acetylcholinesterase, motilin, and gastrin), and elevated cecal concentration of short chain fatty acids (SCFAs). Analysis of cecal microbiota reveals that P. pentosaceus B49 was colonized in the intestine of constipated mice, and altered the cecal microbiota by increasing beneficial SCFAs-producing bacteria (i.e., Lactobacillus, Ruminococcaceae_UCG-014, and Bacteroidales_S24-7) and decreasing potential pathogenic bacteria (i.e., Staphylococcus and Helicobacter). Moreover, transcriptome analysis of the colon tissue shows that P. pentosaceus B49 partly normalized the expression of genes related to GI peristalsis (i.e., Ache, Chrm2, Slc18a3, Grp, and Vip), water and electrolyte absorption and transport (i.e., Aqp4, Aqp8, and Atp12a), while down-regulating the expression of pro-inflammatory and pro-oncogenic genes (i.e., Lbp, Lgals2, Bcl2, Bcl2l15, Gsdmc2, and Olfm4) in constipated mice. Our findings indicate that P. pentosaceus B49 effectively relieves constipation in mice and is a promising candidate for treating constipation.
Also flagged:NSCLClung cancerspathogenesisgene expressiontumormethylation
Journal Article2020-06-01No SnippetsCai X, Lin L, Zhang Q, Wu W, Su A.
Show Full Abstract
<h4>Objective</h4>Non-small cell lung cancer (NSCLC) accounts for approximately 80% of all lung cancers, but its pathogenesis has not been fully elucidated. Therefore, it is valuable to explore the pathogenesis of NSCLC to improve diagnosis and identify novel treatment biomarkers.<h4>Methods</h4>Circular (circ)RNA, micro (mi)RNA, and gene expression datasets of NSCLC were analyzed to identify those that were differentially expressed between tumor and healthy tissues. Common genes were found and pathway enrichment analyses were performed. Survival analysis was used to identify hub genes, and their level of methylation and association with immune cell infiltration were analyzed. Finally, an NSCLC circRNA-miRNA-mRNA network was constructed.<h4>Results</h4>Eight miRNAs and 211 common genes were identified. Gene ontology and Kyoto Encyclopedia of Genes and Genomes analyses revealed that cell projection morphogenesis, blood vessel morphogenesis, muscle cell proliferation, and synapse organization were enriched. Ten hub genes were found, of which the expression of <i>DTL</i> and <i>RRM2</i> was significantly related to NSCLC patient prognosis. Significant methylation changes and immune cell infiltration correlations with <i>DTL</i> and <i>RRM2</i> were also detected.<h4>Conclusions</h4>hsa_circ_0001947/hsa-miR-637/RRM2 and hsa_circ_0072305/hsa-miR-127-5p/DTL networks were constructed, and identified molecules may be involved in the occurrence and development of NSCLC.
Also flagged:PathogenesisProstate CancerGene Expressionmale cancerPCaProstate Adenocarcinoma
Journal Article2020-06-01No SnippetsLiu S, Wang W, Zhao Y, Liang K, Huang Y.
Show Full Abstract
<b>Background:</b> Prostate cancer (PCa)is a malignancy of the urinary system with a high incidence, which is the second most common male cancer in the world. There are still huge challenges in the treatment of prostate cancer. It is urgent to screen out potential key biomarkers for the pathogenesis and prognosis of PCa. <b>Methods:</b> Multiple gene differential expression profile datasets of PCa tissues and normal prostate tissues were integrated analysis by R software. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of the overlapping Differentially Expressed Genes (DEG) were performed. The STRING online database was used in conjunction with Cytospace software for protein-protein interaction (PPI) network analysis to define hub genes. The relative mRNA expression of hub genes was detected in Gene Expression Profiling Interactive Analysis (GEPIA) database. A prognostic gene signature was identified by Univariate and multivariate Cox regression analysis. <b>Results:</b> Three hundred twelve up-regulated genes and 85 down-regulated genes were identified from three gene expression profiles (GSE69223, GSE3325, GSE55945) and The Cancer Genome Atlas Prostate Adenocarcinoma (TCGA-PRAD) dataset. Seven hub genes (FGF2, FLNA, FLNC, VCL, CAV1, ACTC1, and MYLK) further were detected, which related to the pathogenesis of PCa. Seven prognostic genes (BCO1, BAIAP2L2, C7, AP000844.2, ASB9, MKI67P1, and TMEM272) were screened to construct a prognostic gene signature, which shows good predictive power for survival by the ROC curve analysis. <b>Conclusions:</b> We identified a robust set of new potential key genes in PCa, which would provide reliable biomarkers for early diagnosis and prognosis and would promote molecular targeting therapy for PCa.
In recent years, the nuclear pore complex (NPC) has emerged as a key player in genome regulation and cellular homeostasis. New discoveries have revealed that the NPC has multiple cellular functions besides mediating the molecular exchange between the nucleus and the cytoplasm. In this review, we discuss non-transport aspects of the NPC focusing on the NPC-genome interaction, the extreme longevity of the NPC proteins, and NPC dysfunction in age-related diseases. The examples summarized herein demonstrate that the NPC, which first evolved to enable the biochemical communication between the nucleus and the cytoplasm, now doubles as the gatekeeper of cellular identity and aging.
Also flagged:Glucocorticoidglucocorticoidscorticosteroidprothrombinascitesliver failure
Journal Article2020-06-01✓ 1 SnippetGao R, Li Y, Cao Y, Zheng R, Tang L, Yang J, Lu X.
