Gene Literature Dashboard

Viewing September 2020 — 654 paper(s) from the local store. (Local view only — run without --view to fetch new papers.)
← August 2020 October 2020 →
Also flagged:aspartic proteasesynthesisβ‐sliding clampazidealkynesulfonylazides
Journal Article 2020-09-30 ✓ 1 Snippet Mancini F, Unver MY, Elgaher WAM, Jumde VR, Alhayek A, Lukat P, Herrmann J, Witte MD, Köck M, Blankenfeldt W, Müller R, Hirsch AKH.
In-Text Gene Mentions

…building blocks, whereasDCCassembles ligands via…

Show Full Abstract

Kinetic target-guided synthesis represents an efficient hit-identification strategy, in which the protein assembles its own inhibitors from a pool of complementary building blocks via an irreversible reaction. Herein, we pioneered an in situ Ugi reaction for the identification of novel inhibitors of a model enzyme and binders for an important drug target, namely, the aspartic protease endothiapepsin and the bacterial β-sliding clamp DnaN, respectively. Highly sensitive mass-spectrometry methods enabled monitoring of the protein-templated reaction of four complementary reaction partners, which occurred in a background-free manner for endothiapepsin or with a clear amplification of two binders in the presence of DnaN. The Ugi products we identified show low micromolar activity on endothiapepsin or moderate affinity for the β-sliding clamp. We succeeded in expanding the portfolio of chemical reactions and biological targets and demonstrated the efficiency and sensitivity of this approach, which can find application on any drug target.

Also flagged:acetylarylboronatesthiosemicarbazidearylboronatenitrogenboronate
Journal Article 2020-09-30 ✓ 1 Snippet Palvai S, Bhangu J, Akgun B, Moody CT, Hall DG, Brudno Y.
In-Text Gene Mentions

DCC

Show Full Abstract

Bioorthogonal click reactions yielding stable and irreversible adducts are in high demand for <i>in vivo</i> applications, including in biomolecular labeling, diagnostic imaging, and drug delivery. Previously, we reported a novel bioorthogonal "click" reaction based on the coupling of ortho-acetyl arylboronates and thiosemicarbazide-functionalized nopoldiol. We now report that a detailed structural analysis of the arylboronate/nopoldiol adduct by X-ray crystallography and <sup>11</sup>B NMR reveals that the bioorthogonal reactants form, unexpectedly, a tetracyclic adduct through the cyclization of the distal nitrogen into the semithiocarbazone leading to a strong B-N dative bond and two new 5-membered rings. The cyclization adduct, which protects the boronate unit against hydrolytic breakdown, sheds light on the irreversible nature of this polycondensation. The potential of this reaction to work in a live animal setting was studied through <i>in vivo</i> capture of fluorescently labeled molecules <i>in vivo</i>. Arylboronates were introduced into tissues through intradermal injection of their activated NHS esters, which react with amines in the extracellular matrix. Fluorescently labeled nopoldiol molecules were administered systemically and were efficiently captured by the arylboronic acids in a location-specific manner. Taken together, these <i>in vivo</i> proof-of-concept studies establish arylboronate/nopoldiol bioorthogonal chemistry as a candidate for wide array of applications in chemical biology and drug delivery.

Also flagged:metabolismmembraneABCC1ABCC4ABCC5ABCG2
Journal Article 2020-09-30 ✓ 1 Snippet Flegel WA, Srivastava K, Sissung TM, Goldspiel BR, Figg WD.
In-Text Gene Mentions

SERPINC1

Show Full Abstract

The PharmacoScan pharmacogenomics platform screens for variation in genes that affect drug absorption, distribution, metabolism, elimination, immune adverse reactions and targets. Among the 1,191 genes tested on the platform, 12 genes are expressed in the red cell membrane: ABCC1, ABCC4, ABCC5, ABCG2, CFTR, SLC16A1, SLC19A1, SLC29A1, ATP7A, CYP4F3, EPHX1 and FLOT1. These genes represent 5 ATP-binding cassette proteins, 3 solute carrier proteins, 1 ATP transport protein and 3 genes associated with drug metabolism and adverse drug reactions. Only ABCG2 and SLC29A1 encode blood group systems, JR and AUG, respectively. We propose red cells as an ex vivo model system to study the effect of heritable variants in genes encoding the transport proteins on the pharmacokinetics of drugs. Altered pharmacodynamics in red cells could also cause adverse reactions, such as haemolysis, hitherto unexplained by other mechanisms.

Also flagged:translationalresponse tobehavioralanxietypsychiatric disorderscortisol
Journal Article 2020-09-30 No Snippets Gellner AK, Voelter J, Schmidt U, Beins EC, Stein V, Philipsen A, Hurlemann R.
Show Full Abstract

Humans and animals live in social relationships shaped by actions of approach and avoidance. Both are crucial for normal physical and mental development, survival, and well-being. Active withdrawal from social interaction is often induced by the perception of threat or unpleasant social experience and relies on adaptive mechanisms within neuronal networks associated with social behavior. In case of confrontation with overly strong or persistent stressors and/or dispositions of the affected individual, maladaptive processes in the neuronal circuitries and its associated transmitters and modulators lead to pathological social avoidance. This review focuses on active, fear-driven social avoidance, affected circuits within the mesocorticolimbic system and associated regions and a selection of molecular modulators that promise translational potential. A comprehensive review of human research in this field is followed by a reflection on animal studies that offer a broader and often more detailed range of analytical methodologies. Finally, we take a critical look at challenges that could be addressed in future translational research on fear-driven social avoidance.

Also flagged:Mef2cGAPDHluciferasemembranetranscription factorsMyoD
Journal Article 2020-09-30 No Snippets Shi Y, Mao X, Cai M, Hu S, Lai X, Chen S, Jia X, Wang J, Lai S.
Show Full Abstract

Skeletal muscle satellite cells (SMSCs), also known as a multipotential stem cell population, play a crucial role during muscle growth and regeneration. In recent years, numerous miRNAs have been associated with the proliferation and differentiation of SMSCs in a number of mammalian species; however, the regulatory mechanisms of miR-194-5p in rabbit SMSCs still remain scarce. In this study, miR-194-5p was first observed to be highly expressed in the rabbit leg muscle. Furthermore, both the mimics and inhibitor of miR-194-5p were used to explore its role in the proliferation and differentiation of rabbit SMSCs cultured in vitro. Results from both EdU and CCK8 assays showed that miR-194-5p inhibited the proliferation of SMSCs. Meanwhile, Mef2c was identified as a target gene of miR-194-5p based on the dual-luciferase reporter assay results. In addition, upregulation of miR-194-5p decreased the expression levels of Mef2c and MyoG during rabbit SMSCs differentiation on Days 3 and 7 of in vitro culture. Taken together, these data demonstrated that miR-194-5p negatively regulates the proliferation and differentiation of rabbit SMSCs by targeting Mef2c.

Also flagged:chromatingene expressionmethylationcytosinehistoneschromatin modifications
Journal Article 2020-09-30 No Snippets Toth M.
Show Full Abstract

This review explores how different classes of drugs, including those with therapeutic and abuse potential, alter brain functions and behavior via the epigenome. Epigenetics, in its simplest interpretation, is the study of the regulation of a genes' transcriptional potential. The epigenome is established during development but is malleable throughout life by a wide variety of drugs, with both clinical utility and abuse potential. An epigenetic effect can be central to the drug's therapeutic or abuse potential, or it can be independent from the main effect but nevertheless produce beneficial or adverse side effects. Here, I discuss the various epigenetic effects of main pharmacological drug classes, including antidepressants, antiepileptics, and drugs of abuse.

Also flagged:CMIPchromosomesPlatelet activationS21pancreatic cancerTransport
Journal Article 2020-09-30 No Snippets Rivello F, Matuła K, Piruska A, Smits M, Mehra N, Huck WTS.
Show Full Abstract

Despite their important role in metastatic disease, no general method to detect circulating stromal cells (CStCs) exists. Here, we present the Metabolic Assay-Chip (MA-Chip) as a label-free, droplet-based microfluidic approach allowing single-cell extracellular pH measurement for the detection and isolation of highly metabolically active cells (hm-cells) from the tumor microenvironment. Single-cell mRNA-sequencing analysis of the hm-cells from metastatic prostate cancer patients revealed that approximately 10% were canonical EpCAM<sup>+</sup> hm-CTCs, 3% were EpCAM<sup>-</sup> hm-CTCs with up-regulation of prostate-related genes, and 87% were hm-CStCs with profiles characteristic for cancer-associated fibroblasts, mesenchymal stem cells, and endothelial cells. Kaplan-Meier analysis shows that metastatic prostate cancer patients with more than five hm-cells have a significantly poorer survival probability than those with zero to five hm-cells. Thus, prevalence of hm-cells is a prognosticator of poor outcome in prostate cancer, and a potentially predictive and therapy response biomarker for agents cotargeting stromal components and preventing epithelial-to-mesenchymal transition.

Also flagged:latent infectionsimmune responsesinnate immunityHSV-1 infectionsignal transductionHSV-1 infections
Journal Article 2020-09-30 No Snippets Zhu H, Zheng C.
Show Full Abstract

Herpes simplex virus 1 (HSV-1) is very successful in establishing acute and latent infections in humans by counteracting host antiviral innate immune responses. HSV-1 has evolved various strategies to evade host antiviral innate immunity and some cellular survival-associated pathways. Since there is still no vaccine available for HSV-1, a continuous update of information regarding the interaction between HSV-1 infection and the host antiviral innate immunity will provide novel insights to develop new therapeutic strategies for HSV-1 infection and its associated diseases. Here, we update recent studies about how HSV-1 evades the host antiviral innate immunity, specifically how HSV-1 proteins directly or indirectly target the adaptors in the antiviral innate immunity signaling pathways to downregulate the signal transduction. Additionally, some classical intracellular stress responses, which also play important roles in defense of viral invasion, will be discussed here. With a comprehensive review of evasion mechanisms of antiviral innate immunity by HSV-1, we will be able to develop potential new targets for therapies and a possible vaccine against HSV-1 infections.

Also flagged:phospholipidlipidfatty-acylbile acidmetabolismmitochondrial
Journal Article 2020-09-30 No Snippets Ronda OAHO, van de Heijning BJM, Martini I, Gerding A, Wolters JC, van der Veen YT, Koehorst M, Jurdzinski A, Havinga R, van der Beek EM, Kuipers F, Verkade HJ.
Show Full Abstract

We recently reported that feeding mice in their early life a diet containing a lipid structure more similar to human milk (eIMF, Nuturis) results in lower body weights and fat mass gain upon high fat feeding in later life, compared to control (cIMF). To understand the underlying mechanisms, we now explored parameters possibly involved in this long-term effect. Male C57BL/6JOlaHsd mice, fed rodent diets containing eIMF or cIMF from postnatal (PN) day 16-42, were sacrificed at PN42. Hepatic proteins were measured using targeted proteomics. Lipids were assessed by LC-MS/MS (acylcarnitines) and GC-FID (fatty-acyl chain profiles). Early life growth and body composition, cytokines, and parameters of bile acid metabolism were similar between the groups. Hepatic concentrations of multiple proteins involved in β-oxidation (+ 17%) the TCA cycle (+ 15%) and mitochondrial antioxidative proteins (+ 28%) were significantly higher in eIMF versus cIMF-fed mice (p < 0.05). Hepatic L-carnitine levels, required for fatty acid uptake into the mitochondria, were higher (+ 33%, p < 0.01) in eIMF-fed mice. The present study indicates that eIMF-fed mice have higher hepatic levels of proteins involved in fatty acid metabolism and oxidation. We speculate that eIMF feeding programs the metabolic handling of dietary lipids.

Also flagged:membraneGAPDHFUT8NT5C2ssJen
Journal Article 2020-09-30 No Snippets Chen YT, Lin WD, Liao WL, Tsai YC, Liao JW, Tsai FJ.
Show Full Abstract

Epigenetics alternation of non-genetic variation and genome-wide association study proven allelic variants may associate with insulin secretion in type 2 diabetes (T2D) development. We analyzed promoter DNA methylation array to evaluate the associated with increased susceptibility to T2D (30 cases, 10 controls) and found 1,091 gene hypermethylated in promoter regions. We performed the association study of T2D and found 698 single nucleotide polymorphisms in exon and promoter sites by using 2,270 subjects (560 cases, 1,710 controls). A comparison of DNA hypermethylation and gene silencing of mouse T2D results in our T2D patients' results showed that the 5'-nucleotidase, cytosolic II (NT5C2) and fucosyltransferase 8 (FUT8) genes were strongly associated with increased susceptibility to T2D. DNA hypermethylation in promoter regions reduced NT5C2 gene expression, but not FUT8 in T2D patients. NT5C2 protein expression was decreased in pancreatic β-cells from T2D mice. Transient transfection NT5C2 into RIN-m5F cells down-regulated DNA methyltransferase I (DNMT1) expression and up-regulation of the insulin receptor. Moreover, NT5C2 knockdown induced in DNMT1 overexpression and insulin receptor inhibition. Taken together, these results showed that NT5C2 epigenetically regulated insulin receptor in patients and mice with T2D, and maybe provide for T2D therapy strategy.

Also flagged:cytoplasmiccancerErbinLRRPDZ (LAPLAP
Journal Article 2020-09-30 ✓ 4 Snippets Santoni MJ, Kashyap R, Camoin L, Borg JP.
In-Text Gene Mentions

This finding is consistent with the phenotype of lrrc7 mutant mice which present juvenile aggressive and anxiety-like behaviors and social dysfunction in adulthood [79].

…domain, much likeDensin-180/LRRC7 previously characterize…

…domain, much like Densin-180/LRRC7previously characterized in…

…Scribble, Erbin, andDensin-180, we identified a…

Show Full Abstract

Among the more than 160 PDZ containing proteins described in humans, the cytoplasmic scaffold Scribble stands out because of its essential role in many steps of cancer development and dissemination. Its fame has somehow blurred the importance of homologous proteins, Erbin and Lano, all belonging to the LRR and PDZ (LAP) protein family first described twenty years ago. In this review, we will retrace the history of LAP family protein research and draw attention to their contribution in cancer by detailing the features of its members at the structural and functional levels, and highlighting their shared-but also different-implication in the tumoral process.

Also flagged:WRNRecQ DNA helicasecancercell cycle arrestcancersdinucleotide
Journal Article 2020-09-30 No Snippets van Wietmarschen N, Sridharan S, Nathan WJ, Tubbs A, Chan EM, Callen E, Wu W, Belinky F, Tripathi V, Wong N, Foster K, Noorbakhsh J, Garimella K, Cruz-Migoni A, Sommers JA, Huang Y, Borah AA, Smith JT, Kalfon J, Kesten N, Fugger K, Walker RL, Dolzhenko E, Eberle MA, Hayward BE, Usdin K, Freudenreich CH, Brosh RM, West SC, McHugh PJ, Meltzer PS, Bass AJ, Nussenzweig A, Nussenzweig A.
Show Full Abstract

The RecQ DNA helicase WRN is a synthetic lethal target for cancer cells with microsatellite instability (MSI), a form of genetic hypermutability that arises from impaired mismatch repair<sup>1-4</sup>. Depletion of WRN induces widespread DNA double-strand breaks in MSI cells, leading to cell cycle arrest and/or apoptosis. However, the mechanism by which WRN protects MSI-associated cancers from double-strand breaks remains unclear. Here we show that TA-dinucleotide repeats are highly unstable in MSI cells and undergo large-scale expansions, distinct from previously described insertion or deletion mutations of a few nucleotides<sup>5</sup>. Expanded TA repeats form non-B DNA secondary structures that stall replication forks, activate the ATR checkpoint kinase, and require unwinding by the WRN helicase. In the absence of WRN, the expanded TA-dinucleotide repeats are susceptible to cleavage by the MUS81 nuclease, leading to massive chromosome shattering. These findings identify a distinct biomarker that underlies the synthetic lethal dependence on WRN, and support the development of therapeutic agents that target WRN for MSI-associated cancers.

Also flagged:RibonucleoproteinsHeterogenous nuclear ribonucleoproteinsRNA binding proteinstranslationalstress granule formationcell cycle
Journal Article 2020-09-30 No Snippets Low YH, Asi Y, Foti SC, Lashley T.
Show Full Abstract

Heterogenous nuclear ribonucleoproteins (hnRNPs) are a complex and functionally diverse family of RNA binding proteins with multifarious roles. They are involved, directly or indirectly, in alternative splicing, transcriptional and translational regulation, stress granule formation, cell cycle regulation, and axonal transport. It is unsurprising, given their heavy involvement in maintaining functional integrity of the cell, that their dysfunction has neurological implications. However, compared to their more established roles in cancer, the evidence of hnRNP implication in neurological diseases is still in its infancy. This review aims to consolidate the evidences for hnRNP involvement in neurological diseases, with a focus on spinal muscular atrophy (SMA), Alzheimer's disease (AD), amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), multiple sclerosis (MS), congenital myasthenic syndrome (CMS), and fragile X-associated tremor/ataxia syndrome (FXTAS). Understanding more about hnRNP involvement in neurological diseases can further elucidate the pathomechanisms involved in these diseases and perhaps guide future therapeutic advances.

Also flagged:Dopamineprogestin receptor-Aprogestin receptorsPRreproductionprogestins
Journal Article 2020-09-30 ✓ 1 Snippet Acharya KD, Nettles SA, Lichti CF, Warre-Cornish K, Dutan Polit L, Srivastava DP, Denner L, Tetel MJ.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Neural progestin receptors (PR) function in reproduction, neural development, neuroprotection, learning, memory and the anxiety response. In the absence of progestins, PR can be activated by dopamine (DA) in the rodent hypothalamus to elicit female sexual behaviour. The present study investigated mechanisms of DA activation of PR by testing the hypothesis that proteins from DA-treated hypothalami interact with PR in the absence of progestins. Ovariectomised, oestradiol-primed mice were infused with a D1-receptor agonist, SKF38393 (SKF), into the third ventricle 30 minutes prior to death. Proteins from SKF-treated hypothalami were pulled-down with glutathione S-transferase-tagged mouse PR-A or PR-B and the interactomes were analysed by mass spectrometry. The largest functional group to interact with PR-A in a DA-dependent manner was synaptic proteins. To test the hypothesis that DA activation of PR regulates synaptic proteins, we developed oestradiol-induced PR-expressing hypothalamic-like neurones derived from human-induced pluripotent stem cells (hiPSCs). Similar to progesterone (P4), SKF treatment of hiPSCs increased synapsin1/2 expression. This SKF-dependent effect was blocked by the PR antagonist RU486, suggesting that PR are necessary for this DA-induced increase. The second largest DA-dependent PR-A protein interactome comprised metabolic regulators involved in glucose metabolism, lipid synthesis and mitochondrial energy production. Interestingly, hypothalamic proteins interacted with PR-A, but not PR-B, in an SKF-dependent manner, suggesting that DA promotes the interaction of multiple hypothalamic proteins with PR-A. These in vivo and in vitro results indicate novel mechanisms by which DA can differentially activate PR isoforms in the absence of P4 and provide a better understanding of ligand-independent PR activation in reproductive, metabolic and mental health disorders in women.

Also flagged:WARS2TBX15tryptophanyl tRNA synthetase 2mitochondrialactinomycin-Dluciferase
Journal Article 2020-09-30 ✓ 1 Snippet Mušo M, Dumbell R, Pulit S, Sinnott-Armstrong N, Laber S, Zolkiewski L, Bentley L, Claussnitzer M, Cox RD.
In-Text Gene Mentions

…aspartyl-tRNA synthetase (DARS2) has been…

Show Full Abstract

We have prioritised a single nucleotide polymorphism (SNP) rs2645294 as one candidate functional SNP in the TBX15-WARS2 waist-hip-ratio locus using posterior probability analysis. This SNP is located in the 3' untranslated region of the WARS2 (tryptophanyl tRNA synthetase 2, mitochondrial) gene with which it has an expression quantitative trait in subcutaneous white adipose tissue. We show that transcripts of the WARS2 gene in a human white adipose cell line, heterozygous for the rs2645294 SNP, showed allelic imbalance. We tested whether the rs2645294 SNP altered WARS2 RNA stability using three different methods: actinomycin-D inhibition and RNA decay, mature and nascent RNA analysis and luciferase reporter assays. We found no evidence of a difference in RNA stability between the rs2645294 alleles indicating that the allelic expression imbalance was likely due to transcriptional regulation.

Also flagged:DicerDicer RibonucleaseGene expressionRNA-binding proteincancercardiovascular diseases
Journal Article 2020-09-30 ✓ 1 Snippet Theotoki EI, Pantazopoulou VI, Georgiou S, Kakoulidis P, Filippa V, Stravopodis DJ, Anastasiadou E.
In-Text Gene Mentions

The relation of siCNGs and HD has been previously reported, due to a CAG expansion within the first exon of the Huntingtin (HTT) gene.

Show Full Abstract

Gene expression dictates fundamental cellular processes and its de-regulation leads to pathological conditions. A key contributor to the fine-tuning of gene expression is Dicer, an RNA-binding protein (RBPs) that forms complexes and affects transcription by acting at the post-transcriptional level via the targeting of mRNAs by Dicer-produced small non-coding RNAs. This review aims to present the contribution of Dicer protein in a wide spectrum of human pathological conditions, including cancer, neurological, autoimmune, reproductive and cardiovascular diseases, as well as viral infections. Germline mutations of <i>Dicer</i> have been linked to Dicer1 syndrome, a rare genetic disorder that predisposes to the development of both benign and malignant tumors, but the exact correlation of Dicer protein expression within the different cancer types is unclear, and there are contradictions in the data. Downregulation of Dicer is related to Geographic atrophy (GA), a severe eye-disease that is a leading cause of blindness in industrialized countries, as well as to psychiatric and neurological diseases such as depression and Parkinson's disease, respectively. Both loss and upregulation of Dicer protein expression is implicated in severe autoimmune disorders, including psoriasis, ankylosing spondylitis, rheumatoid arthritis, multiple sclerosis and autoimmune thyroid diseases. Loss of Dicer contributes to cardiovascular diseases and causes defective germ cell differentiation and reproductive system abnormalities in both sexes. Dicer can also act as a strong antiviral with a crucial role in RNA-based antiviral immunity. In conclusion, Dicer is an essential enzyme for the maintenance of physiology due to its pivotal role in several cellular processes, and its loss or aberrant expression contributes to the development of severe human diseases. Further exploitation is required for the development of novel, more effective Dicer-based diagnostic and therapeutic strategies, with the goal of new clinical benefits and better quality of life for patients.

Also flagged:Phosphorushydroxyapatitesynthesisricketsosteomalaciaaging
Journal Article 2020-09-30 No Snippets Serna J, Bergwitz C.
Show Full Abstract

Inorganic phosphate (P<sub>i</sub>) plays a critical function in many tissues of the body: for example, as part of the hydroxyapatite in the skeleton and as a substrate for ATP synthesis. P<sub>i</sub> is the main source of dietary phosphorus. Reduced bioavailability of P<sub>i</sub> or excessive losses in the urine causes rickets and osteomalacia. While critical for health in normal amounts, dietary phosphorus is plentiful in the Western diet and is often added to foods as a preservative. This abundance of phosphorus may reduce longevity due to metabolic changes and tissue calcifications. In this review, we examine how dietary phosphorus is absorbed in the gut, current knowledge about P<sub>i</sub> sensing, and endocrine regulation of P<sub>i</sub> levels. Moreover, we also examine the roles of P<sub>i</sub> in different tissues, the consequences of low and high dietary phosphorus in these tissues, and the implications for healthy aging.

Also flagged:Autismautism spectrum disorderneurodevelopmental disorderbehavioralFPRPSLC25A12
Journal Article 2020-09-30 No Snippets Lee J, Son MJ, Son CY, Jeong GH, Lee KH, Lee KS, Ko Y, Kim JY, Lee JY, Radua J, Eisenhut M, Gressier F, Koyanagi A, Stubbs B, Solmi M, Rais TB, Kronbichler A, Dragioti E, Vasconcelos DFP, Silva FRPD, Tizaoui K, Brunoni AR, Carvalho AF, Cargnin S, Terrazzino S, Stickley A, Smith L, Thompson T, Shin JI, Fusar-Poli P.
Show Full Abstract

This study aimed to verify noteworthy findings between genetic risk factors and autism spectrum disorder (ASD) by employing the false positive report probability (FPRP) and the Bayesian false-discovery probability (BFDP). PubMed and the Genome-Wide Association Studies (GWAS) catalog were searched from inception to 1 August, 2019. We included meta-analyses on genetic factors of ASD of any study design. Overall, twenty-seven meta-analyses articles from literature searches, and four manually added articles from the GWAS catalog were re-analyzed. This showed that five of 31 comparisons for meta-analyses of observational studies, 40 out of 203 comparisons for the GWAS meta-analyses, and 18 out of 20 comparisons for the GWAS catalog, respectively, had noteworthy estimations under both Bayesian approaches. In this study, we found noteworthy genetic comparisons highly related to an increased risk of ASD. Multiple genetic comparisons were shown to be associated with ASD risk; however, genuine associations should be carefully verified and understood.

Also flagged:GlycosphingolipidsProstate cancerPCamale cancercancerdeath
Journal Article 2020-09-30 ✓ 1 Snippet Snider AJ, Seeds MC, Johnstone L, Snider JM, Hallmark B, Dutta R, Moraga Franco C, Parks JS, Bensen JT, Broeckling CD, Mohler JL, Smith GJ, Fontham ETH, Lin HK, Bresette W, Sergeant S, Chilton FH.
In-Text Gene Mentions

…biosynthetic genes withB4GALT5, which codes…

Show Full Abstract

Prostate cancer (PCa) is the most common male cancer and the second leading cause of cancer death in United States men. Controversy continues over the effectiveness of prostate-specific antigen (PSA) for distinguishing aggressive from indolent PCa. There is a critical need for more specific and sensitive biomarkers to detect and distinguish low- versus high-risk PCa cases. Discovery metabolomics were performed utilizing ultra-performance liquid chromatography-tandem mass spectrometry (UPLC-MS) on plasma samples from 159 men with treatment naïve prostate cancer participating in the North Carolina-Louisiana PCa Project to determine if there were metabolites associated with aggressive PCa. Thirty-five identifiable plasma small molecules were associated with PCa aggressiveness, 15 of which were sphingolipids; nine common molecules were present in both African-American and European-American men. The molecules most associated with PCa aggressiveness were glycosphingolipids; levels of trihexosylceramide and tetrahexosylceramide were most closely associated with high-aggressive PCa. The Cancer Genome Atlas was queried to determine gene alterations within glycosphingolipid metabolism that are associated with PCa and other cancers. Genes that encode enzymes associated with the metabolism of glycosphingolipids were altered in 12% of PCa and >30% of lung, uterine, and ovarian cancers. These data suggest that the identified plasma (glyco)sphingolipids should be further validated for their association with aggressive PCa, suggesting that specific sphingolipids may be included in a diagnostic signature for PCa.

Also flagged:ExtracellularOAosteoarthritisMetalloproteinase(MMP)-9tissue inhibitor of metalloproteinase
Journal Article 2020-09-30 ✓ 1 Snippet Tchetina EV, Glemba KE, Markova GA, Naryshkin EA, Taskina EA, Makarov MA, Lila AM.
In-Text Gene Mentions

…imary synovial chondromatosis,hemochromatosis, chondrocalcinosis, aseptic n…

Show Full Abstract

Osteoarthritis (OA) pain implies an indication for joint replacement in patients with end-stage OA. However, chronic postoperative pain is observed in 10-40% of patients with OA. Here, we identified genes whose expression in the peripheral blood before surgery could denote the risk of postoperative pain development. We examined the peripheral blood of 26 healthy subjects and 50 patients with end-stage OA prior to joint replacement surgery. Pain was evaluated before surgery using the visual analog scale (VAS) index and neuropathic pain questionnaires, Douleur Neuropathique 4 Questions (DN4) and PainDETECT questionnaires. Functional activity was assessed using the Western Ontario and McMaster Universities osteoarthritis index (WOMAC). Three and six months after surgery, pain indices according to VAS of 30% and higher were considered. Metalloproteinase (MMP)-9 and tissue inhibitor of metalloproteinase (TIMP)1 protein levels were measured using ELISA in the peripheral blood mononuclear cells (PBMCs). Total RNA isolated from whole blood was analysed using quantitative real-time RT-PCR for caspase-3, MMP-9, TIMP1, cathepsins K and S, tumour necrosis factor (TNF)α, interleukin (IL)-1β, and cyclooxygenase (COX)-2 gene expression. Seventeen patients reported post-surgical pain. Expression of cathepsins K and S, caspase-3, TIMP1, IL-1β, and TNFα genes before surgery was significantly higher in these patients compared to pain-free patients with OA. Receiver-operating characteristic (ROC) curve analyses confirmed significant associations between these gene expressions and the likelihood of pain development after arthroplasty. High baseline expression of genes associated with extracellular matrix destruction (cathepsins S and K, TIMP1), inflammation (IL-1β, TNFα), and apoptosis (caspase-3) measured in the peripheral blood of patients with end-stage OA before knee arthroplasty might serve as an important biomarker of postoperative pain development.

Also flagged:Iron NanoparticlesOxygenLeukemiaironferroptosisPrussian blue
Journal Article 2020-09-30 No Snippets Luo T, Gao J, Lin N, Wang J.
Show Full Abstract

Leukemia is a common and lethal disease. In recent years, iron-based nanomedicines have been developed as a new ferroptosis inducer to leukemia. However, the cytotoxicity of iron nanoparticles to leukemia cells at the transcriptomic level remains unclear. This study investigated the effects of two kinds of iron nanoparticles, 2,3-Dimercaptosuccinic acid (DMSA)-coated Fe<sub>3</sub>O<sub>4</sub> nanoparticles (FeNPs) as a reactive oxygen species (ROS) inducer and Prussian blue nanoparticles (PBNPs) as an ROS scavenger, on the transcriptomic profiles of two leukemia cells (KG1a and HL60) by RNA-Seq. As a result, 470 and 1690 differentially expressed genes (DEGs) were identified in the FeNP-treated HL60 and KG1a cells, respectively, and 2008 and 2504 DEGs were found in the PBNP-treated HL60 and KG1a cells, respectively. Among them, 14 common upregulated and 4 common downregulated DEGs were found, these genes were representative genes that play key roles in lipid metabolism (GBA and ABCA1), iron metabolism (FTL, DNM1, and TRFC), antioxidation (NQO1, GCLM, and SLC7A11), vesicle traffic (MCTP2, DNM1, STX3, and BIN2), and innate immune response (TLR6, ADGRG3, and DDX24). The gene ontology revealed that the mineral absorption pathway was significantly regulated by PBNPs in two cells, whereas the lipid metabolism and HIF-1 signaling pathways were significantly regulated by FeNPs in two cells. This study established the gene signatures of two kinds of nanoparticles in two leukemia cells, which revealed the main biological processes regulated by the two kinds of iron nanoparticles. These data shed new insights into the cytotoxicity of iron nanoparticles that differently regulate ROS in leukemia cells with variant stemness.

Also flagged:PathogenesisEosinophilic Esophagitisallergic-mediated disease of the esophagusthymic stromal lymphopoietinTSLPtransforming growth factor
Journal Article 2020-09-30 No Snippets Ryu S, Lee KH, Tizaoui K, Terrazzino S, Cargnin S, Effenberger M, Shin JI, Kronbichler A.
Show Full Abstract

Eosinophilic esophagitis (EoE) is a relatively new condition described as an allergic-mediated disease of the esophagus. Clinically, it is characterized by dysphagia, food impaction, and reflux-like symptoms. Multiple genome-wide association studies (GWAS) have been conducted to identify genetic loci associated with EoE. The integration of numerous studies investigating the genetic polymorphisms in EoE and the Mendelian diseases associated with EoE are discussed to provide insights into the genetic risk of EoE, notably focusing on <i>CCL26</i> and <i>CAPN14</i>. We focus on the genetic loci investigated thus far, and their classification according to whether the function near the loci is known. The pathophysiology of EoE is described by separately presenting the known function of each cell and molecule, with the major contributors being eosinophils, Th2 cells, thymic stromal lymphopoietin (TSLP), transforming growth factor (TGF)-β1, and interleukin (IL)-13. This review aims to provide detailed descriptions of the genetics and the comprehensive pathophysiology of EoE.

Also flagged:Autophagydigestionorganelles-related proteinsosteoclast differentiationbone resorption
Journal Article 2020-09-30 No Snippets Montaseri A, Giampietri C, Rossi M, Riccioli A, Del Fattore A, Filippini A.
Show Full Abstract

Autophagy is an evolutionary conserved and highly regulated recycling process of cellular wastes. Having a housekeeping role, autophagy through the digestion of domestic cytosolic organelles, proteins, macromolecules, and pathogens, eliminates unnecessary materials and provides nutrients and energy for cell survival and maintenance. The critical role of autophagy and autophagy-related proteins in osteoclast differentiation, bone resorption, and maintenance of bone homeostasis has previously been reported. Increasing evidence reveals that autophagy dysregulation leads to alteration of osteoclast function and enhanced bone loss, which is associated with the onset and progression of osteoporosis. In this review, we briefly consolidate the current state-of-the-art technology regarding the role of autophagy in osteoclast function in both physiologic and pathologic conditions to have a more general view on this issue.

Also flagged:tubulinpancreatic cancerhydroxypyridintransportercolchicine
Journal Article 2020-09-30 No Snippets Bhattarai RS, Kumar V, Romanova S, Bariwal J, Chen H, Deng S, Bhatt VR, Bronich T, Li W, Mahato RI.
Show Full Abstract

Successful treatment of pancreatic cancer remains a challenge due to desmoplasia, development of chemoresistance, and systemic toxicity. Herein, we synthesized (6-(3-hydroxy-4-methoxylphenyl)pyridin-2-yl) (3,4,5-trimethoxyphenyl)methanone (CH-3-8), a novel microtubule polymerization inhibitor with little susceptible to transporter-mediated chemoresistance. CH-3-8 binding to the colchicine-binding site in tubulin protein was confirmed by tubulin polymerization assay and molecular modeling. CH-3-8 disrupted microtubule dynamics at the nanomolar concentration in MIA PaCa-2 and PANC-1 pancreatic cancer cell lines. CH-3-8 significantly inhibited the proliferation of these cells, induced G2/M cell cycle arrest, and led to apoptosis. CH-3-8 is hydrophobic with an aqueous solubility of 0.97 ± 0.16 μg/mL at pH 7.4. We further conjugated it with dodecanol through diglycolate linker to increase hydrophobicity and thus loading in lipid-based delivery systems. Hence, we encapsulated CH-3-8 lipid conjugate (LDC) into methoxy poly(ethylene glycol)-block-poly(2-methyl-2-carboxyl-propylene carbonate-graft-dodecanol) (mPEG-b-PCC-g-DC) polymeric nanoparticles (NPs) by solvent evaporation, resulting in a mean particle size of 125.6 ± 2.3 nm and drug loading of 10 ± 1.0% (w/w) while the same polymer could only load 1.6 ± 0.4 (w/w) CH-3-8 using the same method. Systemic administration of 6 doses of CH-3-8 and LDC loaded NPs at the dose of 20 mg/kg into orthotopic pancreatic tumor-bearing NSG mice every alternate day resulted in significant tumor regression. Systemic toxicity was negligible, as evidenced by histological evaluations. In conclusion, CH-3-8 LDC loaded NPs have the potential to improve outcomes of pancreatic cancer by overcoming transporter-mediated chemoresistance and reducing systemic toxicity.

Also flagged:zincmetalsmagnesiumirondegradationcobalt
Journal Article 2020-09-30 No Snippets Kabir H, Munir K, Wen C, Li Y.
Show Full Abstract

Biodegradable metals (BMs) gradually degrade <i>in vivo</i> by releasing corrosion products once exposed to the physiological environment in the body. Complete dissolution of biodegradable implants assists tissue healing, with no implant residues in the surrounding tissues. In recent years, three classes of BMs have been extensively investigated, including magnesium (Mg)-based, iron (Fe)-based, and zinc (Zn)-based BMs. Among these three BMs, Mg-based materials have undergone the most clinical trials. However, Mg-based BMs generally exhibit faster degradation rates, which may not match the healing periods for bone tissue, whereas Fe-based BMs exhibit slower and less complete <i>in vivo</i> degradation. Zn-based BMs are now considered a new class of BMs due to their intermediate degradation rates, which fall between those of Mg-based BMs and Fe-based BMs, thus requiring extensive research to validate their suitability for biomedical applications. In the present study, recent research and development on Zn-based BMs are reviewed in conjunction with discussion of their advantages and limitations in relation to existing BMs. The underlying roles of alloy composition, microstructure, and processing technique on the mechanical and corrosion properties of Zn-based BMs are also discussed.

Also flagged:programmed cell death 1PD-1programmed death ligand 1PD-L1programmed death ligand 2PD-L2
Journal Article 2020-09-30 ✓ 1 Snippet Wang W, Gao Z, Wang L, Li J, Yu J, Han S, Meng X.
In-Text Gene Mentions

…the ligand CD252,TNFSF4(OX40L) on activated…

Show Full Abstract

Recently, immunotherapies that target the interactions of programmed cell death 1 (PD-1) with its major ligands, programmed death ligand 1 (PD-L1) and programmed death ligand 2 (PD-L2), have achieved significant success. To date, several immune checkpoint inhibitors targeting the PD-1/PD-L1 pathway have been developed to treat melanoma, non-small cell lung cancer, head and neck cancer, renal cell carcinoma, and urothelial carcinoma. Despite promising outcomes with immunotherapy, there are many limitations to several current immune biomarkers for predicting immune benefits and to traditional imaging for evaluating the efficacy and prognosis of immunotherapy and monitoring adverse reactions. In this review, we recommend a novel imaging method, molecular imaging. This paper reviews the application and prospects of molecular imaging in the context of current immunotherapies in regard to the following aspects: 1) detecting the expression of PD-1/PD-L1; 2) evaluating the efficacy of immunotherapy; 3) assessing patient prognosis with immunotherapy; 4) monitoring the toxicity of immunotherapy; and 5) other targets imaging.

Also flagged:Sadenosylmethioninemethylbiosynthesisnicotianaminephytosiderophores
Journal Article 2020-09-30 ✓ 5 Snippets Adami R, Bottai D.
In-Text Gene Mentions

The inadequate quality control system in mitochondria, for example, which is induced by CDK5RAP1 KO (animal models), can contribute to the development of myopathy in vivo49.

Because CDK5RAP1 paucity can reduce the proliferative capability of human malignant melanoma, it enhances the formation of ROS 57.

Finally, CDK5RAP1 SNPs could have a role in vitiligo patients (Fig. 2) 74.

The potential role of CDK5RAP1 in mitochondrial metabolism can provide a key to the development of new clinical treatments for cancer.

We can speculate that the high level of oxidative stress present in some different diseases can result in an inhibition of CDK5RAP1 by oxidation of the [4Fe-4S] clusters 19, 49; indeed, treatment with H2O2 causes a rapid decrease of ms2 modifications, which are reversed by treatment with antioxidants such as pyruvate 49.

Show Full Abstract

S-adenosylmethionine supplies methyl groups to many acceptors, including lipids, proteins, RNA, DNA, and a wide range of small molecules. It acts as the precursor in the biosynthesis of metal ion chelating compounds, such as nicotianamine and phytosiderophores, of the polyamines spermidine and spermine and of some plant hormones. Finally, it is the source of catalytic 5'-deoxyadenosyl radicals. Radical S-adenosylmethionine (SAM) enzymes (RS) represent one of the most abundant groups (more than 100,000) of enzymes, exerting a plethora of biological functions, some of which are still unknown. In this work, we will focus on two RS: CDK5RAP1 and CDKAL1, both of which are involved in tRNA modifications that result in important tRNA folding and stability and in maintaining high translational fidelity. Based on this crucial role, their impairment can be important in the development of different human diseases.

Also flagged:HIV infectionHIV-1 infectionIL-17ASTAT3BCL6IL-21
Journal Article 2020-09-30 ✓ 1 Snippet Planas D, Fert A, Zhang Y, Goulet JP, Richard J, Finzi A, Ruiz MJ, Marchand LR, Chatterjee D, Chen H, Wiche Salinas TR, Gosselin A, Cohen EA, Routy JP, Chomont N, Ancuta P.
In-Text Gene Mentions

…CEACAM1, TNFSF14, LGALS3,TNFSF4), and cytokine biosynthesis…

Show Full Abstract

The frequency and functions of Th17-polarized CCR6<sup>+</sup>RORyt<sup>+</sup>CD4<sup>+</sup> T cells are rapidly compromised upon HIV infection and are not restored with long-term viral suppressive antiretroviral therapy (ART). In line with this, Th17 cells represent selective HIV-1 infection targets mainly at mucosal sites, with long-lived Th17 subsets carrying replication-competent HIV-DNA during ART. Therefore, novel Th17-specific therapeutic interventions are needed as a supplement of ART to reach the goal of HIV remission/cure. Th17 cells express high levels of <i>peroxisome proliferator-activated receptor gamma</i> (PPARy), which acts as a transcriptional repressor of the HIV provirus and the <i>rorc</i> gene, which encodes for the Th17-specific master regulator RORyt. Thus, we hypothesized that the pharmacological inhibition of PPARy will facilitate HIV reservoir reactivation while enhancing Th17 effector functions. Consistent with this prediction, the PPARy antagonist T0070907 significantly increased HIV transcription (cell-associated HIV-RNA) and RORyt-mediated Th17 effector functions (IL-17A). Unexpectedly, the PPARy antagonism limited HIV outgrowth from cells of ART-treated people living with HIV (PLWH), as well as HIV replication <i>in vitro</i>. Mechanistically, PPARy inhibition in CCR6<sup>+</sup>CD4<sup>+</sup> T cells induced the upregulation of transcripts linked to Th17-polarisation (RORyt, STAT3, BCL6 IL-17A/F, IL-21) and HIV transcription (NCOA1-3, CDK9, HTATIP2). Interestingly, several transcripts involved in HIV-restriction were upregulated (Caveolin-1, TRIM22, TRIM5α, BST2, miR-29), whereas HIV permissiveness transcripts were downregulated (CCR5, furin), consistent with the decrease in HIV outgrowth/replication. Finally, PPARy inhibition increased intracellular HIV-p24 expression and prevented BST-2 downregulation on infected T cells, suggesting that progeny virion release is restricted by BST-2-dependent mechanisms. These results provide a strong rationale for considering PPARy antagonism as a novel strategy for HIV-reservoir purging and restoring Th17-mediated mucosal immunity in ART-treated PLWH.

Also flagged:Head and Neck Squamous Cell CarcinomaHNSCCCD8CD4cell activationchemokine
Journal Article 2020-09-30 ✓ 5 Snippets Lu H, Dai W, Guo J, Wang D, Wen S, Yang L, Lin D, Xie W, Wen L, Fang J, Wang Z.
In-Text Gene Mentions
⭐ same-sentence co-mention

Furthermore, we found that the abundance of γδ T cells was positively associated with the expression of the butyrophilin (BTN) family proteins BTN3A1/BTN3A2/BTN3A3 and BTN2A1, but only MICB, one of the ligands of NKG2D, was involved in the activation of γδ T cells, indicating that the BTN family proteins might be involved in the activation and proliferation of γδ T cells in the tumor microenvironment of HNSCC.

Studies have shown that through binding to P-Ags presented by BTN3A1 and BTN2A1 on infected or malignant cells, γδ T cells could be activated, proliferate rapidly, and induce anti-infection or antitumor responses through IFN-γ production (20).

Studies have shown that through the binding to P-Ags presented by BTN3A1 and BTN2A1 on infected or malignant cells, γδ T cells could be activated, proliferate rapidly, and release cytokines to induce anti-infection or antitumor responses (20, 21).

In addition, recent studies have revealed that BTN2A1 was another ligand that cooperated with BTN3A1 to activate Vδ2 T cells (20, 60).Studies have shown that a TP53 gene mutation would lead to the activation of the mevalonate pathway in cancer cells, resulting in the accumulation of isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAPP) in tumor cells (61).

⭐ same-sentence co-mention

However, when we dichotomized the HNSCC cohort based on the median expression levels of BTN3A1/BTN3A2/BTN3A3/BTN2A1, we found that although there was no statistical significance between the high and low groups, the patients with higher expression levels of the BTN family proteins showed better overall survival than patients whose expression levels were lower than the median expression levels (P > 0.05, Supplementary Figure 3B).

Show Full Abstract

γδ T cells are a small subset of unconventional T cells that are enriched in the mucosal areas, and are responsible for pathogen clearance and maintaining integrity. However, the role of γδ T cells in head and neck squamous cell carcinoma (HNSCC) is largely unknown. Here, by using RNA-seq data from The Cancer Genome Atlas (TCGA), we discovered that HNSCC patients with higher levels of γδ T cells were positively associated with lower clinical stages and better overall survival, and high abundance of γδ T cells was positively correlated with CD8+/CD4+ T cell infiltration. Gene ontology and pathway analyses showed that genes associated with T cell activation, proliferation, effector functions, cytotoxicity, and chemokine production were enriched in the group with a higher γδ T cell abundance. Furthermore, we found that the abundance of γδ T cells was positively associated with the expression of the butyrophilin (BTN) family proteins BTN3A1/BTN3A2/BTN3A3 and BTN2A1, but only MICB, one of the ligands of NKG2D, was involved in the activation of γδ T cells, indicating that the BTN family proteins might be involved in the activation and proliferation of γδ T cells in the tumor microenvironment of HNSCC. Our results indicated that γδ T cells, along with their ligands, are promising targets in HNSCC with great prognostic values and treatment potentials.

Also flagged:Lymphoproliferative DiseaseAIDS-defining lymphomasnon-Hodgkin lymphomasNHLHodgkin lymphomaAIDS
Journal Article 2020-09-30 ✓ 1 Snippet Shindiapina P, Ahmed EH, Mozhenkova A, Abebe T, Baiocchi RA.
In-Text Gene Mentions

…genes FHIT, WWOX,DCC, and PARK2 (…

Show Full Abstract

Epstein-Bar virus (EBV) can directly cause lymphoproliferative disease (LPD), including AIDS-defining lymphomas such as Burkitt's lymphoma and other non-Hodgkin lymphomas (NHL), as well as human immunodeficiency virus (HIV)-related Hodgkin lymphoma (HL). The prevalence of EBV in HL and NHL is elevated in HIV-positive individuals compared with the general population. Rates of incidence of AIDS-defining cancers have been declining in HIV-infected individuals since initiation of combination anti-retroviral therapy (cART) use in 1996. However, HIV-infected persons remain at an increased risk of cancers related to infections with oncogenic viruses. Proposed pathogenic mechanisms of HIV-related cancers include decreased immune surveillance, decreased ability to suppress infection-related oncogenic processes and a state of chronic inflammation marked by alteration of the cytokine profile and expanded numbers of cytotoxic T lymphocytes with down-regulated co-stimulatory molecules and increased expression of markers of senescence in the setting of treated HIV infection. Here we discuss the cooperation of EBV-infected B cell- and environment-associated factors that may contribute to EBV-related lymphomagenesis in HIV-infected individuals. Environment-derived lymphomagenic factors include impaired host adaptive and innate immune surveillance, cytokine dysregulation and a pro-inflammatory state observed in the setting of chronic, cART-treated HIV infection. B cell factors include distinctive EBV latency patterns and host protein expression in HIV-associated LPD, as well as B cell-stimulating factors derived from HIV infection. We review the future directions for expanding therapeutic approaches in targeting the viral and immune components of EBV LPD pathogenesis.

Also flagged:Hepatocellular CarcinomapathogenesisGene ExpressiontumorABATDAO
Journal Article 2020-09-30 ✓ 1 Snippet Song H, Ding N, Li S, Liao J, Xie A, Yu Y, Zhang C, Ni C.
In-Text Gene Mentions

…EHHADH, GYC2, andSERPINC1in HCC samples…

Show Full Abstract

<h4>Background</h4>Bioinformatics provides a valuable tool to explore the molecular mechanisms underlying pathogenesis of hepatocellular carcinoma (HCC). To improve prognosis of patients, identification of robust biomarkers associated with the pathogenic pathways of HCC remains an urgent research priority.<h4>Methods</h4>We employed the Robust Rank Aggregation method to integrate nine qualified HCC datasets from the Gene Expression Omnibus. A robust set of differentially expressed genes (DEGs) between tumor and normal tissue samples were screened. Weighted gene co-expression network analysis was applied to cluster DEGs and the key modules related to clinical traits identified. Based on network topology analysis, novel risk genes derived from key modules were mined and biological verification performed. The potential functions of these risk genes were further explored with the aid of miRNA-mRNA regulatory networks. Finally, the prognostic ability of these genes was assessed by constructing a clinical prediction model.<h4>Results</h4>Two key modules showed significant association with clinical traits. In combination with protein-protein interaction analysis, 29 hub genes were identified. Among these genes, 19 from one module showed a pattern of upregulation in HCC and were associated with the tumor node metastasis stage, and 10 from the other module displayed the opposite trend. Survival analyses indicated that all these genes were significantly related to patient prognosis. Based on the miRNA-mRNA regulatory network, 29 genes strongly linked to tumor activity were identified. Notably, five of the novel risk genes, ABAT, DAO, PCK2, SLC27A2, and HAO1, have rarely been reported in previous studies. Gene set enrichment analysis for each gene revealed regulatory roles in proliferation and prognosis of HCC. Least absolute shrinkage and selection operator regression analysis further validated DAO, PCK2, and HAO1 as prognostic factors in an external HCC dataset.<h4>Conclusion</h4>Analysis of multiple datasets combined with global network information presents a successful approach to uncover the complex biological mechanisms of HCC. More importantly, this novel integrated strategy facilitates identification of risk hub genes as candidate biomarkers for HCC, which could effectively guide clinical treatments.

Also flagged:nonalcoholic fatty liver diseaseNAFLDIRalanine aminotransferaseALTaminotransferases
Journal Article 2020-09-30 ✓ 1 Snippet Małecki P, Figlerowicz M, Kemnitz P, Mazur-Melewska K, Służewski W, Mania A.
In-Text Gene Mentions

…is, α1-antitrypsin deficiency,hemochromatosis, celiac disease, Wilson…

Show Full Abstract

<h4>Aim of the study</h4>Assessment of liver fibrosis as a predictive factor of liver-related mortality in children with nonalcoholic fatty liver disease (NAFLD) is crucial. This study aims to estimate the risk of fibrosis using noninvasive markers.<h4>Material and methods</h4>The study group of 49 children with NAFLD (age range 3-16, mean 10.51 ±3.18 years) was created. The diagnosis was based on clinical picture, abdominal ultrasound, and laboratory tests; four children underwent liver biopsy. Then homeostatic model assessment (HOMA-IR) and noninvasive hepatic fibrosis scores were calculated, and patients were divided into four groups depending on body mass index (BMI, obese vs. lean) and aminotransferases.<h4>Results</h4>71.43% of patients were obese, and 14.29% were overweight. We found that overweight children had lower mean corpuscular volume (MCV) than lean patients. In a group of patients with a high risk of fibrosis or significant fibrosis due to pediatric NAFLD fibrosis score (PNFS), higher alanine aminotransferase (ALT) to platelet ratio (APRI) values were observed. The highest values of APRI were found in a group of lean patients with elevated aminotransferases and the highest value of PNFS - among obese patients with elevated aminotransferases. A strong significant correlation between APRI and PNFS was found (<i>r</i> = 0.88).<h4>Conclusions</h4>Apart from aminotransferase activity, complete blood count should be assessed looking for lower MCV caused by iron deficiency. In contrast to FIB-4 (fibrosis score), PNFS and APRI proved to be more accurate in our group. PNFS seems to be appropriate to evaluate fibrosis in a noninvasive diagnostic algorithm.

Also flagged:Infectious MononucleosisAcute Liver FailureHemolytic Anemiainfectionauto-immune hemolytic anemiaHereditary hemochromatosis
Journal Article 2020-09-30 ✓ 5 Snippets Forsberg M, Galan M, Kra J.
In-Text Gene Mentions

Hemochromatosisis one such…

Hemochromatosisis a disorder…

Hemochromatosisis most commonly…

…disorder of theHFEgene on chromosome…

Hemochromatosiswas historically diagnosed…

Show Full Abstract

Infectious mononucleosis is a largely benign disease process that occurs secondary to infection with the Epstein-Barr virus. However, it can also present with more serious complications, including auto-immune hemolytic anemia and acute liver failure. Hereditary hemochromatosis is a genetic disorder that leads to organ damage via increased iron uptake and deposition. This case report describes a 25-year-old man who presented with acute liver failure and severe hemolytic anemia. Workup revealed that not only did he have a rare presentation of Epstein-Barr virus-induced acute liver failure and C<sub>3</sub>-positive IgG-negative hemolytic anemia, he also had previously undiagnosed hereditary hemochromatosis. This combined presentation of these pathologies presents a unique opportunity to study their interaction and possible synergistic pathophysiology. Furthermore, the evolving understanding of the disease mechanisms behind these disease processes is described.

Also flagged:Gene Expressionmastitislactationinflammatory responsesinnate immunityC5AR1
Journal Article 2020-09-30 No Snippets McConnel CS, Crisp SA, Biggs TD, Ficklin SP, Parrish LM, Trombetta SC, Sischo WM, Adams-Progar A.
Show Full Abstract

Specifically designed gene expression studies can be used to prioritize candidate genes and identify novel biomarkers affecting resilience against mastitis and other diseases in dairy cattle. The primary goal of this study was to assess whether specific peripheral leukocyte genes expressed differentially in a previous study of dairy cattle with postpartum disease, also would be expressed differentially in peripheral leukocytes from a diverse set of different dairy cattle with moderate to severe clinical mastitis. Four genes were selected for this study due to their differential expression in a previous transcriptomic analysis of circulating leukocytes from dairy cows with and without evidence of early postpartum disease. An additional 15 genes were included based on their cellular, immunologic, and inflammatory functions associated with resistance and tolerance to mastitis. This fixed cohort study was conducted on a conventional dairy in Washington state. Cows >50 days in milk (DIM) with mastitis (<i>n</i> = 12) were enrolled along with healthy cows (<i>n</i> = 8) selected to match the DIM and lactation numbers of mastitic cows. Blood was collected for a complete blood count (CBC), serum biochemistry, leukocyte isolation, and RNA extraction on the day of enrollment and twice more at 6 to 8-days intervals. Latent class analysis was performed to discriminate healthy vs. mastitic cows and to describe disease resolution. RNA samples were processed by the Primate Diagnostic Services Laboratory (University of Washington, Seattle, WA). Gene expression analysis was performed using the Nanostring System (Nanostring Technologies, Seattle, Washington, USA). Of the four genes (<i>C5AR1, CATHL6, LCN2</i>, and <i>PGLYRP1</i>) with evidence of upregulation in cows with mastitis, three of those genes (<i>CATHL6, LCN2</i>, and <i>PGLYRP1</i>) were investigated due to their previously identified association with postpartum disease. These genes are responsible for immunomodulatory molecules that selectively enhance or alter host innate immune defense mechanisms and modulate pathogen-induced inflammatory responses. Although further research is warranted to explain their functional mechanisms and bioactivity in cattle, our findings suggest that these conserved elements of innate immunity have the potential to bridge disease states and target tissues in diverse dairy populations.

Also flagged:host cellmitochondrialmetabolismdeathmitochondriaadenosine triphosphate
Journal Article 2020-09-30 No Snippets Monk CH, Zwezdaryk KJ.
Show Full Abstract

<h4>Purpose of review</h4>Metabolic rewiring of the host cell is required for optimal viral replication. Human cytomegalovirus (HCMV) has been observed to manipulate numerous mitochondrial functions. In this review, we describe the strategies and targets HCMV uses to control different aspects of mitochondrial function.<h4>Recent findings</h4>The mitochondria are instrumental in meeting the biosynthetic and bioenergetic needs of HCMV replication. This is achieved through altered metabolism and signaling pathways. Morphological changes mediated through biogenesis and fission/fusion dynamics contribute to strategies to avoid cell death, overcome oxidative stress, and maximize the biosynthetic and bioenergetic outputs of mitochondria.<h4>Summary</h4>Emerging data suggests that cytomegalovirus relies on intact, functional host mitochondria for optimal replication. HCMV large size and slow replication kinetics create a dependency on mitochondria during replication. Targeting the host mitochondria is an attractive antiviral target.

Also flagged:zirconiumglycerophosphatephosphoric acidβ-glycerophosphatewaterhydroxyapatite
Journal Article 2020-09-30 No Snippets Nakamura J, Endo K, Sugawara-Narutaki A, Ohtsuki C.
Show Full Abstract

This study aims to evaluate the <i>in vitro</i> cytocompatibility of layered zirconium phosphate (ZP) and its derivative material that was organically modified using glycerophosphate (ZGP). The ZP and ZGP particles were prepared <i>via</i> a reflux method in an aqueous solution containing phosphoric acid. The field emission scanning electron microscopy showed the prepared samples were fine particles with 70-100 nm diameter. X-ray diffraction and Raman spectrometry indicated the presence of a layered crystal structure. The interlayer distance of ZP was estimated to be 0.76 nm from the 002 diffraction. Modification of ZP with β-glycerophosphate, lead to expansion of the interlayer distance of 0.85 nm. Grazing incidence X-ray diffraction and Raman spectrometry showed that the crystal structures of ZP and ZGP were maintained even after the samples were coated onto polyethylene (PE) substrates <i>via</i> hot pressing. The water droplet contact angles on the PE substrates coated with the ZP and ZGP particles (ZP/PE and ZGP/PE) were 2 ∼ 6° lesser than that on the uncoated PE substrate. After human adipose-derived stem cells (hASCs) were cultured on the substrates, 2.5-3.5 times higher numbers of adhered cells were observed on the substrates coated with ZP and ZGP than on the uncoated PE substrates and 1.1-1.6 times higher than on the substrate coated with hydroxyapatite particles (HAp/PE). Increasing cell numbers were observed after culturing for 24 h, indicating that the ZP/PE and ZGP/PE showed low cytotoxicity to the hASCs. Furthermore, the ZP/PE showed the highest area of hASC adhesion among all the samples. These results highlight the possibility that layered zirconium phosphate and its organically modified substances can be applied to biomaterials for tissue repair.

bioRxiv 2020-09-30 Preprint (No Snippets API) Martin-Sancho L, Lewinski MK, Pache L, Stoneham CA, Yin X, Pratt D, Churas C, Rosenthal SB, Liu S, De Jesus PD, O’Neill AM, Gounder AP, Nguyen C, Pu Y, Oom AL, Miorin L, Rodriguez-Frandsen A, Urbanowski M, Shaw ML, Chang MW, Benner C, Frieman MB, García-Sastre A, Ideker T, Hultquist JF, Guatelli J, Chanda SK.
Show Full Abstract

<h4>SUMMARY</h4> A deficient interferon response to SARS-CoV-2 infection has been implicated as a determinant of severe COVID-19. To identify the molecular effectors that govern interferon control of SARS-CoV-2 infection, we conducted a large-scale gain-of-function analysis that evaluated the impact of human interferon stimulated genes (ISGs) on viral replication. A limited subset of ISGs were found to control viral infection, including endosomal factors that inhibited viral entry, nucleic acid binding proteins that suppressed viral RNA synthesis, and a highly enriched cluster of ER and Golgi-resident ISGs that inhibited viral translation and egress. These included the type II integral membrane protein BST2/tetherin, which was found to impede viral release, and is targeted for immune evasion by SARS-CoV-2 Orf7a protein. Overall, these data define the molecular basis of early innate immune control of viral infection, which will facilitate the understanding of host determinants that impact disease severity and offer potential therapeutic strategies for COVID-19.

medRxiv 2020-09-30 Preprint (No Snippets API) Yaren O, McCarter J, Phadke N, Bradley KM, Overton B, Yang Z, Ranade S, Patil K, Bangale R, Benner SA.
Show Full Abstract

Managing the pandemic caused by SARS-CoV-2 requires new capabilities in testing, including the possibility of identifying, in minutes, infected individuals as they enter spaces where they must congregate in a functioning society, including workspaces, schools, points of entry, and commercial business establishments. Here, the only useful tests (a) require no sample transport, (b) require minimal sample manipulation, (c) can be performed by unlicensed individuals, (d) return results on the spot in much less than one hour, and (e) cost no more than a few dollars. The sensitivity need not be as high as normally required by the FDA for screening asymptomatic carriers (as few as 10 virions per sample), as these viral loads are almost certainly not high enough for an individual to present a risk for forward infection. This allows tests specifically useful for this pandemic to trade-off unneeded sensitivity for necessary speed, simplicity, and frugality. In some studies, it was shown that viral load that creates forward-infection risk may exceed 10 5 virions per milliliter, easily within the sensitivity of an RNA amplification architecture, but unattainable by antibody-based architectures that simply target viral antigens. Here, we describe such a test based on a displaceable probe loop amplification architecture.

Also flagged:pyrophosphateolefinsynthesismethylenedifluoromethylenephosphonamidate
Journal Article 2020-09-29 ✓ 2 Snippets Kadri H, Taher TE, Xu Q, Sharif M, Ashby E, Bryan RT, Willcox BE, Mehellou Y.
In-Text Gene Mentions

…member, butyrophilin 2A1 (BTN2A1), with which it…

…in combination withBTN2A1, forms a “composite…

Show Full Abstract

Vγ9/Vδ2 T-cells are activated by pyrophosphate-containing small molecules known as phosphoantigens (PAgs). The presence of the pyrophosphate group in these PAgs has limited their drug-like properties because of its instability and polar nature. In this work, we report a novel and short Grubbs olefin metathesis-mediated synthesis of methylene and difluoromethylene monophosphonate derivatives of the PAg (<i>E</i>)-4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMBP) as well as their aryloxy diester phosphonamidate prodrugs, termed ProPAgens. These prodrugs showed excellent stability in human serum (<i>t</i><sub>1/2</sub> > 12 h) and potent activation of Vγ9/Vδ2 T-cells (EC<sub>50</sub> ranging from 5 fM to 73 nM), which translated into sub-nanomolar γδ T-cell-mediated eradication of bladder cancer cells <i>in vitro</i>. Additionally, a combination of <i>in silico</i> and <i>in vitro</i> enzymatic assays demonstrated the metabolism of these phosphonamidates to release the unmasked PAg monophosphonate species. Collectively, this work establishes HMBP monophosphonate ProPAgens as ideal candidates for further investigation as novel cancer immunotherapeutic agents.

Also flagged:Androgen receptordocetaxelARprostate cancerandrogentestosterone
Journal Article 2020-09-29 ✓ 5 Snippets Mout L, Moll JM, Chen M, de Morrée ES, de Ridder CMA, Gibson A, Stuurman D, Aghai A, Erkens-Schulze S, Mathijssen RHJ, Sparreboom A, de Wit R, Lolkema MP, van Weerden WM.
In-Text Gene Mentions

Moreover, testosterone supplementation resulted in strong AR-pathway activation in PC346C-DCC-K tumours as exemplified by increased prostate-specific antigen production, AR nuclear localisation, AR target gene expression and tumour cell proliferation (Supplementary Fig. 2).

Moreover, we observed a trend towards decreased tubulin stabilisation in PC346C-DCC-K tumours from short-term docetaxel-treated mice supplemented with testosterone (19% decrease, P = 0.17; Fig. 2a and Supplementary Fig. 4c).

Indeed, a small but consistent survival advantage was achieved by R1881 under effective docetaxel concentrations in AR-positive CRPC cell lines (Fig. 2c; > 0.3 nM docetaxel with P = 0.032 and 0.073 for PC36C-DCC-K and VCaP-DCC-E, respectively).

Testosterone-induced strong AR-pathway stimulation, as shown by AR nuclear localisation and target gene expression, which led to rapid outgrowth in five out of seven PC346C-DCC-K tumours (Fig. 2d and Supplementary Fig. 7).

Furthermore, these cell lines do not express ABCB1 (P-glycoprotein), which has been shown to induce multidrug resistance.9 For in vivo experiments, NMRI nu/nu male mice were subcutaneously inoculated with PC346C-DCC-K cells and surgically castrated once tumours established (Supplementary Methods).

Show Full Abstract

Androgen receptor (AR) signalling drives neoplastic growth and therapy resistance in prostate cancer. Recent clinical data show that docetaxel combined with androgen deprivation therapy improves outcome in hormone-sensitive disease. We studied whether testosterone and AR signalling interferes with docetaxel treatment efficacy in castration-resistant prostate cancer (CRPC). We found that testosterone supplementation significantly impaired docetaxel tumour accumulation in a CRPC model, resulting in decreased tubulin stabilisation and antitumour activity. Furthermore, testosterone competed with docetaxel for uptake by the drug transporter OATP1B3. Irrespective of docetaxel-induced tubulin stabilisation, AR signalling by testosterone counteracted docetaxel efficacy. AR-pathway activation could also reverse long-term tumour regression by docetaxel treatment in vivo. These results indicate that to optimise docetaxel efficacy, androgen levels and AR signalling need to be suppressed. This study lends evidence for continued maximum suppression of AR signalling by combining targeted therapeutics with docetaxel in CRPC.

Also flagged:Histone deacetylasedeathHDpathogenesisHuntington diseaseHdac2
Journal Article 2020-09-29 ✓ 5 Snippets Kovalenko M, Erdin S, Andrew MA, St Claire J, Shaughnessey M, Hubert L, Neto JL, Stortchevoi A, Fass DM, Mouro Pinto R, Haggarty SJ, Wilson JH, Talkowski ME, Wheeler VC.
In-Text Gene Mentions

Our results identify novel modifiers of different aspects of HD pathogenesis in medium-spiny neurons and highlight a complex relationship between the expanded Htt allele and Hdac2 with implications for targeting transcriptional dysregulation in HD.

…genetic knockout, inHtt Q111 miceQ111 mice, of…

…elicited by theHttQ111 allele, likely…

…between the expandedHttallele and Hdac2…

…mouse model (HttQ111 ) (…

Show Full Abstract

Somatic expansion of the Huntington's disease (HD) CAG repeat drives the rate of a pathogenic process ultimately resulting in neuronal cell death. Although mechanisms of toxicity are poorly delineated, transcriptional dysregulation is a likely contributor. To identify modifiers that act at the level of CAG expansion and/or downstream pathogenic processes, we tested the impact of genetic knockout, in <i>Htt</i><sup>Q111</sup> mice, of <i>Hdac2</i> or <i>Hdac3</i> in medium-spiny striatal neurons that exhibit extensive CAG expansion and exquisite disease vulnerability. Both knockouts moderately attenuated CAG expansion, with <i>Hdac2</i> knockout decreasing nuclear huntingtin pathology. <i>Hdac2</i> knockout resulted in a substantial transcriptional response that included modification of transcriptional dysregulation elicited by the <i>Htt</i><sup>Q111</sup> allele, likely via mechanisms unrelated to instability suppression. Our results identify novel modifiers of different aspects of HD pathogenesis in medium-spiny neurons and highlight a complex relationship between the expanded <i>Htt</i> allele and <i>Hdac2</i> with implications for targeting transcriptional dysregulation in HD.

Also flagged:oxaliplatinportal hypertensionPHcolorectal cancersinusoidal obstruction syndrome of the liverliver metastasis
Journal Article 2020-09-29 ✓ 1 Snippet Uehara H, Kawanaka H, Nakanoko T, Sugiyama M, Ota M, Mano Y, Sugimachi K, Morita M, Toh Y.
In-Text Gene Mentions

…anticoagulation therapy withantithrombin-IIIconcentrates and danaparoid…

Show Full Abstract

<h4>Background</h4>Ectopic variceal bleeding is a rare but life-threatening complication of portal hypertension (PH). Oxaliplatin-based chemotherapy for colorectal cancer (CRC) is associated with sinusoidal obstruction syndrome of the liver, which can lead to PH.<h4>Case presentation</h4>Here, we report a successful hybrid surgery that included intraoperative obliteration of ileal conduit stomal varices (ICSVs) for a 66-year-old woman with CRC and liver metastasis that had been treated multimodally during the previous 4 years, including 17 courses of oxaliplatin-based chemotherapy. She was admitted to our hospital for massive hemorrhage from an ileal conduct stoma. Image findings showed ICSVs as a part of portosystemic shunt, which were afferently supplied from the superior mesenteric vein (SMV) and drained by the numerous cutaneous veins connected to the left femoral vein. Obliteration of the stomal varices by interventional radiologic techniques alone was inappropriate because of difficulties of cannulating the efferent cutaneous veins. We, therefore, performed hybrid surgery for the ICSV, which included cannulation into the SMV branch and antegrade obliteration of the varices with a 5% solution of ethanolamine oleate with iopamidol under blocking the SMV flow, using a vascular clip and ligation. Hemorrhage in her ileal conduit stoma disappeared completely.<h4>Conclusion</h4>Customized treatment of ectopic varices should be based on their precise vascular anatomy; hybrid surgery with intraoperative angiography is an alternative treatment for ectopic varices such as ICSV.

Also flagged:calcitemineralizationcalciumcarbonlactateacetate
Journal Article 2020-09-29 No Snippets Ferral-Pérez H, Galicia-García M, Alvarado-Tenorio B, Izaguirre-Pompa A, Aguirre-Ramírez M.
Show Full Abstract

Bacteria mineralization is a promising biotechnological approach to apply in biomaterials development. In this investigation, we demonstrate that Bacillus subtilis 168 induces and influences CaCO<sub>3</sub> composites precipitation. Crystals were formed in calcium-carbon non-coupled (glycerol + CaCl<sub>2</sub>, GLY; or glucose + CaCl<sub>2</sub>, GLC) and coupled (calcium lactate, LAC; or calcium acetate, ACE) agar-sources, only maintaining the same Ca<sup>2+</sup> concentration. The mineralized colonies showed variations in morphology, size, and crystallinity form properties. The crystals presented spherulitic growth in all conditions, and botryoidal shapes in GLC one. Birefringence and diffraction patterns confirmed that all biogenic carbonate crystals (BCC) were organized as calcite. The CaCO<sub>3</sub> in BCC was organized as calcite, amorphous calcium carbon (ACC) and organic matter (OM) of biofilm; all of them with relative abundance related to bacteria growth condition. BCC-GLY presented greatest OM composition, while BCC-ACE highest CaCO<sub>3</sub> content. Nucleation mechanism and OM content impacted in BCC crystallinity.

Also flagged:angiogenesisdiabetic retinopathyGene ExpressionrelatedPIK3CBALDH3A1
Journal Article 2020-09-29 No Snippets Gu C, Lhamo T, Zou C, Zhou C, Su T, Draga D, Luo D, Zheng Z, Yin L, Qiu Q.
Show Full Abstract

<h4>Background</h4>Angiogenesis is an important parameter in the development of diabetic retinopathy (DR), and it is indicative of an early stage evolving into a late phase. Therefore, examining the role of angiogenic factors in early DR is crucial to understanding the mechanism of neovascularization.<h4>Methods</h4>The present study identified hub genes and pathways associated with angiogenesis in early DR using bioinformatics analysis. Genes from published literature and Gene Expression Omnibus (GEO) were collected and analysed.<h4>Results</h4>We collected 73 genes from 70 published studies in PubMed, which were referred to as DR-related gene set 1 (DRgset1). The gene expression profile of GSE12610 was downloaded, and 578 differentially expressed genes (DEGs) between diabetic and normal samples were identified. DEGs and DRgset1 were further combined to create DR-related gene set 2 (DRgset2). After an enrichment analysis, we identified 12 GO terms and 2 pathways associated with neovascularization in DRgset1, and 8 GO terms and 2 pathways in DRgset2. We found 39 new genes associated with angiogenesis and verified 8 candidate angiogenesis-related genes in DR cells using real-time PCR: PIK3CB, ALDH3A1, ITGA7, FGF23, THBS1, COL1A1, MAPK13, and AIF1. We identified 10 hub genes associated with neovascularization by constructing a protein-protein interaction (PPI) network: TNF, VEGFA, PIK3CB, TGFB1, EDN1, MMP9, TLR4, PDGFB, MMP2, and THBS1.<h4>Conclusions</h4>The present study analysed angiogenesis-related genes and pathways in early DR in a comprehensive and systematic manner. PIK3CB, ALDH3A1, ITGA7, FGF23, THBS1, COL1A1, MAPK13, and AIF1 may be the candidate genes to further explore the mechanisms of angiogenesis in early DR. TNF, PIK3CB, TGFB1, EDN1, MMP9, TLR4, PDGFB, MMP2, and THBS1 may be new targets for early neovascularization therapy in the future.

Also flagged:Stanford type B aortic dissectionD-dimerfibrinogendegradationrenal insufficiencydeath
Journal Article 2020-09-29 No Snippets Tie H, Kong L, Tu Z, Chen D, Zheng D, Wu Q, Li Q.
Show Full Abstract

<h4>Background</h4>Open stented elephant trunk (SET) or SET with left subclavian artery (LSCA) to left common carotid artery (LCCA) bypass is proven to a potentially alternative treatment for complicated Stanford type B aortic dissection (TBAD). In the current study, we reported our experience with ten consecutive TBAD patients who underwent open SET.<h4>Methods</h4>Patients with complicated TBAD underwent open SET from May 2016 to November 2018 in our institution were included. Patients' clinical data were obtained from the electronic medical record system, and long-term clinical outcomes were collected by telephone interviews or outpatient interviews.<h4>Results</h4>A total of ten patients with nine males and one female were included, and the average age was 47.3 (31-65) years. Increased D-dimer and fibrinogen degradation products were observed in all patients at admission, and two patients had renal insufficiency. The average postoperative mechanical ventilation time, length of stay in intensive care unit, and postoperative hospital length of stay were 46.9 (6.7-151.2) hours, 7.7 (4-17) days, and 15.7 (10-26) days. No postoperative death occurred. Acute kidney injury and other complications were observed, and they were recovered well when discharge. In long-term follow-up, computed tomography angiography indicated that aortas were completely well remodeled, and blood supply of the brachiocephalic trunks was normal without anastomotic complications. All patients lived well.<h4>Conclusion</h4>SET or SET with subclavian artery correction shows satisfactory clinical outcomes, and it could be considered as an alternative treatment. Well-designed, large-scale studies with long-term follow-up are still needed.

Also flagged:carbapenemmonobactamcefuroximecefotaximeceftriaxonemeropenem
Journal Article 2020-09-29 ✓ 1 Snippet Peña-Mendizabal E, Morais S, Maquieira Á.
In-Text Gene Mentions

Benzylpenicillin sodium salt, meropenem trihydrate, aztreonam, cefuroxime sodium salt, cefotaxime sodium salt, ceftriaxone disodium salt hemi(heptahydrate), N,N′-dicyclohexylcarbodiimide (DCC), N-hydroxysuccinimide (NHS), Tween 20, human serum albumin (HSA), histone from calf thymus (H1) and keyhole limpet hemocyanin (KLH) came from Sigma-Aldrich (Madrid, Spain).

Show Full Abstract

New antigens deriving from -lloyl and -llanyl, major and minor determinants, respectively, were produced for β-lactam antibiotics cefuroxime, cefotaxime, ceftriaxone, meropenem and aztreonam. Twenty β-lactam antigens were produced using human serum albumin and histone H1 as carrier proteins. Antigens were tested by multiplex in vitro immunoassays and evaluated based on the detection of specific IgG and IgE in the serum samples. Both major and minor determinants were appropriate antigens for detecting specific anti-β-lactam IgG in immunised rabbit sera. In a cohort of 37 allergic patients, we observed that only the minor determinants (-llanyl antigens) were suitable for determining specific anti-β-lactam IgE antibodies with high sensitivity (< 0.01 IU/mL; 24 ng/L) and specificity (100%). These findings reveal that not only the haptenisation of β-lactam antibiotics renders improved molecular recognition events when the 4-member β-lactam ring remains unmodified, but also may contribute to develop promising minor antigens suitable for detecting specific IgE-mediated allergic reactions. This will facilitate the development of sensitive and selective multiplexed in vitro tests for drug-allergy diagnoses to antibiotics cephalosporin, carbapenem and monobactam.

Also flagged:CreatininePET1HD 3CancerHuntington DiseaseHuntington's disease
Journal Article 2020-09-29 ✓ 1 Snippet Grachev ID, Meyer PM, Becker GA, Bronzel M, Marsteller D, Pastino G, Voges O, Rabinovich L, Knebel H, Zientek F, Rullmann M, Sattler B, Patt M, Gerhards T, Strauss M, Kluge A, Brust P, Savola JM, Gordon MF, Geva M, Hesse S, Barthel H, Hayden MR, Sabri O.
In-Text Gene Mentions

…Huntingtin gene (HTT).…

Show Full Abstract

<h4>Purpose</h4>Pridopidine is an investigational drug for Huntington disease (HD). Pridopidine was originally thought to act as a dopamine stabilizer. However, pridopidine shows highest affinity to the sigma-1 receptor (S1R) and enhances neuroprotection via the S1R in preclinical studies. Using [<sup>18</sup>F] fluspidine and [<sup>18</sup>F] fallypride PET, the purpose of this study was to assess in vivo target engagement/receptor occupancy of pridopidine to the S1R and dopamine D2/D3 receptor (D2/D3R) at clinical relevant doses in healthy volunteers (HVs) and as proof-of-concept in a small number of patients with HD.<h4>Methods</h4>Using [<sup>18</sup>F] fluspidine PET (300 MBq, 0-90 min), 11 male HVs (pridopidine 0.5 to 90 mg; six dose groups) and three male patients with HD (pridopidine 90 mg) were investigated twice, without and 2 h after single dose of pridopidine. Using [<sup>18</sup>F] fallypride PET (200 MBq, 0-210 min), four male HVs were studied without and 2 h following pridopidine administration (90 mg). Receptor occupancy was analyzed by the Lassen plot.<h4>Results</h4>S1R occupancy as function of pridopidine dose (or plasma concentration) in HVs could be described by a three-parameter Hill equation with a Hill coefficient larger than one. A high degree of S1R occupancy (87% to 91%) was found throughout the brain at pridopidine doses ranging from 22.5 to 90 mg. S1R occupancy was 43% at 1 mg pridopidine. In contrast, at 90 mg pridopidine, the D2/D3R occupancy was only minimal (~ 3%).<h4>Conclusions</h4>Our PET findings indicate that at clinically relevant single dose of 90 mg, pridopidine acts as a selective S1R ligand showing near to complete S1R occupancy with negligible occupancy of the D2/D3R. The dose S1R occupancy relationship suggests cooperative binding of pridopidine to the S1R. Our findings provide significant clarification about pridopidine's mechanism of action and support further use of the 45-mg twice-daily dose to achieve full and selective targeting of the S1R in future clinical trials of neurodegenerative disorders. Clinical Trials.gov Identifier: NCT03019289 January 12, 2017; EUDRA-CT-Nr. 2016-001757-41.

Also flagged:Sickle Cell DiseaseCD34CD38hydroxyureachemokinesCCL2
Journal Article 2020-09-29 ✓ 1 Snippet Minniti CP, Tolu SS, Wang K, Yan Z, Robert K, Zhang S, Crouch AS, Uehlinger J, Manwani D, Bouhassira EE.
In-Text Gene Mentions

…addition to Bcl11a,Sox6, Klf1, and Tal1…

Show Full Abstract

The concentration of circulating hematopoietic stem and progenitor cells has not been studied longitudinally. Here, we report that the proportions of Lin-CD34+38- hematopoietic multipotent cells (HMCs) and of Lin-CD34+CD38+ hematopoietic progenitors cells (HPCs) are highly variable between individuals but stable over long periods of time, in both healthy individuals and sickle cell disease (SCD) patients. This suggests that these proportions are regulated by genetic polymorphisms or by epigenetic mechanisms. We also report that in SCD patients treated with hydroxyurea, the proportions of circulating HMCs and HPCs show a strong positive and negative correlation with fetal hemoglobin (HbF) levels, respectively. Titration of 65 cytokines revealed that the plasma concentration of chemokines CCL2, CCL11, CCL17, CCL24, CCL27, and PDGF-BB were highly correlated with the proportion of HMCs and HPCs and that a subset of these cytokines were also correlated with HbF levels. A linear model based on four of these chemokines could explain 80% of the variability in the proportion of circulating HMCs between individuals. The proportion of circulating HMCs and HPCs and the concentration of these chemokines might therefore become useful biomarkers for HbF response to HU in SCD patients. Such markers might become increasingly clinically relevant, as alternative treatment modalities for SCD are becoming available.

Also flagged:PCatumourprostate tumourtumourscytokeratin 8androgen receptor
Journal Article 2020-09-29 ✓ 5 Snippets Haughey CM, Mukherjee D, Steele RE, Popple A, Dura-Perez L, Pickard A, Patel M, Jain S, Mullan PB, Williams R, Oliveira P, Buckley NE, Honeychurch J, S McDade S, Illidge T, Mills IG, Eddie SL.
In-Text Gene Mentions

…Unfortunately,TRAMP C1C1 allografts develop…

…DVL3 and theTRAMP C1C1 tumours were…

…cells compared toTRAMP C1C1 and the…

…dissociated DVL3 andTRAMP C1C1 (gating strategy…

…compared to theTRAMP C1C1 tumours (…

Show Full Abstract

The prostate cancer (PCa) field lacks clinically relevant, syngeneic mouse models which retain the tumour microenvironment observed in PCa patients. This study establishes a cell line from prostate tumour tissue derived from the <i>Pten<sup>-/-</sup>/trp53<sup>-/-</sup></i> mouse, termed DVL3 which when subcutaneously implanted in immunocompetent C57BL/6 mice, forms tumours with distinct glandular morphology, strong cytokeratin 8 and androgen receptor expression, recapitulating high-risk localised human PCa. Compared to the commonly used TRAMP C1 model, generated with SV40 large T-antigen, DVL3 tumours are immunologically cold, with a lower proportion of CD8+ T-cells, and high proportion of immunosuppressive myeloid derived suppressor cells (MDSCs), thus resembling high-risk PCa. Furthermore, DVL3 tumours are responsive to fractionated RT, a standard treatment for localised and metastatic PCa, compared to the TRAMP C1 model. RNA-sequencing of irradiated DVL3 tumours identified upregulation of type-1 interferon and STING pathways, as well as transcripts associated with MDSCs. Upregulation of STING expression in tumour epithelium and the recruitment of MDSCs following irradiation was confirmed by immunohistochemistry. The DVL3 syngeneic model represents substantial progress in preclinical PCa modelling, displaying pathological, micro-environmental and treatment responses observed in molecular high-risk disease. Our study supports using this model for development and validation of treatments targeting PCa, especially novel immune therapeutic agents.

Also flagged:neurodegenerative diseasesneurodegenerative diseaseADagingmitochondrialamyloid-β
Journal Article 2020-09-29 ✓ 1 Snippet Ali AM, Kunugi H.
In-Text Gene Mentions

Glial activation and high levels of cytokines contribute to the upregulation of astrocytic serotonin transporter (5-HTT) and the reduction of extracellular serotonin/5-HT levels [148].

Show Full Abstract

The astronomical increase of the world's aged population is associated with the increased prevalence of neurodegenerative diseases, heightened disability, and extremely high costs of care. Alzheimer's Disease (AD) is a widespread, age-related, multifactorial neurodegenerative disease that has enormous social and financial drawbacks worldwide. The unsatisfactory outcomes of available AD pharmacotherapy necessitate the search for alternative natural resources that can target various the underlying mechanisms of AD pathology and reduce disease occurrence and/or progression. Royal jelly (RJ) is the main food of bee queens; it contributes to their fertility, long lifespan, and memory performance. It represents a potent nutraceutical with various pharmacological properties, and has been used in a number of preclinical studies to target AD and age-related cognitive deterioration. To understand the mechanisms through which RJ affects cognitive performance both in natural aging and AD, we reviewed the literature, elaborating on the metabolic, molecular, and cellular mechanisms that mediate its anti-AD effects. Preclinical findings revealed that RJ acts as a multidomain cognitive enhancer that can restore cognitive performance in aged and AD models. It promotes brain cell survival and function by targeting multiple adversities in the neuronal microenvironment such as inflammation, oxidative stress, mitochondrial alterations, impaired proteostasis, amyloid-β toxicity, Ca excitotoxicity, and bioenergetic challenges. Human trials using RJ in AD are limited in quantity and quality. Here, the limitations of RJ-based treatment strategies are discussed, and directions for future studies examining the effect of RJ in cognitively impaired subjects are noted.

Also flagged:osteoarthritistranslationalosteochondritis dissecansOAinfectionknee
Journal Article 2020-09-29 No Snippets Madry H, Venkatesan JK, Carballo-Pedrares N, Rey-Rico A, Cucchiarini M.
Show Full Abstract

Osteochondral defects involve both the articular cartilage and the underlying subchondral bone. If left untreated, they may lead to osteoarthritis. Advanced biomaterial-guided delivery of gene vectors has recently emerged as an attractive therapeutic concept for osteochondral repair. The goal of this review is to provide an overview of the variety of biomaterials employed as nonviral or viral gene carriers for osteochondral repair approaches both in vitro and in vivo, including hydrogels, solid scaffolds, and hybrid materials. The data show that a site-specific delivery of therapeutic gene vectors in the context of acellular or cellular strategies allows for a spatial and temporal control of osteochondral neotissue composition in vitro. In vivo, implantation of acellular hydrogels loaded with nonviral or viral vectors has been reported to significantly improve osteochondral repair in translational defect models. These advances support the concept of scaffold-mediated gene delivery for osteochondral repair.

Also flagged:COVID-19intracerebral hemorrhageacute hemorrhagic necrotizing encephalopathymeningitisencephalitisencephalopathy
Journal Article 2020-09-29 ✓ 2 Snippets Padda I, Khehra N, Jaferi U, Parmar MS.
In-Text Gene Mentions

…reported antithrombin III (ATIII) as a biomarker…

…DD, FDP, andATIIIto be predictors…

Show Full Abstract

Several neurological manifestations and complications linked to SARS-CoV-2 have been reported along with well-known respiratory pathology. The global active transmission of SARS-CoV-2 and its unexplained characteristics has led to a pandemic. Since its rapid emergence from Wuhan, China, in December 2019, several studies have reported the impacts of COVID-19 on the CNS and PNS and its implications. This comprehensive review article comprises case reports, case series, metaanalysis, cohort studies, retrospective studies, and narrative reviews focusing on COVID-19-associated CNS and PNS complexities. The authors searched for over 200 articles and used 52 publications related to the neurological complexities of COVID-19 affecting the CNS and PNS as part of the literature review process. The predominant CNS symptoms noted in COVID-19 patients were headaches and dizziness, and the most common PNS symptoms were alterations in smell and taste. Case reports on headache/dizziness, intracerebral hemorrhage, acute hemorrhagic necrotizing encephalopathy, meningitis/encephalitis, encephalopathy, cerebrovascular events, chemosensory dysfunction, Guillain-Barre syndrome, and acute transverse myelitis/acute necrotizing myelitis in PCR-confirmed SARS-CoV-2 subjects are also reported. New-onset neurological symptoms were also observed in children with PCR-confirmed SARS-CoV-2 that developed pediatric multisystem inflammatory syndrome (PIMS). This comprehensive review article will assist the clinicians and researchers to gain information about the neurological manifestations and complications associated with COVID-19 and develop planning to treat these symptoms in concerned patients of all ages. However, it is unclear whether SARS-CoV2-associated neurological effects are due to primary infections or secondary response to the possible mechanisms discussed in this review.

Also flagged:mitochondrialcell cyclePeroxiredoxin 6tumorcancerphospholipid hydroperoxides
Journal Article 2020-09-29 ✓ 5 Snippets López-Grueso MJ, Lagal DJ, García-Jiménez ÁF, Tarradas RM, Carmona-Hidalgo B, Peinado J, Requejo-Aguilar R, Bárcena JA, Padilla CA.
In-Text Gene Mentions

However, this does not seem to be the case, indicating that either oxidative equivalents do not reach KEAP1 cysteines when PRDX6 is absent or that NRF2 is being down-regulated by a KEAP1-independent mechanism.

The prominent induction of Fatty acylCoA-6-desaturase (FADS2) and microsomal cytochrome b5, two enzymes responsible for the first steps of long chain polyunsaturated fatty acids (LC-PUFA) and eicosanoids biosynthesis, could be a compensatory cellular response to deprivation of arachidonic acid (AA) caused by lack of PRDX6.

The PLA2 activity of PRDX6 on phosphatidylcholine phospholipids would stimulate the production of lysophosphatidic acid (LPA) and the sequential action of its peroxidase and PLA2 activities would also liberate a hydroxy fatty acid (HFA) [19,20].

Elevated levels of PRDX6 have been found in a broad variety of human cancers and its overexpression promotes invasion and metastasis in lung cancer [13] and growth of lung tumors in mice through activation of JAK2/STAT3 signaling [14].

Moreover, a relationship has been described between AA and PRDX6 tumor promoting functions [13] through activation of NOX2 or Src family kinases (SFK) [16].

Show Full Abstract

Peroxiredoxin 6 (PRDX6) has been associated with tumor progression and cancer metastasis. Its acting on phospholipid hydroperoxides and its phospholipase-A2 activity are unique among the peroxiredoxin family and add complexity to its action mechanisms. As a first step towards the study of PRDX6 involvement in cancer, we have constructed a human hepatocarcinoma HepG2<sup>PRDX6</sup><sup>-</sup><sup>/-</sup> cell line using the CRISPR/Cas9 technique and have characterized the cellular response to lack of PRDX6. Applying quantitative global and redox proteomics, flow cytometry, in vivo extracellular flow analysis, Western blot and electron microscopy, we have detected diminished respiratory capacity, downregulation of mitochondrial proteins and altered mitochondrial morphology. Autophagic vesicles were abundant while the unfolded protein response (UPR), HIF1A and NRF2 transcription factors were not activated, despite increased levels of p62/SQSTM1 and reactive oxygen species (ROS). Insulin receptor (INSR), 3-phosphoinositide-dependent protein kinase 1 (PDPK1), uptake of glucose and hexokinase-2 (HK2) decreased markedly while nucleotide biosynthesis, lipogenesis and synthesis of long chain polyunsaturated fatty acids (LC-PUFA) increased. 254 Cys-peptides belonging to 202 proteins underwent significant redox changes. PRDX6 knockout had an antiproliferative effect due to cell cycle arrest at G2/M transition, without signs of apoptosis. Loss of PLA2 may affect the levels of specific lipids altering lipid signaling pathways, while loss of peroxidase activity could induce redox changes at critical sensitive cysteine residues in key proteins. Oxidation of specific cysteines in Proliferating Cell Nuclear Antigen (PCNA) could interfere with entry into mitosis. The GSH/Glutaredoxin system was downregulated likely contributing to these redox changes. Altogether the data demonstrate that loss of PRDX6 slows down cell division and alters metabolism and mitochondrial function, so that cell survival depends on glycolysis to lactate for ATP production and on AMPK-independent autophagy to obtain building blocks for biosynthesis. PRDX6 is an important link in the chain of elements connecting redox homeostasis and proliferation.

Also flagged:gene expressionendoplasmic reticulumtunicamycinmetabolismimmune responsesynthesis
Journal Article 2020-09-29 No Snippets Mav D, Phadke DP, Balik-Meisner MR, Merrick BA, Auerbach S, Niemeijer M, Huppelschoten S, Baze A, Parmentier C, Richert L, van de Water B, Shah RR, Paules RS.
Show Full Abstract

The TempO-Seq S1500+ platform(s), now available for human, mouse, rat, and zebrafish, measures a discrete number of genes that are representative of biological and pathway co-regulation across the entire genome in a given species. While measurement of these genes alone provides a direct assessment of gene expression activity, extrapolating expression values to the whole transcriptome (~26 000 genes in humans) can estimate measurements of non-measured genes of interest and increases the power of pathway analysis algorithms by using a larger background gene expression space. Here, we use data from primary hepatocytes of 54 donors that were treated with the endoplasmic reticulum (ER) stress inducer tunicamycin and then measured on the human S1500+ platform containing ~3000 representative genes. Measurements for the S1500+ genes were then used to extrapolate expression values for the remaining human transcriptome. As a case study of the improved downstream analysis achieved by extrapolation, the "measured only" and "whole transcriptome" (measured + extrapolated) gene sets were compared. Extrapolation increased the number of significant genes by 49%, bringing to the forefront many that are known to be associated with tunicamycin exposure. The extrapolation procedure also correctly identified established tunicamycin-related functional pathways reflected by coordinated changes in interrelated genes while maintaining the sample variability observed from the "measured only" genes. Extrapolation improved the gene- and pathway-level biological interpretations for a variety of downstream applications, including differential expression analysis, gene set enrichment pathway analysis, DAVID keyword analysis, Ingenuity Pathway Analysis, and NextBio correlated compound analysis. The extrapolated data highlight the role of metabolism/metabolic pathways, the ER, immune response, and the unfolded protein response, each of which are key activities associated with tunicamycin exposure that were unrepresented or underrepresented in one or more of the analyses of the original "measured only" dataset. Furthermore, the inclusion of the extrapolated genes raised "tunicamycin" from third to first upstream regulator in Ingenuity Pathway Analysis and from sixth to second most correlated compound in NextBio analysis. Therefore, our case study suggests an approach to extend and enhance data from the S1500+ platform for improved insight into biological mechanisms and functional outcomes of diseases, drugs, and other perturbations.

Also flagged:termkeyhowoxygenfolateindocyanine green
Journal Article 2020-09-29 No Snippets Huda K, Wu C, Sider JG, Bayer CL.
Show Full Abstract

Photoacoustic tomography has great potential to image dynamic functional changes <i>in vivo</i>. Many tomographic systems are built with a circular view geometry, necessitating a linear translation along one axis of the subject to obtain a three-dimensional volume. In this work, we evaluated a prototype spherical view photoacoustic tomographic system which acquires a 3D volume in a single scan, without linear translation. We simultaneously measured relative hemoglobin oxygen saturation in multiple placentas of pregnant mice under oxygen challenge. We also synthesized a folate-conjugated indocyanine green (ICG) contrast agent to image folate kinetics in the placenta. Photoacoustic tomography performed at the wavelength of peak optical absorption of our contrast agent revealed increased ICG signal over time. Through these phantom and <i>in vivo</i> studies, we have demonstrated that the spherical view 3D photoacoustic tomographic system achieves high sensitivity and fast image acquisition, enabling <i>in vivo</i> experiments to assess physiological and molecular dynamics.

Also flagged:Estrogen ReceptorBreast CancerTamoxifenFulvestrantmalignant tumorER
Journal Article 2020-09-29 No Snippets Cheng R, Qi L, Kong X, Wang Z, Fang Y, Wang J.
Show Full Abstract

Breast cancer is the most frequent malignant tumor in women, and the estrogen receptor (ER) plays a vital role in the vast majority of breast cancers. The purpose of the present study was to identify the significant genes regulated by ER in ER-positive breast cancer and to explore their expression pattern changes when tamoxifen or fulvestrant resistance occurs. For this purpose, the gene expression profiles GSE11324, GSE27473, and GSE5840 from the Gene Expression Omnibus database were used, which contain gene expression data from MCF7 cells treated with estrogen, MCF7 cells with silencing of ER, and tamoxifen- and fulvestrant-resistant MCF7 cells treated with estrogen (17β-estradiol), respectively. Differentially expressed genes (DEGs) between the treatment group and negative control were identified and subjected to pathway enrichment and protein-protein interaction (PPI) analyses. There were 230 DEGs in common among the three datasets, including 160 genes positively regulated by ER and 70 genes negatively regulated by ER. DEGs mainly showed enrichment for pathways in cancer, progesterone-mediated oocyte maturation, RNA transport, glycerophospholipid metabolism, oocyte meiosis, platelet activation, and so on. PPI network and modular analysis selected three significant clusters containing 19 genes. A total of 44 genes were involved in Kyoto Encyclopedia of Gene and Genome pathway results or PPI modular analysis, and 16 of them were found to correlate with relapse-free survival in patients with ER<sup>+</sup>/human epidermal growth factor receptor 2-negative breast cancer who had undergone endocrine therapies only. Some of the genes' expression patterns were different among wild-type, tamoxifen-resistant, and fulvestrant-resistant MCF7 cells such as <i>DDX18</i>, <i>ANAPC7</i>, <i>MAD2L1</i>, <i>RSL1D1</i>, and <i>CALCR</i>, etc., indicating different resistance mechanisms and potential prognostic markers or therapeutic targets for fulvestrant- or tamoxifen-resistant breast cancer.

Also flagged:Cardiac FibrosisComplete heart blockcardiomyopathyRadiation-induced heart diseaselymphomabreast cancer
Journal Article 2020-09-29 ✓ 1 Snippet Malyshev Y, Chukwuka N, Hashmi AT, Rosanel S, Kulbak G.
In-Text Gene Mentions

…diseases like amyloidosis,hemochromatosis, and sarcoidosis […

Show Full Abstract

Complete heart block (CHB) in a young patient is a rare phenomenon necessitating an extensive workup to identify the etiology of conduction disturbance. Radiotherapy of the thorax is a known risk factor for cardiomyopathy; however, CHB is a rare complication. Here we present a case of a 46-year-old man who presented with CHB and was found to have significant cardiac fibrosis and calcification of the mitral valve annulus. His management required a multidisciplinary and multimodality approach to be able to identify childhood radiation as the cause of cardiomyopathy and establish a personalized management strategy with cardiac resynchronization therapy defibrillator. This case highlights radiation therapy as an important cause of cardiac conduction abnormalities even decades later, and the importance of extensive search for other reversible etiologies using the multimodality approach.

Also flagged:Mitochondrial diseasesphosphorylationmitochondrialmitochondrial diseaseMitochondriaorganelles
Journal Article 2020-09-29 ✓ 4 Snippets Saneto RP.
In-Text Gene Mentions

…repeat protein 4 (FBXL4) is located in…

…space and recessiveFBXL4variants have been…

…with overexpression ofFBXL4were found to…

…ndrial hyperfusion, suggestingFBXL4involvement in fusion…

Show Full Abstract

Mitochondrial diseases are clinically and genetically heterogeneous. These diseases were initially described a little over three decades ago. Limited diagnostic tools created disease descriptions based on clinical, biochemical analytes, neuroimaging, and muscle biopsy findings. This diagnostic mechanism continued to evolve detection of inherited oxidative phosphorylation disorders and expanded discovery of mitochondrial physiology over the next two decades. Limited genetic testing hampered the definitive diagnostic identification and breadth of diseases. Over the last decade, the development and incorporation of massive parallel sequencing has identified approximately 300 genes involved in mitochondrial disease. Gene testing has enlarged our understanding of how genetic defects lead to cellular dysfunction and disease. These findings have expanded the understanding of how mechanisms of mitochondrial physiology can induce dysfunction and disease, but the complete collection of disease-causing gene variants remains incomplete. This article reviews the developments in disease gene discovery and the incorporation of gene findings with mitochondrial physiology. This understanding is critical to the development of targeted therapies.

Also flagged:tumorimmune responsesantibodiescancerB7CD28
Journal Article 2020-09-29 No Snippets Zhang C, Zhang Z, Sun N, Zhang Z, Zhang G, Wang F, Luo Y, Che Y, He J.
Show Full Abstract

<h4>Background</h4>Costimulatory molecules play significant roles in mounting anti-tumor immune responses, and antibodies targeting these molecules are recognized as promising adjunctive cancer immunotherapies. Here, we aim to conduct a first full-scale exploration of costimulatory molecules from the B7-CD28 and TNF families in patients with lung adenocarcinoma (LUAD) and generated a costimulatory molecule-based signature (CMS) to predict survival and response to immunotherapy.<h4>Methods</h4>We enrolled 1549 LUAD cases across 10 different cohorts and included 502 samples from TCGA for discovery. The validation set included 970 cases from eight different Gene Expression Omnibus (GEO) datasets and 77 frozen tumor tissues with qPCR data. The underlying mechanisms and predictive immunotherapy capabilities of the CMS were also explored.<h4>Results</h4>A five gene-based CMS (CD40LG, TNFRSF6B, TNFSF13, TNFRSF13C, and TNFRSF19) was initially constructed using the bioinformatics method from TCGA that classifies cases as high- vs. low-risk groups per OS. Multivariable Cox regression analysis confirmed that the CMS was an independent prognostic factor. As expected, CMS exhibited prognostic significance in the stratified cohorts and different validation cohorts. Additionally, the prognostic meta-analysis revealed that CMS was superior to the previous signature. Samples in high- and low-risk groups exhibited significantly different tumor-infiltrating leukocytes and inflammatory activities. Importantly, we found that the CMS scores were closely related to multiple immunotherapy biomarkers.<h4>Conclusion</h4>We conducted the first and most comprehensive costimulatory molecule landscape analysis of patients with LUAD and built a clinically feasible CMS for prognosis and immunotherapy response prediction, which will be helpful for further optimize immunotherapies for cancer.

Also flagged:HDautosomal dominant neurodegenerative disorderbehavioralcytosineadenineguanine
Journal Article 2020-09-29 ✓ 1 Snippet Hett K, Giraud R, Johnson H, Paulsen JS, Long JD, Oguz I.
In-Text Gene Mentions

HTT

Show Full Abstract

Deep learning techniques have demonstrated state-of-the-art performances in many medical imaging applications. These methods can efficiently learn specific patterns. An alternative approach to deep learning is patch-based grading methods, which aim to detect local similarities and differences between groups of subjects. This latter approach usually requires less training data compared to deep learning techniques. In this work, we propose two major contributions: first, we combine patch-based and deep learning methods. Second, we propose to extend the patch-based grading method to a new patch-based abnormality metric. Our method enables us to detect localized structural abnormalities in a test image by comparison to a template library consisting of images from a variety of healthy controls. We evaluate our method by comparing classification performance using different sets of features and models. Our experiments show that our novel patch-based abnormality metric increases deep learning performance from 91.3% to 95.8% of accuracy compared to standard deep learning approaches based on the MRI intensity.

SSRN 2020-09-29 Preprint (No Snippets API) Maras JS, Sharma S, Bhat A, Rooge s, Agarwal R, Gupta E, Sarin SK.
Show Full Abstract

Rapid diagnosis and outcome prediction of SARS-CoV-2 infection remains a major challenge. A multi-omic approach was adopted, and in the discovery phase, respiratory specimens of 20 SARS-CoV-2 positive, 20 negative and 5 H1N1 positive cases were subjected to global proteomics, metaproteomics and metabolomics. We identified MX1 (MX Dynamin like GTPase 1) and WARS (Tryptophan--tRNA ligase) as clues to viral diagnosis and outcome which was validated in 200 SARS-CoV-2 suspects. MX1>30pg/ml and WARS>25ng/ml distinctly segregated virus positives [AUC=94%CI(0.91-0.97)], severe and symptomatic patients [AUC>0.85%]. SARS-CoV-2 infection mediated a distinct increase in immune activation, metabolic reprograming and decrease in oxygen transport, wound healing, vitamin and steroid metabolism. Multi-omics profiling correlated with viraemia and segregated asymptomatic COVID-19 patients. Additionally, we identified increased respiratory pathogens [Burkholderiales, Klebsiella-pneumonia] and decreased lactobacillus salivarius (FDR<0.05) in COVID-19 specimens.<br><br>Conclusion: Baseline levels of MX1 and WARS can reliably diagnose SARS-CoV-2 infection and identify patient’s predisposed to higher severity.<br><br>FundIng: The work was supported from project DST (DST-SERB) (EMR/2016/004829).<br><br>Conflict of Interest: All authors have declared no conflict of interest.<br>

Also flagged:NS2AdegradationKPNA2karyopherin subunit alpha 2nucleocytoplasmictransporter
Journal Article 2020-09-28 ✓ 1 Snippet He J, Yang L, Chang P, Yang S, Lin S, Tang Q, Wang X, Zhang YJ.
In-Text Gene Mentions

POU3F2

Show Full Abstract

KPNA2/importin-alpha1 (karyopherin subunit alpha 2) is the primary nucleocytoplasmic transporter for some transcription factors to activate cellular proliferation and differentiation. Aberrant increase of KPNA2 level is identified as a prognostic marker in a variety of cancers. Yet, the turnover mechanism of KPNA2 remains unknown. Here, we demonstrate that KPNA2 is degraded via the chaperone-mediated autophagy (CMA) and that Zika virus (ZIKV) enhances the KPNA2 degradation. KPNA2 contains a CMA motif, which possesses an indispensable residue Gln109 for the CMA-mediated degradation. RNAi-mediated knockdown of LAMP2A, a vital component of the CMA pathway, led to a higher level of KPNA2. Moreover, ZIKV reduced KPNA2 via the viral NS2A protein, which contains an essential residue Thr100 for inducing the CMA-mediated KPNA2 degradation. Notably, mutant ZIKV with T100A alteration in NS2A replicates much weaker than the wild-type virus. Also, knockdown of KPNA2 led to a higher ZIKV viral yield, which indicates that KPNA2 mediates certain antiviral effects. These data provide insights into the KPNA2 turnover and the ZIKV-cell interactions.

Also flagged:neuropeptidespeptidessecretogranin-2phosphatidylethanolamine-binding protein-1synapseslong-term potentiation
Journal Article 2020-09-28 ✓ 1 Snippet Liu R, Wei P, Keller C, Orefice NS, Shi Y, Li Z, Huang J, Cui Y, Frost DC, Han S, Cross TL, Rey FE, Li L.
In-Text Gene Mentions

PEBP1

Show Full Abstract

Gut microbiota can regulate host physiological and pathological status through gut-brain communications or pathways. However, the impact of the gut microbiome on neuropeptides and proteins involved in regulating brain functions and behaviors is still not clearly understood. To address the problem, integrated label-free and 10-plex DiLeu isobaric tag-based quantitative methods were implemented to compare the profiling of neuropeptides and proteins in the hypothalamus of germ-free (GF)- vs conventionally raised (ConvR)-mice. A total of 2943 endogenous peptides from 63 neuropeptide precursors and 3971 proteins in the mouse hypothalamus were identified. Among these 368 significantly changed peptides (fold changes over 1.5 and a <i>p</i>-value of <0.05), 73.6% of the peptides showed higher levels in GF-mice than in ConvR-mice, and 26.4% of the peptides had higher levels in ConvR-mice than in GF-mice. These peptides were mainly from secretogranin-2, phosphatidylethanolamine-binding protein-1, ProSAAS, and proenkephalin-A. A quantitative proteomic analysis employing DiLeu isobaric tags revealed that 282 proteins were significantly up- or down-regulated (fold changes over 1.2 and a <i>p</i>-value of <0.05) among the 3277 quantified proteins. These neuropeptides and proteins were mainly involved in regulating behaviors, transmitter release, signaling pathways, and synapses. Interestingly, pathways including long-term potentiation, long-term depression, and circadian entrainment were involved. In the present study, a combined label-free and 10-plex DiLeu-based quantitative method enabled a comprehensive profiling of gut microbiome-induced dynamic changes of neuropeptides and proteins in the hypothalamus, suggesting that the gut microbiome might mediate a range of behavioral changes, brain development, and learning and memory through these neuropeptides and proteins.

Also flagged:reninangiotensinaldosteroneACE2heart failurediabetes mellitus
Journal Article 2020-09-28 No Snippets Chirinos JA, Cohen JB, Zhao L, Hanff T, Sweitzer N, Fang J, Corrales-Medina V, Anmar R, Morley M, Zamani P, Bhattacharya P, Brandimarto J, Jia Y, Basso MD, Wang Z, Ebert C, Ramirez-Valle F, Schafer PH, Seiffert D, Gordon DA, Cappola T.
Show Full Abstract

ACE2 (angiotensin-converting enzyme 2) is a key component of the renin-angiotensin-aldosterone system. Yet, little is known about the clinical and biologic correlates of circulating ACE2 levels in humans. We assessed the clinical and proteomic correlates of plasma (soluble) ACE2 protein levels in human heart failure. We measured plasma ACE2 using a modified aptamer assay among PHFS (Penn Heart Failure Study) participants (n=2248). We performed an association study of ACE2 against ≈5000 other plasma proteins measured with the SomaScan platform. Plasma ACE2 was not associated with ACE inhibitor and angiotensin-receptor blocker use. Plasma ACE2 was associated with older age, male sex, diabetes mellitus, a lower estimated glomerular filtration rate, worse New York Heart Association class, a history of coronary artery bypass surgery, and higher pro-BNP (pro-B-type natriuretic peptide) levels. Plasma ACE2 exhibited associations with 1011 other plasma proteins. In pathway overrepresentation analyses, top canonical pathways associated with plasma ACE2 included clathrin-mediated endocytosis signaling, actin cytoskeleton signaling, mechanisms of viral exit from host cells, EIF2 (eukaryotic initiation factor 2) signaling, and the protein ubiquitination pathway. In conclusion, in humans with heart failure, plasma ACE2 is associated with various clinical factors known to be associated with severe coronavirus disease 2019 (COVID-19), including older age, male sex, and diabetes mellitus, but is not associated with ACE inhibitor and angiotensin-receptor blocker use. Plasma ACE2 protein levels are prominently associated with multiple cellular pathways involved in cellular endocytosis, exocytosis, and intracellular protein trafficking. Whether these have a causal relationship with ACE2 or are relevant to novel coronavirus-2 infection remains to be assessed in future studies.

Also flagged:spermidineglyoxalasemembranelipidascorbic acidglutathione
Journal Article 2020-09-28 ✓ 1 Snippet Li C, Han Y, Hao J, Qin X, Liu C, Fan S.
In-Text Gene Mentions

Vigna radiata L .

Show Full Abstract

In this research, the lettuce high-temperature-sensitive variety Beisan San 3 was used as a test material. The effects of exogenous spermidine (Spd) on membrane lipid peroxidation, the antioxidant system, the ascorbic acid-glutathione (AsA-GSH) system and the glyoxalase (Glo) system in lettuce seedlings under high-temperature stress were studied by spraying either 1 mM spermidine or ionized water as a control. The results showed that, under high-temperature stress, the growth of lettuce seedlings was weak, and the dry weight (DW) and fresh weight (FW) were reduced by 68.9% and 82%, respectively, compared with those of the normal-temperature controls. In addition, the degree of membrane lipid peroxidation increased, and the reactive oxygen species (ROS) level increased, both of which led to a significant increase in malondialdehyde (MDA) content and lipoxygenase (LOX) activity. Under high-temperature stress, the activity of superoxide dismutase (SOD) decreased, the activities of peroxidase (POD) and catalase (CAT) increased first but then decreased, and the activity of ascorbic acid peroxidase (APX) decreased first but then increased. Glutathione reductase (GR) activity, ascorbic acid (AsA) and glutathione (GSH) content showed an upward trend under high-temperature stress. The activities of glyoxalase (GloI and GloII) in the lettuce seedling leaves increased significantly under high-temperature stress. In contrast, the application of exogenous Spd alleviated the oxidative damage to the lettuce seedlings, which showed a decrease in MDA content and LOX activity and an increase in SOD, POD, CAT, APX, GR, GloI, and GloII activities. In addition, the antioxidant AsA and GSH contents also increased to varying degrees. It can be seen from the results that high temperature stress leads to an increase in the level of ROS and cause peroxidation in lettuce seedlings, and exogenous Spd can enhance the ability of lettuce seedlings to withstand high temperature by enhancing the antioxidant system, glyoxalase system and AsA-GSH cycle system.

Also flagged:heart failurediastolic dysfunctionLV hypertrophyNPdysfunctionheart failure with preserved ejection
Journal Article 2020-09-28 ✓ 1 Snippet Kapłon-Cieślicka A, Kupczyńska K, Dobrowolski P, Michalski B, Jaguszewski MJ, Banasiak W, Burchardt P, Chrzanowski Ł, Darocha S, Domienik-Karłowicz J, Drożdż J, Fijałkowski M, Filipiak KJ, Gruchała M, Jankowska EA, Jankowski P, Kasprzak JD, Kosmala W, Lipiec P, Mitkowski P, Mizia-Stec K, Szymański P, Tycińska A, Wańha W, Wybraniec M, Witkowski A, Ponikowski P, "Club 30" Of The Polish Cardiac Society OBO.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

The definition of heart failure with preserved ejection fraction (HFpEF) has evolved from a clinically based "diagnosis of exclusion" to definitions focused on objective evidence of diastolic dysfunction and/or elevated left ventricular filling pressures. Despite advances in our understanding of HFpEF pathophysiology and the development of more sophisticated imaging modalities, the diagnosis of HFpEF remains challenging, especially in the chronic setting, given that symptoms are provoked by exertion and diagnostic evaluation is largely conducted at rest. Invasive hemodynamic study, and in particular - invasive exercise testing, is considered the reference method for HFpEF diagnosis. However, its use is limited as opposed to the high number of patients with suspected HFpEF. Thus, diagnostic criteria for HFpEF should be principally based on non-invasive measurements. As no single non-invasive variable can adequately corroborate or refute the diagnosis, different combinations of clinical, echocardiographic, and/or biochemical parameters have been introduced. Recent years have brought an abundance of HFpEF definitions. Here, we present and compare four of them: 1) the 2016 European Society of Cardiology criteria for HFpEF; 2) the 2016 echocardiographic algorithm for diagnosing diastolic dysfunction; 3) the 2018 evidence-based H2FPEF score; and 4) the most recent, 2019 Heart Failure Association HFA-PEFF algorithm. These definitions vary in their approach to diagnosis, as well as sensitivity and specificity. Further studies to validate and compare the diagnostic accuracy of HFpEF definitions are warranted. Nevertheless, it seems that the best HFpEF definition would originate from a randomized clinical trial showing a favorable effect of an intervention on prognosis in HFpEF.

Also flagged:prostate cancerAtherosclerosisNKX3-1cancerdeathgene expression
Journal Article 2020-09-28 ✓ 2 Snippets Fiorica PN, Schubert R, Morris JD, Abdul Sami M, Wheeler HE.
In-Text Gene Mentions

…genes were identified:PLCL1, NKX3-1 ,…

PLCL1has been nominally…

Show Full Abstract

The genetic risk for prostate cancer has been governed by a few rare variants with high penetrance and over 150 commonly occurring variants with lower impact on risk; however, most of these variants have been identified in studies containing exclusively European individuals. People of non-European ancestries make up less than 15% of prostate cancer GWAS subjects. Across the globe, incidence of prostate cancer varies with population due to environmental and genetic factors. The discrepancy between disease incidence and representation in genetics highlights the need for more studies of the genetic risk for prostate cancer across diverse populations. To better understand the genetic risk for prostate cancer across diverse populations, we performed PrediXcan and GWAS in a case-control study of 4,769 self-identified African American (2,463 cases and 2,306 controls), 2,199 Japanese American (1,106 cases and 1,093 controls), and 2,147 Latin American (1,081 cases and 1,066 controls) individuals from the Multiethnic Genome-wide Scan of Prostate Cancer. We used prediction models from 46 tissues in GTEx version 8 and five models from monocyte transcriptomes in the Multi-Ethnic Study of Atherosclerosis. Across the three populations, we predicted 19 gene-tissue pairs, including five unique genes, to be significantly (lfsr < 0.05) associated with prostate cancer. One of these genes, NKX3-1, replicated in a larger European study. At the SNP level, 110 SNPs met genome-wide significance in the African American study while 123 SNPs met significance in the Japanese American study. Fine mapping revealed three significant independent loci in the African American study and two significant independent loci in the Japanese American study. These identified loci confirm findings from previous GWAS of prostate cancer in diverse populations while PrediXcan-identified genes suggest potential new directions for prostate cancer research in populations across the globe.

Also flagged:AMPKautophagy receptorAutophagydegradationmacroautophagymicroautophagy
Journal Article 2020-09-28 ✓ 3 Snippets Mizuno T, Muroi K, Irie K.
In-Text Gene Mentions

…previous study identifiedCCPG1as an ER-phagy…

…Intriguingly, only mammalianCCPG1and yeast Atg39…

…mammal, expression ofCCPG1acting as an…

Show Full Abstract

Autophagy is a fundamental process responsible for degradation and recycling of intracellular contents. In the budding yeast, non-selective macroautophagy and microautophagy of the endoplasmic reticulum (ER) are caused by ER stress, the circumstance where aberrant proteins accumulate in the ER. The more recent study showed that protein aggregation in the ER initiates ER-selective macroautophagy, referred to as ER-phagy; however, the mechanisms by which ER stress induces ER-phagy have not been fully elucidated. Here, we show that the expression levels of ATG39, encoding an autophagy receptor specific for ER-phagy, are significantly increased under ER-stressed conditions. ATG39 upregulation in ER stress response is mediated by activation of its promoter, which is positively regulated by Snf1 AMP-activated protein kinase (AMPK) and negatively by Mig1 and Mig2 transcriptional repressors. In response to ER stress, Snf1 promotes nuclear export of Mig1 and Mig2. Our results suggest that during ER stress response, Snf1 mediates activation of the ATG39 promoter and consequently facilitates ER-phagy by negatively regulating Mig1 and Mig2.

Also flagged:cognitive declinedementiaAlzheimerADmild cognitive impairmentmemory impairment
Journal Article 2020-09-28 ✓ 5 Snippets Wearn AR, Saunders-Jennings E, Nurdal V, Hadley E, Knight MJ, Newson M, Kauppinen RA, Coulthard EJ.
In-Text Gene Mentions

…TheACE-IIIwas repeated after…

…cognitive decline onACE-IIIover the 12…

…able to predictACE-IIIdecline status (AUC…

…three points onACE-IIIto be detected,…

…responsiveness of theACE-IIIto detecting subtle…

Show Full Abstract

<h4>Background</h4>Here, we address a pivotal factor in Alzheimer's prevention-identifying those at risk early, when dementia can still be avoided. Recent research highlights an accelerated forgetting phenotype as a risk factor for Alzheimer's disease. We hypothesized that delayed recall over 4 weeks would predict cognitive decline over 1 year better than 30-min delayed recall, the current gold standard for detecting episodic memory problems which could be an early clinical manifestation of incipient Alzheimer's disease. We also expected hippocampal subfield volumes to improve predictive accuracy.<h4>Methods</h4>Forty-six cognitively healthy older people (mean age 70.7 ± 7.97, 21/46 female), recruited from databases such as Join Dementia Research, or a local database of volunteers, performed 3 memory tasks on which delayed recall was tested after 30 min and 4 weeks, as well as Addenbrooke's Cognitive Examination III (ACE-III) and CANTAB Paired Associates Learning. Medial temporal lobe subregion volumes were automatically measured using high-resolution 3T MRI. The ACE-III was repeated after 12 months to assess the change in cognitive ability. We used univariate linear regressions and ROC curves to assess the ability of tests of delayed recall to predict cognitive decline on ACE-III over the 12 months.<h4>Results</h4>Fifteen of the 46 participants declined over the year (≥ 3 points lost on ACE-III). Four-week verbal memory predicted cognitive decline in healthy older people better than clinical gold standard memory tests and hippocampal MRI. The best single-test predictor of cognitive decline was the 4-week delayed recall on the world list (R<sup>2</sup> = .123, p = .018, β = .418). Combined with hippocampal subfield volumetry, 4-week verbal recall identifies those at risk of cognitive decline with 93% sensitivity and 86% specificity (AUC = .918, p < .0001).<h4>Conclusions</h4>We show that a test of accelerated long-term forgetting over 4 weeks can predict cognitive decline in healthy older people where traditional tests of delayed recall cannot. Accelerated long-term forgetting is a sensitive, easy-to-test predictor of cognitive decline in healthy older people. Used alone or with hippocampal MRI, accelerated forgetting probes functionally relevant Alzheimer's-related change. Accelerated forgetting will identify early-stage impairment, helping to target more invasive and expensive molecular biomarker testing.

Also flagged:adenomacarcinomacancercolorectal cancertranslational4E-BP1
Journal Article 2020-09-28 ✓ 1 Snippet Smit WL, Spaan CN, Johannes de Boer R, Ramesh P, Martins Garcia T, Meijer BJ, Vermeulen JLM, Lezzerini M, MacInnes AW, Koster J, Medema JP, van den Brink GR, Muncan V, Heijmans J.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Deregulated global <i>mRNA</i> translation is an emerging feature of cancer cells. Oncogenic transformation in colorectal cancer (CRC) is driven by mutations in <i>APC</i>, <i>KRAS</i>, <i>SMAD4</i>, and <i>TP53</i>, known as the adenoma-carcinoma sequence (ACS). Here we introduce each of these driver mutations into intestinal organoids to show that they are modulators of global translational capacity in intestinal epithelial cells. Increased global translation resulting from loss of <i>Apc</i> expression was potentiated by the presence of oncogenic <i>Kras</i><sup><i>G12D</i></sup> Knockdown of <i>Smad4</i> further enhanced global translation efficiency and was associated with a lower 4E-BP1-to-eIF4E ratio. Quadruple mutant cells with additional P53 loss displayed the highest global translational capacity, paralleled by high proliferation and growth rates, indicating that the proteome is heavily geared toward cell division. Transcriptional reprogramming facilitating global translation included elevated ribogenesis and activation of mTORC1 signaling. Accordingly, interfering with the mTORC1/4E-BP/eIF4E axis inhibited the growth potential endowed by accumulation of multiple drivers. In conclusion, the ACS is characterized by a strongly altered global translational landscape in epithelial cells, exposing a therapeutic potential for direct targeting of the translational apparatus.

Also flagged:neurodevelopmental disordersmicrotubulesschizophreniabipolar disorderpsychiatric disorderschromosome
Journal Article 2020-09-28 No Snippets Cuellar-Partida G, Tung JY, Eriksson N, Albrecht E, Aliev F, Andreassen OA, Barroso I, Beckmann JS, Boks MP, Boomsma DI, Boyd HA, Breteler MMB, Campbell H, Chasman DI, Cherkas LF, Davies G, de Geus EJC, Deary IJ, Deloukas P, Dick DM, Duffy DL, Eriksson JG, Esko T, Feenstra B, Geller F, Gieger C, Giegling I, Gordon SD, Han J, Hansen TF, Hartmann AM, Hayward C, Heikkilä K, Hicks AA, Hirschhorn JN, Hottenga JJ, Huffman JE, Hwang LD, Ikram MA, Kaprio J, Kemp JP, Khaw KT, Klopp N, Konte B, Kutalik Z, Lahti J, Li X, Loos RJF, Luciano M, Magnusson SH, Mangino M, Marques-Vidal P, Martin NG, McArdle WL, McCarthy MI, Medina-Gomez C, Melbye M, Melville SA, Metspalu A, Milani L, Mooser V, Nelis M, Nyholt DR, O'Connell KS, Ophoff RA, Palmer C, Palotie A, Palviainen T, Pare G, Paternoster L, Peltonen L, Penninx BWJH, Polasek O, Pramstaller PP, Prokopenko I, Raikkonen K, Ripatti S, Rivadeneira F, Rudan I, Rujescu D, Smit JH, Smith GD, Smoller JW, Soranzo N, Spector TD, Pourcain BS, Starr JM, Stefánsson H, Steinberg S, Teder-Laving M, Thorleifsson G, Stefánsson K, Timpson NJ, Uitterlinden AG, van Duijn CM, van Rooij FJA, Vink JM, Vollenweider P, Vuoksimaa E, Waeber G, Wareham NJ, Warrington N, Waterworth D, Werge T, Wichmann HE, Widen E, Willemsen G, Wright AF, Wright MJ, Xu M, Zhao JH, Kraft P, Hinds DA, Lindgren CM, Mägi R, Neale BM, Evans DM, Medland SE.
Show Full Abstract

Handedness has been extensively studied because of its relationship with language and the over-representation of left-handers in some neurodevelopmental disorders. Using data from the UK Biobank, 23andMe and the International Handedness Consortium, we conducted a genome-wide association meta-analysis of handedness (N = 1,766,671). We found 41 loci associated (P < 5 × 10<sup>-8</sup>) with left-handedness and 7 associated with ambidexterity. Tissue-enrichment analysis implicated the CNS in the aetiology of handedness. Pathways including regulation of microtubules and brain morphology were also highlighted. We found suggestive positive genetic correlations between left-handedness and neuropsychiatric traits, including schizophrenia and bipolar disorder. Furthermore, the genetic correlation between left-handedness and ambidexterity is low (r<sub>G</sub> = 0.26), which implies that these traits are largely influenced by different genetic mechanisms. Our findings suggest that handedness is highly polygenic and that the genetic variants that predispose to left-handedness may underlie part of the association with some psychiatric disorders.

Also flagged:maintenance of chromosomechromosomesbinding
Journal Article 2020-09-28 ✓ 1 Snippet Ryu JK, Katan AJ, van der Sluis EO, Wisse T, de Groot R, Haering CH, Dekker C.
In-Text Gene Mentions

Condensinbinds DNA via…

Show Full Abstract

Structural maintenance of chromosome (SMC) protein complexes are the key organizers of the spatiotemporal structure of chromosomes. The condensin SMC complex has recently been shown to be a molecular motor that extrudes large loops of DNA, but the mechanism of this unique motor remains elusive. Using atomic force microscopy, we show that budding yeast condensin exhibits mainly open 'O' shapes and collapsed 'B' shapes, and it cycles dynamically between these two states over time, with ATP binding inducing the O to B transition. Condensin binds DNA via its globular domain and also via the hinge domain. We observe a single condensin complex at the stem of extruded DNA loops, where the neck size of the DNA loop correlates with the width of the condensin complex. The results are indicative of a type of scrunching model in which condensin extrudes DNA by a cyclic switching of its conformation between O and B shapes.

Also flagged:gene expressiontranscription factorsgene expressionCiapin1Ccl9Il1a
Journal Article 2020-09-28 No Snippets Vangala P, Murphy R, Quinodoz SA, Gellatly K, McDonel P, Guttman M, Garber M.
Show Full Abstract

Eukaryotic gene expression regulation involves thousands of distal regulatory elements. Understanding the quantitative contribution of individual enhancers to gene expression is critical for assessing the role of disease-associated genetic risk variants. Yet, we lack the ability to accurately link genes with their distal regulatory elements. To address this, we used 3D enhancer-promoter (E-P) associations identified using split-pool recognition of interactions by tag extension (SPRITE) to build a predictive model of gene expression. Our model dramatically outperforms models using genomic proximity and can be used to determine the quantitative impact of enhancer loss on gene expression in different genetic backgrounds. We show that genes that form stable E-P hubs have less cell-to-cell variability in gene expression. Finally, we identified transcription factors that regulate stimulation-dependent E-P interactions. Together, our results provide a framework for understanding quantitative contributions of E-P interactions and associated genetic variants to gene expression.

Also flagged:cancerepidermal growth factor receptorEGFRhealth problems in pregnancylung cancerCisplatin
Journal Article 2020-09-28 ✓ 1 Snippet Long HK, Osterwalder M, Welsh IC, Hansen K, Davies JOJ, Liu YE, Koska M, Adams AT, Aho R, Arora N, Ikeda K, Williams RM, Sauka-Spengler T, Porteus MH, Mohun T, Dickel DE, Swigut T, Hughes JR, Higgs DR, Visel A, Selleri L, Wysocka J.
In-Text Gene Mentions

…SOX5 andSOX6are two SOX…

Show Full Abstract

Non-coding mutations at the far end of a large gene desert surrounding the SOX9 gene result in a human craniofacial disorder called Pierre Robin sequence (PRS). Leveraging a human stem cell differentiation model, we identify two clusters of enhancers within the PRS-associated region that regulate SOX9 expression during a restricted window of facial progenitor development at distances up to 1.45 Mb. Enhancers within the 1.45 Mb cluster exhibit highly synergistic activity that is dependent on the Coordinator motif. Using mouse models, we demonstrate that PRS phenotypic specificity arises from the convergence of two mechanisms: confinement of Sox9 dosage perturbation to developing facial structures through context-specific enhancer activity and heightened sensitivity of the lower jaw to Sox9 expression reduction. Overall, we characterize the longest-range human enhancers involved in congenital malformations, directly demonstrate that PRS is an enhanceropathy, and illustrate how small changes in gene expression can lead to morphological variation.

Also flagged:CholangiocarcinomacancerMUC5ACIL-6STAT3NOTCH
Journal Article 2020-09-28 No Snippets Chang YC, Chen MH, Yeh CN, Hsiao M.
Show Full Abstract

Cholangiocarcinoma (CCA) has been identified as a highly malignant cancer that can be transformed from epithelial cells of the bile duct, including intrahepatic, perihilar and extrahepatic. High-resolution imaging tools (abdominal ultrasound, computed tomography and percutaneous transhepatic cholangial drainage) are recruited for diagnosis. However, the lack of early diagnostic biomarkers and treatment evaluation can lead to serious outcomes and poor prognosis (i.e., CA19-9, MUC5AC). In recent years, scientists have established a large number of omics profiles to reveal underlying mechanisms and networks (i.e., IL-6/STAT3, NOTCH). With these results, we achieved several genomic alteration events (i.e., TP53<sub>mut,</sub> KRAS<sub>mut</sub>) and epigenetic modifications (i.e., DNA methylation, histone modification) in CCA cells and clinical patients. Moreover, we reviewed candidate gene (such as NF-kB, YAP1) that drive gene transcription factors and canonical pathways through transcriptomics profiles (including microarrays and next-generation sequencing). In addition, the proteomics database also indicates which molecules and their directly binding status could trigger dysfunction signatures in tumorigenesis (carbohydrate antigen 19-9, mucins). Most importantly, we collected metabolomics datasets and pivotal metabolites. These results reflect the pharmacotherapeutic options and evaluate pharmacokinetic/pharmacodynamics in vitro and in vivo. We reversed the panels and selected many potentially small compounds from the connectivity map and L1000CDS<sup>2</sup> system. In this paper, we summarize the prognostic value of each candidate gene and correlate this information with clinical events in CCA. This review can serve as a reference for further research to clearly investigate the complex characteristics of CCA, which may lead to better prognosis, drug repurposing and treatment strategies.

Also flagged:Indoxyl SulfateEnd-stage renal diseaseESRDchronic kidney diseasecardiovascular diseaseCVD
Journal Article 2020-09-28 No Snippets Kim HY, Lee SJ, Hwang Y, Lee GH, Yoon CE, Kim HC, Yoo TH, Lee WW.
Show Full Abstract

End-stage renal disease (ESRD) is the final stage of chronic kidney disease, which is increasingly prevalent worldwide and is associated with the progression of cardiovascular disease (CVD). Indoxyl sulfate (IS), a major uremic toxin, plays a key role in the pathology of CVD via adverse effects in endothelial and immune cells. Thus, there is a need for a transcriptomic overview of IS responsive genes in immune cells of ESRD patients. Here, we investigated IS-mediated alterations in gene expression in monocytes from ESRD patients. Transcriptomic analysis of ESRD patient-derived monocytes and IS-stimulated monocytes from healthy controls was performed, followed by analysis of differentially expressed genes (DEGs) and gene ontology (GO). We found that 148 upregulated and 139 downregulated genes were shared between ESRD patient-derived and IS-stimulated monocytes. Interaction network analysis using STRING and ClueGo suggests that mainly metabolic pathways, such as the pentose phosphate pathway, are modified by IS in ESRD patient-derived monocytes. These findings were confirmed in IS-stimulated monocytes by the increased mRNA expression of genes including G6PD, PGD, and TALDO1. Our data suggest that IS causes alteration of metabolic pathways in monocytes of ESRD patients and, thus, these altered genes may be therapeutic targets.

Also flagged:MelatoninAutophagyAgingendoplasmic reticulummitochondrialdeath
Journal Article 2020-09-28 No Snippets Luo F, Sandhu AF, Rungratanawanich W, Williams GE, Akbar M, Zhou S, Song BJ, Wang X.
Show Full Abstract

With aging, the nervous system gradually undergoes degeneration. Increased oxidative stress, endoplasmic reticulum stress, mitochondrial dysfunction, and cell death are considered to be common pathophysiological mechanisms of various neurodegenerative diseases (NDDs) such as Alzheimer's disease (AD), Parkinson's disease (PD), Huntington's disease (HD), organophosphate-induced delayed neuropathy (OPIDN), and amyotrophic lateral sclerosis (ALS). Autophagy is a cellular basic metabolic process that degrades the aggregated or misfolded proteins and abnormal organelles in cells. The abnormal regulation of neuronal autophagy is accompanied by the accumulation and deposition of irregular proteins, leading to changes in neuron homeostasis and neurodegeneration. Autophagy exhibits both a protective mechanism and a damage pathway related to programmed cell death. Because of its "double-edged sword", autophagy plays an important role in neurological damage and NDDs including AD, PD, HD, OPIDN, and ALS. Melatonin is a neuroendocrine hormone mainly synthesized in the pineal gland and exhibits a wide range of biological functions, such as sleep control, regulating circadian rhythm, immune enhancement, metabolism regulation, antioxidant, anti-aging, and anti-tumor effects. It can prevent cell death, reduce inflammation, block calcium channels, etc. In this review, we briefly discuss the neuroprotective role of melatonin against various NDDs via regulating autophagy, which could be a new field for future translational research and clinical studies to discover preventive or therapeutic agents for many NDDs.

Also flagged:PSMAPolyamideAmineBoneprostate cancerprostate-specific membrane antigen
Journal Article 2020-09-28 No Snippets Ye Y, Zhang L, Dai Y, Wang Z, Li C, Peng Y, Ma D, He P.
Show Full Abstract

<h4>Objective</h4>This study aimed to develop aptamer-anchored hyperbranched poly(amido amine) (HPAA) for the systemic delivery of <i>miRNA-133a-3p</i> and to evaluate its therapeutic potential against bone metastasis of prostate cancer in vivo and in vitro.<h4>Methods</h4>A glutathione (GSH)-responsive cationic HPAA was prepared by the Michael addition reaction. Furthermore, HPAA-PEG was produced by PEGylation, and then the aptamer targeted to prostate-specific membrane antigen (PSMA) was conjugated to the HPAA-PEG. The obtained HPAA-PEG-APT could form nanocomplexes with <i>miRNA-133a-3p</i> through electrostatic adsorption.<h4>Results</h4>The results of immunocytochemistry indicated that the complexes could target PSMA-expressing LNCaP cells. The ability of HPAA-PEG-APT to facilitate the delivery of <i>miRNA-133a-3p</i> into LNCaP cells was proven, and HPAA-PEG-APT/<i>miRNA-133a-3p</i> demonstrated enhanced antitumor activity, lower cytotoxicity and better biocompatibility in vitro. Moreover, in a <i>mouse</i> tibial injection tumor model, the intravenous injection of the HPAA-PEG-APT/<i>miRNA-133a-3p</i> complex significantly inhibited cancer growth and extended the survival time.<h4>Conclusion</h4>This study provided an aptamer-anchored HPAA-loaded gene system to deliver <i>miRNA-133a-3p</i> for better therapeutic efficacy of bone metastasis of prostate cancer.

Also flagged:circular lysophosphatidic acid receptor 1osteogenesisbone deficienciesasvesiclesmembrane
Journal Article 2020-09-28 ✓ 1 Snippet Xie L, Guan Z, Zhang M, Lyu S, Thuaksuban N, Kamolmattayakul S, Nuntanaranont T.
In-Text Gene Mentions

…tumor suppressor gene (DCC) initially investigating exon…

Show Full Abstract

Human dental pulp stem cells (DPSCs) hold great promise in bone regeneration. However, the exact mechanism of osteogenic differentiation of DPSCs remains unknown, especially the role of exosomes played in. The DPSCs were cultured and received osteogenic induction; then, exosomes from osteogenic-induced DPSCs (OI-DPSC-Ex) at different time intervals were isolated and sequenced for circular RNA (circRNA) expression profiles. Gradually, increased circular lysophosphatidic acid receptor 1 (circLPAR1) expression was found in the OI-DPSC-Ex coincidentally with the degree of osteogenic differentiation. Meanwhile, results from osteogenic differentiation examinations showed that the OI-DPSC-Ex had osteogenic effect on the recipient homotypic DPSCs. To investigate the mechanism of exosomal circLPAR1 on osteogenic differentiation, we verified that circLPAR1 could competently bind to hsa-miR-31, by eliminating the inhibitory effect of hsa-miR-31 on osteogenesis, therefore promoting osteogenic differentiation of the recipient homotypic DPSCs. Our study showed that exosomal circRNA played an important role in osteogenic differentiation of DPSCs and provided a novel way of utilization of exosomes for the treatment of bone deficiencies.

Also flagged:WNT2BWntstem cell proliferationHedgehogDHHCytotoxin
Journal Article 2020-09-28 ✓ 1 Snippet In JG, Yin J, Atanga R, Doucet M, Cole RN, DeVine L, Donowitz M, Zachos NC, Blutt SE, Estes MK, Kovbasnjuk O.
In-Text Gene Mentions

…2, 3, LGR5,OLFM4, or BMI1 compared…

Show Full Abstract

Intestinal regeneration and crypt hyperplasia after radiation or pathogen injury relies on Wnt signaling to stimulate stem cell proliferation. Mesenchymal Wnts are essential for homeostasis and regeneration in mice, but the role of epithelial Wnts remains largely uncharacterized. Using the enterohemorrhagic <i>E. coli</i>-secreted cytotoxin EspP to induce injury to human colonoids, we evaluated a simplified, epithelial regeneration model that lacks mesenchymal Wnts. Here, we demonstrate that epithelial-produced WNT2B is upregulated following injury and essential for regeneration. Hedgehog signaling, specifically activation via the ligand Desert Hedgehog (DHH), but not Indian or Sonic Hedgehog, is another driver of regeneration and modulates WNT2B expression. These findings highlight the importance of epithelial WNT2B and DHH in regulating human colonic regeneration after injury.

Also flagged:toptranslationphpyouTLR4immune responses
Journal Article 2020-09-28 ✓ 1 Snippet Mo Y, Cheung AKL, Liu Y, Liu L, Chen Z.
In-Text Gene Mentions

…butyrophilin (BTN)3A1 andBTN2A1molecules appear to…

Show Full Abstract

TLR ligands can contribute to T cell immune responses by indirectly stimulating antigen presentation and cytokines and directly serving as co-stimulatory signals. We have previously reported that the human endogenous surface protein, Δ42PD1, is expressed primarily on (Vγ9)Vδ2 cells and can interact with TLR4. Since Vδ2 cells possess antigen presentation capacity, we sought to further characterize if the Δ42PD1-TLR4 interaction has a role in stimulating T cell responses. In this study, we found that stimulation of Vδ2 cells not only upregulated Δ42PD1 expression but also increased MHC class II molecules necessary for the antigen presentation. In a mixed leukocyte reaction assay, upregulation of Δ42PD1 on Vδ2 cells elevated subsequent T cell proliferation. Furthermore, the interaction between Δ42PD1-TLR4 augments Vδ2 cell stimulation of autologous CMV pp65-or TT-specific CD4<sup>+</sup> T cell proliferation and IFN-γ responses, which was specifically and significantly reduced by blocking the Δ42PD1-TLR4 interaction. Furthermore, confocal microscopy analysis confirmed the interaction between Δ42PD1<sup>+</sup>HLA-DR<sup>+</sup>Vδ2 cells and TLR4<sup>+</sup>CD4 T cells. Interestingly, the subset of CD4<sup>+</sup> T cells expressing TLR4 appears to be PD-1<sup>+</sup> CD45RO<sup>+</sup>CD45RA<sup>+</sup> transitional memory T cells and responded to Δ42PD1<sup>+</sup>HLA-DR<sup>+</sup>Vδ2 cells. Overall, this study demonstrated an important biological role of Δ42PD1 protein exhibited by Vδ2 antigen-presenting cells in augmenting T cell activation through TLR4, which may serve as an additional co-stimulatory signal.