In-Text Gene Mentions
Methods)
…sclerosis, liver degeneration,hemochromatosis, or other non-severe…
Show Full Abstract
<h4>Objective</h4>This meta-analysis aimed to assess the efficacy and safety of glucocorticoid versus traditional therapy for hepatitis B virus (HBV)-related acute-on-chronic liver failure (ACLF).<h4>Methods</h4>PubMed, Cochrane Central Register of Clinical Trials, and EMBASE were searched. All clinical studies, including randomized controlled studies and cohort studies, comparing glucocorticoids with traditional treatments (until November 1, 2018), were included.<h4>Results</h4>A total of 3 randomized controlled trials and 5 cohort studies (including 3 retrospective cohort studies), involving 538 patients, were subjected to the meta-analysis. The total bilirubin levels before treatment were not significantly different (odds ratio [OR]: -0.97; 95% confidence interval [CI]: -2.56 to 0.62; P = .23), and, however, they were significantly reduced after treatment in the corticosteroid group compared with the traditional treatment group (OR: -8.83; 95% CI: -14.99 to 2.67; P = .005). Moreover, prothrombin time was significantly long before treatment in either group, with no significant differences (OR: 0.28; 95% CI: -0.79 to 1.34; P = 0.61). However, after treatment, prothrombin time was significantly shortened in the traditional treatment group (OR: 31.71; 95% CI: 3.62-59.81; P = .03). Furthermore, inpatient mortality (OR: 0.23; 95% CI: 0.08-0.67; P = .007) and ascites events (OR: 0.35; 95% CI: 0.18-0.67; P = .90) were significantly lower in the corticosteroid treatment group.<h4>Conclusions</h4>Glucocorticoid is more effective for reducing the T-bili level, significantly decreasing in-hospital mortality and ascites events in HBV-related ACLF patients. Moreover, bilirubin may play a pivotal role in the early stage of HBV-related ACLF progression to advanced liver failure.
Also flagged:ARSataxiaepilepsyepileptic encephalopathygeneralized tonic-clonic seizurehearing
Journal Article2020-06-01✓ 3 SnippetsWu TH, Peng J, Zhang CL, Wu LW, Yang LF, Peng P, Pang N, Yin F, He F.
In-Text Gene Mentions
Abstract)
…Mutations were found in five genes: 3 had novel mutations in the AARS2 gene (c.331G>C, c.2682+5G>A, c.2164C>T, and c.761G>A), 2 had known mutations in the DARS2 gene (c.228-16C>A and c.536G>A), 1 had novel mutations in the CARS2 gene (c.1036C>T and c.323T>G), 1 had novel mutations in the RARS2 gene (c.1210A>G and c.622C>T), and 3 had novel mutations in the AARS gene (c.1901T>A, c.229C>T, c.244C>T, c.961G>C, c.2248C>T, and Chr16:70298860-70316687del).<h4>Conclusions</h4>A high heterogeneity is observed in the clinical phenotypes of the diseases associated with the ARS deficiency.…
<h4>Objective</h4>To study the clinical features of the diseases associated with aminoacyl-tRNA synthetases (ARS) deficiency.<h4>Methods</h4>A retrospective analysis was performed of the clinical and gene mutation data of 10 children who were diagnosed with ARS gene mutations, based on next-generation sequencing from January 2016 to October 2019.<h4>Results</h4>The age of onset ranged from 0 to 9 years among the 10 children. Convulsion was the most common initial symptom (7 children). Clinical manifestations included ataxia and normal or mildly retarded intellectual development (with or without epilepsy; n=4) and onset of epilepsy in childhood with developmental regression later (n=2). Some children experienced disease onset in the neonatal period and had severe epileptic encephalopathy, with myoclonus, generalized tonic-clonic seizure, and convulsive seizure (n=4); 3 had severe delayed development, 2 had feeding difficulty, and 1 had hearing impairment. Mutations were found in five genes: 3 had novel mutations in the AARS2 gene (c.331G>C, c.2682+5G>A, c.2164C>T, and c.761G>A), 2 had known mutations in the DARS2 gene (c.228-16C>A and c.536G>A), 1 had novel mutations in the CARS2 gene (c.1036C>T and c.323T>G), 1 had novel mutations in the RARS2 gene (c.1210A>G and c.622C>T), and 3 had novel mutations in the AARS gene (c.1901T>A, c.229C>T, c.244C>T, c.961G>C, c.2248C>T, and Chr16:70298860-70316687del).<h4>Conclusions</h4>A high heterogeneity is observed in the clinical phenotypes of the diseases associated with the ARS deficiency. A total of 14 novel mutations in 5 genes are reported in this study, which enriches the clinical phenotypes and genotypes of the diseases associated with ARS deficiency.
Lineage tracing aims to identify the progeny of a defined population of dividing progenitor cells, a daunting task in the developing central nervous system where thousands of cell types are generated. In mice, lineage analysis has been accomplished using Cre recombinase to indelibly label a defined progenitor population and its progeny. However, the interpretation of historical recombination events is hampered by the fact that driver genes are often expressed in both progenitors and postmitotic cells. Genetically inducible approaches provide temporal specificity but are afflicted by mosaicism and toxicity. Here, we present PRISM, a progenitor-restricted intersectional fate mapping approach in which Flp recombinase expression is both dependent on Cre and restricted to neural progenitors, thus circumventing the aforementioned confounds. This tool can be used in conjunction with existing Cre lines making it broadly applicable. We applied PRISM to resolve two developmentally important, but contentious, lineages-Shh and Cux2.
…Another hub protein—PRDX6, an antioxidant enzyme—is…
Show Full Abstract
Data-driven analyses are increasingly valued in modern medicine. We integrate quantitative proteomics and transcriptomics from over 1,000 post-mortem brains from six cohorts representing Alzheimer's disease (AD), asymptomatic AD, progressive supranuclear palsy (PSP), and control patients from the Accelerating Medicines Partnership - Alzheimer's Disease consortium. We define robust co-expression trajectories related to disease progression, including early neuronal, microglial, astrocyte, and immune response modules, and later mRNA splicing and mitochondrial modules. The majority of, but not all, modules are conserved at the transcriptomic level, including module C3, which is only observed in proteome networks and enriched in mitogen-activated protein kinase (MAPK) signaling. Genetic risk enriches in modules changing early in disease and indicates that AD and PSP have distinct causal biological drivers at the pathway level, despite aspects of similar pathology, including synaptic loss and glial inflammatory changes. The conserved, high-confidence proteomic changes enriched in genetic risk represent targets for drug discovery.
Also flagged:axonsaxontolloidTGFβbmp4metalloproteinase
Journal Article2020-06-01✓ 2 SnippetsScimone ML, Atabay KD, Fincher CT, Bonneau AR, Li DJ, Reddien PW.
In-Text Gene Mentions
Text
…DCC…
Text
…DCC receptor…
Show Full Abstract
Neuronal circuits damaged or lost after injury can be regenerated in some adult organisms, but the mechanisms enabling this process are largely unknown. We used the planarian <i>Schmidtea mediterranea</i> to study visual system regeneration after injury. We identify a rare population of muscle cells tightly associated with photoreceptor axons at stereotyped positions in both uninjured and regenerating animals. Together with a neuronal population, these cells promote de novo assembly of the visual system in diverse injury and eye transplantation contexts. These muscle guidepost-like cells are specified independently of eyes, and their position is defined by an extrinsic array of positional information cues. These findings provide a mechanism, involving adult formation of guidepost-like cells typically observed in embryos, for axon pattern restoration in regeneration.
Also flagged:Ironacute respiratory distress syndromeARDSacute lung injuryinflammatory responseHepcidin
Journal Article2020-06-01✓ 3 SnippetsZhang V, Ganz T, Nemeth E, Kim A.
In-Text Gene Mentions
Discussion)
…compared WT toHfe‐/‐ mice, a model…
Discussion)
…bronchoalveolar space inHfe‐/‐ mice with no…
Discussion)
…Hfe‐/‐ mice also had…
Show Full Abstract
Recent studies have demonstrated a strong link between acute respiratory distress syndrome (ARDS) and the levels of iron and iron-related proteins in the lungs. However, the role of iron overload in ARDS development has yet to be characterized. In this study, we compared the highly iron-overloaded hepcidin knockout mice (HKO) to their iron-sufficient wild-type (WT) littermates in a model of sterile acute lung injury (ALI) induced by treatment with oropharyngeal (OP) LPS. There were no major differences in systemic inflammatory response or airway neutrophil infiltration between the two groups at the time of maximal injury (days 2 and 3) or during the recovery phase (day 7). Hepcidin knockout mice had transiently increased bronchoalveolar lavage fluid (BALF) protein and MPO activity in the lung and BALF on day 3, indicating worse vascular leakage and increased neutrophil activity, respectively. The increased ALI severity in iron-overloaded mice may be a result of increased apoptosis of lung tissue, as evidenced by an increase in cleaved capsase-3 protein in lung homogenates from HKO mice versus WT mice on day 3. Altogether, our data suggest that even severe iron overload has a relatively minor and transient effect in LPS-induced ALI.
Also flagged:hemeproteolysistranscriptional repressorBach1gene expressiontransposase
Journal Article2020-06-01✓ 1 SnippetLiao R, Zheng Y, Liu X, Zhang Y, Seim G, Tanimura N, Wilson GM, Hematti P, Coon JJ, Fan J, Xu J, Keles S, Bresnick EH.
In-Text Gene Mentions
Text
…Prdx6…
Show Full Abstract
Protein ensembles control genome function by establishing, maintaining, and deconstructing cell-type-specific chromosomal landscapes. A plethora of small molecules orchestrate cellular functions and therefore may link physiological processes with genome biology. The metabolic enzyme and hemoglobin cofactor heme induces proteolysis of a transcriptional repressor, Bach1, and regulates gene expression post-transcriptionally. However, whether heme controls genome function broadly or through prescriptive actions is unclear. Using assay for transposase-accessible chromatin sequencing (ATAC-seq), we establish a heme-dependent chromatin atlas in wild-type and mutant erythroblasts lacking enhancers that confer normal heme synthesis. Amalgamating chromatin landscapes and transcriptomes in cells with sub-physiological heme and post-heme rescue reveals parallel Bach1-dependent and Bach1-independent mechanisms that target heme-sensing chromosomal hotspots. The hotspots harbor a DNA motif demarcating heme-regulated chromatin and genes encoding proteins not known to be heme regulated, including metabolic enzymes. The heme-omics analysis establishes how an essential biochemical cofactor controls genome function and cellular physiology.
ATRX gene mutations have been identified in syndromic and non-syndromic intellectual disabilities in humans. ATRX is known to maintain genomic stability in neuroprogenitor cells, but its function in differentiated neurons and memory processes remains largely unresolved. Here, we show that the deletion of neuronal Atrx in mice leads to distinct hippocampal structural defects, fewer presynaptic vesicles, and an enlarged postsynaptic area at CA1 apical dendrite-axon junctions. We identify male-specific impairments in long-term contextual memory and in synaptic gene expression, linked to altered miR-137 levels. We show that ATRX directly binds to the miR-137 locus and that the enrichment of the suppressive histone mark H3K27me3 is significantly reduced upon the loss of ATRX. We conclude that the ablation of ATRX in excitatory forebrain neurons leads to sexually dimorphic effects on miR-137 expression and on spatial memory, identifying a potential therapeutic target for neurological defects caused by ATRX dysfunction.