Also flagged:Serotonin TransporteraggressionSLC6A4transportersserotoninmetabolism
Journal Article 2020-09-28 ✓ 3 Snippets Peeters DGA, Lange WG, von Borries AKL, Franke B, Volman I, Homberg JR, Verkes RJ, Roelofs K.
In-Text Gene Mentions

The short (S) allele is associated with reduced transcription of the 5-HTT mRNA compared to the long (L) allele variant, resulting in less transporters and consequently decreased serotonin reuptake, increased synaptic serotonin levels and an adaptive decrease in serotonergic neurotransmission (Gregory et al., 1998; Hanna et al., 1998; Greenberg et al., 1999; Lesch, 2001).

…serotonin transporter gene (5-HTT, official name SLC6A4).…

…transcription of the5-HTTmRNA compared to…

Show Full Abstract

The short (S) allele of the serotonin transporter-linked promoter region (5-HTTLPR) polymorphism has been linked to reactive aggression in men, but this association is less consistent in females. Reactive aggression has been particularly described as a result of fear-driven defense to threat, but how this interaction between defensive behavior and aggression is expressed in S-allele carriers remains unknown. In order to explore this interplay between 5-HTTLPR genotype, defensive behavior and reactive aggression, we combined genotyping with objective measures of action tendencies toward angry faces in an approach-avoidance task (AAT) and reactive aggression in the Taylor aggression paradigm (TAP) in healthy females, <i>N</i> = 95. This study shows that female S-allele carriers in general display increased implicit reactive aggression (administering aversive white noise) toward opponents. Furthermore, we found that threat-avoidance tendencies moderate the association between 5-HTTLPR genotype and aggression displayed on the TAP. Together, these findings indicate a positive correlation between avoidance of angry faces in the AAT and reactive aggression in the TAP exclusively present in S-allele carriers.

Also flagged:Inflammatory responseto cellularspinal cord injuriesSRX1lipopolysaccharidesuperoxide dismutase
Journal Article 2020-09-28 ✓ 3 Snippets Wu Z, Lu Z, Ou J, Su X, Liu J.
In-Text Gene Mentions

…b15571; 1:1,000; Abcam), anti-PRDX6(cat.…

…levels of PRDX1,PRDX6, TXNRD1 and SOD2…

…PRDX1 andPRDX6are members of…

Show Full Abstract

Sulfiredoxin‑1 (SRX1) is a conserved endogenous antioxidative protein, which is involved in the response to cellular damage caused by oxidative stress. Oxidative stress and inflammation are the primary pathological changes in spinal cord injuries (SCI). The aim of present study was to explore the roles of SRX1 in SCI. Using reverse transcription‑quantitative PCR and western blotting, the present study discovered that the expression levels of SRX1 were downregulated in the spinal cord tissues of SCI model rats. Massive irregular cavities and decreased Nissl bodies were observed in the model group compared with the sham group. Thus, to determine the underlying mechanisms, neuron‑like PC12 cells were cultured in vitro. Western blotting analysis indicated that SRX1 expression levels were downregulated following the exposure of cells to lipopolysaccharide (LPS). Following the transfection with the SRX1 overexpression plasmid and stimulation with LPS, the results of the Cell Counting Kit‑8 assay indicated that the cell viability was increased compared with LPS stimulation alone. Furthermore, the expression levels of proinflammatory cytokines secreted by LPS‑treated PC12 cells were downregulated following SRX1 overexpression. Increased malondialdehyde content, decreased superoxide dismutase activity and reactive oxygen species production were also identified in PC12 cells treated with LPS using commercial detection kits, whereas the overexpression of SRX1 partially reversed the effects caused by LPS stimulation. The aforementioned results were further verified by determining the expression levels of antioxidative proteins using western blotting analysis. In addition, nuclear factor erythroid‑2‑related factor 2 (NRF2), a transcription factor known to regulate SRX1, was indicated to participate in the protective effect of SRX1 against oxidative stress. Inhibition of NRF2 further downregulated the expression levels of SRX1, NAD(P)H dehydrogenase quinone 1 and heme oxygenase‑1 in the presence of LPS, while activation of NRF2 reversed the effects of LPS on the expression levels of these proteins. In conclusion, the results of the present study indicated that the anti‑inflammatory and antioxidative effects of SRX1 may depend on NRF2, providing evidence that SRX1 may serve as a novel molecular target to exert a neuroprotective effect in SCI.

Also flagged:MBD2p38MAPKERK1methyl-CpG-binding domain protein 2vancomycinacute kidney injury
Journal Article 2020-09-28 No Snippets Xie Y, Liu B, Pan J, Liu J, Li X, Li H, Qiu S, Xiang X, Zheng P, Chen J, Yuan Y, Dong Z, Zhang D.
Show Full Abstract

Our previous study demonstrated that the methyl-CpG-binding domain protein 2 (MBD2) mediates vancomycin (VAN)-induced acute kidney injury (AKI). However, the role and regulation of MBD2 in septic AKI are unknown. Herein, MBD2 was induced by lipopolysaccharide (LPS) in Boston University mouse proximal tubules (BUMPTs) and mice. For both <i>in vitro</i> and <i>in vivo</i> experiments, we showed that inhibition of MBD2 by MBD2 small interfering RNA (siRNA) and MBD2-knockout (KO) substantially improved the survival rate and attenuated both LPS and cecal ligation and puncture (CLP)-induced AKI, renal cell apoptosis, and inflammatory factor production. Global genetic expression analyses and <i>in vitro</i> experiments suggest that the expression of protein kinase C eta (PKCη), caused by LPS, is markedly suppressed in MBD2-KO mice and MBD2 siRNA, respectively. Mechanistically, chromatin immunoprecipitation (ChIP) analysis indicates that MBD2 directly binds to promoter region CpG islands of PKCη via suppression of promoter methylation. Furthermore, PKCη siRNA improves the survival rate and attenuates LPS-induced BUMPT cell apoptosis and inflammatory factor production via inactivation of p38 mitogen-activated protein kinase (MAPK) and extracellular signal-regulated kinase (ERK)1/2, which were further verified by PKCη siRNA treatment in CLP-induced AKI. Finally, MBD2-KO mice exhibited CLP-induced renal cell apoptosis and inflammatory factor production by inactivation of PKCη/p38MAPK and ERK1/2 signaling. Taken together, the data indicate that MBD2 mediates septic-induced AKI through the activation of PKCη/p38MAPK and the ERK1/2 axis. MBD2 represents a potential target for treatment of septic AKI.

bioRxiv 2020-09-28 Preprint (No Snippets API) Jain R, Ramaswamy S, Harilal D, Uddin M, Loney T, Nowotny N, Alsuwaidi H, Varghese R, Deesi Z, Alkhajeh A, Khansaheb H, Alsheikh-Ali A, Tayoun AA.
Show Full Abstract

Characterizing key molecular and cellular pathways involved in COVID-19 is essential for disease prognosis and management. We perform shotgun transcriptome sequencing of human RNA obtained from nasopharyngeal swabs of patients with COVID-19, and identify a molecular signature associated with disease severity. Specifically, we identify globally dysregulated immune related pathways, such as cytokine-cytokine receptor signaling, complement and coagulation cascades, JAK-STAT, and TGF-β signaling pathways in all, though to a higher extent in patients with severe symptoms. The excessive release of cytokines and chemokines such as CCL2, CCL22, CXCL9 and CXCL12 and certain interferons and interleukins related genes like IFIH1, IFI44, IFIT1 and IL10 were significantly higher in patients with severe clinical presentation compared to mild and moderate presentations. Moreover, early induction of the TGF-β signaling pathway might be the primary cause of pulmonary fibrosis in patients with severe disease. Differential gene expression analysis identified a small set of regulatory genes that might act as strong predictors of patient outcome. Our data suggest that rapid transcriptome analysis of nasopharyngeal swabs can be a powerful approach to quantify host molecular response and may provide valuable insights into COVID-19 pathophysiology.

Also flagged:antigen receptorsantigen receptorT-cell antigen receptorsMajor Histocompatibility ComplexMHCclass I
Journal Article 2020-09-27 ✓ 1 Snippet Herrmann T, Karunakaran MM, Fichtner AS.
In-Text Gene Mentions

…butyrophilin (BTN)3A andBTN2A1in PAg-sensing and…

Show Full Abstract

Both, jawless and jawed vertebrates possess three lymphocyte lineages defined by highly diverse antigen receptors: Two T-cell- and one B-cell-like lineage. In both phylogenetic groups, the theoretically possible number of individual antigen receptor specificities can even outnumber that of lymphocytes of a whole organism. Despite fundamental differences in structure and genetics of these antigen receptors, convergent evolution led to functional similarities between the lineages. Jawed vertebrates possess αβ and γδ T-cells defined by eponymous αβ and γδ T-cell antigen receptors (TCRs). "Conventional" αβ T-cells recognize complexes of Major Histocompatibility Complex (MHC) class I and II molecules and peptides. Non-conventional T-cells, which can be αβ or γδ T-cells, recognize a large variety of ligands and differ strongly in phenotype and function between species and within an organism. This review describes similarities and differences of non-conventional T-cells of various species and discusses ligands and functions of their TCRs. A special focus is laid on Vγ9Vδ2 T-cells whose TCRs act as sensors for phosphorylated isoprenoid metabolites, so-called phosphoantigens (PAg), associated with microbial infections or altered host metabolism in cancer or after drug treatment. We discuss the role of butyrophilin (BTN)3A and BTN2A1 in PAg-sensing and how species comparison can help in a better understanding of this human Vγ9Vδ2 T-cell subset.

Also flagged:CalciumCytokineSecretionCalcium phosphatetumortitanium
Journal Article 2020-09-27 No Snippets Litvinova LS, Khaziakhmatova OG, Shupletsova VV, Yurova KA, Malashchenko VV, Shunkin EO, Ivanov PA, Komarova EG, Chebodaeva VV, Porokhova ED, Gereng EA, Khlusov IA.
Show Full Abstract

Calcium phosphate (CaP) materials are among the best bone graft substitutes, but their use in the repair of damaged bone in tumor patients is still unclear. The human Jurkat T lymphoblast leukemia-derived cell line (Jurkat T cells) was exposed in vitro to a titanium (Ti) substrate (10 × 10 × 1 mm<sup>3</sup>) with a bilateral rough (average roughness index (<i>R<sub>a</sub></i>) = 2-5 μm) CaP coating applied via the microarc oxidation (MAO) technique, and the morphofunctional response of the cells was studied. Scanning electron microscopy (SEM), X-ray diffraction (XRD), and energy dispersive X-ray spectroscope (EDX) analyses showed voltage-dependent (150-300 V) growth of structural (<i>R<sub>a</sub></i> index, mass, and thickness) and morphological surface and volume elements, a low Ca/P<sub>aT</sub> ratio (0.3-0.6), and the appearance of crystalline phases of CaHPO<sub>4</sub> (monetite) and β-Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub> (calcium pyrophosphate). Cell and molecular reactions in 2-day and 14-day cultures differed strongly and correlated with the <i>Ra</i> values. There was significant upregulation of <i>hTERT</i> expression (1.7-fold), IL-17 secretion, the presentation of the activation antigens CD25 (by 2.7%) and CD95 (by 5.15%) on CD4<sup>+</sup> cells, and 1.5-2-fold increased cell apoptosis and necrosis after two days of culture. Hyperactivation-dependent death of CD4<sup>+</sup> cells triggered by the surface roughness of the CaP coating was proposed. Conversely, a 3.2-fold downregulation in <i>hTERT</i> expression increased the percentages of CD4<sup>+</sup> cells and their CD95<sup>+</sup> subset (by 15.5% and 22.9%, respectively) and inhibited the secretion of 17 of 27 test cytokines/chemokines without a reduction in Jurkat T cell survival after 14 days of coculture. Thereafter, cell hypoergy and the selection of an <i>hTERT-</i>independent viable CD4<sup>+</sup> subset of tumor cells were proposed. The possible role of negative zeta potentials and Ca<sup>2+</sup> as effectors of CaP roughness was discussed. The continuous (2-14 days) 1.5-6-fold reductions in the secretion of vascular endothelial growth factor (VEGF) by tumor cells correlated with the <i>R<sub>a</sub></i> values of microarc CaP-coated Ti substrates seems to limit surgical stress-induced metastasis of lymphoid malignancies.

Also flagged:Cancerprostate cancerbreast cancercolorectal cancercancerscolorectal cancers
Journal Article 2020-09-27 No Snippets Zheng G, Catalano C, Bandapalli OR, Paramasivam N, Chattopadhyay S, Schlesner M, Sijmons R, Hemminki A, Dymerska D, Lubinski J, Hemminki K, Försti A.
Show Full Abstract

Familial clustering, twin concordance, and identification of high- and low-penetrance cancer predisposition variants support the idea that there are families that are at a high to moderate excess risk of cancer. To what extent there may be families that are protected from cancer is unknown. We wanted to test genetically whether cancer-free families share fewer breast, colorectal, and prostate cancer risk alleles than the population at large. We addressed this question by whole-genome sequencing (WGS) of 51 elderly cancer-free individuals whose numerous (ca. 1000) family members were found to be cancer-free ('cancer-free families', CFFs) based on face-to-face interviews. The average coverage of the 51 samples in the WGS was 42x. We compared cancer risk allele frequencies in cancer-free individuals with those in the general population available in public databases. The CFF members had fewer loss-of-function variants in suggested cancer predisposition genes compared to the ExAC data, and for high-risk cancer predisposition genes, no pathogenic variants were found in CFFs. For common low-penetrance breast, colorectal, and prostate cancer risk alleles, the results were not conclusive. The results suggest that, in line with twin and family studies, random environmental causes are so dominant that a clear demarcation of cancer-free populations using genetic data may not be feasible.

Also flagged:gene expressionacute myeloid leukaemiaAMLtumourpathogenesisleukaemia
Journal Article 2020-09-27 ✓ 3 Snippets Davis L, Mills KI, Orchard KH, Guinn BA.
In-Text Gene Mentions

We found SOX6 in both TCGA poor versus good and intermediate versus good risk subgroup comparisons and SOX5, SOX15 and SOX18 in both the TARGET standard versus low risk and TCGA poor versus good risk subgroup comparisons; however, only SOX18 has previously been implicated in reduced disease-free and OS in AML patients [46].

…significant DEGs, whileSOX6was found to…

…We foundSOX6in both TCGA…

Show Full Abstract

Few studies have compared gene expression in paediatric and adult acute myeloid leukaemia (AML). In this study, we have analysed mRNA-sequencing data from two publicly accessible databases: (1) National Cancer Institute's Therapeutically Applicable Research to Generate Effective Treatments (NCI-TARGET), examining paediatric patients, and (2) The Cancer Genome Atlas (TCGA), examining adult patients with AML. With a particular focus on 144 known tumour antigens, we identified <i>STEAP1</i>, <i>SAGE1</i>, <i>MORC4</i>, <i>SLC34A2</i> and <i>CEACAM3</i> as significantly different in their expression between standard and low risk paediatric AML patient subgroups, as well as between poor and good, and intermediate and good risk adult AML patient subgroups. We found significant differences in event-free survival (EFS) in paediatric AML patients, when comparing standard and low risk subgroups, and quartile expression levels of <i>BIRC5</i>, <i>MAGEF1</i>, <i>MELTF</i>, <i>STEAP1</i> and <i>VGLL4</i>. We found significant differences in EFS in adult AML patients when comparing intermediate and good, and poor and good risk adult AML patient subgroups and quartile expression levels of <i>MORC4</i> and <i>SAGE1</i>, respectively. When examining Kyoto Encyclopedia of Genes and Genomes (KEGG) (2016) pathway data, we found that genes altered in AML were involved in key processes such as the evasion of apoptosis (<i>BIRC5</i>, <i>WNT1</i>) or the control of cell proliferation (<i>SSX2IP</i>, <i>AML1-ETO</i>). For the first time we have compared gene expression in paediatric AML patients with that of adult AML patients. This study provides unique insights into the differences and similarities in the gene expression that underlies AML, the genes that are significantly differently expressed between risk subgroups, and provides new insights into the molecular pathways involved in AML pathogenesis.

Also flagged:PD-L1CancerTumorprogrammed cell death-1PD-1cytotoxic T-lymphocyte-associated protein-4
Journal Article 2020-09-27 No Snippets Shklovskaya E, Rizos H.
Show Full Abstract

Immunotherapies blocking immune inhibitory receptors programmed cell death-1 (PD-1) and cytotoxic T-lymphocyte-associated protein-4 (CTLA-4) on T-cells have dramatically improved patient outcomes in a range of advanced cancers. However, the lack of response, and the development of resistance remain major obstacles to long-term improvements in patient outcomes. There is significant interest in the clinical use of biomarkers to improve patient selection, and the expression of PD-1 ligand 1 (PD-L1) is often reported as a potential biomarker of response. However, accumulating evidence suggests that the predictive value of PD-L1 expression in tumor biopsies is relatively low due, in part, to its complex biology. In this review, we discuss the biological consequences of PD-L1 expression by various cell types within the tumor microenvironment, and the complex mechanisms that regulate PD-L1 expression at the genomic, transcriptomic and proteomic levels.

Also flagged:AMLMyelodysplastic syndromesacute myeloid leukemiatumorcontrol ofgene expression
Journal Article 2020-09-27 No Snippets Bauer M, Vaxevanis C, Heimer N, Al-Ali HK, Jaekel N, Bachmann M, Wickenhauser C, Seliger B.
Show Full Abstract

Myelodysplastic syndromes (MDS), heterogeneous diseases of hematopoietic stem cells, exhibit a significant risk of progression to secondary acute myeloid leukemia (sAML) that are typically accompanied by MDS-related changes and therefore significantly differ to de novo acute myeloid leukemia (AML). Within these disorders, the spectrum of cytogenetic alterations and oncogenic mutations, the extent of a predisposing defective osteohematopoietic niche, and the irregularity of the tumor microenvironment is highly diverse. However, the exact underlying pathophysiological mechanisms resulting in hematopoietic failure in patients with MDS and sAML remain elusive. There is recent evidence that the post-transcriptional control of gene expression mediated by microRNAs (miRNAs), long noncoding RNAs, and/or RNA-binding proteins (RBPs) are key components in the pathogenic events of both diseases. In addition, an interplay between RBPs and miRNAs has been postulated in MDS and sAML. Although a plethora of miRNAs is aberrantly expressed in MDS and sAML, their expression pattern significantly depends on the cell type and on the molecular make-up of the sample, including chromosomal alterations and single nucleotide polymorphisms, which also reflects their role in disease progression and prediction. Decreased expression levels of miRNAs or RBPs preventing the maturation or inhibiting translation of genes involved in pathogenesis of both diseases were found. Therefore, this review will summarize the current knowledge regarding the heterogeneity of expression, function, and clinical relevance of miRNAs, its link to molecular abnormalities in MDS and sAML with specific focus on the interplay with RBPs, and the current treatment options. This information might improve the use of miRNAs and/or RBPs as prognostic markers and therapeutic targets for both malignancies.

Also flagged:tumorsHypoxia inducible factor‐2αHypoxia inducible factor (HIF)‐2αcancerepithelial‐to‐mesenchymal transitiongrowth arrest
Journal Article 2020-09-26 No Snippets Niklasson CU, Fredlund E, Monni E, Lindvall JM, Kokaia Z, Hammarlund EU, Bronner ME, Mohlin S.
Show Full Abstract

<h4>Background</h4>The neural crest is a transient embryonic stem cell population. Hypoxia inducible factor (HIF)-2α is associated with neural crest stem cell appearance and aggressiveness in tumors. However, little is known about its role in normal neural crest development.<h4>Results</h4>Here, we show that HIF-2α is expressed in trunk neural crest cells of human, murine, and avian embryos. Knockdown as well as overexpression of HIF-2α in vivo causes developmental delays, induces proliferation, and self-renewal capacity of neural crest cells while decreasing the proportion of neural crest cells that migrate ventrally to sympathoadrenal sites. Reflecting the in vivo phenotype, transcriptome changes after loss of HIF-2α reveal enrichment of genes associated with cancer, invasion, epithelial-to-mesenchymal transition, and growth arrest.<h4>Conclusions</h4>Taken together, these results suggest that expression levels of HIF-2α must be strictly controlled during normal trunk neural crest development and that dysregulated levels affects several important features connected to stemness, migration, and development.

Also flagged:attachmentserotonin transporterserotonin5-HTTLPR5behavioral problems
Journal Article 2020-09-26 No Snippets Lee JK, Schoppe-Sullivan SJ, Beauchaine TP.
Show Full Abstract

Children with higher socioemotional competence are more likely to build constructive relationships with others and experience more positive adjustment outcomes in later periods. Securely attached children are likely to develop better socioemotional competence, but genetic moderation of associations between attachment and later socioemotional competence has received less attention. Using structural equation modeling, this study analyzed data collected from 1,337 children (51% male) born from 1998 to 2000 in the Fragile Families and Child Wellbeing study. The results demonstrated that relations between attachment security at age 3 years and their social competence at age 5 years differed by two serotonin transporter variants (5-HTTLPR, STin2). Effect sizes of these interactions were larger than effect sizes of main effects and the benefit of having sensitive alleles was consistently supported. This implies that having more secure attachment in the early developmental period is advantageous especially for children with minor alleles who have greater environmental sensitivity.

Also flagged:RING ubiquitin ligasescell differentiationtranslationallocalizationE3 ligasesE1
Journal Article 2020-09-26 ✓ 1 Snippet Asmar AJ, Beck DB, Werner A.
In-Text Gene Mentions

…Interestingly, CRL3-KLHL20also controls RhoA…

Show Full Abstract

Metazoan development relies on intricate cell differentiation, communication, and migration pathways, which ensure proper formation of specialized cell types, tissues, and organs. These pathways are crucially controlled by ubiquitylation, a reversible post-translational modification that regulates the stability, activity, localization, or interaction landscape of substrate proteins. Specificity of ubiquitylation is ensured by E3 ligases, which bind substrates and co-operate with E1 and E2 enzymes to mediate ubiquitin transfer. Cullin3-RING ligases (CRL3s) are a large class of multi-subunit E3s that have emerged as important regulators of cell differentiation and development. In particular, recent evidence from human disease genetics, animal models, and mechanistic studies have established their involvement in the control of craniofacial and brain development. Here, we summarize regulatory principles of CRL3 assembly, substrate recruitment, and ubiquitylation that allow this class of E3s to fulfill their manifold functions in development. We further review our current mechanistic understanding of how specific CRL3 complexes orchestrate neuroectodermal differentiation and highlight diseases associated with their dysregulation. Based on evidence from human disease genetics, we propose that other unknown CRL3 complexes must help coordinate craniofacial and brain development and discuss how combining emerging strategies from the field of disease gene discovery with biochemical and human pluripotent stem cell approaches will likely facilitate their identification.

Also flagged:gene expressionstress-related disordersdepressionposttraumatic stress disordersneuroblast migrationneurogenesis
Journal Article 2020-09-26 ✓ 5 Snippets Musaelyan K, Yildizoglu S, Bozeman J, Du Preez A, Egeland M, Zunszain PA, Pariante CM, Fernandes C, Thuret S.
In-Text Gene Mentions

…target genes [huntingtin (Htt), Lep, Myelin Regulatory…

…to the analysis,Httwas identified as…

…and Hdac4 followedHttwith seven to…

…the observed behaviours (Htt, Lep).…

…as well asHttand Bdnf-centred networks…

Show Full Abstract

Adult hippocampal neurogenesis is involved in stress-related disorders such as depression, posttraumatic stress disorders, as well as in the mechanism of antidepressant effects. However, the molecular mechanisms involved in these associations remain to be fully explored. In this study, unpredictable chronic mild stress in mice resulted in a deficit in neuronal dendritic tree development and neuroblast migration in the hippocampal neurogenic niche. To investigate molecular pathways underlying neurogenesis alteration, genome-wide gene expression changes were assessed in the prefrontal cortex, hippocampus and the hypothalamus alongside neurogenesis changes. Cluster analysis showed that the transcriptomic signature of chronic stress is much more prominent in the prefrontal cortex compared to the hippocampus and the hypothalamus. Pathway analyses suggested huntingtin, leptin, myelin regulatory factor, methyl-CpG binding protein and brain-derived neurotrophic factor as the top predicted upstream regulators of transcriptomic changes in the prefrontal cortex. Involvement of the satiety regulating pathways (leptin) was corroborated by behavioural data showing increased food reward motivation in stressed mice. Behavioural and gene expression data also suggested circadian rhythm disruption and activation of circadian clock genes such as Period 2. Interestingly, most of these pathways have been previously shown to be involved in the regulation of adult hippocampal neurogenesis. It is possible that activation of these pathways in the prefrontal cortex by chronic stress indirectly affects neuronal differentiation and migration in the hippocampal neurogenic niche via reciprocal connections between the two brain areas.

Also flagged:leukocyte immunoglobulin-like receptor A5LILRA5Marek's diseaseMDamino acidsphosphorylation
Journal Article 2020-09-25 No Snippets Truong AD, Hong Y, Nguyen HT, Nguyen CT, Chu NT, Tran HTT, Dang HV, Lillehoj HS, Hong YH.
Show Full Abstract

1. Leukocyte immunoglobulin-like receptor A5 (LILRA5) is a key molecule that regulates the immune system. However, the <i>LILRA5</i> gene has not been characterised in avian species, including chickens. The present study aimed to identify and functionally characterise <i>LILRA5</i> identified from two genetically disparate chicken lines, <i>viz</i>., Marek's disease (MD)-resistant (R) line 6.3 and MD-susceptible (S) line 7.2. 2. Multiple sequence alignment and phylogenetic analyses confirmed that the identity and similarity homologies of amino acids of LILRA5 in chicken lines 6.3 and 7.2 ranged between 93% and 93.7%, whereas those between chicken and mammals ranged between 20.9% and 43.7% and 21.1% to 43.9%, respectively. The newly cloned <i>LILRA5</i> from chicken lines 6.3 and 7.2 revealed high conservation and a close relationship with other known mammalian LILRA5 proteins. 3. The results indicated that LILRA5 from chicken lines 6.3 and 7.2 was associated with phosphorylation of Src kinases and protein tyrosine phosphatase non-receptor type 11 (SHP2), which play a regulatory role in immune functions. Moreover, the results demonstrated that <i>LILRA5</i> in these lines was associated with the activation of major histocompatibility complex (MHC) class I and β2-microglobulin and induced the expression of the transporter associated with antigen processing. In addition, <i>LILRA5</i> in both chicken lines activated and induced Janus kinase (JAK)-signal transducer and the activator of transcription (STAT), nuclear factor kappa B (NF-κB), phosphoinositide-3-kinase (PI3K)/protein kinase B (AKT) and the extracellular signal-regulated kinase (ERK)1/2 signalling pathways; toll-like receptors; and Th1-, Th2-, and Th17- cytokines. 4. The data suggested that LILRA5 has innate immune receptors essential for macrophage immune response and provide novel insights into the regulation of immunity and immunopathology.

Also flagged:BRAFRAF1MAPKpediatric cancersMEKpediatric cancer
Journal Article 2020-09-25 ✓ 2 Snippets Rankin A, Johnson A, Roos A, Kannan G, Knipstein J, Britt N, Rosenzweig M, Haberberger J, Pavlick D, Severson E, Vergilio JA, Squillace R, Erlich R, Sathyan P, Cramer S, Kram D, Ross J, Miller V, Reddy P, Alexander B, Ali SM, Ramkissoon S.
In-Text Gene Mentions

…fusions TMF1‐RAF1 andSOX6‐RAF1 .…

SOX6

Show Full Abstract

RAF family protein kinases signal through the MAPK pathway to orchestrate cellular proliferation, survival, and transformation. Identifying BRAF alterations in pediatric cancers is critically important as therapeutic agents targeting BRAF or MEK may be incorporated into the clinical management of these patients. In this study, we performed comprehensive genomic profiling on 3,633 pediatric cancer samples and identified a cohort of 221 (6.1%) cases with known or novel alterations in BRAF or RAF1 detected in extracranial solid tumors, brain tumors, or hematological malignancies. Eighty percent (176/221) of these tumors had a known-activating short variant (98, 55.7%), fusion (72, 40.9%), or insertion/deletion (6, 3.4%). Among BRAF altered cancers, the most common tumor types were brain tumors (74.4%), solid tumors (10.8%), hematological malignancies (9.1%), sarcomas (3.4%), and extracranial embryonal tumors (2.3%). RAF1 fusions containing intact RAF1 kinase domain (encoded by exons 10-17) were identified in seven tumors, including two novel fusions TMF1-RAF1 and SOX6-RAF1. Additionally, we highlight a subset of patients with brain tumor with positive clinical response to BRAF inhibitors, demonstrating the rationale for incorporating precision medicine into pediatric oncology. IMPLICATIONS FOR PRACTICE: Precision medicine has not yet gained a strong foothold in pediatric cancers. This study describes the landscape of BRAF and RAF1 genomic alterations across a diverse spectrum of pediatric cancers, primarily brain tumors, but also encompassing melanoma, sarcoma, several types of hematologic malignancy, and others. Given the availability of multiple U.S. Food and Drug Administration-approved BRAF inhibitors, identification of these alterations may assist with treatment decision making, as described here in three cases of pediatric cancer.

Also flagged:neurodevelopmental disordersnucleotidechromatincongenital diseasepathogenesisvision
Journal Article 2020-09-25 No Snippets D'haene E, Vergult S.
Show Full Abstract

The emergence of novel sequencing technologies has greatly improved the identification of structural variation, revealing that a human genome harbors tens of thousands of structural variants (SVs). Since these SVs primarily impact noncoding DNA sequences, the next challenge is one of interpretation, not least to improve our understanding of human disease etiology. However, this task is severely complicated by the intricacy of the gene regulatory landscapes embedded within these noncoding regions, their incomplete annotation, as well as their dependence on the three-dimensional (3D) conformation of the genome. Also in the context of neurodevelopmental disorders (NDDs), reports of putatively causal, noncoding SVs are accumulating and understanding their impact on transcriptional regulation is presenting itself as the next step toward improved genetic diagnosis.

Also flagged:Huntington's DiseaseHDneurodegenerative diseasenanofibrilsfibrilspeptides
Journal Article 2020-09-25 ✓ 5 Snippets Wetzel R.
In-Text Gene Mentions

…the protein huntingtin (htt).…

…to Q<sub>36</sub> inhttare not known…

…of HD-associated intraneuronalhttinclusions in 1997,…

…"exon1" fragment ofhtt(htt-ex1).…

…fragment of htt (htt-ex1).…

Show Full Abstract

Huntington's disease (HD) is a progressive, familial neurodegenerative disease triggered by the expansion of a polyglutamine (polyQ) track in the protein huntingtin (htt). PolyQ sequences up to Q<sub>36</sub> in htt are not known to be toxic, while polyQ lengths above Q<sub>36</sub> almost invariably lead to increased disease risk and decreased ages of onset. The large number of physical states (monomers, dimers, tetramers, non-β oligomers, nanofibrils, and clustered amyloid fibrils) on the self-association landscape, with their overlapping kinetics of formation, have greatly complicated identification of the molecular species responsible for HD toxicity, drawing attention to the need for innovative approaches.After reports of HD-associated intraneuronal htt inclusions in 1997, we elucidated aggregation mechanisms of both simple polyQ sequences and the more complex polyQ-containing "exon1" fragment of htt (htt-ex1). Grounded in this work, the more recent results described here were made possible by breakthroughs in the molecular design of diagnostic polyQ derivatives and in fluorescence applications for characterizing amyloid assembly intermediates. Thus, insertion of β-turn-promoting mutations into relatively short, disordered polyQ sequences created "pro-β-hairpin" polyQs (βHPs) that exhibit amyloid formation rates comparable to the enhanced rates seen with expanded polyQ peptides. Introduction of "β-breaker" mutations into these βHP polyQ sequences created molecules that are blocked from aggregating into amyloid and also can inhibit amyloid formation by other polyQ proteins. These mutational effects were then successfully transferred into more complex htt-ex1 sequence backgrounds. Insights into the aggregation properties of htt-ex1 derivatives-as well as into the nucleation process itself-were obtained using fluorescence correlation spectroscopy (FCS) and a novel thioflavin-T (ThT) protocol that allows quantitation of htt-ex1 assembly intermediates.Using these tools, we quantified physical states of htt-ex1 at different growth times in mammalian PC12 cells engineered for inducible expression of both normal and expanded polyQ repeat length versions of htt-ex1. For expanded polyQ versions, we found tetramers, oligomers, and fibrils (but no monomers) all populated in these cells at a time when the first indication of toxicity (nuclear DNA damage) was observed. These experiments provided a strong hint that monomeric forms of htt-ex1 are not involved in toxicity, but we were otherwise unable to implicate a specific toxic self-assembled state because of the overlapping kinetics of formation. To gain a more intimate focus and control over the timelines of htt-ex1 self-assembly and the resulting toxic response, we engineered various htt-ex1-βHP molecules-with and without added β-breaker mutations-that could be expressed in rat neuronal and <i>Drosophila</i> models of HD. In both models, novel htt-ex1-βHP analogues exhibiting strong aggregation in spite of their very short polyQ repeat lengths proved to be toxic, dramatically breaking the "repeat length paradigm" and strongly suggesting that the toxic species must be some kind of aggregate. In both models, β-breaker analogues of htt-ex1-βHP that are slow to make amyloid-instead favoring accumulation of non-β oligomers-were nontoxic. In contrast, htt-ex1-βHP analogues that rapidly progress to amyloid states were toxic, suggesting that an aggregate possessing the fundamental amyloid folding motif is very likely the major toxic species in HD.

Also flagged:ChromosomePHF23SIN3HDAChistonecancers
Journal Article 2020-09-25 ✓ 1 Snippet Chen M, Chen X, Li S, Pan X, Gong Y, Zheng J, Xu J, Zhao C, Zhang Q, Zhang S, Qi L, Wang Z, Shi K, Ding BS, Xue Z, Chen L, Yang S, Wang Y, Niu T, Dai L, Lowe SW, Chen C, Liu Y.
In-Text Gene Mentions

SUDS3

Show Full Abstract

Chromosome copy-number variations are a hallmark of cancer. Among them, the prevalent chromosome 17p deletions are associated with poor prognosis and can promote tumorigenesis more than <i>TP53</i> loss. Here, we use multiple functional genetic strategies and identify a new 17p tumor suppressor gene (TSG), plant homeodomain finger protein 23 (<i>PHF23</i>). Its deficiency impairs B-cell differentiation and promotes immature B-lymphoblastic malignancy. Mechanistically, we demonstrate that PHF23, an H3K4me3 reader, directly binds the SIN3-HDAC complex through its <i>N</i>-terminus and represses its deacetylation activity on H3K27ac. Thus, the PHF23-SIN3-HDAC (PSH) complex coordinates these two major active histone markers for the activation of downstream TSGs and differentiation-related genes. Furthermore, dysregulation of the PSH complex is essential for the development and maintenance of <i>PHF23</i>-deficient and 17p-deleted tumors. Hence, our study reveals a novel epigenetic regulatory mechanism that contributes to the pathology of 17p-deleted cancers and suggests a susceptibility in this disease. SIGNIFICANCE: We identify <i>PHF23</i>, encoding an H3K4me3 reader, as a new TSG on chromosome 17p, which is frequently deleted in human cancers. Mechanistically, PHF23 forms a previously unreported histone-modifying complex, the PSH complex, which regulates gene activation through a synergistic link between H3K4me3 and H3K27ac.<i>This article is highlighted in the In This Issue feature, p. 1</i>.

Also flagged:chromosomeswound healingmetabolismSorl1Dach1Cdh10
Journal Article 2020-09-25 ✓ 1 Snippet Hillis DA, Yadgary L, Weinstock GM, Pardo-Manuel de Villena F, Pomp D, Fowler AS, Xu S, Chan F, Garland T.
In-Text Gene Mentions

Sox6

Show Full Abstract

The biological basis of exercise behavior is increasingly relevant for maintaining healthy lifestyles. Various quantitative genetic studies and selection experiments have conclusively demonstrated substantial heritability for exercise behavior in both humans and laboratory rodents. In the "High Runner" selection experiment, four replicate lines of <i>Mus domesticus</i> were bred for high voluntary wheel running (HR), along with four nonselected control (C) lines. After 61 generations, the genomes of 79 mice (9-10 from each line) were fully sequenced and single nucleotide polymorphisms (SNPs) were identified. We used nested ANOVA with MIVQUE estimation and other approaches to compare allele frequencies between the HR and C lines for both SNPs and haplotypes. Approximately 61 genomic regions, across all somatic chromosomes, showed evidence of differentiation; 12 of these regions were differentiated by all methods of analysis. Gene function was inferred largely using Panther gene ontology terms and KO phenotypes associated with genes of interest. Some of the differentiated genes are known to be associated with behavior/motivational systems and/or athletic ability, including <i>Sorl1</i>, <i>Dach1</i>, and <i>Cdh10</i> Sorl1 is a sorting protein associated with cholinergic neuron morphology, vascular wound healing, and metabolism. <i>Dach1</i> is associated with limb bud development and neural differentiation. <i>Cdh10</i> is a calcium ion binding protein associated with phrenic neurons. Overall, these results indicate that selective breeding for high voluntary exercise has resulted in changes in allele frequencies for multiple genes associated with both motivation and ability for endurance exercise, providing candidate genes that may explain phenotypic changes observed in previous studies.

Also flagged:mitochondrialHuntington diseaseHDhereditary neurodegenerative disorderPhosphorylationserine
Journal Article 2020-09-25 ✓ 5 Snippets Xu X, Ng B, Sim B, Radulescu CI, Yusof NABM, Goh WI, Lin S, Lim JSY, Cha Y, Kusko R, Kay C, Ratovitski T, Ross C, Hayden MR, Wright G, Pouladi MA.
In-Text Gene Mentions

Huntington disease (HD), a devastating hereditary neurodegenerative disorder, is caused by an expansion of a CAG trinucleotide repeat that encodes a polyglutamine (polyQ) tract in the huntingtin (HTT) gene.

These isogenic hiPSC lines contain full-length HTT alleles under an endogenous promoter in the context of human physiology, and thus represent relatively ideal models in which to study the role of S421 phosphorylation in HD.

…the huntingtin (HTT) gene.…

HTTis a ubiquitously…

…scaffold 1 ,HTTinteracts with a…

Show Full Abstract

Huntington disease (HD) is a hereditary neurodegenerative disorder caused by mutant huntingtin (mHTT). Phosphorylation at serine-421 (pS421) of mHTT has been shown to be neuroprotective in cellular and rodent models. However, the genetic context of these models differs from that of HD patients. Here we employed human pluripotent stem cells (hiPSCs), which express endogenous full-length mHTT. Using genome editing, we generated isogenic hiPSC lines in which the S421 site in mHTT has been mutated into a phospho-mimetic aspartic acid (S421D) or phospho-resistant alanine (S421A). We observed that S421D, rather than S421A, confers neuroprotection in hiPSC-derived neural cells. Although we observed no effect of S421D on mHTT clearance or axonal transport, two aspects previously reported to be impacted by phosphorylation of mHTT at S421, our analysis revealed modulation of several aspects of mitochondrial form and function. These include mitochondrial surface area, volume, and counts, as well as improved mitochondrial membrane potential and oxidative phosphorylation. Our study validates the protective role of pS421 on mHTT and highlights a facet of the relationship between mHTT and mitochondrial changes in the context of human physiology with potential relevance to the pathogenesis of HD.

Also flagged:cancergene expressionNrasBRCA1fitTpr
Journal Article 2020-09-25 ✓ 1 Snippet Liu J, Adhav R, Miao K, Su SM, Mo L, Chan UI, Zhang X, Xu J, Li J, Shu X, Zeng J, Zhang X, Lyu X, Pardeshi L, Tan K, Sun H, Wong KH, Deng C, Xu X.
In-Text Gene Mentions

The SNV and CNV data of human breast cancer patients with BRCA1 germline mutations from the WSI breast invasive carcinoma dataset21 were downloaded from the web-based International Cancer Genome Consortium (ICGC)66 (https://dcc.icgc.org/).

Show Full Abstract

Single-cell whole-exome sequencing (scWES) is a powerful approach for deciphering intratumor heterogeneity and identifying cancer drivers. So far, however, simultaneous analysis of single nucleotide variants (SNVs) and copy number variations (CNVs) of a single cell has been challenging. By analyzing SNVs and CNVs simultaneously in bulk and single cells of premalignant tissues and tumors from mouse and human BRCA1-associated breast cancers, we discover an evolution process through which the tumors initiate from cells with SNVs affecting driver genes in the premalignant stage and malignantly progress later via CNVs acquired in chromosome regions with cancer driver genes. These events occur randomly and hit many putative cancer drivers besides p53 to generate unique genetic and pathological features for each tumor. Upon this, we finally identify a tumor metastasis suppressor Plekha5, whose deficiency promotes cancer metastasis to the liver and/or lung.

Also flagged:mitochondrialtelomerebisphenol Aimmune disorderstumourER
Journal Article 2020-09-25 No Snippets Tran HTT, Herz C, Lamy E.
Show Full Abstract

Exposure to the endocrine disruptor bisphenol A (BPA) has been linked with immune disorders and increased tumour risk. Our previous work in activated human peripheral blood mononuclear cells demonstrated that exposure to "low-dose" BPA diminished telomerase activity via an ER/GPR30-ERK signalling pathway. Leukocyte telomerase activity and telomere maintenance are crucial for normal immune function and homeostasis. We thus here further studied the effects of BPA on human T cell subpopulations. Exposure to 0.3-3 nM BPA, i. e. at doses in the realm of human exposure, notably reduced telomerase activity in activated CD8 + T but not CD4 + T cells in a non-monotonic response pattern as determined by the TRAP-ELISA assay. Under long-term BPA exposure, significant telomere length shortening, reduction in mitochondrial DNA copy number, cell proliferation and IFN-γ as well as hTERT protein suppression could be observed in CD8 + lymphocytes, as analysed by qRT-PCR, flow cytometry and western blot analysis. This study extends our previous in vitro findings that "low-dose" BPA has potential negative effects on healthy human cytotoxic T cell response. These results might merit some special attention to further investigate chronic BPA exposure in the context of adaptive immune response dysfunction and early onset of cancer in man.

Also flagged:intraventricular hemorrhagecoagulationangiogenesisCytokinesRTIBara
Journal Article 2020-09-25 No Snippets Thornburg CD, Erickson SW, Page GP, Clark EAS, DeAngelis MM, Hartnett ME, Goldstein RF, Dagle JM, Murray JC, Poindexter BB, Das A, Cotten CM, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To test associations between grades 3 or 4 (severe) intraventricular hemorrhage (IVH) and single nucleotide polymorphisms (SNPs) associated with coagulation, inflammation, angiogenesis, and organ development in an exploratory study.<h4>Study design</h4>Extremely low-birthweight (ELBW) infants enrolled in the Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network's (NRN) Cytokines Study were included if they had cranial ultrasound (CUS) and genotyping data available in the NRN Anonymized DNA Repository and Database. Associations between SNPs and IVH severity were tested with multivariable logistic regression analysis.<h4>Result</h4>One hundred thirty-nine infants with severe IVH and 687 infants with grade 1 or 0 IVH were included. One thousand two hundred seventy-nine SNPs were genotyped. Thirteen were preliminarily associated with severe IVH including five related to central nervous system (CNS) neuronal and neurovascular development.<h4>Conclusion</h4>Genetic variants for CNS neuronal and neurovascular development may be associated with severe IVH in premature infants.

Also flagged:Mitochondrial ribosomal proteinsMrpembryogenesisamino acidmitochondrialribosomal protein
Journal Article 2020-09-25 ✓ 1 Snippet Cheong A, Lingutla R, Mager J.
In-Text Gene Mentions

MRPL39

Show Full Abstract

Mitochondrial ribosomal proteins (MRPs) are essential components for the structural and functional integrity of the mitoribosome complex. Throughout evolution, the mammalian mitoribosome has acquired new Mrp genes to compensate for loss of ribosomal RNA. More than 80 MRPs have been identified in mammals. Here we document expression pattern of 79 Mrp genes during mouse development and adult tissues and find that these genes are consistently expressed throughout early embryogenesis with little stage or tissue specificity. Further investigation of the amino acid sequence reveals that this group of proteins has little to no protein similarity. Recent work has shown that the majority of Mrp genes are essential resulting in early embryonic lethality, suggesting no functional redundancy among the group. Taken together, these results indicate that the Mrp genes are not a gene family descended from a single ancestral gene, and that each MRP has unique and essential role in the mitoribosome complex. The lack of functional redundancy is surprising given the importance of the mitoribosome for cellular and organismal viability. Further, these data suggest that genomic variants in Mrp genes may be causative for early pregnancy loss and should be evaluated as clinically.

Also flagged:nucleotidescell differentiationcancerangiogenesistumoroxygen
Journal Article 2020-09-25 No Snippets Teppan J, Barth DA, Prinz F, Jonas K, Pichler M, Klec C.
Show Full Abstract

Long non-coding RNAs (lncRNAs) are defined as non-protein coding transcripts with a minimal length of 200 nucleotides. They are involved in various biological processes such as cell differentiation, apoptosis, as well as in pathophysiological processes. Numerous studies considered that frequently deregulated lncRNAs contribute to all hallmarks of cancer including metastasis, drug resistance, and angiogenesis. Angiogenesis, the formation of new blood vessels, is crucial for a tumor to receive sufficient amounts of nutrients and oxygen and therefore, to grow and exceed in its size over the diameter of 2 mm. In this review, the regulatory mechanisms of lncRNAs are described, which influence tumor angiogenesis by directly or indirectly regulating oncogenic pathways, interacting with other transcripts such as microRNAs (miRNAs) or modulating the tumor microenvironment. Further, angiogenic lncRNAs occurring in several cancer types such as liver, gastrointestinal cancer, or brain tumors are summarized. Growing evidence on the influence of lncRNAs on tumor angiogenesis verified these transcripts as potential predictive or diagnostic biomarkers or therapeutic targets of anti-angiogenesis treatment. However, there are many unsolved questions left which are pointed out in this review, hence driving comprehensive research in this area is necessary to enable an effective use of lncRNAs as either therapeutic molecules or diagnostic targets in cancer.

Also flagged:Retinoblastomaextracellularmembranelipidvesiclesvesicular bodies
Journal Article 2020-09-25 ✓ 1 Snippet Lande K, Gupta J, Ranjan R, Kiran M, Torres Solis LF, Solís Herrera A, Aliev G, Karnati R.
In-Text Gene Mentions

DCC (deleted in colorectal carcinoma), a tumor suppressor gene, whose functional loss in colorectal cancer suggests its metastatic role [160].

Show Full Abstract

Exosomes, considered as cell debris or garbage bags, have been later characterized as nanometer-sized extracellular double-membrane lipid bilayer bio-vesicles secreted by the fusion of vesicular bodies with the plasma membrane. The constituents and the rate of exosomes formation differ in different pathophysiological conditions. Exosomes are also observed and studied in different parts of the eye, like the retina, cornea, aqueous, and vitreous humor. Tear fluid consists of exosomes that are shown to regulate various cellular processes. The role of exosomes in eye cancers, especially retinoblastoma (RB), is not well explored, although few studies point towards their presence. Retinoblastoma is an intraocular tumor that constitutes 3% of cases of cancer in children. Diagnosis of RB may require invasive procedures, which might lead to the spread of the disease to other parts. Due to this reason, better ways of diagnosis are being explored. Studies on the exosomes in RB tumors and serum might help designing better diagnostic approaches for RB. In this article, we reviewed studies on exosomes in the eye, with a special emphasis on RB. We also reviewed miRNAs expressed in RB tumor, serum, and cell lines and analyzed the targets of these miRNAs from the proteins identified in the RB tumor exosomes. hsa-miR-494 and hsa-miR-9, upregulated and downregulated, respectively in RB, have the maximum number of targets. Although oppositely regulated, they share the same targets in the proteins identified in RB tumor exosomes. Overall this review provides the up-to-date progress in the area of eye exosome research, with an emphasis on RB.

Also flagged:neurodegenerative diseaseHDacetylcarnitinecreatineL
Journal Article 2020-09-25 ✓ 3 Snippets Christodoulou CC, Demetriou CA, Zamba-Papanicolaou E.
In-Text Gene Mentions

The huntingtin (HTT) gene, which is mutated in HD, consists of cytosine-adenine-guanine (CAG) which are repeated multiple times.

…The huntingtin (HTT) gene, which is…

…form of theHTTprotein, called mutant…

Show Full Abstract

Decades of research and experimental studies have investigated Huntington's disease (HD), a rare neurodegenerative disease. Similarly, several studies have investigated whether high/moderate adherence to the Mediterranean Diet and specific macro and micronutrients can decrease cognitive loss and provide a neuroprotective function to neurons. This review systematically identifies and examines studies that have investigated Mediterranean Diet adherence, micro- and macronutrients, supplementation and caloric intake in people with HD, in order to identify if dietary exposures resulted in improvement of disease symptoms, a delay in age of onset or if they contributed to an earlier age of onset in people with HD. A systematic search of PubMed, Directory of open access journal and HubMed was performed independently by two reviewers using specific search terms criteria for studies. The identified abstracts were screened and the studies were included in the review if they satisfied predetermined inclusion criteria. Reference screening of included studies was also performed. A total of 18 studies were included in the review. A few studies found that patients who had high/moderate adherence to Mediterranean Diet showed a slight improvement in their Unified Huntington's Disease Rating Scale and Total Functional Capacity. In addition, people with HD who had high Mediterranean Diet adherence showed an improvement in both cognitive and motor scores and had a better quality of life compared to patients who had low Mediterranean Diet adherence. Furthermore, a few studies showed that supplementation with specific nutrients, such as triheaptanoin, L-acetyl-carnitine and creatine, had no beneficial effect on the patients' Unified Huntington's Disease Rating Scale score. A few studies suggest that the Mediterranean Diet may confer a motor and cognitive benefit to people with HD. Unfortunately, there was little consistency among study findings. It is important for more research to be conducted to have a better understanding of which dietary exposures are beneficial and may result delaying age of onset or disease progression in people with HD.

Also flagged:IronmetabolisminfectionhemeinfectionsFungal Infections
Journal Article 2020-09-25 No Snippets Chhabra R, Saha A, Chamani A, Schneider N, Shah R, Nanjundan M.
Show Full Abstract

Iron is an essential element required to support the health of organisms. This element is critical for regulating the activities of cellular enzymes including those involved in cellular metabolism and DNA replication. Mechanisms that underlie the tight control of iron levels are crucial in mediating the interaction between microorganisms and their host and hence, the spread of infection. Microorganisms including viruses, bacteria, and fungi have differing iron acquisition/utilization mechanisms to support their ability to acquire/use iron (e.g., from free iron and heme). These pathways of iron uptake are associated with promoting their growth and virulence and consequently, their pathogenicity. Thus, controlling microorganismal survival by limiting iron availability may prove feasible through the use of agents targeting their iron uptake pathways and/or use of iron chelators as a means to hinder development of infections. This review will serve to assimilate findings regarding iron and the pathogenicity of specific microorganisms, and furthermore, find whether treating infections mediated by such organisms via iron chelation approaches may have potential clinical benefit.

Also flagged:Dentinogenesis Imperfecta Type IIDentinogenesis imperfectaDGI type IIgenetic disordertooth developmentgenetic disorders
Journal Article 2020-09-25 ✓ 1 Snippet Alrashdi M, Schoener J, Contreras CI, Chen S.
In-Text Gene Mentions

…that DGI-II andDGI-IIIare associated with…

Show Full Abstract

<h4>Background</h4>Dentinogenesis imperfecta (DGI) is a complex anomaly, not only by its structure but by treatment approach. The treatment protocol depends on the severity, behavior, and the age of the patient.<h4>Case description</h4>This paper presents two siblings' cases of DGI type II (DGI-II) with different treatment based on the patient's clinical severity, behavior, and age (mixed versus primary dentition). The first case involves a patient in the primary dentition with severe attrition leading to a reduction in the vertical dimension of occlusion (VDO) treated by the fabrication of complete overlay dentures. The second case involves a patient in the early mixed dentition treated with restorations and extractions.<h4>Conclusion</h4>Full mouth rehabilitation in the two patients dramatically improves function, aesthetics, and proved to be a significant psychological boost to the patient's well-being.<h4>Practical implications</h4>Early diagnosis and a multidisciplinary approach for patients with DGI to preserve the remaining teeth and rehabilitation for their function and aesthetics are essential for obtaining a favorable prognosis.

Also flagged:Sideroblastic AnemiaanemiaserythropoiesishemebiosynthesisCongenital
Journal Article 2020-09-25 ✓ 1 Snippet Abu-Zeinah G, DeSancho MT.
In-Text Gene Mentions

…to guidelines forhemochromatosispatients.…

Show Full Abstract

Sideroblastic anemia (SA) consists of a group of inherited and acquired anemias of ineffective erythropoiesis characterized by the accumulation of ring sideroblasts in the bone marrow due to disrupted heme biosynthesis. Congenital sideroblastic anemia (CSA) is rare and has three modes of inheritance: X-linked (XLSA), autosomal recessive (ARCSA), and maternal. Acquired SA is more common and can be a result of myelodysplastic syndromes (MDS) or other, generally reversible causes. The diagnostic approach to SA includes a work-up for reversible causes and genetic testing for CSA based on clinical suspicion, family history and genetic pedigree. The treatment of SA depends on the underlying etiology but remains primarily supportive with vitamin B6 supplementation for select cases of XLSA, thiamine for thiamine-responsive megaloblastic anemia subtype, red blood cell transfusions for symptomatic patients and iron chelation therapy for iron overload. The management of anemia in MDS subtypes with ring sideroblasts remains unique and includes the recently approved erythroid maturation agent, Luspatercept. Although there is currently no curative therapy for CSA, anecdotal reports of hematopoietic stem cell transplant demonstrate remissions in selective, non-syndromic cases. This review summarizes the genetics, pathophysiology, diagnosis and treatment of SA for general practitioners and clinical hematologists.

Also flagged:Breast Cancercancersorganizationnucleobaseheterocyclefocal adhesion
Journal Article 2020-09-25 ✓ 4 Snippets Xiao K, Li K, Long S, Kong C, Zhu S.
In-Text Gene Mentions

…1 (HDAC1), huntingtin (HTT), RAC-alpha serine/threonine-…

…growth factor (HDGF),roquin-1(RC3H1), chromobox protein…

…factor (HDGF), roquin-1 (RC3H1), chromobox protein homolog…

…Downregulation ofHTTtranscription and protein…

Show Full Abstract

Breast cancer is one of the most common cancers endangering women's health all over the world. Traditional Chinese medicine is increasingly recognized as a possible complementary and alternative therapy for breast cancer. Chaihu-Shugan-San is a traditional Chinese medicine prescription, which is extensively used in clinical practice. Its therapeutic effect on breast cancer has attracted extensive attention, but its mechanism of action is still unclear. In this study, we explored the molecular mechanism of Chaihu-Shugan-San in the treatment of breast cancer by network pharmacology. The results showed that 157 active ingredients and 8074 potential drug targets were obtained in the TCMSP database according to the screening conditions. 2384 disease targets were collected in the TTD, OMIM, DrugBank, GeneCards disease database. We applied the Bisogenet plug-in in Cytoscape 3.7.1 to obtain 451 core targets. The biological process of gene ontology (GO) involves the mRNA catabolic process, RNA catabolic process, telomere organization, nucleobase-containing compound catabolic process, heterocycle catabolic process, and so on. In cellular component, cytosolic part, focal adhesion, cell-substrate adherens junction, and cell-substrate junction are highly correlated with breast cancer. In the molecular function category, most proteins were addressed to ubiquitin-like protein ligase binding, protein domain specific binding, and Nop56p-associated pre-rRNA complex. Besides, the results of the KEGG pathway analysis showed that the pathways mainly involved in apoptosis, cell cycle, transcriptional dysregulation, endocrine resistance, and viral infection. In conclusion, the treatment of breast cancer by Chaihu-Shugan-San is the result of multicomponent, multitarget, and multipathway interaction. This study provides a certain theoretical basis for the treatment of breast cancer by Chaihu-Shugan-San and has certain reference value for the development and application of new drugs.

Also flagged:Liver Cirrhosischronic liver diseaseslung diseasehepato-pulmonary syndromeHPSporto-pulmonary hypertension
Journal Article 2020-09-25 ✓ 1 Snippet Benz F, Mohr R, Tacke F, Roderburg C.
In-Text Gene Mentions

…storage disorders likehemochromatosis, Wilson’s disease and…

Show Full Abstract

Patients with advanced chronic liver diseases, particularly with decompensated liver cirrhosis, can develop specific pulmonary complications independently of any pre-existing lung disease. Especially when dyspnea occurs in combination with liver cirrhosis, patients should be evaluated for hepato-pulmonary syndrome (HPS), porto-pulmonary hypertension (PPHT), hepatic hydrothorax and spontaneous bacterial empyema, which represent the clinically most relevant pulmonary complications of liver cirrhosis. Importantly, the pathophysiology, clinical features, diagnosis and the corresponding therapeutic options differ between these entities, highlighting the role of specific diagnostics in patients with liver cirrhosis who present with dyspnea. Liver transplantation may offer a curative therapy, including selected cases of HPS and PPHT. In this review article, we summarize the pathogenesis, clinical features, diagnostic algorithms and treatment options of the 4 specific pulmonary complications in patients with liver cirrhosis.

Also flagged:miRNAstrokepathogenesisreverse transcriptioncell adhesionMoyamoya Disease
Journal Article 2020-09-25 ✓ 1 Snippet Wang G, Wen Y, Faleti OD, Zhao Q, Liu J, Zhang G, Li M, Qi S, Feng W, Lyu X.
In-Text Gene Mentions

…RAB3B, RSPO4, SCN4B,SHISA6, TEAD1, ZDHHC9 (…

Show Full Abstract

<h4>Background</h4>Moyamoya disease (MMD) is an important cause of stroke in children and young adults in Asia. To date, diagnosis remains challenging due to varying clinical manifestations and unknown pathogenesis. The study aims to identify cerebrospinal fluid (CSF) exosomal microRNAs (exomiRs) that can serve as a novel diagnostic biomarker for diagnosis and assess its clinical applications.<h4>Methods</h4>CSF samples were taken from 31 MMD patients and 31 healthy controls. Initial screening of miRNA expression was performed on samples pooled from MMD patients and controls using microarray and validated using quantitative reverse transcription polymerase chain reaction (qRT-PCR). The diagnostic accuracy of the potential exosomal miRNAs was evaluated using receiver operating characteristic curve analyses in an independent patient cohort. The potential pathways regulated by the miRNAs was also determined using bioinformatics analysis.<h4>Results</h4>The microarray results demonstrated that six exomiRs were dysregulated in the MMD patients compared to the controls. Using qRT-PCR, we validated four of the miRNAs (miR-3679-5p, miR-6165, miR-6760-5p, and miR-574-5p) as a biomarker for MMD diagnosis. The four exomiRs showed enhanced sensitivity (75%) and specificity (93.75%) in terms of differentiating MMD patients from healthy subjects [area under the curve (AUC) = 0.9453]. Pathway enrichment analysis for potential targets of six exomiRs identified proteins involved in cell adhesion and junction formation in the brain.<h4>Conclusions</h4>We identified a novel and highly sensitive exomiRs signature for MMD detection and explored its potential targets using bioinformatics analysis.

Also flagged:ion channel
Journal Article 2020-09-25 No Snippets Liu Z, Roberts R, Shi T, Mikailov M, Tong W.
Show Full Abstract

No abstract available.

Also flagged:Taumicrotubule binding proteinaxonsnucleusnucleolusenvelope
Journal Article 2020-09-25 ✓ 5 Snippets Diez L, Wegmann S.
In-Text Gene Mentions

Grima et al. confirmed the interaction of Nup62 and RanGap1 with intranuclear polyQ–Htt inclusions in HD transgenic mouse and Drosophila models, primary neurons expressing polyQ–Htt, HD patient-derived iPSC neurons, and post-mortem human HD brain regions (45).

Huntington's disease is caused by a CAG-repeat expansion in exon 1 of the huntingtin gene, which leads to a long polyglutamine (polyQ; n = 35–60+) stretch on the N-terminal end of the Huntingtin protein (Htt) (169, 170).

…., artificial β-sheets, polyQ–Httfragments, cytoplasmic fragmen…

…the Huntingtin protein (Htt) ( 169 ,…

Httis equipped with…

Show Full Abstract

Tau is a cytosolic microtubule binding protein that is highly abundant in the axons of the central nervous system. However, alternative functions of tau also in other cellular compartments are suggested, for example, in the nucleus, where interactions of tau with specific nuclear entities such as DNA, the nucleolus, and the nuclear envelope have been reported. We would like to review the current knowledge about tau-nucleus interactions and lay out possible neurotoxic mechanisms that are based on the (pathological) interactions of tau with the nucleus.

Also flagged:fatty acidslactationgene expressionlipidmetabolismsynthesis
Journal Article 2020-09-25 ✓ 2 Snippets Li C, Zhu J, Shi H, Luo J, Zhao W, Shi H, Xu H, Wang H, Loor JJ.
In-Text Gene Mentions

B4GALT5, SERPINE1, and MDH2 were identified as the top-most abundant DEGs in the lactose metabolic process/pathway (Supplementary Table S10).

B4GALT5, SERPINE1 ,…

Show Full Abstract

Milk fatty acids secreted by the mammary gland are one of the most important determinants of the nutritional value of goat milk. Unlike cow milk, limited data are available on the transcriptome-wide changes across stages of lactation in dairy goats. In this study, goat mammary gland tissue collected at peak lactation, cessation of milking, and involution were analyzed with digital gene expression (DGE) sequencing to generate longitudinal transcript profiles. A total of 51,299 unigenes were identified and further annotated to 12,763 genes, of which 9,131 were differentially expressed across various stages of lactation. Most abundant genes and differentially expressed genes (DEGs) were functionally classified through clusters of euKaryotic Orthologous Groups (KOG), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. A total of 16 possible expression patterns were uncovered, and 13 genes were deemed novel candidates for regulation of lactation in the goat: <i>POLG</i>, <i>SPTA1</i>, <i>KLC</i>, <i>GIT2</i>, <i>COPS3</i>, <i>PDP</i>, <i>CD31</i>, <i>USP16/29/37</i>, <i>TLL1</i>, <i>NCAPH</i>, <i>ABI2</i>, <i>DNAJC4</i>, and <i>MAPK8IP3</i>. In addition, <i>PLA2</i>, <i>CPT1</i>, <i>PLD</i>, <i>GGA</i>, <i>SRPRB</i>, and <i>AP4S1</i> are proposed as novel and promising candidates regulating mammary fatty acid metabolism. "Butirosin and neomycin biosynthesis" and "Glyoxylate and dicarboxylate metabolism" were the most impacted pathways, and revealed novel metabolic alterations in lipid metabolism as lactation progressed. Overall, the present study provides new insights into the synthesis and metabolism of fatty acids and lipid species in the mammary gland along with more detailed information on molecular regulation of lactogenesis. The major findings will benefit efforts to further improve milk quality in dairy goats.

Also flagged:Circularbindingcancermesial temporal lobe epilepsysynapsessignal transduction
Journal Article 2020-09-25 ✓ 5 Snippets Gray LG, Mills JD, Curry-Hyde A, Devore S, Friedman D, Thom M, Scott C, Thijs RD, Aronica E, Devinsky O, Janitz M.
In-Text Gene Mentions

…by CIRCexplorer2 andDCCand those detected…

…binding to circRNA-FBXL4, there was…

…CircRNA-FBXL4is expressed from…

…locus of theF-Box and leucine-rich repeat protein 4and leucine-rich repeat…

…TheFBXL4protein colocalizes with…

Show Full Abstract

Circular RNAs (circRNAs) regulate mRNA translation by binding to microRNAs (miRNAs), and their expression is altered in diverse disorders, including cancer, cardiovascular disease, and Parkinson's disease. Here, we compare circRNA expression patterns in the temporal cortex and hippocampus of patients with pharmacoresistant mesial temporal lobe epilepsy (MTLE) and healthy controls. Nine circRNAs showed significant differential expression, including circRNA-<i>HOMER1</i>, which is expressed in synapses. Further, we identified miRNA binding sites within the sequences of differentially expressed (DE) circRNAs; expression levels of mRNAs correlated with changes in complementary miRNAs. Gene set enrichment analysis of mRNA targets revealed functions in heterocyclic compound binding, regulation of transcription, and signal transduction, which maintain the structure and function of hippocampal neurons. The circRNA-miRNA-mRNA interaction networks illuminate the molecular changes in MTLE, which may be pathogenic or an effect of the disease or treatments and suggests that DE circRNAs and associated miRNAs may be novel therapeutic targets.

Also flagged:laminaextracellularneuronal migrationneuron migrationaxonGolgi
Journal Article 2020-09-25 No Snippets Hansen AH, Hippenmeyer S.
Show Full Abstract

Concerted radial migration of newly born cortical projection neurons, from their birthplace to their final target lamina, is a key step in the assembly of the cerebral cortex. The cellular and molecular mechanisms regulating the specific sequential steps of radial neuronal migration <i>in vivo</i> are however still unclear, let alone the effects and interactions with the extracellular environment. In any <i>in vivo</i> context, cells will always be exposed to a complex extracellular environment consisting of (1) secreted factors acting as potential signaling cues, (2) the extracellular matrix, and (3) other cells providing cell-cell interaction through receptors and/or direct physical stimuli. Most studies so far have described and focused mainly on intrinsic cell-autonomous gene functions in neuronal migration but there is accumulating evidence that non-cell-autonomous-, local-, systemic-, and/or whole tissue-wide effects substantially contribute to the regulation of radial neuronal migration. These non-cell-autonomous effects may differentially affect cortical neuron migration in distinct cellular environments. However, the cellular and molecular natures of such non-cell-autonomous mechanisms are mostly unknown. Furthermore, physical forces due to collective migration and/or community effects (i.e., interactions with surrounding cells) may play important roles in neocortical projection neuron migration. In this concise review, we first outline distinct models of non-cell-autonomous interactions of cortical projection neurons along their radial migration trajectory during development. We then summarize experimental assays and platforms that can be utilized to visualize and potentially probe non-cell-autonomous mechanisms. Lastly, we define key questions to address in the future.

Also flagged:Cardiovascular diseaseaginggene expressioncardiovascular diseasesheart failureatrial hypertrophy
Journal Article 2020-09-25 No Snippets Greenig M, Melville A, Huntley D, Isalan M, Mielcarek M.
Show Full Abstract

Cardiovascular disease accounts for millions of deaths each year and is currently the leading cause of mortality worldwide. The aging process is clearly linked to cardiovascular disease, however, the exact relationship between aging and heart function is not fully understood. Furthermore, a holistic view of cardiac aging, linking features of early life development to changes observed in old age, has not been synthesized. Here, we re-purpose RNA-sequencing data previously-collected by our group, investigating gene expression differences between wild-type mice of different age groups that represent key developmental milestones in the murine lifespan. DESeq2's generalized linear model was applied with two hypothesis testing approaches to identify differentially-expressed (DE) genes, both between pairs of age groups and across mice of all ages. Pairwise comparisons identified genes associated with specific age transitions, while comparisons across all age groups identified a large set of genes associated with the aging process more broadly. An unsupervised machine learning approach was then applied to extract common expression patterns from this set of age-associated genes. Sets of genes with both linear and non-linear expression trajectories were identified, suggesting that aging not only involves the activation of gene expression programs unique to different age groups, but also the re-activation of gene expression programs from earlier ages. Overall, we present a comprehensive transcriptomic analysis of cardiac gene expression patterns across the entirety of the murine lifespan.

Also flagged:gene expressionprotein synthesisbehavioral disordersnucleotideFolliculinchromosome
Journal Article 2020-09-25 No Snippets Smith M.
Show Full Abstract

The growth of expertise in molecular techniques, their application to clinical evaluations, and the establishment of databases with molecular genetic information has led to greater insights into the roles of molecular processes related to gene expression in neurodevelopment and functioning. The goal of this review is to examine new insights into messenger RNA transcription, translation, and cellular protein synthesis and the relevance of genetically determined alterations in these processes in neurodevelopmental, cognitive, and behavioral disorders.

Also flagged:Multiple MyelomaMultiple myelomastem cell malignancyanemiakidney diseasehypercalcemia
Journal Article 2020-09-25 ✓ 1 Snippet Waleed MS, Sadiq W.
In-Text Gene Mentions

…leading to secondaryhemochromatosis.…

Show Full Abstract

Multiple myeloma is a hematopoietic stem cell malignancy that involves the plasma cells. It starts insidiously and usually involves males in their 60's. Clinical manifestations usually include anemia, kidney disease, hypercalcemia, and bone pains. We present a male with multiple myeloma whose blood group changed from AB positive to O positive. ABO blood group change can occur in multiple myeloma so blood group should be checked thoroughly in patients with hematological malignancies to prevent serious hematological reactions.

Also flagged:COVID-19Acute Limb IschemiaCoronavirus disease 2019disseminated intravascular coagulationcoagulopathyhypertension
Journal Article 2020-09-25 ✓ 5 Snippets Gubitosa JC, Xu P, Ahmed A, Pergament K.
In-Text Gene Mentions

…of antithrombin III (ATIII).…

…of antithrombin III (ATIII) compared to control…

ATIIItargets and inactivates…

…used fondaparinux potentiateATIIIas their primary…

…hereditary or acquiredATIIIdeficiency (as in…

Show Full Abstract

Coronavirus disease 2019 (COVID-19), caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has been found to cause multiple complications across several organ systems in patterns not typically observed in previous iterations of the virus. Hemostatic mechanisms have been noted to be significantly altered in particular, resulting in a disseminated intravascular coagulation (DIC)-like picture with elements of coagulopathy as well as hypercoagulability. A 65-year-old man with hypertension, hyperlipidemia, prior tobacco use, chronic kidney disease, and diabetes presented from a correctional facility with hypoxia. The diagnosis of COVID-19 was confirmed. With his elevated D-dimer of >7,955 ng/mL (reference: 90-500 ng/mL) in the setting of COVID-19 and hypoxia, he was empirically started on therapeutic anticoagulation with enoxaparin. His oxygen requirements increased, mental status deteriorated, and platelets began falling, raising concern for heparin-induced thrombocytopenia versus DIC. Heparin products were discontinued in favor of a direct oral anticoagulant. He later became obtunded and unable to tolerate oral medications. Fondaparinux was initiated. Two days later, he was found to have acute limb ischemia of the right lower extremity. He underwent surgical thrombectomy but required an above-the-knee amputation the following day. Shortly after he died secondary to hypoxic respiratory failure. This case highlights the derangement of hemostatic mechanisms seen prominently in COVID-19 infection and raises questions as to appropriate anticoagulant choices to adequately prevent thrombosis. Thorough physical exams should be performed on all patients with COVID-19, taking into account this documented hypercoagulability. Further investigation is warranted into the use of heparin products as the anticoagulant of choice in these patients given observed deficiencies of antithrombin III (ATIII).

Also flagged:immune responses(NCF)2NCF4NCF2intracranial aneurysmsubarachnoid hemorrhage
Journal Article 2020-09-25 ✓ 2 Snippets Huang L, Li X, Chen Z, Liu Y, Zhang X.
In-Text Gene Mentions

…upregulated lncRNAs [HCG27,ZNFX1antisense RNA 1,…

…degree=198), one pink [ZNFX1antisense RNA 1…

Show Full Abstract

Ruptured intracranial aneurysm (IA)‑induced subarachnoid hemorrhage (SAH) triggers a series of immune responses and inflammation in the brain and body. The present study was conducted to identify additional circulating biomarkers that may serve as potential therapeutic targets for SAH‑induced inflammation. Differentially expressed (DE) long non‑coding RNAs (lncRNAs; DElncRNAs) and genes (DEGs) in the peripheral blood mononuclear cells between patients with IA rupture‑induced SAH and healthy controls were identified in the GSE36791 dataset. DEGs were used for weighted gene co‑expression network analysis (WGCNA), and SAH‑associated WGCNA modules were identified. Subsequently, an lncRNA‑mRNA regulatory network was constructed using the DEGs in SAH‑associated WGCNA modules. A total of 25 DElncRNAs and 1,979 DEGs were screened from patients with IA‑induced SAH in the GSE36791 dataset compared with the controls. A total of 11 WGCNA modules, including four upregulated modules significantly associated with IA rupture‑induced SAH were obtained. The DEGs in the SAH‑associated modules were associated with Gene Ontology biological processes such as 'regulation of programmed cell death', 'apoptosis' and 'immune response'. The subsequent lncRNA‑mRNA regulatory network included seven upregulated lncRNAs [HCG27, ZNFX1 antisense RNA 1, long intergenic non‑protein coding RNA (LINC)00265, murine retrovirus integration site 1 homolog‑antisense RNA 1, cytochrome P450 1B1‑AS1, LINC01347 and LINC02193] and 375 DEGs. Functional enrichment analysis and screening in the Comparative Toxicogenomics Database demonstrated that SAH‑associated DEGs, including neutrophil cytosolic factor (NCF)2 and NCF4, were enriched in 'chemokine signaling pathway' (hsa04062), 'leukocyte transendothelial migration' (hsa04670) and 'Fc gamma R‑mediated phagocytosis' (hsa04666). The upregulated lncRNAs and genes, including NCF2 and NCF4, in patients with IA rupture‑induced SAH indicated their respective potentials as anti‑inflammatory therapeutic targets.

Congenital Mirror Movements

Also flagged:NTN1RAD51AD
Journal Article 2020-09-24 ✓ 3 Snippets Méneret A, Trouillard O, Dunoyer M, Depienne C, Roze E.
In-Text Gene Mentions

…pathogenic variant inDCCmay have CMM…

…pathogenic variant inDCC, NTN1, or RAD51…

…and/or has aDCC, NTN1, or RAD51…

Show Full Abstract

<h4>Clinical characteristics</h4>The disorder of congenital mirror movements (CMM) is characterized by early-onset, obvious mirror movements (involuntary movements of one side of the body that mirror intentional movements on the opposite side) in individuals who typically have no other clinical signs or symptoms. Although mirror movements vary in severity, most affected individuals have strong and sustained mirror movements of a lesser amplitude than the corresponding voluntary movements. Mirror movements usually persist throughout life, without deterioration or improvement, and are not usually associated with subsequent onset of additional neurologic manifestations. However, a subset of affected individuals with a heterozygous pathogenic variant in DCC may have CMM with abnormalities of the corpus callosum and concomitant cognitive and/or neuropsychiatric issues.<h4>Diagnosis/testing</h4>The diagnosis of CMM is established in a proband with suggestive clinical findings and occasionally by identification of a heterozygous pathogenic variant in DCC, NTN1, or RAD51 by molecular genetic testing.<h4>Management</h4>Treatment of manifestations: Adaptation of the school environment (e.g., allocation of extra time during examinations and limitation of the amount of handwriting) is recommended. Stigmatizing children and adolescents should be avoided to assure that educational opportunities are not lost as a result of mirror movements. Adolescents and young adults should be encouraged to consider a profession that does not require complex bimanual movements, repetitive or sustained hand movements, or extensive handwriting. Standard therapy for any neurocognitive issues is recommended. Agents/circumstances to avoid: Complex bimanual movements or sustained/repetitive hand activity in order to reduce pain or discomfort in the upper limbs.<h4>Genetic counseling</h4>CMM is generally inherited in an autosomal dominant (AD) manner. (Autosomal recessive inheritance has been suggested in one family.) For AD inheritance: most individuals with CMM resulting from a pathogenic variant in DCC, NTN1, or RAD51 inherited the pathogenic variant from a parent who may be symptomatic or asymptomatic. If a parent of the proband is affected and/or has a DCC, NTN1, or RAD51 pathogenic variant, the risk to the sibs of inheriting the variant is 50%. Of note, the sibs of a proband who has clinically unaffected parents are still at increased risk for CMM because of the significant possibility of reduced penetrance in a heterozygous parent. Each child of an individual with AD CMM has a 50% chance of inheriting the causative variant; however, because of reduced penetrance, offspring who inherit the pathogenic variant may not manifest CMM. Once the CMM-causing pathogenic variant has been identified in an affected family member, prenatal and preimplantation genetic testing are possible.

Also flagged:cancerscancerXKR9gene expressioncyclin B1RB1CC1
Journal Article 2020-09-24 ✓ 2 Snippets Li Y, Pang X, Cui Z, Zhou Y, Mao F, Lin Y, Zhang X, Shen S, Zhu P, Zhao T, Sun Q, Zhang J.
In-Text Gene Mentions

Given that XKR9 (XK related 9) could be the gene directly regulated by one or more of the transcription factors (FOXA2, RXRA, HNF4A, YY1, ZNF644, FOXA1, SP1, SOX13, and HNF4G) through one or more of the SNPs (multiple SNPs around chr8:71579362 and chr8:71917527) to cause some of the observed cancer racial disparities, we conducted literature search to find more about the links between XKR9 and cancer.

…RXRA, HNF4A, YY1,ZNF644, FOXA1, SP1, SOX13,…

Show Full Abstract

It is well known that different racial groups have significantly different incidence and mortality rates for certain cancers. It has been suggested that biological factors play a major role in these cancer racial disparities. Previous studies on the biological factors contributing to cancer racial disparity have generated a very large number of candidate factors, although there is modest agreement among the results of the different studies. Here, we performed an integrative analysis using genomic data of 21 cancer types from TCGA, GTEx, and the 1000 Genomes Project to identify biological factors contributing to racial disparity in cancer. We also built a companion website with additional results for cancer researchers to freely mine. Our study identified genes, gene families, and pathways displaying similar differential expression patterns between different racial groups across multiple cancer types. Among them, XKR9 gene expression was found to be significantly associated with overall survival for all cancers combined as well as for several individual cancers. Our results point to the interesting hypothesis that XKR9 could be a novel drug target for cancer immunotherapy. Bayesian network modeling showed that XKR9 is linked to important cancer-related genes, including FOXM1, cyclin B1, and RB1CC1 (RB1 regulator). In addition, metabolic pathways, neural signaling pathways, and several cancer-related gene families were found to be significantly associated with cancer racial disparities for multiple cancer types. Single nucleotide polymorphisms (SNPs) discovered through integrating data from the TCGA, GTEx, and 1000 Genomes databases provide biologists the opportunity to test highly promising, targeted hypotheses to gain a deeper understanding of the genetic drivers of cancer racial disparity and cancer biology in general.

Also flagged:gene expressionneurogenesisBahcc1chromatinNr2f1top
Journal Article 2020-09-24 ✓ 1 Snippet Hezroni H, Ben-Tov Perry R, Gil N, Degani N, Ulitsky I.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Mammalian genomes encode thousands of long noncoding RNAs (lncRNAs), yet the biological functions of most of them remain unknown. A particularly rich repertoire of lncRNAs found in mammalian brain and in the early embryo. We used RNA-seq and computational analysis to prioritize lncRNAs that may regulate commitment of pluripotent cells to a neuronal fate and perturbed their expression prior to neuronal differentiation. Knockdown by RNAi of two highly conserved and well-expressed lncRNAs, Reno1 (2810410L24Rik) and lnc-Nr2f1, decreased the expression of neuronal markers and led to massive changes in gene expression in the differentiated cells. We further show that the Reno1 locus forms increasing spatial contacts during neurogenesis with its adjacent protein-coding gene Bahcc1. Loss of either Reno1 or Bahcc1 leads to an early arrest in neuronal commitment, failure to induce a neuronal gene expression program, and to global reduction in chromatin accessibility at regions that are marked by the H3K4me3 chromatin mark at the onset of differentiation. Reno1 and Bahcc1 thus form a previously uncharacterized circuit required for the early steps of neuronal commitment.

Also flagged:restrictive cardiomyopathiesmyocardial diseasespathogenesisironcardiac amyloidosisheart disease
Journal Article 2020-09-24 ✓ 1 Snippet Galea N, Polizzi G, Gatti M, Cundari G, Figuera M, Faletti R.
In-Text Gene Mentions

…(AFD), glycogen storage,hemochromatosisand iron overload…

Show Full Abstract

The restrictive cardiomyopathies constitute a heterogeneous group of myocardial diseases with a different pathogenesis and overlapping clinical presentations. Diagnosing them frequently poses a challenge. Echocardiography, electrocardiograms and laboratory tests may show non-specific changes. In this context, cardiac magnetic resonance (CMR) may play a crucial role in defining the diagnosis and guiding treatments, by offering a robust myocardial characterization based on the inherent magnetic properties of abnormal tissues, thus limiting the use of endomyocardial biopsy. In this review article, we explore the role of CMR in the assessment of a wide range of myocardial diseases causing restrictive patterns, from iron overload to cardiac amyloidosis, endomyocardial fibrosis or radiation-induced heart disease. Here, we emphasize the incremental value of novel relaxometric techniques such as T1 and T2 mapping, which may recognize different storage diseases based on the intrinsic magnetic properties of the accumulating metabolites, with or without the use of gadolinium-based contrast agents. We illustrate the importance of these CMR techniques and their great support when contrast media administration is contraindicated. Finally, we describe the useful role of cardiac computed tomography for diagnosis and management of restrictive cardiomyopathies when CMR is contraindicated.

Also flagged:Prostanoid ReceptorsProstaglandinprostanoidG-protein-coupled, prostanoid-specific receptorsG-proteinsProstaglandins
Journal Article 2020-09-24 No Snippets Biringer RG.
Show Full Abstract

Prostaglandin signaling controls a wide range of biological processes from blood pressure homeostasis to inflammation and resolution thereof to the perception of pain to cell survival. Disruption of normal prostanoid signaling is implicated in numerous disease states. Prostaglandin signaling is facilitated by G-protein-coupled, prostanoid-specific receptors and the array of associated G-proteins. This review focuses on the expression, characterization, regulation, and mechanism of action of prostanoid receptors with particular emphasis on human isoforms.

Also flagged:doxorubicinoxygenmethioninesuccinatecancertumor
Journal Article 2020-09-24 No Snippets Zhang X, Zhu T, Miao Y, Zhou L, Zhang W.
Show Full Abstract

<h4>Background</h4>The enhancement of tumor retention and cellular uptake of drugs are important factors in maximizing anticancer therapy and minimizing side effects of encapsulated drugs. Herein, a delivery nanoplatform, armed with a pH-triggered charge-reversal capability and self-amplifiable reactive oxygen species (ROS)-induced drug release, is constructed by encapsulating doxorubicin (DOX) in pH/ROS-responsive polymeric micelle.<h4>Results</h4>The surface charge of this system was converted from negative to positive from pH 7.4 to pH 6.8, which facilitated the cellular uptake. In addition, methionine-based system was dissociated in a ROS-rich and acidic intracellular environment, resulting in the release of DOX and α-tocopheryl succinate (TOS). Then, the exposed TOS segments further induced the generation of ROS, leading to self-amplifiable disassembly of the micelles and drug release.<h4>Conclusions</h4>We confirms efficient DOX delivery into cancer cells, upregulation of tumoral ROS level and induction of the apoptotic capability in vitro. The system exhibits outstanding tumor inhibition capability in vivo, indicating that dual stimuli nano-system has great potential to function as an anticancer drug delivery platform.

Also flagged:39S ribosomal protein L12, mitochondrialkeratin, type I cytoskeletal 10actin-related protein 2/3 complex subunit 3keratin, type I cytoskeletal 14keratin, type I cytoskeletal 16RPS7
Journal Article 2020-09-24 ✓ 2 Snippets Sweetman E, Kleffmann T, Edgar C, de Lange M, Vallings R, Tate W.
In-Text Gene Mentions

…These includedPRDX6(whole cell body)…

…of these H1linker histoneshistones, along with…

Show Full Abstract

<h4>Background</h4>Myalgic Encephalomyelitis/Chronic Fatigue Syndrome (ME/CFS) is a serious and complex physical illness that affects all body systems with a multiplicity of symptoms, but key hallmarks of the disease are pervasive fatigue and 'post-exertional malaise', exacerbation after physical and/or mental activity of the intrinsic fatigue and other symptoms that can be highly debilitating and last from days to months. Although the disease can vary widely between individuals, common symptoms also include pain, cognitive deficits, sleep dysfunction, as well as immune, neurological and autonomic symptoms. Typically, it is a very isolating illness socially, carrying a stigma because of the lack of understanding of the cause and pathophysiology.<h4>Methods</h4>To gain insight into the pathophysiology of ME/CFS, we examined the proteomes of peripheral blood mononuclear cells (PBMCs) by SWATH-MS analysis in a small well-characterised group of patients and matched controls. A principal component analysis (PCA) was used to stratify groups based on protein abundance patterns, which clearly segregated the majority of the ME/CFS patients (9/11) from the controls. This majority subgroup of ME/CFS patients was then further compared to the control group.<h4>Results</h4>A total of 60 proteins in the ME/CFS patients were differentially expressed (P < 0.01, Log<sub>10</sub> (Fold Change) > 0.2 and < -0.2). Comparison of the PCA selected subgroup of ME/CFS patients (9/11) with controls increased the number of proteins differentially expressed to 99. Of particular relevance to the core symptoms of fatigue and post-exertional malaise experienced in ME/CFS, a proportion of the identified proteins in the ME/CFS groups were involved in mitochondrial function, oxidative phosphorylation, electron transport chain complexes, and redox regulation. A significant number were also involved in previously implicated disturbances in ME/CFS, such as the immune inflammatory response, DNA methylation, apoptosis and proteasome activation.<h4>Conclusions</h4>The results from this study support a model of deficient ATP production in ME/CFS, compensated for by upregulation of immediate pathways upstream of Complex V that would suggest an elevation of oxidative stress. This study and others have found evidence of a distinct pathology in ME/CFS that holds promise for developing diagnostic biomarkers.

Also flagged:FGFR1RBL2TumorPLCG1Small cell lung cancerSCLC
Journal Article 2020-09-24 ✓ 1 Snippet Kim KB, Kim Y, Rivard CJ, Kim DW, Park KS.
In-Text Gene Mentions

Dcc

Show Full Abstract

Small cell lung cancer (SCLC) remains a recalcitrant disease where limited therapeutic options have not improved overall survival, and approved targeted therapies are lacking. Amplification of the tyrosine kinase receptor FGFR1 (fibroblast growth factor receptor 1) is one of the few actionable alterations found in the SCLC genome. However, efforts to develop targeted therapies for <i>FGFR1</i>-amplified SCLC are hindered by critical gaps in knowledge around the molecular origins and mediators of FGFR1-driven signaling as well as the physiologic impact of targeting FGFR1. Here we show that increased FGFR1 promotes tumorigenic progression in precancerous neuroendocrine cells and is required for SCLC development <i>in vivo</i>. Notably, <i>Fgfr1</i> knockout suppressed tumor development in a mouse model lacking the retinoblastoma-like protein 2 (<i>Rbl2</i>) tumor suppressor gene but did not affect a model with wild-type <i>Rbl2</i>. In support of a functional interaction between these two genes, loss of RBL2 induced FGFR1 expression and restoration of RBL2 repressed it, suggesting a novel role for RBL2 as a regulator of FGFR1 in SCLC. Additionally, FGFR1 activated phospholipase C gamma 1 (PLCG1), whereas chemical inhibition of PLCG1 suppressed SCLC growth, implicating PLCG1 as an effector of FGFR1 signaling in SCLC. Collectively, this study uncovers mechanisms underlying FGFR1-driven SCLC that involve RBL2 upstream and PLCG1 downstream, thus providing potential biomarkers for anti-FGFR1 therapy. SIGNIFICANCE: This study identifies RBL2 and PLCG1 as critical components of amplified FGFR1 signaling in SCLC, thus representing potential targets for biomarker analysis and therapeutic development in this disease.

Also flagged:SMARCA5tumorglioblastomaGBMtumorstemozolomide
Journal Article 2020-09-24 ✓ 5 Snippets Cui T, Bell EH, McElroy J, Liu K, Sebastian E, Johnson B, Gulati PM, Becker AP, Gray A, Geurts M, Subedi D, Yang L, Fleming JL, Meng W, Barnholtz-Sloan JS, Venere M, Wang QE, Robe PA, Haque SJ, Chakravarti A.
In-Text Gene Mentions

IMPLICATIONS: miR-146a predicts favorable prognosis and the miR-146a-POU3F2/SMARCA5 pathway is important for the suppression of stemness in GBM.

A Novel miR-146a-POU3F2/SMARCA5 Pathway Regulates Stemness and Therapeutic Response in Glioblastoma.

Mechanistically, miR-146a directly silenced <i>POU3F2</i> and <i>SMARCA5</i>, two transcription factors that mutually regulated each other, significantly compromising GBM-stemness and increasing TMZ response.

Collectively, our data show that miR-146a-POU3F2/SMARCA5 pathway plays a critical role in suppressing GBM-stemness and increasing TMZ-response, suggesting that <i>POU3F2</i> and <i>SMARCA5</i> may serve as novel therapeutic targets in GBM.

…A Novel miR-146a-POU3F2/SMARCA5 Pathway Regulates Ste…

Show Full Abstract

Rapid tumor growth, widespread brain-invasion, and therapeutic resistance critically contribute to glioblastoma (GBM) recurrence and dismal patient outcomes. Although GBM stem cells (GSC) are shown to play key roles in these processes, the molecular pathways governing the GSC phenotype (GBM-stemness) remain poorly defined. Here, we show that epigenetic silencing of miR-146a significantly correlated with worse patient outcome and importantly, miR-146a level was significantly lower in recurrent tumors compared with primary ones. Further, miR-146a overexpression significantly inhibited the proliferation and invasion of GBM patient-derived primary cells and increased their response to temozolomide (TMZ), both <i>in vitro</i> and <i>in vivo</i>. Mechanistically, miR-146a directly silenced <i>POU3F2</i> and <i>SMARCA5</i>, two transcription factors that mutually regulated each other, significantly compromising GBM-stemness and increasing TMZ response. Collectively, our data show that miR-146a-POU3F2/SMARCA5 pathway plays a critical role in suppressing GBM-stemness and increasing TMZ-response, suggesting that <i>POU3F2</i> and <i>SMARCA5</i> may serve as novel therapeutic targets in GBM. IMPLICATIONS: miR-146a predicts favorable prognosis and the miR-146a-POU3F2/SMARCA5 pathway is important for the suppression of stemness in GBM.

Also flagged:microtubuleorganellesciliopathiesdevelopmental delaysbrain developmentneurogenesis
Journal Article 2020-09-24 ✓ 5 Snippets Karunakaran KB, Chaparala S, Lo CW, Ganapathiraju MK.
In-Text Gene Mentions

In addition, several ciliary proteins interact with proteins that are known to play a role in neuropsychiatric disorders: PCM1, BBS4 with DISC1 in schizophrenia, bipolar disorder and depression19,20, KIF3A, PCNT with DCDC2 in dyslexia21,22, and PCM, AHI1 with HTT in Huntington disease12,23,24.

The identification of Huntington’s disease (HD) pathway in the cilia interactome is also notable given that the protein huntingtin (HTT) localizes to the centrosome and plays an important role in ciliogenesis.

…T57-CLTA, DYNLL2-KIF2B, IFT57-HTT, CHMP5-UBAP1 (‘ part…

…TERT- IFT57 ,HTT- IFT57 , FOS-DYNLT3,…

…the protein huntingtin (HTT) localizes to the…

Show Full Abstract

Cilia are dynamic microtubule-based organelles present on the surface of many eukaryotic cell types and can be motile or non-motile primary cilia. Cilia defects underlie a growing list of human disorders, collectively called ciliopathies, with overlapping phenotypes such as developmental delays and cognitive and memory deficits. Consistent with this, cilia play an important role in brain development, particularly in neurogenesis and neuronal migration. These findings suggest that a deeper systems-level understanding of how ciliary proteins function together may provide new mechanistic insights into the molecular etiologies of nervous system defects. Towards this end, we performed a protein-protein interaction (PPI) network analysis of known intraflagellar transport, BBSome, transition zone, ciliary membrane and motile cilia proteins. Known PPIs of ciliary proteins were assembled from online databases. Novel PPIs were predicted for each ciliary protein using a computational method we developed, called High-precision PPI Prediction (HiPPIP) model. The resulting cilia "interactome" consists of 165 ciliary proteins, 1,011 known PPIs, and 765 novel PPIs. The cilia interactome revealed interconnections between ciliary proteins, and their relation to several pathways related to neuropsychiatric processes, and to drug targets. Approximately 184 genes in the cilia interactome are targeted by 548 currently approved drugs, of which 103 are used to treat various diseases of nervous system origin. Taken together, the cilia interactome presented here provides novel insights into the relationship between ciliary protein dysfunction and neuropsychiatric disorders, for e.g. interconnections of Alzheimer's disease, aging and cilia genes. These results provide the framework for the rational design of new therapeutic agents for treatment of ciliopathies and neuropsychiatric disorders.

Also flagged:spermatogenesisphosphorylationreproductionfertilizationouter dense fiber protein 1ODF1
Journal Article 2020-09-24 ✓ 1 Snippet Huang YL, Zhang PF, Fu Q, He WT, Xiao K, Zhang M.
In-Text Gene Mentions

…TTBK1, TTBK2, VRK1,VRK2, and VRK3) (Fig.…

Show Full Abstract

To understand mechanisms of spermatogenesis, the proteome and the phosphoproteome in prepubertal and pubertal swamp buffalo (Bubalus bubalis) testes were analyzed using tandem mass tag (TMT) coupled with liquid chromatography-tandem mass spectrometry (LC-MS/MS). In prepubertal testes, 80 proteins were overexpressed, 148 proteins were underexpressed, and 139 and 142 protein sites had higher and lower phosphorylation, respectively, compared to the levels in pubertal testes. Several of these proteins were associated with reproductive processes such as sexual reproduction, spermatogenesis, fertilization, and spermatid development. In particular, outer dense fiber protein 1 (ODF1), protein maelstrom homolog (MAEL), actin-like protein 7B (ACTL7B), tyrosine-(Y)-phosphorylation regulated (CABYR), and tripartite motif containing 36 (TRIM36) were upregulated with age at both the proteome and phosphoproteome levels. Combining proteome and phosphoproteome analysis can be effectively applied to study the protein/phosphorylation patterns of buffalo testes. These data provide new regulatory candidates and evidence for a complex network in spermatogenesis in buffalo testes, and serve as an important resource for exploring the physiological mechanism of spermatogenesis in mammals.

Also flagged:HypophosphatasiaALPLHPPalkaline phosphatasemineralizationTissue Nonspecific Alkaline Phosphatase
Journal Article 2020-09-24 ✓ 1 Snippet Mornet E, Taillandier A, Domingues C, Dufour A, Benaloun E, Lavaud N, Wallon F, Rousseau N, Charle C, Guberto M, Muti C, Simon-Bouy B.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Hypophosphatasia (HPP) is caused by pathogenic variants in the ALPL gene. There is a large continuum in the severity, ranging from a lethal perinatal form to dental issues. We analyzed a cohort of 424 HPP patients from European geographic origin or ancestry. Using 3D modeling and results of functional tests we classified ALPL pathogenic variants according to their dominant negative effect (DNE) and their severity. The cohort was described by the genotypes resulting from alleles s (severe recessive), Sd (severe dominant), and m (moderate). Many recurrent variants showed a regional anchor pointing out founder effects rather than multiple mutational events. Homozygosity was an aggravating factor of the severity and moderate alleles were rare both in number and frequency. Pathogenic variants with DNE were found in both recessive and dominant HPP. Sixty percent of the adults tested were heterozygous for a variant showing no DNE, suggesting another mechanism of dominance like haploinsufficiency. Adults with dominant HPP without DNE were found statistically less severely affected than adults with DNE variants. Adults with dominant HPP without DNE represent a new clinical entity mostly diagnosed from 2010s, characterized by nonspecific signs of HPP and low alkaline phosphatase, and for which a high prevalence is expected. In conclusion, the genetic composition of our cohort suggests a nosology with 3 clinical forms: severe HPP is recessive and rare, moderate HPP is recessive or dominant and more common, and mild HPP, characterized by low alkaline phosphatase and unspecific clinical signs, is dominantly inherited and very common.

Also flagged:Vogt-Koyanagi-Haradaautoimmune diseasemelaninHLAIL-12bATG10
Journal Article 2020-09-24 ✓ 1 Snippet Albalawi AM, Al-Barry MA.
In-Text Gene Mentions

…HLA genes, IL-12b,TNFSF4, and miR-20-5p genes…

Show Full Abstract

<h4>Purpose</h4>Vogt-Koyanagi-Harada (VKH) disease is a rare autoimmune disease. The autoimmune response in VKH disease is against the melanin-producing cells; therefore, in affected individuals melanocyte-containing organs manifest disease symptoms including eyes, ears, skin and nervous system. VKH is a multifactorial disease, and the precise cause of the VKH disease is unknown. Studies have suggested that both environmental and genetic factors are responsible for the VKH disease. In this review, the authors have collected all the available literature on the genetics of VKH to their knowledge and discussed the role of genetic variants in causing VKH disease.<h4>Methods</h4>An extensive literature search was performed in order to review all the published studies regarding VKH clinical phenotyping and genetic variants in VKH disease. Medline, PubMed, Cochrane library, and Scopus was searched using combination of keywords.<h4>Results</h4>It was found that variants in HLA genes, IL-12b, TNFSF4, and miR-20-5p genes are significantly associated with VKH; however, variants in genes ATG10, TNIP1 and CLEC16A did not achieve significant genome-wide association threshold. Moreover, polymorphisms in TNIP1 and CLEC16A play a protective role against VKH.<h4>Conclusion</h4>The authors conclude that increased sample size and a more homogeneous VKH patient population may reveal a significant association of variants in ATG10, TNIP1 and CLEC16A genes with VKH disease.

Also flagged:CholesterolPancreatic Cancerlipidmetabolismtumorpancreatic ductal adenocarcinoma
Journal Article 2020-09-24 No Snippets Gabitova-Cornell L, Surumbayeva A, Peri S, Franco-Barraza J, Restifo D, Weitz N, Ogier C, Goldman AR, Hartman TR, Francescone R, Tan Y, Nicolas E, Shah N, Handorf EA, Cai KQ, O'Reilly AM, Sloma I, Chiaverelli R, Moffitt RA, Khazak V, Fang CY, Golemis EA, Cukierman E, Astsaturov I.
Show Full Abstract

Oncogenic transformation alters lipid metabolism to sustain tumor growth. We define a mechanism by which cholesterol metabolism controls the development and differentiation of pancreatic ductal adenocarcinoma (PDAC). Disruption of distal cholesterol biosynthesis by conditional inactivation of the rate-limiting enzyme Nsdhl or treatment with cholesterol-lowering statins switches glandular pancreatic carcinomas to a basal (mesenchymal) phenotype in mouse models driven by Kras<sup>G12D</sup> expression and homozygous Trp53 loss. Consistently, PDACs in patients receiving statins show enhanced mesenchymal features. Mechanistically, statins and NSDHL loss induce SREBP1 activation, which promotes the expression of Tgfb1, enabling epithelial-mesenchymal transition. Evidence from patient samples in this study suggests that activation of transforming growth factor β signaling and epithelial-mesenchymal transition by cholesterol-lowering statins may promote the basal type of PDAC, conferring poor outcomes in patients.

Also flagged:organizationchromatincell nucleusnucleusgene expressionheterochromatin
Journal Article 2020-09-24 ✓ 1 Snippet Misteli T.
In-Text Gene Mentions

linker histones

Show Full Abstract

Genomes have complex three-dimensional architectures. The recent convergence of genetic, biochemical, biophysical, and cell biological methods has uncovered several fundamental principles of genome organization. They highlight that genome function is a major driver of genome architecture and that structural features of chromatin act as modulators, rather than binary determinants, of genome activity. The interplay of these principles in the context of self-organization can account for the emergence of structural chromatin features, the diversity and single-cell heterogeneity of nuclear architecture in cell types and tissues, and explains evolutionarily conserved functional features of genomes, including plasticity and robustness.

Also flagged:enamel proteinamelogeninenamel formationbiomineralizationhydroxyapatitemineral
Journal Article 2020-09-24 No Snippets Shaw WJ, Tarasevich BJ, Buchko GW, Arachchige RMJ, Burton SD.
Show Full Abstract

Amelogenin, a protein critical to enamel formation, is presented as a model for understanding how the structure of biomineralization proteins orchestrate biomineral formation. Amelogenin is the predominant biomineralization protein in the early stages of enamel formation and contributes to the controlled formation of hydroxyapatite (HAP) enamel crystals. The resulting enamel mineral is one of the hardest tissues in the human body and one of the hardest biominerals in nature. Structural studies have been hindered by the lack of techniques to evaluate surface adsorbed proteins and by amelogenin's disposition to self-assemble. Recent advancements in solution and solid state nuclear magnetic resonance (NMR) spectroscopy, atomic force microscopy (AFM), and recombinant isotope labeling strategies are now enabling detailed structural studies. These recent studies, coupled with insights from techniques such as CD and IR spectroscopy and computational methodologies, are contributing to important advancements in our structural understanding of amelogenesis. In this review we focus on recent advances in solution and solid state NMR spectroscopy and in situ AFM that reveal new insights into the secondary, tertiary, and quaternary structure of amelogenin by itself and in contact with HAP. These studies have increased our understanding of the interface between amelogenin and HAP and how amelogenin controls enamel formation.

Also flagged:Infertilityinmale reproductionprostasomesazoospermiaasthenozoospermia
Journal Article 2020-09-24 No Snippets Candenas L, Chianese R.
Show Full Abstract

Infertility has become a global health issue, with approximately 50% of infertility cases generated by disorders in male reproduction. Spermatozoa are conveyed towards female genital tracts in a safe surrounding provided by the seminal plasma. Interestingly, this dynamically changing medium is a rich source of proteins, essential not only for sperm transport, but also for its protection and maturation. Most of the seminal proteins are acquired by spermatozoa in transit through exosomes (epididymosomes and prostasomes). The high number of seminal proteins, the increasing knowledge of their origins and biological functions and their differential expression in the case of azoospermia, asthenozoospermia, oligozoospermia and teratozoospermia or other conditions of male infertility have allowed the identification of a wide variety of biomarker candidates and their involvement in biological pathways, thus to strongly suggest that the proteomic landscape of seminal plasma may be a potential indicator of sperm dysfunction. This review summarizes the current knowledge in seminal plasma proteomics and its potentiality as a diagnostic tool in different degrees of male infertility.

Also flagged:PPARPeroxisome Proliferator-Activated ReceptorsPPARsendocannabinoidnuclear receptorsanandamide
Journal Article 2020-09-24 No Snippets Brunetti L, Carrieri A, Piemontese L, Tortorella P, Loiodice F, Laghezza A.
Show Full Abstract

In recent years, Peroxisome Proliferator-Activated Receptors (PPARs) have been connected to the endocannabinoid system. These nuclear receptors indeed mediate the effects of anandamide and similar substances such as oleoyl-ethanolamide and palmitoyl-ethanolamide. An increasing body of literature describing the interactions between the endocannabinoid system and PPARs has slowly but surely been accumulating over the past decade, and a multitarget approach involving these receptors and endocannabinoid degrading enzyme FAAH has been proposed for the treatment of inflammatory states, cancer, and Alzheimer's disease. The lack of knowledge about compounds endowed with such an activity profile therefore led us to investigate a library of readily available, well-characterized PPAR agonists that we had synthesized over the years in order to find a plausible lead compound for further development. Moreover, we propose a rationalization of our results via a docking study, which sheds some light on the binding mode of these PPAR agonists to FAAH and opens the way for further research in this field.

Also flagged:BMP-2Medication-related osteonecrosis of the jawbone resorptionbone remodelingBone Morphogenetic Proteinosteoblast differentiation
Journal Article 2020-09-24 No Snippets Mikai A, Ono M, Tosa I, Nguyen HTT, Hara ES, Nosho S, Kimura-Ono A, Nawachi K, Takarada T, Kuboki T, Oohashi T.
Show Full Abstract

Medication-related osteonecrosis of the jaw (MRONJ) is a severe pathological condition associated mainly with the long-term administration of bone resorption inhibitors, which are known to induce suppression of osteoclast activity and bone remodeling. Bone Morphogenetic Protein (BMP)-2 is known to be a strong inducer of bone remodeling, by directly regulating osteoblast differentiation and osteoclast activity. This study aimed to evaluate the effects of BMP-2 adsorbed onto beta-tricalcium phosphate (β-TCP), which is an osteoinductive bioceramic material and allows space retention, on the prevention and treatment of MRONJ in mice. Tooth extraction was performed after 3 weeks of zoledronate (ZA) and cyclophosphamide (CY) administration. For prevention studies, BMP-2/β-TCP was transplanted immediately after tooth extraction, and the mice were administered ZA and CY for an additional 4 weeks. The results showed that while the tooth extraction socket was mainly filled with a sparse tissue in the control group, bone formation was observed at the apex of the tooth extraction socket and was filled with a dense connective tissue rich in cellular components in the BMP-2/β-TCP transplanted group. For treatment studies, BMP-2/β-TCP was transplanted 2 weeks after tooth extraction, and bone formation was followed up for the subsequent 4 weeks under ZA and CY suspension. The results showed that although the tooth extraction socket was mainly filled with soft tissue in the control group, transplantation of BMP-2/β-TCP could significantly accelerate bone formation, as shown by immunohistochemical analysis for osteopontin, and reduce the bone necrosis in tooth extraction sockets. These data suggest that the combination of BMP-2/β-TCP could become a suitable therapy for the management of MRONJ.

Also flagged:cancerliver cancernon-alcoholic fatty liver diseaseoxygencell proliferationtumor
Journal Article 2020-09-24 No Snippets Ali ES, Rychkov GY, Barritt GJ.
Show Full Abstract

Hepatocellular carcinoma (HCC) is a considerable health burden worldwide and a major contributor to cancer-related deaths. HCC is often not noticed until at an advanced stage where treatment options are limited and current systemic drugs can usually only prolong survival for a short time. Understanding the biology and pathology of HCC is a challenge, due to the cellular and anatomic complexities of the liver. While not yet fully understood, liver cancer stem cells play a central role in the initiation and progression of HCC and in resistance to drugs. There are approximately twenty Ca<sup>2+</sup>-signaling proteins identified as potential targets for therapeutic treatment at different stages of HCC. These potential targets include inhibition of the self-renewal properties of liver cancer stem cells; HCC initiation and promotion by hepatitis B and C and non-alcoholic fatty liver disease (principally involving reduction of reactive oxygen species); and cell proliferation, tumor growth, migration and metastasis. A few of these Ca<sup>2+</sup>-signaling pathways have been identified as targets for natural products previously known to reduce HCC. Promising Ca<sup>2+</sup>-signaling targets include voltage-operated Ca<sup>2+</sup> channel proteins (liver cancer stem cells), inositol trisphosphate receptors, store-operated Ca<sup>2+</sup> entry, TRP channels, sarco/endoplasmic reticulum (Ca<sup>2+</sup>+Mg<sup>2+</sup>) ATP-ase and Ca<sup>2+</sup>/calmodulin-dependent protein kinases. However, none of these Ca<sup>2+</sup>-signaling targets has been seriously studied any further than laboratory research experiments. The future application of more systematic studies, including genomics, gene expression (RNA-seq), and improved knowledge of the fundamental biology and pathology of HCC will likely reveal new Ca<sup>2+</sup>-signaling protein targets and consolidate priorities for those already identified.

Also flagged:dermatomyositisidiopathic inflammatory myopathypathogenesislung cancerautoantibodiesTIF-1-γ
Journal Article 2020-09-24 ✓ 4 Snippets Aljabban J, Syed S, Syed S, Rohr M, Weisleder N, McElhanon KE, Hasan L, Safeer L, Hoffman K, Aljabban N, Mukhtar M, Adapa N, Allarakhia Z, Panahiazar M, Neuhaus I, Kim S, Hadley D, Jarjour W.
In-Text Gene Mentions

…TRIM25, TRIM27, andTRIM38.…

…TRIM21, TRIM34, andTRIM38and downregulation of…

…TRIM6, TRIM21, andTRIM38.…

TRIM38has also been…

Show Full Abstract

<h4>Aims</h4>Dermatomyositis (DM) is a progressive, idiopathic inflammatory myopathy with poorly understood pathogenesis. A hallmark of DM is an increased risk for developing breast, ovarian, and lung cancer. Since autoantibodies against anti-TIF-1-γ, a member of the tripartite motif (TRIM) proteins, has a strong association with malignancy, we examined expression of the TRIM gene family to identify pathways that may be contributing to DM pathogenesis.<h4>Materials and methods</h4>We employed the Search Tag Analyze Resource for GEO platform to search the NCBI Gene Expression Omnibus to elucidate TRIM family gene expression as well as oncogenic drivers in DM pathology. We conducted meta-analysis of the data from human skin (60 DM vs 34 healthy) and muscle (71 DM vs 22 healthy).<h4>Key findings</h4>We identified genes involved in innate immunity, antigen presentation, metabolism, and other cellular processes as facilitators of DM disease activity and confirmed previous observations regarding the presence of a robust interferon signature. Moreover, analysis of DM muscle samples revealed upregulation of TRIM14, TRIM22, TRIM25, TRIM27, and TRIM38. Likewise, analysis of DM skin samples showed upregulation of TRIM5, TRIM6, TRIM 14, TRIM21, TRIM34, and TRIM38 and downregulation of TRIM73. Additionally, we noted upregulation of oncogenes IGLC1, IFI44, POSTN, MYC, NPM1, and IDO1 and related this change to interferon signaling. While the clinical data associated with genetic data that was analyzed did not contain clinical data regarding malignancy in these cohorts, the observed genetic changes may be associated with homeostatic and signaling changes that relate to the increased risk in malignancy in DM.<h4>Significance</h4>Our results implicate previously unknown genes as potential drivers of DM pathology and suggest certain TRIM family members may have disease-specific roles with potential diagnostic and therapeutic implications.

Also flagged:cancerlung adenocarcinomaLUADMetabolismGene ExpressionLung cancer
Journal Article 2020-09-24 ✓ 1 Snippet Zhao Z, He B, Cai Q, Zhang P, Peng X, Zhang Y, Xie H, Wang X.
In-Text Gene Mentions

…genes (AKR1A1, NT5E,PTGIS, GMPS, MBOAT1, ADCY9,…

Show Full Abstract

<h4>Background</h4>The highest rate of cancer-related deaths worldwide is from lung adenocarcinoma (LUAD) annually. Metabolism was associated with tumorigenesis and cancer development. Metabolic-related genes may be important biomarkers and metabolic therapeutic targets for LUAD.<h4>Materials and methods</h4>In this study, the gleaned cohort included LUAD RNA-SEQ data from the Cancer Genome Atlas (TCGA) and corresponding clinical data (<i>n</i> = 445). The training cohort was utilized to model construction, and data from the Gene Expression Omnibus (GEO, GSE30219 cohort, <i>n</i> = 83; GEO, GSE72094, <i>n</i> = 393) were regarded as a testing cohort and utilized for validation. First, we used a lasso-penalized Cox regression analysis to build a new metabolic-related signature for predicting the prognosis of LUAD patients. Next, we verified the metabolic gene model by survival analysis, C-index, receiver operating characteristic (ROC) analysis. Univariate and multivariate Cox regression analyses were utilized to verify the gene signature as an independent prognostic factor. Finally, we constructed a nomogram and performed gene set enrichment analysis to facilitate subsequent clinical applications and molecular mechanism analysis.<h4>Result</h4>Patients with higher risk scores showed significantly associated with poorer survival. We also verified the signature can work as an independent prognostic factor for LUAD survival. The nomogram showed better clinical application performance for LUAD patient prognostic prediction. Finally, KEGG and GO pathways enrichment analyses suggested several especially enriched pathways, which may be helpful for us investigative the underlying mechanisms.

Also flagged:Vitamin DVDRAgingvitamin deficiencyHypovitaminosis Dchronic diseases
Journal Article 2020-09-24 No Snippets de Souza Freitas R, Fratelli CF, de Souza Silva CM, de Lima LR, Stival MM, da Silva ICR, Schwerz Funghetto S.
Show Full Abstract

Aging is accompanied by various functional modifications determined by their environment, lifestyle, nutrition, and genetics. Based on these factors, it is essential to verify the vitamin deficiency in the elderly population. Hypovitaminosis D is commonly present in human aging, increasing the chances of developing noncommunicable chronic diseases. The VDR gene TaqI polymorphism may modify the vitamin D metabolic pathway by altering the interaction between the vitamin D receptor and the active circulating vitamin D. Therefore, this study aimed to investigate the association between serum vitamin D and biochemical and genetic factors, considering the TaqI polymorphism of the VDR gene, in an elderly population of the Federal District. The study was a descriptive, case-control, quantitative, and cross-sectional type and was conducted in two basic health units in the administrative region of Ceilândia, Federal District, DF, Brazil, with women aged 60 years or older. Anthropometric, biochemical, and genetic parameters (VDR TaqI polymorphism) were evaluated. The adopted significance level was 5%, and statistical analyses were performed using the SPSS version 20.0 program. The study consisted of 128 participants. The most prevalent age was from 60 to 65 years (<i>N</i> = 53; 41.4%). 66 elderly (51.6%) were part of the case group (hypovitaminosis D), while 62 were in the control group. In the case group, 30.2% had grade I obesity, 77.3% were hypertensive, and 51.5% were diabetic. The TT genotype was present in 47% of the case group and 54.8% in the control group (<i>p</i>=0.667). There was no association between serum vitamin D levels and the VDR gene variant TaqI polymorphism in an elderly Brazilian population.

Also flagged:synthesisureaFGFR1Triple-negative breast cancercancermetastatic breast cancer
Journal Article 2020-09-24 ✓ 1 Snippet Ashraf-Uz-Zaman M, Shahi S, Akwii R, Sajib MS, Farshbaf MJ, Kallem RR, Putnam W, Wang W, Zhang R, Alvina K, Trippier PC, Mikelis CM, German NA.
In-Text Gene Mentions

DCC

Show Full Abstract

Triple-negative breast cancer (TNBC) is an aggressive type of cancer characterized by higher metastatic and reoccurrence rates, where approximately one-third of TNBC patients suffer from the metastasis in the brain. At the same time, TNBC shows good responses to chemotherapy, a feature that fuels the search for novel compounds with therapeutic potential in this area. Recently, we have identified novel urea-based compounds with cytotoxicity against selected cell lines and with the ability to cross the blood-brain barrier in vivo. We have synthesized and analyzed a library of more than 40 compounds to elucidate the key features responsible for the observed activity. We have also identified FGFR1 as a molecular target that is affected by the presence of these compounds, confirming our data using in silico model. Overall, we envision that these compounds can be further developed for the potential treatment of metastatic breast cancer.

Also flagged:Acute Hepatitis EAcute Liver FailureinfectionHEV infectionacute myeloid leukemiaAML
Journal Article 2020-09-24 ✓ 2 Snippets Field Z, Russin M, Murillo Alvarez RM, Madruga M, Carlan S.
In-Text Gene Mentions

…herpes-simplex PCR, andhemochromatosisgene (HFE) gene…

…and hemochromatosis gene (HFE) gene analysis were…

Show Full Abstract

Immunocompromised patients are particularly at risk to develop hepatitis E virus (HEV) infection and its related complications. We present a rare case of HEV infection in a 35-year-old Hispanic female with concomitant acute myeloid leukemia (AML). The patient presented with acute liver failure within a few weeks after receiving a blood transfusion. Our case likely represented an acute de novo HEV infection after chemotherapy in a patient with concurrent AML, evidenced by the presence of anti-HEV IgM antibodies as well as histological findings, and with a previous history of recent transfusions being one of the strongest risk factors for transmission. Liver failure from an acute de novo hepatitis E infection with concurrent AML can be catastrophic in the immunosuppressed patient. Our case is particularly unique due to the uncommon presentation of acute hepatitis E in a non-pregnant reproductive aged Hispanic female with recently diagnosed AML. Clinicians should maintain a low threshold to test serum HEV-RNA if a patient presents with signs and symptoms suggestive of acute hepatitis.

Also flagged:Rabgap1membranecell migrationphosphotyrosinebindingcytoplasmic
Journal Article 2020-09-23 ✓ 1 Snippet Samarelli AV, Ziegler T, Meves A, Fässler R, Böttcher RT.
In-Text Gene Mentions

Rabgap1L

Show Full Abstract

Integrin function depends on the continuous internalization of integrins and their subsequent endosomal recycling to the plasma membrane to drive adhesion dynamics, cell migration and invasion. Here we assign a pivotal role for Rabgap1 (GAPCenA) in the recycling of endocytosed active β1 integrins to the plasma membrane. The phosphotyrosine-binding (PTB) domain of Rabgap1 binds to the membrane-proximal NPxY motif in the cytoplasmic domain of β1 integrin subunits on endosomes. Silencing Rabgap1 in mouse fibroblasts leads to the intracellular accumulation of active β1 integrins, alters focal adhesion formation, and decreases cell migration and cancer cell invasion. Functionally, Rabgap1 facilitates active β1 integrin recycling to the plasma membrane through attenuation of Rab11 activity. Taken together, our results identify Rabgap1 as an important factor for conformation-specific integrin trafficking and define the role of Rabgap1 in β1-integrin-mediated cell migration in mouse fibroblasts and breast cancer cells.

Also flagged:Nrf2Keap1metabolismpurinedetoxificationmitochondrial
Journal Article 2020-09-23 No Snippets Gao L, Kumar V, Vellichirammal NN, Park SY, Rudebush TL, Yu L, Son WM, Pekas EJ, Wafi AM, Hong J, Xiao P, Guda C, Wang HJ, Schultz HD, Zucker IH.
Show Full Abstract

<h4>Key points</h4>Nrf2 is a master regulator of endogenous cellular defences, governing the expression of more than 200 cytoprotective proteins, including a panel of antioxidant enzymes. Nrf2 plays an important role in redox haemostasis of skeletal muscle in response to the increased generation of reactive oxygen species during contraction. Employing skeletal muscle-specific transgenic mouse models with unbiased-omic approaches, we uncovered new target proteins, downstream pathways and molecular networks of Nrf2 in skeletal muscle following Nrf2 or Keap1 deletion. Based on the findings, we proposed a two-way model to understand Nrf2 function: a tonic effect through a Keap1-independent mechanism under basal conditions and an induced effect through a Keap1-dependent mechanism in response to oxidative and other stresses.<h4>Abstract</h4>Although Nrf2 has been recognized as a master regulator of cytoprotection, its functional significance remains to be completely defined. We hypothesized that proteomic/bioinformatic analyses from Nrf2-deficient or overexpressed skeletal muscle tissues will provide a broader spectrum of Nrf2 targets and downstream pathways than are currently known. To this end, we created two transgenic mouse models; the iMS-Nrf2<sup>flox/flox</sup> and iMS-Keap1<sup>flox/flox</sup> , employing which we demonstrated that selective deletion of skeletal muscle Nrf2 or Keap1 separately impaired or improved skeletal muscle function. Mass spectrometry revealed that Nrf2-KO changed expression of 114 proteins while Keap1-KO changed expression of 117 proteins with 10 proteins in common between the groups. Gene ontology analysis suggested that Nrf2 KO-changed proteins are involved in metabolism of oxidoreduction coenzymes, purine ribonucleoside triphosphate, ATP and propanoate, which are considered as the basal function of Nrf2, while Keap1 KO-changed proteins are involved in cellular detoxification, NADP metabolism, glutathione metabolism and the electron transport chain, which belong to the induced effect of Nrf2. Canonical pathway analysis suggested that Keap1-KO activated four pathways, whereas Nrf2-KO did not. Ingenuity pathway analysis further revealed that Nrf2-KO and Keap1-KO impacted different signal proteins and functions. Finally, we validated the proteomic and bioinformatics data by analysing glutathione metabolism and mitochondrial function. In conclusion, we found that Nrf2-targeted proteins are assigned to two groups: one mediates the tonic effects evoked by a low level of Nrf2 at basal condition; the other is responsible for the inducible effects evoked by a surge of Nrf2 that is dependent on a Keap1 mechanism.

Also flagged:CarbonAminoglycosidepyranosidepentosespentitols2-deoxystreptamine
Journal Article 2020-09-23 No Snippets Pirrone MG, Gysin M, Haldimann K, Hobbie SN, Vasella A, Crich D.
Show Full Abstract

With a view to facilitating prediction of the exocyclic bond to the pyranoside ring in higher carbon sugars, a model is advanced that relates the relative configuration of the three stereogenic centers comprised of the branchpoint and of the two flanking centers (C4-C5-C6 in aldoheptoses and higher and C5-C6-C7 in sialic and ulosonic acids) to that of the simple ring-opened pentoses. Assignment of a given stereotriad as arabino, lxyo, ribo, or xylo by inspection of the Fischer projection formulas permits prediction of conformation of the exocyclic bond by comparison with the known solution (= crystal in all cases) conformations of the simple pentitols. More remote stereogenic centers in the side chain, as in the 8-position of <i>N</i>-acetylneuraminic acid, have little impact on the conformation of the exocyclic bond. On the basis of this model the conformation of the exocyclic bond in ring I of 6'-homologated 4,5-disubstituted 2-deoxystreptamine class aminoglycoside antibiotics was predicted and was borne out by NMR analysis of newly synthesized derivatives in D<sub>2</sub>O at pD5. The antiribosomal and antibacterial activity of these derivatives is briefly presented and discussed in terms of preorganization of the side chain for binding to the ribosomal decoding A site. It is anticipated that this predictive analysis will also find use in the prediction of the conformation of the exocyclic bonds in other 2-(1-hydroxyalkyl)-3-hydroxytetrahydropyrans and tetrahydrofurans.

Also flagged:BCAS2prostate cancerNBS1androgen receptorPCaGlutathione-S-transferase
Journal Article 2020-09-23 No Snippets Wang LP, Chen TY, Kang CK, Huang HP, Chen SL.
Show Full Abstract

<h4>Background</h4>Breast cancer amplified sequence 2 (BCAS2) plays crucial roles in pre-mRNA splicing and androgen receptor transcription. Previous studies suggested that BCAS2 is involved in double-strand breaks (DSB); therefore, we aimed to characterise its mechanism and role in prostate cancer (PCa).<h4>Methods</h4>Western blotting and immunofluorescence microscopy were used to assay the roles of BCAS2 in the DSBs of PCa cells and apoptosis in Drosophila, respectively. The effect of BCAS2 dosage on non-homologous end joining (NHEJ) and homologous recombination (HR) were assayed by precise end-joining assay and flow cytometry, respectively. Glutathione-S-transferase pulldown and co-immunoprecipitation assays were used to determine whether and how BCAS2 interacts with NBS1. The expression of BCAS2 and other proteins in human PCa was determined by immunohistochemistry.<h4>Results</h4>BCAS2 helped repair radiation-induced DSBs efficiently in both human PCa cells and Drosophila. BCAS2 enhanced both NHEJ and HR, possibly by interacting with NBS1, which involved the BCAS2 N-terminus as well as both the NBS1 N- and C-termini. The overexpression of BCAS2 was significantly associated with higher Gleason and pathology grades and shorter survival in patients with PCa.<h4>Conclusion</h4>BCAS2 promotes two DSB repair pathways by interacting with NBS1, and it may affect PCa progression.

Also flagged:LYS2Hsp40TATACytosolszuo1GFP
Journal Article 2020-09-23 ✓ 1 Snippet Singh A, Vashistha N, Heck J, Tang X, Wipf P, Brodsky JL, Hampton RY.
In-Text Gene Mentions

…FUS, TDP43, andHtt( McClellan et…

Show Full Abstract

Chaperones can mediate both protein folding and degradation. This process is referred to as protein triage, which demands study to reveal mechanisms of quality control for both basic scientific and translational purposes. In yeast, many misfolded proteins undergo chaperone-dependent ubiquitination by the action of the E3 ligases Ubr1 and San1, allowing detailed study of protein triage. In cells, both HSP70 and HSP90 mediated substrate ubiquitination, and the canonical ATP cycle was required for HSP70's role: we have found that ATP hydrolysis by HSP70, the nucleotide exchange activity of Sse1, and the action of J-proteins are all needed for Ubr1-mediated quality control. To discern whether chaperones were directly involved in Ubr1-mediated ubiquitination, we developed a bead-based assay with covalently immobilized but releasable misfolded protein to obviate possible chaperone effects on substrate physical state or transport. In this in vitro assay, only HSP70 was required, along with its ATPase cycle and relevant cochaperones, for Ubr1-mediated ubiquitination. The requirement for the HSP70 ATP cycle in ubiquitination suggests a possible model of triage in which efficiently folded proteins are spared, while slow-folding or nonfolding proteins are iteratively tagged with ubiquitin for subsequent degradation.

Also flagged:preeclampsiagestational diabetes mellituspregnancy complicationssphingolipidspeptidesfatty acid
Journal Article 2020-09-23 ✓ 1 Snippet Odenkirk MT, Stratton KG, Gritsenko MA, Bramer LM, Webb-Robertson BM, Bloodsworth KJ, Weitz KK, Lipton AK, Monroe ME, Ash JR, Fourches D, Taylor BD, Burnum-Johnson KE, Baker ES.
In-Text Gene Mentions

PEBP1

Show Full Abstract

To fully enable the development of diagnostic tools and progressive pharmaceutical drugs, it is imperative to understand the molecular changes occurring before and during disease onset and progression. Systems biology assessments utilizing multi-omic analyses (e.g. the combination of proteomics, lipidomics, genomics, etc.) have shown enormous value in determining molecules prevalent in diseases and their associated mechanisms. Herein, we utilized multi-omic evaluations, multi-dimensional analysis methods, and new cheminformatics-based visualization tools to provide an in depth understanding of the molecular changes taking place in preeclampsia (PRE) and gestational diabetes mellitus (GDM) patients. Since PRE and GDM are two prevalent pregnancy complications that result in adverse health effects for both the mother and fetus during pregnancy and later in life, a better understanding of each is essential. The multi-omic evaluations performed here provide new insight into the end-stage molecular profiles of each disease, thereby supplying information potentially crucial for earlier diagnosis and treatments.

Also flagged:chromosomespairingchromosomesex chromosomeshistoneshost genome
Journal Article 2020-09-23 No Snippets Ahmad SF, Jehangir M, Cardoso AL, Wolf IR, Margarido VP, Cabral-de-Mello DC, O'Neill R, Valente GT, Martins C.
Show Full Abstract

<h4>Background</h4>One of the biggest challenges in chromosome biology is to understand the occurrence and complex genetics of the extra, non-essential karyotype elements, commonly known as supernumerary or B chromosomes (Bs). The non-Mendelian inheritance and non-pairing abilities of B chromosomes make them an interesting model for genomics studies, thus bringing to bear different questions about their genetic composition, evolutionary survival, maintenance and functional role inside the cell. This study uncovers these phenomena in multiple species that we considered as representative organisms of both vertebrate and invertebrate models for B chromosome analysis.<h4>Results</h4>We sequenced the genomes of three animal species including two fishes Astyanax mexicanus and Astyanax correntinus, and a grasshopper Abracris flavolineata, each with and without Bs, and identified their B-localized genes and repeat contents. We detected unique sequences occurring exclusively on Bs and discovered various evolutionary patterns of genomic rearrangements associated to Bs. In situ hybridization and quantitative polymerase chain reactions further validated our genomic approach confirming detection of sequences on Bs. The functional annotation of B sequences showed that the B chromosome comprises regions of gene fragments, novel genes, and intact genes, which encode a diverse set of functions related to important biological processes such as metabolism, morphogenesis, reproduction, transposition, recombination, cell cycle and chromosomes functions which might be important for their evolutionary success.<h4>Conclusions</h4>This study reveals the genomic structure, composition and function of Bs, which provide new insights for theories of B chromosome evolution. The selfish behavior of Bs seems to be favored by gained genes/sequences.

Also flagged:Huntingtinorganic solutestranscription factorpolyolinclusion bodiesurea
Journal Article 2020-09-23 ✓ 5 Snippets Aravindan S, Chen S, Choudhry H, Molfetta C, Chen KY, Liu AYC.
In-Text Gene Mentions

This change in the physical state of mHtt from diffuse to IB is correlated with alleviation of CREB dysfunction and enhanced cell survival under stress, results supporting the hypothesis that lower molecular weight entities of polyQ-expanded Htt are relevant pathogenic species in HD.

…of the 103QHttExon1 -EGFP sequences…

…the quantitation ofHttintensity and scoring…

…of the normalHtt(25Q) and the…

…the normal (15Q)Httprotein causes apoptotic…

Show Full Abstract

Osmolytes are organic solutes that change the protein folding landscape shifting the equilibrium towards the folded state. Herein, we use osmolytes to probe the structuring and aggregation of the intrinsically disordered mutant Huntingtin (mHtt) vis-a-vis the pathogenicity of mHtt on transcription factor function and cell survival. Using an inducible PC12 cell model of Huntington's disease (HD), we show that stabilizing polyol osmolytes drive the aggregation of Htt103Q<sup>Exon1</sup>-EGFP from a diffuse ensemble into inclusion bodies (IBs), whereas the destabilizing osmolyte urea does not. This effect of stabilizing osmolytes is innate, generic, countered by urea, and unaffected by HSP70 and HSC70 knockdown. A qualitatively similar result of osmolyte-induced mHtt IB formation is observed in a conditionally immortalized striatal neuron model of HD, and IB formation correlates with improved survival under stress. Increased expression of diffuse mHtt sequesters the CREB transcription factor to repress CREB-reporter gene activity. This repression is mitigated either by stabilizing osmolytes, which deplete diffuse mHtt or by urea, which negates protein-protein interaction. Our results show that stabilizing polyol osmolytes promote mHtt aggregation, alleviate CREB dysfunction, and promote survival under stress to support the hypothesis that lower molecular weight entities of disease protein are relevant pathogenic species in neurodegeneration.

Also flagged:angiogenesisdegradationmucositisatrophycollagenbinding
Journal Article 2020-09-23 No Snippets Apanasevich V, Papynov E, Plehova N, Zinoviev S, Kotciurbii E, Stepanyugina A, Korshunova O, Afonin I, Evdokimov I, Shichalin O, Bardin A, Nevozhai V, Polezhaev A.
Show Full Abstract

The study describes the influence of synthetic CaSiO<sub>3</sub>/HAp powder biocomposite on the process of regeneration in osseous tissue in the alveolar ridges in terms of the morphological characteristics of the osteoplastic potential. The authors investigated the osteoinduction and osteoconduction "in vivo" processes during bone tissue regeneration in the mandible defect area of an experimental animal (rabbit). The possibility of angiogenesis in the graft as an adaptation factor was studied in the process of bone tissue regeneration. The results of the histological study that included the qualitative parameters of bone tissue regeneration, the morphometric parameters (microarchitectonics) of the bone, the parameters of osteosynthesis (thickness of the osteoid plates), and resorption (volume density of the eroded surface) were presented. The results allowed the authors to characterize the possibility of the practical adaptation for synthetic powder biocomposite as an osteoplastic graft for the rehabilitation of osseous defects in dentistry.

Also flagged:furiniron oxideBreast cancertumorcancerproprotein convertase
Journal Article 2020-09-23 No Snippets Pang Y, Su L, Fu Y, Jia F, Zhang C, Cao X, He W, Kong X, Xu J, Zhao J, Qin A.
Show Full Abstract

Breast cancer bone metastasis poses significant challenge for therapeutic strategies. Inside the metastatic environment, osteoclasts and tumor cells interact synergistically to promote cancer progression. In this study, the proprotein convertase furin is targeted due to its critical roles in both tumor cell invasion and osteoclast function. Importantly, the furin inhibitor is specifically delivered by bone targeting superparamagnetic iron oxide (SPIO) nanoparticles. Our <i>in vitro</i> and <i>in vivo</i> data demonstrate that this system can effectively inhibit both osteoclastic bone resorption and breast cancer invastion, leading to alleviated osteolysis. Therefore, the bone targeting & furin inhibition nanoparticle system is a promising therapeutic and diagnostic strategy for breast cancer bone metastasis.

Also flagged:proteasomesMethylene BlueagingnicotinamideN -hydroxylamines
Journal Article 2020-09-23 No Snippets Sadowska-Bartosz I, Bartosz G.
Show Full Abstract

Replicative senescence is an unalterable growth arrest of primary cells in the culture system. It has been reported that aging <i>in vivo</i> is related to the limited replicative capacity that normal somatic cells show <i>in vitro</i>. If oxidative damage contributes to the lifespan limitation, antioxidants are expected to extend the replicative lifespan of fibroblasts. This article critically reviews the results of experiments devoted to this problem performed within the last decades under conditions of <i>in vitro</i> culture. The results of studied are heterogeneous, some papers showing no effects of antioxidants; most finding limited enhancement of reproductive capacity of fibroblasts, some reporting a significant extension of replicative lifespan (RLS). Both natural and synthetic antioxidants were found to extend the RLS of fibroblasts, either by a direct antioxidant effect or, indirectly, by activation of signaling pathways and activation of proteasomes or hormetic effects. Most significant prolongation of RLS was reported so far for nicotinamide, <i>N</i>-hydroxylamines, carnosine and Methylene Blue. These results may be of importance for the design of skin-protecting cosmetics.

Also flagged:CD44Methylglyoxaldicarbonylinsulin resistanceatherosclerosiscoagulation
Journal Article 2020-09-23 ✓ 1 Snippet Bai S, Chaurasiya AH, Banarjee R, Walke PB, Rashid F, Unnikrishnan AG, Kulkarni MJ.
In-Text Gene Mentions

…included complement C3,antithrombin-III, plasma protease C1…

Show Full Abstract

Methylglyoxal (MG), a glycolytic intermediate and reactive dicarbonyl, is responsible for exacerbation of insulin resistance and diabetic complication. In this study, MG-induced secretome of rat muscle cells was identified and relatively quantified by SWATH-MS. A total of 643 proteins were identified in MG-induced secretome, of which 82 proteins were upregulated and 99 proteins were downregulated by more than 1.3-fold in SWATH analysis. Further, secretory proteins from the classical secretory pathway and nonclassical secretory pathway were identified using SignalP and SecretomeP, respectively. A total of 180 proteins were identified with SignalP, and 113 proteins were identified with SecretomeP. The differentially expressed proteins were functionally annotated by KEGG pathway analysis using Cytoscape software with plugin clusterMaker. The differentially expressed proteins were found to be involved in various pathways like extracellular matrix (ECM)-receptor interaction, leukocyte transendothelial migration, fluid shear stress and atherosclerosis, complement and coagulation cascades, and lysosomal pathway. Since the MG levels are high in diabetic conditions, the presence of MG-induced secreted proteins was inspected by profiling human plasma of healthy and diabetic subjects (<i>n</i> = 10 each). CD44, a predominant MG-induced secreted protein, was found to be elevated in the diabetic plasma and to have a role in the development of insulin resistance.

Also flagged:metabolismacyl-CoA dehydrogenaseacyl-CoA-binding protein3-hydroxyacyl-CoA dehydrogenaseglyceraldehyde 3-phosphate dehydrogenasephosphoglycerate mutase 1
Journal Article 2020-09-23 ✓ 1 Snippet Xin JW, Chai ZX, Zhang CF, Yang YM, Zhang Q, Zhu Y, Cao HW, Yang Ji C, Zhong JC, Ji QM.
In-Text Gene Mentions

…( SLC1A2 ,HTTand SLC1A1 )…

Show Full Abstract

The mechanisms underlying yak adaptation to high-altitude environments have been investigated using various methods, but no report has focused on long non-coding RNA (lncRNA). In the present study, lncRNAs were screened from the gluteus transcriptomes of yak and their transcriptional levels were compared with those in Sanjiang cattle, Holstein cattle and Tibetan cattle. The potential target genes of the differentially expressed lncRNAs between species/strains were predicted using <i>cis</i> and <i>trans</i> models. Based on <i>cis</i>-regulated target genes, no KEGG pathway was significantly enriched. Based on <i>trans</i>-regulated target genes, 11 KEGG pathways in relation to energy metabolism and three KEGG pathways associated with muscle contraction were significantly enriched. Compared with cattle strains, transcriptional levels of acyl-CoA dehydrogenase, acyl-CoA-binding protein, 3-hydroxyacyl-CoA dehydrogenase were relatively higher and those of glyceraldehyde 3-phosphate dehydrogenase, phosphoglycerate mutase 1, pyruvate kinase and lactate/malate dehydrogenase were relatively lower in yak, suggesting that yaks activated fatty acid oxidation but inhibited glucose oxidation and glycolysis. Besides, NADH dehydrogenase and ATP synthase showed lower transcriptional levels in yak than in cattle, which might protect muscle tissues from deterioration caused by reactive oxygen species (ROS). Compared with cattle strains, the higher transcriptional level of glyoxalase in yak might contribute to dicarbonyl stress resistance. Voltage-dependent calcium channel/calcium release channel showed a lower level in yak than in cattle strains, which could reduce the Ca<sup>2+</sup> influx and subsequently decrease the risk of hypertension. However, levels of EF-hand and myosin were higher in yak than in cattle strains, which might enhance the negative effects of reduced Ca<sup>2+</sup> on muscle contraction. Overall, the present study identified lncRNAs and proposed their potential regulatory functions in yak.

Also flagged:SLC14A1oncometaboliteHDAC1Urothelial carcinomaupper tract urothelial carcinomaurinary bladder urothelial carcinoma
Journal Article 2020-09-23 ✓ 5 Snippets Chan TC, Wu WJ, Li WM, Shiao MS, Shiue YL, Li CF.
In-Text Gene Mentions

A quantitative chromatin immunoprecipitation assay further confirmed the binding of HDAC1 to putative HDAC1-responsive elements in the HK2 promoter in J82 (Supplementary Figure S14D) and UMUC3 (Figure 6K) cells as well as the DEGS1 promoter in both cell lines (Supplementary Figure S14E), suggesting that nuclear SLC14A1 recruits HDAC1 with the coordination of SIN3A, ARID4B and/or SUDS3 to transrepress HK2 and DEGS1 genes in UC-derived cells (Supplementary Figure S15).

…-ARID4B (Proteintech) or -SUDS3(Novus Biologicals, USA)…

…ARID4B, SIN3A andSUDS3were identified in…

…these, ARID4B andSUDS3are components of…

…SIN3A, ARID4B and/orSUDS3to transrepress HK2…

Show Full Abstract

Urothelial carcinoma (UC), including upper tract urothelial carcinoma (UTUC) and urinary bladder urothelial carcinoma (UBUC), is a common malignant disease in developed countries. Oncogenic metabolic lesions have been associated with UC development. <b>Methods:</b> Using data mining, a series of studies were performed to study the involvement of SLC14A1 in UC specimens, animal models and UC-derived cell lines. <b>Results:</b> In two cohorts of UTUC (<i>n</i> = 340) and UBUC (<i>n</i> = 295), the SLC14A1 protein level was an independent prognostic factor. Epigenetic silencing contributed to SLC14A1 downregulation in UCs. Total and membranous SLC14A1 played tumor suppressive roles through the inhibition of cell proliferation and metastasis in distinct UC-derived cells and animal models. Functional SLC14A1 prevented the accumulation of arginine and urea, enhanced mitochondrial fusion and aerobic respiration, inhibited glycolysis by altering the expression levels of several related proteins and sensitized arginine-deprivation treatment in <i>ASS1</i>-deficient UC-derived cells. In vitro and in vivo, SLC14A1 inhibited the mTOR signaling pathway and subsequently tumorigenesis, supported by reduced arginine concentrations in vitro. Nuclear SLC14A1 transrepressed <i>HK2</i> and <i>DEGS1</i> genes via recruitment of HDAC1 and/or SIN3A to maintain metabolic homeostasis and thereafter impeded tumorigenesis. <b>Conclusion:</b> Clinical associations, animal models and in vitro indications provide solid evidence that the <i>SLC14A1</i> gene is a novel tumor suppressor in UCs. Total and membranous SLC14A1 prevents urea and arginine accumulation via the mTOR signaling pathway. Nuclear SLC14A1 recruits HDAC1 to transrepress oncometabolite genes.

Also flagged:InsulinLeptinmetabolismglucoselipidhyperglycemia
Journal Article 2020-09-23 ✓ 1 Snippet Singha A, Palavicini JP, Pan M, Farmer S, Sandoval D, Han X, Fujikawa T.
In-Text Gene Mentions

…-, Sst /Unc13c-, SSt /…

Show Full Abstract

Leptin is a potent endocrine hormone produced by adipose tissue and regulates a broad range of whole-body metabolism such as glucose and lipid metabolism, even without insulin. Central leptin signaling can lower hyperglycemia in insulin-deficient rodents via multiple mechanisms, including improvements of dyslipidemia. However, the specific neurons that regulate anti-dyslipidemia effects of leptin remain unidentified. Here we report that leptin receptors (LEPRs) in neurons expressing Cre recombinase driven by a short fragment of a promoter region of <i>Ins2</i> gene (RIP-Cre<sup>25Mgn</sup> neurons) are required for central leptin signaling to reverse dyslipidemia, thereby hyperglycemia in insulin-deficient mice. Ablation of LEPRs in RIP-Cre<sup>25Mgn</sup> neurons completely blocks glucose-lowering effects of leptin in insulin-deficient mice. Further investigations reveal that insulin-deficient mice lacking LEPRs in RIP-Cre<sup>25Mgn</sup> neurons (RIP-Cre<sup>ΔLEPR</sup> mice) exhibit greater lipid levels in blood and liver compared to wild-type controls, and that leptin injection into the brain does not suppress dyslipidemia in insulin-deficient RIP-Cre<sup>ΔLEPR</sup> mice. Leptin administration into the brain combined with acipimox, which lowers blood lipids by suppressing triglyceride lipase activity, can restore normal glycemia in insulin-deficient RIP-Cre<sup>ΔLEPR</sup> mice, suggesting that excess circulating lipids are a driving-force of hyperglycemia in these mice. Collectively, our data demonstrate that LEPRs in RIP-Cre<sup>25Mgn</sup> neurons significantly contribute to glucose-lowering effects of leptin in an insulin-independent manner by improving dyslipidemia.

Also flagged:Hepatocellular Carcinomamalignant tumorsmetabolic disorderstumorcancersHepatitis
Journal Article 2020-09-23 ✓ 2 Snippets Zhang Q, Yu X, Zheng Q, He Y, Guo W.
In-Text Gene Mentions

…, CTNNB1 ,CACNA1E, and MUC16…

…of CTNNB1 andCACNA1Ewere upregulated in…

Show Full Abstract

Hepatitis B virus (HBV)-related hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world with a very poor prognosis. Immunotyping is of great significance for predicting HCC outcomes and guiding immunotherapy. Therefore, we sought to establish a reliable prognostic model for HBV-related HCC based on immune scores. We identified immune-related modules of The Cancer Genome Atlas LIHC and GSE14520 data sets through weighted gene co-expression network analysis and evaluated HCC through a non-negative matrix factorization algorithm. Through further bioinformatics analyses, we identified causes for prognostic differences between subtypes. The results illustrate a significant difference in prognosis based on immunotypes, which may stem from metabolic disorders and increased tumor invasion associated with the high expression of genes related to stem cell characteristics. In conclusion, we identified a novel HBV-related HCC immune subtype and determined its immunological characteristics, which provides ideas for further individualized immunotherapy research.

Also flagged:Familial hypercholesterolemiaFHdiseaselipoproteincoronary artery diseaselow-density lipoprotein receptor
Journal Article 2020-09-23 ✓ 1 Snippet Oommen D, Kizhakkedath P, Jawabri AA, Varghese DS, Ali BR.
In-Text Gene Mentions

…FAM134B, RTN3, SEC62,CCPG1, ATL3, and TEX264…

Show Full Abstract

Familial hypercholesterolemia (FH) is an autosomal genetic disease characterized by high serum low-density lipoprotein (LDL) content leading to premature coronary artery disease. The main genetic and molecular causes of FH are mutations in low-density lipoprotein receptor gene (<i>LDLR</i>) resulting in the non-clearance of LDL from the blood by hepatocytes and consequently the formation of plaques. LDLR is synthesized and glycosylated in the endoplasmic reticulum (ER) and then transported to the plasma membrane via Golgi. It is estimated that more than 50% of reported FH-causing mutations in LDLR result in misfolded proteins that are transport-defective and hence retained in ER. ER accumulation of misfolded proteins causes ER-stress and activates unfolded protein response (UPR). UPR aids protein folding, blocks further protein synthesis, and eliminates misfolded proteins via ER-associated degradation (ERAD) to alleviate ER stress. Various studies demonstrated that ER-retained LDLR mutants are subjected to ERAD. Interestingly, chemical chaperones and genetic or pharmacological inhibition of ERAD have been reported to rescue the transport defective mutant LDLR alleles from ERAD and restore their ER-Golgi transport resulting in the expression of functional plasma membrane LDLR. This suggests the possibility of pharmacological modulation of proteostasis in the ER as a therapeutic strategy for FH. In this review, we picture a detailed analysis of UPR and the ERAD processes activated by ER-retained LDLR mutants associated with FH. In addition, we discuss and critically evaluate the potential role of chemical chaperones and ERAD modulators in the therapeutic management of FH.

Research Square 2020-09-23 Preprint (No Snippets API) Xiong X, Chi J, Gao Q.
Show Full Abstract

<h4>Background: </h4> Coagulation abnormalities in COVID-19 patients accompanied with poor prognosis.This study aimed to determine the prevalence and risk factors of thrombotic events on COVID-19 patients. <h4>Methods: </h4> We systematically reviewed all the studies about thrombotic events on COVID-19 patients in PubMed, Embase, Web of Science, MedRxiv, bioRxiv, from Dec 1st, 2019 to July 5, 2020. The weighted mean difference (MD) or odds ratio (OR) or relative risk (RR) with 95% confidence intervals (CI) for clinical data in COVID-19 patients with or without thrombotic events was calculated. <h4>Results: </h4> 12 articles contained 1083 patients were included for meta-analysis. The prevalence of thrombosis was 22% (95% CI 0.08-0.40) in COVID-19 patients and increased to 43% (95% CI 0.29-0.65) after admission to the intensive care unit (ICU). Compared with non-thrombotic patients, thrombotic patients had higher levels of D-dimer (MD=2.79, 95% CI 2.27–3.31), lactate dehydrogenase (LDH) (MD=112.71, 95% CI 62.40–163.02), and white blood cells (WBC) (MD=1.14, 95% CI 0.47–1.81) while decreased lymphocytes (MD= -0.20, 95% CI -0.38 – -0.02). Age, platelet counts, and male sex tended to be risks while diabetes tended to be a protection for thrombosis for COVID-19 patients , although no statistical difference was achieved. Finally, patients with thrombosis were at a higher risk of death (OR=2.39, 95% CI 1.36–4.20). <h4>Conclusions: </h4> Prevalence of thrombosis in COVID-19 patients was high, especially in ICU, though pharmacologic thromboembolism prophylaxis was applied. Therefore, higher levels of D-dimer, LDH, WBC, and decreased lymphocytes needed to be paid close attention to in patients with COVID-19.

Also flagged:Huntington's DiseaseHDneurodegenerative disorderHuntingtinfumarateasparagine
Journal Article 2020-09-22 ✓ 1 Snippet Bertrand M, Decoville M, Meudal H, Birman S, Landon C.
In-Text Gene Mentions

…the human Huntingtin (HTT) protein containing a…

Show Full Abstract

Huntington's disease (HD) is an inherited neurodegenerative disorder, for which diagnostic development and discovery of new therapeutic targets are urgently required. In this study, a model of HD in <i>Drosophila melanogaster</i> has been used to identify metabolic biomarkers at presymptomatic and symptomatic stages of the disease. The pan-neuronal expression of a pathogenic fragment of the human Huntingtin (HTT) protein containing a 93-repeat polyglutamine expansion (Httex1p Q93) in transgenic flies induces a neuropathology with several characteristics of the human disease. The discriminant metabolites between the diseased flies and their controls were identified by <sup>1</sup>H nuclear magnetic resonance and orthogonal partial least squares discriminant multivariate analysis. The experiments carried out with 10-day-old flies allowed us to identify a set of 10 biomarkers of the presymptomatic stage: NAD<sup>+</sup>, AMP, fumarate, asparagine, dimethylamine, β-alanine, glutamine, succinate, glutamate, and ethanol. Remarkably, the experiments conducted with 16-day-old flies, when the symptoms of the disease were present, highlighted a different set of 6 biomarkers: phosphocholine, ethanolamine, 2-oxoglutarate, succinate, pyruvate, and acetate. Our results provide a better understanding of the metabolic impairments in a widely used HD model and demonstrate that metabolism perturbations change dramatically during the development of the disease.

Also flagged:TFGautophagyendoplasmic reticulumantibodiesmacroautophagyproteasomal
Journal Article 2020-09-22 ✓ 1 Snippet Steinmetz TD, Schlötzer-Schrehardt U, Hearne A, Schuh W, Wittner J, Schulz SR, Winkler TH, Jäck HM, Mielenz D.
In-Text Gene Mentions

Ccpg1

Show Full Abstract

Plasma cells depend on quality control of newly synthesized antibodies in the endoplasmic reticulum (ER) via macroautophagy/autophagy and proteasomal degradation. The cytosolic adaptor protein TFG (Trk-fused gene) regulates ER-Golgi transport, the secretory pathway and proteasome activity in non-immune cells. We show here that TFG is upregulated during lipopolysaccharide- and CpG-induced differentiation of B1 and B2 B cells into plasmablasts, with the highest expression of TFG in mature plasma cells. CRISPR-CAS9-mediated gene disruption of <i>tfg</i> in the B lymphoma cell line CH12 revealed increased apoptosis, which was reverted by BCL2 but even more by ectopic TFG expression. Loss of TFG disrupted ER structure, leading to an expanded ER and increased expression of ER stress genes. When compared to wild-type CH12 cells, <i>tfg</i> KO CH12 cells were more sensitive toward ER stress induced by tunicamycin, monensin and proteasome inhibition or by expression of an ER-bound immunoglobulin (Ig) μ heavy (µH) chain. CH12 <i>tfg</i> KO B cells displayed more total LC3, lower LC3-II turnover and increased numbers and size of autophagosomes. Tandem-fluorescent-LC3 revealed less accumulation of GFP-LC3 in starved and chloroquine-treated CH12 <i>tfg</i> KO B cells. The GFP:RFP ratio of tandem-fluorescent-LC3 was higher in tunicamycin-treated CH12 <i>tfg</i> KO B cells, suggesting less autophagy flux during induced ER stress. Based on these data, we suggest that TFG controls autophagy flux in CH12 B cells and propose that TFG is a survival factor that alleviates ER stress through the support of autophagy flux in activated B cells and mature plasma cells.<b>Abbreviations</b>: Ab, antibody; Ag, antigen; ASC, antibody-secreting cells; ATG, autophagy-related; BCR, B cell receptor; COPII, coat protein complex II; CpG, non-methylated CpG oligonucleotide; ER, endoplasmic reticulum; ERAD, ER-associated degradation; FO, follicular; GFP, green fluorescent protein; HC, heavy chain; Ig, immunoglobulin; IRES, internal ribosomal entry site; LC, light chain; MZ, marginal zone; NFKB, nuclear factor of kappa light polypeptide gene enhancer in B cells; TLR, toll-like receptor; UPR, unfolded protein response.

Also flagged:cholesterolbiosynthesisHDsynthesiscognitive declinesynaptic transmission
Journal Article 2020-09-22 ✓ 2 Snippets Birolini G, Valenza M, Di Paolo E, Vezzoli E, Talpo F, Maniezzi C, Caccia C, Leoni V, Taroni F, Bocchi VD, Conforti P, Sogne E, Petricca L, Cariulo C, Verani M, Caricasole A, Falqui A, Biella G, Cattaneo E.
In-Text Gene Mentions

The basis of HD is expansion of a CAG trinucleotide repeat in the gene encoding the Huntingtin protein (HTT; Saudou & Humbert, 2016).

…the Huntingtin protein (HTT; Saudou & Humbert,…

Show Full Abstract

A variety of pathophysiological mechanisms are implicated in Huntington's disease (HD). Among them, reduced cholesterol biosynthesis has been detected in the HD mouse brain from pre-symptomatic stages, leading to diminished cholesterol synthesis, particularly in the striatum. In addition, systemic injection of cholesterol-loaded brain-permeable nanoparticles ameliorates synaptic and cognitive function in a transgenic mouse model of HD. To identify an appropriate treatment regimen and gain mechanistic insights into the beneficial activity of exogenous cholesterol in the HD brain, we employed osmotic mini-pumps to infuse three escalating doses of cholesterol directly into the striatum of HD mice in a continuous and rate-controlled manner. All tested doses prevented cognitive decline, while amelioration of disease-related motor defects was dose-dependent. In parallel, we found morphological and functional recovery of synaptic transmission involving both excitatory and inhibitory synapses of striatal medium spiny neurons. The treatment also enhanced endogenous cholesterol biosynthesis and clearance of mutant Huntingtin aggregates. These results indicate that cholesterol infusion to the striatum can exert a dose-dependent, disease-modifying effect and may be therapeutically relevant in HD.

Also flagged:ovarian canceramino acidsivermectinHIV1 infectionvirus infection19
Journal Article 2020-09-22 No Snippets Li N, Zhao L, Zhan X.
Show Full Abstract

Viruses such as human cytomegalovirus (HCMV), human papillomavirus (HPV), Epstein-Barr virus (EBV), human immunodeficiency virus (HIV), and coronavirus (severe acute respiratory syndrome coronavirus 2 [SARS-CoV-2]) represent a great burden to human health worldwide. FDA-approved anti-parasite drug ivermectin is also an antibacterial, antiviral, and anticancer agent, which offers more potentiality to improve global public health, and it can effectively inhibit the replication of SARS-CoV-2 in vitro. This study sought to identify ivermectin-related virus infection pathway alterations in human ovarian cancer cells. Stable isotope labeling by amino acids in cell culture (SILAC) quantitative proteomics was used to analyze human ovarian cancer cells TOV-21G treated with and without ivermectin (20 μmol/L) for 24 h, which identified 4447 ivermectin-related proteins in ovarian cancer cells. Pathway network analysis revealed four statistically significant antiviral pathways, including HCMV, HPV, EBV, and HIV1 infection pathways. Interestingly, compared with the reported 284 SARS-CoV-2/COVID-19-related genes from GencLip3, we identified 52 SARS-CoV-2/COVID-19-related protein alterations when treated with and without ivermectin. Protein-protein network (PPI) was constructed based on the interactions between 284 SARS-CoV-2/COVID-19-related genes and between 52 SARS-CoV-2/COVID-19-related proteins regulated by ivermectin. Molecular complex detection analysis of PPI network identified three hub modules, including cytokines and growth factor family, MAP kinase and G-protein family, and HLA class proteins. Gene Ontology analysis revealed 10 statistically significant cellular components, 13 molecular functions, and 11 biological processes. These findings demonstrate the broad-spectrum antiviral property of ivermectin benefiting for COVID-19 treatment in the context of predictive, preventive, and personalized medicine in virus-related diseases.

Also flagged:SOX5degradationchondrogenesispolymerasetranscription factorschondrocyte differentiation
Journal Article 2020-09-22 ✓ 2 Snippets Yang Z, Ren Z, She R, Ao J, Wa Q, Sun Z, Li B, Tian X.
In-Text Gene Mentions

…cells via targetingSOX6/SOX5.…

…the expression ofSOX6/SOX5, transcription factors t…

Show Full Abstract

Cartilage generation and degradation are controlled by miRNAs. Our previous study showed miR-23a-3p was downregulated during chondrogenic differentiation in chondrogenic human adipose-derived mesenchymal stem cells (hADSCs). In the present study, we explored the function of miR-23a-3p in chondrogenesis differentiation. The role of miR-23a-3p in chondrogenic differentiation potential of hADSCs was assessed by Alcian blue staining, quantitative real-time polymerase chain reaction (qRT-PCR), and Western blot. We show that miR-23a-3p suppressed the chondrogenic differentiation of hADSCs. LncRNA SNHG5 interacted with miR-23a-3p, and suppression or overexpression of SNHG5 correlates with inhibition and promotion of hADSC chondrogenic differentiation, respectively. We have determined that SNHG5 can sponge miR-23a-3p to regulate the expression of SOX6/SOX5, transcription factors that play essential roles in chondrocyte differentiation. Furthermore, the overexpression of SNHG5 activates the JNK/MAPK/ERK pathway. In conclusion, miR-23a-3p regulated by lncRNA SNHG5 suppresses the chondrogenic differentiation of human adipose-derived stem cells via targeting SOX6/SOX5.

Also flagged:pathogenesishereditary colorectal cancercolon cancerFAT4tumorsCOL6A5
Journal Article 2020-09-22 ✓ 1 Snippet Kim JC, Kim JH, Ha YJ, Kim CW, Tak KH, Yoon YS, Kwon YH, Roh SA, Cho DH, Kim SK, Kim SY, Kim YS.
In-Text Gene Mentions

LRRC7

Show Full Abstract

<h4>Purpose</h4>As few genotype-phenotype correlations are available for nonsyndromic hereditary colorectal cancer (CRC), we implemented genomic analysis on the basis of the revised Bethesda guideline (RBG) and extended (12 items) to verify possible subtypes.<h4>Methods</h4>Patients with sporadic CRC (n = 249) were enrolled, stratified according to the revised Bethesda guidelines (RBG+ and RBG- groups) plus additional criteria. Exome/transcriptome analyses (n = 98) and cell-based functional assays were conducted.<h4>Results</h4>We detected 469 somatic and 830 germline gene mutations differing significantly between the positive and negative groups, associated with 12 RBG items/additional criteria. Twenty-one genes had significantly higher mutation rates in left, relative to right, colon cancer, while USP40, HCFC1, and HSPG2 mutation rates were higher in rectal than colon cancer. FAT4 mutation rates were lower in early-onset CRC, in contrast to increased rates in microsatellite instability (MSI)-positive tumors, potentially defining an early-onset microsatellite-stable subtype. The mutation rates of COL6A5 and MGAM2 were significantly and SETD5 was assumably, associated CRC pedigree with concurrent gastric cancer (GC). The predicted deleterious/damaging germline variants, SH2D4A rs35647122, was associated with synchronous/metachronous CRC with related tumors, while NUP160 rs381660 and KRTAP27-1 rs2244485 were potentially associated with a GC pedigree and less strictly defined hereditary CRC, respectively. SH2D4A and NUP160 acted as oncogenic facilitators.<h4>Conclusion</h4>Our limited genomic analysis for RBG and additional items suggested that specific somatic alterations in the respective items may enlighten relevant pathogenesis along with the knowledge of germline mutations. Further validation is needed to indicate appropriate surveillance in suspected individuals.

Also flagged:COVID-19acute respiratory failuremyocardialacute kidney injuryprothrombinfibrinogen
Journal Article 2020-09-22 ✓ 1 Snippet Gerotziafas GT, Sergentanis TN, Voiriot G, Lassel L, Papageorgiou C, Elabbadi A, Turpin M, Vandreden P, Papageorgiou L, Psaltopoulou T, Terpos E, Dimopoulos MA, Parrot A, Cadranel J, Pialoux G, Fartoukh M, Elalamy I.
In-Text Gene Mentions

ATIII

Show Full Abstract

The prospective observational cohort study COMPASS-COVID-19 aimed to develop a risk assessment model for early identification of hospitalized COVID-19 patients at risk for worsening disease. Patients with confirmed COVID-19 (<i>n</i> = 430) hospitalized between March 18 and April 21, 2020 were divided in derivation (<i>n</i> = 310) and validation (<i>n</i> = 120) cohorts. Two groups became evident: (1) <i>good prognosis group</i> (G-group) with patients hospitalized at the conventional COVID-19 ward and (2) <i>Worsening disease group</i> (W-group) with patients admitted to the intensive care unit (ICU) from the emergency departments. The study end point was disease worsening (acute respiratory failure, shock, myocardial dysfunction, bacterial or viral coinfections, and acute kidney injury) requiring ICU admission. All patients were routinely evaluated for full blood count, prothrombin time, fibrinogen, D-dimers, antithrombin (AT), and protein C activity. Data from the first hospitalization day at the conventional ward or the ICU were analyzed. Cardiovascular risk factors and comorbidities were routinely registered. Obesity, hypertension, diabetes and male gender, increased fibrinogen and D-dimers, thrombocytopenia, AT deficiency, lymphopenia, and an International Society on Thrombosis and Haemostasis (ISTH) score for compensated disseminated intravascular coagulation score (cDIC-ISTH) <i>≥</i>5 were significant risk factors for worsening disease. The COMPASS-COVID-19 score was derived from multivariate analyses and includes obesity, gender, hemoglobin, lymphocyte, and the cDIC-ISTH score (including platelet count, prothrombin time, D-dimers, AT, and protein C levels). The score has a very good discriminating capacity to stratify patients at high and low risk for worsening disease, with an area under the receiver operating characteristic curve value of 0.77, a sensitivity of 81%, and a specificity of 60%. Application of the COMPASS-COVID-19 score at the validation cohort showed 96% sensitivity. The COMPASS-COVID-19 score is an accurate clinical decision-making tool for an easy identification of COVID-19 patients being at high risk for disease worsening.

Also flagged:sickle cell diseasebehavioralminocyclinecognitive dysfunctionsickle cellCD45
Journal Article 2020-09-22 ✓ 1 Snippet Hardy RA, Rached NA, Jones JA, Archer DR, Hyacinth HI.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

<h4>Impact statement</h4>This study provides crucial information that could be helpful in the development of new or repurposing of existing therapies for the treatment of cognitive deficit in individuals with sickle cell disease (SCD). Its impact is in demonstrating for the first time that neuroinflammation and along with abnormal neuroplasticity are among the underlying mechanism of cognitive and behavioral deficits in SCD and that drugs such as minocycline which targets these pathophysiological mechanisms could be repurposed for the treatment of this life altering complication of SCD.

Also flagged:IL-8IFN-γdeathIL-6TNFGM-CSF
Journal Article 2020-09-22 No Snippets Burke H, Freeman A, Cellura DC, Stuart BL, Brendish NJ, Poole S, Borca F, Phan HTT, Sheard N, Williams S, Spalluto CM, Staples KJ, Clark TW, Wilkinson TMA, REACT COVID investigators.
Show Full Abstract

<h4>Background</h4>The COVID-19 pandemic has led to more than 760,000 deaths worldwide (correct as of 16th August 2020). Studies suggest a hyperinflammatory response is a major cause of disease severity and death. Identitfying COVID-19 patients with hyperinflammation may identify subgroups who could benefit from targeted immunomodulatory treatments. Analysis of cytokine levels at the point of diagnosis of SARS-CoV-2 infection can identify patients at risk of deterioration.<h4>Methods</h4>We used a multiplex cytokine assay to measure serum IL-6, IL-8, TNF, IL-1β, GM-CSF, IL-10, IL-33 and IFN-γ in 100 hospitalised patients with confirmed COVID-19 at admission to University Hospital Southampton (UK). Demographic, clinical and outcome data were collected for analysis.<h4>Results</h4>Age > 70 years was the strongest predictor of death (OR 28, 95% CI 5.94, 139.45). IL-6, IL-8, TNF, IL-1β and IL-33 were significantly associated with adverse outcome. Clinical parameters were predictive of poor outcome (AUROC 0.71), addition of a combined cytokine panel significantly improved the predictability (AUROC 0.85). In those ≤70 years, IL-33 and TNF were predictive of poor outcome (AUROC 0.83 and 0.84), addition of a combined cytokine panel demonstrated greater predictability of poor outcome than clinical parameters alone (AUROC 0.92 vs 0.77).<h4>Conclusions</h4>A combined cytokine panel improves the accuracy of the predictive value for adverse outcome beyond standard clinical data alone. Identification of specific cytokines may help to stratify patients towards trials of specific immunomodulatory treatments to improve outcomes in COVID-19.

Also flagged:mannoseN-glycosylationPMM2glycosylationphosphomannomutase 2deficiency
Journal Article 2020-09-22 ✓ 1 Snippet Taday R, Grüneberg M, DuChesne I, Reunert J, Marquardt T.
In-Text Gene Mentions

…Plasma levels ofATIII, factor IX, protein…

Show Full Abstract

<h4>Background</h4>PMM2-CDG (CDG-Ia) is the most frequent N-glycosylation disorder. While supplying mannose to PMM2-deficient fibroblasts corrects the altered N-glycosylation in vitro, short term therapeutic approaches with mannose supplementation in PMM2-CDG patients have been unsuccessful. Mannose found no further mention in the design of a potential therapy for PMM2-CDG in the past years, as it applies to be ineffective. This retrospective study analyzes the first long term mannose supplementation in 20 PMM2-CDG patients. Mannose was given at a total of 1-2 g mannose/kg b.w./d divided into 5 single doses over a mean time of 57,75 ± 25,85 months. Protein glycosylation, blood mannose concentration and clinical presentation were monitored in everyday clinical practice.<h4>Results</h4>After a mean time period of more than 1 year the majority of patients showed significant improvements in protein glycosylation.<h4>Conclusion</h4>Dietary mannose supplementation shows biological effects in PMM2-CDG patients improving glycosylation in the majority of patients. A double-blind randomized study is needed to examine the role of mannose in the design of a therapy for children with PMM2-CDG in more detail.

Also flagged:cRNAβ-catenincdtBmCherryCarcinoma of the gallbladdertumor
Journal Article 2020-09-22 No Snippets Sepe LP, Hartl K, Iftekhar A, Berger H, Kumar N, Goosmann C, Chopra S, Schmidt SC, Gurumurthy RK, Meyer TF, Boccellato F.
Show Full Abstract

Carcinoma of the gallbladder (GBC) is the most frequent tumor of the biliary tract. Despite epidemiological studies showing a correlation between chronic infection with <i>Salmonella enterica</i> Typhi/Paratyphi A and GBC, the underlying molecular mechanisms of this fatal connection are still uncertain. The murine serovar <i>Salmonella</i> Typhimurium has been shown to promote transformation of genetically predisposed cells by driving mitogenic signaling. However, insights from this strain remain limited as it lacks the typhoid toxin produced by the human serovars Typhi and Paratyphi A. In particular, the CdtB subunit of the typhoid toxin directly induces DNA breaks in host cells, likely promoting transformation. To assess the underlying principles of transformation, we used gallbladder organoids as an infection model for <i>Salmonella</i> Paratyphi A. In this model, bacteria can invade epithelial cells, and we observed host cell DNA damage. The induction of DNA double-strand breaks after infection depended on the typhoid toxin CdtB subunit and extended to neighboring, non-infected cells. By cultivating the organoid derived cells into polarized monolayers in air-liquid interphase, we could extend the duration of the infection, and we observed an initial arrest of the cell cycle that does not depend on the typhoid toxin. Non-infected intoxicated cells instead continued to proliferate despite the DNA damage. Our study highlights the importance of the typhoid toxin in causing genomic instability and corroborates the epidemiological link between <i>Salmonella</i> infection and GBC.<b>IMPORTANCE</b> Bacterial infections are increasingly being recognized as risk factors for the development of adenocarcinomas. The strong epidemiological evidence linking <i>Helicobacter pylori</i> infection to stomach cancer has paved the way to the demonstration that bacterial infections cause DNA damage in the host cells, initiating transformation. In this regard, the role of bacterial genotoxins has become more relevant. <i>Salmonella enterica</i> serovars Typhi and Paratyphi A have been clinically associated with gallbladder cancer. By harnessing the stem cell potential of cells from healthy human gallbladder explant, we regenerated and propagated the epithelium of this organ <i>in vitro</i> and used these cultures to model <i>S.</i> Paratyphi A infection. This study demonstrates the importance of the typhoid toxin, encoded only by these specific serovars, in causing genomic instability in healthy gallbladder cells, posing intoxicated cells at risk of malignant transformation.

Also flagged:Down syndrome cell adhesion moleculeclustered protocadhreinIgfibronectinclustered protocadherinsaggregation
Journal Article 2020-09-22 ✓ 1 Snippet Zhou F, Cao G, Dai S, Li G, Li H, Ding Z, Hou S, Xu B, You W, Wiseglass G, Shi F, Yang X, Rubinstein R, Jin Y.
In-Text Gene Mentions

DCC receptor

Show Full Abstract

Thousands of Down syndrome cell adhesion molecule (Dscam1) isoforms and ∼60 clustered protocadhrein (cPcdh) proteins are required for establishing neural circuits in insects and vertebrates, respectively. The strict homophilic specificity exhibited by these proteins has been extensively studied and is thought to be critical for their function in neuronal self-avoidance. In contrast, significantly less is known about the Dscam1-related family of ∼100 shortened <i>Dscam</i> (sDscam) proteins in Chelicerata. We report that Chelicerata sDscamα and some sDscamβ protein <i>trans</i> interactions are strictly homophilic, and that the <i>trans</i> interaction is meditated via the first Ig domain through an antiparallel interface. Additionally, different sDscam isoforms interact promiscuously in <i>cis</i> via membrane proximate fibronectin-type III domains. We report that cell-cell interactions depend on the combined identity of all sDscam isoforms expressed. A single mismatched sDscam isoform can interfere with the interactions of cells that otherwise express an identical set of isoforms. Thus, our data support a model by which sDscam association in <i>cis</i> and <i>trans</i> generates a vast repertoire of combinatorial homophilic recognition specificities. We propose that in Chelicerata, sDscam combinatorial specificity is sufficient to provide each neuron with a unique identity for self-nonself discrimination. Surprisingly, while sDscams are related to <i>Drosophila</i> Dscam1, our results mirror the findings reported for the structurally unrelated vertebrate cPcdh. Thus, our findings suggest a remarkable example of convergent evolution for the process of neuronal self-avoidance and provide insight into the basic principles and evolution of metazoan self-avoidance and self-nonself discrimination.

Also flagged:oxygenwaterbioapatitedeathmineralssalt
Journal Article 2020-09-22 No Snippets Dotsika E.
Show Full Abstract

In this study a methodology for identifying the geographic origin of unidentified persons, their residence and moving patterns while providing information on lifestyle, diet and socio-economic status by combining stable isotopic data, with the biological information (isotopic composition of the skeleton), is presented. This is accomplished by comparing the oxygen isotopic composition of the spring water that individuals were drinking, during their living period, with the oxygen isotopic composition of their tooth enamel bioapatite. Spring water and teeth samples were collected from individuals from three different areas of Greece: North Greece, Central Greece and South Greece and isotopic analysis of δ<sup>13</sup>C and δ<sup>18</sup>O of tooth enamel bioapatite and δ<sup>18</sup>O of spring water were conducted. For these three areas the isotopic methodology is a promising tool for discriminating the provenance. Furthermore, as a case study, this methodology is applied to two archeological sites of Greece (Medieval-Thebes and Roman-Edessa) in order to determine paleomobility patterns.

Also flagged:Cholesterolmembraneshemostasiswound healingoxygenphenolic compounds
Journal Article 2020-09-22 No Snippets Ruwizhi N, Aderibigbe BA.
Show Full Abstract

Several researchers have reported the use of cholesterol-based carriers in drug delivery. The presence of cholesterol in cell membranes and its wide distribution in the body has led to it being used in preparing carriers for the delivery of a variety of therapeutic agents such as anticancer, antimalarials and antivirals. These cholesterol-based carriers were designed as micelles, nanoparticles, copolymers, liposomes, etc. and their routes of administration include oral, intravenous and transdermal. The biocompatibility, good bioavailability and biological activity of cholesterol-based carriers make them potent prodrugs. Several in vitro and in vivo studies revealed cholesterol-based carriers potentials in delivering bioactive agents. In this manuscript, a critical review of the efficacy of cholesterol-based carriers is reported.

Also flagged:FibronectinColorectal cancercancerglycoproteinsagglutininimmune responses
Journal Article 2020-09-22 ✓ 1 Snippet Chantaraamporn J, Champattanachai V, Khongmanee A, Verathamjamras C, Prasongsook N, Mingkwan K, Luevisadpibul V, Chutipongtanate S, Svasti J.
In-Text Gene Mentions

…AZGP1, ITH1, ITH2,SERPINC1and SERPING2 were…

Show Full Abstract

Colorectal cancer (CRC) is a major cause of cancer mortality. Currently used CRC biomarkers provide insufficient sensitivity and specificity; therefore, novel biomarkers are needed to improve the CRC detection. Label-free quantitative proteomics were used to identify and compare glycoproteins, enriched by wheat germ agglutinin, from plasma of CRC patients and age-matched healthy controls. Among 189 identified glycoproteins, the levels of 7 and 15 glycoproteins were significantly altered in the non-metastatic and metastatic CRC groups, respectively. Protein-protein interaction analysis revealed that they were predominantly involved in immune responses, complement pathways, wound healing and coagulation. Of these, the levels of complement C9 (C9) was increased and fibronectin (FN1) was decreased in both CRC states in comparison to those of the healthy controls. Moreover, their levels detected by immunoblotting were validated in another independent cohort and the results were consistent with in the study cohort. Combination of CEA, a commercial CRC biomarker, with C9 and FN1 showed better diagnostic performance. Interestingly, predominant glycoforms associated with acetylneuraminic acid were obviously detected in alpha-2 macroglobulin, haptoglobin, alpha-1-acid glycoprotein 1, and complement C4-A of CRC patient groups. This glycoproteomic approach provides invaluable information of plasma proteome profiles of CRC patients and identification of CRC biomarker candidates.

Also flagged:transcription regulatory factorsIGF1VGLL3PPARGproteolysisCTSC
Journal Article 2020-09-22 No Snippets Fernández-Barroso MÁ, Caraballo C, Silió L, Rodríguez C, Nuñez Y, Sánchez-Esquiliche F, Matos G, García-Casco JM, Muñoz M.
Show Full Abstract

Tenderness is one of the most important meat quality traits and it can be measured through shear force with the Warner-Bratzler test. In the current study, we use the RNA-seq technique to analyze the transcriptome of <i>Longissimus dorsi</i> (LD) muscle in two groups of Iberian pigs (Tough and Tender) divergent for shear force breeding values. We identified 200 annotated differentially expressed genes (DEGs) and 245 newly predicted isoforms. The RNAseq expression results of 10 genes were validated with quantitative PCR (qPCR). Functional analyses showed an enrichment of DE genes in biological processes related to proteolysis (<i>CTSC</i>, <i>RHOD</i>, <i>MYH8</i>, <i>ACTC1</i>, <i>GADD45B</i>, <i>CASQ2</i>, <i>CHRNA9</i> and <i>ANKRD1</i>), skeletal muscle tissue development (<i>ANKRD1</i>, <i>DMD</i>, <i>FOS</i> and <i>MSTN</i>), lipid metabolism (<i>FABP3</i> and <i>PPARGC1A</i>) and collagen metabolism (<i>COL14A1</i>). The upstream analysis revealed a total of 11 transcription regulatory factors that could regulate the expression of some DEGs. Among them, IGF1, VGLL3 and PPARG can be highlighted since they regulate the expression of genes involved in biological pathways that could affect tenderness. The experiment revealed a set of candidate genes and regulatory factors suggestive to search polymorphisms that could be incorporated in a breeding program for improving meat tenderness.

Also flagged:cDNAExtracellular Vesiclesextracellularvesiclestumorimmune response
Journal Article 2020-09-22 No Snippets Nazari-Shafti TZ, Neuber S, Duran AG, Exarchos V, Beez CM, Meyborg H, Krüger K, Wolint P, Buschmann J, Böni R, Seifert M, Falk V, Emmert MY.
Show Full Abstract

The cardioprotective properties of extracellular vesicles (EVs) derived from mesenchymal stromal cells (MSCs) are currently being investigated in preclinical studies. Although microRNAs (miRNAs) encapsulated in EVs have been identified as one component responsible for the cardioprotective effect of MSCs, their potential off-target effects have not been sufficiently characterized. In the present study, we aimed to investigate the miRNA profile of EVs isolated from MSCs that were derived from cord blood (CB) and adipose tissue (AT). The identified miRNAs were then compared to known targets from the literature to discover possible adverse effects prior to clinical use. Our data show that while many cardioprotective miRNAs such as miR-22-3p, miR-26a-5p, miR-29c-3p, and miR-125b-5p were present in CB- and AT-MSC-derived EVs, a large number of known oncogenic and tumor suppressor miRNAs such as miR-16-5p, miR-23a-3p, and miR-191-5p were also detected. These findings highlight the importance of quality assessment for therapeutically applied EV preparations.

Also flagged:Huntington Diseaseneurodegenerative disordermitochondrialHDCas9Mitochondria
Journal Article 2020-09-22 ✓ 3 Snippets Lopes C, Tang Y, Anjo SI, Manadas B, Onofre I, de Almeida LP, Daley GQ, Schlaeger TM, Rego ACC.
In-Text Gene Mentions

…expansion in theHTTgene.…

…expansion in theHTTgene, encoding for…

…exogenous/endogenous WT/mutantHTTgene, being associated…

Show Full Abstract

Mitochondrial deregulation has gained increasing support as a pathological mechanism in Huntington's disease (HD), a genetic-based neurodegenerative disorder caused by CAG expansion in the <i>HTT</i> gene. In this study, we thoroughly investigated mitochondrial-based mechanisms in HD patient-derived iPSC (HD-iPSC) and differentiated neural stem cells (NSC) <i>versus</i> control cells, as well as in cells subjected to CRISPR/Cas9-CAG repeat deletion. We analyzed mitochondrial morphology, function and biogenesis, linked to exosomal release of mitochondrial components, glycolytic flux, ATP generation and cellular redox status. Mitochondria in HD cells exhibited round shape and fragmented morphology. Functionally, HD-iPSC and HD-NSC displayed lower mitochondrial respiration, exosomal release of cytochrome c, decreased ATP/ADP, reduced PGC-1α and complex III subunit expression and activity, and were highly dependent on glycolysis, supported by pyruvate dehydrogenase (PDH) inactivation. HD-iPSC and HD-NSC mitochondria showed ATP synthase reversal and increased calcium retention. Enhanced mitochondrial reactive oxygen species (ROS) were also observed in HD-iPSC and HD-NSC, along with decreased UCP2 mRNA levels. CRISPR/Cas9-CAG repeat deletion in HD-iPSC and derived HD-NSC ameliorated mitochondrial phenotypes. Data attests for intricate metabolic and mitochondrial dysfunction linked to transcriptional deregulation as early events in HD pathogenesis, which are alleviated following CAG deletion.

Also flagged:saponinpancreatic lipaseSaponinshyperlipidemiasapogeninssapogenin
Journal Article 2020-09-22 ✓ 1 Snippet Navarro Del Hierro J, Casado-Hidalgo G, Reglero G, Martin D.
In-Text Gene Mentions

Saponin-rich extracts and their hydrolysates from fenugreek (FE, HFE) and quinoa (QE, HQE), and saponin and sapogenin standards, were assessed on the inhibition of pancreatic lipase and interference on the bioaccessibility of cholesterol by in vitro digestion models.

Show Full Abstract

Saponins are promising compounds for ameliorating hyperlipidemia but scarce information exists about sapogenins, the hydrolyzed forms of saponins. Saponin-rich extracts and their hydrolysates from fenugreek (FE, HFE) and quinoa (QE, HQE), and saponin and sapogenin standards, were assessed on the inhibition of pancreatic lipase and interference on the bioaccessibility of cholesterol by in vitro digestion models. All extracts inhibited pancreatic lipase (IC<sub>50</sub> between 1.15 and 0.59 mg/mL), although the hydrolysis enhanced the bioactivity of HQE (p = 0.014). The IC<sub>50</sub> value significantly correlated to the saponin content (r = -0.82; p = 0.001). Only the hydrolyzed extracts showed a reduction of bioaccessible cholesterol (p < 0.001) higher than that of phytosterols (35% reduction). Sapogenin standards exhibited no bioactivities, protodioscin and hederacoside C slightly inhibited the lipase (around 10%) and protodioscin reduced the bioaccessible cholesterol (23% reduction, p = 0.035). The hydrolysis process of saponin-rich extracts enhances the bioactivity and allows developing multibioactive products against pancreatic lipase and cholesterol absorption simultaneously.

Also flagged:chromiumion transport-relateddigestionPEPT1BAT1MDU1
Journal Article 2020-09-22 ✓ 1 Snippet Jiao L, Dai T, Cao T, Jin M, Sun P, Zhou Q.
In-Text Gene Mentions

…and peroxisome (ACOX1,ECI2, NUDT12) pathways implied…

Show Full Abstract

Heavy metal pollution arising from agricultural and industrial activities poses a significant threat to the aquatic environment, especially the increasing levels of chromium (Cr) that is exacerbating marine pollution. Given the economic importance of the Pacific white shrimp Litopenaeus vannamei (L. vannamei), understanding the impact of marine Cr pollution is deemed to be significant. In this study, we used the transcriptome sequencing (RNA-seq) technique to characterize the molecular mechanism of Cr exposure in L. vannamei. Gene ontology enrichment analysis showed substrate-specific and ion transport-related functions were mainly influenced by Cr exposure. We further identified genes involved in protein digestion and absorption (PEPT1, BAT1, MDU1), chemical carcinogenesis (GST and UGTs), ABC transporters (ABCC2), apoptosis (CAPN1, CASP10, PARP), implying the potentially Cr disintoxication mechanisms in L. vannamei. Genes within pancreatic secretion (ALT, LDH), lysosome (CTSL and HEXB), and peroxisome (ACOX1, ECI2, NUDT12) pathways implied the potentially Cr toxicity mechanisms in L. vannamei.

Also flagged:CD19type 1 diabetesantigen receptordeathendoplasmic reticulumGSDMD
Journal Article 2020-09-22 ✓ 3 Snippets Ma H, Jeppesen JF, Jaenisch R.
In-Text Gene Mentions

The results summarized in Figures 5B and 5C suggest that exposure of β-like cells and primary islets to activated T cell-conditioned medium stimulated expression of multiple immunomodulatory genes, including IDO1, BTN3A1, BTN3A2, BTN3A3, and CD47, consistent with β cells actively recruiting immune-protective mechanisms that may modify the course of T1D progression.

…BTN3A2 , andBTN3A3.…

…BTN3A1, BTN3A2 ,BTN3A3, and CD47…

Show Full Abstract

Autoimmune destruction of pancreatic β cells underlies type 1 diabetes (T1D). To understand T cell-mediated immune effects on human pancreatic β cells, we combine β cell-specific expression of a model antigen, CD19, and anti-CD19 chimeric antigen receptor T (CAR-T) cells. Coculturing CD19-expressing β-like cells and CD19 CAR-T cells results in T cell-mediated β-like cell death with release of activated T cell cytokines. Transcriptome analysis of β-like cells and human islets treated with conditioned medium of the immune reaction identifies upregulation of immune reaction genes and the pyroptosis mediator <i>GSDMD</i> as well as its activator <i>CASP4</i>. Caspase-4-mediated cleaved GSDMD is detected in β-like cells under inflammation and endoplasmic reticulum (ER) stress conditions. Among immune-regulatory genes, <i>PDL1</i> is one of the most upregulated, and <i>PDL1</i> overexpression partially protects human β-like cells transplanted into mice. This experimental platform identifies potential mechanisms of β cell destruction and may allow testing of therapeutic strategies.

Also flagged:gene expressioncancerLDAEPIPgene expressionTumor
Journal Article 2020-09-22 ✓ 1 Snippet Baur B, Shin J, Zhang S, Roy S.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Transcriptional regulatory networks control context-specific gene expression patterns and play important roles in normal and disease processes. Advances in genomics are rapidly increasing our ability to measure different components of the regulation machinery at the single-cell and bulk population level. An important challenge is to combine different types of regulatory genomic measurements to construct a more complete picture of gene regulatory networks across different disease, environmental, and developmental contexts. In this review, we focus on recent computational methods that integrate regulatory genomic data sets to infer context specificity and dynamics in regulatory networks.

Also flagged:epilepsyKCNA2membranedepolarizationencephalopathyvoltage-gated K + channel K V 1.2
Journal Article 2020-09-21 ✓ 1 Snippet Pantazis A, Kaneko M, Angelini M, Steccanella F, Westerlund AM, Lindström SH, Nilsson M, Delemotte L, Saitta SC, Olcese R.
In-Text Gene Mentions

ARFGEF2

Show Full Abstract

<h4>Key points</h4>K<sub>V</sub>1.2 channels, encoded by the KCNA2 gene, regulate neuronal excitability by conducting K<sup>+</sup> upon depolarization. A new KCNA2 missense variant was discovered in a patient with epilepsy, causing amino acid substitution F302L at helix S4, in the K<sub>V</sub>1.2 voltage-sensing domain. Immunocytochemistry and flow cytometry showed that F302L does not impair KCNA2 subunit surface trafficking. Molecular dynamics simulations indicated that F302L alters the exposure of S4 residues to membrane lipids. Voltage clamp fluorometry revealed that the voltage-sensing domain of K<sub>V</sub>1.2-F302L channels is more sensitive to depolarization. Accordingly, K<sub>V</sub>1.2-F302L channels opened faster and at more negative potentials; however, they also exhibited enhanced inactivation: that is, F302L causes both gain- and loss-of-function effects. Coexpression of KCNA2-WT and -F302L did not fully rescue these effects. The proband's symptoms are more characteristic of patients with loss of KCNA2 function. Enhanced K<sub>V</sub>1.2 inactivation could lead to increased synaptic release in excitatory neurons, steering neuronal circuits towards epilepsy.<h4>Abstract</h4>An exome-based diagnostic panel in an infant with epilepsy revealed a previously unreported de novo missense variant in KCNA2, which encodes voltage-gated K<sup>+</sup> channel K<sub>V</sub>1.2. This variant causes substitution F302L, in helix S4 of the K<sub>V</sub>1.2 voltage-sensing domain (VSD). F302L does not affect KCNA2 subunit membrane trafficking. However, it does alter channel functional properties, accelerating channel opening at more hyperpolarized membrane potentials, indicating gain of function. F302L also caused loss of K<sub>V</sub>1.2 function via accelerated inactivation onset, decelerated recovery and shifted inactivation voltage dependence to more negative potentials. These effects, which are not fully rescued by coexpression of wild-type and mutant KCNA2 subunits, probably result from the enhancement of VSD function, as demonstrated by optically tracking VSD depolarization-evoked conformational rearrangements. In turn, molecular dynamics simulations suggest altered VSD exposure to membrane lipids. Compared to other encephalopathy patients with KCNA2 mutations, the proband exhibits mild neurological impairment, more characteristic of patients with KCNA2 loss of function. Based on this information, we propose a mechanism of epileptogenesis based on enhanced K<sub>V</sub>1.2 inactivation leading to increased synaptic release preferentially in excitatory neurons, and hence the perturbation of the excitatory/inhibitory balance of neuronal circuits.

Also flagged:hydroxyapatiteosteogenesisangiogenesisvascular endothelial growth factorVEGFcalcium
Journal Article 2020-09-21 No Snippets Piard C, Luthcke R, Kamalitdinov T, Fisher J.
Show Full Abstract

Promoting the growth of blood vessels within engineered tissues remains one of the main challenge in bone tissue engineering. One way to improve angiogenesis is the use of vascular endothelial growth factor (VEGF) as it holds the ability to increase the formation of a vascular network. In the present study, collagen scaffolds with VEGF-releasing hydroxyapatite particles were fabricated, in order to engineer a material both capable of presenting an osteoconductive surface and delivering an angiogenic growth factor in a localized and sustained manner, in order to enhance osteogenesis as well as angiogenesis. To this end, we developed microparticles and characterize their size, chemical properties and Ca/P ratio to validate the formation of hydroxyapatite. We then evaluated the osteogenic potential of HAp when cultured with mesenchymal stem cells and compare it to commercially available hydroxyapatite (SBp). Finally, we characterized the encapsulation and release of VEGF in the HAp and assess the angiogenic potential of the VEGF-HAp when cultured with endothelial cells. We demonstrated the successful fabrication of calcium deficient hydroxyapatite microparticles (CDHAp), with biological properties closer to the bone than stoichiometric, commercially available hydroxyapatite. This CDHAp exhibited a well-defined 3D network of crystalline nanoplates forming mesoporous and hollow structures. The high specific area created by those structures enabled the loading of VEGF with high efficiency when compared to the loading efficiency of SBp. Furthermore, their biological performances were evaluated in vitro. Our results indicate that VEGF-CDHAp can be used to improve both osteogenesis and angiogenesis in vitro.

Also flagged:MethylationageingCHIMPmethylcytosineguanine
Journal Article 2020-09-21 ✓ 1 Snippet Guevara EE, Lawler RR, Staes N, White CM, Sherwood CC, Ely JJ, Hopkins WD, Bradley BJ.
In-Text Gene Mentions

DCC

Show Full Abstract

Methylation levels have been shown to change with age at sites across the human genome. Change at some of these sites is so consistent across individuals that it can be used as an 'epigenetic clock' to predict an individual's chronological age to within a few years. Here, we examined how the pattern of epigenetic ageing in chimpanzees compares with humans. We profiled genome-wide blood methylation levels by microarray for 113 samples from 83 chimpanzees aged 1-58 years (26 chimpanzees were sampled at multiple ages during their lifespan). Many sites (greater than 65 000) showed significant change in methylation with age and around one-third (32%) of these overlap with sites showing significant age-related change in humans. At over 80% of sites showing age-related change in both species, chimpanzees displayed a significantly faster rate of age-related change in methylation than humans. We also built a chimpanzee-specific epigenetic clock that predicted age in our test dataset with a median absolute deviation from known age of only 2.4 years. However, our chimpanzee clock showed little overlap with previously constructed human clocks. Methylation at CpGs comprising our chimpanzee clock showed moderate heritability. Although the use of a human microarray for profiling chimpanzees biases our results towards regions with shared genomic sequence between the species, nevertheless, our results indicate that there is considerable conservation in epigenetic ageing between chimpanzees and humans, but also substantial divergence in both rate and genomic distribution of ageing-associated sites. This article is part of the theme issue 'Evolution of the primate ageing process'.

Also flagged:NTRK1pediatric tumorsmesenchymal tumorssarcomasundifferentiated sarcomaETV6
Journal Article 2020-09-21 ✓ 1 Snippet Kang J, Park JW, Won JK, Bae JM, Koh J, Yim J, Yun H, Kim SK, Choi JY, Kang HJ, Kim WS, Shin JH, Park SH.
In-Text Gene Mentions

…protein 1-like (RABGAP1L) , chromatin target…

Show Full Abstract

<h4>Background</h4>While ETV6- NTRK3 fusion is common in infantile fibrosarcoma, NTRK1/3 fusion in pediatric tumors is scarce and, consequently, not well known. Herein, we evaluated for the presence of NTRK1/3 fusion in pediatric mesenchymal tumors, clinicopathologically and immunophenotypically.<h4>Methods</h4>We reviewed nine NTRK fusion-positive pediatric sarcomas confirmed by fluorescence in situ hybridization and/or next-generation sequencing from Seoul National University Hospital between 2002 and 2020.<h4>Results</h4>One case of TPR-NTRK1 fusion-positive intracranial, extra-axial, high-grade undifferentiated sarcoma (12-year-old boy), one case of LMNA-NTRK1 fusion-positive low-grade infantile fibrosarcoma of the forehead (3-year-old boy), one case of ETV6-NTRK3 fusion-positive inflammatory myofibroblastic tumor (IMT) (3-months-old girl), and six cases of ETV6-NTRK3 fusion-positive infantile fibrosarcoma (median age: 2.6 months, range: 1.6-5.6 months, M: F = 5:1) were reviewed. The Trk immunopositivity patterns were distinct, depending on what fusion genes were present. We observed nuclear positivity in TPR-NTRK1 fusion-positive sarcoma, nuclear membrane positivity in LMNA-NTRK1 fusion-positive sarcoma, and both cytoplasmic and nuclear positivity in ETV6-NTRK3 fusion-positive IMT and infantile fibrosarcomas. Also, the TPR-NTRK1 fusion-positive sarcoma showed robust positivity for CD34/nestin, and also showed high mitotic rate. The LMNA-NTRK1 fusion-positive sarcoma revealed CD34/S100 protein/nestin/CD10 coexpression, and a low mitotic rate. The IMT with ETV6-NTRK3 fusion expressed SMA. Six infantile fibrosarcomas with ETV6-NTRK3 fusion showed variable coexpression of nestin (6/6)/CD10 (4/5)/ S100 protein (3/6).<h4>Conclusions</h4>All cases of NTRK1 and NTRK3 fusion-positive pediatric tumors robustly expressed the Trk protein. A Trk immunopositive pattern and CD34/S100/nestin/CD10/SMA immunohistochemical expression may suggest the presence of NTRK fusion partner genes. LMNA-NTRK1 fusion sarcoma might be a low-grade subtype of infantile fibrosarcoma. Interestingly, more than half of the infantile fibrosarcoma cases were positive for S100 protein and CD10. The follow-up period of TPR-NTRK1 and LMNA-NTRK1 fusion-positive tumors are not enough to predict prognosis. However, ETV6-NTRK3 fusion-positive infantile fibrosarcomas showed an excellent prognosis with no evidence of disease for an average of 11.7 years, after gross total resection of the tumor.

Also flagged:cancerdeoxyribonucleic acidbreast cancerlung cancerchromosomegene expression
Journal Article 2020-09-21 No Snippets Pour AF, Pietrzak M, Sucheston-Campbell LE, Karaesmen E, Dalton LA, Rempała GA.
Show Full Abstract

<h4>Background</h4>Developing binary classification rules based on SNP observations has been a major challenge for many modern bioinformatics applications, e.g., predicting risk of future disease events in complex conditions such as cancer. Small-sample, high-dimensional nature of SNP data, weak effect of each SNP on the outcome, and highly non-linear SNP interactions are several key factors complicating the analysis. Additionally, SNPs take a finite number of values which may be best understood as ordinal or categorical variables, but are treated as continuous ones by many algorithms.<h4>Methods</h4>We use the theory of high dimensional model representation (HDMR) to build appropriate low dimensional glass-box models, allowing us to account for the effects of feature interactions. We compute the second order HDMR expansion of the log-likelihood ratio to account for the effects of single SNPs and their pairwise interactions. We propose a regression based approach, called linear approximation for block second order HDMR expansion of categorical observations (LABS-HDMR-CO), to approximate the HDMR coefficients. We show how HDMR can be used to detect pairwise SNP interactions, and propose the fixed pattern test (FPT) to identify statistically significant pairwise interactions.<h4>Results</h4>We apply LABS-HDMR-CO and FPT to synthetically generated HAPGEN2 data as well as to two GWAS cancer datasets. In these examples LABS-HDMR-CO enjoys superior accuracy compared with several algorithms used for SNP classification, while also taking pairwise interactions into account. FPT declares very few significant interactions in the small sample GWAS datasets when bounding false discovery rate (FDR) by 5%, due to the large number of tests performed. On the other hand, LABS-HDMR-CO utilizes a large number of SNP pairs to improve its prediction accuracy. In the larger HAPGEN2 dataset FTP declares a larger portion of SNP pairs used by LABS-HDMR-CO as significant.<h4>Conclusion</h4>LABS-HDMR-CO and FPT are interesting methods to design prediction rules and detect pairwise feature interactions for SNP data. Reliably detecting pairwise SNP interactions and taking advantage of potential interactions to improve prediction accuracy are two different objectives addressed by these methods. While the large number of potential SNP interactions may result in low power of detection, potentially interacting SNP pairs, of which many might be false alarms, can still be used to improve prediction accuracy.

Also flagged:cancersdeathovarian cancercancertranscription factorsMYC
Journal Article 2020-09-21 ✓ 1 Snippet Zhang T, Zhang L, Li F.
In-Text Gene Mentions

…AKT1S1, FOXA2, PDPK1,HTT, MAP2K6, TNFRSF1A, TNF,…

Show Full Abstract

<h4>Background</h4>Though accounts for 2.5% of all cancers in female, the death rate of ovarian cancer is high, which is the fifth leading cause of cancer death (5% of all cancer death) in female. The 5-year survival rate of ovarian cancer is less than 50%. The oncogenic molecular signaling of ovarian cancer are complicated and remain unclear, and there is a lack of effective targeted therapies for ovarian cancer treatment.<h4>Methods</h4>In this study, we propose to investigate activated signaling pathways of individual ovarian cancer patients and sub-groups; and identify potential targets and drugs that are able to disrupt the activated signaling pathways. Specifically, we first identify the up-regulated genes of individual cancer patients using Markov chain Monte Carlo (MCMC), and then identify the potential activated transcription factors. After dividing ovarian cancer patients into several sub-groups sharing common transcription factors using K-modes method, we uncover the up-stream signaling pathways of activated transcription factors in each sub-group. Finally, we mapped all FDA approved drugs targeting on the upstream signaling.<h4>Results</h4>The 427 ovarian cancer samples were divided into 3 sub-groups (with 100, 172, 155 samples respectively) based on the activated TFs (with 14, 25, 26 activated TFs respectively). Multiple up-stream signaling pathways, e.g., MYC, WNT, PDGFRA (RTK), PI3K, AKT TP53, and MTOR, are uncovered to activate the discovered TFs. In addition, 66 FDA approved drugs were identified targeting on the uncovered core signaling pathways. Forty-four drugs had been reported in ovarian cancer related reports. The signaling diversity and heterogeneity can be potential therapeutic targets for drug combination discovery.<h4>Conclusions</h4>The proposed integrative network analysis could uncover potential core signaling pathways, targets and drugs for ovarian cancer treatment.

Also flagged:TNF-α-induced protein 3TNFAIP3anti-inflammatory proteinimmune responsesdeathautoimmune diseases
Journal Article 2020-09-21 No Snippets Wu Y, He X, Huang N, Yu J, Shao B.
Show Full Abstract

A20, also known as TNF-α-induced protein 3 (TNFAIP3), is an anti-inflammatory protein that plays an important part in both immune responses and cell death. Impaired A20 function is associated with several human inflammatory and autoimmune diseases. Although the role of A20 in mediating inflammation has been frequently discussed, its intrinsic link to arthritis awaits further explanation. Here, we review new findings that further demonstrate the molecular mechanisms through which A20 regulates inflammatory arthritis, and we discuss the regulation of A20 by many factors. We conclude by reviewing the latest A20-associated mouse models that have been applied in related research because they reflect the characteristics of arthritis, the study of which will hopefully cast new light on anti-arthritis treatments.

Also flagged:cancerdecitabinedemethylationtumorretrovirusesinterferon
Journal Article 2020-09-21 ✓ 1 Snippet Takeshima H, Yoda Y, Wakabayashi M, Hattori N, Yamashita S, Ushijima T.
In-Text Gene Mentions

…of SFRP1 ,DCC, and ZNF229…

Show Full Abstract

<h4>Background</h4>Epigenetic reprogramming using DNA demethylating drugs is a promising approach for cancer therapy, but its efficacy is highly dependent on the dosing regimen. Low-dose treatment for a prolonged period shows a remarkable therapeutic efficacy, despite its small demethylating effect. Here, we aimed to explore the mechanisms of how such low-dose treatment shows this remarkable efficacy by focusing on epigenetic reprograming at the single-cell level.<h4>Methods</h4>Expression profiles in HCT116 cells treated with decitabine (DAC) were analyzed by single-cell RNA-sequencing (scRNA-seq). Functional consequences and DNA demethylation at the single-cell level were analyzed using cloned HCT116 cells after DAC treatment.<h4>Results</h4>scRNA-seq revealed that DAC-treated cells had highly diverse expression profiles at the single-cell level, and tumor-suppressor genes, endogenous retroviruses, and interferon-stimulated genes were upregulated in random fractions of cells. DNA methylation analysis of cloned HCT116 cells revealed that, while only partial reduction of DNA methylation levels was observed in bulk cells, complete demethylation of specific cancer-related genes, such as cell cycle regulation, WNT pathway, p53 pathway, and TGF-β pathway, was observed, depending upon clones. Functionally, a clone with complete demethylation of CDKN2A (p16) had a larger fraction of cells with tetraploid than parental cells, indicating induction of cellular senescence due to normalization of cell cycle regulation.<h4>Conclusions</h4>Epigenetic reprogramming of specific cancer-related pathways at the single-cell level is likely to underlie the remarkable efficacy of low-dose DNA demethylating therapy.

Also flagged:PRAMzipnucleotidesPik3cgchromosomeChromosomes
Journal Article 2020-09-21 No Snippets Liu P, Soukup AA, Bresnick EH, Dewey CN, Keleş S.
Show Full Abstract

Publicly available RNA-seq data is routinely used for retrospective analysis to elucidate new biology. Novel transcript discovery enabled by joint analysis of large collections of RNA-seq data sets has emerged as one such analysis. Current methods for transcript discovery rely on a '2-Step' approach where the first step encompasses building transcripts from individual data sets, followed by the second step that merges predicted transcripts across data sets. To increase the power of transcript discovery from large collections of RNA-seq data sets, we developed a novel '1-Step' approach named Pooling RNA-seq and Assembling Models (PRAM) that builds transcript models from pooled RNA-seq data sets. We demonstrate in a computational benchmark that 1-Step outperforms 2-Step approaches in predicting overall transcript structures and individual splice junctions, while performing competitively in detecting exonic nucleotides. Applying PRAM to 30 human ENCODE RNA-seq data sets identified unannotated transcripts with epigenetic and RAMPAGE signatures similar to those of recently annotated transcripts. In a case study, we discovered and experimentally validated new transcripts through the application of PRAM to mouse hematopoietic RNA-seq data sets. We uncovered new transcripts that share a differential expression pattern with a neighboring gene <i>Pik3cg</i> implicated in human hematopoietic phenotypes, and we provided evidence for the conservation of this relationship in human. PRAM is implemented as an R/Bioconductor package.

Also flagged:MAFBcleft palateLNPMNPgene expressionBA1
Journal Article 2020-09-21 No Snippets Samuels BD, Aho R, Brinkley JF, Bugacov A, Feingold E, Fisher S, Gonzalez-Reiche AS, Hacia JG, Hallgrimsson B, Hansen K, Harris MP, Ho TV, Holmes G, Hooper JE, Jabs EW, Jones KL, Kesselman C, Klein OD, Leslie EJ, Li H, Liao EC, Long H, Lu N, Maas RL, Marazita ML, Mohammed J, Prescott S, Schuler R, Selleri L, Spritz RA, Swigut T, van Bakel H, Visel A, Welsh I, Williams C, Williams TJ, Wysocka J, Yuan Y, Chai Y.
Show Full Abstract

The FaceBase Consortium was established by the National Institute of Dental and Craniofacial Research in 2009 as a 'big data' resource for the craniofacial research community. Over the past decade, researchers have deposited hundreds of annotated and curated datasets on both normal and disordered craniofacial development in FaceBase, all freely available to the research community on the FaceBase Hub website. The Hub has developed numerous visualization and analysis tools designed to promote integration of multidisciplinary data while remaining dedicated to the FAIR principles of data management (findability, accessibility, interoperability and reusability) and providing a faceted search infrastructure for locating desired data efficiently. Summaries of the datasets generated by the FaceBase projects from 2014 to 2019 are provided here. FaceBase 3 now welcomes contributions of data on craniofacial and dental development in humans, model organisms and cell lines. Collectively, the FaceBase Consortium, along with other NIH-supported data resources, provide a continuously growing, dynamic and current resource for the scientific community while improving data reproducibility and fulfilling data sharing requirements.

Also flagged:Pex3pexophagyperoxisomesmacroautophagyautophagycytoplasmic
Journal Article 2020-09-21 No Snippets Meguro S, Zhuang X, Kirisako H, Nakatogawa H.
Show Full Abstract

In macroautophagy (hereafter autophagy), cytoplasmic molecules and organelles are randomly or selectively sequestered within double-membrane vesicles called autophagosomes and delivered to lysosomes or vacuoles for degradation. In selective autophagy, the specificity of degradation targets is determined by autophagy receptors. In the budding yeast <i>Saccharomyces cerevisiae</i>, autophagy receptors interact with specific targets and Atg11, resulting in the recruitment of a protein complex that initiates autophagosome formation. Previous studies have revealed that autophagy receptors are regulated by posttranslational modifications. In selective autophagy of peroxisomes (pexophagy), the receptor Atg36 localizes to peroxisomes by binding to the peroxisomal membrane protein Pex3. We previously reported that Atg36 is phosphorylated by Hrr25 (casein kinase 1δ), increasing the Atg36-Atg11 interaction and thereby stimulating pexophagy initiation. However, the regulatory mechanisms underlying Atg36 phosphorylation are unknown. Here, we show that Atg36 phosphorylation is abolished in cells lacking Pex3 or expressing a Pex3 mutant defective in the interaction with Atg36, suggesting that the interaction with Pex3 is essential for the Hrr25-mediated phosphorylation of Atg36. Using recombinant proteins, we further demonstrated that Pex3 directly promotes Atg36 phosphorylation by Hrr25. A co-immunoprecipitation analysis revealed that the interaction of Atg36 with Hrr25 depends on Pex3. These results suggest that Pex3 increases the Atg36-Hrr25 interaction and thereby stimulates Atg36 phosphorylation on the peroxisomal membrane. In addition, we found that Pex3 binding protects Atg36 from proteasomal degradation. Thus, Pex3 confines Atg36 activity to the peroxisome by enhancing its phosphorylation and stability on this organelle.

Also flagged:Endoplasmic reticulumchaperonesMR1MHC class I-related protein 1bindingCas9
Journal Article 2020-09-21 ✓ 1 Snippet McWilliam HEG, Mak JYW, Awad W, Zorkau M, Cruz-Gomez S, Lim HJ, Yan Y, Wormald S, Dagley LF, Eckle SBG, Corbett AJ, Liu H, Li S, Reddiex SJJ, Mintern JD, Liu L, McCluskey J, Rossjohn J, Fairlie DP, Villadangos JA.
In-Text Gene Mentions

HFE

Show Full Abstract

The antigen-presenting molecule MR1 (MHC class I-related protein 1) presents metabolite antigens derived from microbial vitamin B<sub>2</sub> synthesis to activate mucosal-associated invariant T (MAIT) cells. Key aspects of this evolutionarily conserved pathway remain uncharacterized, including where MR1 acquires ligands and what accessory proteins assist ligand binding. We answer these questions by using a fluorophore-labeled stable MR1 antigen analog, a conformation-specific MR1 mAb, proteomic analysis, and a genome-wide CRISPR/Cas9 library screen. We show that the endoplasmic reticulum (ER) contains a pool of two unliganded MR1 conformers stabilized via interactions with chaperones tapasin and tapasin-related protein. This pool is the primary source of MR1 molecules for the presentation of exogenous metabolite antigens to MAIT cells. Deletion of these chaperones reduces the ER-resident MR1 pool and hampers antigen presentation and MAIT cell activation. The MR1 antigen-presentation pathway thus co-opts ER chaperones to fulfill its unique ability to present exogenous metabolite antigens captured within the ER.

Also flagged:Chromosomechromatinnucleosomedinucleosomeshistonebinding
Journal Article 2020-09-21 ✓ 2 Snippets Adhireksan Z, Sharma D, Lee PL, Davey CA.
In-Text Gene Mentions

…chitectural factors, includinglinker histoneshistones, which are…

…the core histones,linker histoneshistones, DNA and…

Show Full Abstract

Chromosome structure at the multi-nucleosomal level has remained ambiguous in spite of its central role in epigenetic regulation and genome dynamics. Recent investigations of chromatin architecture portray diverse modes of interaction within and between nucleosome chains, but how this is realized at the atomic level is unclear. Here we present near-atomic resolution crystal structures of nucleosome fibres that assemble from cohesive-ended dinucleosomes with and without linker histone. As opposed to adopting folded helical '30 nm' structures, the fibres instead assume open zigzag conformations that are interdigitated with one another. Zigzag conformations obviate extreme bending of the linker DNA, while linker DNA size (nucleosome repeat length) dictates fibre configuration and thus fibre-fibre packing, which is supported by variable linker histone binding. This suggests that nucleosome chains have a predisposition to interdigitate with specific characteristics under condensing conditions, which rationalizes observations of local chromosome architecture and the general heterogeneity of chromatin structure.

Also flagged:Lgr5-EGFPcDNA3-phosphate16S rRNA V416S rRNAV9
Journal Article 2020-09-21 ✓ 1 Snippet Chakravarti D, Hu B, Mao X, Rashid A, Li J, Li J, Liao WT, Whitley EM, Dey P, Hou P, LaBella KA, Chang A, Wang G, Spring DJ, Deng P, Zhao D, Liang X, Lan Z, Lin Y, Sarkar S, Terranova C, Deribe YL, Blutt SE, Okhuysen P, Zhang J, Vilar E, Nielsen OH, Dupont A, Younes M, Patel KR, Shroyer NF, Rai K, Estes MK, Wang YA, Bertuch AA, DePinho RA.
In-Text Gene Mentions

…(e.g., LSL-mTert xOlfm4-IRES-eGFPCreERT2 or Villin-Cr…

Show Full Abstract

Germline telomere maintenance defects are associated with an increased incidence of inflammatory diseases in humans, yet whether and how telomere dysfunction causes inflammation are not known. Here, we show that telomere dysfunction drives pATM/c-ABL-mediated activation of the YAP1 transcription factor, up-regulating the major pro-inflammatory factor, pro-IL-18. The colonic microbiome stimulates cytosolic receptors activating caspase-1 which cleaves pro-IL-18 into mature IL-18, leading to recruitment of interferon (IFN)-γ-secreting T cells and intestinal inflammation. Correspondingly, patients with germline telomere maintenance defects exhibit DNA damage (γH2AX) signaling together with elevated YAP1 and IL-18 expression. In mice with telomere dysfunction, telomerase reactivation in the intestinal epithelium or pharmacological inhibition of ATM, YAP1, or caspase-1 as well as antibiotic treatment, dramatically reduces IL-18 and intestinal inflammation. Thus, telomere dysfunction-induced activation of the ATM-YAP1-pro-IL-18 pathway in epithelium is a key instigator of tissue inflammation.

Also flagged:retinopathy of prematuritytype 1 ROPVEGFretinopathyMyopiablindness
Journal Article 2020-09-21 ✓ 1 Snippet Balasubramanian H, Sindhur M, Doshi A, Srinivasan L, Kabra NS, Malpani A, Agashe P.
In-Text Gene Mentions

Type 1 retinopathy

Show Full Abstract

<h4>Aim</h4>To determine predictors of rescue treatment among infants treated for retinopathy of prematurity and to evaluate their ocular outcomes at 18-24 months of corrected age.<h4>Methods</h4>This is a single centre retrospective study of infants who received treatment for type 1 ROP, using laser photocoagulation or anti VEGF agents. Multivariable logistic regression was used to generate a prediction model for rescue treatment of ROP. The primary outcome was an abnormal refractive outcome by 24 months of corrected age, among infants primarily treated with laser therapy.<h4>Results</h4>Two hundred and eight infants (including 416 eyes) who received single (n = 151) or rescue (multiple) treatments (n = 57) were included. Ninety three percent of the infants were primarily treated with laser photocoagulation. Lower gestational age, small for gestational age, early packed red blood cell transfusion (within 2 weeks of postnatal age), and presence of Zone 1 retinopathy predicted the need for rescue treatment in treated infants [area under the receiver operating characteristic curve: 0.81 (0.73-0.89)]. The incidence of abnormal refractive outcome, assessed in a total of 174 infants, was found to be significantly higher in the rescue treatment group (67% versus 21%, adjusted odds ratio: 7.56 (3.3-17.2), P < 0.001). Myopia, very high myopia and use of spectacles was significantly higher in the rescue treatment group (P < 0.001 for each).<h4>Conclusions</h4>Rescue treatment for ROP was associated with an increased incidence of refractive errors and requirement of spectacles by 2 years of age. Larger prospective multicentre studies are required to confirm the findings from our study.

Also flagged:EtamycinclarithromycininfectionM. abscessus infectionswateraging
Journal Article 2020-09-21 ✓ 1 Snippet Hanh BTB, Kim TH, Park JW, Lee DG, Kim JS, Du YE, Yang CS, Oh DC, Jang J.
In-Text Gene Mentions

…six week-old femaleC57BL/six micemice (Orient Bio,…

Show Full Abstract

The increase in drug-resistant <i>Mycobacterium abscessus</i>, which has become resistant to existing standard-of-care agents, is a major concern, and new antibacterial agents are strongly needed. In this study, we introduced etamycin that showed an excellent activity against <i>M. abscessus</i>. We found that etamycin significantly inhibited the growth of <i>M. abscessus</i> wild-type strain, three subspecies, and clinical isolates in vitro and inhibited the growth of <i>M. abscessus</i> that resides in macrophages without cytotoxicity. Furthermore, the in vivo efficacy of etamycin in the zebrafish (<i>Danio rerio</i>) infection model was greater than that of clarithromycin, which is recommended as the core agent for treating <i>M. abscessus</i> infections. Thus, we concluded that etamycin is a potential anti-<i>M. abscessus</i> candidate for further development as a clinical drug candidate.

Also flagged:Chromatinfungal infectionstransposasegene expressionCap1binding
Journal Article 2020-09-21 No Snippets Jenull S, Tscherner M, Mair T, Kuchler K.
Show Full Abstract

Human fungal pathogens often encounter fungicidal stress upon host invasion, but they can swiftly adapt by transcriptional reprogramming that enables pathogen survival. Fungal immune evasion is tightly connected to chromatin regulation. Hence, fungal chromatin modifiers pose alternative treatment options to combat fungal infections. Here, we present an assay for transposase-accessible chromatin using sequencing (ATAC-seq) protocol adapted for the opportunistic pathogen <i>Candida albicans</i> to gain further insight into the interplay of chromatin accessibility and gene expression mounted during fungal adaptation to oxidative stress. The ATAC-seq workflow not only facilitates the robust detection of genomic regions with accessible chromatin but also allows for the precise modeling of nucleosome positions in <i>C. albicans</i>. Importantly, the data reveal genes with altered chromatin accessibility in upstream regulatory regions, which correlate with transcriptional regulation during oxidative stress. Interestingly, many genes show increased chromatin accessibility without change in gene expression upon stress exposure. Such chromatin signatures could predict yet unknown regulatory factors under highly dynamic transcriptional control. Additionally, de novo motif analysis in genomic regions with increased chromatin accessibility upon H<sub>2</sub>O<sub>2</sub> treatment shows significant enrichment for Cap1 binding sites, a major factor of oxidative stress responses in <i>C. albicans</i>. Taken together, the ATAC-seq workflow enables the identification of chromatin signatures and highlights the dynamics of regulatory mechanisms mediating environmental adaptation of <i>C. albicans</i>.

Also flagged:neurodegenerative disorderglutamineHuntingtonDiseaseHuntingtinBinding
Journal Article 2020-09-21 ✓ 1 Snippet Hervás R, Murzin AG, Si K.
In-Text Gene Mentions

The connection between HD and the expansion of the glutamine tract in the huntingtin (HTT) gene, which codes for the multidomain and multifunctional HTT protein [3,4], was identified in the early 1990s [5].

Show Full Abstract

Huntington's disease is a progressive, autosomal dominant, neurodegenerative disorder caused by an expanded CAG repeat in the huntingtin gene. As a result, the translated protein, huntingtin, contains an abnormally long polyglutamine stretch that makes it prone to misfold and aggregating. Aggregation of huntingtin is believed to be the cause of Huntington's disease. However, understanding on how, and why, huntingtin aggregates are deleterious has been hampered by lack of enough relevant structural data. In this review, we discuss our recent findings on a glutamine-based functional amyloid isolated from <i>Drosophila</i> brain and how this information provides plausible structural insight on the structure of huntingtin deposits in the brain.

Also flagged:transcription factorsCYP450tissue remodelingopioid receptorOPRM1Opioid Receptor Mu 1
Journal Article 2020-09-21 ✓ 5 Snippets Suntsov V, Jovanovic F, Knezevic E, Candido KD, Knezevic NN.
In-Text Gene Mentions

Another significant CBP-associated gene variant is the lead SNP rs4384683, an intronic variant in the gene DCC (deleted in colorectal carcinoma) [21].

3.1.3. DCC (Deleted in Colorectal Carcinoma)

DCC(Deleted in Colorectal…

…in the geneDCC(deleted in colorectal…

DCCencodes the protein…

Show Full Abstract

Etiology of back pain is multifactorial and not completely understood, and for the majority of people who suffer from chronic low back pain (cLBP), the precise cause cannot be determined. We know that back pain is somewhat heritable, chronic pain more so than acute. The aim of this review is to compile the genes identified by numerous genetic association studies of chronic pain conditions, focusing on cLBP specifically. Higher-order neurologic processes involved in pain maintenance and generation may explain genetic contributions and functional predisposition to formation of cLBP that does not involve spine pathology. Several genes have been identified in genetic association studies of cLBP and roughly, these genes could be grouped into several categories, coding for: receptors, enzymes, cytokines and related molecules, and transcription factors. Treatment of cLBP should be multimodal. In this review, we discuss how an individual's genotype could affect their response to therapy, as well as how genetic polymorphisms in CYP450 and other enzymes are crucial for affecting the metabolic profile of drugs used for the treatment of cLBP. Implementation of gene-focused pharmacotherapy has the potential to deliver select, more efficacious drugs and avoid unnecessary, polypharmacy-related adverse events in many painful conditions, including cLBP.

Also flagged:Boronic AcidsBoronbortezomibboronic acidSynthesisboric acid
Journal Article 2020-09-21 No Snippets Silva MP, Saraiva L, Pinto M, Sousa ME.
Show Full Abstract

Boron containing compounds have not been widely studied in Medicinal Chemistry, mainly due to the idea that this group could confer some toxicity. Nowadays, this concept has been demystified and, especially after the discovery of the drug bortezomib, the interest for these compounds, mainly boronic acids, has been growing. In this review, several activities of boronic acids, such as anticancer, antibacterial, antiviral activity, and even their application as sensors and delivery systems are addressed. The synthetic processes used to obtain these active compounds are also referred. Noteworthy, the molecular modification by the introduction of boronic acid group to bioactive molecules has shown to modify selectivity, physicochemical, and pharmacokinetic characteristics, with the improvement of the already existing activities. Besides, the preparation of compounds with this chemical group is relatively simple and well known. Taking into consideration these findings, this review reinforces the relevance of extending the studies with boronic acids in Medicinal Chemistry, in order to obtain new promising drugs shortly.

Also flagged:AT-rich Interactive Domain 1Atumorpancreatic ductal adenocarcinomasPDACpathogenesisCas9
Journal Article 2020-09-21 ✓ 1 Snippet Ferri-Borgogno S, Barui S, McGee AM, Griffiths T, Singh PK, Piett CG, Ghosh B, Bhattacharyya S, Singhi A, Pradhan K, Verma A, Nagel Z, Maitra A, Gupta S.
In-Text Gene Mentions

…RUNX3 (25 sites),SOX6(14 sites), FOXA1…

Show Full Abstract

<i>Background & Aims</i>: ARID1A is postulated to be a tumor suppressor gene owing to loss-of-function mutations in human pancreatic ductal adenocarcinomas (PDAC). However, its role in pancreatic pathogenesis is not clear despite recent studies using genetically engineered mouse (GEM) models. We aimed at further understanding of its direct functional role in PDAC, using a combination of GEM model and PDAC cell lines. <i>Methods</i>: Pancreas-specific mutant <i>Arid1a</i>-driven GEM model (<i>Ptf1a</i>-Cre; <i>Kras<sup>G12D</sup></i>; <i>Arid1a</i><sup>f/f</sup> or "KAC") was generated by crossing <i>Ptf1a</i>-Cre; <i>Kras<sup>G12D</sup></i> ("KC") mice with <i>Arid1a</i><sup>f/f</sup> mice and characterized histologically with timed necropsies. <i>Arid1a</i> was also deleted using CRISPR-Cas9 system in established human and murine PDAC cell lines to study the immediate effects of Arid1a loss in isogenic models. Cell lines with or without Arid1a expression were developed from respective autochthonous PDAC GEM models, compared functionally using various culture assays, and subjected to RNA-sequencing for comparative gene expression analysis. DNA damage repair was analyzed in cultured cells using immunofluorescence and COMET assay. <i>Results</i>: Retention of Arid1a is critical for early progression of mutant <i>Kras</i>-driven pre-malignant lesions into PDAC, as evident by lower Ki-67 and higher apoptosis staining in "KAC" as compared to "KC" mice. Enforced deletion of <i>Arid1a</i> in established PDAC cell lines caused suppression of cellular growth and migration, accompanied by compromised DNA damage repair. Despite early development of relatively indolent cystic precursor lesions called intraductal papillary mucinous neoplasms (IPMNs), a subset of "KAC" mice developed aggressive PDAC in later ages. PDAC cells obtained from older autochthonous "KAC" mice revealed various compensatory ("escaper") mechanisms to overcome the growth suppressive effects of Arid1a loss. <i>Conclusions</i>: Arid1a is an essential survival gene whose loss impairs cellular growth, and thus, its expression is critical during early stages of pancreatic tumorigenesis in mouse models. In tumors that arise in the setting of ARID1A loss, a multitude of "escaper" mechanisms drive progression.

Also flagged:RNA-Binding ProteinsCancergene expressionlocalizationoncogenestumor
Journal Article 2020-09-21 ✓ 1 Snippet Kang D, Lee Y, Lee JS.
In-Text Gene Mentions

In lung cancer, cervical cancer, prostate cancer, gastric cancer, and mesothelioma miR-18a downregulates target mRNAs, such as IRF2, PTEN, WNK2, SOX6, STK4, and PIAS3, to induce cancer progression and development.

Show Full Abstract

RNA-binding proteins (RBPs) crucially regulate gene expression through post-transcriptional regulation, such as by modulating microRNA (miRNA) processing and the alternative splicing, alternative polyadenylation, subcellular localization, stability, and translation of RNAs. More than 1500 RBPs have been identified to date, and many of them are known to be deregulated in cancer. Alterations in the expression and localization of RBPs can influence the expression levels of oncogenes, tumor-suppressor genes, and genome stability-related genes. RBP-mediated gene regulation can lead to diverse cancer-related cellular phenotypes, such as proliferation, apoptosis, angiogenesis, senescence, and epithelial-mesenchymal transition (EMT)/invasion/metastasis. This regulation can also be associated with cancer prognosis. Thus, RBPs can be potential targets for the development of therapeutics for the cancer treatment. In this review, we describe the molecular functions of RBPs, their roles in cancer-related cellular phenotypes, and various approaches that may be used to target RBPs for cancer treatment.

Also flagged:autoantibodyautoimmune diseasesautoimmune disorderscytoplasmicsaltautoantibodies
Journal Article 2020-09-21 No Snippets Wang JY, Zhang W, Rho JH, Roehrl MW, Roehrl MH.
Show Full Abstract

<h4>Background</h4>Autoantibodies are a hallmark of autoimmune diseases. Autoantibody screening by indirect immunofluorescence staining of HEp-2 cells with patient sera is a current standard in clinical practice. Differential diagnosis of autoimmune disorders is based on commonly recognizable nuclear and cytoplasmic staining patterns. In this study, we attempted to identify as many autoantigens as possible from HEp-2 cells using a unique proteomic DS-affinity enrichment strategy.<h4>Methods</h4>HEp-2 cells were cultured and lysed. Total proteins were extracted from cell lysate and fractionated with DS-Sepharose resins. Proteins were eluted with salt gradients, and fractions with low to high affinity were collected and sequenced by mass spectrometry. Literature text mining was conducted to verify the autoantigenicity of each protein. Protein interaction network and pathway analyses were performed on all identified proteins.<h4>Results</h4>This study identified 107 proteins from fractions with low to high DS-affinity. Of these, 78 are verified autoantigens with previous reports as targets of autoantibodies, whereas 29 might be potential autoantigens yet to be verified. Among the 107 proteins, 82 can be located to nucleus and 15 to the mitotic cell cycle, which may correspond to the dominance of nuclear and mitotic staining patterns in HEp-2 test. There are 55 vesicle-associated proteins and 12 ribonucleoprotein granule proteins, which may contribute to the diverse speckled patterns in HEp-2 stains. There are also 32 proteins related to the cytoskeleton. Protein network analysis indicates that these proteins have significantly more interactions among themselves than would be expected of a random set, with the top 3 networks being mRNA metabolic process regulation, apoptosis, and DNA conformation change.<h4>Conclusions</h4>This study provides a proteomic repertoire of confirmed and potential autoantigens for future studies, and the findings are consistent with a mechanism for autoantigenicity: how self-molecules may form molecular complexes with DS to elicit autoimmunity. Our data contribute to the molecular etiology of autoimmunity and may deepen our understanding of autoimmune diseases.

Also flagged:Synthesis1,4-benzothiazinonesacylpyruvic acidsenaminonesfuran-2,3-dioneso -aminothiophenol
Journal Article 2020-09-21 No Snippets Stepanova EE, Dmitriev MV, Maslivets AN.
Show Full Abstract

Two synthetic approaches to enaminones fused to 1,4-benzothiazin-2-one moiety, which can be interesting in studies on biological activity, chemosensors, and fluorescence, were developed via the reaction of furan-2,3-diones or acylpyruvic acids in the presence of carbodiimides with <i>o</i>-aminothiophenols. The target enaminones were formed together with pharmaceutically interesting 2-hydroxy-2<i>H</i>-1,4-benzothiazin-3(4<i>H</i>)-ones. A selective synthetic approach to 2-hydroxy-2<i>H</i>-1,4-benzothiazin-3(4<i>H</i>)-ones was developed via the solvent-switchable reaction of furan-2,3-diones with <i>o</i>-aminothiophenol. Preliminary biological assays (antimicrobial, acute toxicity) of the new compounds were carried out.

Also flagged:liver tumorTP53INP1hepatocellular carcinomahepatomasorafenibliver cancer
Journal Article 2020-09-21 ✓ 4 Snippets Huang Y, Zhang J, Li H, Peng H, Gu M, Wang H.
In-Text Gene Mentions

It was reported that miR-96 targeted the 3ʹ-UTR of SOX6, FOXO1 and FOXO3a in hepatoma cells (18, 19).

…the 3ʹ-UTR ofSOX6, FOXO1 and FOXO3a…

…we doubted whetherSOX6, FOXO1 and FOXO3a…

…data found thatSOX6, FOXO1 and FOXO3a…

Show Full Abstract

Liver tumor-initiating cells (T-ICs) contribute to tumorigenesis, progression, recurrence and drug resistance of hepatocellular carcinoma (HCC). However, the underlying mechanism for the propagation of liver T-ICs remains unclear. In the present study, our finding shows that miR-96 is upregulated in liver T-ICs. Functional studies revealed that forced miR-96 promotes liver T-ICs self-renewal and tumorigenesis. Conversely, knockdown miR-96 inhibits liver T-ICs self-renewal and tumorigenesis. Mechanistically, miR-96 downregulates TP53INP1 via its mRNA 3'UTR in liver T-ICs. Furthermore, the miR-96 expression determines the responses of hepatoma cells to sorafenib treatment. Analysis of patient cohorts and patient-derived xenografts (PDXs) further demonstrate that the miR-96 may predict sorafenib benefits in HCC patients. Our findings revealed the crucial role of the miR-96 in liver T-ICs expansion and sorafenib response, rendering miR-96 as an optimal target for the prevention and intervention of HCC.

Also flagged:polycystic kidney diseaseschronic kidney diseaseregulation ofgene expressionpathogenesisautosomal dominant polycystic disease
Journal Article 2020-09-21 No Snippets Li D, Sun L.
Show Full Abstract

Important advances have been made regarding the diagnosis and management of polycystic kidney diseases. Care of patients with polycystic kidney diseases has moved beyond supportive care for complications and chronic kidney disease to new potentially disease-modifying therapies. Recently, the role of noncoding RNAs, in particular microRNAs, has been described in polycystic kidney diseases. microRNAs are involved in the regulation of gene expression, in which <i>PKD1</i>, <i>PKD2</i>, and other genes that contribute to the pathogenesis of polycystic kidney diseases are considerable participants. Seminal studies have highlighted the potential importance of microRNAs as new therapeutic targets and innovative diagnostic and/or prognostic biomarkers. Furthermore, an anti-miR-17 drug has advanced through preclinical autosomal dominant polycystic disease studies, and an anti-miR-21 drug has already cleared a phase 1 clinical trial. Most probably, new drugs in the microRNA research field will be yielded as a result of ongoing and planned therapeutic trials. To provide a foundation for understanding microRNA functions as a disease-modifying therapeutic drug in novel targeted therapies, in this narrative review we present an overview of the current knowledge of microRNAs in the pathogenesis of polycystic kidney diseases.

Also flagged:amitriptylinenickeltitaniumbone formationbone resorptionsecretion
Journal Article 2020-09-21 ✓ 2 Snippets Ahmad Akhoundi MS, Shaygan-Mehr M, Keshvad MA, Etemad Moghaddam S, Alaeddini M, Dehpour A, Mirhashemi AH.
In-Text Gene Mentions

It suppresses the production and secretion of nitric oxide and prostaglandin E2 by 16‒27%, and acts as an anti-inflammatory agent, leading to inhibitory effects on the bone remodeling process.13 On the other hand, similar to selective serotonin reuptake inhibitors (SSRIs), amitriptyline is known to block the serotonin transporter gene (5-HTT), balance the transmission of noradrenaline, and inhibit serotonin and noradrenaline reuptake, which can cause bone resorption and osteoporosis as shown by Calarge et al.2,14 Therefore, amitriptyline might exert a dual effect on the rate of OTM.

…serotonin transporter gene (5-HTT), balance the transmission…

Show Full Abstract

<b>Background.</b> Orthodontic tooth movement (OTM) occurs in the alveolar bone; therefore, any condition affecting bone quality can alter OTM. This study aimed to evaluate the effect of amitriptyline on OTM in rats. <b>Methods.</b> Forty-five male Wistar rats were randomly divided into three groups: (I) no injection, (II) injection with saline solution, and (III) injection of amitriptyline. Next, a 60-gr force was applied to the maxillary left first molar tooth of all the rats, using a nickel‒titanium closed-coil spring ligated between the maxillary incisors and the left first molar tooth. The rats were sacrificed after 21 days to measure OTM and perform histological analysis to determine the number, width, and depth of resorptive lacunae, osteoclast counts, and periodontal ligament (PDL) width. <b>Results.</b> The highest and the lowest OTM rates were found in the control and amitriptyline groups, respectively; however, there was no significant difference between the study groups in this regard. Histological analysis showed a significantly lower number of resorption lacunae in the amitriptyline group than the saline group. <b>Conclusion.</b> Although no significant difference was noted in OTM after amitriptyline administration, a reduction in the number of resorptive lacunae in rats injected with amitriptyline suggests that amitriptyline affects the bone tissue at the cellular level.

Also flagged:alcoholnon-alcoholic fatty livernon-alcoholic steatohepatitisNASHNAFLDALT
Journal Article 2020-09-21 ✓ 1 Snippet Degertekin B, Tozun N, Soylemez AG, Gurtay E, Bozkurt U, Yilmaz Y, Yapali S, Vardareli E, Unal HU, Colakoglu B, Alpaydin CB.
In-Text Gene Mentions

…cholestatic liver disease,hemochromatosis, drug-induced liver disease…

Show Full Abstract

<h4>Background and aim</h4>This study aims to investigate the effects of chronic coffee consumption (>5 years) and type of coffee in non-alcoholic steatohepatitis (NASH), non-alcoholic fatty liver (NAFLD) and patients who have regular alcohol consumption.<h4>Materials and methods</h4>In this study, 158 healthy individuals and 101 patients with histologically proven NASH were enrolled. The daily amount of coffee intake, amount of alcohol use and type of coffee were calculated for all patients. The degree of steatosis and fibrosis was analyzed by transient elastography and liver ultrasound in non-NASH and by liver biopsy in NASH patients.<h4>Results</h4>Patients with a history of coffee consumption (n=132) had lower liver enzyme levels compared to the non-coffee group (n=127) (p=0.001). Serum ALT level was significantly lower [ALT: 21.2±11.7 U/L vs. 56.4±15.6 U/L (p=0.004)], and the liver histopathology was significantly better for patients with a coffee consumption of daily for >5years (p=0.045 for fibrosis score for NASH, p=0.036 for LSM and p=0.015 for CAP measurements for the non-NASH patient).<h4>Conclusion</h4>Coffee seems to have a positive protective effect on liver histology and liver enzyme levels in healthy individuals, in patients with chronic alcohol consumption, NAFLD and NASH. These results are more prominent in patients who drink coffee on a regular daily base for more than five years.

bioRxiv 2020-09-21 Preprint (No Snippets API) Dolan ME, Hill DP, Mukherjee G, McAndrews MS, Chesler EJ, Blake JA.
Show Full Abstract

The emergence of the SARS-CoV-2 virus and subsequent COVID-19 pandemic initiated intense research into the mechanisms of action for this virus. It was quickly noted that COVID-19 presents more seriously in conjunction with other human disease conditions such as hypertension, diabetes, and lung diseases. We conducted a bioinformatics analysis of COVID-19 comorbidity-associated gene sets, identifying genes and pathways shared among the comorbidities, and evaluated current knowledge about these genes and pathways as related to current information about SARS-CoV-2 infection. We performed our analysis using GeneWeaver (GW), Reactome, and several biomedical ontologies to represent and compare common COVID-19 comorbidities. Phenotypic analysis of shared genes revealed significant enrichment for immune system phenotypes and for cardiovascular-related phenotypes, which might point to alleles and phenotypes in mouse models that could be evaluated for clues to COVID-19 severity. Through pathway analysis, we identified enriched pathways shared by comorbidity datasets and datasets associated with SARS-CoV-2 infection.

Also flagged:kidney renal clear cell carcinomatumourmethylationneoplasmcalciumdecitabine
Journal Article 2020-09-20 ✓ 2 Snippets Miao Y, Cao F, Li P, Liu P.
In-Text Gene Mentions

Furthermore, methylation of PCDH17 in serum samples is frequent detected in RCC and is associated with poor outcomes.34

…Furthermore, methylation ofPCDH17in serum samples…

Show Full Abstract

It has been reported that loss of Hugl-2 contributes to tumour formation and progression in vitro and in vivo. However, whether Hugl-2 levels decrease during kidney renal clear cell carcinoma (KIRC) and the mechanism involved remain unknown. This study aimed to investigate whether DNA methylation of Hugl-2 reduces its expression, leading to the progression and poor prognosis of KIRC. Hugl-2 methylation and mRNA expression and KIRC clinicopathological data were extracted from The Cancer Genome Atlas (TCGA), and relationships among these factors were analyzed using UALCAN, MethHC, Wanderer and LinkedOmics web tools. We found that Hugl-2 mRNA and protein levels were reduced in KIRC tissues. Moreover, Hugl-2 mRNA levels were related to tumour grade and overall survival, and Hugl-2 methylation was increased in KIRC. According to the results of methylation-specific PCR, KIRC cells had higher Hugl-2 DNA methylation levels than HKC cells. Moreover, Hugl-2 DNA methylation correlated negatively with Hugl-2 mRNA and was also related to the pathology and T stage of KIRC patients. KIRC patients with high Hugl-2 DNA methylation also had shorter overall survival. Additionally, methylation of cg08827674, a Hugl-2 probe, was related to pathologic stage, T stage, neoplasm histologic grade, serum calcium level without laterality, M stage, N stage, and ethnicity. Furthermore, treatment with the DNA methylation inhibitor decitabine resulted in upregulation of Hugl-2 mRNA and protein levels in KIRC cell lines. These results indicate that Hugl-2 DNA methylation may be both a prognostic marker and a therapeutic target in KIRC.

Also flagged:ENKDARPP32dendritenucleusbehavioralHD
Journal Article 2020-09-20 ✓ 1 Snippet Deng Y, Wang H, Joni M, Sekhri R, Reiner A.
In-Text Gene Mentions

…a full‐length mouseHttlocus.…

Show Full Abstract

We used behavioral testing and morphological methods to detail the progression of basal ganglia neuron type-specific pathology and the deficits stemming from them in male heterozygous Q175 mice, compared to age-matched WT males. A rotarod deficit was not present in Q175 mice until 18 months, but increased open field turn rate (reflecting hyperkinesia) and open field anxiety were evident at 6 months. No loss of striatal neurons was seen out to 18 months, but ENK+ and DARPP32+ striatal perikarya were fewer by 6 months, due to diminished expression, with further decline by 18 months. No reduction in SP+ striatal perikarya or striatal interneurons was seen in Q175 mice at 18 months, but cholinergic interneurons showed dendrite attenuation by 6 months. Despite reduced ENK expression in indirect pathway striatal perikarya, ENK-immunostained terminals in globus pallidus externus (GPe) were more abundant at 6 months and remained so out to 18 months. Similarly, SP-immunostained terminals from striatal direct pathway neurons were more abundant in globus pallidus internus and substantia nigra at 6 months and remained so at 18 months. FoxP2+ arkypallidal GPe neurons and subthalamic nucleus neurons were lost by 18 months but not prototypical PARV+ GPe neurons or dopaminergic nigral neurons. Our results show that striatal projection neuron abnormalities and behavioral abnormalities reflecting them develop between 2 and 6 months of age in Q175 male heterozygotes, indicating early effects of the HD mutation. The striatal pathologies resemble those in human HD, but are less severe at 18 months than even in premanifest HD.

Also flagged:chondrogenesisHDAC1osteoarthritisOAmetabolismluciferase
Journal Article 2020-09-20 ✓ 1 Snippet Lu J, Zhou Z, Sun B, Han B, Fu Q, Han Y, Yuan W, Xu Z, Chen A.
In-Text Gene Mentions

…Sox family (Sox5,Sox6, and Sox9) […

Show Full Abstract

MicroRNAs (miRNAs) play an essential role in the chondrogenesis and the progression of osteoarthritis (OA). This study aimed to determine miRNAs associated with chondrogenesis of human mesenchymal stem cells (hMSCs) and chondrocyte metabolism. MiRNAs were screened in hMSCs during chondrogenesis by RNA-seq and qRT-PCR. MiRNA expression was determined in primary human chondrocytes (PHCs), and degraded cartilage samples. MiRNA mimics and inhibitors were transfected to cells to determine the effect of miRNA. Bioinformatic analysis and luciferase reporter assays were applied to determine the target gene of miRNA. The results demonstrated that miR-520d-5p was increased in hMSCs chondrogenesis. The overexpression and knockdown of miR-520d-5p promoted and inhibited chondrogenesis, and regulated chondrocyte metabolism. Histone deacetylase 1 (HDAC1) was decreased in hMSCs chondrogenesis, and HDAC1 was a targeting gene of miR-520d-5p. CI994, HDAC1 inhibitor, elevated cartilage-specific gene expressions and promoted hMSCs chondrogenesis. In IL-1β-treated PHCs, CI994 promoted AGGRECAN expression and suppressed MMP-13 expression, abolishing the effect of IL-1β on PHCs. Taken together, these results suggest that miR-520d-5p promotes hMSCs chondrogenesis and regulates chondrocyte metabolism through targeting HDAC1. This study provides novel understanding of the molecular mechanism of OA progression.

Also flagged:metabolismprotein degradationprotein synthesisagingribosomal proteinsprotein catabolism
Journal Article 2020-09-20 No Snippets Skariah G, Todd PK.
Show Full Abstract

Protein metabolism plays central roles in age-related decline and neurodegeneration. While a large body of research has explored age-related changes in protein degradation, alterations in the efficiency and fidelity of protein synthesis with aging are less well understood. Age-associated changes occur in both the protein synthetic machinery (ribosomal proteins and rRNA) and within regulatory factors controlling translation. At the same time, many of the interventions that prolong lifespan do so in part by pre-emptively decreasing protein synthesis rates to allow better harmonization to age-related declines in protein catabolism. Here we review the roles of translation regulation in aging, with a specific focus on factors implicated in age-related neurodegeneration. We discuss how emerging technologies such as ribosome profiling and superior mass spectrometric approaches are illuminating age-dependent mRNA-specific changes in translation rates across tissues to reveal a critical interplay between catabolic and anabolic pathways that likely contribute to functional decline. These new findings point to nodes in posttranscriptional gene regulation that both contribute to aging and offer targets for therapy. This article is categorized under: Translation > Translation Regulation Translation > Ribosome Biogenesis Translation > Translation Mechanisms.

Also flagged:Metabolic Syndromemetabolismmetabolic disordershyperglycemiainsulin resistanceIR
Journal Article 2020-09-20 ✓ 1 Snippet Włodarski A, Strycharz J, Wróblewski A, Kasznicki J, Drzewoski J, Śliwińska A.
In-Text Gene Mentions

…target mRNAs hemochromatosis (Hfe) and hemojuvelin (Hjv)…

Show Full Abstract

Oxidative stress (OxS) is the cause and the consequence of metabolic syndrome (MetS), the incidence and economic burden of which is increasing each year. OxS triggers the dysregulation of signaling pathways associated with metabolism and epigenetics, including microRNAs, which are biomarkers of metabolic disorders. In this review, we aimed to summarize the current knowledge regarding the interplay between microRNAs and OxS in MetS and its components. We searched PubMed and Google Scholar to summarize the most relevant studies. Collected data suggested that different sources of OxS (e.g., hyperglycemia, insulin resistance (IR), hyperlipidemia, obesity, proinflammatory cytokines) change the expression of numerous microRNAs in organs involved in the regulation of glucose and lipid metabolism and endothelium. Dysregulated microRNAs either directly or indirectly affect the expression and/or activity of molecules of antioxidative signaling pathways (SIRT1, FOXOs, Keap1/Nrf2) along with effector enzymes (e.g., GPx-1, SOD1/2, HO-1), ROS producers (e.g., NOX4/5), as well as genes of numerous signaling pathways connected with inflammation, insulin sensitivity, and lipid metabolism, thus promoting the progression of metabolic imbalance. MicroRNAs appear to be important epigenetic modifiers in managing the delicate redox balance, mediating either pro- or antioxidant biological impacts. Summarizing, microRNAs may be promising therapeutic targets in ameliorating the repercussions of OxS in MetS.

Also flagged:Cas9modificationsgene expressionClustered regularly interspaced short palindromic repeatsCRISPR-associated nuclease 9genetic disorders
Journal Article 2020-09-20 No Snippets Sharma G, Sharma AR, Bhattacharya M, Lee SS, Chakraborty C.
Show Full Abstract

At present, the idea of genome modification has revolutionized the modern therapeutic research era. Genome modification studies have traveled a long way from gene modifications in primary cells to genetic modifications in animals. The targeted genetic modification may result in the modulation (i.e., either upregulation or downregulation) of the predefined gene expression. Clustered regularly interspaced short palindromic repeats (CRISPR)-CRISPR-associated nuclease 9 (Cas9) is a promising genome-editing tool that has therapeutic potential against incurable genetic disorders by modifying their DNA sequences. In comparison with other genome-editing techniques, CRISPR-Cas9 is simple, efficient, and very specific. This enabled CRISPR-Cas9 genome-editing technology to enter into clinical trials against cancer. Besides therapeutic potential, the CRISPR-Cas9 tool can also be applied to generate genetically inhibited animal models for drug discovery and development. This comprehensive review paper discusses the origin of CRISPR-Cas9 systems and their therapeutic potential against various genetic disorders, including cancer, allergy, immunological disorders, Duchenne muscular dystrophy, cardiovascular disorders, neurological disorders, liver-related disorders, cystic fibrosis, blood-related disorders, eye-related disorders, and viral infection. Finally, we discuss the different challenges, safety concerns, and strategies that can be applied to overcome the obstacles during CRISPR-Cas9-mediated therapeutic approaches.

Also flagged:chromosomeschromosometripartite motif-containing 37TRIM37protein phosphatasePPM1E
Journal Article 2020-09-19 ✓ 1 Snippet Bizarria Dos Santos W, Pimenta Schettini G, Fonseca MG, Pereira GL, Loyola Chardulo LA, Rodrigues Machado Neto O, Baldassini WA, Nunes de Oliveira H, Abdallah Curi R.
In-Text Gene Mentions

…carbonic anhydrase 10 (CA10).…

Show Full Abstract

With the availability of high-density SNP panels and the establishment of approaches for characterizing homozygosity and heterozygosity sites, it is possible to access fine-scale information regarding genomes, providing more than just comparisons of different inbreeding coefficients. This is the first study that seeks to access such information for the Mangalarga Marchador (MM) horse breed on a genomic scale. To this end, we aimed to assess inbreeding levels using different coefficients, as well as to characterize homozygous and heterozygous runs in the population. Using Axiom ® Equine Genotyping Array-670k SNP (Thermo Fisher), 192 horses were genotyped. Our results showed different estimates: inbreeding from genomic coefficients (F<sub>ROH</sub> ) = 0.16; pedigree-based (F<sub>PED</sub> ) = 0.008; and a method based on excess homozygosity (F<sub>HOM</sub> ) = 0.010. The correlations between the inbreeding coefficients were low to moderate, and some comparisons showed negative correlations, being practically null. In total, 85,295 runs of homozygosity (ROH) and 10,016 runs of heterozygosity (ROHet) were characterized for the 31 horse autosomal chromosomes. The class with the highest percentage of ROH was 0-2 Mbps, with 92.78% of the observations. In the ROHet results, only the 0-2 class presented observations, with chromosome 11 highlighted in a region with high genetic variability. Three regions from the ROHet analyses showed genes with known functions: tripartite motif-containing 37 (TRIM37), protein phosphatase, Mg<sup>2+</sup> /Mn<sup>2+</sup> dependent 1E (PPM1E) and carbonic anhydrase 10 (CA10). Therefore, our findings suggest moderate inbreeding, possibly attributed to breed formation, annulling possible recent inbreeding. Furthermore, regions with high variability in the MM genome were identified (ROHet), associated with the recent selection and important events in the development and performance of MM horses over generations.

Also flagged:MetabolismGlycosphingolipidsmembraneceramidecarbohydratelipid
Journal Article 2020-09-19 No Snippets Ryckman AE, Brockhausen I, Walia JS.
Show Full Abstract

Glycosphingolipids (GSLs) are a specialized class of membrane lipids composed of a ceramide backbone and a carbohydrate-rich head group. GSLs populate lipid rafts of the cell membrane of eukaryotic cells, and serve important cellular functions including control of cell-cell signaling, signal transduction and cell recognition. Of the hundreds of unique GSL structures, anionic gangliosides are the most heavily implicated in the pathogenesis of lysosomal storage diseases (LSDs) such as Tay-Sachs and Sandhoff disease. Each LSD is characterized by the accumulation of GSLs in the lysosomes of neurons, which negatively interact with other intracellular molecules to culminate in cell death. In this review, we summarize the biosynthesis and degradation pathways of GSLs, discuss how aberrant GSL metabolism contributes to key features of LSD pathophysiology, draw parallels between LSDs and neurodegenerative proteinopathies such as Alzheimer's and Parkinson's disease and lastly, discuss possible therapies for patients.

Also flagged:ProteasomeNeurodegenerative Diseasesubiquitinagingα-synucleinParkinson's
Journal Article 2020-09-19 No Snippets Fernández-Cruz I, Reynaud E.
Show Full Abstract

The ubiquitin-proteasome system is the major pathway for the maintenance of protein homeostasis. Its inhibition causes accumulation of ubiquitinated proteins; this accumulation has been associated with several of the most common neurodegenerative diseases. Several genetic factors have been identified for most neurodegenerative diseases, however, most cases are considered idiopathic, thus making the study of the mechanisms of protein accumulation a relevant field of research. It is often mentioned that the biggest risk factor for neurodegenerative diseases is aging, and several groups have reported an age-related alteration of the expression of some of the 26S proteasome subunits and a reduction of its activity. Proteasome subunits interact with proteins that are known to accumulate in neurodegenerative diseases such as α-synuclein in Parkinson's, tau in Alzheimer's, and huntingtin in Huntington's diseases. These interactions have been explored for several years, but only until recently, we are beginning to understand them. In this review, we discuss the known interactions, the underlying patterns, and the phenotypes associated with the 26S proteasome subunits in the etiology and progression of neurodegenerative diseases where there is evidence of proteasome involvement. Special emphasis is made in reviewing proteasome subunits that interact with proteins known to have an age-related altered expression or to be involved in neurodegenerative diseases to explore key effectors that may trigger or augment their progression. Interestingly, while the causes of age-related reduction of some of the proteasome subunits are not known, there are specific relationships between the observed neurodegenerative disease and the affected proteasome subunits.

Also flagged:hydroxyapatiteCrystallinemineralcarbonatecollagen
Journal Article 2020-09-19 No Snippets Madhavasarma P, Veeraragavan P, Kumaravel S, Sridevi M.
Show Full Abstract

Crystalline Hydroxyapatite (Ca10 (PO<sub>4</sub>)<sub>6</sub>(OH)<sub>2</sub>) non linear optical crystal plays a major role in biomedical applications. Crystalline Hydroxyapatite was synthesized using natural human bone sample by thermal methods. This Hydroxyapatite was characterized by Fourier Transform infra-red spectroscopy (FTIR), scanning electron microscope, UV-Vis spectroscopy, X-ray diffraction and conductivity studies. It was found that compared to bovine bone, the changes to the molecular structure associated with the mineral (carbonate) and the organic content (collagen) was good. The sintering methods showed that the synthesized Hydroxyapatite has remarkable heat stability up to 750 °C. The XRD and FTIR results showed a high purity of the synthesized HA powders, in terms of the electronic transitions, in UV-Vis which require a certain amount of energy it is proportional to the wavelength absorbed and absorption coefficient, the optical band energy of the natural human bone is found to be 4.65 eV and the electrical conductivity of the bone material is 9.11 × 10<sup>-6</sup> Ω <sup>-1</sup> cm<sup>-1.</sup> Natural bone Hydroxyapatite gives superior results.

Also flagged:PhosphorylationCullin-RING ligasesdegradationproteasometumorkinases
Journal Article 2020-09-19 No Snippets Chen Y, Shao X, Cao J, Zhu H, Yang B, He Q, Ying M.
Show Full Abstract

Cullin-RING ligases (CRLs) recognize and interact with substrates for ubiquitination and degradation, and can be targeted for disease treatment when the abnormal expression of substrates involves pathologic processes. Phosphorylation, either of substrates or receptors of CRLs, can alter their interaction. Phosphorylation-dependent ubiquitination and proteasome degradation influence various cellular processes and can contribute to the occurrence of various diseases, most often tumorigenesis. These processes have the potential to be used for tumor intervention through the regulation of the activities of related kinases, along with the regulation of the stability of specific oncoproteins and tumor suppressors. This review describes the mechanisms and biological functions of crosstalk between phosphorylation and ubiquitination, and most importantly its influence on tumorigenesis, to provide new directions and strategies for tumor therapy.

Also flagged:proprioceptionneuropathysensory neuropathyvisionspinal cord injuryiridium-oxide
Journal Article 2020-09-18 No Snippets Kumaravelu K, Tomlinson T, Callier T, Sombeck J, Bensmaia SJ, Miller LE, Grill WM.
Show Full Abstract

<h4>Objective</h4>Touch and proprioception are essential to motor function as shown by the movement deficits that result from the loss of these senses, e.g. due to neuropathy of sensory nerves. To achieve a high-performance brain-controlled prosthetic arm/hand thus requires the restoration of somatosensation, perhaps through intracortical microstimulation (ICMS) of somatosensory cortex (S1). The challenge is to generate patterns of neuronal activation that evoke interpretable percepts. We present a framework to design optimal spatiotemporal patterns of ICMS (STIM) that evoke naturalistic patterns of neuronal activity and demonstrate performance superior to four previous approaches.<h4>Approach</h4>We recorded multiunit activity from S1 during a center-out reach task (from proprioceptive neurons in Brodmann's area 2) and during application of skin indentations (from cutaneous neurons in Brodmann's area 1). We implemented a computational model of a cortical hypercolumn and used a genetic algorithm to design STIM that evoked patterns of model neuron activity that mimicked their experimentally-measured counterparts. Finally, from the ICMS patterns, the evoked neuronal activity, and the stimulus parameters that gave rise to it, we trained a recurrent neural network (RNN) to learn the mapping function between the physical stimulus and the biomimetic stimulation pattern, i.e. the sensory encoder to be integrated into a neuroprosthetic device.<h4>Main results</h4>We identified ICMS patterns that evoked simulated responses that closely approximated the measured responses for neurons within 50 µm of the electrode tip. The RNN-based sensory encoder generalized well to untrained limb movements or skin indentations. STIM designed using the model-based optimization approach outperformed STIM designed using existing linear and nonlinear mappings.<h4>Significance</h4>The proposed framework produces an encoder that converts limb state or patterns of pressure exerted onto the prosthetic hand into STIM that evoke naturalistic patterns of neuronal activation.

Also flagged:Formylglycinecysteineamino acidconjugationsynthesisEGF receptor
Journal Article 2020-09-18 No Snippets Janson N, Krüger T, Karsten L, Boschanski M, Dierks T, Müller KM, Sewald N.
Show Full Abstract

Formylglycine-generating enzymes specifically oxidize cysteine within the consensus sequence CxPxR to C<sup>α</sup> -formylglycine (FGly). This noncanonical electrophilic amino acid can subsequently be addressed selectively by bioorthogonal hydrazino-iso-Pictet-Spengler (HIPS) or Knoevenagel ligation to attach payloads like fluorophores or drugs to proteins to obtain a defined payload-to-protein ratio. However, the disadvantages of these conjugation techniques include the need for a large excess of conjugation building block, comparably low reaction rates and limited stability of FGly-containing proteins. Therefore, functionalized clickable HIPS and tandem Knoevenagel building blocks were synthesized, conjugated to small proteins (DARPins) and subsequently linked to strained alkyne-containing payloads for protein labeling. This procedure allowed the selective bioconjugation of one or two DBCO-carrying payloads with nearly stoichiometric amounts at low concentrations. Furthermore, an azide-modified tandem Knoevenagel building block enabled the synthesis of branched PEG linkers and the conjugation of two fluorophores, resulting in an improved signal-to-noise ratio in live-cell fluorescence-imaging experiments targeting the EGF receptor.

Also flagged:solute carrier proteinsSLCtransporter proteinstransport proteinsmembranesorganelles
Journal Article 2020-09-18 No Snippets Pizzagalli MD, Bensimon A, Superti-Furga G.
Show Full Abstract

This review aims to serve as an introduction to the solute carrier proteins (SLC) superfamily of transporter proteins and their roles in human cells. The SLC superfamily currently includes 458 transport proteins in 65 families that carry a wide variety of substances across cellular membranes. While members of this superfamily are found throughout cellular organelles, this review focuses on transporters expressed at the plasma membrane. At the cell surface, SLC proteins may be viewed as gatekeepers of the cellular milieu, dynamically responding to different metabolic states. With altered metabolism being one of the hallmarks of cancer, we also briefly review the roles that surface SLC proteins play in the development and progression of cancer through their influence on regulating metabolism and environmental conditions.

Also flagged:Glycosaminoglycanglycosaminoglycanssulfateoligosaccharideuronic acidoligosaccharides
Journal Article 2020-09-18 ✓ 1 Snippet Liu H, Liang Q, Sharp JS.
In-Text Gene Mentions

ATIII

Show Full Abstract

The structures of glycosaminoglycans (GAGs), especially the patterns of modification, are crucial to modulate interactions with various protein targets. It is very challenging to determine the fine structures using liquid chromatography-mass spectrometry (LC-MS) due in large part to the gas-phase sulfate losses upon collisional activation. Previously, our group reported a method for fine structure analysis that required permethylation of the GAG oligosaccharide. However, uncontrolled depolymerization during the permethylation process due to esterification of uronic acid lowers the reliability of the method to resolve structures of GAGs, especially for larger oligosaccharides. Here, we describe a simplified derivatization method using propionylation and desulfation. The oligosaccharides have all hydroxyl and amine groups protected with propionyl groups and then have sulfate groups removed to generate unprotected hydroxyl and amine groups at all sites that were previously sulfated. This derivatized oligosaccharide generates informative fragments during collision-induced dissociation that resolve the original sulfation patterns. This method is demonstrated to enable accurate determination of sulfation patterns of even the highly sulfated pentasaccharide fondaparinux by MS<sup>2</sup> and MS<sup>3</sup>. Using a mixture of dp6 from porcine heparin, we demonstrate that this method allows for structural characterization of complex mixtures, including clear chromatographic separation and sequencing of structural isomers, all at high yields without evidence of depolymerization. This represents a marked improvement in the reliability to structurally characterize GAG oligosaccharides over permethylation-based derivatization schemes.

Also flagged:neurotrophic factorBDNFcardiovascular diseasesextracellularTrkBtyrosine kinase receptor
Journal Article 2020-09-18 No Snippets Brigadski T, Leßmann V.
Show Full Abstract

The neurotrophic factor BDNF is an important regulator for the development of brain circuits, for synaptic and neuronal network plasticity, as well as for neuroregeneration and neuroprotection. Up- and downregulations of BDNF levels in human blood and tissue are associated with, e.g., neurodegenerative, neurological, or even cardiovascular diseases. The changes in BDNF concentration are caused by altered dynamics in BDNF expression and release. To understand the relevance of major variations of BDNF levels, detailed knowledge regarding physiological and pathophysiological stimuli affecting intra- and extracellular BDNF concentration is important. Most work addressing the molecular and cellular regulation of BDNF expression and release have been performed in neuronal preparations. Therefore, this review will summarize the stimuli inducing release of BDNF, as well as molecular mechanisms regulating the efficacy of BDNF release, with a focus on cells originating from the brain. Further, we will discuss the current knowledge about the distinct stimuli eliciting regulated release of BDNF under physiological conditions.

Also flagged:degradationoligonucleotidesAmyotrophic Lateral Sclerosisbindingpyrimidineprotein synthesis
Journal Article 2020-09-18 ✓ 4 Snippets Aarum J, Cabrera CP, Jones TA, Rajendran S, Adiutori R, Giovannoni G, Barnes MR, Malaspina A, Sheer D.
In-Text Gene Mentions

…TDP‐43 (NEB, #G400),HTT(NEB, #D7F7), FUS…

HTT, neurofilament heavy chain…

…observed for Actin,HTT, TDP‐43 and RPL7…

…examine here, likeHTTand RPL7, RNA…

Show Full Abstract

Most proteins in cell and tissue lysates are soluble. We show here that in lysate from human neurons, more than 1,300 proteins are maintained in a soluble and functional state by association with endogenous RNA, as degradation of RNA invariably leads to protein aggregation. The majority of these proteins lack conventional RNA-binding domains. Using synthetic oligonucleotides, we identify the importance of nucleic acid structure, with single-stranded pyrimidine-rich bulges or loops surrounded by double-stranded regions being particularly efficient in the maintenance of protein solubility. These experiments also identify an apparent one-to-one protein-nucleic acid stoichiometry. Furthermore, we show that protein aggregates isolated from brain tissue from Amyotrophic Lateral Sclerosis patients can be rendered soluble after refolding by both RNA and synthetic oligonucleotides. Together, these findings open new avenues for understanding the mechanism behind protein aggregation and shed light on how certain proteins remain soluble.

Also flagged:adolescent idiopathic scoliosisextracellularkeratinsKRT6AKRT14KRT5
Journal Article 2020-09-18 ✓ 3 Snippets Rajasekaran S, Tangavel C, Anand KSSV, Soundararajan DCR, Nayagam SM, Sunmathi R, Raveendran M, Shetty AP, Kanna RM, Pushpa BT.
In-Text Gene Mentions

…n-2 (PRDX2), peroxiredoxin-6 (PRDX6), catalase (CAT), apolipoprot…

…homeostasis like PRDX2,PRDX6, CAT, APOE, MPO,…

PRDX6, is the only…

Show Full Abstract

<h4>Study design</h4>Proteomic analysis of human intervertebral discs.<h4>Objectives</h4>To compare the characters of scoliotic discs and discs from magnetic resonance imaging (MRI)-normal voluntary organ donors controls used in disc research employing proteomics and establish "true controls" that can be utilized for future intervertebral disc (IVD) research.<h4>Methods</h4>Eight MRI-normal discs from 8 brain-dead voluntary organ donors (ND) and 8 scoliotic discs (SD) from 3 patients who underwent anterior surgery for adolescent idiopathic scoliosis were subjected to tandem mass spectrometry, and further analysis was performed.<h4>Results</h4>Mass spectrometry identified a total of 235 proteins in ND and 438 proteins in the SD group. Proteins involved in extracellular matrix integrity (Versican, keratins KRT6A, KRT14, KRT5, and KRT 13A1, A-kinase anchor protein 13, coagulation factor XIII A chain, proteoglycan 4) and proteins involved in transcription and DNA repair (Von Willebrand factor A domain-containing 3B, eukaryotic initiation factor 2B, histone H4, leukocyte cell-derived chemotaxin 2) were found to be downregulated in SD. Inflammatory proteins (C3, C1S), and oxidative stress response proteins (peroxiredoxin-2,6, catalase, myeloperoxidase, apolipoprotein E) were found to be upregulated in SD. These changes were reflected at the pathway level also.<h4>Conclusion</h4>Findings of our study confirm that scoliotic discs have an abundance of inflammatory, oxidative stress response proteins, which are either absent or downregulated in the ND group indicating that scoliotic discs are not pathologically inert. Furthermore, this study has established MRI-normal discs from voluntary organ donors as the "true" control for molecular studies in IVD research.

Also flagged:Atrial FibrillationEdoxabanVitamin KAFstroketransient ischemic attack
Journal Article 2020-09-18 ✓ 5 Snippets Rago A, Papa AA, Attena E, Parisi V, Golino P, Nigro G, Nigro G, Russo V.
In-Text Gene Mentions

Our data confirm the results of the ENSURE AF study [16], which showed in 2199 AF patients undergoing DCC a similar cumulative incidence for the composite net clinical benefit outcome of stroke, systemic embolic event, transient ischemic attack, myocardial infarction, cardiovascular mortality, and major bleeding events between edoxaban group vs enoxaparin-VKA group.

Real-world evidences on clinical performance of non-vitamin K antagonist oral anticoagulant (NOACs) use in AF patients scheduled for DCC are relevant to address current unmet medical needs and to better define the specific role of such agents in this clinical setting.

The purpose of the present study was to compare the long-term effectiveness and safety of newly initiated anticoagulation with edoxaban (EDO) versus uninterrupted vitamin K antagonist (VKA) therapy in patients with atrial fibrillation (AF) scheduled for transesophageal echocardiogram (TEE)-guided direct electrical current cardioversion (DCC).

However, there are no real-world data on clinical outcomes following direct current cardioversion (DCC) in AF patients treated with edoxaban.

Our results did not show a statistically significant difference in the cumulative incidence of both major bleedings and thromboembolic events among AF patients who underwent DCC on edoxaban vs VKA.

Show Full Abstract

<h4>Purpose</h4>The purpose of the present study was to compare the long-term effectiveness and safety of newly initiated anticoagulation with edoxaban (EDO) versus uninterrupted vitamin K antagonist (VKA) therapy in patients with atrial fibrillation (AF) scheduled for transesophageal echocardiogram (TEE)-guided direct electrical current cardioversion (DCC).<h4>Methods</h4>A propensity score-matched cohort observational study was performed comparing the safety and effectiveness of edoxaban versus well-controlled VKA therapy among a cohort of consecutive non-valvular AF patients scheduled for DCC. The primary safety outcome was major bleeding. The primary efficacy outcome was the composite of stroke, transient ischemic attack (TIA), and systemic embolism (SE).<h4>Findings</h4>A total of 130 AF patients receiving edoxaban 60-mg (EDO) treatment were compared with the same number of VKA recipients. The cumulative incidence of major bleedings was 1.54% in the EDO group and 3.08% in the VKA group (P = 0.4). The cumulative incidence of thromboembolic events was 1.54% in the EDO group and 2.31% in the VKA group (P = 0.9). A non-significant trend in improved adherence was observed between the EDO and VKA groups with a total anticoagulant therapy discontinuation rate of 4.62% (6/130) vs 6.15% (8/130), respectively (P = 0.06).<h4>Implications</h4>Our study provides the evidence of a safe and effective use of edoxaban in this clinical setting, justified by no significant difference in major bleedings and thromboembolic events between edoxaban and well-controlled VKA treatments.

Also flagged:head andneuroendocrine tumorscarotid paragangliomastumorsparagangliomaspheochromocytomas
Journal Article 2020-09-18 ✓ 2 Snippets Kudryavtseva AV, Kalinin DV, Pavlov VS, Savvateeva MV, Fedorova MS, Pudova EA, Kobelyatskaya AA, Golovyuk AL, Guvatova ZG, Razmakhaev GS, Demidova TB, Simanovsky SA, Slavnova EN, Poloznikov AА, Polyakov AP, Melnikova NV, Dmitriev AA, Krasnov GS, Snezhkina AV.
In-Text Gene Mentions

In this patient’s VPGL, we first identified likely pathogenic variants in a number of genes that have previously been found in other tumors according to the COSMIC database: VSIG10 (COSM935687; endometrial cancer), MRGPRX1 (COSM3687222; colon and lung cancer), DUSP27 (COSM144660; diffuse large B cell lymphoma), and C10orf88 (COSM3686556; colon cancer).

…the COSMIC database:VSIG10(COSM935687; endometrial cance…

Show Full Abstract

<h4>Background</h4>Vagal paragangliomas (VPGLs) belong to a group of rare head and neck neuroendocrine tumors. VPGLs arise from the vagus nerve and are less common than carotid paragangliomas. Both diagnostics and therapy of the tumors raise significant challenges. Besides, the genetic and molecular mechanisms behind VPGL pathogenesis are poorly understood.<h4>Methods</h4>The collection of VPGLs obtained from 8 patients of Russian population was used in the study. Exome library preparation and high-throughput sequencing of VPGLs were performed using an Illumina technology.<h4>Results</h4>Based on exome analysis, we identified pathogenic/likely pathogenic variants of the SDHx genes, frequently mutated in paragangliomas/pheochromocytomas. SDHB variants were found in three patients, whereas SDHD was mutated in two cases. Moreover, likely pathogenic missense variants were also detected in SDHAF3 and SDHAF4 genes encoding for assembly factors for the succinate dehydrogenase (SDH) complex. In a patient, we found a novel variant of the IDH2 gene that was predicted as pathogenic by a series of algorithms used (such as SIFT, PolyPhen2, FATHMM, MutationTaster, and LRT). Additionally, pathogenic/likely pathogenic variants were determined for several genes, including novel genes and some genes previously reported as associated with different types of tumors.<h4>Conclusions</h4>Results indicate a high heterogeneity among VPGLs, however, it seems that driver events in most cases are associated with mutations in the SDHx genes and SDH assembly factor-coding genes that lead to disruptions in the SDH complex.

Also flagged:clottingproteasesproteasemineralscoagulation
Journal Article 2020-09-18 No Snippets Sbhatu DB, Tekle HT, Tesfamariam KH.
Show Full Abstract

<h4>Objective</h4>The demand for cheese, the insufficient supply and high cost of rennet, and the ethical issues of harvesting rennet oblige us to search for suitable alternatives of finding new proteases from plants. Ficus palmata FORSKåL (Moraceae) is one of the plants producing a protease called ficin that coagulates fresh milk. This study aims to study the milk coagulating abilities of bark, leaf, and stem powders of F. palmata FORSKåL.<h4>Results</h4>Stem powder has yielded better results. Chemical analyses of the powders have revealed that the percentage of crude protein of leaf, bark, and stem powders were 4.17, 7.39, and 16.26. This is an indication of the suitability of stem biomass as source of the enzyme of interest. Further research needs to aim at qualitative and quantitative analyses of milk-coagulating enzymes of F. palmata FORSKåL stem biomass to get new insights into industrial extraction of the enzymes of interest.

Also flagged:Hirschsprung diseasezipBACE2Crestint1ENS
Journal Article 2020-09-18 ✓ 1 Snippet Fu AX, Lui KN, Tang CS, Ng RK, Lai FP, Lau ST, Li Z, Garcia-Barcelo MM, Sham PC, Tam PK, Ngan ES, Yip KY.
In-Text Gene Mentions

…replace SOX5 andSOX6in governing oligodendrocyte…

Show Full Abstract

It is widely recognized that noncoding genetic variants play important roles in many human diseases, but there are multiple challenges that hinder the identification of functional disease-associated noncoding variants. The number of noncoding variants can be many times that of coding variants; many of them are not functional but in linkage disequilibrium with the functional ones; different variants can have epistatic effects; different variants can affect the same genes or pathways in different individuals; and some variants are related to each other not by affecting the same gene but by affecting the binding of the same upstream regulator. To overcome these difficulties, we propose a novel analysis framework that considers convergent impacts of different genetic variants on protein binding, which provides multiscale information about disease-associated perturbations of regulatory elements, genes, and pathways. Applying it to our whole-genome sequencing data of 918 short-segment Hirschsprung disease patients and matched controls, we identify various novel genes not detected by standard single-variant and region-based tests, functionally centering on neural crest migration and development. Our framework also identifies upstream regulators whose binding is influenced by the noncoding variants. Using human neural crest cells, we confirm cell stage-specific regulatory roles of three top novel regulatory elements on our list, respectively in the <i>RET</i>, <i>RASGEF1A</i>, and <i>PIK3C2B</i> loci. In the <i>PIK3C2B</i> regulatory element, we further show that a noncoding variant found only in the patients affects the binding of the gliogenesis regulator NFIA, with a corresponding up-regulation of multiple genes in the same topologically associating domain.

Also flagged:Transcription factorgene-expressiongene expressionchromatintranscription factorsbinding
Journal Article 2020-09-18 ✓ 5 Snippets Heavner WE, Ji S, Notwell JH, Dyer ES, Tseng AM, Birgmeier J, Yoo B, Bejerano G, McConnell SK.
In-Text Gene Mentions

Shisa6

Vsig10

Sox6

Prdx6

Mms22l

Show Full Abstract

We are only just beginning to catalog the vast diversity of cell types in the cerebral cortex. Such categorization is a first step toward understanding how diversification relates to function. All cortical projection neurons arise from a uniform pool of progenitor cells that lines the ventricles of the forebrain. It is still unclear how these progenitor cells generate the more than 50 unique types of mature cortical projection neurons defined by their distinct gene-expression profiles. Moreover, exactly how and when neurons diversify their function during development is unknown. Here we relate gene expression and chromatin accessibility of two subclasses of projection neurons with divergent morphological and functional features as they develop in the mouse brain between embryonic day 13 and postnatal day 5 in order to identify transcriptional networks that diversify neuron cell fate. We compare these gene-expression profiles with published profiles of single cells isolated from similar populations and establish that layer-defined cell classes encompass cell subtypes and developmental trajectories identified using single-cell sequencing. Given the depth of our sequencing, we identify groups of transcription factors with particularly dense subclass-specific regulation and subclass-enriched transcription factor binding motifs. We also describe transcription factor-adjacent long noncoding RNAs that define each subclass and validate the function of <i>Myt1l</i> in balancing the ratio of the two subclasses in vitro. Our multidimensional approach supports an evolving model of progressive restriction of cell fate competence through inherited transcriptional identities.

Also flagged:NLRP3immune signal receptorsinflammatory responsesNLR-family pyrin domain-containing protein 3interleukin (IL)-1βIL-18
Journal Article 2020-09-18 No Snippets Bai B, Yang Y, Wang Q, Li M, Tian C, Liu Y, Aung LHH, Li PF, Yu T, Chu XM.
Show Full Abstract

Inflammasomes are a class of cytosolic protein complexes. They act as cytosolic innate immune signal receptors to sense pathogens and initiate inflammatory responses under physiological and pathological conditions. The NLR-family pyrin domain-containing protein 3 (NLRP3) inflammasome is the most characteristic multimeric protein complex. Its activation triggers the cleavage of pro-interleukin (IL)-1β and pro-IL-18, which are mediated by caspase-1, and secretes mature forms of these mediators from cells to promote the further inflammatory process and oxidative stress. Simultaneously, cells undergo pro-inflammatory programmed cell death, termed pyroptosis. The danger signals for activating NLRP3 inflammasome are very extensive, especially reactive oxygen species (ROS), which act as an intermediate trigger to activate NLRP3 inflammasome, exacerbating subsequent inflammatory cascades and cell damage. Vascular endothelium at the site of inflammation is actively involved in the regulation of inflammation progression with important implications for cardiovascular homeostasis as a dynamically adaptable interface. Endothelial dysfunction is a hallmark and predictor for cardiovascular ailments or adverse cardiovascular events, such as coronary artery disease, diabetes mellitus, hypertension, and hypercholesterolemia. The loss of proper endothelial function may lead to tissue swelling, chronic inflammation, and the formation of thrombi. As such, elimination of endothelial cell inflammation or activation is of clinical relevance. In this review, we provided a comprehensive perspective on the pivotal role of NLRP3 inflammasome activation in aggravating oxidative stress and endothelial dysfunction and the possible underlying mechanisms. Furthermore, we highlighted the contribution of noncoding RNAs to NLRP3 inflammasome activation-associated endothelial dysfunction, and outlined potential clinical drugs targeting NLRP3 inflammasome involved in endothelial dysfunction. Collectively, this summary provides recent developments and perspectives on how NLRP3 inflammasome interferes with endothelial dysfunction and the potential research value of NLRP3 inflammasome as a potential mediator of endothelial dysfunction.

Also flagged:complexinflammatory diseaseshormonecancersinflammatory bowel diseasesulcerative colitis
Journal Article 2020-09-18 No Snippets Momozawa Y, Mizukami K.
Show Full Abstract

Genome-wide association studies have identified >10,000 genetic variants associated with various phenotypes and diseases. Although the majority are common variants, rare variants with >0.1% of minor allele frequency have been investigated by imputation and using disease-specific custom SNP arrays. Rare variants sequencing analysis mainly revealed have played unique roles in the genetics of complex diseases in humans due to their distinctive features, in contrast to common variants. Unique roles are hypothesis-free evidence for gene causality, a precise target of functional analysis for understanding disease mechanisms, a new favorable target for drug development, and a genetic marker with high disease risk for personalized medicine. As whole-genome sequencing continues to identify more rare variants, the roles associated with rare variants will also increase. However, a better estimation of the functional impact of rare variants across whole genome is needed to enhance their contribution to improvements in human health.

Also flagged:autophagytumordeathtumorsColorectal cancermalignant tumor
Journal Article 2020-09-18 No Snippets Xie Q, Liu Y, Li X.
Show Full Abstract

Autophagy and apoptosis play crucial roles in tumorigenesis. Recent studies have shown that autophagy and apoptosis have a cross-talk relationship in anti-tumor therapy. It is well established that apoptosis is one of the main pathways of tumor cell death. While autophagy can occurs in tumors with opposite function: protective autophagy and lethal autophagy. Protective autophagy can inhibit tumor apoptosis induced by anticancer drugs, while lethal autophagy can induce tumor cell apoptosis in cooperation with anticancer drugs. Hence, autophagy and apoptosis have synergistic and antagonistic effects in tumor. Colorectal cancer is a common malignant tumor with high morbidity and mortality. In recent years, colorectal carcinoma has achieved improved clinical efficacy with drug treatment. Nonetheless, increasing drug-resistance limit the treatment efficacy, highlighting the urgency of exploring the molecular events that drive drug resistance. Researchers have found that autophagy is one of the major factors leading to drug resistance in colon cancer. Therefore, elucidating the interaction between autophagy and apoptosis is helpful to improve the efficacy of anticancer drugs in clinical treatment of colorectal cancer. This review attaches great importance to the relationship between autophagy and apoptosis and related factors in colorectal cancer.

Also flagged:Pelvic Organ Prolapsefemale reproductive system disorderschitosandicarboxylic acidsaminoacidmalonic acid
Journal Article 2020-09-18 No Snippets Radwan-Pragłowska J, Stangel-Wójcikiewicz K, Piątkowski M, Janus Ł, Matýsek D, Kot M, Majka M, Amrom D.
Show Full Abstract

The growing number of female reproductive system disorders creates a need for novel treatment methods. Tissue engineering brings hope for patients, which enables damaged tissue reconstruction. For this purpose, epithelial cells are cultured on three-dimensional scaffolds. One of the most promising materials is chitosan, which is known for its biocompatibility and biodegradability. The aim of the following study was to verify the potential of chitosan-based biomaterials for pelvic organ prolapse regeneration. The scaffolds were obtained under microwave-assisted conditions in crosslinking reactions, using dicarboxylic acids and aminoacid as crosslinkers, including l-glutamic acid, adipic acid, malonic acid, and levulinic acid. The products were characterized over their physicochemical and biological properties. FT-IR analysis confirmed formation of amide bonds. The scaffolds had a highly porous structure, which was confirmed by SEM analysis. Their porosity was above 90%. The biomaterials had excellent swelling abilities and very good antioxidant properties. The cytotoxicity study was performed on vaginal epithelial VK2/E6E7 and human colon cancer HCT116 cell lines. The results showed that after certain modifications, the proposed scaffolds could be used in pelvic organ prolapse (POP) treatment.