Also flagged:chronic obstructive pulmonary diseaseCOPDdiabeteshypertensioncerebral strokeosteoporosis
Journal Article2020-06-01✓ 1 SnippetLee E, Park B, Chung WY, Park JE, Hwang SC, Park KJ, Sheen SS, Ahn SV, Park JB, Ahn CM, Lee SH, Kim JY, Chun EM, Park YS, Yoo KH, Yoon HK, Park JH, Korean Smoking Cessation Study Group.
In-Text Gene Mentions
Discussion)
…receptor gene, andhemochromatosisgene can make…
Show Full Abstract
<h4>Background</h4>Lead exposure is a resurgent environmental issue globally. Smoking can be a source of lead exposure, although the majority of lead poisonings originate from workplace exposures. However, no study has been undertaken concerning the blood lead levels based on the chronic obstructive pulmonary disease (COPD), smoking status, and other risk factors of COPD. This cross-sectional study was conducted to investigate the blood lead levels according to COPD and clinical variables associated with COPD.<h4>Methods</h4>Data (total number =53,829) were collected from the Korean National Health and Nutrition Examination Survey (IV in 2008 and 2009, V in 2010-2012, and VI in 2013). Multivariable linear regression analyses were performed to determine variables associated with elevated blood lead levels.<h4>Results</h4>Univariate regression analysis showed that male sex, older age, smoking, occupation level, income level, education level, and presence of COPD were related to higher blood lead levels, whereas the other co-morbidities including diabetes, hypertension, cerebral stroke, osteoporosis, asthma, and depression were not related (P<0.05). Multivariable regression analysis demonstrated that older age, male sex, smoking, occupation, and education level were independently associated with higher blood lead levels (P<0.05).<h4>Conclusions</h4>Smoking status, occupation, and education level along with old age and male sex were independently associated with higher blood lead levels; however, COPD was not after adjustment of all confounding factors.
Also flagged:gastric cancertranscription factorbindingmalignant tumorlung cancerliver cancer
Journal Article2020-06-01✓ 2 SnippetsGao Y, Wang JW, Ren JY, Guo M, Guo CW, Ning SW, Yu S.
In-Text Gene Mentions
S I O 001029)
…The expression of HULC and ZNFX1-AS1 is higher in the peripheral blood of GC patients because they can be released into circulation via exosomes[66].…
S I O 001029)
…Xian et al[66] suggested that the expression of the lncRNAs ZNFX1-AS1 and HULC are differential in the plasma of GC patients compared with healthy control samples.…
Show Full Abstract
Long noncoding RNAs (lncRNAs) are important regulators of cell processes that are usually dysregulated in gastric cancer (GC). Based on their high specificity and ease of detection in tissues and body fluids, increasing attention has spurred the study of the roles of lncRNAs in GC patients. Thus, it is necessary to elucidate the molecular mechanisms and further explore the clinical applications of lncRNAs in GC. In this review, we summarize current knowledge to examine dysregulated lncRNAs in GC and their underlying molecular mechanisms and activities in GC, which involve microRNA sponging, mRNA stability, genetic variants, alternative splicing, transcription factor binding, and epigenetic modification. More significantly, the potential of lncRNAs as prognostic, circulating, and drug-resistant biomarkers for GC is also described. This review highlights the method of dissecting molecular mechanisms to explore the clinical application of lncRNAs in GC. Overall, this review offers assistance in using lncRNAs as novel candidates for molecular mechanisms and for the identification of revolutionary biomarkers for GC.
Also flagged:Fc gamma receptorphagocytosisnon-small cell lung cancerinnate immunityNSCLCCancer
Journal Article2020-06-01✓ 1 SnippetQian D, Liu H, Zhao L, Wang X, Luo S, Moorman PG, Patz EF, Su L, Shen S, Christiani DC, Wei Q.
In-Text Gene Mentions
Acknowledgments)
…CA074386, CA090578) toDCC.…
Show Full Abstract
<h4>Background</h4>Both antibody-dependent cellular cytotoxicity and phagocytosis activate innate immunity, and the Fc gamma receptor (FCGR)-mediated phagocytosis is an integral part of the process. We assessed associations between single-nucleotide polymorphisms (SNPs) in FCGR-related genes and survival of patients with non-small cell lung cancer (NSCLC).<h4>Methods</h4>We evaluated associations between 24,734 (SNPs) in 97 FCGR-related genes and survival of 1,185 patients with NSCLC using a published genome-wide association study (GWAS) dataset from the Prostate, Lung, Colorectal and Ovarian (PLCO) Cancer Screening Trial and validated the results in another independent dataset of 894 NSCLC patients.<h4>Results</h4>In the single-locus analysis with Bayesian false discovery probability (BFDP) for multiple testing correction, we found 1,084 SNPs to be significantly associated overall survival (OS) (P<0.050 and BFDP ≤0.80), of which two independent SNPs (<i>PLCG2</i> rs9673682 T>G and <i>PLPP1</i> rs115613985 T>A) were further validated in another GWAS dataset of 894 patients from the Harvard Lung Cancer Susceptibility (HLCS) Study, with combined allelic hazards ratios for OS of 0.87 [95% confidence interval (CI): 0.81-0.94 and P=5.90×10<sup>-4</sup>] and 1.18 (95% CI: 1.08-1.29 and 1.32×10<sup>-4</sup>, respectively). Expression quantitative trait loci analysis showed that the rs9673682 G allele was significantly correlated with increased mRNA expression levels of <i>PLCG2</i> in 373 transformed lymphoblastoid cell-lines (P=7.20×10<sup>-5</sup>). Additional evidence from differential expression analysis further supported a tumor-suppressive effect of <i>PLCG2</i> on OS of patients with lung cancer, with lower mRNA expression levels in both lung squamous carcinoma and adenocarcinoma than in adjacent normal tissues.<h4>Conclusions</h4>Genetic variants in <i>PLCG2</i> of the FCGR-mediated phagocytosis pathway may be promising predictors of NSCLC survival, possibly through modulating gene expression, but additional investigation of the molecular mechanisms of <i>PLPP1</i> rs115613985 is warranted.