Also flagged:FGFRCancerFibroblast growth factor receptorsFGFRstyrosine kinase receptorstumor
Journal Article 2020-09-18 ✓ 1 Snippet De Luca A, Esposito Abate R, Rachiglio AM, Maiello MR, Esposito C, Schettino C, Izzo F, Nasti G, Normanno N.
In-Text Gene Mentions

Several other partners involved in FGFR2 fusion genes, whose biological activity has not been fully characterized, have been described in cholangiocarcinoma, including KIAA1217, KIAA1598, DDX21, LAMC1, NRAP, NOL4, PHC1, RABGAP1L, RASAL2, ROCK1, TFEC, AFF4, CELF2, DCTN2, DNAJC12, DZIP1, FOXP1, INA, KCTD1,LGSN, LPXN, MYPN, PRKN, PCM1, RNF41, SH3GLB1, STK3, SORBS1, TBC1D1, and UBQLN1 [33,34,35].

Show Full Abstract

Fibroblast growth factor receptors (FGFRs) are tyrosine kinase receptors involved in many biological processes. Deregulated FGFR signaling plays an important role in tumor development and progression in different cancer types. <i>FGFR</i> genomic alterations, including <i>FGFR</i> gene fusions that originate by chromosomal rearrangements, represent a promising therapeutic target. Next-generation-sequencing (NGS) approaches have significantly improved the discovery of <i>FGFR</i> gene fusions and their detection in clinical samples. A variety of FGFR inhibitors have been developed, and several studies are trying to evaluate the efficacy of these agents in molecularly selected patients carrying <i>FGFR</i> genomic alterations. In this review, we describe the most frequent <i>FGFR</i> aberrations in human cancer. We also discuss the different approaches employed for the detection of <i>FGFR</i> fusions and the potential role of these genomic alterations as prognostic/predictive biomarkers.

Also flagged:COL2A1tumormelanomacell adhesionSTATAkt
Journal Article 2020-09-18 ✓ 2 Snippets Talluri B, Amar K, Saul M, Shireen T, Konjufca V, Ma J, Ha T, Chowdhury F.
In-Text Gene Mentions

…F11r , andNegr1.…

…, Col11a2 ,Negr1, and Cd47…

Show Full Abstract

Soft 3D-fibrin-gel selected tumor repopulating cells (TRCs) from the B16F1 melanoma cell line exhibit extraordinary self-renewal and tumor-regeneration capabilities. However, their biomarkers and gene regulatory features remain largely unknown. Here, we utilized the next-generation sequencing-based RNA sequencing (RNA-seq) technique to discover novel biomarkers and active gene regulatory features of TRCs. Systems biology analysis of RNA-seq data identified differentially expressed gene clusters, including the cell adhesion cluster, which subsequently identified highly specific and novel biomarkers, such as <i>Col2a1</i>, <i>Ncam1</i>, <i>F11r</i>, and <i>Negr1</i>. We validated the expression of these genes by real-time qPCR. The expression level of <i>Col2a1</i> was found to be relatively low in TRCs but twenty-fold higher compared to the parental control cell line, thus making the biomarker very specific for TRCs. We validated the COL2A1 protein by immunofluorescence microscopy, showing a higher expression of COL2A1 in TRCs compared to parental control cells. KEGG pathway analysis showed the JAK/STAT, hypoxia, and Akt signaling pathways to be active in TRCs. Besides, the aerobic glycolysis pathway was found to be very active, indicating a typical Warburg Effect on highly tumorigenic cells. Together, our study revealed highly specific biomarkers and active cell signaling pathways of melanoma TRCs that can potentially target and neutralize TRCs.

Also flagged:Membrane17β-EstradiolironlipidLPO-
Journal Article 2020-09-18 ✓ 5 Snippets Rynkowska A, Stępniak J, Karbownik-Lewińska M.
In-Text Gene Mentions

It is worth mentioning that in women with hemochromatosis (caused by, for example, a mutated HFE gene), thyroid diseases can be accompanied by pathological process in ovaries; C282Y mutation in the HFE gene may cause the development of epithelial ovarian cancer [29].

…asymptomatic and symptomatichemochromatosisare characterized by…

…in patients withhemochromatosis, while in healthy…

…to hemosiderosis orhemochromatosis, typically associated with…

Hemochromatosis, a genetically-determined dis…

Show Full Abstract

The Fenton reaction (Fe<sup>2+</sup>+H<sub>2</sub>O<sub>2</sub>→Fe<sup>3+</sup>+<sup>•</sup>OH+OH<sup>-</sup>) results in strong oxidative damage to macromolecules when iron (Fe) or hydrogen peroxide (H<sub>2</sub>O<sub>2</sub>) are in excess. This study aims at comparing Fe<sup>2+</sup>+H<sub>2</sub>O<sub>2</sub>-induced oxidative damage to membrane lipids (lipid peroxidation, LPO) and protective effects of 17β-estradiol (a potential antioxidant) in porcine ovary and thyroid homogenates. Iron, as one of the Fenton reaction substrates, was used in the highest achievable concentrations. Thyroid or ovary homogenates were incubated in the presence of: (1st) FeSO<sub>4</sub>+H<sub>2</sub>O<sub>2</sub> with/without 17β-estradiol (1 mM; 100, 10.0, 1.0 µM; 100, 10.0, 1.0 nM; 100, 10.0, 1.0 pM); five experiments were performed with different FeSO<sub>4</sub> concentrations (2400, 1200, 600, 300, 150 µM); (2nd) FeSO<sub>4</sub> (2400, 1200, 600, 300, 150 µM)+H<sub>2</sub>O<sub>2</sub> with/without 17β-estradiol; three experiments were performed with three highest 17β-estradiol concentrations; (3rd) FeSO<sub>4</sub> (2400, 1200, 1100, 1000, 900, 800, 700, 600, 300, 150, 75 µM)+H<sub>2</sub>O<sub>2</sub> (5 mM). LPO level [MDA+4-HDA/mg protein] was measured spectrophotometrically. The basal LPO level is lower in ovary than in thyroid homogenates. However, experimentally-induced LPO was higher in the former tissue, which was confirmed for the three highest Fe<sup>2+</sup> concentrations (2400, 1200, 1100 µM). Exogenous 17β-estradiol (1 mM, 100, and 10 µM) reduced experimentally-induced LPO independently of iron concentration and that protective effect did not differ between tissues. The ovary, compared to the thyroid, reveals higher sensitivity to prooxidative effects of iron, however, it showed similar responsivity to protective 17β-estradiol activity. The therapeutic effect of 17β-estradiol against iron overload consequences should be considered with relation to both tissues.

Also flagged:PeriodontitisColorectal Cancercell cycleinflammatory responsemicrobially-associated inflammatory diseasesystemic inflammatory conditions
Journal Article 2020-09-18 No Snippets Di Spirito F, Toti P, Pilone V, Carinci F, Lauritano D, Sbordone L.
Show Full Abstract

Periodontitis has been associated with an increased risk of and mortality associated with human colorectal cancer (CRC). Current evidence attributes such an association to the direct and indirect effects of virulence factors belonging to periodontal pathogens, to inflammatory mediators and to genetic factors. The aims of the study were to assess the existence of a genetic linkage between periodontitis and human CRC, to identify genes considered predominant in such a linkage, thus named leader genes, and to determine pathogenic mechanisms related to the products of leader genes. Genes linking periodontitis and CRC were identified and classified in order of predominance, through an experimental investigation, performed via computer simulation, employing the leader gene approach. Pathogenic mechanisms relating to leader genes were determined through cross-search databases. Of the 83 genes linking periodontitis and CRC, 12 were classified as leader genes and were pathogenically implicated in cell cycle regulation and in the immune-inflammatory response. The current results, obtained via computer simulation and requiring further validation, support the existence of a genetic linkage between periodontitis and CRC. Cell cycle dysregulation and the alteration of the immuno-inflammatory response constitute the pathogenic mechanisms related to the products of leader genes.

Also flagged:ARWntcancerdeathandrogenprostate cancer
Journal Article 2020-09-18 No Snippets Luo J, Wang D, Wan X, Xu Y, Lu Y, Kong Z, Li D, Gu W, Wang C, Li Y, Ji C, Gu S, Xu Y.
Show Full Abstract

<h4>Introduction</h4>Prostate cancer (PCa) is the most commonly diagnosed cancer and the third leading cause of cancer-related death in males in the United States. Despite the initial efficacy of androgen deprivation therapy in prostate cancer (PCa) patients, most patients progress to castration-resistant prostate cancer. However, the mechanisms underlying the androgen-independent progression of PCa remain largely unknown.<h4>Methods</h4>In this study, we established a PCa cell line (LNCaP-AI) by maintaining LNCaP cells under androgen-depleted conditions. To explore the cellular and molecular mechanisms of androgen-independent growth of PCa, we analyzed the gene expression patterns in androgen-independent prostate cancer (AIPC) compared with that in androgen-dependent prostate cancer (ADPC). KEGG pathway analysis revealed that Wnt signaling pathways were activated after androgen deprivation therapy (ADT). In vitro experiments showed that the inhibition of Wnt pathway reduced AIPC cell growth by inhibiting cell cycle progression and promoting apoptosis. Furthermore, <i>WNT5A, LEF1</i> were identified as direct targets of AR by chromatin immunoprecipitation (ChIP) assay and public ChIP-seq datasets analysis.<h4>Results</h4>In the present study, we found a regulatory mechanism through which crosstalk between androgen receptor (AR) and Wnt signals promoted androgen-independent conversion of PCa. The Wnt pathway was inhibited by androgen in androgen-dependent prostate cancer cells, but this blocking effect was not elicited in androgen-independent prostate cancer (AIPC) cells. Moreover, Wnt pathway genes <i>WNT5A</i> and <i>LEF1</i> were directly downregulated by AR. In vitro experiments showed that inhibition of the Wnt pathways repressed AIPC cell growth by inhibiting cell cycle progression and promoting apoptosis. We found that <i>WNT5A</i> and <i>LEF1</i> were downregulated in low-grade PCa but upregulated in metastatic PCa.<h4>Conclusion</h4>In summary, we revealed that crosstalk between AR and Wnt signaling pathways promotes androgen-independent growth of PCa, which may provide novel therapeutic opportunities for castration-resistant prostate cancer.

Also flagged:Ironmetabolismtumordeathferroptosisleukemia
Journal Article 2020-09-18 No Snippets Grignano E, Birsen R, Chapuis N, Bouscary D.
Show Full Abstract

Despite its crucial importance in numerous physiological processes, iron also causes oxidative stress and damage which can promote the growth and proliferation of leukemic cells. Iron metabolism is strictly regulated and the related therapeutic approaches to date have been to restrict iron availability to tumor cells. However, since a new form of iron-catalyzed cell death has been described, termed ferroptosis, and subsequently better understood, iron excess is thought to represent an opportunity to selectively kill leukemic cells and spare normal hematopoietic cells, based on their differential iron needs. This review summarizes the physiology of iron metabolism and its deregulation in leukemia, the known ferrotoposis pathways, and therapeutic strategies to target the altered iron metabolism in leukemia for the purposes of initiating ferroptosis in these cancer cells.

Also flagged:AgingPathogenesisHuntington diseaseHDneurodegenerative disorderautosomal dominant neurodegenerative disease
Journal Article 2020-09-18 ✓ 5 Snippets Machiela E, Jeloka R, Caron NS, Mehta S, Schmidt ME, Baddeley HJE, Tom CM, Polturi N, Xie Y, Mattis VB, Hayden MR, Southwell AL.
In-Text Gene Mentions

Huntington disease (HD) is a fatal, inherited neurodegenerative disorder caused by a mutation in the huntingtin (HTT) gene.

While mutant HTT is present ubiquitously throughout life, HD onset typically occurs in mid-life.

Huntington disease (HD) is an autosomal dominant neurodegenerative disease caused by an expanded polyglutamine encoding CAG tract in the huntingtin (HTT) gene (MacDonald et al., 1993).

…the huntingtin (HTT) gene.…

…the huntingtin (HTT) gene (MacDonald…

Show Full Abstract

Huntington disease (HD) is a fatal, inherited neurodegenerative disorder caused by a mutation in the huntingtin (<i>HTT</i>) gene. While mutant HTT is present ubiquitously throughout life, HD onset typically occurs in mid-life. Oxidative damage accumulates in the aging brain and is a feature of HD. We sought to interrogate the roles and interaction of age and oxidative stress in HD using primary Hu97/18 mouse neurons, neurons differentiated from HD patient induced pluripotent stem cells (iPSCs), and the brains of HD mice. We find that primary neurons must be matured in culture for canonical stress responses to occur. Furthermore, when aging is accelerated in mature HD neurons, mutant HTT accumulates and sensitivity to oxidative stress is selectively enhanced. Furthermore, we observe HD-specific phenotypes in neurons and mouse brains that have undergone accelerated aging, including a selective increase in DNA damage. These findings suggest a role for aging in HD pathogenesis and an interaction between the biological age of HD neurons and sensitivity to exogenous stress.

Also flagged:Microtubular Tubulin Beta 6 Class VTUBB6GlioblastomaGBMmitochondriamitochondrial-
Journal Article 2020-09-18 ✓ 2 Snippets Jiang L, Zhu X, Yang H, Chen T, Lv K.
In-Text Gene Mentions

Recently, we detected the HMG-box family establishing the significance of SOX6 in the malignant progression of GBM (Jiang et al., 2020a), and found three core genes associated with survival in GBM (Jiang et al., 2020b).

…the significance ofSOX6in the malignant…

Show Full Abstract

Glioblastoma (GBM) has long been a major clinical research challenge to scientists. The pivotal role of the mitochondria related gene family in the promotion of GBM tumorigenesis is not clear. We detected that microtubular tubulin beta 6 class V (TUBB6) was one of 33 differentially expressed mitochondrial-focused genes (DEMFGs) in GBM, and considered that TUBB6 is a potential therapeutic target in GBM. TUBB6 was vital for GBM and marked as the key prognostic gene in primary GBM. Mutations of TUBB6 in GBM were rare. Only four TUBB6 co-expressed hub genes (ANXA2, S100A11, FLNA, and MSN) exhibited poorer overall survival rates in higher expression groups (<i>p</i>-value < 0.05). We have confirmed the up-regulation of TUBB6 and its partners, ANXA2 and S100A11 in GBM and validated their importance as prognostic factors in primary GBM. TUBB6 was significantly correlated with stromal score in GBM samples (<i>p</i>-value = 6.99E-04). This study aimed to assess the importance of novel hub genes by analyzing the expression, potential function and prognostic impact of TUBB6 in human primary GBM cancer.

medRxiv 2020-09-18 Preprint (No Snippets API) Reyes L, Sanchez-Garcia MA, Morrison T, Howden AJ, Watts ER, Arienti S, Sadiku P, Coelho P, Mirchandani AS, Hope D, Clark SK, Singleton J, Johnston S, Grecian R, Poon A, Mcnamara S, Harper I, Fourman MH, Brenes AJ, Pathak S, Lloyd A, Blanco GR, Kriegsheim Av, Ghesquiere B, Vermaelen W, Cologna CT, Dhaliwal K, Hirani N, Dockrell D, Whyte MK, Griffith D, Cantrell DA, Walmsley SR.
Show Full Abstract

<h4>Summary</h4> Understanding the mechanisms by which infection with SARS-CoV-2 leads to acute respiratory distress syndrome (ARDS) is of significant clinical interest given the mortality associated with severe and critical coronavirus induced disease 2019 (COVID-19). Neutrophils play a key role in the lung injury characteristic of non-COVID-19 ARDS, but a relative paucity of these cells is observed at post-mortem in lung tissue of patients who succumb to infection with SARS-CoV-2. With emerging evidence of a dysregulated innate immune response in COVID-19, we undertook a functional proteomic survey of circulating neutrophil populations, comparing patients with COVID-19 ARDS, non-COVID-19 ARDS, moderate COVID-19, and healthy controls. We observe that expansion of the circulating neutrophil compartment and the presence of activated low and normal density mature and immature neutrophil populations occurs in both COVID-19 and non-COVID-19 ARDS. In contrast, release of neutrophil granule proteins, neutrophil activation of the clotting cascade and formation of neutrophil platelet aggregates is significantly increased in COVID-19 ARDS. Importantly, activation of components of the neutrophil type I IFN responses is specific to infection with SARS-CoV-2 and linked to metabolic rewiring. Together this work highlights how differential activation of circulating neutrophil populations may contribute to the pathogenesis of ARDS, identifying processes that are specific to COVID-19 ARDS.

medRxiv 2020-09-18 Preprint (No Snippets API) Bernardes JP, Mishra N, Tran F, Bahmer T, Best L, Blase JI, Bordoni D, Franzenburg J, Geisen U, Josephs-Spaulding J, Köhler P, Künstner A, Rosati E, Aschenbrenner AC, Bacher P, Baran N, Boysen T, Brandt B, Bruse N, Dörr J, Dräger A, Elke G, Ellinghaus D, Fischer J, Forster M, Franke A, Franzenburg S, Frey N, Friedrichs A, Fuß J, Glück A, Hamm J, Hinrichsen F, Hoeppner MP, Imm S, Junker R, Kaiser S, Kan YH, Knoll R, Lange C, Laue G, Lier C, Lindner M, Marinos G, Markewitz R, Nattermann J, Noth R, Pickkers P, Rabe KF, Renz A, Röcken C, Rupp J, Schaffarzyk A, Scheffold A, Schulte-Schrepping J, Schunck D, Skowasch D, Ulas T, Wandinger K, Wittig M, Zimmermann J, Zimmermann J, Busch H, Hoyer B, Kaleta C, Heyckendorf J, Kox M, Rybniker J, Schreiber S, Schultze J, Rosenstiel P, HCA Lung Biological Network and the Deutsche COVID-19 Omics Initiative (DeCOI).
Show Full Abstract

The pandemic spread of the potentially life-threatening disease COVID-19 requires a thorough understanding of the longitudinal dynamics of host responses. Temporal resolution of cellular features associated with a severe disease trajectory will be a pre-requisite for finding disease outcome predictors. Here, we performed a longitudinal multi-omics study using a two-centre German cohort of 13 patients (from Cologne and Kiel, cohort 1). We analysed the bulk transcriptome, bulk DNA methylome, and single-cell transcriptome (>358,000 cells, including BCR profiles) of peripheral blood samples harvested from up to 5 time points. The results from single-cell and bulk transcriptome analyses were validated in two independent cohorts of COVID-19 patients from Bonn (18 patients, cohort 2) and Nijmegen (40 patients, cohort 3), respectively. We observed an increase of proliferating, activated plasmablasts in severe COVID-19, and show a distinct expression pattern related to a hyperactive cellular metabolism of these cells. We further identified a notable expansion of type I IFN-activated circulating megakaryocytes and their progenitors, indicative of emergency megakaryopoiesis, which was confirmed in cohort 2. These changes were accompanied by increased erythropoiesis in the critical phase of the disease with features of hypoxic signalling. Finally, projecting megakaryocyte- and erythroid cell-derived co-expression modules to longitudinal blood transcriptome samples from cohort 3 confirmed an association of early temporal changes of these features with fatal COVID-19 disease outcome. In sum, our longitudinal multi-omics study demonstrates distinct cellular and gene expression dynamics upon SARS-CoV-2 infection, which point to metabolic shifts of circulating immune cells, and reveals changes in megakaryocytes and increased erythropoiesis as important outcome indicators in severe COVID-19 patients.

Research Square 2020-09-18 Preprint (No Snippets API) Krivosheeva I, Filatova A, Moshkovskii S, Baranova A, Skoblov M.
Show Full Abstract

<title>Abstract</title> <p>Cancers may be treated by selective targeting of the genes vital for their survival. A number of attempts have led to discovery of several genes essential for surviving of tumor cells of different types. In this work, we tried to analyze genes that were previously predicted to be essential for melanoma surviving. Here we present the results of transient siRNA-mediated knockdown of the four of such genes, namely, UNC45A, STK11IP, RHPN2 and ZNFX1, in melanoma cell line A375, then assayed the cells for their viability, proliferation and ability to migrate in vitro. In our study, the knockdown of the genes predicted as essential for melanoma survival does not lead to statistically significant changes in cell viability. On the other hand, for each of the studied genes, mobility assays showed that the knockdown of each of the target genes accelerates the speed of cells migrating. Possible explanation for such counterintuitive results may include insufficiency of the predicting computational models or the necessity of a multiplex knockdown of the genes.AimsTo examine the hypothesis of essentiality of hypomutated genes for melanoma surviving we have performed knockdown of several genes in melanoma cell line and analyzed cell viability and their ability to migrate.MethodsKnockdown was performed by siRNAs transfected by Metafectene PRO. The levels of mRNAs before and after knockdown were evaluated by RT-qPCR analysis. Cell viability and proliferation were assessed by MTT assay. Cell migration was assessed by wound healing assay.ResultsThe knockdown of the genes predicted as essential for melanoma survival does not lead to statistically significant changes in cell viability. On the other hand, for each of the studied genes, mobility assays showed that the knockdown of each of the target genes accelerates the speed of cells migrating. ConclusionOur results do not confirm initial hypothesis that the genes predicted essential for melanoma survival as a matter of fact support the survival of melanoma cells.</p>

Also flagged:catalytic activitymacromoleculeinfectionglutamine amidotransferaseGATkinase
Journal Article 2020-09-17 No Snippets Wang TY, Zhao J, Savas AC, Zhang S, Feng P, Feng P.
Show Full Abstract

Pseudoenzymes are proteins that are evolutionarily related to active enzymes, but lack relevant catalytic activity. As obligate intracellular pathogens, viruses complete their life cycle fully dependent on the cellular supplies of macromolecule and energy. Traditionally, studies of viral proteins sharing high homology with host counterparts reveal insightful mechanisms by which host signaling pathways are delicately regulated. Recent investigations into the action of cellular pseudoenzymes elucidate diverse molecular means how enzymes are differentially controlled under various physiological conditions, hinting to the potential that pathogens may exploit these regulatory modalities. To date, there have been three types of viral pseudoenzymes reported and our understanding concerning their mechanism of regulation is rudimentary at best. However, it is clear that viral pseudoenzymes are emerging with surprising functions in infection and immunity, and we are only at the beginning to understand this new group of enzyme regulators. In this review, we will summarize current knowledge in viral pseudoenzymes and provide a perspective for future research.

Also flagged:silverdiaminefluorideproanthocyanidinwatercollagen
Journal Article 2020-09-17 No Snippets Firouzmandi M, Vasei F, Giti R, Sadeghi H.
Show Full Abstract

The aim of this study was to evaluate the effect of silver diamine fluoride and grape seed extract on the microstructure and mechanical properties of carious dentin following exposure to acidic challenge. Ninety-eight molars with occlusal caries were used. In the control group the specimens were kept in distilled water. In the GSE group, the specimens were immersed in 6.5% grape seed extract solution for 30 minutes. In the SDF group, the specimens were immersed in 30% SDF solution for 4 minutes. In the GSE+SDF group, the specimens were immersed in 6.5% grape seed extract solution for 30 minutes and then exposed to 30% SDF solution for 4 minutes. All the groups underwent pH cycling model for 8 days. Microhardness measurements were taken at the baseline before surface treatments and after pH cycling. Elastic modulus was measured, after pH cycling. In the control group, the final hardness was significantly lower than the initial hardness (P = 0.001). In the SDF group, the final hardness was significantly higher than the initial hardness (P < 0.001). There was no significant difference between the initial and final hardness values in the GSE and GSE + SDF groups (p = 0.92, p = 0.07). The H1-H0 in the SDF group was significantly higher than the other groups (P<0.05). Moreover, elastic modulus of the experimental groups except GSE+SDF group was significantly higher than control. The highest mean elastic modulus was detected in the SDF group (P<0.001). The use of SDF and GSE prior to the acid challenge improved mechanical properties. Microstructural investigation, using scanning electron microscope showed dentin structure protection against acid challenges with SDF treatment and collagen matrix stabilization with GSE treatment. However combined use of these agents was not beneficious.

Also flagged:synapsesmembranesynapseSOMVIPlocomotion
Journal Article 2020-09-17 No Snippets Sanzeni A, Histed MH, Brunel N.
Show Full Abstract

Combining information from multiple sources is a fundamental operation performed by networks of neurons in the brain, whose general principles are still largely unknown. Experimental evidence suggests that combination of inputs in cortex relies on nonlinear summation. Such nonlinearities are thought to be fundamental to perform complex computations. However, these non-linearities are inconsistent with the balanced-state model, one of the most popular models of cortical dynamics, which predicts networks have a linear response. This linearity is obtained in the limit of very large recurrent coupling strength. We investigate the stationary response of networks of spiking neurons as a function of coupling strength. We show that, while a linear transfer function emerges at strong coupling, nonlinearities are prominent at finite coupling, both at response onset and close to saturation. We derive a general framework to classify nonlinear responses in these networks and discuss which of them can be captured by rate models. This framework could help to understand the diversity of non-linearities observed in cortical networks.

Also flagged:Gene expressionparkinsonismdegenerative diseasePDα-synucleinPink1
Journal Article 2020-09-17 ✓ 5 Snippets Kelm-Nelson CA, Gammie S.
In-Text Gene Mentions

…and Krt2 andHfewere found in…

…Kert2 , andHfe.…

…between Pink1 andHfesuggests a mitochondrial:…

Hfeexpression modulates cellular…

Hfepolymorphisms also affect…

Show Full Abstract

<h4>Background</h4>Parkinson's disease (PD) is a degenerative disease with early-stage pathology hypothesized to manifest in brainstem regions. Vocal deficits, including soft, monotone speech, result in significant clinical and quality of life issues and are present in 90% of PD patients; yet the underlying pathology mediating these significant voice deficits is unknown. The Pink1-/- rat is a valid model of early-onset PD that presents with analogous vocal communication deficits. Previous work shows abnormal α-synuclein protein aggregation in the periaqueductal gray (PAG), a brain region critical and necessary to the modulation of mammalian vocal behavior. In this study, we used high-throughput RNA sequencing to examine gene expression within the PAG of both male and female Pink1-/- rats as compared to age-matched wildtype controls. We used a bioinformatic approach to (1) test the hypothesis that loss of Pink1 in the PAG will influence the differential expression of genes that interact with Pink1, (2) highlight other key genes that relate to this type of Mendelian PD, and (3) catalog molecular targets that may be important for the production of rat vocalizations.<h4>Results</h4>Knockout of the Pink1 gene resulted in differentially expressed genes for both male and female rats that also mapped to human PD datasets. Pathway analysis highlighted several significant metabolic pathways. Weighted gene co-expression network analysis (WGCNA) was used to identify gene nodes and their interactions in (A) males, (B) females, and (C) combined-sexes datasets. For each analysis, within the module containing the Pink1 gene, Pink1 itself was the central node with the highest number of interactions with other genes including solute carriers, glutamate metabotropic receptors, and genes associated with protein localization. Strong connections between Pink1 and Krt2 and Hfe were found in both males and female datasets. In females a number of modules were significantly correlated with vocalization traits.<h4>Conclusions</h4>Overall, this work supports the premise that gene expression changes in the PAG may contribute to the vocal deficits observed in this PD rat model. Additionally, this dataset identifies genes that represent new therapeutic targets for PD voice disorders.

Also flagged:N6-methyladeninemetabolismnuclear exportmalignant tumour of the central nervousgliomasglioblastoma
Journal Article 2020-09-17 ✓ 1 Snippet Zhang Y, Geng X, Li Q, Xu J, Tan Y, Xiao M, Song J, Liu F, Fang C, Wang H.
In-Text Gene Mentions

…synergistic with Sox2,Pou3f2and Sall2 and…

Show Full Abstract

The chemical modification of RNA is a newly discovered epigenetic regulation mechanism in cells and plays a crucial role in a variety of biological processes. N6-methyladenine (m6A) mRNA modification is the most abundant form of posttranscriptional RNA modification in eukaryotes. Through the development of m6A RNA sequencing, the relevant molecular mechanism of m6A modification has gradually been revealed. It has been found that the effect of m6A modification on RNA metabolism involves processing, nuclear export, translation and even decay. As the most common malignant tumour of the central nervous system, gliomas (especially glioblastoma) have a very poor prognosis, and treatment efficacy is not ideal even with the application of high-intensity treatment measures of surgery combined with chemoradiotherapy. Exploring the origin and development mechanisms of tumour cells from the perspective of tumour biogenesis has always been a hotspot in the field of glioma research. Emerging evidence suggests that m6A modification can play a key role in gliomas through a variety of mechanisms, providing more possibilities for early diagnosis and targeted therapy of gliomas. The aim of the present review is to focus on the research progress regarding the association between m6A modification and gliomas. And to provide a theoretical basis according to the currently available literature for further exploring this association. This review may provide new insights for the molecular mechanism, early diagnosis, histologic grading, targeted therapy and prognostic evaluation of gliomas.

Also flagged:gastric canceradenocarcinomasmucinMuc6Muc2CD10
Journal Article 2020-09-17 ✓ 1 Snippet Fujita Y, Uesugi N, Sugimoto R, Eizuka M, Toya Y, Akasaka R, Matsumoto T, Sugai T.
In-Text Gene Mentions

…polymorphisms at theDCClocus were tested.…

Show Full Abstract

<h4>Background</h4>Crawling-type adenocarcinoma (CRA) is an important gastric cancer (GC) subtype that exhibits a specific histological pattern and has characteristic clinicopathological findings. Despite its characteristic histology, little is known about the molecular characteristics of CRA.<h4>Methods</h4>We examined 177 GC cases, including 51 cases of CRA and 126 cases having conventional differentiated adenocarcinomas (CDAs). Results for immunohistochemistry (mucin phenotype; Muc5AC, Muc6, Muc2 and CD10, CDX-2, MLH-1, p53 and β-catenin), mutation analysis (TP53, KRAS and BRAF), microsatellite instability (BAT25, BAT26, D2S123, D5S346 and D17S250), DNA methylation status by a two-panel method (RUNX3, MINT31, LOX, NEUROG1, ELMO1 and THBD), MLH-1 promoter methylation, and allelic imbalance (AI; 1p, 3p, 4p, 5q, 8p, 9p, 13q, TP53, 18q and 22q) were examined.<h4>Results</h4>CRAs were more likely to occur in the middle third of the stomach, in younger patients and to be macroscopically depressed. Nuclear accumulation of β-catenin and loss of MLH-1 expression were less frequent among CRA cases compared to CDA cases. At a molecular level, CRA is often characterized by the deletion mutation c.529_546 (18-base pair deletion at codon 177-182 in exon 5) in the TP53 gene (10 cases). Although the low methylation epigenotype was significantly more frequent for CRAs compared to CDAs, multiple AIs were more often seen in CRAs relative to CDAs.<h4>Conclusions</h4>The results demonstrated that TP53 mutations, particularly c.529_546del, and multiple AIs are closely associated with CRA carcinogenesis. Our results suggest that CRA is an independent entity of GC in terms of clinicopathologic and molecular findings.

Also flagged:Brain-Derived Neurotrophic FactorNeurodegenerative DiseasesBDNFneurotrophinneurogenesispathogenesis
Journal Article 2020-09-17 ✓ 1 Snippet Eyileten C, Sharif L, Wicik Z, Jakubik D, Jarosz-Popek J, Soplinska A, Postula M, Czlonkowska A, Kaplon-Cieslicka A, Mirowska-Guzel D.
In-Text Gene Mentions

Ultimately, HD is caused by an expanded CAG repeat in the huntingtin gene (HTT) which results in abnormal protein processing and aggregation [61].

Show Full Abstract

Brain-derived neurotrophic factor (BDNF) is a member of the neurotrophin family of growth factors that plays a crucial role in the development of the nervous system while supporting the survival of existing neurons and instigating neurogenesis. Altered levels of BDNF, both in the circulation and in the central nervous system (CNS), have been reported to be involved in the pathogenesis of neurodegenerative diseases, including Alzheimer's disease (AD), Parkinson's disease (PD), amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), multiple sclerosis (MS), and ischemic stroke. MicroRNAs (miRNAs) are a class of non-coding RNAs found in body fluids such as peripheral blood and cerebrospinal fluid. Several different miRNAs, and their target genes, are recognized to be involved in the pathophysiology of neurodegenerative and neurovascular diseases. Thus, they present as promising biomarkers and a novel treatment approach for CNS disorders. Currently, limited studies provide viable evidence of miRNA-mediated post-transcriptional regulation of BDNF. The aim of this review is to provide a comprehensive assessment of the current knowledge regarding the potential diagnostic and prognostic values of miRNAs affecting BDNF expression and its role as a CNS disorders and neurovascular disease biomarker. Moreover, a novel therapeutic approach in neurodegenerative diseases and ischemic stroke targeting miRNAs associated with BDNF will be discussed.

Also flagged:nucleotidesorganizationcancerRNA polymerase IIcell cycleimmune response
Journal Article 2020-09-17 ✓ 1 Snippet Sun Q, Song YJ, Prasanth KV.
In-Text Gene Mentions

OLFM4

Show Full Abstract

Long noncoding RNAs (lncRNAs) are RNA transcripts longer than 200 nucleotides that do not code for proteins. LncRNAs play crucial regulatory roles in several biological processes via diverse mechanisms and their aberrant expression is associated with various diseases. LncRNA genes are further subcategorized based on their relative organization in the genome. MicroRNA (miRNA)-host-gene-derived lncRNAs (lnc-MIRHGs) refer to lncRNAs whose genes also harbor miRNAs. There exists crosstalk between the processing of lnc-MIRHGs and the biogenesis of the encoded miRNAs. Although the functions of the encoded miRNAs are usually well understood, whether those lnc-MIRHGs play independent functions are not fully elucidated. Here, we review our current understanding of lnc-MIRHGs, including their biogenesis, function, and mechanism of action, with a focus on discussing the miRNA-independent functions of lnc-MIRHGs, including their involvement in cancer. Our current understanding of lnc-MIRHGs strongly indicates that this class of lncRNAs could play important roles in basic cellular events as well as in diseases. This article is categorized under: Regulatory RNAs/RNAi/Riboswitches > Regulatory RNAs Regulatory RNAs/RNAi/Riboswitches > Biogenesis of Effector Small RNAs.

Also flagged:WntaxonaxonsaxonalNetrinRobo2
Journal Article 2020-09-17 ✓ 1 Snippet Zhang Q, Zhang C, Zhang C, Peng G.
In-Text Gene Mentions

…the guidance moleculesDcc-Netrin and Robo2-Slit, but…

Show Full Abstract

The nervous system relies upon correct interconnections to exert its normal function. During vertebrate embryonic development, highly stereotyped scaffolds of axon tracts are formed early in the brain to set the foundation for the neuronal interconnections. During zebrafish early development, anterior dorsal telencephalic (ADt) neurons extend axons along the ipsilateral supraoptic tract (SOT) and the contralateral anterior commissure (AC). Our previous study shows axonal outgrowths along the AC/SOT tracts are coordinated by the guidance molecules Dcc-Netrin and Robo2-Slit, but it is not known how the expressions of these guidance molecules are regulated in the forebrain tissues. Here we show ectopic activation of Wnt signaling abolishes the ipsilateral SOT originating from the ADt neurons. Further mechanistic studies show ectopic activation of Wnt signaling significantly reduces Slits' expression, whilst mis-expression of Slit3 rescues SOT outgrowth. Together, our findings indicate Wnt signaling controls the ipsilateral axonal outgrowth through the regulation of slits' expression in the zebrafish forebrain.

Also flagged:Metabolismischemic heart diseasemitochondriallipidorganizationlipomatosis
Journal Article 2020-09-17 ✓ 1 Snippet Azimzadeh O, Azizova T, Merl-Pham J, Blutke A, Moseeva M, Zubkova O, Anastasov N, Feuchtinger A, Hauck SM, Atkinson MJ, Tapio S.
In-Text Gene Mentions

…delta isomerase 2 (ECI2) were all downregulated.…

Show Full Abstract

Epidemiological studies on workers employed at the Mayak plutonium enrichment plant have demonstrated an association between external gamma ray exposure and an elevated risk of ischemic heart disease (IHD). In a previous study using fresh-frozen post mortem samples of the cardiac left ventricle of Mayak workers and non-irradiated controls, we observed radiation-induced alterations in the heart proteome, mainly downregulation of mitochondrial and structural proteins. As the control group available at that time was younger than the irradiated group, we could not exclude age as a confounding factor. To address this issue, we have now expanded our study to investigate additional samples using archival formalin-fixed paraffin-embedded (FFPE) tissue. Importantly, the control group studied here is older than the occupationally exposed (>500 mGy) group. Label-free quantitative proteomics analysis showed that proteins involved in the lipid metabolism, sirtuin signaling, mitochondrial function, cytoskeletal organization, and antioxidant defense were the most affected. A histopathological analysis elucidated large foci of fibrotic tissue, myocardial lipomatosis and lymphocytic infiltrations in the irradiated samples. These data highlight the suitability of FFPE material for proteomics analysis. The study confirms the previous results emphasizing the role of adverse metabolic changes in the radiation-associated IHD. Most importantly, it excludes age at the time of death as a confounding factor.

Also flagged:hematologic malignanciessolid tumorshematological tumorwaterhematologic malignanciescancer
Journal Article 2020-09-17 No Snippets Antona S, Platzman I, Spatz JP.
Show Full Abstract

Natural killer (NK) cells are key players of the innate immune system. Due to their rapid cytotoxicity against infectious pathogens, hematologic malignancies, and solid tumors, NK cells represent solid candidates for cell-based immunotherapy. Despite the progress made in recent years, the heterogeneity in their cytotoxic behavior represents a drawback. With the goal of screening the intrinsic diversity of NK cells, droplet-based microfluidic technology is exploited to develop a single-cell time-efficient cytotoxicity assay. Toward this end, NK-92 cells are coencapsulated with hematological tumor cell lines in water-in-oil droplets of different sizes and their cytotoxic activity is evaluated. The effect of droplet-based confinement on NK cytotoxicity is investigated by controlling the droplet volume. The successful optimization of the droplet size allows for time efficiency compared to cytotoxicity assays based on flow cytometry. Additionally, the ability of individual NK-92 cells to kill multiple target cells in series is explored, expanding the knowledge about the serial killing process dynamics. The developed droplet-based microfluidic assay does not require the labeling of NK cells and represents a step toward developing of a forthcoming process for the selection of NK cells with the highest cytotoxicity against specific targets.

Also flagged:Eating DisordersEDmiscarriagematernal malnutritionmalnutritionsubstance of abuse
Journal Article 2020-09-17 ✓ 2 Snippets Sebastiani G, Andreu-Fernández V, Herranz Barbero A, Aldecoa-Bilbao V, Miracle X, Meler Barrabes E, Balada Ibañez A, Astals-Vizcaino M, Ferrero-Martínez S, Gómez-Roig MD, García-Algar O.
In-Text Gene Mentions

Other genes silenced by a high-fat diet and recently related to obesity are FYN (a member of the Src family of non-receptor tyrosine kinase related to inflammation, adipocyte differentiation, and insulin signaling), TAOK3 (an activator of the protein kinase MAPK cascade which affects fundamental cellular signaling pathways), PIWIL4 (a regulator of adipocyte proliferation) (139), and SIRT1 (expression stimulates the metabolism of fats in adipocytes by suppressing the Peroxisome proliferator-activated receptor PPARγ, also participating in the regulation of glucose homeostasis, anti-inflammatory activity and oxidative stress) (140).

…and insulin signaling),TAOK3(an activator of…

Show Full Abstract

<b>Introduction:</b> Eating disorders (EDs) have increased globally in women of childbearing age, related to the concern for body shape promoted in industrialized countries. Pregnancy may exacerbate a previous ED or conversely may be a chance for improving eating patterns due to the mother's concern for the unborn baby. EDs may impact pregnancy evolution and increase the risk of adverse outcomes such as miscarriage, preterm delivery, poor fetal growth, or malformations, but the knowledge on this topic is limited. <b>Methods:</b> We performed a systematic review of studies on humans in order to clarify the mechanisms underpinning the adverse pregnancy outcomes in patients with EDs. <b>Results:</b> Although unfavorable fetal development could be multifactorial, maternal malnutrition, altered hormonal pathways, low pre-pregnancy body mass index, and poor gestational weight gain, combined with maternal psychopathology and stress, may impair the evolution of pregnancy. Environmental factors such as malnutrition or substance of abuse may also induce epigenetic changes in the fetal epigenome, which mark lifelong health concerns in offspring. <b>Conclusions:</b> The precocious detection of dysfunctional eating behaviors in the pre-pregnancy period and an early multidisciplinary approach comprised of nutritional support, psychotherapeutic techniques, and the use of psychotropics if necessary, would prevent lifelong morbidity for both mother and fetus. Further prospective studies with large sample sizes are needed in order to design a structured intervention during every stage of pregnancy and in the postpartum period.

Also flagged:Sox2Lrig1Bmi1gastric cancercancerstomach diseases
Journal Article 2020-09-17 ✓ 2 Snippets Xiao S, Zhou L.
In-Text Gene Mentions

…markers: Lgr5, CD44,OLFM4Immunofluorescence/confocal mi…

…G protein-coupled receptor,OLFM4Olfactomedin 4, Muc…

Show Full Abstract

Gastric epithelium operates in a hazardous environment that curtails the lifespan of the constituent cells, imposing a requirement for continuous epithelial renewal. Stem cells that reside in the stomach are thus essential for regulating physiological tissue renewal and injury repair because of their self-renewal, high proliferation capacity and multiple differentiation potentials. Recent investigations using lineage tracing models have identified diverse populations of gastric stem cells and even fully differentiated cells that can regain stem cell capacity, so enriching our understanding on the identity and plasticity of gastric stem cells. These cell populations include the Villin promotor, Lgr5<sup>+</sup>, CCKR2<sup>+</sup>, Axin2<sup>+</sup> and AQP5<sup>+</sup> stem cells in the antrum, TFF2 mRNA, Mist1<sup>+</sup> cells and Troy<sup>+</sup> mature chief cells in the corpus, as well as Sox2, eR1, Lrig1, Bmi1-marked cell in both the antrum and the corpus. Establishment of gastric organoids derived from primary gastric tissues and pluripotent stem cells or embryonic stem cells characterizes niche factors required by the gastric stem cell populations, and further provides new insights into stomach development, host-Helicobacter pylori interactions and malignant transformation. Furthermore, focus on the gastric stem cells and their niches uncovers the initiation of stomach precancerous lesions and origin of gastric cancer, providing options for cancer prevention and intervention. In summary, with the development of stem cell research, gastric stem cells give us more opportunities to prevent and treat stomach diseases.

Also flagged:corticalcell adhesion moleculesfibronectin leucine-rich repeat transmembrane proteinscell adhesionaxonsynapse
Journal Article 2020-09-17 ✓ 3 Snippets Peregrina C, Del Toro D.
In-Text Gene Mentions

…hrough heterodimerization withDCCbetween their cytoplasmic…

…BothDCCand Unc5D are…

…Overexpression ofDCCdelays neuron migration…

Show Full Abstract

During development, two coordinated events shape the morphology of the mammalian cerebral cortex, leading to the cortex's columnar and layered structure: the proliferation of neuronal progenitors and cortical migration. Pyramidal neurons originating from germinal zones migrate along radial glial fibers to their final position in the cortical plate by both radial migration and tangential dispersion. These processes rely on the delicate balance of intercellular adhesive and repulsive signaling that takes place between neurons interacting with different substrates and guidance cues. Here, we focus on the function of the cell adhesion molecules fibronectin leucine-rich repeat transmembrane proteins (FLRTs) in regulating both the radial migration of neurons, as well as their tangential spread, and the impact these processes have on cortex morphogenesis. In combining structural and functional analysis, recent studies have begun to reveal how FLRT-mediated responses are precisely tuned - from forming different protein complexes to modulate either cell adhesion or repulsion in neurons. These approaches provide a deeper understanding of the context-dependent interactions of FLRTs with multiple receptors involved in axon guidance and synapse formation that contribute to finely regulated neuronal migration.

Also flagged:deathFerroptosisRASapoptotic cellironlipid
Journal Article 2020-09-17 No Snippets Kuang F, Liu J, Tang D, Kang R.
Show Full Abstract

Many new types of regulated cell death have been recently implicated in human health and disease. These regulated cell deaths have different morphological, genetic, biochemical, and functional hallmarks. Ferroptosis was originally described as a carcinogenic RAS-dependent non-apoptotic cell death, and is now defined as a type of regulated necrosis characterized by iron accumulation, lipid peroxidation, and the release of damage-associated molecular patterns (DAMPs). Multiple oxidative and antioxidant systems, acting together autophagy machinery, shape the process of lipid peroxidation during ferroptosis. In particular, the production of reactive oxygen species (ROS) that depends on the activity of nicotinamide adenine dinucleotide phosphate (NADPH) oxidases (NOXs) and the mitochondrial respiratory chain promotes lipid peroxidation by lipoxygenase (ALOX) or cytochrome P450 reductase (POR). In contrast, the glutathione (GSH), coenzyme Q10 (CoQ10), and tetrahydrobiopterin (BH<sub>4</sub>) system limits oxidative damage during ferroptosis. These antioxidant processes are further transcriptionally regulated by nuclear factor, erythroid 2-like 2 (NFE2L2/NRF2), whereas membrane repair during ferroptotic damage requires the activation of endosomal sorting complexes required for transport (ESCRT)-III. A further understanding of the process and function of ferroptosis may provide precise treatment strategies for disease.

Also flagged:AdiponectinObesitytriglyceridenon-alcoholic fatty liver diseaseNAFLDfibroblast growth factor
Journal Article 2020-09-17 ✓ 1 Snippet Tas E, Bai S, Ou X, Mercer K, Lin H, Mansfield K, Buchmann R, Diaz EC, Oden J, Børsheim E, Adams SH, Dranoff J.
In-Text Gene Mentions

…hepatitis, Wilson's disease,hemochromatosis, and biopsy or…

Show Full Abstract

<b>Background:</b> There is a pressing need for effective and non-invasive biomarkers to track intrahepatic triglyceride (IHTG) in children at-risk for non-alcoholic fatty liver disease (NAFLD), as standard-of-care reference tools, liver biopsy and magnetic resonance imaging (MRI), are impractical to monitor the course disease. <b>Objective:</b> We aimed to examine the association between serum fibroblast growth factor (FGF)-21 to adiponectin ratio (FAR) and IHTG as assessed by MRI in children with obesity. <b>Methods:</b> Serum FGF21 and adiponectin levels and IHTG were measured at two time points (baseline, 6 months) in obese children enrolled in a clinical weight loss program. The association between percent change in FAR and IHTG at final visit was examined using a multiple linear regression model. <b>Results:</b> At baseline, FAR was higher in the subjects with NAFLD (<i>n</i> = 23, 35.8 ± 41.9 pg/ng) than without NAFLD (<i>n</i> = 35, 19.8 ± 13.7 pg/ng; <i>p</i> = 0.042). Forty-eight subjects completed both visits and were divided into IHTG loss (≥1% reduction than baseline), no change (within ±1% change), and gain (≥1% increase than baseline) groups. At 6 months, the percent change in FAR was different among the three groups (<i>p</i> = 0.005). Multiple linear regression showed a positive relationship between percent change in FAR and the final liver fat percent in sex and pubertal stage-similar subjects with NAFLD at baseline (slope coefficient 6.18, 95% CI 1.90-10.47, <i>P</i> = 0.007), but not in those without NAFLD. <b>Conclusions:</b> Higher value in percent increase in FAR is positively associated with higher level of IHTG percent value at 6 months in children with baseline NAFLD. FAR could be a potential biomarker to monitor the changes in IHTG in children with NAFLD.

Also flagged:Hepatocellular CarcinomaLysine-translational modificationcancerhistone
Journal Article 2020-09-17 ✓ 2 Snippets Zhao Q, Zhang Z, Li J, Xu F, Zhang B, Liu M, Liu Y, Chen H, Yang J, Zhang J.
In-Text Gene Mentions

In this study, most proteins involved in reactive oxygen species (ROS) and oxidative stress contained lysine acetylation sites, such as SOD1, SOD2, PRDX1, PRDX3, PRDX6, HSD17B4, PECR, GSTA1, TXN, and CAT.

…SOD2, PRDX1, PRDX3,PRDX6, HSD17B4, PECR, GSTA1,…

Show Full Abstract

Lysine acetylation is a vital post-translational modification (PTM) of proteins, which plays an important role in cancer development. In healthy human liver tissues, multiple non-histone proteins were identified with acetylation modification, however, the role of acetylated proteins in hepatocellular carcinoma (HCC) development remains largely unknown. Here we performed a quantitative acetylome study of tumor and normal liver tissues from HCC patients. Overall, 598 lysine acetylation sites in 325 proteins were quantified, and almost 59% of their acetylation levels were significantly changed. The differentially acetylated proteins mainly consisted of non-histone proteins located in mitochondria and cytoplasm, which accounted for 42% and 24%, respectively. Bioinformatics analysis showed that differentially acetylated proteins were enriched in metabolism, oxidative stress, and signal transduction processes. In tumor tissues, 278 lysine sites in 189 proteins showed decreased acetylation levels, which occupied 98% of differentially acetylated proteins. Moreover, we collected twenty pairs of tumor and normal liver tissues from HCC male patients, and found that expression levels of SIRT1 (<i>p</i> = 0.002), SIRT2 (<i>p</i> = 0.01), and SIRT4 (<i>p</i> = 0.045) were significantly up-regulated in tumor tissues. Over-expression of possibly accounted for the widespread deacetylation of non-histone proteins identified in HCC tumor tissues, which could serve as promising predictors of HCC. Taken together, our work illustrates abundant differentially acetylated proteins in HCC tumor tissues, and offered insights into the role of lysine acetylation in HCC development. It provided potential biomarker and drug target candidates for clinical HCC diagnosis and treatment.

Also flagged:aggressionshydroxyapatitecollagenwatersodiumhypochlorite
Journal Article 2020-09-17 No Snippets Özcan M, Volpato CAM.
Show Full Abstract

Adhesion science is one of the greatest contributions to restorative dentistry. Adhesion not only established the current principles of tissue preservation, but also allowed for the production of more hermetic and long-lasting restorations. Although adhesive strategies are routinely used in most clinical situations, adhesion to root dentin is still a major challenge. The presence of humidity together with less intertubular dentin are factors that limit the adhesive potential of root dentin. This situation is more unfavorable in endodontically treated teeth prepared for prefabricated or custom-made intraradicular posts; these procedures may alter the mechanical properties of teeth by modifying the viable dentin surface for adhesion. Also, contaminants deposited on the dentin surface are difficult to remove through conventional techniques. Moreover, root canal morphology has a very unfavorable C-factor, bringing undesirable effects resulting from polymerization contraction of resin-based materials. However, the differences between coronal and root dentin are not a barrier for dentin adhesion. Standardization of procedures and care during clinical steps are fundamental to the success of adhesion to coronal or intraradicular dentin. Thus, it is essential to know the anatomy of the root structure, the factors that interfere with intraradicular adhesion, as well as the current adhesive materials and techniques.

Research Square 2020-09-17 Preprint (No Snippets API) Yan L, Chen H, Tang L, Jiang P, Yan F.
Show Full Abstract

<title>Abstract</title> <p><bold>Background:</bold> Super-enhancer-associated long non-coding RNAs (SE-lncRNAs) have been reported to play essential roles in tumorigenesis, but the fundamental mechanism of SE-lncRNAs in colorectal cancer (CRC) remains largely unknown. <bold>Methods:</bold> A microarray was performed to identify the differentially expressed SE-lncRNAs between CRC tissues and peritumoral tissues. A novel SE-lncRNA AC005592.2 was selected from these differentially expressed SE-lncRNAs to explore its effects in the CRC development. Fluorescence quantitative real-time PCR (qRT-PCR) was used to assay the expression of AC005592.2 in CRC tissues and cell lines. Functional assays were applied to identify the biological effects of AC005592.2 in CRC cells. Furthermore, RNA-seq was employed to predict potential targets of AC005592.2. <bold>Results:</bold> AC005592.2 was significantly increased in CRC tissues and cells. And the high expression of AC005592.2 was significantly associated with TNM stage and tumor differentiation of CRC patients. Knockdown of AC005592.2 suppressed CRC cell proliferation, invasion and migration, but promoted apoptosis, while AC005592.2 overexpression exerted precisely the opposite effects on CRC cells. Besides, AC005592.2 positively regulated the expression of olfactomedin 4 (OLFM4), which was also up-regulation in CRC tissues. <bold>Conclusion: </bold>The findings suggested that AC005592.2 is a crucial promoter of CRC progression, and may serve as an attractive therapeutic target for CRC.</p>

Also flagged:bindingproteaseCNRSARSCaddyCaly
Journal Article 2020-09-16 ✓ 1 Snippet Sheik Amamuddy O, Verkhivker GM, Tastan Bishop Ö.
In-Text Gene Mentions

DCC

Show Full Abstract

A new coronavirus (SARS-CoV-2) is a global threat to world health and economy. Its dimeric main protease (M<sup>pro</sup>), which is required for the proteolytic cleavage of viral precursor proteins, is a good candidate for drug development owing to its conservation and the absence of a human homolog. Improving our understanding of M<sup>pro</sup> behavior can accelerate the discovery of effective therapies to reduce mortality. All-atom molecular dynamics (MD) simulations (100 ns) of 50 mutant M<sup>pro</sup> dimers obtained from filtered sequences from the GISAID database were analyzed using root-mean-square deviation, root-mean-square fluctuation, <i>R</i><sub>g</sub>, averaged betweenness centrality, and geometry calculations. The results showed that SARS-CoV-2 M<sup>pro</sup> essentially behaves in a similar manner to its SAR-CoV homolog. However, we report the following new findings from the variants: (1) Residues GLY15, VAL157, and PRO184 have mutated more than once in SARS CoV-2; (2) the D48E variant has lead to a novel "TSEEMLN"" loop at the binding pocket; (3) inactive apo M<sup>pro</sup> does not show signs of dissociation in 100 ns MD; (4) a non-canonical pose for PHE140 widens the substrate binding surface; (5) dual allosteric pockets coinciding with various stabilizing and functional components of the substrate binding pocket were found to display correlated compaction dynamics; (6) high betweenness centrality values for residues 17 and 128 in all M<sup>pro</sup> samples suggest their high importance in dimer stability-one such consequence has been observed for the M17I mutation whereby one of the N-fingers was highly unstable. (7) Independent coarse-grained Monte Carlo simulations suggest a relationship between the rigidity/mutability and enzymatic function. Our entire approach combining database preparation, variant retrieval, homology modeling, dynamic residue network (DRN), relevant conformation retrieval from 1-D kernel density estimates from reaction coordinates to other existing approaches of structural analysis, and data visualization within the coronaviral M<sup>pro</sup> is also novel and is applicable to other coronaviral proteins.

Also flagged:HuntingtinembryogenesisHDnucleotidesmetabolismnucleotide
Journal Article 2020-09-16 ✓ 5 Snippets Tomczyk M, Glaser T, Ulrich H, Slominska EM, Smolenski RT.
In-Text Gene Mentions

…Huntingtin (HTT) is a multifunctional…

…We usedHTTKO mice embryonic…

…We noted thatHTTnull cardiomyocytes showed…

…0.4 nmol/mg proteinHTTKO vs. SCR)…

…± 0.1 nmol/mgHTTKO vs. SCR).…

Show Full Abstract

Huntingtin (HTT) is a multifunctional protein crucial for proper embryogenesis and nervous system development. Mutation of a single allele in gene coded this protein results in the Huntington׳s disease (HD). There is growing evidence of cardiovascular system pathologies coexisting with the neurological symptoms in HD patients. Thus, this study aims to establish the role of huntingtin protein in cardiomyocytes cellular energy and nucleotides metabolism. We used HTT KO mice embryonic stem cells (ESC) obtained with CRISPR method, wild type mice ESC treated by CRISPR with Scramble control sequence (SCR) as well as wild type (WT) mice ESC and differentiate it into cardiomyocytes. Analysis of intracellular concentration of ATP, ADP, and NAD<sup>+</sup>, as well as nucleotide catabolites were performed with HPLC. We noted that HTT null cardiomyocytes showed diminished intracellular ATP (4.9 ± 0.5; 6.7 ± 0.4 nmol/mg protein HTT KO vs. SCR) and NAD<sup>+</sup> (0.9 ± 0.1; 1.6 ± 0.1 nmol/mg HTT KO vs. SCR). We noted also reduced cellular medium concentration of total purines pool (17.1 ± 1.7; 24.7 ± 2.7 nmol/ml HTT KO vs. SCR) as well as IMP concentration (7.7 ± 0.6; 10.2 ± 0.4 nmol/ml HTT KO vs. SCR). This study indicates that HTT plays an important role in cellular energy balance as well as in nucleotide metabolism in cardiomyocytes. Furthermore, our findings underline that the deterioration in energy metabolism observed in HD may be caused not only by cellular mutant HTT accumulation but also by the loss of HTT function.

Also flagged:Shhmyosin heavy chainNeuNPAX7lackneurogenesis
Journal Article 2020-09-16 ✓ 1 Snippet Verissimo KM, Perez LN, Dragalzew AC, Senevirathne G, Darnet S, Barroso Mendes WR, Ariel Dos Santos Neves C, Monteiro Dos Santos E, Nazare de Sousa Moraes C, Elewa A, Shubin N, Fröbisch NB, de Freitas Sousa J, Schneider I.
In-Text Gene Mentions

Cse1l

Show Full Abstract

Salamanders, frog tadpoles and diverse lizards have the remarkable ability to regenerate tails. Palaeontological data suggest that this capacity is plesiomorphic, yet when the developmental and genetic architecture of tail regeneration arose is poorly understood. Here, we show morphological and molecular hallmarks of tetrapod tail regeneration in the West African lungfish <i>Protopterus annectens</i>, a living representative of the sister group of tetrapods. As in salamanders, lungfish tail regeneration occurs via the formation of a proliferative blastema and restores original structures, including muscle, skeleton and spinal cord. In contrast with lizards and similar to salamanders and frogs, lungfish regenerate spinal cord neurons and reconstitute dorsoventral patterning of the tail. Similar to salamander and frog tadpoles, <i>Shh</i> is required for lungfish tail regeneration. Through RNA-seq analysis of uninjured and regenerating tail blastema, we show that the genetic programme deployed during lungfish tail regeneration maintains extensive overlap with that of tetrapods, with the upregulation of genes and signalling pathways previously implicated in amphibian and lizard tail regeneration. Furthermore, the lungfish tail blastema showed marked upregulation of genes encoding post-transcriptional RNA processing components and transposon-derived genes. Our results show that the developmental processes and genetic programme of tetrapod tail regeneration were present at least near the base of the sarcopterygian clade and establish the lungfish as a valuable research system for regenerative biology.

Also flagged:Notchcell proliferationsquamous cell carcinomastumorgene expressionsquamous carcinoma
Journal Article 2020-09-16 No Snippets Pan L, Lemieux ME, Thomas T, Rogers JM, Lipper CH, Lee W, Johnson C, Sholl LM, South AP, Marto JA, Adelmant GO, Blacklow SC, Aster JC.
Show Full Abstract

Notch signaling regulates squamous cell proliferation and differentiation and is frequently disrupted in squamous cell carcinomas, in which Notch is tumor suppressive. Here, we show that conditional activation of Notch in squamous cells activates a context-specific gene expression program through lineage-specific regulatory elements. Among direct Notch target genes are multiple DNA damage response genes, including <i>IER5</i>, which we show is required for Notch-induced differentiation of squamous carcinoma cells and TERT-immortalized keratinocytes. <i>IER5</i> is epistatic to <i>PPP2R2A</i>, a gene that encodes the PP2A B55α subunit, which we show interacts with IER5 in cells and in purified systems. Thus, Notch and DNA-damage response pathways converge in squamous cells on common genes that promote differentiation, which may serve to eliminate damaged cells from the proliferative pool. We further propose that crosstalk involving Notch and PP2A enables tuning and integration of Notch signaling with other pathways that regulate squamous differentiation.

Also flagged:hearingbehavioraltopLearningAEPsix
Journal Article 2020-09-16 No Snippets Talkington WJ, Donai J, Kadner AS, Layne ML, Forino A, Wen S, Gao S, Gray MM, Ashraf AJ, Valencia GN, Smith BD, Khoo SK, Gray SJ, Lass N, Brefczynski-Lewis JA, Engdahl S, Graham D, Frum CA, Lewis JW.
Show Full Abstract

Purpose From an anthropological perspective of hominin communication, the human auditory system likely evolved to enable special sensitivity to sounds produced by the vocal tracts of human conspecifics whether attended or passively heard. While numerous electrophysiological studies have used stereotypical human-produced verbal (speech voice and singing voice) and nonverbal vocalizations to identify human voice-sensitive responses, controversy remains as to when (and where) processing of acoustic signal attributes characteristic of "human voiceness" per se initiate in the brain. Method To explore this, we used animal vocalizations and human-mimicked versions of those calls ("mimic voice") to examine late auditory evoked potential responses in humans. Results Here, we revealed an N1b component (96-120 ms poststimulus) during a nonattending listening condition showing significantly greater magnitude in response to mimics, beginning as early as primary auditory cortices, preceding the time window reported in previous studies that revealed species-specific vocalization processing initiating in the range of 147-219 ms. During a sound discrimination task, a P600 (500-700 ms poststimulus) component showed specificity for accurate discrimination of human mimic voice. Distinct acoustic signal attributes and features of the stimuli were used in a classifier model, which could distinguish most human from animal voice comparably to behavioral data-though none of these single features could adequately distinguish human voiceness. Conclusions These results provide novel ideas for algorithms used in neuromimetic hearing aids, as well as direct electrophysiological support for a neurocognitive model of natural sound processing that informs both neurodevelopmental and anthropological models regarding the establishment of auditory communication systems in humans. Supplemental Material https://doi.org/10.23641/asha.12903839.

Also flagged:ACEcoronavirus disease 2019COVID-19deathAngiotensin-converting enzyme 2ACE2
Journal Article 2020-09-16 No Snippets Cohen JB, Hanff TC, Corrales-Medina V, William P, Renna N, Rosado-Santander NR, Rodriguez-Mori JE, Spaak J, Andrade-Villanueva J, Chang TI, Barbagelata A, Alfonso CE, Bernales-Salas E, Coacalla J, Castro-Callirgos CA, Tupayachi-Venero KE, Medina C, Valdivia R, Villavicencio M, Vasquez CR, Harhay MO, Chittams J, Sharkoski T, Byrd JB, Edmonston DL, Sweitzer N, Chirinos JA.
Show Full Abstract

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the virus responsible for coronavirus disease 2019 (COVID-19), is associated with high incidence of multiorgan dysfunction and death. Angiotensin-converting enzyme 2 (ACE2), which facilitates SARS-CoV-2 host cell entry, may be impacted by angiotensin-converting enzyme inhibitors (ACEIs) and angiotensin receptor blockers (ARBs), two commonly used antihypertensive classes. In a multicenter, international randomized controlled trial that began enrollment on March 31, 2020, participants are randomized to continuation vs withdrawal of their long-term outpatient ACEI or ARB upon hospitalization with COVID-19. The primary outcome is a hierarchical global rank score incorporating time to death, duration of mechanical ventilation, duration of renal replacement or vasopressor therapy, and multiorgan dysfunction severity. Approval for the study has been obtained from the Institutional Review Board of each participating institution, and all participants will provide informed consent. A data safety monitoring board has been assembled to provide independent oversight of the project.

Also flagged:protein degradationmuscle diseasesUPSproteasomesubiquitinproteasome
Journal Article 2020-09-16 No Snippets Kitajima Y, Yoshioka K, Suzuki N.
Show Full Abstract

Skeletal muscle is one of the most abundant and highly plastic tissues. The ubiquitin-proteasome system (UPS) is recognised as a major intracellular protein degradation system, and its function is important for muscle homeostasis and health. Although UPS plays an essential role in protein degradation during muscle atrophy, leading to the loss of muscle mass and strength, its deficit negatively impacts muscle homeostasis and leads to the occurrence of several pathological phenotypes. A growing number of studies have linked UPS impairment not only to matured muscle fibre degeneration and weakness, but also to muscle stem cells and deficiency in regeneration. Emerging evidence suggests possible links between abnormal UPS regulation and several types of muscle diseases. Therefore, understanding of the role of UPS in skeletal muscle may provide novel therapeutic insights to counteract muscle wasting, and various muscle diseases. In this review, we focussed on the role of proteasomes in skeletal muscle and its regeneration, including a brief explanation of the structure of proteasomes. In addition, we summarised the recent findings on several diseases and elaborated on how the UPS is related to their pathological states.

Also flagged:familial hypercholesterolemiaFHmetabolic disorderslipoproteincholesterolatherosclerosis
Journal Article 2020-09-16 No Snippets Wang D, Liu B, Xiong T, Yu W, She Q.
Show Full Abstract

<h4>Background</h4>Familial hypercholesterolemia (FH) is one of the commonest inherited metabolic disorders. Abnormally high level of low-density lipoprotein cholesterol (LDL-C) in blood leads to premature atherosclerosis onset and a high risk of cardiovascular disease (CVD). However, the specific mechanisms of the progression process are still unclear. Our study aimed to investigate the potential differently expressed genes (DEGs) and mechanism of FH using various bioinformatic tools.<h4>Methods</h4>GSE13985 and GSE6054 were downloaded from the Gene Expression Omnibus (GEO) database for bioinformatic analysis in this study. First, limma package of R was used to identify DEGs between blood samples of patients with FH and those from healthy individuals. Then, the functional annotation of DEGs was carried out by Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis and Gene Ontology (GO) analysis. Based on Search Tool for the Retrieval of Interacting Genes (STRING) tool, we constructed the Protein-Protein Interactions (PPIs) network among DEGs and mined the core genes as well.<h4>Results</h4>A total of 102 communal DEGs (49 up-regulated and 53 down-regulated) are identified in FH samples compared with control samples. The functional changes of DEGs are mainly associated with the focal adhere and glucagon signaling pathway. Ten genes (ITGAL, TLN1, POLR2A, CD69, GZMA, VASP, HNRNPUL1, SF1, SRRM2, ITGAV) were identified as core genes. Bioinformatic analysis showed that the core genes are mainly enriched in numerous processes related to cell adhesion, integrin-mediated signaling pathway and cell-matrix adhesion. In the transcription factor (TF) target regulating network, 219 nodes were detected, including 214 DEGs and 5 TFs (SP1, EGR3, CREB, SEF1, HOX13). In conclusion, the DEGs and hub genes identified in this study may help us understand the potential etiology of the occurrence and development of AS.<h4>Conclusion</h4>Up-regulated ITGAL, TLN1, POLR2A, VASP, HNRNPUL1, SF1, SRRM2, and down-regulated CD69, GZMA and ITGAV performed important promotional effects for the formation of atherosclerotic plaques those suffering from FH. Moreover, SP1, EGR3, CREB, SEF1 and HOX13 were the potential transcription factors for DEGs and could serve as underlying targets for AS rupture prevention. These findings provide a theoretical basis for us to understand the potential etiology of the occurrence and development of AS in FH patients and we may be able to find potential diagnostic and therapeutic targets.

Also flagged:Primary haemochromatosisdilated cardiomyopathyPHgenetic disorderironmetabolism
Journal Article 2020-09-16 ✓ 4 Snippets Goyal A, Mohan B, Saggar K, Wander GS.
In-Text Gene Mentions

…to mutations inHFEor more rarely…

…IfHFEis negative, analysis…

…negative, analysis of non-HFEmutation should always…

HFE

Show Full Abstract

Primary haemochromatosis (PH) is a genetic disorder of iron metabolism with multiorgan involvement due to mutations in HFE or more rarely haemojuvelin (HJV) gene. Cardiac involvement results in dilated cardiomyopathy with reduced ejection fraction and progressive heart failure. PH is rarely reported from India and cardiomyopathy due to PH from HJV mutations is thought to be uncommon. We report two families with cardiomyopathy resulting from PH. Diagnosis was suspected on the basis of skin pigmentation, markedly elevated serum ferritin and transferring saturation. Genetic testing revealed a rare mutation in HJV gene in one family. Being a treatable condition, PH should be suspected and investigated in cardiomyopathy patients in Indian subcontinent. If HFE is negative, analysis of non-HFE mutation should always be considered.

Also flagged:ShhGlineurogenesisPhox2bembryogenesisaging
Journal Article 2020-09-16 No Snippets Dias JM, Alekseenko Z, Jeggari A, Boareto M, Vollmer J, Kozhevnikova M, Wang H, Matise MP, Alexeyenko A, Iber D, Ericson J.
Show Full Abstract

How time is measured by neural stem cells during temporal neurogenesis has remained unresolved. By combining experiments and computational modeling, we define a Shh/Gli-driven three-node timer underlying the sequential generation of motor neurons (MNs) and serotonergic neurons in the brainstem. The timer is founded on temporal decline of Gli-activator and Gli-repressor activities established through down-regulation of Gli transcription. The circuitry conforms an incoherent feed-forward loop, whereby Gli proteins not only promote expression of Phox2b and thereby MN-fate but also account for a delayed activation of a self-promoting transforming growth factor-β (Tgfβ) node triggering a fate switch by repressing Phox2b. Hysteresis and spatial averaging by diffusion of Tgfβ counteract noise and increase temporal accuracy at the population level, providing a functional rationale for the intrinsically programmed activation of extrinsic switch signals in temporal patterning. Our study defines how time is reliably encoded during the sequential specification of neurons.

Also flagged:kidney renal clear cell carcinomaCancerrenal malignant tumourcell cycleproto-oncogenesoncogenes
Journal Article 2020-09-16 No Snippets Ng KL, Taguchi YH.
Show Full Abstract

Cancer is a highly complex disease caused by multiple genetic factors. MicroRNA (miRNA) and mRNA expression profiles are useful for identifying prognostic biomarkers for cancer. Kidney renal clear cell carcinoma (KIRC), which accounts for more than 70% of all renal malignant tumour cases, was selected for our analysis. Traditional methods of identifying cancer prognostic markers may not be accurate. Tensor decomposition (TD) is a useful method uncovering the underlying low-dimensional structures in the tensor. The TD-based unsupervised feature extraction method was applied to analyse mRNA and miRNA expression profiles. Biological annotations of the prognostic miRNAs and mRNAs were examined utilizing the pathway and oncogenic signature databases DIANA-miRPath and MSigDB. TD identified the miRNA signatures and the associated genes. These genes were found to be involved in cancer-related pathways, and 23 genes were significantly correlated with the survival of KIRC patients. We demonstrated that the results are robust and not highly dependent upon the databases we selected. Compared with traditional supervised methods tested, TD achieves much better performance in selecting prognostic miRNAs and mRNAs. These results suggest that integrated analysis using the TD-based unsupervised feature extraction technique is an effective strategy for identifying prognostic signatures in cancer studies.

Also flagged:ExtracellularvesiclesOX40tumorTNFSF4-1BBL
Journal Article 2020-09-16 No Snippets Semionatto IF, Palameta S, Toscaro JM, Manrique-Rincón AJ, Ruas LP, Paes Leme AF, Bajgelman MC.
Show Full Abstract

Genetically modified tumor cells harboring immunomodulators may be used as therapeutic vaccines to stimulate antitumor immunity. The therapeutic benefit of these tumor vaccines is extensively investigated and mechanisms by which they boost antitumor response may be further explored. Tumor cells are large secretors of extracellular vesicles (EVs). These EVs are able to vehiculate RNA and proteins to target cells, and engineered EVs also vehiculate recombinant proteins. In this study, we explore immunomodulatory properties of EVs derived from antitumor vaccines expressing the TNFSF ligands 4-1BBL and OX40L, modulating immune response mediated by immune cells and eliminating tumors. Our results suggest that the EVs secreted by genetically modified tumor cells harboring TNFSF ligands can induce T cell proliferation, inhibit the transcription factor FoxP3, associated with the maintenance of Treg phenotype, and enhance antitumor activity mediated by immune cells. The immunomodulatory extracellular vesicles have potential to be further engineered for developing new approaches for cancer therapy.

Also flagged:kidney diseaseacute kidney injurychronic kidney diseasekidney damagecreatinineprotein
Journal Article 2020-09-16 No Snippets Ong E, Wang LL, Schaub J, O'Toole JF, Steck B, Rosenberg AZ, Dowd F, Hansen J, Barisoni L, Jain S, de Boer IH, Valerius MT, Waikar SS, Park C, Crawford DC, Alexandrov T, Anderton CR, Stoeckert C, Weng C, Diehl AD, Mungall CJ, Haendel M, Robinson PN, Himmelfarb J, Iyengar R, Kretzler M, Mooney S, He Y, Kidney Precision Medicine Project.
Show Full Abstract

An important need exists to better understand and stratify kidney disease according to its underlying pathophysiology in order to develop more precise and effective therapeutic agents. National collaborative efforts such as the Kidney Precision Medicine Project are working towards this goal through the collection and integration of large, disparate clinical, biological and imaging data from patients with kidney disease. Ontologies are powerful tools that facilitate these efforts by enabling researchers to organize and make sense of different data elements and the relationships between them. Ontologies are critical to support the types of big data analysis necessary for kidney precision medicine, where heterogeneous clinical, imaging and biopsy data from diverse sources must be combined to define a patient's phenotype. The development of two new ontologies - the Kidney Tissue Atlas Ontology and the Ontology of Precision Medicine and Investigation - will support the creation of the Kidney Tissue Atlas, which aims to provide a comprehensive molecular, cellular and anatomical map of the kidney. These ontologies will improve the annotation of kidney-relevant data, and eventually lead to new definitions of kidney disease in support of precision medicine.

Also flagged:anxietyAnxiety disordersmental disordersanxiety disorderDepressionmental illnesses
Journal Article 2020-09-16 No Snippets Thomas AL, Evans LM, Nelsen MD, Chesler EJ, Powers MS, Booher WC, Lowry CA, DeFries JC, Ehringer MA.
Show Full Abstract

We conducted whole-genome sequencing of four inbred mouse strains initially selected for high (H1, H2) or low (L1, L2) open-field activity (OFA), and then examined strain distribution patterns for all DNA variants that differed between their BALB/cJ and C57BL/6J parental strains. Next, we assessed genome-wide sharing (3,678,826 variants) both between and within the High and Low Activity strains. Results suggested that about 10% of these DNA variants may be associated with OFA, and clearly demonstrated its polygenic nature. Finally, we conducted bioinformatic analyses of functional genomics data from mouse, rat, and human to refine previously identified quantitative trait loci (QTL) for anxiety-related measures. This combination of sequence analysis and genomic-data integration facilitated refinement of previously intractable QTL findings, and identified possible genes for functional follow-up studies.

Also flagged:ubiquitinproteasomedegradationtripartite motifTRIME3 ubiquitin ligases
Journal Article 2020-09-16 No Snippets Lee HR, Lee MK, Kim CW, Kim M.
Show Full Abstract

The ubiquitin-proteasome system (UPS) has been recognized for regulating fundamental cellular processes, followed by induction of proteasomal degradation of target proteins, and triggers multiple signaling pathways that are crucial for numerous aspects of cellular physiology. Especially tripartite motif (TRIM) proteins, well-known E3 ubiquitin ligases, emerge as having critical roles in several antiviral signaling pathways against varying viral infections. Here we highlight recent advances in the study of antiviral roles of TRIM proteins toward influenza virus infection in terms of the modulation of pathogen recognition receptor (PRR)-mediated innate immune sensing, direct obstruction of influenza viral propagation, and participation in virus-induced autophagy.

Also flagged:Titaniumcalcium phosphatemetalsvanadiumzirconiumniobium
Journal Article 2020-09-16 No Snippets Komarova EG, Sharkeev YP, Sedelnikova MB, Prosolov KA, Khlusov IA, Prymak O, Epple M.
Show Full Abstract

Zn- and Cu-containing CaP‑based coatings, obtained by micro-arc oxidation process, were deposited on substrates made of pure titanium (Ti) and novel Ti-40Nb alloy. The microstructure, phase, and elemental composition, as well as physicochemical and mechanical properties, were examined for unmodified CaP and Zn- or Cu-containing CaP coatings, in relation to the applied voltage that was varied in the range from 200 to 350 V. The unmodified CaP coatings on both types of substrates had mainly an amorphous microstructure with a minimal content of the CaHPO<sub>4</sub> phase for all applied voltages. The CaP coatings modified with Zn or Cu had a range from amorphous to nano- and microcrystalline structure that contained micro-sized CaHPO<sub>4</sub> and Ca(H<sub>2</sub>PO<sub>4</sub>)<sub>2</sub>·H<sub>2</sub>O phases, as well as nano‑sized β‑Ca<sub>2</sub>P<sub>2</sub>O<sub>7</sub>, CaHPO<sub>4</sub>, TiO<sub>2</sub>, and Nb<sub>2</sub>O<sub>5</sub> phases. The crystallinity of the formed coatings increased in the following order: CaP/TiNb < Zn-CaP/TiNb < Cu-CaP/TiNb < CaP/Ti < Zn-CaP/Ti < Cu-CaP/Ti. The increase in the applied voltage led to a linear increase in thickness, roughness, and porosity of all types of coatings, unlike adhesive strength that was inversely proportional to an increase in the applied voltage. The increase in the applied voltage did not affect the Zn or Cu concentration (~0.4 at%), but led to an increase in the Ca/P atomic ratio from 0.3 to 0.7.

Also flagged:lactationfatty acidcancerscardiovascular diseasespolyunsaturated fatty acidsrumenic acids
Journal Article 2020-09-16 No Snippets Monllor P, Muelas R, Roca A, Atzori AS, Díaz JR, Sendra E, Romero G.
Show Full Abstract

The aim of this experiment was to study the effects of a 40% inclusion of broccoli by-product (BB) and artichoke plant (AP) silages in dairy goat diets on the milk yield, composition and animal health status during a full lactation. Feed consumption was lower in AP and BB animals due to their composition and higher moisture content, and BB animals showed a significant reduction in body weight. Milk from the BB treatment had the highest fat content, total solids and useful dry matter content (5.02, 13.9 and 8.39%, respectively). The Se level was slightly lower in AP and BB animals; however, the milk of these treatments was the lowest in Na and, in the case of BB animals, the richest in Ca (1267 mg/kg). Control and AP milk showed a similar fatty acid profile, although AP had a more beneficial aptitude for human health (lower ratio of n6/n3, 12.5). Plasma components, as metabolic parameters, were adequate for goats. It was concluded that a 40% inclusion of AP is an adequate solution to reduce the cost of feeding without harming the animals' health or performance and to improve the nutritional milk quality. It is necessary to lower the BB level of inclusion to increase feed consumption.

Also flagged:Extracellular vesiclesmembranousendocytosispathogenesisneurodegenerative disordersPD
Journal Article 2020-09-16 ✓ 1 Snippet Leggio L, Paternò G, Vivarelli S, L'Episcopo F, Tirolo C, Raciti G, Pappalardo F, Giachino C, Caniglia S, Serapide MF, Marchetti B, Iraci N.
In-Text Gene Mentions

…(TXN), the peroxiredoxin-6 (PRDX6) and HSP70—but also…

Show Full Abstract

Extracellular vesicles (EVs) are naturally occurring membranous structures secreted by normal and diseased cells, and carrying a wide range of bioactive molecules. In the central nervous system (CNS), EVs are important in both homeostasis and pathology. Through receptor-ligand interactions, direct fusion, or endocytosis, EVs interact with their target cells. Accumulating evidence indicates that EVs play crucial roles in the pathogenesis of many neurodegenerative disorders (NDs), including Parkinson's disease (PD). PD is the second most common ND, characterized by the progressive loss of dopaminergic (DAergic) neurons within the Substantia Nigra pars compacta (SNpc). In PD, EVs are secreted by both neurons and glial cells, with either beneficial or detrimental effects, via a complex program of cell-to-cell communication. The functions of EVs in PD range from their etiopathogenetic relevance to their use as diagnostic tools and innovative carriers of therapeutics. Because they can cross the blood-brain barrier, EVs can be engineered to deliver bioactive molecules (e.g., small interfering RNAs, catalase) within the CNS. This review summarizes the latest findings regarding the role played by EVs in PD etiology, diagnosis, prognosis, and therapy, with a particular focus on their use as novel PD nanotherapeutics.

Also flagged:immune responsenerve growth factor receptorIFIT2IFIT3OASLCCL2
Journal Article 2020-09-16 ✓ 5 Snippets Zhong Y, Hu Z, Wu J, Dai F, Lee F, Xu Y.
In-Text Gene Mentions

Therefore, it can be concluded that STAU1 may be a novel potential therapeutic target for NP.

STAU1selectively regulates the…

…Staufen homolog 1 (STAU1) is a highly…

…high expression ofSTAU1led to changes…

…Furthermore,STAU1was revealed to…

Show Full Abstract

Double‑stranded RNA‑binding protein Staufen homolog 1 (STAU1) is a highly conserved multifunctional double‑stranded RNA‑binding protein, and is a key factor in neuronal differentiation. RNA sequencing was used to analyze the overall transcriptional levels of the upregulated cells by STAU1 and control cells, and select alternative splicing (AS). It was determined that the high expression of STAU1 led to changes in the expression levels of a variety of inflammatory and immune response genes, including IFIT2, IFIT3, OASL, and CCL2. Furthermore, STAU1 was revealed to exert a significant regulatory effect on the AS of genes related to the 'nerve growth factor receptor signaling pathway'. This is of significant importance for neuronal survival, differentiation, growth, post‑damage repair, and regeneration. In conclusion, overexpression of STAU1 was associated with immune response and regulated AS of pathways related to neuronal growth and repair. In the present study, the whole transcriptome of STAU1 expression was first analyzed, which laid a foundation for further understanding the key functions of STAU1.

Also flagged:ion channelCys-loop receptoracetylcholine-binding proteinligandbindingamino acid
Journal Article 2020-09-16 No Snippets Gulsevin A, Meiler J, Horenstein NA.
Show Full Abstract

The α7 nicotinic acetylcholine receptor is a homopentameric ion channel from the Cys-loop receptor superfamily targeted for psychiatric indications and inflammatory pain. Molecular dynamics studies of the receptor have focused on residue mobility and global conformational changes to address receptor function. However, a comparative analysis of α7 with its homologs that cannot trigger channel opening has not been made so far. To identify the residues involved in α7 activation, we ran triplicate 500-ns molecular dynamics simulations with an α7 extracellular domain homology model and two acetylcholine-binding protein homologs. We tested the effect of ligand binding and amino acid sequence on the structure and dynamics of the three proteins. We found that mobile regions identified based on root mean-square deviation and root mean-square fluctuation values are not always consistent among the individual α7 extracellular domain simulations. Comparison of the replica-average properties of the three proteins based on dynamic cross-correlation maps showed that ligand binding affects the coupling between the C-loop and the Cys-loop, vestibular loop, and β1-β2 loops. In addition, the main-immunogenic-region-like domain of α7 went through correlated motions with multiple domains of the receptor. These correlated motions were absent or diminished in α7 homologs, suggesting a unique role in α7 activation.

Also flagged:tumorCancerT cell receptorsimmune responsecancerssolid cancers
Journal Article 2020-09-16 ✓ 1 Snippet Chabab G, Barjon C, Bonnefoy N, Lafont V.
In-Text Gene Mentions

…of butyrophilin 2A1 (BTN2A1) ( 4 ).…

Show Full Abstract

The tumor immune microenvironment contributes to tumor initiation, progression and response to therapy. Among the immune cell subsets that play a role in the tumor microenvironment, innate-like T cells that express T cell receptors composed of γ and δ chains (γδ T cells) are of particular interest. Indeed, γδ T cells contribute to the immune response against many cancers, notably through their powerful effector functions that lead to the elimination of tumor cells and the recruitment of other immune cells. However, their presence in the tumor microenvironment has been associated with poor prognosis in various solid cancers (breast, colon and pancreatic cancer), suggesting that γδ T cells also display pro-tumor activities. In this review, we outline the current evidences of γδ T cell pro-tumor functions in human cancer. We also discuss the factors that favor γδ T cell polarization toward a pro-tumoral phenotype, the characteristics and functions of such cells, and the impact of pro-tumor subsets on γδ T cell-based therapies.

Also flagged:Methylcytosinemethylationgene expressionchromatinaginggenomic imprinting
Journal Article 2020-09-16 No Snippets Manavalan B, Hasan MM, Basith S, Gosu V, Shin TH, Lee G.
Show Full Abstract

DNA <i>N</i> <sup>4</sup>-methylcytosine (4mC) is a crucial epigenetic modification involved in various biological processes. Accurate genome-wide identification of these sites is critical for improving our understanding of their biological functions and mechanisms. As experimental methods for 4mC identification are tedious, expensive, and labor-intensive, several machine learning-based approaches have been developed for genome-wide detection of such sites in multiple species. However, the predictions projected by these tools are difficult to quantify and compare. To date, no systematic performance comparison of 4mC tools has been reported. The aim of this study was to compare and critically evaluate 12 publicly available 4mC site prediction tools according to species specificity, based on a huge independent validation dataset. The tools 4mCCNN (<i>Escherichia coli</i>), DNA4mC-LIP (<i>Arabidopsis thaliana</i>), iDNA-MS (<i>Fragaria vesca</i>), DNA4mC-LIP and 4mCCNN (<i>Drosophila melanogaster</i>), and four tools for <i>Caenorhabditis elegans</i> achieved excellent overall performance compared with their counterparts. However, none of the existing methods was suitable for <i>Geoalkalibacter subterraneus</i>, <i>Geobacter pickeringii</i>, and <i>Mus musculus</i>, thereby limiting their practical applicability. Model transferability to five species and non-transferability to three species are also discussed. The presented evaluation will assist researchers in selecting appropriate prediction tools that best suit their purpose and provide useful guidelines for the development of improved 4mC predictors in the future.

Also flagged:bindingluciferaseAKTFOSperoxisome proliferator-activated receptor gammaadipocyte differentiation
Journal Article 2020-09-16 ✓ 1 Snippet Kang Z, Zhang S, Jiang E, Wang X, Wang Z, Chen H, Lan X.
In-Text Gene Mentions

…DNAAF4-CCPG1lncRNA also exists…

Show Full Abstract

Although many circular RNAs (circRNAs) and long non-coding RNAs (lncRNAs) have been discovered in adipocytes, their precise functions and molecular mechanisms remain poorly understood. Based on existing circRNA and lncRNA sequencing data of bovine adipocytes, we screened for the differential expression of <i>circFLT1</i> and <i>lncCCPG1</i> in preadipocytes and adipocytes and further analyzed their function and regulation during adipogenesis. The overexpression of <i>circFLT1</i> and <i>lncCCPG1</i> together facilitated adipocyte differentiation and suppressed proliferation. Computationally, the RNA hybrid showed that <i>circFLT1</i> and <i>lncCCPG1</i> had multiple potential binding sites with miR-93. Additionally, luciferase reporting experiments verified that <i>circFLT1</i> and <i>lncCCPG1</i> may interact with miR-93. We also demonstrated that overexpressed miR-93 effectively suppresses the expression of <i>lncSLC30A9</i>. Signaling pathway enrichment analysis, luciferase activity assay, and expression analysis revealed that <i>lncSLC30A9</i> inhibits proliferation by inhibiting the expression of AKT protein and promotes differentiation by recruiting the FOS protein to the promoter of peroxisome proliferator-activated receptor gamma (<i>PPARG</i>). In sum, our results elucidate the regulatory mechanisms of <i>circFLT1</i> and <i>lncCCPG1</i> as miR-93 sponges in bovine adipocytes.

Also flagged:phosphoglucomutase 1PGM1genetic disorderglycogenmetabolismprotein
Journal Article 2020-09-15 ✓ 2 Snippets Altassan R, Radenkovic S, Edmondson AC, Barone R, Brasil S, Cechova A, Coman D, Donoghue S, Falkenstein K, Ferreira V, Ferreira C, Fiumara A, Francisco R, Freeze H, Grunewald S, Honzik T, Jaeken J, Krasnewich D, Lam C, Lee J, Lefeber D, Marques-da-Silva D, Pascoal C, Quelhas D, Raymond KM, Rymen D, Seroczynska M, Serrano M, Sykut-Cegielska J, Thiel C, Tort F, Vals MA, Videira P, Voermans N, Witters P, Morava E.
In-Text Gene Mentions

antithrombin-III

ATIII

Show Full Abstract

Phosphoglucomutase 1 (PGM1) deficiency is a rare genetic disorder that affects glycogen metabolism, glycolysis, and protein glycosylation. Previously known as GSD XIV, it was recently reclassified as a congenital disorder of glycosylation, PGM1-CDG. PGM1-CDG usually manifests as a multisystem disease. Most patients present as infants with cleft palate, liver function abnormalities and hypoglycemia, but some patients present in adulthood with isolated muscle involvement. Some patients develop life-threatening cardiomyopathy. Unlike most other CDG, PGM1-CDG has an effective treatment option, d-galactose, which has been shown to improve many of the patients' symptoms. Therefore, early diagnosis and initiation of treatment for PGM1-CDG patients are crucial decisions. In this article, our group of international experts suggests diagnostic, follow-up, and management guidelines for PGM1-CDG. These guidelines are based on the best available evidence-based data and experts' opinions aiming to provide a practical resource for health care providers to facilitate successful diagnosis and optimal management of PGM1-CDG patients.

Also flagged:OctacalciumcollagenTeriparatideparathyroid hormoneosteoporosishydroxyapatite
Journal Article 2020-09-15 No Snippets Matsui K, Kawai T, Ezoe Y, Yanagisawa T, Takahashi T, Kamakura S.
Show Full Abstract

Octacalcium phosphate and collagen composite (OCPcol) demonstrated superior bone regeneration and has been commercialized recently in Japan. Teriparatide (TPTD) is a bioactive recombinant form of parathyroid hormone that is approved for osteoporosis treatment. Because mandibular bone reconstruction after segmental resection is a key clinical problem, it was examined whether single-dose local administration of OCPcol with TPTD can affect recovery after this procedure. OCPcol was prepared, and a commercially available hydroxyapatite and collagen composite (HAPcol) was used as a control. A 15 mm length segmental bone defect was made in the mandibular region of male beagle dogs. The experimental animals were divided in four groups. OCPcol treated with TPTD (OCPcol + TPTD), OCPcol, HAPcol treated with TPTD (HAPcol + TPTD), or HAPcol was implanted into the defect. The radiopaque areas of the implanted site were measured and statistically analyzed, and histological examination was performed after 6 months. The value of radiopaque area in total region of OCPcol + TPTD was highest (90.8 ± 7.3 mm<sup>2</sup>), followed in order by OCPcol (49.3 ± 21.8 mm<sup>2</sup>), HAPcol + TPTD (10.6 ± 2.3 mm<sup>2</sup>), and HAPcol (6.4 ± 2.3 mm<sup>2</sup>), and that of OCPcol + TPTD was significantly higher than that of HAPcol + TPTD or HAPcol. All segmented mandibles of OCPcol + TPTD and a part of those of OCPcol were bridged with newly formed bone, whereas no bone bridges were observed in HAPcol + TPTD or HAPcol. These results suggested that OCPcol treated with TPTD enabled bone reconstruction after segmental mandibular resection more than other three groups.

Also flagged:traumatic disordersgene expressionadhesion moleculesaxonalorganizationsynucleopathies
Journal Article 2020-09-15 No Snippets Ernsberger U, Deller T, Rohrer H.
Show Full Abstract

Selective sympathetic and parasympathetic pathways that act on target organs represent the terminal actors in the neurobiology of homeostasis and often become compromised during a range of neurodegenerative and traumatic disorders. Here, we delineate several neurotransmitter and neuromodulator phenotypes found in diverse parasympathetic and sympathetic ganglia in humans and rodent species. The comparative approach reveals evolutionarily conserved and non-conserved phenotypic marker constellations. A developmental analysis examining the acquisition of selected neurotransmitter properties has provided a detailed, but still incomplete, understanding of the origins of a set of noradrenergic and cholinergic sympathetic neuron populations, found in the cervical and trunk region. A corresponding analysis examining cholinergic and nitrergic parasympathetic neurons in the head, and a range of pelvic neuron populations, with noradrenergic, cholinergic, nitrergic, and mixed transmitter phenotypes, remains open. Of particular interest are the molecular mechanisms and nuclear processes that are responsible for the correlated expression of the various genes required to achieve the noradrenergic phenotype, the segregation of cholinergic locus gene expression, and the regulation of genes that are necessary to generate a nitrergic phenotype. Unraveling the neuron population-specific expression of adhesion molecules, which are involved in axonal outgrowth, pathway selection, and synaptic organization, will advance the study of target-selective autonomic pathway generation.

Also flagged:viral infectionsdenguedengue infectionmetabolisminfectiondengue fever
Journal Article 2020-09-15 ✓ 5 Snippets Saini J, Bandyopadhyay B, Pandey AD, Ramachandran VG, Das S, Sood V, Banerjee A, Vrati S.
In-Text Gene Mentions
⭐ same-sentence co-mention

Several upregulated genes (e.g., MPO, OLFM4, NAMPT, and CACNA1E) that were associated with the neutrophil activation process were found to be targeted by the several miRNAs whose expressions were downregulated in the DS group of patients compared to the DI group.

Several genes, e.g., NAMPT and CACNA1E, which were identified as the potential target genes of miR-320a in silico, were significantly downregulated under the severe dengue conditions.

⭐ same-sentence co-mention

…genes (e.g., MPO,OLFM4, NAMPT, and CACNA1E)…

⭐ same-sentence co-mention

…OLFM4, NAMPT, andCACNA1E) that were associated…

…e.g., NAMPT andCACNA1E, which were identified…

Show Full Abstract

The circulating microRNA (miRNA) profile has been widely used for identifying potential biomarkers against viral infections. However, data on circulating microRNA expression patterns in dengue patients are scanty. Considering the impact of severity caused by dengue infection, circulating miRNA profiles in plasma of dengue patients may prove to be valuable for developing early prognostic markers for the disease severity. Here, we described an in-depth analytical study of small RNA sequencing data obtained from the plasma of 39 dengue patients. Integrating bioinformatics and <i>in vitro</i> studies, we identified differentially expressed miRNAs (DEMs) (log<sub>2</sub> fold change ≥1.5, <i>P</i> < 0.05) associated with dengue disease progression. In comparing miRNA expression pattern with the follow-up samples, nine miRNAs were found to exhibit an altered expression that could distinguish between severe dengue and the convalescent patients. To understand the abundance and specificity of the DEMs in the context of dengue infection and disease progression, eight top-hit DEMs were further validated in the dengue virus-infected cell lines as well as in the patient's plasma and peripheral blood mononuclear cells (PBMCs) using the quantitative reverse transcription-PCR (qRT-PCR) method. Importantly, receiver operating curve analysis further confirmed that the plasma expression pattern of hsa-miR-122-5p could differentiate between different stages of dengue infection (area under the concentration-time curve [AUC] = 0.792), and dengue-negative patients with other febrile illnesses (AUC = 0.984). The <i>in silico</i> analysis of DEM target genes suggested an enrichment of the pathways associated with metabolism and inflammation. Our study gives a global view of miRNA expression in the plasma from dengue patients and provides a precious resource of candidate miRNAs involved in dengue infection and disease progression.<b>IMPORTANCE</b> Dengue virus (DENV) infection usually causes dengue fever (DF) with flu-like illness affecting infants, young children, and adults. The DF occasionally evolves into a potentially lethal complication called dengue severe (DS) leading to a rapid fall in platelet count along with plasma leakage, fluid accumulation, respiratory distress, and severe bleeding. The diverse clinical spectrum of dengue disease, as well as its significant similarity to other febrile viral illnesses, makes early identification more challenging in this high-risk group. microRNAs (miRNAs) are small (∼19 to 21 nucleotides [nt] in length), noncoding RNAs, extremely stable and easily detectable in the plasma; thus, they have potential as biomarkers for diagnosing and monitoring human diseases. This study provides a comprehensive analysis of miRNAs circulating in plasma of dengue virus-infected patients and identifies the miRNA signatures that have biomarker potential for dengue infection and disease progression.

Also flagged:myo-inositolInositolsugaralcoholinositol-phosphatesglycolipids
Journal Article 2020-09-15 No Snippets Brion LP, Phelps DL, Ward RM, Nolen TL, Hallman NMK, Das A, Zaccaro DJ, Ball MB, Watterberg KL, Frantz ID, Cotten CM, Poindexter BB, Oh W, Lugo RA, Van Meurs KP, O'Shea TM, Zaterka-Baxter KM, Higgins RD, Eunice Kennedy Shriver National Institute of Child Health and Human Development Neonatal Research Network.
Show Full Abstract

<h4>Objective</h4>To describe relationship between cord blood (representing fetal) myo-inositol concentrations and gestational age (GA) and to determine trends of blood concentrations in enterally and parenterally fed infants from birth to 70 days of age.<h4>Design/methods</h4>Samples were collected in 281 fed or unfed infants born in 2005 and 2006. Myo-inositol concentrations were displayed in scatter plots and analyzed with linear regression models of natural log-transformed values.<h4>Results</h4>In 441 samples obtained from 281 infants, myo-inositol concentrations varied from nondetectable to 1494 μmol/L. Cord myo-inositol concentrations decreased an estimated 11.9% per week increase in GA. Postnatal myo-inositol concentrations decreased an estimated 14.3% per week increase in postmenstrual age (PMA) and were higher for enterally fed infants compared to unfed infants (51% increase for fed vs. unfed infants).<h4>Conclusions</h4>Fetal myo-inositol concentrations decreased with increasing GA. Postnatal concentrations decreased with increasing PMA and were higher among enterally fed than unfed infants.

Also flagged:GBF1Axonal Neuropathyaxonal Charcot-Marie-Tooth neuropathyHMNGolgibrefeldin A-resistant guanine nucleotide exchange factor 1
Journal Article 2020-09-15 ✓ 1 Snippet Mendoza-Ferreira N, Karakaya M, Cengiz N, Beijer D, Brigatti KW, Gonzaga-Jauregui C, Fuhrmann N, Hölker I, Thelen MP, Zetzsche S, Rombo R, Puffenberger EG, De Jonghe P, Deconinck T, Zuchner S, Strauss KA, Carson V, Schrank B, Wunderlich G, Baets J, Wirth B.
In-Text Gene Mentions

Similarly, bi-allelic variants in a second ARF1 activator, ADP-ribosylation factor guanine nucleotide exchange factor 2 (ARFGEF2 [MIM: 605371]), were associated with proliferation and migration defects of cortical neurons, causing a severe malformation of the cerebral cortex known as periventricular heterotopia with microcephaly (ARPHM [MIM: 608097]).66

Show Full Abstract

Distal hereditary motor neuropathies (HMNs) and axonal Charcot-Marie-Tooth neuropathy (CMT2) are clinically and genetically heterogeneous diseases characterized primarily by motor neuron degeneration and distal weakness. The genetic cause for about half of the individuals affected by HMN/CMT2 remains unknown. Here, we report the identification of pathogenic variants in GBF1 (Golgi brefeldin A-resistant guanine nucleotide exchange factor 1) in four unrelated families with individuals affected by sporadic or dominant HMN/CMT2. Genomic sequencing analyses in seven affected individuals uncovered four distinct heterozygous GBF1 variants, two of which occurred de novo. Other known HMN/CMT2-implicated genes were excluded. Affected individuals show HMN/CMT2 with slowly progressive distal muscle weakness and musculoskeletal deformities. Electrophysiological studies confirmed axonal damage with chronic neurogenic changes. Three individuals had additional distal sensory loss. GBF1 encodes a guanine-nucleotide exchange factor that facilitates the activation of members of the ARF (ADP-ribosylation factor) family of small GTPases. GBF1 is mainly involved in the formation of coatomer protein complex (COPI) vesicles, maintenance and function of the Golgi apparatus, and mitochondria migration and positioning. We demonstrate that GBF1 is present in mouse spinal cord and muscle tissues and is particularly abundant in neuropathologically relevant sites, such as the motor neuron and the growth cone. Consistent with the described role of GBF1 in Golgi function and maintenance, we observed marked increase in Golgi fragmentation in primary fibroblasts derived from all affected individuals in this study. Our results not only reinforce the existing link between Golgi fragmentation and neurodegeneration but also demonstrate that pathogenic variants in GBF1 are associated with HMN/CMT2.

Also flagged:p53Hepatitis Chepatocellular carcinomapathogenesis5-hydroxycytosinepolymerase
Journal Article 2020-09-15 ✓ 2 Snippets Galli A, Munnia A, Cellai F, Tarocchi M, Ceni E, van Schooten FJ, Godschalk R, Giese RW, Peluso M.
In-Text Gene Mentions

…from studies onhemochromatosis[ 2 ],…

…in patients withhemochromatosis.…

Show Full Abstract

Molecular mechanisms underlying Hepatitis C virus (HCV)-associated hepatocellular carcinoma (HCC) pathogenesis are still unclear. Therefore, we analyzed the levels of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG) and other oxidative lesions at codon 176 of the p53 gene, as well as the generation of 3-(2-deoxy-β-d-erythro-pentafuranosyl)pyrimido[1,2-α]purin-10(3H)-one deoxyguanosine (M<sub>1</sub>dG), in a cohort of HCV-related HCC patients from Italy. Detection of 8-oxodG and 5-hydroxycytosine (5-OHC) was performed by ligation mediated-polymerase chain reaction assay, whereas the levels of M<sub>1</sub>dG were measured by chromatography and mass-spectrometry. Results indicated a significant 130% excess of 8-oxodG at -TGC- position of p53 codon 176 in HCV-HCC cases as compared to controls, after correction for age and gender, whereas a not significant increment of 5-OHC at -TGC- position was found. Then, regression models showed an 87% significant excess of M<sub>1</sub>dG in HCV-HCC cases relative to controls. Our study provides evidence that increased adduct binding does not occur randomly on the sequence of the p53 gene but at specific sequence context in HCV-HCC patients. By-products of lipid peroxidation could also yield a role in HCV-HCC development. Results emphasize the importance of active oxygen species in inducing nucleotide lesions at a p53 mutational hotspot in HCV-HCC patients living in geographical areas without dietary exposure to aflatoxin B<sub>1</sub>.

Also flagged:Extracellular VesiclesSubstance Abuselipidvesiclesaddictionmethamphetamine
Journal Article 2020-09-15 No Snippets Odegaard KE, Chand S, Wheeler S, Tiwari S, Flores A, Hernandez J, Savine M, Gowen A, Pendyala G, Yelamanchili SV.
Show Full Abstract

Extracellular vesicles (EVs) are a broad, heterogeneous class of membranous lipid-bilayer vesicles that facilitate intercellular communication throughout the body. As important carriers of various types of cargo, including proteins, lipids, DNA fragments, and a variety of small noncoding RNAs, including miRNAs, mRNAs, and siRNAs, EVs may play an important role in the development of addiction and other neurological pathologies, particularly those related to HIV. In this review, we summarize the findings of EV studies in the context of methamphetamine (METH), cocaine, nicotine, opioid, and alcohol use disorders, highlighting important EV cargoes that may contribute to addiction. Additionally, as HIV and substance abuse are often comorbid, we discuss the potential role of EVs in the intersection of substance abuse and HIV. Taken together, the studies presented in this comprehensive review shed light on the potential role of EVs in the exacerbation of substance use and HIV. As a subject of growing interest, EVs may continue to provide information about mechanisms and pathogenesis in substance use disorders and CNS pathologies, perhaps allowing for exploration into potential therapeutic options.

Also flagged:Autosomal Dominant HypercholesterolemiaFHlow-density lipoprotein (LDL) receptorcholesterolhypercholesterolemiaFamilial hypercholesterolemia
Journal Article 2020-09-15 ✓ 2 Snippets Martín-Campos JM, Ruiz-Nogales S, Ibarretxe D, Ortega E, Sánchez-Pujol E, Royuela-Juncadella M, Vila À, Guerrero C, Zamora A, Soler I Ferrer C, Arroyo JA, Carreras G, Martínez-Figueroa S, Roig R, Plana N, Blanco-Vaca F, Xarxa d'Unitats de Lípids I Arteriosclerosi Xula.
In-Text Gene Mentions

…4299376), SLC22A1 (rs1564348),HFE(rs1800562), MYLIP (rs3757354)…

…( SLC22A1 rs1564348,HFErs1800562, and NYNRIN…

Show Full Abstract

Familial hypercholesterolemia (FH) is associated with mutations in the low-density lipoprotein (LDL) receptor (<i>LDLR</i>), apolipoprotein B (<i>APOB</i>), and proprotein convertase subtilisin/kexin 9 (<i>PCSK9</i>) genes. A pathological variant has not been identified in 30-70% of clinically diagnosed FH patients, and a burden of LDL cholesterol (LDL-c)-raising alleles has been hypothesized as a potential cause of hypercholesterolemia in these patients. Our aim was to study the distribution of weighted LDL-c-raising single-nucleotide polymorphism (SNP) scores (weighted gene scores or wGS) in a population recruited in a clinical setting in Catalonia. The study included 670 consecutive patients with a clinical diagnosis of FH and a prior genetic study involving 250 mutation-positive (FH/M+) and 420 mutation-negative (FH/M-) patients. Three wGSs based on LDL-c-raising variants were calculated to evaluate their distribution among FH patients and compared with 503 European samples from the 1000 Genomes Project. The FH/M- patients had significantly higher wGSs than the FH/M+ and control populations, with sensitivities ranging from 42% to 47%. A wGS based only on the SNPs significantly associated with FH (wGS8) showed a higher area under the receiver operating characteristic curve, and higher diagnostic specificity and sensitivity, with 46.4% of the subjects in the top quartile. wGS8 would allow for the assignment of a genetic cause to 66.4% of the patients if those with polygenic FH are added to the 37.3% of patients with monogenic FH. Our data indicate that a score based on 8 SNPs and the75th percentile cutoff point may identify patients with polygenic FH in Catalonia, although with limited diagnostic sensitivity and specificity.

Also flagged:Nucleic Acidβ-globinpathogenesisoligonucleotidesα-globinγ-globin
Journal Article 2020-09-15 No Snippets d'Arqom A.
Show Full Abstract

β-thalassemia is caused by mutations in the β-globin gene which diminishes or abolishes β-globin chain production. This reduction causes an imbalance of the α/β-globin chain ratio and contributes to the pathogenesis of the disease. Several approaches to reduce the imbalance of the α/β ratio using several nucleic acid-based technologies such as RNAi, lentiviral mediated gene therapy, splice switching oligonucleotides (SSOs) and gene editing technology have been investigated extensively. These approaches aim to reduce excess free α-globin, either by reducing the α-globin chain, restoring β-globin expression and reactivating γ-globin expression, leading a reduced disease severity, treatment necessity, treatment interval, and disease complications, thus, increasing the life quality of the patients and alleviating economic burden. Therefore, nucleic acid-based therapy might become a potential targeted therapy for β-thalassemia.

Also flagged:EpilepsyTemporal lobe epilepsyneurological disorderpathogenesishippocampal sclerosisgene expression
Journal Article 2020-09-15 No Snippets Baloun J, Bencurova P, Totkova T, Kubova H, Hermanova M, Hendrych M, Pail M, Pospisilova S, Brazdil M.
Show Full Abstract

Temporal lobe epilepsy (TLE) is a severe neurological disorder accompanied by recurrent spontaneous seizures. Although the knowledge of TLE onset is still incomplete, TLE pathogenesis most likely involves the aberrant expression of microRNAs (miRNAs). miRNAs play an essential role in organism homeostasis and are widely studied in TLE as potential therapeutics and biomarkers. However, many discrepancies in discovered miRNAs occur among TLE studies due to model-specific miRNA expression, different onset ages of epilepsy among patients, or technology-related bias. We employed a massive parallel sequencing approach to analyze brain tissues from 16 adult mesial TLE (mTLE)/hippocampal sclerosis (HS) patients, 8 controls and 20 rats with TLE-like syndrome, and 20 controls using the same workflow and categorized these subjects based on the age of epilepsy onset. All categories were compared to discover overlapping miRNAs with an aberrant expression, which could be involved in TLE. Our cross-comparative analyses showed distinct miRNA profiles across the age of epilepsy onset and found that the miRNA profile in rats with adult-onset TLE shows the closest resemblance to the profile in mTLE/HS patients. Additionally, this analysis revealed overlapping miRNAs between patients and the rat model, which should participate in epileptogenesis and ictogenesis. Among the overlapping miRNAs stand out miR-142-5p and miR-142-3p, which regulate immunomodulatory agents with pro-convulsive effects and suppress neuronal growth. Our cross-comparison study enhanced the insight into the effect of the age of epilepsy onset on miRNA expression and deepened the knowledge of epileptogenesis. We employed the same methodological workflow in both patients and the rat model, thus improving the reliability and accuracy of our results.

Also flagged:FER1L4gastric cancermalignant tumorsFer-1-like family member 4reverse transcriptionpolymerase
Journal Article 2020-09-15 ✓ 1 Snippet Xu J, Li N, Deng W, Luo S.
In-Text Gene Mentions

ZNFX1

Show Full Abstract

Gastric cancer (GC) is one of the most malignant tumors in the world. Growing evidence has highlighted the crucial role of long noncoding RNAs (lncRNAs) in the tumorigenesis of GC. The aim of the research was to elucidate the effects of lncRNA Fer-1-like family member 4 (FER1L4) in GC and identify the potential mechanisms. The present study investigated FER1L4 controlling cell survival and migration of SGC-7901 cells. Results indicated that the expression level of FER1L4 was distinctly decreased in GC cells, as evidenced by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis. By using cell proliferation assay, Transwell assay, wound healing assay and western blotting, we found out that overexpression of FER1L4 in SGC-7901 cells hindered the capacities of cell proliferation, invasion, migration and lymphatic metastasis. Furthermore, results of the western blotting and immunofluorescence assay unveiled that overexpression of FER1L4 led to a notable reduction in the expression of C-X-C chemokine receptor type 4 (CXCR4) and C-X-C motif chemokine 12 (CXCL12) in SGC-7901 cells. Besides, activation of Hippo pathway by upregulating Yes-associated protein (YAP) expression or treatment of CXCR4 inhibitor WZ811 reversed the inhibitory effects of FER1L4 on proliferation and metastasis of SGC-7901 cells. Moreover, co-transfection with YAP and FER1L4 overexpression plasmids abrogated the repressive effects of FER1L4 overexpression on proliferation and metastasis. Taken together, these results demonstrated that lncRNA FER1L4 suppressed cell proliferation, invasion, migration and lymphatic metastasis of GC cells by inactivation of the Hippo-YAP pathway, providing novel insights into regulatory mechanism under GC and new strategies for clinical practice.

Also flagged:hepatocellular carcinomaPost-transcriptionalmethylationmethylcytosinecancerstumor
Journal Article 2020-09-15 No Snippets He Y, Zhang Q, Zheng Q, Yu X, Guo W.
Show Full Abstract

Recent studies have indicated that several circular RNAs (circRNAs) can affect the occurrence and development of hepatocellular carcinoma (HCC). Post-transcriptional methylation modifications, including 5-methylcytosine (m5C) modification, are closely related to the tumorigenesis of cancers. However, the map of m5C modification of circRNA in HCC remains to be investigated. In this study, we performed MeRIP-seq to identify m5C sites on circRNA of human HCC tissues and paired adjacent non-tumor tissues. Further, we analyzed the relationship between m5C and HCC. Moreover, we performed a bioinformatics analysis to predict the function of specific methylated transcripts. We found that there was a significant difference in m5C between HCC tissues and paired non-tumor tissues, suggesting potential critical roles of m5C of circRNA in HCC development. In addition, the Gene Ontology (GO) analysis results indicated that the unique distribution pattern of circRNA m5C in HCC was associated with specific metabolism-associated pathways. In conclusion, our findings suggest a possible association between HCC and m5C of circRNA. Additionally, our results provide new insights into a novel function of m5C RNA methylation of circRNA in HCC progression.

Also flagged:Colon cancercancercolorectal cancersTumorcolorectal cancerABCB1
Journal Article 2020-09-15 ✓ 1 Snippet Badic B, Durand S, El Khoury F, De La Grange P, Gentien D, Simon B, Le Jossic-Corcos C, Corcos L.
In-Text Gene Mentions

DCC

Show Full Abstract

Colon cancer develops according to a defined temporal sequence of genetic and epigenetic molecular events that may primarily affect cancer stem cells. In an attempt to identify new markers of such cells that would help predict patient outcome, we performed a comparative transcriptome analysis of colon cancer stem cells and normal colon stem cells. We identified 162 mRNAs, either over- or under-expressed. According to Cox multivariate regression with our set of 83 colorectal cancers, low expression of <i>ABCB1, NEO1</i>, tumor size and the presence of distant metastases were predictive factors for overall survival. Combined expression of <i>ABCC1</i> and <i>NEO1</i> was a significant predictor for overall survival in our cohort, which was confirmed by external validation in 221 colorectal cancers from the Cancer Genome Atlas (TCGA) portal. Tumor size, lymph node involvement and <i>HIST1H2AE</i> expression were also independently correlated with disease-free survival. Taken together, our results suggest that molecular markers of colorectal cancers <i>ABCB1, NEO1</i> and <i>HIST1H2AE</i> are prognostic factors in colorectal cancer patients. It can be proposed that surveying expression of these marker genes should help better characterizing CRC prognosis, and help selecting the best therapeutic options.

Also flagged:CachexiaSkeletal muscle atrophyatrophycatabolismmuscular atrophypathogenesis
Journal Article 2020-09-15 No Snippets Chen R, Lei S, Jiang T, She Y, Shi H.
Show Full Abstract

Skeletal muscle atrophy is a common complication of cachexia, characterized by progressive bodyweight loss and decreased muscle strength, and it significantly increases the risks of morbidity and mortality in the population with atrophy. Numerous complications associated with decreased muscle function can activate catabolism, reduce anabolism, and impair muscle regeneration, leading to muscle wasting. microRNAs (miRNAs) and long non-coding RNAs (lncRNAs), types of non-coding RNAs, are important for regulation of skeletal muscle development. Few studies have specifically identified the roles of miRNAs and lncRNAs in cellular or animal models of muscular atrophy during cachexia, and the pathogenesis of skeletal muscle wasting in cachexia is not entirely understood. To develop potential approaches to improve skeletal muscle mass, strength, and function, a more comprehensive understanding of the known key pathophysiological processes leading to muscular atrophy is needed. In this review, we summarize the known miRNAs, lncRNAs, and corresponding signaling pathways involved in regulating skeletal muscle atrophy in cachexia and other diseases. A comprehensive understanding of the functions and mechanisms of miRNAs and lncRNAs during skeletal muscle wasting in cachexia and other diseases will, therefore, promote therapeutic treatments for muscle atrophy.

Also flagged:Cadherincell adhesion moleculesCell-cell adhesioncell adhesion proteinscalciumbinding
Journal Article 2020-09-15 No Snippets Martinez-Garay I.
Show Full Abstract

During development of the cerebral cortex, different types of neurons migrate from distinct origins to create the different cortical layers and settle within them. Along their way, migrating neurons use cell adhesion molecules on their surface to interact with other cells that will play critical roles to ensure that migration is successful. Radially migrating projection neurons interact primarily with radial glia and Cajal-Retzius cells, whereas interneurons originating in the subpallium follow a longer, tangential route and encounter additional cellular substrates before reaching the cortex. Cell-cell adhesion is therefore essential for the correct migration of cortical neurons. Several members of the cadherin superfamily of cell adhesion proteins, which mediate cellular interactions through calcium-dependent, mostly homophilic binding, have been shown to play important roles during neuronal migration of both projection neurons and interneurons. Although several classical cadherins and protocadherins are involved in this process, the most prominent is CDH2. This mini review will explore the cellular and molecular mechanisms underpinning cadherin function during cortical migration, including recent advances in our understanding of the control of adhesive strength through regulation of cadherin surface levels.

Also flagged:PseudomelanosisPMpathogenesispigmentationsystemic diseaseschronic renal disease
Journal Article 2020-09-15 ✓ 1 Snippet Rana NK, Minhas U, Mahl T.
In-Text Gene Mentions

…syndrome, hemosiderosis andhemochromatosis[ 16 -…

Show Full Abstract

Pseudomelanosis (PM) is a rare condition of unknown etiology and pathogenesis, described as speckled black pigmentation of intestinal mucosa. It is usually discovered as an incidental finding during endoscopy. Although, etiology of PM is unclear, it has been associated with different medications and systemic diseases such as chronic renal disease and diabetes mellitus. In this report, we describe a case of a 72-year-old male with multiple co-morbidities who presented with epigastric pain, nausea and hematemesis. Subsequently, upper endoscopy performed revealed intestinal PM with no active bleeding. Although considered a benign condition, knowing the existence of PM is important to exclude other serious conditions with similar endoscopic findings.

Also flagged:Psychiatric Disordersnucleotidespiwibrain developmentschizophreniamajor depressive disorder
Journal Article 2020-09-15 ✓ 1 Snippet Yoshino Y, Dwivedi Y.
In-Text Gene Mentions

(147) examined whether the expression of Netrin-1 guidance cue receptor DCC (deleted in colorectal cancer) gene was associated with resiliency or susceptibility to PFC dysfunctions in MDD suicide via miRNAs.

Show Full Abstract

It is well known that only a small proportion of the human genome code for proteins; the rest belong to the family of RNAs that do not code for protein and are known as non-coding RNAs (ncRNAs). ncRNAs are further divided into two subclasses based on size: 1) long non-coding RNAs (lncRNAs; >200 nucleotides) and 2) small RNAs (<200 nucleotides). Small RNAs contain various family members that include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). The roles of ncRNAs, especially lncRNAs and miRNAs, are well documented in brain development, homeostasis, stress responses, and neural plasticity. It has also been reported that ncRNAs can influence the development of psychiatric disorders including schizophrenia, major depressive disorder, and bipolar disorder. More recently, their roles are being investigated in suicidal behavior. In this article, we have comprehensively reviewed the findings of lncRNA and miRNA expression changes and their functions in various psychiatric disorders including suicidal behavior. We primarily focused on studies that have been done in <i>postmortem</i> human brain. In addition, we have briefly reviewed the role of other small RNAs (<i>e.g.</i> piwiRNA, siRNA, snRNA, and snoRNAs) and their expression changes in psychiatric illnesses.

Research Square 2020-09-15 Preprint (No Snippets API) Sun Q, Guo D, Li S, Xu Y, Jiang M, Li Y, Duan H, Zhuo W, Liu W, Zhu S, Liu X, Wang L, Zhou T.
Show Full Abstract

<title>Abstract</title> <p><bold>Background</bold>: The AJCC staging system is considered as the golden standard in clinical practice. However, it remains some pitfalls in assessing the prognosis of gastric cancer (GC) patients with similar clinicopathological characteristics. We aim to develop a new clinic and genetic risk score (CGRS) to improve the prognosis prediction of GC patients.<bold>Methods: </bold>The gene expression profiles of the training set from the Asian Cancer Research Group (ACRG) cohort were used for developing genetic risk score (GRS) by LASSO-Cox regression algorithms. CGRS was established by integrating GRS with clinical risk score (CRS) derived from Surveillance, Epidemiology, and End Results (SEER) database. GRS and CGRS were validated in ACRG validation set and other four independent GC cohorts with different data types, such as microarray, RNA sequencing, and qRT-PCR. Multivariable Cox regression was adopted to evaluate the independence of GRS and CGRS in prognosis evaluation.<bold>Results:<italic> </italic></bold>We established GRS based on a nine-gene signature including <italic>APOD, CCDC92</italic>, <italic>CYS1</italic>, <italic>GSDME</italic>, <italic>ST8SIA5</italic>, <italic>STARD3NL</italic>, <italic>TIMEM245</italic>, <italic>TSPYL5</italic>, and <italic>VAT1</italic>. GRS and CGRS dichotomized GC patients into high and low risk groups with significantly different prognosis in four independent cohorts, including our Zhejiang cohort (all HR > 1, all <italic>P</italic> < 0.001). Both GRS and CGRS were prognostic signatures independent of the AJCC staging system. Receiver operating characteristic (ROC) analysis showed that area under ROC curve of CGRS was larger than that of the AJCC staging system in most cohorts we studied. Nomogram and web tool (http://39.100.117.92/CGRS/) based on CGRS were developed for clinicians to conveniently assess GC prognosis in clinical practice.<bold>Conclusions: </bold>CGRS integrating genetic signature with clinical features shows strong robustness in predicting GC prognosis, and can be easily applied in clinical practice through the web application.</p>

medRxiv 2020-09-15 Preprint (No Snippets API) Lam M, Thompson M, Li B, Edwards AC, Chen C, Ge T, Cai N, Bigdeli T, Lencz T, Kendler K, Huang H.
Show Full Abstract

<h4>Introduction</h4> Recent advances in psychiatric genomics have enabled large-scale genome-wide scans that elucidated genetic architecture both in mood disorder and schizophrenia across individuals of East Asian and European descent. Investigating joint genetic architecture of these psychiatric traits enables the identification of common and diverging etiological mechanisms underlying these psychiatric illnesses. Here, we leverage on the largest GWAS of schizophrenia and mood disorder conducted to date in East Asian and European descent samples to elucidate the joint genetic architecture that underlie these psychiatric disorders. <h4>Methodology</h4> We carried out GWAS meta-analysis on both European (EUR) and East Asian (EAS) Ancestry summary statistics for Major Depressive Disorder (MDD) and Schizophrenia via Multi-Trait Analysis of GWAS. Downstream pathway, eQTL, chromatin interaction analysis were carried out to characterize genome-wide results. In addition we carried out genetic correlations and polygenic risk prediction analysis to further study the joint genetic architectures of mood disorder and schizophrenia. <h4>Results</h4> There were 308 loci that was significantly associated with at least one trait. Specifically, there were 98 independent loci in EUR-MDD, 5 loci for MTAGx-EAS-MDD, 121 loci for MTAGx-EUR-MDD, 8 independent loci for EAS-SZ, 171 independent loci for EUR-SZ, 124 independent loci for MTAGx-EAS-SZ, and 159 independent loci for MTAGx-EUR-SZ. In all, 61 loci were novel across traits. SOAT1 and FOXO3 genes were implicated based on genome-wide associations. 114 gene(s) were implicated in eQTL analysis of gene expression in brain tissue. Gene-set analysis show support for GABA-egic pathways implicated in MDD, driven by several GABA-alpha receptor genes as well as more peripheral PLCL1 and NISCH genes that are responsible for endocytosis and neuronal trafficking. Cross-Ancestry genetic correlations ascertained that the CONVERGE MDD phenotype generally holds higher SNP based heritability and is likely driven by case-ascertainment procedures. Finally, polygenic risk score modelling indicates that MTAGx procedures were effective in enriching GWAS signals in the EAS-MDD for prediction in an independent case-control sample. <h4>Discussion</h4> Here we are able to demonstrate that cross-trait cross-ancestry approaches in schizophrenia and MDD not only yields new discoveries to the genetic architecture of these illnesses; we were able to identify new biological underpinnings within the GABA pathways for depressive disorders. The evidence in the current report underscores the importance of taking into consideration both phenotype and ancestry complexities in genome-wide studies.

Also flagged:liver diseaseHepatitis B core‐related antigenhepatocellular carcinomaChronic hepatitis B virus infectionliver cirrhosisliver failure
Journal Article 2020-09-14 ✓ 1 Snippet Beudeker BJB, Groothuismink ZMA, de Man RA, Witjes CDM, van der Eijk AA, Boonstra A, Sonneveld MJ.
In-Text Gene Mentions

…auto‐immune liver disease,hemochromatosis, Wilson's disease or…

Show Full Abstract

Prognosis of hepatitis B (HBV)-associated hepatocellular carcinoma (HCC) is poor due to high rates of HCC recurrence and progression of underlying liver disease. We studied whether serum hepatitis B core-related antigen (HBcrAg) levels could predict HCC recurrence and outcome in HBV associated. Higher HBcrAg levels at HCC diagnosis were independently associated with reduced overall and recurrence-free survival in patients with early, but not advanced, stage HCC.

Also flagged:lung cancertranslationalsquamous cell lung cancerimmune responsesmajor histocompatibility complexnuclear factor-κB
Journal Article 2020-09-14 ✓ 1 Snippet Sun R, Xu M, Li X, Gaynor S, Zhou H, Li Z, Bossé Y, Lam S, Tsao MS, Tardon A, Chen C, Doherty J, Goodman G, Bojesen SE, Landi MT, Johansson M, Field JK, Bickeböller H, Wichmann HE, Risch A, Rennert G, Arnold S, Wu X, Melander O, Brunnström H, Le Marchand L, Liu G, Andrew A, Duell E, Kiemeney LA, Shen H, Haugen A, Johansson M, Grankvist K, Caporaso N, Woll P, Dawn Teare M, Scelo G, Hong YC, Yuan JM, Lazarus P, Schabath MB, Aldrich MC, Albanes D, Mak R, Barbie D, Brennan P, Hung RJ, Amos CI, Christiani DC, Lin X.
In-Text Gene Mentions

TRIM38

Show Full Abstract

Clinical trial results have recently demonstrated that inhibiting inflammation by targeting the interleukin-1β pathway can offer a significant reduction in lung cancer incidence and mortality, highlighting a pressing and unmet need to understand the benefits of inflammation-focused lung cancer therapies at the genetic level. While numerous genome-wide association studies (GWAS) have explored the genetic etiology of lung cancer, there remains a large gap between the type of information that may be gleaned from an association study and the depth of understanding necessary to explain and drive translational findings. Thus, in this study we jointly model and integrate extensive multiomics data sources, utilizing a total of 40 genome-wide functional annotations that augment previously published results from the International Lung Cancer Consortium (ILCCO) GWAS, to prioritize and characterize single nucleotide polymorphisms (SNPs) that increase risk of squamous cell lung cancer through the inflammatory and immune responses. Our work bridges the gap between correlative analysis and translational follow-up research, refining GWAS association measures in an interpretable and systematic manner. In particular, reanalysis of the ILCCO data highlights the impact of highly associated SNPs from nuclear factor-κB signaling pathway genes as well as major histocompatibility complex mediated variation in immune responses. One consequence of prioritizing likely functional SNPs is the pruning of variants that might be selected for follow-up work by over an order of magnitude, from potentially tens of thousands to hundreds. The strategies we introduce provide informative and interpretable approaches for incorporating extensive genome-wide annotation data in analysis of genetic association studies.

Also flagged:Raf kinase inhibitor proteinPEBP 1MAPKCas9phosphatidylethanolamine‐binding protein 1RKIP
Journal Article 2020-09-14 ✓ 5 Snippets Yang X, Wang Y, Lu P, Shen Y, Zhao X, Zhu Y, Jiang Z, Yang H, Pan H, Zhao L, Zhong Y, Wang J, Liang Z, Shen X, Lu D, Jiang S, Xu J, Wu H, Lu H, Jiang G, Zhu H.
In-Text Gene Mentions

Previous studies indicated that PEBP1, also known as Raf1 kinase inhibitor protein RKIP, is involved in MAPK and NF‐κB signaling pathways via interaction with Raf1 and IKK in cancer cells (Yeung et al, 2001; Lee et al, 2006; Tavel et al, 2012; Wei et al, 2015).

However, during the latency stage induced by a continuous decrease of IL‐2 concentration, PEBP1 gene expression significantly increased until latency was established at day 12 post‐infection (Fig 6C).

Importantly, PEBP1 gene expression decreased during early active viral infection (day 3 post‐infection).

TZM‐bl cells were transfected with Lv-PCDH‐empty or Lv‐PCDH-PEBP1 followed by infection of HIV derived from patient plasma whose viral load is 129 copies/ml.

Next, we wanted to determine whether PEBP1 can directly inhibit the viral transcription in the early stage of infection.

Show Full Abstract

The latent HIV-1 reservoir is a major barrier to viral eradication. However, our understanding of how HIV-1 establishes latency is incomplete. Here, by performing a genome-wide CRISPR-Cas9 knockout library screen, we identify phosphatidylethanolamine-binding protein 1 (PEBP1), also known as Raf kinase inhibitor protein (RKIP), as a novel gene inducing HIV latency. Depletion of PEBP1 leads to the reactivation of HIV-1 in multiple models of latency. Mechanistically, PEBP1 de-phosphorylates Raf1/ERK/IκB and IKK/IκB signaling pathways to sequestrate NF-κB in the cytoplasm, which transcriptionally inactivates HIV-1 to induce latency. Importantly, the induction of PEBP1 expression by the green tea compound epigallocatechin-3-gallate (EGCG) prevents latency reversal by inhibiting nuclear translocation of NF-κB, thereby suppressing HIV-1 transcription in primary CD4<sup>+</sup> T cells isolated from patients receiving antiretroviral therapy (ART). These results suggest a critical role for PEBP1 in the regulation of upstream NF-κB signaling pathways governing HIV transcription. Targeting of this pathway could be an option to control HIV reservoirs in patients in the future.

Also flagged:Autonomic Nervous Systemcell migrationdevelopmental disorders offamilial dysautonomiaHirschsprung diseaseRett syndrome
Journal Article 2020-09-14 No Snippets Lefcort F.
Show Full Abstract

Investigations of the cellular and molecular mechanisms that mediate the development of the autonomic nervous system have identified critical genes and signaling pathways that, when disrupted, cause disorders of the autonomic nervous system. This review summarizes our current understanding of how the autonomic nervous system emerges from the organized spatial and temporal patterning of precursor cell migration, proliferation, communication, and differentiation, and discusses potential clinical implications for developmental disorders of the autonomic nervous system, including familial dysautonomia, Hirschsprung disease, Rett syndrome, and congenital central hypoventilation syndrome.

Also flagged:cancergene expressiontranslational modificationsnucleotidesNAT-transcriptional
Journal Article 2020-09-14 ✓ 1 Snippet Zhao S, Zhang X, Chen S, Zhang S.
In-Text Gene Mentions

…For example,ZNFX1antisense RNA 1…

Show Full Abstract

Natural antisense transcripts (NATs), which are transcribed from opposite strands of DNA with partial or complete overlap, affect multiple stages of gene expression, from epigenetic to post-translational modifications. NATs are dysregulated in various types of cancer, and an increasing number of studies focusing on NATs as pivotal regulators of the hallmarks of cancer and as promising candidates for cancer therapy are just beginning to unravel the mystery. Here, we summarize the existing knowledge on NATs to highlight their underlying mechanisms of functions in cancer biology, discuss their potential roles in therapeutic application, and explore future research directions.

Also flagged:VGluT2Dopaminevesicular glutamate transporter 2glutamate6-hydroxydopamineto
Journal Article 2020-09-14 ✓ 1 Snippet Kouwenhoven WM, Fortin G, Penttinen AM, Florence C, Delignat-Lavaud B, Bourque MJ, Trimbuch T, Luppi MP, Salvail-Lacoste A, Legault P, Poulin JF, Rosenmund C, Awatramani R, Trudeau LÉ.
In-Text Gene Mentions

Sox6

Show Full Abstract

A subset of adult ventral tegmental area dopamine (DA) neurons expresses vesicular glutamate transporter 2 (VGluT2) and releases glutamate as a second neurotransmitter in the striatum, while only few adult substantia nigra DA neurons have this capacity. Recent work showed that cellular stress created by neurotoxins such as MPTP and 6-hydroxydopamine can upregulate VGluT2 in surviving DA neurons, suggesting the possibility of a role in cell survival, although a high level of overexpression could be toxic to DA neurons. Here we examined the level of VGluT2 upregulation in response to neurotoxins and its impact on postlesional plasticity. We first took advantage of an <i>in vitro</i> neurotoxin model of Parkinson's disease and found that this caused an average 2.5-fold enhancement of <i>Vglut2</i> mRNA in DA neurons. This could represent a reactivation of a developmental phenotype because using an intersectional genetic lineage-mapping approach, we find that >98% of DA neurons have a VGluT2<sup>+</sup> lineage. Expression of VGluT2 was detectable in most DA neurons at embryonic day 11.5 and was localized in developing axons. Finally, compatible with the possibility that enhanced VGluT2 expression in DA neurons promotes axonal outgrowth and reinnervation in the postlesional brain, we observed that DA neurons in female and male mice in which VGluT2 was conditionally removed established fewer striatal connections 7 weeks after a neurotoxin lesion. Thus, we propose here that the developmental expression of VGluT2 in DA neurons can be reactivated at postnatal stages, contributing to postlesional plasticity of dopaminergic axons.<b>SIGNIFICANCE STATEMENT</b> A small subset of dopamine neurons in the adult, healthy brain expresses vesicular glutamate transporter 2 (VGluT2) and thus releases glutamate as a second neurotransmitter in the striatum. This neurochemical phenotype appears to be plastic as exposure to neurotoxins, such as 6-OHDA or MPTP, that model certain aspects of Parkinson's disease pathophysiology, boosts VGluT2 expression in surviving dopamine neurons. Here we show that this enhanced VGluT2 expression in dopamine neurons drives axonal outgrowth and contributes to dopamine neuron axonal plasticity in the postlesional brain. A better understanding of the neurochemical changes that occur during the progression of Parkinson's disease pathology will aid the development of novel therapeutic strategies for this disease.

Also flagged:voltage-dependent sodium channelsDravet syndromeepileptic encephalopathySCN1AarthrogryposisArthrogryposis multiplex congenita
Journal Article 2020-09-14 ✓ 4 Snippets Jaber D, Gitiaux C, Blesson S, Marguet F, Buard D, Varela Salgado M, Kaminska A, Saada J, Fallet-Bianco C, Martinovic J, Laquerriere A, Melki J.
In-Text Gene Mentions

NALCN encoding a G-protein–coupled receptor-activated channel is highly expressed in the central nervous system and de novo variants of NALCN are responsible for AMC associated with developmental delay (CLIFAHDD, [MIM: 616266]).4 Epilepsy was reported in two out of seven affected AMC individuals.4 Similarly, CACNA1E encodes the alpha1-subunit of the voltage-gated Cav2.3 channel which is highly expressed in the central nervous system.

…611549) 4 orCACNA1E(MIM: 601013).…

…or NALCN orCACNA1E, two genes…

…4 Similarly,CACNA1Eencodes the alpha1-subunit…

Show Full Abstract

<h4>Background</h4>Arthrogryposis multiplex congenita (AMC) is the direct consequence of reduced fetal movements. AMC includes a large spectrum of diseases which result from variants in genes encoding components required for the formation or the function of the neuromuscular system. AMC may also result from central nervous involvement. <i>SCN1A</i> encodes Nav1.1, a critical component of voltage-dependent sodium channels which underlie action potential generation and propagation. Variants of <i>SCN1A</i> are known to be responsible for Dravet syndrome, a severe early-onset epileptic encephalopathy. We report pathogenic heterozygous missense de novo variants in <i>SCN1A</i> in three unrelated individuals with AMC.<h4>Methods</h4>Whole-exome sequencing was performed from DNA of the index case of AMC families. Heterozygous missense variants in <i>SCN1A</i> (p.Leu893Phe, p.Ala989Thr, p.Ile236Thr) were identified in three patients. Sanger sequencing confirmed the variants and showed that they occurred de novo.<h4>Results</h4>AMC was diagnosed from the second trimester of pregnancy in the three patients. One of them developed drug-resistant epileptic seizures from birth. We showed that <i>SCN1A</i> is expressed in both brain and spinal cord but not in skeletal muscle during human development. The lack of motor denervation as established by electromyographic studies or pathological examination of the spinal cord or skeletal muscle in the affected individuals suggests that AMC is caused by brain involvement.<h4>Conclusion</h4>We show for the first time that <i>SCN1A</i> variants are responsible for early-onset motor defect leading to AMC indicating a critical role of <i>SCN1A</i> in prenatal motor development and broadening the phenotypic spectrum of variants in <i>SCN1A</i>.

Also flagged:MST1UNC5Bgrowthcell proliferationlaminin-related proteinnetrin receptor
Journal Article 2020-09-14 ✓ 3 Snippets Ahn EH, Kang SS, Qi Q, Liu X, Ye K.
In-Text Gene Mentions

DCC

DCC receptor

Htt

Show Full Abstract

The Hippo (MST1/2) pathway plays a critical role in restricting tissue growth in adults and modulating cell proliferation, differentiation, and migration in developing organs. Netrin1, a secreted laminin-related protein, is essential for nervous system development. However, the mechanisms underlying MST1 regulation by the extrinsic signals remain unclear. Here, we demonstrate that Netrin1 reduction in Parkinson's disease (PD) activates MST1, which selectively binds and phosphorylates netrin receptor UNC5B on T428 residue, promoting its apoptotic activation and dopaminergic neuronal loss. Netrin1 deprivation stimulates MST1 activation and interaction with UNC5B, diminishing YAP levels and escalating cell deaths. Knockout of UNC5B abolishes netrin depletion-induced dopaminergic loss, whereas blockade of MST1 phosphorylating UNC5B suppresses neuronal apoptosis. Remarkably, Netrin1 is reduced in PD patient brains, associated with MST1 activation and UNC5B T428 phosphorylation, which is accompanied by YAP reduction and apoptotic activation. Hence, Netrin1 regulates Hippo (MST1) pathway in dopaminergic neuronal loss in PD via UNC5B receptor.

Also flagged:WntextracellularvesiclesNecrotizing enterocolitisNECintestinal disease
Journal Article 2020-09-14 ✓ 2 Snippets Li B, Lee C, O'Connell JS, Antounians L, Ganji N, Alganabi M, Cadete M, Nascimben F, Koike Y, Hock A, Botts SR, Wu RY, Miyake H, Minich A, Maalouf MF, Zani-Ruttenstock E, Chen Y, Johnson-Henry KC, De Coppi P, Eaton S, Maattanen P, Delgado Olguin P, Zani A, Sherman PM, Pierro A.
In-Text Gene Mentions

…markers Lgr5 andOlfm4(Fig. 3g, h…

…, Lgr5, andOlfm4expression (Fig. 6e–h…

Show Full Abstract

Necrotizing enterocolitis (NEC) is a devastating intestinal disease primarily affecting preterm neonates and causing high morbidity, high mortality, and huge costs for the family and society. The treatment and the outcome of the disease have not changed in recent decades. Emerging evidence has shown that stimulating the Wnt/β-catenin pathway and enhancing intestinal regeneration are beneficial in experimental NEC, and that they could potentially be used as a novel treatment. Amniotic fluid stem cells (AFSC) and AFSC-derived extracellular vesicles (EV) can be used to improve intestinal injury in experimental NEC. However, the mechanisms by which they affect the Wnt/β-catenin pathway and intestinal regeneration are unknown. In our current study, we demonstrated that AFSC and EV attenuate NEC intestinal injury by activating the Wnt signaling pathway. AFSC and EV stimulate intestinal recovery from NEC by increasing cellular proliferation, reducing inflammation and ultimately regenerating a normal intestinal epithelium. EV administration has a rescuing effect on intestinal injury when given during NEC induction; however, it failed to prevent injury when given prior to NEC induction. AFSC-derived EV administration is thus a potential emergent novel treatment strategy for NEC.