Also flagged:primary tumortumornucleotidelung squamous cell carcinomaPTlymph node
Journal Article2020-06-01No SnippetsPeng Y, Yuan C, Tao X, Zhao Y, Yao X, Zhuge L, Huang J, Zheng Q, Zhang Y, Hong H, Chen H, Sun Y.
Show Full Abstract
<h4>Background</h4>Intratumoral heterogeneity is a crucial factor to the outcome of patients and resistance to therapies, in which structural variants play an indispensable but undiscovered role.<h4>Methods</h4>We performed an integrated analysis of optical mapping and whole-genome sequencing on a primary tumor (PT) and matched metastases including lymph node metastasis (LNM) and tumor thrombus in the pulmonary vein (TPV). Single nucleotide variants, indels and structural variants were analyzed to reveal intratumoral genetic heterogeneity among tumor cells in different sites.<h4>Results</h4>Our results demonstrated there were less nonsynonymous somatic variants shared with PT in LNM than in TPV, while there were more structural variants shared with PT in LNM than in TPV. More private variants and its affected genes associated with tumorigenesis and progression were identified in TPV than in LNM. It should be noticed that optical mapping detected an average of 77.1% (74.5-78.5%) large structural variants (>5,000 bp) not detected by whole-genome sequencing and identified several structural variants private to metastases.<h4>Conclusions</h4>Our study does demonstrate structural variants, especially large structural variants play a crucial role in intratumoral genetic heterogeneity and optical mapping could make up for the deficiency of whole-genome sequencing to identify structural variants.
Also flagged:5-hydroxytryptamine transporterejaculationpremature ejaculationPEsexual disfunctionprotein
Journal Article2020-06-01✓ 5 SnippetsZhou K, Song Y, Lu Y, Yang Y, Wang X, Liu K, Liu X.
In-Text Gene Mentions
Introduction)
…The function of 5-HTT is to promote reabsorbing serotonin from the synapse.…
Introduction)
…ydroxytryptamine transporter (5-HTT).…
Introduction)
…The function of5-HTTis to promote…
Introduction)
…one of the5-HTTgene, which has…
Introduction)
…the function of5-HTT( 12 ).…
Show Full Abstract
The relationship between 5-hydroxytryptamine transporter-linked promoter region (5-HTTLPR) gene and lifelong premature ejaculation (LPE) risk was discussed widely for the last few years, which was still controversial and remained to be explored. We performed the meta-analysis with 8 reliable research, which were searched in the following databases: PubMed, Embase and Cochrane Library. We also performed random and fixed effects models to evaluate the odds ratios (ORs) and 95% confidence intervals respectively. By pooling all included studies, we found that SS genotype of 5-HTTLPR polymorphism was linked with significantly higher PE risk in Caucasian population (OR =0.635, 95% CI: 0.417-0.958, I<sup>2</sup>=0.311, P=0.035), and S-allele of 5-HTTLPR polymorphism increased the risk of LPE significantly in Asian population (OR =0.656, 95% CI: 0.539-0.799, I<sup>2</sup>=0.435, P<0.001). However, no significant was observed between 5-HTTLPR gene polymorphism and LPE risk in overall studies. Further studies were anticipated to be done.
Also flagged:dyslipidemiamethylationgene expressioncholesterollipoproteintriglycerides
Journal Article2020-06-01✓ 1 SnippetOuidir M, Zeng X, Workalemahu T, Shrestha D, Grantz KL, Mendola P, Zhang C, Tekola-Ayele F.
In-Text Gene Mentions
Text
…ECI2…
Show Full Abstract
<b>Aim:</b> To identify placental DNA methylation changes that are associated with early pregnancy maternal dyslipidemia. <b>Materials & methods:</b> We analyzed placental genome-wide DNA methylation (n = 262). Genes annotating differentially methylated CpGs were evaluated for gene expression in placenta (n = 64). <b>Results:</b> We found 11 novel significant differentially methylated CpGs associated with high total cholesterol, low-density lipoprotein cholesterol and triglycerides, and low high-density lipoprotein cholesterol. High triglycerides were associated with decreased methylation of cg02785814 (<i>ALX4</i>) and decreased expression of <i>ALX4</i> in placenta. Genes annotating the differentially methylated CpGs play key roles in lipid metabolism and were enriched in dyslipidemia pathways. Functional annotation found <i>cis</i>-methylation quantitative trait loci for genetic loci in <i>ALX4</i> and <i>EXT2</i>. <b>Conclusion:</b> Our findings lend novel insights into potential placental epigenetic mechanisms linked with maternal dyslipidemia. <b>Trial Registration:</b> ClinicalTrials.gov, NCT00912132.