Also flagged:nicotinealcoholgene expressiondopamineaddictionsynapse
Journal Article 2020-09-14 No Snippets Kazemi T, Huang S, Avci NG, Waits CMK, Akay YM, Akay M.
Show Full Abstract

Nicotine and alcohol are two of the most commonly used and abused recreational drugs, are often used simultaneously, and have been linked to significant health hazards. Furthermore, patients diagnosed with dependence on one drug are highly likely to be dependent on the other. Several studies have shown the effects of each drug independently on gene expression within many brain regions, including the ventral tegmental area (VTA). Dopaminergic (DA) neurons of the dopamine reward pathway originate from the VTA, which is believed to be central to the mechanism of addiction and drug reinforcement. Using a well-established rat model for both nicotine and alcohol perinatal exposure, we investigated miRNA and mRNA expression of dopaminergic (DA) neurons of the VTA in rat pups following perinatal alcohol and joint nicotine-alcohol exposure. Microarray analysis was then used to profile the differential expression of both miRNAs and mRNAs from DA neurons of each treatment group to further explore the altered genes and related biological pathways modulated. Predicted and validated miRNA-gene target pairs were analyzed to further understand the roles of miRNAs within these networks following each treatment, along with their post transcription regulation points affecting gene expression throughout development. This study suggested that glutamatergic synapse and axon guidance pathways were specifically enriched and many miRNAs and genes were significantly altered following alcohol or nicotine-alcohol perinatal exposure when compared to saline control. These results provide more detailed insight into the cell proliferation, neuronal migration, neuronal axon guidance during the infancy in rats in response to perinatal alcohol/ or nicotine-alcohol exposure.

Also flagged:mineralChromosomehipSE1SE2Beta2
Journal Article 2020-09-14 ✓ 1 Snippet Feng GJ, Wei XT, Zhang H, Yang XL, Shen H, Tian Q, Deng HW, Zhang L, Pei YF.
In-Text Gene Mentions

SOX6

Show Full Abstract

Bone mineral density (BMD) and lean body mass (LBM) not only have a considerable heritability each, but also are genetically correlated. However, common genetic determinants shared by both traits are largely unknown. In the present study, we performed a bivariate genome-wide association study (GWAS) meta-analysis of hip BMD and trunk lean mass (TLM) in 11,335 subjects from 6 samples, and performed replication in estimated heel BMD and TLM in 215,234 UK Biobank (UKB) participants. We identified 2 loci that nearly attained the genome-wide significance (GWS, p < 5.0 × 10<sup>-8</sup>) level in the discovery GWAS meta-analysis and that were successfully replicated in the UKB sample: 11p15.2 (lead SNP rs12800228, discovery p = 2.88 × 10<sup>-7</sup>, replication p = 1.95 × 10<sup>-4</sup>) and 18q21.32 (rs489693, discovery p = 1.67 × 10<sup>-7</sup>, replication p = 1.17 × 10<sup>-3</sup>). The above 2 pleiotropic loci may play a pleiotropic role for hip BMD and TLM development. So our findings provide useful insights that further enhance our understanding of genetic interplay between BMD and LBM.

Also flagged:GFAPdendritePax6Nestingene expressionVGLUT1
Journal Article 2020-09-14 ✓ 5 Snippets Ding C, Zhang C, Kopp R, Kuney L, Meng Q, Wang L, Xia Y, Jiang Y, Dai R, Min S, Yao WD, Wong ML, Ruan H, Liu C, Chen C.
In-Text Gene Mentions

POU3F2

In addition, spatiotemporal expression data from SZDB (schizophrenia database) showed that the mRNA expression levels of POU3F2 and TRIM8 gradually increased and then peaked during the early developmental stages of the prefrontal cortex (fetal and infant stages; Supplementary Fig. 3C).

Transcription factor POU3F2 regulates TRIM8 expression contributing to cellular functions implicated in schizophrenia

Since bipolar disorder is also a neurodevelopmental disorder, and POU3F2 is located in its genome-wide significant risk locus44, 45, POU3F2-regulated neural functions might also be related to the etiology of bipolar disorder.

Children with a mutation in POU3F2 possess varying degrees of developmental delay and intellectual disability49, 50.

Show Full Abstract

Schizophrenia (SCZ) is a neuropsychiatric disorder with aberrant expression of multiple genes. However, identifying its exact causal genes remains a considerable challenge. The brain-specific transcription factor POU3F2 (POU domain, class 3, transcription factor 2) has been recognized as a risk factor for SCZ, but our understanding of its target genes and pathogenic mechanisms are still limited. Here we report that POU3F2 regulates 42 SCZ-related genes in knockdown and RNA-sequencing experiments of human neural progenitor cells (NPCs). Among those SCZ-related genes, TRIM8 (Tripartite motif containing 8) is located in SCZ-associated genetic locus and is aberrantly expressed in patients with SCZ. Luciferase reporter and electrophoretic mobility shift assays (EMSA) showed that POU3F2 induces TRIM8 expression by binding to the SCZ-associated SNP (single nucleotide polymorphism) rs5011218, which affects POU3F2-binding efficiency at the promoter region of TRIM8. We investigated the cellular functions of POU3F2 and TRIM8 as they co-regulate several pathways related to neural development and synaptic function. Knocking down either POU3F2 or TRIM8 promoted the proliferation of NPCs, inhibited their neuronal differentiation, and impaired the excitatory synaptic transmission of NPC-derived neurons. These results indicate that POU3F2 regulates TRIM8 expression through the SCZ-associated SNP rs5011218, and both genes may be involved in the etiology of SCZ by regulating neural development and synaptic function.

Also flagged:cysteineAbdominal Aortic AneurysmSuccinate dehydrogenase complexgil60 kDa heat shock protein, mitochondrialBiP
Journal Article 2020-09-14 ✓ 1 Snippet Jeong SJ, Cho MJ, Ko NY, Kim S, Jung IH, Min JK, Lee SH, Park JG, Oh GT.
In-Text Gene Mentions

…includes six isoforms (PRDX1–PRDX6), which are distributed…

Show Full Abstract

Abdominal aortic aneurysm (AAA) is an inflammatory vascular disease characterized by structural deterioration of the aorta caused by inflammation and oxidative stress, leading to aortic dilatation and rupture. Peroxiredoxin 2 (PRDX2), an antioxidant enzyme, has been reported as a potential negative regulator of inflammatory vascular diseases, and it has been identified as a protein that is increased in patients with ruptured AAA compared to patients with nonruptured AAA. In this study, we demonstrated that PRDX2 was a pivotal factor involved in the inhibition of AAA progression. PRDX2 levels were increased in AAA compared with those in normal aortas in both humans and mice. Ultrasound imaging revealed that the loss of PRDX2 accelerated the development of AAA in the early stages and increased AAA incidence in mice infused with angiotensin II (Ang II). Prdx2<sup>-/-</sup> mice infused with Ang II exhibited increased aortic dilatation and maximal aortic diameter without a change in blood pressure. Structural deterioration of the aortas from Prdx2<sup>-/-</sup> mice infused with Ang II was associated with increases in the degradation of elastin, oxidative stress, and intramural thrombi caused by microhemorrhages, immature neovessels, and the activation of matrix metalloproteinases compared to that observed in controls. Moreover, an increase in inflammatory responses, including the production of cell adhesion molecules and the accumulation of inflammatory cells and proinflammatory cytokines due to PRDX2 deficiency, accelerated Ang II-induced AAA progression. Our data confirm that PRDX2 plays a role as a negative regulator of the pathological process of AAA and suggest that increasing PRDX2 activity may be a novel strategy for the prevention and treatment of AAA.

Also flagged:Brightspinischemia3 msDiabetesinfarct
Journal Article 2020-09-14 ✓ 1 Snippet Pavon AG, Georgiopoulos G, Vincenti G, Muller O, Monney P, Berchier G, Cirillo C, Cirillo C, Eeckhout E, Schwitter J, Masci PG.
In-Text Gene Mentions

…who died ofhemochromatosis, and it has…

Show Full Abstract

<h4>Objectives</h4>T2*-weighted (T2*w) is deemed as a reference standard for post-infarction intramyocardial haemorrhage (IMH). However, high proportion of T2* images is affected by off-resonance artefacts hampering image interpretation. Diagnostic accuracy and precision of alternative techniques for IMH diagnosis and quantification have been seldomly investigated.<h4>Methods and results</h4>Between April 2016 and May 2017, 50 ST-segment elevation myocardial infarction patients (66% male, 57 ± 17 years) and 15 healthy controls (60% male, 58 ± 13) were consecutively enrolled. Subjects underwent head-to-head comparison of single mid-infarct slice acquired on black-blood T2-weighted short-TI-inversion recovery (T2w-STIR), bright-blood T2prep-steady-state-free precession (T2prep-SSFP), and T2/T1 maps for IMH diagnosis and quantification against T2*w. All images were graded for quality (grade 1: very poor; grade 4: excellent) and diagnostic confidence (Likert scale, 1: very unsure and 5: highly confident). Reduced relaxation time/hypointense region (hypocore) embedded in infarct-related oedema on T2 map, T1 map, and T2w-STIR had the best overall diagnostic accuracy (per-subject: 91%, 86%, and 86%, respectively; per segment: 95%, 93%, and 93%, respectively). By mixed-effects analysis, image quality, and diagnostic confidence were higher for T2 map and T1 maps than T2*w (p < 0.05 for both scores). For IMH quantification, hypocore on T2 map and T1 map strongly correlated (Spearman's r > 0.7, p < 0.001 for both) with IMH extent on T2*w and presented an overall excellent agreement on Bland-Altman analysis. By linear mixed model analysis, absolute hypocore size did not differ among T1-, T2 map, and T2*w. T2/T1 maps had the best intra- and inter-observer reproducibility among CMR techniques.<h4>Conclusion</h4>Hypocore on T2/T1 map is the best alternative technique to T2*w for diagnosing and quantifying IMH in post-STEMI patients.<h4>Key point</h4>• Mapping techniques are the best alternatives for diagnosing post-infarction intramyocardial haemorrhage. • Mapping techniques are valuable tools for imaging intramyocardial haemorrhage.

Also flagged:SynthesisResveratrol Butyrate Estersresveratrolbutyrate estersbutyric acidester
Journal Article 2020-09-14 No Snippets Tain YL, Jheng LC, Chang SKC, Chen YW, Huang LT, Liao JX, Hou CY.
Show Full Abstract

To facilitate broad applications and enhance bioactivity, resveratrol was esterified to resveratrol butyrate esters (RBE). Esterification with butyric acid was conducted by the Steglich esterification method at room temperature with <i>N</i>-ethyl-<i>N</i>'-(3-dimethylaminopropyl) carbodiimide (EDC) and 4-dimethyl aminopyridine (DMAP). Our experiments demonstrated the synthesis of RBE through EDC- and DMAP-facilitated esterification was successful and that the FTIR spectra of RBE revealed absorption (1751 cm<sup>-1</sup>) in the ester region. <sup>13</sup>C-NMR spectrum of RBE showed a peak at 171 ppm corresponding to the ester group and peaks between 1700 and 1600 cm<sup>-1</sup> in the FTIR spectra. RBE treatment (25 or 50 μM) decreased oleic acid-induced lipid accumulation in HepG2 cells. This effect was stronger than that of resveratrol and mediated through the downregulation of p-ACC and SREBP-2 expression. This is the first study demonstrating RBE could be synthesized by the Steglich method and that resulting RBE could inhibit lipid accumulation in HepG2 cells. These results suggest that RBE could potentially serve as functional food ingredients and supplements for health promotion.

Also flagged:AmelogeninDental cariesdemineralisationmineralpeptidepolyproline
Journal Article 2020-09-14 No Snippets Dissanayake SSM, Ekambaram M, Li KC, Harris PWR, Brimble MA.
Show Full Abstract

Dental caries or tooth decay is a preventable and multifactorial disease that affects billions of people globally and is a particular concern in younger populations. This decay arises from acid demineralisation of tooth enamel resulting in mineral loss from the subsurface. The remineralisation of early enamel carious lesions could prevent the cavitation of teeth. The enamel protein amelogenin constitutes 90% of the total enamel matrix protein in teeth and plays a key role in the biomineralisation of tooth enamel. The physiological importance of amelogenin has led to the investigation of the possible development of amelogenin-derived biomimetics against dental caries. We herein review the literature on amelogenin, its primary and secondary structure, comparison to related species, and its' in vivo processing to bioactive peptide fragments. The key structural motifs of amelogenin that enable enamel remineralisation are discussed. The presence of several motifs in the amelogenin structure (such as polyproline, N- and C-terminal domains and C-terminal orientation) were shown to play a critical role in the formation of particle shape during remineralization. Understanding the function/structure relationships of amelogenin can aid in the rational design of synthetic polypeptides for biomineralisation, halting enamel loss and leading to improved therapies for tooth decay.

Also flagged:Transcription FactorsCartilage HomeostasisOsteoarthritisOAdegenerative joint diseaseextracellular
Journal Article 2020-09-14 No Snippets Neefjes M, van Caam APM, van der Kraan PM.
Show Full Abstract

Osteoarthritis (OA) is the most common degenerative joint disease, and it is characterized by articular cartilage loss. In part, OA is caused by aberrant anabolic and catabolic activities of the chondrocyte, the only cell type present in cartilage. These chondrocyte activities depend on the intra- and extracellular signals that the cell receives and integrates into gene expression. The key proteins for this integration are transcription factors. A large number of transcription factors exist, and a better understanding of the transcription factors activated by the various signaling pathways active during OA can help us to better understand the complex etiology of OA. In addition, establishing such a profile can help to stratify patients in different subtypes, which can be a very useful approach towards personalized therapy. In this review, we discuss crucial transcription factors for extracellular matrix metabolism, chondrocyte hypertrophy, chondrocyte senescence, and autophagy in chondrocytes. In addition, we discuss how insight into these factors can be used for treatment purposes.

Also flagged:SerineglutamineHuntington's diseaseHDpost-translational modificationsphosphorylation
Journal Article 2020-09-14 ✓ 3 Snippets Chatterjee M, Steffan JS, Lukacsovich T, Marsh JL, Agrawal N.
In-Text Gene Mentions

The impact of phosphorylating serine 13/16 of mutant HTT (mHTT) on HD has been documented in cell culture and murine models.

Poly-glutamine expansion near the N-terminus of the huntingtin protein (HTT) is the prime determinant of Huntington's disease (HD) pathology; however, post-translational modifications and protein context are also reported to influence poly-glutamine induced HD toxicity.

…the huntingtin protein (HTT) is the prime…

Show Full Abstract

Poly-glutamine expansion near the N-terminus of the huntingtin protein (HTT) is the prime determinant of Huntington's disease (HD) pathology; however, post-translational modifications and protein context are also reported to influence poly-glutamine induced HD toxicity. The impact of phosphorylating serine 13/16 of mutant HTT (mHTT) on HD has been documented in cell culture and murine models. However, endogenous processing of the human protein in mammalian systems complicates the interpretations. Therefore, to study the impact of S13/16 phosphorylation on the subcellular behavior of HTT under a controlled genetic background with minimal proteolytic processing of the human protein, we employed Drosophila as the model system. We ectopically expressed full-length (FL) and exon1 fragment of human HTT with phosphomimetic and resistant mutations at serines 13 and 16 in different neuronal populations. Phosphomimetic mHTT aggravates and the phosphoresistant mutation ameliorates mHTT-induced toxicity in the context of both FL- and exon1- mHTT in Drosophila although in all cases FL appears less toxic than exon1. Our observations strongly indicate that the phosphorylation status of S13/16 can affect HD pathology in Drosophila and these residues can be potential targets for affecting HD pathogenesis.

Also flagged:postsynaptic densityorganizationscaffolding proteinsbrain disordersmembranesynapses
Journal Article 2020-09-14 No Snippets Wilkinson B, Coba MP.
Show Full Abstract

The postsynaptic density (PSD) plays an essential role in the organization of the synaptic signaling machinery. It contains a set of core scaffolding proteins that provide the backbone to PSD protein-protein interaction networks (PINs). These core scaffolding proteins can be seen as three principal layers classified by protein family, with DLG proteins being at the top, SHANKs along the bottom, and DLGAPs connecting the two layers. Early studies utilizing yeast two hybrid enabled the identification of direct protein-protein interactions (PPIs) within the multiple layers of scaffolding proteins. More recently, mass-spectrometry has allowed the characterization of whole interactomes within the PSD. This expansion of knowledge has further solidified the centrality of core scaffolding family members within synaptic PINs and provided context for their role in neuronal development and synaptic function. Here, we discuss the scaffolding machinery of the PSD, their essential functions in the organization of synaptic PINs, along with their relationship to neuronal processes found to be impaired in complex brain disorders.

Also flagged:Ironascorbic acidlactic acidfermentationhemealcohol
Journal Article 2020-09-14 ✓ 5 Snippets Milman NT.
In-Text Gene Mentions

…Although the HFE-mutations occur with the same frequencies in men and women, preclinical and clinical haemochromatosis is much more prevalent in men than in women and presents at a younger age in men compared to women [4].…

In haemochromatosis, because of a defective HFE-complex, the production/activation of hepcidin is reduced, resulting in an increased intestinal iron uptake, which by and large is independent of the body's iron status.

In patients with HFE-haemochromatosis, excessive alcohol consumption accentuates the biochemical and clinical disease expression and therefore the risk of liver cirrhosis and liver cancer [73].

The various forms of genetic haemochromatosis are caused by mutations on different iron regulatory genes and are divided into two main groups: HFE-haemochromatosis being caused by mutations on the HFE-gene on chromosome 6 and non-HFE-haemochromatosis.

…two main groups:HFE-haemochromatosis being caused…

Show Full Abstract

<h4>Objective</h4>To provide an overview of nutrients and compounds, which influence human intestinal iron absorption, thereby making a platform for elaboration of dietary recommendations that can reduce iron uptake in patients with genetic haemochromatosis.<h4>Design</h4>Review. <i>Setting</i>. A literature search in PubMed and Google Scholar of papers dealing with iron absorption.<h4>Results</h4>The most important promoters of iron absorption in foods are ascorbic acid, lactic acid (produced by fermentation), meat factors in animal meat, the presence of heme iron, and alcohol which stimulate iron uptake by inhibition of hepcidin expression. The most important inhibitors of iron uptake are phytic acid/phytates, polyphenols/tannins, proteins from soya beans, milk, eggs, and calcium. Oxalic acid/oxalate does not seem to influence iron uptake. Turmeric/curcumin may stimulate iron uptake through a decrease in hepcidin expression and inhibit uptake by complex formation with iron, but the net effect has not been clarified.<h4>Conclusions</h4>In haemochromatosis, iron absorption is enhanced due to a decreased expression of hepcidin. Dietary modifications that lower iron intake and decrease iron bioavailability may provide additional measures to reduce iron uptake from the foods. This could stimulate the patients' active cooperation in the treatment of their disorder and reduce the number of phlebotomies.

bioRxiv 2020-09-14 Preprint (No Snippets API) Rao S, Hoskins I, Tonn T, Garcia PD, Ozadam H, Cenik ES, Cenik C.
Show Full Abstract

Viruses rely on the host translation machinery to synthesize their own proteins. Consequently, they have evolved varied mechanisms to co-opt host translation for their survival. SARS-CoV-2 relies on a non-structural protein, Nsp1, for shutting down host translation. However, it is currently unknown how viral proteins and host factors critical for viral replication can escape a global shutdown of host translation. Here, using a novel FACS-based assay called MeTAFlow, we report a dose-dependent reduction in both nascent protein synthesis and mRNA abundance in cells expressing Nsp1. We perform RNA-Seq and matched ribosome profiling experiments to identify gene-specific changes both at the mRNA expression and translation level. We discover a functionally-coherent subset of human genes are preferentially translated in the context of Nsp1 expression. These genes include the translation machinery components, RNA binding proteins, and others important for viral pathogenicity. Importantly, we uncovered a remarkable enrichment of 5′ terminal oligo-pyrimidine (TOP) tracts among preferentially translated genes. Using reporter assays, we validated that 5’ UTRs from TOP transcripts can drive preferential expression in the presence of NSP1. Finally, we found that LARP1, a key effector protein in the mTOR pathway may contribute to preferential translation of TOP transcripts in response to Nsp1 expression. Collectively, our study suggests fine tuning of host gene expression and translation by Nsp1 despite its global repressive effect on host protein synthesis.

Also flagged:Antithrombinantithrombin deficiencyvenous thromboembolismstrokeheparinhydrogen
Journal Article 2020-09-13 ✓ 1 Snippet Orlando C, de la Morena-Barrio B, Pareyn I, Vanhoorelbeke K, Martínez-Martínez I, Vicente V, Corral J, Jochmans K, de la Morena-Barrio ME.
In-Text Gene Mentions

…haplotype involving 13 <i>SERPINC1</i> intragenic single nucleot…

Show Full Abstract

<h4>Background</h4> Hereditary antithrombin deficiency is a rare autosomal-dominant disorder predisposing to recurrent venous thromboembolism (VTE). To date, only two founder mutations have been described.<h4>Objectives</h4> We investigated the antithrombin p.Thr147Ala variant, found in 12 patients of African origin. This variant is known as rs2227606 with minor allele frequency of 0.5% in Africans and absent in Europeans. A possible founder effect was investigated.<h4>Methods</h4> Phenotypical characterization was established through immunological and functional methods, both under basal and stress conditions. Recombinant antithrombin molecules were constructed by site-directed mutagenesis and expressed in HEK-293T cells. Secreted antithrombin was purified and functionally characterized. Structural modeling was performed to predict the impact of the mutation on protein structure. A novel nanopore sequencing approach was used for haplotype investigation.<h4>Results</h4> Ten patients experienced VTE, stroke, or obstetric complications. Antithrombin antigen levels and anti-IIa activity were normal or slightly reduced while anti-Xa activity was reduced with only one commercial assay. On crossed immunoelectrophoresis, an increase of antithrombin fractions with reduced heparin affinity was observed under high ionic strength conditions but not under physiological conditions. The recombinant p.Thr147Ala protein displayed a reduced anti-Xa activity. Structural modeling revealed that residue Thr147 forms three hydrogen bonds that are abolished when mutated to alanine. The investigated patients shared a common haplotype involving 13 <i>SERPINC1</i> intragenic single nucleotide polymorphisms.<h4>Conclusion</h4> Antithrombin p.Thr147Ala, responsible for antithrombin type II heparin binding site deficiency, is the first founder mutation reported in people of African ancestry. This study further emphasizes the limitations of commercial methods to diagnose this specific subtype.

Also flagged:ethylene glycolnorbornenepeptidethiolproteaseadhesion ligands
Journal Article 2020-09-13 No Snippets Arkenberg MR, Dimmitt NH, Johnson HC, Koehler KR, Lin CC.
Show Full Abstract

Xeno-free, chemically defined poly(ethylene glycol) (PEG)-based hydrogels are being increasingly used for in vitro culture and differentiation of human induced pluripotent stem cells (hiPSCs). These synthetic matrices provide tunable gelation and adaptable material properties crucial for guiding stem cell fate. Here, sequential norbornene-click chemistries are integrated to form synthetic, dynamically tunable PEG-peptide hydrogels for hiPSCs culture and differentiation. Specifically, hiPSCs are photoencapsulated in thiol-norbornene hydrogels crosslinked by multiarm PEG-norbornene (PEG-NB) and proteaselabile crosslinkers. These matrices are used to evaluate hiPSC growth under the influence of extracellular matrix properties. Tetrazine-norbornene (Tz-NB) click reaction is then employed to dynamically stiffen the cell-laden hydrogels. Fast reactive Tz and its stable derivative methyltetrazine (mTz) are tethered to multiarm PEG, yielding mono-functionalized PEG-Tz, PEG-mTz, and dualfunctionalized PEG-Tz/mTz that react with PEG-NB to form additional crosslinks in the cell-laden hydrogels. The versatility of Tz-NB stiffening is demonstrated with different Tz-modified macromers or by intermittent incubation of PEG-Tz for temporal stiffening. Finally, the Tz-NB-mediated dynamic stiffening is explored for 4D culture and definitive endoderm differentiation of hiPSCs. Overall, this dynamic hydrogel platform affords exquisite controls of hydrogel crosslinking for serving as a xeno-free and dynamic stem cell niche.

Also flagged:Nonalcoholic Fatty Liver DiseaseNAFLDfattynonalcoholic steatohepatitisNASHcirrhosis
Journal Article 2020-09-13 ✓ 1 Snippet Pillai SS, Lakhani HV, Zehra M, Wang J, Dilip A, Puri N, O'Hanlon K, Sodhi K.
In-Text Gene Mentions

…hosis, sclerosing cholangitis,hemochromatosis, Wilson’s disease and…

Show Full Abstract

(1) Background: Nonalcoholic fatty liver disease (NAFLD) is primarily characterized by the presence of fatty liver, hepatic inflammation and fibrogenesis eventually leading to nonalcoholic steatohepatitis (NASH) or cirrhosis. Obesity and diabetes are common risk factors associated with the development and progression of NAFLD, with one of the highest prevalence of these diseased conditions in the West Virginia population. Currently, the diagnosis of NAFLD is limited to radiologic studies and biopsies, which are not cost-effective and highly invasive. Hence, this study aimed to develop a panel and assess the progressive levels of circulatory biomarkers and miRNA expression in patients at risk for progression to NASH to allow early intervention strategies. (2) Methods: In total, 62 female patients were enrolled and blood samples were collected after 8-10 h of fasting. Computed tomography was performed on abdomen/pelvis following IV contrast administration. The patients were divided into the following groups: Healthy subjects with normal BMI and normal fasting blood glucose (Control, n = 20), Obese with high BMI and normal fasting blood glucose (Obese, n = 20) and Obese with high fasting blood glucose (Obese + DM, n = 22). Based on findings from CT, another subset was created from Obese + DM group with patients who showed signs of fatty liver infiltration (Obese + DM(FI), n = 10). ELISA was performed for measurement of plasma biomarkers and RT-PCR was performed for circulating miRNA expression. (3) Results: Our results show significantly increased levels of plasma IL-6, Leptin and FABP-1, while significantly decreased level of adiponectin in Obese, Obese + DM and Obese + DM(FI) group, as compared to healthy controls. The level of CK-18 was significantly increased in Obese + DM(FI) group as compared to control. Subsequently, the expression of miR-122, miR-34a, miR-375, miR-16 and miR-21 was significantly increased in Obese + DM and Obese + DM(FI) group as compared to healthy control. Our results also show distinct correlation of IL-6, FABP-1 and adiponectin levels with the expression of miRNAs in relation to the extent of NAFLD progression. (4) Conclusion: Our results support the clinical application of these biomarkers and miRNAs in monitoring the progression of NAFLD, suggesting a more advanced diagnostic potential of this panel than conventional methods. This panel may provide an appropriate method for early prognosis and management of NAFLD and subsequent adverse hepatic pathophysiology, potentially reducing the disease burden on the West Virginia population.

Also flagged:diabetic retinopathypathogenesispost-translational modificationinflammatory diseasesglycopeptidesglycoproteins
Journal Article 2020-09-13 ✓ 5 Snippets Sharma A, Cox J, Glass J, Lee TJ, Kodeboyina SK, Zhi W, Ulrich L, Lukowski Z, Sharma S.
In-Text Gene Mentions

Our study found that SERPINC1 was more glycosylated in serum of patients with DR, likely leading to unchecked inflammatory effects on vascular walls.

…2 (SERPIND1), andantithrombin-III(SERPINC1) were found…

…PIND1), and antithrombin-III (SERPINC1) were found to…

…glycosites, 4 glycans),antithrombin-III(SERPINC1, 3 glycosites,…

…4 glycans), antithrombin-III (SERPINC1, 3 glycosites, 2…

Show Full Abstract

The precise molecular mechanisms of diabetic retinopathy (DR) pathogenesis are unclear, and treatment options are limited. There is an urgent need to discover and develop novel therapeutic targets for the treatment of this disease. Glycosylation is a post-translational modification that plays a critical role in determining protein structure, function, and stability. Recent studies have found that serum glycoproteomic changes are associated with the presence or progression of several inflammatory diseases. However, very little is known about the glycoproteomic changes associated with DR. In this study, glycoproteomic profiling of the serum of diabetic patients with and without DR was performed. A total of 15 glycopeptides from 11 glycoproteins were found to be significantly altered (5 upregulated and 10 downregulated) within the serum glycoproteome of DR patients. These glycoproteins are known to be involved in the maintenance of the extracellular matrix and complement system through peptidolytic activity or regulation.

Also flagged:S-glutathionylationBiPbortezomibmultiple myelomasecretiondisulfide
Journal Article 2020-09-13 ✓ 1 Snippet Zhang J, Ye ZW, Chen W, Culpepper J, Jiang H, Ball LE, Mehrotra S, Blumental-Perry A, Tew KD, Townsend DM.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Multiple myeloma (MM) cells have high rates of secretion of proteins rich in disulfide bonds and depend upon compartmentalized redox balance for accurate protein folding. The proteasome inhibitor bortezomib (Btz) is a successful frontline treatment for the disease, but its long-term efficacy is restricted by the acquisition of resistance. We found that MM cell lines resistant to Btz maintain high levels of oxidative stress and are cross resistant to endoplasmic reticulum (ER) stress-inducing agents thapsigargin (ThG), and tunicamycin (TuM). Moreover, cells expressing high/wild type levels of glutathione S-transferase P (GSTP) are more resistant than Gstp1/p2 knockout cells. In agreement, basal levels of S-glutathionylated proteins and redox regulation enzymes, including GSTP are elevated at mRNA and protein levels in resistant cells. GSTP mediated S-glutathionylation (SSG) regulates the activities of a number of redox active ER proteins. Here we demonstrated that the post-translational modification determines the balance between foldase and ATPase activities of the binding immunoglobulin protein (BiP), with Cys41-SSG important for ATPase, and Cys420-SSG for foldase. BiP expression and S-glutathionylation are increased in clinical specimens of bone marrow from MM patients compared to non-cancerous samples. Preventing S-glutathionylation in MM cells with a GSTP specific inhibitor restored BiP activities and reversed resistance to Btz. Therefore, S-glutathionylation of BiP confers pro-survival advantages and represents a novel mechanism of drug resistance in MM cells. We conclude that altered GSTP expression leads to S-glutathionylation of BiP, and contributes to acquired resistance to Btz in MM.

RAD51: Beyond the break.

Also flagged:RAD51metabolismRAD51 recombinaseforkscentromerekinetochore
Journal Article 2020-09-13 No Snippets Wassing IE, Esashi F.
Show Full Abstract

As the primary catalyst of homologous recombination (HR) in vertebrates, RAD51 has been extensively studied in the context of repair of double-stranded DNA breaks (DSBs). With recent advances in the understanding of RAD51 function extending beyond DSBs, the importance of RAD51 throughout DNA metabolism has become increasingly clear. Here we review the suggested roles of RAD51 beyond HR, specifically focusing on their interplay with DNA replication and the maintenance of genomic stability, in which RAD51 function emerges as a double-edged sword.

Also flagged:ResveratrolRKIPcolorectal cancerRaf-1 kinase inhibitory proteintumormetastasis
Journal Article 2020-09-12 No Snippets Dariya B, Behera SK, Srivani G, Aliya S, Alam A, Nagaraju GP.
Show Full Abstract

Raf-1 kinase inhibitory protein (RKIP) acts as a tumor cell metastasis suppressor and prognostic indicator for survival in various cancers. Its use is predicted to improve therapy for various malignancies, including colorectal cancer (CRC). RKIP, frequently denoted as phosphatidylethanolamine-binding protein 1, is expressed in all normal mammalian tissues. RKIP functions as an inhibitor of the Raf-1, PI-3K, and MAP kinase (MAPK) pathways. In this study, we found that resveratrol induced the expression of RKIP at protein levels. To elucidate the structural basis of the interaction between resveratrol and RKIP, we performed computational studies that explore the binding affinity and ligand efficacy of resveratrol against RKIP. This study reveals the prognostic significance of RKIP metastasis suppressor activity against CRC and its structural arrangements during drug-target interactions.

Also flagged:CancerLiver Cancerliver tumorstumorGene expressionhepatocellular carcinoma
Journal Article 2020-09-12 No Snippets Liu J, Li P, Wang L, Li M, Ge Z, Noordam L, Lieshout R, Verstegen MMA, Ma B, Su J, Yang Q, Zhang R, Zhou G, Carrascosa LC, Sprengers D, IJzermans JNM, Smits R, Kwekkeboom J, van der Laan LJW, Peppelenbosch MP, Pan Q, Cao W.
Show Full Abstract

<h4>Background & aims</h4>Cancer-associated fibroblasts (CAFs) play a key role in the cancer process, but the research progress is hampered by the paucity of preclinical models that are essential for mechanistic dissection of cancer cell-CAF interactions. Here, we aimed to establish 3-dimensional (3D) organotypic co-cultures of primary liver tumor-derived organoids with CAFs, and to understand their interactions and the response to treatment.<h4>Methods</h4>Liver tumor organoids and CAFs were cultured from murine and human primary liver tumors. 3D co-culture models of tumor organoids with CAFs and Transwell culture systems were established in vitro. A xenograft model was used to investigate the cell-cell interactions in vivo. Gene expression analysis of CAF markers in our hepatocellular carcinoma cohort and an online liver cancer database indicated the clinical relevance of CAFs.<h4>Results</h4>To functionally investigate the interactions of liver cancer cells with CAFs, we successfully established murine and human 3D co-culture models of liver tumor organoids with CAFs. CAFs promoted tumor organoid growth in co-culture with direct cell-cell contact and in a Transwell system via paracrine signaling. Vice versa, cancer cells secrete paracrine factors regulating CAF physiology. Co-transplantation of CAFs with liver tumor organoids of mouse or human origin promoted tumor growth in xenograft models. Moreover, tumor organoids conferred resistance to clinically used anticancer drugs including sorafenib, regorafenib, and 5-fluorouracil in the presence of CAFs, or the conditioned medium of CAFs.<h4>Conclusions</h4>We successfully established murine and human 3D co-culture models and have shown robust effects of CAFs in liver cancer nurturing and treatment resistance.

Also flagged:antibodyantibodiesPrntetanusdiphtheriapertussis
Journal Article 2020-09-12 No Snippets Tran TMP, Maertens K, Hoang HTT, Van Damme P, Leuridan E, Hens N.
Show Full Abstract

Serological results obtained in a single laboratory from twin-studies on maternal immunisation, in Vietnam and Belgium offer the opportunity to compare antibody kinetics in infants before and after infant vaccination in the presence of vaccine-induced maternal antibodies. Nonlinear mixed-effects models (NLMMs) making use of a hypothesised dynamic evolution that captures the change in antibody titres over time, were employed to model anti-PT and anti-Prn antibody dynamics. Our proposed modelling approach provided useful insight into understanding the differences in the infants' antibody kinetics in both countries since NLMMs offer the possibility of pooling all data in one analysis and incorporate relevant covariates of interest. In both controlled cohort studies, pregnant women were vaccinated with a tetanus, diphtheria, acellular pertussis (Tdap) vaccine (Boostrix®, Belgium; Adacel®, Vietnam), and children were followed before and after primary vaccination, and before and after booster vaccination (Infanrix hexa®). From our models, both anti-PRN and anti-PT antibody titres at birth of Vietnamese infants were significantly lower than those of Belgian infants born to vaccinated women groups. Even though the antibody titres in the cord at birth of Belgian infants were also higher than those of Vietnamese infants born to the control women groups, the difference was not significant. The significant difference between infants born to vaccinated women in the two countries was likely due to the use of different vaccine brands in pregnant women and the different vaccination histories of women in these two countries. Our analyses also suggested that the blunting effect was present during the primary immunisation but went away afterward for anti-PT data. In contrast, for anti-PRN antibodies, the blunting effect persisted after the primary vaccination and possibly went away after the booster dose. Countries should be aware of the regional situation in view of recommending maternal immunization.

Also flagged:capsuleCoronavirus pneumoniaCOVID-19COVID-19 infectionsPneumoniaNCP
Journal Article 2020-09-12 No Snippets Chen X, Yin YH, Zhang MY, Liu JY, Li R, Qu YQ.
Show Full Abstract

ShuFeng JieDu capsule (SFJDC), a traditional Chinese medicine, has been recommended for the treatment of COVID-19 infections. However, the pharmacological mechanism of SFJDC still remains vague to date. The active ingredients and their target genes of SFJDC were collected from TCMSP. COVID-19 is a type of Novel Coronavirus Pneumonia (NCP). NCP-related target genes were collected from GeneCards database. The ingredients-targets network of SFJDC and PPI networks were constructed. The candidate genes were screened by Venn diagram package for enrichment analysis. The gene-pathway network was structured to obtain key target genes. In total, 124 active ingredients, 120 target genes of SFJDC and 251 NCP-related target genes were collected. The functional annotations cluster 1 of 23 candidate genes (CGs) were related to lung and Virus infection. RELA, MAPK1, MAPK14, CASP3, CASP8 and IL6 were the key target genes. The results suggested that SFJDC cloud be treated COVID-19 by multi-compounds and multi-pathways, and this study showed that the mechanism of traditional Chinese medicine (TCM) in the treatment of disease from the overall perspective.

Also flagged:MALT1NF-κBcancerproteaseIFN-γIL-2
Journal Article 2020-09-12 ✓ 1 Snippet Demeyer A, Driege Y, Skordos I, Coudenys J, Lemeire K, Elewaut D, Staal J, Beyaert R.
In-Text Gene Mentions

…tabilizing proteins Regnase-1,Roquin-1, and Roquin-2 (…

Show Full Abstract

The protease MALT1 is a key regulator of NF-κB signaling and a novel therapeutic target in autoimmunity and cancer. Initial enthusiasm supported by preclinical results with MALT1 inhibitors was tempered by studies showing that germline MALT1 protease inactivation in mice results in reduced regulatory T cells and lethal multi-organ inflammation due to expansion of IFN-γ-producing T cells. However, we show that long-term MALT1 inactivation, starting in adulthood, is not associated with severe systemic inflammation, despite reduced regulatory T cells. In contrast, IL-2-, TNF-, and IFN-γ-producing CD4<sup>+</sup> T cells were strongly reduced. Limited formation of tertiary lymphoid structures was detectable in lungs and stomach, which did not affect overall health. Our data illustrate that MALT1 inhibition in prenatal or adult life has a different outcome and that long-term MALT1 inhibition in adulthood is not associated with severe side effects.

Also flagged:chromosomesHPTbrain-derived neurotrophic factormethylationtopGene expression
Journal Article 2020-09-12 ✓ 5 Snippets Dall'Aglio L, Lewis CM, Pain O.
In-Text Gene Mentions

…onfidence associations includeNEGR1, CTC-467M3.3, TMEM106B, LRFN5…

…TheNEGR1gene (GTEx whole…

…the upregulation ofNEGR1in the blood.…

…their functional role:NEGR1, ESR2 ,…

…showing upregulation forNEGR1and TMEM106B and…

Show Full Abstract

<h4>Background</h4>Major depression (MD) is determined by a multitude of factors including genetic risk variants that regulate gene expression. We examined the genetic component of gene expression in MD by performing a transcriptome-wide association study (TWAS), inferring gene expression-trait relationships from genetic, transcriptomic, and phenotypic information.<h4>Methods</h4>Genes differentially expressed in depression were identified with the TWAS FUSION method, based on summary statistics from the largest genome-wide association analysis of MD (n = 135,458 cases, n = 344,901 controls) and gene expression levels from 21 tissue datasets (brain; blood; thyroid, adrenal, and pituitary glands). Follow-up analyses were performed to extensively characterize the identified associations: colocalization, conditional, and fine-mapping analyses together with TWAS-based pathway investigations.<h4>Results</h4>Transcriptome-wide significant differences between cases and controls were found at 94 genes, approximately half of which were novel. Of the 94 significant genes, 6 represented strong, colocalized, and potentially causal associations with depression. Such high-confidence associations include NEGR1, CTC-467M3.3, TMEM106B, LRFN5, ESR2, and PROX2. Lastly, TWAS-based enrichment analysis highlighted dysregulation of gene sets for, among others, neuronal and synaptic processes.<h4>Conclusions</h4>This study sheds further light on the genetic component of gene expression in depression by characterizing the identified associations, unraveling novel risk genes, and determining which associations are congruent with a causal model. These findings can be used as a resource for prioritizing and designing subsequent functional studies of MD.

Also flagged:NAFLDaspartate aminotransferasealanine aminotransferaseASTALTdiabetes mellitus
Journal Article 2020-09-12 ✓ 1 Snippet Zain SM, Tan HL, Mohamed Z, Chan WK, Mahadeva S, Basu RC, Mohamed R.
In-Text Gene Mentions

…primary biliary cirrhosis,hemochromatosis, α1‐antitrypsin deficiency, b…

Show Full Abstract

<h4>Background and aim</h4>Advanced fibrosis is the most important predictor of liver-related mortality in non-alcoholic fatty liver disease (NAFLD). The aim of this study was to compare the diagnostic performance of noninvasive scoring systems in identifying advanced fibrosis in a Malaysian NAFLD cohort and propose a simplified strategy for the management of NAFLD in a primary care setting.<h4>Methods</h4>We enrolled and reviewed 122 biopsy-proven NAFLD patients. Advanced fibrosis was defined as fibrosis stages 3-4. Noninvasive assessments included aspartate aminotransferase/alanine aminotransferase (AST/ALT) ratio, AST-to-platelet ratio index (APRI), AST/ALT ratio, diabetes (BARD) score, fibrosis-4 (FIB-4) score, and NAFLD fibrosis score.<h4>Results</h4>FIB-4 score had the highest area under the receiver operating characteristic curve (AUROC) and negative predictive value (NPV) of 0.86 and 94.3%, respectively, for the diagnosis of advanced fibrosis. FIB-4 score < 1.3 ruled out advanced fibrosis in 72% of the patients, with 6% being understaged. Further stratification of the indeterminate group patients by other non-alcoholic steatohepatitis (NASH) clinical predictors, such as abnormal gamma-glutamyl transpeptidase (GGT) level and presence diabetes mellitus (DM), could further reduce the number of patients who are unlikely to have advanced fibrosis by 52% and 35%, respectively.<h4>Conclusion</h4>We found that FIB-4 score outperforms other scoring systems based on AUROC and NPV. The use of a simple scoring system such as FIB-4 as first-line triage to risk-stratify NAFLD patients in the primary care setting, with further stratification of those in the indeterminate group using clinical predictors of NASH, can help in the development of a simplified strategy for a public health approach in the management of NAFLD.

Also flagged:synthesisbenzodiazepineGABA A Receptorsionotropic γ‐aminobutyric acid receptorsGABA A Rs
Journal Article 2020-09-11 No Snippets Rustler K, Maleeva G, Gomila AMJ, Gorostiza P, Bregestovski P, König B.
Show Full Abstract

Optogenetic and photopharmacological tools to manipulate neuronal inhibition have limited efficacy and reversibility. We report the design, synthesis, and biological evaluation of Fulgazepam, a fulgimide derivative of benzodiazepine that behaves as a pure potentiator of ionotropic γ-aminobutyric acid receptors (GABA<sub>A</sub> Rs) and displays full and reversible photoswitching in vitro and in vivo. The compound enables high-resolution studies of GABAergic neurotransmission, and phototherapies based on localized, acute, and reversible neuroinhibition.

Also flagged:organizationaxonfertilizationhoxb1ainnervationisl1
Journal Article 2020-09-11 ✓ 1 Snippet Beiriger A, Narayan S, Singh N, Prince V.
In-Text Gene Mentions

DCC

Show Full Abstract

In vertebrate animals, motor and sensory efferent neurons carry information from the central nervous system (CNS) to peripheral targets. These two types of efferent systems sometimes bear a close resemblance, sharing common segmental organization, axon pathways, and chemical messengers. Here, we focus on the development of the octavolateral efferent neurons (OENs) and their interactions with the closely-related facial branchiomotor neurons (FBMNs) in zebrafish. Using live-imaging approaches, we investigate the birth, migration, and projection patterns of OENs. We find that OENs are born in two distinct groups: a group of rostral efferent neurons (RENs) that arises in the fourth segment, or rhombomere (r4), of the hindbrain and a group of caudal efferent neurons (CENs) that arises in r5. Both RENs and CENs then migrate posteriorly through the hindbrain between 18 and 48 hrs postfertilization, alongside the r4-derived FBMNs. Like the FBMNs, migration of the r4-derived RENs depends on function of the segmental identity gene hoxb1a; unlike the FBMNs, however, both OEN populations move independently of prickle1b. Further, we investigate whether the previously described "pioneer" neuron that leads FBMN migration through the hindbrain is an r4-derived FBMN/REN or an r5-derived CEN. Our experiments verify that the pioneer is an r4-derived neuron and reaffirm its role in leading FBMN migration across the r4/5 border. In contrast, the r5-derived CENs migrate independently of the pioneer. Together, these results indicate that the mechanisms OENs use to navigate the hindbrain differ significantly from those employed by FBMNs.

Also flagged:CTCFheterochromatinmitosischromosomeschromatinhistone
Journal Article 2020-09-11 ✓ 1 Snippet Fitz-James MH, Tong P, Pidoux AL, Ozadam H, Yang L, White SA, Dekker J, Allshire RC.
In-Text Gene Mentions

Condensincomplexes are involved…

Show Full Abstract

During mitosis chromosomes reorganise into highly compact, rod-shaped forms, thought to consist of consecutive chromatin loops around a central protein scaffold. Condensin complexes are involved in chromatin compaction, but the contribution of other chromatin proteins, DNA sequence and histone modifications is less understood. A large region of fission yeast DNA inserted into a mouse chromosome was previously observed to adopt a mitotic organisation distinct from that of surrounding mouse DNA. Here, we show that a similar distinct structure is common to a large subset of insertion events in both mouse and human cells and is coincident with the presence of high levels of heterochromatic H3 lysine nine trimethylation (H3K9me3). Hi-C and microscopy indicate that the heterochromatinised fission yeast DNA is organised into smaller chromatin loops than flanking euchromatic mouse chromatin. We conclude that heterochromatin alters chromatin loop size, thus contributing to the distinct appearance of heterochromatin on mitotic chromosomes.

Also flagged:gastric MALT lymphomagastric cancergastric ulcerbindingWntmTOR
Journal Article 2020-09-11 No Snippets Zou Q, Zhang H, Meng F, He L, Zhang J, Xiao D.
Show Full Abstract

<h4>Background</h4>The correlation between the infection of H. pylori and the occurrence of gastric MALT lymphoma (GML) has been well documented. However, the mechanism of how GML is caused by this bacterium is not well understood, although some immunologic mechanisms are thought to be involved.<h4>Materials and methods</h4>In this study, we performed both transcriptomic and proteomic analyses on gastric cancer cells infected by H. pylori isolates from GML patients and the gastric ulcer strain 26695 to investigate the differentially expressed molecular signatures that were induced by GML isolates.<h4>Results</h4>Transcriptomic analyses revealed that the differentially expressed genes (DEGs) were mainly related to binding, catalytic activity, signal transducer activity, molecular transducer activity, nucleic acid binding transcription factor activity, and molecular function regulator. Fifteen pathways, including the Wnt signaling pathway, the mTOR signaling pathway, the NOD-like receptor signaling pathway and the Hippo signaling pathway, were revealed to be related to GML isolates. Proteomic analyses results showed that there were 116 differentially expressed proteins (DEPs). Most of these DEPs were associated with cancer, and 29 have been used as biomarkers for cancer diagnosis. We also found 63 upstream regulators that can inhibit or activate the expression of the DEPs. Combining the proteomic and transcriptomic analyses revealed 12 common pathways. This study provides novel insights into H. pylori-associated GML. The DEPs we found may be good candidates for GML diagnosis and treatment.<h4>Conclusions</h4>This study revealed specific pathways related to GML and potential biomarkers for GML diagnosis.

Also flagged:ribosomeintracellularcytoskeletonreproductioncircadian rhythmcell proliferation
Journal Article 2020-09-11 No Snippets Fé-Gonçalves LM, Araújo JDA, Santos CHDAD, Almeida-Val VMF.
Show Full Abstract

Brazil has five climatically distinct regions, with an annual average temperature difference up to 14 ºC between the northern and southern extremes. Environmental variation of this magnitude can lead to new genetic patterns among farmed fish populations. Genetically differentiated populations of tambaqui (Colossoma macropomum Cuvier, 1818), an important freshwater fish for Brazilian continental aquaculture, may be associated with regional adaptation. In this study, we selected tambaquis raised in two thermally distinct regions, belonging to different latitudes, to test this hypothesis. De novo transcriptome analysis was performed to compare the significant differences of genes expressed in the liver of juvenile tambaqui from a northern population (Balbina) and a southeastern population (Brumado). In total, 2,410 genes were differentially expressed (1,196 in Balbina and 1,214 in Brumado). Many of the genes are involved in a multitude of biological functions such as biosynthetic processes, homeostasis, biorhythm, immunity, cell signaling, ribosome biogenesis, modification of proteins, intracellular transport, structure/cytoskeleton, and catalytic activity. Enrichment analysis based on biological networks showed a different protein interaction profile for each population, whose encoding genes may play potential functions in local thermal adaptation of fish to their respective farming environments.

Also flagged:ADRM1liver tumorproteasometumorscancertumor
Journal Article 2020-09-11 ✓ 1 Snippet Liang YC, Wang JL, Wang HT, Liu H, Zhang HL, Liang YX.
In-Text Gene Mentions

…virus, alcohol consumption,hemochromatosis, obesity, and exposure…

Show Full Abstract

Hepatocellular carcinoma (HCC), a primary liver tumor, is the third leading cause of cancer-related mortality worldwide. The proteasome system is overactivated in the majority of tumors, including HCC. However, targeting the proteasome system in HCC is not as effective as in other types of cancer. Therefore, a new target of HCC therapy needs to be identified, and the potential mechanism must be studied. Using the The Cancer Gene Genome Atlas and GEO datasets, the present investigation demonstrated for the first time that ADRM1 is overexpressed in HCC, and the high level of its expression predicts poor overall survival in HCC patients. The high expression of ADRM1 in HCC was verified using tumor tissue arrays. By comparing paired tumor and nontumor tissues, it was shown that the majority of HCC patients (76.25%) exhibited higher ADRM1 expression in the tumor than in normal tissues. in vitro experiments demonstrated that targeting ADRM1 with shRNAs significantly suppressed the proliferation of HCC cells. RA190, a specific inhibitor of ADRM1, suppressed cell proliferation and colony formation by HCC cells in a concentration-dependent manner. The study of the mechanism of the effects of RA190 revealed that targeting ADRM1 blocked the G2/M transition in the cell cycle and induced apoptosis of HCC cells. Together, the obtained results indicate that ADRM1 is a promising target for HCC therapy and suggest that ADRM1 inhibitors, such as RA190, have the potential for clinical application in the treatment of HCC.

Also flagged:LSD1Wntlysine-specific demethylase 1AKdm1aPaneth cell differentiationchromatin
Journal Article 2020-09-11 ✓ 5 Snippets Zwiggelaar RT, Lindholm HT, Fosslie M, Terndrup Pedersen M, Ohta Y, Díez-Sánchez A, Martín-Alonso M, Ostrop J, Matano M, Parmar N, Kvaløy E, Spanjers RR, Nazmi K, Rye M, Drabløs F, Arrowsmith C, Arne Dahl J, Jensen KB, Sato T, Oudhoff MJ.
In-Text Gene Mentions

…Signaling Technology, 14074S),OLFM4(1:200; Cell Signaling…

…(ACD, 312241), Mm-Olfm4(ACD, 311831), Mm-…

…everse, tgtgagggagatgctcagtg),Olfm4(forward, ggatcctgaacttttggtgc…

…the ISC markerOlfm4in tissues of…

…We foundOLFM4+ cells completely…

Show Full Abstract

Intestinal epithelial homeostasis is maintained by adult intestinal stem cells, which, alongside Paneth cells, appear after birth in the neonatal period. We aimed to identify regulators of neonatal intestinal epithelial development by testing a small library of epigenetic modifier inhibitors in Paneth cell-skewed organoid cultures. We found that lysine-specific demethylase 1A (<i>Kdm1a/Lsd1</i>) is absolutely required for Paneth cell differentiation. <i>Lsd1</i>-deficient crypts, devoid of Paneth cells, are still able to form organoids without a requirement of exogenous or endogenous Wnt. Mechanistically, we find that LSD1 enzymatically represses genes that are normally expressed only in fetal and neonatal epithelium. This gene profile is similar to what is seen in repairing epithelium, and we find that <i>Lsd1</i>-deficient epithelium has superior regenerative capacities after irradiation injury. In summary, we found an important regulator of neonatal intestinal development and identified a druggable target to reprogram intestinal epithelium toward a reparative state.

Also flagged:Iron deficiencyironchronic inflammatory diseasesFerritinnutritional deficiencyanemia
Journal Article 2020-09-11 ✓ 2 Snippets Cacoub P, Nicolas G, Peoc'h K.
In-Text Gene Mentions

…patients hospitalized forhemochromatosisor phlebotomy therapy…

…persons diagnosed withhemochromatosis, resulting in a…

Show Full Abstract

The diagnosis and treatment of iron deficiency is a primary public health goal. This study aimed to make an inventory of the use of biomarkers to assess the iron supply in patients given iron replacement therapy. A retrospective longitudinal real-world study of a cohort of patients receiving iron replacement therapy was conducted using data from healthcare coverage databases between January 2006 and December 2015 in France. The frequency of oral or intravenous iron treatment episodes preceded and/or followed by a biological assessment of iron deficiency was described. We then differentiate patients with or without chronic inflammatory diseases, which could impact the prescription. The evolution between 2006 and 2015 was also studied. The 96,724 patients received an average of 4.9 administrations of iron per patient, corresponding to 1.7 treatment episodes. In one-third of treatment episodes (34.6%), patients had a pre-treatment biological assessment, 15.5% a post-treatment assessment, and 7.3% both. The post-treatment measure of iron supply markers (i.e., Ferritin and transferrin saturation) was more frequent in patients suffering from chronic inflammatory diseases than in those without underlying chronic condition (22.6% to 41.0% vs. 3.1%; p < 0.0001). Serum ferritin was measured 30 times more than transferrin saturation measurements. The use of both tests increased steadily during the study period, although remaining low. Despite the recommendations, biological assessments of iron status are seldom prescribed and/or performed in the context of a pre- or post-treatment assessment, although more frequently realized in patients with chronic inflammatory diseases.

Also flagged:tumorcell proliferationcancergene expressiontumorschimeric antigen receptor
Journal Article 2020-09-11 ✓ 2 Snippets Li M, Zhang Z, Li L, Wang X.
In-Text Gene Mentions

These genes included AHNAK2, TP53, PLEC, COL5A1, FAT3, PCDH17, RIMS1, ASH1L, CDH23, DNAH17, DYNC2H1, MYCBP2, SLIT3, TRRAP, and USH2A. Interestingly, we found 9 of the 15 genes whose mutations were significantly associated with worse OS in pan-cancer (log-rank test, p < 0.05) (Supplementary Fig. 3).

…, FAT3 ,PCDH17, RIMS1 ,…

Show Full Abstract

Intratumor heterogeneity (ITH) is a biomarker of tumor progression, metastasis, and immune evasion. Previous studies evaluated ITH mostly based on DNA alterations. Here, we developed a new algorithm (DEPTH) for quantifying ITH based on mRNA alterations in the tumor. DEPTH scores displayed significant correlations with ITH-associated features (genomic instability, tumor advancement, unfavorable prognosis, immunosuppression, and drug response). Compared to DNA-based ITH scores (EXPANDS, PhyloWGS, MATH, and ABSOLUTE), DEPTH scores had stronger correlations with antitumor immune signatures, cell proliferation, stemness, tumor advancement, survival prognosis, and drug response. Compared to two other mRNA-based ITH scores (tITH and sITH), DEPTH scores showed stronger and more consistent associations with genomic instability, unfavorable tumor phenotypes and clinical features, and drug response. We further validated the reliability and robustness of DEPTH in 50 other datasets. In conclusion, DEPTH may provide new insights into tumor biology and potential clinical implications for cancer prognosis and treatment.

Also flagged:vitiligoskin diseasepathogenesissynthesisSOX1dermatosis
Journal Article 2020-09-11 ✓ 1 Snippet Zhao C, Wang D, Wang X, Mao Y, Xu Z, Sun Y, Mei X, Song J, Shi W.
In-Text Gene Mentions

…revealed that SOX5,SOX6, SOX9, SOX10 and…

Show Full Abstract

Vitiligo is a refractory disfiguring skin disease. However, the aetiology and pathogenesis of vitiligo have not been fully defined. Previous studies have shown that exosomes from normal human keratinocytes improve melanogenesis by up-regulating the expression of melanogenesis-related proteins. Several microRNAs (miRNAs) have been demonstrated to be effective in modulating melanogenesis via exosomes. In the present study, it was found that the effect of exosomes derived from keratinocytes in vitiligo lesions in regulating melanin synthesis is weakened. Furthermore, miR-200c was detected to be significantly down-regulated in exosomes from keratinocytes in vitiligo lesions. In addition, miR-200c enhanced the expression of melanogenesis-related genes via suppressing SOX1 to activate β-catenin. In conclusion, our study revealed that the effect of exosomes secreted by keratinocytes in vitiligo lesions exhibited a weaker capacity in promoting melanogenesis of melanocytes. Moreover, the expression of miR-200c, which mediates melanogenesis in exosomes secreted by keratinocytes in vitiligo lesions, is down-regulated, which may be one of the pathogenesis in vitiligo. Therefore, keratinocyte-derived exosomal miR-200c may be a potential target for the treatment of vitiligo.

Also flagged:Diabetesobesitybehavioralcentral nervous system receptorglucocorticoidschronic diseases
Journal Article 2020-09-11 No Snippets Harrod CS, Elman MR, Vesco KK, Wolfe BM, Mitchell JE, Pories WJ, Pomp A, Boone-Heinonen J, Purnell JQ.
Show Full Abstract

<h4>Objective</h4>This study aimed to examine whether pregnancy following bariatric surgery affects long-term maternal weight change and offspring birth weight.<h4>Methods</h4>Using data from the Longitudinal Assessment of Bariatric Surgery (LABS)-2 study, linear regression was used to evaluate percent change in total body weight over a 5-year follow-up period among reproductive-aged women who underwent Roux-en-Y gastric bypass or laparoscopic adjustable gastric banding as well as evaluate the association of bariatric procedure type and offspring birth weight.<h4>Results</h4>Of 727 women with preoperative age of 36.1 (6.3) years (mean [SD]) and BMI of 46.9 (7.0) kg/m<sup>2</sup> , 80 (11%) reported at least one pregnancy. After adjusting for covariates, percent change in total body weight was not significantly different between women who became pregnant and those who did not during a 5-year follow-up period (β = 2.02; 95% CI: -1.03 to 5.07; P = 0.19). Additionally, mean birth weight was not significantly different between mothers who underwent Roux-en-Y gastric bypass versus laparoscopic adjustable gastric banding (P = 0.99).<h4>Conclusions</h4>Postoperative pregnancy did not diminish long-term weight loss in women in the LABS-2 study. The finding of comparable weight loss is relevant for providers counseling women of reproductive age on weight-loss expectations and family planning following bariatric surgery.

Also flagged:Newcastle Disease Virus InfectionNewcastleinfectionsolute carrier familyhemostasisgene expression
Journal Article 2020-09-11 No Snippets Wang Y, Saelao P, Kern C, Jin S, Gallardo RA, Kelly T, Dekkers JM, Lamont SJ, Zhou H.
Show Full Abstract

Heat stress results in reduced productivity, anorexia, and mortality in chickens. The objective of the study was to identify genes and signal pathways associated with heat stress and Newcastle disease virus (NDV) infection in the liver of chickens through RNA-seq analysis, using two highly inbred chicken lines (Leghorn and Fayoumi). All birds were held in the same environment until 14 days of age. On day 14, half the birds were exposed to 38 °C with 50% relative humidity for 4 h, then 35 °C until the end of the experiment. The remaining birds were kept at 25 °C throughout the experiment. The heat-treated birds were inoculated at 21 days of age with 10<sup>7</sup> EID<sub>50</sub> (One EID<sub>50</sub> unit is the amount of virus that will infect 50 percent of inoculated embryos) NDV La Sota strain to investigate the effects of both heat stress and NDV infection. Physiological parameters were recorded as blood phenotypes at three stages: acute heat (AH), chronic heat (CH1), and chronic heat combined with NDV infection (CH&NDV), at 4 h, 7 days, and 10 days post-initiation of heat treatment, respectively. Our previous work revealed that the heat-resilient Fayoumi line maintained a more stable acid-base balance in their blood compared to the Leghorn line. Liver samples were harvested on both AH and CH&NDV to characterize the transcriptome profiles of these two inbred lines. Both genetic lines and treatments had large impact on the liver transcriptome. Fayoumi birds had more differentially expressed genes (DEGs) than Leghorn birds for both treatments. Metabolic and immune-related genes were on the DEG list, with Fayoumi having more immune-related DEGs than Leghorns, which was confirmed by gene functional enrichment analysis. Weighted correlation network analysis (WGCNA) indicated that the driver genes such as Solute Carrier Family genes could be very important for stabilizing the acid-base balance in Fayoumi birds during heat stress. Therefore, candidate genes such solute carrier family genes could be potential genetic targets that are regulated by Fayoumis to maintain physical hemostasis under heat stress. Differential gene expression showed that Leghorns mainly performed metabolic regulation in response to heat stress and NDV infection, while Fayoumis regulated both immune and metabolic functions. This study provides novel insights and enhances our understandings of liver response to heat stress of heat resilient and susceptible inbred chicken lines.

Also flagged:Carbon Nanotubesextracellularcollagensosteoarthritissynthesiscalcium
Journal Article 2020-09-11 No Snippets Szymański T, Mieloch AA, Richter M, Trzeciak T, Florek E, Rybka JD, Giersig M.
Show Full Abstract

Cartilage and bone injuries are prevalent ailments, affecting the quality of life of injured patients. Current methods of treatment are often imperfect and pose the risk of complications in the long term. Therefore, tissue engineering is a rapidly developing branch of science, which aims at discovering effective ways of replacing or repairing damaged tissues with the use of scaffolds. However, both cartilage and bone owe their exceptional mechanical properties to their complex ultrastructure, which is very difficult to reproduce artificially. To address this issue, nanotechnology was employed. One of the most promising nanomaterials in this respect is carbon nanotubes, due to their exceptional physico-chemical properties, which are similar to collagens-the main component of the extracellular matrix of these tissues. This review covers the important aspects of 3D scaffold development and sums up the existing research tackling the challenges of scaffold design. Moreover, carbon nanotubes-reinforced bone and cartilage scaffolds manufactured using the 3D bioprinting technique will be discussed as a novel tool that could facilitate the achievement of more biomimetic structures.

Also flagged:Adenomyosisendometriosisinterleukin-4interleukin-13LIFJUNB
Journal Article 2020-09-11 No Snippets Prašnikar E, Kunej T, Knez J, Repnik K, Potočnik U, Kovačič B.
Show Full Abstract

<h4>Background</h4>Adenomyosis is a gynaecological condition with limited evidence of negative impact to endometrial receptivity. It is commonly associated with endometriosis, which has been shown to alter endometrial expression patterns. Therefore, the candidate genes identified in endometriosis could serve as a source to study endometrial function in adenomyosis.<h4>Methods</h4>Transcripts/proteins associated with endometrial receptivity in women with adenomyosis or endometriosis and healthy women were obtained from publications and their nomenclature was adopted according to the HUGO Gene Nomenclature Committee (HGNC). Retrieved genes were analysed for enriched pathways using Cytoscape/Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) and Reactome tools to prioritise candidates for endometrial receptivity. These were used for validation on women with (<i>n</i> = 9) and without (<i>n</i> = 13) adenomyosis.<h4>Results</h4>Functional enrichment analysis of 173, 42 and 151 genes associated with endometriosis, adenomyosis and healthy women, respectively, revealed signalling by interleukins and interleukin-4 and interleukin-13 signalling pathways, from which annotated <i>LIF</i>, <i>JUNB</i>, <i>IL6</i>, <i>FOS</i>, <i>IL10</i> and <i>SOCS3</i> were prioritised. Selected genes showed downregulated expression levels in adenomyosis compared to the control group, but without statistical significance.<h4>Conclusion</h4>This is the first integrative study providing putative candidate genes and pathways characterising endometrial receptivity in women with adenomyosis in comparison to healthy women and women with endometriosis.

Also flagged:ALLTumor lysis syndromecancerchromosomesacute lymphoblastic leukemiaB
Journal Article 2020-09-11 No Snippets Wafa A, Jarjour RA, Alolabi D, Liehr T, Hamdan O, Melo JB, Carreira IM, Othman MAK, Al-Achkar W.
Show Full Abstract

<h4>Background</h4>B cell precursor acute lymphoblastic leukemia (B-ALL) is the most common malignancy of childhood, with, after corresponding treatment, an overall complete remission rate of 90%. Approximately 75% of B-ALL cases harbor recurrent abnormalities, including so-called complex karyotypes (CK). Tumor lysis syndrome (TLS) is a metabolic abnormality which may arise during cancer therapy and also, extremely rarely, as spontaneous TLS before initiation of chemotherapy in patients with ALL.<h4>Case presentation</h4>Here we report a 9-year-old male, diagnosed with a de novo pre-B-ALL according to the WHO classification. Cytogenetic, molecular cytogenetic approaches and array comparative genomic hybridization analyses revealed a unique CK involving five chromosomes. It included four yet unreported chromosomal aberrations: a der(11)t(7;11)(p22.1;q24.2), a der(18)t(7;18)(q21.3;p11.22), del(11)(q24.2q25) and dup(18)(q11.1q23). Unfortunately, the patient died 3 months after the initial diagnosis.<h4>Conclusions</h4>To the best of our knowledge, a comparable childhood ALL case was not previously reported. Thus, the combination of the here seen chromosomal aberrations in childhood primary ALL seems to indicate for an extremely adverse prognosis.

Also flagged:ironiron-sulfur cluster containing proteinscongenital diseaseribosomeSBDSpathogenesis
Journal Article 2020-09-11 ✓ 1 Snippet Jain A, Nilatawong P, Mamak N, Jensen LT, Jensen AN.
In-Text Gene Mentions

…Friedrich’s Ataxia andhemochromatosis[ 40 ,…

Show Full Abstract

<h4>Background</h4>Shwachman-Diamond syndrome (SDS) is a congenital disease that affects the bone marrow, skeletal system, and pancreas. The majority of patients with SDS have mutations in the <i>SBDS</i> gene, involved in ribosome biogenesis as well as other processes. A <i>Saccharomyces cerevisiae</i> model of SDS, lacking Sdo1p the yeast orthologue of SBDS, was utilized to better understand the molecular pathogenesis in the development of this disease.<h4>Results</h4>Deletion of <i>SDO1</i> resulted in a three-fold over-accumulation of intracellular iron. Phenotypes associated with impaired iron-sulfur (ISC) assembly, up-regulation of the high affinity iron uptake pathway, and reduced activities of ISC containing enzymes aconitase and succinate dehydrogenase, were observed in <i>sdo1</i>∆ yeast. In cells lacking Sdo1p, elevated levels of reactive oxygen species (ROS) and protein oxidation were reduced with iron chelation, using a cell impermeable iron chelator. In addition, the low activity of manganese superoxide dismutase (Sod2p) seen in <i>sdo1</i>∆ cells was improved with iron chelation, consistent with the presence of reactive iron from the ISC assembly pathway. In yeast lacking Sdo1p, the mitochondrial voltage-dependent anion channel (VDAC) Por1p is over-expressed and its deletion limits iron accumulation and increases activity of aconitase and succinate dehydrogenase.<h4>Conclusions</h4>We propose that oxidative stress from <i>POR1</i> over-expression, resulting in impaired activity of ISC containing proteins and disruptions in iron homeostasis, may play a role in disease pathogenesis in SDS patients.

Also flagged:zinc transporterzincneurodegenerative diseaseHDpathogenesissynaptic transmission
Journal Article 2020-09-11 ✓ 5 Snippets Niu L, Li L, Yang S, Wang W, Ye C, Li H.
In-Text Gene Mentions

Specially, increased level of zinc is detected in the blood of HD patients, indicating that mutant Htt (mHtt) might impair zinc homeostasis [32].

Huntington’s disease (HD) is an autosomal dominant neurodegenerative disease caused by the pathological expansion of CAG repeats (> 36) in the first exon of the HD gene encoding huntingtin (Htt) [1–7].

…gene encoding huntingtin (Htt) [ 1 –…

…indicating that mutantHtt(mHtt) might impair…

…20Q-Htt and pEGFP-exon-1 160Q-Httplasmids, pEBGN-Sp1 plasmid,…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a neurodegenerative disease that involves a complex combination of psychiatric, cognitive and motor impairments. Synaptic dysfunction has been implicated in HD pathogenesis. However, the mechanisms have not been clearly delineated. Synaptic vesicular zinc is closely linked to modulating synaptic transmission and maintaining cognitive ability. It is significant to assess zinc homeostasis for further revealing the pathogenesis of synaptic dysfunction and cognitive impairment in HD.<h4>Results</h4>Histochemical staining by autometallography indicated that synaptic vesicular zinc was decreased in the hippocampus, cortex and striatum of N171-82Q HD transgenic mice. Analyses by immunohistochemistry, Western blot and RT-PCR found that the expression of zinc transporter 3 (ZnT3) required for transport of zinc into synaptic vesicles was obviously reduced in these three brain regions of the HD mice aged from 14 to 20 weeks  and  BHK  cells  expressing  mutant  huntingtin. Significantly, dual-luciferase reporter gene and chromatin immunoprecipitation assays demonstrated that transcription factor Sp1 could activate ZnT3 transcription via its binding to the GC boxes in ZnT3 promoter. Moreover, mutant huntingtin was found to inhibit the binding of Sp1 to the promoter of ZnT3 and down-regulate ZnT3 expression, and the decline in ZnT3 expression could be ameliorated through overexpression of Sp1.<h4>Conclusions</h4>This is first study to reveal a significant loss of synaptic vesicular zinc and a decline in ZnT3 transcriptional activity in the HD transgenic mice. Our work sheds a novel mechanistic insight into pathogenesis of HD that mutant huntingtin down-regulates expression of ZnT3 through inhibiting binding of Sp1 to the promoter of ZnT3 gene, causing disruption of synaptic vesicular zinc homeostasis. Disrupted vesicular zinc ultimately leads to early synaptic dysfunction and cognitive deficits in HD. It is also suggested that maintaining normal synaptic vesicular zinc concentration is a potential therapeutic strategy for HD.

Also flagged:myocardial ischemiaCOronary VAsomotor Disordersdeathmyocardial infarctionstrokeheart failure
Journal Article 2020-09-11 No Snippets Suda A, Takahashi J, Beltrame JF, Berry C, Camici PG, Crea F, Escaned J, Ford T, Carlos Kaski J, Kiyooka T, Metha PK, Ong P, Ozaki Y, Pepine C, Rimoldi O, Safdar B, Sechtem U, Tsujita K, Yii E, Noel Bairey Merz C, Shimokawa H, Coronary Vasomotor Disorders International Study COVADIS Group.
Show Full Abstract

<h4>Background</h4>Patients with signs and symptoms of myocardial ischemia and non-obstructive coronary artery disease (CAD) frequently have coronary functional abnormalities, including coronary microvascular dysfunction. Those with the latter are grouped under the term "microvascular angina" (MVA). Although diagnostic criteria exist for MVA, as recently proposed by our COVADIS (COronary VAsomotor Disorders International Study) group and the condition has been increasingly recognized in clinical practice, the clinical characteristics and long-term prognosis of MVA patients in the current era remain to be fully elucidated.<h4>Aims</h4>In the present study, we aimed to prospectively assess the clinical characteristics and long-term prognosis of MVA subjects in the current era in an international, multicenter, observational, and prospective registry study.<h4>Methods</h4>A total of 15 medical centers across 7 countries (USA, UK, Germany, Spain, Italy, Australia, and Japan) enrolled subjects fulfilling the COVADIS diagnostic criteria for MVA as follows; (1) signs and/or symptoms of myocardial ischemia, (2) absence of obstructive CAD, and (3) objective evidence of myocardial ischemia and/or coronary microvascular dysfunction. The primary endpoint was the composite of major cardiovascular events (MACE), including cardiovascular death, non-fatal myocardial infarction, non-fatal stroke, hospitalization due to heart failure or unstable angina. Between July 2015 and December 2018, a total of 706 subjects with MVA (M/F 256/450, 61.1 ± 11.8 [SD] yrs.) were registered. Subjects will be followed for at least 1 year.<h4>Summary</h4>The present study will provide important information regarding the clinical characteristics, management, and long-term prognosis of MVA patients in the current era.

Also flagged:Histone Deacetylase 6α-Synucleinα-Synmultiple system atrophyglialcytoplasmic
Journal Article 2020-09-11 ✓ 2 Snippets Lemos M, Stefanova N.
In-Text Gene Mentions

Huntington’s disease (HD) is characterized by the accumulation of the huntingtin protein (htt) and disturbances in axonal transport, resulting in cognitive decline, dementia, and impairment in motor coordination (Walker, 2007).

Furthermore, HDAC6 appeared to have an important role in the degradation of htt by recruiting the autophagic machinery to inclusion bodies containing htt in a neuronal cell model of HD (Iwata et al., 2005).

Show Full Abstract

The abnormal accumulation of α-Synuclein (α-Syn) is a prominent pathological feature in a group of diseases called α-Synucleinopathies, such as Parkinson's disease, dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). The formation of Lewy bodies (LBs) and glial cytoplasmic inclusions (GCIs) in neurons and oligodendrocytes, respectively, is highly investigated. However, the molecular mechanisms behind α-Syn improper folding and aggregation remain unclear. Histone deacetylase 6 (HDAC6) is a Class II deacetylase, containing two active catalytic domains and a ubiquitin-binding domain. The properties of HDAC6 and its exclusive cytoplasmic localization allow HDAC6 to modulate the microtubule dynamics, acting as a specific α-tubulin deacetylase. Also, HDAC6 can bind ubiquitinated proteins, facilitating the formation of the aggresome, a cellular defense mechanism to cope with higher levels of misfolded proteins. Several studies report that the aggresome shares similarities in size and composition with LBs and GCIs. HDAC6 is found to co-localize with α-Syn in neurons and in oligodendrocytes, together with other aggresome-related proteins. The involvement of HDAC6 in several neurodegenerative diseases is already under discussion, however, the results obtained by modulating HDAC6 activity are not entirely conclusive. The main goal of this review is to summarize and critically discuss previous <i>in vitro</i> and <i>in vivo</i> data regarding the specific role of HDAC6 in the context of α-Syn accumulation and protein aggregation in α-Synucleinopathies.

Also flagged:Gene ExpressionAktcancergastric cancerreverse transcriptasepolymerase
Journal Article 2020-09-11 No Snippets Kim KH, Kim HS, Kim SC, Kim D, Kim YB, Chung HC, Rha SY.
Show Full Abstract

<h4>Background</h4>Despite the important role of radiotherapy in cancer treatment, a subset of patients responds poorly to treatment majorly due to radioresistance. Particularly the role of radiotherapy has not been established in gastric cancer (GC). Herein, we aimed to identify a radiosensitivity gene signature and to discover relevant targets to enhance radiosensitivity in GC cells.<h4>Methods</h4>An oligonucleotide microarray (containing 22,740 probes) was performed in 12 GC cell lines prior to radiation. A clonogenic assay was performed to evaluate the survival fraction at 2 Gy (SF2) as a surrogate marker for radiosensitivity. Genes differentially expressed (fold change > 6, <i>q</i>-value < 0.025) were identified between radiosensitive and radioresistant cell lines, and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was performed for validation. Gene set and pathway analyses were performed using Ingenuity Pathway Analysis (IPA).<h4>Results</h4>Radiosensitive (SF2 < 0.4) and radioresistant cell lines (SF2 ≥ 0.6) exhibited a marked difference in gene expression. We identified 68 genes that are differentially expressed between radiosensitive and radioresistant cell lines. The identified genes showed interactions via <i>AKT</i>, <i>HIF1A</i>, <i>TGFB1</i>, and <i>TP53</i>, and their functions were associated with the genetic networks associated with cellular growth and proliferation, cellular movement, and cell cycle. The Akt signaling pathway exhibited the highest association with radiosensitivity. Combinatorial treatment with MK-2206, an allosteric Akt inhibitor, and radiotherapy significantly increased cell death compared with radiotherapy alone in two radioresistant cell lines (YCC-2 and YCC-16).<h4>Conclusion</h4>We identified a GC-specific radiosensitivity gene signature and suggest that the Akt signaling pathway could serve as a therapeutic target for GC radiosensitization.

Also flagged:pathogenesisGABA receptorbindingion transportTrigeminal Neuralgiapain
Journal Article 2020-09-11 ✓ 2 Snippets Dong W, Jin SC, Allocco A, Zeng X, Sheth AH, Panchagnula S, Castonguay A, Lorenzo LÉ, Islam B, Brindle G, Bachand K, Hu J, Sularz A, Gaillard J, Choi J, Dunbar A, Nelson-Williams C, Kiziltug E, Furey CG, Conine S, Duy PQ, Kundishora AJ, Loring E, Li B, Lu Q, Zhou G, Liu W, Li X, Sierant MC, Mane S, Castaldi C, López-Giráldez F, Knight JR, Sekula RF, Simard JM, Eskandar EN, Gottschalk C, Moliterno J, Günel M, Gerrard JL, Dib-Hajj S, Waxman SG, Barker FG, Alper SL, Chahine M, Haider S, De Koninck Y, Lifton RP, Kahle KT.
In-Text Gene Mentions

…and trafficking regulatorsPLCL1, JAKMIP1, and…

…, JAKMIP1, andARFGEF2.…

Show Full Abstract

Trigeminal neuralgia (TN) is a common, debilitating neuropathic face pain syndrome often resistant to therapy. The familial clustering of TN cases suggests that genetic factors play a role in disease pathogenesis. However, no unbiased, large-scale genomic study of TN has been performed to date. Analysis of 290 whole exome-sequenced TN probands, including 20 multiplex kindreds and 70 parent-offspring trios, revealed enrichment of rare, damaging variants in GABA receptor-binding genes in cases. Mice engineered with a TN-associated <i>de novo</i> mutation (p.Cys188Trp) in the GABA<sub>A</sub> receptor Cl<sup>-</sup> channel γ-1 subunit (<i>GABRG1</i>) exhibited trigeminal mechanical allodynia and face pain behavior. Other TN probands harbored rare damaging variants in Na<sup>+</sup> and Ca<sup>+</sup> channels, including a significant variant burden in the α-1H subunit of the voltage-gated Ca<sup>2+</sup> channel Ca<sub>v</sub>3.2 (<i>CACNA1H</i>). These results provide exome-level insight into TN and implicate genetically encoded impairment of GABA signaling and neuronal ion transport in TN pathogenesis.

Also flagged:neurodegenerative disordercytosineadenineguanineoligonucleotidesoligonucleotide
Journal Article 2020-09-11 ✓ 5 Snippets Svrzikapa N, Longo KA, Prasad N, Boyanapalli R, Brown JM, Dorset D, Yourstone S, Powers J, Levy SE, Morris AJ, Vargeese C, Goyal J.
In-Text Gene Mentions

,2 HD is caused by a cytosine-adenine-guanine (CAG) trinucleotide repeat expansion in the huntingtin (HTT) gene, which results in production of a mutated form of the huntingtin protein (mHTT).1

Various therapeutic strategies are in development to reduce HTT expression in patients with HD.22

…the huntingtin (HTT) gene, which…

…Wild-typeHTTprotein (wtHTT) is…

…homolog of humanHTT, leads to…

Show Full Abstract

Novel treatments for Huntington's disease (HD), a progressive neurodegenerative disorder, include selective targeting of the mutant allele of the huntingtin gene (m<i>HTT</i>) carrying the abnormally expanded disease-causing cytosine-adenine-guanine (CAG) repeat. WVE-120101 and WVE-120102 are investigational stereopure antisense oligonucleotides that enable selective suppression of m<i>HTT</i> by targeting single-nucleotide polymorphisms (SNPs) that are in haplotype phase with the CAG repeat expansion. Recently developed long-read sequencing technologies can capture CAG expansions and distant SNPs of interest and potentially facilitate haplotype-based identification of patients for clinical trials of oligonucleotide therapies. However, improved methods are needed to phase SNPs with CAG repeat expansions directly and reliably without need for familial genotype/haplotype data. Our haplotype phasing method uses single-molecule real-time sequencing and a custom algorithm to determine with confidence bases at SNPs on mutant alleles, even without familial data. Herein, we summarize this methodology and validate the approach using patient-derived samples with known phasing results. Comparison of experimentally measured CAG repeat lengths, heterozygosity, and phasing with previously determined results showed improved performance. Our methodology enables the haplotype phasing of SNPs of interest and the disease-causing, expanded CAG repeat of the huntingtin gene, enabling accurate identification of patients with HD eligible for allele-selective clinical studies.

Also flagged:mitochondrial diseasesphosphorylationMDmitochondrial diseasemitochondrialCOQ4
Journal Article 2020-09-10 ✓ 2 Snippets Tsang MHY, Kwong AKY, Chan KLS, Fung JLF, Yu MHC, Mak CCY, Yeung KS, Rodenburg RJT, Smeitink JAM, Chan R, Tsoi T, Hui J, Wong SSN, Tai SM, Chan VCM, Ma CK, Fung STH, Wu SP, Chak WK, Chung BHY, Fung CW.
In-Text Gene Mentions

…PC , andFBXL4, were identified…

…pathogenic variants ofFBXL4, ACAD9 ,…

Show Full Abstract

<h4>Background</h4>Mitochondrial diseases (MDs) are a group of clinically and genetically heterogeneous disorders characterized by defects in oxidative phosphorylation. Since clinical phenotypes of MDs may be non-specific, genetic diagnosis is crucial for guiding disease management. In the current study, whole-exome sequencing (WES) was performed for our paediatric-onset MD cohort of a Southern Chinese origin, with the aim of identifying key disease-causing variants in the Chinese patients with MDs.<h4>Methods</h4>We recruited Chinese patients who had paediatric-onset MDs and a minimum mitochondrial disease criteria (MDC) score of 3. Patients with positive target gene or mitochondrial DNA sequencing results were excluded. WES was performed, variants with population frequency ≤ 1% were analysed for pathogenicity on the basis of the American College of Medical Genetics and Genomics guidelines.<h4>Results</h4>Sixty-six patients with pre-biopsy MDC scores of 3-8 were recruited. The overall diagnostic yield was 35% (23/66). Eleven patients (17%) were found to have mutations in MD-related genes, with COQ4 having the highest mutation rate owing to the Chinese-specific founder mutation (4/66, 6%). Twelve patients (12/66, 18%) had mutations in non-MD-related genes: ATP1A3 (n = 3, two were siblings), ALDH5A1, ARX, FA2H, KCNT1, LDHD, NEFL, NKX2-2, TBCK, and WAC.<h4>Conclusions</h4>We confirmed that the COQ4:c.370G>A, p.(Gly124Ser) variant, was a founder mutation among the Southern Chinese population. Screening for this mutation should therefore be considered while diagnosing Chinese patients suspected to have MDs. Furthermore, WES has proven to be useful in detecting variants in patients suspected to have MDs because it helps to obtain an unbiased and precise genetic diagnosis for these diseases, which are genetically heterogeneous.

Also flagged:Atg1 kinaseAutophagyFIP200RB1CC1Atg13Atg101
Journal Article 2020-09-10 ✓ 1 Snippet Pan ZQ, Shao GC, Liu XM, Chen Q, Dong MQ, Du LL.
In-Text Gene Mentions

…bind autophagy receptorsCCPG1and p62 (…

Show Full Abstract

Autophagy is a proteolytic pathway that is conserved from yeasts to mammals. Atg1 kinase is essential for autophagy, but how its activity is controlled remains insufficiently understood. Here, we show that, in the fission yeast <i>Schizosaccharomyces pombe,</i> Atg1 kinase activity requires Atg11, the ortholog of mammalian FIP200/RB1CC1, but does not require Atg13, Atg17, or Atg101. Remarkably, a 62 amino acid region of Atg11 is sufficient for the autophagy function of Atg11 and for supporting the Atg1 kinase activity. This region harbors an Atg1-binding domain and a homodimerization domain. Dimerizing Atg1 is the main role of Atg11, as it can be bypassed by artificially dimerizing Atg1. In an Atg1 dimer, only one Atg1 molecule needs to be catalytically active, suggesting that Atg1 activation can be achieved through cis-autophosphorylation. We propose that mediating Atg1 oligomerization and activation may be a conserved function of Atg11/FIP200 family proteins and cis-autophosphorylation may be a general mechanism of Atg1 activation.

Also flagged:hepatic steatosissteatosisobesityCAPnon-alcoholic fatty liver diseaseNAFLD
Journal Article 2020-09-10 ✓ 1 Snippet Runge JH, van Giessen J, Draijer LG, Deurloo EE, Smets AMJB, Benninga MA, Koot BGP, Stoker J.
In-Text Gene Mentions

…hepatitis, Wilson disease,hemochromatosis, alpha-1 antitrypsin deficien…

Show Full Abstract

<h4>Objectives</h4>To determine the diagnostic accuracy of controlled attenuation parameter (CAP) on FibroScan<sup>®</sup> in detecting and grading steatosis in a screening setting and perform a head-to-head comparison with conventional B-mode ultrasound.<h4>Methods</h4>Sixty children with severe obesity (median BMI z-score 3.37; median age 13.7 years) were evaluated. All underwent CAP and US using a standardized scoring system. Magnetic resonance spectroscopy proton density fat fraction (MRS-PDFF) was used as a reference standard.<h4>Results</h4>Steatosis was present in 36/60 (60%) children. The areas under the ROC (AUROC) of CAP for the detection of grade ≥ S1, ≥ S2, and ≥ S3 steatosis were 0.80 (95% CI: 0.67-0.89), 0.77 (95% CI: 0.65-0.87), and 0.79 (95% CI: 0.66-0.88), respectively. The AUROC of US for the detection of grade ≥ S1 steatosis was 0.68 (95% CI: 0.55-0.80) and not significantly different from that of CAP (p = 0.09). For detecting ≥ S1 steatosis, using the optimal cutoffs, CAP (277 dB/m) and US (US steatosis score ≥ 2) had a sensitivity of 75% and 61% and a specificity of 75% and 71%, respectively. When using echogenicity of liver parenchyma as only the scoring item, US had a sensitivity of 70% and specificity of 46% to detect ≥ S1 steatosis. The difference in specificity of CAP and US when using only echogenicity of liver parenchyma of 29% was significant (p = 0.04).<h4>Conclusion</h4>The overall performance of CAP is not significantly better than that of US in detecting steatosis in children with obesity, provided that the standardized scoring of US features is applied. When US is based on liver echogenicity only, CAP outperforms US in screening for any steatosis (≥ S1).<h4>Key points</h4>• The areas under the ROC curves of CAP and ultrasound (US) for detecting grade ≥ S1 steatosis were 0.80 and 0.68, respectively, and were not significantly different (p = 0.09). • For detecting grade ≥ S1 steatosis in severely obese children, CAP had a sensitivity of 75% and a specificity of 75% at its optimal cutoff value of 277 dB/m. • For detecting grade ≥ S1 steatosis in clinical practice, both CAP and US can be used, provided that the standardized scoring of US images is used.

Also flagged:netrin-1Mitochondriaorganellesmyelinsynthesismitochondrial
Journal Article 2020-09-10 ✓ 1 Snippet Nakamura DS, Lin YH, Khan D, Gothié JM, de Faria O, Dixon JA, McBride HM, Antel JP, Kennedy TE.
In-Text Gene Mentions

…in colorectal carcinoma (DCC), to sites of…

Show Full Abstract

Mitochondria are dynamic organelles that produce energy and molecular precursors that are essential for myelin synthesis. Unlike in neurons, mitochondria in oligodendrocytes increase intracellular movement in response to glutamatergic activation and are more susceptible to oxidative stress than in astrocytes or microglia. The signaling pathways that regulate these cell type-specific mitochondrial responses in oligodendrocytes are not understood. Here, we visualized mitochondria migrating through thin cytoplasmic channels crossing myelin basic protein-positive compacted membranes and localized within paranodal loop cytoplasm. We hypothesized that local extracellular enrichment of netrin-1 might regulate the recruitment and function of paranodal proteins and organelles, including mitochondria. We identified rapid recruitment of mitochondria and paranodal proteins, including neurofascin 155 (NF155) and the netrin receptor deleted in colorectal carcinoma (DCC), to sites of contact between oligodendrocytes and netrin-1-coated microbeads in vitro. We provide evidence that Src-family kinase activation and Rho-associated protein kinase (ROCK) inhibition downstream of netrin-1 induces mitochondrial elongation, hyperpolarization of the mitochondrial inner membrane, and increases glycolysis. Our findings identify a signaling mechanism in oligodendrocytes that is sufficient to locally recruit paranodal proteins and regulate the subcellular localization, morphology, and function of mitochondria.

Also flagged:oxygenimmune responsecoagulationVIMCORO1ACD37
Journal Article 2020-09-10 ✓ 1 Snippet Gaur P, Saini S, Ray K, Asanbekovna KN, Akunov A, Maripov A, Sarybaev A, Singh SB, Kumar B, Vats P.
In-Text Gene Mentions

…, STMN1 ,UNC13C, RHOC and…

Show Full Abstract

High altitude (HA) conditions induce several physiological and molecular changes, prevalent in individuals who are unexposed to this environment. Individuals exposed towards HA hypoxia yields physiological and molecular orchestration to maintain adequate tissue oxygen delivery and supply at altitude. This study aimed to understand the temporal changes at altitude of 4,111m. Physiological parameters and transcriptome study was conducted at high altitude day 3, 7, 14 and 21. We observed changes in differentially expressed gene (DEG) at high altitude time points along with altered BP, HR, SpO2, mPAP. Physiological changes and unsupervised learning of DEG's discloses high altitude day 3 as distinct time point. Gene enrichment analysis of ontologies and pathways indicate cellular dynamics and immune response involvement in early day exposure and later stable response. Major clustering of genes involved in cellular dynamics deployed into broad categories: cell-cell interaction, blood signaling, coagulation system, and cellular process. Our data reveals genes and pathways perturbed for conditions like vascular remodeling, cellular homeostasis. In this study we found the nodal point of the gene interactive network and candidate gene controlling many cellular interactive pathways VIM, CORO1A, CD37, STMN1, RHOC, PDE7B, NELL1, NRP1 and TAGLN and the most significant among them i.e. VIM gene was identified as top hub gene. This study suggests a unique physiological and molecular perturbation likely to play a critical role in high altitude associated pathophysiological condition during early exposure compared to later time points.

Also flagged:immune responseinterferonOsHV-1 infectiondegradationviral infections1
Journal Article 2020-09-10 ✓ 1 Snippet Rosani U, Abbadi M, Green T, Bai CM, Turolla E, Arcangeli G, Wegner KM, Venier P.
In-Text Gene Mentions

…-1,6-beta-D-glucanase BGN16.3,Kelch-like protein 20protein 20, Achaete-scute-like…

Show Full Abstract

<h4>Background</h4>Since 2008, the aquaculture production of Crassostrea gigas was heavily affected by mass mortalities associated to Ostreid herpesvirus 1 (OsHV-1) microvariants worldwide. Transcriptomic studies revealed the major antiviral pathways of the oyster immune response while other findings suggested that also small non-coding RNAs (sncRNA) such as microRNAs might act as key regulators of the oyster response against OsHV-1. To explore the explicit connection between small non-coding and protein-coding transcripts, we performed paired whole transcriptome analysis of sncRNA and messenger RNA (mRNA) in six oysters selected for different intensities of OsHV-1 infection.<h4>Results</h4>The mRNA profiles of the naturally infected oysters were mostly governed by the transcriptional activity of OsHV-1, with several differentially expressed genes mapping to the interferon, toll, apoptosis, and pro-PO pathways. In contrast, miRNA profiles suggested more complex regulatory mechanisms, with 15 differentially expressed miRNAs (DE-miRNA) pointing to a possible modulation of the host response during OsHV-1 infection. We predicted 68 interactions between DE-miRNAs and oyster 3'-UTRs, but only few of them involved antiviral genes. The sncRNA reads assigned to OsHV-1 rather resembled mRNA degradation products, suggesting the absence of genuine viral miRNAs.<h4>Conclusions</h4>We provided data describing the miRNAome during OsHV-1 infection in C. gigas. This information can be used to understand the role of miRNAs in healthy and diseased oysters, to identify new targets for functional studies and, eventually to disentangle cause and effect relationships during viral infections in marine mollusks.

Also flagged:cognitive declinetauironwaterdeathdementia
Journal Article 2020-09-10 ✓ 1 Snippet Wearn AR, Nurdal V, Saunders-Jennings E, Knight MJ, Isotalus HK, Dillon S, Tsivos D, Kauppinen RA, Coulthard EJ.
In-Text Gene Mentions

…1 and theACE-IIIin study 2.…

Show Full Abstract

<h4>Background</h4>Early Alzheimer's disease (AD) diagnosis is vital for development of disease-modifying therapies. Prior to significant brain tissue atrophy, several microstructural changes take place as a result of Alzheimer's pathology. These include deposition of amyloid, tau and iron, as well as altered water homeostasis in tissue and some cell death. T2 relaxation time, a quantitative MRI measure, is sensitive to these changes and may be a useful non-invasive, early marker of tissue integrity which could predict conversion to dementia. We propose that different microstructural changes affect T2 in opposing ways, such that average 'midpoint' measures of T2 are less sensitive than measuring distribution width (heterogeneity). T2 heterogeneity in the brain may present a sensitive early marker of AD pathology.<h4>Methods</h4>In this cohort study, we tested 97 healthy older controls, 49 people with mild cognitive impairment (MCI) and 10 with a clinical diagnosis of AD. All participants underwent structural MRI including a multi-echo sequence for quantitative T2 assessment. Cognitive change over 1 year was assessed in 20 participants with MCI. T2 distributions were modelled in the hippocampus and thalamus using log-logistic distribution giving measures of log-median value (midpoint; T2μ) and distribution width (heterogeneity; T2σ).<h4>Results</h4>We show an increase in T2 heterogeneity (T2σ; p < .0001) in MCI compared to healthy controls, which was not seen with midpoint (T2μ; p = .149) in the hippocampus and thalamus. Hippocampal T2 heterogeneity predicted cognitive decline over 1 year in MCI participants (p = .018), but midpoint (p = .132) and volume (p = .315) did not. Age affects T2, but the effects described here are significant even after correcting for age.<h4>Conclusions</h4>We show that T2 heterogeneity can identify subtle changes in microstructural integrity of brain tissue in MCI and predict cognitive decline over a year. We describe a new model that considers the competing effects of factors that both increase and decrease T2. These two opposing forces suggest that previous conclusions based on T2 midpoint may have obscured the true potential of T2 as a marker of subtle neuropathology. We propose that T2 heterogeneity reflects microstructural integrity with potential to be a widely used early biomarker of conditions such as AD.

Also flagged:Secreted Glycoprotein ReelinglycoproteinReelinbindingsignal transductionDab1
Journal Article 2020-09-10 No Snippets Ogino H, Nakajima T, Hirota Y, Toriuchi K, Aoyama M, Nakajima K, Hattori M.
Show Full Abstract

Oligodendrocyte (OL) progenitor cells (OPCs) are generated, proliferate, migrate, and differentiate in the developing brain. Although the development of OPCs is prerequisite for normal brain function, the molecular mechanisms regulating their development in the neocortex are not fully understood. Several molecules regulate the tangential distribution of OPCs in the developing neocortex, but the cue molecule(s) that regulate their radial distribution remains unknown. Here, we demonstrate that the secreted glycoprotein Reelin suppresses the proliferation of OPCs and acts as a repellent for their migration <i>in vitro</i> These functions rely on the binding of Reelin to its receptors and on the signal transduction involving the intracellular protein Dab1. In the late embryonic neocortex of mice with attenuated Reelin signaling [i.e., Reelin heterozygote-deficient, Dab1 heterozygote-deficient mutant, or very low-density lipoprotein receptor (VLDLR)-deficient mice], the number of OPCs increased and their distribution shifted toward the superficial layers. In contrast, the number of OPCs decreased and they tended to distribute in the deep layers in the neocortex of mice with abrogated inactivation of Reelin by proteolytic cleavage, namely a disintegrin and metalloproteinase with thrombospondin type 1 motifs 3 (ADAMTS-3)-deficient mice and cleavage-resistant Reelin knock-in mice. Both male and female animals were used. These data indicate that Reelin-Dab1 signaling regulates the proliferation and radial distribution of OPCs in the late embryonic neocortex and that the regulation of Reelin function by its specific proteolysis is required for the normal development of OPCs.<b>SIGNIFICANCE STATEMENT</b> Here, we report that Reelin-Dab1 signaling regulates the proliferation and radial distribution of OPCs in the late embryonic mouse neocortex. Oligodendrocyte (OL) progenitor cells (OPCs) express Reelin signaling molecules and respond to Reelin stimulation. Reelin-Dab1 signaling suppresses the proliferation of OPCs both <i>in vitro</i> and <i>in vivo</i> Reelin repels OPCs <i>in vitro</i>, and the radial distribution of OPCs is altered in mice with either attenuated or augmented Reelin-Dab1 signaling. This is the first report identifying the secreted molecule that plays a role in the radial distribution of OPCs in the late embryonic neocortex. Our results also show that the regulation of Reelin function by its specific proteolysis is important for the normal development of OPCs.

Also flagged:-inactivating kappa opioid receptorKORnorbinaltorphiminecJun kinasestress disordersestrogen
Journal Article 2020-09-10 ✓ 1 Snippet Reichard KL, Newton KA, Rivera ZMG, Sotero de Menezes PM, Schattauer SS, Land BB, Chavkin C.
In-Text Gene Mentions

PRDX6

Show Full Abstract

The prototypical member of the receptor-inactivating kappa opioid receptor (KOR) antagonists, norbinaltorphimine (norBNI), produces prolonged receptor inactivation by a cJun kinase mechanism. These antagonists have potential therapeutic utility in the treatment of stress disorders; however, additional preclinical characterization is necessary to understand important aspects of their action. In this study, we report that norBNI does not work as effectively in female mice as in males because of estrogen regulation of G protein receptor kinase (GRK); pretreatment of ovary-intact female mice with the selective GRK2/3 inhibitor, Compound 101, made females equally sensitive to norBNI as males. Prior observations suggested that in vivo treatment with norBNI does not produce long-lasting inhibition of KOR regulation of dopamine release in the nucleus accumbens. We assessed the persistence of norBNI receptor inactivation in subcellular compartments. Fast-scan cyclic voltammetry recordings confirmed that presynaptic inhibition of dopamine release by the KOR agonist U69,593 was not blocked by in vivo pretreatment with norBNI under conditions that prevented KOR-mediated aversion and analgesia. We employed a novel in vivo proxy sensor of KOR activation, adenovirus associated double floxed inverted-HyPerRed, and demonstrated that KOR activation stimulates cJun kinase-dependent reactive oxygen species (ROS) production in somatic regions of ventral tegmental area dopamine neurons, but did not activate ROS production in dopamine terminals. The compartment selective action helps explain how dopamine somatic, but not terminally expressed, KORs are inactivated by norBNI. These results further elucidate molecular signaling mechanisms mediating receptor-inactivating KOR antagonist action and advance medication development for this novel class of stress-resilience medications. SIGNIFICANCE STATEMENT: Kappa opioid receptor (KOR) antagonists are being developed as novel proresilience therapeutics for the treatment of mood and substance use disorders. This study showed that the long-acting KOR antagonists are affected by both the sex of the animal and the subcellular compartment in which the receptor is expressed.

Also flagged:Age-related cataractARCimpairmentreversibleblindnessocular diseases
Journal Article 2020-09-10 ✓ 1 Snippet Liang S, Dou S, Li W, Huang Y.
In-Text Gene Mentions

…as GPX3, SIRT1,PRDX6, ALDH6A1, and SOD1.…

Show Full Abstract

Age-related cataract (ARC) is one of the major causes of visual impairment and reversible blindness worldwide. Accumulating evidence has revealed that circular RNAs (circRNAs) are involved in multiple regulatory processes in various ocular diseases. However, the expression profile, regulatory roles, and underlying mechanisms of circRNAs in ARC remain largely unknown. Herein we deep-sequenced circRNAs of anterior lens capsules from normal and ARC lenses, and detected 23,787 candidate circRNAs. Of these, 466 were significantly differentially expressed, and a higher correlation in down-regulated circRNAs between ARC and diabetic cataract was observed compared with up-regulated ones. Subsequent bioinformatics analysis disclosed that certain differentially expressed circRNAs participated in oxidative stress and apoptosis-related signaling pathways in ARC. Notably, the level of circZNF292 was significantly decreased, while miR-23b-3p was significantly increased in ARC. The target region prediction and dual-luciferase reporter assays proved that circZNF292 acted as a competitive endogenous RNA to regulate the expression of anti-oxidative genes through competing with miR-23b-3p. Our results indicate that circZNF292, a down-regulated circRNA in the anterior lens capsule of ARC patients, may be involved in resistance to oxidative damage and apoptosis of lens epithelial cells by sponging miR-23b-3p, providing a potential target for prevention and treatment of ARC.

Also flagged:genetic disordermethylationHDPEX14GRIK4COX4I2
Journal Article 2020-09-10 ✓ 5 Snippets Lu AT, Narayan P, Grant MJ, Langfelder P, Wang N, Kwak S, Wilkinson H, Chen RZ, Chen J, Simon Bawden C, Rudiger SR, Ciosi M, Chatzi A, Maxwell A, Hore TA, Aaronson J, Rosinski J, Preiss A, Vogt TF, Coppola G, Monckton D, Snell RG, William Yang X, Horvath S.
In-Text Gene Mentions

HDAC4 binds to mutant HTT in a polyglutamine length-dependent manner and is localized to the cytoplasmic inclusions in striatal neurons in HD mouse models, and genetic reduction of murine Hdac4 reduces cytoplasmic mutant Htt aggregation and restores cortico-striatal synaptic transmission in HdhQ150 KI mice44.

Here, the authors characterize DNA methylation levels in tissues from patients, a mouse huntingtin (Htt) gene knock-in model, and a transgenic HTT sheep model, and provide evidence that HD is accompanied by DNA methylation changes in these three species.

HD gene-expansion carriers (HDGECs) have CAG-repeat lengths of 36 or greater on one of the alleles of the huntingtin (HTT) gene.

While our EWAS findings in blood were different to those observed in a previous analysis of brain tissue using a limited brain methylation dataset6, we found that several brain regions exhibited hypermethylation of the HTT cg22982173 locus in HD cases.

…a mouse huntingtin (Htt) gene knock-in model,…

Show Full Abstract

Although Huntington's disease (HD) is a well studied Mendelian genetic disorder, less is known about its associated epigenetic changes. Here, we characterize DNA methylation levels in six different tissues from 3 species: a mouse huntingtin (Htt) gene knock-in model, a transgenic HTT sheep model, and humans. Our epigenome-wide association study (EWAS) of human blood reveals that HD mutation status is significantly (p < 10<sup>-7</sup>) associated with 33 CpG sites, including the HTT gene (p = 6.5 × 10<sup>-26</sup>). These Htt/HTT associations were replicated in the Q175 Htt knock-in mouse model (p = 6.0 × 10<sup>-8</sup>) and in the transgenic sheep model (p = 2.4 × 10<sup>-88</sup>). We define a measure of HD motor score progression among manifest HD cases based on multiple clinical assessments. EWAS of motor progression in manifest HD cases exhibits significant (p < 10<sup>-7</sup>) associations with methylation levels at three loci: near PEX14 (p = 9.3 × 10<sup>-9</sup>), GRIK4 (p = 3.0 × 10<sup>-8</sup>), and COX4I2 (p = 6.5 × 10<sup>-8</sup>). We conclude that HD is accompanied by profound changes of DNA methylation levels in three mammalian species.

Also flagged:ubiquitinconjugationHuntingtinNeurodegenerative Disorders
Journal Article 2020-09-10 No Snippets Ziv NE, Ciechanover A.
Show Full Abstract

No abstract available.

Also flagged:dimethylaminoparthenolidereninangiotensin aldosteroneRAASdiabetic kidney diseaseangiotensin-converting enzyme
Journal Article 2020-09-10 No Snippets Klein J, Caubet C, Camus M, Makridakis M, Denis C, Gilet M, Feuillet G, Rascalou S, Neau E, Garrigues L, Thillaye du Boullay O, Mischak H, Monsarrat B, Burlet-Schiltz O, Vlahou A, Saulnier-Blache JS, Bascands JL, Schanstra JP.
Show Full Abstract

While blocking the renin angiotensin aldosterone system (RAAS) has been the main therapeutic strategy to control diabetic kidney disease (DKD) for many years, 25-30% of diabetic patients still develop the disease. In the present work we adopted a systems biology strategy to analyze glomerular protein signatures to identify drugs with potential therapeutic properties in DKD acting through a RAAS-independent mechanism. Glomeruli were isolated from wild type and type 1 diabetic (Ins2Akita) mice treated or not with the angiotensin-converting enzyme inhibitor (ACEi) ramipril. Ramipril efficiently reduced the urinary albumin/creatine ratio (ACR) of Ins2Akita mice without modifying DKD-associated renal-injuries. Large scale quantitative proteomics was used to identify the DKD-associated glomerular proteins (DKD-GPs) that were ramipril-insensitive (RI-DKD-GPs). The raw data are publicly available via ProteomeXchange with identifier PXD018728. We then applied an in silico drug repurposing approach using a pattern-matching algorithm (Connectivity Mapping) to compare the RI-DKD-GPs's signature with a collection of thousands of transcriptional signatures of bioactive compounds. The sesquiterpene lactone parthenolide was identified as one of the top compounds predicted to reverse the RI-DKD-GPs's signature. Oral treatment of 2 months old Ins2Akita mice with dimethylaminoparthenolide (DMAPT, a water-soluble analogue of parthenolide) for two months at 10 mg/kg/d by gavage significantly reduced urinary ACR. However, in contrast to ramipril, DMAPT also significantly reduced glomerulosclerosis and tubulointerstitial fibrosis. Using a system biology approach, we identified DMAPT, as a compound with a potential add-on value to standard-of-care ACEi-treatment in DKD.

Also flagged:Aginginfectious diseasesCoronavirus Disease 2019COVID-19nucleusangiotensin-converting enzyme 2
Journal Article 2020-09-10 ✓ 2 Snippets Ma S, Sun S, Li J, Fan Y, Qu J, Sun L, Wang S, Zhang Y, Yang S, Liu Z, Wu Z, Zhang S, Wang Q, Zheng A, Duo S, Yu Y, Belmonte JCI, Chan P, Zhou Q, Song M, Zhang W, Liu GH.
In-Text Gene Mentions

…the upregulation ofTNFSF4and MMP9 (Fig.…

…, ANXA1 ,TNFSF4, NFKB1 ,…

Show Full Abstract

Aging is a major risk factor for many diseases, especially in highly prevalent cardiopulmonary comorbidities and infectious diseases including Coronavirus Disease 2019 (COVID-19). Resolving cellular and molecular mechanisms associated with aging in higher mammals is therefore urgently needed. Here, we created young and old non-human primate single-nucleus/cell transcriptomic atlases of lung, heart and artery, the top tissues targeted by SARS-CoV-2. Analysis of cell type-specific aging-associated transcriptional changes revealed increased systemic inflammation and compromised virus defense as a hallmark of cardiopulmonary aging. With age, expression of the SARS-CoV-2 receptor angiotensin-converting enzyme 2 (ACE2) was increased in the pulmonary alveolar epithelial barrier, cardiomyocytes, and vascular endothelial cells. We found that interleukin 7 (IL7) accumulated in aged cardiopulmonary tissues and induced ACE2 expression in human vascular endothelial cells in an NF-κB-dependent manner. Furthermore, treatment with vitamin C blocked IL7-induced ACE2 expression. Altogether, our findings depict the first transcriptomic atlas of the aged primate cardiopulmonary system and provide vital insights into age-linked susceptibility to SARS-CoV-2, suggesting that geroprotective strategies may reduce COVID-19 severity in the elderly.

Also flagged:AndrogenBMPcolorectal cancerandrogen receptorARBMP4
Journal Article 2020-09-10 ✓ 5 Snippets Yu X, Li S, Xu Y, Zhang Y, Ma W, Liang C, Lu H, Ji Y, Liu C, Chen D, Li J.
In-Text Gene Mentions

…stem cells used anti-Olfm4antibody (Cell Signaling,…

…We also usedOlfm4to identify the…

…the number ofOlfm4+ cells increased…

…+ cells, andOlfm4+ cells.…

…+ cells andOlfm4+ cells caused…

Show Full Abstract

Research shows a higher incidence of colorectal cancer in men. However, the molecular mechanisms for this gender disparity remain unknown. We report the roles of androgen in proliferation and differentiation of intestinal stem cells via targeting of the androgen receptor (AR) on intestinal stromal cells by negatively regulating BMP signaling. Orchidectomy (ORX) or the AR antagonist promotes expansion of intestinal epithelium but suppresses intestinal stem cell (ISC) proliferation. Conversely, the AR agonist inhibits ISC differentiation but augments proliferation in ovariectomized mice. Mechanistically, activation of the AR increases expression of BMP antagonists but lowers expression of BMP4 and Wnt antagonists in primary stromal cells, which promotes intestinal organoid growth. Interestingly, the BMP pathway inhibitor LDN-193189 reverses the ORX-induced effects. Our results highlight that stromal cells constitute the intestinal stem cell niche and provide a possible explanation for higher incidence rates of colorectal cancer in men.

Also flagged:synthesisgenetic diseasesmetabolismantibodyantibodiesvesicular transport proteins
Journal Article 2020-09-10 ✓ 1 Snippet Jiang L, Wang M, Lin S, Jian R, Li X, Chan J, Dong G, Fang H, Robinson AE, GTEx Consortium, Snyder MP.
In-Text Gene Mentions

UNC13C

Show Full Abstract

Determining protein levels in each tissue and how they compare with RNA levels is important for understanding human biology and disease as well as regulatory processes that control protein levels. We quantified the relative protein levels from over 12,000 genes across 32 normal human tissues. Tissue-specific or tissue-enriched proteins were identified and compared to transcriptome data. Many ubiquitous transcripts are found to encode tissue-specific proteins. Discordance of RNA and protein enrichment revealed potential sites of synthesis and action of secreted proteins. The tissue-specific distribution of proteins also provides an in-depth view of complex biological events that require the interplay of multiple tissues. Most importantly, our study demonstrated that protein tissue-enrichment information can explain phenotypes of genetic diseases, which cannot be obtained by transcript information alone. Overall, our results demonstrate how understanding protein levels can provide insights into regulation, secretome, metabolism, and human diseases.

Also flagged:skin canceraddictionbehavioralgene expressionFAM76BMTMR2
Journal Article 2020-09-10 ✓ 1 Snippet Sanna M, Li X, Visconti A, Freidin MB, Sacco C, Ribero S, Hysi P, Bataille V, Han J, Falchi M.
In-Text Gene Mentions

…× 10<sup>-8</sup>), andPLCL1/LINC01923/SATB2 (P = 3.93…

Show Full Abstract

Despite growing public awareness of the adverse consequences of excessive sun exposure, modifying sun-seeking behavior is challenging because it appears to be driven by addictive mechanisms. This can have effects on health because sun exposure, although beneficial, when prolonged and repeated shows a causal relationship with skin cancer risk. Using data from 2,500 United Kingdom twins, we observed sun seeking to be significantly heritable (h2 ≥ 58%). In a GWAS meta-analysis of sun-seeking behavior in 261,915 subjects of European ancestry, we identified five GWAS-significant loci previously associated with addiction, behavioral and personality traits, cognitive function, and educational attainment and enriched for CNS gene expression: MIR2113 (P = 2.08 × 10<sup>-11</sup>), FAM76B/MTMR2/CEP57 (P = 3.70 × 10<sup>-9</sup>), CADM2 (P = 9.36 × 10<sup>-9</sup>), TMEM182 (P = 1.64 × 10<sup>-8</sup>), and PLCL1/LINC01923/SATB2 (P = 3.93 × 10<sup>-8</sup>). These findings imply that the behavior concerning UV exposure is complicated by a genetic predisposition shared with neuropsychological traits. This should be taken into consideration when designing awareness campaigns and may help improve people's attitudes toward sun exposure.

Also flagged:RNA-binding proteinsribonucleoproteinPAMPRNA-binding proteinvirion proteinsCSD
Journal Article 2020-09-10 ✓ 5 Snippets Dicker K, Järvelin AI, Garcia-Moreno M, Castello A.
In-Text Gene Mentions

…RNA-binding protein 1 (STAU1) in the cytoplasm…

…oplasm forming HIV-1-dependentSTAU1-RNPs [ [76] ,…

…been proposed thatSTAU1assists Gag interaction…

…Interestingly,STAU1only modulates Gag…

…membrane suggesting thatSTAU1may play a…

Show Full Abstract

RNA is a central molecule in RNA virus biology due to its dual function as messenger and genome. However, the small number of proteins encoded by viral genomes is insufficient to enable virus infection. Hence, viruses hijack cellular RNA-binding proteins (RBPs) to aid replication and spread. In this review we discuss the 'knowns' and 'unknowns' regarding the contribution of host RBPs to the formation of viral particles and the initial steps of infection in the newly infected cell. Through comparison of the virion proteomes of ten different human RNA viruses, we confirm that a pool of cellular RBPs are typically incorporated into viral particles. We describe here illustrative examples supporting the important functions of these RBPs in viral particle formation and infectivity and we propose that the role of host RBPs in these steps can be broader than previously anticipated. Understanding how cellular RBPs regulate virus infection can lead to the discovery of novel therapeutic targets against viruses.

Also flagged:MitochondrialMetabolismCalciumcell proliferationdeathmitochondria
Journal Article 2020-09-10 No Snippets Peruzzo R, Costa R, Bachmann M, Leanza L, Szabò I.
Show Full Abstract

Mitochondria are organelles that are mainly involved in the generation of ATP by cellular respiration. In addition, they modulate several intracellular functions, ranging from cell proliferation and differentiation to cell death. Importantly, mitochondria are social and can interact with other organelles, such as the Endoplasmic Reticulum, lysosomes and peroxisomes. This symbiotic relationship gives advantages to both partners in regulating some of their functions related to several aspects of cell survival, metabolism, sensitivity to cell death and metastasis, which can all finally contribute to tumorigenesis. Moreover, growing evidence indicates that modulation of the length and/or numbers of these contacts, as well as of the distance between the two engaged organelles, impacts both on their function as well as on cellular signaling. In this review, we discuss recent advances in the field of contacts and communication between mitochondria and other intracellular organelles, focusing on how the tuning of mitochondrial function might impact on both the interaction with other organelles as well as on intracellular signaling in cancer development and progression, with a special focus on calcium signaling.

Also flagged:chromosomecarboncancergene expressioncell cycle-cell cycle-promoting
Journal Article 2020-09-10 No Snippets Yamanouchi S, Rhone J, Mao JH, Fujiwara K, Saganti PB, Takahashi A, Hada M.
Show Full Abstract

During space travel, humans are continuously exposed to two major environmental stresses, microgravity (μ<i>G</i>) and space radiation. One of the fundamental questions is whether the two stressors are interactive. For over half a century, many studies were carried out in space, as well as using devices that simulated μ<i>G</i> on the ground to investigate gravity effects on cells and organisms, and we have gained insights into how living organisms respond to μ<i>G</i>. However, our knowledge on how to assess and manage human health risks in long-term mission to the Moon or Mars is drastically limited. For example, little information is available on how cells respond to simultaneous exposure to space radiation and μ<i>G</i>. In this study, we analyzed the frequencies of chromosome aberrations (CA) in cultured human lymphoblastic TK6 cells exposed to X-ray or carbon ion under the simulated μ<i>G</i> conditions. A higher frequency of both simple and complex types of CA were observed in cells exposed to radiation and μ<i>G</i> simultaneously compared to CA frequency in cells exposed to radiation only. Our study shows that the dose response data on space radiation obtained at the 1<i>G</i> condition could lead to the underestimation of astronauts' potential risk for health deterioration, including cancer. This study also emphasizes the importance of obtaining data on the molecular and cellular responses to irradiation under μ<i>G</i> conditions.

Also flagged:sleepreproductionepileptic syndromesdisordersunresponsive wakefulness syndromedisorders of consciousness
Journal Article 2020-09-10 No Snippets Cofré R, Herzog R, Mediano PAM, Piccinini J, Rosas FE, Sanz Perl Y, Tagliazucchi E.
Show Full Abstract

The scope of human consciousness includes states departing from what most of us experience as ordinary wakefulness. These <i>altered states of consciousness</i> constitute a prime opportunity to study how global changes in brain activity relate to different varieties of subjective experience. We consider the problem of explaining how global signatures of altered consciousness arise from the interplay between large-scale connectivity and local dynamical rules that can be traced to known properties of neural tissue. For this purpose, we advocate a research program aimed at bridging the gap between bottom-up generative models of whole-brain activity and the top-down signatures proposed by theories of consciousness. Throughout this paper, we define altered states of consciousness, discuss relevant signatures of consciousness observed in brain activity, and introduce whole-brain models to explore the biophysics of altered consciousness from the bottom-up. We discuss the potential of our proposal in view of the current state of the art, give specific examples of how this research agenda might play out, and emphasize how a systematic investigation of altered states of consciousness via bottom-up modeling may help us better understand the biophysical, informational, and dynamical underpinnings of consciousness.

Also flagged:-CirrhoticCancerhepatocellular adenomascarcinomasglycogenAKT
Journal Article 2020-09-10 ✓ 1 Snippet Metzendorf C, Wineberger K, Rausch J, Cigliano A, Peters K, Sun B, Mennerich D, Kietzmann T, Calvisi DF, Dombrowski F, Ribback S.
In-Text Gene Mentions

…a-1-antitrypsin deficiency andhemochromatosis), obesity [ 2…

Show Full Abstract

Clear cell foci (CCF) of the liver are considered to be pre-neoplastic lesions of hepatocellular adenomas and carcinomas. They are hallmarked by glycogen overload and activation of AKT (v-akt murine thymoma viral oncogene homolog)/mTOR (mammalian target of rapamycin)-signaling. Here, we report the transcriptome and proteome of CCF extracted from human liver biopsies by laser capture microdissection. We found 14 genes and 22 proteins differentially expressed in CCF and the majority of these were expressed at lower levels in CCF. Using immunohistochemistry, the reduced expressions of STBD1 (starch-binding domain-containing protein 1), USP28 (ubiquitin-specific peptidase 28), monad/WDR92 (WD repeat domain 92), CYB5B (Cytochrome b5 type B), and HSPE1 (10 kDa heat shock protein, mitochondrial) were validated in CCF in independent specimens. Knockout of <i>Stbd1</i>, the gene coding for Starch-binding domain-containing protein 1, in mice did not have a significant effect on liver glycogen levels, indicating that additional factors are required for glycogen overload in CCF. <i>Usp28</i> knockout mice did not show changes in glycogen storage in diethylnitrosamine-induced liver carcinoma, demonstrating that CCF are distinct from this type of cancer model, despite the decreased USP28 expression. Moreover, our data indicates that decreased USP28 expression is a novel factor contributing to the pre-neoplastic character of CCF. In summary, our work identifies several novel and unexpected candidates that are differentially expressed in CCF and that have functions in glycogen metabolism and tumorigenesis.

Also flagged:Carbonate ApatiteHydroxyapatiteBreast Cancercancerstranslationaltumor
Journal Article 2020-09-10 No Snippets Islam RA, Al-Busaidi H, Zaman R, Abidin SAZ, Othman I, Chowdhury EH.
Show Full Abstract

<h4>Introduction</h4>Cancer is one of the top-ranked noncommunicable diseases causing deaths to nine million people and affecting almost double worldwide in 2018. Tremendous advancement in surgery, chemotherapy, radiation and targeted immunotherapy have improved the rate of cure and disease-free survival. As genetic mutations vary in different cancers, potential of customized treatment to silence the problem gene/s at the translational level is being explored too. Yet delivering therapeutics at the required dosage only to the affected cells without affecting the healthy ones, is a big hurdle to be overcome. Scientists worldwide have been working to invent a smart drug delivery system for targeted delivery of therapeutics to tumor tissues only. As part of such an effort, few organic nanocarriers went to clinical trials, while inorganic nanoparticles (NPs) are still in development stage despite their many customizable properties. Carbonate apatite (CA), a pH sensitive nanocarrier has emerged as an efficient delivery system for drugs, plasmids and siRNAs in preclinical models of breast and colon cancers. Like hydroxyapatite (HA) which serves as a classical tool for delivery of genetic materials such as siRNA and plasmid, CA is an apatite-based synthetic carrier. We developed simplified methods of formulating CA-in-DMEM and a DMEM-mimicking buffer and HA in a HEPES-buffered solution and characterized them in terms of size, stability, protein corona (PC) composition, cytotoxicity, siRNA delivery efficiency in breast cancer cells and siRNA biodistribution profile in a mouse model of breast cancer.<h4>Methods</h4>Particle growth was analyzed via spectrophotometry and light microscopy, size was measured via dynamic light scattering and scanning electron microscopy and confirmation of functional groups in apatite structures was made by FT-IR. siRNA-binding was analyzed via spectrophotometry. Stability of the formulation solutions/buffers was tested over various time points and at different temperatures to determine their compatibility in the context of practical usage. Cellular uptake was studied via fluorescence microscopy. MTT assay was performed to measure the cytotoxicity of the NPs. Liquid chromatography-mass spectrometry was carried out to analyze the PC formed around all three different NPs in serum-containing media. To explore biodistribution of all the formulations, fluorescence-labeled siRNA-loaded NPs were administered intravenously prior to analysis of fluorescence intensity in the collected organs and tumors of the treated mice.<h4>Results</h4>The size of NPs in 10% serum-containing media was dramatically different where CA-in-DMB and HA were much larger than CA-in-DMEM. Effect of media was notable on the PC composition of all three NPs. All three NPs bound albumin and some common protease inhibitors involved in bone metabolism due to their compositional similarity to our bone materials. Moreover, CA also bound heme-binding proteins and opsonins. Unlike CA, HA bound different kinds of keratins. Difference in PC constitution was likely to influence accumulation of NPs in various organs including those of reticuloendothelial system, such as liver and spleen and the tumor. We found 10 times more tumor accumulation of CA-in-DMB than CA-in-DMEM, which could be due to more stable siRNA-binding and distinct PC composition of the former.<h4>Conclusion</h4>As a nanocarrier CA is more efficient than HA for siRNA delivery to the tumor. CA prepared in a buffer containing only the mere constituents was potentially more efficient than classical CA prepared in DMEM, owing to the exclusion of interference attributed by the inorganic ions and organic molecules present in DMEM.

Also flagged:Aminomethylphenylimidazopyridinecolon cancerheterocyclic aromatic amines
Journal Article 2020-09-10 No Snippets Pan JH, Cicalo C, Le B, Jeon S, Kim S, Hwang KA, Kong B, Lee JH, Kim JK.
Show Full Abstract

Diets high in red meats, particularly meats cooked at high temperature, increase the risk of colon cancer due to a production of heterocyclic aromatic amines (HAAs). Of the identified HAAs, 2-amino-1-methyl-6-phenylimidazo[4,5-b]pyridine (PhIP) is the most mass abundant colon carcinogen in charred meat or fish. Here, we comprehensively examined sex-dependent colon transcriptome signatures in response to PhIP treatment to identify biological discrepancies. Eight-week-old male and female C57BL/6N mice were intraperitoneally injected with PhIP (10 mg/kg of body weight) and colon tissues were harvested 24 h after PhIP injection, followed by colon transcriptomics analysis. A list of differentially expressed genes (DEGs) was utilized for computational bioinformatic analyses. Specifically, overrepresentation test using the Protein Analysis Through Evolutionary Relationships tool was carried out to annotate sex-dependent changes in transcriptome signatures after PhIP treatment. Additionally, the most significantly affected canonical pathways by PhIP treatment were predicted using the Ingenuity Pathway Analysis. As results, male and female mice presented different metabolic signatures in the colon transcriptome. In the male mice, oxidative phosphorylation in the mitochondrial respiratory chain was the pathway impacted the most; this might be due to a shortage of ATP for DNA repair. On the other hand, the female mice showed concurrent activation of lipolysis and adipogenesis. The present study provides the foundational information for future studies of PhIP effects on underlying sex-dependent mechanisms.

Also flagged:Keratin intermediate filamentskeratinkeratin 1keratin 1Bkeratin 5blistering skin disorders
Journal Article 2020-09-10 ✓ 1 Snippet Hinbest AJ, Eldirany SA, Ho M, Bunick CG.
In-Text Gene Mentions

…sequencing of 162hemochromatosispatients as part…

Show Full Abstract

Keratin intermediate filaments constitute the primary cytoskeletal component of epithelial cells. Numerous human disease phenotypes related to keratin mutation remain mechanistically elusive. Our recent crystal structures of the helix 1B heterotetramer from keratin 1/10 enabled further investigation of the effect of pathologic 1B domain mutations on keratin structure. We used our highest resolution keratin 1B structure as a template for homology-modeling the 1B heterotetramers of keratin 5/14 (associated with blistering skin disorders), keratin 8/18 (associated with liver disease), and keratin 74/28 (associated with hair disorder). Each structure was examined for the molecular alterations caused by incorporating pathogenic 1B keratin mutations. Structural modeling indicated keratin 1B mutations can harm the heterodimer interface (R265P<sup>K5</sup>, L311R<sup>K5</sup>, R211P<sup>K14</sup>, I150V<sup>K18</sup>), the tetramer interface (F231L<sup>K1</sup>, F274S<sup>K74</sup>), or higher-order interactions needed for mature filament formation (S233L<sup>K1</sup>, L311R<sup>K5</sup>, Q169E<sup>K8</sup>, H128L<sup>K18</sup>). The biochemical changes included altered hydrophobic and electrostatic interactions, and altered surface charge, hydrophobicity or contour. Together, these findings advance the genotype-structurotype-phenotype correlation for keratin-based human diseases.

Also flagged:breast cancertumorestrogen receptor-negative breast cancerBRCA1BRCA2
Journal Article 2020-09-10 ✓ 1 Snippet Muranen TA, Khan S, Fagerholm R, Aittomäki K, Cunningham JM, Dennis J, Leslie G, McGuffog L, Parsons MT, Simard J, Slager S, Soucy P, Easton DF, Tischkowitz M, Spurdle AB, kConFab Investigators, Schmutzler RK, Wappenschmidt B, Hahnen E, Hooning MJ, HEBON Investigators, Singer CF, Wagner G, Thomassen M, Pedersen IS, Domchek SM, Nathanson KL, Lazaro C, Rossing CM, Andrulis IL, Teixeira MR, James P, Garber J, Weitzel JN, SWE-BRCA Investigators, Jakubowska A, Yannoukakos D, John EM, Southey MC, Schmidt MK, Antoniou AC, Chenevix-Trench G, Blomqvist C, Nevanlinna H.
In-Text Gene Mentions

…BRCA2 meta-analysis (ZNF644and TFCP2L1 )…

Show Full Abstract

Germline genetic variation has been suggested to influence the survival of breast cancer patients independently of tumor pathology. We have studied survival associations of genetic variants in two etiologically unique groups of breast cancer patients, the carriers of germline pathogenic variants in <i>BRCA1</i> or <i>BRCA2</i> genes. We found that rs57025206 was significantly associated with the overall survival, predicting higher mortality of <i>BRCA1</i> carrier patients with estrogen receptor-negative breast cancer, with a hazard ratio 4.37 (95% confidence interval 3.03-6.30, <i>P</i> = 3.1 × 10<sup>-9</sup>). Multivariable analysis adjusted for tumor characteristics suggested that rs57025206 was an independent survival marker. In addition, our exploratory analyses suggest that the associations between genetic variants and breast cancer patient survival may depend on tumor biological subgroup and clinical patient characteristics.

Also flagged:T cell receptorICOStranslationalCD3PI3Klysosomes
Journal Article 2020-09-10 ✓ 5 Snippets Lownik JC, Conrad DH, Martin RK.
In-Text Gene Mentions

…function mutation inRoquin-1led to increased…

…the importance ofRoquin-1in limiting Icos…

…complete loss ofRoquin-1in mice did…

…redundant pathway inRoquin-1mediated regulation of…

…function mutation inRoquin-1, Roquin-2 did not…

Show Full Abstract

The role of the inducible costimulatory of T cells (ICOS) has been shown to be important for many different T cell outcomes and is indispensable for follicular helper T cell (T<sub>FH</sub>) responses. Since its discovery, there have been several studies on the regulation of ICOS at a transcriptional level. However, the post-translational regulation of ICOS has not been well characterized. Here, we demonstrate that ICOS is internalized following ligation. We show that costimulation with CD3 results in differential internalization and fate than stimulation of ICOS alone. Additionally, we show that ICOS internalization is PI3K and clathrin mediated. The studies presented here not only increase the mechanistic understanding of ICOS post-translational regulation but also give insight into the potential mechanisms by which T cells expressing high affinity receptors may be preferentially chosen to become T<sub>FH</sub> cells with increased ICOS levels.

Also flagged:HIV Infectionmethylationgene expressionTranscription-factorbindingtranscription factors
Journal Article 2020-09-10 ✓ 1 Snippet Zeng X, Tsui JC, Shi M, Peng J, Cao CY, Kan LL, Lau CP, Liang Y, Wang L, Liu L, Chen Z, Tsui SK.
In-Text Gene Mentions

…CDKN2A, HEY1, DACT2,HTT, GATA3, HEY2 ,…

Show Full Abstract

<b>Background and methods:</b> Host genomic alterations are closely related to dysfunction of CD4<sup>+</sup> T lymphocytes in the HIV-host interplay. However, the roles of aberrant DNA methylation and gene expression in the response to HIV infection are not fully understood. We investigated the genome-wide DNA methylation and transcriptomic profiles in two HIV-infected T lymphocyte cell lines using high-throughput sequencing. <b>Results:</b> Based on DNA methylation data, we identified 3,060 hypomethylated differentially methylated regions (DMRs) and 2,659 hypermethylated DMRs in HIV-infected cells. Transcription-factor-binding motifs were significantly associated with methylation alterations, suggesting that DNA methylation modulates gene expression by affecting the binding to transcription factors during HIV infection. In support of this hypothesis, genes with promoters overlapping with DMRs were enriched in the biological function related to transcription factor activities. Furthermore, the analysis of gene expression data identified 1,633 upregulated genes and 2,142 downregulated genes on average in HIV-infected cells. These differentially expressed genes (DEGs) were significantly enriched in apoptosis-related pathways. Our results suggest alternative splicing as an additional mechanism that may contribute to T-cell apoptosis during HIV infection. We also demonstrated a genome-scale correlation between DNA methylation and gene expression in HIV-infected cells. We identified 831 genes with alterations in both DNA methylation and gene expression, which were enriched in apoptosis. Our results were validated using various experimental methods. In addition, consistent with our <i>in silico</i> results, a luciferase assay showed that the activity of the <i>PDX1</i> and <i>SMAD3</i> promoters was significantly decreased in the presence of HIV proteins, indicating the potential of these genes as genetic markers of HIV infection. <b>Conclusions:</b> Our results suggest important roles for DNA methylation and gene expression regulation in T-cell apoptosis during HIV infection. We propose a list of novel genes related to these processes for further investigation. This study also provides a comprehensive characterization of changes occurring at the transcriptional and epigenetic levels in T cells in response to HIV infection.

Also flagged:CalciumPhosphorusMetabolismparathyroid hormonePTHvitamin D
Journal Article 2020-09-10 No Snippets Sun M, Wu X, Yu Y, Wang L, Xie D, Zhang Z, Chen L, Lu A, Zhang G, Li F.
Show Full Abstract

Since calcium and phosphorus play vital roles in a multitude of physiologic systems, disorders of calcium and phosphorus metabolism always lead to severe consequences such as skeletal-related and cardiovascular morbidity, or even life-threatening. Physiologically, the maintenance of calcium and phosphorus homeostasis is achieved via a variety of concerted actions of hormones such as parathyroid hormone (PTH), vitamin D, and fibroblast growth factor (FGF23), which could be regulated mainly at three organs, the intestine, kidney, and bone. Disruption of any organ or factor might lead to disorders of calcium and phosphorus metabolism. Currently, lacking of accurate diagnostic approaches and unknown molecular basis of pathophysiology will result in patients being unable to receive a precise diagnosis and personalized treatment timely. Therefore, it is urgent to identify early diagnostic biomarkers and develop therapeutic strategies. Fortunately, proteomics and metabolomics offer promising tools to discover novel indicators and further understanding of pathological mechanisms. Therefore, in this review, we will give a systematic introduction on PTH-1,25(OH)<sub>2</sub>D-FGF23 axis in the disorders of calcium and phosphorus metabolism, diagnostic biomarkers identified, and potential altered metabolic pathways involved.

Also flagged:hydroxyapatiteglycolchitosanpolyethylene glycolsurface antigenminerals
Journal Article 2020-09-10 No Snippets Wang L, Wang J, Zhou X, Sun J, Zhu B, Duan C, Chen P, Guo X, Zhang T, Guo H.
Show Full Abstract

<h4>Background</h4>Fractures are a medical disease with a high incidence, and about 5-10% of patients need bone transplantation to fill the defect. In this study, we aimed to synthesize a new type of coralline hydroxyapatite (CHA)/silk fibroin (SF)/glycol chitosan (GCS)/difunctionalized polyethylene glycol (DF-PEG) self-healing hydrogel and to evaluate the therapeutic effects of this novel self-healing hydrogel as a human umbilical cord mesenchymal stem cells (hucMSC)-derived exosome carrier on bone defects in SD rat.<h4>Methods</h4>HucMSCs were isolated from fetal umbilical cord tissue and characterized by surface antigen analysis and pluripotent differentiation <i>in vitro</i>. The cell supernatant after ultracentrifugation was collected to isolate exosomes, which were characterized by transmission electron microscopy and western blot analysis. <i>In vitro</i> cell induction experiments were performed to observe the effects of hucMSC-derived exosomes on the biological behavior of mouse osteoblast progenitor cells (mOPCs) and human umbilical vein endothelial cells (HUVECs). The CHA/SF/GCS/DF-PEG hydrogels were prepared using DF-PEG as the gel factor and then structural and physical properties were characterized. HucMSCs-derived exosomes were added to the hydrogel and their effects were evaluated in SD rats with induced femoral condyle defect. These effects were analyzed by X-ray and micro-CT imaging and H&E, Masson and immunohistochemistry staining.<h4>Results</h4>HucMSC-derived exosomes can promote osteogenic differentiation of mOPCs and promote the proliferation and migration of HUVECs. The CHA/SF/GCS/DF-PEG hydrogel has a high self-healing capacity, perfect surface morphology and the precipitated CHA crystals have a small size and low crystallinity similar to natural bone minerals. The MTT results showed that the hydrogel was non-toxic and have a good biocompatibility. The <i>in vivo</i> studies have shown that the hydrogel containing exosomes could effectively promote healing of rat bone defect. The histological analysis revealed more new bone tissue and morphogenetic protein 2 (BMP-2) in the hydrogel-exosome group. In addition, the hydrogel-exosome group had the highest microvessel density.<h4>Conclusion</h4>A self-healing CHA/SF/GCS/DF-PEG hydrogel was successfully prepared. The hydrogel has excellent comprehensive properties and is expected to become a new type of bone graft material. This hydrogel has the effect of promoting bone repair, which is more significant after the addition of hucMSC-derived exosomes.

Also flagged:Pathogenesispulmonary edemaoxygenpulmonary vasoconstrictionnitric oxideC-reactive protein
Journal Article 2020-09-10 No Snippets Sharma Kandel R, Mishra R, Gautam J, Alaref A, Hassan A, Jahan N.
Show Full Abstract

High altitude pulmonary edema (HAPE) occurs in individuals rapidly ascending at altitudes greater than 2,500 m within one week of arrival. HAPE is characterized by orthopnea, breathlessness at rest, cough, and pink frothy sputum. Several mechanisms to describe the pathophysiology of HAPE have been proposed in different kinds of literature where most of the mechanisms are reported to be activated before a drop in oxygen saturation levels. The majority of the current studies favor diffuse hypoxic pulmonary vasoconstriction (HPV) as a pathophysiological basis for HAPE. However, some of the studies described inflammation in the lungs and genetic basis as the pathophysiology of HAPE. So, there is a major disagreement regarding the exact pathophysiology of HAPE in the current literature, which raises a question as to what is the exact pathophysiology of HAPE. So, we reviewed 23 different articles which include clinical trials, review articles, randomized controlled trials (RCTs), and original research published from 2010 to 2020 to find out widely accepted pathophysiology of HAPE. In our study, we found out sympathetic stimulation, reduced nitric oxide (NO) bioavailability, increased endothelin, increased pulmonary artery systolic pressure (PASP) resulting in diffuse HPV, and reduced reabsorption of interstitial fluid to be the most important determinants for the development of HAPE. Similarly, with the evaluation of the role of inflammatory mediators like C-reactive protein (CRP) and interleukin (IL-6), we found out that inflammation in the lungs seems to modulate but not cause the process of development of HAPE. Genetic basis as evidenced by increased transcription of certain gene products seems to be another promising hypoxic change leading to HAPE. However, comprehensive studies are still needed to decipher the pathophysiology of HAPE in greater detail.

Also flagged:SteroltuberculosisTBRifampicincholesterolfolic acid
Journal Article 2020-09-10 No Snippets Baena A, Vasco E, Pastrana M, Alzate JF, Barrera LF, Martínez A.
Show Full Abstract

The upsurge and persistence of drug resistant strains of <i>Mycobacterium tuberculosis</i> (Mtb) is an important limitant to the battery of drugs available for the elimination of tuberculosis (TB). To avoid future scarcity of antibiotics against Mtb, it is important to discover new effective anti-mycobacterial agents. In this study, we present data from a series of experiments to determine <i>in vitro</i> and <i>in vivo</i> anti-mycobacterial activity of a library of epidioxy-sterol analogs. We test 15 compounds for their ability to reduce the viability of Mtb. We found that one compound called T5 epidioxy-sterol-ANB display significant potency against Mtb <i>in vitro</i> specifically inside macrophages but without effectivity in axenic cultures. A viability assay confirms that this T5 compound is less toxic for macrophages <i>in vitro</i> as compared to the current Mtb drug Rifampicin at higher concentrations. We use a transcriptomic analysis of Mtb inside macrophages after T5 epidioxy-sterol-ANB treatment, and we found a significant down-regulation of enzymes involved in the cholesterol and folic acid pathways. <i>In vivo</i>, significant differences were found in the lungs and spleen CFUs of Mtb infected mice treated with the T5 epidioxy-sterol-ANB as compared with the untreated control group, which provides additional evidence of the effectivity of the T5 compound. Altogether these results confirm the potential of this T5 epidioxy-sterol-ANB compound against Mtb.

Also flagged:ironnickelpalladiumanilinephenolcarboxylic acid
Journal Article 2020-09-10 No Snippets Boit TB, Bulger AS, Dander JE, Garg NK.
Show Full Abstract

No abstract available.

Journal Article 2020-09-10 ✓ 2 Snippets Hu Y, Hou YG, Oxley L.
In-Text Gene Mentions

DCC-GARCH-SNP

DCC

Show Full Abstract

Recent papers that have explored spot and futures markets for Bitcoin have concluded that price discovery takes place <i>either</i> in the spot, <i>or</i> the futures market. Here, we consider the robustness of previous price discovery conclusions by investigating causal relationships, cointegration and price discovery between spot and futures markets for Bitcoin, using appropriate daily data and time-varying mechanisms. We apply the time-varying Granger causality test of Shi, Phillips, and Hurn [2018]; time-varying cointegration tests of Park and Hahn [1999], and time-varying information share methodologies, concluding that futures prices Granger cause spot prices and that futures prices dominate the price discovery process.

Also flagged:nanocellulosecellulosenanocrystalsnanocrystalaldehydecarbohydrate
Journal Article 2020-09-09 No Snippets Heise K, Delepierre G, King AWT, Kostiainen MA, Zoppe J, Weder C, Kontturi E.
Show Full Abstract

Native plant cellulose has an intrinsic supramolecular structure. Consequently, it can be isolated as nanocellulose species, which can be utilized as building blocks for renewable nanomaterials. The structure of cellulose also permits its end-wise modification, i.e., chemical reactions exclusively on one end of a cellulose chain or a nanocellulose particle. The premises for end-wise modification have been known for decades. Nevertheless, different approaches for the reactions have emerged only recently, because of formidable synthetic and analytical challenges associated with the issue, including the adverse reactivity of the cellulose reducing end and the low abundance of newly introduced functionalities. This Review gives a full account of the scientific underpinnings and challenges related to end-wise modification of cellulose nanocrystals. Furthermore, we present how the chemical modification of cellulose nanocrystal ends may be applied to directed assembly, resulting in numerous possibilities for the construction of new materials, such as responsive liquid crystal templates and composites with tailored interactions.

Also flagged:carcinomastumorcancerscancerBRAFnucleotides
Journal Article 2020-09-09 No Snippets Fang S, Liu Z, Guo Q, Chen C, Ke X, Xu G.
Show Full Abstract

<h4>Background</h4>BRAF-activated noncoding RNA (BANCR) is aberrantly expressed in various tumor tissues and has been confirmed to function as a tumor suppressor or oncogene in many types of cancers. Considering the conflicting results and insufficient sampling, a meta-analysis was performed to explore the prognostic value of BANCR in various carcinomas.<h4>Methods</h4>A comprehensive literature search of PubMed, Web of Science, EMBASE, Cochrane Library and the China National Knowledge Infrastructure (CNKI) was conducted to collect relevant articles.<h4>Results</h4>The pooled results showed a strong relationship between high BANCR expression and poor overall survival (OS) (HR (hazard ratio) =1.60, 95% confidence interval (CI): 1.19-2.15, P = 0.002) and recurrence-free survival (RFS) (HR = 1.53, 95% CI: 1.27-1.85, P < 0.00001). In addition, high BANCR expression predicted advanced tumor stage (OR (odds ratio) =2.39, 95% CI: 1.26-4.53, P = 0.008), presence of lymph node metastasis (OR = 2.03, 95% CI: 1.08-3.83, P = 0.03), positive distant metastasis (OR = 3.08, 95% CI: 1.92-4.96, P < 0.00001) and larger tumor sizes (OR = 1.63, 95% CI: 1.09-2.46, P = 0.02). However, no associations were found for smoking status (OR = 1.01, 95% CI: 0.65-1.56, P = 0.98), age (OR = 0.88, 95% CI: 0.71-1.09, P = 0.236) and sex (OR = 0.91, 95% CI: 0.72-1.16, P = 0.469). The sensitivity analysis of OS showed that the results of each publication were almost consistent with the combined results, and the merged results have high robustness and reliability.<h4>Conclusions</h4>The results showed that elevated BANCR expression was associated with unfavorable prognosis for most cancer patients, and BANCR could serve as a promising therapeutic target and independent prognostic predictor in most of cancer types.

Also flagged:Peroxiredoxin 6PeroxiredoxinPRDX) 6glutathione peroxidasemembrane
Journal Article 2020-09-09 ✓ 5 Snippets Pankiewicz JE, Diaz JR, Martá-Ariza M, Lizińczyk AM, Franco LA, Sadowski MJ.
In-Text Gene Mentions

Prdx6 knock out mice (B6.129-Prdx6tm1Pgn/Pgn; stock #005974) feature disruption of exons 1 and 2 of the Prdx6 gene using a targeting vector containing the neomycin resistance and lacZ genes [17, 18].

…In the CNS,PRDX6is uniquely expressed…

…mice overexpressing wild-typePrdx6allele or to…

…allele or toPrdx6knock out mice.…

…Effect ofPrdx6gene dose on…

Show Full Abstract

<h4>Background</h4>Disruption of β-amyloid (Aβ) homeostasis is the initial culprit in Alzheimer's disease (AD) pathogenesis. Astrocytes respond to emerging Aβ plaques by altering their phenotype and function, yet molecular mechanisms governing astrocytic response and their precise role in countering Aβ deposition remain ill-defined. Peroxiredoxin (PRDX) 6 is an enzymatic protein with independent glutathione peroxidase (Gpx) and phospholipase A2 (PLA<sub>2</sub>) activities involved in repair of oxidatively damaged cell membrane lipids and cellular signaling. In the CNS, PRDX6 is uniquely expressed by astrocytes and its exact function remains unexplored.<h4>Methods</h4>APPswe/PS1<sub>dE9</sub> AD transgenic mice were once crossed to mice overexpressing wild-type Prdx6 allele or to Prdx6 knock out mice. Aβ pathology and associated neuritic degeneration were assessed in mice aged 10 months. Laser scanning confocal microscopy was used to characterize Aβ plaque morphology and activation of plaque-associated astrocytes and microglia. Effect of Prdx6 gene dose on plaque seeding was assessed in mice aged six months.<h4>Results</h4>We show that hemizygous knock in of the overexpressing Prdx6 transgene in APP<sub>swe</sub>/PS1<sub>dE9</sub> AD transgenic mice promotes selective enticement of astrocytes to Aβ plaques and penetration of plaques by astrocytic processes along with increased number and phagocytic activation of periplaque microglia. This effects suppression of nascent plaque seeding and remodeling of mature plaques consequently curtailing brain Aβ load and Aβ-associated neuritic degeneration. Conversely, Prdx6 haplodeficiency attenuates astro- and microglia activation around Aβ plaques promoting Aβ deposition and neuritic degeneration.<h4>Conclusions</h4>We identify here PRDX6 as an important factor regulating response of astrocytes toward Aβ plaques. Demonstration that phagocytic activation of periplaque microglia vary directly with astrocytic PRDX6 expression level implies previously unappreciated astrocyte-guided microglia effect in Aβ proteostasis. Our showing that upregulation of PRDX6 attenuates Aβ pathology may be of therapeutic relevance for AD.

Also flagged:chromosomeorganizationlocalizationcell divisioncondensinschromosomes
Journal Article 2020-09-09 ✓ 2 Snippets Zhao H, Bhowmik BK, Petrushenko ZM, Rybenkov VV.
In-Text Gene Mentions

Condensinsare essential for…

Condensinsact in cooperation…

Show Full Abstract

Condensins are essential for global chromosome organization in diverse bacteria. Atypically, the <i>Pseudomonas aeruginosa</i> chromosome encodes condensins from two superfamilies, SMC-ScpAB and MksBEF. Here, we report that the two proteins play specialized roles in chromosome packing and segregation and are synthetically lethal with ParB. Inactivation of SMC or MksB affected, in a protein-dependent manner, global chromosome layout and its timing of segregation and sometimes triggered a chromosomal inversion. The localization pattern was also unique to each protein. SMC clusters colocalized with <i>oriC</i> throughout the cell cycle except shortly after origin duplication, whereas MksB clusters emerged at cell quarters shortly prior to <i>oriC</i> duplication and stayed there even after cell division. The relocation of the proteins was abrupt and coordinated with <i>oriC</i> dynamic. These data reveal that the two condensins play distinct dual roles in chromosome maintenance by organizing it and mediating its segregation. Furthermore, the choreography of condensins and <i>oriC</i> relocations suggest an elegant mechanism for the birth and maturation of chromosomes.<b>IMPORTANCE</b> Mechanisms that define the chromosome as a structural entity remain unknown. Key elements in this process are condensins, which globally organize chromosomes and contribute to their segregation. This study characterized condensin and chromosome dynamics in <i>Pseudomonas aeruginosa</i>, which harbors condensins from two major protein superfamilies, SMC and MksBEF. The study revealed that both proteins play a dual role in chromosome maintenance by spatially organizing the chromosomes and guiding their segregation but can substitute for each other in some activities. The timing of chromosome, SMC, and MksBEF relocation was highly ordered and interdependent, revealing causative relationships in the process. Moreover, MksBEF produced clusters at the site of chromosome replication that survived cell division and remained in place until replication was complete. Overall, these data delineate the functions of condensins from the SMC and MksBEF superfamilies, reveal the existence of a chromosome organizing center, and suggest a mechanism that might explain the biogenesis of chromosomes.

Also flagged:Androgen receptorTREM-1prostate cancercell line migrationARPCa
Journal Article 2020-09-09 ✓ 2 Snippets Cioni B, Zaalberg A, van Beijnum JR, Melis MHM, van Burgsteden J, Muraro MJ, Hooijberg E, Peters D, Hofland I, Lubeck Y, de Jong J, Sanders J, Vivié J, van der Poel HG, de Boer JP, Griffioen AW, Zwart W, Bergman AM.
In-Text Gene Mentions

…with RPMI, 5%DCC, 20 ng ml…

…cultured in hormone-deprivedDCCmedium.…

Show Full Abstract

The androgen receptor (AR) is the master regulator of prostate cancer (PCa) development, and inhibition of AR signalling is the most effective PCa treatment. AR is expressed in PCa cells and also in the PCa-associated stroma, including infiltrating macrophages. Macrophages have a decisive function in PCa initiation and progression, but the role of AR in macrophages remains largely unexplored. Here, we show that AR signalling in the macrophage-like THP-1 cell line supports PCa cell line migration and invasion in culture via increased Triggering Receptor Expressed on Myeloid cells-1 (TREM-1) signalling and expression of its downstream cytokines. Moreover, AR signalling in THP-1 and monocyte-derived macrophages upregulates IL-10 and markers of tissue residency. In conclusion, our data suggest that AR signalling in macrophages may support PCa invasiveness, and blocking this process may constitute one mechanism of anti-androgen therapy.

Also flagged:membranesmembraneEnd stage renal diseaseESRDHDcytokine
Journal Article 2020-09-09 ✓ 2 Snippets Westphalen H, Saadati S, Eduok U, Abdelrasoul A, Shoker A, Choi P, Doan H, Ein-Mozaffari F.
In-Text Gene Mentions

…ammatory biomarkers of Serpin/Antithrombin-III, Properdin, C5a, 1L-1α,…

…the presence of serpin/antithrombin-III, properdin, complement compon…

Show Full Abstract

End stage renal disease (ESRD) patients depend on hemodialysis (HD) as a life-sustaining treatment, but HD membrane properties play a critical role in blood activation during HD and can lead to severe patient outcomes. This study reports on a series of investigations on the common clinical HD membranes available in Canadian hospitals to explore the key reasons behind their susceptibility to blood activation and unstable cytokine. Clinical HD membranes composed of cellulose triacetate (CTA) and polyvinylpyrrolidone: polyarylethersulfone (PAES: PVP) were thoroughly characterized in terms of morphology and chemical composition. Membrane-surface interactions with uremic blood samples after HD treatment were probed using Fourier Transform Infra-Red (FTIR) and Raman spectroscopic techniques in order to understand changes in chemistry on membrane fibers. In addition, as part of this innovative study, we utilized Molecular Modeling Docking to examine the interactions of human blood proteins and membrane models to gain an in-depth understanding of functional group types responsible for perceived interactions. In-vitro adsorption of fibrinogen on different clinical HD membranes was compared at similar clinical operating conditions. Samples were collected from dialysis patients to ascertain the extent of inflammatory biomarkers released, before, during (30 and 90 min) and after dialysis (4 h). Collected blood samples were analyzed using Luminex assays for the inflammatory biomarkers of Serpin/Antithrombin-III, Properdin, C5a, 1L-1α, 1L-1β, TNF-α, IL6, and vWF. We have likewise incubated uremic blood in vitro with the two membrane materials to determine the impact that membrane materials pose in favor of activation away from the hydrodynamics influences. The results of our morphological, chemical, spectroscopic, and in vitro incubation analyses indicate that CTA membranes have a smoother surface and higher biocompatibility than PAES: PVP membranes, however, it has smaller pore size distribution, which results in poor clearance of a broad spectrum of uremic toxins. However, the rougher surface and greater hydrophilicity of PAES: PVP membranes increases red blood cell rupture at the membrane surface, which promotes protein adsorption and biochemical cascade reactions. Molecular docking studies indicate sulfone functional groups play an important role in the adsorption of proteins and receptors. PAES: PVP membranes result in slower but greater adsorption of fibrinogen, but are more likely to experience reversible and irreversible fouling as well as backfiltration. Our major finding is that a single dialysis session, even with a more biocompatible membrane such as CTA, increases the levels of complement and inflammation factors, but to a milder extent than dialysis with a PAES membrane.

Also flagged:secretioninfectionfatty acidsUnsaturated fatty acidslinoleic acidmembrane-bound
Journal Article 2020-09-09 No Snippets Kengmo Tchoupa A, Watkins KE, Jones RA, Kuroki A, Alam MT, Perrier S, Chen Y, Unnikrishnan M.
Show Full Abstract

The Staphylococcus aureus type VII secretion system (T7SS) exports several proteins that are pivotal for bacterial virulence. The mechanisms underlying T7SS-mediated staphylococcal survival during infection nevertheless remain unclear. Here we report that S. aureus lacking T7SS components are more susceptible to host-derived antimicrobial fatty acids. Unsaturated fatty acids such as linoleic acid (LA) elicited an increased inhibition of S. aureus mutants lacking T7SS effectors EsxC, EsxA and EsxB, or the membrane-bound ATPase EssC, compared to the wild-type (WT). T7SS mutants generated in different S. aureus strain backgrounds also displayed an increased sensitivity to LA. Analysis of bacterial membrane lipid profiles revealed that the esxC mutant was less able to incorporate LA into its membrane phospholipids. Although the ability to bind labelled LA did not differ between the WT and mutant strains, LA induced more cell membrane damage in the T7SS mutants compared to the WT. Furthermore, proteomic analyses of WT and mutant cell fractions revealed that, in addition to compromising membranes, T7SS defects induce oxidative stress and hamper their response to LA challenge. Thus, our findings indicate that T7SS contribute to maintaining S. aureus membrane integrity and homeostasis when bacteria encounter antimicrobial fatty acids.

Also flagged:poly-ADP ribose polymerasebreast cancersTRIM37cell divisioncentrosomesbreast cancer
Journal Article 2020-09-09 No Snippets Yeow ZY, Lambrus BG, Marlow R, Zhan KH, Durin MA, Evans LT, Scott PM, Phan T, Park E, Ruiz LA, Moralli D, Knight EG, Badder LM, Novo D, Haider S, Green CM, Tutt ANJ, Lord CJ, Chapman JR, Holland AJ.
Show Full Abstract

Genomic instability is a hallmark of cancer, and has a central role in the initiation and development of breast cancer<sup>1,2</sup>. The success of poly-ADP ribose polymerase inhibitors in the treatment of breast cancers that are deficient in homologous recombination exemplifies the utility of synthetically lethal genetic interactions in the treatment of breast cancers that are driven by genomic instability<sup>3</sup>. Given that defects in homologous recombination are present in only a subset of breast cancers, there is a need to identify additional driver mechanisms for genomic instability and targeted strategies to exploit these defects in the treatment of cancer. Here we show that centrosome depletion induces synthetic lethality in cancer cells that contain the 17q23 amplicon, a recurrent copy number aberration that defines about 9% of all primary breast cancer tumours and is associated with high levels of genomic instability<sup>4-6</sup>. Specifically, inhibition of polo-like kinase 4 (PLK4) using small molecules leads to centrosome depletion, which triggers mitotic catastrophe in cells that exhibit amplicon-directed overexpression of TRIM37. To explain this effect, we identify TRIM37 as a negative regulator of centrosomal pericentriolar material. In 17q23-amplified cells that lack centrosomes, increased levels of TRIM37 block the formation of foci that comprise pericentriolar material-these foci are structures with a microtubule-nucleating capacity that are required for successful cell division in the absence of centrosomes. Finally, we find that the overexpression of TRIM37 causes genomic instability by delaying centrosome maturation and separation at mitotic entry, and thereby increases the frequency of mitotic errors. Collectively, these findings highlight TRIM37-dependent genomic instability as a putative driver event in 17q23-amplified breast cancer and provide a rationale for the use of centrosome-targeting therapeutic agents in treating these cancers.

Also flagged:HECW2endothelial-mesenchymal transitionlipopolysaccharidepolymeraseRibonuclease(RNase) R
Journal Article 2020-09-09 ✓ 5 Snippets Dong Y, Fan X, Wang Z, Zhang L, Guo S.
In-Text Gene Mentions

…transition by mediatingNEGR1expression.…

…circ_HECW2, miR-30e-5p andneuronal growth regulator 1growth regulator 1…

…growth regulator 1 (NEGR1) were detected by…

…circ_HECW2, miR-30e-5p andNEGR1were verified by…

…thermore, Circ_HECW2 regulatedNEGR1expression through functioning…

Show Full Abstract

Endothelial-mesenchymal transition (EndoMT) plays a critical role in the dysfunction of the blood-brain barrier (BBB). Circular RNAs (circRNAs) function as crucial regulatory factors in EndoMT. Nevertheless, the underlying mechanisms of circRNA HECW2 (circ_HECW2, hsa_circ_0057583) in lipopolysaccharide (LPS)-induced EndoMT remain largely unclear. The levels of circ_HECW2, miR-30e-5p and neuronal growth regulator 1 (NEGR1) were detected by quantitative real-time polymerase chain reaction (qRT-PCR) or western blot. Ribonuclease (RNase) R and Actinomycin D assays were performed to validate the stability of circ_HECW2. Cell colony formation, proliferation and apoptosis were tested by a standard colony formation assay, the 3-(4,5-dimethylthiazol-2yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay and flow cytometry, respectively. Targeted relationships among circ_HECW2, miR-30e-5p and NEGR1 were verified by a dual-luciferase reporter assay. Our data indicated that LPS increased circ_HECW2 expression and reduced miR-30e-5p expression in human brain microvascular endothelial cells (HBMECs). Circ_HECW2 silencing promoted cell proliferation and suppressed cell apoptosis and EndoMT in LPS-treated HBMECs. Mechanistically, circ_HECW2 directly interacted with miR-30e-5p by binding to miR-30e-5p. MiR-30e-5p was a functional mediator of circ_HECW2 in regulating LPS-induced cell EndoMT. Furthermore, Circ_HECW2 regulated NEGR1 expression through functioning as a miR-30e-5p sponge. Moreover, miR-30e-5p overexpression repressed the EndoMT of LPS-treated HBMECs by targeting NEGR1. Collectively, our current study demonstrated that circ_HECW2 silencing suppressed LPS-triggered HBMEC EndoMT at least in part through the regulation of the miR-30e-5p/NEGR1 axis, illuminating a promising strategy for EndoMT inhibition.

Also flagged:Netrinmetamorphosisglutamate decarboxylasepeptideHpimmunoglobulin
Journal Article 2020-09-09 ✓ 5 Snippets Katow H, Abe K, Katow T, Yoshida H, Kiyomoto M.
In-Text Gene Mentions

…in colorectal cancer (DCC) receptor, along with…

…receptor, such asDCC, that in contrast…

…However, althoughDCChomologs are reported…

…of sea urchinDCChave been reported…

…receptors other thanDCC[ 39 ],…

Show Full Abstract

The GABAergic neural circuit is involved in the motile activities of both larval and juvenile sea urchins. Therefore, its function is inherited beyond metamorphosis, despite large scale remodeling of larval organs during that period. However, the initial neural circuit formation mechanism is not well understood, including how glutamate decarboxylase-expressing blastocoelar cells (GADCs) construct the neural circuit along the circumoral ciliary band (a ciliary band-associated strand, CBAS) on the larval body surface. In this study, using whole-mount immunohistochemistry and 3D reconstructed imaging, the ontogenic process of CBAS patterning was studied by focusing on Netrin and the interaction with its receptor, Unc-5. During the early 2-arm pluteus stage, a small number of GADCs egress onto the apical surface of the larval ectoderm. Then, they line up on the circumoral side of the ciliary band, and by being inserted by a further number of GADCs, form longer multicellular strands along the Netrin stripe. Application of a synthetic peptide, CRFNMELYKLSGRKSGGVC of Hp-Netrin, that binds to the immunoglobulin domain of Unc-5 during the prism stage, causes stunted CBAS formation due to inhibition of GADC egression. This also results in reduced ciliary beating. Thus, the Netrin/Unc-5 interaction is involved in the construction and function of the CBAS.

Also flagged:agenesis of the corpus callosumACCmetabolic diseasesCCEpilepsyimpairment
Journal Article 2020-09-09 ✓ 5 Snippets Hofman J, Hutny M, Sztuba K, Paprocka J.
In-Text Gene Mentions

DCCNetrin-1 Receptors in…

…TheDCCgene (18q21.2; MIM…

…mutations of theDCCgene result in…

…of NTN-1 toDCC.…

…missense mutations ofDCC, which are…

Show Full Abstract

Brain hemispheres are connected by commissural structures, which consist of white matter fiber tracts that spread excitatory stimuli to various regions of the cortex. This allows an interaction between the two cerebral halves. The largest commissure is the corpus callosum (CC) which is located inferior to the longitudinal fissure, serving as its lower border. Sometimes this structure is not completely developed, which results in the condition known as agenesis of the corpus callosum (ACC). The aim of this paper was to review the latest discoveries related to the genetic and metabolic background of ACC, including the genotype/phenotype correlations as well as the clinical and imaging symptomatology. Due to various factors, including genetic defects and metabolic diseases, the development of CC may be impaired in many ways, which results in complete or partial ACC. This creates several clinical implications, depending on the specificity of the malformation and other defects in patients. Epilepsy, motor impairment and intellectual disability are the most prevalent. However, an asymptomatic course of the disease is even more common. ACC presents with characteristic images on ultrasound and magnetic resonance imaging (MRI).

Also flagged:Gene ExpressiondopamineNrgnErcc2Otx2Six3
Journal Article 2020-09-09 No Snippets Redina O, Babenko V, Smagin D, Kovalenko I, Galyamina A, Efimov V, Kudryavtseva N.
Show Full Abstract

Daily agonistic interactions of mice are an effective experimental approach to elucidate the molecular mechanisms underlying the excitation of the brain neurons and the formation of alternative social behavior patterns. An RNA-Seq analysis was used to compare the ventral tegmental area (VTA) transcriptome profiles for three groups of male C57BL/6J mice: winners, a group of chronically winning mice, losers, a group of chronically defeated mice, and controls. The data obtained show that both winners and defeated mice experience stress, which however, has a more drastic effect on defeated animals causing more significant changes in the levels of gene transcription. Four genes (<i>Nrgn, Ercc2, Otx2</i>, and <i>Six3</i>) changed their VTA expression profiles in opposite directions in winners and defeated mice. It was first shown that <i>Nrgn</i> (neurogranin) expression was highly correlated with the expression of the genes involved in dopamine synthesis and transport (<i>Th, Ddc, Slc6a3</i>, and <i>Drd2</i>) in the VTA of defeated mice but not in winners. The obtained network of 31 coregulated genes, encoding proteins associated with nervous system development (including 24 genes associated with the generation of neurons), may be potentially useful for studying their role in the VTA dopaminergic neurons maturation under the influence of social stress.

Also flagged:Autophagymembranevesiclesautophagosomeslysosomesxenophagy
Journal Article 2020-09-09 No Snippets Reggio A, Buonomo V, Grumati P.
Show Full Abstract

Autophagy is an evolutionary conserved catabolic process devoted to the removal of unnecessary and harmful cellular components. In its general form, autophagy governs cellular lifecycle through the formation of double membrane vesicles, termed autophagosomes, that enwrap and deliver unwanted intracellular components to lysosomes. In addition to this omniscient role, forms of selective autophagy, relying on specialized receptors for cargo recognition, exert fine-tuned control over cellular homeostasis. In this regard, xenophagy plays a pivotal role in restricting the replication of intracellular pathogens, thus acting as an ancient innate defense system against infections. Recently, selective autophagy of the endoplasmic reticulum (ER), more simply ER-phagy, has been uncovered as a critical mechanism governing ER network shape and function. Six ER-resident proteins have been characterized as ER-phagy receptors and their orchestrated function enables ER homeostasis and turnover overtime. Unfortunately, ER is also the preferred site for viral replication and several viruses hijack ER machinery for their needs. Thus, it is not surprising that some ER-phagy receptors can act to counteract viral replication and minimize the spread of infection throughout the organism. On the other hand, evolutionary pressure has armed pathogens with strategies to evade and subvert xenophagy and ER-phagy. Although ER-phagy biology is still in its infancy, the present review aims to summarize recent ER-phagy literature, with a special focus on its role in counteracting viral infections. Moreover, we aim to offer some hints for future targeted approaches to counteract host-pathogen interactions by modulating xenophagy and ER-phagy pathways.

Also flagged:anemiacancerferric carboxymaltoseerythropoiesis-stimulatingHbC-reactive protein
Journal Article 2020-09-09 ✓ 1 Snippet Abdel-Razeq H, Saadeh SS, Malhis R, Yasser S, Abdulelah H, Eljaber R, Kleib A, Ismael R.
In-Text Gene Mentions

…family history ofhemochromatosis.…

Show Full Abstract

<h4>Background</h4>Anemia is commonly encountered in cancer patients receiving active chemotherapy. Due to adverse events and presumed negative effects on disease-progression and survival, erythropoiesis-stimulating agents are not frequently used. In this study, we assess the efficacy and safety of intravenous ferric carboxymaltose (FCM) to treat cancer-induced anemia (CIA).<h4>Patients and methods</h4>We recruited adult cancer patients on active chemotherapy with a hemoglobin (Hb) level ⩽11.0 g/dL. Based on serum ferritin (sFr) and transferrin saturation (TSAT), patients were divided into 3 groups: group I (absolute iron deficiency, <i>n</i> = 26) with sFr < 30 ng/mL and TSAT < 20%; group II (functional iron deficiency, <i>n</i> = 24) with sFr 30-800 ng/mL and TSAT < 20%; and patients with TSAT ⩾ 20% were placed in group III as "others" (<i>n</i> = 34). All patients were treated with intravenous FCM. Serum hepcidin and C-reactive protein were used as biomarkers to predict response.<h4>Results</h4>A total of 84 patients with a median age (SD) of 53.8 (10.6) were recruited. Baseline median Hb level was 10.2 (range: 8.3-11.0) gm/dL. At week 12, there was a significant increment in Hb level for patients in groups I and II (median increment: 2.35 and 1.5 gm/dL, respectively), with limited response observed in group III, and most of the increment noted as early as week 3 (⩾1.0 g/dL). Responders tended to have lower levels of hepcidin. No clinically significant adverse events were reported; however, asymptomatic hypophosphatemia was observed in 39 (46.4%) patients.<h4>Conclusions</h4>Intravenous FCM is a safe and effective treatment option for the management of a subgroup of patients with CIA.The study was registered at ClinicalTrials.gov [Identifier: NCT04246021].

Also flagged:brain atrophyHDcognitive impairmentdementiaPDatrophy
Journal Article 2020-09-09 ✓ 1 Snippet Martinez-Horta S, Sampedro F, Horta-Barba A, Perez-Perez J, Pagonabarraga J, Gomez-Anson B, Kulisevsky J.
In-Text Gene Mentions

…expansion on theHTTgene ( Walker,…

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD) is a fatal genetic neurodegenerative disorder with no effective treatment currently available. Progressive basal ganglia and whole-brain atrophy and concurrent cognitive deterioration are prototypical aspects of HD. However, the specific patterns of brain atrophy underlying cognitive impairment of different severity in HD are poorly understood. The aim of this study was to investigate the specific structural brain correlates of major cognitive deficits in HD and to explore its association with neuropsychological indicators.<h4>Participants</h4>Thirty-five symptomatic early-to-mild HD patients and 15 healthy controls (HC) with available T1-MRI imaging were included in this study.<h4>Methods</h4>In this cross-sectional study, HD patients were classified as patients with (HD-Dem) and without (HD-ND) major cognitive impairment in the range of dementia. This classification was based on previously validated PD-CRS cutoff scores for HD. Differences in brain atrophy across groups were studied by means of grey-matter volume voxel-based morphometry (GMV-VBM) and cortical thickness (Cth). Voxelwise and vertexwise general linear models were used to assess the group comparisons, controlling for the effects of age, sex, education, CAG repeat length and severity of motor symptoms. Clusters surviving p < 0.05 and family-wise error (FWE) correction were considered statistically significant. In order to characterize the impact on cognitive performance of the observed brain differences across groups, GMV and Cth values in the set of significant regions were computed and correlated with specific neuropsychological tests.<h4>Results</h4>All groups had similar sociodemographic profiles, and the HD groups did not significantly differ in terms of CAG repeat length. Compared to HC, both HD groups exhibited significant atrophy in multiple subcortical and parietal brain regions. However, compared to HC and HD-ND groups, HD-Dem patients showed a more prominent pattern of reduced GMV and cortical thinning. Importantly, this thinning was restricted to regions of the parietal-temporal and occipital cortices. Furthermore, these brain alterations were further associated with poorer cognitive performance in tasks assessing frontal-executive and attention domains as well as memory, language and constructional abilities.<h4>Conclusions</h4>Major cognitive impairment in the range of dementia in HD is associated with brain and cognitive alterations exceeding the prototypical frontal-executive deficits commonly recognized in HD. The observed posterior-cortical damage identified by MRI and its association with memory, language, and visuoconstructive dysfunction suggest a strong involvement of extra-striatal atrophy in the onset of severe cognitive dysfunction in HD patients. Critically, major cognitive impairment in this sample was not associated with CAG repeat length, age or education. This finding could support a possible involvement of additional neuropathological mechanisms aggravating cognitive deterioration in HD.

Also flagged:Ironoxygentranscription factorsmRNA-binding proteinmitochondrialiron deficiency
Journal Article 2020-09-09 ✓ 1 Snippet Ramos-Alonso L, Romero AM, Martínez-Pastor MT, Puig S.
In-Text Gene Mentions

…thies and encephalomyopathies,hemochromatosis, multiple mitochondrial dysfu…

Show Full Abstract

Iron is an essential micronutrient for all eukaryotic organisms because it participates as a redox cofactor in many cellular processes. However, excess iron can damage cells since it promotes the generation of reactive oxygen species. The budding yeast <i>Saccharomyces cerevisiae</i> has been used as a model organism to study the adaptation of eukaryotic cells to changes in iron availability. Upon iron deficiency, yeast utilizes two transcription factors, Aft1 and Aft2, to activate the expression of a set of genes known as the iron regulon, which are implicated in iron uptake, recycling and mobilization. Moreover, Aft1 and Aft2 activate the expression of Cth2, an mRNA-binding protein that limits the expression of genes encoding for iron-containing proteins or that participate in iron-using processes. Cth2 contributes to prioritize iron utilization in particular pathways over other highly iron-consuming and non-essential processes including mitochondrial respiration. Recent studies have revealed that iron deficiency also alters many other metabolic routes including amino acid and lipid synthesis, the mitochondrial retrograde response, transcription, translation and deoxyribonucleotide synthesis; and activates the DNA damage and general stress responses. At high iron levels, the yeast Yap5, Msn2, and Msn4 transcription factors activate the expression of a vacuolar iron importer called Ccc1, which is the most important high-iron protecting factor devoted to detoxify excess cytosolic iron that is stored into the vacuole for its mobilization upon scarcity. The complete sequencing and annotation of many yeast genomes is starting to unveil the diversity and evolution of the iron homeostasis network in this species.

Also flagged:immune responsestumorKSHV infectioncancerγ-Herpesvirus Infectionslymphomas
Journal Article 2020-09-09 ✓ 1 Snippet Münz C.
In-Text Gene Mentions

…by butyrophilin 2A1 (BTN2A1) prevent EBV associated…

Show Full Abstract

Mice with reconstituted human immune systems can mount cell-mediated immune responses against the human tumor viruses Epstein Barr virus (EBV) and Kaposi sarcoma associated herpesvirus (KSHV). Primarily cytotoxic lymphocytes protect the vast majority of persistently infected carriers of these tumor viruses from the respective malignancies for life. Thus, EBV and KSHV infection can teach us how this potent immune control is induced, what phenotype and functions characterize the protective lymphocyte compartments and if similar immune responses could be induced by vaccination. This review will summarize similarities and differences between EBV and KSHV associated pathologies and their immune control in patients and mice with reconstituted human immune systems. Furthermore, it will high-light which aspects of the near perfect immune control can be modeled in the latter preclinical animal models and discuss their relevance for cancer immunology in general.

Also flagged:AutophagydeathGolgi apparatusautophagy-related protein 9Golgiautophagosomes
Journal Article 2020-09-09 ✓ 1 Snippet Deng S, Liu J, Wu X, Lu W.
In-Text Gene Mentions

Huntington’s disease is characterized by a pathologic mutation consisting of an expanded CAG repeat in the huntingtin gene (HTT) on chromosome 4, encoding the huntingtin (htt) protein (Dayalu and Albin, 2015).

Show Full Abstract

Autophagy has dual effects in human diseases: appropriate autophagy may protect cells from stress, while excessive autophagy may cause cell death. Additionally, close interactions exist between autophagy and the Golgi. This review outlines recent advances regarding the role of the Golgi apparatus in autophagy. The signaling processes of autophagy are dependent on the normal function of the Golgi. Specifically, (i) autophagy-related protein 9 is mainly located in the Golgi and forms new autophagosomes in response to stressors; (ii) Golgi fragmentation is induced by Golgi-related proteins and accompanied with autophagy induction; and (iii) the endoplasmic reticulum-Golgi intermediate compartment and the reticular <i>trans</i>-Golgi network play essential roles in autophagosome formation to provide a template for lipidation of microtubule-associated protein 1A/1B-light chain 3 and induce further ubiquitination. Golgi-related proteins regulate formation of autophagosomes, and disrupted formation of autophagy can influence Golgi function. Notably, aberrant autophagy has been demonstrated to be implicated in neurological diseases. Thus, targeted therapies aimed at protecting the Golgi or regulating Golgi proteins might prevent or ameliorate autophagy-related neurological diseases. Further studies are needed to investigate the potential application of Golgi therapy in autophagy-based neurological diseases.

Also flagged:methylationpathogenesiscoronary artery diseaseGene expressionhistone H3RNA polymerase
Journal Article 2020-09-09 ✓ 1 Snippet Zhang X, Xiang Y, He D, Liang B, Wang C, Luo J, Zheng F.
In-Text Gene Mentions

…GRID2, GMNN, andMRPL39( Figures 4E,F…

Show Full Abstract

DNA methylation plays an essential role in the pathogenesis of coronary artery disease (CAD) through regulating mRNA expressions. This study aimed to identify hub genes regulated by DNA methylation as biomarkers of CAD. Gene expression and methylation datasets of peripheral blood leukocytes (PBLs) of CAD were downloaded from the Gene Expression Omnibus (GEO) database. Subsequently, multiple computational approaches were performed to analyze the regulatory networks and to recognize hub genes. Finally, top hub genes were verified in a case-control study, based on their differential expressions and methylation levels between CAD cases and controls. In total, 535 differentially expressed-methylated genes (DEMGs) were identified and partitioned into 4 subgroups. TSS200 and 5'UTR were confirmed as high enrichment areas of differentially methylated CpGs sites (DMCs). The function of DEMGs is enriched in processes of histone H3-K27 methylation, regulation of post-transcription and DNA-directed RNA polymerase activity. Pathway enrichment showed DEMGs participated in the VEGF signaling pathway, adipocytokine signaling pathway, and PI3K-Akt signaling pathway. Besides, expressions of hub genes fibronectin 1 (FN1), phosphatase (PTEN), and tensin homolog and RNA polymerase III subunit A (POLR3A) were discordantly expressed between CAD patients and controls and related with DNA methylation levels. In conclusion, our study identified the potential biomarkers of PBLs for CAD, in which FN1, PTEN, and POLR3A were confirmed.

Also flagged:Phosphonium Cationsmitochondriamitochondrialmembranephosphoniumcations
Journal Article 2020-09-09 No Snippets Pala L, Senn HM, Caldwell ST, Prime TA, Warrington S, Bright TP, Prag HA, Wilson C, Murphy MP, Hartley RC.
Show Full Abstract

There is considerable interest in developing drugs and probes targeted to mitochondria in order to understand and treat the many pathologies associated with mitochondrial dysfunction. The large membrane potential, negative inside, across the mitochondrial inner membrane enables delivery of molecules conjugated to lipophilic phosphonium cations to the organelle. Due to their combination of charge and hydrophobicity, quaternary triarylphosphonium cations rapidly cross biological membranes without the requirement for a carrier. Their extent of uptake is determined by the magnitude of the mitochondrial membrane potential, as described by the Nernst equation. To further enhance this uptake here we explored whether incorporation of a carboxylic acid into a quaternary triarylphosphonium cation would enhance its mitochondrial uptake in response to both the membrane potential and the mitochondrial pH gradient (alkaline inside). Accumulation of arylpropionic acid derivatives depended on both the membrane potential and the pH gradient. However, acetic or benzoic derivatives did not accumulate, due to their lowered pK<sub>a</sub>. Surprisingly, despite not being taken up by mitochondria, the phenylacetic or phenylbenzoic derivatives were not retained within mitochondria when generated within the mitochondrial matrix by hydrolysis of their cognate esters. Computational studies, supported by crystallography, showed that these molecules passed through the hydrophobic core of mitochondrial inner membrane as a neutral dimer. This finding extends our understanding of the mechanisms of membrane permeation of lipophilic cations and suggests future strategies to enhance drug and probe delivery to mitochondria.

Research Square 2020-09-09 Preprint (No Snippets API) Valette K, Li Z, Bon-Baret V, Chignon A, Bérubé J, Eslami A, Lamothe J, Gaudreault N, Joubert P, Obeidat M, Berge Mvd, Timens W, Sin D, Nickle D, Hao K, Labbé C, Godbout K, Côté A, Laviolette M, Boulet L, Mathieu P, Thériault S, Bossé Y.
Show Full Abstract

<title>Abstract</title> <p>To identify susceptibility loci and candidate causal genes of asthma, we performed a genome-wide association study (GWAS) in UK Biobank on a broad asthma definition (n = 56,167 asthma cases and 352,255 controls). We then carried out functional mapping through transcriptome-wide association studies (TWAS) and Mendelian randomization in lung (n = 1,038) and blood (n = 31,684) tissues. The GWAS revealed 72 asthma-associated loci from 116 independent significant variants (P<sub>GWAS</sub><5.0E-8). As expected, the yield of exonic variants associated with asthma was low, but nine were identified as potentially deleterious (CADD > 20) including a stop-gain mutation in the filaggrin (<italic>FLG</italic>) gene. The top lung TWAS gene on 17q12-q21 was <italic>GSDMB</italic> (P<sub>TWAS</sub>=1.42E-54). Other TWAS genes of interest include <italic>TSLP</italic> on 5q22, <italic>RERE</italic> on 1p36, <italic>CLEC16A</italic> on 16p13, and <italic>IL4R</italic> on 16p12, which all replicated in GTEx lung (n = 515). A novel risk locus was also revealed by the lung asthma TWAS on 1q23.3 with the putative gene encoding the gamma chain of the high-affinity IgE receptor (<italic>FCER1G</italic>, P<sub>TWAS</sub>=2.13E-6), which was also replicated in GTEx lung (P<sub>TWAS</sub>=3.71E-7). By testing a comprehensive set of cells and tissues, we then demonstrated that the largest fold enrichment of regulatory and functional annotations among asthma-associated variants was in the blood. We mapped 485 eQTL-regulated genes associated with asthma in the blood and 50 of them were shown to be causally associated with asthma by Mendelian randomization. Prioritization of druggable genes revealed known (<italic>IL4R</italic>, <italic>TSLP</italic>, <italic>IL6</italic>, <italic>TNFSF4</italic>) and potentially new therapeutic targets for asthma.</p>

Also flagged:GliomasTemozolomideCell Growthcancergliomarhodamine 123
Journal Article 2020-09-08 No Snippets Wang W, Han S, Gao W, Feng Y, Li K, Wu D.
Show Full Abstract

Many studies have found that the dysregulation of long noncoding RNA (lncRNA) contributed to cancer initiation, progression, and recurrence via multiple signaling pathways. However, the underlying mechanisms of lncRNA in temozolomide (TMZ)-resistant gliomas were not well understood, hindering the improvement of TMZ-based therapies. The present study demonstrated that the lncRNA KCNQ1OT1 increased in TMZ-resistant glioma cells compared to the TMZ-sensitive cells. The introduction of KCNQ1OT1 promoted cell viability, clonogenicity, and rhodamine 123 efflux while hampering TMZ-induced apoptosis. Moreover, KCNQ1OT1 directly sponged miR-761, which decreased in TMZ-resistant sublines. The overexpression of miR-761 attenuated cell viability and clonogenicity, while triggering apoptosis and rhodamine 123 accumulation post-TMZ exposure, leading to a response to TMZ. The interaction between miR-761 and 3'-untranslated region of PIM1 attenuated PIM1-mediated signaling cascades. Furthermore, the knockdown of KCNQ1OT1 augmented the TMZ-induced tumor regression in TMZ-resistant U251 mouse models. Briefly, the present study evaluated that KCNQ1OT1 conferred TMZ resistance by releasing PIM1 expression from miR-761, resulting in the upregulation of PIM-mediated MDR1, c-Myc, and Survivin. The present findings demonstrated that the interplay of KCNQ1OT1: miR-761: PIM1 regulated chemoresistance in gliomas and provided a promising therapeutic target for TMZ-resistant glioma patients.

Also flagged:Malariasurfaceanion channelsynthesismembranegreen fluorescent protein
Journal Article 2020-09-08 No Snippets Ahmad M, Manzella-Lapeira J, Saggu G, Ito D, Brzostowski JA, Desai SA.
Show Full Abstract

Malaria parasites increase their host erythrocyte's permeability to various nutrients, fueling intracellular pathogen development and replication. The plasmodial surface anion channel (PSAC) mediates this uptake and is linked to the parasite-encoded RhopH complex, consisting of CLAG3, RhopH2, and RhopH3. While interactions between these subunits are well established, it is not clear whether they remain associated from their synthesis in developing merozoites through erythrocyte invasion and trafficking to the host membrane. Here, we explored protein-protein interactions between RhopH subunits using live-cell imaging and Förster resonance energy transfer (FRET) experiments. Using the green fluorescent protein (GFP) derivatives mCerulean and mVenus, we generated single- and double-tagged parasite lines for fluorescence measurements. While CLAG3-mCerulean served as an efficient FRET donor for RhopH2-mVenus within rhoptry organelles, mCerulean targeted to this organelle via a short signal sequence produced negligible FRET. Upon merozoite egress and reinvasion, these tagged RhopH subunits were deposited into the new host cell's parasitophorous vacuole; these proteins were then exported and trafficked to the erythrocyte membrane, where CLAG3 and RhopH2 remained fully associated. Fluorescence intensity measurements identified stoichiometric increases in exported RhopH protein when erythrocytes are infected with two parasites; whole-cell patch-clamp revealed a concomitant increase in PSAC functional copy number and a dose effect for RhopH contribution to ion and nutrient permeability. These studies establish live-cell FRET imaging in human malaria parasites, reveal that RhopH subunits traffic to their host membrane destination without dissociation, and suggest quantitative contribution to PSAC formation.<b>IMPORTANCE</b> Malaria parasites grow within circulating red blood cells and uptake nutrients through a pore on their host membrane. Here, we used gene editing to tag CLAG3 and RhopH2, two proteins linked to the nutrient pore, with fluorescent markers and tracked these proteins in living infected cells. After their synthesis in mature parasites, imaging showed that both proteins are packaged into membrane-bound rhoptries. When parasites ruptured their host cells and invaded new red blood cells, these proteins were detected within a vacuole around the parasite before they migrated and inserted in the surface membrane of the host cell. Using simultaneous labeling of CLAG3 and RhopH2, we determined that these proteins interact tightly during migration and after surface membrane insertion. Red blood cells infected with two parasites had twice the protein at their surface and a parallel increase in the number of nutrient pores. Our work suggests that these proteins directly facilitate parasite nutrient uptake from human plasma.

Also flagged:HDAC3mismatch repair factorTrinucleotideneurological diseasesMsh2Msh3
Journal Article 2020-09-08 ✓ 2 Snippets Williams GM, Paschalis V, Ortega J, Muskett FW, Hodgkinson JT, Li GM, Schwabe JWR, Lahue RS.
In-Text Gene Mentions

This idea is further supported by studies in HD mice, where treatment with the HDAC3-selective inhibitor RGFP966 significantly reduced striatal CAG repeat expansions in the HTT gene (53).

Direct activation of MutSβ by HDAC3 also provides a mechanistic explanation for how RGFP966 treatment of HD mice suppressed striatal instability in the HTT CAG repeat (53).

Show Full Abstract

Trinucleotide repeat (TNR) expansions cause nearly 20 severe human neurological diseases which are currently untreatable. For some of these diseases, ongoing somatic expansions accelerate disease progression and may influence age of onset. This new knowledge emphasizes the importance of understanding the protein factors that drive expansions. Recent genetic evidence indicates that the mismatch repair factor MutSβ (Msh2-Msh3 complex) and the histone deacetylase HDAC3 function in the same pathway to drive triplet repeat expansions. Here we tested the hypothesis that HDAC3 deacetylates MutSβ and thereby activates it to drive expansions. The HDAC3-selective inhibitor RGFP966 was used to examine its biological and biochemical consequences in human tissue culture cells. HDAC3 inhibition efficiently suppresses repeat expansion without impeding canonical mismatch repair activity. Five key lysine residues in Msh3 are direct targets of HDAC3 deacetylation. In cells expressing Msh3 in which these lysine residues are mutated to arginine, the inhibitory effect of RGFP966 on expansions is largely bypassed, consistent with the direct deacetylation hypothesis. RGFP966 treatment does not alter MutSβ subunit abundance or complex formation but does partially control its subcellular localization. Deacetylation sites in Msh3 overlap a nuclear localization signal, and we show that localization of MutSβ is partially dependent on HDAC3 activity. Together, these results indicate that MutSβ is a key target of HDAC3 deacetylation and provide insights into an innovative regulatory mechanism for triplet repeat expansions. The results suggest expansion activity may be druggable and support HDAC3-selective inhibition as an attractive therapy in some triplet repeat expansion diseases.

Also flagged:RKIPpathogenesisatherosclerosisgoutmetabolic disordersRaf kinase inhibitor
Journal Article 2020-09-08 No Snippets Qin Q, Liu H, Shou J, Jiang Y, Yu H, Wang X.
Show Full Abstract

Aberrant inflammasome activation contributes to the pathogenesis of various human diseases, including atherosclerosis, gout, and metabolic disorders. Elucidation of the underlying mechanism involved in the negative regulation of the inflammasome is important for developing new therapeutic targets for these diseases. Here, we showed that Raf kinase inhibitor protein (RKIP) negatively regulates the activation of the NLRP1, NLRP3, and NLRC4 inflammasomes. RKIP deficiency enhanced caspase-1 activation and IL-1β secretion via NLRP1, NLRP3, and NLRC4 inflammasome activation in primary macrophages. The overexpression of RKIP in THP-1 cells inhibited NLRP1, NLRP3, and NLRC4 inflammasome activation. RKIP-deficient mice showed increased sensitivity to Alum-induced peritonitis and Salmonella typhimurium-induced inflammation, indicating that RKIP inhibits NLRP3 and NLRC4 inflammasome activation in vivo. Mechanistically, RKIP directly binds to apoptosis-associated speck-like protein containing a caspase-recruitment domain (ASC) and competes with NLRP1, NLRP3, or NLRC4 to interact with ASC, thus interrupting inflammasome assembly and activation. The depletion of RKIP aggravated inflammasome-related diseases such as monosodium urate (MSU)-induced gouty arthritis and high-fat diet (HFD)-induced metabolic disorders. Furthermore, the expression of RKIP was substantially downregulated in patients with gouty arthritis or type 2 diabetes (T2D) compared to healthy controls. Collectively, our findings suggest that RKIP negatively regulates NLRP1, NLRP3, and NLRC4 inflammasome activation and is a potential therapeutic target for the treatment of inflammasome-related diseases.

Also flagged:breast cancerMale Breast CancerBRCA1BRCA2BRCAamino-acids
Journal Article 2020-09-08 ✓ 1 Snippet Ben Kridis-Rejeb W, Ben Ayed-Guerfali D, Ammous-Boukhris N, Ayadi W, Kifagi C, Charfi S, Saguem I, Sellami-Boudawara T, Daoud J, Khanfir A, Mokdad-Gargouri R.
In-Text Gene Mentions

…candidate genes (MSH5,DCC, ERBB3, NOTCH3, DIAPH1,…

Show Full Abstract

Male Breast Cancer (MBC) is a rare and aggressive disease that is associated with genetic factors. Mutations in BRCA1 and BRCA2 account for 10% of all MBC cases suggesting that other genetic factors are involved. The aim of the present study is to screen whole BRCA1 and BRCA2 exons using the Ampliseq BRCA panel in Tunisian MBC patients with family history. Furthermore, we performed exome sequencing using the TruSight One sequencing panel on an early onset BRCA negative patient. We showed that among the 6 MBC patients, only one (MBC-F1) harbored a novel frameshift mutation in exon 2 of the BRCA2 gene (c.17-20delAAGA, p.Lys6Xfs) resulting in a short BRCA2 protein of only 6 amino-acids. We selected 9 rare variants after applying several filter steps on the exome sequencing data. Among these variants, and based on their role in breast carcinogenesis, we retained 6 candidate genes (MSH5, DCC, ERBB3, NOTCH3, DIAPH1, and DNAH11). Further studies are needed to confirm the association of the selected genes with family MBC.

Also flagged:AnthocyaninsGastrointestinal Cancerspolyphenolschronic disordersanthocyaningene expression
Journal Article 2020-09-08 No Snippets Dharmawansa KVS, Hoskin DW, Rupasinghe HPV.
Show Full Abstract

Anthocyanins are a group of dietary polyphenols, abundant mainly in fruits and their products. Dietary interventions of anthocyanins are being studied extensively related to the prevention of gastrointestinal (GI) cancer, among many other chronic disorders. This review summarizes the hereditary and non-hereditary characteristics of GI cancers, chemistry, and bioavailability of anthocyanins, and the most recent findings of anthocyanin in GI cancer prevention through modulating cellular signaling pathways. GI cancer-preventive attributes of anthocyanins are primarily due to their antioxidative, anti-inflammatory, and anti-proliferative properties, and their ability to regulate gene expression and metabolic pathways, as well as induce the apoptosis of cancer cells.

Also flagged:Colon CancerB4GALNT2biosynthesisfucosyltransferase 6FUT6primary tumor
Journal Article 2020-09-08 No Snippets Pucci M, Gomes Ferreira I, Malagolini N, Ferracin M, Dall'Olio F.
Show Full Abstract

<h4>Background</h4>The Sd<sup>a</sup> antigen and its biosynthetic enzyme B4GALNT2 are highly expressed in healthy colon but undergo a variable down-regulation in colon cancer. The biosynthesis of the malignancy-associated sialyl Lewis x (sLe<sup>x</sup>) antigen in normal and cancerous colon is mediated by fucosyltransferase 6 (FUT6) and is mutually exclusive from that of Sd<sup>a</sup>. It is thought that the reduced malignancy associated with high B4GALNT2 was due to sLe<sup>x</sup> inhibition.<h4>Methods</h4>We transfected the cell lines SW480 and SW620, derived respectively from a primary tumor and a metastasis of the same patient, with the cDNAs of FUT6 or B4GALNT2, generating cell variants expressing either the sLe<sup>x</sup> or the Sd<sup>a</sup> antigens. Transfectants were analyzed for growth in poor adherence, wound healing, stemness and gene expression profile.<h4>Results</h4>B4GALNT2/Sd<sup>a</sup> expression down-regulated all malignancy-associated phenotypes in SW620 but only those associated with stemness in SW480. FUT6/sLe<sup>x</sup> enhanced some malignancy-associated phenotypes in SW620, but had little effect in SW480. The impact on the transcriptome was stronger for FUT6 than for B4GALNT2 and only partially overlapping between SW480 and SW620.<h4>Conclusions</h4>B4GALNT2/Sd<sup>a</sup> inhibits the stemness-associated malignant phenotype, independently of sLe<sup>x</sup> inhibition. The impact of glycosyltransferases on the phenotype and the transcriptome is highly cell-line specific.

Also flagged:MetforminCancerAMPKPrenylationColorectal CancerAMP-activated protein kinase
Journal Article 2020-09-08 ✓ 1 Snippet Seo Y, Kim J, Park SJ, Park JJ, Cheon JH, Kim WH, Kim TI.
In-Text Gene Mentions

…Lgr5, ASCL2, EPHB3,OLFM4, BMI1, Lrig1, TERT,…

Show Full Abstract

Metformin is a well-known AMPK (AMP-activated protein kinase) activator that suppresses cancer stem cells (CSCs) in some cancers. However, the mechanisms of the CSC-suppressing effects of metformin are not yet well understood. In this study, we investigated the CSC-suppressive effect of metformin via the mevalonate (MVA) pathway in colorectal cancer (CRC). Two colorectal cancer cell lines, HT29 and DLD-1 cells, were treated with metformin, mevalonate, or a combination of the two. We measured CSC populations by flow cytometric analysis (CD44+/CD133+) and by tumor spheroid growth. The expression of p-AMPK, mTORC1 (pS6), and key enzymes (HMGCR, FDPS, GGPS1, and SQLE) of the MVA pathway was also analyzed. We investigated the effects of metformin and/or mevalonate in xenograft mice using HT29 cells; immunohistochemical staining for CSC markers and key enzymes of the MVA pathway in tumor xenografts was performed. In both HT29 and DLD-1 cells, the CSC population was significantly decreased following treatment with metformin, AMPK activator (AICAR), HMG-CoA reductase inhibitor (simvastatin), or mTOR inhibitor (rapamycin), and was increased by mevalonate. The CSC-suppressing effect of these drugs was attenuated by mevalonate. The results of tumor spheroid growth matched those of the CSC population experiments. Metformin treatment increased p-AMPK and decreased mTOR (pS6) expression; these effects were reversed by addition of mevalonate. The expression of key MVA pathway enzymes was significantly increased in tumor spheroid culture, and by addition of mevalonate, and decreased upon treatment with metformin, AICAR, or rapamycin. In xenograft experiments, tumor growth and CSC populations were significantly reduced by metformin, and this inhibitory effect of metformin was abrogated by combined treatment with mevalonate. Furthermore, in the MVA pathway, CSC populations were reduced by inhibition of protein prenylation with a farnesyl transferase inhibitor (FTI-277) or a geranylgeranyl transferase inhibitor (GGTI-298), but not by inhibition of cholesterol synthesis with a squalene synthase inhibitor (YM-53601). In conclusion, the CSC-suppressive effect of metformin was associated with AMPK activation and repression of protein prenylation through MVA pathway suppression in colorectal cancer.

Also flagged:COVID-19infectious diseasesinfectionszincironcopper
Journal Article 2020-09-08 No Snippets Galmés S, Serra F, Palou A.
Show Full Abstract

The pandemic caused by the new coronavirus has caused shock waves in many countries, producing a global health crisis worldwide. Lack of knowledge of the biological mechanisms of viruses, plus the absence of effective treatments against the disease (COVID-19) and/or vaccines have pulled factors that can compromise the proper functioning of the immune system to fight against infectious diseases into the spotlight. The optimal status of specific nutrients is considered crucial to keeping immune components within their normal activity, helping to avoid and overcome infections. Specifically, the European Food Safety Authority (EFSA) evaluated and deems six vitamins (D, A, C, Folate, B<sub>6</sub>, B<sub>12</sub>) and four minerals (zinc, iron, copper and selenium) to be essential for the normal functioning of the immune system, due to the scientific evidence collected so far. In this report, an update on the evidence of the contribution of nutritional factors as immune-enhancing aspects, factors that could reduce their bioavailability, and the role of the optimal status of these nutrients within the COVID-19 pandemic context was carried out. First, a non-systematic review of the current state of knowledge regarding the impact of an optimal nutritional status of these nutrients on the proper functioning of the immune system as well as their potential role in COVID-19 prevention/treatment was carried out by searching for available scientific evidence in PubMed and LitCovid databases. Second, a compilation from published sources and an analysis of nutritional data from 10 European countries was performed, and the relationship between country nutritional status and epidemiological COVID-19 data (available in the Worldometers database) was evaluated following an ecological study design. Furthermore, the potential effect of genetics was considered through the selection of genetic variants previously identified in Genome-Wide Association studies (GWAs) as influencing the nutritional status of these 10 considered nutrients. Therefore, access to genetic information in accessible databases (1000genomes, by Ensembl) of individuals from European populations enabled an approximation that countries might present a greater risk of suboptimal status of the nutrients studied. Results from the review approach show the importance of maintaining a correct nutritional status of these 10 nutrients analyzed for the health of the immune system, highlighting the importance of Vitamin D and iron in the context of COVID-19. Besides, the ecological study demonstrates that intake levels of relevant micronutrients-especially Vitamins D, C, B<sub>12</sub>, and iron-are inversely associated with higher COVID-19 incidence and/or mortality, particularly in populations genetically predisposed to show lower micronutrient status. In conclusion, nutrigenetic data provided by joint assessment of 10 essential nutrients for the functioning of the immune system and of the genetic factors that can limit their bioavailability can be a fundamental tool to help strengthen the immune system of individuals and prepare populations to fight against infectious diseases such as COVID-19.

Also flagged:histone H3lysinemethylationSET1gene expressionchromatin
Journal Article 2020-09-08 ✓ 3 Snippets Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
In-Text Gene Mentions

CondensinRNAi Knockdown…

…Germline Expression ofCondensins, Topoisomerase, or Other…

Condensinsubunits, topoisomerase, and…

Show Full Abstract

Deposition of histone H3 lysine 4 (H3K4) methylation at promoters is catalyzed by the SET1/COMPASS complex and is associated with context-dependent effects on gene expression and local changes in chromatin organization. The role of SET1/COMPASS in shaping chromosome architecture has not been investigated. Here we used <i>Caenorhabditis elegans</i> to address this question through a live imaging approach and genetic analysis. Using quantitative FRET (Förster resonance energy transfer)-based fluorescence lifetime imaging microscopy (FLIM) on germ cells expressing histones eGFP-H2B and mCherry-H2B, we find that SET1/COMPASS influences meiotic chromosome organization, with marked effects on the close proximity between nucleosomes. We further show that inactivation of <i>set-2</i>, encoding the <i>C. elegans</i> SET1 homologue, or CFP-1, encoding the chromatin targeting subunit of COMPASS, enhances germline chromosome organization defects and sterility of condensin-II depleted animals. <i>set-2</i> loss also aggravates germline defects resulting from conditional inactivation of topoisomerase II, another structural component of chromosomes. Expression profiling of <i>set-2</i> mutant germlines revealed only minor transcriptional changes, suggesting that the observed effects are at least partly independent of transcription. Altogether, our results are consistent with a role for SET1/COMPASS in shaping meiotic chromosomes in <i>C. elegans</i>, together with the non-histone proteins condensin-II and topoisomerase. Given the high degree of conservation, our findings expand the range of functions attributed to COMPASS and suggest a broader role in genome organization in different species.

Also flagged:IronHomeostasiswound healingcancerocular diseasesextracellular
Journal Article 2020-09-08 ✓ 1 Snippet Bosseboeuf E, Raimondi C.
In-Text Gene Mentions

In mice Hfe-KO model of HH, endothelial-specific BMP2-KO, involved in the feedback mechanism of iron signalling, enhances the hemochromatosis phenotype [254], highlighting the role of iron in HH endothelial dysfunction.

Show Full Abstract

Endothelial cells drive the formation of new blood vessels in physiological and pathological contexts such as embryonic development, wound healing, cancer and ocular diseases. Once formed, all vessels of the vasculature system present an endothelial monolayer (the endothelium), lining the luminal wall of the vessels, that regulates gas and nutrient exchange between the circulating blood and tissues, contributing to maintaining tissue and vascular homeostasis. To perform their functions, endothelial cells integrate signalling pathways promoted by growth factors, cytokines, extracellular matrix components and signals from mechanosensory complexes sensing the blood flow. New evidence shows that endothelial cells rely on specific metabolic pathways for distinct cellular functions and that the integration of signalling and metabolic pathways regulates endothelial-dependent processes such as angiogenesis and vascular homeostasis. In this review, we provide an overview of endothelial functions and the recent advances in understanding the role of endothelial signalling and metabolism in physiological processes such as angiogenesis and vascular homeostasis and vascular diseases. Also, we focus on the signalling pathways promoted by the transmembrane protein Neuropilin-1 (NRP1) in endothelial cells, its recently discovered role in regulating mitochondrial function and iron homeostasis and the role of mitochondrial dysfunction and iron in atherosclerosis and neurodegenerative diseases.

Also flagged:tissue regenerationbutylene succinatepoly (l-lactic acidhydroxyapatitecell adhesionpolyesters
Journal Article 2020-09-08 No Snippets Khan MA, Hussain Z, Liaqat U, Liaqat MA, Zahoor M.
Show Full Abstract

The use of biodegradable polymeric scaffolds for tissue regeneration is becoming a common practice in the clinic. Therefore, an inclined trend is developing with regards to improving the mechanical properties of these scaffolds. Here, we aim to improve the mechanical properties of poly (butylene succinate) (PBS)/poly (l-lactic acid) (PLLA) blends by incorporating hydroxyapatite nanoparticles (HAP) in the blends to form composites. PBS/PLLA = 100/0, 95/5, 90/10, 85/15, and 0/100 wt% blends, along-with the loadings of a few mg of HAPs, were prepared using the solution casting method. A scanning electron microscope showed the voids and droplets, indicating the immiscibility of blends. Due to this immiscibility, the tensile strength values of the blends were found to be in between that of pure PBS (42.85 MPa) and pure PLLA (31.39 MPa). HAPs act as a compatibilizer by incorporating themselves in the voids and spaces caused by the immiscibility, thus increasing the overall tensile strength of the resulting composite to a certain extent, e.g., the tensile strength of PBS/PLLA = 95/5 loaded with 50 mg HAPs was found to be 51.16 MPa. The structural analysis employing the X-ray diffraction (XRD) patterns confirmed the formation of polymer blends and composites. The contact angle analysis showed that the addition of HAPs increased the hydrophilicity of the resulting composites. Selective samples were investigated based on mechanical properties to see if the blends and composites are biocompatible. The obtained results showed that all of the samples with better mechanical properties demonstrated good biocompatibility. This indicates the effectiveness of scaffolds for tissue regeneration.

Also flagged:corticosteroidasthmanitric oxidesteroidscorticosteroidseosinophilia
Journal Article 2020-09-08 No Snippets Heaney LG, Busby J, Hanratty CE, Djukanovic R, Woodcock A, Walker SM, Hardman TC, Arron JR, Choy DF, Bradding P, Brightling CE, Chaudhuri R, Cowan DC, Mansur AH, Fowler SJ, Niven RM, Howarth PH, Lordan JL, Menzies-Gow A, Harrison TW, Robinson DS, Holweg CTJ, Matthews JG, Pavord ID, investigators for the MRC Refractory Asthma Stratification Programme.
Show Full Abstract

<h4>Background</h4>Asthma treatment guidelines recommend increasing corticosteroid dose to control symptoms and reduce exacerbations. This approach is potentially flawed because symptomatic asthma can occur without corticosteroid responsive type-2 (T2)-driven eosinophilic inflammation, and inappropriately high-dose corticosteroid treatment might have little therapeutic benefit with increased risk of side-effects. We compared a biomarker strategy to adjust corticosteroid dose using a composite score of T2 biomarkers (fractional exhaled nitric oxide [FENO], blood eosinophils, and serum periostin) with a standardised symptom-risk-based algorithm (control).<h4>Methods</h4>We did a single-blind, parallel group, randomised controlled trial in adults (18-80 years of age) with severe asthma (at treatment steps 4 and 5 of the Global Initiative for Asthma) and FENO of less than 45 parts per billion at 12 specialist severe asthma centres across England, Scotland, and Northern Ireland. Patients were randomly assigned (4:1) to either the biomarker strategy group or the control group by an online electronic case-report form, in blocks of ten, stratified by asthma control and use of rescue systemic steroids in the previous year. Patients were masked to study group allocation throughout the entirety of the study. Patients attended clinic every 8 weeks, with treatment adjustment following automated treatment-group-specific algorithms: those in the biomarker strategy group received a default advisory to maintain treatment and those in the control group had their treatment adjusted according to the steps indicated by the trial algorithm. The primary outcome was the proportion of patients with corticosteroid dose reduction at week 48, in the intention-to-treat (ITT) population. Secondary outcomes were inhaled corticosteroid (ICS) dose at the end of the study; cumulative dose of ICS during the study; proportion of patients on maintenance oral corticosteroids (OCS) at study end; rate of protocol-defined severe exacerbations per patient year; time to first severe exacerbation; number of hospital admissions for asthma; changes in lung function, Asthma Control Questionnaire-7 score, Asthma Quality of Life Questionnaire score, and T2 biomarkers from baseline to week 48; and whether patients declined to progress to OCS. A secondary aim of our study was to establish the proportion of patients with severe asthma in whom T2 biomarkers remained low when corticosteroid therapy was decreased to a minimum ICS dose. This study is registered with ClinicalTrials.gov, NCT02717689 and has been completed.<h4>Findings</h4>Patients were recruited from Jan 8, 2016, to July 12, 2018. Of 549 patients assessed, 301 patients were included in the ITT population and were randomly assigned to the biomarker strategy group (n=240) or to the control group (n=61). 28·4% of patients in the biomarker strategy group were on a lower corticosteroid dose at week 48 compared with 18·5% of patients in the control group (adjusted odds ratio [aOR] 1·71 [95% CI 0·80-3·63]; p=0·17). In the per-protocol (PP) population (n=121), a significantly greater proportion of patients were on a lower corticosteroid dose at week 48 in the biomarker strategy group (30·7% of patients) compared with the control group (5·0% of patients; aOR 11·48 [95% CI 1·35-97·83]; p=0·026). Patient choice to not follow treatment advice was the principle reason for loss to PP analysis. There was no difference in secondary outcomes between study groups and no loss of asthma control among patients in the biomarker strategy group who reduced their corticosteroid dose.<h4>Interpretation</h4>Biomarker-based corticosteroid adjustment did not result in a greater proportion of patients reducing corticosteroid dose versus control. Understanding the reasons for patients not following treatment advice in both treatment strategies is an important area for future research. The prevalence of T2 biomarker-low severe asthma was low.<h4>Funding</h4>This study was funded, in part, by the Medical Research Council UK.

Also flagged:angiotensin-converting enzyme 2ACE2lung cancerCOVID-192 infection-2 infection
Journal Article 2020-09-08 ✓ 1 Snippet Samad A, Jafar T, Rafi JH.
In-Text Gene Mentions

…(PI3), olfactomedin 4 (OLFM4), galectin 4 (LGALS4),…

Show Full Abstract

COVID-19 is a pandemic that began to spread worldwide caused by SARS-CoV-2. Lung cancer patients are more susceptible to SARS-CoV-2 infection. The SARS-CoV-2 enters into the host by the ACE2 receptor. Thus, ACE2 is the key to understand the mechanism of SARS-CoV-2 infection. However, the lack of knowledge about the biomarker of COVID-19 warrants the development of ACE2 biomarkers. The analysis of ACE2 expression in lung cancer was performed using The Cancer Genome Atlas (TCGA). Therefore, we investigated the prognosis, clinical characteristics, and mutational analysis of lung cancer. We also analyzed the shared proteins between the COVID-19 and lung cancer, protein-protein interactions, gene-miRNAs, gene-transcription factors (TFs), and the signaling pathway. Finally, we compared the mRNA expression of ACE2 and its co-expressed proteins using the TCGA. The up-regulation of ACE2 in lung adenocarcinoma (LUAD) and lung squamous carcinoma (LUSC) was found irrespective of gender and age. We found the low survival rate in high expression of ACE2 in lung cancer patients and 16 mutational positions. The functional assessment of targeted 12,671, 3107, and 29 positive genes were found in COVID-19 disease, LUAD, and LUSC, respectively. Then, we identified eight common genes that interact with 20 genes, 219 miRNAs, and 16 TFs. The common genes performed the mRNA expression in lung cancer, which proved the ACE2 is the best potential biomarker compared to co-expressed genes. This study uncovers the relationship between COVID-19 disease and lung cancer. We identified ACE2 and also its co-expressed proteins are the potential biomarker and therapy as the current COVID-19 disease and lung cancer.

Also flagged:insulinIGF-1tumorinfectioninsulin-like growth factor-1osteogenesis
Journal Article 2020-09-08 No Snippets Zhang X, Xing H, Qi F, Liu H, Gao L, Wang X.
Show Full Abstract

Bone defects caused by trauma, tumor resection, congenital malformation and infection are still a major challenge for clinicians. Biomimetic bone materials have attracted more and more attention in science and industry. Insulin and insulin-like growth factor-1 (IGF-1) have been increasingly recognized as an inducible factor for osteogenesis and angiogenesis. Spatiotemporal release of insulin may serve as the promising strategy. Considering the successful application of nanoparticles in drug loading, various insulin delivery systems have been developed, including (poly (lactic-co-glycolic acid), PLGA), hydroxyapatite (HA), gelatin, chitosan, alginate, and (γ-glutamic acid)/β-tricalcium phosphate, γ-PGA/β-TCP). Here, we have reviewed the progress on nanoparticles carrying insulin/IGF for bone regeneration. In addition, the key regulatory mechanism of insulin in bone regeneration is also summarized. The future application strategies and the challenges in bone regeneration are also discussed.

Also flagged:ADAMTS18Stomach adenocarcinomaSTADgastric cancerADAM metallopeptidase with thrombospondin type 1 motif 18organ development
Journal Article 2020-09-08 ✓ 1 Snippet Jiang K, Li L, Xie Y, Xie D, Xiao Q.
In-Text Gene Mentions

…with FAM218A, ATP8A2,ANKRD45, SRPK2, CHD7, RAB9B…

Show Full Abstract

Stomach adenocarcinoma (STAD) is the most pathological type of gastric cancer. ADAM metallopeptidase with thrombospondin type 1 motif 18 (ADAMTS18) plays an essential role in organ development and tumorigenesis; however, its function in STAD, and its impact on clinical outcome remain unclear. Thus, the present study aimed to investigate the association between ADAMTS18 expression and the prognosis of patients with STAD. Data from 300 patients with STAD in The Cancer Genome Atlas (TCGA) database were analyzed, and the median survival time and overall survival (OS) rate of these patients were assessed. Subsequently, 40 paired tumor and non-tumor tissue samples from patients with STAD were collected, and the relative ADAMTS18 mRNA expression levels were determined. Results from TCGA database demonstrated that high tumor ADAMTS18 expression was associated with a poorer prognosis in patients with STAD. Similarly, results from the assessed patient cohort indicated that ADAMTS18 expression was significantly higher in STAD tissues compared with non-tumor tissues. Furthermore, ADAMTS18 expression was significantly associated with tumor differentiation, lymph node metastasis and tumor node metastasis stage. Taken together, these results suggest that ADAMTS18 is highly expressed in STAD tissues, and thus may act as a potential indicator of poor prognosis in patients with STAD.

Also flagged:SialadenitisiodineLudwig's anginaangioedemaiodideiodide mumps
Journal Article 2020-09-08 ✓ 1 Snippet Park KW, Han AY, Kim CM, Tam K, Chhetri DK.
In-Text Gene Mentions

…a history ofhemochromatosisstatus postorthotopic liver…

Show Full Abstract

Contrast-induced sialadenitis (CIS) is a rare, delayed pseudoallergic reaction from iodine containing contrast. Previously reported cases of CIS demonstrated that the two major salivary glands (parotid and submandibular) can be affected. The initial encounter of this entity can raise alarms to physicians as the differential diagnoses include serious infectious and inflammatory conditions such as Ludwig's angina and angioedema. Subsequently, it may lead to unnecessary testing and increased healthcare cost. Here we present a 60-year-old male who presented with bilateral sublingual gland swelling following exposure to iodinated contrast. With timely diagnosis by the otolaryngologist, the patient received conservative management that led to a full resolution within a few days. To date, this is the first case of CIS only involving the sublingual glands. We conclude that CIS can involve any of the major salivary glands.

Also flagged:p38MAP KinasesMitogen-activated protein (MAP) kinasesp38 kinasesphosphorylationanxiety
Journal Article 2020-09-08 ✓ 2 Snippets Asih PR, Prikas E, Stefanoska K, Tan ARP, Ahel HI, Ittner A.
In-Text Gene Mentions

Poly-glutamine Htt activates p38 MAPK kinase (Taylor et al., 2013), yet conflicting evidence suggests mutant Htt activates ERK MAP kinase rather than JNK or p38 MAP kinases (Apostol et al., 2006).

Huntingtin (Htt) poly-glutamine expansion is a hallmark of Huntington’s disease (Scherzinger et al., 1997).

Show Full Abstract

Mitogen-activated protein (MAP) kinases are a central component in signaling networks in a multitude of mammalian cell types. This review covers recent advances on specific functions of p38 MAP kinases in cells of the central nervous system. Unique and specific functions of the four mammalian p38 kinases are found in all major cell types in the brain. Mechanisms of p38 activation and downstream phosphorylation substrates in these different contexts are outlined and how they contribute to functions of p38 in physiological and under disease conditions. Results in different model organisms demonstrated that p38 kinases are involved in cognitive functions, including functions related to anxiety, addiction behavior, neurotoxicity, neurodegeneration, and decision making. Finally, the role of p38 kinases in psychiatric and neurological conditions and the current progress on therapeutic inhibitors targeting p38 kinases are covered and implicate p38 kinases in a multitude of CNS-related physiological and disease states.

Also flagged:ProthrombinCoagulopathyEnd-Stage Liver Diseaseprothrombin complexwarfarindeep venous thrombosis
Journal Article 2020-09-08 ✓ 1 Snippet Marshall SV, Noble J, Flores AS.
In-Text Gene Mentions

…proteins C&S andATIIIare also decreased…

Show Full Abstract

Suggested treatment for active bleeding or invasive procedure prophylaxis has been described in the setting of end-stage liver disease (ESLD) in patients not receiving anticoagulation, and has included fresh frozen plasma (FFP), prothrombin complex concentrates (PCC), platelets, and cryoprecipitate. Today, the therapy for pharmacologically anticoagulated patients with ESLD presenting for liver transplant surgery remains controversial, poorly studied, and physician-dependent. We observed a variety of treatments administered at initiation of liver transplantation to correct acquired coagulopathy at our leading transplant center and present these cases. Three patients receiving preoperative therapeutic anticoagulation with warfarin for acute deep venous thrombosis and/or atrial fibrillation were transfused PCC, FFP, and/or cryoprecipitate for liver or liver-kidney transplant surgery. No thrombotic complications occurred, and one patient required reoperation for hemorrhage. We report data from these cases including estimated blood loss, presence of complications, duration of ICU stay, and length of hospitalization. Perioperative orthotopic liver transplant hematologic management and a review of relevant literature is presented.

Also flagged:infectious diseasesplagueinfectionantibodyplasminogen activator proteasepla
Journal Article 2020-09-08 ✓ 1 Snippet Feng J, Deng Y, Fu M, Hu X, Luo W, Lu Z, Dai L, Yang H, Zhao X, Du Z, Wen B, Jiang L, Zhou D, Jiao J, Xiong X.
In-Text Gene Mentions

…an individual withhemochromatosis(Frank et al.,…

Show Full Abstract

Plague, which is caused by <i>Yersinia pestis</i>, is one of the most dangerous infectious diseases. No FDA-approved vaccine against plague is available for human use at present. To improve the immune safety of <i>Y. pestis</i> EV76 based live attenuated vaccine and to explore the feasibility of aerosolized intratracheal inoculation (i.t.) route for vaccine delivery, a plasminogen activator protease (<i>pla</i>) gene deletion mutant of the attenuated <i>Y. pestis</i> strain EV76-B-SHU was constructed, and its residual virulence and protective efficacy were evaluated in a mouse model via aerosolized intratracheal inoculation (i.t.) or via subcutaneous injection (s.c.). The residual virulence of EV76-B-SHUΔ<i>pla</i> was significantly reduced compared to that of the parental strain EV76-B-SHU following i.t. and s.c. infection. The EV76-B-SHUΔ<i>pla</i> induced higher levels of mucosal antibody sIgA in the bronchoalveolar lavage fluid of mice immunized by i.t. but not by s.c.. Moreover, after lethal challenge with <i>Y. pestis</i> biovar Microtus strain 201 (avirulent in humans), the protective efficacy and bacterial clearance ability of the EV76-B-SHUΔ<i>pla</i>-i.t. group were comparable to those of the EV76-B-SHUΔ<i>pla</i>-s.c. and EV76-B-SHU immunized groups. Thus, the EV76-B-SHUΔ<i>pla</i> represents an excellent live-attenuated vaccine candidate against pneumonic plague and aerosolized i.t. represents a promising immunization route in mouse model.

Also flagged:MethylationMonoamine OxidasesMajor depressive disordermonoaminemental illnessmental disorders
Journal Article 2020-09-08 ✓ 1 Snippet Xu Q, Jiang M, Gu S, Wang F, Yuan B.
In-Text Gene Mentions

…for serotonin transporter (5-HTT)-encoding gene SLC6A4 (…

Show Full Abstract

Major depressive disorder (MDD) is coming to be the regarded as one of the leading causes for human disabilities. Due to its complicated pathological process, the etiology is still unclear and the treatment is still targeting at the monoamine neurotransmitters. Early life stress has been known as a major cause for MDD, but how early life stress affects adult monoaminergic activity is not clear either. Recently, DNA methylation is considered to be the key mechanism of epigenetics and might play a role in early life stress induced mental illness. DNA methylation is an enzymatic covalent modification of DNA, has been one of the main epigenetic mechanisms investigated. The metabolic enzyme for the monoamine neurotransmitters, monoamine oxidases A/B (<i>MAO A/MAO B</i>) are the prime candidates for the investigation into the role of DNA methylation in mental disorders. In this review, we will review recent advances about the structure and physiological function of monoamine oxidases (MAO), brief narrative other factors include stress induced changes, early life stress, perinatal depression (PD) relationship with other epigenetic changes, such as DNA methylation, microRNA (miRNA). This review will shed light on the epigenetic changes involved in MDD, which may provide potential targets for future therapeutics in depression pathogenesis.

Also flagged:neurological disordersgene expressionspinal muscular atrophyDuchenne muscular dystrophyfamilial amyloid polyneuropathyFAP
Journal Article 2020-09-08 ✓ 2 Snippets Brenner D, Ludolph AC, Weishaupt JH.
In-Text Gene Mentions

A CAG repeat expansion in the HTT gene that encodes the Huntingtin protein causes Huntington’s disease (HD).

…expansion in theHTTgene that encodes…

Show Full Abstract

Gene selective approaches that either correct a disease mutation or a pathogenic mechanism will fundamentally change the treatment of neurological disorders. Basically, gene specific therapies are designed to manipulate RNA expression or reconstitute gene expression and function depending on the disease mechanism. Considerable methodological advances in the last years have made successful clinical translation of gene selective approaches possible, based on RNA interference or viral gene reconstitution in spinal muscular atrophy (SMA), Duchenne muscular dystrophy (DMD), and familial amyloid polyneuropathy (FAP). In this review, we provide an overview of the existing and coming gene specific therapies in neurology and discuss benefits, risks and challenges.

Also flagged:Calcium pyrophosphatecystradiculopathycalcium pyrophosphate deposition diseasecervical myelopathypseudogout
Journal Article 2020-09-08 ✓ 1 Snippet Moon AS, Mabry S, Pittman JL.
In-Text Gene Mentions

…chronic kidney disease,hemochromatosis, hyperparathyroidism, Wilson'…

Show Full Abstract

<h4>Background</h4>Spinal calcium pyrophosphate deposition disease (CPPD) is uncommon, and often resembles more common spine pathologies causing pain and neural compression. Here, we present two unusual cases of CPPD of the cervical and thoracolumbar spines.<h4>Case description</h4>Case 1: A 71-year old female smoker presented with a large epidural mass causing rapidly progressive cervical myelopathy with weakness in the upper and lower extremities.Case 2: A 66-year-old morbidly obese male presented with chronic back pain for several years associated with progressively worsening radicular pain in his left lower extremity.<h4>Outcome</h4>The first case is an example of tumoral CPPD involving the facet joint and expanding into the epidural space. The second case was an example of CPPD involving a thoracolumbar facet cyst, resulting in unilateral radiculopathy. Both patients were treated surgically and had significant improvement in symptoms post-operatively.<h4>Conclusions</h4>CPPD in the spine is an uncommon diagnosis but should be considered in the differential diagnosis of patients presenting with back pain and associated neurological symptoms. Accurate diagnosis of spinal CPPD is important in that it will guide postoperative management with anti-inflammatory medications and reduce risk of recurrence.

Also flagged:thioldisulfanecyclohexylalanineTetrahydroimidazopyrazineSynthesis
Journal Article 2020-09-07 No Snippets Küppers J, Benkel T, Annala S, Kimura K, Reinelt L, Fleischmann BK, Kostenis E, Gütschow M.
Show Full Abstract

The 5,6,7,8-tetrahydroimidazo[1,2-a]pyrazine derivative BIM-46174 and its dimeric form BIM-46187 (1) are heterocyclized dipeptides that belong to the very few cell-permeable compounds known to preferentially silence Gα<sub>q</sub> proteins. To explore the chemical space of Gα<sub>q</sub> inhibitors of the BIM chemotype, a combinatorial approach was conducted towards a library of BIM molecules. This library was evaluated in a second messenger-based fluorescence assay to analyze the activity of Gα<sub>q</sub> proteins through the determination of intracellular myo-inositol 1-phosphate. Structure-activity relationships were deduced and structural requirements for biological activity obtained, which were (i) a redox reactive thiol/disulfane substructure, (ii) an N-terminal basic amino group, (iii) a cyclohexylalanine moiety, and (iv) a bicyclic skeleton. Active compounds exhibited cellular toxicity, which was investigated in detail for the prototypical inhibitor 1. This compound affects the structural cytoskeletal dynamics in a Gα<sub>q/11</sub> -independent manner.

Also flagged:Mental illnessesN-methyl-D-aspartate (NMDA)-receptor(R) encephalitisautoantibodyautoimmune encephalitisAE
Journal Article 2020-09-07 No Snippets Endres D, Maier V, Leypoldt F, Wandinger KP, Lennox B, Pollak TA, Nickel K, Maier S, Feige B, Domschke K, Prüss H, Bechter K, Dersch R, Tebartz van Elst L.
Show Full Abstract

<h4>Background</h4>Autoimmune encephalitis (AE) is an important consideration during the diagnostic work-up of secondary mental disorders. Indeed, isolated psychiatric syndromes have been described in case reports of patients with underlying AE. Therefore, the authors performed a systematic literature review of published cases with AE that have predominant psychiatric/neurocognitive manifestations. The aim of this paper is to present the clinical characteristics of these patients.<h4>Methods</h4>The authors conducted a systematic Medline search via Ovid, looking for case reports/series of AEs with antineuronal autoantibodies (Abs) against cell surface/intracellular antigens combined with predominant psychiatric/neurocognitive syndromes. The same was done for patients with Hashimoto encephalopathy/SREAT. Only patients with signs of immunological brain involvement or tumors in their diagnostic investigations or improvement under immunomodulatory drugs were included.<h4>Results</h4>We identified 145 patients with AE mimicking predominant psychiatric/neurocognitive syndromes. Of these cases, 64% were female, and the mean age among all patients was 43.9 (±22.1) years. Most of the patients had Abs against neuronal cell surface antigens (55%), most frequently against the NMDA-receptor (<i>N</i> = 46). Amnestic/dementia-like (39%) and schizophreniform (34%) syndromes were the most frequently reported. Cerebrospinal fluid changes were found in 78%, electroencephalography abnormalities in 61%, and magnetic resonance imaging pathologies in 51% of the patients. Immunomodulatory treatment was performed in 87% of the cases, and 94% of the patients responded to treatment.<h4>Conclusions</h4>Our findings indicate that AEs can mimic predominant psychiatric and neurocognitive disorders, such as schizophreniform psychoses or neurodegenerative dementia, and that affected patients can be treated successfully with immunomodulatory drugs.

Also flagged:breast cancerERCC1TCF2 1SLC19A1Cancerneoplastic
Journal Article 2020-09-07 ✓ 5 Snippets Bakshi D, Nagpal A, Sharma V, Sharma I, Shah R, Sharma B, Bhat A, Verma S, Bhat GR, Abrol D, Sharma R, Vaishnavi S, Kumar R.
In-Text Gene Mentions

Apart from mutations in colorectal cancers, studies have highlighted the role of DCC in BC.

Out of the fifteen variants shortlisted four variants namely rs1051266, rs12190287, rs2229080, and rs2298881 in SLC19A1, TCF21, DCC, and ERCC1 genes respectively, were found to be significantly associated with BC in the studied cohort.

This showed that the expression of the genes is correlated with that of DCC. Further network analysis revealed that the DCC gene displays protein-protein interaction with CASP9 that is associated with multiple cancer risks [34].

Whereas, the rsIDs rs2229080 and rs2298881 associated with the genes DCC and ERCC1 were found to be causing protection to BC.

We identified four SNPs of genes TCF21, SLC19A1, DCC, and ERCC1 showing significant association with BC in the population under study.

Show Full Abstract

<h4>Background</h4>Breast Cancer (BC) is associated with inherited gene mutations. High throughput genotyping of BC samples has led to the identification and characterization of biomarkers for the diagnosis of BC. The most common genetic variants studied are SNPs (Single Nucleotide Polymorphisms) that determine susceptibility to an array of diseases thus serving as a potential tool for identifying the underlying causes of breast carcinogenesis.<h4>Methods</h4>SNP genotyping employing the Agena MassARRAY offers a robust, sensitive, cost-effective method to assess multiple SNPs and samples simultaneously. In this present study, we analyzed 15 SNPs of 14 genes in 550 samples (150 cases and 400 controls). We identified four SNPs of genes TCF21, SLC19A1, DCC, and ERCC1 showing significant association with BC in the population under study.<h4>Results</h4>The SNPs were rs12190287 (TCF21) having OR 1.713 (1.08-2.716 at 95% CI) p-value 0.022 (dominant), rs1051266 (SLC19A1) having OR 3.461 (2.136-5.609 at 95% CI) p-value 0.000000466 (dominant), rs2229080 (DCC) having OR 0.6867 (0.5123-0.9205 at 95% CI) p-value 0.0116 (allelic) and rs2298881 (ERCC1) having OR 0.669 (0.46-0.973 at 95% CI), p-value 0.035 (additive) respectively. The in-silico analysis was further used to fortify the above findings.<h4>Conclusion</h4>It is further anticipated that the variants should be evaluated in other population groups that may aid in understanding the genetic complexity and bridge the missing heritability.

Also flagged:Multiple sclerosisMSdemyelinating diseasemyelin sheathsaxonsinterferon-gamma
Journal Article 2020-09-07 ✓ 2 Snippets Starost L, Lindner M, Herold M, Xu YKT, Drexler HCA, Heß K, Ehrlich M, Ottoboni L, Ruffini F, Stehling M, Röpke A, Thomas C, Schöler HR, Antel J, Winkler J, Martino G, Klotz L, Kuhlmann T.
In-Text Gene Mentions

hiOL express all major myelin-associated proteins, such as CNP, PLP, MBP, MAG, MOG etc., confirming the oligodendroglial identity, but also some of the proteins which have been found to be unique or enriched on the transcriptional level in oligodendroglial subclusters identified in MS and control brains, such as PDGFRα, BCAN, SOX6, APOE and CD74 [23].

…as PDGFRα, BCAN,SOX6, APOE and CD74…

Show Full Abstract

Multiple sclerosis (MS) is the most frequent demyelinating disease in young adults and despite significant advances in immunotherapy, disease progression still cannot be prevented. Promotion of remyelination, an endogenous repair mechanism resulting in the formation of new myelin sheaths around demyelinated axons, represents a promising new treatment approach. However, remyelination frequently fails in MS lesions, which can in part be attributed to impaired differentiation of oligodendroglial progenitor cells into mature, myelinating oligodendrocytes. The reasons for impaired oligodendroglial differentiation and defective remyelination in MS are currently unknown. To determine whether intrinsic oligodendroglial factors contribute to impaired remyelination in relapsing-remitting MS (RRMS), we compared induced pluripotent stem cell-derived oligodendrocytes (hiOL) from RRMS patients and controls, among them two monozygous twin pairs discordant for MS. We found that hiOL from RRMS patients and controls were virtually indistinguishable with respect to remyelination-associated functions and proteomic composition. However, while analyzing the effect of extrinsic factors we discovered that supernatants of activated peripheral blood mononuclear cells (PBMCs) significantly inhibit oligodendroglial differentiation. In particular, we identified CD4<sup>+</sup> T cells as mediators of impaired oligodendroglial differentiation; at least partly due to interferon-gamma secretion. Additionally, we observed that blocked oligodendroglial differentiation induced by PBMC supernatants could not be restored by application of oligodendroglial differentiation promoting drugs, whereas treatment of PBMCs with the immunomodulatory drug teriflunomide prior to supernatant collection partly rescued oligodendroglial differentiation. In summary, these data indicate that the oligodendroglial differentiation block is not due to intrinsic oligodendroglial factors but rather caused by the inflammatory environment in RRMS lesions which underlines the need for drug screening approaches taking the inflammatory environment into account. Combined, these findings may contribute to the development of new remyelination promoting strategies.

Also flagged:Cell cycleactinpou3integrin-alpha-6cnrsgene expression
Journal Article 2020-09-07 ✓ 1 Snippet Kassmer SH, Langenbacher AD, De Tomaso AW.
In-Text Gene Mentions

POU3F2

Show Full Abstract

Colonial ascidians are the only chordates able to undergo whole body regeneration (WBR), during which entire new bodies can be regenerated from small fragments of blood vessels. Here, we show that during the early stages of WBR in Botrylloides diegensis, proliferation occurs only in small, blood-borne cells that express integrin-alpha-6 (IA6), pou3 and vasa. WBR cannot proceed when proliferating IA6+ cells are ablated with Mitomycin C, and injection of a single IA6+ Candidate stem cell can rescue WBR after ablation. Lineage tracing using EdU-labeling demonstrates that donor-derived IA6+ Candidate stem cells directly give rise to regenerating tissues. Inhibitors of either Notch or canonical Wnt signaling block WBR and reduce proliferation of IA6+ Candidate stem cells, indicating that these two pathways regulate their activation. In conclusion, we show that IA6+ Candidate stem cells are responsible for whole body regeneration and give rise to regenerating tissues.

Also flagged:CytokinescytokinepathogenesisInflammatory diseaseImmune system diseaseAsthma
Journal Article 2020-09-07 No Snippets Salnikova LE, Khadzhieva MB, Kolobkov DS, Gracheva AS, Kuzovlev AN, Abilev SK.
Show Full Abstract

Dysregulation in cytokine production has been linked to the pathogenesis of various immune-mediated traits, in which genetic variability contributes to the etiopathogenesis. GWA studies have identified many genetic variants in or near cytokine genes, nonetheless, the translation of these findings into knowledge of functional determinants of complex traits remains a fundamental challenge. In this study we aimed at collection, analysis and interpretation of data on cytokines focused on their tissue-specific expression, eQTLs and GWAS traits. Using GO annotations, we generated a list of 314 cytokines and analyzed them with the GTEx resource. Cytokines were highly tissue-specific, 82.3% of cytokines had Tau expression metrics ≥ 0.8. In total, 3077 associations for 1760 unique SNPs in or near 244 cytokines were mapped in the NHGRI-EBI GWAS Catalog. According to the Experimental Factor Ontology resource, the largest numbers of disease associations were related to 'Inflammatory disease', 'Immune system disease' and 'Asthma'. The GTEx-based analysis revealed that among GWAS SNPs, 1142 SNPs had eQTL effects and influenced expression levels of 999 eGenes, among them 178 cytokines. Several types of enrichment analysis showed that it was cytokines expression variability that fundamentally contributed to the molecular origins of considered immune-mediated conditions.

Also flagged:ofMCDsneurodevelopmental disordersepilepsycerebral palsyintellectual disability
Journal Article 2020-09-07 ✓ 2 Snippets Oegema R, Barakat TS, Wilke M, Stouffs K, Amrom D, Aronica E, Bahi-Buisson N, Conti V, Fry AE, Geis T, Andres DG, Parrini E, Pogledic I, Said E, Soler D, Valor LM, Zaki MS, Mirzaa G, Dobyns WB, Reiner O, Guerrini R, Pilz DT, Hehr U, Leventer RJ, Jansen AC, Mancini GMS, Di Donato N.
In-Text Gene Mentions

Fourth, it directs patient management (for example, antiviral treatment and screening for progressive hearing loss in infants with congenital CMV infection76, cardiovascular surveillance in FLNA-related and ARFGEF2-related PNVH77,78 or mTORC1 inhibition in patients with tuberous sclerosis complex (TSC))79.

…FLNA -related andARFGEF2-related PNVH 77…

Show Full Abstract

Malformations of cortical development (MCDs) are neurodevelopmental disorders that result from abnormal development of the cerebral cortex in utero. MCDs place a substantial burden on affected individuals, their families and societies worldwide, as these individuals can experience lifelong drug-resistant epilepsy, cerebral palsy, feeding difficulties, intellectual disability and other neurological and behavioural anomalies. The diagnostic pathway for MCDs is complex owing to wide variations in presentation and aetiology, thereby hampering timely and adequate management. In this article, the international MCD network Neuro-MIG provides consensus recommendations to aid both expert and non-expert clinicians in the diagnostic work-up of MCDs with the aim of improving patient management worldwide. We reviewed the literature on clinical presentation, aetiology and diagnostic approaches for the main MCD subtypes and collected data on current practices and recommendations from clinicians and diagnostic laboratories within Neuro-MIG. We reached consensus by 42 professionals from 20 countries, using expert discussions and a Delphi consensus process. We present a diagnostic workflow that can be applied to any individual with MCD and a comprehensive list of MCD-related genes with their associated phenotypes. The workflow is designed to maximize the diagnostic yield and increase the number of patients receiving personalized care and counselling on prognosis and recurrence risk.

Also flagged:Intestinal failureIFHRPOSTBSLC10A2fluor
Journal Article 2020-09-07 ✓ 2 Snippets Meran L, Massie I, Campinoti S, Weston AE, Gaifulina R, Tullie L, Faull P, Orford M, Kucharska A, Baulies A, Novellasdemunt L, Angelis N, Hirst E, König J, Tedeschi AM, Pellegata AF, Eli S, Snijders AP, Collinson L, Thapar N, Thomas GMH, Eaton S, Bonfanti P, De Coppi P, Li VSW.
In-Text Gene Mentions

OLFM4

Olfm4

Show Full Abstract

Intestinal failure, following extensive anatomical or functional loss of small intestine, has debilitating long-term consequences for children<sup>1</sup>. The priority of patient care is to increase the length of functional intestine, particularly the jejunum, to promote nutritional independence<sup>2</sup>. Here we construct autologous jejunal mucosal grafts using biomaterials from pediatric patients and show that patient-derived organoids can be expanded efficiently in vitro. In parallel, we generate decellularized human intestinal matrix with intact nanotopography, which forms biological scaffolds. Proteomic and Raman spectroscopy analyses reveal highly analogous biochemical profiles of human small intestine and colon scaffolds, indicating that they can be used interchangeably as platforms for intestinal engineering. Indeed, seeding of jejunal organoids onto either type of scaffold reliably reconstructs grafts that exhibit several aspects of physiological jejunal function and that survive to form luminal structures after transplantation into the kidney capsule or subcutaneous pockets of mice for up to 2 weeks. Our findings provide proof-of-concept data for engineering patient-specific jejunal grafts for children with intestinal failure, ultimately aiding in the restoration of nutritional autonomy.

Also flagged:TfR2IronChronic AnemiaMotor Neuron DisorderTFtransferrin receptor 2
Journal Article 2020-09-07 ✓ 3 Snippets Tippairote T, Bjørklund G, Peana M, Roytrakul S.
In-Text Gene Mentions

The Proteomics Study of Compounded HFE/TF/TfR2/HJV Genetic Variations in a Thai Family with Iron Overload, Chronic Anemia, and Motor Neuron Disorder.

…iron regulatory genes (HFE) impaired the hepatic…

…compound of uncommonHFErs2794719, together with…

Show Full Abstract

The mutation of the homeostatic iron regulatory genes (HFE) impaired the hepatic hepcidin transcription leading to the chronic excess of the iron pool, with the adverse consequences of free radical oxidative damages. We herein reported the findings of Thai family members who had the compound of uncommon HFE rs2794719, together with transferrin (TF) rs1867504, transferrin receptor 2 (TfR2) rs7385804, and hemojuvelin (HJV) rs16827043 genetic variants involved in the hepcidin transcriptional pathway. These compounded genetic variants could produce the spectrum of clinical phenotypes that spanned from mild to moderate symptoms of chronic anemia to an established motor neuron disorder. The feasible pathophysiologies were the impairment of the transferrin receptor functions, which affected the endocytic uptake of halo-transferrin into the erythroblast precursors. Such a defect left the erythropoiesis depleted of their iron supply. These alterations also promoted the TfR-independent uptake of iron into other target tissues and left the TrF2/BMP-dependent-hepcidin activation pathway unattended. We used the predicted molecular interactive proteomes to support our speculated dysregulated iron metabolism. During the early stage of an elevated ferritin level, there was no inhibition of ferroportin activities from hepcidin. These pathophysiological processes went on to the point of an iron overload threshold. After that, the hepcidin transcription started to kick in with the resulting decreased serum iron levels and deterioration of clinical symptoms.

Also flagged:Autophagosome
Journal Article 2020-09-07 No Snippets Zhang H, An P, Fei Y, Lu B.
Show Full Abstract

No abstract available.

Also flagged:Peptidesacidironlipidrigorproteolysis
Journal Article 2020-09-07 ✓ 4 Snippets Kęska P, Rohn S, Halagarda M, M Wójciak K.
In-Text Gene Mentions

…The peptidase withDPP-III-inhibiting activity has a…

…inhibitory potential forDPP-IIIin in silico…

…peptides that inhibitDPP-IIIfrom meat proteins.…

…potential source ofDPP-IIIis of particular…

Show Full Abstract

The growing consumer interest in organic foods, as well as, in many cases, the inconclusiveness of the research comparing organic and conventional foods, indicates a need to study this issue further. The aim of the study was to compare the effects of meat origin (conventional vs. organic) and selected elements of the pork carcass (ham, loin, and shoulder) on the meat proteome and the antioxidant potential of its peptides. The peptidomic approach was used, while the ability of antioxidants to scavenge 2,2'-azino-bis-3-ethylbenzthiazoline-6-sulfonic acid (ABTS), to chelate Fe(II) ions, and to reduce Fe(III) was determined. Most peptides were derived from myofibrillary proteins. The meat origin and the element of the pork carcass did not have a significant effect on the proteome. On the other hand, the pork origin and the carcass element significantly affected the iron ion-chelating capacity (Fe(II)) and the reducing power of peptides. In particular, pork ham from conventional rearing systems had the best antioxidant properties in relation to potential antioxidant peptides. This could be a factor for human health, as well as for stabilized meat products (e.g., toward lipid oxidation).

Also flagged:BiomineralizationHydroxyapatitemineralizationsynthesisorganizationcell adhesion
Journal Article 2020-09-07 No Snippets Kaushik N, Nhat Nguyen L, Kim JH, Choi EH, Kumar Kaushik N.
Show Full Abstract

In the field of tissue engineering, there are several issues to consider when designing biomaterials for implants, including cellular interaction, good biocompatibility, and biochemical activity. Biomimetic mineralization has gained considerable attention as an emerging approach for the synthesis of biocompatible materials with complex shapes, categorized organization, controlled shape, and size in aqueous environments. Understanding biomineralization strategies could enhance opportunities for novel biomimetic mineralization approaches. In this regard, mussel-inspired biomaterials have recently attracted many researchers due to appealing features, such as strong adhesive properties on moist surfaces, improved cell adhesion, and immobilization of bioactive molecules via catechol chemistry. This molecular designed approach has been a key point in combining new functionalities into accessible biomaterials for biomedical applications. Polydopamine (PDA) has emerged as a promising material for biomaterial functionalization, considering its simple molecular structure, independence of target materials, cell interactions for adhesion, and robust reactivity for resulting functionalization. In this review, we highlight the strategies for using PDA to induce the biomineralization of hydroxyapatite (HA) on the surface of various implant materials with good mechanical strength and corrosion resistance. We also discuss the interactions between the PDA-HA coating, and several cell types that are intricate in many biomedical applications, involving bone defect repair, bone regeneration, cell attachment, and antibacterial activity.

Also flagged:Chronic Kidney Diseasedamagepathogenesishypertensive nephropathydiabetic nephropathyglomerulonephritis
Journal Article 2020-09-07 No Snippets Peters LJF, Floege J, Biessen EAL, Jankowski J, van der Vorst EPC.
Show Full Abstract

There are still major challenges regarding the early diagnosis and treatment of chronic kidney disease (CKD), which is in part due to the fact that its pathophysiology is very complex and not clarified in detail. The diagnosis of CKD commonly is made after kidney damage has occurred. This highlights the need for better mechanistic insight into CKD as well as improved clinical tools for both diagnosis and treatment. In the last decade, many studies have focused on microRNAs (miRs) as novel diagnostic tools or clinical targets. MiRs are small non-coding RNA molecules that are involved in post-transcriptional gene regulation and many have been studied in CKD. A wide array of pre-clinical and clinical studies have highlighted the potential role for miRs in the pathogenesis of hypertensive nephropathy, diabetic nephropathy, glomerulonephritis, kidney tubulointerstitial fibrosis, and some of the associated cardiovascular complications. In this review, we will provide an overview of the miRs studied in CKD, especially highlighting miR-103a-3p, miR-192-5p, the miR-29 family and miR-21-5p as these have the greatest potential to result in novel therapeutic and diagnostic strategies.

Also flagged:IronHepcidinCOVID infectionpneumoniainsulinViral disease
Journal Article 2020-09-07 ✓ 3 Snippets Banchini F, Vallisa D, Maniscalco P, Capelli P.
In-Text Gene Mentions

…uman Hemochromatosis Protein (HFE) and hepcidin.…

…editary Hemochromatosis Gene (HFE) that is bound…

…TfR1 and TfR2; -HFEseems to stimulate…

Show Full Abstract

<h4>Background</h4>The COVID epidemic hit like a tsunami worldwide. At the time of its arrival in Italy, available literary data were meager, and most of them concerned its epidemiology. World Health Organization proposed guidelines in march 2020, a strategy of treatment has been developed, and a significant number of subsequent articles have been published to understand, prevent, and cure COVID patients.<h4>Methods</h4>From the observation of two patients, we performed a careful analysis of scientific literature to unearth the relation between COVID infection, clinical manifestations as pneumonia and thrombosis, and to find out why it frequently affects obese, diabetics, and elderly patients.<h4>Results</h4>The analysis shows that hepcidin could represent one of such correlating factors. Hepcidin is most elevated in older age, in non-insulin diabetics patients and in obese people. It is the final target therapy of many medicaments frequently used. Viral disease, and in particular SARS-CoV19, could induce activation of the hepcidin pathway, which in turn is responsible for an increase in the iron load. Excess of iron can lead to cell death by ferroptosis and release into the bloodstream, such as free iron, which in turn has toxic and pro-coagulative effects.<h4>Conclusions</h4>Overexpression of hepcidin and iron overload might play a crucial role in COVID infection, becoming potential targets for treatment. Hepcidin could also be considered as a biomarker to measure the effectiveness of our treatments and the restoration of iron homeostasis the final intent. (www.actabiomedica.it).

Also flagged:polymerasechondrogenesiscartilage developmenttranscription factorSox9Col2a1
Journal Article 2020-09-07 ✓ 3 Snippets Yao B, Wang C, Zhou Z, Zhang M, Zhao D, Bai X, Leng X.
In-Text Gene Mentions

…Pappa2, Sdk2, Nf1,Sox6, Runx2, Foxl2, Prkg2,…

…Col11a1, Acan andSox6during cartilage development…

…Col2a1, Acan, Sox9,Sox6, Col11a1 and Fgfr3.…

Show Full Abstract

<h4>Background</h4>Deer antlers have become a valuable model for biomedical research due to the capacities of regeneration and rapid growth. However, the molecular mechanism of rapid antler growth remains to be elucidated. The aim of the present study was to compare and explore the molecular control exerted by the main beam and brow tine during rapid antler growth.<h4>Methods</h4>The main beams and brow tines of sika deer antlers were collected from Chinese sika deer (<i>Cervus nippon</i>) at the rapid growth stage. Comparative transcriptome analysis was conducted using RNA-Seq technology. Differential expression was assessed using the DEGseq package. Functional Gene Ontology (GO) enrichment analysis was accomplished using a rigorous algorithm according to the GO Term Finder tool, and KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway enrichment analysis was accomplished with the R function phyper, followed by the hypergeometric test and Bonferroni correction. Quantitative real-time polymerase chain reaction (qRT-PCR) was carried out to verify the RNA levels for differentially expressed mRNAs.<h4>Results</h4>The expression levels of 16 differentially expressed genes (DEGs) involved in chondrogenesis and cartilage development were identified as significantly upregulated in the main beams, including transcription factor SOX-9 (Sox9), collagen alpha-1(II) chain (Col2a1), aggrecan core protein (Acan), etc. However, the expression levels of 17 DEGs involved in endochondral ossification and bone formation were identified as significantly upregulated in the brow tines, including collagen alpha-1(X) chain (Col10a1), osteopontin (Spp1) and bone sialoprotein 2 (Ibsp), etc.<h4>Conclusion</h4>These results suggest that the antler main beam has stronger growth capacity involved in chondrogenesis and cartilage development compared to the brow tine during rapid antler growth, which is mainly achieved through regulation of Sox9 and its target genes, whereas the antler brow tine has stronger capacities of endochondral bone formation and resorption compared to the main beam during rapid antler growth, which is mainly achieved through the genes involved in regulating osteoblast and osteoclast activities. Thus, the current research has deeply expanded our understanding of the intrinsic molecular regulation displayed by the main beam and brow tine during rapid antler growth.

Also flagged:procyanidinslipidmetabolismalcoholironAlcoholic Liver Disease
Journal Article 2020-09-07 ✓ 1 Snippet Lobo A, Liu Y, Song Y, Liu S, Zhang R, Liang H, Xin H.
In-Text Gene Mentions

…close relation betweenhemochromatosisand excessive alcohol…

Show Full Abstract

<h4>Background</h4>Lifestyle involving uncontrolled alcohol consumption coupled regularly with red meat and other iron sources has detrimental effects on the liver, which in the long term, results in Alcoholic Liver Disease (ALD). Procyanidin has lately garnered increasing attention and has become the focus of research owing to its antioxidant properties. This study explores the anti-inflammatory effects of procyanidins, in preventing ALD, by analyzing the biological activities of the compound on liver injury caused by excessive alcohol and iron.<h4>Method</h4>Male SPF Wistar rats were placed in 4 groups; the control Group A (basic diet); the model Group B (excess alcohol 8-12 mL/kg/d and iron 1000 mg/kg diet); the low dose procyanidin Group C (model group diet plus 60 mg/kg/d of procyanidin); and the high dose procyanidin Group D (model group diet plus 120 mg/kg/d of procyanidin). Serum biochemical markers for liver damage were measured spectrophotometrically. The NFκB and IκB mRNA expression levels were determined using RT-PCR; the NFκB p65 and IκB protein expression levels were assessed via western blotting, while ELISA was used to detect serum inflammatory factors.<h4>Results</h4>The pathological score of the model Group B, low and high dose procyanidin Groups C and D were 6.58 ± 0.90,4.69 ± 0.70 and 2.00 ± 0.73, respectively (P < 0.05). The results showed that high alcohol and iron contents in the model group led to significant damage of liver structure, increased low-density lipoproteins (LDLs), steatosis, and increased levels of inflammatory cytokines. High amounts of procyanidins led to the preservation of the liver structure, production of high-density lipoproteins, and reduction in serum inflammatory cytokines while also significantly decreasing the expression levels of NFκB p65.<h4>Conclusion</h4>The results prove that procyanidins have hepatoprotective potential and could be effective in reversing histopathology, possibly by alleviating inflammation and improving lipid metabolism.

Also flagged:disorder ofglycosylationCDGcarbohydratemannoseportal hypertension
Journal Article 2020-09-07 ✓ 1 Snippet Abdel Ghaffar TY, Ng BG, Elsayed SM, El Naghi S, Helmy S, Mohammed N, El Hennawy A, Freeze HH.
In-Text Gene Mentions

…was 77% andATIIIactivity was 56%.…

Show Full Abstract

MPI-CDG is a rare congenital disorder of glycosylation (CDG) which presents with hepato-gastrointestinal symptoms and hypoglycemia. We report on hepatic evaluation of two pediatric patients who presented to us with gastrointestinal symptoms. Analysis of carbohydrate deficient transferrin (CDT) showed a Type 1 pattern and molecular analysis confirmed the diagnosis of MPI-CDG. Oral mannose therapy was markedly effective in one patient but was only partially effective in the other who showed progressive portal hypertension.

Also flagged:fluoridecasein phosphopeptidecariesCalciumphosphoruscalcium phosphate
Journal Article 2020-09-07 No Snippets Khanduri N, Kurup D, Mitra M.
Show Full Abstract

<h4>Background</h4>The aim of this study is to quantitatively evaluate the remineralization potential of three remineralizing systems as follows: fluoride, casein phosphopeptide-amorphous calcium phosphate (CPP-ACP), and CPP-ACP with fluoride, under scanning electron microscope with energy-dispersive X-ray analysis.<h4>Materials and methods</h4>In this <i>in vitro</i> study A total of 40 enamel specimens were prepared from the buccal or lingual surfaces of human premolars extracted for orthodontic reason. Specimens were then placed in demineralizing solution for 96 h, to produce artificial caries-like lesion. Calcium and phosphate weight percentage of demineralized specimens was measured. Specimens were divided into four groups as follows: (a) control, (b) CPP-ACP, (c) CPP-ACP with fluoride, and (d) fluoride varnish. Except for the control group, the entire specimens were subjected to remineralization using respective remineralizing agents of their groups. The prepared specimens were assessed for calcium and phosphate weight percentage using scanning electron microscopy-energy dispersive X-ray spectroscopy. One way analysis of variance (ANOVA), followed by Tukey's test, was performed with the help of critical difference (CD) or least significant difference at 5% and 1% level of significance. <i>P</i> ≤ 0.05 was taken to be statistically significant and <i>P</i> < 0.001 as statistically highly significant.<h4>Results</h4>The mean weight percentage of calcium and phosphorus of specimens treated with CPP-amorphous calcium phosphate nanocomplexes plus fluoride (ACPF) was significantly higher than other groups.<h4>Conclusion</h4>All the groups showed statistically significant remineralization. However, because of added benefit of fluoride, CPP-ACPF showed statistically significant amount of remineralization than CPP-ACP.

Also flagged:RNA-associated proteins-associatedspindlebeatingdyneinCfap44
Journal Article 2020-09-06 ✓ 1 Snippet Drew K, Lee C, Cox RM, Dang V, Devitt CC, McWhite CD, Papoulas O, Huizar RL, Marcotte EM, Wallingford JB.
In-Text Gene Mentions

Stau1

Show Full Abstract

Cell-type specific RNA-associated proteins are essential for development and homeostasis in animals. Despite a massive recent effort to systematically identify RNA-associated proteins, we currently have few comprehensive rosters of cell-type specific RNA-associated proteins in vertebrate tissues. Here, we demonstrate the feasibility of determining the RNA-associated proteome of a defined vertebrate embryonic tissue using DIF-FRAC, a systematic and universal (i.e., label-free) method. Application of DIF-FRAC to cultured tissue explants of Xenopus mucociliary epithelium identified dozens of known RNA-associated proteins as expected, but also several novel RNA-associated proteins, including proteins related to assembly of the mitotic spindle and regulation of ciliary beating. In particular, we show that the inner dynein arm tether Cfap44 is an RNA-associated protein that localizes not only to axonemes, but also to liquid-like organelles in the cytoplasm called DynAPs. This result led us to discover that DynAPs are generally enriched for RNA. Together, these data provide a useful resource for a deeper understanding of mucociliary epithelia and demonstrate that DIF-FRAC will be broadly applicable for systematic identification of RNA-associated proteins from embryonic tissues.

Also flagged:cGMP Phosphodiesterasephosphodiesteraseorganizationbindingretinal degenerative diseasesWater
Journal Article 2020-09-06 No Snippets Gupta R, Liu Y, Wang H, Nordyke CT, Puterbaugh RZ, Cui W, Varga K, Chu F, Ke H, Vashisth H, Cote RH.
Show Full Abstract

Regulation of photoreceptor phosphodiesterase (PDE6) activity is responsible for the speed, sensitivity, and recovery of the photoresponse during visual signaling in vertebrate photoreceptor cells. It is hypothesized that physiological differences in the light responsiveness of rods and cones may result in part from differences in the structure and regulation of the distinct isoforms of rod and cone PDE6. Although rod and cone PDE6 catalytic subunits share a similar domain organization consisting of tandem GAF domains (GAFa and GAFb) and a catalytic domain, cone PDE6 is a homodimer whereas rod PDE6 consists of two homologous catalytic subunits. Here we provide the x-ray crystal structure of cone GAFab regulatory domain solved at 3.3 Å resolution, in conjunction with chemical cross-linking and mass spectrometric analysis of conformational changes to GAFab induced upon binding of cGMP and the PDE6 inhibitory γ-subunit (Pγ). Ligand-induced changes in cross-linked residues implicate multiple conformational changes in the GAFa and GAFb domains in forming an allosteric communication network. Molecular dynamics simulations of cone GAFab revealed differences in conformational dynamics of the two subunits forming the homodimer and allosteric perturbations on cGMP binding. Cross-linking of Pγ to GAFab in conjunction with solution NMR spectroscopy of isotopically labeled Pγ identified the central polycationic region of Pγ interacting with the GAFb domain. These results provide a mechanistic basis for developing allosteric activators of PDE6 with therapeutic implications for halting the progression of several retinal degenerative diseases.

Also flagged:Huntington's diseaseHDbehavioralcognitive declineneurodegenerative disease
Journal Article 2020-09-06 ✓ 1 Snippet Pierzynowska K, Podlacha M, Łuszczek D, Rintz E, Gaffke L, Szczudło Z, Tomczyk M, Smoleński RT, Węgrzyn G.
In-Text Gene Mentions

…exon of theHTTgene, is a…

Show Full Abstract

Huntington's disease (HD), caused by expansion of CAG repeats in the 1st exon of the HTT gene, is a disorder inherited in an autosomal dominant manner. HD symptoms include chorea, behavioral disturbances and cognitive decline. Although it is described as a neurodegenerative disease, due to expression of HTT in all types of cells, peripheral symptoms also occur. R6/1 and R6/2 mouse lines, which demonstrate many different phenotypical disturbances, are among the most commonly used HD animal models. Nevertheless, in this report, we underlined, for the first time, a previously undescribed R6/1 and R6/2 feature, hair dysmorphology. We observed changes in the general view of pelage, as well as specific changes in the shape of hair, assessed under electron microscope (deep cavity and hilly hair surface or concave and convex areas on the long hair axis with an appearance of the hair as flat). Hair diameter was significantly increased in both HD mouse models relative to control animals. Moreover, loosened contact between the scales and loosened scale texture were observed in R6/1 and R6/2. Thus, this study highlighted that the hair morphology might be a useful, noninvasive and simple marker of a widely used HD mouse models, R6/1 and R6/2 lines, particularly in testing effects of potential therapeutics or disease progression.

Also flagged:PDParkinsonian disordersneurological diseasesagingalpha-synucleinmitochondrial
Journal Article 2020-09-06 No Snippets Acharya S, Salgado-Somoza A, Stefanizzi FM, Lumley AI, Zhang L, Glaab E, May P, Devaux Y.
Show Full Abstract

Parkinson's disease (PD) is a complex and heterogeneous disorder involving multiple genetic and environmental influences. Although a wide range of PD risk factors and clinical markers for the symptomatic motor stage of the disease have been identified, there are still no reliable biomarkers available for the early pre-motor phase of PD and for predicting disease progression. High-throughput RNA-based biomarker profiling and modeling may provide a means to exploit the joint information content from a multitude of markers to derive diagnostic and prognostic signatures. In the field of PD biomarker research, currently, no clinically validated RNA-based biomarker models are available, but previous studies reported several significantly disease-associated changes in RNA abundances and activities in multiple human tissues and body fluids. Here, we review the current knowledge of the regulation and function of non-coding RNAs in PD, focusing on microRNAs, long non-coding RNAs, and circular RNAs. Since there is growing evidence for functional interactions between the heart and the brain, we discuss the benefits of studying the role of non-coding RNAs in organ interactions when deciphering the complex regulatory networks involved in PD progression. We finally review important concepts of harmonization and curation of high throughput datasets, and we discuss the potential of systems biomedicine to derive and evaluate RNA biomarker signatures from high-throughput expression data.

Also flagged:AngiogenesisCINEarly Invasive Carcinomaepithelial-to-mesenchymal transitionepithelial tumorslymphangiogenesis
Journal Article 2020-09-06 ✓ 3 Snippets Kurmyshkina O, Kovchur P, Schegoleva L, Volkova T.
In-Text Gene Mentions

Several of them exert their tumor-suppressing activity via enhancing homophilic cell–cell adhesion (MPZL3, FAT4, GJB2, LMO7, NEGR1, PCDH18, CRYAB, and SERPINB1), maintaining epithelial integrity, or modulating the WNT-, TGFBR-, SHH-, and Hippo signaling pathways and retinoic acid metabolism, exerting thereby anti-EMT and anti-metastatic effect.

…PTPRU, SLIT2, LMO7,NEGR1, AIF1L, DEPTOR, and…

…FAT4, GJB2, LMO7,NEGR1, PCDH18, CRYAB ,…

Show Full Abstract

The establishment of a proangiogenic phenotype and epithelial-to-mesenchymal transition (EMT) are considered as critical events that promote the induction of invasive growth in epithelial tumors, and stimulation of lymphangiogenesis is believed to confer the capacity for early dissemination to cancer cells. Recent research has revealed substantial interdependence between these processes at the molecular level as they rely on common signaling networks. Of great interest are the molecular mechanisms of (lymph-)angiogenesis and EMT associated with the earliest stages of transition from intraepithelial development to invasive growth, as they could provide the source of potentially valuable tools for targeting tumor metastasis. However, in the case of early-stage cervical cancer, the players of (lymph-)angiogenesis and EMT processes still remain substantially uncharacterized. In this study, we used RNA sequencing to compare transcriptomes of HPV(+) preinvasive neoplastic lesions and early-stage invasive carcinoma of the cervix and to identify (lymph-)angiogenesis- and EMT-related genes and pathways that may underlie early acquisition of invasive phenotype and metastatic properties by cervical cancer cells. Second, we applied flow cytometric analysis to evaluate the expression of three key lymphangiogenesis/EMT markers (VEGFR3, MET, and SLUG) in epithelial cells derived from enzymatically treated tissue specimens. Overall, among 201 differentially expressed genes, a considerable number of (lymph-)angiogenesis and EMT regulatory factors were identified, including genes encoding cytokines, growth factor receptors, transcription factors, and adhesion molecules. Pathway analysis confirmed enrichment for angiogenesis, epithelial differentiation, and cell guidance pathways at transition from intraepithelial neoplasia to invasive carcinoma and suggested immune-regulatory/inflammatory pathways to be implicated in initiation of invasive growth of cervical cancer. Flow cytometry showed cell phenotype-specific expression pattern for VEGFR3, MET, and SLUG and revealed correlation with the amount of tumor-infiltrating lymphocytes at the early stages of cervical cancer progression. Taken together, these results extend our understanding of driving forces of angiogenesis and metastasis in HPV-associated cervical cancer and may be useful for developing new treatments.

Also flagged:Polyglutaminedeathpolyglutamine (polyQ) diseasesofpeptideglutamine
Journal Article 2020-09-06 ✓ 2 Snippets Owada R, Awata S, Suzue K, Kanetaka H, Kakuta Y, Nakamura K.
In-Text Gene Mentions

…Huntingtin protein (HTT) is the causative…

…Addition of mutantHttknock-in microglia (Q175/Q175)…

Show Full Abstract

Expanded polyglutamine-containing proteins in neurons intrinsically contributes to neuronal dysfunctions and neuronal cell death in polyglutamine (polyQ) diseases. In addition, an expanded polyQ-containing protein in microglia also leads to apoptosis of neurons. However, detailed morphological analysis of neurons exposed to conditioned medium (CM) derived from polyQ-containing microglia has not been essentially carried out. Here, we introduced aggregated peptide with 69 glutamine repeat (69Q) into BV2 microglial cells. The 69Q-containing BV2 cells showed shorter branches. The CM from 69Q-containing microglia (69Q-CM) induced neurite retraction and fewer number of branch point of neurites of differentiated PC12 cells. Likewise, the 69Q-CM induces disturbed differentiation of PC12 cells with shorter total length of neurites and fewer number of branch point of neurites. Thus, the factor(s) released from polyQ-containing microglia affect both differentiation and degeneration of neuron-like cells.

Also flagged:-CytokinesFibromyalgiasleepcognitive dysfunctionchronic
Journal Article 2020-09-06 ✓ 1 Snippet Peck MM, Maram R, Mohamed A, Ochoa Crespo D, Kaur G, Ashraf I, Malik BH.
In-Text Gene Mentions

5-HT2A: 5-hydroxytryptamine receptor 2A, 5-HTT: 5-hydroxytryptamine transporter, SLC6A4: solute carrier family 6 member 4, rs: reference single nucleotide polymorphism, 5-HTTLPR: serotonin-transporter-linked polymorphic region, DRD4: dopamine receptor D4, DAT1: dopamine transporter 1, SLC1A5: solute carrier family 1 member 5, SCL25A22: solute carrier family 25 member 22, GABRB3: γ-aminobutyric acid receptor β3 subunit, GABA: γ-aminobutyric acid, GRM6: metabotropic glutamate receptor, GRIA4: inotropic glutamate receptor AMPA type subunit GluR4, SNPs: single nucleotide polymorphisms, COMT: Catechol-O-methyltransferase, Val158Met: valine to methionine substitution at codon 158 [1-2,7,33-41]

Show Full Abstract

Fibromyalgia is a complex syndrome characterized by widespread chronic pain, without any obvious etiology, and it is often accompanied by a constellation of symptoms such as fatigue, sleep disturbances and cognitive dysfunction, to name a few. The syndrome may be associated with a variety of autoimmune and psychiatric conditions. Fibromyalgia can occur with other musculoskeletal pathologies and its symptoms can overlap with other chronic painful conditions such as chronic myofascial pain syndromes seen in cervical and lumbar spinal osteoarthritis and degenerative disc disease. Gene polymorphisms have been related to a decreased pain threshold and an increased susceptibility to disorders associated with chronic pain. Some of those genetic variants might trigger the onset of fibromyalgia. Researchers are looking into the possible factors that might contribute to its pathophysiology. It is important to study the connections between pro-inflammatory cytokines and genetic variants in pain-related genes and their roles in predisposition and development of fibromyalgia. The objective of this review article is to provide a brief overview of the pro-inflammatory cytokines commonly associated with fibromyalgia, as well as to look into the genes that have shown some level of involvement in the development of fibromyalgia and its symptomatology.

Also flagged:atrial flutterPeriodic acidvaricose veinsdeep vein thrombosiselectroncollagen
Journal Article 2020-09-05 No Snippets Yamaki KI, Akita K.
Show Full Abstract

No abstract available.

Also flagged:Pancreatic acinar cell carcinomaductal adenocarcinomaacinar cell carcinomaACCpancreatic head tumorpancreatic head cancer
Journal Article 2020-09-05 ✓ 5 Snippets Kimura T, Tabata S, Togawa T, Onchi H, Iida A, Sato Y, Goi T.
In-Text Gene Mentions

For tumorigenesis, we considered four possible mechanisms in this case: (1) ACC arose from DCC through transdifferentiation; (2) DCC arose from ACC through transdifferentiation; (3) both ACC and DCC developed from the same cancer stem cell; and (4) ACC and DCC developed independently (collision tumor).

…ACC arose fromDCCthrough transdifferentiation; …

…ough transdifferentiation; (2)DCCarose from ACC…

…both ACC andDCCdeveloped from the…

…(4) ACC andDCCdeveloped independently (colli…

Show Full Abstract

<h4>Background</h4>Pancreatic cancer composed of acinar cell carcinoma (ACC) and ductal adenocarcinoma (DAC) is rare, and the clinicopathological characteristics of ACC with DAC have yet to be elucidated. Herein, we report a case of ACC with a DAC component of the pancreas and examined the histogenesis of this tumor.<h4>Case presentation</h4>A 69-year-old man was admitted to our hospital complaining of appetite loss, constipation, epigastric dull pain, and jaundice. Abdominal computed tomography and magnetic resonance cholangiopancreatography revealed a pancreatic head tumor with dilatation of the bile duct and the distal main pancreatic duct. Under the diagnosis of pancreatic head cancer, a pancreatoduodenectomy was performed. The histology of the resected tumor consisted of mainly ACC with a focus of DAC, which was confirmed by mucin staining and immunohistochemistry for antigens such as BCL10, trypsin, Smad4, p16, p53, and MUC1. There was histological transition between the components of ACC and DAC, and immunostaining of the transitional zone showed equivocal results for the antigens. KRAS was wild-type in both ACC and DAC. The patient was treated with adjuvant chemotherapy with S-1 for 1 year. No evidence of recurrence or metastasis was observed after 9 years of follow-up.<h4>Conclusions</h4>A rare case of pancreatic ACC with a DAC component in a patient with long-term survival after surgery was reported. Immunohistochemical and molecular analysis indicated that DAC might have arisen from ACC through transdifferentiation in this case.

Also flagged:Episodic AtaxiasEAautosomal dominant diseasesataxiaautosomal dominant disorderscerebellar ataxia
Journal Article 2020-09-05 ✓ 1 Snippet Giunti P, Mantuano E, Frontali M.
In-Text Gene Mentions

…TPK1 , andDARS2gene).…

Show Full Abstract

The term Episodic Ataxias (EA) was originally used for a few autosomal dominant diseases, characterized by attacks of cerebellar dysfunction of variable duration and frequency, often accompanied by other ictal and interictal signs. The original group subsequently grew to include other very rare EAs, frequently reported in single families, for some of which no responsible gene was found. The clinical spectrum of these diseases has been enormously amplified over time. In addition, episodes of ataxia have been described as phenotypic variants in the context of several different disorders. The whole group is somewhat confused, since a strong evidence linking the mutation to a given phenotype has not always been established. In this review we will collect and examine all instances of ataxia episodes reported so far, emphasizing those for which the pathophysiology and the clinical spectrum is best defined.

Also flagged:Episodic ataxia type 2autosomal dominant neurological disorderataxiaacetazolamide4-aminopyridinegenetic diseases
Journal Article 2020-09-05 ✓ 3 Snippets Jaudon F, Baldassari S, Musante I, Thalhammer A, Zara F, Cingolani LA.
In-Text Gene Mentions

CACNA1B and CACNA1E are homologous to CACNA1A (59.4% and 54.0% identity at the amino acidic level, respectively) and, like CACNA1A, are extensively spliced, with the splicing pattern often conserved across the three mammalian CaV2 channels [7].

…α 1 subunit:CACNA1E).…

…CACNA1B andCACNA1Eare homologous to…

Show Full Abstract

Episodic ataxia type 2 (EA2) is an autosomal dominant neurological disorder characterized by paroxysmal attacks of ataxia, vertigo, and nausea that usually last hours to days. It is caused by loss-of-function mutations in <i>CACNA1A</i>, the gene encoding the pore-forming α<sub>1</sub> subunit of P/Q-type voltage-gated Ca<sup>2+</sup> channels. Although pharmacological treatments, such as acetazolamide and 4-aminopyridine, exist for EA2, they do not reduce or control the symptoms in all patients. <i>CACNA1A</i> is heavily spliced and some of the identified EA2 mutations are predicted to disrupt selective isoforms of this gene. Modulating splicing of <i>CACNA1A</i> may therefore represent a promising new strategy to develop improved EA2 therapies. Because RNA splicing is dysregulated in many other genetic diseases, several tools, such as antisense oligonucleotides, <i>trans</i>-splicing, and CRISPR-based strategies, have been developed for medical purposes. Here, we review splicing-based strategies used for genetic disorders, including those for Duchenne muscular dystrophy, spinal muscular dystrophy, and frontotemporal dementia with Parkinsonism linked to chromosome 17, and discuss their potential applicability to EA2.

Also flagged:SMAD7Colorectal Cancercancerluciferasebindingcell proliferation
Journal Article 2020-09-05 ✓ 1 Snippet Zhao X, Liu S, Yan B, Yang J, Chen E.
In-Text Gene Mentions

…( APC ,DCC) act as…

Show Full Abstract

Metastasis is a well-known poor prognostic factor and primary cause of mortality in patients with colorectal cancer (CRC). Recently, with the progress of high through-put sequencing, aberrantly expressed non-coding RNAs (ncRNAs) were found to participate in the initiation and development of cancer. However, the mechanisms of ncRNA-mediated regulation of metastasis in CRC remain largely unknown. In this study, we systematically analyzed the expression network of microRNAs (miRNAs) and genes in CRC metastasis using bioinformatics, and discovered that the miR-581/SMAD7 axis could be a potential factor that drives CRC metastasis. A dual luciferase report assay and protein analysis confirmed the binding relationship between miR-581 and SMAD7. Further functional assays revealed that miR-581 inhibition could suppress cell proliferation and induce apoptosis in SW480 cells. Up-regulation or down-regulation of miR-581 could both affect cell invasion capacity and modulate epithelial to mesenchymal transition (EMT) via a SMAD7/TGFβ signaling pathway. In conclusion, our findings elucidated that miR-581/SMAD7 could be essential for CRC metastasis, and may serve as a potential therapeutic target for CRC patients.

Also flagged:Tris-acetatepeptidescartilage oligomeric matrix proteinPC2metalloprotease-1MMP-1
Journal Article 2020-09-05 No Snippets Black RM, Wang Y, Struglics A, Lorenzo P, Tillgren V, Rydén M, Grodzinsky AJ, Önnerfjord P.
Show Full Abstract

<h4>Objectives</h4>In this exploratory study, we used discovery proteomics to follow the release of proteins from bovine knee articular cartilage in response to mechanical injury and cytokine treatment. We also studied the effect of the glucocorticoid Dexamethasone (Dex) on these responses.<h4>Design</h4>Bovine cartilage explants were treated with either cytokines alone (10 ng/ml TNFα, 20 ng/ml IL-6, 100 ng/ml sIL-6R), a single compressive mechanical injury, cytokines and injury, or no treatment, and cultured in serum-free DMEM supplemented with 1% ITS for 22 days. All samples were incubated with or without addition of 100 nM Dex. Mass spectrometry and western blot analyses were performed on medium samples for the identification and quantification of released proteins.<h4>Results</h4>We identified 500 unique proteins present in all three biological replicates. Many proteins involved in the catabolic response of cartilage degradation had increased release after inflammatory stress. Dex rescued many of these catabolic effects. The release of some proteins involved in anabolic and chondroprotective processes was inconsistent, indicating differential effects on processes that may protect cartilage from injury. Dex restored only a small fraction of these to the control state, while others had their effects exacerbated by Dex exposure.<h4>Conclusions</h4>We identified proteins that were released upon cytokine treatment which could be potential biomarkers of the inflammatory contribution to cartilage degradation. We also demonstrated the imperfect rescue of Dex on the effects of cartilage degradation, with many catabolic factors being reduced, while other anabolic or chondroprotective processes were not.

Also flagged:Cyanineperfluorocarbonslocalizationoxygenfluorinepolycyclic aromatic hydrocarbon
Journal Article 2020-09-04 No Snippets Lim I, Vian A, van de Wouw HL, Day RA, Gomez C, Liu Y, Rheingold AL, Campàs O, Sletten EM.
Show Full Abstract

The bioorthogonal nature of perfluorocarbons provides a unique platform for introducing dynamic nano- and microdroplets into cells and organisms. To monitor the localization and deformation of the droplets, fluorous soluble fluorophores that are compatible with standard fluorescent protein markers and applicable to cells, tissues, and small organisms are necessary. Here, we introduce fluorous cyanine dyes that represent the most red-shifted fluorous soluble fluorophores to date. We study the effect of covalently appended fluorous tags on the cyanine scaffold and evaluate the changes in photophysical properties imparted by the fluorous phase. Ultimately, we showcase the utility of the fluorous soluble pentamethine cyanine dye for tracking the localization of perfluorocarbon nanoemulsions in macrophage cells and for measurements of mechanical forces in multicellular spheroids and zebrafish embryonic tissues. These studies demonstrate that the red-shifted cyanine dyes offer spectral flexibility in multiplexed imaging experiments and enhanced precision in force measurements.

Also flagged:Huntington DiseaseHDtranslationalAmino acidspeptidepeptides
Journal Article 2020-09-04 ✓ 5 Snippets Cozzolino F, Landolfi A, Iacobucci I, Monaco V, Caterino M, Celentano S, Zuccato C, Cattaneo E, Monti M.
In-Text Gene Mentions

In western blot assays (Fig 5A), the expression levels of IRGM1, OSBPL2 and SERPIN B6, which were up-regulated in HD mice and hnRNP H, HTT, SAMM50, UQCRQ and HOMER1, whose expression was instead decreased in HD mice were evaluated on total protein extracts of three WT and three HD mice (the same samples employed for the proteomic experiment), in duplicate.

…4955), rabbit monoclonal anti-HTT(Cell Signalling Technology,…

…pooled respectively, andHTT, SERPIN B6, HOMER1,…

…run A, includedHTT, HOMER1, RIC8A; run…

…(HD) (homozygous mutantHTTknock in line…

Show Full Abstract

Spectral Counts approaches (SpCs) are largely employed for the comparison of protein expression profiles in label-free (LF) differential proteomics applications. Similarly, to other comparative methods, also SpCs based approaches require a normalization procedure before Fold Changes (FC) calculation. Here, we propose new Complexity Based Normalization (CBN) methods that introduced a variable adjustment factor (f), related to the complexity of the sample, both in terms of total number of identified proteins (CBN(P)) and as total number of spectral counts (CBN(S)). Both these new methods were compared with the Normalized Spectral Abundance Factor (NSAF) and the Spectral Counts log Ratio (Rsc), by using standard protein mixtures. Finally, to test the robustness and the effectiveness of the CBNs methods, they were employed for the comparative analysis of cortical protein extract from zQ175 mouse brains, model of Huntington Disease (HD), and control animals (raw data available via ProteomeXchange with identifier PXD017471). LF data were also validated by western blot and MRM based experiments. On standard mixtures, both CBN methods showed an excellent behavior in terms of reproducibility and coefficients of variation (CVs) in comparison to the other SpCs approaches. Overall, the CBN(P) method was demonstrated to be the most reliable and sensitive in detecting small differences in protein amounts when applied to biological samples.

Also flagged:distal cholangiocarcinomatumorcholangiocarcinomalymph node metastasesepithelial tumorgastrointestinal cancers
Journal Article 2020-09-04 No Snippets Byrling J, Kristl T, Hu D, Pla I, Sanchez A, Sasor A, Andersson R, Marko-Varga G, Andersson B.
Show Full Abstract

<h4>Background</h4>Distal cholangiocarcinoma is an aggressive malignancy with a dismal prognosis. Diagnostic and prognostic biomarkers for distal cholangiocarcinoma are lacking. The aim of the present study was to identify differentially expressed proteins between distal cholangiocarcinoma and normal bile duct samples.<h4>Methods</h4>A workflow utilizing discovery mass spectrometry and verification by parallel reaction monitoring was used to analyze surgically resected formalin-fixed, paraffin-embedded samples from distal cholangiocarcinoma patients and normal bile duct samples. Bioinformatic analysis was used for functional annotation and pathway analysis. Immunohistochemistry was performed to validate the expression of thrombospondin-2 and investigate its association with survival.<h4>Results</h4>In the discovery study, a total of 3057 proteins were identified. Eighty-seven proteins were found to be differentially expressed (q < 0.05 and fold change ≥ 2 or ≤ 0.5); 31 proteins were upregulated and 56 were downregulated in the distal cholangiocarcinoma samples compared to controls. Bioinformatic analysis revealed an abundance of differentially expressed proteins associated with the tumor reactive stroma. Parallel reaction monitoring verified 28 proteins as upregulated and 18 as downregulated in distal cholangiocarcinoma samples compared to controls. Immunohistochemical validation revealed thrombospondin-2 to be upregulated in distal cholangiocarcinoma epithelial and stromal compartments. In paired lymph node metastases samples, thrombospondin-2 expression was significantly lower; however, stromal thrombospondin-2 expression was still frequent (72%). Stromal thrombospondin-2 was an independent predictor of poor disease-free survival (HR 3.95, 95% CI 1.09-14.3; P = 0.037).<h4>Conclusion</h4>Several proteins without prior association with distal cholangiocarcinoma biology were identified and verified as differentially expressed between distal cholangiocarcinoma and normal bile duct samples. These proteins can be further evaluated to elucidate their biomarker potential and role in distal cholangiocarcinoma carcinogenesis. Stromal thrombospondin-2 is a potential prognostic marker in distal cholangiocarcinoma.