<h4>Background</h4>The prevalence of nonalcoholic fatty liver disease (NAFLD) is significantly rising worldwide. Type-2 diabetes (T2D) is a major risk factor for NAFLD progression.<h4>Aim</h4>To assess the association of commonly used medications to advanced fibrosis (AF) in patients with biopsy-proven NAFLD and T2D.<h4>Methods</h4>We used the International Classification of Disease 9<sup>th</sup> Revision Clinical Modification coding system to identify patients with T2D and included patients who underwent liver biopsy for suspected NAFLD between January 1, 2000 to December 31, 2015. We compared demographics, clinical characteristics, and differences in pattern of medication use in patients who had biopsy-proven AF to those without it. A univariate and multivariate analysis was performed to assess the association of different classes of medication with the presence of AF.<h4>Results</h4>A total of 1183 patients were included in the final analysis, out of which 32% (<i>n</i> = 381) had AF on liver biopsy. Mean age of entire cohort was 52 years and majority were females (65%) and Caucasians (85%). Among patients with AF, 51% were on oral hypoglycemics, 30% were on insulin, 66% were on antihypertensives and 27% were on lipid lowering agents for the median duration of 19 mo, 10 mo, 26 mo, and 24 mo respectively. Medications associated with decreased risk of AF included metformin, liraglutide, lisinopril, hydrochlorothiazide, atorvastatin and simvastatin while the use of furosemide and spironolactone were associated with higher prevalence of AF.<h4>Conclusion</h4>In our cohort of T2D with biopsy proven NAFLD, the patients who were receiving metformin, liraglutide, lisinopril, hydrochlorothiazide, atorvastatin and simvastatin were less likely to have AF on biopsy, while patients who were receiving furosemide and spironolactone had a higher likelihood of having AF when they underwent liver biopsy. Future studies are needed to confirm these findings and to establish measures for prevention of NAFLD progression in patients with T2D.
Also flagged:Synthesisinflammatory bowel diseaseulcerative colitisesterpolyethylene glycoldimethylaniline
Journal Article2020-06-01No SnippetsSadeghi F, Eidizade A, Saremnejad F, Hadizadeh F, Khodaverdi E, Akhgari A.
Show Full Abstract
<h4>Objectives</h4>4-aminosalicylic acid (4-ASA) is an isomer of mesalazine that has recently been shown to be effective against inflammatory bowel disease (IBD), and more specifically, ulcerative colitis. However, the majority of orally administered 4-ASA is readily and extensively absorbed from the stomach and small intestine, so only a small amount is transported to the colon. A mutual ester and azo prodrug of 4-ASA was synthesized with polyethylene glycol (PEG) and dimethylaniline, respectively , to overcome this issue.<h4>Materials and methods</h4>The 4-ASA prodrug was synthesized via a two-step process and then characterized by 1H-NMR. The stability of the prodrug was evaluated in simulated gastric fluid (pH 1.2). Furthermore, the <i>in vitro</i> release profiles of the drug conjugate was evaluated at pH 1.2, as well as pH 6.8 in the absence or presence of rat cecal content.<h4>Results</h4>The prepared prodrug was stable at pH 1.2, indicating that it could be protected from the acidic environment of the stomach. Also, the results of drug release at pH 6.8 showed that the amount of 4-ASA released was 63% within 12 hr in the absence of rat cecal content, while in the presence of rat cecal content, 97% of 4-ASA was released from the prodrug in 6 hr.<h4>Conclusion</h4>Overall, the synthesized PEGylated azo-based 4-ASA prodrug could be a potential candidate for targeted drug delivery to the inflamed gut tissue in IBD.
Also flagged:mitochondrialphosphorylationmitochondriadendritesneurodegenerative diseasessynaptic transmission
Journal Article2020-06-01No SnippetsSeager R, Lee L, Henley JM, Wilkinson KA.
Show Full Abstract
Neurons are highly polarised, complex and incredibly energy intensive cells, and their demand for ATP during neuronal transmission is primarily met by oxidative phosphorylation by mitochondria. Thus, maintaining the health and efficient function of mitochondria is vital for neuronal integrity, viability and synaptic activity. Mitochondria do not exist in isolation, but constantly undergo cycles of fusion and fission, and are actively transported around the neuron to sites of high energy demand. Intriguingly, axonal and dendritic mitochondria exhibit different morphologies. In axons mitochondria are small and sparse whereas in dendrites they are larger and more densely packed. The transport mechanisms and mitochondrial dynamics that underlie these differences, and their functional implications, have been the focus of concerted investigation. Moreover, it is now clear that deficiencies in mitochondrial dynamics can be a primary factor in many neurodegenerative diseases. Here, we review the role that mitochondrial dynamics play in neuronal function, how these processes support synaptic transmission and how mitochondrial dysfunction is implicated in neurodegenerative disease.
Cardiac amyloidosis is a heterogeneous and challenging diagnostic disease with poor prognosis that is now being altered by introduction of new therapies. Echocardiography remains the first-line imaging tool, and when disease is suspected on echocardiography, cardiac magnetic resonance imaging and nuclear imaging play critical roles in the non-invasive diagnosis and evaluation of cardiac amyloidosis. Advances in multi-modality cardiac imaging allowing earlier diagnosis and initiation of novel therapies have significantly improved the outcomes in these patients. Cardiac imaging also plays important roles in the risk stratification of patients presenting with cardiac amyloidosis. In the current review, we provide a clinical and imaging focused update, and importantly outline the imaging protocols, diagnostic and prognostic utility of multimodality cardiac imaging in the assessment of cardiac amyloidosis.
Also flagged:Budd-Chiari syndromeparoxysmal nocturnal hemoglobinuriaParoxysmal nocturnal haemoglobinuriablood disorderphosphatidylinositolglycan
Journal Article2020-06-01✓ 1 SnippetGioia S, De Santis E, Cerbelli B, Nardelli S, Ridola L, De Santis A, d'Amati G, Riggio O.
In-Text Gene Mentions
Introduction)
…drugs, viral, autoimmune,hemochromatosis, Wilson disease, NASH/NAFLD)…
Show Full Abstract
Small hepatic veins Budd-Chiari syndrome is a rare disorder characterized by hepatic venous outflow obstruction limited to the small intrahepatic veins, with normal appearance of the large hepatic veins at imaging. In this case only a liver biopsy can demonstrate the presence of a small vessels outflow block. Paroxysmal nocturnal haemoglobinuria (PNH) is one of the most severe acquired thrombophilic state and represents one of the main aetiological factors of Budd-Chiari syndrome. In patient affected by PNH with liver impairment and/or ascites, Budd-Chiari syndrome must be always taken into consideration and, if necessary, a liver biopsy performed to exclude the small hepatic veins involvement. We report a case of small hepatic veins Budd-Chiari syndrome secondary to paroxysmal nocturnal haemoglobinuria.
The allocation of resources to the production of one sex or another has been observed in a large variety of animals. Its theoretical basis allows accurate predictions of offspring sex ratios in many species, but the mechanisms by which sex allocation is controlled are poorly understood. Using previously published data, we investigated whether alternative splicing, combined with differential gene expression, was involved with sex allocation in the parasitoid wasp, <i>Nasonia vitripennis</i>. We found that sex allocation is not controlled by alternative splicing but changes in gene and transcript-specific expression, which were identified to be involved with oviposition, were shown to be similar to those involved in sperm motility and capacitation. Genes involved in cholesterol efflux, a key component of capacitation, along with calcium transport, neurotransmission, trypsin, and MAPKinase activity were regulated in ovipositing wasps. The results show evidence for regulation of sperm motility and of capacitation in an insect which, in the context of the physiology of the <i>N. vitripennis</i> spermatheca, could be important for sex allocation.
Also flagged:PathogenesisPsoriasisgene expressionHLA-Cinnate immunityhistone
Journal Article2020-06-01No SnippetsNedoszytko B, Szczerkowska-Dobosz A, Stawczyk-Macieja M, Owczarczyk-Saczonek A, Reich A, Bartosiñska J, Batycka-Baran A, Czajkowski R, Dobrucki IT, Dobrucki LW, Górecka-Sokołowska M, Janaszak-Jasiecka A, Kalinowski L, Krasowska D, Purzycka-Bohdan D, Radulska A, Reszka E, Samotij D, Sobalska-Kwapis M, Słominski A, Słominski R, Strapagiel D, Szczêch J, Żmijewski M, Nowicki RJ.
Show Full Abstract
Psoriasis is a multifactorial disease in which genetic, environmental and epigenetic factors regulating gene expression play a key role. In the "genomic era", genome-wide association studies together with target genotyping platforms performed in different ethnic populations have found more than 50 genetic susceptible markers associated with the risk of psoriasis which have been identified so far. Up till now, the strongest association with the risk of the disease has been proved for HLA-C*06 gene. The majority of other psoriasis risk SNPs are situated near the genes encoding molecules involved in adaptive and innate immunity, and skin barrier function. Many contemporary studies indicate that the epigenetic changes: histone modification, promoter methylations, long non-coding and micro-RNA hyperexpression are considered as factors contributing to psoriasis pathogenesis as they regulate abnormal keratinocyte differentiation and proliferation, aberrant keratinocytes - inflammatory cells communication, neoangiogenesis and chronic inflammation. The circulating miRNAs detected in the blood may become specific markers in the diagnosis, prognosis and response to the treatment of the disease. The inhibition of expression in selected miRNAs may be a new promising therapy option for patients with psoriasis.
Also flagged:bisphenol Acell migrationmatrix metalloproteinasesMMPstissue inhibitors of MMPsTIMPs
Journal Article2020-06-01✓ 2 SnippetsWei P, Ru D, Li X, Shi D, Zhang M, Xu Q, Zhou H, Wen S.
In-Text Gene Mentions
Results)
…nucleotide-exchange factor 2 (ARFGEF2), and kinesin family…
Discussion)
…affecting ANKRD13A, PDGFRB,ARFGEF2, and KIF16B protein…
Show Full Abstract
Environmental pollutants, such as bisphenol A (BPA) have recently been implicated in the development of adverse birth outcomes. However, the underlying teratogenic mechanisms remain unclear. We investigated the effects of BPA on the migration and invasion of human primary extravillous trophoblast HTR-8/SVneo cells. Our results indicated that BPA reduced cell migration and invasion. Moreover, it altered the ratio of matrix metalloproteinases (MMPs) and tissue inhibitors of MMPs (TIMPs) by downregulating MMP-2 and MMP-9, and upregulating TIMP-1 and TIMP-2. Furthermore, BPA suppressed integrin β1, integrin α5, and vimentin. Interestingly, BPA-induced invasion was partially restored by G15, a membrane G-protein-coupled estrogen receptor 30 antagonist. We further revealed that 42 proteins were differentially expressed by mass spectrometry analysis, which could be divided into three categories based on gene ontology including biological process, cellular component, and molecular function. These results suggest that BPA reduces HTR-8/SVneo cell migration and invasion by downregulating MMP-2 and MMP-9, up-regulating TIMP-1 and TIMP-2, and suppressing adhesion molecules.