Also flagged:organizationchromosomesdigestionGCN4GB1antibody
Journal Article 2020-09-04 No Snippets Chaudhary N, Nho SH, Cho H, Gantumur N, Ra JS, Myung K, Kim H.
Show Full Abstract

The higher-order structural organization and dynamics of the chromosomes play a central role in gene regulation. To explore this structure-function relationship, it is necessary to directly visualize genomic elements in living cells. Genome imaging based on the CRISPR system is a powerful approach but has limited applicability due to background signals and nonspecific aggregation of fluorophores within nuclei. To address this issue, we developed a novel visualization scheme combining tripartite fluorescent proteins with the SunTag system and demonstrated that it strongly suppressed background fluorescence and amplified locus-specific signals, allowing long-term tracking of genomic loci. We integrated the multicomponent CRISPR system into stable cell lines to allow quantitative and reliable analysis of dynamic behaviors of genomic loci. Due to the greatly elevated signal-to-background ratio, target loci with only small numbers of sequence repeats could be successfully tracked, even under a conventional fluorescence microscope. This feature enables the application of CRISPR-based imaging to loci throughout the genome and opens up new possibilities for the study of nuclear processes in living cells.

Also flagged:organizationRac1synapsessynapsesmallGTPase
Journal Article 2020-09-04 ✓ 1 Snippet Nakazawa S, Yoshimura Y, Takagi M, Mizuno H, Iwasato T.
In-Text Gene Mentions

5-HTT

Show Full Abstract

Spatially-organized spontaneous activity is a characteristic feature of developing mammalian sensory systems. However, the transitions of spontaneous-activity spatial organization during development and related mechanisms remain largely unknown. We reported previously that layer 4 (L4) glutamatergic neurons in the mouse barrel cortex exhibit spontaneous activity with a patchwork-type pattern at postnatal day (P)5, which is during barrel formation. In the current work, we revealed that spontaneous activity in mouse barrel-cortex L4 glutamatergic neurons exhibits at least three phases during the first two weeks of postnatal development. Phase I activity has a patchwork-type pattern and is observed not only at P5, but also P1, before barrel formation. Phase II is found at P9, by which time barrel formation is completed, and exhibits broadly synchronized activity across barrel borders. Phase III emerges around P11 when L4-neuron activity is desynchronized. The Phase I activity, but not Phase II or III activity, is blocked by thalamic inhibition, demonstrating that the Phase I to II transition is associated with loss of thalamic dependency. Dominant-negative (DN)-Rac1 expression in L4 neurons hampers the Phase II to III transition. It also suppresses developmental increases in spine density and excitatory synapses of L4 neurons in the second postnatal week, suggesting that Rac1-mediated synapse maturation could underlie the Phase II to III transition. Our findings revealed the presence of distinct mechanisms for Phase I to II and Phase II to III transition. They also highlighted the role of a small GTPase in the developmental desynchronization of cortical spontaneous activity.<b>SIGNIFICANCE STATEMENT</b> Developing neocortex exhibits spatially-organized spontaneous activity, which plays a critical role in cortical circuit development. The features of spontaneous-activity spatial organization and the mechanisms underlying its changes during development remain largely unknown. In the present study, using two-photon <i>in vivo</i> imaging, we revealed three phases (Phases I, II, and III) of spontaneous activity in barrel-cortex layer 4 (L4) glutamatergic neurons during the first two postnatal weeks. We also demonstrated the presence of distinct mechanisms underlying phase transitions. Phase I to II shift arose from the switch in the L4-neuron driving source, and Phase II to III transition relied on L4-neuron Rac1 activity. These results provide new insights into the principles of developmental transitions of neocortical spontaneous-activity spatial patterns.

Also flagged:developmental delayautism spectrum disorderepileptic encephalopathyneurodevelopmental disordercognitive impairmentsocial-communication disorder
Journal Article 2020-09-04 No Snippets Llamosas N, Arora V, Vij R, Kilinc M, Bijoch L, Rojas C, Reich A, Sridharan B, Willems E, Piper DR, Scampavia L, Spicer TP, Miller CA, Holder JL, Rumbaugh G.
Show Full Abstract

<i>SYNGAP1</i> is a major genetic risk factor for global developmental delay, autism spectrum disorder, and epileptic encephalopathy. <i>De novo</i> loss-of-function variants in this gene cause a neurodevelopmental disorder defined by cognitive impairment, social-communication disorder, and early-onset seizures. Cell biological studies in mouse and rat neurons have shown that <i>Syngap1</i> regulates developing excitatory synapse structure and function, with loss-of-function variants driving formation of larger dendritic spines and stronger glutamatergic transmission. However, studies to date have been limited to mouse and rat neurons. Therefore, it remains unknown how <i>SYNGAP1</i> loss of function impacts the development and function of human neurons. To address this, we used CRISPR/Cas9 technology to ablate <i>SYNGAP1</i> protein expression in neurons derived from a commercially available induced pluripotent stem cell line (hiPSC) obtained from a human female donor. Reducing SynGAP protein expression in developing hiPSC-derived neurons enhanced dendritic morphogenesis, leading to larger neurons compared with those derived from isogenic controls. Consistent with larger dendritic fields, we also observed a greater number of morphologically defined excitatory synapses in cultures containing these neurons. Moreover, neurons with reduced SynGAP protein had stronger excitatory synapses and expressed synaptic activity earlier in development. Finally, distributed network spiking activity appeared earlier, was substantially elevated, and exhibited greater bursting behavior in <i>SYNGAP1</i> null neurons. We conclude that <i>SYNGAP1</i> regulates the postmitotic maturation of human neurons made from hiPSCs, which influences how activity develops within nascent neural networks. Alterations to this fundamental neurodevelopmental process may contribute to the etiology of <i>SYNGAP1</i>-related disorders.<b>SIGNIFICANCE STATEMENT</b><i>SYNGAP1</i> is a major genetic risk factor for global developmental delay, autism spectrum disorder, and epileptic encephalopathy. While this gene is well studied in rodent neurons, its function in human neurons remains unknown. We used CRISPR/Cas9 technology to disrupt <i>SYNGAP1</i> protein expression in neurons derived from an induced pluripotent stem cell line. We found that induced neurons lacking SynGAP expression exhibited accelerated dendritic morphogenesis, increased accumulation of postsynaptic markers, early expression of synapse activity, enhanced excitatory synaptic strength, and early onset of neural network activity. We conclude that <i>SYNGAP1</i> regulates the postmitotic differentiation rate of developing human neurons and disrupting this process impacts the function of nascent neural networks. These altered developmental processes may contribute to the etiology of <i>SYNGAP1</i> disorders.

Also flagged:unfolded proteinendoplasmic reticulummembrane proteinsIRE1ATF6PERK
Journal Article 2020-09-04 No Snippets Grandjean JMD, Wiseman RL.
Show Full Abstract

The unfolded protein response (UPR) plays a central role in regulating endoplasmic reticulum (ER) and global cellular physiology in response to pathologic ER stress. The UPR is comprised of three signaling pathways activated downstream of the ER membrane proteins IRE1, ATF6, and PERK. Once activated, these proteins initiate transcriptional and translational signaling that functions to alleviate ER stress, adapt cellular physiology, and dictate cell fate. Imbalances in UPR signaling are implicated in the pathogenesis of numerous, etiologically-diverse diseases, including many neurodegenerative diseases, protein misfolding diseases, diabetes, ischemic disorders, and cancer. This has led to significant interest in establishing pharmacologic strategies to selectively modulate IRE1, ATF6, or PERK signaling to both ameliorate pathologic imbalances in UPR signaling implicated in these different diseases and define the importance of the UPR in diverse cellular and organismal contexts. Recently, there has been significant progress in the identification and characterization of UPR modulating compounds, providing new opportunities to probe the pathologic and potentially therapeutic implications of UPR signaling in human disease. Here, we describe currently available UPR modulating compounds, specifically highlighting the strategies used for their discovery and specific advantages and disadvantages in their application for probing UPR function. Furthermore, we discuss lessons learned from the application of these compounds in cellular and <i>in vivo</i> models to identify favorable compound properties that can help drive the further translational development of selective UPR modulators for human disease.

Also flagged:bindingproteasomeribonucleasespermadhesin-1gelsolinglyceraldehyde-3-phosphate dehydrogenase
Journal Article 2020-09-04 ✓ 1 Snippet Gomes FP, Park R, Viana AG, Fernandez-Costa C, Topper E, Kaya A, Memili E, Yates JR, Moura AA.
In-Text Gene Mentions

…both PRDX1 andPRDX6are altered in…

Show Full Abstract

The present study investigated the seminal plasma proteome of Holstein bulls with low (LF; n = 6) and high (HF; n = 8) sperm freezability. The percentage of viable frozen-thawed sperm (%ViableSperm) determined by flow cytometry varied from -2.2 in LF to + 7.8 in HF bulls, as compared to the average %ViableSperm (54.7%) measured in an 860-sire population. Seminal proteins were analyzed by label free mass spectrometry, with the support of statistical and bioinformatics analyses. This approach identified 1,445 proteins, associated with protein folding, cell-cell adhesion, NADH dehydrogenase activity, ATP-binding, proteasome complex, among other processes. There were 338 seminal proteins differentially expressed (p < 0.05) in LF and HF bulls. Based on multivariate analysis, BSP5 and seminal ribonuclease defined the HF phenotype, while spermadhesin-1, gelsolin, tubulins, glyceraldehyde-3-phosphate dehydrogenase, calmodulin, ATP synthase, sperm equatorial segment protein 1, peroxiredoxin-5, secretoglobin family 1D and glucose-6-phosphate isomerase characterized the LF phenotype. Regression models indicated that %ViableSperm of bulls was related to seminal plasma peroxiredoxin-5, spermadhesin-1 and the spermadhesin-1 × BSP5 interaction (R<sup>2</sup> = 0.84 and 0.79; p < 0.05). This report is the largest dataset of bovine seminal plasma proteins. Specific proteins of the non-cellular microenvironment of semen are potential markers of sperm cryotolerance.

Also flagged:oxygencardiac rhythmcardiovascular diseasefertilizationIsoproterenolresponse
Journal Article 2020-09-04 No Snippets Santoso F, Farhan A, Castillo AL, Malhotra N, Saputra F, Kurnia KA, Chen KH, Huang JC, Chen JR, Hsiao CD.
Show Full Abstract

The heart is the most important muscular organ of the cardiovascular system, which pumps blood and circulates, supplying oxygen and nutrients to peripheral tissues. Zebrafish have been widely explored in cardiotoxicity research. For example, the zebrafish embryo has been used as a human heart model due to its body transparency, surviving several days without circulation, and facilitating mutant identification to recapitulate human diseases. On the other hand, adult zebrafish can exhibit the amazing regenerative heart muscle capacity, while adult mammalian hearts lack this potential. This review paper offers a brief description of the major methodologies used to detect zebrafish cardiac rhythm at both embryonic and adult stages. The dynamic pixel change method was mostly performed for the embryonic stage. Other techniques, such as kymography, laser confocal microscopy, artificial intelligence, and electrocardiography (ECG) have also been applied to study heartbeat in zebrafish embryos. Nevertheless, ECG is widely used for heartbeat detection in adult zebrafish since ECG waveforms' similarity between zebrafish and humans is prominent. High-frequency ultrasound imaging (echocardiography) and modern electronic sensor tag also have been proposed. Despite the fact that each method has its benefits and limitations, it is proved that zebrafish have become a promising animal model for human cardiovascular disease, drug pharmaceutical, and toxicological research. Using those tools, we conclude that zebrafish behaviors as an excellent small animal model to perform real-time monitoring for the developmental heart process with transparent body appearance, to conduct the in vivo cardiovascular performance and gene function assays, as well as to perform high-throughput/high content drug screening.

Also flagged:Strokeoxygenacute ischemic strokeischemic strokeOxygenationStrokes
Journal Article 2020-09-04 No Snippets Cozene B, Sadanandan N, Gonzales-Portillo B, Saft M, Cho J, Park YJ, Borlongan CV.
Show Full Abstract

Stroke serves as a life-threatening disease and continues to face many challenges in the development of safe and effective therapeutic options. The use of hyperbaric oxygen therapy (HBOT) demonstrates pre-clinical effectiveness for the treatment of acute ischemic stroke and reports reductions in oxidative stress, inflammation, and neural apoptosis. These pathophysiological benefits contribute to improved functional recovery. Current pre-clinical and clinical studies are testing the applications of HBOT for stroke neuroprotection, including its use as a preconditioning regimen. Mild oxidative stress may be able to prime the brain to tolerate full extensive oxidative stress that occurs during a stroke, and HBOT preconditioning has displayed efficacy in establishing such ischemic tolerance. In this review, evidence on the use of HBOT following an ischemic stroke is examined, and the potential for HBOT preconditioning as a neuroprotective strategy. Additionally, HBOT as a stem cell preconditioning is also discussed as a promising strategy, thus maximizing the use of HBOT for ischemic stroke.

Also flagged:iron oxidepolyolfolic acidnanostructuressilicaBreast Cancer
Journal Article 2020-09-04 No Snippets Heydari Sheikh Hossein H, Jabbari I, Zarepour A, Zarrabi A, Ashrafizadeh M, Taherian A, Makvandi P.
Show Full Abstract

In recent years, the intrinsic magnetic properties of magnetic nanoparticles (MNPs) have made them one of the most promising candidates for magnetic resonance imaging (MRI). This study aims to evaluate the effect of different coating agents (with and without targeting agents) on the magnetic property of MNPs. In detail, iron oxide nanoparticles (IONPs) were prepared by the polyol method. The nanoparticles were then divided into two groups, one of which was coated with silica (SiO<sub>2</sub>) and hyperbranched polyglycerol (HPG) (SPION@SiO<sub>2</sub>@HPG); the other was covered by HPG alone (SPION@HPG). In the following section, folic acid (FA), as a targeting agent, was attached on the surface of nanoparticles. Physicochemical properties of nanostructures were characterized using Fourier transform infrared spectroscopy (FT-IR), transmission electron microscopy (TEM), and a vibrating sample magnetometer (VSM). TEM results showed that SPION@HPG was monodispersed with the average size of about 20 nm, while SPION@SiO<sub>2</sub>@HPG had a size of about 25 nm. Moreover, HPG coated nanoparticles had much lower magnetic saturation than the silica coated ones. The MR signal intensity of the nanostructures showed a relation between increasing the nanoparticle concentrations inside the MCF-7 cells and decreasing the signal related to the <i>T<sub>2</sub></i> relaxation time. The comparison of coating showed that SPION@SiO<sub>2</sub>@HPG (with/without a targeting agent) had significantly higher <i>r</i><sub>2</sub> value in comparison to Fe<sub>3</sub>O<sub>4</sub>@HPG. Based on the results of this study, the Fe<sub>3</sub>O<sub>4</sub>@SiO<sub>2</sub>@HPG-FA nanoparticles have shown the best magnetic properties, and can be considered promising contrast agents for magnetic resonance imaging applications.

Also flagged:COVID-19ReninCoronavirus disease 2019hypertensionatherothrombosisSARS
Journal Article 2020-09-04 ✓ 1 Snippet Lumpuy-Castillo J, Lorenzo-Almorós A, Pello-Lázaro AM, Sánchez-Ferrer C, Egido J, Tuñón J, Peiró C, Lorenzo Ó.
In-Text Gene Mentions

…agents such asantithrombin-III, protein C, or…

Show Full Abstract

Coronavirus disease 2019 (COVID-19) is usually more severe and associated with worst outcomes in individuals with pre-existing cardiovascular pathologies, including hypertension or atherothrombosis. Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) can differentially infect multiple tissues (i.e., lung, vessel, heart, liver) in different stages of disease, and in an age- and sex-dependent manner. In particular, cardiovascular (CV) cells (e.g., endothelial cells, cardiomyocytes) could be directly infected and indirectly disturbed by systemic alterations, leading to hyperinflammatory, apoptotic, thrombotic, and vasoconstrictive responses. Until now, hundreds of clinical trials are testing antivirals and immunomodulators to decrease SARS-CoV-2 infection or related systemic anomalies. However, new therapies targeting the CV system might reduce the severity and lethality of disease. In this line, activation of the non-canonical pathway of the renin-angiotensin-aldosterone system (RAAS) could improve CV homeostasis under COVID-19. In particular, treatments with angiotensin-converting enzyme inhibitors (ACEi) and angiotensin-receptor blockers (ARB) may help to reduce hyperinflammation and viral propagation, while infusion of soluble ACE2 may trap plasma viral particles and increase cardioprotective Ang-(1-9) and Ang-(1-7) peptides. The association of specific ACE2 polymorphisms with increased susceptibility of infection and related CV pathologies suggests potential genetic therapies. Moreover, specific agonists of Ang-(1-7) receptor could counter-regulate the hypertensive, hyperinflammatory, and hypercoagulable responses. Interestingly, sex hormones could also regulate all these RAAS components. Therefore, while waiting for an efficient vaccine, we suggest further investigations on the non-canonical RAAS pathway to reduce cardiovascular damage and mortality in COVID-19 patients.

Also flagged:Atopic dermatitispathogenesisepidermal structural proteinsimmune responsesmethylationhistone
Journal Article 2020-09-04 ✓ 1 Snippet Nedoszytko B, Reszka E, Gutowska-Owsiak D, Trzeciak M, Lange M, Jarczak J, Niedoszytko M, Jablonska E, Romantowski J, Strapagiel D, Skokowski J, Siekierzycka A, Nowicki RJ, Dobrucki IT, Zaryczańska A, Kalinowski L.
In-Text Gene Mentions

…ting the dysregulated miR-335/SOX6axis [ 111…

Show Full Abstract

Atopic dermatitis is a heterogeneous disease, in which the pathogenesis is associated with mutations in genes encoding epidermal structural proteins, barrier enzymes, and their inhibitors; the role of genes regulating innate and adaptive immune responses and environmental factors inducing the disease is also noted. Recent studies point to the key role of epigenetic changes in the development of the disease. Epigenetic modifications are mainly mediated by DNA methylation, histone acetylation, and the action of specific non-coding RNAs. It has been documented that the profile of epigenetic changes in patients with atopic dermatitis (AD) differs from that observed in healthy people. This applies to the genes affecting the regulation of immune response and inflammatory processes, e.g., both affecting Th1 bias and promoting Th2 responses and the genes of innate immunity, as well as those encoding the structural proteins of the epidermis. Understanding of the epigenetic alterations is therefore pivotal to both create new molecular classifications of atopic dermatitis and to enable the development of personalized treatment strategies.

Also flagged:tumorcancercross-presentationcell activationdoxorubicinindocyanine green
Journal Article 2020-09-04 No Snippets Qin L, Cao J, Shao K, Tong F, Yang Z, Lei T, Wang Y, Hu C, Umeshappa CS, Gao H, Peppas NA.
Show Full Abstract

Application of cancer vaccines is limited due to their systemic immunotoxicity and inability to satisfy all the steps, including loading of tumor antigens, draining of antigens to lymph nodes (LNs), internalization of antigens by dendritic cells (DCs), DC maturation, and cross-presentation of antigens for T cell activation. Here, we present a combinatorial therapy, based on a α-cyclodextrin (CD)-based gel system, DOX/ICG/CpG-P-ss-M/CD, fabricated by encapsulating doxorubicin (DOX) and the photothermal agent indocyanine green (ICG). Upon irradiation, the gel system exhibited heat-responsive release of DOX and vaccine-like nanoparticles, CpG-P-ss-M, along with chemotherapy- and phototherapy-generated abundant tumor-specific antigen storage in situ. The released CpG-P-ss-M acted as a carrier adsorbed and delivered antigens to LNs, promoting the uptake of antigens by DCs and DC maturation. Notably, combined with PD-L1 blocking, the therapy effectively inhibited primary tumor growth and induced tumor-specific immune response against tumor recurrence and metastasis.

Also flagged:acute coronary syndromesST-elevation myocardial infarctioncoronary heart diseasedeathmyocardial infarctionMI
Journal Article 2020-09-04 No Snippets Vu HTT, Pham HM, Nguyen HTT, Nguyen QN, Do LD, Pham NM, Norman R, Huxley RR, Lee CMY, Reid CM.
Show Full Abstract

<h4>Background</h4>Little is known about percutaneous coronary intervention (PCI) practices and outcomes in low-and middle-income nations, despite its rapid uptake across Asia. For the first time, we report on clinical characteristics and in-hospital outcomes for patients undergoing PCI at a leading cardiac centre in Vietnam.<h4>Methods</h4>Information on characteristics, treatments, and outcomes of patients undergoing PCI was collected into the first PCI registry through direct interviews using a standardised form, medical record abstraction, and reading PCI imaging data on secured disks. Subgroup analysis was also conducted to explore gender differences.<h4>Results</h4>Between September 2017 and May 2018, 1022 patients undergoing PCI were recruited from a total of 1041 procedures. The mean age was 68.3 years and two thirds were male. While 54.4% of patients presented with acute coronary syndromes, the rate of ST-elevation myocardial infarction was 14.5%. The majority of lesions were classified as type B2 and C and the radial artery was the most common access location for PCI (79.2%). The use of drug-eluting stents was universal and the angiographic success rate was 99.4%. Cardiac complications following PCI were rare with the exception of major bleeding (2.0%). Female patients were older with relatively more comorbidities and a higher incidence of major bleeding than males (p < 0.05).<h4>Conclusions</h4>Findings of this study provide an opportunity to benchmark current PCI practices in Vietnam, identify possible care gaps and potentially inform the adoption of treatment guidelines as well as use of prevention strategies.

Also flagged:Catastrophic thrombotic syndromethrombotic stormTSfactor VIIIpulmonary embolismST-elevation myocardial infarction
Journal Article 2020-09-04 ✓ 1 Snippet Kropf J, Cheyney S, Vachon J, Flaherty P, Vo M, Carlan SJ.
In-Text Gene Mentions

…and antithrombin III (ATIII).…

Show Full Abstract

Catastrophic thrombotic syndrome, otherwise known as thrombotic storm (TS) is an extreme prothrombotic clinical syndrome that presents as rapid onset of multiple thromboembolic events affecting a large variety of vasculature. In recent studies, there has been a correlation of high plasma levels of factor VIII with thrombotic events. We present the case of a young man who exhibited multi-organ failure due to thrombotic storm. A 38-year-old male presented to the emergency department for progressive dyspnea and was diagnosed to have pulmonary embolism. The patient developed respiratory distress requiring intubation and was diagnosed with both an ST-elevation myocardial infarction and right cerebral infarction during the hospital course. The patient expired and autopsy revealed the cause of death to be myocardial, cerebral and renal infarction from widespread vascular thrombosis. Autopsy revealed cause of death to be elevated factor VIII associated thrombotic coagulopathy. Factor VIII level upon autopsy was 375% (55-200%). Although TS is rare, it can be lifethreatening if not recognized early. Survival depends on the prompt initiation and duration of anticoagulation.

Also flagged:PhosphoruschromosomeschromosomemineralP deficiencycalcium
Journal Article 2020-09-04 ✓ 1 Snippet Gao S, Xia J, Yuan S, Shen Y, Zhong X, Zhang S, Li Y, Hu D, Zeng J, Lan T, Liu Y, Chen G.
In-Text Gene Mentions

…Classification Values Units Soil pH 6.89 – Organic content 15.8 g kg–1 Total nitrogen (N) 0.4 g kg–1 Alkali-hydrolyzable N 44.68 mg kg–1 Available P 5.14 mg kg–1 Rapidly available kalium (K) 23.69 mg kg–1 Ca2−P 7.25 mg kg–1 Ca8−P 3.97 mg kg–1 Ca10−P 230.67 mg kg–1 Al−P 16.2 mg kg–1 Fe−P 76.85 mg kg–1 Organic−P 100.54 mg kg–1 Active phytate P 2.25 mg kg–1 Secondary active phytate P 145.12 mg kg–1 Secondary stable phytate P 39.75 mg kg–1 High stable phytate P 8.08 mg kg–1 For each replication, 10 uniformly sized seeds of each of RILs as well as the parents were surface-sterilized by soaking in a 10% solution of hydroperoxide (H2O2) for 30 min followed by washing in deionized water.…

Show Full Abstract

Phosphorus (P) deficiency in agricultural soil is a major constraint for crop production and increasing P acquisition efficiency (PAE) of plants is considered as one of the most cost-effective solutions for yield increase. The objective of this study was to detect quantitative trait loci (QTL) controlling (PAE) and P utilization efficiency (PUE) in barley under applied (+P) and non-applied P (-P) conditions. Based on the analysis of a recombinant inbred lines (RILs) population derived from a cross between a malting barley variety and a wild barley accession, 17 QTL controlling PAE, PUE and yield traits were detected. The phenotypic variation explained by each of these QTL ranges from 11.0 to 24.7%. Significant correlation was detected between most of P-related traits and yield traits. Five QTL clusters were identified on four different chromosomes (1H, 3H, 5H, and 7H). Two of the QTL clusters, located on chromosome 1H (for GPUP/PUP) and 7H (for SPUE/SPC), respectively, are novel. Fourteen genes located in the interval harboring the major QTL were identified as candidates associated with P efficiency. The stable QTL for PAE, PUE and yield-related traits could be important for breeding P-efficient barley varieties.

Also flagged:acute myeloid leukemiaAMLhematological malignanciesneoplasiasAcute leukemiasmalignant
Journal Article 2020-09-04 ✓ 1 Snippet Brukman-Jimenez SA, Bobadilla-Morales L, Corona-Rivera JR, Chávez-Panduro PA, Ortega-de-la-Torre C, Santana-Bejarano UF, Torres-Anguiano E, Mendoza-Maldonado L, Sánchez-Zubieta FA, Corona-Rivera A.
In-Text Gene Mentions

…ABL1), t(10;11)(p12;q23) (MLL-MLLT10), t(11;17)(q23;q21) (MLL-MLLT…

Show Full Abstract

<h4>Background</h4>Acute leukemias represent the main malignancies occurring among children under the age of 15 years. Around 17% corresponds to acute myeloid leukemia (AML). The cytogenetic analysis of bone marrow complements the diagnosis of hematological malignancies, therefore finding chromosomal aberrations provides a more reliable prognosis of the disease. Among the cytogenetic aberrations, sole trisomy is frequent in malignant neoplasias, but few cases related to AML have been reported.<h4>Case presentation</h4>We report a sole trisomy 6 in a pediatric patient diagnosed as AML M4 and poor progression. We carried out a literature review of AML patients with sole trisomy 6 and compared their evolution against AML patients with normal karyotype.<h4>Conclusions</h4>This is the first case of pediatric AML M4 with this cytogenetic finding. Sole trisomy 6 is infrequently reported in AML but scarce in pediatric cases. Based on overall survival analysis, we suggest that sole trisomy 6 could be associated with poor prognosis, in both, adult as well as pediatric AML.

Also flagged:Biosynthesisfolatecoppernasopharyngeal cancersynthesispolylactide
Journal Article 2020-09-03 No Snippets Guo LM, Xu XM, Zhao D, Cai XG, Zhou B.
Show Full Abstract

Cytotoxicity of CuO nanoparticles (NPs) are an impediment in utilizing them as an effective nanocarriers of chemotherapeutic drugs for targeted drug delivery in nasopharyngeal cancer. In our current study, we have designed a two-step synthesis and coating of CuO NPs with different concentrations of PLGA (polylactide-co-glycolide) to reduce the cytotoxicity. This was further conjugated with folic acid to enhance targeting to specific tissue. The multiple drugs loaded in the NPs were two potent anticancer drugs doxorubicin and docetaxel. A complete characterization studies including micrographic analysis, zeta potential measurements, polydispersity index, Fourier transform infrared spectroscopy (FTIR), encapsulation and loading efficiencies, stability and in vitro release studies were done. Cytoxicity studies were done with MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, acridine orange/ethidium bromide and DAPI (4, 6-diamidino-2-phenylindole, dihydrochloride) staining procedures. Impediametric studies were also carried out to reinforce the reduction in cytotoxicity. Finally the cellular uptake of the NPs was seen. It was evident from the results that the multiple drugs loaded CuO NPs formed with PLGA coating were uniform, non-agglomerated in size ranging from 180 to 195 nm. The FTIR revealed no major changes in drug peaks. Encapsulation and loading efficiencies showed sufficient amount of drug being loaded into the NPs. The drug loaded NPs showed no change in size or zeta potential even after a period of 30 days. The cytotoxicity studies revealed significant reduction in toxicity after coating the surface treated with PLGA as evident from the microscopic analysis of cells. Hence the current study may be prioritized and further in vivo/in vitro studies may be carried out.

Also flagged:coronavirus disease 2019COVID-19conjunctivitisangiotensin converting enzyme-2infectioninfections
Journal Article 2020-09-03 ✓ 1 Snippet Al-Sharif E, Strianese D, AlMadhi NH, D'Aponte A, dell'Omo R, Di Benedetto R, Costagliola C.
In-Text Gene Mentions

…with SARS-CoV-1 andMERS-CoV-1in the context…

Show Full Abstract

<h4>Purpose</h4>Several studies have reported conflicting results on ocular manifestations and transmission of coronavirus disease 2019 (COVID-19) whose causative virus, SARS-CoV-2, belongs to the coronavirus family, the seventh recognized as a human pathogen and the third causing a severe clinical syndrome. COVID-19 primarily affects the lungs, similar to the other human coronaviruses. Comparing the relation between the animal-to-human transmitted coronaviruses (SARS-CoV-1, SARS-Cov-2, MERS-CoV, CoV-229E, NL63, OC43, HKU1) and the eye may contribute to determining their actual eye-tissue tropism and risk of ocular transmission.<h4>Methods</h4>Literature review was conducted via Pubmed.gov, Google Scholar and medRixv using the following keywords: COVID-19, SARS-CoV-2, SARS-CoV-1, MERS-CoV, CoV-229E, NL63, OC43, HKU1, conjunctivitis, tear swab, ocular expression, ocular symptoms and human angiotensin converting enzyme-2 expression. Studies with lack in methodology were excluded.<h4>Results</h4>Sixteen observational studies were selected. The range for detection of viral RNA in tears was 0-8% for SARS-CoV-1 and 0-5.3% for SARS-CoV-2, while no reports were found for other coronaviruses. Ocular manifestations have been reported for NL63 and SARS-CoV-2. Ocular symptoms in the form of conjunctivitis/conjunctival congestion predominantly were detected in 65 (3.17%) out of 2048 reported patients with COVID-19 (range of 0.8-32%). Eye symptoms were not reported for the other coronaviruses.<h4>Conclusions</h4>Data aggregation for coronaviruses shows a relatively low eye-tissue tropism. Conjunctival congestion is an uncommon manifestation of COVID-19 similar to all human coronaviruses' infections. In a low percentage of patients, the virus can be excreted in ocular fluids at different stages of the infection, regardless of positive SARS-Cov-2 throat swab. Albeit high viral loads in ocular tissue seem to have relatively low prevalence, the eye should be regarded as a potential source of infection dissemination for COVID-19.

Also flagged:tauopathytautauopathiesneurodegenerative proteinopathiesproteinopathiesantibodies
Journal Article 2020-09-03 No Snippets Wiersma VI, Hoozemans JJM, Scheper W.
Show Full Abstract

In the brains of tauopathy patients, tau pathology coincides with the presence of granulovacuolar degeneration bodies (GVBs) both at the regional and cellular level. Recently, it was shown that intracellular tau pathology causes GVB formation in experimental models thus explaining the strong correlation between these neuropathological hallmarks in the human brain. These novel models of GVB formation provide opportunities for future research into GVB biology, but also urge reevaluation of previous post-mortem observations. Here, we review neuropathological data on GVBs in tauopathies and other neurodegenerative proteinopathies. We discuss the possibility that intracellular aggregates composed of proteins other than tau are also able to induce GVB formation. Furthermore, the potential mechanisms of GVB formation and the downstream functional implications hereof are outlined in view of the current available data. In addition, we provide guidelines for the identification of GVBs in tissue and cell models that will help to facilitate and streamline research towards the elucidation of the role of these enigmatic and understudied structures in neurodegeneration.

Also flagged:SMOC2SPARC-related modular calcium-binding protein 2colorectal cancercancerhyperplastic polypsadenomas
Journal Article 2020-09-03 ✓ 5 Snippets Jang BG, Kim HS, Bae JM, Kim WH, Kim HU, Kang GH.
In-Text Gene Mentions

As SMOC2 is enriched in the stem cells of the intestinal crypts, we examined whether there is any correlation between SMOC2 and other ISC markers, including LGR5, ASCL2, EPHB2, and OLFM4. We found that only OLFM4 demonstrated a positive association with SMOC2 (r2 = 0.15, P = 0.04) (Fig. 1c), suggesting that the close relationship between ISC signature genes observed in the normal stem cell niche is disrupted during cancer development.

In our study, we showed that SMOC2 transcript level was higher in CRC samples than in normal mucosa (P = 0.017); this level was not associated with candidate cancer stem cell markers (CD44, CD166, CD133, and CD24) or intestinal stem cell markers (LGR5, ASCL2, and EPHB2) except for OLFM4 (P = 0.04).

…) except forOLFM4( P =…

…70888_s1 (ASCL2), Hs00197437 (OLFM4), Hs00362096-m1 (EPHB2), Hs01…

…EPHB2 , andOLFM4.…

Show Full Abstract

We aimed to investigate the expression profile of SPARC-related modular calcium-binding protein 2 (SMOC2) during colorectal cancer (CRC) progression and assess its prognostic impact in CRC patients. In our study, we showed that SMOC2 transcript level was higher in CRC samples than in normal mucosa (P = 0.017); this level was not associated with candidate cancer stem cell markers (CD44, CD166, CD133, and CD24) or intestinal stem cell markers (LGR5, ASCL2, and EPHB2) except for OLFM4 (P = 0.04). Immunohistochemical analysis showed that SMOC2-positive cells were confined to the crypt bases in the normal intestinal mucosa, hyperplastic polyps, and sessile serrated adenomas, whereas traditional serrated adenomas and conventional adenomas exhibited focal or diffuse distribution patterns. In total, 28% of 591 CRCs were positive for SMOC2, but SMOC2 positivity had negative correlations with lymphatic invasion (P = 0.002), venous invasion (P = 0.002), and tumor stage (P < 0.001). However, a positive association with nuclear β-catenin expression was seen. Furthermore, while upregulated SMOC2 expression was maintained during the adenoma-carcinoma transition, it decreased in cancer cells at the invasive front but did not decline further during lymph node metastasis. SMOC2 positivity showed no correlations with molecular abnormalities, including microsatellite instability, CpG island methylator phenotype, and mutations of KRAS and BRAF. In addition, we showed comprehensively that SMOC2 positivity is an independent prognostic marker for better clinical outcomes in a large cohort of CRC patients (P = 0.006). In vitro studies also demonstrated that induced SMOC2 expression in DLD1 cells exerts a suppressive role in tumor growth as well as in migration, colony, and sphere formation abilities. Taken together, our results suggest SMOC2 as a candidate tumor suppressor in CRC progression.

Also flagged:FOXA1Chromatintranscription factorbreast canceraromatasebinding
Journal Article 2020-09-03 ✓ 1 Snippet Arruabarrena-Aristorena A, Maag JLV, Kittane S, Cai Y, Karthaus WR, Ladewig E, Park J, Kannan S, Ferrando L, Cocco E, Ho SY, Tan DS, Sallaku M, Wu F, Acevedo B, Selenica P, Ross DS, Witkin M, Sawyers CL, Reis-Filho JS, Verma CS, Jauch R, Koche R, Baselga J, Razavi P, Toska E, Scaltriti M.
In-Text Gene Mentions

linker histones

Show Full Abstract

Mutations in the pioneer transcription factor FOXA1 are a hallmark of estrogen receptor-positive (ER<sup>+</sup>) breast cancers. Examining FOXA1 in ∼5,000 breast cancer patients identifies several hotspot mutations in the Wing2 region and a breast cancer-specific mutation SY242CS, located in the third β strand. Using a clinico-genomically curated cohort, together with breast cancer models, we find that FOXA1 mutations associate with a lower response to aromatase inhibitors. Mechanistically, Wing2 mutations display increased chromatin binding at ER loci upon estrogen stimulation, and an enhanced ER-mediated transcription without changes in chromatin accessibility. In contrast, SY242CS shows neomorphic properties that include the ability to open distinct chromatin regions and activate an alternative cistrome and transcriptome. Structural modeling predicts that SY242CS confers a conformational change that mediates stable binding to a non-canonical DNA motif. Taken together, our results provide insights into how FOXA1 mutations perturb its function to dictate cancer progression and therapeutic response.

Also flagged:KLF5COX2PTENcancerssignal transductioncyclooxygenase2
Journal Article 2020-09-03 ✓ 1 Snippet Zhang L, Wu Y, Wu J, Zhou M, Li D, Wan X, Jin F, Wang Y, Lin W, Zha X, Liu Y.
In-Text Gene Mentions

Tumor suppressor gene PTENsuppressor gene PTEN…

Show Full Abstract

Tumor suppressor gene PTEN is frequently mutated in a wide variety of cancers. However, the downstream targets or signal transduction pathways of PTEN remain not fully understood. By analyzing Pten-null mouse embryonic fibroblasts (MEFs) cell lines and their isogenic counterparts, we showed that loss of PTEN led to increased cyclooxygenase2 (COX2) expression in an AKT-independent manner. Moreover, we demonstrated that PTEN deficiency promotes the transcription of COX2 via upregulation of the transcription factor Krüppel-like factor 5 (KLF5). Knocked down the expression of COX2 suppressed proliferation, migration and tumoral growth of Pten-null cells. Further experiments revealed that COX2 enhanced Pten-null MEFs growth and migration through upregulation of NADPH oxidase 4 (NOX4). In addition, MK-2206, a specific inhibitor of AKT, in combination with celecoxib, a COX2 inhibitor, strongly inhibited Pten-deficient cell growth. We concluded that KLF5/COX2/NOX4 signaling pathway is critical for cell growth and migration caused by the loss of PTEN, and the combination of MK-2206 and celecoxib may be an effective new approach to treating PTEN deficiency related tumors.

Also flagged:CNS-Adrenergic ReceptorsEpinephrinenorepinephrinepsychostimulantsadrenergic receptorspositron
Journal Article 2020-09-03 No Snippets Alluri SR, Kim SW, Volkow ND, Kil KE.
Show Full Abstract

Epinephrine (E) and norepinephrine (NE) play diverse roles in our body's physiology. In addition to their role in the peripheral nervous system (PNS), E/NE systems including their receptors are critical to the central nervous system (CNS) and to mental health. Various antipsychotics, antidepressants, and psychostimulants exert their influence partially through different subtypes of adrenergic receptors (ARs). Despite the potential of pharmacological applications and long history of research related to E/NE systems, research efforts to identify the roles of ARs in the human brain taking advantage of imaging have been limited by the lack of subtype specific ligands for ARs and brain penetrability issues. This review provides an overview of the development of positron emission tomography (PET) radiotracers for in vivo imaging of AR system in the brain.

Also flagged:Neurodegenerative proteinopathiesproteostasissynthesisdegradationproteinopathiespolypeptide
Journal Article 2020-09-03 No Snippets Lualdi M, Alberio T, Fasano M.
Show Full Abstract

Neurodegenerative proteinopathies are complex diseases that share some pathogenetic processes. One of these is the failure of the proteostasis network (PN), which includes all components involved in the synthesis, folding, and degradation of proteins, thus leading to the aberrant accumulation of toxic protein aggregates in neurons. The single components that belong to the three main modules of the PN are highly interconnected and can be considered as part of a single giant network. Several pharmacological strategies have been proposed to ameliorate neurodegeneration by targeting PN components. Nevertheless, effective disease-modifying therapies are still lacking. In this review article, after a general description of the PN and its failure in proteinopathies, we will focus on the available pharmacological tools to target proteostasis. In this context, we will discuss the main advantages of systems-based pharmacology in contrast to the classical targeted approach, by focusing on network pharmacology as a strategy to innovate rational drug design.

Also flagged:Hepatic SteatosisNon-alcoholic fatty liver diseaseNAFLDsteatosisfatty liverfatty
Journal Article 2020-09-03 ✓ 2 Snippets Jung TY, Kim MS, Hong HP, Kang KA, Jun DW.
In-Text Gene Mentions

…biliary cirrhosis, andhemochromatosis( Figure 1…

…Wilson’s disease orhemochromatosis.…

Show Full Abstract

Several hepatic steatosis formulae have been validated in various cohorts using ultrasonography. However, none of these studies has been validated in a community-based setting using the gold standard method. Thus, the aim of this study was to externally validate hepatic steatosis formulae in community-based settings using magnetic resonance imaging (MRI). A total of 1301 community-based health checkup subjects who underwent liver fat quantification with MRI were enrolled in this study. Diagnostic performance was assessed using the area under the receiver operating characteristic curve (AUROC). Non-alcoholic fatty liver disease (NAFLD) liver fat score showed the highest diagnostic performance with an AUROC of 0.72, followed by Framingham steatosis index (0.70), hepatic steatosis index (HSI, 0.69), ZJU index (0.69), and fatty liver index (FLI, 0.68). There were considerable gray zones in three fatty liver prediction models using two cutoffs (FLI, 28.9%; HSI, 48.9%; and ZJU index, 53.6%). The diagnostic performance of NAFLD liver fat score for detecting steatosis was comparable to that of ultrasonography. The diagnostic agreement was 72.7% between NAFLD liver fat score and 70.9% between ultrasound and MRI. In conclusion, the NAFLD liver fat score showed the best diagnostic performance for detecting hepatic steatosis. Its diagnostic performance was comparable to that of ultrasonography in a community-based setting.

Also flagged:epileptic encephalopathiesepilepsiesEarly infantile epileptic encephalopathyEIEEDEEepilepsy
Journal Article 2020-09-03 No Snippets Takai A, Yamaguchi M, Yoshida H, Chiyonobu T.
Show Full Abstract

Developmental and epileptic encephalopathies (DEEs) are the spectrum of severe epilepsies characterized by early-onset, refractory seizures occurring in the context of developmental regression or plateauing. Early infantile epileptic encephalopathy (EIEE) is one of the earliest forms of DEE, manifesting as frequent epileptic spasms and characteristic electroencephalogram findings in early infancy. In recent years, next-generation sequencing approaches have identified a number of monogenic determinants underlying DEE. In the case of EIEE, 85 genes have been registered in Online Mendelian Inheritance in Man as causative genes. Model organisms are indispensable tools for understanding the in vivo roles of the newly identified causative genes. In this review, we first present an overview of epilepsy and its genetic etiology, especially focusing on EIEE and then briefly summarize epilepsy research using animal and patient-derived induced pluripotent stem cell (iPSC) models. The <i>Drosophila</i> model, which is characterized by easy gene manipulation, a short generation time, low cost and fewer ethical restrictions when designing experiments, is optimal for understanding the genetics of DEE. We therefore highlight studies with <i>Drosophila</i> models for EIEE and discuss the future development of their practical use.

Also flagged:Type I Interferoninfectionautoimmune diseasescancerimmune responseIFN
Journal Article 2020-09-03 No Snippets Suarez B, Prats-Mari L, Unfried JP, Fortes P.
Show Full Abstract

The proper functioning of the immune system requires a robust control over a delicate equilibrium between an ineffective response and immune overactivation. Poor responses to viral insults may lead to chronic or overwhelming infection, whereas unrestrained activation can cause autoimmune diseases and cancer. Control over the magnitude and duration of the antiviral immune response is exerted by a finely tuned positive or negative regulation at the DNA, RNA, and protein level of members of the type I interferon (IFN) signaling pathways and on the expression and activity of antiviral and proinflammatory factors. As summarized in this review, committed research during the last decade has shown that several of these processes are exquisitely regulated by long non-coding RNAs (lncRNAs), transcripts with poor coding capacity, but highly versatile functions. After infection, viruses, and the antiviral response they trigger, deregulate the expression of a subset of specific lncRNAs that function to promote or repress viral replication by inactivating or potentiating the antiviral response, respectively. These IFN-related lncRNAs are also highly tissue- and cell-type-specific, rendering them as promising biomarkers or therapeutic candidates to modulate specific stages of the antiviral immune response with fewer adverse effects.

Also flagged:chronic atrophic gastritisgastric intestinal metaplasiaadenocarcinomavitamin Cgastric cancertumour
Journal Article 2020-09-03 No Snippets Toh JWT, Wilson RB.
Show Full Abstract

<i>Helicobacter pylori</i> is a class one carcinogen which causes chronic atrophic gastritis, gastric intestinal metaplasia, dysplasia and adenocarcinoma. The mechanisms by which <i>H. pylori</i> interacts with other risk and protective factors, particularly vitamin C in gastric carcinogenesis are complex. Gastric carcinogenesis includes metabolic, environmental, epigenetic, genomic, infective, inflammatory and oncogenic pathways. The molecular classification of gastric cancer subtypes has revolutionized the understanding of gastric carcinogenesis. This includes the tumour microenvironment, germline mutations, and the role of <i>Helicobacter pylori</i> bacteria, <i>Epstein Barr</i> virus and epigenetics in somatic mutations. There is evidence that ascorbic acid, phytochemicals and endogenous antioxidant systems can modify the risk of gastric cancer. Gastric juice ascorbate levels depend on dietary intake of ascorbic acid but can also be decreased by <i>H. pylori</i> infection, <i>H. pylori</i> CagA secretion, tobacco smoking, achlorhydria and chronic atrophic gastritis. Ascorbic acid may be protective against gastric cancer by its antioxidant effect in gastric cytoprotection, regenerating active vitamin E and glutathione, inhibiting endogenous N-nitrosation, reducing toxic effects of ingested nitrosodimethylamines and heterocyclic amines, and preventing <i>H. pylori</i> infection. The effectiveness of such cytoprotection is related to <i>H. pylori</i> strain virulence, particularly CagA expression. The role of vitamin C in epigenetic reprogramming in gastric cancer is still evolving. Other factors in conjunction with vitamin C also play a role in gastric carcinogenesis. Eradication of <i>H. pylori</i> may lead to recovery of vitamin C secretion by gastric epithelium and enable regression of premalignant gastric lesions, thereby interrupting the Correa cascade of gastric carcinogenesis.

Also flagged:Tumor necrosis factor receptorTNFR-relatedtumor necrosis factorTNFSFToll-like/interleukin-1 receptor
Journal Article 2020-09-03 ✓ 1 Snippet Li J, Liu N, Tang L, Yan B, Chen X, Zhang J, Peng C.
In-Text Gene Mentions

Prdx6competitively interacted with…

Show Full Abstract

Tumor necrosis factor receptor (TNFR)-related factors (TRAFs) are important linker molecules in the tumor necrosis factor superfamily (TNFSF) and the Toll-like/interleukin-1 receptor (TLR/ILR) superfamily. There are seven members: TRAF1-TRAF7, among those members, tumor necrosis factor receptor-associated factor 6 (TRAF6) is upregulated in various tumors, which has been related to tumorigenesis and development. With the in-depth study of the relationship between TRAF6 and different types of tumors, <i>TRAF6</i> has oncogenic characteristics involved in tumorigenesis, tumor development, invasion, and metastasis through various signaling pathways, therefore, targeting TRAF6 has provided a novel strategy for tumor treatment. This review summarizes and analyzes the role of TRAF6 in tumorigenesis and tumor development in combination with the current research on TRAF6 and tumors.

Also flagged:bicuspid aortic valvecoarctation of the aortaresponse to growthphosphoproteinphosphoproteinsIL12
Journal Article 2020-09-03 No Snippets Skeffington KL, Bond AR, Bigotti MG, AbdulGhani S, Iacobazzi D, Kang SL, Heesom KJ, Wilson MC, Stoica S, Martin R, Caputo M, Suleiman MS, Ghorbel MT.
Show Full Abstract

Neonates with coarctation of the aorta (CoA) combined with a bicuspid aortic valve (BAV) show significant structural differences compared to neonatal CoA patients with a normal tricuspid aortic valve (TAV). These effects are likely to change over time in response to growth. This study investigated proteomic differences between coarcted aortic tissue of BAV and TAV patients in children older than one month. Aortic tissue just proximal to the coarctation site was collected from 10 children (BAV; n=6, 1.9±1.7 years, TAV; n=4, 1.7±1.5 years, (mean ± SEM, P=0.92.) Tissue were snap frozen, proteins extracted, and the extracts used for proteomic and phosphoproteomic analysis using Tandem Mass Tag (TMT) analysis. A total of 1811 protein and 76 phosphoprotein accession numbers were detected, of which 40 proteins and 6 phosphoproteins were significantly differentially expressed between BAV and TAV patients. Several canonical pathways involved in inflammation demonstrated enriched protein expression, including acute phase response signalling, EIF2 signalling and macrophage production of IL12 and reactive oxygen species. Acute phase response signalling also demonstrated enriched phosphoprotein expression, as did Th17 activation. Other pathways with significantly enriched protein expression include degradation of superoxide radicals and several pathways involved in apoptosis. This work suggests that BAV CoA patients older than one month have an altered proteome consistent with changes in inflammation, apoptosis and oxidative stress compared to TAV CoA patients of the same age. There is no evidence of structural differences, suggesting the pathology associated with BAV evolves with age in paediatric CoA patients.

Also flagged:aquaporin 5dry eyefluoresceinsodiumAQP5reverse transcription
Journal Article 2020-09-03 No Snippets Liu Y, Di G, Hu S, Zhao T, Xu X, Wang X, Chen P.
Show Full Abstract

<b>Purpose:</b> This work aimed to identify differentially expressed circular RNAs (circRNAs) and elucidate their potential function in aquaporin 5 (AQP5) knockout (AQP5<sup>-/-</sup>) mice with the primary dry eye phenotype. <b>Methods:</b> A slit lamp examination was performed on AQP5<sup>-/-</sup> mice to assess corneal epithelial defects using fluorescein sodium staining. Hematoxylin-eosin staining and transmission electron microscopy analysis were performed to identify structural changes in lacrimal gland epithelial cells due to AQP5 deficiency. The expression profiles of circRNA and messenger RNA (mRNA) were determined by a microarray analysis. The selected circRNA was verified by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to predict the biological functions and the potential pathways of parental genes involved in lacrimal gland epithelial cell changes. According to the bioinformatics analysis of identified circRNAs, we predicted a circRNA-miRNA-mRNA network of phagosomes. <b>Results:</b> The AQP5<sup>-/-</sup> mice spontaneously exhibit dry eye symptoms, wherein the AQP5 deficiency changes the structure of lacrimal gland epithelial cells. The analysis revealed that, compared to AQP5<sup>+/+</sup> mice, 30 circRNAs in the lacrimal glands of AQP5<sup>-/-</sup> mice were differentially expressed (fold change ≥ 2.0, <i>p</i> < 0.05). Nine upregulated circRNAs were identified using qRT-PCR, and nine upregulated validated circRNAs, 40 altered microRNAs (miRNAs), and nine upregulated mRNAs were identified through a network analysis. The KEGG analysis showed that these nine target genes were expressed in phagosomes. <b>Conclusion:</b> The AQP5<sup>-/-</sup> mice have primary and stable dry eye phenotypes from birth. We identified differently expressed circRNAs in the lacrimal glands of AQP5<sup>-/-</sup> and AQP5<sup>+/+</sup> mice, predicting a circRNA-miRNA-mRNA network of phagosomes. CircRNA likely plays an important role in lacrimal gland epithelial cell pathogenesis. Therefore, it is reasonable to use circRNA as a potential therapeutic agent for the treatment of dry eyes.

Also flagged:gene expressionpeptidescancerocular diseasespathogenesiseye diseases
Journal Article 2020-09-03 ✓ 1 Snippet Zhang C, Hu J, Yu Y.
In-Text Gene Mentions

…transcripts of theDCCgene, SRY gene…

Show Full Abstract

A newly rediscovered subclass of noncoding RNAs, circular RNAs (circRNAs), is produced by a back-splicing mechanism with a covalently closed loop structure. They not only serve as the sponge for microRNAs (miRNAs) and proteins but also regulate gene expression and epigenetic modification, translate into peptides, and generate pseudogenes. Dysregulation of circRNA expression has opened a new chapter in the etiology of various human disorders, including cancer and cardiovascular, neurodegenerative, and ocular diseases. Recent studies recognized the vital roles that circRNAs played in the pathogenesis of various eye diseases, highlighting circRNAs as promising biomarkers for diagnosis and assessment of progression and prognosis. Interventions targeting circRNAs provide insights for developing novel treatments for these ocular diseases. This review summarizes our current perception of the properties, biogenesis, and functions of circRNAs and the development of circRNA researches related to ophthalmologic diseases, including diabetic retinopathy, age-related macular degeneration, retinopathy of prematurity, glaucoma, corneal neovascularization, cataract, pterygium, proliferative vitreoretinopathy, retinoblastoma, and ocular melanoma.

Also flagged:COVID-19virus infectionamino acidCoronavirus Disease-19localizationbinding
Journal Article 2020-09-03 No Snippets Dey L, Chakraborty S, Mukhopadhyay A.
Show Full Abstract

<h4>Background</h4>COVID-19 (Coronavirus Disease-19), a disease caused by the SARS-CoV-2 virus, has been declared as a pandemic by the World Health Organization on March 11, 2020. Over 15 million people have already been affected worldwide by COVID-19, resulting in more than 0.6 million deaths. Protein-protein interactions (PPIs) play a key role in the cellular process of SARS-CoV-2 virus infection in the human body. Recently a study has reported some SARS-CoV-2 proteins that interact with several human proteins while many potential interactions remain to be identified.<h4>Method</h4>In this article, various machine learning models are built to predict the PPIs between the virus and human proteins that are further validated using biological experiments. The classification models are prepared based on different sequence-based features of human proteins like amino acid composition, pseudo amino acid composition, and conjoint triad.<h4>Result</h4>We have built an ensemble voting classifier using SVM<sup>Radial</sup>, SVM<sup>Polynomial</sup>, and Random Forest technique that gives a greater accuracy, precision, specificity, recall, and F1 score compared to all other models used in the work. A total of 1326 potential human target proteins of SARS-CoV-2 have been predicted by the proposed ensemble model and validated using gene ontology and KEGG pathway enrichment analysis. Several repurposable drugs targeting the predicted interactions are also reported.<h4>Conclusion</h4>This study may encourage the identification of potential targets for more effective anti-COVID drug discovery.

Also flagged:Bile Cast NephropathyHemophagocytic LymphohistiocytosisAcute kidney injuryacute tubular necrosistumor lysis syndromeglomerulopathies
Journal Article 2020-09-03 ✓ 1 Snippet Chango Azanza JJ, Lopetegui Lia N, Calle Sarmiento PM.
In-Text Gene Mentions

…metabolic disorders, andhemochromatosis(including negative genetic…

Show Full Abstract

Acute kidney injury (AKI) is a common complication seen in patients with hemophagocytic lymphohistiocytosis (HLH). More than half of patients with HLH require renal replacement therapy (RRT). There are four main causes of kidney dysfunction in HLH, which include acute tubular necrosis (ATN), hypoperfusion, tumor lysis syndrome (TLS), and HLH-related glomerulopathies. Bile cast nephropathy (BCN) is a known cause of kidney injury in patients with liver failure and hyperbilirubinemia. We present the case of a 58-year-old man who presented to the hospital with painless jaundice, choluria, acholia, and generalized malaise and was found to have hyperbilirubinemia and kidney injury in the setting of HLH, who underwent a renal biopsy showing bile salt casts with degenerating tubular lining cells consistent with BCN. This case highlights the importance of considering BCN as a cause of kidney injury when a patient with HLH presents with liver failure and elevated bilirubin levels.

Also flagged:Movement Disordersmovement disorderPDHDNeurotrophicnucleus
Journal Article 2020-09-03 ✓ 5 Snippets Troncoso-Escudero P, Sepulveda D, Pérez-Arancibia R, Parra AV, Arcos J, Grunenwald F, Vidal RL.
In-Text Gene Mentions

knock-in mouse having human HTT exon 1 sequence with 140 glutamine repeats

knock-in mouse having mouse HTT exon 1 sequence with 150 glutamine repeats

knock-in mouse having human HTT exon 1 sequence with 111 glutamine repeats

HD is caused by a mutation in the gene that encodes for the protein huntingtin (HTT), which leads to an expanded CAG trinucleotide, causing an abnormally long polyglutamine (polyQ) tract in HTT.

Using IONIS-HTTRx against HTT mRNA, Tabrizi et al. (2019) reported the first results obtained from a phase I–II multicenter clinical trial in which this ASO was intrathecally administered in early-manifest HD patients.

Show Full Abstract

Movement disorders are neurological conditions in which patients manifest a diverse range of movement impairments. Distinct structures within the basal ganglia of the brain, an area involved in movement regulation, are differentially affected for every disease. Among the most studied movement disorder conditions are Parkinson's (PD) and Huntington's disease (HD), in which the deregulation of the movement circuitry due to the loss of specific neuronal populations in basal ganglia is the underlying cause of motor symptoms. These symptoms are due to the loss principally of dopaminergic neurons of the substantia nigra (SN) par compacta and the GABAergic neurons of the striatum in PD and HD, respectively. Although these diseases were described in the 19th century, no effective treatment can slow down, reverse, or stop disease progression. Available pharmacological therapies have been focused on preventing or alleviating motor symptoms to improve the quality of life of patients, but these drugs are not able to mitigate the progressive neurodegeneration. Currently, considerable therapeutic advances have been achieved seeking a more efficacious and durable therapeutic effect. Here, we will focus on the new advances of several therapeutic approaches for PD and HD, starting with the available pharmacological treatments to alleviate the motor symptoms in both diseases. Then, we describe therapeutic strategies that aim to restore specific neuronal populations or their activity. Among the discussed strategies, the use of Neurotrophic factors (NTFs) and genetic approaches to prevent the neuronal loss in these diseases will be described. We will highlight strategies that have been evaluated in both Parkinson's and Huntington's patients, and also the ones with strong preclinical evidence. These current therapeutic techniques represent the most promising tools for the safe treatment of both diseases, specifically those aimed to avoid neuronal loss during disease progression.

Also flagged:membraneion channelsglucosepenicillinstreptomycintrypsin
Journal Article 2020-09-03 No Snippets Wong SW, Lenzini S, Bargi R, Feng Z, Macaraniag C, Lee JC, Peng Z, Shin JW.
Show Full Abstract

Advances in engineered hydrogels reveal how cells sense and respond to 3D biophysical cues. However, most studies rely on interfacing a population of cells in a tissue-scale bulk hydrogel, an approach that overlooks the heterogeneity of local matrix deposition around individual cells. A droplet microfluidic technique to deposit a defined amount of 3D hydrogel matrices around single cells independently of material composition, elasticity, and stress relaxation times is developed. Mesenchymal stem cells (MSCs) undergo isotropic volume expansion more rapidly in thinner gels that present an Arg-Gly-Asp integrin ligand. Mathematical modeling and experiments show that MSCs experience higher membrane tension as they expand in thinner gels. Furthermore, thinner gels facilitate osteogenic differentiation of MSCs. By modulating ion channels, it is shown that isotropic volume expansion of single cells predicts intracellular tension and stem cell fate. The results suggest the utility of precise microscale gel deposition to control single cell functions.

Also flagged:adenosinecancerCD73FluoresceinbenzylEcto-5′-nucleotidase
Journal Article 2020-09-03 ✓ 1 Snippet Schmies CC, Rolshoven G, Idris RM, Losenkova K, Renn C, Schäkel L, Al-Hroub H, Wang Y, Garofano F, Schmidt-Wolf IGH, Zimmermann H, Yegutkin GG, Müller CE.
In-Text Gene Mentions

DCC

Show Full Abstract

Ecto-5'-nucleotidase (CD73) catalyzes the hydrolysis of AMP to anti-inflammatory, immunosuppressive adenosine. It is expressed on vascular endothelial, epithelial, and also numerous cancer cells where it strongly contributes to an immunosuppressive microenvironment. In the present study we designed and synthesized fluorescent-labeled CD73 inhibitors with low nanomolar affinity and high selectivity based on <i>N</i> <sup><i>6</i></sup> <i>-</i>benzyl-α,β-methylene-ADP (PSB-12379) as a lead structure. Fluorescein was attached to the benzyl residue via different linkers resulting in PSB-19416 (<b>14b</b>, <i>K</i> <sub><i>i</i></sub> 12.6 nM) and PSB-18332 (<b>14a</b>, <i>K</i> <sub><i>i</i></sub> 2.98 nM) as fluorescent high-affinity probes for CD73. These compounds are anticipated to become useful tools for biological studies, drug screening, and diagnostic applications.

Also flagged:Cancernon-small cell lung cancergene expressionTBX22ZSCAN12TRIM39
Journal Article 2020-09-03 No Snippets Ji X, Lin L, Shen S, Dong X, Chen C, Li Y, Zhu Y, Huang H, Chen J, Chen X, Wei L, He J, Duan W, Su L, Jiang Y, Fan J, Guan J, You D, Shafer A, Bjaanaes MM, Karlsson A, Planck M, Staaf J, Helland Å, Esteller M, Wei Y, Zhang R, Chen F, Christiani DC.
Show Full Abstract

Tripartite motif containing 27 (TRIM27) is highly expressed in lung cancer, including non-small-cell lung cancer (NSCLC). Here, we profiled DNA methylation of lung adenocarcinoma (LUAD) and lung squamous cell carcinoma (LUSC) tumours from 613 early-stage NSCLC patients and evaluated associations between CpG methylation of TRIM27 and overall survival. Significant CpG probes were confirmed in 617 samples from The Cancer Genome Atlas. The methylation of the CpG probe cg05293407<sub>TRIM27</sub> was significantly associated with overall survival in patients with LUSC (HR = 1.65, 95% CI: 1.30-2.09, P = 4.52 × 10<sup>-5</sup>), but not in patients with LUAD (HR = 1.08, 95% CI: 0.87-1.33, P = 0.493). As incidence of LUSC is associated with higher smoking intensity compared to LUAD, we investigated whether smoking intensity impacted on the prognostic effect of cg05293407<sub>TRIM27</sub> methylation in NSCLC. LUSC patients had a higher average pack-year of smoking (37.49<sub>LUAD</sub> vs 54.79<sub>LUSC</sub>, P = 1.03 × 10<sup>-19</sup>) and included a higher proportion of current smokers than LUAD patients (28.24%<sub>LUAD</sub> vs 34.09%<sub>LUSC</sub>, P = 0.037). cg05293407<sub>TRIM27</sub> was significantly associated with overall survival only in NSCLC patients with medium-high pack-year of smoking (HR = 1.58, 95% CI: 1.26-1.96, P = 5.25 × 10<sup>-5</sup>). We conclude that cg05293407<sub>TRIM27</sub> methylation is a potential predictor of LUSC prognosis, and smoking intensity may impact on its prognostic value across the various types of NSCLC.

Also flagged:prion diseaseneurodegenerative diseasesManganeseamyotrophic lateral sclerosismetalsALS
Journal Article 2020-09-02 No Snippets Martins AC, Gubert P, Villas Boas GR, Meirelles Paes M, Santamaría A, Lee E, Tinkov AA, Bowman AB, Aschner M.
Show Full Abstract

<h4>Introduction</h4>Neurodegenerative diseases, such as Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis and prion disease represent important public health concerns. Exposure to high levels of  heavy metals such as manganese (Mn) may contribute to their development.<h4>Areas covered</h4>In this critical review, we address the role of Mn in the etiology of neurodegenerative diseases and discuss emerging treatments of Mn overload, such as chelation therapy. In addition, we discuss natural and synthetic compounds under development as prospective therapeutics. Moreover, bioinformatic approaches to identify new potential targets and therapeutic substances to reverse the neurodegenerative diseases are discussed.<h4>Expert opinion</h4>Here, the authors highlight the importance of better understanding the molecular mechanisms of toxicity associated with neurodegenerative diseases, and the role of Mn in these diseases. Additional emphasis should be directed to the discovery of new agents to treat Mn-induced diseases, since present day chelator therapies have limited bioavailability. Furthermore, the authors encourage the scientific community to develop research using libraries of compounds to screen those compounds that show efficacy in regulating brain Mn levels. In addition, bioinformatics may provide novel insight for pathways and clinical treatments associated with Mn-induced neurodegeneration, leading to a new direction in Mn toxicological research.

Also flagged:ferrochelataseFECHerythropoietic protoporphyriaEPPhemeprotoporphyrin
Journal Article 2020-09-02 No Snippets Dickey AK, Quick C, Ducamp S, Zhu Z, Feng YA, Naik H, Balwani M, Anderson KE, Lin X, Phillips JE, Rebeiz L, Bonkovsky HL, McGuire BM, Wang B, Chasman DI, Smoller JW, Fleming MD, Christiani DC.
Show Full Abstract

<h4>Purpose</h4>Erythropoietic protoporphyria (EPP), characterized by painful cutaneous photosensitivity, results from pathogenic variants in ferrochelatase (FECH). For 96% of patients, EPP results from coinheriting a rare pathogenic variant in trans of a common hypomorphic variant c.315-48T>C (minor allele frequency 0.05). The estimated prevalence of EPP derived from the number of diagnosed individuals in Europe is 0.00092%, but this may be conservative due to underdiagnosis. No study has estimated EPP prevalence using large genetic data sets.<h4>Methods</h4>Disease-associated FECH variants were identified in the UK Biobank, a data set of 500,953 individuals including 49,960 exome sequences. EPP prevalence was then estimated. The association of FECH variants with EPP-related traits was assessed.<h4>Results</h4>Analysis of pathogenic FECH variants in the UK Biobank provides evidence that EPP prevalence is 0.0059% (95% confidence interval [CI]: 0.0042-0.0076%), 1.7-3.0 times more common than previously thought in the UK. In homozygotes for the common c.315-48T>C FECH variant, there was a novel decrement in both erythrocyte mean corpuscular volume (MCV) and hemoglobin.<h4>Conclusion</h4>The prevalence of EPP has been underestimated secondary to underdiagnosis. The common c.315-48T>C allele is associated with both MCV and hemoglobin, an association that could be important both for those with and without EPP.

Also flagged:pleocytosiscoronavirus infectionCOVID-19astheniaanosmiaglucose
Journal Article 2020-09-02 No Snippets de Oliveira FAA, Palmeira DCC, Rocha-Filho PAS.
Show Full Abstract

In December 2019, a new coronavirus infection was identified in China. Although the clinical presentation of COVID-19 is predominantly respiratory, more than 35%% of patients have neurological symptoms. We report an elderly female with asthenia, dry cough, anosmia, ageusia, fever, nausea, and a severe and persistent headache. She had confirmed COVID-19 using the nasal swab RT-PCR technique. Her cranial tomography was normal. The CSF analysis demonstrated a cell count of 21 cells/mm<sup>3</sup> (80% lymphocytes and 20% monocytes), 34 mg/dl protein, and 79 mg/dl glucose. She improved after 4 days. Our report draws attention to the meningeal involvement of SARS-Cov-2.

Also flagged:HSPA1BORFVreverse transcriptionviral infectionheat shock 70-kDa protein 1Bcytoplasm
Journal Article 2020-09-02 No Snippets Hao JH, Kong HJ, Yan MH, Shen CC, Xu GW, Zhang DJ, Zhang KS, Zheng HX, Liu XT.
Show Full Abstract

Orf virus (ORFV) infects sheep and goat tissues, resulting in severe proliferative lesions. To analyze cellular protein expression in ORFV-infected goat skin fibroblast (GSF) cells, we used two-dimensional liquid chromatography-tandem mass spectrometry coupled with isobaric tags for relative and absolute quantification (iTRAQ). The proteomics approach was used along with quantitative reverse transcription polymerase chain reaction (RT-qPCR) to detect differentially expressed proteins in ORFV-infected GSF cells and mock-infected GSF cells. A total of 282 differentially expressed proteins were identified. It was found that 222 host proteins were upregulated and 60 were downregulated following viral infection. We confirmed that these proteins were differentially expressed and found that heat shock 70-kDa protein 1B (HSPA1B) was differentially expressed and localized in the cytoplasm. It was also noted that HSPA1B caused inhibition of viral proliferation, in the middle and late stages of viral infection. The differentially expressed proteins were associated with the biological processes of viral binding, cell structure, signal transduction, cell adhesion, and cell proliferation.

Also flagged:chronic hepatitis CchronicinfectionHepatitis Cinfectious viral diseasechronic hepatitis C infection
Journal Article 2020-09-02 No Snippets Büsch K, Hansson F, Holton M, Lagging M, Westin J, Kövamees J, Sällberg M, Söderholm J.
Show Full Abstract

<h4>Objective</h4>The objective of this study was to evaluate sick leave and disability pension in patients with chronic hepatitis C virus (HCV) infection as compared with a matched general population cohort.<h4>Design</h4>Retrospective register study.<h4>Setting</h4>Nationwide in Sweden.<h4>Participants</h4>This register-based study used the Swedish National Patient Register to identify working-age patients with HCV in 2012 (n=32 021) who were diagnosed between 1999 and 2007 (n=19 362). Sick leave and disability pension data were retrieved from Statistics Sweden (1994-2012), with up to five matched individuals from the general population.<h4>Primary and secondary outcome measures</h4>The primary outcome was workdays lost due to sick leave episodes (>14 days) and disability pension overall. The secondary outcome was workdays lost per subgroup of patients with chronic HCV.<h4>Results</h4>In 2012, 14% of the HCV patients had ≥1 registered sick leave episode compared with 10% in the matched comparator cohort. For disability pension benefits, results were 30% versus 8%, respectively. Overall, in 2012, 57% of patients with HCV did not have any registered workdays lost, whereas 30% were absent ≥360 days compared with 83% and 9% in the matched cohort, respectively. The mean total number of annual workdays lost in 2012 was 126 days in the HCV patient cohort compared with 40 days in the matched general population comparator cohort. Annual days lost increased from a mean of 86 days 5 years before diagnosis to 136 days during the year of diagnosis.<h4>Conclusions</h4>These results show that Swedish HCV patients used more sick days and have a higher frequency of disability pension compared with a comparator cohort from the general Swedish population. Whether earlier diagnosis of HCV and treatment might impact work absence in Sweden warrants further investigation.

Also flagged:HDautosomal dominant neurodegenerative diseaseHuntington DiseaseAkinetic Rigidchromosomesoligonucleotides
Journal Article 2020-09-02 ✓ 1 Snippet Apolinário TA, Rodrigues DC, Lemos MB, Antão Paiva CL, Agostinho LA.
In-Text Gene Mentions

HTT

Show Full Abstract

<h4>Background</h4>Huntington's disease (HD)(MIM:143100) is an severe autosomal dominant neurodegenerative disease caused by the dynamic expansion of CAG trinucleotides (> 35) in the <i>HTT</i> gene [Genomic Coordinates- (GRCh38):4:3,074,680-3,243,959].<h4>Objectives</h4>The aim of this systematic review was to investigate the reported associations between the frequencies of the A1 and A2 haplotypes in HD-affected and non-affected populations from different countries on different continents, in order to demonstrate the overall profile of these haplotypes worldwide, pointing towards the most frequent haplotypes that could be useful for <i>HTT</i> mutant-specific allele silencing in different populations.<h4>Methods</h4>Publications in MEDLINE (PubMed) and Embase from the last 10 years (PROSPERO CRD42018115282) were assessed.<h4>Results</h4>A total of 20 articles from 113 were selected for evaluation in their entirety, and eight were eligible for this study.<h4>Conclusion</h4>Regardless of the size of the CAG tract, the articles included in this review demonstrate that populations with high HD prevalence present higher frequencies of the A1 or A2 haplotypes than populations exhibiting low HD prevalence, even when similar average CAG numbers are noted. Based on the presented articles, we suggest that the haplotypic profile is more closely related to the ancestral origin than to the size of the CAG tract. The identification of populations presenting a higher frequency of high-risk genotypes can contribute to more accurate genetic counseling, in addition to providing knowledge on HD epidemiology. According to the continued progress in the development of specific genetic silencing therapies by different research groups and pharmaceutical companies, such as haplotype targeting strategies for allele-specific <i>HTT</i> suppression, we conclude that the definition of haplotypes in phase with CAG expansions will contribute to the design of gene-silencing drugs specific for different populations worldwide.

Also flagged:drug actionS21S11S30S26S15
Journal Article 2020-09-02 ✓ 4 Snippets Khan AH, Lin A, Wang RT, Bloom JS, Lange K, Smith DJ.
In-Text Gene Mentions

DNAJC1

DARS2

…the RH samples,DARS2, GORAB ,…

DARS2encodes human mitochondrial…

Show Full Abstract

Genetic screens in mammalian cells commonly focus on loss-of-function approaches. To evaluate the phenotypic consequences of extra gene copies, we used bulk segregant analysis (BSA) of radiation hybrid (RH) cells. We constructed six pools of RH cells, each consisting of ∼2500 independent clones, and placed the pools under selection in media with or without paclitaxel. Low pass sequencing identified 859 growth loci, 38 paclitaxel loci, 62 interaction loci, and three loci for mitochondrial abundance at genome-wide significance. Resolution was measured as ∼30 kb, close to single-gene. Divergent properties were displayed by the RH-BSA growth genes compared to those from loss-of-function screens, refuting the balance hypothesis. In addition, enhanced retention of human centromeres in the RH pools suggests a new approach to functional dissection of these chromosomal elements. Pooled analysis of RH cells showed high power and resolution and should be a useful addition to the mammalian genetic toolkit.

Also flagged:chromatinorganizationgene expressionCD4rheumatoid arthritisCas9
Journal Article 2020-09-02 ✓ 1 Snippet Yang J, McGovern A, Martin P, Duffus K, Ge X, Zarrineh P, Morris AP, Adamson A, Fraser P, Rattray M, Eyre S.
In-Text Gene Mentions

…proximal to theTNFSF4and TNFSF18 genes,…

Show Full Abstract

Genome-wide association studies have identified genetic variation contributing to complex disease risk. However, assigning causal genes and mechanisms has been more challenging because disease-associated variants are often found in distal regulatory regions with cell-type specific behaviours. Here, we collect ATAC-seq, Hi-C, Capture Hi-C and nuclear RNA-seq data in stimulated CD4+ T cells over 24 h, to identify functional enhancers regulating gene expression. We characterise changes in DNA interaction and activity dynamics that correlate with changes in gene expression, and find that the strongest correlations are observed within 200 kb of promoters. Using rheumatoid arthritis as an example of T cell mediated disease, we demonstrate interactions of expression quantitative trait loci with target genes, and confirm assigned genes or show complex interactions for 20% of disease associated loci, including FOXO1, which we confirm using CRISPR/Cas9.

Also flagged:Hepatocellular carcinomacancercancershepatitis Bliver cancerC
Journal Article 2020-09-02 ✓ 1 Snippet Yerukala Sathipati S, Ho SY.
In-Text Gene Mentions

…alcoholism 5 ,hemochromatosis6 and alpha-1-antitrypsin…

Show Full Abstract

Hepatocellular carcinoma (HCC) is one of the leading causes of cancer deaths worldwide. Recently, microRNAs (miRNAs) are reported to be altered and act as potential biomarkers in various cancers. However, miRNA biomarkers for predicting the stage of HCC are limitedly discovered. Hence, we sought to identify a novel miRNA signature associated with cancer stage in HCC. We proposed a support vector machine (SVM)-based cancer stage prediction method, SVM-HCC, which uses an inheritable bi-objective combinatorial genetic algorithm for selecting a minimal set of miRNA biomarkers while maximizing the accuracy of predicting the early and advanced stages of HCC. SVM-HCC identified a 23-miRNA signature that is associated with cancer stages in patients with HCC and achieved a 10-fold cross-validation accuracy, sensitivity, specificity, Matthews correlation coefficient, and area under the receiver operating characteristic curve (AUC) of 92.59%, 0.98, 0.74, 0.80, and 0.86, respectively; and test accuracy and test AUC of 74.28% and 0.73, respectively. We prioritized the miRNAs in the signature based on their contributions to predictive performance, and validated the prognostic power of the prioritized miRNAs using Kaplan-Meier survival curves. The results showed that seven miRNAs were significantly associated with prognosis in HCC patients. Correlation analysis of the miRNA signature and its co-expressed miRNAs revealed that hsa-let-7i and its 13 co-expressed miRNAs are significantly involved in the hepatitis B pathway. In clinical practice, a prediction model using the identified 23-miRNA signature could be valuable for early-stage detection, and could also help to develop miRNA-based therapeutic strategies for HCC.

Also flagged:breast cancerbasal-like breast cancerhigh-grade serous ovarian cancergene expressionserous ovarian cancercancer
Journal Article 2020-09-02 ✓ 1 Snippet Zhang Y, Liu J, Raj-Kumar PK, Sturtz LA, Praveen-Kumar A, Yang HH, Lee MP, Fantacone-Campbell JL, Hooke JA, Kovatich AJ, Shriver CD, Hu H.
In-Text Gene Mentions

OLFM4

Show Full Abstract

<h4>Purpose</h4>Molecular similarities have been reported between basal-like breast cancer (BLBC) and high-grade serous ovarian cancer (HGSOC). To date, there have been no prognostic biomarkers that can provide risk stratification and inform treatment decisions for both BLBC and HGSOC. In this study, we developed a molecular signature for risk stratification in BLBC and further validated this signature in HGSOC.<h4>Methods</h4>RNA-seq data was downloaded from The Cancer Genome Atlas (TCGA) project for 190 BLBC and 314 HGSOC patients. Analyses of differentially expressed genes between recurrent vs. non-recurrent cases were performed using different bioinformatics methods. Gene Signature was established using weighted linear combination of gene expression levels. Their prognostic performance was evaluated using survival analysis based on progression-free interval (PFI) and disease-free interval (DFI).<h4>Results</h4>63 genes were differentially expressed between 18 recurrent and 40 non-recurrent BLBC patients by two different methods. The recurrence index (RI) calculated from this 63-gene signature significantly stratified BLBC patients into two risk groups with 38 and 152 patients in the low-risk (RI-Low) and high-risk (RI-High) groups, respectively (p = 0.0004 and 0.0023 for PFI and DFI, respectively). Similar performance was obtained in the HGSOC cohort (p = 0.0131 and 0.004 for PFI and DFI, respectively). Multivariate Cox regression adjusting for age, grade, and stage showed that the 63-gene signature remained statistically significant in stratifying HGSOC patients (p = 0.0005).<h4>Conclusion</h4>A gene signature was identified to predict recurrence in BLBC and HGSOC patients. With further validation, this signature may provide an additional prognostic tool for clinicians to better manage BLBC, many of which are triple-negative and HGSOC patients who are currently difficult to treat.

Also flagged:Interleukin-6inflammatory responsesneurodegenerative disorderC-reactive proteinCRPIL-6
Journal Article 2020-09-02 ✓ 3 Snippets Corey-Bloom J, Fischer RS, Kim A, Snell C, Parkin GM, Granger DA, Granger SW, Thomas EA.
In-Text Gene Mentions

…the Huntington (HTT) gene […

…encoded Huntingtin protein (Htt) exhibits ubiquitous expressi…

…through which mutantHttmight lead to…

Show Full Abstract

Growing evidence suggests that inflammatory responses, in both the brain and peripheral tissues, contribute to disease pathology in Huntington's disease (HD), an inherited, progressive neurodegenerative disorder typically affecting adults in their 30-40 s. Hence, studies of inflammation-related markers in peripheral fluids might be useful to better characterize disease features. In this study, we measured levels of C-reactive protein (CRP), Interleukin-6 (IL-6), interleukin 1 beta (IL-1B), and alpha-amylase (AA) in saliva and plasma from <i>n</i> = 125 subjects, including <i>n</i> = 37 manifest HD patients, <i>n</i> = 36 premanifest patients, and <i>n</i> = 52 healthy controls, using immunoassays. We found increases in salivary levels of IL-6, IL-1B and CRP across different disease groups and increased levels of IL-6 in the plasma of HD patients as compared to premanifest patients and controls. The levels of salivary IL-6 were significantly correlated with each of the other salivary markers, as well as with IL-6 levels measured in plasma. Further, salivary IL-6 and IL-1B levels were significantly positively correlated with Total Motor Score (TMS) and chorea scores and negatively correlated with Total Functional Capacity (TFC) in HD patients, whereby in healthy control subjects, IL-6 was significantly negatively correlated with Montreal Cognitive Assessment (MoCA) and the Symbol Digit Modalities test (SDM). Interestingly, the plasma levels of IL-6 did not show similar correlations to any clinical measures in either HD or control subjects. These findings suggest that salivary IL-6 is particularly relevant as a potential non-invasive biomarker for HD symptoms. The advent of an effective, dependable salivary biomarker would meet the urgent need for a less invasive means of identifying and monitoring HD disease progression.

Also flagged:Cancergold nanorodsdoxorubicinaspartic acidimidazoletumors
Journal Article 2020-09-02 No Snippets Sim T, Lim C, Hoang NH, Shin Y, Kim JC, Park JY, Her J, Lee ES, Youn YS, Oh KT.
Show Full Abstract

Combination therapy is considered to be a promising strategy for improving the therapeutic efficiency of cancer treatment. In this study, an on-demand pH-sensitive nanocluster (NC) system was prepared by the encapsulation of gold nanorods (AuNR) and doxorubicin (DOX) by a pH-sensitive polymer, poly(aspartic acid-graft-imidazole)-PEG, to enhance the therapeutic effect of chemotherapy and photothermal therapy. At pH 6.5, the NC systems formed aggregated structures and released higher drug amounts while sustaining a stable nano-assembly, structured with less systemic toxicity at pH 7.4. The NC could also increase antitumor efficacy as a result of improved accumulation and release of DOX from the NC system at pH<sub>ex</sub> and pH<sub>en</sub> with locally applied near-infrared light. Therefore, an NC system would be a potent strategy for on-demand combination treatment to target tumors with less systemic toxicity and an improved therapeutic effect.

Also flagged:Cardiovascular DiseaseAtherosclerosisgene expressionmembrane-associatedSEMA6BSEMA6D
Journal Article 2020-09-02 ✓ 1 Snippet Zhang H, Bredewold EOW, Vreeken D, Duijs JMGJ, de Boer HC, Kraaijeveld AO, Jukema JW, Pijls NH, Waltenberger J, Biessen EAL, van der Veer EP, van Zonneveld AJ, van Gils JM.
In-Text Gene Mentions

…PLXNC1, DSCAM andDCC, while the most…

Show Full Abstract

Atherosclerosis is the underlying pathology in a major part of cardiovascular disease, the leading cause of mortality in developed countries. The infiltration of monocytes into the vessel walls of large arteries is a key denominator of atherogenesis, making monocytes accountable for the development of atherosclerosis. With the development of high-throughput transcriptome profiling platforms and cytometric methods for circulating cells, it is now feasible to study in-depth the predicted functional change of circulating monocytes reflected by changes of gene expression in certain pathways and correlate the changes to disease outcome. Neuroimmune guidance cues comprise a group of circulating- and cell membrane-associated signaling proteins that are progressively involved in monocyte functions. Here, we employed the CIRCULATING CELLS study cohort to classify cardiovascular disease patients and healthy individuals in relation to their expression of neuroimmune guidance cues in circulating monocytes. To cope with the complexity of human datasets featured by noisy data, nonlinearity and multidimensionality, we assessed various machine-learning methods. Of these, the linear discriminant analysis, Naïve Bayesian model and stochastic gradient boost model yielded perfect or near-perfect sensibility and specificity and revealed that expression levels of the neuroimmune guidance cues SEMA6B, SEMA6D and EPHA2 in circulating monocytes were of predictive values for cardiovascular disease outcome.

Also flagged:dementia with Lewy bodiespathogenesissynaptic vesicleAKTMAPKSEK1
Journal Article 2020-09-02 No Snippets Lachén-Montes M, Mendizuri N, Schvartz D, Fernández-Irigoyen J, Sánchez JC, Santamaría E.
Show Full Abstract

Olfactory dysfunction is one of the prodromal symptoms in dementia with Lewy bodies (DLB). However, the molecular pathogenesis associated with decreased smell function remains largely undeciphered. We generated quantitative proteome maps to detect molecular alterations in olfactory bulbs (OB) derived from DLB subjects compared to neurologically intact controls. A total of 3214 olfactory proteins were quantified, and 99 proteins showed significant alterations in DLB cases. Protein interaction networks disrupted in DLB indicated an imbalance in translation and the synaptic vesicle cycle. These alterations were accompanied by alterations in AKT/MAPK/SEK1/p38 MAPK signaling pathways that showed a distinct expression profile across the OB-olfactory tract (OT) axis. Taken together, our data partially reflect the missing links in the biochemical understanding of olfactory dysfunction in DLB.

Also flagged:Ubiquitinationtranslationalautophagylysosomevacuoledegradation
Journal Article 2020-09-02 No Snippets Yin Z, Popelka H, Lei Y, Yang Y, Klionsky DJ.
Show Full Abstract

Ubiquitination, the post-translational modification essential for various intracellular processes, is implicated in multiple aspects of autophagy, the major lysosome/vacuole-dependent degradation pathway. The autophagy machinery adopted the structural architecture of ubiquitin and employs two ubiquitin-like protein conjugation systems for autophagosome biogenesis. Ubiquitin chains that are attached as labels to protein aggregates or subcellular organelles confer selectivity, allowing autophagy receptors to simultaneously bind ubiquitinated cargos and autophagy-specific ubiquitin-like modifiers (Atg8-family proteins). Moreover, there is tremendous crosstalk between autophagy and the ubiquitin-proteasome system. Ubiquitination of autophagy-related proteins or regulatory components plays significant roles in the precise control of the autophagy pathway. In this review, we summarize and discuss the molecular mechanisms and functions of ubiquitin and ubiquitination, in the process and regulation of autophagy.

Also flagged:tumorendometrial cancerUterine corpus endometrial cancerUCECPTENITGB3
Journal Article 2020-09-02 ✓ 1 Snippet Wang G, Wang D, Sun M, Liu X, Yang Q.
In-Text Gene Mentions

…mutations of PTEN,CSE1Land ITGB3.…

Show Full Abstract

Uterine corpus endometrial cancer (UCEC) is one of the most prevalent female malignancies in clinical practice. Due to the lack of effective biomarkers and personalized treatments, the prognosis of advanced-stage EC remains unfavorable. Modulation of the immune microenvironment is closely related to the onset and development of endometrial cancer. In the present study, we attempt to systematically analyze the characteristics of the immune microenvironment of endometrial cancer and investigate its association with clinical features by applying bioinformatics. RNA-Seq in TCGA (The Cancer Genome Atlas) and clinical follow-up information of patents were used for analysis. The Tumor Microenvironment (TME) score infiltration patterns of 523 endometrial cancer patients were evaluated using CIBERSORT. Random forest, multivariable cox analysis were used to build the TME score. Fisher's exact test was used to compare the genes that show significant differences in the frequency of mutations between groups. Two TME phenotypes were defined. There is a significant relationship between the TME score and grade. High TME score samples are highly expressed in immune activation, TGF pathway activation and immune checkpoint genes, and low TME score samples have high frequency mutations of PTEN, CSE1L and ITGB3. Therefore, describing the comprehensive landscape of UCEC's TME characteristics may help explain patients' response to immunotherapy and provide new strategies for cancer treatment.

Also flagged:OCTOCT4POU5F1Pit-Oct-Unctranscription factorsOCT6
Journal Article 2020-09-02 ✓ 1 Snippet Kim KP, Wu Y, Yoon J, Adachi K, Wu G, Velychko S, MacCarthy CM, Shin B, Röpke A, Arauzo-Bravo MJ, Stehling M, Han DW, Gao Y, Kim J, Gao S, Schöler HR.
In-Text Gene Mentions

…(also known asPOU3F2and BRN2), OCT8…

Show Full Abstract

OCT4 (also known as POU5F1) plays an essential role in reprogramming. It is the only member of the POU (Pit-Oct-Unc) family of transcription factors that can induce pluripotency despite sharing high structural similarities to all other members. Here, we discover that OCT6 (also known as POU3F1) can elicit reprogramming specifically in human cells. OCT6-based reprogramming does not alter the mesenchymal-epithelial transition but is attenuated through the delayed activation of the pluripotency network in comparison with OCT4-based reprogramming. Creating a series of reciprocal domain-swapped chimeras and mutants across all OCT factors, we clearly delineate essential elements of OCT4/OCT6-dependent reprogramming and, conversely, identify the features that prevent induction of pluripotency by other OCT factors. With this strategy, we further discover various chimeric proteins that are superior to OCT4 in reprogramming. Our findings clarify how reprogramming competences of OCT factors are conferred through their structural components.

Also flagged:Thalassemiagenetichaematological disorderβ-globinhaemoglobinopathiesiron
Journal Article 2020-09-02 No Snippets Amjad F, Fatima T, Fayyaz T, Khan MA, Qadeer MI.
Show Full Abstract

Thalassemia is a genetic haematological disorder that arises due to defects in the α and β-globin genes. Worldwide, 0.3-0.4 million children are born with haemoglobinopathies per year. Thalassemic patients, as well as their families, face various serious clinical, socio-economic, and psychosocial challenges throughout their life. Different therapies are available in clinical practice to minimize the suffering of thalassemic patients to some extent and potentially cure the disease. Predominantly, patients undergo transfusion therapy to maintain their haemoglobin levels. Due to multiple transfusions, the iron levels in their bodies are elevated. Iron overload results in damage to body organs, resulting in heart failure, liver function failure or endocrine failure, all of which are commonly observed. Certain drugs have been developed to enhance the expression of the γ-gene, which ultimately results in augmentation of fetal haemoglobin (HbF) levels and total haemoglobin levels in the body. However, its effectiveness is dependent on the genetic makeup of the individual patient. At present, allogeneic haematopoietic Stem Cell Transplantation (HSCT) is the only practically available option with a high curative rate. However, the outcome of HSCT is strongly influenced by factors such as age at transplantation, irregular iron chelation history before transplantation, histocompatibility, and source of stem cells. Gene therapy using the lentiglobin vector is the most recent method for cure without any mortality, graft rejection and clonal dominance issues. However, delayed platelet engraftment is being reported in some patients. Genome editing is a novel approach which may be used to treat patients with thalassemia; it makes use of targeted nucleases to correct the mutations in specific DNA sequences and modify the sequence to the normal wild-type sequence. To edit the genome at the required sites, CRISPR/Cas9 is an efficient and accurate tool that is used in various genetic engineering programs. Genome editing mediated by CRISPR/Cas9 has the ability to restore the normal β-globin function with minimal side effects. Using CRISPR/Cas9, expression of <i>BCL11A</i> can be downregulated along with increased production of HbF. However, these genome editing tools are still under <i>in-vitro</i> trials. CRISPR/Cas9 has can be used for precise transcriptional regulation, genome modification and epigenetic editing. Additional research is required in this regard, as CRISPR/Cas9 may potentially exhibit off-target activity and there are legal and ethical considerations regarding its use.

Also flagged:C9orf72Amyotrophic Lateral SclerosisALSfrontotemporal dementiadipeptidesTDP-43
Journal Article 2020-09-02 No Snippets Yang Q, Jiao B, Shen L.
Show Full Abstract

The expanded GGGGCC hexanucleotide repeat in the non-coding region of the <i>C9orf72</i> gene is the most common genetic cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD). There are three main disease mechanisms: loss of function of C9ORF72 protein, gain of function from the accumulation of sense and antisense (GGGGCC)n in RNA, and from the production of toxic dipeptides repeat proteins (DPRs) by non-AUG initiated translation. While many of the downstream mechanisms have been identified, the specific pathogenic pathway is still unclear. In this article, we provide an overview on the currently available literature and propose several hypotheses: (1) The pathogenesis of <i>C9orf72</i>-associated ALS/FTD, which cannot be explained by a single mechanism, involves a dual mechanism of both loss and gain of function. (2) The loss of function and gain of function can cause TDP-43 aggregation and damage nucleocytoplasmic transport. (3) Neurodegeneration can be caused by an accumulation of toxic substances in neurons themselves. In addition, we suggest that microglia may cause neurodegeneration by releasing inflammatory factors to neurons. Finally, we summarize several of the most promising treatment strategies.

Also flagged:IronCadmiumMitochondriahomeostasismitochondrialphosphorylation
Journal Article 2020-09-02 ✓ 1 Snippet Thévenod F, Lee WK, Garrick MD.
In-Text Gene Mentions

…in systemic (e.g.,hemochromatosis) and local (e.g.,…

Show Full Abstract

Regulation of body fluid homeostasis is a major renal function, occurring largely through epithelial solute transport in various nephron segments driven by Na<sup>+</sup>/K<sup>+</sup>-ATPase activity. Energy demands are greatest in the proximal tubule and thick ascending limb where mitochondrial ATP production occurs through oxidative phosphorylation. Mitochondria contain 20-80% of the cell's iron, copper, and manganese that are imported for their redox properties, primarily for electron transport. Redox reactions, however, also lead to reactive, toxic compounds, hence careful control of redox-active metal import into mitochondria is necessary. Current dogma claims the outer mitochondrial membrane (OMM) is freely permeable to metal ions, while the inner mitochondrial membrane (IMM) is selectively permeable. Yet we recently showed iron and manganese import at the OMM involves divalent metal transporter 1 (DMT1), an H<sup>+</sup>-coupled metal ion transporter. Thus, iron import is not only regulated by IMM mitoferrins, but also depends on the OMM to intermembrane space H<sup>+</sup> gradient. We discuss how these mitochondrial transport processes contribute to renal injury in systemic (e.g., hemochromatosis) and local (e.g., hemoglobinuria) iron overload. Furthermore, the environmental toxicant cadmium selectively damages kidney mitochondria by "ionic mimicry" utilizing iron and calcium transporters, such as OMM DMT1 or IMM calcium uniporter, and by disrupting the electron transport chain. Consequently, unraveling mitochondrial metal ion transport may help develop new strategies to prevent kidney injury induced by metals.

Also flagged:TNFinflammatory bowel diseaseIL-23Inflammatory bowel diseaseschronic inflammatory disordersCrohn's disease
Journal Article 2020-09-02 No Snippets Atreya R, Neurath MF, Siegmund B.
Show Full Abstract

The advent of anti-TNF agents as the first approved targeted therapy in the treatment of inflammatory bowel disease (IBD) patients has made a major impact on our existing therapeutic algorithms. They have not only been approved for induction and maintenance treatment in IBD patients, but have also enabled us to define and achieve novel therapeutic outcomes, such as combination of clinical symptom control and endoscopic remission, as well as mucosal healing. Nevertheless, approximately one third of treated patients do not respond to initiated anti-TNF therapy and these treatments are associated with sometimes severe systemic side-effects. There is therefore the currently unmet clinical need do establish predictive markers of response to identify the subgroup of IBD patients, that have a heightened probability of response. There have so far been approaches from different fields of IBD research, to descry markers that would empower us to apply TNF-inhibitors in a more rational manner. These markers encompass findings from disease-related and clinical factors, pharmacokinetics, biochemical markers, blood and stool derived parameters, pharmacogenomics, microbial species, metabolic compounds, and mucosal factors. Furthermore, changes in the intestinal immune cell composition in response to therapeutic pressure of anti-TNF treatment have recently been implicated in the process of molecular resistance to these drugs. Insights into factors that determine resistance to anti-TNF therapy give reasonable hope, that a more targeted approach can then be utilized in these non-responders. Here, IL-23 could be identified as one of the key factors determining resistance to TNF-inhibitors. Growing insights into the molecular mechanism of action of TNF-inhibitors might also enable us to derive critical molecular markers that not only mediate the clinical effects of anti-TNF therapy, but which level of expression might also correlate with its therapeutic efficacy. In this narrative review, we present an overview of currently identified possible predictive markers for successful anti-TNF therapy and discuss identified molecular pathways that drive resistance to these substances. We will also point out the necessity and difficulty of developing and validating a diagnostic marker concerning clinically relevant outcome parameters, before they can finally enter daily clinical practice and enable a more personalized therapeutic approach.

Also flagged:superoxide dismutasecolorectal cancerSODSOD1cancermalignant
Journal Article 2020-09-02 ✓ 1 Snippet Warsinggih, Irawan B, Labeda I, Lusikooy RE, Sampetoding S, Kusuma MI, Uwuratuw JA, Syarifuddin E, Prihantono, Faruk M.
In-Text Gene Mentions

…leted in Colorectal Carcinoma/DCC, p53, nm23 gene…

Show Full Abstract

<h4>Introduction</h4>The increase of superoxide dismutase (SOD) level in colorectal cancer (CRC) patients based on the examination of staging and grade of differentiation still evidently represents a clinical problem. SOD level raises at a certain staging and reduce at a certain grade of differentiation. For that reason, this study aimed to assess the association between SOD and the variables analyzed in this study.<h4>Materials and methods</h4>This study was observational study using a cross-sectional research design aimed to measure the association between SOD and staging as well as grade of differentiation in CRC incidence. The study was conducted in our institution from January until March 2018.<h4>Results</h4>Statistical analyses of the data derived from the laboratory indicated that age and histopathological examination (TNM staging) had statistically significant correlation with SOD1 level. This significant correlation was proven from results of the statistical analyses of each variable at p = 0.039 (age) and p = 0.001 (TNM staging) respectively. Subsequent tests concerning the correlation between age and TNM staging on SOD1 level revealed that the study samples in the category of 30-49 age years old showed statistically significant correlation with SOD1 level with p = 0.009.<h4>Conclusion</h4>The increase of grade of differentiation was proportional to the increase of SOD1 level as antioxidant against cancer in CRC patients.

Also flagged:Brain MetastasesBreast CancerHer2neuhormone receptorbrain
Journal Article 2020-09-02 ✓ 5 Snippets Weykamp F, El Shafie RA, König L, Seidensaal K, Forster T, Arians N, Regnery S, Hoegen P, Deutsch TM, Schneeweiss A, Debus J, Hörner-Rieber J.
In-Text Gene Mentions

Positive (LC): KPS ≥70, no prior WBRT, smaller total tumor volume Positive (DCC): controlled extracranial disease, lower number of metastases at the time of SRS, absence of lung metastasesPositive (OS): controlled extracranial disease, KPS score ≥70, smaller total tumor volume, absence of brainstem metastases, Her2+

…groups, for LC,DCC, EC, and OS,…

…assessment of LC,DCC, EC, and OS…

…LC,DCC, EC, and OS…

…for OS andDCC), and the diagnosis…

Show Full Abstract

<b>Purpose:</b> Several prognostic indexes for overall survival (OS) after radiotherapy of brain metastases in breast cancer patients exist but are mainly validated for whole-brain radiotherapy or not specifically for breast cancer patients. To date, no such index provides information beyond mere OS. <b>Methods:</b> We retrospectively analyzed 95 breast cancer patients treated with stereotactic radiosurgery for 203 brain metastases. The Kaplan-Meier method with log-rank test was used to assess OS, local control (LC), distant cranial control (DCC), and extracranial control (EC). Cox regression was applied to detect prognostic outcome factors. A point scoring system was designed to stratify patients based on outcome. Nine established prognostic indexes were analyzed using the concordance index (c-index). <b>Results:</b> Two out of nine analyzed prognostic indexes for OS showed a significant c-index, the breast graded prognostic assessment (bGPA; 0.631; 95% CI, 0.514-0.748; <i>p</i> = 0.037) and the modified bGPA (mod-bGPA; 0.662; 95% CI, 0.547-0.777; <i>p</i> = 0.010). Significant results from multivariate analysis (Karnofsky Performance Score, Her2/neu receptor status, extracranial control) were used to generate a new point system: the breast cancer stereotactic radiotherapy score (bSRS), which discriminated three significantly different prognostic groups, for LC, DCC, EC, and OS, respectively. However, the c-index was only significant for OS (0.689; 95% CI, 0.577-0.802; <i>p</i> = 0.003). <b>Conclusions:</b> The new bSRS score was superior to the bGPA and mod-bGPA scores for prognosis of OS. The bSRS is easy to use and the first tool, which might also provide outcome assessment beyond mere OS. Future studies need to validate these findings.

Also flagged:NEDD4Breast CancerTriple-negative breast cancerbreast cancerscancerMyc
Journal Article 2020-09-02 ✓ 2 Snippets Jeon SA, Kim DW, Lee DB, Cho JY.
In-Text Gene Mentions

Finally, 12 upregulated proteins, such as AKAP12, CD82, GSK3B, EPHB2, DNMT1, PDCD4, PEBP1, CDKN1A, SFN, STAT3, GSTP1, and LIMD1, were matched with both CSC-related and tumor suppressors (Figure 4A and Table 1), and seven downregulated proteins, such as SQSTM1, SUZ12, UBE2C, EZH2, CTGF, KIAA1524, and YBX1, were matched with both CSC-related and oncoproteins (Figure 4B and Table 2).

…EPHB2, DNMT1, PDCD4,PEBP1, CDKN1A, SFN, STAT3,…

Show Full Abstract

Triple-negative breast cancer (TNBC) is the most aggressive type with poor prognosis among the breast cancers and has a high population of cancer stem cells (CSCs), which are the main target to cure and inhibit TNBC. In this study, we examined the role of neural precursor cell expressed developmentally downregulated protein 4 (NEDD4) in the proliferation, migration, and CSC characteristics of MDA-MB-231, a TNBC cell line. Interestingly, the Kaplan-Meier plotter showed that the survival rate of patients with a higher expression level of NEDD4 was significantly shorter than those of patients with a lower expression only in relatively aggressive and higher stage (grade 3) breast cancer patients. The knockdown of NEDD4 drastically decreased the proliferation, migration, and mammosphere formation in MDA-MB-231 cells. A proteomic analysis revealed the alteration of CSC-related proteins; notably, Myc targets stem cell-like signatures in siNEDD4-treated MDA-MB-231. An immunoassay also showed that the expression and the activity of breast CSC markers are decreased in NEDD4-deleted MDA-MB-231. Taken together, these results indicate that NEDD4 is involved in the maintenance of populations and characteristics of breast CSCs.

Also flagged:photonTrastuzumabHER2breast tumorvisioniron
Journal Article 2020-09-02 No Snippets Ochoa M, Rudkouskaya A, Yao R, Yan P, Barroso M, Intes X.
Show Full Abstract

Single pixel imaging frameworks facilitate the acquisition of high-dimensional optical data in biological applications with photon starved conditions. However, they are still limited to slow acquisition times and low pixel resolution. Herein, we propose a convolutional neural network for fluorescence lifetime imaging with compressed sensing at high compression (NetFLICS-CR), which enables in vivo applications at enhanced resolution, acquisition and processing speeds, without the need for experimental training datasets. NetFLICS-CR produces intensity and lifetime reconstructions at 128 × 128 pixel resolution over 16 spectral channels while using only up to 1% of the required measurements, therefore reducing acquisition times from ∼2.5 hours at 50% compression to ∼3 minutes at 99% compression. Its potential is demonstrated in silico, in vitro and for mice in vivo through the monitoring of receptor-ligand interactions in liver and bladder and further imaging of intracellular delivery of the clinical drug Trastuzumab to HER2-positive breast tumor xenografts. The data acquisition time and resolution improvement through NetFLICS-CR, facilitate the translation of single pixel macroscopic flurorescence lifetime imaging (SP-MFLI) for in vivo monitoring of lifetime properties and drug uptake.

Dyskeratosis congenita.

Also flagged:genetic syndromeoral leukoplakianail dystrophybone marrow failureliver diseasestelomeres
Journal Article 2020-09-02 ✓ 1 Snippet Gitto L, Stoppacher R, Richardson TE, Serinelli S.
In-Text Gene Mentions

…iron overload andhemochromatosis.…

Show Full Abstract

Dyskeratosis congenita (DC) is a genetic syndrome with progressive multisystem involvement classically characterized by the clinical triad of oral leukoplakia, nail dystrophy, and reticular hyperpigmentation. Frequent complications are bone marrow failure, increased rate of malignancy, lung and liver diseases. DC results from an anomalous progressive shortening of telomeres resulting in DNA replication problems inducing replicative senescence. We report a death due to DC in a 16-year-old male with bone marrow failure and multiple organ dysfunction. At autopsy, nail dystrophy and skin hypopigmentation were observed. Gross and microscopic examinations of the internal organs showed cardiac hypertrophy, multiple lung consolidations and prominent interstitial fibrosis, liver cirrhosis, and fibrosis. Multiple foci of extramedullary hematopoiesis were identified, including on the epidural surface of the dura, that is an infrequent location, mimicking a focal area of epidural hemorrhage. Only a few autopsy studies about DC are reported in the literature. Further research should be done to understand the pathophysiology of the disease and its complications.

Also flagged:COVID-19influenzadepressionreproduction-19pneumonia
Journal Article 2020-09-02 ✓ 1 Snippet Corbet S, Hou Y, Hu Y, Oxley L, Xu D.
In-Text Gene Mentions

DCC-GARCH t-copula…

Show Full Abstract

No abstract available.

medRxiv 2020-09-02 Preprint (No Snippets API) Pandey A, Mala R, Neelam C, Mridula P, Ravindra S, Kanchan M, Umesh Y, Shivkant S.
Show Full Abstract

<h4>Background</h4> There is lack of information on impact of Corona Virus Disease (COVID-19) pandemic on routine cancer care delivery. <h4>Aims and Objectives</h4> To evaluate the change in Day Care Chemotherapy (DCC) and Out Patient Department (OPD) patient numbers before and after COVID-19 national lockdown. <h4>Material and Methods</h4> Demographic data, diagnosis, type and frequency of chemotherapy delivered in Day Care between 1st February 2020 to 31st July 2020 were retrieved. Out Patient Department daily patient numbers were collected. Descriptive statistics, Odds ratio, Chi-square and Student T test were used to measure change in pattern of DDC and OPD patient numbers before and after 24th March 2020 (day of Lockdown). Pearson correlation coefficient was used to measure the strength of correlation between rise in COVID-19 cases and patient numbers. <h4>Results</h4> 3192 DCC and 8209 OPD visits were recorded in 126 working days. Median age was 47 years(SD + 19.06). Breast (17%) and Gall bladder(15%) were the most common cancers receiving chemotherapy. There was a significant decrease in number of DCC delivered in post COVID lockdown [mean 21.97 (+ 9.7)] compared to pre COVID lockdown [mean 33.30 (+11.4)], t=4.11, p = 0.001.There was a significant decrease in number of OPD visits in post COVID lockdown [mean 47.13 (+ 18.8)] compared to pre COVID lockdown [mean 89.91 (+30.0)], t=7.09, p = 0.001. The odds of receiving weekly chemotherapy over non weekly regimes significantly decreased post COVID lockdown with Odds ratio of 0.52 (95% CI, 0.36-0.75) with Chi square of 12.57, p =0.001. Daily COVID cases in State and OPD patient number were found to be moderately positively correlated on Pearson correlation coefficient, r = 0.35,p =0.001. <h4>Conclusion</h4> There was a significant fall in patient visit and chemotherapy cycles immediately after lockdown. The numbers increased later despite rise in COVID-19 cases.

Research Square 2020-09-02 Preprint (No Snippets API) Bakshi D, Nagpal A, Sharma V, Sharma I, Shah R, Sharma B, Bhat A, Verma S, Bhat GR, Abrol D, Sharma R, Vashnavi S, Kumar R.
Show Full Abstract

<h4>Background: </h4> Breast Cancer (BC) is associated with inherited gene mutations. High throughput genotyping of BC samples has led to the identification and characterization of biomarkers for the diagnosis of BC. The most common genetic variants studied are SNPs (Single Nucleotide Polymorphisms) that determine susceptibility to an array of diseases thus serving as a potential tool for identifying the underlying causes of breast carcinogenesis. <h4>Methods: </h4> SNP genotyping employing the Agena MassARRAY offers a robust, sensitive, cost-effective method to assess multiple SNPs and samples simultaneously. In this present study, we analyzed 15 SNPs of 14 genes in 550 samples (150 cases and 400 controls). We identified four SNPs of genes TCF2 1, SLC19A1, DCC, and ERCC1 showing significant association with BC in the population under study. <h4>Results: </h4> The SNPs were rs12190287 ( TCF2 1) having OR 1.713 (1.08-2.716 at 95% CI) p-value 0.022 (dominant), rs1051266 ( SLC19A1 ) having OR 3.461 (2.136-5.609 at 95% CI) p-value 0.000000466 (dominant), rs2229080 ( DCC ) having OR 0.6867 (0.5123 -0.9205 at 95% CI) p-value 0.0116 (allelic) and rs2298881 ( ERCC1 ) having OR 0.669 (0.46-0.973 at 95% CI), p-value 0.035 (additive) respectively. The in-silico analysis was further used to fortify the above findings. <h4>Conclusion: </h4> It is further anticipated that the variants should be evaluated in other population groups that may aid in understanding the genetic complexity and bridge the missing heritability.

Also flagged:dengueWaterdengue feverSTAbehaviouralvector-borne diseases
Journal Article 2020-09-01 No Snippets Islam S, Haque CE, Hossain S, Walker D.
Show Full Abstract

<h4>Background</h4>This study examines vector density, the prevailing knowledge, awareness, attitudes and practice (KAAP) of community members regarding dengue disease and their willingness to pay (WTP) for vector control in Dhaka, Bangladesh.<h4>Methods</h4>A population-based, cross-sectional study design was followed: (i) an entomological survey was carried out in 727 randomly selected households in 12 wards, representing four urban ecological zones and (ii) a survey of 330 household heads was conducted to study their KAAP. The χ2 test and multinomial logistic regression (MLR) were applied to investigate factors associated with WTP and other variables.<h4>Results</h4>The Stegomyia indices significantly vary among the urban zones, revealing that the paved and built areas with concentrated public/commercial services have the highest mosquito density. Most respondents (93.9%) knew about dengue and its severity (90.3%); however, many of them were unaware (79.3%) about the types of mosquitoes causing dengue. MLR modelling reveals that average spending per month for mosquito control, household income and knowledge about the effects of land use and seasonality on dengue were significantly associated with the WTP for controlling the dengue vector.<h4>Conclusions</h4>Concerted efforts should be made to increase awareness about dengue transmission and develop community-based sustainable dengue vector control programmes involving both the public and private sectors.

Also flagged:Antithrombin IIIMembraneheparin
Journal Article 2020-09-01 ✓ 5 Snippets Omecene NE, Kishk OA, Lardieri AB, Walker LK, Bhutta AT.
In-Text Gene Mentions

…two antithrombin III (ATIII) products in pediatric…

…received either recombinantATIII(rATIII) or human-derived…

…(rATIII) or human-derivedATIII(hATIII).…

…86 doses ofATIIIwere included in…

…at 24 hours post-ATIIIsupplementation.…

Show Full Abstract

The study investigated the safety and efficacy of two antithrombin III (ATIII) products in pediatric patients receiving extracorporeal membrane oxygenation (ECMO) by performing a retrospective analysis of patients who received either recombinant ATIII (rATIII) or human-derived ATIII (hATIII). Twenty-two patients were included in the study from January 2014 to September 2015 and all received unfractionated heparin (UFH) as anticoagulation during ECMO. In total, 86 doses of ATIII were included in the analysis in which 37 doses (43%) were rATIII and 49 doses (57%) were hATIII. Unfractionated heparin rates were also evaluated for all cases (n = 86) at 24 hours post-ATIII supplementation. The UFH rate decreased after the administration of both types of ATIII. However, neither the reduction in UFH rate between the two ATIII products (p = 0.52) nor the UFH rates pre- and post-ATIII supplementation at 24 hours (p = 0.08) reached statistical significance. There was a significant difference in cost favoring the rATIII product (p < 0.0001). An ad-hoc estimation of waste associated with ATIII supplementation showed >$100,000 in financial loss of unused drug. Future studies are warranted to evaluate the efficacy of ATIII supplementation in pediatric ECMO.

Also flagged:reflexneurogenesisaxon regenerationgenes expressionRegenerationMethylation
Journal Article 2020-09-01 No Snippets Zhang BY, Chang PY, Zhu QS, Zhu YH, Saijilafu.
Show Full Abstract

Spinal cord injury that results in severe neurological disability is often incurable. The poor clinical outcome of spinal cord injury is mainly caused by the failure to reconstruct the injured neural circuits. Several intrinsic and extrinsic determinants contribute to this inability to reconnect. Epigenetic regulation acts as the driving force for multiple pathological and physiological processes in the central nervous system by modulating the expression of certain critical genes. Recent studies have demonstrated that post-SCI alteration of epigenetic landmarks is strongly associated with axon regeneration, glial activation and neurogenesis. These findings not only establish a theoretical foundation for further exploration of spinal cord injury, but also provide new avenues for the clinical treatment of spinal cord injury. This review focuses on the epigenetic regulation in axon regeneration and secondary spinal cord injury. Together, these discoveries are a selection of epigenetic-based prognosis biomarkers and attractive therapeutic targets in the treatment of spinal cord injury.

Also flagged:BRMS1FAKepidermal growth factor receptorEGFRNF-κBchromatin
Journal Article 2020-09-01 No Snippets Zimmermann RC, Welch DR.
Show Full Abstract

Despite high mortality rates, molecular understanding of metastasis remains limited. It can be regulated by both pro- and anti-metastasis genes. The metastasis suppressor, breast cancer metastasis suppressor 1 (BRMS1), has been positively correlated with patient outcomes, but molecular functions are still being characterized. BRMS1 has been implicated in focal adhesion kinase (FAK), epidermal growth factor receptor (EGFR), and NF-κB signaling pathways. We review evidence that BRMS1 regulates these vast signaling pathways through chromatin remodeling as a member of mSin3 histone deacetylase complexes.

Also flagged:malaria infectionsinfectionspolymeraseovale Infectioninfectionmalaria
Journal Article 2020-09-01 No Snippets Nguyen HTT, Romano F, Wampfler R, Mühlethaler K, Tannich E, Oberli A.
Show Full Abstract

In clinical practice, mixed-species malaria infections are often not detected by light microscopy (LM) or rapid diagnostic test, as a low number of parasites of one species may occur. Here, we report the case of an 8-year-old girl migrating with her family from Afghanistan with a two-species mixed infection with <i>Plasmodium vivax</i> and <i>Plasmodium ovale</i>. This case demonstrates the significance of molecular testing in the detection of mixed-species malaria infections and highlights the importance of a detailed data analysis during the medical validation procedure to prevent underestimation of mixed-species infections. To our knowledge, this is the first case report of a two-species mixed infection comprising both <i>P. vivax</i> and <i>P. ovale</i> confirmed by LM and different real-time polymerase chain reaction (PCR) approaches.

Also flagged:transcriptional regulatorsextracellularcell-to-cell adhesionlung developmentchronic diseasegene expression
Journal Article 2020-09-01 No Snippets Portas L, Pereira M, Shaheen SO, Wyss AB, London SJ, Burney PGJ, Hind M, Dean CH, Minelli C.
Show Full Abstract

<b>Rationale:</b> Poor lung health in adult life may occur partly through suboptimal growth and development, as suggested by epidemiological evidence pointing to early life risk factors.<b>Objectives:</b> To systematically investigate the effects of lung development genes on adult lung function.<b>Methods:</b> Using UK Biobank data, we tested the association of 391 genes known to influence lung development with FVC and FEV<sub>1</sub>/FVC. We split the dataset into two random subsets of 207,616 and 138,411 individuals, using the larger subset to select the most promising signals and the smaller subset for replication.<b>Measurements and Main Results:</b> We identified 55 genes, of which 36 (16 for FVC, 19 for FEV<sub>1</sub>/FVC, and one for both) had not been identified in the largest, most recent genome-wide study of lung function. Most of these 36 signals were intronic variants; expression data from blood and lung tissue showed that the majority affect the expression of the genes they lie within. Further testing of 34 of these 36 signals in the CHARGE and SpiroMeta consortia showed that 16 replicated after Bonferroni correction and another 12 replicated at nominal significance level. Of the 55 genes, 53 fell into four biological categories whose function is to regulate organ size and cell integrity (growth factors; transcriptional regulators; cell-to-cell adhesion; extracellular matrix), suggesting that these specific processes are important for adult lung health.<b>Conclusions:</b> Our study demonstrates the importance of lung development genes in regulating adult lung function and influencing both restrictive and obstructive patterns. Further investigation of these developmental pathways could lead to druggable targets.

Also flagged:cancerbreast cancerHER2triple-negative breast cancerbrainbreast tumors
Journal Article 2020-09-01 ✓ 2 Snippets Hosonaga M, Saya H, Arima Y.
In-Text Gene Mentions

We found that expression of the mouse genes Tph2, Sspo, Ptprq, and Pole was specifically upregulated in brain tissue harboring metastases, whereas that of the human genes CXCR4, PLLP, TNFSF4, VCAM1, SLC8A2, and SLC7A11 was specifically upregulated in brain-metastasizing cancer cells.

…, PLLP ,TNFSF4, VCAM1 ,…

Show Full Abstract

Metastasis of cancer cells to the brain occurs frequently in patients with certain subtypes of breast cancer. In particular, patients with HER2-positive or triple-negative breast cancer are at high risk for the development of brain metastases. Despite recent advances in the treatment of primary breast tumors, the prognosis of breast cancer patients with brain metastases remains poor. A better understanding of the molecular and cellular mechanisms underlying brain metastasis might be expected to lead to improvements in the overall survival rate for these patients. Recent studies have revealed complex interactions between metastatic cancer cells and their microenvironment in the brain. Such interactions result in the activation of various signaling pathways related to metastasis in both cancer cells and cells of the microenvironment including astrocytes and microglia. In this review, we focus on such interactions and on their role both in the metastatic process and as potential targets for therapeutic intervention.

Also flagged:β-globinbeta-hemoglobinopathiesfetal hemoglobinHPFHbindingBeta-globin
Journal Article 2020-09-01 ✓ 1 Snippet Demirci S, Leonard A, Tisdale JF.
In-Text Gene Mentions

SOX6

Show Full Abstract

Genome editing to correct a defective β-globin gene or induce fetal globin (HbF) for patients with beta-hemoglobinopathies has the potential to be a curative strategy available to all. HbF reactivation has long been an area of intense interest given the HbF inhibition of sickle hemoglobin (HbS) polymerization. Patients with HbS who also have high HbF tend to have less severe or even minimal clinical manifestations. Approaches to genetically engineer high HbF include de novo generation of naturally occurring hereditary persistence of fetal hemoglobin (HPFH) mutations, editing of transcriptional HbF repressors or their binding sites and/or regulating epigenetic intermediates controlling HbF expression. Recent preclinical and early clinical trial data show encouraging results; however, long-term follow-up is lacking, and the safety and efficacy concerns of genome editing remain.

Also flagged:Alcoholic HepatitisAHalcoholliver diseasedeathalcohol-
Journal Article 2020-09-01 ✓ 2 Snippets Lee DH, Choi YI, Bae JM, Chang MS, Joo SK, Jung YJ, Lee KL, Kim BG, Kim W.
In-Text Gene Mentions

…drug-induced liver injury,hemochromatosis, primary biliary cholangitis,…

…syphilitic hepatitis, n=1;hemochromatosis, n=1; or drug-induced…

Show Full Abstract

<h4>Background/aims</h4>The alcoholic hepatitis histologic score (AHHS) is a recently developed clinical model for predicting short-term mortality in Caucasian patients with alcoholic hepatitis (AH). The AHHS has not been extensively validated in other ethnic populations. This study validated the AHHS in a Korean patient cohort.<h4>Methods</h4>We conducted a prospective cohort study of hospitalized Korean patients with AH between January 2010 and August 2017. Histopathological findings were assessed to determine the AHHS in all study subjects. Histopathological risk factors were examined by Cox regression analysis to predict overall survival (OS). Kaplan-Meier curves were plotted to assess the diagnostic performance of the AHHS.<h4>Results</h4>We recruited a total of 107 patients with biopsy-proven AH. None of the individual AHHS components were associated with 3-month mortality. However, the bilirubinostasis type and fibrosis severity were significantly associated with AH mortality beyond 6 months (all p<0.05, except fibrosis severity for 6-month mortality) and OS (all p<0.05). The modified AHHS classification as a binary variable (<5 vs ≥5) was also associated with OS (hazard ratio, 2.88; 95% confidence interval [CI], 1.50 to 5.56; p=0.002), and had higher predictive performance for OS (concordance index [C-index], 0.634; 95% CI, 0.561 to 0.707) than the original AHHS classification (mild vs moderate vs severe: C-index, 0.577; 95% CI, 0.498 to 0.656). This difference was statistically significant (p=0.045).<h4>Conclusions</h4>In this prospective Korean AH cohort, the modified AHHS was significantly associated with OS. Therefore, the AHHS might be a useful histological prognosticator for long-term prognosis in patients with nonsevere AH.

Also flagged:chromatin-modifying proteinHUB2ligninPRN2β-galactosidasecell walls
Journal Article 2020-09-01 ✓ 1 Snippet Zhang B, Sztojka B, Seyfferth C, Escamez S, Miskolczi P, Chantreau M, Bakó L, Delhomme N, Gorzsás A, Bhalerao RP, Tuominen H.
In-Text Gene Mentions

…binding to thelinker histone variant H1.3histone variant H1.3…

Show Full Abstract

PIRIN2 (PRN2) was earlier reported to suppress syringyl (S)-type lignin accumulation of xylem vessels of Arabidopsis thaliana. In the present study, we report yeast two-hybrid results supporting the interaction of PRN2 with HISTONE MONOUBIQUITINATION2 (HUB2) in Arabidopsis. HUB2 has been previously implicated in several plant developmental processes, but not in lignification. Interaction between PRN2 and HUB2 was verified by β-galactosidase enzymatic and co-immunoprecipitation assays. HUB2 promoted the deposition of S-type lignin in the secondary cell walls of both stem and hypocotyl tissues, as analysed by pyrolysis-GC/MS. Chemical fingerprinting of individual xylem vessel cell walls by Raman and Fourier transform infrared microspectroscopy supported the function of HUB2 in lignin deposition. These results, together with a genetic analysis of the hub2 prn2 double mutant, support the antagonistic function of PRN2 and HUB2 in deposition of S-type lignin. Transcriptome analyses indicated the opposite regulation of the S-type lignin biosynthetic gene FERULATE-5-HYDROXYLASE1 by PRN2 and HUB2 as the underlying mechanism. PRN2 and HUB2 promoter activities co-localized in cells neighbouring the xylem vessel elements, suggesting that the S-type lignin-promoting function of HUB2 is antagonized by PRN2 for the benefit of the guaiacyl (G)-type lignin enrichment of the neighbouring xylem vessel elements.

Also flagged:cancercell receptorsbindingsynapsemembranetumor
Journal Article 2020-09-01 ✓ 4 Snippets Vyborova A, Beringer DX, Fasci D, Karaiskaki F, van Diest E, Kramer L, de Haas A, Sanders J, Janssen A, Straetemans T, Olive D, Leusen J, Boutin L, Nedellec S, Schwartz SL, Wester MJ, Lidke KA, Scotet E, Lidke DS, Heck AJ, Sebestyen Z, Kuball J.
In-Text Gene Mentions

…the γ9δ2TCR toBTN2A1through the regions…

…pAg-dependent proximity toBTN2A1, enhanced cell-cell conjugate…

BTN3A3

BTN2A1

Show Full Abstract

γ9δ2T cells play a major role in cancer immune surveillance, yet the clinical translation of their in vitro promise remains challenging. To address limitations of previous clinical attempts using expanded γ9δ2T cells, we explored the clonal diversity of γ9δ2T cell repertoires and characterized their target. We demonstrated that only a fraction of expanded γ9δ2T cells was active against cancer cells and that activity of the parental clone, or functional avidity of selected γ9δ2 T cell receptors (γ9δ2TCRs), was not associated with clonal frequency. Furthermore, we analyzed the target-receptor interface and provided a 2-receptor, 3-ligand model. We found that activation was initiated by binding of the γ9δ2TCR to BTN2A1 through the regions between CDR2 and CDR3 of the TCR γ chain and modulated by the affinity of the CDR3 region of the TCRδ chain, which was phosphoantigen independent (pAg independent) and did not depend on CD277. CD277 was secondary, serving as a mandatory coactivating ligand. We found that binding of CD277 to its putative ligand did not depend on the presence of γ9δ2TCR, did depend on usage of the intracellular CD277, created pAg-dependent proximity to BTN2A1, enhanced cell-cell conjugate formation, and stabilized the immunological synapse (IS). This process critically depended on the affinity of the γ9δ2TCR and required membrane flexibility of the γ9δ2TCR and CD277, facilitating their polarization and high-density recruitment during IS formation.

Also flagged:Epithelioid MesotheliomaLung Adenocarcinomasex-determining region Y box 6gene expressioncalretininpodoplanin
Journal Article 2020-09-01 ✓ 5 Snippets Kambara T, Amatya VJ, Kushitani K, Suzuki R, Fujii Y, Kai Y, Miyata Y, Okada M, Takeshima Y.
In-Text Gene Mentions

The sensitivity and specificity of SOX6 expression for differentiating epithelioid mesothelioma and lung adenocarcinoma were 98% and 93%, respectively.

In conclusion, SOX6 is a novel candidate immunohistochemical marker for differentiating epithelioid mesothelioma from lung adenocarcinoma.

Immunohistochemically, SOX6 expression was present in 53 of 54 (98%) cases of epithelioid mesothelioma, compared with its expression in only 5 of 69 (7%) cases of lung adenocarcinoma.

SOX6 is a Novel Immunohistochemical Marker for Differential Diagnosis of Epithelioid Mesothelioma From Lung Adenocarcinoma.

SOX6is a Novel…

Show Full Abstract

The differential diagnosis of epithelioid mesothelioma from lung adenocarcinoma using immunohistochemistry is improving. However, immunohistochemical markers with high sensitivity and specificity have yet to be identified. In this study, we investigated the utility of sex-determining region Y box 6 (SOX6) as a novel immunohistochemical marker, identified by analyzing previous gene expression data. Immunohistochemically, SOX6 expression was present in 53 of 54 (98%) cases of epithelioid mesothelioma, compared with its expression in only 5 of 69 (7%) cases of lung adenocarcinoma. The sensitivity and specificity of SOX6 expression for differentiating epithelioid mesothelioma and lung adenocarcinoma were 98% and 93%, respectively. SOX6 expression showed similar sensitivity and far better specificity than those of calretinin or podoplanin (D2-40). In addition, SOX6 expression was more sensitive than Wilms' tumor 1 expression. The combination of SOX6 with other markers showed comparable or better sensitivity and specificity relative to other combinations. In particular, the sensitivity of positivity for both SOX6 and calretinin (96%) and the specificity of positivity for both SOX6 and Wilms' tumor 1 (93%) were higher than those of the other combinations. In conclusion, SOX6 is a novel candidate immunohistochemical marker for differentiating epithelioid mesothelioma from lung adenocarcinoma.

Also flagged:+TIP Navigator-1Microtubule+TIPscytoskeletonsgrowth conesaxon
Journal Article 2020-09-01 ✓ 3 Snippets Sánchez-Huertas C, Bonhomme M, Falco A, Fagotto-Kaufmann C, van Haren J, Jeanneteau F, Galjart N, Debant A, Boudeau J.
In-Text Gene Mentions

…in Colorectal Cancer (DCC) at the surface…

…the netrin-1 receptorDCCleads to a…

…to an impaired netrin-1–DCCsignaling in the…

Show Full Abstract

Microtubule (MT) plus-end tracking proteins (+TIPs) are central players in the coordination between the MT and actin cytoskeletons in growth cones (GCs) during axon guidance. The +TIP Navigator-1 (NAV1) is expressed in the developing nervous system, yet its neuronal functions remain poorly elucidated. Here, we report that NAV1 controls the dynamics and motility of the axonal GCs of cortical neurons in an EB1-dependent manner and is required for axon turning toward a gradient of netrin-1. NAV1 accumulates in F-actin-rich domains of GCs and binds actin filaments in vitro. NAV1 can also bind MTs independently of EB1 in vitro and crosslinks nonpolymerizing MT plus ends to actin filaments in axonal GCs, preventing MT depolymerization in F-actin-rich areas. Together, our findings pinpoint NAV1 as a key player in the actin-MT crosstalk that promotes MT persistence at the GC periphery and regulates GC steering. Additionally, we present data assigning to NAV1 an important role in the radial migration of cortical projection neurons in vivo.

Also flagged:inflammatory bowel diseaseiron deficiencyironC-reactive proteinCRPFerritin
Journal Article 2020-09-01 ✓ 2 Snippets Widbom L, Ekblom K, Karling P, Hultdin J.
In-Text Gene Mentions

…2 and theHFEgene regulating iron…

…also influenced byHFEgenotype, was early…

Show Full Abstract

<h4>Background</h4>Iron deficiency is common among inflammatory bowel disease (IBD) patients, generally reported without comparisons with controls. The aim of this study was to analyse if iron deficiency was more common among those later developing IBD compared to matched controls in a prospective setting.<h4>Methods</h4>We included 96 healthy subjects later developing IBD and 191 matched controls from the Northern Sweden Health and Disease Study. We analysed iron, ferritin, transferrin, and calculated transferrin saturation in plasma sampled at least 1 year prior to IBD diagnosis. Iron deficiency was defined as plasma ferritin <30 µg/L if C-reactive protein (CRP) was <3 mg/L. When CRP was >3 mg/L, iron deficiency could not be excluded if ferritin was <100 µg/L.<h4>Results</h4>Iron deficiency could not be excluded among more male cases vs controls (25.0% vs 2.2%; P < 0.001), whereas with no differences for women (39.6% vs 35.3%; P = 0.538). Ferritin was lower among male IBD cases (P = 0.001) and for ulcerative colitis (P = 0.016 for males and 0.017 for females), but not for Crohn's disease. Ferritin was associated with a lower risk for IBD and in the ulcerative colitis subgroup when using sex-based z-scores. Ferritin quartiles 2-4 had a 65% lower odds ratio for all IBD, ulcerative colitis, and Crohn's disease in multivariable analysis.<h4>Conclusions</h4>Lower ferritin was associated with higher risk for developing IBD in a prospective setting. Iron deficiency was more common among healthy males years later developing IBD compared to matched controls, but not among women.

Also flagged:HAMPironFPNgestationbehavioralanemia
Journal Article 2020-09-01 ✓ 2 Snippets Kämmerer L, Mohammad G, Wolna M, Robbins PA, Lakhal-Littleton S.
In-Text Gene Mentions

hemochromatosis

HFE

Show Full Abstract

In the adult, the liver-derived hormone hepcidin (HAMP) controls systemic iron levels by blocking the iron-exporting protein ferroportin (FPN) in the gut and spleen, the sites of iron absorption and recycling, respectively. Impaired HAMP expression or FPN responsiveness to HAMP result in iron overload. HAMP is also expressed in the fetal liver but its role in controlling fetal iron stores is not understood. To address this question in a manner that safeguards against the confounding effects of altered maternal iron homeostasis, we generated fetuses harboring a paternally-inherited ubiquitous knock-in of the HAMP-resistant fpnC326Y. Additionally, to safeguard against any confounding effects of altered placental iron homeostasis, we generated fetuses with a liver-specific knock-in of fpnC326Y or knockout of the hamp gene. These fetuses had reduced liver iron stores and hemoglobin, and markedly increased FPN in the liver, but not in the placenta. Thus, fetal liver HAMP operates cell-autonomously to increase fetal liver iron stores. Our findings also suggest that FPN in the placenta is not actively regulated by fetal liver HAMP under normal physiological conditions.

Also flagged:Glucagon-like peptidegraft-versus-host diseaseAcute graft-versus-host diseaseGVHDGlucagon-like-peptide
Journal Article 2020-09-01 ✓ 1 Snippet Norona J, Apostolova P, Schmidt D, Ihlemann R, Reischmann N, Taylor G, Köhler N, de Heer J, Heeg S, Andrieux G, Siranosian BA, Schmitt-Graeff A, Pfeifer D, Catalano A, Frew IJ, Proietti M, Grimbacher B, Bulashevska A, Bhatt AS, Brummer T, Clauditz T, Zabelina T, Kroeger N, Blazar BR, Boerries M, Ayuk F, Zeiser R.
In-Text Gene Mentions

Olfm4

Show Full Abstract

Acute graft-versus-host disease (GVHD) is a life-threatening complication after allogeneic hematopoietic cell transplantation (allo-HCT). Although currently used GVHD treatment regimens target the donor immune system, we explored here an approach that aims at protecting and regenerating Paneth cells (PCs) and intestinal stem cells (ISCs). Glucagon-like-peptide-2 (GLP-2) is an enteroendocrine tissue hormone produced by intestinal L cells. We observed that acute GVHD reduced intestinal GLP-2 levels in mice and patients developing GVHD. Treatment with the GLP-2 agonist, teduglutide, reduced de novo acute GVHD and steroid-refractory GVHD, without compromising graft-versus-leukemia (GVL) effects in multiple mouse models. Mechanistically GLP-2 substitution promoted regeneration of PCs and ISCs, which enhanced production of antimicrobial peptides and caused microbiome changes. GLP-2 expanded intestinal organoids and reduced expression of apoptosis-related genes. Low numbers of L cells in intestinal biopsies and high serum levels of GLP-2 were associated with a higher incidence of nonrelapse mortality in patients undergoing allo-HCT. Our findings indicate that L cells are a target of GVHD and that GLP-2-based treatment of acute GVHD restores intestinal homeostasis via an increase of ISCs and PCs without impairing GVL effects. Teduglutide could become a novel combination partner for immunosuppressive GVHD therapy to be tested in clinical trials.

Also flagged:Histone methyltransferase MLL4gene expressionhistone monomethyl transferase MLL4KMT2Dmitochondrialfatty acid
Journal Article 2020-09-01 ✓ 1 Snippet Liu L, Ding C, Fu T, Feng Z, Lee JE, Xiao L, Xu Z, Yin Y, Guo Q, Sun Z, Sun W, Mao Y, Yang L, Zhou Z, Zhou D, Xu L, Zhu Z, Qiu Y, Ge K, Gan Z.
In-Text Gene Mentions

SOX6

Show Full Abstract

Skeletal muscle depends on the precise orchestration of contractile and metabolic gene expression programs to direct fiber-type specification and to ensure muscle performance. Exactly how such fiber type-specific patterns of gene expression are established and maintained remains unclear, however. Here, we demonstrate that histone monomethyl transferase MLL4 (KMT2D), an enhancer regulator enriched in slow myofibers, plays a critical role in controlling muscle fiber identity as well as muscle performance. Skeletal muscle-specific ablation of MLL4 in mice resulted in downregulation of the slow oxidative myofiber gene program, decreased numbers of type I myofibers, and diminished mitochondrial respiration, which caused reductions in muscle fatty acid utilization and endurance capacity during exercise. Genome-wide ChIP-Seq and mRNA-Seq analyses revealed that MLL4 directly binds to enhancers and functions as a coactivator of the myocyte enhancer factor 2 (MEF2) to activate transcription of slow oxidative myofiber genes. Importantly, we also found that the MLL4 regulatory circuit is associated with muscle fiber-type remodeling in humans. Thus, our results uncover a pivotal role for MLL4 in specifying structural and metabolic identities of myofibers that govern muscle performance. These findings provide therapeutic opportunities for enhancing muscle fitness to combat a variety of metabolic and muscular diseases.

Also flagged:SLC2A3ETV1Testicular germ cell tumoursembryonal carcinomaschromosometesticular
Journal Article 2020-09-01 ✓ 5 Snippets Hoff AM, Kraggerud SM, Alagaratnam S, Berg KCG, Johannessen B, Høland M, Nilsen G, Lingjærde OC, Andrews PW, Lothe RA, Skotheim RI.
In-Text Gene Mentions

SLC2A14 (or GLUT14) expression is deregulated in several cancer types and is suggested to be a prognostic factor for a number of cancers, for example, in thyroid carcinoma (Chai et al. 2017).

The roles of SLC2A14 and SLC2A3 in cancer have more recently gained attention.

…and parts ofSLC2A14.…

…including SLC2A3 andSLC2A14, were gained…

…, SLC2A3 ,SLC2A14, and TULP3.…

Show Full Abstract

Testicular germ cell tumours (TGCTs) appear as different histological subtypes or mixtures of these. They show similar, multiple DNA copy number changes, where gain of 12p is pathognomonic. However, few high-resolution analyses have been performed and focal DNA copy number changes with corresponding candidate target genes remain poorly described for individual subtypes. We present the first high-resolution DNA copy number aberration (CNA) analysis on the subtype embryonal carcinomas (ECs), including 13 primary ECs and 5 EC cell lines. We identified recurrent gains and losses and allele-specific CNAs. Within these regions, we nominate 30 genes that may be of interest to the EC subtype. By in silico analysis of data from 150 TGCTs from The Cancer Genome Atlas (TCGA), we further investigated CNAs, RNA expression, somatic mutations and fusion transcripts of these genes. Among primary ECs, ploidy ranged between 2.3 and 5.0, and the most common aberrations were DNA copy number gains at chromosome (arm) 7, 8, 12p, and 17, losses at 4, 10, 11, and 18, replicating known TGCT genome characteristics. Gain of whole or parts of 12p was found in all samples, including a highly amplified 100 kbp segment at 12p13.31, containing SLC2A3. Gain at 7p21, encompassing ETV1, was the second most frequent aberration. In conclusion, we present novel CNAs and the genes located within these regions, where the copy number gain of SLC2A3 and ETV1 are of interest, and which copy number levels also correlate with expression in TGCTs.

Also flagged:phytocannabinoidscannabidivarincannabichromenecannabichromenic acidcannabigerolcannabigerolic acid
Journal Article 2020-09-01 No Snippets Stone NL, Murphy AJ, England TJ, O'Sullivan SE.
Show Full Abstract

Embase and PubMed were systematically searched for articles addressing the neuroprotective properties of phytocannabinoids, apart from cannabidiol and Δ<sup>9</sup> -tetrahydrocannabinol, including Δ<sup>9</sup> -tetrahydrocannabinolic acid, Δ<sup>9</sup> -tetrahydrocannabivarin, cannabidiolic acid, cannabidivarin, cannabichromene, cannabichromenic acid, cannabichromevarin, cannabigerol, cannabigerolic acid, cannabigerivarin, cannabigerovarinic acid, cannabichromevarinic acid, cannabidivarinic acid, and cannabinol. Out of 2,341 studies, 31 articles met inclusion criteria. Cannabigerol (range 5 to 20 mg·kg<sup>-1</sup> ) and cannabidivarin (range 0.2 to 400 mg·kg<sup>-1</sup> ) displayed efficacy in models of Huntington's disease and epilepsy. Cannabichromene (10-75 mg·kg<sup>-1</sup> ), Δ<sup>9</sup> -tetrahydrocannabinolic acid (20 mg·kg<sup>-1</sup> ), and tetrahydrocannabivarin (range 0.025-2.5 mg·kg<sup>-1</sup> ) showed promise in models of seizure and hypomobility, Huntington's and Parkinson's disease. Limited mechanistic data showed cannabigerol, its derivatives VCE.003 and VCE.003.2, and Δ<sup>9</sup> -tetrahydrocannabinolic acid mediated some of their effects through PPAR-γ, but no other receptors were probed. Further studies with these phytocannabinoids, and their combinations, are warranted across a range of neurodegenerative disorders.

Also flagged:Dnmt1methylationdemethylationcytoplasmiclocalizationmaintenance methyltransferase
Journal Article 2020-09-01 No Snippets Min B, Park JS, Jeong YS, Jeon K, Kang YK.
Show Full Abstract

Genome-wide passive DNA demethylation in cleavage-stage mouse embryos is related to the cytoplasmic localization of the maintenance methyltransferase DNMT1. However, recent studies provided evidences of the nuclear localization of DNMT1 and its contribution to the maintenance of methylation levels of imprinted regions and other genomic loci in early embryos. Using the DNA adenine methylase identification method, we identified Dnmt1-binding regions in four- and eight-cell embryos. The unbiased distribution of Dnmt1 peaks in the genic regions (promoters and CpG islands) as well as the absence of a correlation between the Dnmt1 peaks and the expression levels of the peak-associated genes refutes the active participation of Dnmt1 in the transcriptional regulation of genes in the early developmental period. Instead, Dnmt1 was found to associate with genomic retroelements in a greatly biased fashion, particularly with the LINE1 (long interspersed nuclear elements) and ERVK (endogenous retrovirus type K) sequences. Transcriptomic analysis revealed that the transcripts of the Dnmt1-enriched retroelements were overrepresented in Dnmt1 knockdown embryos. Finally, methyl-CpG-binding domain sequencing proved that the Dnmt1-enriched retroelements, which were densely methylated in wild-type embryos, became demethylated in the Dnmt1-depleted embryos. Our results indicate that Dnmt1 is involved in the repression of retroelements through DNA methylation in early mouse development.

Also flagged:Cell differentiationTCRAchromatinHOXA5-9transcription factorsHOXA
Journal Article 2020-09-01 ✓ 1 Snippet Cieslak A, Charbonnier G, Tesio M, Mathieu EL, Belhocine M, Touzart A, Smith C, Hypolite G, Andrieu GP, Martens JHA, Janssen-Megens E, Gut M, Gut I, Boissel N, Petit A, Puthier D, Macintyre E, Stunnenberg HG, Spicuglia S, Asnafi V.
In-Text Gene Mentions

…in T-ALLs with PICALM-MLLT10or SET-NUP214 translocations…

Show Full Abstract

Cell differentiation is accompanied by epigenetic changes leading to precise lineage definition and cell identity. Here we present a comprehensive resource of epigenomic data of human T cell precursors along with an integrative analysis of other hematopoietic populations. Although T cell commitment is accompanied by large scale epigenetic changes, we observed that the majority of distal regulatory elements are constitutively unmethylated throughout T cell differentiation, irrespective of their activation status. Among these, the TCRA gene enhancer (Eα) is in an open and unmethylated chromatin structure well before activation. Integrative analyses revealed that the HOXA5-9 transcription factors repress the Eα enhancer at early stages of T cell differentiation, while their decommission is required for TCRA locus activation and enforced αβ T lineage differentiation. Remarkably, the HOXA-mediated repression of Eα is paralleled by the ectopic expression of homeodomain-related oncogenes in T cell acute lymphoblastic leukemia. These results highlight an analogous enhancer repression mechanism at play in normal and cancer conditions, but imposing distinct developmental constraints.

Also flagged:Egr2histone H2Bmyelin sheathsperipheral neuropathiesCharcot-Marie-Tooth diseaseSchwann cell development
Journal Article 2020-09-01 ✓ 1 Snippet Wüst HM, Wegener A, Fröb F, Hartwig AC, Wegwitz F, Kari V, Schimmel M, Tamm ER, Johnsen SA, Wegner M, Sock E.
In-Text Gene Mentions

…(also known asPou3f2), and Oct6…

Show Full Abstract

Schwann cells are the nerve ensheathing cells of the peripheral nervous system. Absence, loss and malfunction of Schwann cells or their myelin sheaths lead to peripheral neuropathies such as Charcot-Marie-Tooth disease in humans. During Schwann cell development and myelination chromatin is dramatically modified. However, impact and functional relevance of these modifications are poorly understood. Here, we analyzed histone H2B monoubiquitination as one such chromatin modification by conditionally deleting the Rnf40 subunit of the responsible E3 ligase in mice. Rnf40-deficient Schwann cells were arrested immediately before myelination or generated abnormally thin, unstable myelin, resulting in a peripheral neuropathy characterized by hypomyelination and progressive axonal degeneration. By combining sequencing techniques with functional studies we show that H2B monoubiquitination does not influence global gene expression patterns, but instead ensures selective high expression of myelin and lipid biosynthesis genes and proper repression of immaturity genes. This requires the specific recruitment of the Rnf40-containing E3 ligase by Egr2, the central transcriptional regulator of peripheral myelination, to its target genes. Our study identifies histone ubiquitination as essential for Schwann cell myelination and unravels new disease-relevant links between chromatin modifications and transcription factors in the underlying regulatory network.

Also flagged:FingolimodNeurologic DisordersMSneurodegenerative diseasessphingosine-1-phosphateS1P) receptors
Journal Article 2020-09-01 No Snippets Bascuñana P, Möhle L, Brackhan M, Pahnke J.
Show Full Abstract

Fingolimod is an approved treatment for relapsing-remitting multiple sclerosis (MS), and its properties in different pathways have raised interest in therapy research for other neurodegenerative diseases. Fingolimod is an agonist of sphingosine-1-phosphate (S1P) receptors. Its main pharmacologic effect is immunomodulation by lymphocyte homing, thereby reducing the numbers of T and B cells in circulation. Because of the ubiquitous expression of S1P receptors, other effects have also been described. Here, we review preclinical experiments evaluating the effects of treatment with fingolimod in neurodegenerative diseases other than MS, such as Alzheimer's disease or epilepsy. Fingolimod has shown neuroprotective effects in different animal models of neurodegenerative diseases, summarized here, correlating with increased brain-derived neurotrophic factor and improved disease phenotype (cognition and/or motor abilities). As expected, treatment also induced reductions in different neuroinflammatory markers because of not only inhibition of lymphocytes but also direct effects on astrocytes and microglia. Furthermore, fingolimod treatment exhibited additional effects for specific neurodegenerative disorders, such as reduction of amyloid-β production, and antiepileptogenic properties. The neuroprotective effects exerted by fingolimod in these preclinical studies are reviewed and support the translation of fingolimod into clinical trials as treatment in neurodegenerative diseases beyond neuroinflammatory conditions (MS).

Also flagged:PPARGC1BNontraumatic Osteonecrosis of theosteonecrosis of the femoral headsteroidSAMD9
Journal Article 2020-09-01 ✓ 1 Snippet Zhang Y, Bowen TR, Lietman SA, Suk M, Williams MS, Lee MTM.
In-Text Gene Mentions

…rs116468452 nearCACNA1Ewas significantly associated…

Show Full Abstract

<h4>Background</h4>Previous studies have demonstrated the influence of heritable factors on the development of nontraumatic osteonecrosis of the femoral head (ONFH). We hypothesized that genetic variation is associated with an increased risk of ONFH, and that variants could be identified by a genomewide association study (GWAS).<h4>Methods</h4>Using data collected from the MyCode Community Health Initiative, we identified 118 adult patients with radiographically confirmed nontraumatic ONFH. Study patients were statistically compared with a control population of 56,811 unrelated individuals without a diagnosis of ONFH. A case-control GWAS was performed to identify single nucleotide variants (SNVs) associated with ONFH. Sensitivity analyses were performed to evaluate the association of the top SNVs with (cortico)steroid-associated ONFH and ONFH with femoral head collapse. Gene-based analyses were performed to identify potential causal genes.<h4>Results</h4>Of the 118 patients, 114 (96.6%) had bilateral ONFH at a median of 5 years of follow-up; 90.7% had at least one 3-week steroid prescription compared with 68.3% in controls. A GWAS identified 4 SNVs reaching genomewide significance. rs116468452 near CACNA1E was significantly associated with ONFH (p = 3.26 × 10, odds ratio [OR] = 5.6, 95% confidence interval [CI] = 3.21 to 9.76). rs10953090 in SAMD9 was significantly associated with ONFH in the steroid-exposed subset (p = 2.96 × 10, OR = 2.57, 95% CI = 1.84 to 3.58). rs112467115 in PI4K1B showed enhanced association in the collapsed subset (p = 7.82 × 10, OR = 4.5, 95% CI = 2.60 to 7.79). Gene-based analyses identified PPARGC1B as the only gene significantly associated with ONFH after Bonferroni correction (p = 1 × 10), with the lead SNV being rs78814834 (OR = 2.86, 95% CI = 1.87 to 4.38).<h4>Conclusions</h4>We identified 4 SNVs and 1 gene, PPARGC1B, associated with ONFH.<h4>Level of evidence</h4>Prognostic Level IV. See Instructions for Authors for a complete description of levels of evidence.

Diamond-Blackfan anemia.

Also flagged:Diamond-Blackfan anemiainheritedbone marrow failure syndromeErythroblastopeniaribosomal diseasesribosomal
Journal Article 2020-09-01 ✓ 1 Snippet Da Costa L, Leblanc T, Mohandas N.
In-Text Gene Mentions

hemochromatosis

Show Full Abstract

Diamond-Blackfan anemia (DBA) was the first ribosomopathy described and is a constitutional inherited bone marrow failure syndrome. Erythroblastopenia is the major characteristic of the disease, which is a model for ribosomal diseases, related to a heterozygous allelic variation in 1 of the 20 ribosomal protein genes of either the small or large ribosomal subunit. The salient feature of classical DBA is a defect in ribosomal RNA maturation that generates nucleolar stress, leading to stabilization of p53 and activation of its targets, resulting in cell-cycle arrest and apoptosis. Although activation of p53 may not explain all aspects of DBA erythroid tropism, involvement of GATA1/HSP70 and globin/heme imbalance, with an excess of the toxic free heme leading to reactive oxygen species production, account for defective erythropoiesis in DBA. Despite significant progress in defining the molecular basis of DBA and increased understanding of the mechanistic basis for DBA pathophysiology, progress in developing new therapeutic options has been limited. However, recent advances in gene therapy, better outcomes with stem cell transplantation, and discoveries of putative new drugs through systematic drug screening using large chemical libraries provide hope for improvement.

Also flagged:cysteinecell surfaceionsnucleic acidextracellularrecombinase
Journal Article 2020-09-01 ✓ 5 Snippets Khalaj AJ, Sterky FH, Sclip A, Schwenk J, Brunger AT, Fakler B, Südhof TC.
In-Text Gene Mentions

Fig. S2 shows that FAM19A1-A4, but not FAM19A5, binds to all neurexin isoforms and splice variants tested as assessed by the neurexin-mediated exposure of FAM19A proteins on the surface of HEK293T cells coexpressing the various FAM19A proteins and neurexins. Fig. S3 shows that exogenously added FAM19A1 protein binds weakly to surface β-neurexin, in contrast to coexpressed FAM19A1 protein, which binds stoichiometrically, and purified recombinant FAM19A1 exists as a monomer as well as disulfide-mediated dimers. Fig. S4 shows that FAM19A1 binding to Nrxn1β is dependent on the cysteine residues in the neurexin Cys-loop domain, but the Cys-loop domain is insufficient for FAM19A1 binding since FAM19A1 does not bind to Nrxn1γ, which contains the Cys-loop domain, whereas CA10 does bind to Nrxn1γ. Fig. S5 shows that the deletion of neurexins decreases levels of surface-exposed FAM19A1 localized adjacent to dendrites but has no effect on the intrinsic electrical properties of neurons.

FAM19A1 binding to Nrxn1β is dependent on the cysteine residues in the neurexin cysteine-loop domain, but the cysteine-loop domain is insufficient for FAM19A1 binding since FAM19A1 does not bind to Nrxn1γ that contains the cysteine-loop domain, whereas CA10 does bind to Nrxn1γ.

…Cys-loop domain, whereasCA10does bind to…

…does bind toCA10, another recently described…

…calsyntenins, C1qls, andCA10/11) with more than…

Show Full Abstract

Neurexins are presynaptic adhesion molecules that organize synapses by binding to diverse trans-synaptic ligands, but how neurexins are regulated is incompletely understood. Here we identify FAM19A/TAFA proteins, "orphan" cytokines, as neurexin regulators that interact with all neurexins, except for neurexin-1γ, via an unusual mechanism. Specifically, we show that FAM19A1-A4 bind to the cysteine-loop domain of neurexins by forming intermolecular disulfide bonds during transport through the secretory pathway. FAM19A-binding required both the cysteines of the cysteine-loop domain and an adjacent sequence of neurexins. Genetic deletion of neurexins suppressed FAM19A1 expression, demonstrating that FAM19As physiologically interact with neurexins. In hippocampal cultures, expression of exogenous FAM19A1 decreased neurexin O-glycosylation and suppressed its heparan sulfate modification, suggesting that FAM19As regulate the post-translational modification of neurexins. Given the selective expression of FAM19As in specific subtypes of neurons and their activity-dependent regulation, these results suggest that FAM19As serve as cell type-specific regulators of neurexin modifications.

Also flagged:histonenuclear divisionsembryogenesishistonesH1nucleosome
Journal Article 2020-09-01 ✓ 2 Snippets Henn L, Szabó A, Imre L, Román Á, Ábrahám A, Vedelek B, Nánási P, Boros IM.
In-Text Gene Mentions

…In Drosophilalinker histone variant BigH1histone variant BigH1…

…that express chimeralinker histoneshistones constructed by…

Show Full Abstract

In most animals, the start of embryogenesis requires specific histones. In Drosophila linker histone variant BigH1 is present in early embryos. To uncover the specific role of this alternative linker histone at early embryogenesis, we established fly lines in which domains of BigH1 have been replaced partially or completely with that of H1. Analysis of the resulting Drosophila lines revealed that at normal temperature somatic H1 can substitute the alternative linker histone, but at low temperature the globular and C-terminal domains of BigH1 are essential for embryogenesis. In the presence of BigH1 nucleosome stability increases and core histone incorporation into nucleosomes is more rapid, while nucleosome spacing is unchanged. Chromatin formation in the presence of BigH1 permits the fast-paced nuclear divisions of the early embryo. We propose a model which explains how this specific linker histone ensures the rapid nucleosome reassembly required during quick replication cycles at the start of embryogenesis.

Also flagged:foxc1forkhead/winged helix transcription factorAxenfeld-Rieger syndromefoxc1bfoxc1apitx2
Journal Article 2020-09-01 ✓ 2 Snippets Ferre-Fernández JJ, Sorokina EA, Thompson S, Collery RF, Nordquist E, Lincoln J, Semina EV.
In-Text Gene Mentions

…Abstract TheForkhead Box C1Box C1 (…

Forkhead Box C1

Show Full Abstract

The Forkhead Box C1 (FOXC1) gene encodes a forkhead/winged helix transcription factor involved in embryonic development. Mutations in this gene cause dysgenesis of the anterior segment of the eye, most commonly Axenfeld-Rieger syndrome (ARS), often with other systemic features. The developmental mechanisms and pathways regulated by FOXC1 remain largely unknown. There are two conserved orthologs of FOXC1 in zebrafish, foxc1a and foxc1b. To further examine the role of FOXC1 in vertebrates, we generated foxc1a and foxc1b single knockout zebrafish lines and bred them to obtain various allelic combinations. Three genotypes demonstrated visible phenotypes: foxc1a-/- single homozygous and foxc1-/- double knockout homozygous embryos presented with similar characteristics comprised of severe global vascular defects and early lethality, as well as microphthalmia, periocular edema and absence of the anterior chamber of the eye; additionally, fish with heterozygous loss of foxc1a combined with homozygosity for foxc1b (foxc1a+/-;foxc1b-/-) demonstrated craniofacial defects, heart anomalies and scoliosis. All other single and combined genotypes appeared normal. Analysis of foxc1 expression detected a significant increase in foxc1a levels in homozygous and heterozygous mutant eyes, suggesting a mechanism for foxc1a upregulation when its function is compromised; interestingly, the expression of another ARS-associated gene, pitx2, was responsive to the estimated level of wild-type Foxc1a, indicating a possible role for this protein in the regulation of pitx2 expression. Altogether, our results support a conserved role for foxc1 in the formation of many organs, consistent with the features observed in human patients, and highlight the importance of correct FOXC1/foxc1 dosage for vertebrate development.

Also flagged:SchizophreniacancertumoroncogenesLPAR1Lysophosphatidic Acid Receptor 1
Journal Article 2020-09-01 ✓ 4 Snippets Barel G, Herwig R.
In-Text Gene Mentions

But, there are also some genes with intermediate weights, which are only predicted by NetCore, such as BTN2A1 and AP2M1. BTN2A1 was also found significant in the more recent Schizophrenia GWAS study (‘Materials and Methods’ section), in addition to seven more genes that were predicted by NetCore.

…NetCore, such asBTN2A1and AP2M1 .…

BTN2A1was also found…

…For example,BTN2A1, which is…

Show Full Abstract

We present NetCore, a novel network propagation approach based on node coreness, for phenotype-genotype associations and module identification. NetCore addresses the node degree bias in PPI networks by using node coreness in the random walk with restart procedure, and achieves improved re-ranking of genes after propagation. Furthermore, NetCore implements a semi-supervised approach to identify phenotype-associated network modules, which anchors the identification of novel candidate genes at known genes associated with the phenotype. We evaluated NetCore on gene sets from 11 different GWAS traits and showed improved performance compared to the standard degree-based network propagation using cross-validation. Furthermore, we applied NetCore to identify disease genes and modules for Schizophrenia GWAS data and pan-cancer mutation data. We compared the novel approach to existing network propagation approaches and showed the benefits of using NetCore in comparison to those. We provide an easy-to-use implementation, together with a high confidence PPI network extracted from ConsensusPathDB, which can be applied to various types of genomics data in order to obtain a re-ranking of genes and functionally relevant network modules.

Also flagged:prostate cancergene expressionlipidautoimmune diseaseschromatinlocalization
Journal Article 2020-09-01 ✓ 1 Snippet Hutchinson A, Asimit J, Wallace C.
In-Text Gene Mentions

HTT

Show Full Abstract

Whilst thousands of genetic variants have been associated with human traits, identifying the subset of those variants that are causal requires a further 'fine-mapping' step. We review the basic fine-mapping approach, which is computationally fast and requires only summary data, but depends on an assumption of a single causal variant per associated region which is recognized as biologically unrealistic. We discuss different ways that the approach has been built upon to accommodate multiple causal variants in a region and to incorporate additional layers of functional annotation data. We further review methods for simultaneous fine-mapping of multiple datasets, either exploiting different linkage disequilibrium (LD) structures across ancestries or borrowing information between distinct but related traits. Finally, we look to the future and the opportunities that will be offered by increasingly accurate maps of causal variants for a multitude of human traits.

Also flagged:factorstranscription factorsSBFgene expressionG1 phasecell division
Journal Article 2020-09-01 ✓ 1 Snippet Black L, Tollis S, Fu G, Fiche JB, Dorsey S, Cheng J, Ghazal G, Notley S, Crevier B, Bigness J, Nollmann M, Tyers M, Royer CA.
In-Text Gene Mentions

Condensinand cohesin are…

Show Full Abstract

In budding yeast, the transcription factors SBF and MBF activate a large program of gene expression in late G1 phase that underlies commitment to cell division, termed Start. SBF/MBF are limiting with respect to target promoters in small G1 phase cells and accumulate as cells grow, raising the questions of how SBF/MBF are dynamically distributed across the G1/S regulon and how this impacts the Start transition. Super-resolution Photo-Activatable Localization Microscopy (PALM) mapping of the static positions of SBF/MBF subunits in fixed cells revealed each transcription factor was organized into discrete clusters containing approximately eight copies regardless of cell size and that the total number of clusters increased as cells grew through G1 phase. Stochastic modeling using reasonable biophysical parameters recapitulated growth-dependent SBF/MBF clustering and predicted TF dynamics that were confirmed in live cell PALM experiments. This spatio-temporal organization of SBF/MBF may help coordinate activation of G1/S regulon and the Start transition.

Journal Article 2020-09-01 ✓ 1 Snippet Unknown Authors
In-Text Gene Mentions
⭐ same-sentence co-mention

…Corrigendum to: TargetingGpr52lowers mutant HTT…

Show Full Abstract

No abstract available.

Also flagged:colorectal cancercolorectal tumorsAPCKRASSMADtumor
Journal Article 2020-09-01 ✓ 2 Snippets Del Carmen S, Sayagués JM, Abad M.
In-Text Gene Mentions

Accordingly, while the presence of mutations in the APC and/or KRAS genes is associated with neoplastic transformation, mutations in SMAD and DCC, different chromosomal abnormalities located at 7, 17p and 18q, and complex karyotypes are frequently linked with tumor progression.

…in SMAD andDCC, different chromosomal abnorm…

Show Full Abstract

In recent years, important advances have been achieved in the understanding of the genetic abnormalities present in colorectal tumors and their association with their ontogeny and progression. Accordingly, while the presence of mutations in the APC and/or KRAS genes is associated with neoplastic transformation, mutations in SMAD and DCC, different chromosomal abnormalities located at 7, 17p and 18q, and complex karyotypes are frequently linked with tumor progression. From a clinical point of view, the presence of microsatellite instability (MSI) is associated with lower relapse rates and a greater overall survival, as well as resistance to adjuvant treatment with fluoropyrimidines, whereas mutations in the BRAF gene have been associated with early relapse. At the molecular level, studies of intratumoral genetic heterogeneity associated with the metastatic process of colorectal cancer (CRC) have focused on analyzing mutations in the genes involved in the treatment of the disease. In fact, different mutational profiles have been observed among primary tumors, lymph node metastases and liver metastases in the same patient. In this sense, the genetic heterogeneity of CRC at the intratumor level may explain the high relapse rates reported and the refractory nature of tumors treated with monoclonal antibodies.

Also flagged:tauubiquitinneurofilament proteinsapolipoprotein EPHF1synaptic protein
Journal Article 2020-09-01 ✓ 1 Snippet Drummond E, Pires G, MacMurray C, Askenazi M, Nayak S, Bourdon M, Safar J, Ueberheide B, Wisniewski T.
In-Text Gene Mentions

PRDX6

Show Full Abstract

Accumulation of phosphorylated tau is a key pathological feature of Alzheimer's disease. Phosphorylated tau accumulation causes synaptic impairment, neuronal dysfunction and formation of neurofibrillary tangles. The pathological actions of phosphorylated tau are mediated by surrounding neuronal proteins; however, a comprehensive understanding of the proteins that phosphorylated tau interacts with in Alzheimer's disease is surprisingly limited. Therefore, the aim of this study was to determine the phosphorylated tau interactome. To this end, we used two complementary proteomics approaches: (i) quantitative proteomics was performed on neurofibrillary tangles microdissected from patients with advanced Alzheimer's disease; and (ii) affinity purification-mass spectrometry was used to identify which of these proteins specifically bound to phosphorylated tau. We identified 542 proteins in neurofibrillary tangles. This included the abundant detection of many proteins known to be present in neurofibrillary tangles such as tau, ubiquitin, neurofilament proteins and apolipoprotein E. Affinity purification-mass spectrometry confirmed that 75 proteins present in neurofibrillary tangles interacted with PHF1-immunoreactive phosphorylated tau. Twenty-nine of these proteins have been previously associated with phosphorylated tau, therefore validating our proteomic approach. More importantly, 34 proteins had previously been associated with total tau, but not yet linked directly to phosphorylated tau (e.g. synaptic protein VAMP2, vacuolar-ATPase subunit ATP6V0D1); therefore, we provide new evidence that they directly interact with phosphorylated tau in Alzheimer's disease. In addition, we also identified 12 novel proteins, not previously known to be physiologically or pathologically associated with tau (e.g. RNA binding protein HNRNPA1). Network analysis showed that the phosphorylated tau interactome was enriched in proteins involved in the protein ubiquitination pathway and phagosome maturation. Importantly, we were able to pinpoint specific proteins that phosphorylated tau interacts with in these pathways for the first time, therefore providing novel potential pathogenic mechanisms that can be explored in future studies. Combined, our results reveal new potential drug targets for the treatment of tauopathies and provide insight into how phosphorylated tau mediates its toxicity in Alzheimer's disease.

Also flagged:CSTF2RNA-binding proteinaspartic acidalanineintellectual disabilitybrain development
Journal Article 2020-09-01 ✓ 1 Snippet Grozdanov PN, Masoumzadeh E, Kalscheuer VM, Bienvenu T, Billuart P, Delrue MA, Latham MP, MacDonald CC, MacDonald CC.
In-Text Gene Mentions

Frequently, mRNAs in the brain have extremely long 3′ untranslated regions (UTRs), and altered 3′ UTRs in MECP2 (Rett syndrome), APP (Alzheimer disease) and HTT (Huntington disease) are associated with improper metabolism of each of these mRNAs leading to disease states.

Show Full Abstract

CSTF2 encodes an RNA-binding protein that is essential for mRNA cleavage and polyadenylation (C/P). No disease-associated mutations have been described for this gene. Here, we report a mutation in the RNA recognition motif (RRM) of CSTF2 that changes an aspartic acid at position 50 to alanine (p.D50A), resulting in intellectual disability in male patients. In mice, this mutation was sufficient to alter polyadenylation sites in over 1300 genes critical for brain development. Using a reporter gene assay, we demonstrated that C/P efficiency of CSTF2D50A was lower than wild type. To account for this, we determined that p.D50A changed locations of amino acid side chains altering RNA binding sites in the RRM. The changes modified the electrostatic potential of the RRM leading to a greater affinity for RNA. These results highlight the significance of 3' end mRNA processing in expression of genes important for brain plasticity and neuronal development.

Also flagged:amino acid oxidasetumorAmino acidsamino acidcytoskeletonAAO
Journal Article 2020-09-01 No Snippets Chu Q, Chu Q, Zhu H, Liu B, Cao G, Fang C, Wu Y, Li X, Han G.
Show Full Abstract

Amino acids are the fundamental building blocks of proteins in tumor cells. The consumption of amino acid can be an effective approach for destroying the tumor cytoskeleton and malfunctioning of the intracellular metabolic balance. Following this concept, herein, amino acid oxidase (AAO) is delivered by hollow Fe3+/tannic acid nanocapsules (HFe-TA) and incorporated within the cancer cell membrane (M) for the first time for synergistic tumor therapy. In this system (M@AAO@HFe-TA), the intracellularly delivered AAO molecules catalyze the oxidative deamination effectively and consume amino acids significantly. The upregulation of intracellular acid and H2O2 concentration facilitates the HFe-TA mediated Fenton reaction and enhances the induction of cytotoxic ˙OH. With the combined effects, considerable in vitro and in vivo tumor inhibition was achieved by M@AAO@Fe-TA due to the activated Bcl-2/Bax/Cyt C/caspase 3 mitochondrial apoptotic pathway. This study offers an alternative therapeutic platform, functioning as a biomimetic cascade nanozyme, to enable synergistic starvation and chemodynamic tumor therapy with high efficacy.

Also flagged:DiabetesinsulinsecretionGlucosepathogenesiswater
Journal Article 2020-09-01 No Snippets Unknown Authors
Show Full Abstract

No abstract available.

Also flagged:hemophagocytic syndromeHPS/T-cell lymphoma-associated hemophagocytic syndrometumorsbindingNK/T-cell lymphoma-associated hemophagocytic syndrome
Journal Article 2020-09-01 No Snippets Man C, Fan Y, Yin G, Huang J, Wang J, Qiu H.
Show Full Abstract

Circular RNAs (circRNAs) may be potential biomarkers or therapeutic targets of hemophagocytic syndrome (HPS) due to their high stability, covalently closed structure and implicated roles in gene regulation. The aim of the present study was to determine and characterize the circRNAs from natural killer (NK)/T-cell lymphoma-associated hemophagocytic syndrome (NK/T-LAHS). CircRNA in NK/T-LAHS and healthy control patient serum were assessed using next-generation sequencing (NGS). One hundred and forty-three differentially expressed circRNAs of which 114 were up-regulated and 29 were down-regulated in NK/T-LAHS patients were identified. Next, Gene Ontology (GO) function and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses to explore the roles of these circRNAs were utilized, and a microRNA (miRNA) target gene prediction software to predict the interaction of circRNAs and miRNAs was used. Moreover, five circRNAs were then selected as NK/T-LAHS candidate circRNAs which were related to tumors and contained NK/T-LAHS-related miRNA-binding sites. Using real-time PCR, the significant up-regulation of these five circRNAs in NK/T-LAHS patient serum were verified. Together these results show that circRNAs may serve as valuable diagnostic biomarkers of early NK/T-LAHS, with potential therapeutic targets in disease progression.

Also flagged:Alstrӧm syndromeALMS1cone-rod retinal dystrophydilated cardiomyopathyhearing lossobesity
Journal Article 2020-09-01 No Snippets Gatticchi L, Miertus J, Maltese PE, Bressan S, De Antoni L, Podracká L, Piteková L, Rísová V, Mällo M, Jaakson K, Joost K, Colombo L, Bertelli M.
Show Full Abstract

<h4>Background</h4>Alström syndrome is a rare recessively inherited disorder caused by variants in the ALMS1 gene. It is characterized by multiple organ dysfunction, including cone-rod retinal dystrophy, dilated cardiomyopathy, hearing loss, obesity, insulin resistance, hyperinsulinemia, type 2 diabetes mellitus and systemic fibrosis. Heterogeneity and age-dependent development of clinical manifestations make it difficult to obtain a clear diagnosis, especially in pediatric patients.<h4>Case presentation</h4>Here we report the case of a girl with Alström syndrome. Genetic examination was proposed at age 22 months when suspected macular degeneration was the only major finding. Next generation sequencing of a panel of genes linked to eye-related pathologies revealed two compound heterozygous variants in the ALMS1 gene. Frameshift variants c.1196_1202del, p.(Thr399Lysfs*11), rs761292021 and c.11310_11313del, (p.Glu3771Trpfs*18), rs747272625 were detected in exons 5 and 16, respectively. Both variants cause frameshifts and generation of a premature stop-codon that probably leads to mRNA nonsense-mediated decay. Validation and segregation of ALMS1 variants were confirmed by Sanger sequencing.<h4>Conclusions</h4>Genetic testing makes it possible, even in childhood, to increase the number of correct diagnoses of patients who have ambiguous phenotypes caused by rare genetic variants. The development of high-throughput sequencing technologies offers an exceptionally valuable screening tool for clear genetic diagnoses and ensures early multidisciplinary management and treatment of the emerging symptoms.

Also flagged:Lgr5organizationdigestionhormonesecretionmucus
Journal Article 2020-09-01 ✓ 1 Snippet Liu Y, Chen YG.
In-Text Gene Mentions

…highly express Lgr5,Olfm4, CD133 and Lrig1,…

Show Full Abstract

The intestinal epithelium possesses a great capacity of self-renewal under normal homeostatic conditions and of regeneration upon damages. The renewal and regenerative processes are driven by intestinal stem cells (ISCs), which reside at the base of crypts and are marked by Lgr5. As Lgr5<sup>+</sup> ISCs undergo fast cycling and are vulnerable to damages, there must be other types of cells that can replenish the lost Lgr5<sup>+</sup> ISCs and then regenerate the damage epithelium. In addition to Lgr5<sup>+</sup> ISCs, quiescent ISCs at the + 4 position in the crypt have been proposed to convert to Lgr5<sup>+</sup> ISCs during regeneration. However, this "reserve stem cell" model still remains controversial. Different from the traditional view of a hierarchical organization of the intestinal epithelium, recent works support the dynamic "dedifferentiation" model, in which various cell types within the epithelium can de-differentiate to revert to the stem cell state and then regenerate the epithelium upon tissue injury. Here, we provide an overview of the cell identity and features of two distinct models and discuss the possible mechanisms underlying the intestinal epithelial plasticity.

Also flagged:esophageal adenocarcinomagene expressionPDGFDNPTX1ITPR1Cancer
Journal Article 2020-09-01 ✓ 1 Snippet Zhao M, Wang J, Yuan M, Ma Z, Bao Y, Hui Z.
In-Text Gene Mentions

…were PAX6, POU2F1,POU3F2, FOXK1, NKX6‐1, HMX1,…

Show Full Abstract

<h4>Background</h4>Despite the recent development of molecular-targeted treatment and immunotherapy, survival of patients with esophageal adenocarcinoma (EAC) with poor prognosis is still poor due to lack of an effective biomarker. In this study, we aimed to explore the ceRNA and construct a multivariate gene expression predictor model using data from The Cancer Genome Atlas (TCGA) to predict the prognosis of EAC patients.<h4>Methods</h4>We conducted differential expression analysis using mRNA, miRNA and lncRNA transciptome data from EAC and normal patients as well as corresponding clinical information from TCGA database, and gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis of those unique differentially expressed mRNAs using the Integrate Discovery Database (DAVID) database. We then constructed the lncRNA-miRNA-mRNA competing endogenous RNA (ceRNA) network of EAC and used Cox proportional hazard analysis to generate a multivariate gene expression predictor model. We finally performed survival analysis to determine the effect of differentially expressed mRNA on patients' overall survival and discover the hub gene.<h4>Results</h4>We identified a total of 488 lncRNAs, 33 miRNAs, and 1207 mRNAs with differentially expressed profiles. Cox proportional hazard analysis and survival analysis using the ceRNA network revealed four genes (IL-11, PDGFD, NPTX1, ITPR1) as potential biomarkers of EAC prognosis in our predictor model, and IL-11 was identified as an independent prognostic factor.<h4>Conclusions</h4>In conclusion, we identified differences in the ceRNA regulatory networks and constructed a four-gene expression-based survival predictor model, which could be referential for future clinical research.

Also flagged:gene-expressionanxietybehavioralorganizationgene expressionbehavioural
Journal Article 2020-09-01 ✓ 5 Snippets O'Leary TP, Sullivan KE, Wang L, Clements J, Lemire AL, Cembrowski MS.
In-Text Gene Mentions

…Nnat (432631-T10) ,Negr1(806361-T11), and Cplx1…

…binary Cplx1 vs.Negr1phenotyping, based upon…

…of Cplx1 vs.Negr1expression ( Figure…

…either Cplx1 orNegr1phenotypes by identifying…

…discarded, and bothNegr1and Cplx1 signals…

Show Full Abstract

The basolateral amygdala complex (BLA), extensively connected with both local amygdalar nuclei as well as long-range circuits, is involved in a diverse array of functional roles. Understanding the mechanisms of such functional diversity will be greatly informed by understanding the cell-type-specific landscape of the BLA. Here, beginning with single-cell RNA sequencing, we identified both discrete and graded continuous gene-expression differences within the mouse BLA. Via in situ hybridization, we next mapped this discrete transcriptomic heterogeneity onto a sharp spatial border between the basal and lateral amygdala nuclei, and identified continuous spatial gene-expression gradients within each of these regions. These discrete and continuous spatial transformations of transcriptomic cell-type identity were recapitulated by local morphology as well as long-range connectivity. Thus, BLA excitatory neurons are a highly heterogenous collection of neurons that spatially covary in molecular, cellular, and circuit properties. This heterogeneity likely drives pronounced spatial variation in BLA computation and function.

Also flagged:DiabeteshyperglycemiaangiogenesisIL-6heat shock proteins14-3-3
Journal Article 2020-09-01 ✓ 1 Snippet Robinson R, Youngblood H, Iyer H, Bloom J, Lee TJ, Chang L, Lukowski Z, Zhi W, Sharma A, Sharma S.
In-Text Gene Mentions

…binding protein 1 (Pebp1), carbonic anhydrase 2…

Show Full Abstract

<h4>Purpose</h4>Diabetic retinopathy (DR) is a microvascular complication caused by prolonged hyperglycemia and characterized by leaky retinal vasculature and ischemia-induced angiogenesis. Vitreous humor is a gel-like biofluid in the posterior segment of the eye between the lens and the retina. Disease-related changes are observed in the biochemical constituents of the vitreous, including proteins and macromolecules. Recently, we found that IL-6 trans-signaling plays a significant role in the vascular leakage and retinal pathology associated with DR. Therefore, in this study, comprehensive proteomic profiling of the murine vitreous was performed to identify diabetes-induced alterations and to determine effects of IL-6 trans-signaling inhibition on these changes.<h4>Methods</h4>Vitreous samples from mice were collected by evisceration, and proteomic analyses were performed using liquid chromatography-tandem mass spectrometry (LC-MS/MS).<h4>Results</h4>A total of 154 proteins were identified with high confidence in control mice and were considered to be characteristic of healthy murine vitreous fluid. The levels of 72 vitreous proteins were significantly altered in diabetic mice, including several members of heat shock proteins, 14-3-3 proteins, and tubulins. Alterations in 52 out of 72 proteins in diabetic mice were mitigated by IL-6 trans-signaling inhibition.<h4>Conclusions</h4>Proteomic analysis of murine vitreous fluid performed in this study provides important information about the changes caused by diabetes in the ocular microenvironment. These diabetes-induced alterations in the murine vitreous proteome were mitigated by IL-6 trans-signaling inhibition. These findings further support that IL-6 trans-signaling may be an important therapeutic target for the treatment of DR.

Also flagged:tumorsoft tissue sarcomatranscription factorTFMYH11ADM
Journal Article 2020-09-01 ✓ 1 Snippet Hu C, Chen B, Huang Z, Liu C, Ye L, Wang C, Tong Y, Yang J, Zhao C.
In-Text Gene Mentions

…SECTM1 + 0.12620*TNFSF4−0.63813* BECN1 +…

Show Full Abstract

<h4>Background</h4>Immune-related genes (IRGs) have been confirmed to have an important role in tumorigenesis and tumor microenvironment formation. Nevertheless, a systematic analysis of IRGs and their clinical significance in soft tissue sarcoma (STS) patients is lacking.<h4>Methods</h4>Gene expression files from The Cancer Genome Atlas (TCGA) database and Genotype-Tissue Expression (GTEx) were used to select differentially expressed genes (DEGs). Differentially expressed immune-related genes (DEIRGs) were determined by matching the DEG and ImmPort gene sets, which were evaluated by functional enrichment analysis. Unsupervised clustering of the identified DEIRGs was conducted, and associations with prognosis, the tumor microenvironment (TME), immune checkpoints, and immune cells were analyzed simultaneously. Two prognostic signatures, one for overall survival (OS) and one for progression free survival (PFS), were established and validated in an independent set. Finally, two transcription factor (TF)-IRG regulatory networks were constructed, and a crucial regulatory axis was validated.<h4>Results</h4>In total, 364 DEIRGs and four clusters were identified. OS, TME scores, five immune checkpoints, and 12 types of immune cells were found to be significantly different among the four clusters. The two prognostic signatures incorporating 20 DEIRGs showed favorable discrimination and were successfully validated. Two nomograms combining signature and clinical variables were generated. The C-indexes were 0.879 (95%CI 0.832 ~ 0.926) and 0.825 (95%CI 0.776 ~ 0.874) for the OS and PFS signatures, respectively. Finally, TF-IRG regulatory networks were established, and the MYH11-ADM regulatory axis was verified in three independent datasets.<h4>Conclusion</h4>This comprehensive analysis of the IRG landscape in soft tissue sarcoma revealed novel IRGs related to carcinogenesis and the immune microenvironment. These findings have implications for prognosis and therapeutic responses, which reveal novel potential prognostic biomarkers, promote precision medicine, and provide potential novel targets for immunotherapy.

Also flagged:Pancreatic CancerPancreatic ductal adenocarcinomaPDACcancerBETtumor
Journal Article 2020-09-01 ✓ 1 Snippet Honselmann KC, Finetti P, Birnbaum DJ, Monsalve CS, Wellner UF, Begg SKS, Nakagawa A, Hank T, Li A, Goldsworthy MA, Sharma H, Bertucci F, Birnbaum D, Tai E, Ligorio M, Ting DT, Schilling O, Biniossek ML, Bronsert P, Ferrone CR, Keck T, Mino-Kenudson M, Lillemoe KD, Warshaw AL, Fernández-Del Castillo C, Liss AS.
In-Text Gene Mentions

…BET family ofchromatin adaptorsadaptors to the…

Show Full Abstract

Pancreatic ductal adenocarcinoma (PDAC) is characterized by a highly desmoplastic reaction, warranting intense cancer-stroma communication. In this study, we interrogated the contribution of the BET family of chromatin adaptors to the cross-talk between PDAC cells and the tumor stroma. Short-term treatment of orthotopic xenograft tumors with CPI203, a small-molecule inhibitor of BET proteins, resulted in broad changes in the expression of genes encoding components of the extracellular matrix (matrisome) in both cancer and stromal cells. Remarkably, more than half of matrisome genes were expressed by cancer cells. <i>In vitro</i> cocultures of PDAC cells and cancer-associated fibroblasts (CAF) demonstrated that matrisome expression was regulated by BET-dependent cancer-CAF cross-talk. Disrupting this cross-talk <i>in vivo</i> resulted in diminished growth of orthotopic patient-derived xenograft tumors, reduced proliferation of cancer cells, and changes in collagen structure consistent with that of patients who experienced better survival. Examination of matrisome gene expression in publicly available data sets of 573 PDAC tumors identified a 65-gene signature that was able to distinguish long- and short-term PDAC survivors. Importantly, the expression of genes predictive of short-term survival was diminished in the cancer cells of orthotopic xenograft tumors of mice treated with CPI203. Taken together, these results demonstrate that inhibiting the activity BET proteins results in transcriptional and structural differences in the matrisome are associated with better patient survival. IMPLICATIONS: These studies highlight the biological relevance of the matrisome program in PDAC and suggest targeting of epigenetically driven tumor-stroma cross-talk as a potential therapeutic avenue.

Also flagged:HNF1BEZH2Hepatocyte nuclear factor 1 betatranscription factortumorsprostate carcinoma
Journal Article 2020-09-01 ✓ 5 Snippets Dundr P, Bártů M, Hojný J, Michálková R, Hájková N, Stružinská I, Krkavcová E, Hadravský L, Kleissnerová L, Kopejsková J, Hiep BQ, Němejcová K, Jakša R, Čapoun O, Řezáč J, Jirsová K, Franková V.
In-Text Gene Mentions

Despite the equivocal relations between HNF1B, EZH2 and ECI2, the high expression of EZH2 and ECI2 in PC seems to be a potential therapeutic target, especially in the case of EZH2 as suggested in previous studies17,58–63.

The data of TCGA including the clinico-pathological findings and mRNA expression (z-score) of HNF1B, EZH2 and ECI2 was downloaded through cBioPortal (www.cbioportal.org; Prostate Adenocarcinoma (TCGA, Firehose Legacy, access March 2020)).

The high expression of EZH2 (especially) and ECI2 in PC seems to be a potential therapeutic target.

The immunohistochemical analysis of all three markers including HNF1B, EZH2 and ECI2 was performed on the total of 101 PC and 18 AH samples.

In our study we focused on analyzing HNF1B in prostate carcinoma (PC) and adenomyomatous hyperplasia (AH), as well as its possible relation to the upstream gene EZH2 and downstream gene ECI2. The results of our study showed that on an immunohistochemical level, the expression of HNF1B was low in PC, did not differ between PC and AH, and did not correlate with any clinical outcomes.

Show Full Abstract

Hepatocyte nuclear factor 1 beta (HNF1B) is a tissue specific transcription factor, which seems to play an important role in the carcinogenesis of several tumors. In our study we focused on analyzing HNF1B in prostate carcinoma (PC) and adenomyomatous hyperplasia (AH), as well as its possible relation to the upstream gene EZH2 and downstream gene ECI2. The results of our study showed that on an immunohistochemical level, the expression of HNF1B was low in PC, did not differ between PC and AH, and did not correlate with any clinical outcomes. In PC, mutations of HNF1B gene were rare, but the methylation of its promotor was a common finding and was positively correlated with Gleason score and stage. The relationship between HNF1B and EZH2/ECI2 was equivocal, but EZH2 and ECI2 were positively correlated on both mRNA and protein level. The expression of EZH2 was associated with poor prognosis. ECI2 did not correlate with any clinical outcomes. Our results support the oncosuppressive role of HNF1B in PC, which may be silenced by promotor methylation and other mechanisms, but not by gene mutation. The high expression of EZH2 (especially) and ECI2 in PC seems to be a potential therapeutic target.

Also flagged:metalsneurodegenerative diseasesmethylationtranslationalhistonemanganese
Journal Article 2020-09-01 No Snippets Ijomone OM, Ijomone OK, Iroegbu JD, Ifenatuoha CW, Olung NF, Aschner M.
Show Full Abstract

Continuous globalization and industrialization have ensured metals are an increasing aspect of daily life. Their usefulness in manufacturing has made them vital to national commerce, security and global economy. However, excess exposure to metals, particularly as a result of environmental contamination or occupational exposures, has been detrimental to overall health. Excess exposure to several metals is considered environmental risk in the aetiology of several neurological and neurodegenerative diseases. Metal-induced neurotoxicity has been a major health concern globally with intensive research to unravel the mechanisms associated with it. Recently, greater focus has been directed at epigenetics to better characterize the underlying mechanisms of metal-induced neurotoxicity. Epigenetic changes are those modifications on the DNA that can turn genes on or off without altering the DNA sequence. This review discusses how epigenetic changes such as DNA methylation, post translational histone modification and noncoding RNA-mediated gene silencing mediate the neurotoxic effects of several metals, focusing on manganese, arsenic, nickel, cadmium, lead, and mercury.

Also flagged:Ubiquitin EnzymesPathogenesisUbiquitinationubiquitindegradationubiquitin-activating enzymes
Journal Article 2020-09-01 No Snippets Celebi G, Kesim H, Ozer E, Kutlu O.
Show Full Abstract

Ubiquitination is a multi-step enzymatic process that involves the marking of a substrate protein by bonding a ubiquitin and protein for proteolytic degradation mainly via the ubiquitin-proteasome system (UPS). The process is regulated by three main types of enzymes, namely ubiquitin-activating enzymes (E1), ubiquitin-conjugating enzymes (E2), and ubiquitin ligases (E3). Under physiological conditions, ubiquitination is highly reversible reaction, and deubiquitinases or deubiquitinating enzymes (DUBs) can reverse the effect of E3 ligases by the removal of ubiquitin from substrate proteins, thus maintaining the protein quality control and homeostasis in the cell. The dysfunction or dysregulation of these multi-step reactions is closely related to pathogenic conditions; therefore, understanding the role of ubiquitination in diseases is highly valuable for therapeutic approaches. In this review, we first provide an overview of the molecular mechanism of ubiquitination and UPS; then, we attempt to summarize the most common diseases affecting the dysfunction or dysregulation of these mechanisms.

Also flagged:Chemotaxishost cellviral infectionMiddle East Respiratoryinterferonimmune response
Journal Article 2020-09-01 ✓ 1 Snippet Shaath H, Alajez NM.
In-Text Gene Mentions

…include MAPK1, IL1RN,RC3H1and MYC, which…

Show Full Abstract

The continuous and rapid emergence of new viral strains calls for a better understanding of the fundamental changes occurring within the host cell upon viral infection. In this study, we analyzed RNA-seq transcriptome data from Calu-3 human lung epithelial cells infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) compared to five other viruses namely, severe acute respiratory syndrome coronavirus (SARS-CoV), Middle East Respiratory Syndrome (SARS-MERS), influenzavirus A (FLUA), influenzavirus B (FLUB), and rhinovirus (RHINO) compared to mock-infected cells and characterized their coding and noncoding RNA transcriptional portraits. The induction of interferon, inflammatory, and immune response was a hallmark of SARS-CoV-2 infection. Comprehensive bioinformatics revealed the activation of immune response and defense response to the virus as a common feature of viral infection. Interestingly however, the degree of functional categories and signaling pathways activation varied among different viruses. Ingenuity pathways analysis highlighted altered conical and casual pathways related to TNF, IL1A, and TLR7, which are seen more predominantly during SARS-CoV-2 infection. Nonetheless, the activation of chemotaxis and lipid synthesis was prominent in SARS-CoV-2-infected cells. Despite the commonality among all viruses, our data revealed the hyperactivation of chemotaxis and immune cell trafficking as well as the enhanced fatty acid synthesis as plausible mechanisms that could explain the inflammatory cytokine storms associated with severe cases of COVID-19 and the rapid spread of the virus, respectively.

Also flagged:membrane proteinsprotein secretionGolgi apparatustransportexocytosisfibroblast growth factor 2
Journal Article 2020-09-01 ✓ 2 Snippets Tang BL.
In-Text Gene Mentions

…sion of the protein Huntingtin (HTT) [16]. …

…-function by mutant HTT (mHTT) and its exon…

Show Full Abstract

Conventional protein secretion in eukaryotic cells occurs via vesicular trafficking of proteins that are first targeted to the endoplasmic reticulum (ER), through the Golgi apparatus, and subsequently routed to the plasma membrane (PM), where membrane proteins take up residence while luminal proteins are released extracellularly [...].

Also flagged:IBCbreast cancertumorInflammatory Breast Cancerdeathlocally advanced breast cancer
Journal Article 2020-09-01 ✓ 2 Snippets Wang X, Semba T, Phi LTH, Chainitikun S, Iwase T, Lim B, Ueno NT.
In-Text Gene Mentions

A Phase 1b/2 study of rebastinib (DCC-2036), a selective and potent inhibitor of Tie2, in combination with paclitaxel in patients with advanced or metastatic solid tumors, including IBC, is ongoing (ClinicalTrials.gov Identifier: NCT03601897; An Open-Label, Multicenter, Phase 1b/2 Study of Rebastinib (DCC-2036) in Combination With Paclitaxel to Assess Safety, Tolerability, and Pharmacokinetics in Patients With Advanced or Metastatic Solid Tumors; Table 1) [115].

IBC patients have increased expression of the prostaglandin I2 synthase gene PTGIS, which encodes an enzyme located downstream of COX-2 [20].

Show Full Abstract

Inflammatory breast cancer (IBC), although rare, is the most aggressive type of breast cancer. Only 2-4% of breast cancer cases are classified as IBC, but-owing to its high rate of metastasis and poor prognosis-8% to 10% of breast cancer-related mortality occur in patients with IBC. Currently, IBC-specific targeted therapies are not available, and there is a critical need for novel therapies derived via understanding novel targets. In this review, we summarize the biological functions of critical signaling pathways in the progression of IBC and the preclinical and clinical studies of targeting these pathways in IBC. We also discuss studies of crosstalk between several signaling pathways and the IBC tumor microenvironment.

Also flagged:cancersgene expressiontumorATMDAXXradio
Journal Article 2020-09-01 ✓ 1 Snippet Bodei L, Schöder H, Baum RP, Herrmann K, Strosberg J, Caplin M, Öberg K, Modlin IM.
In-Text Gene Mentions

DCC

Show Full Abstract

Peptide receptor radionuclide therapy (PRRT) is a type of radiotherapy that targets peptide receptors and is typically used for neuroendocrine tumours (NETs). Some of the key challenges in its use are the prediction of efficacy and toxicity, patient selection, and response optimisation. In this Review, we assess current knowledge on the molecular profile of NETs and the strategies and tools used to predict, monitor, and assess the toxicity of PRRT. The few mutations in tumour genes that can be evaluated (eg, ATM and DAXX) are limited to pancreatic NETs and are most likely not informative. Assays that are transcriptomic or based on genes are effective in the prediction of radiotherapy response in other cancers. A blood-based assay for eight genes (the PRRT prediction quotient [PPQ]) has an overall accuracy of 95% for predicting responses to PRRT in NETs. No molecular markers exist that can predict the toxicity of PRRT. Candidate molecular targets include seven single nucleotide polymorphisms (SNPs) that are susceptible to radiation. Transcriptomic evaluations of blood and a combination of gene expression and specific SNPs, assessed by machine learning with algorithms that are tumour-specific, might yield molecular tools to enhance the efficacy and safety of PRRT.

Also flagged:IL7secretioncDNACMPCLPMega
Journal Article 2020-09-01 No Snippets Chen MH, Raffield LM, Mousas A, Sakaue S, Huffman JE, Moscati A, Trivedi B, Jiang T, Akbari P, Vuckovic D, Bao EL, Zhong X, Manansala R, Laplante V, Chen M, Lo KS, Qian H, Lareau CA, Beaudoin M, Hunt KA, Akiyama M, Bartz TM, Ben-Shlomo Y, Beswick A, Bork-Jensen J, Bottinger EP, Brody JA, van Rooij FJA, Chitrala K, Cho K, Choquet H, Correa A, Danesh J, Di Angelantonio E, Dimou N, Ding J, Elliott P, Esko T, Evans MK, Floyd JS, Broer L, Grarup N, Guo MH, Greinacher A, Haessler J, Hansen T, Howson JMM, Huang QQ, Huang W, Jorgenson E, Kacprowski T, Kähönen M, Kamatani Y, Kanai M, Karthikeyan S, Koskeridis F, Lange LA, Lehtimäki T, Lerch MM, Linneberg A, Liu Y, Lyytikäinen LP, Manichaikul A, Martin HC, Matsuda K, Mohlke KL, Mononen N, Murakami Y, Nadkarni GN, Nauck M, Nikus K, Ouwehand WH, Pankratz N, Pedersen O, Preuss M, Psaty BM, Raitakari OT, Roberts DJ, Rich SS, Rodriguez BAT, Rosen JD, Rotter JI, Schubert P, Spracklen CN, Surendran P, Tang H, Tardif JC, Trembath RC, Ghanbari M, Völker U, Völzke H, Watkins NA, Zonderman AB, VA Million Veteran Program, Wilson PWF, Li Y, Butterworth AS, Gauchat JF, Chiang CWK, Li B, Loos RJF, Astle WJ, Evangelou E, van Heel DA, Sankaran VG, Okada Y, Soranzo N, Johnson AD, Reiner AP, Auer PL, Lettre G.
Show Full Abstract

Most loci identified by GWASs have been found in populations of European ancestry (EUR). In trans-ethnic meta-analyses for 15 hematological traits in 746,667 participants, including 184,535 non-EUR individuals, we identified 5,552 trait-variant associations at p < 5 × 10<sup>-9</sup>, including 71 novel associations not found in EUR populations. We also identified 28 additional novel variants in ancestry-specific, non-EUR meta-analyses, including an IL7 missense variant in South Asians associated with lymphocyte count in vivo and IL-7 secretion levels in vitro. Fine-mapping prioritized variants annotated as functional and generated 95% credible sets that were 30% smaller when using the trans-ethnic as opposed to the EUR-only results. We explored the clinical significance and predictive value of trans-ethnic variants in multiple populations and compared genetic architecture and the effect of natural selection on these blood phenotypes between populations. Altogether, our results for hematological traits highlight the value of a more global representation of populations in genetic studies.

Also flagged:trans-eQTL-geneoxygenclottinghematopoiesistranscription factorshematologic disorders
Journal Article 2020-09-01 ✓ 4 Snippets Vuckovic D, Bao EL, Akbari P, Lareau CA, Mousas A, Jiang T, Chen MH, Raffield LM, Tardaguila M, Huffman JE, Ritchie SC, Megy K, Ponstingl H, Penkett CJ, Albers PK, Wigdor EM, Sakaue S, Moscati A, Manansala R, Lo KS, Qian H, Akiyama M, Bartz TM, Ben-Shlomo Y, Beswick A, Bork-Jensen J, Bottinger EP, Brody JA, van Rooij FJA, Chitrala KN, Wilson PWF, Choquet H, Danesh J, Di Angelantonio E, Dimou N, Ding J, Elliott P, Esko T, Evans MK, Felix SB, Floyd JS, Broer L, Grarup N, Guo MH, Guo Q, Greinacher A, Haessler J, Hansen T, Howson JMM, Huang W, Jorgenson E, Kacprowski T, Kähönen M, Kamatani Y, Kanai M, Karthikeyan S, Koskeridis F, Lange LA, Lehtimäki T, Linneberg A, Liu Y, Lyytikäinen LP, Manichaikul A, Matsuda K, Mohlke KL, Mononen N, Murakami Y, Nadkarni GN, Nikus K, Pankratz N, Pedersen O, Preuss M, Psaty BM, Raitakari OT, Rich SS, Rodriguez BAT, Rosen JD, Rotter JI, Schubert P, Spracklen CN, Surendran P, Tang H, Tardif JC, Ghanbari M, Völker U, Völzke H, Watkins NA, Weiss S, VA Million Veteran Program, Cai N, Kundu K, Watt SB, Walter K, Zonderman AB, Cho K, Li Y, Loos RJF, Knight JC, Georges M, Stegle O, Evangelou E, Okada Y, Roberts DJ, Inouye M, Johnson AD, Auer PL, Astle WJ, Reiner AP, Butterworth AS, Ouwehand WH, Lettre G, Sankaran VG, Soranzo N.
In-Text Gene Mentions

Of these five, two variants previously reported as pathogenic for autosomal recessive diseases (rs116100695 in PKLR for pyruvate kinase deficiency of red cells and rs1800730 in HFE for hemochromatosis) were found in apparently healthy homozygous UK Biobank participants.

…( PKLR ,HFE, HBB ,…

…and rs1800730 inHFEfor hemochromatosis) were…

…in HFE forhemochromatosis) were found in…

Show Full Abstract

Blood cells play essential roles in human health, underpinning physiological processes such as immunity, oxygen transport, and clotting, which when perturbed cause a significant global health burden. Here we integrate data from UK Biobank and a large-scale international collaborative effort, including data for 563,085 European ancestry participants, and discover 5,106 new genetic variants independently associated with 29 blood cell phenotypes covering a range of variation impacting hematopoiesis. We holistically characterize the genetic architecture of hematopoiesis, assess the relevance of the omnigenic model to blood cell phenotypes, delineate relevant hematopoietic cell states influenced by regulatory genetic variants and gene networks, identify novel splice-altering variants mediating the associations, and assess the polygenic prediction potential for blood traits and clinical disorders at the interface of complex and Mendelian genetics. These results show the power of large-scale blood cell trait GWAS to interrogate clinically meaningful variants across a wide allelic spectrum of human variation.

Also flagged:Dystonianeurological disorderanxietydepressionobsessive-compulsive disorderschizophrenia
Journal Article 2020-09-01 ✓ 2 Snippets Mencacci NE, Reynolds R, Ruiz SG, Vandrovcova J, Forabosco P, Sánchez-Ferrer A, Volpato V, UK Brain Expression Consortium, International Parkinson’s Disease Genomics Consortium, Weale ME, Bhatia KP, Webber C, Hardy J, Botía JA, Ryten M.
In-Text Gene Mentions

Furthermore, the putamen ‘cyan’ module contained several other genes linked to monogenic hyperkinetic movement disorders, including genes associated with inherited forms of chorea (PDE2A, GPR88, HTT, VPS13A, JPH3) and dyskinetic epileptic encephalopathies (GNB1, UNC13A, GRIN1, STX1B, KNCQ2, and CACNA1B), strongly suggesting that similar neuroanatomical and biological substrates underlie different clinical subtypes of monogenic dystonias and other hyperkinetic movement disorders.

…, GPR88 ,HTT, VPS13A ,…

Show Full Abstract

Dystonia is a neurological disorder characterized by sustained or intermittent muscle contractions causing abnormal movements and postures, often occurring in absence of any structural brain abnormality. Psychiatric comorbidities, including anxiety, depression, obsessive-compulsive disorder and schizophrenia, are frequent in patients with dystonia. While mutations in a fast-growing number of genes have been linked to Mendelian forms of dystonia, the cellular, anatomical, and molecular basis remains unknown for most genetic forms of dystonia, as does its genetic and biological relationship to neuropsychiatric disorders. Here we applied an unbiased systems-biology approach to explore the cellular specificity of all currently known dystonia-associated genes, predict their functional relationships, and test whether dystonia and neuropsychiatric disorders share a genetic relationship. To determine the cellular specificity of dystonia-associated genes in the brain, single-nuclear transcriptomic data derived from mouse brain was used together with expression-weighted cell-type enrichment. To identify functional relationships among dystonia-associated genes, we determined the enrichment of these genes in co-expression networks constructed from 10 human brain regions. Stratified linkage-disequilibrium score regression was used to test whether co-expression modules enriched for dystonia-associated genes significantly contribute to the heritability of anxiety, major depressive disorder, obsessive-compulsive disorder, schizophrenia, and Parkinson's disease. Dystonia-associated genes were significantly enriched in adult nigral dopaminergic neurons and striatal medium spiny neurons. Furthermore, 4 of 220 gene co-expression modules tested were significantly enriched for the dystonia-associated genes. The identified modules were derived from the substantia nigra, putamen, frontal cortex, and white matter, and were all significantly enriched for genes associated with synaptic function. Finally, we demonstrate significant enrichments of the heritability of major depressive disorder, obsessive-compulsive disorder and schizophrenia within the putamen and white matter modules, and a significant enrichment of the heritability of Parkinson's disease within the substantia nigra module. In conclusion, multiple dystonia-associated genes interact and contribute to pathogenesis likely through dysregulation of synaptic signalling in striatal medium spiny neurons, adult nigral dopaminergic neurons and frontal cortical neurons. Furthermore, the enrichment of the heritability of psychiatric disorders in the co-expression modules enriched for dystonia-associated genes indicates that psychiatric symptoms associated with dystonia are likely to be intrinsic to its pathophysiology.

Also flagged:Gene expressionHuntington diseaseneurodegenerative disorderHDconditionscognitive decline
Journal Article 2020-09-01 ✓ 5 Snippets Wright GEB, Caron NS, Ng B, Casal L, Casazza W, Xu X, Ooi J, Pouladi MA, Mostafavi S, Ross CJD, Hayden MR.
In-Text Gene Mentions

Cortically expressed prioritized HD transcriptomic modifier genes, as well as MSH3 and HTT, were also assessed with regard to associations with these ROSMAP phenotypes.

This is pertinent, since it is well documented that changes in gene expression are a hallmark of HD pathology (17,18), and HTT is expressed ubiquitously across tissues (19).

In order to determine whether groups of genes whose expression is mediated by mutant huntingtin were enriched in the HD modifier association results (mean S-PrediXcan Z2-scores from the TWAS), we analyzed transcriptomic coexpression networks from a large time course experiment from HD knock-in mice with increasing Htt CAG lengths (17).

…tract in theHTTgene ( 3…

…mediated by murineHttCAG length and…

Show Full Abstract

Huntington disease (HD) is a neurodegenerative disorder that is caused by a CAG repeat expansion in HTT. The length of this repeat, however, only explains a proportion of the variability in age of onset in patients. Genome-wide association studies have identified modifiers that contribute toward a proportion of the observed variance. By incorporating tissue-specific transcriptomic information with these results, additional modifiers can be identified. We performed a transcriptome-wide association study assessing heritable differences in genetically determined expression in diverse tissues, with genome-wide data from over 4000 patients. Functional validation of prioritized genes was undertaken in isogenic HD stem cells and patient brains. Enrichment analyses were performed with biologically relevant gene sets to identify the core pathways. HD-associated gene coexpression modules were assessed for associations with neurological phenotypes in an independent cohort and to guide drug repurposing analyses. Transcriptomic analyses identified genes that were associated with age of HD onset and displayed colocalization with gene expression signals in brain tissue (FAN1, GPR161, PMS2, SUMF2), with supporting evidence from functional experiments. This included genes involved in DNA repair, as well as novel-candidate modifier genes that have been associated with other neurological conditions. Further, cortical coexpression modules were also associated with cognitive decline and HD-related traits in a longitudinal cohort. In summary, the combination of population-scale gene expression information with HD patient genomic data identified novel modifier genes for the disorder. Further, these analyses expanded the pathways potentially involved in modifying HD onset and prioritized candidate therapeutics for future study.

Also flagged:5-hydroxytryptaminetransporterserotonin transportersolute carrier family 6 member 4Autism spectrum disorderpervasive developmental disorderautism
Journal Article 2020-09-01 ✓ 2 Snippets Wongpaiboonwattana W, Plong-On O, Hnoonual A, Limprasert P.
In-Text Gene Mentions

This gene is located on chromosome 17q11 and encodes 5-hydroxytryptamine transporter (5-HTT, SERT) which transports serotonin to nerve cells.

…ydroxytryptamine transporter (5-HTT, SERT) which transports…

Show Full Abstract

Autism spectrum disorder (ASD) is a form of pervasive developmental disorder manifested by impairment in social interactions and repetitive behaviors. Although genetic contribution is strongly suspected in autism, the specific genetic factors remain unidentified. Hyperserotoninemia has been reported in some autistic patients, and several studies have demonstrated an association between 5-hydroxytryptamine-transporter-linked promoter region (5-HTTLPR) polymorphisms and rs25531 single nucleotide polymorphism in the serotonin transporter gene (solute carrier family 6 member 4; SLC6A4) and ASD, indicating a possible involvement of the serotonin system in the etiology of ASD.To explore this situation further, a case-control association study of 5-HTTLPR and rs25531 polymorphisms on Thai ASD patients was conducted. A total of 188 ASD cases fulfilling the Diagnostic and Statistical Manual of Mental Disorders, 4th Edition (DSM-IV) criteria (156 males and 32 females) and a total of 250 normal controls were recruited from the same ethnic backgrounds. 5-HTTLPR polymorphisms (Long, L; Short, S) and rs25531 (A/G) single nucleotide polymorphism were genotyped and compared between the patients and normal controls using chi-square statistics.The L/L genotype was more common in patients than in the controls (13.8% vs 5.2%, P = .006), and the LA haplotype was found in patients more than the controls (16.9% vs 12.2%, P = .048). When male patients were analyzed alone (156 individuals), the associations were also statistically significant with P = .017 for L/L genotype, and P = .019 for LA haplotype distribution.Our findings support previous reports suggesting an association between the 5-HTTLPR and rs25531 polymorphisms of SLC6A4 and patients with ASD.

Also flagged:Asthmachronic diseaseskeratin 1KRT1apolipoprotein BAPOB
Journal Article 2020-09-01 ✓ 5 Snippets Bai J, Zhong JY, Liao W, Hu R, Chen L, Wu XJ, Liu SP.
In-Text Gene Mentions

These results suggested that SERPINC1 may serve as a sympathetic molecule for the development of asthma, vascular thrombosis and pulmonary embolism; thus, it is an important finding with academic value.

In the past decade, considerable research has identified that genetic variants of SERPINC1 were associated with a risk of thrombosis (41–44).

Few studies have focused on the role of SERPINC1 in asthma; therefore, it remains unknown whether the increased risk of venous thrombosis in patients with asthma is associated with SERPINC1.

…proteins (KRT1, APOB,SERPINC1and SERPINA1) showed…

…1, antithrombin III (SERPINC1) and α-1-antitrypsin (SERPINA…

Show Full Abstract

Asthma is one of the most common childhood chronic diseases worldwide. Subcutaneous immunotherapy (SCIT) is commonly used in the treatment of house dust mite (HDM)‑related asthma in children. However, the therapeutic mechanism of SCIT in asthma remains unclear. The present study aimed to investigate the molecular biomarkers associated with HDM‑related asthma in asthmatic children prior and subsequent to SCIT treatment compared with those in healthy children via proteomic analysis. The study included a control group (30 healthy children), ‑Treatment group (30 children with HDM‑related allergic asthma) and +Treatment group (30 children with HDM‑related allergic asthma treated with SCIT). An isobaric labeling with relative and absolute quantification‑based method was used to analyze serum proteome changes to detect differentially expressed proteins, while functional enrichment and protein‑protein interaction network analysis were used to select candidate biomarkers. A total of 72 differentially expressed proteins were detected in the ‑Treatment, +Treatment and control groups. A total of 33 and 57 differentially expressed proteins were observed in the ‑Treatment vs. control and +Treatment vs. control groups, respectively. Through bioinformatics analysis, 5 candidate proteins [keratin 1 (KRT1), apolipoprotein B (APOB), fibronectin 1, antithrombin III (SERPINC1) and α‑1‑antitrypsin (SERPINA1)] were selected for validation by western blotting; among them, 4 proteins (KRT1, APOB, SERPINC1 and SERPINA1) showed robust reproducibility in asthma and control samples. This study illustrated the changes in proteome regulation following SCIT treatment for asthma. The 4 identified proteins may serve as potential biomarkers prior and subsequent to SCIT treatment, and help elucidate the molecular regulation mechanisms of SCIT to treat HDM‑related asthma.

Also flagged:major depressive disorderschizophreniabipolar I disorderC-reactive proteinCRPantithrombin III
Journal Article 2020-09-01 ✓ 1 Snippet Shi Y, Song R, Wang L, Qi Y, Zhang H, Zhu J, Zhang X, Tang X, Zhan Q, Zhao Y, Swaab DF, Bao AM, Zhang Z.
In-Text Gene Mentions

…(CRP), antithrombin III (ATIII), inter-alpha-trypsin inhibit…

Show Full Abstract

<h4>Background</h4>There are currently no objective diagnostic biomarkers for major depressive disorder (MDD) due to the biological complexity of the disorder. The existence of blood-based biomarkers with high specificity would be convenient for the clinical diagnosis of MDD.<h4>Methods</h4>A comprehensive plasma proteomic analysis was conducted in a highly homogeneous cohort [7 drug-naïve MDD patients and 7 healthy controls (HCs)], with bioinformatics analysis combined with machine learning used to screen candidate proteins. Verification of reproducibility and specificity was conducted in independent cohorts [60 HCs and 74 MDD, 42 schizophrenia (SZ) and 39 bipolar I disorder (BD-I) drug-naïve patients]. Furthermore, verification of consistency was accomplished by proteomic analysis of postmortem brain tissue from 16 MDD patients and 16 HCs.<h4>Results</h4>Levels of C-reactive protein (CRP), antithrombin III (ATIII), inter-alpha-trypsin inhibitor heavy chain 4 (ITIH4) and vitamin D-binding protein (VDB) were significantly higher in MDD patients, both in the discovery cohort and independent replication cohort. In comparison with SZ or BD-I patients, two proteins (VDB and ITIH4) were significantly elevated only in MDD patients. In addition, increased VDB and ITIH4 were observed consistently in both plasma and postmortem dorsolateral prefrontal cortex tissues of MDD patients. Furthermore, a panel consisting of all four plasma proteins was able to distinguish MDD patients from HCs or SZ or BD-I patients with the highest accuracy.<h4>Conclusion</h4>Plasma ITIH4 and VDB may be potential plasma biomarkers of MDD with high specificity. The four-protein panel is more suitable as a potential clinical diagnostic marker for MDD.

Also flagged:peptidesamyloglucosidaseethanolsodium metabisulfitepeptidedipeptidyl peptidase
Journal Article 2020-09-01 ✓ 5 Snippets Castro-Jácome TP, Alcántara-Quintana LE, Tovar-Pérez EG.
In-Text Gene Mentions

…dipeptidyl peptidase III (DPP-III) inhibitors, antioxidative, h…

…small amount ofDPP-IIIinhibitors ( A…

…Hypotensive,DPP-IIIinhibitors, antioxidative and…

…KAF with ACE,DPP-III, DPP-IV inhibitory activity…

…inhibitor, DPP-IV inhibitor,DPP-IIIinhibitor, and antioxidant.…

Show Full Abstract

The interest in extracting kafirins (KAF), the main storage protein from sorghum grain has recently increased due to its gluten-free content and the significant scientific evidence showing the health benefits of the bioactive peptides from cereal grains in human diets. The objectives were to obtain the highest percentage of KAF extraction using amyloglucosidase as pretreatment to increase the extraction yield and predict the bioactive peptides in the KAF. In this study, pretreatments with amyloglucosidase increased the extraction yield of KAF compared with extraction methods using only ethanol and sodium metabisulfite. Two protein fragment sequences were identified from KAF extract and were evaluated for potential bioactive peptide using the BIOPEP-UWM database, which suggest that KAF proteins from white sorghum may be considered as good precursors of dipeptidyl peptidase-inhibitor, angiotensin-converting enzyme inhibitor, antioxidant and hypotensive peptides following chymotrypsin, thermolysin, and subtilisin and their combination. Average scores aligned using PeptideRanker confirmed KAF proteins' potential sources of bioactive peptides with over 5 peptides scored over 0.8. In addition, 31 unexplored peptide sequences that could have biological activity were identified. Our results suggest that KAF can be used in the peptide productions with potential biological activity and beyond.

Also flagged:LeukoencephalopathyLactateLBSLataxia
Journal Article 2020-09-01 ✓ 2 Snippets Yazici Gencdal I, Dincer A, Obuz O, Yapici Z.
In-Text Gene Mentions

<h4>Introduction</h4>Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) is caused by a recessive mutation in the DARS2 gene and can be recognized by specific magnetic resonance imaging patterns.<h4>Case report</h4>A girl who developed leg tremors at age 4 years was diagnosed at age 17 years with LBSL -after evolution of ataxia and sensory loss.

…mutation in theDARS2gene and can…

Show Full Abstract

<h4>Introduction</h4>Leukoencephalopathy with brain stem and spinal cord involvement and lactate elevation (LBSL) is caused by a recessive mutation in the DARS2 gene and can be recognized by specific magnetic resonance imaging patterns.<h4>Case report</h4>A girl who developed leg tremors at age 4 years was diagnosed at age 17 years with LBSL -after evolution of ataxia and sensory loss. Examination at age 29 revealed mild spastic gait, ataxia, and sensory loss, and she did not require assistance to walk.<h4>Conclusion</h4>This report illustrates the clinical and magnetic resonance imaging characteristics of a slowly progressive long-term course of childhood-onset LBSL.

Also flagged:OsteoarthritisOAGene ExpressionDEFA4ARG1LTF
Journal Article 2020-09-01 ✓ 4 Snippets Yang Z, Ni J, Kuang L, Gao Y, Tao S.
In-Text Gene Mentions

…LTF, RETN, PGLYRP1,OLFM4, ORM1, and BPI.…

…LTF, RETN, PGLYRP1,OLFM4, ORM1, and BPI…

…hub genes PGLYRP1,OLFM4, ORM1, and BPI…

…, 48 ]OLFM4encodes a member…

Show Full Abstract

Osteoarthritis (OA) is a high prevalent musculoskeletal problem, which can cause severe pain, constitute a huge social and economic burden, and seriously damage the quality of life. This study was intended to identify genetic characteristics of subchondral bone in patients with OA and to elucidate the potential molecular mechanisms involved. Data of gene expression profiles (GSE51588), which contained 40 OA samples and 10 normal samples, was obtained from the Gene Expression Omnibus (GEO). The raw data were integrated to obtain differentially expressed genes (DEGs) and were further analyzed with bioinformatic analysis. The protein-protein interaction (PPI) networks were built and analyzed via Search Tool for the Retrieval of Interacting Genes (STRING). The significant modules and hub genes were identified via Cytoscape. Moreover, Gene Ontology (GO) and Kyoto Encyclopaedia of Genes and Genomes (KEGG) enrichment analysis were performed. Totally 235 DEGs were differentially expressed in the subchondral bone from OA patients compared with those of normal individuals, of which 78 were upregulated and 157 were downregulated. Eight hub genes were identified, including DEFA4, ARG1, LTF, RETN, PGLYRP1, OLFM4, ORM1, and BPI. The enrichment analyses of the DEGs and significant modules indicated that DEGs were mainly involved in inflammatory response, extracellular space, RAGE receptor binding, and amoebiasis pathway. The present study provides a novel and in-depth understanding of pathogenesis of the OA subchondral bone at molecular level. DEFA4, ARG1, LTF, RETN, PGLYRP1, OLFM4, ORM1, and BPI may be the new candidate targets for diagnosis and therapies on patients with OA in the future.

Also flagged:COADcolon adenocarcinomaSerpin Family E Member 1SERPINE1secreted phosphoprotein 1SPP1
Journal Article 2020-09-01 No Snippets Liu Y, Li C, Dong L, Chen X, Fan R.
Show Full Abstract

<h4>Background</h4>Colorectal cancer (CRC) is the third most lethal malignancy in the world, wherein colon adenocarcinoma (COAD) is the most prevalent type of CRC. Exploring biomarkers is important for the diagnosis, treatment, and prevention of COAD.<h4>Methods</h4>We used GEO2R and Venn online software for differential gene screening analysis. Hub genes were screened via Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) and Cytoscape, following Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. Finally, survival analysis and RNA expression validation were performed via UALCAN online software and real-time PCR. Immunohistochemistry (IHC) was performed to verify the protein expression level of hub genes from tissues of COAD patients.<h4>Results</h4>In the present study, we screened 323 common differentially expressed genes (DEGs) from four GSE datasets. Furthermore, four hub genes were selected for survival correlation analysis and expression level verification, three of which were shown to be statistically significant.<h4>Conclusion</h4>Our study suggests that Serpin Family E Member 1 (SERPINE1), secreted phosphoprotein 1 (SPP1) and tissue inhibitor of metalloproteinase 1 (TIMP1) may be biomarkers closely related to the prognosis of CRC patients.

Also flagged:Rspo1stem cell differentiationfibrosisCFTRmultiple intestinal atresiaTTC7A
Journal Article 2020-09-01 ✓ 1 Snippet Pleguezuelos-Manzano C, Puschhof J, van den Brink S, Geurts V, Beumer J, Clevers H.
In-Text Gene Mentions

…are: AXIN2 orOLFM4for stem cells,…

Show Full Abstract

Human intestinal organoids derived from adult stem cells are miniature ex vivo versions of the human intestinal epithelium. Intestinal organoids are useful tools for the study of intestinal physiology as well as many disease conditions. These organoids present numerous advantages compared to immortalized cell lines, but working with them requires dedicated techniques. The protocols described in this article provide a basic guide to establishment and maintenance of human intestinal organoids derived from small intestine and colon biopsies. Additionally, this article provides an overview of several downstream applications of human intestinal organoids. © 2020 The Authors. Basic Protocol 1: Establishment of human small intestine and colon organoid cultures from fresh biopsies Basic Protocol 2: Mechanical splitting, passage, and expansion of human intestinal organoids Alternate Protocol: Differentiation of human intestinal organoids Basic Protocol 3: Cryopreservation and thawing of human intestinal organoids Basic Protocol 4: Immunofluorescence staining of human intestinal organoids Basic Protocol 5: Generation of single-cell clonal intestinal organoid cultures Support Protocol 1: Production of Wnt3A conditioned medium Support Protocol 2: Production of Rspo1 conditioned medium Support Protocol 3: Extraction of RNA from intestinal organoid cultures.

Also flagged:osteoporosistranscription factorHNF1Agene expressionluciferase
Journal Article 2020-09-01 ✓ 5 Snippets Tuo XM, Zhu DL, Chen XF, Rong Y, Guo Y, Yang TL.
In-Text Gene Mentions

The osteoporosis susceptible SNP rs4325274 remotely regulates the SOX6 gene through enhancers.

…remotely regulates theSOX6gene through enhancers.…

…found that theSOX6gene might be…

…an enhancer regulatingSOX6gene expression by…

…HNF1A decreased theSOX6gene expression.…

Show Full Abstract

Osteoporosis is a typical polygenic disease, and its heritability is as high as 85%. The incidence of osteoporosis has jumped to the fifth among the common diseases. Although a large number of osteoporosis-susceptible SNPs have been identified, most of them are in the non-coding regions of the genome and the functional mechanisms are unknown. The purpose of this study was to explore the function of non-coding osteoporosis-susceptible SNP rs4325274 and dissect the molecular regulatory mechanisms through integrating bioinformatics analysis and functional experiments. Firstly, we found the SNP rs4325274 resided in a putative enhancer element through functional annotation. eQTL and Hi-C analysis found that the SOX6 gene might be a potential distal target of rs4325274. We conducted the motif prediction using multiple databases and verified the result using ChIP-seq data from GEO database. The result showed that the transcription factor HNF1A could preferentially bind to SNP rs4325274-G allele. We further demonstrated that SNP rs4325274 acted as an enhancer regulating SOX6 gene expression by using dual-luciferase reporter assays. Knockdown of HNF1A decreased the SOX6 gene expression. Taken together, our results uncovered a new mechanism of a non-coding functional SNP rs4325274 as a distal enhancer to modulate SOX6 expression, which provides new insights into deciphering molecular regulatory mechanisms underlying non-coding susceptibility SNPs on complex diseases.

Also flagged:preeclampsiaPEcoagulationlipidmetabolismtumor
Journal Article 2020-09-01 ✓ 1 Snippet Tu C, Tao F, Qin Y, Wu M, Cheng J, Xie M, Shen B, Ren J, Xu X, Huang D, Chen H.
In-Text Gene Mentions

…whereas AAT andATIIIwere downregulated compared…

Show Full Abstract

<h4>Background</h4>Preeclampsia remains a serious disorder that puts at risk the lives of perinatal mothers and infants worldwide. This study assessed potential pathogenic mechanisms underlying preeclampsia by investigating differentially expressed proteins (DEPs) in the serum of patients with early-onset preeclampsia (EOPE) and late-onset preeclampsia (LOPE) compared with healthy pregnant women.<h4>Methods</h4>Blood samples were collected from four women with EOPE, four women with LOPE, and eight women with normal pregnancies, with four women providing control samples for each preeclampsia group. Serum proteins were identified by isobaric tags for relative and absolute quantitation combined with liquid chromatography-tandem mass spectrometry. Serum proteins with differences in their levels compared with control groups of at least 1.2 fold-changes and that were also statistically significantly different between the groups at <i>P</i> < 0.05 were further analyzed. Bioinformatics analyses, including gene ontology and Kyoto Encyclopedia of Genes and Genomes signaling pathway analyses, were used to determine the key proteins and signaling pathways associated with the development of PE and to determine those DEPs that differed between women with EOPE and those with LOPE. Key protein identified by mass spectrometry was verified by enzyme linked immunosorbent assay (ELISA).<h4>Results</h4>Compared with serum samples from healthy pregnant women, those from women with EOPE displayed 70 proteins that were differentially expressed with significance. Among them, 51 proteins were significantly upregulated and 19 proteins were significantly downregulated. In serum samples from women with LOPE, 24 DEPs were identified , with 10 proteins significantly upregulated and 14 proteins significantly downregulated compared with healthy pregnant women. Bioinformatics analyses indicated that DEPs in both the EOPE and LOPE groups were associated with abnormalities in the activation of the coagulation cascade and complement system as well as with lipid metabolism. In addition, 19 DEPs in the EOPE group were closely related to placental development or invasion of tumor cells. Downregulationof pregnancy-specific beta-1-glycoprotein 9 (PSG9) in the LOPE group was confirmed by ELISA.<h4>Conclusion</h4>The pathogenesis of EOPE and LOPE appeared to be associated with coagulation cascade activation, lipid metabolism, and complement activation. However, the pathogenesis of EOPE also involved processes associated with greater placental injury. This study provided several new proteins in the serum which may be valuable for clinical diagnosis of EOPE and LOPE, and offered potential mechanisms underpinning the development of these disorders.

Also flagged:HRIsickle cell diseaseheme-regulatedEIF2AK1protein kinase
Journal Article 2020-09-01 ✓ 1 Snippet Peslak SA, Khandros E, Huang P, Lan X, Geronimo CL, Grevet JD, Abdulmalik O, Zhang Z, Giardine BM, Keller CA, Shi J, Hardison RC, Blobel GA.
In-Text Gene Mentions

SOX6

Show Full Abstract

Increasing fetal hemoglobin (HbF) provides clinical benefit in patients with sickle cell disease (SCD). We recently identified heme-regulated inhibitor (HRI, EIF2AK1), as a novel HbF regulator. Because HRI is an erythroid-specific protein kinase, it presents a potential target for pharmacologic intervention. We found that maximal HbF induction required >80% to 85% HRI depletion. Because it remains unclear whether this degree of HRI inhibition can be achieved pharmacologically, we explored whether HRI knockdown can be combined with pharmacologic HbF inducers to achieve greater HbF production and minimize potential adverse effects associated with treatments. Strongly cooperative HbF induction was observed when HRI depletion was combined with exposure to pomalidomide or the EHMT1/2 inhibitor UNC0638, but not to hydroxyurea. Mechanistically, reduction in the levels of the HbF repressor BCL11A reflected the cooperativity of HRI loss and pomalidomide treatment, whereas UNC0638 did not modulate BCL11A levels. In conjunction with HRI loss, pomalidomide maintained its HbF-inducing activity at 10-fold lower concentrations, in which condition there were minimal observed detrimental effects on erythroid cell maturation and viability, as well as fewer alterations in the erythroid transcriptome. When tested in cells from patients with SCD, combining HRI depletion with pomalidomide or UNC0638 achieved up to 50% to 60% HbF and 45% to 50% HbF, respectively, as measured by high-performance liquid chromatography, and markedly counteracted cell sickling. In summary, this study provides a foundation for the exploration of combining future small-molecule HRI inhibitors with additional pharmacologic HbF inducers to maximize HbF production and preserve erythroid cell functionality for the treatment of SCD and other hemoglobinopathies.

[Role of iron in infection].

Also flagged:ironinfectionPraxisHbFerritin
Journal Article 2020-09-01 No Snippets Nielsen P.
Show Full Abstract

No abstract available.

Also flagged:organic solutesABCG2bindingcyclodextrinamino acidoxygen
Journal Article 2020-09-01 No Snippets He X, Man VH, Yang W, Lee TS, Wang J.
Show Full Abstract

The General AMBER Force Field (GAFF) has been broadly used by researchers all over the world to perform in silico simulations and modelings on diverse scientific topics, especially in the field of computer-aided drug design whose primary task is to accurately predict the affinity and selectivity of receptor-ligand binding. The atomic partial charges in GAFF and the second generation of GAFF (GAFF2) were originally developed with the quantum mechanics derived restrained electrostatic potential charge, but in practice, users usually adopt an efficient charge method, Austin Model 1-bond charge corrections (AM1-BCC), based on which, without expensive ab initio calculations, the atomic charges could be efficiently and conveniently obtained with the ANTECHAMBER module implemented in the AMBER software package. In this work, we developed a new set of BCC parameters specifically for GAFF2 using 442 neutral organic solutes covering diverse functional groups in aqueous solution. Compared to the original BCC parameter set, the new parameter set significantly reduced the mean unsigned error (MUE) of hydration free energies from 1.03 kcal/mol to 0.37 kcal/mol. More excitingly, this new AM1-BCC model also showed excellent performance in the solvation free energy (SFE) calculation on diverse solutes in various organic solvents across a range of different dielectric constants. In this large-scale test with totally 895 neutral organic solvent-solute systems, the new parameter set led to accurate SFE predictions with the MUE and the root-mean-square-error of 0.51 kcal/mol and 0.65 kcal/mol, respectively. This newly developed charge model, ABCG2, paved a promising path for the next generation GAFF development.

Also flagged:pulmonary arterial hypertensionsolute carrier family 6 member 4SLC6A4right heart failureendothelial cell proliferationserotonin
Journal Article 2020-09-01 ✓ 4 Snippets Zhang F, Yang M, Xiao T, Hua Y, Chen Y, Xu S, Ni C.
In-Text Gene Mentions

The critical effects of serotonin (5-hydroxytryptamine [5-HT]) has been recently noted in pulmonary vascular remodelling.4 Patients receiving appetite suppressants that block the 5-HT transporter (5-HTT) have been shown to have an elevated PAH risk.4 5-HTT enables the reuptake of excess 5-HT from the synaptic cleft, which is vitally important in regulating 5-HT synaptic function.5 However, there is controversy over the mechanism underlying the effects of 5-HT on pulmonary vasculature.6 The solute carrier family 6 member 4 (SLC6A4) gene is localized on chromosome 17q11.2-17q12 and it encodes 5-HTT.4 Polymorphisms of this gene can cause changes in 5-HT concentrations, including two polymorphisms (variable number tandem repeat [VNTR] and 5-HTTLPR), named the SLC6A4 gene L/S polymorphism.7 Cells with the ‘L/L’ 5-HTTLPR genotype have been reported to uptake more serotonin than those with the ‘S/L’ or ‘S/S’ genotypes.4 That is to say, the S allele indicates lower uptake activity.

The electronic database PubMed® was searched from January 2000 to January 2020 to identify relevant studies using a combination of keywords and subject terms as follows: “serotonin transporter” or “5-HTT”, “polymorphism” and “pulmonary arterial hypertension”.

…the 5-HT transporter (5-HTT) have been shown…

…“serotonin transporter” or “5-HTT”, “polymorphism” and “pulmona…

Show Full Abstract

<h4>Objective</h4>To investigate the association between the solute carrier family 6 member 4 (<i>SLC6A4</i>) gene L/S polymorphism and pulmonary arterial hypertension (PAH).<h4>Methods</h4>The relevant literature was retrieved from the PubMed® database and the data were extracted. STATA® version 12.0 software was used to calculate pooled odds ratios (ORs) and 95% confidence intervals (CI).<h4>Results</h4>Eight case-control studies qualified for inclusion in the meta-analysis. These studies included 1215 cases and 936 control subjects. There was no significant association between the <i>SLC6A4</i> gene L/S polymorphism and PAH risk in the total population (LL versus SS: OR 1.83, 95% CI 0.95, 3.51; LS versus SS: OR 1.37, 95% CI 0.93, 2.02; dominant model: OR 1.38, 95% CI 0.97, 1.97; recessive model: OR 1.54, 95% CI 0.84, 2.83). Subgroup analysis based on study quality scores and Hardy-Weinberg equilibrium also showed no significant association.<h4>Conclusion</h4>The findings of this meta-analysis suggest that the <i>SLC6A4</i> gene L/S polymorphism is unlikely to be related to PAH risk. Well-designed studies with more participants will be required to validate these results.

Also flagged:Chromatintransposasetranscriptional regulatorsIFN-Iautoimmune diseasespathogenesis
Journal Article 2020-09-01 No Snippets Leylek R, Alcántara-Hernández M, Granja JM, Chavez M, Perez K, Diaz OR, Diaz OR, Li R, Satpathy AT, Chang HY, Idoyaga J.
Show Full Abstract

Human dendritic cells (DCs) comprise subsets with distinct phenotypic and functional characteristics, but the transcriptional programs that dictate their identity remain elusive. Here, we analyze global chromatin accessibility profiles across resting and stimulated human DC subsets by means of the assay for transposase-accessible chromatin using sequencing (ATAC-seq). We uncover specific regions of chromatin accessibility for each subset and transcriptional regulators of DC function. By comparing plasmacytoid DC responses to IFN-I-producing and non-IFN-I-producing conditions, we identify genetic programs related to their function. Finally, by intersecting chromatin accessibility with genome-wide association studies, we recognize DC subset-specific enrichment of heritability in autoimmune diseases. Our results unravel the basis of human DC subset heterogeneity and provide a framework for their analysis in disease pathogenesis.

Also flagged:mitosiscancerchromatinChromosomecell cyclecondensin-I
Journal Article 2020-09-01 ✓ 4 Snippets Boteva L, Nozawa RS, Naughton C, Samejima K, Earnshaw WC, Gilbert N.
In-Text Gene Mentions

…condensin loading •Condensindepletion increases the…

…is near toLRRC7(0.32 Mb) and…

…Mb away fromNEGR1(0.89 Mb).…

Condensindepletion appeared to…

Show Full Abstract

Cells coordinate interphase-to-mitosis transition, but recurrent cytogenetic lesions appear at common fragile sites (CFSs), termed CFS expression, in a tissue-specific manner after replication stress, marking regions of instability in cancer. Despite such a distinct defect, no model fully provides a molecular explanation for CFSs. We show that CFSs are characterized by impaired chromatin folding, manifesting as disrupted mitotic structures visible with molecular fluorescence in situ hybridization (FISH) probes in the presence and absence of replication stress. Chromosome condensation assays reveal that compaction-resistant chromatin lesions persist at CFSs throughout the cell cycle and mitosis. Cytogenetic and molecular lesions are marked by faulty condensin loading at CFSs, a defect in condensin-I-mediated compaction, and are coincident with mitotic DNA synthesis (MIDAS). This model suggests that, in conditions of exogenous replication stress, aberrant condensin loading leads to molecular defects and CFS expression, concomitantly providing an environment for MIDAS, which, if not resolved, results in chromosome instability.

Also flagged:tumournon-small cell lung cancertumourscancernucleotidemetastatic breast cancer
Journal Article 2020-09-01 ✓ 1 Snippet Perakis SO, Weber S, Zhou Q, Graf R, Hojas S, Riedl JM, Gerger A, Dandachi N, Balic M, Hoefler G, Schuuring E, Groen HJM, Geigl JB, Heitzer E, Speicher MR.
In-Text Gene Mentions

…case of aRABGAP1L–ROS1 fusion (see online…

Show Full Abstract

<h4>Objective</h4>Precision oncology depends on translating molecular data into therapy recommendations. However, with the growing complexity of next-generation sequencing-based tests, clinical interpretation of somatic genomic mutations has evolved into a formidable task. Here, we compared the performance of three commercial clinical decision support tools, that is, NAVIFY Mutation Profiler (NAVIFY; Roche), QIAGEN Clinical Insight (QCI) Interpret (QIAGEN) and CureMatch Bionov (CureMatch).<h4>Methods</h4>In order to obtain the current status of the respective tumour genome, we analysed cell-free DNA from patients with metastatic breast, colorectal or non-small cell lung cancer. We evaluated somatic copy number alterations and in parallel applied a 77-gene panel (AVENIO ctDNA Expanded Panel). We then assessed the concordance of tier classification approaches between NAVIFY and QCI and compared the strategies to determine actionability among all three platforms. Finally, we quantified the alignment of treatment suggestions across all decision tools.<h4>Results</h4>Each platform varied in its mode of variant classification and strategy for identifying druggable targets and clinical trials, which resulted in major discrepancies. Even the frequency of concordant actionable events for tier I-A or tier I-B classifications was only 4.3%, 9.5% and 28.4% when comparing NAVIFY with QCI, NAVIFY with CureMatch and CureMatch with QCI, respectively, and the obtained treatment recommendations differed drastically.<h4>Conclusions</h4>Treatment decisions based on molecular markers appear at present to be arbitrary and dependent on the chosen strategy. As a consequence, tumours with identical molecular profiles would be differently treated, which challenges the promising concepts of genome-informed medicine.

Also flagged:Coagulopathycardiopulmonary insufficiencycoagulation factorsfibrinogencoagulationHeparin
Journal Article 2020-09-01 ✓ 1 Snippet Reed CR, Bonadonna D, Everitt J, Robinson V, Otto J, Tracy ET.
In-Text Gene Mentions

antithrombin-III

Show Full Abstract

Venoarterial extracorporeal membrane oxygenation (VA-ECMO) is used to support patients with reversible cardiopulmonary insufficiency. Although it is a lifesaving technology, bleeding, inflammation, and thrombosis are well-described complications of ECMO. Adult porcine models of ECMO have been used to recapitulate the physiology and hemostatic consequences of ECMO cannulation in adults. However, these models lack the unique physiology and persistence of fetal forms of coagulation factors and fibrinogen as in human infants. We aimed to describe physiologic and coagulation parameters of piglets cannulated and supported with VA-ECMO. Four healthy piglets (5.7-6.4 kg) were cannulated via jugular vein and carotid artery by cutdown and supported for a maximum of 20 hours. Heparin was used with a goal activated clotting time of 180-220 seconds. Arterial blood gas (ABG) was performed hourly, and blood was transfused from an adult donor to maintain hematocrit (Hct) > 24%. Rotational thromboelastometry (ROTEM) was performed at seven time points. All animals achieved adequate flow with a patent circuit throughout the run (pre- and post-oxygenator pressure gradient <10 mmHg). There was slow but significant hemorrhage at cannulation, arterial line, and bladder catheter sites. All animals required the maximum blood transfusion volume available. All animals became anemic after exhaustion of blood for transfusion. ABG showed progressively declining Hct and adequate oxygenation. ROTEM demonstrated decreasing fibrin-only ROTEM (FIBTEM) clot firmness. Histology was overall unremarkable. Pediatric swine are an important model for the study of pediatric ECMO. We have demonstrated the feasibility of such a model while providing descriptions of physiologic, hematologic, and coagulation parameters throughout. Weak whole-blood clot firmness by ROTEM suggested defects in fibrinogen, and there was a clinical bleeding tendency in all animals studied. This model serves as an important means to study the complex derangements in hemostasis during ECMO.

Also flagged:Budd-Chiari syndromeendophlebitistumoursabscesscystsvenous thrombosis
Journal Article 2020-09-01 ✓ 1 Snippet Inchingolo R, Posa A, Mariappan M, Tibana TK, Nunes TF, Spiliopoulos S, Brountzos E.
In-Text Gene Mentions

…cy, antiphospholipid syndrome,antithrombin-IIIdeficiency as well…

Show Full Abstract

Budd-Chiari syndrome (BCS) is a relatively rare clinical condition with a wide range of symptomatology, caused by the obstruction of the hepatic venous outflow. If left untreated, it has got an high mortality rate. Its management is based on a step-wise approach, depending on the clinical presentation, and includes different treatment from anticoagulation therapy up to Interventional Radiology techniques, such as transjugular intrahepatic portosystemic shunt (TIPS). TIPS is today considered a safe and highly effective treatment and should be recommended for BCS patients, including those awaiting orthotopic liver transplantation. In this review the pathophysiology, diagnosis and treatment options of BCS are presented, with a special focus on published data regarding the techniques and outcomes of TIPS for the treatment of BCS. Moreover, unresolved issues and future research will be discussed.

Also flagged:major depressive disorderpostpartum depressiondepressionemotional disorderserotoninpathogenesis
Journal Article 2020-09-01 ✓ 3 Snippets Li J, Chen Y, Xiang Q, Xiang J, Tang Y, Tang L.
In-Text Gene Mentions

…the serotonin transporter (5-HTT) is located on…

…25 ] The5-HTTgene is a…

…] The human5-HTTgene (also known…

Show Full Abstract

<h4>Objective</h4>Postpartum depression (PPD) is an episode of major depressive disorder that affecting women of childbearing age. 5-HTTLPR is 1 of the most extensively investigated polymorphisms in PPD. However, the previous results were inconsistent and inclusive. Hence, we performed a meta-analysis to precisely evaluate the association between 5-HTTLPR polymorphism and PPD susceptibility.<h4>Methods</h4>The studies were retrieved through databases including PubMed, web of science, EMASE, and CNKI. The odd ratios (ORs) and 95% confidence interval (CIs) were applied for evaluating the genetic association between 5-HTTLPR (L/S) polymorphism and PPD risk.<h4>Results</h4>Six studies with 519 cases and 737 controls were enrolled in the present study. The frequencies of allelic (OR = 0.72, 95%CI = 0.60-0.85, P = .0001) and dominant (OR = 0.57, 95%CI = 0.44-0.73, P = .004) models of 5-HTTLPR polymorphism significantly decreased in patients with PPD than those in the healthy controls. Subgroup analysis based on ethnicity revealed that the allelic (OR = 0.71, 95%CI = 0.60-0.85, P = .0001) and dominant (OR = 0.51, 95%CI = 0.32-0.79, P = .003) models of 5-HTTLPR polymorphism were significantly associated with PPD risk in Asian population (P > .05). No evidence was observed between the recessive model of 5-HTTLPR polymorphism and PPD risk (P > .05).<h4>Conclusions</h4>The allelic and dominant models of 5-HTTLPR polymorphism might be protective factors for PPD. To confirm these results, larger number of association studies or multicenter case-control studies are necessary in the future.

Also flagged:BDNFStrokeDementiacognitive impairmentsbrain-derived neurotrophic factor
Journal Article 2020-09-01 ✓ 1 Snippet Rezaei S, Mobarake KA, Saberi A, Keshavarz P.
In-Text Gene Mentions

…total score ofACE-III.…

Show Full Abstract

<h4>Purpose</h4>The patients with more severe stroke, have more chance to develop higher levels of cognitive impairments; and family history of dementia as a genetic background, can give rise to an increased risk of the severity of cognitive deterioration. In this study, we sought to investigate whether the risk alleles of Val66Met of brain-derived neurotrophic factor (BDNF) polymorphism, has a destructive interaction with the stroke severity (SS) and family history of dementia (FHD) for cognitive impairments?<h4>Method</h4>In a case-control study, the carriers of at least one Val allele (n=56) were compared to the carriers of Met/Met homozygotes (n=156) in terms of FHD and SS (through National Institutes of Health Stroke Scale) on the north of Iran. To determine the cognitive functions, the third version of Addenbrooke's Cognitive Examination (ACE-III) was used.<h4>Result</h4>The mean age of patients was 64.52±11.71, and in average 202 day had passed from their stroke. The interactive effects of genotypes Val66Met BDNF with SS[F=8.95, ή2=0.04, P=0.003] and FHD[F=4.59, ή2=0.02, P=0.03] were significant for total score of ACE-III. It means that the Met/ Met homozygosity, modulated the effect of risk factors of SS and FHD on the cognitive function. Such homozygosity protects the attentional function and language abilities against the SS and FHD(P≤0.05).<h4>Conclusion</h4>It can be speculated that presence of Val/Met heterozygosity has a destructive interaction with the SS and FHD for decreasing the cognitive function, particularly in attention and language domains. Our findings suggested that the inhibition of signaling and trafficking of Val/Met heterozygosity is possibly a practical strategy in reducing the cognitive impairments following the stroke.

Also flagged:AnemiaHbFerritin
Journal Article 2020-09-01 No Snippets Fu X, Dang D, Li S, Xu Z, Wu H.
Show Full Abstract

<h4>Objective</h4>To assess the effects of delayed cord clamping (DCC) on hemoglobin (Hb), mean corpuscular volume (MCV) and ferritin level in infants 2 months or older.<h4>Evidence acquisition</h4>Meta-analysis of randomized control trials searched systematically from PubMed, Cochrane and Web of science. Trials published from Jan 1,1975 to Mar 12, 2018, no language and country restrictions. Twelve studies were included in this meta-analysis. In total, 993 infants were treated with DCC, while 989 cases received early cord clamping. Delayed cord clamping was defined as umbilical cord clamping time greater than 60s after delivery. Outcomes assed were (i) hemoglobin (Hb), (ii) mean corpuscular volume (MCV) and ferritin level.<h4>Results</h4>The results show that DCC increased hemoglobin level (SMD=0.4678 95%CI: [0.1515, 0.7841]), Ferritin level (SMD=2.1450 95%CI: [1.0431, 3.2470]) and MCV (SMD=0.5751 95%CI: [0.1637, 0.9865]) in infants between 2-12 months compared to ECC subject analysis noted the effects of Hb increase was greater in Asian infants.<h4>Conclusions</h4>Delayed cord clamping improved the Hb, MCV and ferritin level of infants after birth.

Also flagged:NotchCholangiocarcinomaextra-hepatic cholangiocarcinomaintrahepatic cholangiocarcinoma cancersprimary sclerosing cholangitischronic hepatitis virus infection
Journal Article 2020-09-01 ✓ 1 Snippet Rauff B, Malik A, Bhatti YA, Chudhary SA, Qadri I, Rafiq S.
In-Text Gene Mentions

…diseases like cirrhosis,hemochromatosis, viral hepatitis and…

Show Full Abstract

Cholangiocarcinoma (CCA) comprises of extra-hepatic cholangiocarcinoma and intrahepatic cholangiocarcinoma cancers as a result of inflammation of epithelium cell lining of the bile duct. The incidence rate is increasing dramatically worldwide with highest rates in Eastern and South Asian regions. Major risk factors involve chronic damage and inflammation of bile duct epithelium from primary sclerosing cholangitis, chronic hepatitis virus infection, gallstones and liver fluke infection. Various genetic variants have also been identified and as CCA develops on the background of biliary inflammation, diverse range of molecular mechanisms are involved in its progression. Among these, the Notch signalling pathway acts as a major driver of cholangiocarcinogenesis and its components (receptors, ligands and downstream signalling molecules) represent a promising therapeutic targets. Gamma-Secretase Inhibitors have been recognized in inhibiting the Notch pathway efficiently. A comprehensive knowledge of the molecular pathways activated by the Notch signalling cascade as well as its functional crosstalk with other signalling pathways provide better approach in developing innovative therapies against CCA.

Also flagged:Synthesisfolic aciddendrimertumourconjugationdendrimers
Journal Article 2020-09-01 No Snippets Zamani S, Shafeie-Ardestani M, Bitarafan-Rajabi A, Khalaj A, Sabzevari O.
Show Full Abstract

Hence, in this study, the authors aimed to develop a dendrimer-based imaging agent comprised of poly(ethylene glycol) (PEG)-citrate, technetium-99 m (<sup>99m</sup>Tc), and folic acid. The dendrimer-G3 was synthesised and conjugated with folic acid, which confirmed by Fourier transform infrared, proton nuclear magnetic resonance, dynamic light scattering, and transition electron microscopy. 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-Tetrazolium-5-Carboxanilide cytotoxicity assay kit was used to measure the cellular toxicity of dendrimer. Imaging and biodistribution studies were conducted on the mice bearing tumour. The results showed that the fabricated dendrimer-G3 has a size of 90 ± 3 nm, which was increased to 100 ± 4 nm following the conjugation with folic acid. The radiostablity investigation showed that the fabricated dendrimers were stable in the human serum at various times. Toxicity assessment confirmed no cellular toxicity against HEK-293 cells at 0.25, 0.5, 1, 2, 4, and 8 mg/μl concentrations. The in vivo studies demonstrated that the synthesised dendrimers were able to provide a bright SPECT image applicable for tumour detection. In conclusion, the authors' study documented the positive aspects of PEG-citrate dendrimer conjugated with folic acid as the SPECT contrast agent for breast cancer detection.

Also flagged:diabetesDiabetes mellituschronic liver diseaseshepatocellular carcinomainsulin resistancepathogenesis
Journal Article 2020-09-01 ✓ 1 Snippet Chung W, Promrat K, Wands J.
In-Text Gene Mentions

…chronic ALD orhemochromatosisdue to β-cell…

Show Full Abstract

Diabetes mellitus (DM) negatively affects the development and progression of chronic liver diseases (CLD) of various etiologies. Concurrent DM and CLD are also associated with worse clinical outcomes with respect to mortality, the occurrence of hepatic decompensation, and the development of hepatocellular carcinoma (HCC). Unfortunately, early diagnosis and optimal treatment of DM can be challenging, due to the lack of established clinical guidelines as well as the medical complexity of this patient population. We conducted an exploratory review of relevant literature to provide an up-to-date review for internists and hepatologists caring for this patient population. We reviewed the epidemiological and pathophysiological associations between DM and CLD, the impact of insulin resistance on the progression and manifestations of CLD, the pathogenesis of hepatogenic diabetes, as well as the practical challenges in diagnosis and monitoring of DM in this patient population. We also reviewed the latest clinical evidence on various pharmacological antihyperglycemic therapies with an emphasis on liver disease-related clinical outcomes. Finally, we proposed an algorithm for managing DM in patients with CLD and discussed the clinical and research questions that remain to be addressed.

Also flagged:nonalcoholic fatty liver diseaseNAFLDliver diseasenonalcoholic steatohepatitisNASHsteatosis
Journal Article 2020-09-01 ✓ 1 Snippet Amorim VB, Parente DB, Paiva FF, Oliveira Neto JA, Miranda AA, Moreira CC, Fernandes FF, Campos CFF, Leite NC, Perez RM, Rodrigues RS.
In-Text Gene Mentions

…disorder, Wilson disease,hemochromatosis, alpha-1-antitripsin deficien…

Show Full Abstract

<h4>Background</h4>Nonalcoholic fatty liver disease (NAFLD) is a major cause of liver disease worldwide. The diagnosis of nonalcoholic steatohepatitis (NASH), the most severe form of NAFLD, is crucial and has prognostic and therapeutic implications. However, currently this diagnosis is based on liver biopsy and has several limitations.<h4>Aim</h4>To evaluate the performance of gadoxetic acid-enhanced magnetic resonance imaging (GA-MRI) in differentiating isolated steatosis from NASH in patients with NAFLD.<h4>Methods</h4>In this prospective study, 56 patients with NAFLD (18 with isolated steatosis and 38 with NASH) underwent GA-MRI. The contrast enhancement index (CEI) was calculated as the rate of increase of the liver-to-muscle signal intensity ratio from before and 20 min after intravenous GA administration. Between-group differences in mean CEI were examined using Student's <i>t</i> test. The area under the receiver operator characteristic curve and the diagnostic performance of gadoxetic acid-enhanced magnetic resonance imaging were evaluated.<h4>Results</h4>The mean CEI for all subjects was 1.82 ± 0.19. The mean CEI was significantly lower in patients with NASH than in those with isolated steatosis (<i>P</i> = 0.008). Two CEI cut-off points were used: < 1.66 (94% specificity) to characterize NASH and > 2.00 (89% sensitivity) to characterize isolated steatosis. CEI values between 1.66 and 2.00 indicated liver biopsy, and the procedure could be avoided in 40% of patients with NAFLD.<h4>Conclusion</h4>GA-MRI is an effective noninvasive method that may be useful for the differentiation of NASH from isolated steatosis, and could help to avoid liver biopsy in patients with NAFLD.

Also flagged:Non-alcoholic fatty liver diseaseendocrine disordersdyslipidemiacentral obesityhypogonadismmyopathy
Journal Article 2020-09-01 ✓ 1 Snippet Tanaka N, Kimura T, Fujimori N, Ichise Y, Sano K, Horiuchi A.
In-Text Gene Mentions

…drugs and toxicants,hemochromatosis, Wilson disease, and…

Show Full Abstract

<h4>Background</h4>Myotonic dystrophy (MD) is sometimes accompanied by metabolic/endocrine disorders, including dyslipidemia, central obesity, and hypogonadism. Due to considerable individual differences in the severity and progression of myopathy, MD patients with minimal-to-mild muscle symptoms might be followed as having other diseases, such as non-alcoholic fatty liver disease (NAFLD).<h4>Case summary</h4>A 40-year-old non-obese man without a history of regular ethanol consumption was referred to our hospital due to persistent liver dysfunction and hyperlipidemia. His body mass index was 23.4 kg/m<sup>2</sup>. Liver histology demonstrated macrovesicular steatosis, ballooned hepatocytes with eosinophilic inclusion bodies, and perisinusoidal fibrosis, leading to the diagnosis of non-alcoholic steatohepatitis (NASH). Although he had no discernable muscle pain or weakness, persistently high serum creatine kinase (CK) and myoglobin levels as well as the presence of frontal baldness, a hatched face, history of cataract surgery, and grip myotonia indicated the possibility of MD. Southern blotting of the patient's DNA revealed the presence of CTG repeats, confirming the diagnosis.<h4>Conclusion</h4>When gastroenterologists encounter NAFLD/NASH patients, serum CK should be verified. If hyperCKemia, frontal baldness, a hatched face, history of cataract surgery, and grip myotonia are noted, the possibility of MD may be considered.

Also flagged:pyruvate kinasePKnon-spherocytic hemolytic anemiaPKLRanemiagallstones
Journal Article 2020-09-01 No Snippets Bianchi P, Fermo E.
Show Full Abstract

Red cell pyruvate kinase (PK) deficiency is the most common glycolytic defect associated with congenital non-spherocytic hemolytic anemia. The disease, transmitted as an autosomal recessive trait, is caused by mutations in the PKLR gene and is characterized by molecular and clinical heterogeneity; anemia ranges from mild or fully compensated hemolysis to life-threatening forms necessitating neonatal exchange transfusions and/or subsequent regular transfusion support; complications include gallstones, pulmonary hypertension, extramedullary hematopoiesis and iron overload. Since identification of the first pathogenic variants responsible for PK deficiency in 1991, more than 300 different variants have been reported, and the study of molecular mechanisms and the existence of genotype-phenotype correlations have been investigated in-depth. In recent years, during which progress in genetic analysis, next-generation sequencing technologies and personalized medicine have opened up important landscapes for diagnosis and study of molecular mechanisms of congenital hemolytic anemias, genotyping has become a prerequisite for accessing new treatments and for evaluating disease state and progression. This review examines the extensive molecular heterogeneity of PK deficiency, focusing on the diagnostic impact of genotypes and new acquisitions on pathogenic non-canonical variants. The recent progress and the weakness in understanding the genotype-phenotype correlation, and its practical usefulness in light of new therapeutic opportunities for PK deficiency are also discussed.

Also flagged:HydroxyapatiteBreast Adenocarcinomacancerbreast adenocarcinoma cancerbreast cancerNanohydroxyapatite
Journal Article 2020-09-01 No Snippets Soleimani M, Elmi F, Mousavie Anijdan SH, Mitra Elmi M.
Show Full Abstract

<h4>Background</h4>Nanohydroxyapatite (nHAP) exhibit anti-proliferative effects on various cancer cells. However, to date, there are only a few studies on the radiosensitization effect of nHAP. The present study aimed to investigate the possible enhancement of the radiosensitization effect of nHAP on human breast adenocarcinoma cancer (MCF-7) and fibroblast.<h4>Methods</h4>nHAP was extracted from fish scales using the thermal alkaline method and characterized at Babol University of Medical Sciences (Babol, Iran) in 2017. The anti-proliferative and the radiosensitization effects of nHAP were investigated by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-Diphenyltetrazolium Bromide (MTT), clonogenic assay, and apoptosis assay. MCF-7 cells and fibroblasts were incubated with different concentrations of nHAP and at different periods. The MTT solution was added and the absorbance was measured at 570 nm. The MCF-7 cells were exposed to 0, 1.5, 3.5, and 5 Gy X-ray irradiation and incubated for 10-14 days. The data were compared using the one-way analysis of variance (ANOVA) followed by the post hoc tests (Tukey's method).<h4>Results</h4>The results showed that nHAP significantly inhibited the growth of MCF-7 cells compared with controls (P<0.001), but the difference was not statistically significant for fibroblasts (P=0.686 at 400 µg/mL at 72 hours). After 48 hours, the proliferation of MCF-7 cells and fibroblasts was inhibited by about 81% and 34% at 400 µg/mL concentration, respectively. The radiosensitization enhancement factor for MCF-7 cells and fibroblasts at a dose of 3.5 Gy and 100 μg/mL concentration were 1.87 and 1.3, respectively.<h4>Conclusion</h4>nHAP can be considered as a breast cancer radiosensitization agent with limited damage to the surrounding healthy tissue.

Also flagged:Transcription FactorsColorectal Cancer
Journal Article 2020-09-01 No Snippets Soheilifar MH, Izadi F, Amini R, Saidijam M.
Show Full Abstract

No abstract available.

Also flagged:TBTuberculosisacquired immune deficiency syndromeAIDSco-infectionlatent TB infection
Journal Article 2020-09-01 ✓ 1 Snippet Li X, Xie Y, Zhang D, Wang Y, Wu J, Sun X, Wu Q.
In-Text Gene Mentions

…ELANE, HP, HPSE,OLFM4, PGLYRP1, TCN1).<h4>Conclusio…

Show Full Abstract

<h4>Objective</h4>Tuberculosis (TB) is the most common cause of acquired immune deficiency syndrome (AIDS)-related deaths worldwide. The purpose of this study was to identify genes that are significant for the mechanisms involved in Mycobacterium tuberculosis (MTB) and human immunodeficiency virus (HIV) co-infection.<h4>Materials and methods</h4>We selected 113 HIV/TB and 109 HIV/LTBI (latent TB infection) genes from GSE37250 and GSE69581 datasets. The Database for Annotation, Visualization and Integrated Discovery (DAVID) was used for Kyoto Encyclopedia of Gene and Genome (KEGG) pathway and gene ontology (GO) analyses. The protein-protein interaction (PPI) network of common differentially expressed genes (DEGs) were visualized using Cytoscape software with Search Tool for the Retrieval of Interacting Genes (STRING).<h4>Results</h4>A total of 83 DEGs were found to be common to both datasets. These included 64 up-regulated genes and 19 down-regulated genes. The PPI network was analyzed, and 12 up-regulated genes were identified. Re-analysis using DAVID found no significant signaling pathways enriched by these twelve genes (CAMP, CTSG, DEFA1, DEFA1B, DEFA3, DEFA4, ELANE, HP, HPSE, OLFM4, PGLYRP1, TCN1).<h4>Conclusions</h4>Twelve significantly up-regulated DEGs that may be potential therapeutic targets for HIV/TB were identified using a series of bioinformatics analytical methods.

Also flagged:amyotrophic lateral sclerosisPolymerasesporadic amyotrophic lateral sclerosis
Journal Article 2020-09-01 No Snippets Zhang QQ, Jiang H, Li CY, Liu YL, Tian XY.
Show Full Abstract

This paper describes the genetic etiology of sporadic amyotrophic lateral sclerosis in a single population. Polymerase chain reaction-restriction fragment length polymorphism and DNA sample sequencing of 3 common <i>HFE</i> gene variants (C282Y and H63D and S65C) were performed on 10 randomly selected samples of H63D gene variant (124 patients with sporadic amyotrophic lateral sclerosis) and 10 wild types of H63D samples (210 controls). The C282Y and S65C gene variant were absent. There were 24 cases (7.18%) with H63D heterozygous variants, including 16 cases (13%) in the sporadic amyotrophic lateral sclerosis group and 8 cases (4%) in the healthy control group. The polymorphism frequency of the H63D gene variant in the sporadic amyotrophic lateral sclerosis group was significantly different than that in the control group (<i>p</i> < 0.05), and the difference at allele level, which is still more significant (<i>p</i> < 0.05). H63D gene variant could be a risk factor for sporadic amyotrophic lateral sclerosis in a single population. The results showed <i>HFE</i> gene variants play a role in the occurrence of sporadic amyotrophic lateral sclerosis, but its effect should be carefully estimated.

Also flagged:hepatitis B infectionchronic hepatitis Binfectionhepatitis B e antigenHBeAgalanine aminotransferase
Journal Article 2020-09-01 ✓ 1 Snippet Yeo YH, Tseng TC, Hosaka T, Cunningham C, Fung JYY, Ho HJ, Kwak MS, Trinh HN, Ungtrakul T, Yu ML, Kobayashi M, Le AK, Henry L, Li J, Zhang J, Sriprayoon T, Jeong D, Tanwandee T, Gane E, Cheung RC, Wu CY, Lok AS, Lee HS, Suzuki F, Yuen MF, Kao JH, Yang HI, Nguyen MH.
In-Text Gene Mentions

…iseases (autoimmune hepatitis,hemochromatosis, Wilson disease, and…

Show Full Abstract

<h4>Introduction</h4>Spontaneous hepatitis B surface antigen (HBsAg) seroclearance, the functional cure of hepatitis B infection, occurs rarely. Prior original studies are limited by insufficient sample size and/or follow-up, and recent meta-analyses are limited by inclusion of only study-level data and lack of adjustment for confounders to investigate HBsAg seroclearance rates in most relevant subgroups. Using a cohort with detailed individual patient data, we estimated spontaneous HBsAg seroclearance rates through patient and virologic characteristics.<h4>Methods</h4>We analyzed 11,264 untreated patients with chronic hepatitis B with serial HBsAg data from 4 North American and 8 Asian Pacific centers, with 1,393 patients with HBsAg seroclearance (≥2 undetectable HBsAg ≥6 months apart) during 106,192 person-years. The annual seroclearance rate with detailed categorization by infection phase, further stratified by hepatitis B e antigen (HBeAg) status, sex, age, and quantitative HBsAg (qHBsAg), was performed.<h4>Results</h4>The annual seroclearance rate was 1.31% (95% confidence interval: 1.25-1.38) and over 7% in immune inactive patients aged ≥55 years and with qHBsAg <100 IU/mL. The 5-, 10-, 15-, and 20-year cumulative rates were 4.74%, 10.72%, 18.80%, and 24.79%, respectively. On multivariable analysis, male (adjusted hazard ratio [aHR] = 1.66), older age (41-55 years: aHR = 1.16; >55 years: aHR = 1.21), negative HBeAg (aHR = 6.34), and genotype C (aHR = 1.82) predicted higher seroclearance rates, as did lower hepatitis B virus DNA and lower qHBsAg (P < 0.05 for all), and inactive carrier state.<h4>Discussion</h4>The spontaneous annual HBsAg seroclearance rate was 1.31%, but varied from close to zero to about 5% among most chronic hepatitis B subgroups, with older, male, HBeAg-negative, and genotype C patients with lower alanine aminotransferase and hepatitis B virus DNA, and qHBsAg independently associated with higher rates (see Visual Abstract, Supplementary Digital Content 2, http://links.lww.com/CTG/A367).

Also flagged:Peroxiredoxin 4oxygenPrdx4male factor infertilityfertilizationinfertility
Journal Article 2020-09-01 ✓ 1 Snippet Yi Q, Meng C, Cai LB, Cui YG, Liu JY, Meng Y.
In-Text Gene Mentions

…The level ofPrdx6expression is increased…

Show Full Abstract

<h4>Background</h4>Peroxiredoxin 4 (Prdx4), a member of the Prdx family, can catalyze the reduction of reactive oxygen species. This study aims to explore whether Prdx4 can serve as an effective marker in follicular fluid (FF) for predicting <i>in vitro</i> fertilization/intracytoplasmic sperm injection (IVF/ICSI) cycle outcomes.<h4>Methods</h4>In this prospective study, all participants were recruited from the center of clinical reproductive medicine from 2017 September to 2018 December. Women with tubal or male factor infertility undergoing their first IVF/ICSI cycle were recruited (n=138). FF samples from each patient were collected on the day of oocyte retrieval. Prdx4 concentrations were measured, and the correlation between Prdx4 levels and IVF outcomes was analyzed.<h4>Results</h4>The results showed that pregnant women had higher levels of Prdx4 than nonpregnant women. Prdx4 was positively correlated with the oocyte fertilization rate (r =0.334; P=0.011) and good quality embryo rate (r =0.326; P=0.013). Furthermore, we found that the clinical pregnancy rate was positively correlated with Prdx4 levels in a concentration-dependent manner in the Prdx4 quartiles (<13.38, 13.83-16.93, 16.93-22.93, >22.93 ng/mL). The fertilization rates, clinical pregnancy rates and live pregnancy rates were all significantly higher in the highest Prdx4 quartile group than in the lowest quartile. Moreover, the results indicated that Prdx4 had an area under the receiver operating characteristic curve (AUC) of 0.754, corresponding to an optimal cutoff point of 22.30 ng/mL.<h4>Conclusions</h4>Our results provide evidence that higher expression of antioxidants, such as Prdx4, in the FF of IVF patients tends to indicate a higher likelihood of pregnancy through an oocyte quality mechanism.

Also flagged:osteoarthritisOApathogenesisjoint diseaseobesitycysts
Journal Article 2020-09-01 ✓ 1 Snippet Huang C, Zhang Z, Chen Y, Zhang Y, Xing D, Zhao L, Lin J, Mei Y, Lin HY, Zheng Y, Tsai WC, Liu S, Jiang Q, Liu Y, Chen J, Ye Z, Chen M, Chen Y, Chu CQ, Gao M, He L, Lin J, Wu L, Xu J, Yang P, Zhang X, Jiang Q, Lei G, Li M, Yang W, Gu X, Zhou Y, He D, Liu W, Zhang W, Ding C, Zeng X.
In-Text Gene Mentions

…excess caused byhemochromatosismay lead to…

Show Full Abstract

<h4>Background</h4>The classification criteria of osteoarthritis (OA) is lack of the support of relevant research evidence and there is no standardized protocol for detailed steps of the development or clinical verification of classification criteria has yet been established. This study aims to describe the development process of the Categorization of Osteoarthritis CHecklist (COACH), which is designed to choose the precise treatment option for patients with OA.<h4>Methods</h4>A multidisciplinary panel was established to gather opinions. We conducted questionnaire survey and literature review to generate and COACH Panel members were invited to review the drafted classification criteria and optimize classification criteria. The final list of items was discussed and reached the agreement by the core group of the panel.<h4>Results</h4>Thirty-six experts participated in COACH Panel including rheumatologist (80.6%; 29/36), orthopedist (13.9%; 5/36), methodologist (2.8%; 1/36) and rehabilitation physician (2.8%; 1/36) for classification factors generating and optimizing. The main body of the final classification criteria consists of six types of OA pathogenesis, eight types of medical findings (which can be grouped into two categories), and six types of the location. The final criteria include load-based type, structure-based type, inflammation-based type, metabolic-based type, systemic factor based type and mixed type.<h4>Conclusions</h4>COACH can better help clinicians quickly classify OA patients and help to choose the best treatment option from the aspects of types, findings and locations. What's more, the classification criteria are also helpful to promote the basic medical research and targeted prevention of OA.

Also flagged:Mitochondrial complex IIsuccinate:ubiquinone oxidoreductasephosphorylationsuccinatefumaratetricarboxylic acid
Journal Article 2020-09-01 ✓ 1 Snippet Fullerton M, McFarland R, Taylor RW, Alston CL.
In-Text Gene Mentions

An alternative aetiology (bi-allelic DARS2 variants) has been established for the clinically-affected individual in whom compound heterozygous c.541-2A>G and c.423+20T>A SDHB splicing variants were initially suspected; so, although the pathogenicity of the c.541-2A>G variant that affects the conserved donor sequence is not in question, it has yet to be implicated in mitochondrial disease [26].

Show Full Abstract

Mitochondrial complex II (succinate:ubiquinone oxidoreductase) is the smallest complex of the oxidative phosphorylation system, a tetramer of just 140 kDa. Despite its diminutive size, it is a key complex in two coupled metabolic pathways - it oxidises succinate to fumarate in the tricarboxylic acid cycle and the electrons are used to reduce FAD to FADH<sub>2</sub>, ultimately reducing ubiquinone to ubiquinol in the respiratory chain. The biogenesis and assembly of complex II is facilitated by four ancillary proteins, all of which are autosomally-encoded. Numerous pathogenic defects have been reported which describe two broad clinical manifestations, either susceptibility to cancer in the case of single, heterozygous germline variants, or a mitochondrial disease presentation, almost exclusively due to bi-allelic recessive variants and associated with an isolated complex II deficiency. Here we present a compendium of pathogenic gene variants that have been documented in the literature in patients with an isolated mitochondrial complex II deficiency. To date, 61 patients are described, harbouring 32 different pathogenic variants in four distinct complex II genes: three structural subunit genes (SDHA, SDHB and SDHD) and one assembly factor gene (SDHAF1). Many pathogenic variants result in a null allele due to nonsense, frameshift or splicing defects however, the missense variants that do occur tend to induce substitutions at highly conserved residues in regions of the proteins that are critical for binding to other subunits or substrates. There is phenotypic heterogeneity associated with defects in each complex II gene, similar to other mitochondrial diseases.

Also flagged:FKBP35RapamycinbindingcysteineFK506 Binding Protein 35FK506-binding protein 35
Journal Article 2020-09-01 No Snippets Atack TC, Raymond DD, Blomquist CA, Pasaje CF, McCarren PR, Moroco J, Befekadu HB, Robinson FP, Pal D, Esherick LY, Ianari A, Niles JC, Sellers WR.
Show Full Abstract

FK506-binding protein 35, FKBP35, has been implicated as an essential malarial enzyme. Rapamycin and FK506 exhibit antiplasmodium activity in cultured parasites. However, due to the highly conserved nature of the binding pockets of FKBPs and the immunosuppressive properties of these drugs, there is a need for compounds that selectively inhibit FKBP35 and lack the undesired side effects. In contrast to human FKBPs, FKBP35 contains a cysteine, C106, adjacent to the rapamycin binding pocket, providing an opportunity to develop targeted covalent inhibitors of <i>Plasmodium</i> FKBP35. Here, we synthesize inhibitors of FKBP35, show that they directly bind FKBP35 in a model cellular setting, selectively covalently modify C106, and exhibit antiplasmodium activity in blood-stage cultured parasites.

Also flagged:pseudocystchronic pancreatitisPV fistulapseudocystsinfectioncyst
Journal Article 2020-09-01 ✓ 1 Snippet Kimura A, Hayashi K, Oda C, Hosaka K, Kimura N, Tominaga K, Ikarashi S, Tsuchiya A, Terai S.
In-Text Gene Mentions

…anemia and administeredantithrombin-IIIfor PV thrombosis.…

Show Full Abstract

Pancreatic pseudocyst-portal vein (PP-PV) fistula, mostly occurring after pseudocyst formation following acute/chronic pancreatitis, is a rare but life-threatening condition. The majority of treatments are based on conservative or surgical interventions. We report the case of a 70-year-old man with a PP-PV fistula and PV thrombosis. We adopted conservative treatment at first due to his mild symptoms. However, after resuming food intake, the patient had severe abdominal pain. Following endoscopic retrograde cholangiopancreatography, we found that the pseudocyst was connected with the PV through the fistula. Subsequently, an endoscopic nasopancreatic drainage (ENPD) catheter was inserted into the main pancreatic duct to establish pancreatic drainage, which resulted in a decrease in the abdominal pain. After the ENPD tube had been exchanged for endoscopic pancreatic stenting, his abdominal pain did not recur. Therefore, this case demonstrated endoscopic treatment as an effective treatment option for PP-PV fistula.

Also flagged:Pentoxifyllinemetforminnonalcoholic fatty liver diseasenonalcoholic steatohepatitisNASHNAFLD
Journal Article 2020-09-01 ✓ 1 Snippet Ćulafić M, Vezmar-Kovačević S, Dopsaj V, Oluić B, Bidžić N, Miljković B, Ćulafić Đ.
In-Text Gene Mentions

…lpha-1-antitrypsin deficiency,hemochromatosis, drug-induced liver disease.…

Show Full Abstract

<h4>Background</h4>The progression of the nonalcoholic fatty liver disease to nonalcoholic steatohepatitis (NASH) is multifactorial, and there is still a lack of approved medications for its treatment. The study aimed to evaluate the impact of combined treatment with Pentoxifylline and Metformin on biochemical parameters in patients with Nash. Setting: Outpatient hepatology clinic.<h4>Methods</h4>A prospective trial was conducted. The first cohort included patients with biopsy-proven Nash, while the second cohort consisted of patients with biopsy-confirmed NAFLD. Blood tests were checked at baseline and every three months. Pentoxifylline at a dosage of 400 mg t.i.d. and Metformin at the dosage of 500 mg t.i.d. were introduced for six months in Nash group. The impact of the treatment was assessed based on biochemical results after combined treatment with low-cost medications.<h4>Results</h4>All 33 Nash patients completed 24 weeks of treatment. We observed significant improvement (p<0.05) of median values after treatment for the following parameters: serum uric acid levels decreased by 51.0 mmol/L, calcium decreased for 0.27 mmoL/L, magnesium showed an increase of 0.11 mmoL/L. Insulin resistance improved as a reduction of HOMA - IR by 1.3 was detected. A significant decrease of median in liver enzymes, alanine aminotransferase, aspartate aminotransferase and gamma-glutamyltransferase by 24.0 U/L, 9.1 U/L, 10.8 U/L respectively, was noted.<h4>Conclusions</h4>Pentoxifylline and Metformin may provide possible treatment option in Nash. Some new potential benefit of the therapy in improving liver function whilst decreasing cardiovascular risk was perceived.

Also flagged:Cognitionbehaviouralcognitive impairmentprimary progressive aphasiaprogressive non-fluent aphasiasemantic dementia
Journal Article 2020-09-01 ✓ 1 Snippet Arshad F, Paplikar A, Mekala S, Varghese F, Purushothaman VV, Kumar DJ, Shingavi L, Vengalil S, Ramakrishnan S, Yadav R, Pal PK, Nalini A, Alladi S.
In-Text Gene Mentions

…positive correlation betweenACE-III, POFA total score,…

Show Full Abstract

<h4>Objectives</h4>Frontotemporal dementia (FTD) syndromes are a complex group of disorders characterised by profound changes in behaviour and cognition. Many of the observed behavioural abnormalities are now recognised to be due to impaired social cognition. While deficits in emotion recognition and empathy are well-recognised in behavioural-variant (Bv)FTD, limited information exists about the nature of social cognitive impairment in the language variant primary progressive aphasia (PPA) that includes progressive non-fluent aphasia (PNFA) and semantic dementia (SD), and in the motor variants FTD amyotrophic lateral sclerosis (FTD-ALS) and FTD progressive supranuclear palsy (FTD-PSP). This prospective study sought to explore the nature and profile of social cognition deficits across the spectrum of FTD.<h4>Methods</h4>Sixty patients on the FTD spectrum, i.e., classical (16 with BvFTD and 20 with PPA) and overlap FTD syndromes (13 with FTD-ALS and 11 with FTD-PSP) were evaluated by means of the social cognition tasks, the Interpersonal Reactivity Index (IRI) for empathy, and pictures of facial affect (POFA) for emotion recognition. General cognition and behaviour were also assessed.<h4>Results</h4>A significant impairment in emotion recognition and empathy was detected in both the classical and overlap FTD syndromes. The recognition of positive emotions was relatively preserved compared to that of negative emotions. Among the FTD subtypes, maximal impairment of empathy was demonstrated in FTD-PSP.<h4>Conclusion</h4>Social cognition impairment is pervasive across the spectrum of FTD disorders, and tests of emotion recognition and empathy are clinically useful to identify the nature of behavioural problems in both classical and overlap FTD. Our findings also have implications for understanding the neural basis of social cognition in FTD.

Also flagged:Cpsf5NxnMyo-inositol oxygenaseByslhookgalactoside
Journal Article 2020-09-01 ✓ 5 Snippets Mayfield RD, Zhu L, Smith TA, Tiwari GR, Tucker HO.
In-Text Gene Mentions

Dnajc1

Prdx6

Toward this end, we employed the zQ175 KI allele in which the human Htt exon 1 carrying an ~190 ​amino acid CAG repeat tract replaces the murine Htt exon 1 (Brüggemann et al., 2013).

There are several categories of TG mice that carry the distinguishing feature of HD—CAG repeats of varying length within the mouse Huntingtin (Htt) genomic locus (Goldberg et al., 2003).

…mouse Huntingtin (Htt) genomic locus…

Show Full Abstract

SMYD1 and the skNAC isoform of the NAC transcription factor have both previously been characterized as transcription factors in hematopoiesis and cardiac/skeletal muscle. Here we report that comparative analysis of genes deregulated by SMYD1 or skNAC knockdown in differentiating C2C12 myoblasts identified transcripts characteristic of neurodegenerative diseases, including Alzheimer's, Parkinson's and Huntington's Diseases (AD, PD, and HD). This led us to determine whether SMYD1 and skNAC function together or independently within the brain. Based on meta-analyses and direct experimentation, we observed SMYD1 and skNAC expression within cortical striata of human brains, mouse brains and transgenic mouse models of these diseases. We observed some of these features in mouse myoblasts induced to differentiate into neurons. Finally, several defining features of Alzheimer's pathology, including the brain-specific, axon-enriched microtubule-associated protein, Tau, are deregulated upon SMYD1 loss.

Also flagged:Iron deficiency anemiaironProton pumpiron deficiencyhereditary hemochromatosisgastrin
Journal Article 2020-09-01 ✓ 2 Snippets Boxer M.
In-Text Gene Mentions

…two patients withhemochromatosiswho never received…

…mutation in theHFEgene.…

Show Full Abstract

<h4>Background</h4>Iron deficiency anemia without evidence for blood loss can present a diagnostic challenge. Proton pump inhibitors have been associated with iron deficiency anemia for many years, yet the relationship between the two until recently was not fully understood. Treatment recommendations are lacking.<h4>Methods and methods</h4>This study evaluated 43 iron deficient patients who were taking proton pump inhibitors, 41 of whom were unresponsive to oral iron, and for whom no etiology for the iron deficiency could be found. Two patients who had hereditary hemochromatosis never were treated with oral iron.<h4>Results</h4>Forty-three patients taking a proton pump inhibitor had elevated serum gastrin ≥100 pg/mL. Upon treatment with intravenous iron, 95% (41/43) responded with increased hemoglobin concentration ≥2 g/dL. Improvements were also achieved in the mean corpuscular volume, ferritin, and transferrin saturation.<h4>Conclusions</h4>These findings suggest that proton pump inhibitors have been an under-recognized cause for iron deficiency anemia and need to be considered in patients who are taking a proton pump inhibitor. The iron deficiency does correct with intravenous iron replacement.

Also flagged:Cysticercosisprimary canceralbendazolesteroidparasitic infectionmyocysticercosis
Journal Article 2020-09-01 ✓ 1 Snippet Singh A, Subash A, Majumdar K, Bhinyaram.
In-Text Gene Mentions

DCC

Show Full Abstract

Disseminated cysticercosis is a rare manifestation of cysticercosis, a relatively common tropical disease in Asia, Africa and South America. Here the embryo of pork tapeworm <i>Taenia Solium</i> gets disseminated to multiple organs and tissues via hepatoportal system. we report here a 45 year gentleman with stage IV oral malignancy who was incidentally found to have disseminated cysticercosis on pre-operative work up. Along with the management of primary cancer and new found asymptomatic disseminated cysticercosis, the ethical challenge was to choose an appropriate reconstructive option for the composite oral cavity resection defect, since all the skeletal muscles in body where studded with cysticercosis larvae. We couldn't find any such report in literature to resolve our dilemma. After surgical board discussion, we zeroed down to pedicled pectoralis major myocutaneous flap, the most versatile and workhorse flap for head and neck reconstruction. Eventually the patient underwent surgery and adjuvant radiotherapy without any delay. He was simultaneously treated with oral albendazole under steroid cover and remained complication free at 2 years.

Also flagged:peptidepeptidesnanofibrilsfibrilsdiphenylalaninedi-homopeptide
Journal Article 2020-09-01 No Snippets Levin A, Hakala TA, Schnaider L, Bernardes GJL, Gazit E, Knowles TPJ.
Show Full Abstract

Natural biomolecular systems have evolved to form a rich variety of supramolecular materials and machinery fundamental to cellular function. The assembly of these structures commonly involves interactions between specific molecular building blocks, a strategy that can also be replicated in an artificial setting to prepare functional materials. The self-assembly of synthetic biomimetic peptides thus allows the exploration of chemical and sequence space beyond that used routinely by biology. In this Review, we discuss recent conceptual and experimental advances in self-assembling artificial peptidic materials. In particular, we explore how naturally occurring structures and phenomena have inspired the development of functional biomimetic materials that we can harness for potential interactions with biological systems. As our fundamental understanding of peptide self-assembly evolves, increasingly sophisticated materials and applications emerge and lead to the development of a new set of building blocks and assembly principles relevant to materials science, molecular biology, nanotechnology and precision medicine.

Research Square 2020-09-01 Preprint (No Snippets API) SOUCHELNYTSKYI S, Souchelnytskyi N.
Show Full Abstract

<title>Abstract</title> <p>BACKGROUND Chloroquine is used for the treatment of COVID-19 patients. However, efficacy of the chloroquine has been under discussion. Variability of clinical outputs of the drug application requires implementation of a companion diagnostic that would allow monitoring responsiveness to chloroquine. The first line of such markers would be markers already used in clinics. Analysis of reported mechanisms of COVID-19 and chloroquine may lead to such markers. METHODS Systemic analysis of molecular mechanisms and markers engaged by chloroquine and COVID-19 virus was performed. The networks of regulatory mechanisms were explored for an intersection and relevance to clinical markers. RESULTS Reported here systemic analysis describes the intersection of molecular mechanisms of chloroquine and processes engaged by COVID-19. 266 nodes provide insight into the mechanisms of chloroquine impact on the infection and represent a pool of companion diagnostic markers. As an example, an intersection with the markers of heart arrhythmia retrieved 19 nodes. Thirteen of them were reported in human plasma: levels of albumin, amyloid precursor protein, and endoglin correlate with adverse cardiac effects. CONCLUSIONS Reported nodes are the candidate markers for companion diagnostic of the chloroquine application to COVID-19 patients. Some of these markers are already used in the clinic and their interpretation may contribute to monitoring for adverse effects of chloroquine.</p>