Also flagged:cognitionagingchronic diseasesParkinson'sAlzheimer'sneuroendocrine disorders
Journal Article2020-06-01✓ 1 SnippetDias IR, Santos CS, Magalhães CODE, de Oliveira LRS, Peixoto MFD, De Sousa RAL, Cassilhas RC.
In-Text Gene Mentions
Results)
…Jin et al. demonstrated that metformin, a drug that mimics the various metabolic effects of CR, prevented cell toxicity induced by mutant huntingtin (HTT), activated AMPK, prevented depolarization of the mitochondrial membrane and excess fission in the cells in HD model of mice (Jin et al., 2016).…
Show Full Abstract
Calorie restriction (CR) has been considered the most effective non-pharmacological intervention to counteract aging-related diseases and improve longevity. This intervention has shown beneficial effects in the prevention and treatment of several chronic diseases and functional declines related to aging, such as Parkinson's, Alzheimer's, and neuroendocrine disorders. However, the effects of CR on cognition show controversial results since its effects vary according to intensity, duration, and the period of CR. This review focuses on the main studies published in the last ten years regarding the consequences of CR on cognition in different neurological diseases and conditions of experimental animals. Also, possible CR mimetics are discussed. These findings highlight the potential beneficial effects of CR of up to 40 % on cognition when started early in life in non human animals.
Also flagged:reward deficiencyironmetabolismReward Deficiency Syndromeinflammatory responsesiron-deficiency anemia
Journal Article2020-06-01✓ 2 SnippetsBlum K, Downs BW, Bagchi M, Kushner S, Morrison BS, Galvin J, Randsdorp K, Randsdorp J, Badgaiyan RD, Braverman ER, Bagchi D.
In-Text Gene Mentions
Introduction)
…blood known ashemochromatosis, or ‘iron overload…
Discussion)
…can lead tohemochromatosis, also known as…
Show Full Abstract
<h4>Background</h4>A common neurological condition worldwide is Reward Deficiency Syndrome (RDS) leading to both substance and non-substance addictive behaviors, that must be combatted by integrating both central nervous system and peripheral nervous system biological approaches. Integrity of hemoglobin is a crucial determining factor for the overall health functions. Nutrient repletion therapy should be a fundamental strategy to restore the healthy properties of blood. A unique patent-pending iron-free VMP35 formulation was engineered by our laboratory to restore iron-dependent hemoglobin in anemic cells using a proprietary Prodosome<sup>®</sup> absorption technology. This formulation, containing an array of nano-emulsified botanical ingredients rich in bioflavonoids, strengthens the structural integrity of connective tissues, and potentiates immune competence, cellular aerobic metabolism, and enhances efficient regulation of inflammatory events. We discuss the intricate aspects of strong vs. fragile immunity and consequential inflammatory responses to convey a deeper understanding of the varied and overly complex sequela of immunological behaviors and events. The effect of the VMP35 is mediated through highly absorbable nutritional/nutrigenomic repletion enabling improvements in the systemic set of functional behaviors. In fact, the iron-free VMP35 facilitates a "Systems Biology Approach" which restores hemoglobin status, reverses anaerobic hypoxia, improves competent immune responsivity, and regulates appropriate and controlled activation of general and neuro-inflammatory sequela. Under these pathogenic circumstances, iron-deficiency anemia has been misconceptualized, and a new nosological term, Chronic Anemia Syndrome, is proposed. The comparative therapeutic rationale of Reductionist vs. Systems Biology approaches is also explained in detail.<h4>Methods</h4>The efficacy of the novel therapeutic iron-free VMP35 liquid nutraceutical is detailed in restoring iron-dependent hemoglobin to RBCs and boosting cellular morphology, viability, and immune competence, thereby reducing the need for prolonging inflammatory sequela.<h4>Results</h4>This was demonstrated in a previous IRB approved multi-subject human study. In addition, two recent case studies report dramatic restorative benefits of nutrient repletion therapy of the VMP35 on subjects having experienced near-fatal events, which confirmed the findings explained in this manuscript.<h4>Conclusions</h4>This novel iron-free VMP35 modulates an array of homeostatic biological parameters such as enhanced hemoglobinization, aerobic metabolism, viral immuno-competence, and inflammatory regulation. Further research, examining mechanistic and beneficial effects in athletic performance, is in progress. Importantly, during these troubled immune challenging times, modulating an array of homeostatic immunological and inflammatory dysfunctions are tantamount to improved population outcomes.<h4>Trial registration</h4>The Clinical investigation in a total of 38 subjects was conducted under an Institutional Review Board (IRB) from the Path Foundation in New York, NY (#13-009 April 25, 2013). The two case studies were done at Lancaster General Hospital, Lancaster, PA, and Jefferson University Hospital, Philadelphia, PA, USA. Both studies were retrospectively registered.
bioRxiv2020-06-01Preprint (No Snippets API)Ding J, Lugo-Martinez J, Yuan Y, Huang J, Hume AJ, Suder EL, Mühlberger E, Kotton DN, Bar-Joseph Z.
Show Full Abstract
Several molecular datasets have been recently compiled to characterize the activity of SARS-CoV-2 within human cells. Here we extend computational methods to integrate several different types of sequence, functional and interaction data to reconstruct networks and pathways activated by the virus in host cells. We identify key proteins in these networks and further intersect them with genes differentially expressed at conditions that are known to impact viral activity. Several of the top ranked genes do not directly interact with virus proteins. We experimentally tested treatments for a number of the predicted targets. We show that blocking one of the predicted indirect targets significantly reduces viral loads in stem cell-derived alveolar epithelial type II cells (iAT2s). <h4>Software and interactive visualization</h4> https://github.com/phoenixding/sdremsc